Antibody to the gp120 V1/V2 loops and CD4+and CD8+ T-cell responses in protection from SIVmac251 vaginal acquisition and persistent viremia

PubMed Central

Gordon, Shari N.; Doster, Melvin N; Kines, Rhonda C.; Keele, Brandon F; Cofano, Egidio Brocca; Guan, Yongjun; Pegu, Poonam; Liyanage, Namal P.M.; Vaccari, Monica; Cuburu, Nicolas; Buck, Christopher B.; Ferrari, Guido; Montefiori, David; Piatak, Mike; Lifson, Jeffrey D; Xenophontos, Anastasia M.; Venzon, David; Robert-Guroff, Marjorie; Graham, Barney S.; Lowy, Douglas R.; Schiller, John T.; Franchini, Genoveffa

2015-01-01

The human papilloma virus pseudovirions (HPV-PsVs) approach is an effective gene-delivery system that can prime or boost an immune response in the vaginal tract of non human primates and mice. Intra-vaginal vaccination with HPV-PsVs expressing SIV genes, combined with an intra-muscular gp120 protein injection, induced humoral and cellular SIV-specific responses in macaques. Priming systemic immune responses with intramuscular immunization with ALVAC-SIV vaccines, followed by intra-vaginal HPV-PsV-SIV/gp120 boosting, expanded and/or recruited T-cells in the female genital tract. Using a stringent repeated low dose intra-vaginal challenge with the highly pathogenic SIVmac251, we show that while these regimens did not demonstrate significant protection from virus acquisition, they provided control of viremia in a number of animals. High avidity antibody responses to the envelope gp120 V1/V2 region correlated with delayed SIVmac251 acquisition, while virus levels in mucosal tissues were inversely correlated with anti-envelope CD4+T-cell responses. CD8+T-cell depletion in animals with controlled viremia caused an increase in tissue virus load in some animals, suggesting a role for CD8+T-cells in virus control. This study highlights the importance of CD8+ cells and anti-envelope CD4+ T-cell in curtailing virus replication and anti-envelope V1/V2 antibodies in preventing SIVmac251 acquisition. PMID:25398324

Structural basis for Epstein–Barr virus host cell tropism mediated by gp42 and gHgL entry glycoproteins

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sathiyamoorthy, Karthik; Hu, Yao Xiong; Möhl, Britta S.

Herpesvirus entry into host cells is mediated by multiple virally encoded receptor binding and membrane fusion glycoproteins. Despite their importance in host cell tropism and associated disease pathology, the underlying and essential interactions between these viral glycoproteins remain poorly understood. For Epstein–Barr virus (EBV), gHgL/gp42 complexes bind HLA class II to activate membrane fusion with B cells, but gp42 inhibits fusion and entry into epithelial cells. To clarify the mechanism by which gp42 controls the cell specificity of EBV infection, in this paper we determined the structure of gHgL/gp42 complex bound to an anti-gHgL antibody (E1D1). The critical regulator ofmore » EBV tropism is the gp42 N-terminal domain, which tethers the HLA-binding domain to gHgL by wrapping around the exterior of three gH domains. Both the gp42 N-terminal domain and E1D1 selectively inhibit epithelial-cell fusion; however, they engage distinct surfaces of gHgL. Finally, these observations clarify key determinants of EBV host cell tropism.« less

Structural basis for Epstein–Barr virus host cell tropism mediated by gp42 and gHgL entry glycoproteins

DOE PAGES

Sathiyamoorthy, Karthik; Hu, Yao Xiong; Möhl, Britta S.; ...

2016-12-08

Herpesvirus entry into host cells is mediated by multiple virally encoded receptor binding and membrane fusion glycoproteins. Despite their importance in host cell tropism and associated disease pathology, the underlying and essential interactions between these viral glycoproteins remain poorly understood. For Epstein–Barr virus (EBV), gHgL/gp42 complexes bind HLA class II to activate membrane fusion with B cells, but gp42 inhibits fusion and entry into epithelial cells. To clarify the mechanism by which gp42 controls the cell specificity of EBV infection, in this paper we determined the structure of gHgL/gp42 complex bound to an anti-gHgL antibody (E1D1). The critical regulator ofmore » EBV tropism is the gp42 N-terminal domain, which tethers the HLA-binding domain to gHgL by wrapping around the exterior of three gH domains. Both the gp42 N-terminal domain and E1D1 selectively inhibit epithelial-cell fusion; however, they engage distinct surfaces of gHgL. Finally, these observations clarify key determinants of EBV host cell tropism.« less

HIV-1 gp120 and Modified Vaccinia Virus Ankara (MVA) gp140 Boost Immunogens Increase Immunogenicity of a DNA/MVA HIV-1 Vaccine.

PubMed

Shen, Xiaoying; Basu, Rahul; Sawant, Sheetal; Beaumont, David; Kwa, Sue Fen; LaBranche, Celia; Seaton, Kelly E; Yates, Nicole L; Montefiori, David C; Ferrari, Guido; Wyatt, Linda S; Moss, Bernard; Alam, S Munir; Haynes, Barton F; Tomaras, Georgia D; Robinson, Harriet L

2017-12-15

An important goal of human immunodeficiency virus (HIV) vaccine design is identification of strategies that elicit effective antiviral humoral immunity. One novel approach comprises priming with DNA and boosting with modified vaccinia virus Ankara (MVA) expressing HIV-1 Env on virus-like particles. In this study, we evaluated whether the addition of a gp120 protein in alum or MVA-expressed secreted gp140 (MVAgp140) could improve immunogenicity of a DNA prime-MVA boost vaccine. Five rhesus macaques per group received two DNA primes at weeks 0 and 8 followed by three MVA boosts (with or without additional protein or MVAgp140) at weeks 18, 26, and 40. Both boost immunogens enhanced the breadth of HIV-1 gp120 and V1V2 responses, antibody-dependent cellular cytotoxicity (ADCC), and low-titer tier 1B and tier 2 neutralizing antibody responses. However, there were differences in antibody kinetics, linear epitope specificity, and CD4 T cell responses between the groups. The gp120 protein boost elicited earlier and higher peak responses, whereas the MVAgp140 boost resulted in improved antibody durability and comparable peak responses after the final immunization. Linear V3 specific IgG responses were particularly enhanced by the gp120 boost, whereas the MVAgp140 boost also enhanced responses to linear C5 and C2.2 epitopes. Interestingly, gp120, but not the MVAgp140 boost, increased peak CD4 + T cell responses. Thus, both gp120 and MVAgp140 can augment potential protection of a DNA/MVA vaccine by enhancing gp120 and V1/V2 antibody responses, whereas potential protection by gp120, but not MVAgp140 boosts, may be further impacted by increased CD4 + T cell responses. IMPORTANCE Prior immune correlate analyses with humans and nonhuman primates revealed the importance of antibody responses in preventing HIV-1 infection. A DNA prime-modified vaccinia virus Ankara (MVA) boost vaccine has proven to be potent in eliciting antibody responses. Here we explore the ability of boosts with

Galectin-8 regulates targeting of Gp135/podocalyxin and lumen formation at the apical surface of renal epithelial cells.

PubMed

Lim, HooiCheng; Yu, Chun-Ying; Jou, Tzuu-Shuh

2017-11-01

Establishment of apical-basal polarity, through correct targeting of polarity determinants to distinct domains of the plasma membrane, is a fundamental process for the development of functioning epithelial tubules. Here we report that galectin (Gal)-8 regulates apical-basal polarity of Madin-Darby canine kidney (MDCK) cells via apical targeting of 135-kDa glycoprotein (Gp135). Gal-8 interacts with newly synthesized Gp135 in a glycan-dependent manner. Gal-8 knockdown induces aberrant lumens at the lateral domain and mistargeting of Gp135 to this structure, thus disrupting the kidney epithelial polarity of MDCK cells, which organize lumens at the apical surface. The O -glycosylation deletion mutant of Gp135 phenocopies the effect of Gal-8 knockdown, which suggests that Gal-8 is the decoding machinery for the apical sorting signals of Gp135 residing at its O -glycosylation-rich region. Collectively, our results reveal a new role of Gal-8 in the development of luminal organs by regulating targeting of apical polarity protein Gp135.-Lim, H., Yu, C.-Y., Jou, T.-S. Galectin-8 regulates targeting of Gp135/podocalyxin and lumen formation at the apical surface of renal epithelial cells. © FASEB.

Protective effects of naringin against gp120-induced injury mediated by P2X7 receptors in BV2 microglial cells.

PubMed

Chen, Q; Hu, J; Qin, S S; Liu, C L; Wu, H; Wang, J R; Lu, X M; Wang, J; Chen, G Q; Liu, Y; Liu, B Y; Xu, C S; Liang, S D

2016-05-13

This study was aimed at exploring the effects of P2X7 receptors on gp120-induced injury and naringin's protective effects against gp120-induced injury in BV2 microglia. BV2 microglia injury model was established by gp120 treatment and MTS assay was used to verify whether naringin has a cell-protective effect against gp120-induced injury. Changes in P2X7 receptor expression were assayed using RT-PCR, qPCR, and western blot. Results showed that the ODs of the Ctrl, gp120, gp120+naringin, and gp120+BBG groups were 0.91 ± 0.10, 0.71 ± 0.09, 0.83 ± 0.10, and 0.83 ± 0.10, respectively. Compared to the control group, the gp120 group showed a significantly decreased cell survival rate. Cell survival rates of the gp120+naringin group increased significantly compared to those of the gp120 group, while no difference was observed when compared to the gp120+BBG group. The relative P2X7 mRNA expression levels in the Ctrl, gp120, gp120+naringin, and gp120+BBG groups were 0.73 ± 0.06, 1.05 ± 0.06, 0.78 ± 0.05, and 0.81 ± 0.04, respectively. The corresponding P2X7 protein expression levels were 0.46 ± 0.04, 0.79 ± 0.04, 0.38 ± 0.07, and 0.42 ± 0.06. P2X7 mRNA and protein expression in the gp120 group increased significantly compared to those in the control group, and declined in the gp120+naringin group compared to those in the gp120 group. Therefore, P2X7 receptors might be involved in gp120-induced injury in BV2 microglia, and naringin might play a protective role by inhibiting the up-regulated expression of P2X7 receptors.

Kunjin Virus Replicon-Based Vaccines Expressing Ebola Virus Glycoprotein GP Protect the Guinea Pig Against Lethal Ebola Virus Infection

PubMed Central

Reynard, O.; Mokhonov, V.; Mokhonova, E.; Leung, J.; Page, A.; Mateo, M.; Pyankova, O.; Georges-Courbot, M. C.; Raoul, H.; Khromykh, A. A.

2011-01-01

Pre- or postexposure treatments against the filoviral hemorrhagic fevers are currently not available for human use. We evaluated, in a guinea pig model, the immunogenic potential of Kunjin virus (KUN)–derived replicons as a vaccine candidate against Ebola virus (EBOV). Virus like particles (VLPs) containing KUN replicons expressing EBOV wild-type glycoprotein GP, membrane anchor-truncated GP (GP/Ctr), and mutated GP (D637L) with enhanced shedding capacity were generated and assayed for their protective efficacy. Immunization with KUN VLPs expressing full-length wild-type and D637L-mutated GPs but not membrane anchor–truncated GP induced dose-dependent protection against a challenge of a lethal dose of recombinant guinea pig-adapted EBOV. The surviving animals showed complete clearance of the virus. Our results demonstrate the potential for KUN replicon vectors as vaccine candidates against EBOV infection. PMID:21987742

CB2 Receptor Agonists Protect Human Dopaminergic Neurons against Damage from HIV-1 gp120

PubMed Central

Hu, Shuxian; Sheng, Wen S.; Rock, R. Bryan

2013-01-01

Despite the therapeutic impact of anti-retroviral therapy, HIV-1-associated neurocognitive disorder (HAND) remains a serious threat to AIDS patients, and there currently remains no specific therapy for the neurological manifestations of HIV-1. Recent work suggests that the nigrostriatal dopaminergic area is a critical brain region for the neuronal dysfunction and death seen in HAND and that human dopaminergic neurons have a particular sensitivity to gp120-induced damage, manifested as reduced function (decreased dopamine uptake), morphological changes, and reduced viability. Synthetic cannabinoids inhibit HIV-1 expression in human microglia, suppress production of inflammatory mediators in human astrocytes, and there is substantial literature demonstrating the neuroprotective properties of cannabinoids in other neuropathogenic processes. Based on these data, experiments were designed to test the hypothesis that synthetic cannabinoids will protect dopaminergic neurons against the toxic effects of the HIV-1 protein gp120. Using a human mesencephalic neuronal/glial culture model, which contains dopaminergic neurons, microglia, and astrocytes, we were able to show that the CB1/CB2 agonist WIN55,212-2 blunts gp120-induced neuronal damage as measured by dopamine transporter function, apoptosis and lipid peroxidation; these actions were mediated principally by the CB2 receptor. Adding supplementary human microglia to our cultures enhances gp120-induced damage; WIN55,212-2 is able to alleviate this enhanced damage. Additionally, WIN55,212-2 inhibits gp120-induced superoxide production by purified human microglial cells, inhibits migration of human microglia towards supernatants generated from gp120-stimulated human mesencephalic neuronal/glial cultures and reduces chemokine and cytokine production from the human mesencephalic neuronal/glial cultures. These data suggest that synthetic cannabinoids are capable of protecting human dopaminergic neurons from gp120 in a variety

HIV-1 gp41 and gp160 are hyperthermostable proteins in a mesophilic environment. Characterization of gp41 mutants.

PubMed

Krell, Tino; Greco, Frédéric; Engel, Olivier; Dubayle, Jean; Dubayle, Joseline; Kennel, Audrey; Charloteaux, Benoit; Brasseur, Robert; Chevalier, Michel; Sodoyer, Regis; El Habib, Raphaëlle

2004-04-01

HIV gp41(24-157) unfolds cooperatively over the pH range of 1.0-4.0 with T(m) values of > 100 degrees C. At pH 2.8, protein unfolding was 80% reversible and the DeltaH(vH)/DeltaH(cal) ratio of 3.7 is indicative of gp41 being trimeric. No evidence for a monomer-trimer equilibrium in the concentration range of 0.3-36 micro m was obtained by DSC and tryptophan fluorescence. Glycosylation of gp41 was found to have only a marginal impact on the thermal stability. Reduction of the disulfide bond or mutation of both cysteine residues had only a marginal impact on protein stability. There was no cooperative unfolding event in the DSC thermogram of gp160 in NaCl/P(i), pH 7.4, over a temperature range of 8-129 degrees C. When the pH was lowered to 5.5-3.4, a single unfolding event at around 120 degrees C was noted, and three unfolding events at 93.3, 106.4 and 111.8 degrees C were observed at pH 2.8. Differences between gp41 and gp160, and hyperthermostable proteins from thermophile organisms are discussed. A series of gp41 mutants containing single, double, triple or quadruple point mutations were analysed by DSC and CD. The impact of mutations on the protein structure, in the context of generating a gp41 based vaccine antigen that resembles a fusion intermediate state, is discussed. A gp41 mutant, in which three hydrophobic amino acids in the gp41 loop were replaced with charged residues, showed an increased solubility at neutral pH.

Lessons from the GP-B Experience for Future Fundamental Physics Missions in Space

NASA Technical Reports Server (NTRS)

Kolodziejczak, Jeffery

2006-01-01

Gravity Probe B launched in April 2004 and completed its science data collection in September 2005, with the objective of sub-milliarcsec measurement of two General Relativistic effects on the spin axis orientation of orbiting gyroscopes. Much of the technology required by GP-B has potential application in future missions intended to make precision measurements. The philosophical approach and experiment design principles developed for GP-B are equally adaptable to these mission concepts. This talk will discuss GP-B's experimental approach and the technological and philosophical lessons learned that apply to future experiments in fundamental physics. Measurement of fundamental constants to high precision, probes of short-range forces, searches for equivalence principle violations, and detection of gravitational waves are examples of concepts and missions that will benefit kern GP-B's experience.

Debio 0507 primarily forms diaminocyclohexane-Pt-d(GpG) and -d(ApG) DNA adducts in HCT116 cells

PubMed Central

King, C. L.; Ramachandran, S.; Collins, L.; Swenberg, J. A.; deKrafft, K. E.; Lin, W.; Cicurel, L.; Barbier, M.

2013-01-01

Purpose To characterize the cellular action mechanism of Debio 0507, we compared the major DNA adducts formed by Debio 0507- and oxaliplatin-treated HCT116 human colon carcinoma cells by a combination of inductively coupled plasma mass spectrometry (ICP-MS) and ultra-performance liquid chromatography mass spectrometry (UPLC-MS/MS). Methods HCT116 cells were treated with IC50 doses of Debio 0507 or oxaliplatin for 3 days. Total cellular Pt–DNA adducts were determined by ICP-MS. The DNA was digested, and the major Pt–DNA adducts formed by both drugs were characterized by UPLC/MS/MS essentially as described previously for cisplatin (Baskerville-Abraham et al. in Chem Res Toxicol 22:905–912, 2009). Results The Pt level/deoxynucleotide was 7.4/104 for DNA from Debio 0507-treated cells and 5.5/104 for oxaliplatin-treated cells following a 3-day treatment at the IC50 for each drug. UPLC-MS/MS in the positive ion mode confirmed the major Pt–DNA adducts formed by both drugs were dach-Pt-d(GpG) (904.2 m/z → 610 m/z and 904.2 m/z → 459 m/z) and dach-Pt-d(ApG) (888.2 m/z → 594 m/z and 888.2 m/z → 459 m/z). Conclusions These data show that the major DNA adducts formed by Debio 0507 are the dach-Pt-d(GpG) and dach-Pt-d(ApG) adducts and at equitoxic doses Debio 0507 and oxaliplatin form similar levels of dach-Pt-d(GpG) and dach-Pt-d(ApG) adducts. This suggests that the action mechanisms of Debio 0507 and oxaliplatin are similar at a cellular level. PMID:21968950

Debio 0507 primarily forms diaminocyclohexane-Pt-d(GpG) and -d(ApG) DNA adducts in HCT116 cells.

PubMed

King, C L; Ramachandran, S; Chaney, S G; Collins, L; Swenberg, J A; DeKrafft, K E; Lin, W; Cicurel, L; Barbier, M

2012-03-01

To characterize the cellular action mechanism of Debio 0507, we compared the major DNA adducts formed by Debio 0507- and oxaliplatin-treated HCT116 human colon carcinoma cells by a combination of inductively coupled plasma mass spectrometry (ICP-MS) and ultraperformance liquid chromatography mass spectrometry (UPLC-MS/MS). HCT116 cells were treated with IC(50) doses of Debio 0507 or oxaliplatin for 3 days. Total cellular Pt-DNA adducts were determined by ICP-MS. The DNA was digested, and the major Pt-DNA adducts formed by both drugs were characterized by UPLC/MS/MS essentially as described previously for cisplatin (Baskerville-Abraham et al. in Chem Res Toxicol 22:905-912, 2009). The Pt level/deoxynucleotide was 7.4/10(4) for DNA from Debio 0507-treated cells and 5.5/10(4) for oxaliplatin-treated cells following a 3-day treatment at the IC(50) for each drug. UPLC-MS/MS in the positive ion mode confirmed the major Pt-DNA adducts formed by both drugs were dach-Pt-d(GpG) (904.2 m/z → 610 m/z and 904.2 m/z → 459 m/z) and dach-Pt-d(ApG) (888.2 m/z → 594 m/z and 888.2 m/z → 459 m/z). These data show that the major DNA adducts formed by Debio 0507 are the dach-Pt-d(GpG) and dach-Pt-d(ApG) adducts and at equitoxic doses Debio 0507 and oxaliplatin form similar levels of dach-Pt-d(GpG) and dach-Pt-d(ApG) adducts. This suggests that the action mechanisms of Debio 0507 and oxaliplatin are similar at a cellular level.

Bone age assessment in Hispanic children: digital hand atlas compared with the Greulich and Pyle (G&P) atlas

NASA Astrophysics Data System (ADS)

Fernandez, James Reza; Zhang, Aifeng; Vachon, Linda; Tsao, Sinchai

2008-03-01

Bone age assessment is most commonly performed with the use of the Greulich and Pyle (G&P) book atlas, which was developed in the 1950s. The population of theUnited States is not as homogenous as the Caucasian population in the Greulich and Pyle in the 1950s, especially in the Los Angeles, California area. A digital hand atlas (DHA) based on 1,390 hand images of children of different racial backgrounds (Caucasian, African American, Hispanic, and Asian) aged 0-18 years was collected from Children's Hospital Los Angeles. Statistical analysis discovered significant discrepancies exist between Hispanic and the G&P atlas standard. To validate the usage of DHA as a clinical standard, diagnostic radiologists performed reads on Hispanic pediatric hand and wrist computed radiography images using either the G&P pediatric radiographic atlas or the Children's Hospital Los Angeles Digital Hand Atlas (DHA) as reference. The order in which the atlas is used (G&P followed by DHA or vice versa) for each image was prepared before actual reading begins. Statistical analysis of the results was then performed to determine if a discrepancy exists between the two readings.

Template-directed synthesis on the pentanucleotide CpCpGpCpC

NASA Technical Reports Server (NTRS)

Inoue, T.; Joyce, G. F.; Grzeskowiak, K.; Orgel, L. E.; Brown, J. M.; Reese, C. B.

1984-01-01

Experiments in which CpCpGpCpC is used as a template to facilitate the co-oligomerization of 2-MeImpG and 2-MeImpC are described. It is shown that 3' to 5' prime-linked pGpGpCpGpG, whose sequence is complementary to that of the template, is substantially the most adundant pentameric product of the template-directed reaction. The yield of pGpGpCpGpG is never large (less than 20 percent), presumably becauase off-template reactions consume template-directed products. Thus pGpGpCpGpG is converted to the various isomers of G5C and G4C2 by off-template terminal addition of G or C. The 3' to 5' isomer of GpG is elongated on the template to give GpGpC, GpGpCpG, and GpGpCpGpG, while the 2' to 5' isomer does not initiate the synthesis of detectable amounts of longer oligomers.

Alphavirus Replicon DNA Vectors Expressing Ebola GP and VP40 Antigens Induce Humoral and Cellular Immune Responses in Mice

PubMed Central

Ren, Shoufeng; Wei, Qimei; Cai, Liya; Yang, Xuejing; Xing, Cuicui; Tan, Feng; Leavenworth, Jianmei W.; Liang, Shaohui; Liu, Wenquan

2018-01-01

Ebola virus (EBOV) causes severe hemorrhagic fevers in humans, and no approved therapeutics or vaccine is currently available. Glycoprotein (GP) is the major protective antigen of EBOV, and can generate virus-like particles (VLPs) by co-expression with matrix protein (VP40). In this study, we constructed a recombinant Alphavirus Semliki Forest virus (SFV) replicon vector DREP to express EBOV GP and matrix viral protein (VP40). EBOV VLPs were successfully generated and achieved budding from 293 cells after co-transfection with DREP-based GP and VP40 vectors (DREP-GP+DREP-VP40). Vaccination of BALB/c mice with DREP-GP, DREP-VP40, or DREP-GP+DREP-VP40 vectors, followed by immediate electroporation resulted in a mixed IgG subclass production, which recognized EBOV GP and/or VP40 proteins. This vaccination regimen also led to the generation of both Th1 and Th2 cellular immune responses in mice. Notably, vaccination with DREP-GP and DREP-VP40, which produces both GP and VP40 antigens, induced a significantly higher level of anti-GP IgG2a antibody and increased IFN-γ secreting CD8+ T-cell responses relative to vaccination with DREP-GP or DREP-VP40 vector alone. Our study indicates that co-expression of GP and VP40 antigens based on the SFV replicon vector generates EBOV VLPs in vitro, and vaccination with recombinant DREP vectors containing GP and VP40 antigens induces Ebola antigen-specific humoral and cellular immune responses in mice. This novel approach provides a simple and efficient vaccine platform for Ebola disease prevention. PMID:29375526

Plasma IgG to Linear Epitopes in the V2 and V3 Regions of HIV-1 gp120 Correlate with a Reduced Risk of Infection in the RV144 Vaccine Efficacy Trial

PubMed Central

Gottardo, Raphael; Bailer, Robert T.; Korber, Bette T.; Gnanakaran, S.; Phillips, Joshua; Shen, Xiaoying; Tomaras, Georgia D.; Turk, Ellen; Imholte, Gregory; Eckler, Larry; Wenschuh, Holger; Zerweck, Johannes; Greene, Kelli; Gao, Hongmei; Berman, Phillip W.; Francis, Donald; Sinangil, Faruk; Lee, Carter; Nitayaphan, Sorachai; Rerks-Ngarm, Supachai; Kaewkungwal, Jaranit; Pitisuttithum, Punnee; Tartaglia, James; Robb, Merlin L.; Michael, Nelson L.; Kim, Jerome H.; Zolla-Pazner, Susan; Haynes, Barton F.; Mascola, John R.; Self, Steve; Gilbert, Peter; Montefiori, David C.

2013-01-01

Neutralizing and non-neutralizing antibodies to linear epitopes on HIV-1 envelope glycoproteins have potential to mediate antiviral effector functions that could be beneficial to vaccine-induced protection. Here, plasma IgG responses were assessed in three HIV-1 gp120 vaccine efficacy trials (RV144, Vax003, Vax004) and in HIV-1-infected individuals by using arrays of overlapping peptides spanning the entire consensus gp160 of all major genetic subtypes and circulating recombinant forms (CRFs) of the virus. In RV144, where 31.2% efficacy against HIV-1 infection was seen, dominant responses targeted the C1, V2, V3 and C5 regions of gp120. An analysis of RV144 case-control samples showed that IgG to V2 CRF01_AE significantly inversely correlated with infection risk (OR= 0.54, p=0.0042), as did the response to other V2 subtypes (OR=0.60-0.63, p=0.016-0.025). The response to V3 CRF01_AE also inversely correlated with infection risk but only in vaccine recipients who had lower levels of other antibodies, especially Env-specific plasma IgA (OR=0.49, p=0.007) and neutralizing antibodies (OR=0.5, p=0.008). Responses to C1 and C5 showed no significant correlation with infection risk. In Vax003 and Vax004, where no significant protection was seen, serum IgG responses targeted the same epitopes as in RV144 with the exception of an additional C1 reactivity in Vax003 and infrequent V2 reactivity in Vax004. In HIV-1 infected subjects, dominant responses targeted the V3 and C5 regions of gp120, as well as the immunodominant domain, heptad repeat 1 (HR-1) and membrane proximal external region (MPER) of gp41. These results highlight the presence of several dominant linear B cell epitopes on the HIV-1 envelope glycoproteins. They also generate the hypothesis that IgG to linear epitopes in the V2 and V3 regions of gp120 are part of a complex interplay of immune responses that contributed to protection in RV144. PMID:24086607

G protection: interaction of straining maneuvers and positive pressure breathing.

PubMed

Eiken, Ola; Kölegärd, Roger; Bergsten, Eddie; Grönkvist, Mikael

2007-04-01

G protection in the 39 Gripen aircraft is provided by a full coverage anti-G suit, a pressure-breathing system, and anti-G straining maneuvers (AGSM). The purpose was to study (1) the interaction of pressure breathing and AGSM while wearing an anti-G suit; and (2) the G-protective properties of the anti-G suit alone and in combination with the pressure-breathing system. During rapid onset rate G-time profiles (< or =9 G), 10 subjects were investigated in 5 conditions: (I) sitting relaxed, without any G-protective garment; (II) sitting relaxed and wearing an anti-G suit; (III) sitting relaxed, wearing an anti-G suit, and pressure breathing; IV) wearing an anti-G suit and performing AGSM; and V) wearing an anti-G suit, pressure breathing, and performing AGSM. In supplementary experiments (n=9), the share of the anti-G suit protection afforded by the abdominal bladder was investigated. G tolerance was 3.4 Gz (range: 2.8-4.3) in condition I, > or = 6.5 Gz (4.5-9.0) in II, > or = 8.0 Gz (6.5-9.0) in III, > or = 8.9 Gz (8.5-9.0) in IV and > or = 9.0 Gz (8.5-9.0) in V. In the supplementary experiments, the anti-G suit afforded a 2.8-G protection, a third of which was contributed by the abdominal bladder. In the relaxed state, pressure applied to the airways was transmitted undistorted to the intrathoracic space. During AGSM, intrathoracic pressure rose to 10-14 kPa, regardless of whether AGSM was performed with or without pressure breathing. The anti-G suit and the pressure breathing system provide G protection of > or = 4.6 G, of which the anti-G suit contributes about 3.0 G. The C-protective properties of the anti-G suit and those of pressure breathing appears to be additive, whereas the G protection afforded by pressure breathing does not add to that provided by AGSM.

Uncoupling GP1 and GP2 Expression in the Lassa Virus Glycoprotein Complex: Implications for GP1 Ectodomain Shedding

DTIC Science & Technology

2008-12-23

glycoprotein precursor (GPC) signal peptide (SP) or human IgG signal sequences (s.s.). GP2 was secreted from cells only when (1) the transmembrane (TM) domain... peptide (SP) or human IgG signal sequences (s.s.). GP2 was secreted from cells only when (1) the transmembrane (TM) domain was deleted, the...terminal signal peptide (SP), which directs the precursor to the endoplasmic retic- ulum (ER) for further processing [11]. The SP, which has been

Are dinucleoside monophosphates relevant models for the study of DNA intrastrand cross-link lesions? The example of g[8-5m]T.

PubMed

Garrec, Julian; Dumont, Elise

2014-07-21

Oxidatively generated tandem lesions such as G[8-5m]T pose a potent threat to genome integrity. Direct experimental studies of the kinetics and thermodynamics of a specific lesion within DNA are very challenging, mostly due to the variety of products that can be formed in oxidative conditions. Dinucleoside monophosphates (DM) involving only the reactive nucleobases in water represent appealing alternative models on which most physical chemistry and structural techniques can be applied. However, it is not yet clear how relevant these models are. Here, we present QM/MM MD simulations of the cyclization step involved in the formation of G[8-5m]T from the guanine-thymine (GpT) DM in water, with the aim of comparing our results to our previous investigation of the same reaction in DNA ( Garrec , J. , Patel , C. , Rothlisberger , U. , and Dumont , E. ( 2012 ) J. Am. Chem. Soc. 134 , 2111 - 2119 ). We show that, despite the different levels of preorganization of the two systems, the corresponding reactions share many energetic and structural characteristics. The main difference lies in the angle between the G and T bases, which is slightly higher in the transition state (TS) and product of the reaction in water than in the reaction in DNA. This effect is due to the Watson-Crick H-bonds, which are absent in the {GpT+water} system and restrain the relative positioning of the reactive nucleobases in DNA. However, since the lesion is accommodated easily in the DNA macromolecule, the induced energetic penalty is relatively small. The high similarity between the two reactions strongly supports the use of GpT in water as a model of the corresponding reaction in DNA.

General Practitioner (GP) trainees' experience of a '1-h protected supervision model' given during psychiatry placements in the United Kingdom.

PubMed

Thomas, Gareth; McNeill, Helen

2018-01-05

Background A '1-hour protected supervision model' is well established for Psychiatry trainees. This model is also extended to GP trainees who are on placement in psychiatry. To explore the experiences of the '1-hour protected supervision model' for GP trainees in psychiatry placements in the UK. Methods Using a mixed methods approach, an anonymous online questionnaire was sent to GP trainees in the North West of England who had completed a placement in Psychiatry between February and August 2015. Results Discussing clinical cases whilst using the e-portfolio was the most useful learning event in this model. Patient care can potentially improve if a positive relationship develops between trainee/supervisor, which is impacted by the knowledge of this model at the start of the placement. Trainees found that clinical pressures were impacting on the occurrence of supervision. Conclusion The model works best when both GP trainees and their supervisors understand the model. The most frequently used and educationally beneficial aspect for GP trainees in psychiatry is the exploration of clinical cases using the learning portfolio as an educational tool. For effective delivery of this model of supervision, organisations must reflect on the balance between service delivery and allowing the supervisor and trainee adequate time for it to occur.

Antibodies with High Avidity to the gp120 Envelope Protein in Protection from Simian Immunodeficiency Virus SIVmac251 Acquisition in an Immunization Regimen That Mimics the RV-144 Thai Trial

PubMed Central

Pegu, Poonam; Vaccari, Monica; Gordon, Shari; Keele, Brandon F.; Doster, Melvin; Guan, Yongjun; Ferrari, Guido; Pal, Ranajit; Ferrari, Maria Grazia; Whitney, Stephen; Hudacik, Lauren; Billings, Erik; Rao, Mangala; Montefiori, David; Tomaras, Georgia; Alam, S. Munir; Fenizia, Claudio; Lifson, Jeffrey D.; Stablein, Donald; Tartaglia, Jim; Michael, Nelson; Kim, Jerome; Venzon, David

2013-01-01

The recombinant canarypox vector, ALVAC-HIV, together with human immunodeficiency virus (HIV) gp120 envelope glycoprotein, has protected 31.2% of Thai individuals from HIV acquisition in the RV144 HIV vaccine trial. This outcome was unexpected, given the limited ability of the vaccine components to induce CD8+ T-cell responses or broadly neutralizing antibodies. We vaccinated macaques with an immunization regimen intended to mimic the RV144 trial and exposed them intrarectally to a dose of the simian immunodeficiency virus SIVmac251 that transmits few virus variants, similar to HIV transmission to humans. Vaccination induced anti-envelope antibodies in all vaccinees and CD4+ and CD8+ T-cell responses. Three of the 11 macaques vaccinated with ALVAC-SIV/gp120 were protected from SIVmac251 acquisition, but the result was not significant. The remaining vaccinees were infected and progressed to disease. The magnitudes of vaccine-induced SIVmac251-specific T-cell responses and binding antibodies were not significantly different between protected and infected animals. However, sera from protected animals had higher avidity antibodies to gp120, recognized the variable envelope regions V1/V2, and reduced SIVmac251 infectivity in cells that express high levels of α4β7 integrins, suggesting a functional role of antibodies to V2. The current results emphasize the utility of determining the titer of repeated mucosal challenge in the preclinical evaluation of HIV vaccines. PMID:23175374

Prodigiosin inhibits gp91{sup phox} and iNOS expression to protect mice against the oxidative/nitrosative brain injury induced by hypoxia-ischemia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chang, Chia-Che; Graduate Institute of Basic Medical Science, China Medical University, Taichung, Taiwan; Agricultural Biotechnology Center, National Chung-Hsing University, Taichung, Taiwan

2011-11-15

This study aimed to explore the mechanisms by which prodigiosin protects against hypoxia-induced oxidative/nitrosative brain injury induced by middle cerebral artery occlusion/reperfusion (MCAo/r) injury in mice. Hypoxia in vitro was modeled using oxygen-glucose deprivation (OGD) followed by reoxygenation of BV-2 microglial cells. Our results showed that treatment of mice that have undergone MCAo/r injury with prodigiosin (10 and 100 {mu}g/kg, i.v.) at 1 h after hypoxia ameliorated MCAo/r-induced oxidative/nitrosative stress, brain infarction, and neurological deficits in the mice, and enhanced their survival rate. MCAo/r induced a remarkable production in the mouse brains of reactive oxygen species (ROS) and a significantmore » increase in protein nitrosylation; this primarily resulted from enhanced expression of NADPH oxidase 2 (gp91{sup phox}), inducible nitric oxide synthase (iNOS), and the infiltration of CD11b leukocytes due to breakdown of blood-brain barrier (BBB) by activation of nuclear factor-kappa B (NF-{kappa}B). All these changes were significantly diminished by prodigiosin. In BV-2 cells, OGD induced ROS and nitric oxide production by up-regulating gp91{sup phox} and iNOS via activation of the NF-{kappa}B pathway, and these changes were suppressed by prodigiosin. In conclusion, our results indicate that prodigiosin reduces gp91{sup phox} and iNOS expression possibly by impairing NF-{kappa}B activation. This compromises the activation of microglial and/or inflammatory cells, which then, in turn, mediates prodigiosin's protective effect in the MCAo/r mice. -- Highlights: Black-Right-Pointing-Pointer Prodigiosin ameliorated brain infarction and deficits. Black-Right-Pointing-Pointer Prodigiosin protected against hypoxia/reperfusion-induced brain injury. Black-Right-Pointing-Pointer Prodigiosin diminished oxidative/nitrosativestress and leukocytes infiltration. Black-Right-Pointing-Pointer Prodigiosin reduced BBB breakdown. Black

Characterization of HIV-1 gp120 antibody specificities induced in anogenital secretions of RV144 vaccine recipients after late boost immunizations

PubMed Central

Karnasuta, Chitraporn; Vasan, Sandhya; Rerks-Ngarm, Supachai; Pitisuttithum, Punnee; Madnote, Sirinan; Savadsuk, Hathairat; Rittiroongrad, Surawach; Puangkaew, Jiraporn; Phogat, Sanjay; Tartaglia, James; Sinangil, Faruk; de Souza, Mark S.; Excler, Jean-Louis; Kim, Jerome H.; Robb, Merlin L.; Michael, Nelson L.; Ngauy, Viseth; O'Connell, Robert J.; Karasavvas, Nicos

2018-01-01

Sexual transmission is the principal driver of the human immunodeficiency virus (HIV) pandemic. Understanding HIV vaccine-induced immune responses at mucosal surfaces can generate hypotheses regarding mechanisms of protection, and may influence vaccine development. The RV144 (ClinicalTrials.gov NCT00223080) efficacy trial showed protection against HIV infections but mucosal samples were not collected, therefore, the contribution of mucosal antibodies to preventing HIV-1 acquisition is unknown. Here, we report the generation, magnitude and persistence of antibody responses to recombinant gp120 envelope and antigens including variable one and two loop scaffold antigens (gp70V1V2) previously shown to correlate with risk in RV144. We evaluated antibody responses to gp120 A244gD and gp70V1V2 92TH023 (both CRF01_AE) and Case A2 (subtype B) in cervico-vaginal mucus (CVM), seminal plasma (SP) and rectal secretions (RS) from HIV-uninfected RV144 vaccine recipients, who were randomized to receive two late boosts of ALVAC-HIV/AIDSVAX®B/E, AIDSVAX®B/E, or ALVAC-HIV alone at 0 and 6 months. Late vaccine boosting increased IgG geometric mean titers (GMT) to gp120 A244gD in AIDSVAX®B/E and ALVAC-HIV/AIDSVAX®B/E CVM (28 and 17 fold, respectively), followed by SP and RS. IgG to gp70V1V2 92TH023 increased in AIDSVAX®B/E and ALVAC-HIV/AIDSVAX®B/E CVM (11–17 fold) and SP (2 fold) two weeks post first boost. IgG to Case A2 was only detected in AIDSVAX®B/E and ALVAC-HIV/AIDSVAX®B/E CVM. Mucosal IgG to gp120 A244gD (CVM, SP, RS), gp70V1V2 92TH023 (CVM, SP), and Case A2 (CVM) correlated with plasma IgG levels (p<0.001). Although the magnitude of IgG responses declined after boosting, anti-gp120 A244gD IgG responses in CVM persisted for 12 months post final vaccination. Further studies in localization, persistence and magnitude of envelope specific antibodies (IgG and dimeric IgA) in anogenital secretions will help determine their role in preventing mucosal HIV acquisition. PMID

Models for the Binary Complex of Bacteriophage T4 Gp59 Helicase Loading Protein. GP32 Single-Stranded DNA-Binding Protein and Ternary Complex with Pseudo-Y Junction DNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hinerman, Jennifer M.; Dignam, J. David; Mueser, Timothy C.

2012-04-05

The bacteriophage T4 gp59 helicase assembly protein (gp59) is required for loading of gp41 replicative helicase onto DNA protected by gp32 single-stranded DNA-binding protein. The gp59 protein recognizes branched DNA structures found at replication and recombination sites. Binding of gp32 protein (full-length and deletion constructs) to gp59 protein measured by isothermal titration calorimetry demonstrates that the gp32 protein C-terminal A-domain is essential for protein-protein interaction in the absence of DNA. Sedimentation velocity experiments with gp59 protein and gp32ΔB protein (an N-terminal B-domain deletion) show that these proteins are monomers but form a 1:1 complex with a dissociation constant comparable withmore » that determined by isothermal titration calorimetry. Small angle x-ray scattering (SAXS) studies indicate that the gp59 protein is a prolate monomer, consistent with the crystal structure and hydrodynamic properties determined from sedimentation velocity experiments. SAXS experiments also demonstrate that gp32ΔB protein is a prolate monomer with an elongated A-domain protruding from the core. Moreover, fitting structures of gp59 protein and the gp32 core into the SAXS-derived molecular envelope supports a model for the gp59 protein-gp32ΔB protein complex. Our earlier work demonstrated that gp59 protein attracts full-length gp32 protein to pseudo-Y junctions. A model of the gp59 protein-DNA complex, modified to accommodate new SAXS data for the binary complex together with mutational analysis of gp59 protein, is presented in the accompanying article (Dolezal, D., Jones, C. E., Lai, X., Brister, J. R., Mueser, T. C., Nossal, N. G., and Hinton, D. M. (2012) J. Biol. Chem. 287, 18596–18607).« less

Antibodies with high avidity to the gp120 envelope protein in protection from simian immunodeficiency virus SIV(mac251) acquisition in an immunization regimen that mimics the RV-144 Thai trial.

PubMed

Pegu, Poonam; Vaccari, Monica; Gordon, Shari; Keele, Brandon F; Doster, Melvin; Guan, Yongjun; Ferrari, Guido; Pal, Ranajit; Ferrari, Maria Grazia; Whitney, Stephen; Hudacik, Lauren; Billings, Erik; Rao, Mangala; Montefiori, David; Tomaras, Georgia; Alam, S Munir; Fenizia, Claudio; Lifson, Jeffrey D; Stablein, Donald; Tartaglia, Jim; Michael, Nelson; Kim, Jerome; Venzon, David; Franchini, Genoveffa

2013-02-01

The recombinant canarypox vector, ALVAC-HIV, together with human immunodeficiency virus (HIV) gp120 envelope glycoprotein, has protected 31.2% of Thai individuals from HIV acquisition in the RV144 HIV vaccine trial. This outcome was unexpected, given the limited ability of the vaccine components to induce CD8(+) T-cell responses or broadly neutralizing antibodies. We vaccinated macaques with an immunization regimen intended to mimic the RV144 trial and exposed them intrarectally to a dose of the simian immunodeficiency virus SIV(mac251) that transmits few virus variants, similar to HIV transmission to humans. Vaccination induced anti-envelope antibodies in all vaccinees and CD4(+) and CD8(+) T-cell responses. Three of the 11 macaques vaccinated with ALVAC-SIV/gp120 were protected from SIV(mac251) acquisition, but the result was not significant. The remaining vaccinees were infected and progressed to disease. The magnitudes of vaccine-induced SIV(mac251)-specific T-cell responses and binding antibodies were not significantly different between protected and infected animals. However, sera from protected animals had higher avidity antibodies to gp120, recognized the variable envelope regions V1/V2, and reduced SIV(mac251) infectivity in cells that express high levels of α(4)β(7) integrins, suggesting a functional role of antibodies to V2. The current results emphasize the utility of determining the titer of repeated mucosal challenge in the preclinical evaluation of HIV vaccines.

[NF-kappaB-induced gp96 up-regulation promotes hepatocyte growth, cell cycle progression and transition].

PubMed

Feng, Cong; Wu, Bo; Fan, Hongxia; Li, Changfei; Meng, Songdong

2014-10-04

To investigate the mechanism of gp96 raised during hepatitis B virus (HBV) infection and the pathological mechanism. The mechanism of NF-KB activating gp96 expression was determined by bioinformatics analysis, luciferase reporter assay, real-time PCR and Western blot. The effect of over-expression and knockdown gp96 expression by transfection or RNA interference on hepatocyte proliferation, apoptosis and cell cycle was examined by CCK-8 and flow cytometry. The role of gp96 for HCC development was determined by epithelial-mesenchymal transition (EMT) and colony formation assay. NF-kB significantly increased the gp96 expression by binding to the NF-kappaB binding site. Over-expression and knockdown studies both show that gp96 promoted hepatocyte proliferation, inhibited apoptosis, and induced G0/G1 to S phase cell cycle progression. Moreover, gp96 induced epithelial-mesenchymal transition and increased colony formation ability of hepatocytes. Our results therefore provide insights in chronic HBV infection-induced gp96 expression, and indicate that elevated gp96 may contribute to HCC development during chronic inflammation.

Induction of Broad CD4+ and CD8+ T-Cell Responses and Cross- Neutralizing Antibodies against Hepatitis C Virus by Vaccination with Th1-Adjuvanted Polypeptides Followed by Defective Alphaviral Particles Expressing Envelope Glycoproteins gpE1 and gpE2 and Nonstructural Proteins 3, 4, and 5▿ †

PubMed Central

Lin, Yinling; Kwon, Taewoo; Polo, John; Zhu, Yi-Fei; Coates, Stephen; Crawford, Kevin; Dong, Christine; Wininger, Mark; Hall, John; Selby, Mark; Coit, Doris; Medina-Selby, Angelica; McCoin, Colin; Ng, Philip; Drane, Debbie; Chien, David; Han, Jang; Vajdy, Michael; Houghton, Michael

2008-01-01

Broad, multispecific CD4+ and CD8+ T-cell responses to the hepatitis C virus (HCV), as well as virus-cross-neutralizing antibodies, are associated with recovery from acute infection and may also be associated in chronic HCV patients with a favorable response to antiviral treatment. In order to recapitulate all of these responses in an ideal vaccine regimen, we have explored the use of recombinant HCV polypeptides combined with various Th1-type adjuvants and replication-defective alphaviral particles encoding HCV proteins in various prime/boost modalities in BALB/c mice. Defective chimeric alphaviral particles derived from the Sindbis and Venezuelan equine encephalitis viruses encoding either the HCV envelope glycoprotein gpE1/gpE2 heterodimer (E1E2) or nonstructural proteins 3, 4, and 5 (NS345) elicited strong CD8+ T-cell responses but low CD4+ T helper responses to these HCV gene products. In contrast, recombinant E1E2 glycoproteins adjuvanted with MF59 containing a CpG oligonucleotide elicited strong CD4+ T helper responses but no CD8+ T-cell responses. A recombinant NS345 polyprotein also stimulated strong CD4+ T helper responses but no CD8+ T-cell responses when adjuvanted with Iscomatrix containing CpG. Optimal elicitation of broad CD4+ and CD8+ T-cell responses to E1E2 and NS345 was obtained by first priming with Th1-adjuvanted proteins and then boosting with chimeric, defective alphaviruses expressing these HCV genes. In addition, this prime/boost regimen resulted in the induction of anti-E1E2 antibodies capable of cross-neutralizing heterologous HCV isolates in vitro. This vaccine formulation and regimen may therefore be optimal in humans for protection against this highly heterogeneous global pathogen. PMID:18508900

Imbalanced gp130 signalling in ApoE-deficient mice protects against atherosclerosis.

PubMed

Jones, Gareth W; McLeod, Louise; Kennedy, Catherine L; Bozinovski, Steven; Najdovska, Meri; Jenkins, Brendan J

2015-02-01

Interleukin (IL)-6 is a key modulator of the acute phase response (APR), and while both are implicated in atherosclerosis, the pathological role of specific IL-6 signalling cascades is ill-defined. Since IL-6 employs the cytokine receptor gp130 to primarily activate the STAT3 pathway, here we evaluate whether gp130-dependent STAT3 activation modulates atherosclerosis. High-fat diet-induced atherosclerosis was established in ApoE(-/-) mice crossed with gp130(F/F) knock-in mice displaying elevated gp130-dependent STAT3 activation and production of the APR protein, serum amyloid A (SAA). Also generated were gp130(F/F):Stat3(-/+):ApoE(-/-) mice displaying genetically-normalised STAT3 activation and SAA levels, and bone marrow chimeras involving ApoE(-/-) and gp130(F/F):ApoE(-/-) mice. At 10 weeks post high-fat diet, aortic atherosclerotic lesions, including the presence of CD68(+) macrophages, and plasma lipid and SAA profiles, were assessed. Aortic plaque development and plasma triglyceride levels in gp130(F/F):ApoE(-/-) mice were significantly reduced (3-fold, P < 0.001) compared to ApoE(-/-) littermates. By contrast, in gp130(F/F):ApoE(-/-) mice, atherosclerotic plaques contained augmented CD68(+) macrophage infiltrates, and plasma SAA levels were elevated, compared to ApoE(-/-) mice. Atherosclerotic lesion development and plasma triglyceride levels in gp130(F/F):ApoE(-/-) and gp130(F/F):Stat3(-/+):ApoE(-/-) mice were comparable, despite a significant (P < 0.05) reduction in macrophage numbers in lesions, and also plasma SAA levels, in gp130(F/F):Stat3(-/+):ApoE(-/-) mice. Aortic plaque development and plasma triglyceride levels were comparable in ApoE(-/-) mice reconstituted with gp130(F/F):ApoE(-/-) (ApoE(F/F:ApoE)) or ApoE(-/-) (ApoE(ApoE)) bone marrow cells. Deregulation of gp130/STAT3 signalling augments the APR and macrophage infiltration during atherosclerosis without impacting on the development of aortic plaques. Copyright © 2014 Elsevier Ireland Ltd

Mass spectrometry of cis-diamminedichloroplatinum(II) adducts with the dinucleosidemonophosphates d(ApG), d(GpG) and d(TpC) in an ion trap.

PubMed

Hagemeister, Timo; Linscheid, Michael

2002-07-01

The detection and fragmentation behaviour of adducts of the chemotherapeutic cis-diamminedichloroplatinum(II) (cisplatin) with the dinucleosidemonophosphates d(ApG), d(GpG) and d(TpC) as model compounds for DNA adducts in an ion trap with electrospray ionization were studied. Mainly the monofunctional adduct, the bifunctional adduct and the bifunctional adduct with platinum bridging two dinucleosidemonophosphates were detected. In addition, several more complex adducts were seen resulting from reactions among these species. Adduct formation was low in the case of d(TpC). Fragmentation could be controlled strongly by varying the temperature of the transfer capillary; furthermore, tandem mass spectrometric (MS/MS) experiments on both the monofunctional and the bifunctional adducts were performed. For the adducts of d(ApG) and d(GpG) losses of NH(3) and HCl were the most dominant reactions, followed by the losses of one, then another two units of 98 amu from the sugar-phosphate backbone, whereas d(TpC)-Pt predominantly forms the dinucleosidemonophosphate. In the gas phase, the conversion of the monofunctional into the bifunctional adducts through binding to another site in the dinucleotide accompanied by loss of NH(3) or HCl could also be observed. The removal of a ligand from the coordination sphere of the square-planar platinum complexes appeared to be the crucial step for the induction of further fragmentation of the dinucleotide ligand. MS(n) experiments of the bifunctional adducts of d(ApG) and d(GpG) revealed different fragmentation pathways involving the loss of phosphoric acid, metaphosphoric acid, deoxyribose units (intact or dehydrated) and the nucleobases in different orders, leaving characteristic binding site-determining fragments. Fragmentation of these ions was also performed, mainly resulting in fragmentation of the bases. The study confirmed the remarkable stability of the platinum-guanine bond compared with other nucleobases. Copyright 2002 John

The Broadly Neutralizing Anti-Human Immunodeficiency Virus Type 1 Antibody 2G12 Recognizes a Cluster of α1→2 Mannose Residues on the Outer Face of gp120

PubMed Central

Scanlan, Christopher N.; Pantophlet, Ralph; Wormald, Mark R.; Ollmann Saphire, Erica; Stanfield, Robyn; Wilson, Ian A.; Katinger, Hermann; Dwek, Raymond A.; Rudd, Pauline M.; Burton, Dennis R.

2002-01-01

2G12 is a broadly neutralizing human monoclonal antibody against human immunodeficiency virus type-1 (HIV-1) that has previously been shown to bind to a carbohydrate-dependent epitope on gp120. Here, site-directed mutagenesis and carbohydrate analysis were used to define further the 2G12 epitope. Extensive alanine scanning mutagenesis showed that elimination of the N-linked carbohydrate attachment sequences associated with residues N295, N332, N339, N386, and N392 by N→A substitution produced significant decreases in 2G12 binding affinity to gp120JR-CSF. Further mutagenesis suggested that the glycans at N339 and N386 were not critical for 2G12 binding to gp120JR-CSF. Comparison of the sequences of isolates neutralized by 2G12 was also consistent with a lesser role for glycans attached at these positions. The mutagenesis studies provided no convincing evidence for the involvement of gp120 amino acid side chains in 2G12 binding. Antibody binding was inhibited when gp120 was treated with Aspergillus saitoi mannosidase, Jack Bean mannosidase, or endoglycosidase H, indicating that Manα1→2Man-linked sugars of oligomannose glycans on gp120 are required for 2G12 binding. Consistent with this finding, the binding of 2G12 to gp120 could be inhibited by monomeric mannose but not by galactose, glucose, or N-acetylglucosamine. The inability of 2G12 to bind to gp120 produced in the presence of the glucose analogue N-butyl-deoxynojirimycin similarly implicated Manα1→2Man-linked sugars in 2G12 binding. Competition experiments between 2G12 and the lectin cyanovirin for binding to gp120 showed that 2G12 only interacts with a subset of available Manα1→2Man-linked sugars. Consideration of all the data, together with inspection of a molecular model of gp120, suggests that the most likely epitope for 2G12 is formed from mannose residues contributed by the glycans attached to N295 and N332, with the other glycans playing an indirect role in maintaining epitope conformation

HIV-1 gp120 neurotoxicity proximally and at a distance from the point of exposure: protection by rSV40 delivery of antioxidant enzymes.

PubMed

Louboutin, Jean-Pierre; Agrawal, Lokesh; Reyes, Beverly A S; Van Bockstaele, Elisabeth J; Strayer, David S

2009-06-01

Toxicity of HIV-1 envelope glycoprotein (gp120) for substantia nigra (SN) neurons may contribute to the Parkinsonian manifestations often seen in HIV-1-associated dementia (HAD). We studied the neurotoxicity of gp120 for dopaminergic neurons and potential neuroprotection by antioxidant gene delivery. Rats were injected stereotaxically into their caudate-putamen (CP); CP and (substantia nigra) SN neuron loss was quantified. The area of neuron loss extended several millimeters from the injection site, approximately 35% of the CP area. SN neurons, outside of this area of direct neurotoxicity, were also severely affected. Dopaminergic SN neurons (expressing tyrosine hydroxylase, TH, in the SN and dopamine transporter, DAT, in the CP) were mostly affected: intra-CP gp120 caused approximately 50% DAT+ SN neuron loss. Prior intra-CP gene delivery of Cu/Zn superoxide dismutase (SOD1) or glutathione peroxidase (GPx1) protected SN neurons from intra-CP gp120. Thus, SN dopaminergic neurons are highly sensitive to HIV-1 gp120-induced neurotoxicity, and antioxidant gene delivery, even at a distance, is protective.

Analysis of adenovirus-induced immunity to infection with Listeria monocytogenes: Fading protection coincides with declining CD8 T cell numbers and phenotypic changes.

PubMed

Jahn, Marie Louise; Steffensen, Maria Abildgaard; Christensen, Jan Pravsgaard; Thomsen, Allan Randrup

2018-05-11

Defining correlates of T cell mediated protection is important in order to accelerate the development of efficient T cell based vaccines conferring long-term immunity. Extensive studies have provided important insight regarding the characteristics and functional properties of the effector and memory CD8 T cells induced by viral vector based vaccines. However, long-term protection has been difficult to achieve with T cell inducing vaccines, and the determinants underlying this loss in protection over time are still not fully defined. In this study we analyzed different parameters of the CD8 T cell response as a function of time after vaccination with a human serotype 5 adenovector expressing the glycoprotein (GP) of LCMV tethered to the MHC class II-associated invariant chain. Using this vector we have previously found that CD8 T cells mediate protection from challenge with GP-expressing Listeria monocytogenes at 60 days post vaccination, but only little protection after further 60 days, and we now confirm this observation. A comparison of vaccine-primed CD8 T cells early and late after vaccination revealed a minor decline in the overall numbers of antigen specific memory CD8 T cells during this interval. More importantly, we also observed phenotypic changes over time with a distinct decline in the frequency and number of KLRG1 + CD8 T cells, and, notably, adoptive transfer studies confirmed that memory CD8 T cells expressing KLRG1 are central to protection from systemic L. monocytogenes infection. Together these findings imply that multiple factors including changes in memory T cell numbers and phenotypic composition over time influence the longevity of CD8 T-cell mediated protection. Copyright © 2018 Elsevier Ltd. All rights reserved.

Mini-P-gp and P-gp Co-Expression in Brown Trout Erythrocytes: A Prospective Blood Biomarker of Aquatic Pollution

PubMed Central

Valton, Emeline; Amblard, Christian; Desmolles, François; Combourieu, Bruno; Penault-Llorca, Frédérique; Bamdad, Mahchid

2015-01-01

In aquatic organisms, such as fish, blood is continually exposed to aquatic contaminants. Multidrug Resistance (MDR) proteins are ubiquitous detoxification membrane pumps, which recognize various xenobiotics. Moreover, their expression is induced by a large class of drugs and pollutants. We have highlighted the co-expression of a mini P-gp of 75 kDa and a P-gp of 140 kDa in the primary culture of brown trout erythrocytes and in the erythrocytes of wild brown trout collected from three rivers in the Auvergne region of France. In vitro experiments showed that benzo[a]pyrene, a highly toxic pollutant model, induced the co-expression of mini-P-gp and P-gp in trout erythrocytes in a dose-dependent manner and relay type response. Similarly, in the erythrocytes of wild brown trout collected from rivers contaminated by a mixture of PAH and other multi-residues of pesticides, mini-P-gp and P-gp were able to modulate their expression, according to the nature of the pollutants. The differential and complementary responses of mini-P-gp and P-gp in trout erythrocytes suggest the existence in blood cells of a real protective network against xenobiotics/drugs. This property could be exploited to develop a blood biomarker of river pollution. PMID:26854141

Uncoupling GP1 and GP2 Expression in the Lassa Virus Glycoprotein Complex: Implications for GPI Ectodomain Shedding

DTIC Science & Technology

2008-12-23

glycoprotein precursor (GPC) signal peptide (SP) or human IgG signal sequences (s.s.). GP2 was secreted from cells only when (1) the transmembrane (TM) domain...consistent with viral TM fusion proteins [9,10]. GPC con- tains a 58 residue hydrophobic N-terminal signal peptide (SP), which directs the precursor to the...including GPC, GP1, and GP2. Various signal peptides , purification tags, and modifications to internal domains were employed for the generation and

Construction and immunogenicity of a DNA vaccine coexpressing GP3 and GP5 of genotype-I porcine reproductive and respiratory syndrome virus

PubMed Central

2014-01-01

Background The European (EU) genotype of porcine reproductive and respiratory syndrome virus (Genotype-I PRRSV) has recently emerged in China. The coexistence of Genotype-I and -II PRRSV strains could cause seriously affect PRRSV diagnosis and management. Current vaccines are not able to protect against PRRSV infection completely and have inherent drawbacks. Thus, genetically engineered vaccines, including DNA vaccine and live vector engineered vaccines, have been developed. This study aimed to determine the enhanced immune responses of mice inoculated with a DNA vaccine coexpressing GP3 and GP5 of a Genotype-I PRRSV. Results To evaluate the immunogenicity of GP3 and GP5 proteins from European-type PRRSV, three DNA vaccines, pVAX1-EU-ORF3-ORF5, pVAX1-EU-ORF3 and pVAX1-EU-ORF5, were constructed, which were based on a Genotype-I LV strain (GenBank ID: M96262). BALB/c mice were immunized with the DNA vaccines; delivered in the form of chitosan-DNA nanoparticles. To increase the efficiency of the vaccine, Quil A (Quillaja) was used as an adjuvant. GP3 and GP5-specific antibodies, neutralizing antibodies and cytokines (IL-2, IL-4, IL-10 and IFN gamma) from the immunized mice sera, and other immune parameters, were examined, including T-cell proliferation responses and subgroups of spleen T-lymphocytes. The results showed that ORF3 and ORF5 proteins of Genotype-I PRRSV induced GP3 and GP5-specific antibodies that could neutralize the virus. The levels of Cytokines IL-2, IL-4, IL-10, and IFN–γ of the experimental groups were significantly higher than those of control groups after booster vaccination (P < 0.05). The production of CD3+CD4+ and CD3+CD8+ T lymphocyte was also induced. T lymphocyte proliferation assays showed that the PRRSV LV strain virus could stimulate the proliferation of T lymphocytes in mice in the experimental group. Conclusions Using Quil A as adjuvant, Genotype-I PRRSV GP3 and GP5 proteins produced good immunogenicity and reactivity. More

Peptides designed to spatially depict the Epstein-Barr virus major virion glycoprotein gp350 neutralization epitope elicit antibodies that block virus-neutralizing antibody 72A1 interaction with the native gp350 molecule.

PubMed

Tanner, Jerome E; Coinçon, Mathieu; Leblond, Valérie; Hu, Jing; Fang, Janey M; Sygusch, Jurgen; Alfieri, Caroline

2015-05-01

Epstein-Barr virus (EBV) is the etiologic agent of infectious mononucleosis and the root cause of B-cell lymphoproliferative disease in individuals with a weakened immune system, as well as a principal cofactor in nasopharyngeal carcinoma, various lymphomas, and other cancers. The EBV major virion surface glycoprotein gp350 is viewed as the best vaccine candidate to prevent infectious mononucleosis in healthy EBV-naive persons and EBV-related cancers in at-risk individuals. Previous epitope mapping of gp350 revealed only one dominant neutralizing epitope, which has been shown to be the target of the monoclonal antibody 72A1. Computer modeling of the 72A1 antibody interaction with the gp350 amino terminus was used to identify gp350 amino acids that could form strong ionic, electrostatic, or hydrogen bonds with the 72A1 antibody. Peptide DDRTTLQLAQNPVYIPETYPYIKWDN (designated peptide 2) and peptide GSAKPGNGSYFASVKTEMLGNEID (designated peptide 3) were designed to spatially represent the gp350 amino acids predicted to interact with the 72A1 antibody paratope. Peptide 2 bound to the 72A1 antibody and blocked 72A1 antibody recognition of the native gp350 molecule. Peptide 2 and peptide 3 were recognized by human IgG and shown to elicit murine antibodies that could target gp350 and block its recognition by the 72A1 antibody. This work provides a structural mapping of the interaction between the EBV-neutralizing antibody 72A1 and the major virion surface protein gp350. gp350 mimetic peptides that spatially depict the EBV-neutralizing epitope would be useful as a vaccine to focus the immune system exclusively to this important virus epitope. The production of virus-neutralizing antibodies targeting the Epstein-Barr virus (EBV) major surface glycoprotein gp350 is important for the prevention of infectious mononucleosis and EBV-related cancers. The data presented here provide the first in silico map of the gp350 interaction with a virus-blocking monoclonal antibody

Enhanced Immune Responses to HIV-1 Envelope Elicited by a Vaccine Regimen Consisting of Priming with Newcastle Disease Virus Expressing HIV gp160 and Boosting with gp120 and SOSIP gp140 Proteins.

PubMed

Khattar, Sunil K; DeVico, Anthony L; LaBranche, Celia C; Panda, Aruna; Montefiori, David C; Samal, Siba K

2016-02-01

Newcastle disease virus (NDV) expressing HIV-1 BaL gp160 was evaluated either alone or with monomeric BaL gp120 and BaL SOSIP gp140 protein in a prime-boost combination in guinea pigs to enhance envelope (Env)-specific humoral and mucosal immune responses. We showed that a regimen consisting of an NDV prime followed by a protein boost elicited stronger serum and mucosal Th-1-biased IgG responses and neutralizing antibody responses than NDV-only immunizations. Additionally, these responses were higher after the gp120 than after the SOSIP gp140 protein boost. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Saccharomyces cerevisiae expressing Gp43 protects mice against Paracoccidioides brasiliensis infection.

PubMed

Assis-Marques, Mariana Aprigio; Oliveira, Aline Ferreira; Ruas, Luciana Pereira; dos Reis, Thaila Fernanda; Roque-Barreira, Maria Cristina; Coelho, Paulo Sergio Rodrigues

2015-01-01

The dimorphic fungus Paracoccidioides brasiliensis is the etiological agent of paracoccidioidomycosis (PCM). It is believed that approximately 10 million people are infected with the fungus and approximately 2% will eventually develop the disease. Unlike viral and bacterial diseases, fungal diseases are the ones against which there is no commercially available vaccine. Saccharomyces cerevisiae may be a suitable vehicle for immunization against fungal infections, as they require the stimulation of different arms of the immune response. Here we evaluated the efficacy of immunizing mice against PCM by using S. cerevisiae yeast expressing gp43. When challenged by inoculation of P. brasiliensis yeasts, immunized animals showed a protective profile in three different assays. Their lung parenchyma was significantly preserved, exhibiting fewer granulomas with fewer fungal cells than found in non-immunized mice. Fungal burden was reduced in the lung and spleen of immunized mice, and both organs contained higher levels of IL-12 and IFN-γ compared to those of non-vaccinated mice, a finding that suggests the occurrence of Th1 immunity. Taken together, our results indicate that the recombinant yeast vaccine represents a new strategy to confer protection against PCM.

Structure of an Antibody in Complex with Its Mucin Domain Linear Epitope That Is Protective against Ebola Virus

PubMed Central

Olal, Daniel; Kuehne, Ana I.; Bale, Shridhar; Halfmann, Peter; Hashiguchi, Takao; Fusco, Marnie L.; Lee, Jeffrey E.; King, Liam B.; Kawaoka, Yoshihiro; Dye, John M.

2012-01-01

Antibody 14G7 is protective against lethal Ebola virus challenge and recognizes a distinct linear epitope in the prominent mucin-like domain of the Ebola virus glycoprotein GP. The structure of 14G7 in complex with its linear peptide epitope has now been determined to 2.8 Å. The structure shows that this GP sequence forms a tandem β-hairpin structure that binds deeply into a cleft in the antibody-combining site. A key threonine at the apex of one turn is critical for antibody interaction and is conserved among all Ebola viruses. This work provides further insight into the mechanism of protection by antibodies that target the protruding, highly accessible mucin-like domain of Ebola virus and the structural framework for understanding and characterizing candidate immunotherapeutics. PMID:22171276

Structure of an antibody in complex with its mucin domain linear epitope that is protective against Ebola virus.

PubMed

Olal, Daniel; Kuehne, Ana I; Bale, Shridhar; Halfmann, Peter; Hashiguchi, Takao; Fusco, Marnie L; Lee, Jeffrey E; King, Liam B; Kawaoka, Yoshihiro; Dye, John M; Saphire, Erica Ollmann

2012-03-01

Antibody 14G7 is protective against lethal Ebola virus challenge and recognizes a distinct linear epitope in the prominent mucin-like domain of the Ebola virus glycoprotein GP. The structure of 14G7 in complex with its linear peptide epitope has now been determined to 2.8 Å. The structure shows that this GP sequence forms a tandem β-hairpin structure that binds deeply into a cleft in the antibody-combining site. A key threonine at the apex of one turn is critical for antibody interaction and is conserved among all Ebola viruses. This work provides further insight into the mechanism of protection by antibodies that target the protruding, highly accessible mucin-like domain of Ebola virus and the structural framework for understanding and characterizing candidate immunotherapeutics.

Analysis of canine herpesvirus gB, gC and gD expressed by a recombinant vaccinia virus.

PubMed

Xuan, X; Kojima, A; Murata, T; Mikami, T; Otsuka, H

1997-01-01

The genes encoding the canine herpesvirus (CHV) glycoprotein B (gB), gC and gD homologues have been reported already. However, products of these genes have not been identified yet. Previously, we have identified three CHV glycoproteins, gp 145/112, gp80 and gp47 using a panel of monoclonal antibodies (MAbs). To determine which CHV glycoprotein corresponds to gB, gC or gD, the putative genes of gB, gC, and gD of CHV were inserted into the thymidine kinase gene of vaccinia virus LC16mO strain under the control of the early-late promoter for the vaccinia virus 7.5-kilodalton polypeptide. We demonstrated here that gp145/112, gp80 and gp47 were the translation products of the CHV gB, gC and gD genes, respectively. The antigenic authenticity of recombinant gB, gC and gD were confirmed by a panel of MAbs specific for each glycoprotein produced in CHV-infected cells. Immunization of mice with these recombinants produced high titers of neutralizing antibodies against CHV. These results suggest that recombinant vaccinia viruses expressing CHV gB, gC and gD may be useful to develop a vaccine to control CHV infection.

Interaction of colicin E7 with the major coat protein (g8p) may confer limited protection on colicinogenic Escherichia coli against M13 bacteriophage infection.

PubMed

Chen, Yuh-Ren; Yang, Tsung-Yeh; Lei, Guang-Sheng; Liao, Chen-Chung; Chak, Kin-Fu

2010-11-01

Colicin release provides producer strains with a competitive advantage under certain circumstances. We found that propagation of M13 bacteriophage in cells producing colicin E7 is impaired, without alteration in the efficiency of bacteriophage adsorption, as compared with non-producing cells. In contrast to the protective effect of the colicin against M13 bacteriophage infection, the endogenously expressed colicin does not confer limited protection against transfection with M13 bacteriophage DNA. Furthermore, it was found that the translocation-receptor-binding domain and toxicity domain of the colicin are able to interact with the M13 major coat protein, g8p, during bacteriophage infection. Based on these observations, we propose that interaction between colicin E7 and g8p during infection interferes with g8p depolymerizing into the cytoplasmic membrane during bacteriophage DNA penetration, thus resulting in the limited protection against M13 bacteriophage infection.

Distinct Immunogenicity and Efficacy of Poxvirus-Based Vaccine Candidates against Ebola Virus Expressing GP and VP40 Proteins.

PubMed

Lázaro-Frías, Adrián; Gómez-Medina, Sergio; Sánchez-Sampedro, Lucas; Ljungberg, Karl; Ustav, Mart; Liljeström, Peter; Muñoz-Fontela, César; Esteban, Mariano; García-Arriaza, Juan

2018-06-01

Zaire and Sudan ebolavirus species cause a severe disease in humans and nonhuman primates (NHPs) characterized by a high mortality rate. There are no licensed therapies or vaccines against Ebola virus disease (EVD), and the recent 2013 to 2016 outbreak in West Africa highlighted the need for EVD-specific medical countermeasures. Here, we generated and characterized head-to-head the immunogenicity and efficacy of five vaccine candidates against Zaire ebolavirus (EBOV) and Sudan ebolavirus (SUDV) based on the highly attenuated poxvirus vector modified vaccinia virus Ankara (MVA) expressing either the virus glycoprotein (GP) or GP together with the virus protein 40 (VP40) forming virus-like particles (VLPs). In a human monocytic cell line, the different MVA vectors (termed MVA-EBOVs and MVA-SUDVs) triggered robust innate immune responses, with production of beta interferon (IFN-β), proinflammatory cytokines, and chemokines. Additionally, several innate immune cells, such as dendritic cells, neutrophils, and natural killer cells, were differentially recruited in the peritoneal cavity of mice inoculated with MVA-EBOVs. After immunization of mice with a homologous prime/boost protocol (MVA/MVA), total IgG antibodies against GP or VP40 from Zaire and Sudan ebolavirus were differentially induced by these vectors, which were mainly of the IgG1 and IgG3 isotypes. Remarkably, an MVA-EBOV construct coexpressing GP and VP40 protected chimeric mice challenged with EBOV to a greater extent than a vector expressing GP alone. These results support the consideration of MVA-EBOVs and MVA-SUDVs expressing GP and VP40 and producing VLPs as best-in-class potential vaccine candidates against EBOV and SUDV. IMPORTANCE EBOV and SUDV cause a severe hemorrhagic fever affecting humans and NHPs. Since their discovery in 1976, they have caused several sporadic epidemics, with the recent outbreak in West Africa from 2013 to 2016 being the largest and most severe, with more than 11,000 deaths

Distinct effects of Broncho-Vaxom (OM-85 BV) on gp130 binding cytokines

PubMed Central

Roth, M; Block, L

2000-01-01

.
CONCLUSION—In vitro OM-85 BV exerts immunomodulatory action via modulation of the signal transducer gp130 and gp130 binding cytokines. The increase of IL-6 and IL-11 may explain enhanced T and B cell activity, immunoglobulin synthesis, and IgM to IgG switch. Suppression of IL-12 and LIF receptor-α further contributes to organ protection. With regard to gp130 mediated signalling of the investigated cytokines, OM-85 BV modifies the host immune response towards an increased sensitisation of cells to gp130 binding proteins.

 PMID:10899245

Vesicular Stomatitis Virus Pseudotyped with Ebola Virus Glycoprotein Serves as a Protective, Noninfectious Vaccine against Ebola Virus Challenge in Mice

PubMed Central

Lennemann, Nicholas J.; Herbert, Andrew S.; Brouillette, Rachel; Rhein, Bethany; Bakken, Russell A.; Perschbacher, Katherine J.; Cooney, Ashley L.; Miller-Hunt, Catherine L.; Ten Eyck, Patrick; Biggins, Julia; Olinger, Gene; Dye, John M.

2017-01-01

ABSTRACT The recent Ebola virus (EBOV) epidemic in West Africa demonstrates the potential for a significant public health burden caused by filoviral infections. No vaccine or antiviral is currently FDA approved. To expand the vaccine options potentially available, we assessed protection conferred by an EBOV vaccine composed of vesicular stomatitis virus pseudovirions that lack native G glycoprotein (VSVΔG) and bear EBOV glycoprotein (GP). These pseudovirions mediate a single round of infection. Both single-dose and prime/boost vaccination regimens protected mice against lethal challenge with mouse-adapted Ebola virus (ma-EBOV) in a dose-dependent manner. The prime/boost regimen provided significantly better protection than a single dose. As N-linked glycans are thought to shield conserved regions of the EBOV GP receptor-binding domain (RBD), thereby blocking epitopes within the RBD, we also tested whether VSVΔG bearing EBOV GPs that lack GP1 N-linked glycans provided effective immunity against challenge with ma-EBOV or a more distantly related virus, Sudan virus. Using a prime/boost strategy, high doses of GP/VSVΔG partially or fully denuded of N-linked glycans on GP1 protected mice against ma-EBOV challenge, but these mutants were no more effective than wild-type (WT) GP/VSVΔG and did not provide cross protection against Sudan virus. As reported for other EBOV vaccine platforms, the protection conferred correlated with the quantity of EBOV GP-specific Ig produced but not with the production of neutralizing antibodies. Our results show that EBOV GP/VSVΔG pseudovirions serve as a successful vaccination platform in a rodent model of Ebola virus disease and that GP1 N-glycan loss does not influence immunogenicity or vaccination success. IMPORTANCE The West African Ebola virus epidemic was the largest to date, with more than 28,000 people infected. No FDA-approved vaccines are yet available, but in a trial vaccination strategy in West Africa, recombinant

Ebola virus glycoprotein Fc fusion protein confers protection against lethal challenge in vaccinated mice

PubMed Central

Konduru, Krishnamurthy; Bradfute, Steven B.; Jacques, Jerome; Manangeeswaran, Mohanraj; Nakamura, Siham; Morshed, Sufi; Wood, Steven C.; Bavari, Sina

2011-01-01

Ebola virus is a Filoviridae that causes hemorrhagic fever in humans and induces high morbidity and mortality rates. Filoviruses are classified as "Category A bioterrorism agents", and currently there are no licensed therapeutics or vaccines to treat and prevent infection. The Filovirus glycoprotein (GP) is sufficient to protect individuals against infection, and several vaccines based on GP are under development including recombinant adenovirus, parainfluenza virus, Venezuelan equine encephalitis virus, vesicular stomatitis virus (VSV) and virus-like particles. Here we describe the development of a GP Fc fusion protein as a vaccine candidate. We expressed the extracellular domain of the Zaire Ebola virus (ZEBOV) GP fused to the Fc fragment of human IgG1 (ZEBOVGP-Fc) in mammalian cells and showed that GP undergoes the complex furin cleavage and processing observed in the native membrane-bound GP. Mice immunized with ZEBOVGP-Fc developed T-cell immunity against ZEBOV GP and neutralizing antibodies against replication-competent VSV-G deleted recombinant VSV containing ZEBOV GP. The ZEBOVGP-Fc vaccinated mice were protected against challenge with a lethal dose of ZEBOV. These results show that vaccination with the ZEBOVGP-Fc fusion protein alone without the need of a viral vector or assembly into virus-like particles is sufficient to induce protective immunity against ZEBOV in mice. Our data suggested that Filovirus GP Fc fusion proteins could be developed as a simple, safe, efficacious, and cost effective vaccine against Filovirus infection for human use. PMID:21329775

Comparative In Vitro and In Vivo Studies of Porcine Rotavirus G9P[13] and Human Rotavirus Wa G1P[8

PubMed Central

Shao, Lulu; Fischer, David D.; Kandasamy, Sukumar; Rauf, Abdul; Langel, Stephanie N.; Wentworth, David E.; Stucker, Karla M.; Halpin, Rebecca A.; Lam, Ham Ching; Marthaler, Douglas

2015-01-01

ABSTRACT The changing epidemiology of group A rotavirus (RV) strains in humans and swine, including emerging G9 strains, poses new challenges to current vaccines. In this study, we comparatively assessed the pathogenesis of porcine RV (PRV) G9P[13] and evaluated the short-term cross-protection between this strain and human RV (HRV) Wa G1P[8] in gnotobiotic pigs. Complete genome sequencing demonstrated that PRV G9P[13] possessed a human-like G9 VP7 genotype but shared higher overall nucleotide identity with historic PRV strains. PRV G9P[13] induced longer rectal virus shedding and RV RNAemia in pigs than HRV Wa G1P[8] and generated complete short-term cross-protection in pigs challenged with HRV or PRV, whereas HRV Wa G1P[8] induced only partial protection against PRV challenge. Moreover, PRV G9P[13] replicated more extensively in porcine monocyte-derived dendritic cells (MoDCs) than did HRV Wa G1P[8]. Cross-protection was likely not dependent on serum virus-neutralizing (VN) antibodies, as the heterologous VN antibody titers in the sera of G9P[13]-inoculated pigs were low. Thus, our results suggest that heterologous protection by the current monovalent G1P[8] HRV vaccine against emerging G9 strains should be evaluated in clinical and experimental studies to prevent further dissemination of G9 strains. Differences in the pathogenesis of these two strains may be partially attributable to their variable abilities to replicate and persist in porcine immune cells, including dendritic cells (DCs). Additional studies are needed to evaluate the emerging G9 strains as potential vaccine candidates and to test the susceptibility of various immune cells to infection by G9 and other common HRV/PRV genotypes. IMPORTANCE The changing epidemiology of porcine and human group A rotaviruses (RVs), including emerging G9 strains, may compromise the efficacy of current vaccines. An understanding of the pathogenesis and genetic, immunological, and biological features of the new emerging

Ortho-para transition rate in mu-molecular hydrogen and the proton's induced pseudoscalar coupling gp.

PubMed

Clark, J H D; Armstrong, D S; Gorringe, T P; Hasinoff, M D; King, P M; Stocki, T J; Tripathi, S; Wright, D H; Zolnierczuk, P A

2006-02-24

We report a measurement of the ortho-para transition rate in the p mu p molecule. The experiment was conducted at TRIUMF via the measurement of the time dependence of the 5.2 MeV neutrons from muon capture in liquid hydrogen. The measurement yielded an ortho-para rate Lambda op = (11.1 +/- 1.7 +/-(0.9)(0.6)) x 10(4) s(-1), which is substantially larger than the earlier result of Bardin et al. The result has striking implications for the proton's induced pseudoscalar coupling g(p), changing the value of g(p) obtained from the most precise ordinary muon capture measurement from 10.6 +/- 2.7 to 0.8 +/- 2.8, and from the sole radiative muon capture measurement from 12.2 +/- 1.1 to 10.6 +/- 1.2, bringing the latter result closer to theoretical predictions.

Structures of Ebola virus GP and sGP in complex with therapeutic antibodies.

PubMed

Pallesen, Jesper; Murin, Charles D; de Val, Natalia; Cottrell, Christopher A; Hastie, Kathryn M; Turner, Hannah L; Fusco, Marnie L; Flyak, Andrew I; Zeitlin, Larry; Crowe, James E; Andersen, Kristian G; Saphire, Erica Ollmann; Ward, Andrew B

2016-08-08

The Ebola virus (EBOV) GP gene encodes two glycoproteins. The major product is a soluble, dimeric glycoprotein (sGP) that is secreted abundantly. Despite the abundance of sGP during infection, little is known regarding its structure or functional role. A minor product, resulting from transcriptional editing, is the transmembrane-anchored, trimeric viral surface glycoprotein (GP). GP mediates attachment to and entry into host cells, and is the intended target of antibody therapeutics. Because large portions of sequence are shared between GP and sGP, it has been hypothesized that sGP may potentially subvert the immune response or may contribute to pathogenicity. In this study, we present cryo-electron microscopy structures of GP and sGP in complex with GP-specific and GP/sGP cross-reactive antibodies undergoing human clinical trials. The structure of the sGP dimer presented here, in complex with both an sGP-specific antibody and a GP/sGP cross-reactive antibody, permits us to unambiguously assign the oligomeric arrangement of sGP and compare its structure and epitope presentation to those of GP. We also provide biophysical evaluation of naturally occurring GP/sGP mutations that fall within the footprints identified by our high-resolution structures. Taken together, our data provide a detailed and more complete picture of the accessible Ebolavirus glycoprotein landscape and a structural basis to evaluate patient and vaccine antibody responses towards differently structured products of the GP gene.

gp-91 mediates histone deacetylase inhibition-induced cardioprotection

PubMed Central

Zhao, Ting C; Zhang, Ling X; Cheng, Guangmao; Liu, Jun T

2010-01-01

We have recently shown that the inhibition of histone deacetylases (HDAC) protects the heart against ischemia and reperfusion (I/R) injury. The mechanism by which HDAC inhibition induces cardioprotection remains unknown. We sought to investigate whether the genetic disruption of gp-91, a subunit of NADPH-oxidase, would mitigate cardioprotection of HDAC inhibition. Wild-type and gp-91−/− mice were treated with a potent inhibitor of HDACs, trichostatin A (TSA, 0.1mg/kg, i.p.). Twenty-four hours later, the perfused hearts were subjected to 30 min of ischemia and 30 min of reperfusion. HDAC inhibition in wild-type mice produced marked improvements in ventricular functional recovery and the reduction of infarct size. TSA-induced cardioprotection was eliminated with genetic deletion of gp91. Notably, Western blot and immunostaining displayed a significant increase in gp-91 in myocardium following HDAC inhibition, which resulted in a mildly subsequent increase in the production of reactive oxygen species (ROS). The pretreatment of H9c2 cardiomyoblasts with TSA (50 nmol/L) decreased cell necrosis and increased viability in response to simulated ischemia (SI), which was abrogated by the transfection of cells with gp-91 siRNA, but not by scrambled siRNA. Furthermore, treatment of PLB-985 gp91+/+cells with TSA increased the resistance to SI, which also diminished with genetic disruption of gp91 in gp91phox-deficient PLB-985 cells. TSA treatment inhibited the increased active caspase-3 in H9c2 cardiomyoblasts and PLB-985 gp91+/+cells exposed to SI, which were prevented by knockdown of gp-91 by siRNA. These results suggest that a cascade consisting of gp-91 and HDAC inhibition plays an essential role in orchestrating the cardioprotective effect. PMID:20433879

HIV-Exposed Infants Vaccinated with an MF59/Recombinant gp120 Vaccine Have Higher-Magnitude Anti-V1V2 IgG Responses than Adults Immunized with the Same Vaccine.

PubMed

McGuire, Erin P; Fong, Youyi; Toote, Christopher; Cunningham, Coleen K; McFarland, Elizabeth J; Borkowsky, William; Barnett, Susan; Itell, Hannah L; Kumar, Amit; Gray, Glenda; McElrath, M Julianna; Tomaras, Georgia D; Permar, Sallie R; Fouda, Genevieve G

2018-01-01

reduce the number of these ongoing infant infections and also prime for long-term immunity prior to sexual debut. We previously reported that immunization of infants with an MF59-adjuvanted recombinant gp120 vaccine induced higher-magnitude, potentially protective anti-V1V2 IgG responses than in adult vaccinees receiving the moderately effective RV144 vaccine. In the present study, we demonstrate that the robust response observed in infants is not due to differences in vaccine regimen or vaccine dose between adults and infants. Our results suggest that HIV vaccine adjuvants may differentially modulate immune responses in adults and infants, highlighting the need to conduct vaccine trials in pediatric populations. Copyright © 2017 American Society for Microbiology.

Potentiating Effects of MPL on DSPC Bearing Cationic Liposomes Promote Recombinant GP63 Vaccine Efficacy: High Immunogenicity and Protection

PubMed Central

Mazumder, Saumyabrata; Maji, Mithun; Ali, Nahid

2011-01-01

Background Vaccines that activate strong specific Th1-predominant immune responses are critically needed for many intracellular pathogens, including Leishmania. The requirement for sustained and efficient vaccination against leishmaniasis is to formulate the best combination of immunopotentiating adjuvant with the stable antigen (Ag) delivery system. The aim of the present study is to evaluate the effectiveness of an immunomodulator on liposomal Ag through subcutaneous (s.c.) route of immunization, and its usefulness during prime/boost against visceral leishmaniasis (VL) in BALB/c mice. Methodology/Principal Findings Towards this goal, we formulated recombinant GP63 (rGP63)-based vaccines either with monophosphoryl lipid A-trehalose dicorynomycolate (MPL-TDM) or entrapped within cationic liposomes or both. Combinatorial administration of liposomes with MPL-TDM during prime confers activation of dendritic cells, and induces an early robust T cell response. To investigate whether the combined formulation is required for optimum immune response during boost as well, we chose to evaluate the vaccine efficacy in mice primed with combined adjuvant system followed by boosting with either rGP63 alone, in association with MPL-TDM, liposomes or both. We provide evidences that the presence of either liposomal rGP63 or combined formulations during boost is necessary for effective Th1 immune responses (IFN-γ, IL-12, NO) before challenge infection. However, boosting with MPL-TDM in conjugation with liposomal rGP63 resulted in a greater number of IFN-γ producing effector T cells, significantly higher levels of splenocyte proliferation, and Th1 responses compared to mice boosted with liposomal rGP63, after virulent Leishmania donovani (L. donovani) challenge. Moreover, combined formulations offered superior protection against intracellular amastigote replication in macrophages in vitro, and hepatic and splenic parasite load in vivo. Conclusion Our results define the

[Active participation in research and teaching during post-graduate GP training: perspectives of future general practitioners].

PubMed

Haumann, Hannah; Flum, Elisabeth; Joos, Stefanie

2016-12-01

future clinical position in a research practice (3.8±1.2 vs. 2.5±1.2, p<0.001) and as a lecturer at an academic institution of general practice (4.3±0.9 vs. 3.9±1.1, p=0.04). There is an interest in professional involvement in research and teaching during post-graduate GP training among GP trainees and young GPs. For those interested, structured concepts (e.g. "clinician scientist") need to be developed in order to facilitate the combination of clinical work and a position in research and teaching during post-graduate GP training. In doing so, the existing potential could be better exploited and more future GPs could be involved in research and teaching. Copyright © 2016. Published by Elsevier GmbH.

The Australian Defence Force Post‑discharge GP Health Assessment.

PubMed

Reed, Richard L; Masters, Stacey; Roeger, Leigh S

2016-03-01

All former serving members of the Australian Defence Force (ADF) can receive a comprehensive health assessment from their general practitioners (GPs). The aim of this article is to describe the ADF Post-discharge GP Health Assessment and introduce a tool that assists GPs in performing the assessment. The ADF Post-discharge GP Health Assessment is intended to promote the early detection and intervention of potential mental or physical health concerns in the veteran population and facilitate the establishment of ongoing care with a GP.

g8: Physics with Linearly-Polarized Photons in Hall B of JLab

NASA Astrophysics Data System (ADS)

Cole, Philip L.

2001-11-01

The set of experiments forming the g8 run in Hall B took place this past summer (6/4/01-8/13/01) in Hall B of Jefferson Lab. These experiments make use of a beam of linearly-polarized photons produced through coherent bremsstrahlung and represent the first time such a probe has been employed at Jefferson Lab. Several new and upgraded Hall-B beamline devices were commissioned prior to the production running of g8. The scientific purpose of g8 is to improve the understanding of the underlying symmetry of the quark degrees of freedom in the nucleon, the nature of the parity exchange between the incident photon and the target nucleon, and the mechanism of associated strangeness production in electromagnetic reactions. With the high-quality beam of the tagged and collimated linearly-polarized photons and the nearly complete angular coverage of the Hall-B spectrometer, we will extract the differential cross sections and polarization observables for the photoproduction of vector mesons and kaons at photon energies ranging between 1.9 and 2.1 GeV. We collected over 1.2 trillion triggers. After data cuts, we expect to have 500 times the world's data set on rhos and omegas produced via a beam of linearly-polarized photons. A report on the results of the commissioning of the beamline devices and the progress of the analysis of the g8 run will be presented.

Modification on ursodeoxycholic acid (UDCA) scaffold. discovery of bile acid derivatives as selective agonists of cell-surface G-protein coupled bile acid receptor 1 (GP-BAR1).

PubMed

Sepe, Valentina; Renga, Barbara; Festa, Carmen; D'Amore, Claudio; Masullo, Dario; Cipriani, Sabrina; Di Leva, Francesco Saverio; Monti, Maria Chiara; Novellino, Ettore; Limongelli, Vittorio; Zampella, Angela; Fiorucci, Stefano

2014-09-25

Bile acids are signaling molecules interacting with the nuclear receptor FXR and the G-protein coupled receptor 1 (GP-BAR1/TGR5). GP-BAR1 is a promising pharmacological target for the treatment of steatohepatitis, type 2 diabetes, and obesity. Endogenous bile acids and currently available semisynthetic bile acids are poorly selective toward GP-BAR1 and FXR. Thus, in the present study we have investigated around the structure of UDCA, a clinically used bile acid devoid of FXR agonist activity, to develop a large family of side chain modified 3α,7β-dihydroxyl cholanoids that selectively activate GP-BAR1. In vivo and in vitro pharmacological evaluation demonstrated that administration of compound 16 selectively increases the expression of pro-glucagon 1, a GP-BAR1 target, in the small intestine, while it had no effect on FXR target genes in the liver. Further, compound 16 results in a significant reshaping of bile acid pool in a rodent model of cholestasis. These data demonstrate that UDCA is a useful scaffold to generate novel and selective steroidal ligands for GP-BAR1.

Head-to-head right-handed cross-links of the antitumor-active bis(mu-N,N'-di-p-tolylformamidinato)dirhodium(II,II) unit with the dinucleotides d(GpA) and d(ApG).

PubMed

Chifotides, Helen T; Dunbar, Kim R

2008-01-01

Reactions of cis-[Rh(2)(DTolF)(2)(NCCH(3))(6)](BF(4))(2) with the dinucleotides d(GpA) and d(ApG) proceed to form [Rh(2)(DTolF)(2){d(GpA)}] and [Rh(2)(DTolF)(2){d(ApG)}], respectively, with bridging purine bases spanning the Rh-Rh unit in the equatorial positions. Both dirhodium adducts exhibit head-to-head (HH) arrangement of the bases, as indicated by the presence of H8/H8 NOE cross-peaks in the 2D ROESY NMR spectra. The guanine bases bind to the dirhodium core at positions N7 and O6, a conclusion that is supported by the absence of N7 protonation at low pH values and the notable increase in the acidity of the guanine N1H sites (pK(a) approximately 7.4 in 4:1 CD(3)CN/D(2)O), inferred from the pH-dependence titrations of the guanine H8 proton resonances. In both dirhodium adducts, the adenine bases coordinate to the metal atoms through N6 and N7, which induces stabilization of the rare imino tautomer of the bases with a concomitant substantial decrease in the basicity of the N1H adenine sites (pK(a) approximately 7.0-7.1 in 4:1 CD(3)CN/D(2)O), as compared to the imino form of free adenosine. The presence of the adenine bases in the rare imino form is further corroborated by the observation of DQF-COSY H2/N1H and ROE N1H/N6H cross-peaks in the 2D NMR spectra of [Rh(2)(DTolF)(2){d(GpA)}] and [Rh(2)(DTolF)(2){d(ApG)}] in CD(3)CN at -38 degrees C. The 2D NMR spectroscopic data and the molecular modeling results suggest the presence of right-handed variants, HH1R, in solution for both adducts (HH1R refers to the relative base canting and the direction of propagation of the phosphodiester backbone with respect to the 5' base). Complete characterization of [Rh(2)(DTolF)(2){d(GpA)}] and [Rh(2)(DTolF)(2){d(ApG)}] by 2D NMR spectroscopy and molecular modeling supports anti-orientation of the sugar residues for both adducts about the glycosyl bonds as well as N- and S-type conformations for the 5'- and 3'-deoxyribose residues, respectively.

TssA forms a gp6-like ring attached to the type VI secretion sheath.

PubMed

Planamente, Sara; Salih, Osman; Manoli, Eleni; Albesa-Jové, David; Freemont, Paul S; Filloux, Alain

2016-08-01

The type VI secretion system (T6SS) is a supra-molecular bacterial complex that resembles phage tails. It is a killing machine which fires toxins into target cells upon contraction of its TssBC sheath. Here, we show that TssA1 is a T6SS component forming dodecameric ring structures whose dimensions match those of the TssBC sheath and which can accommodate the inner Hcp tube. The TssA1 ring complex binds the T6SS sheath and impacts its behaviour in vivo In the phage, the first disc of the gp18 sheath sits on a baseplate wherein gp6 is a dodecameric ring. We found remarkable sequence and structural similarities between TssA1 and gp6 C-termini, and propose that TssA1 could be a baseplate component of the T6SS Furthermore, we identified similarities between TssK1 and gp8, the former interacting with TssA1 while the latter is found in the outer radius of the gp6 ring. These observations, combined with similarities between TssF and gp6N-terminus or TssG and gp53, lead us to propose a comparative model between the phage baseplate and the T6SS. © 2016 The Authors. Published under the terms of the CC BY 4.0 license.

A Chimeric HIV-1 gp120 Fused with Vaccinia Virus 14K (A27) Protein as an HIV Immunogen

PubMed Central

Vijayan, Aneesh; García-Arriaza, Juan; C. Raman, Suresh; Conesa, José Javier; Chichón, Francisco Javier; Santiago, César; Sorzano, Carlos Óscar S.; Carrascosa, José L.; Esteban, Mariano

2015-01-01

In the HIV vaccine field, there is a need to produce highly immunogenic forms of the Env protein with the capacity to trigger broad B and T-cell responses. Here, we report the generation and characterization of a chimeric HIV-1 gp120 protein (termed gp120-14K) by fusing gp120 from clade B with the vaccinia virus (VACV) 14K oligomeric protein (derived from A27L gene). Stable CHO cell lines expressing HIV-1 gp120-14K protein were generated and the protein purified was characterized by size exclusion chromatography, electron microscopy and binding to anti-Env antibodies. These approaches indicate that gp120-14K protein is oligomeric and reacts with a wide spectrum of HIV-1 neutralizing antibodies. Furthermore, in human monocyte-derived dendritic cells (moDCs), gp120-14K protein upregulates the levels of several proinflammatory cytokines and chemokines associated with Th1 innate immune responses (IL-1β, IFN-γ, IL-6, IL-8, IL-12, RANTES). Moreover, we showed in a murine model, that a heterologous prime/boost immunization protocol consisting of a DNA prime with a plasmid expressing gp120-14K protein followed by a boost with MVA-B [a recombinant modified vaccinia virus Ankara (MVA) expressing HIV-1 gp120, Gag, Pol and Nef antigens from clade B], generates stronger, more polyfunctional, and greater effector memory HIV-1-specific CD4+ and CD8+ T-cell immune responses, than immunization with DNA-gp120/MVA-B. The DNA/MVA protocol was superior to immunization with the combination of protein/MVA and the latter was superior to a prime/boost of MVA/MVA or protein/protein. In addition, these immunization protocols enhanced antibody responses against gp120 of the class IgG2a and IgG3, together favoring a Th1 humoral immune response. These results demonstrate that fusing HIV-1 gp120 with VACV 14K forms an oligomeric protein which is highly antigenic as it activates a Th1 innate immune response in human moDCs, and in vaccinated mice triggers polyfunctional HIV-1-specific adaptive

Structure and Recognition of a Novel HIV-1 gp120-gp41 Interface Antibody that Caused MPER Exposure through Viral Escape

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wibmer, Constantinos Kurt; Gorman, Jason; Ozorowski, Gabriel

A comprehensive understanding of the regions on HIV-1 envelope trimers targeted by broadly neutralizing antibodies may contribute to rational design of an HIV-1 vaccine. We previously identified a participant in the CAPRISA cohort, CAP248, who developed trimer-specific antibodies capable of neutralizing 60% of heterologous viruses at three years post-infection. Here, we report the isolation by B cell culture of monoclonal antibody CAP248-2B, which targets a novel membrane proximal epitope including elements of gp120 and gp41. Despite low maximum inhibition plateaus, often below 50% inhibitory concentrations, the breadth of CAP248-2B significantly correlated with donor plasma. Site-directed mutagenesis, X-ray crystallography, and negative-stainmore » electron microscopy 3D reconstructions revealed how CAP248-2B recognizes a cleavage-dependent epitope that includes the gp120 C terminus. While this epitope is distinct, it overlapped in parts of gp41 with the epitopes of broadly neutralizing antibodies PGT151, VRC34, 35O22, 3BC315, and 10E8. CAP248-2B has a conformationally variable paratope with an unusually long 19 amino acid light chain third complementarity determining region. Two phenylalanines at the loop apex were predicted by docking and mutagenesis data to interact with the viral membrane. Neutralization by CAP248-2B is not dependent on any single glycan proximal to its epitope, and low neutralization plateaus could not be completely explained by N- or O-linked glycosylation pathway inhibitors, furin co-transfection, or pre-incubation with soluble CD4. Viral escape from CAP248-2B involved a cluster of rare mutations in the gp120-gp41 cleavage sites. Simultaneous introduction of these mutations into heterologous viruses abrogated neutralization by CAP248-2B, but enhanced neutralization sensitivity to 35O22, 4E10, and 10E8 by 10-100-fold. Altogether, this study expands the region of the HIV-1 gp120-gp41 quaternary interface that is a target for broadly

Structure and Recognition of a Novel HIV-1 gp120-gp41 Interface Antibody that Caused MPER Exposure through Viral Escape

PubMed Central

Elliott, Debra H.; Rouelle, Julie; Smira, Ashley; Ndabambi, Nonkululeko; Druz, Aliaksandr; Williamson, Carolyn

2017-01-01

A comprehensive understanding of the regions on HIV-1 envelope trimers targeted by broadly neutralizing antibodies may contribute to rational design of an HIV-1 vaccine. We previously identified a participant in the CAPRISA cohort, CAP248, who developed trimer-specific antibodies capable of neutralizing 60% of heterologous viruses at three years post-infection. Here, we report the isolation by B cell culture of monoclonal antibody CAP248-2B, which targets a novel membrane proximal epitope including elements of gp120 and gp41. Despite low maximum inhibition plateaus, often below 50% inhibitory concentrations, the breadth of CAP248-2B significantly correlated with donor plasma. Site-directed mutagenesis, X-ray crystallography, and negative-stain electron microscopy 3D reconstructions revealed how CAP248-2B recognizes a cleavage-dependent epitope that includes the gp120 C terminus. While this epitope is distinct, it overlapped in parts of gp41 with the epitopes of broadly neutralizing antibodies PGT151, VRC34, 35O22, 3BC315, and 10E8. CAP248-2B has a conformationally variable paratope with an unusually long 19 amino acid light chain third complementarity determining region. Two phenylalanines at the loop apex were predicted by docking and mutagenesis data to interact with the viral membrane. Neutralization by CAP248-2B is not dependent on any single glycan proximal to its epitope, and low neutralization plateaus could not be completely explained by N- or O-linked glycosylation pathway inhibitors, furin co-transfection, or pre-incubation with soluble CD4. Viral escape from CAP248-2B involved a cluster of rare mutations in the gp120-gp41 cleavage sites. Simultaneous introduction of these mutations into heterologous viruses abrogated neutralization by CAP248-2B, but enhanced neutralization sensitivity to 35O22, 4E10, and 10E8 by 10-100-fold. Altogether, this study expands the region of the HIV-1 gp120-gp41 quaternary interface that is a target for broadly neutralizing

Phase 3 randomised study of the proposed biosimilar adalimumab GP2017 in psoriasis - impact of multiple switches.

PubMed

Blauvelt, A; Lacour, J-P; Fowler, J F; Weinberg, J M; Gospodinov, D; Schuck, E; Jauch-Lembach, J; Balfour, A; Leonardi, C L

2018-06-19

The impact of multiple switches between GP2017 and reference adalimumab (ref-ADMB) was assessed following the demonstration of equivalent efficacy and similar safety and immunogenicity, in adult patients with active, clinically stable, moderate-to-severe plaque psoriasis. This 51-week double-blinded, phase 3 study randomly assigned patients to GP2017 (N=231) or ref-ADMB (N=234) 80 mg subcutaneously at Week 0, then 40 mg biweekly from Week 1. At Week 17, patients were re-randomised to switch (n=126) or continue (n=253) treatment. Primary endpoint: patients achieving Psoriasis Area and Severity Index (PASI)75 at Week 16 (equivalence confirmed if the 95% confidence interval [CI] for the difference in PASI75 between treatments was ±18%). Key secondary endpoint: change from baseline to Week 16 in continuous PASI. Other endpoints: PASI over time, PASI 50/75/90/100, pharmacokinetics, safety, tolerability and immunogenicity for the switched and continued treatment groups. Equivalent efficacy between GP2017 and ref-ADMB was confirmed for the primary (66.8% and 65.0%, respectively; 95% CI, -7.46, 11.15) and key secondary (-60.7% and -61.5%, respectively; 95% CI, -3.15, 4.84) endpoints. PASI improved over time and was similar between treatment groups at Week 16, and the switched/continued groups from Weeks 17-51. There were no relevant safety or immunogenicity differences between GP2017 and ref-ADMB at Week 16, or the switched/continued groups from Weeks 17-51. No hypersensitivity to adalimumab was reported upon switching. Following the demonstration of GP2017 biosimilarity to ref-ADMB, switching up to four times between GP2017 and ref-ADMB had no detectable impact on efficacy, safety or immunogenicity. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Investigation of the function of the putative self-association site of Epstein-Barr virus (EBV) glycoprotein 42 (gp42)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rowe, Cynthia L., E-mail: c-rowe@northwestern.edu; Matsuura, Hisae, E-mail: hisaem@stanford.edu; Interdepartmental Biological Sciences Program, Northwestern University, Evanston, IL 60208

The Epstein-Barr virus (EBV) glycoprotein 42 (gp42) is a type II membrane protein essential for entry into B cells but inhibits entry into epithelial cells. X-ray crystallography suggests that gp42 may form dimers when bound to human leukocyte antigen (HLA) class II receptor (Mullen et al., 2002) or multimerize when not bound to HLA class II (Kirschner et al., 2009). We investigated this self-association of gp42 using several different approaches. We generated soluble mutants of gp42 containing mutations within the self-association site and found that these mutants have a defect in fusion. The gp42 mutants bound to gH/gL and HLAmore » class II, but were unable to bind wild-type gp42 or a cleavage mutant of gp42. Using purified gp42, gH/gL, and HLA, we found these proteins associate 1:1:1 by gel filtration suggesting that gp42 dimerization or multimerization does not occur or is a transient event undetectable by our methods.« less

Topical CpG Adjuvantation of a Protein-Based Vaccine Induces Protective Immunity to Listeria monocytogenes

PubMed Central

Cheng, Wing Ki; Wee, Kathleen; Kollmann, Tobias R.

2014-01-01

Robust CD8+ T cell responses are essential for immune protection against intracellular pathogens. Using parenteral administration of ovalbumin (OVA) protein as a model antigen, the effect of the Toll-like receptor 9 (TLR9) agonist, CpG oligodeoxynucleotide (ODN) 1826, as an adjuvant delivered either topically, subcutaneously, or intramuscularly on antigen-specific CD8+ T cell responses in a mouse model was evaluated. Topical CpG adjuvant increased the frequency of OVA-specific CD8+ T cells in the peripheral blood and in the spleen. The more effective strategy to administer topical CpG adjuvant to enhance CD8+ T cell responses was single-dose administration at the time of antigen injection with a prime-boost regimen. Topical CpG adjuvant conferred both rapid and long-lasting protection against systemic challenge with recombinant Listeria monocytogenes expressing the cytotoxic T lymphocyte (CTL) epitope of OVA257–264 (strain Lm-OVA) in a TLR9-dependent manner. Topical CpG adjuvant induced a higher proportion of CD8+ effector memory T cells than parenteral administration of the adjuvant. Although traditional vaccination strategies involve coformulation of antigen and adjuvant, split administration using topical adjuvant is effective and has advantages of safety and flexibility. Split administration of topical CpG ODN 1826 with parenteral protein antigen is superior to other administration strategies in enhancing both acute and memory protective CD8+ T cell immune responses to subcutaneous protein vaccines. This vaccination strategy induces rapid and persistent protective immune responses against the intracellular organism L. monocytogenes. PMID:24391136

Ebolavirus Glycoprotein Fc Fusion Protein Protects Guinea Pigs against Lethal Challenge

PubMed Central

Konduru, Krishnamurthy; Shurtleff, Amy C.; Bradfute, Steven B.; Nakamura, Siham; Bavari, Sina; Kaplan, Gerardo

2016-01-01

Ebola virus (EBOV), a member of the Filoviridae that can cause severe hemorrhagic fever in humans and nonhuman primates, poses a significant threat to the public health. Currently, there are no licensed vaccines or therapeutics to prevent and treat EBOV infection. Several vaccines based on the EBOV glycoprotein (GP) are under development, including vectored, virus-like particles, and protein-based subunit vaccines. We previously demonstrated that a subunit vaccine containing the extracellular domain of the Ebola ebolavirus (EBOV) GP fused to the Fc fragment of human IgG1 (EBOVgp-Fc) protected mice against EBOV lethal challenge. Here, we show that the EBOVgp-Fc vaccine formulated with QS-21, alum, or polyinosinic-polycytidylic acid-poly-L-lysine carboxymethylcellulose (poly-ICLC) adjuvants induced strong humoral immune responses in guinea pigs. The vaccinated animals developed anti-GP total antibody titers of approximately 105−106 and neutralizing antibody titers of approximately 103 as assessed by a BSL-2 neutralization assay based on vesicular stomatitis virus (VSV) pseudotypes. The poly-ICLC formulated EBOVgp-Fc vaccine protected all the guinea pigs against EBOV lethal challenge performed under BSL-4 conditions whereas the same vaccine formulated with QS-21 or alum only induced partial protection. Vaccination with a mucin-deleted EBOVgp-Fc construct formulated with QS-21 adjuvant did not have a significant effect in anti-GP antibody levels and protection against EBOV lethal challenge compared to the full-length GP construct. The bulk of the humoral response induced by the EBOVgp-Fc vaccine was directed against epitopes outside the EBOV mucin region. Our findings indicate that different adjuvants can eliciting varying levels of protection against lethal EBOV challenge in guinea pigs vaccinated with EBOVgp-Fc, and suggest that levels of total anti-GP antibodies elicit by protein-based GP subunit vaccines do not correlate with protection. Our data further support

Ebolavirus Glycoprotein Fc Fusion Protein Protects Guinea Pigs against Lethal Challenge.

PubMed

Konduru, Krishnamurthy; Shurtleff, Amy C; Bradfute, Steven B; Nakamura, Siham; Bavari, Sina; Kaplan, Gerardo

2016-01-01

Ebola virus (EBOV), a member of the Filoviridae that can cause severe hemorrhagic fever in humans and nonhuman primates, poses a significant threat to the public health. Currently, there are no licensed vaccines or therapeutics to prevent and treat EBOV infection. Several vaccines based on the EBOV glycoprotein (GP) are under development, including vectored, virus-like particles, and protein-based subunit vaccines. We previously demonstrated that a subunit vaccine containing the extracellular domain of the Ebola ebolavirus (EBOV) GP fused to the Fc fragment of human IgG1 (EBOVgp-Fc) protected mice against EBOV lethal challenge. Here, we show that the EBOVgp-Fc vaccine formulated with QS-21, alum, or polyinosinic-polycytidylic acid-poly-L-lysine carboxymethylcellulose (poly-ICLC) adjuvants induced strong humoral immune responses in guinea pigs. The vaccinated animals developed anti-GP total antibody titers of approximately 105-106 and neutralizing antibody titers of approximately 103 as assessed by a BSL-2 neutralization assay based on vesicular stomatitis virus (VSV) pseudotypes. The poly-ICLC formulated EBOVgp-Fc vaccine protected all the guinea pigs against EBOV lethal challenge performed under BSL-4 conditions whereas the same vaccine formulated with QS-21 or alum only induced partial protection. Vaccination with a mucin-deleted EBOVgp-Fc construct formulated with QS-21 adjuvant did not have a significant effect in anti-GP antibody levels and protection against EBOV lethal challenge compared to the full-length GP construct. The bulk of the humoral response induced by the EBOVgp-Fc vaccine was directed against epitopes outside the EBOV mucin region. Our findings indicate that different adjuvants can eliciting varying levels of protection against lethal EBOV challenge in guinea pigs vaccinated with EBOVgp-Fc, and suggest that levels of total anti-GP antibodies elicit by protein-based GP subunit vaccines do not correlate with protection. Our data further support

Ebolavirus Glycoprotein Fc Fusion Protein Protects Guinea Pigs against Lethal Challenge

DOE PAGES

Konduru, Krishnamurthy; Shurtleff, Amy C.; Bradfute, Steven B.; ...

2016-09-13

Ebola virus (EBOV), a member of the Filoviridae that can cause severe hemorrhagic fever in humans and nonhuman primates, poses a significant threat to the public health. Currently, there are no licensed vaccines or therapeutics to prevent and treat EBOV infection. Several vaccines based on the EBOV glycoprotein (GP) are under development, including vectored, virus-like particles, and protein-based subunit vaccines. We previously demonstrated that a subunit vaccine containing the extracellular domain of the Ebola ebolavirus (EBOV) GP fused to the Fc fragment of human IgG1 (EBOVgp-Fc) protected mice against EBOV lethal challenge. Here, we show that the EBOVgp-Fc vaccine formulatedmore » with QS-21, alum, or polyinosinic-polycytidylic acid-poly-L-lysine carboxymethylcellulose (poly-ICLC) adjuvants induced strong humoral immune responses in guinea pigs. The vaccinated animals developed anti-GP total antibody titers of approximately 10 5–10 6 and neutralizing antibody titers of approximately 10 3 as assessed by a BSL-2 neutralization assay based on vesicular stomatitis virus (VSV) pseudotypes. The poly-ICLC formulated EBOVgp-Fc vaccine protected all the guinea pigs against EBOV lethal challenge performed under BSL-4 conditions whereas the same vaccine formulated with QS-21 or alum only induced partial protection. Vaccination with a mucin-deletedEBOVgp-Fc construct formulated with QS-21 adjuvant did not have a significant effect in anti-GP antibody levels and protection against EBOV lethal challenge compared to the full-lengthGP construct. The bulk of the humoral response induced by the EBOVgp-Fc vaccine was directed against epitopes outside the EBOV mucin region. Our findings indicate that different adjuvants can eliciting varying levels of protection against lethal EBOV challenge in guinea pigs vaccinated with EBOVgp-Fc,and suggest that levels of total anti-GP antibodies elicit by protein-based GP subunit vaccines do not correlate with protection. In conclusion

Ebolavirus Glycoprotein Fc Fusion Protein Protects Guinea Pigs against Lethal Challenge

DOE Office of Scientific and Technical Information (OSTI.GOV)

Konduru, Krishnamurthy; Shurtleff, Amy C.; Bradfute, Steven B.

Ebola virus (EBOV), a member of the Filoviridae that can cause severe hemorrhagic fever in humans and nonhuman primates, poses a significant threat to the public health. Currently, there are no licensed vaccines or therapeutics to prevent and treat EBOV infection. Several vaccines based on the EBOV glycoprotein (GP) are under development, including vectored, virus-like particles, and protein-based subunit vaccines. We previously demonstrated that a subunit vaccine containing the extracellular domain of the Ebola ebolavirus (EBOV) GP fused to the Fc fragment of human IgG1 (EBOVgp-Fc) protected mice against EBOV lethal challenge. Here, we show that the EBOVgp-Fc vaccine formulatedmore » with QS-21, alum, or polyinosinic-polycytidylic acid-poly-L-lysine carboxymethylcellulose (poly-ICLC) adjuvants induced strong humoral immune responses in guinea pigs. The vaccinated animals developed anti-GP total antibody titers of approximately 10 5–10 6 and neutralizing antibody titers of approximately 10 3 as assessed by a BSL-2 neutralization assay based on vesicular stomatitis virus (VSV) pseudotypes. The poly-ICLC formulated EBOVgp-Fc vaccine protected all the guinea pigs against EBOV lethal challenge performed under BSL-4 conditions whereas the same vaccine formulated with QS-21 or alum only induced partial protection. Vaccination with a mucin-deletedEBOVgp-Fc construct formulated with QS-21 adjuvant did not have a significant effect in anti-GP antibody levels and protection against EBOV lethal challenge compared to the full-lengthGP construct. The bulk of the humoral response induced by the EBOVgp-Fc vaccine was directed against epitopes outside the EBOV mucin region. Our findings indicate that different adjuvants can eliciting varying levels of protection against lethal EBOV challenge in guinea pigs vaccinated with EBOVgp-Fc,and suggest that levels of total anti-GP antibodies elicit by protein-based GP subunit vaccines do not correlate with protection. In conclusion

Structural analysis of a highly glycosylated and unliganded gp120-based antigen using mass spectrometry†

PubMed Central

Wang, Liwen; Qin, Yali; Ilchenko, Serguei; Bohon, Jen; Shi, Wuxian; Cho, Michael W.; Takamoto, Keiji; Chance, Mark R.

2010-01-01

Structural characterization of the HIV envelope protein gp120 is very important to provide an understanding of the protein's immunogenicity and it's binding to cell receptors. So far, crystallographic structure determination of gp120 with an intact V3 loop (in the absence of CD4 co-receptor or antibody) has not been achieved. The third variable region (V3) of the gp120 is immunodominant and contains glycosylation signatures that are essential for co-receptor binding and viral entry to T-cells. In this study, we characterized the structure of the outer domain of gp120 with an intact V3 loop (gp120-OD8) purified from Drosophila S2 cells utilizing mass spectrometry-based approaches. We mapped the glycosylation sites and calculated glycosylation occupancy of gp120-OD8; eleven sites from fifteen glycosylation motifs were determined as having high mannose or hybrid glycosylation structures. The specific glycan moieties of nine glycosylation sites from eight unique glycopeptides were determined by a combination of ECD and CID MS approaches. Hydroxyl radical-mediated protein footprinting coupled with mass spectrometry analysis was employed to provide detailed information on protein structure of gp120-OD8 by directly identifying accessible and hydroxyl radical-reactive side chain residues. Comparison of gp120-OD8 experimental footprinting data with a homology model derived from the ligated CD4/ gp120-OD8 crystal structure revealed a flexible V3 loop structure where the V3 tip may provide contacts with the rest of the protein while residues in the V3 base remain solvent accessible. In addition, the data illustrate interactions between specific sugar moieties and amino acid side chains potentially important to the gp120-OD8 structure. PMID:20825246

Comprehensive functional analysis of N-linked glycans on Ebola virus GP1.

PubMed

Lennemann, Nicholas J; Rhein, Bethany A; Ndungo, Esther; Chandran, Kartik; Qiu, Xiangguo; Maury, Wendy

2014-01-28

Ebola virus (EBOV) entry requires the virion surface-associated glycoprotein (GP) that is composed of a trimer of heterodimers (GP1/GP2). The GP1 subunit contains two heavily glycosylated domains, the glycan cap and the mucin-like domain (MLD). The glycan cap contains only N-linked glycans, whereas the MLD contains both N- and O-linked glycans. Site-directed mutagenesis was performed on EBOV GP1 to systematically disrupt N-linked glycan sites to gain an understanding of their role in GP structure and function. All 15 N-glycosylation sites of EBOV GP1 could be removed without compromising the expression of GP. The loss of these 15 glycosylation sites significantly enhanced pseudovirion transduction in Vero cells, which correlated with an increase in protease sensitivity. Interestingly, exposing the receptor-binding domain (RBD) by removing the glycan shield did not allow interaction with the endosomal receptor, NPC1, indicating that the glycan cap/MLD domains mask RBD residues required for binding. The effects of the loss of GP1 N-linked glycans on Ca(2+)-dependent (C-type) lectin (CLEC)-dependent transduction were complex, and the effect was unique for each of the CLECs tested. Surprisingly, EBOV entry into murine peritoneal macrophages was independent of GP1 N-glycans, suggesting that CLEC-GP1 N-glycan interactions are not required for entry into this important primary cell. Finally, the removal of all GP1 N-glycans outside the MLD enhanced antiserum and antibody sensitivity. In total, our results provide evidence that the conserved N-linked glycans on the EBOV GP1 core protect GP from antibody neutralization despite the negative impact the glycans have on viral entry efficiency. Filovirus outbreaks occur sporadically throughout central Africa, causing high fatality rates among the general public and health care workers. These unpredictable hemorrhagic fever outbreaks are caused by multiple species of Ebola viruses, as well as Marburg virus. While filovirus

Re-Audit of the Contents of GP Referral letters to General Adult Community Psychiatrists.

PubMed

Odelola, Catherine; Jabbar, Farid

2017-09-01

The quality of information provided by referring general practitioners to secondary care mental health services are crucial elements in the effective management of patients. In order to establish effective communication, both primary and secondary care health professionals should contribute to planning and organising this process taking into account their different opinions and views. Anonymous questionnaire was designed to collect information on items that GPs and psychiatrist rated as most important items in GP referral letters to psychiatrists. The questionnaires were sent out electronically. Each item was scored using a rating scale where 0 was least important and 10 was most important. Items that scored 8 and above were agreed by all as the most important items. 76 GP letters were audited using a devised checklist of the identified most important items. Data was collected and analysed using a devised data collection tool. A re-audit was done 6months later. A response rate of 70% was obtained for both psychiatrists and GPs. Reasons for referral were described in almost all GP referral letters (95%). Only 24% referral letters had details about current physical health which improved to 59%. Concerns about risk were described in only 47% of letters and treatment provided by GP in 50% of letters. These improved in 79% and 71% of letters respectively in the re-audit. The involvement of professionals in devising a standardised approach for referral letters has improved communication in this re-audit between GPs and Psychiatrists. This is evident in the improvement in key aspects of the referral letters: past medical history, past psychiatric history, current physical health, treatment provided by GP. Efficient communication between GPs and psychiatrists improves the quality of health care for patients.

GP Workbench Manual: Technical Manual, User's Guide, and Software Guide

USGS Publications Warehouse

Oden, Charles P.; Moulton, Craig W.

2006-01-01

GP Workbench is an open-source general-purpose geophysical data processing software package written primarily for ground penetrating radar (GPR) data. It also includes support for several USGS prototype electromagnetic instruments such as the VETEM and ALLTEM. The two main programs in the package are GP Workbench and GP Wave Utilities. GP Workbench has routines for filtering, gridding, and migrating GPR data; as well as an inversion routine for characterizing UXO (unexploded ordinance) using ALLTEM data. GP Workbench provides two-dimensional (section view) and three-dimensional (plan view or time slice view) processing for GPR data. GP Workbench can produce high-quality graphics for reports when Surfer 8 or higher (Golden Software) is installed. GP Wave Utilities provides a wide range of processing algorithms for single waveforms, such as filtering, correlation, deconvolution, and calculating GPR waveforms. GP Wave Utilities is used primarily for calibrating radar systems and processing individual traces. Both programs also contain research features related to the calibration of GPR systems and calculating subsurface waveforms. The software is written to run on the Windows operating systems. GP Workbench can import GPR data file formats used by major commercial instrument manufacturers including Sensors and Software, GSSI, and Mala. The GP Workbench native file format is SU (Seismic Unix), and subsequently, files generated by GP Workbench can be read by Seismic Unix as well as many other data processing packages.

Psychosocial factors in GP work: the effects of taking a GP position or leaving GP work.

PubMed

Heponiemi, Tarja; Kouvonen, Anne; Aalto, Anna-Mari; Elovainio, Marko

2013-06-01

We examined the effects of leaving public sector general practitioner (GP) work and of taking a GP position on changes in work-related psychosocial factors, such as time pressure, patient-related stress, distress and work interference with family. In addition, we examined whether changes in time pressure and patient-related stress mediated the association of employment change with changes of distress and work interference with family. Participants were 1705 Finnish physicians (60% women) who responded to surveys in 2006 and 2010. Analyses of covariance were conducted to examine the effect of employment change to outcome changes adjusted for gender, age and response format. Mediational effects were tested following the procedures outlined by Baron and Kenny. Employment change was significantly associated with all the outcomes. Leaving public sector GP work was associated with substantially decreased time pressure, patient-related stress, distress and work interference with family. In contrast, taking a position as a public sector GP was associated with an increase in these factors. Mediation tests suggested that the associations of employment change with distress change and work interference with family change were partially explained by the changes in time pressure and patient-related stress. Our results showed that leaving public sector GP work is associated with favourable outcomes, whereas taking a GP position in the public sector is associated with adverse effects. Primary health-care organizations should pay more attention to the working conditions of their GPs, in particular, to time pressure and patient-related stress.

Impact of donor hematopoietic cells mobilized with G-CSF and plerixafor on murine acute graft-versus-host-disease.

PubMed

Arbez, Jessy; Saas, Philippe; Lamarthée, Baptiste; Malard, Florent; Couturier, Mélanie; Mohty, Mohamad; Gaugler, Béatrice

2015-07-01

This study aimed to characterize the immune effectors contained in the grafts from donor mice mobilized by granulocyte colony-stimulating factor (G-CSF) and plerixafor and to evaluate their impact on the development of acute graft-versus-host-disease (aGVHD). Mobilization was done with G-CSF alone or G-CSF plus plerixafor (G+P). In grafts collected after G+P mobilization, we observed a significantly higher proportion of c-kit(+)Sca-1(+) hematopoietic stem cells compared with G-CSF. A significant increase in the percentage of plasmacytoid dendritic cells was detected in the G+P graft compared with G-CSF graft. We also studied the ability of stem cell grafts mobilized with G+P to induce GVHD in a mouse model. We observed higher mortality (P < 0.001) associated with increased aGVHD clinical score (P < 0.0001) as well as higher pathology score in the intestine of mice receiving G+P as compared with G-CSF grafts (P < 0.001). Moreover, the exacerbated aGVHD severity was associated with upregulation of CCR6 expression on both CD4(+) and CD8(+) T cells from the G+P grafts, as well as on T cells from mice transplanted with G+P grafts. In conclusion, we showed that grafts mobilized with G+P exhibited functional features different from those mobilized with G-CSF alone, which increase the severity of aGVHD in the recipients. Copyright © 2015 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.

Antigenicity and Immunogenicity of RV144 Vaccine AIDSVAX Clade E Envelope Immunogen Is Enhanced by a gp120 N-Terminal Deletion

PubMed Central

Liao, Hua-Xin; Tomaras, Georgia D.; Bonsignori, Mattia; Tsao, Chun-Yen; Hwang, Kwan-Ki; Chen, Haiyan; Lloyd, Krissey E.; Bowman, Cindy; Sutherland, Laura; Jeffries, Thomas L.; Kozink, Daniel M.; Stewart, Shelley; Anasti, Kara; Jaeger, Frederick H.; Parks, Robert; Yates, Nicole L.; Overman, R. Glenn; Sinangil, Faruk; Berman, Phillip W.; Pitisuttithum, Punnee; Kaewkungwal, Jaranit; Nitayaphan, Sorachai; Karasavva, Nicos; Rerks-Ngarm, Supachai; Kim, Jerome H.; Michael, Nelson L.; Zolla-Pazner, Susan; Santra, Sampa; Letvin, Norman L.; Harrison, Stephen C.

2013-01-01

An immune correlates analysis of the RV144 HIV-1 vaccine trial revealed that antibody responses to the gp120 V1/V2 region correlated inversely with infection risk. The RV144 protein immunogens (A244-rp120 and MN-rgp120) were modified by an N-terminal 11-amino-acid deletion (Δ11) and addition of a herpes simplex virus (HSV) gD protein-derived tag (gD). We investigated the effects of these modifications on gp120 expression, antigenicity, and immunogenicity by comparing unmodified A244 gp120 with both Δ11 deletion and gD tag and with Δ11 only. Analysis of A244 gp120, with or without Δ11 or gD, demonstrated that the Δ11 deletion, without the addition of gD, was sufficient for enhanced antigenicity to gp120 C1 region, conformational V2, and V1/V2 gp120 conformational epitopes. RV144 vaccinee serum IgGs bound more avidly to A244 gp120 Δ11 than to the unmodified gp120, and their binding was blocked by C1, V2, and V1/V2 antibodies. Rhesus macaques immunized with the three different forms of A244 gp120 proteins gave similar levels of gp120 antibody titers, although higher antibody titers developed earlier in A244 Δ11 gp120-immunized animals. Conformational V1/V2 monoclonal antibodies (MAbs) gave significantly higher levels of blocking of plasma IgG from A244 Δ11 gp120-immunized animals than IgG from animals immunized with unmodified A244 gp120, thus indicating a qualitative difference in the V1/V2 antibodies induced by A244 Δ11 gp120. These results demonstrate that deletion of N-terminal residues in the RV144 A244 gp120 immunogen improves both envelope antigenicity and immunogenicity. PMID:23175357

Safety and immunogenicity of the rVSV∆G-ZEBOV-GP Ebola virus vaccine candidate in healthy adults: a phase 1b randomised, multicentre, double-blind, placebo-controlled, dose-response study.

PubMed

Heppner, D Gray; Kemp, Tracy L; Martin, Brian K; Ramsey, William J; Nichols, Richard; Dasen, Emily J; Link, Charles J; Das, Rituparna; Xu, Zhi Jin; Sheldon, Eric A; Nowak, Teresa A; Monath, Thomas P

2017-08-01

The 2014 Zaire Ebola virus outbreak highlighted the need for a safe, effective vaccine with a rapid onset of protection. We report the safety and immunogenicity of the recombinant vesicular stomatitis virus-Zaire Ebola virus envelope glycoprotein vaccine (rVSV∆G-ZEBOV-GP) across a 6 log 10 dose range in two sequential cohorts. In this phase 1b double-blind, placebo-controlled, dose-response study we enrolled and randomly assigned healthy adults (aged 18-61 years) at eight study sites in the USA to receive a single injection of vaccine or placebo, administered by intramuscular injection. In cohort 1, participants were assigned to receive 3 × 10 3 , 3 × 10 4 , 3 × 10 5 , or 3 × 10 6 PFU doses of rVSV∆G-ZEBOV-GP or placebo. In cohort 2, participants were assigned to receive 3 × 10 6 , 9 × 10 6 , 2 × 10 7 , or 1 × 10 8 PFU doses of rVSV∆G-ZEBOV-GP or placebo. Participants were centrally allocated by the study statistician to vaccine groups or placebo through computer-generated randomisation lists. The primary safety outcome was incidence of adverse events within 14 days in the modified intention-to-treat population (all randomly assigned participants who received vaccine or placebo), and the primary outcome for immunogenicity was IgG ELISA antibody titres at day 28 in the per-protocol population. Surveillance was enhanced for arthritis and dermatitis through to day 56. This study is registered with ClinicalTrials.gov, number NCT02314923. Between Dec 26, 2014, and June 8, 2015, 513 participants were enrolled and randomly assigned; one was not immunised because of unsuccessful phlebotomy. In cohort 1, 256 participants received vaccine (3 × 10 3 [n=64], 3 × 10 4 [n=64], 3 × 10 5 [n=64], or 3 × 10 6 PFU [n=64]) and 74 received placebo. In cohort 2, 162 participants received vaccine (3 × 10 6 [n=20], 9 × 10 6 [n=47], 2 × 10 7 [n=47], or 1 × 10 8 PFU [n=48]) and 20 received placebo. Most

Cloning and Characterization of the Genes Encoding the Murine Homologues of the Human Melanoma Antigens MART1 and gp100

PubMed Central

Zhai, Yifan; Yang, James C.; Spiess, Paul; Nishimura, Michael I.; Overwijk, Willem W.; Roberts, Bruce; Restifo, Nicholas P.; Rosenberg, Steven A.

2008-01-01

The recent identification of genes encoding melanoma-associated antigens has opened new possibilities for the development of cancer vaccines designed to cause the rejection of established tumors. To develop a syngeneic animal model for evaluating antigen-specific vaccines in cancer therapy, the murine homologues of the human melanoma antigens MART1 and gp 100, which were specifically recognized by tumor-infiltrating lymphocytes from patients with melanoma, were cloned and sequenced from a murine B16 melanoma cDNA library. The open reading frames of murine MART1 and gp 100 encode proteins of 113- and 626-amino acids with 68.8 and 77% identity to the respective human proteins. Comparison of the DNA sequences of the murine MART1 genes, derived from normal melanocytes, the immortalized nontumorgenic melanocyte line Melan-a and the B16 melanoma, showed all to be identical. Northern and Western blot analyses confirmed that both genes encoded products that were melanocyte lineage proteins. Mice immunized with murine MART1 or gp 100 using recombinant vaccinia virus failed to produce any detectable T-cell responses or protective immunity against B16 melanoma. In contrast, immunization of mice with human gp 100 using recombinant adenoviruses elicited T cells specific for hgp100, but these T cells also cross reacted with B16 tumor in vitro and induced significant but weak protection against B16 challenge. Immunization with human and mouse gp100 together [adenovirus type 2 (Ad2)-hep100 plus recombinant vaccinia virus (rVV)-mgp100], or immunization with human gp100 (Ad2-hgp100) and boosting with heterologous vector (rVV-hgp100 or rVV-mgp100) or homologous vector (Ad2-hgp100), did not significantly enhance the protective response against B16 melanoma. These results may suggest that immunization with heterologous tumor antigen, rather than self, may be more effective as an immunotherapeutic reagent in designing antigen-specific cancer vaccines. PMID:9101410

The consequence of regional gradients of P-gp and CYP3A4 for drug-drug interactions by P-gp inhibitors and the P-gp/CYP3A4 interplay in the human intestine ex vivo.

PubMed

Li, Ming; de Graaf, Inge A M; van de Steeg, Evita; de Jager, Marina H; Groothuis, Geny M M

2017-04-01

Intestinal P-gp and CYP3A4 work coordinately to reduce the intracellular concentration of drugs, and drug-drug interactions (DDIs) based on this interplay are of clinical importance and require pre-clinical investigation. Using precision-cut intestinal slices (PCIS) of human jejunum, ileum and colon, we investigated the P-gp/CYP3A4 interplay and related DDIs with P-gp inhibitors at the different regions of the human intestine with quinidine (Qi), dual substrate of P-gp and CYP3A4, as probe. All the P-gp inhibitors increased the intracellular concentrations of Qi by 2.1-2.6 fold in jejunum, 2.6-3.8 fold in ileum but only 1.2-1.3 fold in colon, in line with the different P-gp expression in these intestinal regions. The selective P-gp inhibitors (CP100356 and PSC833) enhanced 3-hydroxy-quinidine (3OH-Qi) in jejunum and ileum, while dual inhibitors of P-gp and CYP3A4 (verapamil and ketoconazole) decreased the 3OH-Qi production, despite of the increased intracellular Qi concentration, due to inhibition of CYP3A4. The outcome of DDIs based on P-gp/CYP3A4 interplay, shown as remarkable changes in the intracellular concentration of both the parent drug and the metabolite, varied among the intestinal regions, probably due to the different expression of P-gp and CYP3A4, and were different from those found in rat PCIS, which may have important implications for the disposition and toxicity of drugs and their metabolites. Copyright © 2016 Elsevier Ltd. All rights reserved.

G-protection mechanisms afforded by the anti-G suit abdominal bladder with and without pressure breathing.

PubMed

Eiken, Ola; Bergsten, Eddie; Grönkvist, Mikael

2011-10-01

G protection afforded by the abdominal bladder of a pneumatic anti-G suit is usually attributed to counteraction of G-induced caudad displacement of the heart and pooling of blood in the abdominal veins. The study examined whether the abdominal bladder might provide G protection also via other mechanisms. Each subject was exposed to +Gz loads while sitting relaxed, wearing a full-coverage anti-G suit modified to permit separate pressurization of the abdominal and leg bladders. In two experimental series (N = 8, N = 14), subjects were breathing at positive airway pressure (PPB); in a third series, five subjects were breathing at atmospheric airway pressure. Intrathoracic pressures were estimated by use of esophageal catheters. During PPB at high G loads, intrathoracic pressure was higher with than without the pressurized abdominal bladder. In 7 of the 14 subjects, basilar intrathoracic pressure exceeded airway pressure during PPB when the abdominal bladder was pressurized. The mean arterial pressure response at high G loads was higher in this subset of subjects (55 +/- 23 mmHg) than in the subjects in whom airway pressure exceeded intrathoracic pressure (41 +/- 27 mmHg). Without PPB at increased G load, the intrathoracic pressure gradient was higher with than without the pressurized abdominal bladder. During PPB, the abdominal bladder acts as an airway counterpressure, thereby facilitating pressure transmission from the airways to the thorax and hence improving G protection. It also appears that in several individuals, pressure may be transmitted from the abdominal bladder to the thorax and heart.

Recognition of similar epitopes on varicella-zoster virus gpI and gpIV by monoclonal antibodies.

PubMed Central

Vafai, A; Wroblewska, Z; Mahalingam, R; Cabirac, G; Wellish, M; Cisco, M; Gilden, D

1988-01-01

Two monoclonal antibodies, MAb43.2 and MAb79.0, prepared against varicella-zoster virus (VZV) proteins were selected to analyze VZV gpIV and gpI, respectively. MAb43.2 reacted only with cytoplasmic antigens, whereas MAb79.0 recognized both cytoplasmic and membrane antigens in VZV-infected cells. Immunoprecipitation of in vitro translation products with MAb43.2 revealed only proteins encoded by the gpIV gene, whereas MAb79.0 precipitated proteins encoded by the gpIV and gpI genes. Pulse-chase analysis followed by immunoprecipitation of VZV-infected cells indicated reactivity of MAb43.2 with three phosphorylated precursor species of gpIV and reactivity of MAb79.0 with the precursor and mature forms of gpI and gpIV. These results indicated that (i) MAb43.2 and MAb79.0 recognize different epitopes on VZV gpIV, (ii) glycosylation of gpIV ablates recognition by MAb43.2, and (iii) gpIV is phosphorylated. To map the binding site of MAb79.0 on gpI, the pGEM transcription vector, containing the coding region of the gpI gene, was linearized, and three truncated gpI DNA fragments were generated. RNA was transcribed from each truncated fragment by using SP6 RNA polymerase, translated in vitro in a rabbit reticulocyte lysate, and immunoprecipitated with MAb79.0 and human sera. The results revealed the existence of an antibody-binding site within 14 amino acid residues located between residues 109 to 123 on the predicted amino acid sequences of gpI. From the predicted amino acid sequences, 14 residues on gpI (residues 107 to 121) displayed a degree of similarity (36%) to two regions (residues 55 to 69 and 245 to 259) of gp IV. Such similarities may account for the binding of MAb79.0 to both VZV gpI and gpIV. Images PMID:2455814

32 CFR 644.140 - Physical protection.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 32 National Defense 4 2010-07-01 2010-07-01 true Physical protection. 644.140 Section 644.140... ESTATE HANDBOOK Acquisition Acquisition by Leasing § 644.140 Physical protection. It is essential that the Division or District Engineer make provision for the physical protection for all facilities under...

32 CFR 644.140 - Physical protection.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 32 National Defense 4 2013-07-01 2013-07-01 false Physical protection. 644.140 Section 644.140... ESTATE HANDBOOK Acquisition Acquisition by Leasing § 644.140 Physical protection. It is essential that the Division or District Engineer make provision for the physical protection for all facilities under...

32 CFR 644.140 - Physical protection.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 32 National Defense 4 2014-07-01 2013-07-01 true Physical protection. 644.140 Section 644.140... ESTATE HANDBOOK Acquisition Acquisition by Leasing § 644.140 Physical protection. It is essential that the Division or District Engineer make provision for the physical protection for all facilities under...

32 CFR 644.140 - Physical protection.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 32 National Defense 4 2011-07-01 2011-07-01 false Physical protection. 644.140 Section 644.140... ESTATE HANDBOOK Acquisition Acquisition by Leasing § 644.140 Physical protection. It is essential that the Division or District Engineer make provision for the physical protection for all facilities under...

32 CFR 644.140 - Physical protection.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 32 National Defense 4 2012-07-01 2011-07-01 true Physical protection. 644.140 Section 644.140... ESTATE HANDBOOK Acquisition Acquisition by Leasing § 644.140 Physical protection. It is essential that the Division or District Engineer make provision for the physical protection for all facilities under...

The Influences of Glycosylation on the Antigenicity, Immunogenicity, and Protective Efficacy of Ebola Virus GP DNA Vaccines

DTIC Science & Technology

2006-11-22

multiple muta- tions were not studied, (iii) a vaccinia virus (VACV)- T7 system was used for transient expression, (iv) pseudotyped retrovi- ruses were used...those studies produced little to no detectable GP1 or GP2 in the transient VACV- T7 expression assays, whereas in our studies with the DNA con- structs...type GP2 was detected in pseudotyped retroviruses, a result seemingly in conflict with these authors’ findings with the VACV- T7 expression. Although

Diversion of HIV-1 Vaccine-induced Immunity by gp41-Microbiota Cross-reactive Antibodies

PubMed Central

Williams, Wilton B; Liao, Hua-Xin; Moody, M. Anthony; Kepler, Thomas B.; Alam, S Munir; Gao, Feng; Wiehe, Kevin; Trama, Ashley M.; Jones, Kathryn; Zhang, Ruijun; Song, Hongshuo; Marshall, Dawn J; Whitesides, John F; Sawatzki, Kaitlin; Hua, Axin; Liu, Pinghuang; Tay, Matthew Z; Seaton, Kelly; Shen, Xiaoying; Foulger, Andrew; Lloyd, Krissey E.; Parks, Robert; Pollara, Justin; Ferrari, Guido; Yu, Jae-Sung; Vandergrift, Nathan; Montefiori, David C.; Sobieszczyk, Magdalena E; Hammer, Scott; Karuna, Shelly; Gilbert, Peter; Grove, Doug; Grunenberg, Nicole; McElrath, Julie; Mascola, John R.; Koup, Richard A; Corey, Lawrence; Nabel, Gary J.; Morgan, Cecilia; Churchyard, Gavin; Maenza, Janine; Keefer, Michael; Graham, Barney S.; Baden, Lindsey R.; Tomaras, Georgia D.; Haynes, Barton F.

2015-01-01

A HIV-1 DNA prime-recombinant Adenovirus Type 5 (rAd5) boost vaccine failed to protect from HIV-1 acquisition. We studied the nature of the vaccine-induced antibody (Ab) response to HIV-1 envelope (Env). HIV-1-reactive plasma Ab titers were higher to Env gp41 than gp120, and repertoire analysis demonstrated that 93% of HIV-1-reactive Abs from memory B cells was to Env gp41. Vaccine-induced gp41-reactive monoclonal antibodies (mAbs) were non-neutralizing, and frequently polyreactive with host and environmental antigens including intestinal microbiota (IM). Next generation sequencing of an IGHV repertoire prior to vaccination revealed an Env-IM cross-reactive Ab that was clonally-related to a subsequent vaccine-induced gp41-reactive Ab. Thus, HIV-1 Env DNA-rAd5 vaccine induced a dominant IM-polyreactive, non-neutralizing gp41-reactive Ab repertoire response that was associated with no vaccine efficacy. PMID:26229114

Antibody responses to prime-boost vaccination with an HIV-1 gp145 envelope protein and chimpanzee adenovirus vectors expressing HIV-1 gp140.

PubMed

Emmer, Kristel L; Wieczorek, Lindsay; Tuyishime, Steven; Molnar, Sebastian; Polonis, Victoria R; Ertl, Hildegund C J

2016-10-23

Over 2 million individuals are infected with HIV type 1 (HIV-1) each year, yet an effective vaccine remains elusive. The most successful HIV-1 vaccine to date demonstrated 31% efficacy. Immune correlate analyses associated HIV-1 envelope (Env)-specific antibodies with protection, thus providing a path toward a more effective vaccine. We sought to test the antibody response from novel prime-boost vaccination with a chimpanzee-derived adenovirus (AdC) vector expressing a subtype C Env glycoprotein (gp)140 combined with either a serologically distinct AdC vector expressing gp140 of a different subtype C isolate or an alum-adjuvanted, partially trimeric gp145 from yet another subtype C isolate. Three different prime-boost regimens were tested in mice: AdC prime-protein boost, protein prime-AdC boost, and AdC prime-AdC boost. Each regimen was tested at two different doses of AdC vector in a total of six experimental groups. Sera were collected at various time points and evaluated by ELISA for Env-specific antibody binding, isotype, and avidity. Antibody functionality was assessed by pseudovirus neutralization assay. Priming with AdC followed by a protein boost or sequential immunizations with two AdC vectors induced HIV-1 Env-specific binding antibodies, including those to the variable region 2, whereas priming with protein followed by an AdC boost was relatively ineffective. Antibodies that cross-neutralized tier 1 HIV-1 from different subtypes were elicited with vaccine regimens that included immunizations with protein. Our study warrants further investigation of AdC vector and gp145 protein prime-boost vaccines and their ability to protect against acquisition in animal challenge studies.

Susceptibility of Tsetse Species to Glossina pallidipes Salivary Gland Hypertrophy Virus (GpSGHV)

PubMed Central

Demirbas-Uzel, Güler; Kariithi, Henry M.; Parker, Andrew G.; Vreysen, Marc J. B.; Mach, Robert L.; Abd-Alla, Adly M. M.

2018-01-01

Salivary gland hytrosaviruses (SGHVs, family Hytrosaviridae) are non-occluded dsDNA viruses that are pathogenic to some dipterans. SGHVs primarily replicate in salivary glands (SG), thereby inducing overt salivary gland hypertrophy (SGH) symptoms in their adult hosts. SGHV infection of non-SG tissues results in distinct pathobiologies, including reproductive dysfunctions in tsetse fly, Glossina pallidipes (Diptera: Glossinidae) and house fly. Infection with the G. pallidipes virus (GpSGHV) resulted in the collapse of several laboratory colonies, which hindered the implementation of area wide integrated pest management (AW-IPM) programs that had a sterile insect technique (SIT) component. Although the impact of GpSGHV infection has been studied in some detail in G. pallidipes, the impact of the virus infection on other tsetse species remains largely unknown. In the current study, we assessed the susceptibility of six Glossina species (G. pallidipes, G. brevipalpis, G. m. morsitans, G. m. centralis, G. f. fuscipes, and G. p. gambiensis) to GpSGHV infections, and the impact of the viral infection on the fly pupation rate, adult emergence, and virus replication and transmission from the larval to adult stages. We also evaluated the ability of the virus to infect conspecific Glossina species through serial passages. The results indicate that the susceptibility of Glossina to GpSGHV varied widely amongst the tested species, with G. pallidipes and G. brevipalpis being the most susceptible and most refractory to the virus, respectively. Further, virus injection into the hemocoel of teneral flies led to increased viral copy number over time, while virus injection into the third instar larvae delayed adult eclosion. Except in G. pallidipes, virus injection either into the larvae or teneral adults did not induce any detectable SGH symptoms, although virus infections were PCR-detectable in the fly carcasses. Taken together, our results indicate that although GpSGHV may only

A "Trojan horse" bispecific-antibody strategy for broad protection against ebolaviruses.

PubMed

Wec, Anna Z; Nyakatura, Elisabeth K; Herbert, Andrew S; Howell, Katie A; Holtsberg, Frederick W; Bakken, Russell R; Mittler, Eva; Christin, John R; Shulenin, Sergey; Jangra, Rohit K; Bharrhan, Sushma; Kuehne, Ana I; Bornholdt, Zachary A; Flyak, Andrew I; Saphire, Erica Ollmann; Crowe, James E; Aman, M Javad; Dye, John M; Lai, Jonathan R; Chandran, Kartik

2016-10-21

There is an urgent need for monoclonal antibody (mAb) therapies that broadly protect against Ebola virus and other filoviruses. The conserved, essential interaction between the filovirus glycoprotein, GP, and its entry receptor Niemann-Pick C1 (NPC1) provides an attractive target for such mAbs but is shielded by multiple mechanisms, including physical sequestration in late endosomes. Here, we describe a bispecific-antibody strategy to target this interaction, in which mAbs specific for NPC1 or the GP receptor-binding site are coupled to a mAb against a conserved, surface-exposed GP epitope. Bispecific antibodies, but not parent mAbs, neutralized all known ebolaviruses by coopting viral particles themselves for endosomal delivery and conferred postexposure protection against multiple ebolaviruses in mice. Such "Trojan horse" bispecific antibodies have potential as broad antifilovirus immunotherapeutics. Copyright © 2016, American Association for the Advancement of Science.

Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice

PubMed Central

Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.

2001-01-01

Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339

Targeted Delivery of GP5 Antigen of PRRSV to M Cells Enhances the Antigen-Specific Systemic and Mucosal Immune Responses

PubMed Central

Du, Luping; Yu, Zhengyu; Pang, Fengjiao; Xu, Xiangwei; Mao, Aihua; Yuan, Wanzhe; He, Kongwang; Li, Bin

2018-01-01

Efficient delivery of antigens through oral immunization is a first and critical step for successful induction of mucosal immunity, which can provide protection against pathogens invading the mucosa. Membranous/microfold cells (M cells) within the mucosa can transcytose internalized antigen without degradation and thus play an important role in initiating antigen-specific mucosal immune responses through inducing secretory IgA production. In this research, we modified poly (D, L-lactide-co-glycolide) (PLGA) nanoparticles (NPs) with Ulex europaeus agglutinin 1 (UEA-1) and successfully prepared an oral vaccine delivery system, UEA-1/PLGA NPs. PLGA NPs were prepared using a standard double emulsion solvent evaporation technique, which can protect the entrapped PRRSV DNA vaccine [pcDNA3.1-SynORF5 (synthetic ORF5)] or subunit vaccine ORF5-encoded glycoprotein (GP5) from exposure to the gastrointestinal (GI) tract and release the plasmids in a controlled manner. With UEA-1 modification, the UEA-1/PLGA NPs can be effectively transported by M-cells. We investigated immune response induced by UEA-1/PLGA-SynORF5 or UEA-1/PLGA-GP5 following inoculation in mice and piglets. Compared with PLGA-SynORF5 or PLGA-GP5 NPs, UEA-1/PLGA-SynORF5, or UEA-1/PLGA-GP5 NPs stimulated significantly increased serum IgG levels and augmented intestinal IgA levels in mice and piglets (P < 0.05). Our findings indicate UEA-1/PLGA NPs can be applied as a promising and universally robust oral vaccine delivery system. PMID:29423381

HIV-1 gp120 Induces Expression of IL-6 through a Nuclear Factor-Kappa B-Dependent Mechanism: Suppression by gp120 Specific Small Interfering RNA

PubMed Central

Shah, Ankit; Verma, Ashish S.; Patel, Kalpeshkumar H.; Noel, Richard; Rivera-Amill, Vanessa; Silverstein, Peter S.; Chaudhary, Suman; Bhat, Hari K.; Stamatatos, Leonidas; Singh, Dhirendra P.; Buch, Shilpa; Kumar, Anil

2011-01-01

In addition to its role in virus entry, HIV-1 gp120 has also been implicated in HIV-associated neurocognitive disorders. However, the mechanism(s) responsible for gp120-mediated neuroinflammation remain undefined. In view of increased levels of IL-6 in HIV-positive individuals with neurological manifestations, we sought to address whether gp120 is involved in IL-6 over-expression in astrocytes. Transfection of a human astrocyte cell line with a plasmid encoding gp120 resulted in increased expression of IL-6 at the levels of mRNA and protein by 51.3±2.1 and 11.6±2.2 fold respectively; this effect of gp120 on IL-6 expression was also demonstrated using primary human fetal astrocytes. A similar effect on IL-6 expression was observed when primary astrocytes were treated with gp120 protein derived from different strains of X4 and R5 tropic HIV-1. The induction of IL-6 could be abrogated by use of gp120-specific siRNA. Furthermore, this study showed that the NF-κB pathway is involved in gp120-mediated IL-6 over-expression, as IKK-2 and IKKβ inhibitors inhibited IL-6 expression by 56.5% and 60.8%, respectively. These results were also confirmed through the use of NF-κB specific siRNA. We also showed that gp120 could increase the phosphorylation of IκBα. Furthermore, gp120 transfection in the SVGA cells increased translocation of NF-κB from cytoplasm to nucleus. These results demonstrate that HIV-1 gp120-mediated over-expression of IL-6 in astrocytes is one mechanism responsible for neuroinflammation in HIV-infected individuals and this is mediated by the NF-κB pathway. PMID:21712995

10 CFR 72.182 - Design for physical protection.

Code of Federal Regulations, 2013 CFR

2013-01-01

... Physical Protection § 72.182 Design for physical protection. The design for physical protection must show the site layout and the design features provided to protect the ISFSI or MRS from sabotage. It must... 10 Energy 2 2013-01-01 2013-01-01 false Design for physical protection. 72.182 Section 72.182...

10 CFR 72.182 - Design for physical protection.

Code of Federal Regulations, 2010 CFR

2010-01-01

... Physical Protection § 72.182 Design for physical protection. The design for physical protection must show the site layout and the design features provided to protect the ISFSI or MRS from sabotage. It must... 10 Energy 2 2010-01-01 2010-01-01 false Design for physical protection. 72.182 Section 72.182...

10 CFR 72.182 - Design for physical protection.

Code of Federal Regulations, 2012 CFR

2012-01-01

... Physical Protection § 72.182 Design for physical protection. The design for physical protection must show the site layout and the design features provided to protect the ISFSI or MRS from sabotage. It must... 10 Energy 2 2012-01-01 2012-01-01 false Design for physical protection. 72.182 Section 72.182...

10 CFR 72.182 - Design for physical protection.

Code of Federal Regulations, 2014 CFR

2014-01-01

... Physical Protection § 72.182 Design for physical protection. The design for physical protection must show the site layout and the design features provided to protect the ISFSI or MRS from sabotage. It must... 10 Energy 2 2014-01-01 2014-01-01 false Design for physical protection. 72.182 Section 72.182...

10 CFR 72.182 - Design for physical protection.

Code of Federal Regulations, 2011 CFR

2011-01-01

... Physical Protection § 72.182 Design for physical protection. The design for physical protection must show the site layout and the design features provided to protect the ISFSI or MRS from sabotage. It must... 10 Energy 2 2011-01-01 2011-01-01 false Design for physical protection. 72.182 Section 72.182...

Effect of naringin on gp120-induced injury mediated by P2X7 receptors in rat primary cultured microglia

PubMed Central

Liu, Chenglong; Deng, Zeyu; Liu, Yang; Chen, Guoqiao; Liu, Baoyun

2017-01-01

Human immunodeficiency virus type-1 (HIV-1) envelope glycoprotein 120 has been shown to activate microglia, causing release of inflammatory and toxic factors. The P2X7 receptor, primarily expressed on microglia, is closely associated with inflammation. Naringin, a plant bioflavonoid, has anti-inflammatory and anti-oxidative properties. We hypothesized that P2X7 receptor mediated gp120-induced injury in primary cultured microglia, and that naringin would have a protective effect. We showed that HIV-1 gp120 peptide (V3 loop, fragment 308–331) appeared to induce apoptosis of primary cultured microglia. However, there was a decrease of microglia apoptosis in gp120+naringin group compared with gp120 group. Using qPCR, Western blot, and immunofluorescence, we showed that gp120 stimulated expression of P2X7 mRNA and receptor protein, and this stimulation was inhibited by naringin. Treatment with gp120 increased concentrations of eATP, TNFα and IL-1β, and these effects were inhibited by naringin. Taken together, these results suggested that gp120 contributed to microglial cell injury and neurotoxic activity by up-regulating expression of P2X7, in a naringin-protective manner. PMID:28832643

Effect of naringin on gp120-induced injury mediated by P2X7 receptors in rat primary cultured microglia.

PubMed

Chen, Qiang; Wu, Hui; Tao, Jia; Liu, Chenglong; Deng, Zeyu; Liu, Yang; Chen, Guoqiao; Liu, Baoyun; Xu, Changshui

2017-01-01

Human immunodeficiency virus type-1 (HIV-1) envelope glycoprotein 120 has been shown to activate microglia, causing release of inflammatory and toxic factors. The P2X7 receptor, primarily expressed on microglia, is closely associated with inflammation. Naringin, a plant bioflavonoid, has anti-inflammatory and anti-oxidative properties. We hypothesized that P2X7 receptor mediated gp120-induced injury in primary cultured microglia, and that naringin would have a protective effect. We showed that HIV-1 gp120 peptide (V3 loop, fragment 308-331) appeared to induce apoptosis of primary cultured microglia. However, there was a decrease of microglia apoptosis in gp120+naringin group compared with gp120 group. Using qPCR, Western blot, and immunofluorescence, we showed that gp120 stimulated expression of P2X7 mRNA and receptor protein, and this stimulation was inhibited by naringin. Treatment with gp120 increased concentrations of eATP, TNFα and IL-1β, and these effects were inhibited by naringin. Taken together, these results suggested that gp120 contributed to microglial cell injury and neurotoxic activity by up-regulating expression of P2X7, in a naringin-protective manner.

Baculovirus GP64-mediated entry into mammalian cells.

PubMed

Kataoka, Chikako; Kaname, Yuuki; Taguwa, Shuhei; Abe, Takayuki; Fukuhara, Takasuke; Tani, Hideki; Moriishi, Kohji; Matsuura, Yoshiharu

2012-03-01

The baculovirus Autographa californica multiple nucleopolyhedrovirus (AcMNPV) serves as an efficient viral vector, not only for abundant gene expression in insect cells, but also for gene delivery into mammalian cells. Lentivirus vectors pseudotyped with the baculovirus envelope glycoprotein GP64 have been shown to acquire more potent gene transduction than those with vesicular stomatitis virus (VSV) envelope glycoprotein G. However, there are conflicting hypotheses about the molecular mechanisms of the entry of AcMNPV. Moreover, the mechanisms of the entry of pseudotyped viruses bearing GP64 into mammalian cells are not well characterized. Determination of the entry mechanisms of AcMNPV and the pseudotyped viruses bearing GP64 is important for future development of viral vectors that can deliver genes into mammalian cells with greater efficiency and specificity. In this study, we generated three pseudotyped VSVs, NPVpv, VSVpv, and MLVpv, bearing envelope proteins of AcMNPV, VSV, and murine leukemia virus, respectively. Depletion of membrane cholesterol by treatment with methyl-β-cyclodextrin, which removes cholesterol from cellular membranes, inhibited GP64-mediated internalization in a dose-dependent manner but did not inhibit attachment to the cell surface. Treatment of cells with inhibitors or the expression of dominant-negative mutants for dynamin- and clathrin-mediated endocytosis abrogated the internalization of AcMNPV and NPVpv into mammalian cells, whereas inhibition of caveolin-mediated endocytosis did not. Furthermore, inhibition of macropinocytosis reduced GP64-mediated internalization. These results suggest that cholesterol in the plasma membrane, dynamin- and clathrin-dependent endocytosis, and macropinocytosis play crucial roles in the entry of viruses bearing baculovirus GP64 into mammalian cells.

Protection against radiation (biological, pharmacological, chemical, physical)

NASA Technical Reports Server (NTRS)

Saksonov, P. P.

1975-01-01

Physical, chemical, and biological protection for astronauts from penetrating radiation on long-term space flights is discussed. The status of pharmacochemical protection, development of protective substances, medical use of protective substances, protection for spacecraft ecologic systems, adaptogens and physical conditioning, bone marrow transplants and local protection are discussed. Combined use of local protection and pharmacochemical substances is also briefly considered.

40 CFR Table 32 to Subpart G of... - Typical Number of Roof Legs, a NF8

Code of Federal Regulations, 2010 CFR

2010-07-01

... 40 Protection of Environment 9 2010-07-01 2010-07-01 false Typical Number of Roof Legs, a NF8 32 Table 32 to Subpart G of Part 63 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) NATIONAL EMISSION STANDARDS FOR HAZARDOUS AIR POLLUTANTS FOR SOURCE CATEGORIES National Emission Standards for Organic...

10 CFR 72.180 - Physical protection plan.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 10 Energy 2 2014-01-01 2014-01-01 false Physical protection plan. 72.180 Section 72.180 Energy... NUCLEAR FUEL, HIGH-LEVEL RADIOACTIVE WASTE, AND REACTOR-RELATED GREATER THAN CLASS C WASTE Physical Protection § 72.180 Physical protection plan. The licensee shall establish, maintain, and follow a detailed...

10 CFR 72.180 - Physical protection plan.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 10 Energy 2 2012-01-01 2012-01-01 false Physical protection plan. 72.180 Section 72.180 Energy... NUCLEAR FUEL, HIGH-LEVEL RADIOACTIVE WASTE, AND REACTOR-RELATED GREATER THAN CLASS C WASTE Physical Protection § 72.180 Physical protection plan. The licensee shall establish, maintain, and follow a detailed...

10 CFR 72.180 - Physical protection plan.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 10 Energy 2 2013-01-01 2013-01-01 false Physical protection plan. 72.180 Section 72.180 Energy... NUCLEAR FUEL, HIGH-LEVEL RADIOACTIVE WASTE, AND REACTOR-RELATED GREATER THAN CLASS C WASTE Physical Protection § 72.180 Physical protection plan. The licensee shall establish, maintain, and follow a detailed...

10 CFR 72.180 - Physical protection plan.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 10 Energy 2 2011-01-01 2011-01-01 false Physical protection plan. 72.180 Section 72.180 Energy... NUCLEAR FUEL, HIGH-LEVEL RADIOACTIVE WASTE, AND REACTOR-RELATED GREATER THAN CLASS C WASTE Physical Protection § 72.180 Physical protection plan. The licensee shall establish, maintain, and follow a detailed...

10 CFR 72.180 - Physical protection plan.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 10 Energy 2 2010-01-01 2010-01-01 false Physical protection plan. 72.180 Section 72.180 Energy... NUCLEAR FUEL, HIGH-LEVEL RADIOACTIVE WASTE, AND REACTOR-RELATED GREATER THAN CLASS C WASTE Physical Protection § 72.180 Physical protection plan. The licensee shall establish, maintain, and follow a detailed...

Polymerization by DNA polymerase eta is blocked by cis-diamminedichloroplatinum(II) 1,3-d(GpTpG) cross-link: implications for cytotoxic effects in nucleotide excision repair-negative tumor cells.

PubMed

Chijiwa, Shotaro; Masutani, Chikahide; Hanaoka, Fumio; Iwai, Shigenori; Kuraoka, Isao

2010-03-01

cis-Diamminedichloroplatinum(II) (cisplatin) forms DNA adducts that interfere with replication and transcription. The most common adducts formed in vivo are 1,2-intrastrand d(GpG) cross-links (Pt-GG) and d(ApG) cross-links (Pt-AG), with minor amounts of 1,3-d(GpNpG) cross-links (Pt-GNG), interstrand cross-links and monoadducts. Although the relative contribution of these different adducts to toxicity is not known, literature implicates that Pt-GG and Pt-AG adducts block replication. Thus, nucleotide excision repair (NER), by which platinum adducts are excised, and translesion DNA synthesis (TLS), which permits adduct bypass, are thought to be associated with cisplatin resistance. Recent studies have reported that the clinical benefit from platinum-based chemotherapy is high if tumor cells express low levels of NER factors. To investigate the role of platinum-DNA adducts in mediating tumor cell survival by TLS, we examined whether 1,3-intrastrand d(GpTpG) platinum cross-links (Pt-GTG), which probably exist in NER-negative tumor cells but not in NER-positive tumor cells, are bypassed by the translesion DNA polymerase eta (pol eta), which is known to bypass Pt-GG. We show that pol eta can incorporate the correct deoxycytidine triphosphate opposite the first 3'-cross-linked G of Pt-GTG but cannot insert any nucleotides opposite the second intact T or the third 5'-cross-linked G of the adducts, thereby suggesting that TLS does not facilitate replication past Pt-GTG adducts. Thus, our findings implicate Pt-GNG adducts as mediating the cytotoxicity of platinum-DNA adducts in NER-negative tumors in vivo.

Immunogenicity of recombinant vaccinia virus vaccines co-expressing GP3/GP5 of European PRRSV and Cap protein of PCV2 in pigs.

PubMed

Han, Jicheng; Ma, Haibin; Cao, Liang; Jing, Jie; Xiao, Pengpeng; Sun, Wenchao; Xie, Changzhan; Wen, Shubo; Li, Yiquan; Tian, Mingyao; Lu, Huijun; Jin, Ningyi

2018-02-01

Porcine reproductive and respiratory syndrome (PRRS) is almost always caused by the North American strain of PRRS virus (PRRSV) in China; the European genotype of PRRSV has emerged in China. The mixed infection of PRRSV and Porcine circovirus type 2 virus (PCV2) are always found in pigs and PRRSV-augmented PCV2 replication and serious clinical symptoms. Current vaccines cannot protect mixed European PRRSV and PCV2 infections. Therefore, the development of a safe and effective new vaccine to prevent and control the mixed infection of European PRRSV and PCV2 is both urgent and necessary. In this study, we developed a recombinant vaccinia vaccine co-expressing the GP3 and GP5 proteins of European PRRSV and the ORF2 protein of PCV2 and evaluated the immunogenicity and its protective effects and its inactivated vaccine in pigs. The recombinant vaccinia vaccine and its inactivated vaccine both elicited significant humoral and cellular immune responses with a higher level of specific antibody responses and T-lymphocyte proliferation than the control group. Furthermore, the pigs inoculated with the recombinant vaccinia vaccine were completely protected against challenge with 10 5 TCID 50 of European PRRSV strain LV. These data suggest that the recombinant vaccinia vaccine is a potential candidate vaccine against European PRRSV and PCV2.

Epstein-Barr Virus Glycoprotein gB and gHgL Can Mediate Fusion and Entry in trans, and Heat Can Act as a Partial Surrogate for gHgL and Trigger a Conformational Change in gB

PubMed Central

Chesnokova, Liudmila S.; Ahuja, Munish K.

2014-01-01

ABSTRACT Epstein-Barr virus (EBV) fusion with an epithelial cell requires virus glycoproteins gHgL and gB and is triggered by an interaction between gHgL and integrin αvβ5, αvβ6, or αvβ8. Fusion with a B cell requires gHgL, gp42, and gB and is triggered by an interaction between gp42 and human leukocyte antigen class II. We report here that, like alpha- and betaherpesviruses, EBV, a gammaherpesvirus, can mediate cell fusion if gB and gHgL are expressed in trans. Entry of a gH-null virus into an epithelial cell is possible if the epithelial cell expresses gHgL, and entry of the same virus, which phenotypically lacks gHgL and gp42, into a B cell expressing gHgL is possible in the presence of a soluble integrin. Heat is capable of inducing the fusion of cells expressing only gB, and the proteolytic digestion pattern of gB in virions changes in the same way following the exposure of virus to heat or to soluble integrins. It is suggested that the Gibbs free energy released as a result of the high-affinity interaction of gHgL with an integrin contributes to the activation energy required to cause the refolding of gB from a prefusion to a postfusion conformation. IMPORTANCE The core fusion machinery of herpesviruses consists of glycoproteins gB and gHgL. We demonstrate that as in alpha- and betaherpesvirus, gB and gHgL of the gammaherpesvirus EBV can mediate fusion and entry when expressed in trans in opposing membranes, implicating interactions between the ectodomains of the proteins in the activation of fusion. We further show that heat and exposure to a soluble integrin, both of which activate fusion, result in the same changes in the proteolytic digestion pattern of gB, possibly representing the refolding of gB from its prefusion to its postfusion conformation. PMID:25142593

Differential role of gp130-dependent STAT and Ras signalling for haematopoiesis following bone-marrow transplantation.

PubMed

Kroy, Daniela C; Hebing, Lisa; Sander, Leif E; Gassler, Nikolaus; Erschfeld, Stephanie; Sackett, Sara; Galm, Oliver; Trautwein, Christian; Streetz, Konrad L

2012-01-01

Bone marrow transplantation (BMT) is a complex process regulated by different cytokines and growth factors. The pleiotropic cytokine IL-6 (Interleukin-6) and related cytokines of the same family acting on the common signal transducer gp130 are known to play a key role in bone marrow (BM) engraftment. In contrast, the exact signalling events that control IL-6/gp130-driven haematopoietic stem cell development during BMT remain unresolved. Conditional gp130 knockout and knockin mice were used to delete gp130 expression (gp130(ΔMx)), or to selectively disrupt gp130-dependent Ras (gp130(ΔMxRas)) or STAT signalling (gp130(ΔMxSTAT)) in BM cells. BM derived from the respective strains was transplanted into irradiated wildtype hosts and repopulation of various haematopoietic lineages was monitored by flow cytometry. BM derived from gp130 deficient donor mice (gp130(ΔMx)) displayed a delayed engraftment, as evidenced by reduced total white blood cells (WBC), marked thrombocytopenia and anaemia in the early phase after BMT. Lineage analysis unravelled a restricted development of CD4(+) and CD8(+) T-cells, CD19(+) B-cells and CD11b(+) myeloid cells after transplantation of gp130-deficient BM grafts. To further delineate the two major gp130-induced signalling cascades, Ras-MAPK and STAT1/3-signalling respectively, we used gp130(ΔMxRas) and gp130(ΔMxSTAT) donor BM. BMT of gp130(ΔMxSTAT) cells significantly impaired engraftment of CD4(+), CD8(+), CD19(+) and CD11b(+) cells, whereas gp130(ΔMxRas) BM displayed a selective impairment in early thrombopoiesis. Importantly, gp130-STAT1/3 signalling deficiency in BM grafts severely impaired survival of transplanted mice, thus demonstrating a pivotal role for this pathway in BM graft survival and function. Our data unravel a vital function of IL-6/gp130-STAT1/3 signals for BM engraftment and haematopoiesis, as well as for host survival after transplantation. STAT1/3 and ras-dependent pathways thereby exert distinct functions on

Membrane insertion and assembly of epitope-tagged gp9 at the tip of the M13 phage.

PubMed

Ploss, Martin; Kuhn, Andreas

2011-09-26

Filamentous M13 phage extrude from infected Escherichia coli with a tip structure composed of gp7 and gp9. This tip structure is extended by the assembly of the filament composed of the major coat protein gp8. Finally, gp3 and gp6 terminate the phage structure at the proximal end. Up to now, gp3 has been the primary tool for phage display technology. However, gp7, gp8 and gp9 could also be used for phage display and these phage particles should bind to two different or more surfaces when the modified coat proteins are combined. Therefore, we tested here if the amino-terminal end of gp9 can be modified and whether the modified portion is exposed and detectable on the M13 phage particles. The amino-terminal region of gp9 was modified by inserting short sequences that encode antigenic epitopes. We show here that the modified gp9 proteins correctly integrate into the membrane using the membrane insertase YidC exposing the modified epitope into the periplasm. The proteins are then efficiently assembled onto the phage particles. Also extensions up to 36 amino acid residues at the amino-terminal end of gp9 did not interfere with membrane integration and phage assembly. The exposure of the antigenic tags on the phage was visualised with immunogold labelling by electron microscopy and verified by dot blotting with antibodies to the tags. Our results suggest that gp9 at the phage tip is suitable for the phage display technology. The modified gp9 can be supplied in trans from a plasmid and fully complements M13 phage with an amber mutation in gene 9. The modified phage tip is very well accessible to antibodies.

Membrane insertion and assembly of epitope-tagged gp9 at the tip of the M13 phage

PubMed Central

2011-01-01

Background Filamentous M13 phage extrude from infected Escherichia coli with a tip structure composed of gp7 and gp9. This tip structure is extended by the assembly of the filament composed of the major coat protein gp8. Finally, gp3 and gp6 terminate the phage structure at the proximal end. Up to now, gp3 has been the primary tool for phage display technology. However, gp7, gp8 and gp9 could also be used for phage display and these phage particles should bind to two different or more surfaces when the modified coat proteins are combined. Therefore, we tested here if the amino-terminal end of gp9 can be modified and whether the modified portion is exposed and detectable on the M13 phage particles. Results The amino-terminal region of gp9 was modified by inserting short sequences that encode antigenic epitopes. We show here that the modified gp9 proteins correctly integrate into the membrane using the membrane insertase YidC exposing the modified epitope into the periplasm. The proteins are then efficiently assembled onto the phage particles. Also extensions up to 36 amino acid residues at the amino-terminal end of gp9 did not interfere with membrane integration and phage assembly. The exposure of the antigenic tags on the phage was visualised with immunogold labelling by electron microscopy and verified by dot blotting with antibodies to the tags. Conclusions Our results suggest that gp9 at the phage tip is suitable for the phage display technology. The modified gp9 can be supplied in trans from a plasmid and fully complements M13 phage with an amber mutation in gene 9. The modified phage tip is very well accessible to antibodies. PMID:21943062

GP trainers and trainees - trait and gender differences in personality: implications for GP training.

PubMed

Joffe, Megan; MacLeod, Sheona; Kedziora, Marta; Main, Paul

2016-05-01

This study looked at differences between established GP trainers and current GP trainees in relation to personality traits. Personality differences are particularly important for training in the UK context where the attributes of successful GPs may be evolving as the context changes, and where there is a unique one-to-one relationship between trainer and trainee. GP trainers and trainees attending educational events were invited to participate in this study by completing the NEO-PI-R, a personality measure. Correlation and multiple regression analysis demonstrated differences between these groups; some in line with expected differences relating to age and gender. Others, such as lower reported levels of emotional resilience, may be particular to this trainee population. Overall the gender differences are significant given the trend towards the feminisation of the medical profession. Generational differences may also explain some behaviour and attitudinal differences which can aid trainers' understanding of training issues. The findings have important implications for training, particularly in relation to the development of emotional resilience for GP trainees, and for recruitment. Further research correlating educational outcomes and perceived satisfaction with a GP career and GP training would indicate if trainer/trainee personality differences have a direct bearing on educational outcomes and future practice.

Molecular characterization of the monoclonal antibodies composing ZMAb: a protective cocktail against Ebola virus.

PubMed

Audet, Jonathan; Wong, Gary; Wang, Han; Lu, Guangwen; Gao, George F; Kobinger, Gary; Qiu, Xiangguo

2014-11-06

Ebola virus (EBOV) causes severe viral hemorrhagic fever in humans and non-human primates, with a case fatality rate of up to 88% in human outbreaks. Over the past 3 years, monoclonal antibody (mAb) cocktails have demonstrated high efficacy as treatments against EBOV infection. One such cocktail is ZMAb, which consists of three mouse antibodies, 1H3, 2G4, and 4G7. Here, we present the epitope binding properties of mAbs 1H3, 2G4, and 4G7. We showed that these antibodies have different variable region sequences, suggesting that the individual mAbs are not clonally related. All three antibodies were found to neutralize EBOV variant Mayinga. Additionally, 2G4 and 4G7 were shown to cross-inhibit each other in vitro and select for an escape mutation at the same position on the EBOV glycoprotein (GP), at amino acid 508. 1H3 selects an escape mutant at amino acid 273 on EBOV GP. Surface plasmon resonance studies showed that all three antibodies have dissociation constants on the order of 10(-7). In combination with previous studies evaluating the binding sites of other protective antibodies, our results suggest that antibodies targeting the GP1-GP2 interface and the glycan cap are often selected as efficacious antibodies for post-exposure interventions against EBOV.

Formalin-Inactivated Coxiella burnetii Phase I Vaccine-Induced Protection Depends on B Cells To Produce Protective IgM and IgG

PubMed Central

Peng, Ying; Schoenlaub, Laura; Elliott, Alexandra; Mitchell, William; Zhang, Yan

2013-01-01

To further understand the mechanisms of formalin-inactivated Coxiella burnetii phase I (PI) vaccine (PIV)-induced protection, we examined if B cell, T cell, CD4+ T cell, or CD8+ T cell deficiency in mice significantly affects the ability of PIV to confer protection against a C. burnetii infection. Interestingly, compared to wild-type (WT) mice, PIV conferred comparable levels of protection in CD4+ T cell- or CD8+ T cell-deficient mice and partial protection in T cell-deficient mice but did not provide measurable protection in B cell-deficient mice. These results suggest that PIV-induced protection depends on B cells. In addition, anti-PI-specific IgM was the major detectable antibody (Ab) in immune sera from PIV-vaccinated CD4+ T cell-deficient mice, and passive transfer of immune sera from PIV-vaccinated CD4+ T cell-deficient mice conferred significant protection. These results suggest that T cell-independent anti-PI-specific IgM may contribute to PIV-induced protection. Our results also suggested that PIV-induced protection may not depend on complement activation and Fc receptor-mediated effector functions. Furthermore, our results demonstrated that both IgM and IgG from PIV-vaccinated WT mouse sera were able to inhibit C. burnetii infection in vivo, but only IgM from PIV-vaccinated CD4+ T cell-deficient mouse sera inhibited C. burnetii infection. Collectively, these findings suggest that PIV-induced protection depends on B cells to produce protective IgM and IgG and that T cell-independent anti-PI-specific IgM may play a critical role in PIV-induced protection against C. burnetii infection. PMID:23545296

TNFR2-deficient memory CD8 T cells provide superior protection against tumor cell growth.

PubMed

Kim, Edward Y; Teh, Soo-Jeet; Yang, Jocelyn; Chow, Michael T; Teh, Hung-Sia

2009-11-15

TNF receptor-2 (TNFR2) plays a critical role in promoting the activation and survival of naive T cells during the primary response. Interestingly, anti-CD3 plus IL-2 activated TNFR2(-/-) CD8 T cells are highly resistant to activation-induced cell death (AICD), which correlates with high expression levels of prosurvival molecules such as Bcl-2, survivin, and CD127 (IL-7Ralpha). We determined whether the resistance of activated TNFR2(-/-) CD8 T cells to AICD contributes to more effective protection against tumor cell growth. We found that during a primary tumor challenge, despite initial inferiority in controlling tumor cell growth, TNFR2(-/-) mice were able to more effectively control tumor burden over time compared with wild-type (WT) mice. Furthermore, vaccination of TNFR2(-/-) mice with recombinant Listeria monocytogenes that express OVA confers better protection against the growth of OVA-expressing E.G7 tumor cells relative to similarly vaccinated WT mice. The enhanced protection against tumor cell growth was not due to more effective activation of OVA-specific memory CD8 T cells in vaccinated TNFR2(-/-) mice. In vitro studies indicate that optimally activated OVA-specific TNFR2(-/-) CD8 T cells proliferated to the same extent and possess similar cytotoxicity against E.G7 tumor cells as WT CD8 T cells. However, relative to WT cells, activated OVA-specific TNFR2(-/-) CD8 T cells were highly resistant to AICD. Thus, the enhanced protection against E.G7 in TNFR2(-/-) mice is likely due to the recruitment and activation of OVA-specific memory TNFR2(-/-) CD8 T cells and their prolonged survival at the tumor site.

40 CFR Table 8 to Subpart G of... - Organic HAP's Subject to the Wastewater Provisions for Process Units at New Sources

Code of Federal Regulations, 2012 CFR

2012-07-01

... Wastewater Provisions for Process Units at New Sources 8 Table 8 to Subpart G of Part 63 Protection of... Vessels, Transfer Operations, and Wastewater Pt. 63, Subpt. G, Table 8 Table 8 to Subpart G of Part 63—Organic HAP's Subject to the Wastewater Provisions for Process Units at New Sources Chemical name CAS No...

40 CFR Table 8 to Subpart G of... - Organic HAP's Subject to the Wastewater Provisions for Process Units at New Sources

Code of Federal Regulations, 2013 CFR

2013-07-01

... Wastewater Provisions for Process Units at New Sources 8 Table 8 to Subpart G of Part 63 Protection of... Vessels, Transfer Operations, and Wastewater Pt. 63, Subpt. G, Table 8 Table 8 to Subpart G of Part 63—Organic HAP's Subject to the Wastewater Provisions for Process Units at New Sources Chemical name CAS No...

40 CFR Table 8 to Subpart G of... - Organic HAP's Subject to the Wastewater Provisions for Process Units at New Sources

Code of Federal Regulations, 2014 CFR

2014-07-01

... Wastewater Provisions for Process Units at New Sources 8 Table 8 to Subpart G of Part 63 Protection of... Vessels, Transfer Operations, and Wastewater Pt. 63, Subpt. G, Table 8 Table 8 to Subpart G of Part 63—Organic HAP's Subject to the Wastewater Provisions for Process Units at New Sources Chemical name CAS No...

Poly(GP) proteins are a useful pharmacodynamic marker for C9ORF72-associated amyotrophic lateral sclerosis.

PubMed

Gendron, Tania F; Chew, Jeannie; Stankowski, Jeannette N; Hayes, Lindsey R; Zhang, Yong-Jie; Prudencio, Mercedes; Carlomagno, Yari; Daughrity, Lillian M; Jansen-West, Karen; Perkerson, Emilie A; O'Raw, Aliesha; Cook, Casey; Pregent, Luc; Belzil, Veronique; van Blitterswijk, Marka; Tabassian, Lilia J; Lee, Chris W; Yue, Mei; Tong, Jimei; Song, Yuping; Castanedes-Casey, Monica; Rousseau, Linda; Phillips, Virginia; Dickson, Dennis W; Rademakers, Rosa; Fryer, John D; Rush, Beth K; Pedraza, Otto; Caputo, Ana M; Desaro, Pamela; Palmucci, Carla; Robertson, Amelia; Heckman, Michael G; Diehl, Nancy N; Wiggs, Edythe; Tierney, Michael; Braun, Laura; Farren, Jennifer; Lacomis, David; Ladha, Shafeeq; Fournier, Christina N; McCluskey, Leo F; Elman, Lauren B; Toledo, Jon B; McBride, Jennifer D; Tiloca, Cinzia; Morelli, Claudia; Poletti, Barbara; Solca, Federica; Prelle, Alessandro; Wuu, Joanne; Jockel-Balsarotti, Jennifer; Rigo, Frank; Ambrose, Christine; Datta, Abhishek; Yang, Weixing; Raitcheva, Denitza; Antognetti, Giovanna; McCampbell, Alexander; Van Swieten, John C; Miller, Bruce L; Boxer, Adam L; Brown, Robert H; Bowser, Robert; Miller, Timothy M; Trojanowski, John Q; Grossman, Murray; Berry, James D; Hu, William T; Ratti, Antonia; Traynor, Bryan J; Disney, Matthew D; Benatar, Michael; Silani, Vincenzo; Glass, Jonathan D; Floeter, Mary Kay; Rothstein, Jeffrey D; Boylan, Kevin B; Petrucelli, Leonard

2017-03-29

There is no effective treatment for amyotrophic lateral sclerosis (ALS), a devastating motor neuron disease. However, discovery of a G 4 C 2 repeat expansion in the C9ORF72 gene as the most common genetic cause of ALS has opened up new avenues for therapeutic intervention for this form of ALS. G 4 C 2 repeat expansion RNAs and proteins of repeating dipeptides synthesized from these transcripts are believed to play a key role in C9ORF72 -associated ALS (c9ALS). Therapeutics that target G 4 C 2 RNA, such as antisense oligonucleotides (ASOs) and small molecules, are thus being actively investigated. A limitation in moving such treatments from bench to bedside is a lack of pharmacodynamic markers for use in clinical trials. We explored whether poly(GP) proteins translated from G 4 C 2 RNA could serve such a purpose. Poly(GP) proteins were detected in cerebrospinal fluid (CSF) and in peripheral blood mononuclear cells from c9ALS patients and, notably, from asymptomatic C9ORF72 mutation carriers. Moreover, CSF poly(GP) proteins remained relatively constant over time, boding well for their use in gauging biochemical responses to potential treatments. Treating c9ALS patient cells or a mouse model of c9ALS with ASOs that target G 4 C 2 RNA resulted in decreased intracellular and extracellular poly(GP) proteins. This decrease paralleled reductions in G 4 C 2 RNA and downstream G 4 C 2 RNA-mediated events. These findings indicate that tracking poly(GP) proteins in CSF could provide a means to assess target engagement of G 4 C 2 RNA-based therapies in symptomatic C9ORF72 repeat expansion carriers and presymptomatic individuals who are expected to benefit from early therapeutic intervention. Copyright © 2017, American Association for the Advancement of Science.

Poly(GP) proteins are a useful pharmacodynamic marker for C9ORF72-associated amyotrophic lateral sclerosis

PubMed Central

Gendron, Tania F.; Chew, Jeannie; Stankowski, Jeannette N.; Hayes, Lindsey R.; Zhang, Yong-Jie; Prudencio, Mercedes; Carlomagno, Yari; Daughrity, Lillian M.; Jansen-West, Karen; Perkerson, Emilie A.; O’Raw, Aliesha; Cook, Casey; Pregent, Luc; Belzil, Veronique; van Blitterswijk, Marka; Tabassian, Lilia J.; Lee, Chris W.; Yue, Mei; Tong, Jimei; Song, Yuping; Castanedes-Casey, Monica; Rousseau, Linda; Phillips, Virginia; Dickson, Dennis W.; Rademakers, Rosa; Fryer, John D.; Rush, Beth K.; Pedraza, Otto; Caputo, Ana M.; Desaro, Pamela; Palmucci, Carla; Robertson, Amelia; Heckman, Michael G.; Diehl, Nancy N.; Wiggs, Edythe; Tierney, Michael; Braun, Laura; Farren, Jennifer; Lacomis, David; Ladha, Shafeeq; Fournier, Christina N.; McCluskey, Leo F.; Elman, Lauren B.; Toledo, Jon B.; McBride, Jennifer D.; Tiloca, Cinzia; Morelli, Claudia; Poletti, Barbara; Solca, Federica; Prelle, Alessandro; Wuu, Joanne; Jockel-Balsarotti1, Jennifer; Rigo, Frank; Ambrose, Christine; Datta, Abhishek; Yang, Weixing; Raitcheva, Denitza; Antognetti, Giovanna; McCampbell, Alexander; Van Swieten, John C.; Miller, Bruce L.; Boxer, Adam L.; Brown, Robert H.; Bowser, Robert; Miller, Timothy M.; Trojanowski, John Q.; Grossman, Murray; Berry, James D.; Hu, William T.; Ratti, Antonia; Traynor, Bryan J.; Disney, Matthew D.; Benatar, Michael; Silani, Vincenzo; Glass, Jonathan D.; Floeter, Mary Kay; Rothstein, Jeffrey D.; Boylan, Kevin B.; Petrucelli, Leonard

2017-01-01

There is no effective treatment for amyotrophic lateral sclerosis (ALS), a devastating motor neuron disease. However, discovery of a G4C2 repeat expansion in the C9ORF72 gene as the most common genetic cause of ALS has opened up new avenues for therapeutic intervention for this form of ALS. G4C2 repeat expansion RNAs and proteins of repeating dipeptides synthesized from these transcripts are believed to play a key role in C9ORF72-associated ALS (c9ALS). Therapeutics that target G4C2 RNA, such as antisense oligonucleotides (ASOs) and small molecules, are thus being actively investigated. A limitation in moving such treatments from bench to bedside is a lack of pharmacodynamic markers for use in clinical trials. We explored whether poly(GP) proteins translated from G4C2 RNA could serve such a purpose. Poly(GP) proteins were detected in cerebrospinal fluid (CSF) and in peripheral blood mononuclear cells from c9ALS patients and, notably, from asymptomatic C9ORF72 mutation carriers. Moreover, CSF poly(GP) proteins remained relatively constant over time, boding well for their use in gauging biochemical responses to potential treatments. Treating c9ALS patient cells or a mouse model of c9ALS with ASOs that target G4C2 RNA resulted in decreased intracellular and extracellular poly(GP) proteins. This decrease paralleled reductions in G4C2 RNA and downstream G4C2 RNA–mediated events. These findings indicate that tracking poly(GP) proteins in CSF could provide a means to assess target engagement of G4C2 RNA–based therapies in symptomatic C9ORF72 repeat expansion carriers and presymptomatic individuals who are expected to benefit from early therapeutic intervention. PMID:28356511

Subtype C gp140 Vaccine Boosts Immune Responses Primed by the South African AIDS Vaccine Initiative DNA-C2 and MVA-C HIV Vaccines after More than a 2-Year Gap

PubMed Central

Mayer, Kenneth H.; Elizaga, Marnie L.; Bekker, Linda-Gail; Allen, Mary; Morris, Lynn; Montefiori, David; De Rosa, Stephen C.; Sato, Alicia; Gu, Niya; Tomaras, Georgia D.; Tucker, Timothy; Barnett, Susan W.; Mkhize, Nonhlanhla N.; Shen, Xiaoying; Downing, Katrina; Williamson, Carolyn; Pensiero, Michael; Corey, Lawrence; Williamson, Anna-Lise

2016-01-01

A phase I safety and immunogenicity study investigated South African AIDS Vaccine Initiative (SAAVI) HIV-1 subtype C (HIV-1C) DNA vaccine encoding Gag-RT-Tat-Nef and gp150, boosted with modified vaccinia Ankara (MVA) expressing matched antigens. Following the finding of partial protective efficacy in the RV144 HIV vaccine efficacy trial, a protein boost with HIV-1 subtype C V2-deleted gp140 with MF59 was added to the regimen. A total of 48 participants (12 U.S. participants and 36 Republic of South Africa [RSA] participants) were randomized to receive 3 intramuscular (i.m.) doses of SAAVI DNA-C2 of 4 mg (months 0, 1, and 2) and 2 i.m. doses of SAAVI MVA-C of 1.45 × 109 PFU (months 4 and 5) (n = 40) or of a placebo (n = 8). Approximately 2 years after vaccination, 27 participants were rerandomized to receive gp140/MF59 at 100 μg or placebo, as 2 i.m. injections, 3 months apart. The vaccine regimen was safe and well tolerated. After the DNA-MVA regimen, CD4+ T-cell and CD8+ T-cell responses occurred in 74% and 32% of the participants, respectively. The protein boost increased CD4+ T-cell responses to 87% of the subjects. All participants developed tier 1 HIV-1C neutralizing antibody responses as well as durable Env binding antibodies that recognized linear V3 and C5 peptides. The HIV-1 subtype C DNA-MVA vaccine regimen showed promising cellular immunogenicity. Boosting with gp140/MF59 enhanced levels of binding and neutralizing antibodies as well as CD4+ T-cell responses to HIV-1 envelope. (This study has been registered at ClinicalTrials.gov under registration no. NCT00574600 and NCT01423825.) PMID:27098021

How can educators support general practice (GP) trainees to develop resilience to prevent burnout?

PubMed

Sales, Bryony; Macdonald, Alexandra; Scallan, Samantha; Crane, Sue

2016-11-01

Burnout impacts adversely on professional and personal life, and holds implications for patient care. Current research on burnout mainly focuses on established general practitioners but it is unclear how early the signs of burnout really start. This work seeks to identify whether specific GP trainee groups are particularly at risk of burnout and the aspects of training they find stressful. A longitudinal cohort study, collecting qualitative and quantitative data through a single mode of data collection (questionnaire) took place with trainees from all GP training years (ST1-3), across a vocational training scheme (n = 48). Data gathered included the Oldenburg Burnout Inventory (OLBI). Higher than anticipated levels of burnout were displayed by all trainees. A sub-group self reporting higher levels of burnout comprised all-female, UK-trained-at-undergraduate GP trainees, with a partner but no children. Top reported stressors included knowledge/uncertainty, workload/time pressures and ePortfolio. Less than 50% of trainees perceived their burnout levels to be as high as their OLBI showing potential lack of insight. This research demonstrates that high levels of burnout are experienced in GP trainees as early as the first year of training. Early identification of burnout amongst trainees is essential by GP educators to help protect the future GP workforce.

A single amino-acid change in a highly conserved motif of gp41 elicits HIV-1 neutralization and protects against CD4 depletion.

PubMed

Petitdemange, Caroline; Achour, Abla; Dispinseri, Stefania; Malet, Isabelle; Sennepin, Alexis; Ho Tsong Fang, Raphaël; Crouzet, Joël; Marcelin, Anne-Geneviève; Calvez, Vincent; Scarlatti, Gabriella; Debré, Patrice; Vieillard, Vincent

2013-09-01

The induction of neutralizing antibodies against conserved regions of the human immunodeficiency virus type 1 (HIV-1) envelope protein is a major goal of vaccine strategies. We previously identified 3S, a critical conserved motif of gp41 that induces the NKp44L ligand of an activating NK receptor. In vivo, anti-3S antibodies protect against the natural killer (NK) cell-mediated CD4 depletion that occurs without efficient viral neutralization. Specific substitutions within the 3S peptide motif were prepared by directed mutagenesis. Virus production was monitored by measuring the p24 production. Neutralization assays were performed with immune-purified antibodies from immunized mice and a cohort of HIV-infected patients. Expression of NKp44L on CD4(+) T cells and degranulation assay on activating NK cells were both performed by flow cytometry. Here, we show that specific substitutions in the 3S motif reduce viral infection without affecting gp41 production, while decreasing both its capacity to induce NKp44L expression on CD4(+) T cells and its sensitivity to autologous NK cells. Generation of antibodies in mice against the W614 specific position in the 3S motif elicited a capacity to neutralize cross-clade viruses, notable in its magnitude, breadth, and durability. Antibodies against this 3S variant were also detected in sera from some HIV-1-infected patients, demonstrating both neutralization activity and protection against CD4 depletion. These findings suggest that a specific substitution in a 3S-based immunogen might allow the generation of specific antibodies, providing a foundation for a rational vaccine that combine a capacity to neutralize HIV-1 and to protect CD4(+) T cells.

Analysis of Select Herpes Simplex Virus 1 (HSV-1) Proteins for Restriction of Human Immunodeficiency Virus Type 1 (HIV-1): HSV-1 gM Protein Potently Restricts HIV-1 by Preventing Intracellular Transport and Processing of Env gp160.

PubMed

Polpitiya Arachchige, Sachith; Henke, Wyatt; Pramanik, Ankita; Kalamvoki, Maria; Stephens, Edward B

2018-01-15

Virus-encoded proteins that impair or shut down specific host cell functions during replication can be used as probes to identify potential proteins/pathways used in the replication of viruses from other families. We screened nine proteins from herpes simplex virus 1 (HSV-1) for the ability to enhance or restrict human immunodeficiency virus type 1 (HIV-1) replication. We show that several HSV-1 proteins (glycoprotein M [gM], US3, and UL24) potently restricted the replication of HIV-1. Unlike UL24 and US3, which reduced viral protein synthesis, we observed that gM restriction of HIV-1 occurred through interference with the processing and transport of gp160, resulting in a significantly reduced level of mature gp120/gp41 released from cells. Finally, we show that an HSV-1 gM mutant lacking the majority of the C-terminal domain (HA-gM[Δ345-473]) restricted neither gp160 processing nor the release of infectious virus. These studies identify proteins from heterologous viruses that can restrict viruses through novel pathways. IMPORTANCE HIV-1 infection of humans results in AIDS, characterized by the loss of CD4 + T cells and increased susceptibility to opportunistic infections. Both HIV-1 and HSV-1 can infect astrocytes and microglia of the central nervous system (CNS). Thus, the identification of HSV-1 proteins that directly restrict HIV-1 or interfere with pathways required for HIV-1 replication could lead to novel antiretroviral strategies. The results of this study show that select viral proteins from HSV-1 can potently restrict HIV-1. Further, our results indicate that the gM protein of HSV-1 restricts HIV-1 through a novel pathway by interfering with the processing of gp160 and its incorporation into virus maturing from the cell. Copyright © 2018 American Society for Microbiology.

Development of Small-molecule HIV Entry Inhibitors Specifically Targeting gp120 or gp41

PubMed Central

Lu, Lu; Yu, Fei; Cai, Lifeng; Debnath, Asim K.; Jiang, Shibo

2015-01-01

Human immunodeficiency virus type 1 (HIV-1) envelope (Env) glycoprotein surface subunit gp120 and transmembrane subunit gp41 play important roles in HIV-1 entry, thus serving as key targets for the development of HIV-1 entry inhibitors. T20 peptide (enfuvirtide) is the first U.S. FDA-approved HIV entry inhibitor; however, its clinical application is limited by the lack of oral availability. Here, we have described the structure and function of the HIV-1 gp120 and gp41 subunits and reviewed advancements in the development of small-molecule HIV entry inhibitors specifically targeting these two Env glycoproteins. We then compared the advantages and disadvantages of different categories of HIV entry inhibitor candidates and further predicted the future trend of HIV entry inhibitor development. PMID:26324044

Structure of HIV-1 gp120 with gp41-interactive region reveals layered envelope architecture and basis of conformational mobility

PubMed Central

Pancera, Marie; Majeed, Shahzad; Ban, Yih-En Andrew; Chen, Lei; Huang, Chih-chin; Kong, Leopold; Stuckey, Jonathan; Zhou, Tongqing; Robinson, James E.; Schief, William R.; Sodroski, Joseph; Wyatt, Richard; Kwong, Peter D.

2009-01-01

The viral spike of HIV-1 is composed of three gp120 envelope glycoproteins attached noncovalently to three gp41 transmembrane molecules. Viral entry is initiated by binding to the CD4 receptor on the cell surface, which induces large conformational changes in gp120. These changes not only provide a model for receptor-triggered entry, but affect spike sensitivity to drug- and antibody-mediated neutralization. Although some of the details of the CD4-induced conformational change have been visualized by crystal structures and cryoelectron tomograms, the critical gp41-interactive region of gp120 was missing from previous atomic-level characterizations. Here we determine the crystal structure of an HIV-1 gp120 core with intact gp41-interactive region in its CD4-bound state, compare this structure to unliganded and antibody-bound forms to identify structurally invariant and plastic components, and use ligand-oriented cryoelectron tomograms to define component mobility in the viral spike context. Newly defined gp120 elements proximal to the gp41 interface complete a 7-stranded β-sandwich, which appeared invariant in conformation. Loop excursions emanating from the sandwich form three topologically separate—and structurally plastic—layers, topped off by the highly glycosylated gp120 outer domain. Crystal structures, cryoelectron tomograms, and interlayer chemistry were consistent with a mechanism in which the layers act as a shape-changing spacer, facilitating movement between outer domain and gp41-associated β-sandwich and providing for conformational diversity used in immune evasion. A “layered” gp120 architecture thus allows movement among alternative glycoprotein conformations required for virus entry and immune evasion, whereas a β-sandwich clamp maintains gp120–gp41 interaction and regulates gp41 transitions. PMID:20080564

Structure of HIV-1 gp120 with gp41-interactive region reveals layered envelope architecture and basis of conformational mobility.

PubMed

Pancera, Marie; Majeed, Shahzad; Ban, Yih-En Andrew; Chen, Lei; Huang, Chih-chin; Kong, Leopold; Kwon, Young Do; Stuckey, Jonathan; Zhou, Tongqing; Robinson, James E; Schief, William R; Sodroski, Joseph; Wyatt, Richard; Kwong, Peter D

2010-01-19

The viral spike of HIV-1 is composed of three gp120 envelope glycoproteins attached noncovalently to three gp41 transmembrane molecules. Viral entry is initiated by binding to the CD4 receptor on the cell surface, which induces large conformational changes in gp120. These changes not only provide a model for receptor-triggered entry, but affect spike sensitivity to drug- and antibody-mediated neutralization. Although some of the details of the CD4-induced conformational change have been visualized by crystal structures and cryoelectron tomograms, the critical gp41-interactive region of gp120 was missing from previous atomic-level characterizations. Here we determine the crystal structure of an HIV-1 gp120 core with intact gp41-interactive region in its CD4-bound state, compare this structure to unliganded and antibody-bound forms to identify structurally invariant and plastic components, and use ligand-oriented cryoelectron tomograms to define component mobility in the viral spike context. Newly defined gp120 elements proximal to the gp41 interface complete a 7-stranded beta-sandwich, which appeared invariant in conformation. Loop excursions emanating from the sandwich form three topologically separate--and structurally plastic--layers, topped off by the highly glycosylated gp120 outer domain. Crystal structures, cryoelectron tomograms, and interlayer chemistry were consistent with a mechanism in which the layers act as a shape-changing spacer, facilitating movement between outer domain and gp41-associated beta-sandwich and providing for conformational diversity used in immune evasion. A "layered" gp120 architecture thus allows movement among alternative glycoprotein conformations required for virus entry and immune evasion, whereas a beta-sandwich clamp maintains gp120-gp41 interaction and regulates gp41 transitions.

Cultural competency training of GP Registrars-exploring the views of GP Supervisors.

PubMed

Watt, Kelly; Abbott, Penny; Reath, Jenny

2015-10-06

An equitable multicultural society requires General Practitioners (GPs) to be proficient in providing health care to patients from diverse backgrounds. This requires a certain set of attitudes, knowledge and skills known as cultural competence. While training in cultural competence is an important part of the Australian GP Registrar training curriculum, it is unclear who provides this training apart from in Aboriginal and Torres Strait Islander training posts. The majority of Australian GP Registrar training takes place in a workplace setting facilitated by the GP Supervisor. In view of the central role of GP Supervisors, their views on culturally competent practice, and their role in its development in Registrars, are important to ascertain. We conducted 14 semi-structured interviews with GP Supervisors. These were audiotaped, transcribed verbatim and thematically analyzed using an iterative approach. The Supervisors interviewed frequently viewed cultural competence as adequately covered by using patient-centered approaches. The Supervisor role in promoting cultural competence of Registrars was affirmed, though training was noted to occur opportunistically and focused largely on patient-centered care rather than health disparities. Formal training for both Registrars and Supervisors may be beneficial not only to develop a deeper understanding of cultural competence and its relevance to practice but also to promote more consistency in training from Supervisors in the area, particularly with respect to self-reflection, non-conscious bias and utilizing appropriate cultural knowledge without stereotyping and assumption-making.

The Protective Effects of IGF-1 on Different Subpopulations of DRG Neurons with Neurotoxicity Induced by gp120 and Dideoxycytidine In Vitro.

PubMed

Lu, Lin; Dong, Haixia; Liu, Guixiang; Yuan, Bin; Li, Yizhao; Liu, Huaxiang

2014-11-01

Peripheral neuropathy induced by human immunodeficiency virus (HIV) infection and antiretroviral therapy is not only difficult to distinguish in clinical practice, but also difficult to relieve the pain symptoms by analgesics because of the severity of the disease at the later stage. Hence, to explore the mechanisms of HIV-related neuropathy and find new therapeutic options are particularly important for relieving neuropathic pain symptoms of the patients. In the present study, primary cultured embryonic rat dorsal root ganglion (DRG) neurons were used to determine the neurotoxic effects of HIV-gp120 protein and/or antiretroviral drug dideoxycytidine (ddC) and the therapeutic actions of insulin-like growth factor-1 (IGF-1) on gp120- or ddC-induced neurotoxicity. DRG neurons were exposed to gp120 (500 pmol/L), ddC (50 μmol/L), gp120 (500 pmol/L) plus ddC (50 μmol/L), gp120 (500 pmol/L) plus IGF-1 (20 nmol/L), ddC (50 μmol/L) plus IGF-1 (20 nmol/L), gp120 (500 pmol/L) plus ddC (50 μmol/L) plus IGF-1 (20 nmol/L), respectively, for 72 hours. The results showed that gp120 and/or ddC caused neurotoxicity of primary cultured DRG neurons. Interestingly, the severity of neurotoxicity induced by gp120 and ddC was different in different subpopulation of DRG neurons. gp120 mainly affected large diameter DRG neurons (>25 μm), whereas ddC mainly affected small diameter DRG neurons (≤25 μm). IGF-1 could reverse the neurotoxicity induced by gp120 and/or ddC on small, but not large, DRG neurons. These data provide new insights in elucidating the pathogenesis of HIV infection- or antiretroviral therapy-related peripheral neuropathy and facilitating the development of novel treatment strategies.

The Protective Effects of IGF-1 on Different Subpopulations of DRG Neurons with Neurotoxicity Induced by gp120 and Dideoxycytidine In Vitro

PubMed Central

Lu, Lin; Dong, Haixia; Liu, Guixiang; Yuan, Bin; Li, Yizhao; Liu, Huaxiang

2014-01-01

Peripheral neuropathy induced by human immunodeficiency virus (HIV) infection and antiretroviral therapy is not only difficult to distinguish in clinical practice, but also difficult to relieve the pain symptoms by analgesics because of the severity of the disease at the later stage. Hence, to explore the mechanisms of HIV-related neuropathy and find new therapeutic options are particularly important for relieving neuropathic pain symptoms of the patients. In the present study, primary cultured embryonic rat dorsal root ganglion (DRG) neurons were used to determine the neurotoxic effects of HIV-gp120 protein and/or antiretroviral drug dideoxycytidine (ddC) and the therapeutic actions of insulin-like growth factor-1 (IGF-1) on gp120- or ddC-induced neurotoxicity. DRG neurons were exposed to gp120 (500 pmol/L), ddC (50 μmol/L), gp120 (500 pmol/L) plus ddC (50 μmol/L), gp120 (500 pmol/L) plus IGF-1 (20 nmol/L), ddC (50 μmol/L) plus IGF-1 (20 nmol/L), gp120 (500 pmol/L) plus ddC (50 μmol/L) plus IGF-1 (20 nmol/L), respectively, for 72 hours. The results showed that gp120 and/or ddC caused neurotoxicity of primary cultured DRG neurons. Interestingly, the severity of neurotoxicity induced by gp120 and ddC was different in different subpopulation of DRG neurons. gp120 mainly affected large diameter DRG neurons (>25 μm), whereas ddC mainly affected small diameter DRG neurons (≤25 μm). IGF-1 could reverse the neurotoxicity induced by gp120 and/or ddC on small, but not large, DRG neurons. These data provide new insights in elucidating the pathogenesis of HIV infection- or antiretroviral therapy-related peripheral neuropathy and facilitating the development of novel treatment strategies. PMID:25489421

Immune modulation with high-dose heat-shock protein gp96: therapy of murine autoimmune diabetes and encephalomyelitis.

PubMed

Chandawarkar, Rajiv Y; Wagh, Mihir S; Kovalchin, Joseph T; Srivastava, Pramod

2004-04-01

Immunization with heat-shock protein (HSP) gp96 elicits protective immunity to the cancer or virus-infected cells from which it is derived. Low doses of gp96 generate immunity, while doses 10 times the immunizing dose do not. We show here that injection of high doses of gp96 generates CD4(+) T cells that down-regulate a variety of ongoing immune responses. Immunization with high doses of gp96 prevents myelin basic protein- or proteolipid protein-induced autoimmune encephalomyelitis in SJL mice and the onset of diabetes in non-obese diabetic mice. The suppression of immune response can be adoptively transferred with CD4(+) cells and does not partition with the CD25 phenotype. The immunomodulatory properties of gp96 (and possibly other HSP) may be used for antigen-specific activation or suppression of cellular immune responses. The latter may form the basis for novel immunotherapies for autoimmune diseases.

Enhanced Central Nervous System Transduction with Lentiviral Vectors Pseudotyped with RVG/HIV-1gp41 Chimeric Envelope Glycoproteins

PubMed Central

Trabalza, Antonio; Eleftheriadou, Ioanna; Sgourou, Argyro; Liao, Ting-Yi; Patsali, Petros; Lee, Heyne

2014-01-01

ABSTRACT To investigate the potential benefits which may arise from pseudotyping the HIV-1 lentiviral vector with its homologous gp41 envelope glycoprotein (GP) cytoplasmic tail (CT), we created chimeric RVG/HIV-1gp41 GPs composed of the extracellular and transmembrane sequences of RVG and either the full-length gp41 CT or C terminus gp41 truncations sequentially removing existing conserved motifs. Lentiviruses (LVs) pseudotyped with the chimeric GPs were evaluated in terms of particle release (physical titer), biological titers, infectivity, and in vivo central nervous system (CNS) transduction. We report here that LVs carrying shorter CTs expressed higher levels of envelope GP and showed a higher average infectivity than those bearing full-length GPs. Interestingly, complete removal of GP CT led to vectors with the highest transduction efficiency. Removal of all C-terminal gp41 CT conserved motifs, leaving just 17 amino acids (aa), appeared to preserve infectivity and resulted in a significantly increased physical titer. Furthermore, incorporation of these 17 aa in the RVG CT notably enhanced the physical titer. In vivo stereotaxic delivery of LV vectors exhibiting the best in vitro titers into rodent striatum facilitated efficient transduction of the CNS at the site of injection. A particular observation was the improved retrograde transduction of neurons in connected distal sites that resulted from the chimeric envelope R5 which included the “Kennedy” sequence (Ken) and lentivirus lytic peptide 2 (LLP2) conserved motifs in the CT, and although it did not exhibit a comparable high titer upon pseudotyping, it led to a significant increase in distal retrograde transduction of neurons. IMPORTANCE In this study, we have produced novel chimeric envelopes bearing the extracellular domain of rabies fused to the cytoplasmic tail (CT) of gp41 and pseudotyped lentiviral vectors with them. Here we report novel effects on the transduction efficiency and physical titer

Innate immunity glycoprotein gp-340 variants may modulate human susceptibility to dental caries

PubMed Central

Jonasson, Anette; Eriksson, Christer; Jenkinson, Howard F; Källestål, Carina; Johansson, Ingegerd; Strömberg, Nicklas

2007-01-01

Background Bacterial adhesion is an important determinant of colonization and infection, including dental caries. The salivary scavenger receptor cysteine-rich glycoprotein gp-340, which mediates adhesion of Streptococcus mutans (implicated in caries), harbours three major size variants, designated gp-340 I to III, each specific to an individual saliva. Here we have examined the association of the gp-340 I to III polymorphisms with caries experience and adhesion of S. mutans. Methods A case-referent study was performed in 12-year-old Swedish children with high (n = 19) or low (n = 19) caries experiences. We measured the gp-340 I to III saliva phenotypes and correlated those with multiple outcome measures for caries experience and saliva adhesion of S. mutans using the partial least squares (PLS) multivariate projection technique. In addition, we used traditional statistics and 2-year caries increment to verify the established PLS associations, and bacterial adhesion to purified gp-340 I to III proteins to support possible mechanisms. Results All except one subject were typed as gp-340 I to III (10, 23 and 4, respectively). The gp-340 I phenotype correlated positively with caries experience (VIP = 1.37) and saliva adhesion of S. mutans Ingbritt (VIP = 1.47). The gp-340 II and III phenotypes tended to behave in the opposite way. Moreover, the gp-340 I phenotype tended to show an increased 2-year caries increment compared to phenotypes II/III. Purified gp-340 I protein mediated markedly higher adhesion of S. mutans strains Ingbritt and NG8 and Lactococcus lactis expressing AgI/II adhesins (SpaP or PAc) compared to gp-340 II and III proteins. In addition, the gp-340 I protein appeared over represented in subjects positive for Db, an allelic acidic PRP variant associated with caries, and subjects positive for both gp-340 I and Db tended to experience more caries than those negative for both proteins. Conclusion Gp-340 I behaves as a caries susceptibility protein. PMID

Protective CD8 Memory T Cell Responses to Mouse Melanoma Are Generated in the Absence of CD4 T Cell Help

PubMed Central

Steinberg, Shannon M.; Zhang, Peisheng; Turk, Mary Jo

2011-01-01

Background We have previously demonstrated that temporary depletion of CD4 T cells in mice with progressive B16 melanoma, followed by surgical tumor excision, induces protective memory CD8 T cell responses to melanoma/melanocyte antigens. We also showed that persistence of these CD8 T cells is supported, in an antigen-dependent fashion, by concurrent autoimmune melanocyte destruction. Herein we explore the requirement of CD4 T cell help in priming and maintaining this protective CD8 T cell response to melanoma. Methodology and Principal Findings To induce melanoma/melanocyte antigen-specific CD8 T cells, B16 tumor bearing mice were depleted of regulatory T cells (Treg) by either temporary, or long-term continuous treatment with anti-CD4 (mAb clone GK1.5). Total depletion of CD4 T cells led to significant priming of IFN-γ-producing CD8 T cell responses to TRP-2 and gp100. Surprisingly, treatment with anti-CD25 (mAb clone PC61), to specifically deplete Treg cells while leaving help intact, was ineffective at priming CD8 T cells. Thirty to sixty days after primary tumors were surgically excised, mice completely lacking CD4 T cell help developed autoimmune vitiligo, and maintained antigen-specific memory CD8 T cell responses that were highly effective at producing cytokines (IFN-γ, TNF-α, and IL-2). Mice lacking total CD4 T cell help also mounted protection against re-challenge with B16 melanoma sixty days after primary tumor excision. Conclusions and Significance This work establishes that CD4 T cell help is dispensable for the generation of protective memory T cell responses to melanoma. Our findings support further use of CD4 T cell depletion therapy for inducing long-lived immunity to cancer. PMID:22046294

Leucine-rich Repeats of Bacterial Surface Proteins Serve as Common Pattern Recognition Motifs of Human Scavenger Receptor gp340*

PubMed Central

Loimaranta, Vuokko; Hytönen, Jukka; Pulliainen, Arto T.; Sharma, Ashu; Tenovuo, Jorma; Strömberg, Nicklas; Finne, Jukka

2009-01-01

Scavenger receptors are innate immune molecules recognizing and inducing the clearance of non-host as well as modified host molecules. To recognize a wide pattern of invading microbes, many scavenger receptors bind to common pathogen-associated molecular patterns, such as lipopolysaccharides and lipoteichoic acids. Similarly, the gp340/DMBT1 protein, a member of the human scavenger receptor cysteine-rich protein family, displays a wide ligand repertoire. The peptide motif VEVLXXXXW derived from its scavenger receptor cysteine-rich domains is involved in some of these interactions, but most of the recognition mechanisms are unknown. In this study, we used mass spectrometry sequencing, gene inactivation, and recombinant proteins to identify Streptococcus pyogenes protein Spy0843 as a recognition receptor of gp340. Antibodies against Spy0843 are shown to protect against S. pyogenes infection, but no function or host receptor have been identified for the protein. Spy0843 belongs to the leucine-rich repeat (Lrr) family of eukaryotic and prokaryotic proteins. Experiments with truncated forms of the recombinant proteins confirmed that the Lrr region is needed in the binding of Spy0843 to gp340. The same motif of two other Lrr proteins, LrrG from the Gram-positive S. agalactiae and BspA from the Gram-negative Tannerella forsythia, also mediated binding to gp340. Moreover, inhibition of Spy0843 binding occurred with peptides containing the VEVLXXXXW motif, but also peptides devoid of the XXXXW motif inhibited binding of Lrr proteins. These results thus suggest that the conserved Lrr motif in bacterial proteins serves as a novel pattern recognition motif for unique core peptides of human scavenger receptor gp340. PMID:19465482

Activation of the GP130-STAT3 axis and its potential implications in nonalcoholic fatty liver disease

PubMed Central

Min, Hae-Ki; Mirshahi, Faridoddin; Verdianelli, Aurora; Pacana, Tommy; Patel, Vaishali; Park, Chun-Geon; Choi, Aejin; Lee, Jeong-Hoon; Park, Chung-Berm; Ren, Shunlin

2015-01-01

The status of the GP130-STAT3 signaling pathway in humans with nonalcoholic fatty liver disease (NAFLD) and its relevance to disease pathogenesis are unknown. The expression of the gp130-STAT3 axis and gp130 cytokine receptors were studied in subjects with varying phenotypes of NAFLD including nonalcoholic steatohepatitis (NASH) and compared with lean and weight-matched controls without NAFLD. Gp130 and its downstream signaling element (Tyk2 and STAT3) expression were inhibited in obese controls whereas they were increased in NAFLD. IL-6 levels were increased in NASH and correlated with gp130 expression (P < 0.01). Palmitate inhibited gp130-STAT3 expression and signaling. IL-6 and palmitate inhibited hepatic insulin signaling via STAT3-dependent and independent mechanisms, respectively. STAT3 overexpression reversed palmitate-induced lipotoxicity by increasing autophagy (ATG7) and decreasing endoplasmic reticulum stress. These data demonstrate that the STAT3 pathway is activated in NAFLD and can worsen insulin resistance while protecting against other lipotoxic mechanisms of disease pathogenesis. PMID:25747354

HIV-1 VACCINES. Diversion of HIV-1 vaccine-induced immunity by gp41-microbiota cross-reactive antibodies.

PubMed

Williams, Wilton B; Liao, Hua-Xin; Moody, M Anthony; Kepler, Thomas B; Alam, S Munir; Gao, Feng; Wiehe, Kevin; Trama, Ashley M; Jones, Kathryn; Zhang, Ruijun; Song, Hongshuo; Marshall, Dawn J; Whitesides, John F; Sawatzki, Kaitlin; Hua, Axin; Liu, Pinghuang; Tay, Matthew Z; Seaton, Kelly E; Shen, Xiaoying; Foulger, Andrew; Lloyd, Krissey E; Parks, Robert; Pollara, Justin; Ferrari, Guido; Yu, Jae-Sung; Vandergrift, Nathan; Montefiori, David C; Sobieszczyk, Magdalena E; Hammer, Scott; Karuna, Shelly; Gilbert, Peter; Grove, Doug; Grunenberg, Nicole; McElrath, M Juliana; Mascola, John R; Koup, Richard A; Corey, Lawrence; Nabel, Gary J; Morgan, Cecilia; Churchyard, Gavin; Maenza, Janine; Keefer, Michael; Graham, Barney S; Baden, Lindsey R; Tomaras, Georgia D; Haynes, Barton F

2015-08-14

An HIV-1 DNA prime vaccine, with a recombinant adenovirus type 5 (rAd5) boost, failed to protect from HIV-1 acquisition. We studied the nature of the vaccine-induced antibody (Ab) response to HIV-1 envelope (Env). HIV-1-reactive plasma Ab titers were higher to Env gp41 than to gp120, and repertoire analysis demonstrated that 93% of HIV-1-reactive Abs from memory B cells responded to Env gp41. Vaccine-induced gp41-reactive monoclonal antibodies were non-neutralizing and frequently polyreactive with host and environmental antigens, including intestinal microbiota (IM). Next-generation sequencing of an immunoglobulin heavy chain variable region repertoire before vaccination revealed an Env-IM cross-reactive Ab that was clonally related to a subsequent vaccine-induced gp41-reactive Ab. Thus, HIV-1 Env DNA-rAd5 vaccine induced a dominant IM-polyreactive, non-neutralizing gp41-reactive Ab repertoire response that was associated with no vaccine efficacy. Copyright © 2015, American Association for the Advancement of Science.

Epstein-Barr virus glycoprotein gB and gHgL can mediate fusion and entry in trans, and heat can act as a partial surrogate for gHgL and trigger a conformational change in gB.

PubMed

Chesnokova, Liudmila S; Ahuja, Munish K; Hutt-Fletcher, Lindsey M

2014-11-01

Epstein-Barr virus (EBV) fusion with an epithelial cell requires virus glycoproteins gHgL and gB and is triggered by an interaction between gHgL and integrin αvβ5, αvβ6, or αvβ8. Fusion with a B cell requires gHgL, gp42, and gB and is triggered by an interaction between gp42 and human leukocyte antigen class II. We report here that, like alpha- and betaherpesviruses, EBV, a gammaherpesvirus, can mediate cell fusion if gB and gHgL are expressed in trans. Entry of a gH-null virus into an epithelial cell is possible if the epithelial cell expresses gHgL, and entry of the same virus, which phenotypically lacks gHgL and gp42, into a B cell expressing gHgL is possible in the presence of a soluble integrin. Heat is capable of inducing the fusion of cells expressing only gB, and the proteolytic digestion pattern of gB in virions changes in the same way following the exposure of virus to heat or to soluble integrins. It is suggested that the Gibbs free energy released as a result of the high-affinity interaction of gHgL with an integrin contributes to the activation energy required to cause the refolding of gB from a prefusion to a postfusion conformation. The core fusion machinery of herpesviruses consists of glycoproteins gB and gHgL. We demonstrate that as in alpha- and betaherpesvirus, gB and gHgL of the gammaherpesvirus EBV can mediate fusion and entry when expressed in trans in opposing membranes, implicating interactions between the ectodomains of the proteins in the activation of fusion. We further show that heat and exposure to a soluble integrin, both of which activate fusion, result in the same changes in the proteolytic digestion pattern of gB, possibly representing the refolding of gB from its prefusion to its postfusion conformation. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

A Comparative Phase I Study of Combination, Homologous Subtype-C DNA, MVA, and Env gp140 Protein/Adjuvant HIV Vaccines in Two Immunization Regimes

PubMed Central

Joseph, Sarah; Quinn, Killian; Greenwood, Aldona; Cope, Alethea V.; McKay, Paul F.; Hayes, Peter J.; Kopycinski, Jakub T.; Gilmour, Jill; Miller, Aleisha N.; Geldmacher, Christof; Nadai, Yuka; Ahmed, Mohamed I. M.; Montefiori, David C.; Dally, Len; Bouliotis, George; Lewis, David J. M.; Tatoud, Roger; Wagner, Ralf; Esteban, Mariano; Shattock, Robin J.; McCormack, Sheena; Weber, Jonathan

2017-01-01

There remains an urgent need for a prophylactic HIV vaccine. We compared combined MVA and adjuvanted gp140 to sequential MVA/gp140 after DNA priming. We expected Env-specific CD4+ T-cells after DNA and MVA priming, and Env-binding antibodies in 100% individuals after boosting with gp140 and that combined vaccines would not compromise safety and might augment immunogenicity. Forty volunteers were primed three times with DNA plasmids encoding (CN54) env and (ZM96) gag-pol-nef at 0, 4 and 8 weeks then boosted with MVA-C (CN54 env and gag-pol-nef) and glucopyranosyl lipid adjuvant—aqueous formulation (GLA-AF) adjuvanted CN54gp140. They were randomised to receive them in combination at the same visit at 16 and 20 weeks (accelerated) or sequentially with MVA-C at 16, 20, and GLA-AF/gp140 at 24 and 28 weeks (standard). All vaccinations were intramuscular. Primary outcomes included ≥grade 3 safety events and the titer of CN54gp140-specific binding IgG. Other outcomes included neutralization, binding antibody specificity and T-cell responses. Two participants experienced asymptomatic ≥grade 3 transaminitis leading to discontinuation of vaccinations, and three had grade 3 solicited local or systemic reactions. A total of 100% made anti-CN54gp140 IgG and combining vaccines did not significantly alter the response; geometric mean titer 6424 (accelerated) and 6578 (standard); neutralization of MW965.2 Tier 1 pseudovirus was superior in the standard group (82 versus 45% responders, p = 0.04). T-cell ELISpot responses were CD4+ and Env-dominant; 85 and 82% responding in the accelerated and standard groups, respectively. Vaccine-induced IgG responses targeted multiple regions within gp120 with the V3 region most immunodominant and no differences between groups detected. Combining MVA and gp140 vaccines did not result in increased adverse events and did not significantly impact upon the titer of Env-specific binding antibodies, which were seen in 100% individuals

Broad and potent HIV-1 neutralization by a human antibody that binds the gp41-gp120 interface

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huang, Jinghe; Kang, Byong H.; Pancera, Marie

The isolation of human monoclonal antibodies is providing important insights into the specificities that underlie broad neutralization of HIV-1 (reviewed in ref. 1). Here we report a broad and extremely potent HIV-specific monoclonal antibody, termed 35O22, which binds a novel HIV-1 envelope glycoprotein (Env) epitope. 35O22 neutralized 62% of 181 pseudoviruses with a half-maximum inhibitory concentration (IC 50) <50 μg ml -1. The median IC 50 of neutralized viruses was 0.033 μg ml -1, among the most potent thus far described. 35O22 did not bind monomeric forms of Env tested, but did bind the trimeric BG505 SOSIP.664. Mutagenesis and amore » reconstruction by negative-stain electron microscopy of the Fab in complex with trimer revealed that it bound to a conserved epitope, which stretched across gp120 and gp41. The specificity of 35O22 represents a novel site of vulnerability on HIV Env, which serum analysis indicates to be commonly elicited by natural infection. Binding to this new site of vulnerability may thus be an important complement to current monoclonal-antibody-based approaches to immunotherapies, prophylaxis and vaccine design.« less

Carnauba wax nanoparticles enhance strong systemic and mucosal cellular and humoral immune responses to HIV-gp140 antigen

PubMed Central

Arias, Mauricio A.; Loxley, Andrew; Eatmon, Christy; Van Roey, Griet; Fairhurst, David; Mitchnick, Mark; Dash, Philip; Cole, Tom; Wegmann, Frank; Sattentau, Quentin; Shattock, Robin

2011-01-01

Induction of humoral responses to HIV at mucosal compartments without inflammation is important for vaccine design. We developed charged wax nanoparticles that efficiently adsorb protein antigens and are internalized by DC in the absence of inflammation. HIV-gp140-adsorbed nanoparticles induced stronger in vitro T-cell proliferation responses than antigen alone. Such responses were greatly enhanced when antigen was co-adsorbed with TLR ligands. Immunogenicity studies in mice showed that intradermal vaccination with HIV-gp140 antigen-adsorbed nanoparticles induced high levels of specific IgG. Importantly, intranasal immunization with HIV-gp140-adsorbed nanoparticles greatly enhanced serum and vaginal IgG and IgA responses. Our results show that HIV-gp140-carrying wax nanoparticles can induce strong cellular/humoral immune responses without inflammation and may be of potential use as effective mucosal adjuvants for HIV vaccine candidates. PMID:21145913

Serological responses in chimpanzees inoculated with human immunodeficiency virus glycoprotein (gp120) subunit vaccine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Arthur, L.O.; Pyle, S.W.; Nara, P.L.

1987-12-01

The major envelope glycoprotein of a human immunodeficiency virus (HIV) has been purified and was utilized as a prototype vaccine in chimpanzees. The 120,000-dalton glycoprotein (gp120) was purified from membranes of human T-lymphotropic virus (HTLV)-IIIB-infected cells and the final preparation contained low levels to no detectable HTLV-IIIB core antigen (p24) and low levels of endotoxin. Chimpanzees inoculated with gp120 responded by developing antibodies that precipitated radiolabeled gp120 and neutralized in vitro infection of HTLV-IIIB. Antibodies to HTLV-IIIB p24 were not detected in the gp120-immunized chimpanzees. Peripheral blood leukocytes from the vaccinated animals were examined for T4/sup +/ and T8/sup +/more » cells, and no decrease in the T4/T8 ratio was found, indicating that immunization with a ligand (gp120) that binds to T4 has not detectable adverse effect on the population of T4/sup +/ cells. The only current animal model that can be reproducibly infected with HIV is the chimpanzee. Immunization of chimpanzees with HIV proteins will provide an experimental system for testing the effectiveness of prototype vaccines for preventing HIV infection in vivo.« less

Patient satisfaction with out-of-hours GP cooperatives: a longitudinal study.

PubMed

Smits, Marleen; Huibers, Linda; Oude Bos, Anita; Giesen, Paul

2012-12-01

For over a decade, out-of-hours primary care in the Netherlands has been provided by general practitioner (GP) cooperatives. In the past years, quality improvements have been made and patients have become acquainted with the service. This may have increased patient satisfaction. The objective of this study was to examine changes in patient satisfaction with GP cooperatives over time. Longitudinal observational study. A validated patient satisfaction questionnaire was distributed in 2003-2004 (T1) and 2007-2008 (T2). Items were rated on a scale from 0 to 10 (1 = very bad; 10 = excellent). Eight GP cooperatives in the Netherlands. Stratified sample of 9600 patients. Response was 55% at T1 (n = 2634) and 51% at T2 (n = 2462). Expectations met; satisfaction with triage nurses, GPs, and organization. For most patients the care received at the GP cooperative met their expectations (T1: 86.1% and T2: 88.4%). Patients were satisfied with the triage nurses (overall grade T1: 7.73 and T2: 7.99), GPs (T1: 8.04 and T2: 8.25), and organization (overall grade T1: 7.60 and T2: 7.78). Satisfaction with triage nurses showed the largest increase over time. The quality and effectiveness of advice or treatment were given relatively low grades. Of all organizational aspects, the lowest grades were given for waiting times and information about the cooperative. In general, patients were initially satisfied with GP cooperatives and satisfaction had even increased four years later. However, there is room for improvement in the content of the advice, waiting times, and information supply. More research is needed into satisfaction of specific patient groups.

Structure of a Complex Phosphoglycan Epitope from gp72 of Trypanosoma cruzi *

PubMed Central

Allen, Simon; Richardson, Julia M.; Mehlert, Angela; Ferguson, Michael A. J.

2013-01-01

The parasitic protozoan organism Trypanosoma cruzi is the causative agent of Chagas disease. The insect vector-dwelling epimastigote form of the organism expresses a low abundance glycoprotein associated with the flagellum adhesion zone, called gp72. The gp72 glycoprotein was first identified with an anti-carbohydrate IgG3 monoclonal antibody called WIC29.26 and has been shown to have an unusual sugar composition. Here, we describe a new way to isolate the WIC29.26 carbohydrate epitope of gp72. Using 1H NMR and mass spectrometry before and after derivatization, we provide an almost complete primary chemical structure for the epitope, which is that of a complex phosphosaccharide: Galfβ1–4Rhapα1–2Fucpα1-4(Galpβ1–3)(Galpα1–2)Xylpβ1–4Xylpβ1–3(Xylpβ1–2Galpα1-4(Galpβ1–3)(Rhapα1–2)Fucpα1–4)GlcNAcp, with phosphate attached to one or other of the two Galp terminal residues and in which all residues are of the d-absolute configuration, except for fucose and rhamnose which are l. Combined with previous data (Haynes, P. A., Ferguson, M. A., and Cross, G. A. (1996) Glycobiology 6, 869–878), we postulate that this complex structure and its variants lacking one or more residues are linked to Thr and Ser residues in gp72 via a phosphodiester linkage (GlcNAcpα1-P-Thr/Ser) and that these units may form phosphosaccharide repeats through GlcNAcpα1-P-Galp linkages. The gp72 glycoprotein is associated with the flagellum adhesion zone on the parasite surface, and its ligation has been implicated in inhibiting parasite differentiation from the epimastigote to the metacyclic trypomastigote stage. The detailed structure of the unique phosphosaccharide component of gp72 reported here provides a template for future biosynthetic and functional studies. PMID:23436655

Optional part-time and longer GP training modules in GP practices associated with more trainees becoming GPs - a cohort study in Switzerland.

PubMed

Studerus, Lara; Ahrens, Regina; Häuptle, Christian; Goeldlin, Adrian; Streit, Sven

2018-01-05

Switzerland, like many other countries, has a shortage of General Practitioners (GPs). Optional GP training modules in GP practices were offered during the at least 5-year GP training program to increase student and trainee interest in becoming a GP. The training modules had not yet been evaluated. We determined how many Swiss GP trainees became practicing GPs after they completed optional training modules, and if longer modules were associated with higher rates of GP specialization. In this population-based cohort study, we included GP trainees who chose an optional GP training module in GP practice, provided by the Foundation to Promote Training in General Practice (WHM) between 2006 and 2015. GP trainees were invited to complete an online survey to assess the primary outcome (becoming a practicing GP by 2016). Data on non-responders was collected via an internet search. We calculated univariate time-to-event curves to become a practicing GP, stratified by trainee's gender, length, part-time training, and number of years after graduation until training modules were completed. We used a multivariate model to adjust for characteristics of participants, training, and satisfaction with training modules. We assessed primary outcome for 351 (92.1%) of 381 former GP trainees who participated in a WHM program between 2006 and 2015. Of these 218 (57%) were practicing GPs by 2016. When focusing on the trainees who had completed training between 2006 and 2010, the rate of practicing GPs was even 73%. Longer (p = 0.018) and part-time training modules (p = 0.003) were associated with higher rates of being a practicing GP. Most (81%) practicing GPs thought their optional GP training module was (very) important in their choice of specialty. GP trainees who spent more time training in a GP practice, or who trained part-time were more likely to become practicing GPs. Most (80%) rated their training module as (very) important in their choice of career, highlighting that

Humanin G (HNG) protects age-related macular degeneration (AMD) transmitochondrial ARPE-19 cybrids from mitochondrial and cellular damage.

PubMed

Nashine, Sonali; Cohen, Pinchas; Chwa, Marilyn; Lu, Stephanie; Nesburn, Anthony B; Kuppermann, Baruch D; Kenney, M Cristina

2017-07-20

Age-related macular degeneration (AMD) ranks third among the leading causes of visual impairment with a blindness prevalence rate of 8.7%. Despite several treatment regimens, such as anti-angiogenic drugs, laser therapy, and vitamin supplementation, being available for wet AMD, to date there are no FDA-approved therapies for dry AMD. Substantial evidence implicates mitochondrial damage and retinal pigment epithelium (RPE) cell death in the pathogenesis of AMD. However, the effects of AMD mitochondria and Humanin G (HNG), a more potent variant of the mitochondrial-derived peptide (MDP) Humanin, on retinal cell survival have not been elucidated. In this study, we characterized mitochondrial and cellular damage in transmitochondrial cybrid cell lines that contain identical nuclei but possess mitochondria from either AMD or age-matched normal (Older-normal (NL)) subjects. AMD cybrids showed (1) reduced levels of cell viability, lower mtDNA copy numbers, and downregulation of mitochondrial replication/transcription genes and antioxidant enzyme genes; and (2) elevated levels of genes related to apoptosis, autophagy and ER-stress along with increased mtDNA fragmentation and higher susceptibility to amyloid-β-induced toxicity compared to NL cybrids. In AMD cybrids, HNG protected the AMD mitochondria, reduced pro-apoptosis gene and protein levels, upregulated gp130 (a component of the HN receptor complex), and increased the protection against amyloid-β-induced damage. In summary, in cybrids, damaged AMD mitochondria mediate cell death that can be reversed by HNG treatment. Our results also provide evidence of Humanin playing a pivotal role in protecting cells with AMD mitochondria. In the future, it may be possible that AMD patient's blood samples containing damaged mitochondria may be useful as biomarkers for this condition. In conclusion, HNG may be a potential therapeutic target for treatment of dry AMD, a debilitating eye disease that currently has no available

Protecting the Library and Its Resources. A Guide to Physical Protection and Insurance.

ERIC Educational Resources Information Center

Johnson, Edward M., Ed.

The first part of this manual contains information about providing physical protection for libraries and is organized into the following chapters--(1) types of physical losses, (2) the prevention of losses, (3) fire defense measures, (4) fire protection equipment, and (5) fire protection in library planning. The second part is concerned with…

32 CFR 228.12 - Physical protection of facilities.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 32 National Defense 2 2010-07-01 2010-07-01 false Physical protection of facilities. 228.12 Section 228.12 National Defense Department of Defense (Continued) OFFICE OF THE SECRETARY OF DEFENSE (CONTINUED) MISCELLANEOUS SECURITY PROTECTIVE FORCE § 228.12 Physical protection of facilities. The willful...

32 CFR 228.12 - Physical protection of facilities.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 32 National Defense 2 2014-07-01 2014-07-01 false Physical protection of facilities. 228.12 Section 228.12 National Defense Department of Defense (Continued) OFFICE OF THE SECRETARY OF DEFENSE (CONTINUED) MISCELLANEOUS SECURITY PROTECTIVE FORCE § 228.12 Physical protection of facilities. The willful...

32 CFR 228.12 - Physical protection of facilities.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 32 National Defense 2 2011-07-01 2011-07-01 false Physical protection of facilities. 228.12 Section 228.12 National Defense Department of Defense (Continued) OFFICE OF THE SECRETARY OF DEFENSE (CONTINUED) MISCELLANEOUS SECURITY PROTECTIVE FORCE § 228.12 Physical protection of facilities. The willful...

32 CFR 228.12 - Physical protection of facilities.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 32 National Defense 2 2013-07-01 2013-07-01 false Physical protection of facilities. 228.12 Section 228.12 National Defense Department of Defense (Continued) OFFICE OF THE SECRETARY OF DEFENSE (CONTINUED) MISCELLANEOUS SECURITY PROTECTIVE FORCE § 228.12 Physical protection of facilities. The willful...

32 CFR 228.12 - Physical protection of facilities.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 32 National Defense 2 2012-07-01 2012-07-01 false Physical protection of facilities. 228.12 Section 228.12 National Defense Department of Defense (Continued) OFFICE OF THE SECRETARY OF DEFENSE (CONTINUED) MISCELLANEOUS SECURITY PROTECTIVE FORCE § 228.12 Physical protection of facilities. The willful...

Phylogenetic analysis of G1P[8] and G12P[8] rotavirus A samples obtained in the pre- and post-vaccine periods, and molecular modeling of VP4 and VP7 proteins.

PubMed

Almeida, Tâmera Nunes Vieira; de Sousa, Teresinha Teixeira; da Silva, Roosevelt Alves; Fiaccadori, Fabíola Souza; Souza, Menira; Badr, Kareem Rady; de Paula Cardoso, Divina das Dôres

2017-09-01

Reduction in morbimortality rates for acute gastroenteritis (AGE) by Rotavirus A (RVA) has been observed after the introduction of vaccines, however the agent continues to circulate. The present study described the genomic characterization of the 11 dsRNA segments of two RVA samples G1P[8] obtained in the pre- and post-vaccination periods and one of G12P[8] sample (post-vaccine), compared to Rotarix™ vaccine. Analysis by molecular sequencing of the samples showed that the three samples belonged to genogroup I. In addition, the analysis of VP7 gene revealed that the samples G1 (pre-vaccine), G1 (post-vaccine) and G12 were characterized as lineages II, I and III, respectively. Regarding to VP4 and NSP4 gene it was observed that all samples belonged to lineage III, whereas for VP6 gene, the sample of the pre- and post-vaccine belonged to the lineage IV and I, respectively. Considering the VP7 gene, it was observed high nucleotide and amino acid identity for the two G1 samples when compared to Rotarix™ vaccine and lesser identity for the G12 sample. In relation to antigenic epitope of VP7 greater modifications were observed for the G12 sample in the 7-2 epitope that was confirmed by molecular modeling. On the other hand, for VP4, some changes in the 8-1 and 8-3 antigenic epitopes was observed for the three samples. This data could be interpreted as a low selective pressure exerted by vaccination in relation to G1P[8] samples and lesser protection in relation to G12P[8]. Thus, the continuous monitoring of RVA circulating samples remains important. Copyright © 2017 Elsevier B.V. All rights reserved.

Carnauba wax nanoparticles enhance strong systemic and mucosal cellular and humoral immune responses to HIV-gp140 antigen.

PubMed

Arias, Mauricio A; Loxley, Andrew; Eatmon, Christy; Van Roey, Griet; Fairhurst, David; Mitchnick, Mark; Dash, Philip; Cole, Tom; Wegmann, Frank; Sattentau, Quentin; Shattock, Robin

2011-02-01

Induction of humoral responses to HIV at mucosal compartments without inflammation is important for vaccine design. We developed charged wax nanoparticles that efficiently adsorb protein antigens and are internalized by DC in the absence of inflammation. HIV-gp140-adsorbed nanoparticles induced stronger in vitro T-cell proliferation responses than antigen alone. Such responses were greatly enhanced when antigen was co-adsorbed with TLR ligands. Immunogenicity studies in mice showed that intradermal vaccination with HIV-gp140 antigen-adsorbed nanoparticles induced high levels of specific IgG. Importantly, intranasal immunization with HIV-gp140-adsorbed nanoparticles greatly enhanced serum and vaginal IgG and IgA responses. Our results show that HIV-gp140-carrying wax nanoparticles can induce strong cellular/humoral immune responses without inflammation and may be of potential use as effective mucosal adjuvants for HIV vaccine candidates. Copyright © 2010 Elsevier Ltd. All rights reserved.

45 CFR 707.8 - Physical access.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 45 Public Welfare 3 2012-10-01 2012-10-01 false Physical access. 707.8 Section 707.8 Public... § 707.8 Physical access. (a) Discrimination prohibited. Except as otherwise provided in this section, no... shall be made available for public inspection. The plan shall, at a minimum— (i) Identify physical...

45 CFR 707.8 - Physical access.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 45 Public Welfare 3 2014-10-01 2014-10-01 false Physical access. 707.8 Section 707.8 Public... § 707.8 Physical access. (a) Discrimination prohibited. Except as otherwise provided in this section, no... shall be made available for public inspection. The plan shall, at a minimum— (i) Identify physical...

45 CFR 707.8 - Physical access.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 45 Public Welfare 3 2010-10-01 2010-10-01 false Physical access. 707.8 Section 707.8 Public... § 707.8 Physical access. (a) Discrimination prohibited. Except as otherwise provided in this section, no... shall be made available for public inspection. The plan shall, at a minimum— (i) Identify physical...

45 CFR 707.8 - Physical access.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 45 Public Welfare 3 2013-10-01 2013-10-01 false Physical access. 707.8 Section 707.8 Public... § 707.8 Physical access. (a) Discrimination prohibited. Except as otherwise provided in this section, no... shall be made available for public inspection. The plan shall, at a minimum— (i) Identify physical...

45 CFR 707.8 - Physical access.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 45 Public Welfare 3 2011-10-01 2011-10-01 false Physical access. 707.8 Section 707.8 Public... § 707.8 Physical access. (a) Discrimination prohibited. Except as otherwise provided in this section, no... shall be made available for public inspection. The plan shall, at a minimum— (i) Identify physical...

The Genital Tract Virulence Factor pGP3 Is Essential for Chlamydia muridarum Colonization in the Gastrointestinal Tract.

PubMed

Shao, Lili; Zhang, Tianyuan; Melero, Jose; Huang, Yumeng; Liu, Yuanjun; Liu, Quanzhong; He, Cheng; Nelson, David E; Zhong, Guangming

2018-01-01

The cryptic plasmid is essential for Chlamydia muridarum dissemination from the genital tract to the gastrointestinal (GI) tract. Following intravaginal inoculation, a C. muridarum strain deficient in plasmid-encoded pGP3 or pGP4 but not pGP5, pGP7, or pGP8 failed to spread to the mouse gastrointestinal tract, although mice infected with these strains developed productive genital tract infections. pGP3- or pGP4-deficient strains also failed to colonize the gastrointestinal tract when delivered intragastrically. pGP4 regulates pGP3, while pGP3 does not affect pGP4 expression, indicating that pGP3 is critical for C. muridarum colonization of the gastrointestinal tract. Mutants deficient in GlgA, a chromosome-encoded protein regulated by pGP4, also consistently colonized the mouse gastrointestinal tract. Interestingly, C. muridarum colonization of the gastrointestinal tract positively correlated with pathogenicity in the upper genital tract. pGP3-deficient C. muridarum strains did not induce hydrosalpinx or spread to the GI tract even when delivered to the oviduct by intrabursal inoculation. Thus, the current study not only has revealed that pGP3 is a novel chlamydial colonization factor in the gastrointestinal tract but also has laid a foundation for investigating the significance of gastrointestinal Chlamydia . Copyright © 2017 American Society for Microbiology.

Biosynthesis and processing of the Autographa californica nuclear polyhedrosis virus gp64 protein.

PubMed

Jarvis, D L; Garcia, A

1994-11-15

gp64 is a major virion envelope glycoprotein of the baculovirus Autographa californica multicapsid nuclear polyhedrosis virus (AcMNPV). gp64 plays an important role in AcMNPV infection, probably mediating penetration of one form of the virus into host cells through the endocytic pathway. gp64 also represents an excellent probe for studying the membrane glycoprotein processing capabilities of baculovirus-infected insect cells, which are used widely as a eucaryotic expression system. The goals of this study were to characterize gp64 biosynthesis and processing and determine how N-glycosylation and N-linked oligosaccharide processing influence the fate and function of gp64 in AcMNPV-infected insect cells. We found that gp64 was synthesized in a biphasic fashion, with peaks at 8 and 24 hr postinfection in both the intracellular and extracellular fractions. Interestingly, the first peak preceded detectable budded virus (BV) production, suggesting that gp64 is shed from infected cells early in infection. Transcriptional regulation accounted for the biphasic mode of gp64 protein synthesis, as transcription initiated at a consensus early motif during early times of infection, at a late motif during late times of infection, and there was a lag between the peak of early and the onset of late transcription. In vitro transcription-translation assays showed that the second ATG in the AcMNPV gp64 long open reading frame is used as the translational initiation codon and that downstream sequences encode a functional signal peptide. Pulse-chase analyses, endoglycosidases, and various inhibitors were used to show that some N-linked oligosaccharides on gp64 are processed by glucosidases and alpha-mannosidases in AcMNPV-infected insect cells. These experiments also revealed that at least two differentially processed gp64 glycoforms are produced in these cells and that both can reach the cell surface and assemble into progeny BV. However, N-linked oligosaccharide processing was not

Echinococcus canadensis (Cestoda: Taeniidae) is a valid species consisting of the mitochondrial genotypes G6, G7, G8 and G10

USDA-ARS?s Scientific Manuscript database

The species status of Echinococcus canadensis has long been controversial, mainly because it consists of the mitochondrial genotypes G6, G7, G8 and G10 with different host affinity: G6 (camel strain) and G7 (pig strain) with domestic cycles and G8 (cervid strain) and G10 (Fennoscandian cervid strain...

Neuron-derived IgG protects neurons from complement-dependent cytotoxicity.

PubMed

Zhang, Jie; Niu, Na; Li, Bingjie; McNutt, Michael A

2013-12-01

Passive immunity of the nervous system has traditionally been thought to be predominantly due to the blood-brain barrier. This concept must now be revisited based on the existence of neuron-derived IgG. The conventional concept is that IgG is produced solely by mature B lymphocytes, but it has now been found to be synthesized by murine and human neurons. However, the function of this endogenous IgG is poorly understood. In this study, we confirm IgG production by rat cortical neurons at the protein and mRNA levels, with 69.0 ± 5.8% of cortical neurons IgG-positive. Injury to primary-culture neurons was induced by complement leading to increases in IgG production. Blockage of neuron-derived IgG resulted in more neuronal death and early apoptosis in the presence of complement. In addition, FcγRI was found in microglia and astrocytes. Expression of FcγR I in microglia was increased by exposure to neuron-derived IgG. Release of NO from microglia triggered by complement was attenuated by neuron-derived IgG, and this attenuation could be reversed by IgG neutralization. These data demonstrate that neuron-derived IgG is protective of neurons against injury induced by complement and microglial activation. IgG appears to play an important role in maintaining the stability of the nervous system.

Patient satisfaction with out-of-hours GP cooperatives: A longitudinal study

PubMed Central

Smits, Marleen; Huibers, Linda; Oude Bos, Anita; Giesen, Paul

2012-01-01

Objective For over a decade, out-of-hours primary care in the Netherlands has been provided by general practitioner (GP) cooperatives. In the past years, quality improvements have been made and patients have become acquainted with the service. This may have increased patient satisfaction. The objective of this study was to examine changes in patient satisfaction with GP cooperatives over time. Design Longitudinal observational study. A validated patient satisfaction questionnaire was distributed in 2003–2004 (T1) and 2007–2008 (T2). Items were rated on a scale from 0 to 10 (1 = very bad; 10 = excellent). Setting Eight GP cooperatives in the Netherlands. Subjects Stratified sample of 9600 patients. Response was 55% at T1 (n = 2634) and 51% at T2 (n = 2462). Main outcome measures Expectations met; satisfaction with triage nurses, GPs, and organization. Results For most patients the care received at the GP cooperative met their expectations (T1: 86.1% and T2: 88.4%). Patients were satisfied with the triage nurses (overall grade T1: 7.73 and T2: 7.99), GPs (T1: 8.04 and T2: 8.25), and organization (overall grade T1: 7.60 and T2: 7.78). Satisfaction with triage nurses showed the largest increase over time. The quality and effectiveness of advice or treatment were given relatively low grades. Of all organizational aspects, the lowest grades were given for waiting times and information about the cooperative. Conclusion In general, patients were initially satisfied with GP cooperatives and satisfaction had even increased four years later. However, there is room for improvement in the content of the advice, waiting times, and information supply. More research is needed into satisfaction of specific patient groups. PMID:23113756

Vaccination With a Highly Attenuated Recombinant Vesicular Stomatitis Virus Vector Protects Against Challenge With a Lethal Dose of Ebola Virus

PubMed Central

Matassov, Demetrius; Marzi, Andrea; Latham, Terri; Xu, Rong; Ota-Setlik, Ayuko; Feldmann, Friederike; Geisbert, Joan B.; Mire, Chad E.; Hamm, Stefan; Nowak, Becky; Egan, Michael A.; Geisbert, Thomas W.; Eldridge, John H.; Feldmann, Heinz; Clarke, David K.

2015-01-01

Previously, recombinant vesicular stomatitis virus (rVSV) pseudotypes expressing Ebolavirus glycoproteins (GPs) in place of the VSV G protein demonstrated protection of nonhuman primates from lethal homologous Ebolavirus challenge. Those pseudotype vectors contained no additional attenuating mutations in the rVSV genome. Here we describe rVSV vectors containing a full complement of VSV genes and expressing the Ebola virus (EBOV) GP from an additional transcription unit. These rVSV vectors contain the same combination of attenuating mutations used previously in the clinical development pathway of an rVSV/human immunodeficiency virus type 1 vaccine. One of these rVSV vectors (N4CT1-EBOVGP1), which expresses membrane-anchored EBOV GP from the first position in the genome (GP1), elicited a balanced cellular and humoral GP-specific immune response in mice. Guinea pigs immunized with a single dose of this vector were protected from any signs of disease following lethal EBOV challenge, while control animals died in 7–9 days. Subsequently, N4CT1-EBOVGP1 demonstrated complete, single-dose protection of 2 macaques following lethal EBOV challenge. A single sham-vaccinated macaque died from disease due to EBOV infection. These results demonstrate that highly attenuated rVSV vectors expressing EBOV GP may provide safer alternatives to current EBOV vaccines. PMID:26109675

30 CFR 19.8 - Protection against bodily hazard.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Protection against bodily hazard. 19.8 Section 19.8 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR TESTING, EVALUATION, AND APPROVAL OF MINING PRODUCTS ELECTRIC CAP LAMPS § 19.8 Protection against bodily hazard. This...

HIV-specific antibodies but not t-cell responses are associated with protection in seronegative partners of HIV-1-infected individuals in Cambodia.

PubMed

Nguyen, Marie; Pean, Polidy; Lopalco, Lucia; Nouhin, Janin; Phoung, Viseth; Ly, Nary; Vermisse, Pierre; Henin, Yvette; Barré-Sinoussi, Françoise; Burastero, Samuele E; Reynes, Jean-Marc; Carcelain, Guislaine; Pancino, Gianfranco

2006-08-01

To study biological factors related to protection against HIV-1 infection in Cambodia, we recruited 48 partners of HIV-1-infected patients who remained uninfected (exposed uninfected individuals, EUs) despite unprotected sexual intercourse for more than 1 year and 49 unexposed controls (UCs). HIV-1-specific antibodies (IgA anti-gp41 and IgG anti-CD4-gp120 complex), T-cell responses, and cellular factors that may be involved in protection (peripheral blood mononuclear cell [PBMC] resistance to HIV-1 infection and beta-chemokine production) were evaluated. Anti-HIV-1 antibodies were higher in EUs than those in UCs (P = 0.01 and P = 0.04 for anti-gp41 and anti-CD4-gp120, respectively). We observed a decreased susceptibility to a primary Cambodian isolate, HIV-1KH019, in EU PBMCs as compared with UC PBMCs (P = 0.03). A weak T-cell response to one pool of HIV-1 Gag peptides was found by ELISpot in 1 of 19 EUs. Whereas T-cell specific immunity was not associated to protection, our results suggest that HIV-specific humoral immunity and reduced cell susceptibility to infection may contribute to protection against HIV-1 infection in Cambodian EUs.

The G protein alpha subunit (GP alpha1) is associated with the ER and the plasma membrane in meristematic cells of Arabidopsis and cauliflower.

PubMed

Weiss, C A; White, E; Huang, H; Ma, H

1997-05-05

Towards the elucidation of the cellular function(s) of GP alpha1, we have characterized its subcellular localization using immunofluorescence and cell fractionation. GP alpha1 is not present in nuclei or chloroplasts. It is a membrane-bound protein, and analysis of isolated endoplasmic and plasma membranes indicates a good correlation between GP alpha1 in both the plasma membrane and the ER compartment. Interestingly, these results may suggest more different functions for GP alpha1: it might be involved in transmission of extracellular signals across the plasma membrane and in the cytoplasm, and/or it may also be involved in regulating some aspects of the ER functions or membrane trafficking between both membranes.

Identification and Characterization of a Broadly Cross-Reactive HIV-1 Human Monoclonal Antibody That Binds to Both gp120 and gp41

PubMed Central

Zhang, Mei-Yun; Yuan, Tingting; Li, Jingjing; Rosa Borges, Andrew; Watkins, Jennifer D.; Guenaga, Javier; Yang, Zheng; Wang, Yanping; Wilson, Richard; Li, Yuxing; Polonis, Victoria R.; Pincus, Seth H.; Ruprecht, Ruth M.; Dimitrov, Dimiter S.

2012-01-01

Identification of broadly cross-reactive HIV-1-neutralizing antibodies (bnAbs) may assist vaccine immunogen design. Here we report a novel human monoclonal antibody (mAb), designated m43, which co-targets the gp120 and gp41 subunits of the HIV-1 envelope glycoprotein (Env). M43 bound to recombinant gp140 s from various primary isolates, to membrane-associated Envs on transfected cells and HIV-1 infected cells, as well as to recombinant gp120 s and gp41 fusion intermediate structures containing N-trimer structure, but did not bind to denatured recombinant gp140 s and the CD4 binding site (CD4bs) mutant, gp120 D368R, suggesting that the m43 epitope is conformational and overlaps the CD4bs on gp120 and the N-trimer structure on gp41. M43 neutralized 34% of the HIV-1 primary isolates from different clades and all the SHIVs tested in assays based on infection of peripheral blood mononuclear cells (PBMCs) by replication-competent virus, but was less potent in cell line-based pseudovirus assays. In contrast to CD4, m43 did not induce Env conformational changes upon binding leading to exposure of the coreceptor binding site, enhanced binding of mAbs 2F5 and 4E10 specific for the membrane proximal external region (MPER) of gp41 Envs, or increased gp120 shedding. The overall modest neutralization activity of m43 is likely due to the limited binding of m43 to functional Envs which could be increased by antibody engineering if needed. M43 may represent a new class of bnAbs targeting conformational epitopes overlapping structures on both gp120 and gp41. Its novel epitope and possibly new mechanism(s) of neutralization could helpdesign improved vaccine immunogens and candidate therapeutics. PMID:22970187

Ebola GP-specific monoclonal antibodies protect mice and guinea pigs from lethal Ebola virus infection.

PubMed

Qiu, Xiangguo; Fernando, Lisa; Melito, P Leno; Audet, Jonathan; Feldmann, Heinz; Kobinger, Gary; Alimonti, Judie B; Jones, Steven M

2012-01-01

Ebola virus (EBOV) causes acute hemorrhagic fever in humans and non-human primates with mortality rates up to 90%. So far there are no effective treatments available. This study evaluates the protective efficacy of 8 monoclonal antibodies (MAbs) against Ebola glycoprotein in mice and guinea pigs. Immunocompetent mice or guinea pigs were given MAbs i.p. in various doses individually or as pools of 3-4 MAbs to test their protection against a lethal challenge with mouse- or guinea pig-adapted EBOV. Each of the 8 MAbs (100 µg) protected mice from a lethal EBOV challenge when administered 1 day before or after challenge. Seven MAbs were effective 2 days post-infection (dpi), with 1 MAb demonstrating partial protection 3 dpi. In the guinea pigs each MAb showed partial protection at 1 dpi, however the mean time to death was significantly prolonged compared to the control group. Moreover, treatment with pools of 3-4 MAbs completely protected the majority of animals, while administration at 2-3 dpi achieved 50-100% protection. This data suggests that the MAbs generated are capable of protecting both animal species against lethal Ebola virus challenge. These results indicate that MAbs particularly when used as an oligoclonal set are a potential therapeutic for post-exposure treatment of EBOV infection.

8 CFR 207.8 - Physical presence in the United States.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 8 Aliens and Nationality 1 2012-01-01 2012-01-01 false Physical presence in the United States. 207... ADMISSION OF REFUGEES § 207.8 Physical presence in the United States. For the purpose of adjustment of status under section 209(a)(1) of the Act, the required one year physical presence of the applicant in...

8 CFR 207.8 - Physical presence in the United States.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 8 Aliens and Nationality 1 2014-01-01 2014-01-01 false Physical presence in the United States. 207... ADMISSION OF REFUGEES § 207.8 Physical presence in the United States. For the purpose of adjustment of status under section 209(a)(1) of the Act, the required one year physical presence of the applicant in...

18 CFR 1316.8 - Employee protected activities.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 18 Conservation of Power and Water Resources 2 2014-04-01 2014-04-01 false Employee protected... Conditions and Certifications § 1316.8 Employee protected activities. When so indicated in TVA contract... Protected Activities (Applicable to contracts for goods or services delivered to nuclear facilities or...

18 CFR 1316.8 - Employee protected activities.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Employee protected... Conditions and Certifications § 1316.8 Employee protected activities. When so indicated in TVA contract... Protected Activities (Applicable to contracts for goods or services delivered to nuclear facilities or...

18 CFR 1316.8 - Employee protected activities.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 18 Conservation of Power and Water Resources 2 2013-04-01 2012-04-01 true Employee protected... Conditions and Certifications § 1316.8 Employee protected activities. When so indicated in TVA contract... Protected Activities (Applicable to contracts for goods or services delivered to nuclear facilities or...

18 CFR 1316.8 - Employee protected activities.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 18 Conservation of Power and Water Resources 2 2012-04-01 2012-04-01 false Employee protected... Conditions and Certifications § 1316.8 Employee protected activities. When so indicated in TVA contract... Protected Activities (Applicable to contracts for goods or services delivered to nuclear facilities or...

18 CFR 1316.8 - Employee protected activities.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 18 Conservation of Power and Water Resources 2 2011-04-01 2011-04-01 false Employee protected... Conditions and Certifications § 1316.8 Employee protected activities. When so indicated in TVA contract... Protected Activities (Applicable to contracts for goods or services delivered to nuclear facilities or...

Structure of the Bacteriophage [phi]KZ Lytic Transglycosylase gp144

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fokine, Andrei; Miroshnikov, Konstantin A.; Shneider, Mikhail M.

2008-04-02

Lytic transglycosylases are enzymes that act on the peptidoglycan of bacterial cell walls. They cleave the glycosidic linkage between N-acetylmuramoyl and N-acetylglucosaminyl residues with the concomitant formation of a 1,6-anhydromuramoyl product. The x-ray structure of the lytic transglycosylase gp144 from the Pseudomonas bacteriophage {phi}KZ has been determined to 2.5-{angstrom} resolution. This protein is probably employed by the bacteriophage in the late stage of the virus reproduction cycle to destroy the bacterial cell wall to release the phage progeny. {phi}KZ gp144 is a 260-residue {alpha}-helical protein composed of a 70-residue N-terminal cell wall-binding domain and a C-terminal catalytic domain. The foldmore » of the N-terminal domain is similar to the peptidoglycan-binding domain from Streptomyces albus G d-Ala-d-Ala carboxypeptidase and to the N-terminal prodomain of human metalloproteinases that act on extracellular matrices. The C-terminal catalytic domain of gp144 has a structural similarity to the catalytic domain of the transglycosylase Slt70 from Escherichia coli and to lysozymes. The gp144 catalytic domain has an elongated groove that can bind at least five sugar residues at sites A-E. As in other lysozymes, the peptidoglycan cleavage (catalyzed by Glu{sup 115} in gp144) occurs between sugar-binding subsites D and E. The x-ray structure of the {phi}KZ transglycosylase complexed with the chitotetraose (N-acetylglucosamine){sub 4} has been determined to 2.6-{angstrom} resolution. The N-acetylglucosamine residues of the chitotetraose bind in sites A-D.« less

10 CFR 73.40 - Physical protection: General requirements at fixed sites.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 10 Energy 2 2011-01-01 2011-01-01 false Physical protection: General requirements at fixed sites. 73.40 Section 73.40 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) PHYSICAL PROTECTION OF PLANTS AND MATERIALS Physical Protection Requirements at Fixed Sites § 73.40 Physical protection: General...

10 CFR 73.40 - Physical protection: General requirements at fixed sites.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 10 Energy 2 2010-01-01 2010-01-01 false Physical protection: General requirements at fixed sites. 73.40 Section 73.40 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) PHYSICAL PROTECTION OF PLANTS AND MATERIALS Physical Protection Requirements at Fixed Sites § 73.40 Physical protection: General...

10 CFR 73.40 - Physical protection: General requirements at fixed sites.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 10 Energy 2 2013-01-01 2013-01-01 false Physical protection: General requirements at fixed sites. 73.40 Section 73.40 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) PHYSICAL PROTECTION OF PLANTS AND MATERIALS Physical Protection Requirements at Fixed Sites § 73.40 Physical protection: General...

10 CFR 73.40 - Physical protection: General requirements at fixed sites.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 10 Energy 2 2014-01-01 2014-01-01 false Physical protection: General requirements at fixed sites. 73.40 Section 73.40 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) PHYSICAL PROTECTION OF PLANTS AND MATERIALS Physical Protection Requirements at Fixed Sites § 73.40 Physical protection: General...

Comparative Glycoprofiling of HIV gp120 Immunogens by Capillary Electrophoresis and MALDI Mass Spectrometry

PubMed Central

Guttman, Miklós; Váradi, Csaba; Lee, Kelly K.; Guttman, András

2015-01-01

The Human Immunodeficiency Virus (HIV) envelope glycoprotein (Env) is the primary antigenic feature on the surface of the virus and is of key importance in HIV vaccinology. Vaccine trials with the gp120 subunit of Env are ongoing with the recent RV144 trial showing moderate efficacy. gp120 is densely covered with N-linked glycans that are thought to help evade the host's humoral immune response. To assess how the global glycosylation patterns vary between gp120 constructs, the glycan profiles of several gp120s were examined by capillary electrophoresis with laser induced fluorescence detection and MALDI-MS. The glycosylation profiles were found to be similar for chronic vs. transmitter/founder isolates and only varied moderately between gp120s from different clades. This study revealed that the addition of specific tags, such as the gD tag used in the RV144 trial, had significant effects on the overall glycosylation patterns. Such effects are likely to influence the immunogenicity of various Env immunogens and should be considered for future vaccine strategies, emphasizing the importance of the glycosylation analysis approach described in this paper. PMID:25809283

Development of classification models for identifying "true" P-glycoprotein (P-gp) inhibitors through inhibition, ATPase activation and monolayer efflux assays.

PubMed

Rapposelli, Simona; Coi, Alessio; Imbriani, Marcello; Bianucci, Anna Maria

2012-01-01

P-glycoprotein (P-gp) is an efflux pump involved in the protection of tissues of several organs by influencing xenobiotic disposition. P-gp plays a key role in multidrug resistance and in the progression of many neurodegenerative diseases. The development of new and more effective therapeutics targeting P-gp thus represents an intriguing challenge in drug discovery. P-gp inhibition may be considered as a valid approach to improve drug bioavailability as well as to overcome drug resistance to many kinds of tumours characterized by the over-expression of this protein. This study aims to develop classification models from a unique dataset of 59 compounds for which there were homogeneous experimental data on P-gp inhibition, ATPase activation and monolayer efflux. For each experiment, the dataset was split into a training and a test set comprising 39 and 20 molecules, respectively. Rational splitting was accomplished using a sphere-exclusion type algorithm. After a two-step (internal/external) validation, the best-performing classification models were used in a consensus predicting task for the identification of compounds named as "true" P-gp inhibitors, i.e., molecules able to inhibit P-gp without being effluxed by P-gp itself and simultaneously unable to activate the ATPase function.

The Influence of 8 Weeks of Whey-Protein and Leucine Supplementation on Physical and Cognitive Performance

DTIC Science & Technology

2010-01-01

Influence of 8 Weeks of Whey Protein and Leucine Supplementation on Physical and Cognitive Performance 5a. GONTRAGT NUMBER FA8650-04-D-6472 5b. GRANT NUMBER...investigate the ability of whey -protein and leucine supplementation to enhance physical and cognitive performance and body composition. Thirty moderately fit...composition before and after supplementing their daily diet for 8 wk with either 19.7 g of whey protein and 6.2 g leucine (WPL) or a calorie-equivalent placebo

Inhibition of EBV-mediated membrane fusion by anti-gHgL antibodies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sathiyamoorthy, Karthik; Jiang, Jiansen; Mohl, Britta S.

Herpesvirus entry into cells requires the coordinated action of multiple virus envelope glycoproteins, including gH, gL, and gB. For EBV, the gp42 protein assembles into complexes with gHgL heterodimers and binds HLA class II to activate gB-mediated membrane fusion with B cells. EBV tropism is dictated by gp42 levels in the virion, as it inhibits entry into epithelial cells while promoting entry into B cells. The gHgL and gB proteins are targets of neutralizing antibodies and potential candidates for subunit vaccine development, but our understanding of their neutralizing epitopes and the mechanisms of inhibition remain relatively unexplored. Here we studiedmore » the structures and mechanisms of two anti-gHgL antibodies, CL40 and CL59, that block membrane fusion with both B cells and epithelial cells. We determined the structures of the CL40 and CL59 complexes with gHgL using X-ray crystallography and EM to identify their epitope locations. CL59 binds to the C-terminal domain IV of gH, while CL40 binds to a site occupied by the gp42 receptor binding domain. CL40 binding to gHgL/gp42 complexes is not blocked by gp42 and does not interfere with gp42 binding to HLA class II, indicating that its ability to block membrane fusion with B cells represents a defect in gB activation. Furthermore, these data indicate that anti-gHgL neutralizing antibodies can block gHgL-mediated activation of gB through different surface epitopes and mechanisms.« less

Inhibition of EBV-mediated membrane fusion by anti-gHgL antibodies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sathiyamoorthy, Karthik; Jiang, Jiansen; Möhl, Britta S.

Herpesvirus entry into cells requires the coordinated action of multiple virus envelope glycoproteins, including gH, gL, and gB. For EBV, the gp42 protein assembles into complexes with gHgL heterodimers and binds HLA class II to activate gB-mediated membrane fusion with B cells. EBV tropism is dictated by gp42 levels in the virion, as it inhibits entry into epithelial cells while promoting entry into B cells. The gHgL and gB proteins are targets of neutralizing antibodies and potential candidates for subunit vaccine development, but our understanding of their neutralizing epitopes and the mechanisms of inhibition remain relatively unexplored. Here we studiedmore » the structures and mechanisms of two anti-gHgL antibodies, CL40 and CL59, that block membrane fusion with both B cells and epithelial cells. We determined the structures of the CL40 and CL59 complexes with gHgL using X-ray crystallography and EM to identify their epitope locations. CL59 binds to the C-terminal domain IV of gH, while CL40 binds to a site occupied by the gp42 receptor binding domain. CL40 binding to gHgL/gp42 complexes is not blocked by gp42 and does not interfere with gp42 binding to HLA class II, indicating that its ability to block membrane fusion with B cells represents a defect in gB activation. These data indicate that anti-gHgL neutralizing antibodies can block gHgL-mediated activation of gB through different surface epitopes and mechanisms.« less

Inhibition of EBV-mediated membrane fusion by anti-gHgL antibodies

DOE PAGES

Sathiyamoorthy, Karthik; Jiang, Jiansen; Mohl, Britta S.; ...

2017-09-22

Herpesvirus entry into cells requires the coordinated action of multiple virus envelope glycoproteins, including gH, gL, and gB. For EBV, the gp42 protein assembles into complexes with gHgL heterodimers and binds HLA class II to activate gB-mediated membrane fusion with B cells. EBV tropism is dictated by gp42 levels in the virion, as it inhibits entry into epithelial cells while promoting entry into B cells. The gHgL and gB proteins are targets of neutralizing antibodies and potential candidates for subunit vaccine development, but our understanding of their neutralizing epitopes and the mechanisms of inhibition remain relatively unexplored. Here we studiedmore » the structures and mechanisms of two anti-gHgL antibodies, CL40 and CL59, that block membrane fusion with both B cells and epithelial cells. We determined the structures of the CL40 and CL59 complexes with gHgL using X-ray crystallography and EM to identify their epitope locations. CL59 binds to the C-terminal domain IV of gH, while CL40 binds to a site occupied by the gp42 receptor binding domain. CL40 binding to gHgL/gp42 complexes is not blocked by gp42 and does not interfere with gp42 binding to HLA class II, indicating that its ability to block membrane fusion with B cells represents a defect in gB activation. Furthermore, these data indicate that anti-gHgL neutralizing antibodies can block gHgL-mediated activation of gB through different surface epitopes and mechanisms.« less

gp49B-mediated negative regulation of antibody production by memory and marginal zone B cells.

PubMed

Fukao, Saori; Haniuda, Kei; Nojima, Takuya; Takai, Toshiyuki; Kitamura, Daisuke

2014-07-15

The rapid Ab responses observed after primary and secondary immunizations are mainly derived from marginal zone (MZ) and memory B cells, respectively, but it is largely unknown how these responses are negatively regulated. Several inhibitory receptors have been identified and their roles have been studied, but mainly on follicular B cells and much less so on MZ B, and never on memory B cells. gp49B is an Ig superfamily member that contains two ITIMs in its cytoplasmic tail, and it has been shown to negatively regulate mast cell, macrophage, and NK cell responses. In this study, we demonstrate that gp49B is preferentially expressed on memory and MZ B cells. We show that gp49B(-/-) mice produce more IgM after a primary immunization and more IgM and IgG1 after a secondary immunization than gp49B(+/+) mice in T cell-dependent immune responses. Memory and MZ B cells from gp49B(-/-) mice also produce more Abs upon in vitro stimulation with CD40 than those from gp49B(+/+) mice. The in vitro IgM production by MZ B cells from gp49B(+/+), but not gp49B(-/-), mice is suppressed by interaction with a putative gp49B ligand, the integrin αvβ3 heterodimer. In addition, gp49B(-/-) mice exhibited exaggerated IgE production in the memory recall response. These results suggest that plasma cell development from memory and MZ B cells, as well as subsequent Ab production, are suppressed via gp49B. In memory B cells, this suppression also prevents excessive IgE production, thus curtailing allergic diseases. Copyright © 2014 by The American Association of Immunologists, Inc.

Depression management within GP-centered health care - A case-control study based on claims data.

PubMed

Freytag, Antje; Krause, Markus; Lehmann, Thomas; Schulz, Sven; Wolf, Florian; Biermann, Janine; Wasem, Jürgen; Gensichen, Jochen

For most patients with depression, GPs are the first and long-term medical providers. GP-centered health care (GPc-HC) programs target patients with chronic diseases. What are the effects of GPc-HC on primary care depression management? An observational retrospective case-control study was conducted using health insurance claims data of patients with depressive disorder from July 2011 to December 2012. From 40,298 patients insured with the largest health plan in Central Germany participating in the GPc-HC program (intervention group, IG), we observed 4645 patients with depression over 18months: 72.2% women; 66.6years (mean); multiple conditions (morbidity-weight 2.50 (mean), 86%>1.0). We compared them with 4013 patients who did not participate (control group). In participants we found lower number of incomplete/non-specified depression diagnoses (4.46vs.4.82;MD-0.36; p<0.01); lower rate of patients consulting more than one GP-practice (49.1%vs.58.0%;PP-8.9;p<0.01); more GP-contacts (18.19vs.15.59;MD+2.60;p<0.01); more GP-initiated referrals to specialists (82.9%vs.79.3%;PP+3.6;p<0.05), more antidepressant pharmacotherapy prescribed by a GP (37.9%vs.35.4%;PP+2.5;p<0.05), more frequent guideline-concordant therapy duration (19.2%vs.13.1%;PP+6.1;p<0.01) and more patients receiving "GP-psychosomatic basic care" (38.2%vs.30.2%;PP+8.0;p<0.01). Depressive patients participating in a GPc-HC program may be more often diagnosed by a GP, receive symptom-monitoring and appropriate depression treatment. Copyright © 2016 Elsevier Inc. All rights reserved.

HIV proteins (gp120 and Tat) and methamphetamine in oxidative stress-induced damage in the brain: Potential role of the thiol antioxidant N-acetylcysteine amide

PubMed Central

Banerjee, Atrayee; Zhang, Xinsheng; Manda, Kalyan Reddy; Banks, William A; Ercal, Nuran

2010-01-01

An increased risk of HIV-1 associated dementia (HAD) has been observed in patients abusing methamphetamine (METH). Since both HIV viral proteins (gp120, Tat) and METH induce oxidative stress, drug abusing patients are at a greater risk of oxidative stress-induced damage. The objective of this study was to determine if N-acetylcysteine amide (NACA) protects the blood brain barrier (BBB) from oxidative stress-induced damage in animals exposed to gp120, Tat and METH. To study this, CD-1 mice pre-treated with NACA/saline, received injections of gp120, Tat, gp120 + Tat or saline for 5 days, followed by three injections of METH/saline on the fifth day, and sacrificed 24 h after the final injection. Various oxidative stress parameters were measured, and animals treated with gp120+Tat+Meth were found to be the most challenged group, as indicated by their GSH and MDA levels. Treatment with NACA significantly rescued the animals from oxidative stress. Further, NACA-treated animals had significantly higher expression of TJ proteins and BBB permeability as compared to the group treated with gp120+Tat+METH alone, indicating that NACA can protect the BBB from oxidative stress-induced damage in gp120, Tat and METH exposed animals, and thus could be a viable therapeutic option for patients with HAD. PMID:20188164

Multiparametric evaluation of the cytoprotective effect of the Mangifera indica L. stem bark extract and mangiferin in HepG2 cells.

PubMed

Tolosa, Laia; Rodeiro, Idania; Donato, M Teresa; Herrera, José A; Delgado, René; Castell, José V; Gómez-Lechón, M José

2013-07-01

Mango (Mangifera indica L.) stem bark extract (MSBE) is a natural product with biological properties and mangiferin is the major component. This paper reported the evaluation of the protective effects of MSBE and mangiferin against the toxicity induced in HepG2 cells by tert-butyl hydroperoxide or amiodarone. Nuclear morphology, cell viability, intracellular calcium concentration and reactive oxygen species (ROS) production were measured by using a high-content screening multiparametric assay. MSBE and mangiferin produced no toxicity below 500 mg/ml doses. A marked recovery in cell viability, which was reduced by the toxicants, was observed in cells pre-exposed to MSBE or mangiferin at 5-100 mg/ml doses. We also explored the possible interaction of both products over P-glycoprotein (P-gp). MSBE and mangiferin above 100 mg/ml inhibited the activity of P-gp in HepG2 cells. MSBE and mangiferin showed cytoprotective effects of against oxidative damage and mitochondrial toxicity induced by xenobiotics to human hepatic cells but it seemed that other constituents of the extract could contribute to MSBE protective properties. In addition, the drug efflux should be taken into account because of the inhibition of the P-gp function observed in those cells exposed to both natural products. © 2013 Royal Pharmaceutical Society.

Enhanced HIV-1 neutralization by a CD4-VH3-IgG1 fusion protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Meyuhas, Ronit; Noy, Hava; Fishman, Sigal

2009-08-21

HIV-1 gp120 is an alleged B cell superantigen, binding certain VH3+ human antibodies. We reasoned that a CD4-VH3 fusion protein could possess higher affinity for gp120 and improved HIV-1 inhibitory capacity. To test this we produced several human IgG1 immunoligands harboring VH3. Unlike VH3-IgG1 or VH3-CD4-IgG1, CD4-VH3-IgG1 bound gp120 considerably stronger than CD4-IgG1. CD4-VH3-IgG1 exhibited {approx}1.5-2.5-fold increase in neutralization of two T-cell laboratory-adapted strains when compared to CD4-IgG1. CD4-VH3-IgG1 improved neutralization of 7/10 clade B primary isolates or pseudoviruses, exceeding 20-fold for JR-FL and 13-fold for Ba-L. It enhanced neutralization of 4/8 clade C viruses, and had negligible effect onmore » 1/4 clade A pseudoviruses. We attribute this improvement to possible pairing of VH3 with CD4 D1 and stabilization of an Ig Fv-like structure, rather than to superantigen interactions. These novel findings support the current notion that CD4 fusion proteins can act as better HIV-1 entry inhibitors with potential clinical implications.« less

Evaluation of XD/A Plus and ST8G films for cephalometric radiography with Grenex G8 and BH-III screens.

PubMed

Wakoh, M; Farman, A G; Scarfe, W C; Shibuya, H; Nishikawa, K; Kuroyanagi, K

1997-02-01

Sensitometric properties, clinical image quality, and patient dose requirements are important considerations when selecting film for cephalometrics. Two recently released films, XD/A Plus and ST 8G green sensitive films, were studied. The films were each combined with Grenex G8 (Fuji Medical) green-fluorescing matched and BH-III (Kasei Optonix) blue-fluorescing mismatched intensifying screens. The density response and resolution for each screen-film combination were evaluated by use of the characteristic curve and modulation transfer function. The kilovoltage settings providing clinically acceptable images were assessed individually by 12 observers. Clinically acceptable images for each combination were also compared, and the skin entrance doses in the temporomandibular joint region were determined. The average contrast at the most effective density range was found to be slightly higher for the BH-III group than for the G8 group. The modulation transfer function for the BH-III group was inferior to that for the G8 screens. There were no significant differences in diagnostically acceptable image quality among the four combinations; nevertheless the BH-III screen group required two to three times more exposure than the G8 screen group. XD/A Plus and ST8G films provide acceptable image detail for cephalometrics. To minimize the patient dose they should be used with green-emitting screens.

41 CFR 109-27.5104-2 - Physical protection and storage.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 41 Public Contracts and Property Management 3 2013-07-01 2013-07-01 false Physical protection and... PROCUREMENT 27-INVENTORY MANAGEMENT 27.51-Management of Precious Metals § 109-27.5104-2 Physical protection and storage. Precious metals shall be afforded exceptional physical protection from time of receipt...

41 CFR 109-27.5104-2 - Physical protection and storage.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 41 Public Contracts and Property Management 3 2011-01-01 2011-01-01 false Physical protection and... PROCUREMENT 27-INVENTORY MANAGEMENT 27.51-Management of Precious Metals § 109-27.5104-2 Physical protection and storage. Precious metals shall be afforded exceptional physical protection from time of receipt...

41 CFR 109-27.5104-2 - Physical protection and storage.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 41 Public Contracts and Property Management 3 2014-01-01 2014-01-01 false Physical protection and... PROCUREMENT 27-INVENTORY MANAGEMENT 27.51-Management of Precious Metals § 109-27.5104-2 Physical protection and storage. Precious metals shall be afforded exceptional physical protection from time of receipt...

41 CFR 109-27.5104-2 - Physical protection and storage.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Physical protection and... PROCUREMENT 27-INVENTORY MANAGEMENT 27.51-Management of Precious Metals § 109-27.5104-2 Physical protection and storage. Precious metals shall be afforded exceptional physical protection from time of receipt...

41 CFR 109-27.5104-2 - Physical protection and storage.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 41 Public Contracts and Property Management 3 2012-01-01 2012-01-01 false Physical protection and... PROCUREMENT 27-INVENTORY MANAGEMENT 27.51-Management of Precious Metals § 109-27.5104-2 Physical protection and storage. Precious metals shall be afforded exceptional physical protection from time of receipt...

40 CFR Table 8 to Subpart G of... - Organic HAP's Subject to the Wastewater Provisions for Process Units at New Sources

Code of Federal Regulations, 2010 CFR

2010-07-01

... 40 Protection of Environment 9 2010-07-01 2010-07-01 false Organic HAP's Subject to the Wastewater... Operations, and Wastewater Pt. 63, Subpt. G, Table 8 Table 8 to Subpart G of Part 63—Organic HAP's Subject to the Wastewater Provisions for Process Units at New Sources Chemical name CAS No. a Allyl chloride...

40 CFR Table 8 to Subpart G of... - Organic HAP's Subject to the Wastewater Provisions for Process Units at New Sources

Code of Federal Regulations, 2011 CFR

2011-07-01

... 40 Protection of Environment 9 2011-07-01 2011-07-01 false Organic HAP's Subject to the Wastewater... Operations, and Wastewater Pt. 63, Subpt. G, Table 8 Table 8 to Subpart G of Part 63—Organic HAP's Subject to the Wastewater Provisions for Process Units at New Sources Chemical name CAS No. a Allyl chloride...

Clinical and Molecular Characteristics of Human Rotavirus G8P[8] Outbreak Strain, Japan, 2014.

PubMed

Kondo, Kenji; Tsugawa, Takeshi; Ono, Mayumi; Ohara, Toshio; Fujibayashi, Shinsuke; Tahara, Yasuo; Kubo, Noriaki; Nakata, Shuji; Higashidate, Yoshihito; Fujii, Yoshiki; Katayama, Kazuhiko; Yoto, Yuko; Tsutsumi, Hiroyuki

2017-06-01

During March-July 2014, rotavirus G8P[8] emerged as the predominant cause of rotavirus gastroenteritis among children in Hokkaido Prefecture, Japan. Clinical characteristics were similar for infections caused by G8 and non-G8 strains. Sequence and phylogenetic analyses suggest the strains were generated by multiple reassortment events between DS-1-like P[8] strains and bovine strains from Asia.

Modification of radiobiological effects of 171 MeV protons by elements of physical protection

NASA Astrophysics Data System (ADS)

Bulinina, Taisia; Shurshakov, Vyacheslav; Ivanov, Alexander; Molokanov, Alexander

2016-07-01

Space radiation includes protons of various energies. Physical protection is effective in the case of low energy protons (50-100 MeV) and becomes insufficient for radiation with a high part of high-energy protons. In the experiment performed on outbred mice, the purpose of the study was to evaluate the radiobiological effect of 171 MeV protons and protons modified by elements of physical protection of the spacecraft, on a complex of indicators of the functional condition of the system hematopoiesis and the central nervous system in 24 hours after irradiation at 20 cGy dose. The spacecraft radiation protection elements used in the experiment were a construction of wet hygiene wipes called a «protective curtain», and a glass plate imitating an ISS window. Mass thickness of the " protective curtain" in terms of water equivalent was ̴ 6,2 g/cm2. Physical shielding along the path of 171 MeV protons increases their linear energy transfer leading to the absorbed dose elevation and strengthening of the radiobiological effect. In the experiment, the two types of shielding together raised the absorbed dose from 20 to 23.2 cGy. Chemically different materials (glass and water in the wipes) were found to exert unequal modifying effects on physical and biological parameters of the proton-irradiated mice. There was a distinct dose-dependent reduction of bone marrow cellularity within the dose range from 20 cGy to 23.2 cGy in 24 hours after exposure. No modifying effect of the radiation protection elements on spontaneous motor activity was discovered when compared with entrance protons. The group of animals protected by the glass plate exhibited normal orientative-trying reactions and weakened grip with the forelimbs. The effects observed in the experiment indicate the necessity to carry out comprehensive radiobiological researches (physical, biological and mathematical) in assessing the effects of physical protection, that are actual for ensuring radiation safety of crews in

Human Immunodeficiency Virus Envelope Protein Gp120 Induces Proliferation but Not Apoptosis in Osteoblasts at Physiologic Concentrations

PubMed Central

Cummins, Nathan W.; Klicpera, Anna; Sainski, Amy M.; Bren, Gary D.; Khosla, Sundeep; Westendorf, Jennifer J.; Badley, Andrew D.

2011-01-01

Patients with HIV infection have decreased numbers of osteoblasts, decreased bone mineral density and increased risk of fracture compared to uninfected patients; however, the molecular mechanisms behind these associations remain unclear. We questioned whether Gp120, a component of the envelope protein of HIV capable of inducing apoptosis in many cell types, is able to induce cell death in bone-forming osteoblasts. We show that treatment of immortalized osteoblast-like cells and primary human osteoblasts with exogenous Gp120 in vitro at physiologic concentrations does not result in apoptosis. Instead, in the osteoblast-like U2OS cell line, cells expressing CXCR4, a receptor for Gp120, had increased proliferation when treated with Gp120 compared to control (P<0.05), which was inhibited by pretreatment with a CXCR4 inhibitor and a G-protein inhibitor. This suggests that Gp120 is not an inducer of apoptosis in human osteoblasts and likely does not directly contribute to osteoporosis in infected patients by this mechanism. PMID:21931863

8. Building G9; view of No. 8 condenser and top ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

8. Building G-9; view of No. 8 condenser and top of dissolve tank; third floor, looking S. (Ryan) - Holston Army Ammunition Plant, RDX-and-Composition-B Manufacturing Line 9, Kingsport, Sullivan County, TN

Clinical and Molecular Characteristics of Human Rotavirus G8P[8] Outbreak Strain, Japan, 2014

PubMed Central

Kondo, Kenji; Ono, Mayumi; Ohara, Toshio; Fujibayashi, Shinsuke; Tahara, Yasuo; Kubo, Noriaki; Nakata, Shuji; Higashidate, Yoshihito; Fujii, Yoshiki; Katayama, Kazuhiko; Yoto, Yuko; Tsutsumi, Hiroyuki

2017-01-01

During March–July 2014, rotavirus G8P[8] emerged as the predominant cause of rotavirus gastroenteritis among children in Hokkaido Prefecture, Japan. Clinical characteristics were similar for infections caused by G8 and non-G8 strains. Sequence and phylogenetic analyses suggest the strains were generated by multiple reassortment events between DS-1–like P[8] strains and bovine strains from Asia. PMID:28518031

The glycan-mediated mechanism on the interactions of gp120 with CD4 and antibody: Insights from molecular dynamics simulation.

PubMed

Zhang, Yan; Niu, Yuzhen; Tian, Jiaqi; Liu, Xuewei; Yao, Xiaojun; Liu, Huanxiang

2017-12-01

N-linked glycans such as 234 and 276 gp 120 glycans are vital components of HIV evasion from humoral immunity and important for HIV-1 neutralization of many broadly neutralizing antibodies (bNAbs). However, it is unknown the action mechanism of two glycans. To investigate the roles of the glycans on the interactions of gp120 with CD4 and antibody, molecular dynamic simulations based on gp120-CD4-8ANC195 complex with 234 and 276 gp 120 glycans, 234 gp 120 glycan, 276 gp 120 glycan, and without glycan were performed. Our results reveal that 276 gp 120 glycan can enhance gp120-CD4 and gp120-antibody interactions through the formation of hydrogen bonds of the glycan with CD4 and antibody and make the binding interface of gp120, CD4 and antibody stable; 234 gp 120 glycan primarily reinforces gp120-antibody interactions and weakly affects gp120-CD4 interactions as it mainly lies between gp120 and antibody. The co-operating of two glycans can enhance gp120-CD4 and gp120-antibody associations. Through the structural analysis, it can be seen that 234 gp 120 glycan leads to moving upward of two glycans and the variable region of heavy chain, which is favorable for the interactions of gp120 with CD4 and antibody. The information obtained in this study can provide the guidance for design vaccines and small molecule inhibitors. © 2017 John Wiley & Sons A/S.

10 CFR 73.50 - Requirements for physical protection of licensed activities.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 10 Energy 2 2014-01-01 2014-01-01 false Requirements for physical protection of licensed activities. 73.50 Section 73.50 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) PHYSICAL PROTECTION OF PLANTS AND MATERIALS Physical Protection Requirements at Fixed Sites § 73.50 Requirements for physical...

10 CFR 73.50 - Requirements for physical protection of licensed activities.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 10 Energy 2 2013-01-01 2013-01-01 false Requirements for physical protection of licensed activities. 73.50 Section 73.50 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) PHYSICAL PROTECTION OF PLANTS AND MATERIALS Physical Protection Requirements at Fixed Sites § 73.50 Requirements for physical...

Comparative analysis of pentavalent rotavirus vaccine strains and G8 rotaviruses identified during vaccine trial in Africa.

PubMed

Heylen, Elisabeth; Zeller, Mark; Ciarlet, Max; Lawrence, Jody; Steele, Duncan; Van Ranst, Marc; Matthijnssens, Jelle

2015-10-06

RotaTeqTM is a pentavalent rotavirus vaccine based on a bovine rotavirus genetic backbone in vitro reassorted with human outer capsid genes. During clinical trials of RotaTeqTM in Sub-Saharan Africa, the vaccine efficacy over a 2-year follow-up was lower against the genotypes contained in the vaccine than against the heterotypic G8P[6] and G8P[1] rotavirus strains of which the former is highly prevalent in Africa. Complete genome analyses of 43 complete rotavirus genomes collected during phase III clinical trials of RotaTeqTM in Sub-Saharan Africa, were conducted to gain insight into the high level of cross-protection afforded by RotaTeqTM against these G8 strains. Phylogenetic analysis revealed the presence of a high number of bovine rotavirus gene segments in these human G8 strains. In addition, we performed an in depth analysis on the individual amino acid level which showed that G8 rotaviruses were more similar to the RotaTeqTM vaccine than non-G8 strains. Because RotaTeqTM possesses a bovine genetic backbone, the high vaccine efficacy against G8 strains might be partially explained by the fact that all these strains contain a complete or partial bovine-like backbone. Altogether, this study supports the hypothesis that gene segments other than VP7 and VP4 play a role in vaccine-induced immunity.

Supersite of immune vulnerability on the glycosylated face of HIV-1 envelope glycoprotein gp120

PubMed Central

Kong, Leopold; Lee, Jeong Hyun; Doores, Katie J.; Murin, Charles D.; Julien, Jean-Philippe; McBride, Ryan; Liu, Yan; Marozsan, Andre; Cupo, Albert; Klasse, Per-Johan; Hoffenberg, Simon; Caulfield, Michael; King, C. Richter; Hua, Yuanzi; Le, Khoa M.; Khayat, Reza; Deller, Marc C.; Clayton, Thomas; Tien, Henry; Feizi, Ten; Sanders, Rogier W.; Paulson, James C.; Moore, John P.; Stanfield, Robyn L.; Burton, Dennis R.; Ward, Andrew B.; Wilson, Ian A.

2013-01-01

A substantial fraction of broadly neutralizing antibodies (bnAbs) in certain HIV-infected donors recognizes glycan-dependent epitopes on HIV-1 gp120. Here, we elucidate how bnAb PGT 135 recognizes its Asn332 glycan-dependent epitope from its crystal structure with gp120, CD4 and Fab 17b at 3.1 Å resolution. PGT 135 interacts with glycans at Asn332, Asn392 and Asn386, using long CDR loops H1 and H3 to penetrate the glycan shield to access the gp120 protein surface. Electron microscopy reveals PGT 135 can accommodate the conformational and chemical diversity of gp120 glycans by altering its angle of engagement. The combined structural studies of PGT 135, PGT 128 and 2G12 show this Asn332-dependent epitope is highly accessible and much more extensive than initially appreciated, allowing for multiple binding modes and varied angles of approach, thereby representing a supersite of vulnerability for antibody neutralization. PMID:23708606

Antibody quality and protection from lethal Ebola virus challenge in nonhuman primates immunized with rabies virus based bivalent vaccine.

PubMed

Blaney, Joseph E; Marzi, Andrea; Willet, Mallory; Papaneri, Amy B; Wirblich, Christoph; Feldmann, Friederike; Holbrook, Michael; Jahrling, Peter; Feldmann, Heinz; Schnell, Matthias J

2013-01-01

We have previously described the generation of a novel Ebola virus (EBOV) vaccine platform based on (a) replication-competent rabies virus (RABV), (b) replication-deficient RABV, or (c) chemically inactivated RABV expressing EBOV glycoprotein (GP). Mouse studies demonstrated safety, immunogenicity, and protective efficacy of these live or inactivated RABV/EBOV vaccines. Here, we evaluated these vaccines in nonhuman primates. Our results indicate that all three vaccines do induce potent immune responses against both RABV and EBOV, while the protection of immunized animals against EBOV was largely dependent on the quality of humoral immune response against EBOV GP. We also determined if the induced antibodies against EBOV GP differ in their target, affinity, or the isotype. Our results show that IgG1-biased humoral responses as well as high levels of GP-specific antibodies were beneficial for the control of EBOV infection after immunization. These results further support the concept that a successful EBOV vaccine needs to induce strong antibodies against EBOV. We also showed that a dual vaccine against RABV and filoviruses is achievable; therefore addressing concerns for the marketability of this urgently needed vaccine.

Platelet glycoprotein IIb/IIIa receptor inhibition in non-ST-elevation acute coronary syndromes: early benefit during medical treatment only, with additional protection during percutaneous coronary intervention.

PubMed

Boersma, E; Akkerhuis, K M; Théroux, P; Califf, R M; Topol, E J; Simoons, M L

1999-11-16

Glycoprotein (GP) IIb/IIIa receptor blockers prevent life-threatening cardiac complications in patients with acute coronary syndromes without ST-segment elevation and protect against thrombotic complications associated with percutaneous coronary interventions (PCIs). The question arises as to whether these 2 beneficial effects are independent and additive. We analyzed data from the CAPTURE, PURSUIT, and PRISM-PLUS randomized trials, which studied the effects of the GP IIb/IIIa inhibitors abciximab, eptifibatide, and tirofiban, respectively, in acute coronary syndrome patients without persistent ST-segment elevation, with a period of study drug infusion before a possible PCI. During the period of pharmacological treatment, each trial demonstrated a significant reduction in the rate of death or nonfatal myocardial infarction in patients randomized to the GP IIb/IIIa inhibitor compared with placebo. The 3 trials combined showed a 2.5% event rate in this period in the GP IIb/IIIa inhibitor group (N=6125) versus 3.8% in placebo (N=6171), which implies a 34% relative reduction (P<0.001). During study medication, a PCI was performed in 1358 patients assigned GP IIb/IIIa inhibition and 1396 placebo patients. The event rate during the first 48 hours after PCI was also significantly lower in the GP IIb/IIIa inhibitor group (4. 9% versus 8.0%; 41% reduction; P<0.001). No further benefit or rebound effect was observed beyond 48 hours after the PCI. There is conclusive evidence of an early benefit of GP IIb/IIIa inhibitors during medical treatment in patients with acute coronary syndromes without persistent ST-segment elevation. In addition, in patients subsequently undergoing PCI, GP IIb/IIIa inhibition protects against myocardial damage associated with the intervention.

CGP lil-gp 2.1;1.02 User's Manual

NASA Technical Reports Server (NTRS)

Janikow, Cezary Z.; DeWeese, Scott W.

1997-01-01

This document describes extensions provided to lil-gp facilitating dealing with constraints. This document deals specifically with lil-gp 1.02, and the resulting extension is referred to as CGP lil-gp 2.1; 1.02 (the first version is for the extension, the second for the utilized lil-gp version). Unless explicitly needed to avoid confusion, version numbers are omitted.

Venezuelan Equine Encephalitis Virus Replicon Particle Vaccine Protects Nonhuman Primates from Intramuscular and Aerosol Challenge with Ebolavirus

PubMed Central

Herbert, Andrew S.; Kuehne, Ana I.; Barth, James F.; Ortiz, Ramon A.; Nichols, Donald K.; Zak, Samantha E.; Stonier, Spencer W.; Muhammad, Majidat A.; Bakken, Russell R.; Prugar, Laura I.; Olinger, Gene G.; Groebner, Jennifer L.; Lee, John S.; Pratt, William D.; Custer, Max; Kamrud, Kurt I.; Smith, Jonathan F.; Hart, Mary Kate

2013-01-01

There are no vaccines or therapeutics currently approved for the prevention or treatment of ebolavirus infection. Previously, a replicon vaccine based on Venezuelan equine encephalitis virus (VEEV) demonstrated protective efficacy against Marburg virus in nonhuman primates. Here, we report the protective efficacy of Sudan virus (SUDV)- and Ebola virus (EBOV)-specific VEEV replicon particle (VRP) vaccines in nonhuman primates. VRP vaccines were developed to express the glycoprotein (GP) of either SUDV or EBOV. A single intramuscular vaccination of cynomolgus macaques with VRP expressing SUDV GP provided complete protection against intramuscular challenge with SUDV. Vaccination against SUDV and subsequent survival of SUDV challenge did not fully protect cynomolgus macaques against intramuscular EBOV back-challenge. However, a single simultaneous intramuscular vaccination with VRP expressing SUDV GP combined with VRP expressing EBOV GP did provide complete protection against intramuscular challenge with either SUDV or EBOV in cynomolgus macaques. Finally, intramuscular vaccination with VRP expressing SUDV GP completely protected cynomolgus macaques when challenged with aerosolized SUDV, although complete protection against aerosol challenge required two vaccinations with this vaccine. PMID:23408633

Venezuelan equine encephalitis virus replicon particle vaccine protects nonhuman primates from intramuscular and aerosol challenge with ebolavirus.

PubMed

Herbert, Andrew S; Kuehne, Ana I; Barth, James F; Ortiz, Ramon A; Nichols, Donald K; Zak, Samantha E; Stonier, Spencer W; Muhammad, Majidat A; Bakken, Russell R; Prugar, Laura I; Olinger, Gene G; Groebner, Jennifer L; Lee, John S; Pratt, William D; Custer, Max; Kamrud, Kurt I; Smith, Jonathan F; Hart, Mary Kate; Dye, John M

2013-05-01

There are no vaccines or therapeutics currently approved for the prevention or treatment of ebolavirus infection. Previously, a replicon vaccine based on Venezuelan equine encephalitis virus (VEEV) demonstrated protective efficacy against Marburg virus in nonhuman primates. Here, we report the protective efficacy of Sudan virus (SUDV)- and Ebola virus (EBOV)-specific VEEV replicon particle (VRP) vaccines in nonhuman primates. VRP vaccines were developed to express the glycoprotein (GP) of either SUDV or EBOV. A single intramuscular vaccination of cynomolgus macaques with VRP expressing SUDV GP provided complete protection against intramuscular challenge with SUDV. Vaccination against SUDV and subsequent survival of SUDV challenge did not fully protect cynomolgus macaques against intramuscular EBOV back-challenge. However, a single simultaneous intramuscular vaccination with VRP expressing SUDV GP combined with VRP expressing EBOV GP did provide complete protection against intramuscular challenge with either SUDV or EBOV in cynomolgus macaques. Finally, intramuscular vaccination with VRP expressing SUDV GP completely protected cynomolgus macaques when challenged with aerosolized SUDV, although complete protection against aerosol challenge required two vaccinations with this vaccine.

GpIIb/IIIa+ subpopulation of rat megakaryocyte progenitor cells exhibits high responsiveness to human thrombopoietin.

PubMed

Kato, T; Horie, K; Hagiwara, T; Maeda, E; Tsumura, H; Ohashi, H; Miyazaki, H

1996-08-01

The recently cloned factor thrombopoietin (TPO) has been shown to exhibit megakaryocyte colony-stimulating activity in vitro. In this investigation, to further evaluate the action of TPO on megakaryocyte progenitor cells (colony-forming units-megakaryocyte [CFU-MK]), GpIIb/IIIa+ and GpIIb/IIIa- populations of CFU-MK were prepared from rat bone marrow cells based on their reactivity with P55 antibody, a monoclonal antibody against rat GpIIb/IIIa, and their responsiveness to recombinant human TPO (rhTPO) and recombinant rat interleukin-3 (rrIL-3) was examined using a megakaryocyte colony-forming assay (Meg-CSA). rhTPO supported only megakaryocyte colony growth from both fractions in a dose-dependent fashion. The mean colony size observed with the GpIIb/IIIa+ population was smaller than that seen with the GpIIb/IIIa- population. With the optimal concentration of either rhTPO or rrIL-3, similar numbers of megakaryocyte colonies were formed from the GpIIb/IIIa+ population previously shown to be highly enriched for CFU-MK. In contrast, the maximum number of megakaryocyte colonies from the GpIIb/IIIa- population stimulated by rhTPO was only 24.2% of that achieved with rrIL-3. Morphologic analysis of rhTPO-promoted megakaryocyte colonies from the GpIIb/IIIa+ population showed that the average colony size was smaller but that the mean diameter of individual megakaryocytes was larger than in megakaryocyte colonies promoted with rrIL-3. rhTPO plus rrIL-3, each at suboptimal concentrations, had an additive effect on proliferation of CFU-MK in the GpIIb/IIIa+ fraction, whereas rhTPO plus murine IL-6 or murine granulocyte-macrophage colony-stimulating factor (mG-M-CSF) modestly but significantly reduced megakaryocyte colony growth. These results indicate that TPO preferentially acts on GpIIb/IIIa+ late CFU-MK with lower proliferative capacity and interacts with some other cytokines in CFU-MK development.

G 126.1-0.8-14: A molecular shell related to Sh2-187

NASA Astrophysics Data System (ADS)

Cichowolski, S.; Pineault, S.; Gamen, R.; Ortega, M. E.; Arnal, E. M.; Suad, L. A.

2014-10-01

We present a multi-wavelength study of a region where a well defined molecular shell, named G 126.1-0.8-14, is observed. The distance of G 126.1-0.8-14 is about 1 kpc. Based on HI and CO data we analyze the atomic and molecular gas related to the structure and estimate its main physical properties. From the radio continuum and infrared data we analyze whether the emission associated with G 126.1-0.8-14 has a thermal origin. To disentangle the possible origin of the shell, and given the lack of catalogued O-type stars in the area, we observed with GEMINI the spectra of four OB stars located in projection inside the shell, to get their accurate spectral types and distances. The young HII region Sh2-187 is located onto the densest part of this molecular shell. A search for young stellar object candidates (cYSOs) was made using infrared point source catalogs. Several cYSOs are found spread out onto the shell. Based on all the available data, we discuss the possible origin of G 126.1-0.8-14 as well as its role in the formation of a new generation of stars.

Blended learning in CME: the perception of GP trainers.

PubMed

Te Pas, E; Meinema, J G; Visser, M R M; van Dijk, N

2016-05-01

Blended learning (the combination of electronic methods with traditional teaching methods) has the potential to combine the best of traditional education with the best of computer-mediated training. We chose to develop such an intervention for GP trainers who were undertaking a Continuing Medical Education (CME) course in evidence-based medicine (EBM). This study reports on our experience and investigated the factors influencing the perception on usefulness and logistics of blended learning for learners in CME. In total, 170 GP trainers participated in the intervention. We used questionnaires, observations during the four face-to-face meetings and evaluations in the e-course over one year. Additionally we organised focus groups to gain insight in some of the outcomes of the questionnaires and interpretations of the observations. The GP trainers found the design and the educational method (e-course in combination with meetings) attractive, instructive and complementary. Factors influencing their learning were (1) educational design, (2) educational method, (3) topic of the intervention, (4) time (planning), (5) time (intervention), (6) learning style, (7) technical issues, (8) preconditions and (9) level of difficulty. A close link between daily practice and the educational intervention was considered an important precondition for the success of the intervention in this group of learners. GP trainers were positive about blended learning: they found e-learning a useful way to gain knowledge and the meetings a pleasant way of transferring the knowledge into practice. Although some preconditions should be taken into consideration during its development and implementation, they would participate in similarly designed learning in the future.

A soluble form of Epstein-Barr virus gH/gL inhibits EBV-induced membrane fusion and does not function in fusion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rowe, Cynthia L.; Connolly, Sarah A.; Chen, Jia

We investigated whether soluble EBV gH/gL (sgH/gL) functions in fusion and made a series of truncations of gH/gL domains based on the gH/gL crystal structure. We found sgH/gL failed to mediate cell-cell fusion both when co-expressed with the other entry glycoproteins and when added exogenously to fusion assays. Interestingly, sgH/gL inhibited cell-cell fusion in a dose dependent manner when co-expressed. sgH/gL from HSV was unable to inhibit EBV fusion, suggesting the inhibition was specific to EBV gH/gL. sgH/gL stably binds gp42, but not gB nor gH/gL. The domain mutants, DI/gL, DI-II/gL and DI-II-III/gL were unable to bind gp42. Instead, DI-II/gL,more » DI-II-III/gL and sgH/gL but not DI/gL decreased the expression of gp42, resulting in decreased overall fusion. Overall, our results suggest that domain IV may be required for proper folding and the transmembrane domain and cytoplasmic tail of EBV gH/gL are required for the most efficient fusion.« less

Evaluation of Quantitative Anti-F1 IgG and Anti-V IgG ELISAs for use as an in Vitro-Based Potency Assay of Plague Vaccine in Mice

DTIC Science & Technology

2008-04-01

Andrews GP, Welkos SL, Friedlander AM, et al. Protection of mice from fatal bubonic and pneu- monic plague by passive immunization with monoclonal...SL, Andrews GP, Adamovicz J, et al. Protection against experimental bubonic and pneumonic plague by a recombinant capsular F1-V antigen fusion...fusion protein as vaccine antigen against bubonic and pneumonic plague . Biotechnol Prog 2005; 21:1490e510.[21] Simpson WJ, Thomas RE, Schwan TG

Cerebrosides from Sea Cucumber Protect Against Oxidative Stress in SAMP8 Mice and PC12 Cells.

PubMed

Che, Hongxia; Du, Lei; Cong, Peixu; Tao, Suyuan; Ding, Ning; Wu, Fengjuan; Xue, Changhu; Xu, Jie; Wang, Yuming

2017-04-01

Alzheimer's disease (AD) is a neurodegenerative disorder. Emerging evidence implicates β-amyloid (Aβ) plays a critical role in the progression of AD. In this study, we investigated the protective effect of cerebrosides obtained from sea cucumber against senescence-accelerated mouse prone 8 (SAMP8) mice in vivo. We also studied the effect of cerebrosides on Aβ-induced cytotoxicity on the rat pheochromocytoma cell (PC12) and the underlying molecular mechanisms. Cerebrosides ameliorated learning and memory deficits and the Aβ accumulation in demented mice, decreased the content of malondialdehyde (MDA), 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-OHdG), 8-hydroxy-2'-deoxyguanosine (8-oxo-G), and nitric oxide (NO), and enhanced the superoxide dismutase (SOD) activity significantly. The neuroprotective effect of sea cucumber cerebrosides (SCC) was also verified in vitro: the cerebrosides increased the survival rate of PC12 cells, recovered the cellular morphology, downregulated the protein levels of Caspase-9, cleaved Caspase-3, total Caspase-3, and Bax, and upregulated the protein level of Bcl-2, revealing that cerebrosides could inhibit Aβ-induced cell apoptosis. The results showed the protective effect of SCC was regulated by the mitochondria-dependent apoptotic pathway. Our results provide a new approach to developing the marine organisms as functional foods for neuroprotection.

G-theory: The generator of M-theory and supersymmetry

NASA Astrophysics Data System (ADS)

Sepehri, Alireza; Pincak, Richard

2018-04-01

In string theory with ten dimensions, all Dp-branes are constructed from D0-branes whose action has two-dimensional brackets of Lie 2-algebra. Also, in M-theory, with 11 dimensions, all Mp-branes are built from M0-branes whose action contains three-dimensional brackets of Lie 3-algebra. In these theories, the reason for difference between bosons and fermions is unclear and especially in M-theory there is not any stable object like stable M3-branes on which our universe would be formed on it and for this reason it cannot help us to explain cosmological events. For this reason, we construct G-theory with M dimensions whose branes are formed from G0-branes with N-dimensional brackets. In this theory, we assume that at the beginning there is nothing. Then, two energies, which differ in their signs only, emerge and produce 2M degrees of freedom. Each two degrees of freedom create a new dimension and then M dimensions emerge. M-N of these degrees of freedom are removed by symmetrically compacting half of M-N dimensions to produce Lie-N-algebra. In fact, each dimension produces a degree of freedom. Consequently, by compacting M-N dimensions from M dimensions, N dimensions and N degrees of freedom is emerged. These N degrees of freedoms produce Lie-N-algebra. During this compactification, some dimensions take extra i and are different from other dimensions, which are known as time coordinates. By this compactification, two types of branes, Gp and anti-Gp-branes, are produced and rank of tensor fields which live on them changes from zero to dimension of brane. The number of time coordinates, which are produced by negative energy in anti-Gp-branes, is more sensible to number of times in Gp-branes. These branes are compactified anti-symmetrically and then fermionic superpartners of bosonic fields emerge and supersymmetry is born. Some of gauge fields play the role of graviton and gravitino and produce the supergravity. The question may arise that what is the physical reason

Evaluation of TLR Agonists as Potential Mucosal Adjuvants for HIV gp140 and Tetanus Toxoid in Mice

PubMed Central

Buffa, Viviana; Klein, Katja; Fischetti, Lucia; Shattock, Robin J.

2012-01-01

In the present study we investigate the impact of a range of TLR ligands and chitosan as potential adjuvants for different routes of mucosal immunisation (sublingual (SL), intranasal (IN), intravaginal (IVag) and a parenteral route (subcutaneous (SC)) in the murine model. We assess their ability to enhance antibody responses to HIV-1 CN54gp140 (gp140) and Tetanus toxoid (TT) in systemic and vaginal compartments. A number of trends were observed by route of administration. For non-adjuvanted antigen, SC>SL>IN immunisation with respect to systemic IgG responses, where endpoint titres were greater for TT than for gp140. In general, co-administration with adjuvants increased specific IgG responses where IN = SC>SL, while in the vaginal compartment IN>SL>SC for specific IgA. In contrast, for systemic and mucosal IgA responses to antigen alone SL>IN = SC. A number of adjuvants increased specific systemic IgA responses where in general IN>SL>SC immunisation, while for mucosal responses IN = SL>SC. In contrast, direct intravaginal immunisation failed to induce any detectable systemic or mucosal responses to gp140 even in the presence of adjuvant. However, significant systemic IgG responses to TT were induced by intravaginal immunisation with or without adjuvant, and detectable mucosal responses IgG and IgA were observed when TT was administered with FSL-1 or Poly I∶C. Interestingly some TLRs displayed differential activity dependent upon the route of administration. MPLA (TLR4) suppressed systemic responses to SL immunisation while enhancing responses to IN or SC immunisation. CpG B enhanced SL and IN responses, while having little or no impact on SC immunisation. These data demonstrate important route, antigen and adjuvant effects that need to be considered in the design of mucosal vaccine strategies. PMID:23272062

HIV-1 Gp120 clade B/C induces a GRP78 driven cytoprotective mechanism in astrocytoma

PubMed Central

López, Sheila N.; Rodríguez-Valentín, Madeline; Rivera, Mariela; Rodríguez, Maridaliz; Babu, Mohan; Cubano, Luis A.; Xiong, Huangui; Wang, Guangdi; Kucheryavykh, Lilia; Boukli, Nawal M.

2017-01-01

HIV-1 clades are known to be one of the key factors implicated in modulating HIV-associated neurocognitive disorders. HIV-1 B and C clades account for the majority of HIV-1 infections, clade B being the most neuropathogenic. The mechanisms behind HIV-mediated neuropathogenesis remain the subject of active research. We hypothesized that HIV-1 gp120 clade B and C proteins may exert differential proliferation, cell survival and NeuroAIDS effects in human astrocytoma cells via the Unfolded Protein Response, an endoplasmic reticulum- based cytoprotective mechanism. The differential effect of gp120 clade B and C was evaluated using for the first time a Tandem Mass Tag isobaric labeling quantitative proteomic approach. Flow cytometry analyses were performed for cell cycle and cell death identification. Among the proteins differentiated by HIV-1 gp120 proteins figure cytoskeleton, oxidative stress, UPR markers and numerous glycolytic metabolism enzymes. Our results demonstrate that HIV-1 gp120 B induced migration, proliferative and protective responses granted by the expression of GRP78, while HIV-1 gp120 C induced the expression of key inflammatory and pro-apoptotic markers. These novel findings put forward the first evidence that GRP78 is a key player in HIV-1 clade B and C neuropathogenic discrepancies and can be used as a novel target for immunotherapies. PMID:28978127

Integrated musculoskeletal service design by GP consortia

PubMed Central

2011-01-01

Background Musculoskeletal conditions are common in primary care and are associated with significant co-morbidity and impairment of quality of life. Traditional care pathways combined community-based physiotherapy with GP referral to hospital for a consultant opinion. Locally, this model led to only 30% of hospital consultant orthopaedic referrals being listed for surgery, with the majority being referred for physiotherapy. The NHS musculoskeletal framework proposed the use of interface services to provide expertise in diagnosis, triage and management of musculoskeletal problems not requiring surgery. The White Paper Equity and Excellence: Liberating the NHS has replaced PCT commissioning with GP consortia, who will lead future service development. Setting Primary and community care, integrated with secondary care, in the NHS in England. Question How can GP consortia lead the development of integrated musculoskeletal services? Review: The Ealing experience We explore here how Ealing implemented a ‘See and Treat’ interface clinic model to improve surgical conversion rates, reduce unnecessary hospital referrals and provide community treatment more efficiently than a triage model. A high-profile GP education programme enabled GPs to triage in their practices and manage patients without referral. Conclusion In Ealing, we demonstrated that most patients with musculoskeletal conditions can be managed in primary care and community settings. The integrated musculoskeletal service provides clear and fast routes to secondary care. This is both clinically effective and cost-effective, reserving hospital referral for patients most likely to need surgery. GP consortia, in conjunction with strong clinical leadership, inbuilt organisational and professional learning, and a GP champion, are well placed to deliver service redesign by co-ordinating primary care development, local commissioning of community services and the acute commissioning vehicles responsible for secondary

Characterization of the IPEC-J2 MDR1 (iP-gp) cell line as a tool for identification of P-gp substrates.

PubMed

Ozgür, Burak; Saaby, Lasse; Langthaler, Kristine; Brodin, Birger

2018-01-15

Recently, we transfected the porcine intestinal cell line IPEC-J2, with human P-glycoprotein (P-gp, ABCB1). The resulting cell line, iP-gp, has a high expression of functional human P-gp in the apical membrane, and a low expression of nonhuman ATP-binding cassette (ABC) transporters. The aim of the present work was to investigate the usability of iP-gp cell line for determining transepithelial transport kinetics of the prototypical P-gp substrates digoxin and rhodamine 123. The cell line generated tight monolayers after 16days of culture, reflected by high transepithelial electrical resistance values (TEER>15,000Ω·cm 2 ), immunocytochemistry and low fluxes of the paracellular flux marker [ 14 C]-mannitol. Monolayer integrity was not affected the common solvents dimethyl sulfoxide (DMSO), methanol and ethanol in concentrations up to 2% (v/v). Transepithelial fluxes of [ 3 H]-labeled digoxin and rhodamine 123 were measured at varying donor concentrations, and kinetic parameters were estimated. K m and V max of P-gp mediated basolateral-to-apical (B-A) flux of rhodamine 123 were estimated to 332±124μM and 111±16pmol·cm -2 ·min -1 (n=3, total N=6), respectively. V max and K m of digoxin B-A flux could not be estimated due to the low aqueous solubility of digoxin. The half maximal inhibitory concentrations (IC 50 ) of the selective P-gp inhibitor, zosuquidar (LY-335979), were estimated to 0.05±0.01μM (n=3, total N=6) and 0.04±0.01μM (n=3, total N=6) in transport experiments with digoxin and rhodamine 123 as substrates, respectively. Bidirectional fluxes of digoxin and rhodamine 123 were measured in transfected Madin Darby canine kidney cells (MDCK II MDR1) and compared with the fluxes obtained with the iP-gp cell monolayers. Efflux ratios were highest in the iP-gp cells, due to a tighter paracellular pathway. In conclusion, both digoxin and rhodamine 123 could be used to obtain IC 50 values of inhibition, K i values were only possible to obtain using

gp160 of HIV-I synthesized by persistently infected Molt-3 cells is terminally glycosylated: evidence that cleavage of gp160 occurs subsequent to oligosaccharide processing.

PubMed

Merkle, R K; Helland, D E; Welles, J L; Shilatifard, A; Haseltine, W A; Cummings, R D

1991-10-01

The envelope glycoprotein of HIV-I in infected, cultured human T cells is synthesized as a precursor of apparent Mr 160 kDa (gp160) and is cleaved to two glycoproteins, gp120 and gp41, which are the mature envelope glycoproteins in the virus. Neither the temporal and spatial features of glycosylation nor the oligosaccharide processing and proteolytic cleavage of the envelope glycoprotein are well understood. To understand more about these events, we investigated the glycosylation and cleavage of the envelope glycoproteins in the CD4+ human cell line, Molt-3, persistently infected with HIV-I (HTLV IIIB). The carbohydrate analysis of gp160 and gp120 and the behavior of the glycoproteins and glycopeptides derived from them on immobilized lectins demonstrate that both of these glycoproteins contain complex- and high-mannose-type Asn-linked oligosaccharides. In addition, the N-glycanase-resistant oligosaccharides of gp120 were found to contain N-acetyl-galactosamine, a common constituent of Ser/Thr-linked oligosaccharides. Pulse-chase analysis of the conversion of [35S]cysteine-labeled gp160 showed that in Molt-3 cells it takes about 2 h for gp120 to arise with a half-time of conversion of about 5 h. At its earliest detectable occurrence, gp120 was found to contain complex-type Asn-linked oligosaccharides. Taken together, these results indicate that proteolytic cleavage of gp160 to gp120 and gp41 occurs either within the trans-Golgi or in a distal compartment.

IFN-Gamma-Dependent and Independent Mechanisms of CD4⁺ Memory T Cell-Mediated Protection from Listeria Infection.

PubMed

Meek, Stephanie M; Williams, Matthew A

2018-02-13

While CD8⁺ memory T cells can promote long-lived protection from secondary exposure to intracellular pathogens, less is known regarding the direct protective mechanisms of CD4⁺ T cells. We utilized a prime/boost model in which mice are initially exposed to an acutely infecting strain of lymphocytic choriomeningitis virus (LCMV), followed by a heterologous rechallenge with Listeria monocytogenes recombinantly expressing the MHC Class II-restricted LCMV epitope, GP 61-80 (Lm-gp61). We found that heterologous Lm-gp61 rechallenge resulted in robust activation of CD4⁺ memory T cells and that they were required for rapid bacterial clearance. We further assessed the relative roles of TNF and IFNγ in the direct anti-bacterial function of CD4⁺ memory T cells. We found that disruption of TNF resulted in a complete loss of protection mediated by CD4⁺ memory T cells, whereas disruption of IFNγ signaling to macrophages results in only a partial loss of protection. The protective effect mediated by CD4⁺ T cells corresponded to the rapid accumulation of pro-inflammatory macrophages in the spleen and an altered inflammatory environment in vivo. Overall, we conclude that protection mediated by CD4⁺ memory T cells from heterologous Listeria challenge is most directly dependent on TNF, whereas IFNγ only plays a minor role.

Vesicular stomatitis virus-based Ebola vaccines with improved cross-protective efficacy.

PubMed

Marzi, Andrea; Ebihara, Hideki; Callison, Julie; Groseth, Allison; Williams, Kinola J; Geisbert, Thomas W; Feldmann, Heinz

2011-11-01

For Ebola virus (EBOV), 4 different species are known: Zaire, Sudan, Côte d'Ivoire, and Reston ebolavirus. The newly discovered Bundibugyo ebolavirus has been proposed as a 5th species. So far, no cross-neutralization among EBOV species has been described, aggravating progress toward cross-species protective vaccines. With the use of recombinant vesicular stomatitis virus (rVSV)-based vaccines, guinea pigs could be protected against Zaire ebolavirus (ZEBOV) infection only when immunized with a vector expressing the homologous, but not a heterologous, EBOV glycoprotein (GP). However, infection of guinea pigs with nonadapted wild-type strains of the different species resulted in full protection of all animals against subsequent challenge with guinea pig-adapted ZEBOV, showing that cross-species protection is possible. New vectors were generated that contain EBOV viral protein 40 (VP40) or EBOV nucleoprotein (NP) as a second antigen expressed by the same rVSV vector that encodes the heterologous GP. After applying a 2-dose immunization approach, we observed an improved cross-protection rate, with 5 of 6 guinea pigs surviving the lethal ZEBOV challenge if vaccinated with rVSV-expressing SEBOV-GP and -VP40. Our data demonstrate that cross-protection between the EBOV species can be achieved, although EBOV-GP alone cannot induce the required immune response.

Internalization and Axonal Transport of the HIV Glycoprotein gp120

PubMed Central

Berth, Sarah; Caicedo, Hector Hugo; Sarma, Tulika; Morfini, Gerardo

2015-01-01

The HIV glycoprotein gp120, a neurotoxic HIV glycoprotein that is overproduced and shed by HIV-infected macrophages, is associated with neurological complications of HIV such as distal sensory polyneuropathy, but interactions of gp120 in the peripheral nervous system remain to be characterized. Here, we demonstrate internalization of extracellular gp120 in a manner partially independent of binding to its coreceptor CXCR4 by F11 neuroblastoma cells and cultured dorsal root ganglion neurons. Immunocytochemical and pharmacological experiments indicate that gp120 does not undergo trafficking through the endolysosomal pathway. Instead, gp120 is mainly internalized through lipid rafts in a cholesterol-dependent manner, with a minor fraction being internalized by fluid phase pinocytosis. Experiments using compartmentalized microfluidic chambers further indicate that, after internalization, endocytosed gp120 selectively undergoes retrograde but not anterograde axonal transport from axons to neuronal cell bodies. Collectively, these studies illuminate mechanisms of gp120 internalization and axonal transport in peripheral nervous system neurons, providing a novel framework for mechanisms for gp120 neurotoxicity. PMID:25636314

Immunological activation following transcutaneous delivery of HR-gp100 protein

PubMed Central

Frankenburg, Shoshana; Grinberg, Igor; Bazak, Ziva; Fingerut, Lena; Pitcovski, Jacob; Gorodetsky, Raphael; Peretz, Tamar; Spira, Ram M.; Skornik, Yehuda; Goldstein, Ronald S.

2009-01-01

Transcutaneous immunization aims at taking advantage of the skin’s immune system for the purpose of immunoprotection. In the present study we evaluated the potential of topical delivery of a recombinant melanoma protein, HR-gp100, derived from a shorter sequence of the native gp100 gene. The protein was applied on the skin, with and without the addition of two forms of heat labile enterotoxin (nLT and LTB). HR-gp100 fused to Haptide, a cell penetrating 20mer peptide (HR-gp100H) was also tested. Topical HR-gp100 and HR-gp100H application on the ears of mice elicited the production of specific antibodies, and transcutaneous delivery to intact human skin induced dose-dependent LC activation. nLT and LTB also activated LC, but did not further increase the activation induced by HR-gp100. These results show that HR-gp100, an antigenic tumor-derived protein, activates the immune system following transcutaneous delivery, as shown by both Langerhans cell activation and induction of antibody production. PMID:17493711

Functional characterization of Autographa californica multiple nucleopolyhedrovirus gp16 (ac130)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, Ming; Huang, Cui; Qian, Duo-Duo

2014-09-15

To investigate the function of Autographa californica multiple nucleopolyhedrovirus (AcMNPV) gp16, multiple gp16-knockout and repair mutants were constructed and characterized. No obvious difference in productivity of budded virus, DNA synthesis, late gene expression and morphogenesis was observed between gp16-knockout and repair viruses, but gp16 deletion resulted in six hours of lengthening in ST{sub 50} to the third instar Spodoptera exigua larvae in bioassays. GP16 was fractionated mainly in the light membrane fraction, by subcellular fractionation. A GP16-EGFP fusion protein was predominantly localized close around the nuclear membrane in infected cells, being coincident with formation of the vesicles associated with themore » nuclear membrane, which hosted nucleocapsids released from the nucleus. These data suggest that gp16 is not required for viral replication, but may be involved in membrane trafficking associated with the envelopment/de-envelopment of budded viruses when they cross over the nuclear membrane and pass through cytoplasm. - Highlights: • gp16 knockout and repair mutants of AcMNPV were constructed and characterized. • AcMNPV gp16 is not essential to virus replication. • Deletion of gp16 resulted in time lengthening to kill S. exigua larvae. • GP16 was localized close around the nuclear membrane of infected cells. • GP16 was fractionated in the light membrane fraction in subcellular fractionation.« less

Active immunity induced by passive IgG post-exposure protection against ricin.

PubMed

Hu, Charles Chen; Yin, Junfei; Chau, Damon; Cherwonogrodzky, John W; Hu, Wei-Gang

2014-01-21

Therapeutic antibodies can confer an instant protection against biothreat agents when administered. In this study, intact IgG and F(ab')2 from goat anti-ricin hyperimmune sera were compared for the protection against lethal ricin mediated intoxication. Similar ricin-binding affinities and neutralizing activities in vitro were observed between IgG and F(ab')2 when compared at the same molar concentration. In a murine ricin intoxication model, both IgG and F(ab')2 could rescue 100% of the mice by one dose (3 nmol) administration of antibodies 1 hour after 5 × LD50 ricin challenge. Nine days later, when the rescued mice received a second ricin challenge (5 × LD50), only the IgG-treated mice survived; the F(ab')2-treated mice did not. The experimental design excluded the possibility of residual goat IgG responsible for the protection against the second ricin challenge. Results confirmed that the active immunity against ricin in mice was induced quickly following the passive delivery of a single dose of goat IgG post-exposure. Furthermore, it was demonstrated that the induced active immunity against ricin in mice lasted at least 5 months. Therefore, passive IgG therapy not only provides immediate protection to the victim after ricin exposure, but also elicits an active immunity against ricin that subsequently results in long term protection.

Active Immunity Induced by Passive IgG Post-Exposure Protection against Ricin

PubMed Central

Hu, Charles Chen; Yin, Junfei; Chau, Damon; Cherwonogrodzky, John W.; Hu, Wei-Gang

2014-01-01

Therapeutic antibodies can confer an instant protection against biothreat agents when administered. In this study, intact IgG and F(ab’)2 from goat anti-ricin hyperimmune sera were compared for the protection against lethal ricin mediated intoxication. Similar ricin-binding affinities and neutralizing activities in vitro were observed between IgG and F(ab’)2 when compared at the same molar concentration. In a murine ricin intoxication model, both IgG and F(ab’)2 could rescue 100% of the mice by one dose (3 nmol) administration of antibodies 1 hour after 5 × LD50 ricin challenge. Nine days later, when the rescued mice received a second ricin challenge (5 × LD50), only the IgG-treated mice survived; the F(ab’)2-treated mice did not. The experimental design excluded the possibility of residual goat IgG responsible for the protection against the second ricin challenge. Results confirmed that the active immunity against ricin in mice was induced quickly following the passive delivery of a single dose of goat IgG post-exposure. Furthermore, it was demonstrated that the induced active immunity against ricin in mice lasted at least 5 months. Therefore, passive IgG therapy not only provides immediate protection to the victim after ricin exposure, but also elicits an active immunity against ricin that subsequently results in long term protection. PMID:24451844

Immune signatures of protective spleen memory CD8 T cells.

PubMed

Brinza, Lilia; Djebali, Sophia; Tomkowiak, Martine; Mafille, Julien; Loiseau, Céline; Jouve, Pierre-Emmanuel; de Bernard, Simon; Buffat, Laurent; Lina, Bruno; Ottmann, Michèle; Rosa-Calatrava, Manuel; Schicklin, Stéphane; Bonnefoy, Nathalie; Lauvau, Grégoire; Grau, Morgan; Wencker, Mélanie; Arpin, Christophe; Walzer, Thierry; Leverrier, Yann; Marvel, Jacqueline

2016-11-24

Memory CD8 T lymphocyte populations are remarkably heterogeneous and differ in their ability to protect the host. In order to identify the whole range of qualities uniquely associated with protective memory cells we compared the gene expression signatures of two qualities of memory CD8 T cells sharing the same antigenic-specificity: protective (Influenza-induced, Flu-TM) and non-protective (peptide-induced, TIM) spleen memory CD8 T cells. Although Flu-TM and TIM express classical phenotypic memory markers and are polyfunctional, only Flu-TM protects against a lethal viral challenge. Protective memory CD8 T cells express a unique set of genes involved in migration and survival that correlate with their unique capacity to rapidly migrate within the infected lung parenchyma in response to influenza infection. We also enlighten a new set of poised genes expressed by protective cells that is strongly enriched in cytokines and chemokines such as Ccl1, Ccl9 and Gm-csf. CCL1 and GM-CSF genes are also poised in human memory CD8 T cells. These immune signatures are also induced by two other pathogens (vaccinia virus and Listeria monocytogenes). The immune signatures associated with immune protection were identified on circulating cells, i.e. those that are easily accessible for immuno-monitoring and could help predict vaccines efficacy.

Neonatal Fc receptor for IgG (FcRn) regulates cross-presentation of IgG immune complexes by CD8−CD11b+ dendritic cells

PubMed Central

Baker, Kristi; Qiao, Shuo-Wang; Kuo, Timothy T.; Aveson, Victoria G.; Platzer, Barbara; Andersen, Jan-Terje; Sandlie, Inger; Chen, Zhangguo; de Haar, Colin; Lencer, Wayne I.; Fiebiger, Edda; Blumberg, Richard S.

2011-01-01

Cross-presentation of IgG-containing immune complexes (ICs) is an important means by which dendritic cells (DCs) activate CD8+ T cells, yet it proceeds by an incompletely understood mechanism. We show that monocyte-derived CD8−CD11b+ DCs require the neonatal Fc receptor for IgG (FcRn) to conduct cross-presentation of IgG ICs. Consequently, in the absence of FcRn, Fcγ receptor (FcγR)-mediated antigen uptake fails to initiate cross-presentation. FcRn is shown to regulate the intracellular sorting of IgG ICs to the proper destination for such cross-presentation to occur. We demonstrate that FcRn traps antigen and protects it from degradation within an acidic loading compartment in association with the rapid recruitment of key components of the phagosome-to-cytosol cross-presentation machinery. This unique mechanism thus enables cross-presentation to evolve from an atypically acidic loading compartment. FcRn-driven cross-presentation is further shown to control cross-priming of CD8+ T-cell responses in vivo such that during chronic inflammation, FcRn deficiency results in inadequate induction of CD8+ T cells. These studies thus demonstrate that cross-presentation in CD8−CD11b+ DCs requires a two-step mechanism that involves FcγR-mediated internalization and FcRn-directed intracellular sorting of IgG ICs. Given the centrality of FcRn in controlling cross-presentation, these studies lay the foundation for a unique means to therapeutically manipulate CD8+ T-cell responses. PMID:21628593

GP workforce participation in Tasmania.

PubMed

Gartlan, Jan; Male, Sarah; Donaldson, Lawrence; Nelson, Mark; Winzenberg, Tania

2007-05-01

Predicting future general practitioner workforce requires information about how demographic factors affect GP workforce participation. Regional differences might not be accounted for in national studies. The authors aimed to determine GP characteristics associated with workforce participation in Tasmania. A self administered census of Tasmanian GPs measured GP demographics and the number of 3.5 hour sessions worked in 1 week in 2005. Four hundred and three GPs responded (76% response rate). Six percent of GPs were on leave at the time of the census. Age, gender and graduation outside of Australia, the United Kingdom or Ireland were associated with workforce participation, but rurality had no effect. The effect of age was modified by gender with women aged over 55 years being more likely to work full time (p=0.03). Factors affecting workforce participation may vary across regions. Predictions based on national models may need to be interpreted in the context of local circumstances.

16 CFR Appendix G8 to Part 305 - Boilers (Electric)

Code of Federal Regulations, 2014 CFR

2014-01-01

... 16 Commercial Practices 1 2014-01-01 2014-01-01 false Boilers (Electric) G8 Appendix G8 to Part... LABELING RULEâ) Appendix G8 to Part 305—Boilers (Electric) Type Range of annual fuel utilization efficiencies (AFUEs) Low High Electric Boilers 100 100 [78 FR 8377, Feb. 6, 2013] ...

Gravitational Physics Research

NASA Technical Reports Server (NTRS)

Wu, S. T.

2000-01-01

Gravitational physics research at ISPAE is connected with NASA's Relativity Mission (Gravity Probe B (GP-B)) which will perform a test of Einstein's General Relativity Theory. GP-B will measure the geodetic and motional effect predicted by General Relativity Theory with extremely stable and sensitive gyroscopes in an earth orbiting satellite. Both effects cause a very small precession of the gyroscope spin axis. The goal of the GP-B experiment is the measurement of the gyroscope precession with very high precision. GP-B is being developed by a team at Stanford University and is scheduled for launch in the year 2001. The related UAH research is a collaboration with Stanford University and MSFC. This research is focussed primarily on the error analysis and data reduction methods of the experiment but includes other topics concerned with experiment systems and their performance affecting the science measurements. The hydrogen maser is the most accurate and stable clock available. It will be used in future gravitational physics missions to measure relativistic effects such as the second order Doppler effect. The HMC experiment, currently under development at the Smithsonian Astrophysical Observatory (SAO), will test the performance and capability of the hydrogen maser clock for gravitational physics measurements. UAH in collaboration with the SAO science team will study methods to evaluate the behavior and performance of the HMC. The GP-B data analysis developed by the Stanford group involves complicated mathematical operations. This situation led to the idea to investigate alternate and possibly simpler mathematical procedures to extract the GP-B measurements form the data stream. Comparison of different methods would increase the confidence in the selected scheme.

Predominant prevalence of human rotaviruses with the G1P[8] and G8P[8] genotypes with a short RNA profile in 2013 and 2014 in Sukhothai and Phetchaboon provinces, Thailand.

PubMed

Guntapong, Ratigorn; Tacharoenmuang, Ratana; Singchai, Phakapun; Upachai, Sompong; Sutthiwarakom, Karun; Komoto, Satoshi; Tsuji, Takao; Tharmaphornpilas, Piyanit; Yoshikawa, Tetsushi; Sangkitporn, Somchai; Taniguchi, Koki

2017-04-01

Of 2,754 stool specimens collected from children with acute gastroenteritis during 2013-2014 in Sukhothai and Phetchaboon provinces, Thailand, 666 (24.2%) were positive for rotavirus A (RVA) in polyacrylamide gel electrophoresis (PAGE). The G and P types of all RVA-positive specimens were determined by semi-nested RT-PCR. G1P[8] (56.5%) was most prevalent, followed by G2P[4] (22.1%). Unusual G8P[8] human RVAs (HuRVAs) were detected at a high frequency (20.0%). Interestingly, 171 of the 376 G1P[8] HuRVAs and all of the 133 G8P[8] HuRVAs showed a short RNA pattern in PAGE. Thus, it was shown that the properties of HuRVAs have been markedly unusual in recent years in Thailand. J. Med. Virol. 89:615-620, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Genetic Pathway of HIV-1 Resistance to Novel Fusion Inhibitors Targeting the Gp41 Pocket

PubMed Central

Su, Yang; Chong, Huihiui; Xiong, Shengwen; Qiao, Yuanyuan; Qiu, Zonglin

2015-01-01

ABSTRACT The peptide drug enfuvirtide (T20) is the only HIV-1 fusion inhibitor in clinical use, but it easily induces drug resistance, calling for new strategies for developing effective drugs. On the basis of the M-T hook structure, we recently developed highly potent short-peptide HIV-1 fusion inhibitors (MTSC22 and HP23), which mainly target the conserved gp41 pocket and possess high genetic barriers to resistance. Here, we focused on the selection and characterization of HIV-1 escape mutants of MTSC22, which revealed new resistance pathways and mechanisms. Two mutations (E49K and L57R) located at the inhibitor-binding site and two mutations (N126K and E136G) located at the C-terminal heptad repeat region of gp41 were identified as conferring high resistance either singly or in combination. While E49K reduced the C-terminal binding of inhibitors via an electrostatic repulsion, L57R dramatically disrupted the N-terminal binding of M-T hook structure and pocket-binding domain. Unlike E49K and N126K, which enhanced the stability of the endogenous viral six-helical bundle core (6-HB), L57R and E136G conversely destabilized the 6-HB structure. We also demonstrated that both primary and secondary mutations caused the structural changes in 6-HB and severely impaired the capability for HIV-1 entry. Collectively, our data provide novel insights into the mechanisms of short-peptide fusion inhibitors targeting the gp41 pocket site and help increase our understanding of the structure and function of gp41 and HIV-1 evolution. IMPORTANCE The deep pocket on the N-trimer of HIV-1 gp41 has been considered an ideal drug target because of its high degree of conservation and essential role in viral entry. Short-peptide fusion inhibitors, which contain an M-T hook structure and mainly target the pocket site, show extremely high binding and inhibitory activities as well as high genetic barriers to resistance. In this study, the HIV-1 mutants resistant to MTSC22 were selected and

The multiple roles of sGP in Ebola pathogenesis.

PubMed

de La Vega, Marc-Antoine; Wong, Gary; Kobinger, Gary P; Qiu, Xiangguo

2015-02-01

Ebola causes severe hemorrhagic fever in humans and nonhuman primates, and there are currently no approved therapeutic countermeasures. The virulence of Ebola virus (EBOV) may be partially attributed to the secreted glycoprotein (sGP), which is the main product transcribed from its GP gene. sGP is secreted from infected cells and can be readily detected in the serum of EBOV-infected hosts. This review summarizes the multiple roles that sGP may play during infection and highlights the implications for the future design of vaccines and treatments.

The Multiple Roles of sGP in Ebola Pathogenesis

PubMed Central

de La Vega, Marc-Antoine; Wong, Gary; Kobinger, Gary P.

2015-01-01

Abstract Ebola causes severe hemorrhagic fever in humans and nonhuman primates, and there are currently no approved therapeutic countermeasures. The virulence of Ebola virus (EBOV) may be partially attributed to the secreted glycoprotein (sGP), which is the main product transcribed from its GP gene. sGP is secreted from infected cells and can be readily detected in the serum of EBOV-infected hosts. This review summarizes the multiple roles that sGP may play during infection and highlights the implications for the future design of vaccines and treatments. PMID:25354393

8 CFR 244.14 - Withdrawal of Temporary Protected Status.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 8 Aliens and Nationality 1 2012-01-01 2012-01-01 false Withdrawal of Temporary Protected Status... TEMPORARY PROTECTED STATUS FOR NATIONALS OF DESIGNATED STATES § 244.14 Withdrawal of Temporary Protected Status. (a) Authority of USCIS. USCIS may withdraw the status of an alien granted Temporary Protected...

8 CFR 244.14 - Withdrawal of Temporary Protected Status.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 8 Aliens and Nationality 1 2014-01-01 2014-01-01 false Withdrawal of Temporary Protected Status... TEMPORARY PROTECTED STATUS FOR NATIONALS OF DESIGNATED STATES § 244.14 Withdrawal of Temporary Protected Status. (a) Authority of USCIS. USCIS may withdraw the status of an alien granted Temporary Protected...

8 CFR 244.14 - Withdrawal of Temporary Protected Status.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 8 Aliens and Nationality 1 2013-01-01 2013-01-01 false Withdrawal of Temporary Protected Status... TEMPORARY PROTECTED STATUS FOR NATIONALS OF DESIGNATED STATES § 244.14 Withdrawal of Temporary Protected Status. (a) Authority of USCIS. USCIS may withdraw the status of an alien granted Temporary Protected...

Levels of HIV1 gp120 3D B-cell epitopes mutability and variability: searching for possible vaccine epitopes.

PubMed

Khrustalev, Vladislav Victorovich

2010-01-01

We used a DiscoTope 1.2 (http://www.cbs.dtu.dk/services/DiscoTope/), Epitopia (http://epitopia.tau.ac.il/) and EPCES (http://www.t38.physik.tu-muenchen.de/programs.htm) algorithms to map discontinuous B-cell epitopes in HIV1 gp120. The most mutable nucleotides in HIV genes are guanine (because of G to A hypermutagenesis) and cytosine (because of C to U and C to A mutations). The higher is the level of guanine and cytosine usage in third (neutral) codon positions and the lower is their level in first and second codon positions of the coding region, the more stable should be an epitope encoded by this region. We compared guanine and cytosine usage in regions coding for five predicted 3D B-cell epitopes of gp120. To make this comparison we used GenBank resource: 385 sequences of env gene obtained from ten HIV1-infected individuals were studied (http://www.barkovsky.hotmail.ru/Data/Seqgp120.htm). The most protected from nonsynonymous nucleotide mutations of guanine and cytosine 3D B-cell epitope is situated in the first conserved region of gp120 (it is mapped from 66th to 86th amino acid residue). We applied a test of variability to confirm this finding. Indeed, the less mutable predicted B-cell epitope is the less variable one. MEGA4 (standard PAM matrix) was used for the alignments and "VVK Consensus" algorithm (http://www.barkovsky.hotmail.ru) was used for the calculations.

HIV-1 Envelope gp41 Antibodies Can Originate from Terminal Ileum B Cells that Share Cross-Reactivity with Commensal Bacteria

PubMed Central

Trama, Ashley M.; Moody, M. Anthony; Alam, S. Munir; Jaeger, Frederick H.; Lockwood, Bradley; Parks, Robert; Lloyd, Krissey E.; Stolarchuk, Christina; Scearce, Richard; Foulger, Andrew; Marshall, Dawn J.; Whitesides, John F.; Jeffries, Thomas L.; Wiehe, Kevin; Morris, Lynn; Lambson, Bronwen; Soderberg, Kelly; Hwang, Kwan-Ki; Tomaras, Georgia D.; Vandergrift, Nathan; Jackson, Katherine J.L.; Roskin, Krishna M.; Boyd, Scott D.; Kepler, Thomas B.; Liao, Hua-Xin; Haynes, Barton F.

2014-01-01

SUMMARY Monoclonal antibodies derived from blood plasma cells of acute HIV-1-infected individuals are predominantly targeted to the HIV Env gp41 and cross-reactive with commensal bacteria. To understand this phenomenon, we examined anti-HIV responses in ileum B cells using recombinant antibody technology and probed their relationship to commensal bacteria. The dominant ileum B cell response was to Env gp41. Remarkably, a majority (82%) of the ileum anti-gp41 antibodies cross-reacted with commensal bacteria, and of those, 43% showed non-HIV-1 antigen polyreactivity. Pyrosequencing revealed shared HIV-1 antibody clonal lineages between ileum and blood. Mutated immunoglobulin G antibodies cross-reactive with both Env gp41 and microbiota could also be isolated from the ileum of HIV-1 uninfected individuals. Thus, the gp41 commensal bacterial antigen cross-reactive antibodies originate in the intestine, and the gp41 Env response in HIV-1 infection can be derived from a preinfection memory B cell pool triggered by commensal bacteria that cross-react with Env. PMID:25121750

12 CFR 563g.8 - Use of the offering circular.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 12 Banks and Banking 5 2010-01-01 2010-01-01 false Use of the offering circular. 563g.8 Section 563g.8 Banks and Banking OFFICE OF THRIFT SUPERVISION, DEPARTMENT OF THE TREASURY SECURITIES OFFERINGS § 563g.8 Use of the offering circular. (a) An offering circular or amendment declared effective by the...

CpG Oligodeoxynucleotide and Montanide ISA 51 Adjuvant Combination Enhanced the Protective Efficacy of a Subunit Malaria Vaccine

PubMed Central

Kumar, Sanjai; Jones, Trevor R.; Oakley, Miranda S.; Zheng, Hong; Kuppusamy, Shanmuga P.; Taye, Alem; Krieg, Arthur M.; Stowers, Anthony W.; Kaslow, David C.; Hoffman, Stephen L.

2004-01-01

Unmethylated CpG dinucleotide motifs present in bacterial genomes or synthetic oligodeoxynucleotides (ODNs) serve as strong immunostimulatory agents in mice, monkeys and humans. We determined the adjuvant effect of murine CpG ODN 1826 on the immunogenicity and protective efficacy of the Saccharomyces cerevisiae-expressed 19-kDa C-terminal region of merozoite surface protein 1 (yMSP119) of the murine malaria parasite Plasmodium yoelii. We found that in C57BL/6 mice, following sporozoite challenge, the degree of protective immunity against malaria induced by yMSP119 in a formulation of Montanide ISA 51 (ISA) plus CpG ODN 1826 was similar or superior to that conferred by yMSP119 emulsified in complete Freund's adjuvant (CFA/incomplete Freund's adjuvant). In total, among mice immunized with yMSP119, 22 of 32 (68.7%) with ISA plus CpG 1826, 0 of 4 (0%) with CFA/incomplete Freund’s adjuvant, 0 of 4 (0%) with CpG 1826 mixed with ISA (no yMSP119), and 0 of 11 (0%) with CpG 1826 alone were completely protected against development of erythrocytic stage infection after sporozoite challenge. The adjuvant effect of CpG ODN 1826 was manifested as both significantly improved complete protection from malaria (defined as the absence of detectable erythrocytic form parasites) (P = 0.007, chi square) and reduced parasite burden in infected mice. In vivo depletions of interleukin-12 and gamma interferon cytokines and CD4+ and CD8+ T cells in vaccinated mice had no significant effect on immunity. On the other hand, immunoglobulin G (IgG) isotype levels appeared to correlate with protection. Inclusion of CpG ODN 1826 in the yMSP119 plus ISA vaccine contributed towards the induction of higher levels of IgG2a and IgG2b (Th1 type) antibodies, suggesting that CpG ODN 1826 caused a shift towards a Th1 type of immune response that could be responsible for the higher degree of protective immunity. Our results indicate that this potent adjuvant formulation should be further evaluated for use

Endosomal recognition of Lactococcus lactis G121 and its RNA by dendritic cells is key to its allergy-protective effects.

PubMed

Stein, Karina; Brand, Stephanie; Jenckel, André; Sigmund, Anna; Chen, Zhijian James; Kirschning, Carsten J; Kauth, Marion; Heine, Holger

2017-02-01

Bacterial cowshed isolates are allergy protective in mice; however, the underlying mechanisms are largely unknown. We examined the ability of Lactococcus lactis G121 to prevent allergic inflammatory reactions. We sought to identify the ligands and pattern recognition receptors through which L lactis G121 confers allergy protection. L lactis G121-induced cytokine release and surface expression of costimulatory molecules by untreated or inhibitor-treated (bafilomycin and cytochalasin D) human monocyte-derived dendritic cells (moDCs), bone marrow-derived mouse dendritic cells (BMDCs), and moDC/naive CD4 + T-cell cocultures were analyzed by using ELISA and flow cytometry. The pathology of ovalbumin-induced acute allergic airway inflammation after adoptive transfer of BMDCs was examined by means of microscopy. L lactis G121-treated murine BMDCs and human moDCs released T H 1-polarizing cytokines and induced T H 1 T cells. Inhibiting phagocytosis and endosomal acidification in BMDCs or moDCs impaired the release of T H 1-polarizing cytokines, costimulatory molecule expression, and T-cell activation on L lactis G121 challenge. In vivo allergy protection mediated by L lactis G121 was dependent on endosomal acidification in dendritic cells (DCs). Toll-like receptor (Tlr) 13 -/- BMDCs showed a weak response to L lactis G121 and were unresponsive to its RNA. The T H 1-polarizing activity of L lactis G121-treated human DCs was blocked by TLR8-specific inhibitors, mediated by L lactis G121 RNA, and synergistically enhanced by activation of nucleotide-binding oligomerization domain-containing protein (NOD) 2. Bacterial RNA is the main driver of L lactis G121-mediated protection against experimentally induced allergy and requires both bacterial uptake by DCs and endosomal acidification. In mice L lactis G121 RNA signals through TLR13; however, the most likely intracellular receptor in human subjects is TLR8. Copyright © 2016 American Academy of Allergy, Asthma & Immunology

In vitro and in vivo evaluation of the effects of piperine on P-gp function and expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Han Yi; Chin Tan, Theresa May; Lim, Lee-Yong

2008-08-01

Piperine, a major component of black pepper, is used as spice and nutrient enhancer. The purpose of the present study was to evaluate the effects of acute and prolonged piperine exposure on cellular P-gp expression and function in vitro and in vivo. Piperine at concentrations ranging from 10 to 100 {mu}M, determined by MTT assay to be non-cytotoxic, was observed to inhibit P-gp mediated efflux transport of [{sup 3}H]-digoxin across L-MDR1 and Caco-2 cell monolayers. The acute inhibitory effect was dependent on piperine concentration, with abolishment of [{sup 3}H]-digoxin polarized transport attained at 50 {mu}M of piperine. In contrast, prolongedmore » (48 and 72 h) co-incubation of Caco-2 cell monolayers with piperine (50 and 100 {mu}M) increased P-gp activity through an up-regulation of cellular P-gp protein and MDR1 mRNA levels. The up-regulated protein was functionally active, as demonstrated by a higher degree of [{sup 3}H]-digoxin efflux across the cell monolayers, but the induction was readily reversed by the removal of the spice from the culture medium. Peroral administration of piperine at the dose of 112 {mu}g/kg body weight/day to male Wistar rats for 14 consecutive days also led to increased intestinal P-gp levels. However, there was a concomitant reduction in the rodent liver P-gp although the kidney P-gp level was unaffected. Our data suggest that caution should be exercised when piperine is to be co-administered with drugs that are P-gp substrates, particularly for patients whose diet relies heavily on pepper.« less

Designing a Soluble Near Full-Length HIV-1 GP41 Trimer

DTIC Science & Technology

2012-11-26

envelope; gp41 trimer; bacteriophage T4 display; prehairpin fusion intermediate. Background: The envelope glycoprotein gp41 is a key component of...protein into trimers and defined oligomers. These gp41 trimers were displayed on bacteriophage T4 capsid nanoparticles by attaching to the small...Construction of the Expression Vectors —All the gp41 constructs were generated by splicing-by- overlap extension PCR using wild-type HXB2 gp41 DNA

8 CFR 244.14 - Withdrawal of Temporary Protected Status.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Withdrawal of Temporary Protected Status... TEMPORARY PROTECTED STATUS FOR NATIONALS OF DESIGNATED STATES § 244.14 Withdrawal of Temporary Protected... Protected Status under section 244 of the Act at any time upon the occurrence of any of the following: (1...

8 CFR 244.14 - Withdrawal of Temporary Protected Status.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Withdrawal of Temporary Protected Status... TEMPORARY PROTECTED STATUS FOR NATIONALS OF DESIGNATED STATES § 244.14 Withdrawal of Temporary Protected... Protected Status under section 244 of the Act at any time upon the occurrence of any of the following: (1...

Junior G8 Summit: Speaking Out with a "Passion for Peace"

ERIC Educational Resources Information Center

Education Canada, 2007

2007-01-01

The Junior G8 competition allows groups of young people from each of the G8 countries to have their voices heard on a global stage--the annual G8 summit. An international essay competition results in the selection of teams of students who travel to the G8 summit to provide a youth perspective on global issues. The 2006 competition focused on four…

Physical protection philosophy and techniques in Sweden

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dufva, B.

1988-01-01

The circumstances for the protection of nuclear power plants are special in Sweden. A very important factor is that armed guards at the facilities are alien to the Swedish society. They do not use them. The Swedish concept of physical protection accepts that the aggressor will get into the facility. With this in mind, the Swedish Nuclear Power Inspectorate (SKI) has established the policy that administrative, technical, and organizational measures will be directed toward preventing an aggressor from damaging the reactor, even if he has occupied the facility. In addition, the best conditions possible shall be established for the operatormore » and the police to reoccupy the plant. The author believes this policy is different from that of many other countries. Therefore, he focusses on the Swedish philosophy and techniques for the physical protection of nuclear power plants.« less

Structural delineation of a quaternary, cleavage-dependent epitope at the gp41-gp120 interface on intact HIV-1 Env trimers.

PubMed

Blattner, Claudia; Lee, Jeong Hyun; Sliepen, Kwinten; Derking, Ronald; Falkowska, Emilia; de la Peña, Alba Torrents; Cupo, Albert; Julien, Jean-Philippe; van Gils, Marit; Lee, Peter S; Peng, Wenjie; Paulson, James C; Poignard, Pascal; Burton, Dennis R; Moore, John P; Sanders, Rogier W; Wilson, Ian A; Ward, Andrew B

2014-05-15

All previously characterized broadly neutralizing antibodies to the HIV-1 envelope glycoprotein (Env) target one of four major sites of vulnerability. Here, we define and structurally characterize a unique epitope on Env that is recognized by a recently discovered family of human monoclonal antibodies (PGT151-PGT158). The PGT151 epitope is comprised of residues and glycans at the interface of gp41 and gp120 within a single protomer and glycans from both subunits of a second protomer and represents a neutralizing epitope that is dependent on both gp120 and gp41. Because PGT151 binds only to properly formed, cleaved trimers, this distinctive property, and its ability to stabilize Env trimers, has enabled the successful purification of mature, cleaved Env trimers from the cell surface as a complex with PGT151. Here we compare the structural and functional properties of membrane-extracted Env trimers from several clades with those of the soluble, cleaved SOSIP gp140 trimer. Copyright © 2014 Elsevier Inc. All rights reserved.

Protection from JP-8 jet fuel induced immunotoxicity by administration of aerosolized substance P.

PubMed

Harris, D T; Sakiestewa, D; Robledo, R F; Witten, M

1997-01-01

Chronic exposure to jet fuel has been shown to cause human liver dysfunction, emotional dysfunction, abnormal electroencephalograms, shortened attention spans, and decreased sensorimotor speed. The United States Air Force has decided to implement the widespread use of JP-8 jet fuel in its operations, although a thorough understanding of its potential effects upon exposed personnel is unclear. Exposure to potential environment toxicants such as JP-8 may have significant effects on host physiology. Previous studies in mice have shown that short-term, low concentration JP-8 exposure had significant effects on the immune system; e.g., decreased viable immune cell numbers, decreased immune organ weights, and loss on immune function that persisted for extended periods of time (i.e., up to 4 weeks post-exposure). Previous studies have shown that JP-8 induced pulmonary dysfunction was associated with a decrease in levels of the neuropeptide substance P (SP) in lung lavage fluids. It was found that administration of aerosolized SP was able to protect exposed animals from such JP-8 induced pulmonary changes. In the current study, aerosolized SP was analyzed for its effects on JP-i induced immunotoxicity in exposed mice. It was observed that SP administration could protect JP-8 exposed animals from losses of viable immune cell numbers, but not losses in immune organ weights. Further, exposure of animals to SP inhibitors generally increased the immunotoxicity of JP-8 exposure. SP appeared to act on all immune cell populations equally as analyzed by flow cytometry, as no one immune cell population appeared to be preferentially protected by SP. Also, SP administration was capable of protecting JP-8 exposed animals from loss of immune function at all concentrations of JP-8 utilized (250-2500 mg/m3). Significantly, SP only needed to be administered for 15 minutes after JP-8 exposure, and was active at both 1 microM and 1 nM concentrations. Thus, SP administration appears to be a

Does G6PD deficiency protect against cancer? A critical review.

PubMed Central

Cocco, P

1987-01-01

Previous observations on the lower mortality for cancer experienced in populations with a higher frequency of G6PD deficiency support biochemical studies on the role of G6PD during cell proliferation. The general agreement among experimental studies prevented a deeper analysis of the sources of what has been called "epidemiological evidence of the protective role of G6PD deficiency against cancer". This review analyses the methods and findings in those papers, stressing their limitations and emphasising that no final conclusions can be drawn from them. Preliminary results of ongoing epidemiological studies of G6PD deficiency and cancer are presented, although they do not prove or disprove the hypothesis that G6PD deficiency protects against cancer. PMID:3309118

Recombinant Influenza Virus Carrying the Conserved Domain of Respiratory Syncytial Virus (RSV) G Protein Confers Protection against RSV without inflammatory disease

PubMed Central

Lee, Yu-Na; Hwang, Hye Suk; Kim, Min-Chul; Lee, Young-Tae; Cho, Min-Kyoung; Kwon, Young-Man; Lee, Jong Seok; Plemper, Richard K.; Kang, Sang-Moo

2014-01-01

Respiratory syncytial virus (RSV) is one of the most important causes for viral lower respiratory tract disease in humans. There is no licensed RSV vaccine. Here, we generated recombinant influenza viruses (PR8/RSV.HA-G) carrying the chimeric constructs of hemagglutinin (HA) and central conserved-domains of the RSV G protein. PR8/RSV.HA-G virus showed lower pathogenicity without compromising immunogenicity in mice. Single intranasal inoculation of mice with PR8/RSV.HA-G induced IgG2a isotype dominant antibodies and RSV neutralizing activity. Mice with single intranasal inoculation of PR8/RSV.HA-G were protected against RSV infection as evidenced by significant reduction of lung viral loads to a detection limit upon RSV challenge. PR8/RSV.HA-G inoculation of mice did not induce pulmonary eosinophilia and inflammation upon RSV infection. These findings support a concept that recombinant influenza viruses carrying the RSV G conserved-domain can be developed as a promising RSV vaccine candidate without pulmonary disease. PMID:25553517

Contemporary conception of anti-G protection of cosmonauts in flights aboard "Soyuz" space vehicles.

PubMed

Kotovskaya, A R; Vil-Viliams, I F; Lukianiuk, V Yu

2004-07-01

To ensure safety of cosmonauts impacted by +Gx loads during insertion into orbit of a Soyuz-type space vehicle, it is critical to conduct appropriate medical selection of candidates to space flights, to give them proper complete physical and specialized centrifuge training, and to make it sure that at the moment of actual injection the cosmonaut's posture is optimal relative to the g-vector and that the body is tight fitting the custom-molded couch. No AGS is needed. For the purposes of protection of cosmonauts descending in the Soyuz vehicles, vital are countermeasures applied in the course of flight, water-salt supplements on the descent day, and the optimal posture, an anti-g suit, and a custom-molded couch with an additional body-restraint system and dampers used on the phase of reentry.

Hydrodynamic immunization leads to poor CD8 T-cell expansion, low frequency of memory CTLs and ineffective antiviral protection.

PubMed

Obeng-Adjei, N; Choo, D K; Weiner, D B

2013-10-01

Hepatotropic pathogens, such as hepatitis B (HBV) and hepatitis C (HCV), often escape cellular immune clearance resulting in chronic infection. As HBV and HCV infections are the most common causes of hepatocellular carcinoma (HCC), prevention of these infections is believed to be key to the prevention of HCC. It is believed that an effective immune therapy must induce strong cytotonic T lymphocytes (CTLs) that can migrate into the liver, where they can clear infected hepatocytes. Here, we compared the induction of CD8 T cells by two different DNA immunization methods for T-cell differentiation, function, memory programming and their distribution within relevant tissues in a highly controlled fashion. We used hydrodynamic tail vein injection of plasmid to establish liver-specific LCMV-gp antigen (Ag) transient expression, and studied CD8 T cells induced using the P14 transgenic mouse model. CD8 T cells from this group exhibited unique and limited expansion, memory differentiation, polyfunctionality and cytotoxicity compared with T cells generated in intramuscularly immunized mice. This difference in liver-generated expansion resulted in lower memory CD8 T-cell frequency, leading to reduced protection against lethal viral challenge. These data show an unusual induction of naive CD8 T cells contributed to the lower frequency of Ag-specific CTLs observed after immunization in the liver, suggesting that limited priming in liver compared with peripheral tissues is responsible for this outcome.

Maternal vitamin D₃ supplementation at 50 μg/d protects against low serum 25-hydroxyvitamin D in infants at 8 wk of age: a randomized controlled trial of 3 doses of vitamin D beginning in gestation and continued in lactation.

PubMed

March, Kaitlin M; Chen, Nancy N; Karakochuk, Crystal D; Shand, Antonia W; Innis, Sheila M; von Dadelszen, Peter; Barr, Susan I; Lyon, Michael R; Whiting, Susan J; Weiler, Hope A; Green, Tim J

2015-08-01

Vitamin D supplementation is recommended for breastfed infants. Maternal supplementation beginning in gestation is a potential alternative, but its efficacy in maintaining infant 25-hydroxyvitamin D [25(OH)D] concentration after birth is unknown. We determined the effect of 3 doses of maternal vitamin D supplementation beginning in gestation and continued in lactation on infant serum 25(OH)D and compared the prevalence of infant serum 25(OH)D cutoffs (>30, >40, >50, and >75 nmol/L) by dose at 8 wk of age. Pregnant women (n = 226) were randomly allocated to receive 10, 25, or 50 μg vitamin D₃/d from 13 to 24 wk of gestation until 8 wk postpartum, with no infant supplementation. Mother and infant blood was collected at 8 wk postpartum. At 8 wk postpartum, mean [nmol/L (95% CI)] infant 25(OH)D at 8 wk was higher in the 50-μg/d [75 (67, 83)] than in the 25-μg/d [52 (45, 58)] or 10-μg/d [45 (38, 52)] vitamin D groups (P < 0.05). Fewer infants born to mothers in the 50-μg/d group had a 25(OH)D concentration <30 nmol/L (indicative of deficiency) than infants in the 25- and 10-μg/d groups, respectively (2% compared with 16% and 43%; P < 0.05). Fewer than 15% of infants in the 10- or 25-μg/d groups achieved a 25(OH)D concentration >75 nmol/L compared with 44% in the 50-μg/d group (P < 0.05). Almost all infants (∼98%, n = 44) born to mothers in the 50-μg/d group achieved a 25(OH)D concentration >30 nmol/L. At 8 wk postpartum, mean maternal 25(OH)D concentration was higher in the 50-μg/d [88 (84, 91)] than in the 25-μg/d [78 (74, 81)] or 10-μg/d [69 (66, 73)] groups (P < 0.05). Maternal supplementation beginning in gestation with 50 μg vitamin D₃/d protects 98% of unsupplemented breastfed infants against 25(OH)D deficiency (<30 nmol/L) to at least 8 wk, whereas 10 or 25 μg vitamin D/d protects only 57% and 84% of infants, respectively. © 2015 American Society for Nutrition.

Mapping of the antigenic determinants of the Leishmania infantum gp63 protein recognized by antibodies elicited during canine visceral leishmaniasis.

PubMed

Morales, G; Carrillo, G; Requena, J M; Guzman, F; Gomez, L C; Patarroyo, M E; Alonso, C

1997-06-01

The gp63 gene encoding the major surface antigen of Leishmania infantum has been cloned and sequenced. In spite of the overall sequence homology with the gp63 genes from other Leishmania species, particularly with the constitutively expressed Leishmania chagasi Gp63 gene, the carboxy-terminal ends of these genes are clearly divergent (62% homology). To study the prevalence of anti-gp63 antibodies in the sera from dogs with visceral leishmaniasis, a recombinant L. infantum gp63 protein was expressed in Escherichia coli. It was found that 100% of the sera from these dogs recognized the recombinant gp63 protein, suggesting that it must function as a potent B cell immunogen during natural canine visceral leishmaniasis. However, heterogeneity in the level of response was observed. Fine mapping of the antigenic determinants was performed by means of 6 overlapping subfragments of the gp63 protein and by the use of a library of synthetic peptides. The data showed that there is some degree of immunological restriction in the recognition of the protein since reactivity was observed preferentially against the most divergent region. The epitope mapping of this region showed 2 immunodominant peptides the response to which seems to be preferentially of the IgG2 type.

Leishmania mexicana Gp63 cDNA Using Gene Gun Induced Higher Immunity to L. mexicana Infection Compared to Soluble Leishmania Antigen in BALB/C

PubMed Central

Rezvan, H; Rees, R; Ali, SA

2011-01-01

Background Leishmaniasis is a worldwide disease prevalent in tropical and sub tropical countries. Many attempts have been made and different strategies have been approached to develop a potent vaccine against Leishmania. DNA immunisation is a method, which is shown to be effective in Leishmania vaccination. Leishmania Soluble Antigen (SLA) has also recently been used Leishmania vaccination. Methods The immunity generated by SLA and L. mexicana gp63 cDNA was compared in groups of 6 mice, which were statistically analysed by student t- test with the P-value of 0.05. SLA was administered by two different methods; intramuscular injection and injection of dendritic cells (DCs) loaded with SLA. L. mexicana gp63 cDNA was administered by the gene gun. Results Immunisation of BALB/c mice with L. mexicana gp63 resulted in high levels of Th1-type immune response and cytotoxic T lymphocytes (CTL) activity, which were accompanied with protection induced by the immunisation against L. mexicana infection. In contrast, administration of SLA, produced a mixed Th1/Th2-type immune responses as well as a high level of CTL activity but did not protect mice from the infection. Conclusion The results indicate higher protection by DNA immunisation using L. mexicana gp63 cDNA compared to SLA, which is accompanied by a high level of Th1 immune response. However, the CTL activity does not necessarily correlate with the protection induced by the vaccine. Also, gene gun immunisation is a potential approach in Leishmania vaccination. These findings would be helpful in opening new windows in Leishmania vaccine research. PMID:22347315

Immunodiagnosis of Paracoccidioidomycosis due to Paracoccidioides brasiliensis Using a Latex Test: Detection of Specific Antibody Anti-gp43 and Specific Antigen gp43

PubMed Central

dos Santos, Priscila Oliveira; Rodrigues, Anderson Messias; Fernandes, Geisa Ferreira; da Silva, Silvia Helena Marques; Burger, Eva; de Camargo, Zoilo Pires

2015-01-01

Background Paracoccidioidomycosis (PCM) is a life-threatening systemic disease and is a neglected public health problem in many endemic regions of Latin America. Though several diagnostic methods are available, almost all of them present with some limitations. Method/Principle Findings A latex immunoassay using sensitized latex particles (SLPs) with gp43 antigen, the immunodominant antigen of Paracoccidioides brasiliensis, or the monoclonal antibody mAb17c (anti-gp43) was evaluated for antibody or antigen detection in sera, cerebrospinal fluid (CSF), and bronchoalveolar lavage (BAL) from patients with PCM due to P. brasiliensis. The gp43-SLPs performed optimally to detect specific antibodies with high levels of sensitivity (98.46%, 95% CI 91.7–100.0), specificity (93.94%, 95% CI 87.3–97.7), and positive (91.4%) and negative (98.9%) predictive values. In addition, we propose the use of mAb17c-SLPs to detect circulating gp43, which would be particularly important in patients with immune deficiencies who fail to produce normal levels of immunoglobulins, achieving good levels of sensitivity (96.92%, 95% CI 89.3–99.6), specificity (88.89%, 95% CI 81.0–94.3), and positive (85.1%) and negative (97.8%) predictive values. Very good agreement between latex tests and double immune diffusion was observed for gp43-SLPs (k = 0.924) and mAb17c-SLPs (k = 0.850), which reinforces the usefulness of our tests for the rapid diagnosis of PCM in less than 10 minutes. Minor cross-reactivity occurred with sera from patients with other fungal infections. We successfully detected antigens and antibodies from CSF and BAL samples. In addition, the latex test was useful for monitoring PCM patients receiving therapy. Conclusions/Significance The high diagnostic accuracy, low cost, reduced assay time, and simplicity of this new latex test offer the potential to be commercialized and makes it an attractive diagnostic assay for use not only in clinics and medical mycology laboratories, but

8 CFR 1244.14 - Withdrawal of Temporary Protected Status.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 8 Aliens and Nationality 1 2013-01-01 2013-01-01 false Withdrawal of Temporary Protected Status... JUSTICE IMMIGRATION REGULATIONS TEMPORARY PROTECTED STATUS FOR NATIONALS OF DESIGNATED STATES § 1244.14 Withdrawal of Temporary Protected Status. (a) Authority of director. The director may withdraw the status of...

8 CFR 1244.14 - Withdrawal of Temporary Protected Status.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 8 Aliens and Nationality 1 2012-01-01 2012-01-01 false Withdrawal of Temporary Protected Status... JUSTICE IMMIGRATION REGULATIONS TEMPORARY PROTECTED STATUS FOR NATIONALS OF DESIGNATED STATES § 1244.14 Withdrawal of Temporary Protected Status. (a) Authority of director. The director may withdraw the status of...

8 CFR 1244.14 - Withdrawal of Temporary Protected Status.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Withdrawal of Temporary Protected Status... JUSTICE IMMIGRATION REGULATIONS TEMPORARY PROTECTED STATUS FOR NATIONALS OF DESIGNATED STATES § 1244.14 Withdrawal of Temporary Protected Status. (a) Authority of director. The director may withdraw the status of...

8 CFR 1244.14 - Withdrawal of Temporary Protected Status.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 8 Aliens and Nationality 1 2014-01-01 2014-01-01 false Withdrawal of Temporary Protected Status... JUSTICE IMMIGRATION REGULATIONS TEMPORARY PROTECTED STATUS FOR NATIONALS OF DESIGNATED STATES § 1244.14 Withdrawal of Temporary Protected Status. (a) Authority of director. The director may withdraw the status of...

8 CFR 1244.14 - Withdrawal of Temporary Protected Status.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Withdrawal of Temporary Protected Status... JUSTICE IMMIGRATION REGULATIONS TEMPORARY PROTECTED STATUS FOR NATIONALS OF DESIGNATED STATES § 1244.14 Withdrawal of Temporary Protected Status. (a) Authority of director. The director may withdraw the status of...

[Eukaryotic Expression and Immunogenic Research of Recombination Ebola Virus Membrane Protein Gp-Fc].

PubMed

Zhang, Xiaoguang; Yang, Ren; Wang, Jiao; Wang, Xuan; Hou, Mieling; An, Lina; Zhu, Ying; Cao, Yuxi; Zeng, Yi

2016-01-01

We used 293 cells to express the recombinant membrane protein of the Ebola virus. Then, the immunogenicity of the recombinant protein was studied by immunized BALB/c mice. According to the codon use frequency of humans, the gene encoding the extracellular domain of the Ebola virus membrane protein was optimized, synthesized, and inserted into the eukaryotic expression plasmid pXG-Fc to construct the human IgG Fc and Ebola GP fusion protein expression plasmid pXG-modGP-Fc. To achieve expression, the fusion protein expression vector was transfected into high-density 293 cells using transient transfection technology. The recombinant protein was purified by protein A affinity chromatography. BALB/c mice were immunized with the purified fusion protein, and serum antibody titers evaluated by an indirect enzyme-linked immunosorbent assay (ELISA). Purification and analyses of the protein revealed that the eukaryotic expression vector could express the recombinant protein GP-Fc effectively, and that the recombinant protein in the supernatant of the cell culture was present as a dimer. After immunization with the purified recombinant protein, a high titer of antigen-specific IgG could be detected in the serum of immunized mice by indirect ELISA, showing that the recombinant protein had good immunogenicity. These data suggest that we obtained a recombinant protein with good immunogenicity. Our study is the basis for development of a vaccine against the Ebola virus and for screening of monoclonal antibodies.

Intrinsic acid-base properties of a hexa-2'-deoxynucleoside pentaphosphate, d(ApGpGpCpCpT): neighboring effects and isomeric equilibria.

PubMed

Domínguez-Martín, Alicia; Johannsen, Silke; Sigel, Astrid; Operschall, Bert P; Song, Bin; Sigel, Helmut; Okruszek, Andrzej; González-Pérez, Josefa María; Niclós-Gutiérrez, Juan; Sigel, Roland K O

2013-06-17

The intrinsic acid-base properties of the hexa-2'-deoxynucleoside pentaphosphate, d(ApGpGpCpCpT) [=(A1∙G2∙G3∙C4∙C5∙T6)=(HNPP)⁵⁻] have been determined by ¹H NMR shift experiments. The pKa values of the individual sites of the adenosine (A), guanosine (G), cytidine (C), and thymidine (T) residues were measured in water under single-strand conditions (i.e., 10% D₂O, 47 °C, I=0.1 M, NaClO₄). These results quantify the release of H⁺ from the two (N7)H⁺ (G∙G), the two (N3)H⁺ (C∙C), and the (N1)H⁺ (A) units, as well as from the two (N1)H (G∙G) and the (N3)H (T) sites. Based on measurements with 2'-deoxynucleosides at 25 °C and 47 °C, they were transferred to pKa values valid in water at 25 °C and I=0.1 M. Intramolecular stacks between the nucleobases A1 and G2 as well as most likely also between G2 and G3 are formed. For HNPP three pKa clusters occur, that is those encompassing the pKa values of 2.44, 2.97, and 3.71 of G2(N7)H⁺, G3(N7)H⁺, and A1(N1)H⁺, respectively, with overlapping buffer regions. The tautomer populations were estimated, giving for the release of a single proton from five-fold protonated H₅(HNPP)(±) , the tautomers (G2)N7, (G3)N7, and (A1)N1 with formation degrees of about 74, 22, and 4%, respectively. Tautomer distributions reveal pathways for proton-donating as well as for proton-accepting reactions both being expected to be fast and to occur practically at no "cost". The eight pKa values for H₅(HNPP)(±) are compared with data for nucleosides and nucleotides, revealing that the nucleoside residues are in part affected very differently by their neighbors. In addition, the intrinsic acidity constants for the RNA derivative r(A1∙G2∙G3∙C4∙C5∙U6), where U=uridine, were calculated. Finally, the effect of metal ions on the pKa values of nucleobase sites is briefly discussed because in this way deprotonation reactions can easily be shifted to the physiological pH range. Copyright © 2013 WILEY

Single-Injection Vaccine Protects Nonhuman Primates against Infection with Marburg Virus and Three Species of Ebola Virus▿

PubMed Central

Geisbert, Thomas W.; Geisbert, Joan B.; Leung, Anders; Daddario-DiCaprio, Kathleen M.; Hensley, Lisa E.; Grolla, Allen; Feldmann, Heinz

2009-01-01

The filoviruses Marburg virus and Ebola virus cause severe hemorrhagic fever with high mortality in humans and nonhuman primates. Among the most promising filovirus vaccines under development is a system based on recombinant vesicular stomatitis virus (VSV) that expresses a single filovirus glycoprotein (GP) in place of the VSV glycoprotein (G). Here, we performed a proof-of-concept study in order to determine the potential of having one single-injection vaccine capable of protecting nonhuman primates against Sudan ebolavirus (SEBOV), Zaire ebolavirus (ZEBOV), Cote d'Ivoire ebolavirus (CIEBOV), and Marburgvirus (MARV). In this study, 11 cynomolgus monkeys were vaccinated with a blended vaccine consisting of equal parts of the vaccine vectors VSVΔG/SEBOVGP, VSVΔG/ZEBOVGP, and VSVΔG/MARVGP. Four weeks later, three of these animals were challenged with MARV, three with CIEBOV, three with ZEBOV, and two with SEBOV. Three control animals were vaccinated with VSV vectors encoding a nonfilovirus GP and challenged with SEBOV, ZEBOV, and MARV, respectively, and five unvaccinated control animals were challenged with CIEBOV. Importantly, none of the macaques vaccinated with the blended vaccine succumbed to a filovirus challenge. As expected, an experimental control animal vaccinated with VSVΔG/ZEBOVGP and challenged with SEBOV succumbed, as did the positive controls challenged with SEBOV, ZEBOV, and MARV, respectively. All five control animals challenged with CIEBOV became severely ill, and three of the animals succumbed on days 12, 12, and 14, respectively. The two animals that survived CIEBOV infection were protected from subsequent challenge with either SEBOV or ZEBOV, suggesting that immunity to CIEBOV may be protective against other species of Ebola virus. In conclusion, we developed an immunization scheme based on a single-injection vaccine that protects nonhuman primates against lethal challenge with representative strains of all human pathogenic filovirus species

Single-injection vaccine protects nonhuman primates against infection with marburg virus and three species of ebola virus.

PubMed

Geisbert, Thomas W; Geisbert, Joan B; Leung, Anders; Daddario-DiCaprio, Kathleen M; Hensley, Lisa E; Grolla, Allen; Feldmann, Heinz

2009-07-01

The filoviruses Marburg virus and Ebola virus cause severe hemorrhagic fever with high mortality in humans and nonhuman primates. Among the most promising filovirus vaccines under development is a system based on recombinant vesicular stomatitis virus (VSV) that expresses a single filovirus glycoprotein (GP) in place of the VSV glycoprotein (G). Here, we performed a proof-of-concept study in order to determine the potential of having one single-injection vaccine capable of protecting nonhuman primates against Sudan ebolavirus (SEBOV), Zaire ebolavirus (ZEBOV), Cote d'Ivoire ebolavirus (CIEBOV), and Marburgvirus (MARV). In this study, 11 cynomolgus monkeys were vaccinated with a blended vaccine consisting of equal parts of the vaccine vectors VSVDeltaG/SEBOVGP, VSVDeltaG/ZEBOVGP, and VSVDeltaG/MARVGP. Four weeks later, three of these animals were challenged with MARV, three with CIEBOV, three with ZEBOV, and two with SEBOV. Three control animals were vaccinated with VSV vectors encoding a nonfilovirus GP and challenged with SEBOV, ZEBOV, and MARV, respectively, and five unvaccinated control animals were challenged with CIEBOV. Importantly, none of the macaques vaccinated with the blended vaccine succumbed to a filovirus challenge. As expected, an experimental control animal vaccinated with VSVDeltaG/ZEBOVGP and challenged with SEBOV succumbed, as did the positive controls challenged with SEBOV, ZEBOV, and MARV, respectively. All five control animals challenged with CIEBOV became severely ill, and three of the animals succumbed on days 12, 12, and 14, respectively. The two animals that survived CIEBOV infection were protected from subsequent challenge with either SEBOV or ZEBOV, suggesting that immunity to CIEBOV may be protective against other species of Ebola virus. In conclusion, we developed an immunization scheme based on a single-injection vaccine that protects nonhuman primates against lethal challenge with representative strains of all human pathogenic

Persistence of Protective Immunity to Malaria Induced by DNA Priming and Poxvirus Boosting: Characterization of Effector and Memory CD8+-T-Cell Populations

PubMed Central

Sedegah, Martha; Brice, Gary T.; Rogers, William O.; Doolan, Denise L.; Charoenvit, Yupin; Jones, Trevor R.; Majam, Victoria F.; Belmonte, Arnel; Lu, Minh; Belmonte, Maria; Carucci, Daniel J.; Hoffman, Stephen L.

2002-01-01

The persistence of immunity to malaria induced in mice by a heterologous DNA priming and poxvirus boosting regimen was characterized. Mice were immunized by priming with DNA vaccine plasmids encoding the Plasmodium yoelii circumsporozoite protein (PyCSP) and murine granulocyte-macrophage colony-stimulating factor and boosting with recombinant vaccinia encoding PyCSP. BALB/c mice immunized with either high-dose (100 μg of p PyCSP plus 30 μg of pGM-CSF) or low-dose (1 μg of p PyCSP plus 1 μg of pGM-CSF DNA) priming were protected against challenge with 50 P. yoelii sporozoites. Protection 2 weeks after immunization was 70 to 100%, persisted at this level for at least 20 weeks, and declined to 30 to 40% by 28 weeks. Eight of eight mice protected at 20 weeks were still protected when rechallenged at 40 weeks. The antigen (Ag)-specific effector CD8+-T-cell population present 2 weeks after boosting had ex vivo Ag-specific cytolytic activity, expressed both gamma interferon (IFN-γ) and tumor necrosis factor alpha, and constituted 12 to 20% of splenic CD8+ T cells. In contrast, the memory CD8+-Ag-specific-cell population at 28 weeks lacked cytolytic activity and constituted only 6% of splenic CD8+ T cells, but at the single-cell level it produced significantly higher levels of IFN-γ than the effectors. High levels of Ag- or parasite-specific antibodies present 2 weeks after boosting had declined three- to sevenfold by 28 weeks. Low-dose priming was similarly immunogenic and as protective as high-dose priming against a 50-, but not a 250-, sporozoite challenge. These results demonstrate that a heterologous priming and boosting vaccination can provide lasting protection against malaria in this model system. PMID:12065488

10 CFR 73.50 - Requirements for physical protection of licensed activities.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 10 Energy 2 2010-01-01 2010-01-01 false Requirements for physical protection of licensed activities. 73.50 Section 73.50 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) PHYSICAL PROTECTION OF... suspicious activity or to the breaching of any physical barrier. (4) An isolation zone shall be maintained...

75 FR 67636 - Physical Protection of Shipments of Irradiated Reactor Fuel

Federal Register 2010, 2011, 2012, 2013, 2014

2010-11-03

...-2010-0340; Draft NUREG-0561, Revision 2] RIN 3150-AI64 Physical Protection of Shipments of Irradiated...- 0561, ``Physical Protection of Shipments of Irradiated Reactor Fuel.'' This document provides guidance to a licensee or applicant for implementation of proposed 10 CFR 73.37, ``Requirements for Physical...

Male reproductive fitness and queen polyandry are linked to variation in the supergene Gp-9 in the fire ant Solenopsis invicta.

PubMed

Lawson, Lucinda P; Vander Meer, Robert K; Shoemaker, Dewayne

2012-08-22

Supergenes are clusters of tightly linked loci maintained in specific allelic combinations to facilitate co-segregation of genes governing adaptive phenotypes. In species where strong selection potentially operates at different levels (e.g. eusocial Hymenoptera), positive selection acting within a population to maintain specific allelic combinations in supergenes may have unexpected consequences for some individuals, including the preservation of disadvantageous traits. The nuclear gene Gp-9 in the invasive fire ant Solenopsis invicta is part of a non-recombining, polymorphic supergene region associated with polymorphism in social organization as well as traits affecting physiology, fecundity and behaviour. We show that both male reproductive success and facultative polyandry in queens have a simple genetic basis and are dependent on male Gp-9 genotype. Gp-9(b) males are unable to maintain exclusive reproductive control over their mates such that queens mated to Gp-9(b) males remain highly receptive to remating. Queens mated to multiple Gp-9(B) males are rare. This difference appears to be independent of mating plug production in fertile males of each Gp-9 genotype. However, Gp-9(b) males have significantly lower sperm counts than Gp-9(B) males, which could be a cue to females to seek additional mates. Despite the reduced fitness of Gp-9(b) males, polygyne worker-induced selective mortality of sexuals lacking b-like alleles coupled with the overall success of the polygyne social form act to maintain the Gp-9(b) allele within nature. Our findings highlight how strong worker-induced selection acting to maintain the Gp-9(b) allele in the polygyne social form may simultaneously result in reduced reproductive fitness for individual sexual offspring.

Male reproductive fitness and queen polyandry are linked to variation in the supergene Gp-9 in the fire ant Solenopsis invicta

PubMed Central

Lawson, Lucinda P.; Vander Meer, Robert K.; Shoemaker, DeWayne

2012-01-01

Supergenes are clusters of tightly linked loci maintained in specific allelic combinations to facilitate co-segregation of genes governing adaptive phenotypes. In species where strong selection potentially operates at different levels (e.g. eusocial Hymenoptera), positive selection acting within a population to maintain specific allelic combinations in supergenes may have unexpected consequences for some individuals, including the preservation of disadvantageous traits. The nuclear gene Gp-9 in the invasive fire ant Solenopsis invicta is part of a non-recombining, polymorphic supergene region associated with polymorphism in social organization as well as traits affecting physiology, fecundity and behaviour. We show that both male reproductive success and facultative polyandry in queens have a simple genetic basis and are dependent on male Gp-9 genotype. Gp-9b males are unable to maintain exclusive reproductive control over their mates such that queens mated to Gp-9b males remain highly receptive to remating. Queens mated to multiple Gp-9B males are rare. This difference appears to be independent of mating plug production in fertile males of each Gp-9 genotype. However, Gp-9b males have significantly lower sperm counts than Gp-9B males, which could be a cue to females to seek additional mates. Despite the reduced fitness of Gp-9b males, polygyne worker-induced selective mortality of sexuals lacking b-like alleles coupled with the overall success of the polygyne social form act to maintain the Gp-9b allele within nature. Our findings highlight how strong worker-induced selection acting to maintain the Gp-9b allele in the polygyne social form may simultaneously result in reduced reproductive fitness for individual sexual offspring. PMID:22535783

An Aptamer That Neutralizes R5 Strains of Human Immunodeficiency Virus Type 1 Blocks gp120-CCR5 Interaction

PubMed Central

Dey, Antu K.; Khati, Makobetsa; Tang, Min; Wyatt, Richard; Lea, Susan M.; James, William

2005-01-01

We recently described the isolation and structural characterization of 2′-fluoropyrimidine-substituted RNA aptamers that bind to gp120 of R5 strains of human immunodeficiency virus type 1 and thereby potently neutralize the infectivity of phylogenetically diverse R5 strains. Here we investigate the physical basis of their antiviral action. We show that both N-linked oligosaccharides and the variable loops V1/V2 and V3 are not required for binding of one aptamer, B40, to gp120. Using surface plasmon resonance binding analyses, we show that the aptamer binds to the CCR5-binding site on gp120 in a relatively CD4-independent manner, providing a mechanistic explanation for its neutralizing potency. PMID:16227301

78 FR 31821 - Physical Protection of Shipments of Irradiated Reactor Fuel

Federal Register 2010, 2011, 2012, 2013, 2014

2013-05-28

... NUCLEAR REGULATORY COMMISSION 10 CFR Part 73 [NRC-2010-0340; NRC-2009-0163] RIN 3150-AI64 Physical..., ``Physical Protection of Shipments of Irradiated Reactor Fuel.'' This revised document sets forth means... physical protection of spent nuclear fuel (SNF) during transportation by road, rail, and water; and for...

The G Protein α Chaperone Ric-8 as a Potential Therapeutic Target

PubMed Central

Papasergi, Makaía M.; Patel, Bharti R.

2015-01-01

Resistance to inhibitors of cholinesterase (Ric-8)A and Ric-8B are essential genes that encode positive regulators of heterotrimeric G protein α subunits. Controversy persists surrounding the precise way(s) that Ric-8 proteins affect G protein biology and signaling. Ric-8 proteins chaperone nucleotide-free Gα-subunit states during biosynthetic protein folding prior to G protein heterotrimer assembly. In organisms spanning the evolutionary window of Ric-8 expression, experimental perturbation of Ric-8 genes results in reduced functional abundances of G proteins because G protein α subunits are misfolded and degraded rapidly. Ric-8 proteins also act as Gα-subunit guanine nucleotide exchange factors (GEFs) in vitro. However, Ric-8 GEF activity could strictly be an in vitro phenomenon stemming from the ability of Ric-8 to induce partial Gα unfolding, thereby enhancing GDP release. Ric-8 GEF activity clearly differs from the GEF activity of G protein–coupled receptors (GPCRs). G protein βγ is inhibitory to Ric-8 action but obligate for receptors. It remains an open question whether Ric-8 has dual functions in cells and regulates G proteins as both a molecular chaperone and GEF. Clearly, Ric-8 has a profound influence on heterotrimeric G protein function. For this reason, we propose that Ric-8 proteins are as yet untested therapeutic targets in which pharmacological inhibition of the Ric-8/Gα protein–protein interface could serve to attenuate the effects of disease-causing G proteins (constitutively active mutants) and/or GPCR signaling. This minireview will chronicle the understanding of Ric-8 function, provide a comparative discussion of the Ric-8 molecular chaperoning and GEF activities, and support the case for why Ric-8 proteins should be considered potential targets for development of new therapies. PMID:25319541

Immunization With Fc-Based Recombinant Epstein–Barr Virus gp350 Elicits Potent Neutralizing Humoral Immune Response in a BALB/c Mice Model

PubMed Central

Zhao, Bingchun; Zhang, Xiao; Krummenacher, Claude; Song, Shuo; Gao, Ling; Zhang, Haojiong; Xu, Miao; Feng, Lin; Feng, Qisheng; Zeng, Musheng; Xu, Yuting; Zeng, Yixin

2018-01-01

Epstein–Barr virus (EBV) was the first human virus proved to be closely associated with tumor development, such as lymphoma, nasopharyngeal carcinoma, and EBV-associated gastric carcinoma. Despite many efforts to develop prophylactic vaccines against EBV infection and diseases, no candidates have succeeded in effectively blocking EBV infection in clinical trials. Previous investigations showed that EBV gp350 plays a pivotal role in the infection of B-lymphocytes. Nevertheless, using monomeric gp350 proteins as antigens has not been effective in preventing infection. Multimeric forms of the antigen are more potently immunogenic than monomers; however, the multimerization elements used in previous constructs are not approved for human clinical trials. To prepare a much-needed EBV prophylactic vaccine that is potent, safe, and applicable, we constructed an Fc-based form of gp350 to serve as a dimeric antigen. Here, we show that the Fc-based gp350 antigen exhibits dramatically enhanced immunogenicity compared with wild-type gp350 protein. The complete or partial gp350 ectodomain was fused with the mouse IgG2a Fc domain. Fusion with the Fc domain did not impair gp350 folding, binding to a conformation-dependent neutralizing antibody (nAb) and binding to its receptor by enzyme-linked immunosorbent assay and surface plasmon resonance. Specific antibody titers against gp350 were notably enhanced by immunization with gp350-Fc dimers compared with gp350 monomers. Furthermore, immunization with gp350-Fc fusion proteins elicited potent nAbs against EBV. Our data strongly suggest that an EBV gp350 vaccine based on Fc fusion proteins may be an efficient candidate to prevent EBV infection in clinical applications. PMID:29765376

16 CFR 1061.8 - Information on the heightened degree of protection afforded.

Code of Federal Regulations, 2010 CFR

2010-01-01

... protection afforded. 1061.8 Section 1061.8 Commercial Practices CONSUMER PRODUCT SAFETY COMMISSION GENERAL APPLICATIONS FOR EXEMPTION FROM PREEMPTION § 1061.8 Information on the heightened degree of protection afforded... State or local requirement provides a significantly higher degree of protection from the risk of injury...

Refolding of soluble leukemia inhibitory factor receptor fusion protein (gp 190 sol DAF) from urea.

PubMed

Liu, H; Moreau, J F; Gualde, N; Fu, J

1997-04-01

The insoluble inclusion bodies of soluble leukemia inhibitory factor receptor fusion protein (gp 190 sol DAF) was solubilized in 8 M urea on the unfolding transitions, and several factors on the aggregate formation were indirectly analyzed for the refolding of gp 190 sol DAF. Results indicate that the refolding yield can be considerably increased at lowering concentration of the unfolding protein, a little soluble protein with the slow refolding appears in the process of the aggregate formation and the concentration of the denaturant must be down to a minimum level for its refolding.

Identifying unmet needs in older patients--nurse-GP collaboration in general practice.

PubMed

Williams, Ian D; O'Doherty, Lorna J; Mitchell, Geoffrey K; Williams, Karen E

2007-09-01

Australia's rapidly aging population has a high prevalence of chronic disease and disability, leading to an increased social and economic burden. The Enhanced Primary Care program seeks to reduce this burden by promoting preventive and coordinated care. This study aimed to identify unmet needs in community dwelling general practice patients aged 75 years and over through annual health assessments performed by a general practitioner-nurse team. Community dwelling patients of a large suburban general practice aged 75 years and over were invited to participate. Five hundred and forty-six consecutive, eligible patients were recruited. Data were collected by GP-nurse teams on physical and psychosocial variables using a combination of physical examination, self reporting, and rating scales. Fifty percent of the women and 25% of the men lived alone. Over 90% of participants reported one or more health problems, with musculoskeletal issues being most common. Men rated their health more poorly than women. Incontinence affected one-third of patients, mainly women. Women reported more psychological distress. There were age and gender differences in activities of daily living (ADL). Mobility, ADL, visual impairment, bowel problems, use of sleep medications and psychological wellbeing were strongly associated to self reported health. Health assessments were effective in identifying significant physical and psychosocial problems in older adults. The importance of such assessments is underscored by strong associations between various domains and perceived general health. Collaboration between a GP and a practice based community nurse represents a potential solution to identifying (and responding to) unmet physical and psychosocial needs to improve quality of life in community dwelling older adults.

Generation and characterization of protective antibodies to Marburg virus.

PubMed

Froude, Jeffrey W; Pelat, Thibaut; Miethe, Sebastian; Zak, Samantha E; Wec, Anna Z; Chandran, Kartik; Brannan, Jennifer Mary; Bakken, Russell R; Hust, Michael; Thullier, Philippe; Dye, John M

Marburg virus (MARV) and Ebola virus (EBOV) have been a source of epidemics and outbreaks for several decades. We present here the generation and characterization of the first protective antibodies specific for wild-type MARV. Non-human primates (NHP), cynomolgus macaques, were immunized with viral-replicon particles expressing the glycoproteins (GP) of MARV (Ci67 isolate). An antibody fragment (single-chain variable fragment, scFv) phage display library was built after four immunogen injections, and screened against the GP 1-649 of MARV. Sequencing of 192 selected clones identified 18 clones with distinct V H and V L sequences. Four of these recombinant antibodies (R4A1, R4B11, R4G2, and R3F6) were produced in the scFv-Fc format for in vivo studies. Mice that were challenged with wild-type Marburg virus (Ci67 isolate) receiving 100 µg of scFv-Fc on days -1, 1 and 3 demonstrated protective efficacies ranging from 75-100%. The amino-acid sequences of the scFv-Fcs are similar to those of their human germline counterparts, sharing an identity ranging between 68 and 100% to human germline immunoglobulin. These results demonstrate for the first time that recombinant antibodies offer protection against wild-type MARV, and suggest they may be promising candidates for further therapeutic development especially due to their human homology.

Polymorphism study of Cryptosporidium hominis gp60 subtypes circulating in Tunisia.

PubMed

Essid, Rym; Chelbi, Hanen; Siala, Emna; Bensghair, Ines; Menotti, Jean; Bouratbine, Aïda

2017-09-01

Cryptosporidium spp. are a major cause of gastrointestinal diseases in humans worldwide. While a single subtype of Cryptosporidium hominis has been shown to be responsible for several large outbreaks related to water contamination in developed countries, little is known about the epidemiology of C. hominis in developing countries. This study reports the first genetic characterization of C. hominis at the subtype level in several human populations in Tunisia using the gp60 gene. Eighteen isolates were identified as C. hominis by a restriction fragment length polymorphism (RFLP) analysis. The prevalence of this species in different human populations ranges from 1.53% to 13.04% with a high prevalence being reported in immunocompromised children (13.04%) followed by patients with malignent myeloma (5.5%) and HIV-infected patients (4.59%). The gp60 analysis on C. hominis isolates, performed in 14 cases, showed the presence of a single subtype family: "Ia". Different subtypes were identified within this family (A11G1R1, A12R3, A23G1R1, A26G1R1, A27G1R1, A28G1R1). The IaA26G1R1 subtype was the most dominant subtype described in this area (50%). Despite the high genetic diversity of Cryptosporidium spp, a low heterogeneity at the subtype level was observed within C. hominis circulating in Tunisia. This distribution is an indicator for intensive and stable anthroponotic cryptosporidiosis in this region. Besides, the presence of a unique genotype in 5 HIV-infected patients attending the same hospital ward suggests the possible occurrence of hospital-acquired infection and underlines the need to implement preventive measures to avoid nosocomial transmission. Copyright © 2017 Elsevier Ltd. All rights reserved.

AFM force measurements of the gp120-sCD4 and gp120 or CD4 antigen-antibody interactions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Yong, E-mail: dr_yongchen@hotmail.com; Department of Microbiology and Immunology, University of Illinois at Chicago, Chicago, IL 60612; Zeng, Gucheng

2011-04-08

Highlights: {yields} The unbinding force of sCD4-gp120 interaction was 25.45 {+-} 20.46 pN. {yields} The unbinding force of CD4 antigen-antibody interaction was 51.22 {+-} 34.64 pN. {yields} The unbinding force of gp120 antigen-antibody interaction was 89.87 {+-} 44.63 pN. {yields} The interaction forces between various HIV inhibitors and the target molecules are significantly different. {yields} Functionalizing on AFM tip or substrate of an interaction pair caused different results. -- Abstract: Soluble CD4 (sCD4), anti-CD4 antibody, and anti-gp120 antibody have long been regarded as entry inhibitors in human immunodeficiency virus (HIV) therapy. However, the interactions between these HIV entry inhibitors andmore » corresponding target molecules are still poorly understood. In this study, atomic force microscopy (AFM) was utilized to investigate the interaction forces among them. We found that the unbinding forces of sCD4-gp120 interaction, CD4 antigen-antibody interaction, and gp120 antigen-antibody interaction were 25.45 {+-} 20.46, 51.22 {+-} 34.64, and 89.87 {+-} 44.63 pN, respectively, which may provide important mechanical information for understanding the effects of viral entry inhibitors on HIV infection. Moreover, we found that the functionalization of an interaction pair on AFM tip or substrate significantly influenced the results, implying that we must perform AFM force measurement and analyze the data with more caution.« less

41 CFR 109-1.5107 - Physical protection of personal property.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 41 Public Contracts and Property Management 3 2012-01-01 2012-01-01 false Physical protection of personal property. 109-1.5107 Section 109-1.5107 Public Contracts and Property Management Federal Property...-INTRODUCTION 1.51-Personal Property Management Standards and Practices § 109-1.5107 Physical protection of...

41 CFR 109-1.5107 - Physical protection of personal property.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 41 Public Contracts and Property Management 3 2014-01-01 2014-01-01 false Physical protection of personal property. 109-1.5107 Section 109-1.5107 Public Contracts and Property Management Federal Property...-INTRODUCTION 1.51-Personal Property Management Standards and Practices § 109-1.5107 Physical protection of...

41 CFR 109-1.5107 - Physical protection of personal property.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Physical protection of personal property. 109-1.5107 Section 109-1.5107 Public Contracts and Property Management Federal Property...-INTRODUCTION 1.51-Personal Property Management Standards and Practices § 109-1.5107 Physical protection of...

41 CFR 109-1.5107 - Physical protection of personal property.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 41 Public Contracts and Property Management 3 2013-07-01 2013-07-01 false Physical protection of personal property. 109-1.5107 Section 109-1.5107 Public Contracts and Property Management Federal Property...-INTRODUCTION 1.51-Personal Property Management Standards and Practices § 109-1.5107 Physical protection of...

41 CFR 109-1.5107 - Physical protection of personal property.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 41 Public Contracts and Property Management 3 2011-01-01 2011-01-01 false Physical protection of personal property. 109-1.5107 Section 109-1.5107 Public Contracts and Property Management Federal Property...-INTRODUCTION 1.51-Personal Property Management Standards and Practices § 109-1.5107 Physical protection of...

Beyond CD34+ cell dose: impact of method of peripheral blood hematopoietic stem cell mobilization (granulocyte-colony-stimulating factor [G-CSF], G-CSF plus plerixafor, or cyclophosphamide G-CSF/granulocyte-macrophage [GM]-CSF) on number of colony-forming unit-GM, engraftment, and Day +100 hematopoietic graft function.

PubMed

Alexander, Erin T; Towery, Jeanne A; Miller, Ashley N; Kramer, Cindy; Hogan, Kathy R; Squires, Jerry E; Stuart, Robert K; Costa, Luciano J

2011-09-01

The dose of CD34+ cells/kg in the mobilized peripheral blood product is the main determinant of neutrophil and platelet (PLT) engraftment after autologous hematopoietic stem cell transplantation (AHSCT). Whether the method of mobilization, namely, granulocyte-colony-stimulating factor (G-CSF) alone (G), G-CSF plus plerixafor (G+P), or cyclophosphamide + G/granulocyte-macrophage (GM)-CSF (Cy+G/GM), independently affects number of colony-forming unit (CFU)-GM, engraftment, and hematopoietic graft function is unknown. We used a database of AHSCT patients with multiple myeloma or lymphoma to identify three groups with different mobilization strategies receiving transplantation with similar CD34+ cell doses. Groups were compared in terms of CFU-GM, ratio of CFU-GM/CD34+, engraftment of neutrophils and PLTs, and hematopoietic graft function on Day +100. Ninety-six patients were included in the analysis, 26 G, 32 G+P, and 38 Cy+G/GM, with median cell doses of 4.21 × 10(6) , 4.11 × 10(6) , and 4.67 × 10(6) CD34+/kg, respectively (p = 0.433). There was no significant difference in number of CFU-GM between the three groups; however, the ratio of CFU-GM/CD34+ was significantly lower for G+P (p = 0.008). Median time for neutrophil engraftment was 13 days in G+P and 12 days in G and Cy+G/GM (p = 0.028), while PLT engraftment happened at a median of 14.5 days in G+P versus 12 days in G and 11 days in Cy+G/GM (p = 0.012). There was no difference in hematopoietic graft function at Day +100. Plerixafor-based mobilization is associated with slightly reduced number of CFU-GM and minimal delay in engraftment that is independent of CD34+ cell dose. Hematopoietic graft function on Day 100 is not affected by mobilization strategy. © 2011 American Association of Blood Banks.

Prime-Boost Immunization of Rabbits with HIV-1 gp120 Elicits Potent Neutralization Activity against a Primary Viral Isolate

PubMed Central

Narayan, Kristin M.; Agrawal, Nitish; Du, Sean X.; Muranaka, Janelle E.; Bauer, Katherine; Leaman, Daniel P.; Phung, Pham; Limoli, Kay; Chen, Helen; Boenig, Rebecca I.; Wrin, Terri; Zwick, Michael B.; Whalen, Robert G.

2013-01-01

Development of a vaccine for HIV-1 requires a detailed understanding of the neutralizing antibody responses that can be experimentally elicited to difficult-to-neutralize primary isolates. Rabbits were immunized with the gp120 subunit of HIV-1 JR-CSF envelope (Env) using a DNA-prime protein-boost regimen. We analyzed five sera that showed potent autologous neutralizing activity (IC50s at ∼103 to 104 serum dilution) against pseudoviruses containing Env from the primary isolate JR-CSF but not from the related isolate JR-FL. Pseudoviruses were created by exchanging each variable and constant domain of JR-CSF gp120 with that of JR-FL or with mutations in putative N-glycosylation sites. The sera contained different neutralizing activities dependent on C3 and V5, C3 and V4, or V4 regions located on the glycan-rich outer domain of gp120. All sera showed enhanced neutralizing activity toward an Env variant that lacked a glycosylation site in V4. The JR-CSF gp120 epitopes recognized by the sera are generally distinct from those of several well characterized mAbs (targeting conserved sites on Env) or other type-specific responses (targeting V1, V2, or V3 variable regions). The activity of one serum requires specific glycans that are also important for 2G12 neutralization and this serum blocked the binding of 2G12 to gp120. Our findings show that different fine specificities can achieve potent neutralization of HIV-1, yet this strong activity does not result in improved breadth. PMID:23326351

[Expression and significance of P-gp/mdr1 mRNA, MRP and LRP in non-Hodgkin's lymphoma].

PubMed

Li, Le; Su, Li-ping; Ma, Li; Zhao, Jin; Zhu, Lei; Zhou, Yong-an

2009-03-01

To explore the expression and clinical significance of P-glycoprotein (P-gp)/mdr1mRNA, multidrug resistance-associated protein (MRP) and lung resistance protein (LRP) in newly diagnosed non-Hodgkin's lymphoma. mdr1 mRNA of in 41 patients with non-Hodgkin's lymphoma was assayed by semi-quantitative RT-PCR. The expressions of P-gp, MRP and LRP proteins in lymph node viable blasts were identified by flow cytometry. The results were compared with those obtained from control cases, and the correlation of the changes with clinical outcomes was analyzed. (1) Among the 41 cases, the positive expression of P-gp protein was detected in 8 cases, MRP in 7 cases, LRP in 15 cases, and mdr 1 mRNA in 11 cases. (2) The P-gp and LRP levels in NHL were significantly higher than those in control group, but MRP wasn't. The P-gp over-expression was significantly associated with mdr1mRNA (r = 0.396, P = 0.01). No correlation was showed among the expressions of P-gp, MRP and LRP. (3) Patients with P-gp expression had a poorer outcome of chemotherapy than those with P-gp-negative (P = 0.005). P-gp expression was significantly associated with higher clinical stage (P = 0.046) and elevated serum lactate dehydrogenase level (P = 0.032), but not associated with malignant degree (P = 0.298). MRP had no impact on the outcome of chemotherapy (P = 0.212), and wasn't significantly associated with higher clinical stage (P = 0.369), elevated LDH (P = 0.762) and higher malignant degree (P = 0.451). Patients with LRP expression had a poorer outcome of chemotherapy than those LRP-negative (P = 0.012). LRP expression was significantly associated with higher clinical stage (P = 0.0019), elevated LDH (P = 0.02) and higher malignant degree (P = 0.01). The data of this study indicate that P-gp and LRP expressions but not MRP expression are important in the mechanism of drug resistance associated with a poor clinical outcome in previously untreated NHL.

Dynamic conformational switching in the chemokine ligand is essential for G-protein-coupled receptor activation

PubMed Central

Joseph, Prem Raj B.; Sawant, Kirti V.; Isley, Angela; Pedroza, Mesias; Garofalo, Roberto P.; Richardson, Ricardo M.; Rajarathnam, Krishna

2014-01-01

Chemokines mediate diverse functions from organogenesis to mobilizing leucocytes, and are unusual agonists for class-A GPCRs (G-protein-coupled receptors) because of their large size and multi-domain structure. The current model for receptor activation, which involves interactions between chemokine N-loop and receptor N-terminal residues (Site-I) and between chemokine N-terminal and receptor extracellular loop/transmembrane residues (Site-II), fails to describe differences in ligand/receptor selectivity and the activation of multiple signalling pathways. In the present study, we show in neutrophil-activating chemokine CXCL8 that the highly conserved GP (glycine-proline) motif located distal to both N-terminal and N-loop residues couples Site-I and Site-II interactions. Mutations in the GP motif caused various differences from native-like function to complete loss of activity that could not be correlated with the specific mutation, receptor affinity or subtype, or a specific signalling pathway. NMR studies indicated that the GP motif does not influence Site-I interactions, but molecular dynamics simulations suggested that this motif dictates substates of the CXCL8 conformational ensemble. We conclude that the GP motif enables diverse receptor functions by controlling cross-talk between Site-I and Site-II, and further propose that the repertoire of chemokine functions is best described by a conformational ensemble model in which a network of long-range coupled indirect interactions mediate receptor activity. PMID:24032673

Marburg Virus Glycoprotein GP2: pH-Dependent Stability of the Ectodomain α-Helical Bundle†

PubMed Central

Harrison, Joseph S.; Koellhoffer, Jayne F.; Chandran, Kartik; Lai, Jonathan R.

2012-01-01

Marburg virus (MARV) and Ebola virus (EBOV) constitute the family Filoviridae of enveloped viruses (filoviruses) that cause severe hemorrhagic fever. Infection by MARV is required for fusion between the host cell and viral membranes, a process that is mediated by the two subunits of the envelope glycoprotein GP1 (surface subunit) and GP2 (transmembrane subunit). Upon viral attachment and uptake, it is believed that the MARV viral fusion machinery is triggered by host factors and environmental conditions found in the endosome. Next, conformational rearrangements in the GP2 ectodomain result in the formation of a highly stable six-helix bundle; this refolding event provides the energetic driving force for membrane fusion. Both GP1 and GP2 from EBOV have been extensively studied, but there is little information available for the MARV glycoproteins. Here we have expressed two variants of the MARV GP2 ectodomain in Escherichia coli and analyzed their biophysical properties. Circular dichroism indicates that the MARV GP2 ectodomain adopts an α-helical conformation, and one variant sediments as a trimer by equilibrium analytical ultracentrifugation. Denaturation studies indicate the α-helical structure is highly stable at pH 5.3 (unfolding energy, ΔGunf H2O, of 33.4 ± 2.5 kcal/mol and melting temperature, Tm, of 75.3 ± 2.1 °C for one variant). Furthermore, we found the α-helical stability to be strongly dependent on pH with higher stability under lower pH conditions (Tm values ranging from ~92 °C at pH 4.0 to ~38 °C at pH 8.0). Mutational analysis suggests two glutamic acid residues (E579 and E580) are partially responsible for this pH-dependent behavior. Based on these results, we hypothesize that pH-dependent folding stability of the MARV GP2 ectodomain provides a mechanism to control conformational preferences such that the six-helix bundle ‘post-fusion’ state is preferred under conditions of appropriately matured endosomes. PMID:22369502

Antiviral Activity of HIV gp120 Targeting Bispecific T Cell Engager (BiTE®) Antibody Constructs.

PubMed

Brozy, Johannes; Schlaepfer, Erika; Mueller, Christina K S; Rochat, Mary-Aude; Rampini, Silvana K; Myburgh, Renier; Raum, Tobias; Kufer, Peter; Baeuerle, Patrick A; Muenz, Markus; Speck, Roberto F

2018-05-02

Today's gold standard in HIV therapy is the combined antiretroviral therapy (cART). It requires strict adherence by patients and life-long medication, which can lower the viral load below detection limits and prevent HIV-associated immunodeficiency, but cannot cure patients. The bispecific T cell engaging (BiTE®) antibody technology has demonstrated long-term relapse-free outcomes in patients with relapsed and refractory acute lymphocytic leukemia. We here generated BiTE® antibody constructs that target the HIV-1 envelope protein gp120 (HIV gp120) using either the scFv B12 or VRC01, the first two extracellular domains (1+2) of human CD4 alone or joined to the single chain variable fragment (scFv) of the antibody 17b fused to an anti-human CD3ϵ scFv. These engineered human BiTE® antibody constructs showed engagement of T cells for redirected lysis of HIV gp120-transfected CHO cells. Furthermore, they substantially inhibited HIV-1 replication in PBMCs as well as in macrophages co-cultured with autologous CD8+ T-cells, the most potent being the human CD4(1+2) BiTE® antibody construct and the CD4(1+2)L17b BiTE® antibody construct. The CD4(1+2) h BiTE® antibody construct promoted HIV infection of human CD4-/CD8+ T cells. In contrast, the neutralizing B12 and the VRC01 BiTE® antibody constructs as well as the CD4(1+2)L17b BiTE® antibody construct did not. Thus, BiTE® antibody constructs targeting HIV gp120 are very promising for constraining HIV and warrant further development as novel antiviral therapy with curative potential. Importance HIV is a chronic infection well controlled with the current cART. However, we lack cure of HIV, and the HIV pandemic goes on. Here we showed in vitro and ex vivo t hat a bispecific T-cell engaging (BiTE®) antibody construct targeting HIV gp120 resulted in substantially reduced HIV replication. In addition, these BiTE® antibody constructs display efficient killing of gp120 expressing cells and inhibited replication in ex vivo

Structural characterization of the N-glycans of gpMuc from Mucuna pruriens seeds.

PubMed

Di Patrizi, Lisa; Rosati, Floriana; Guerranti, Roberto; Pagani, Roberto; Gerwig, Gerrit J; Kamerling, Johannis P

2006-11-01

Mucuna pruriens seeds are used in some countries as a human prophylactic oral anti-snake remedy. Aqueous extracts of M. pruriens seeds possess in vivo activity against cobra and viper venoms, and protect mice against Echis carinatus venom. It was recently demonstrated that the seed immunogen generating the antibody that cross-reacts with the venom proteins is a multiform glycoprotein (gpMuc), and the immunogenic properties of gpMuc seemed to mainly reside in its glycan chains. In the present study, gpMuc was found to contain only N-glycans. Part of the N-glycans could be released with peptide-(N (4)-(N-acetyl-beta -glucosaminyl)asparagine amidase F (PNGase F-sensitive N-glycans); the PNGase F-resistant N-glycans were PNGase A-sensitive. The oligosaccharides released were analyzed by a combination of MALDI-TOF mass spectrometry, HPLC profiling of 2-aminobenzamide-labelled derivatives and (1)H NMR spectroscopy. The PNGase F-sensitive N-glycans comprised a mixture of oligomannose-type structures ranging from Man(5)GlcNAc(2) to Man(9)GlcNAc(2), and two xylosylated structures, Xyl(1)Man(3)GlcNAc(2) and Xyl(1)Man(4)GlcNAc(2). The PNGase A-sensitive N-glycans, containing (alpha 1-3)-linked fucose, were identified as Fuc(1)Xyl(1)Man(2)GlcNAc(2) and Fuc(1)Xyl(1)Man(3)GlcNAc(2). In view of the determined N-glycan ensemble, the immunoreactivity of gpMuc was ascribed to the presence of core (beta 1-2)-linked xylose- and core alpha (1-3)-linked fucose-modified N-glycan chains.

Pathogenesis of Lassa fever virus infection: I. Susceptibility of mice to recombinant Lassa Gp/LCMV chimeric virus.

PubMed

Lee, Andrew M; Cruite, Justin; Welch, Megan J; Sullivan, Brian; Oldstone, Michael B A

2013-08-01

Lassa virus (LASV) is a BSL-4 restricted agent. To allow study of infection by LASV under BSL-2 conditions, we generated a recombinant virus in which the LASV glycoprotein (Gp) was placed on the backbone of lymphocytic choriomeningitis virus (LCMV) Cl13 nucleoprotein, Z and polymerase genes (rLCMV Cl13/LASV Gp). The recombinant virus displayed high tropism for dendritic cells following in vitro or in vivo infection. Inoculation of immunocompetent adults resulted in an acute infection, generation of virus-specific CD8(+) T cells and clearance of the infection. Inoculation of newborn mice with rLCMV Cl13/LASV Gp resulted in a life-long persistent infection. Interestingly, adoptive transfer of rLCMV Cl13/LASV Gp immune memory cells into such persistently infected mice failed to purge virus but, in contrast, cleared virus from mice persistently infected with wt LCMV Cl13. Copyright © 2013 Elsevier Inc. All rights reserved.

Physical Fitness to Enhance Aircrew G Tolerance

DTIC Science & Technology

1988-03-01

tolerance enhancement, G-induced loss of 06 10 consciousness, Physical conditioning, Physical fitness, Weight 0604 training, Weight lifting, Anaerobics ...such as weight lifting, directed toward increasing strength and anaerobic capacity will increase C-duration tolerance. This tolerance increase is...equipment to be used by aviators to increase (and maintain this increase) their strength and anaerobic capacity is described. Aerobics conditioning with

Deletion of Interleukin-6 Signal Transducer gp130 in Small Sensory Neurons Attenuates Mechanonociception and Down-Regulates TRPA1 Expression

PubMed Central

Malsch, Philipp; Andratsch, Manfred; Vogl, Christian; Link, Andrea S.; Alzheimer, Christian; Brierley, Stuart M.; Hughes, Patrick A.

2014-01-01

Glycoprotein 130 (gp130) is the signal transducing receptor subunit for cytokines of the interleukin-6 (IL-6) family, and it is expressed in a multitude of cell types of the immune and nervous system. IL-6-like cytokines are not only key regulators of innate immunity and inflammation but are also essential factors for the differentiation and development of the somatosensory system. Mice with a null mutation of gp130 in primary nociceptive afferents (SNS-gp130−/−) are largely protected from hypersensitivity to mechanical stimuli in mouse models of pathological pain. Therefore, we set out to investigate how neuronal gp130 regulates mechanonociception. SNS-gp130−/− mice revealed reduced mechanosensitivity to high mechanical forces in the von Frey assay in vivo, and this was associated with a reduced sensitivity of nociceptive primary afferents in vitro. Together with these findings, transient receptor potential ankyrin 1 (TRPA1) mRNA expression was significantly reduced in DRG from SNS-gp130−/− mice. This was also reflected by a reduced number of neurons responding with calcium transients to TRPA1 agonists in primary DRG cultures. Downregulation of Trpa1 expression was predominantly discovered in nonpeptidergic neurons, with the deficit becoming evident during stages of early postnatal development. Regulation of Trpa1 mRNA expression levels downstream of gp130 involved the classical Janus kinase family-signal transducer and activator of transcription pathway. Our results closely link proinflammatory cytokines to the expression of TRPA1, both of which have been shown to contribute to hypersensitive pain states. We suggest that gp130 has an essential role in mechanonociception and in the regulation of TRPA1 expression. PMID:25057188

Attenuated Human Parainfluenza Virus Type 1 Expressing Ebola Virus Glycoprotein GP Administered Intranasally Is Immunogenic in African Green Monkeys.

PubMed

Lingemann, Matthias; Liu, Xueqiao; Surman, Sonja; Liang, Bo; Herbert, Richard; Hackenberg, Ashley D; Buchholz, Ursula J; Collins, Peter L; Munir, Shirin

2017-05-15

The recent 2014-2016 Ebola virus (EBOV) outbreak prompted increased efforts to develop vaccines against EBOV disease. We describe the development and preclinical evaluation of an attenuated recombinant human parainfluenza virus type 1 (rHPIV1) expressing the membrane-anchored form of EBOV glycoprotein GP, as an intranasal (i.n.) EBOV vaccine. GP was codon optimized and expressed either as a full-length protein or as an engineered chimeric form in which its transmembrane and cytoplasmic tail (TMCT) domains were replaced with those of the HPIV1 F protein in an effort to enhance packaging into the vector particle and immunogenicity. GP was inserted either preceding the N gene (pre-N) or between the N and P genes (N-P) of rHPIV1 bearing a stabilized attenuating mutation in the P/C gene (C Δ170 ). The constructs grew to high titers and efficiently and stably expressed GP. Viruses were attenuated, replicating at low titers over several days, in the respiratory tract of African green monkeys (AGMs). Two doses of candidates expressing GP from the pre-N position elicited higher GP neutralizing serum antibody titers than the N-P viruses, and unmodified GP induced higher levels than its TMCT counterpart. Unmodified EBOV GP was packaged into the HPIV1 particle, and the TMCT modification did not increase packaging or immunogenicity but rather reduced the stability of GP expression during in vivo replication. In conclusion, we identified an attenuated and immunogenic i.n. vaccine candidate expressing GP from the pre-N position. It is expected to be well tolerated in humans and is available for clinical evaluation. IMPORTANCE EBOV hemorrhagic fever is one of the most lethal viral infections and lacks a licensed vaccine. Contact of fluids from infected individuals, including droplets or aerosols, with mucosal surfaces is an important route of EBOV spread during a natural outbreak, and aerosols also might be exploited for intentional virus spread. Therefore, vaccines that protect

77 FR 73635 - Northwest Storage GP, LLC; Notice of Application

Federal Register 2010, 2011, 2012, 2013, 2014

2012-12-11

... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. CP13-18-000; PF12-2-000] Northwest Storage GP, LLC; Notice of Application Take notice that on November 21, 2012, Northwest Storage GP..., Northwest Storage GP, LLC., 295 Chipeta Way, Salt Lake City, Utah 84108, by phone at 801-584-6857 or by...

Structure-based Design of Cyclically Permuted HIV-1 gp120 Trimers That Elicit Neutralizing Antibodies*

PubMed Central

Kesavardhana, Sannula; Das, Raksha; Citron, Michael; Datta, Rohini; Ecto, Linda; Srilatha, Nonavinakere Seetharam; DiStefano, Daniel; Swoyer, Ryan; Joyce, Joseph G.; Dutta, Somnath; LaBranche, Celia C.; Montefiori, David C.; Flynn, Jessica A.; Varadarajan, Raghavan

2017-01-01

A major goal for HIV-1 vaccine development is an ability to elicit strong and durable broadly neutralizing antibody (bNAb) responses. The trimeric envelope glycoprotein (Env) spikes on HIV-1 are known to contain multiple epitopes that are susceptible to bNAbs isolated from infected individuals. Nonetheless, all trimeric and monomeric Env immunogens designed to date have failed to elicit such antibodies. We report the structure-guided design of HIV-1 cyclically permuted gp120 that forms homogeneous, stable trimers, and displays enhanced binding to multiple bNAbs, including VRC01, VRC03, VRC-PG04, PGT128, and the quaternary epitope-specific bNAbs PGT145 and PGDM1400. Constructs that were cyclically permuted in the V1 loop region and contained an N-terminal trimerization domain to stabilize V1V2-mediated quaternary interactions, showed the highest homogeneity and the best antigenic characteristics. In guinea pigs, a DNA prime-protein boost regimen with these new gp120 trimer immunogens elicited potent neutralizing antibody responses against highly sensitive Tier 1A isolates and weaker neutralizing antibody responses with an average titer of about 115 against a panel of heterologous Tier 2 isolates. A modest fraction of the Tier 2 virus neutralizing activity appeared to target the CD4 binding site on gp120. These results suggest that cyclically permuted HIV-1 gp120 trimers represent a viable platform in which further modifications may be made to eventually achieve protective bNAb responses. PMID:27879316

The Tetherin Antagonism of the Ebola Virus Glycoprotein Requires an Intact Receptor-Binding Domain and Can Be Blocked by GP1-Specific Antibodies.

PubMed

Brinkmann, Constantin; Nehlmeier, Inga; Walendy-Gnirß, Kerstin; Nehls, Julia; González Hernández, Mariana; Hoffmann, Markus; Qiu, Xiangguo; Takada, Ayato; Schindler, Michael; Pöhlmann, Stefan

2016-12-15

The glycoprotein of Ebola virus (EBOV GP), a member of the family Filoviridae, facilitates viral entry into target cells. In addition, EBOV GP antagonizes the antiviral activity of the host cell protein tetherin, which may otherwise restrict EBOV release from infected cells. However, it is unclear how EBOV GP antagonizes tetherin, and it is unknown whether the GP of Lloviu virus (LLOV), a filovirus found in dead bats in Northern Spain, also counteracts tetherin. Here, we show that LLOV GP antagonizes tetherin, indicating that tetherin may not impede LLOV spread in human cells. Moreover, we demonstrate that appropriate processing of N-glycans in tetherin/GP-coexpressing cells is required for tetherin counteraction by EBOV GP. Furthermore, we show that an intact receptor-binding domain (RBD) in the GP1 subunit of EBOV GP is a prerequisite for tetherin counteraction. In contrast, blockade of Niemann-Pick disease type C1 (NPC1), a cellular binding partner of the RBD, did not interfere with tetherin antagonism. Finally, we provide evidence that an antibody directed against GP1, which protects mice from a lethal EBOV challenge, may block GP-dependent tetherin antagonism. Our data, in conjunction with previous reports, indicate that tetherin antagonism is conserved among the GPs of all known filoviruses and demonstrate that the GP1 subunit of EBOV GP plays a central role in tetherin antagonism. Filoviruses are reemerging pathogens that constitute a public health threat. Understanding how Ebola virus (EBOV), a highly pathogenic filovirus responsible for the 2013-2016 Ebola virus disease epidemic in western Africa, counteracts antiviral effectors of the innate immune system might help to define novel targets for antiviral intervention. Similarly, determining whether Lloviu virus (LLOV), a filovirus detected in bats in northern Spain, is inhibited by innate antiviral effectors in human cells might help to determine whether the virus constitutes a threat to humans. The

Increased Circulating Level of the Survival Factor GP88 (Progranulin) in the Serum of Breast Cancer Patients When Compared to Healthy Subjects

PubMed Central

Tkaczuk, Katherine Rak; Yue, Binbin; Zhan, Min; Tait, Nancy; Yarlagadda, Lavanya; Dai, Huifang; Serrero, Ginette

2011-01-01

Introduction: GP88 (PC-Cell Derived Growth Factor, progranulin) is a glycoprotein overexpressed in breast tumors and involved in their proliferation and survival. Since GP88 is secreted, an exploratory study was established to compare serum GP88 level between breast cancer patients (BC) and healthy volunteers (HV). Methods: An IRB approved prospective study enrolled 189 stage 1–4 BC patients and 18 HV. GP88 serum concentration was determined by immunoassay. Results: Serum GP88 level was 28.7 + 5.8 ng/ml in HV and increased to 40.7 + 16.0 ng/ml (P = 0.007) for stage 1–3 and 45.3 + 23.3 ng/ml (P = 0.0007) for stage 4 BC patients. There was no correlation between the GP88 level and BC characteristics such as age, race, tumor grade, ER, PR and HER-2 expression. Conclusion: These data suggest that serial testing of serum GP88 levels may have value as a circulating biomarker for detection, monitoring and follow up of BC. PMID:21792312

FERMI LARGE AREA TELESCOPE OBSERVATIONS OF THE SUPERNOVA REMNANT G8.7-0.1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ajello, M.; Allafort, A.; Bechtol, K.

We present a detailed analysis of the GeV gamma-ray emission toward the supernova remnant (SNR) G8.7-0.1 with the Large Area Telescope (LAT) on board the Fermi Gamma-ray Space Telescope. An investigation of the relationship between G8.7-0.1 and the TeV unidentified source HESS J1804-216 provides us with an important clue on diffusion process of cosmic rays if particle acceleration operates in the SNR. The GeV gamma-ray emission is extended with most of the emission in positional coincidence with the SNR G8.7-0.1 and a lesser part located outside the western boundary of G8.7-0.1. The region of the gamma-ray emission overlaps spatially connectedmore » molecular clouds, implying a physical connection for the gamma-ray structure. The total gamma-ray spectrum measured with LAT from 200 MeV-100 GeV can be described by a broken power-law function with a break of 2.4 {+-} 0.6 (stat) {+-} 1.2 (sys) GeV, and photon indices of 2.10 {+-} 0.06 (stat) {+-} 0.10 (sys) below the break and 2.70 {+-} 0.12 (stat) {+-} 0.14 (sys) above the break. Given the spatial association among the gamma rays, the radio emission of G8.7-0.1, and the molecular clouds, the decay of {pi}{sup 0}s produced by particles accelerated in the SNR and hitting the molecular clouds naturally explains the GeV gamma-ray spectrum. We also find that the GeV morphology is not well represented by the TeV emission from HESS J1804-216 and that the spectrum in the GeV band is not consistent with the extrapolation of the TeV gamma-ray spectrum. The spectral index of the TeV emission is consistent with the particle spectral index predicted by a theory that assumes energy-dependent diffusion of particles accelerated in an SNR. We discuss the possibility that the TeV spectrum originates from the interaction of particles accelerated in G8.7-0.1 with molecular clouds, and we constrain the diffusion coefficient of the particles.« less

Fermi Large Area Telescope Observations of the Supernova Remnant G8.7-0.1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ajello, M.; Allafort, A.; /Stanford U., HEPL /KIPAC, Menlo Park /SLAC

We present a detailed analysis of the GeV gamma-ray emission toward the supernova remnant (SNR) G8.7-0.1 with the Large Area Telescope (LAT) on board the Fermi Gamma-ray Space Telescope. An investigation of the relationship between G8.7-0.1 and the TeV unidentified source HESS J1804-216 provides us with an important clue on diffusion process of cosmic rays if particle acceleration operates in the SNR. The GeV gamma-ray emission is extended with most of the emission in positional coincidence with the SNR G8.7-0.1 and a lesser part located outside the western boundary of G8.7-0.1. The region of the gamma-ray emission overlaps spatially connectedmore » molecular clouds, implying a physical connection for the gamma-ray structure. The total gamma-ray spectrum measured with LAT from 200 MeV-100 GeV can be described by a broken power-law function with a break of 2.4 {+-} 0.6 (stat) {+-} 1.2 (sys) GeV, and photon indices of 2.10 {+-} 0.06 (stat) {+-} 0.10 (sys) below the break and 2.70 {+-} 0.12 (stat) {+-} 0.14 (sys) above the break. Given the spatial association among the gamma rays, the radio emission of G8.7-0.1, and the molecular clouds, the decay of p0s produced by particles accelerated in the SNR and hitting the molecular clouds naturally explains the GeV gamma-ray spectrum. We also find that the GeV morphology is not well represented by the TeV emission from HESS J1804-216 and that the spectrum in the GeV band is not consistent with the extrapolation of the TeV gamma-ray spectrum. The spectral index of the TeV emission is consistent with the particle spectral index predicted by a theory that assumes energy-dependent diffusion of particles accelerated in an SNR. We discuss the possibility that the TeV spectrum originates from the interaction of particles accelerated in G8.7-0.1 with molecular clouds, and we constrain the diffusion coefficient of the particles.« less

Chapter 2: The Need for Physical Protection, Safety, and Regulation

ERIC Educational Resources Information Center

Brazelton, T. Berry; Greenspan, Stanley I.

2007-01-01

This article discusses the need for physical protection and care of infants and young children and families. One of the most important preventable challenges to children's physical safety and protection is toxic substances in their environment. Many toxic substances that affect the central nervous system are in drinking water, soil, air, and areas…

Murine serum glycoprotein gp70 behaves as an acute phase reactant

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hara, I.; Izui, S.; Dixon, F.J.

1982-02-01

A single intraperitoneal injection of bacterial lipopolysaccharide (LPS) or its lipid A component induced high levels of glycoprotein, gp70, in sera of several strains of mice within 24 h. This serum gp70 response induced by LPS was independent of the activation of B cells and the presence of T cells. However, serological and immunohistochemical studies demonstrated the production of gp70 by hepatic parenchymal cells and its subsequent release into the circulating blood. The expression of gp70 in the serum was enhanced not only by LPS but also other inducers of acute phase reactants (APR) such as turpentine oil or polyriboinosinic-polyribocytidylicmore » acid. Further, the serum gp70 response was kinetically identical to those of APR. These results strongly suggest that (a) the liver may be the major source for serum gp70, (b) serum gp70 behaves like an APR, (c) its expression may be controlled by a mechanism similar to that for other APR, and (d) this glycoprotein apparently behaves as a normal host constituent and not a product of a viral genome.« less

Differences in signal peptide processing between GP3 glycoproteins of Arteriviridae.

PubMed

Zhang, Minze; Veit, Michael

2018-04-01

We reported previously that carbohydrate attachment to an overlapping glycosylation site adjacent to the signal peptide of GP3 from equine arteritis virus (EAV) prevents cleavage. Here we investigated whether this unusual processing scheme is a feature of GP3s of other Arteriviridae, which all contain a glycosylation site at a similar position. Expression of GP3 from type-1 and type-2 porcine reproductive and respiratory syndrome virus (PRRSV) and from lactate dehydrogenase-elevating virus (LDV) revealed that the first glycosylation site is used, but has no effect on signal peptide cleavage. Comparison of the SDS-PAGE mobility of deglycosylated GP3 from PRRSV and LDV with mutants having or not having a signal peptide showed that GP3´s signal peptide is cleaved. Swapping the signal peptides between GP3 of EAV and PRRSV revealed that the information for co-translational processing is not encoded in the signal peptide, but in the remaining part of GP3. Copyright © 2017 Elsevier Inc. All rights reserved.

Antibody recognition of the glycoprotein g of viral haemorrhagic septicemia virus (VHSV) purified in large amounts from insect larvae

PubMed Central

2011-01-01

Background There are currently no purification methods capable of producing the large amounts of fish rhabdoviral glycoprotein G (gpG) required for diagnosis and immunisation purposes or for studying structure and molecular mechanisms of action of this molecule (ie. pH-dependent membrane fusion). As a result of the unavailability of large amounts of the gpG from viral haemorrhagic septicaemia rhabdovirus (VHSV), one of the most dangerous viruses affecting cultured salmonid species, research interests in this field are severely hampered. Previous purification methods to obtain recombinant gpG from VHSV in E. coli, yeast and baculovirus grown in insect cells have not produced soluble conformations or acceptable yields. The development of large-scale purification methods for gpGs will also further research into other fish rhabdoviruses, such as infectious haematopoietic necrosis virus (IHNV), spring carp viremia virus (SVCV), hirame rhabdovirus (HIRRV) and snakehead rhabdovirus (SHRV). Findings Here we designed a method to produce milligram amounts of soluble VHSV gpG. Only the transmembrane and carboxy terminal-deleted (amino acid 21 to 465) gpG was efficiently expressed in insect larvae. Recognition of G21-465 by ß-mercaptoethanol-dependent neutralizing monoclonal antibodies (N-MAbs) and pH-dependent recognition by sera from VHSV-hyperimmunized or VHSV-infected rainbow trout (Oncorhynchus mykiss) was demonstrated. Conclusions Given that the purified G21-465 conserved some of its most important properties, this method might be suitable for the large-scale production of fish rhabdoviral gpGs for use in diagnosis, fusion and antigenicity studies. PMID:21693048

Antibody recognition of the glycoprotein g of viral haemorrhagic septicemia virus (VHSV) purified in large amounts from insect larvae.

PubMed

Encinas, Paloma; Gomez-Sebastian, Silvia; Nunez, Maria Carmen; Gomez-Casado, Eduardo; Escribano, Jose M; Estepa, Amparo; Coll, Julio

2011-06-21

There are currently no purification methods capable of producing the large amounts of fish rhabdoviral glycoprotein G (gpG) required for diagnosis and immunisation purposes or for studying structure and molecular mechanisms of action of this molecule (ie. pH-dependent membrane fusion). As a result of the unavailability of large amounts of the gpG from viral haemorrhagic septicaemia rhabdovirus (VHSV), one of the most dangerous viruses affecting cultured salmonid species, research interests in this field are severely hampered. Previous purification methods to obtain recombinant gpG from VHSV in E. coli, yeast and baculovirus grown in insect cells have not produced soluble conformations or acceptable yields. The development of large-scale purification methods for gpGs will also further research into other fish rhabdoviruses, such as infectious haematopoietic necrosis virus (IHNV), spring carp viremia virus (SVCV), hirame rhabdovirus (HIRRV) and snakehead rhabdovirus (SHRV). Here we designed a method to produce milligram amounts of soluble VHSV gpG. Only the transmembrane and carboxy terminal-deleted (amino acid 21 to 465) gpG was efficiently expressed in insect larvae. Recognition of G21-465 by ß-mercaptoethanol-dependent neutralizing monoclonal antibodies (N-MAbs) and pH-dependent recognition by sera from VHSV-hyperimmunized or VHSV-infected rainbow trout (Oncorhynchus mykiss) was demonstrated. Given that the purified G21-465 conserved some of its most important properties, this method might be suitable for the large-scale production of fish rhabdoviral gpGs for use in diagnosis, fusion and antigenicity studies.

Exploring resilience in rural GP registrars--implications for training.

PubMed

Walters, Lucie; Laurence, Caroline O; Dollard, Joanne; Elliott, Taryn; Eley, Diann S

2015-07-02

Resilience can be defined as the ability to rebound from adversity and overcome difficult circumstances. General Practice (GP) registrars face many challenges in transitioning into general practice, and additional stressors and pressures apply for those choosing a career in rural practice. At this time of international rural generalist medical workforce shortages, it is important to focus on the needs of rural GP registrars and how to support them to become resilient health care providers. This study sought to explore GP registrars' perceptions of their resilience and strategies they used to maintain resilience in rural general practice. In this qualitative interpretive research, semi-structured interviews were recorded, transcribed and analysed using an inductive approach. Initial coding resulted in a coding framework which was refined using constant comparison and negative case analysis. Authors developed consensus around the final conceptual model. Eighteen GP registrars from: Australian College of Rural and Remote Medicine Independent Pathway, and three GP regional training programs with rural training posts. Six main themes emerged from the data. Firstly, rural GP registrars described four dichotomous tensions they faced: clinical caution versus clinical courage; flexibility versus persistence; reflective practice versus task-focused practice; and personal connections versus professional commitment. Further themes included: personal skills for balance which facilitated resilience including optimistic attitude, self-reflection and metacognition; and finally GP registrars recognised the role of their supervisors in supporting and stretching them to enhance their clinical resilience. Resilience is maintained as on a wobble board by balancing professional tensions within acceptable limits. These limits are unique to each individual, and may be expanded through personal growth and professional development as part of rural general practice training.

Gold nanoparticle–M2e conjugate coformulated with CpG induces protective immunity against influenza A virus

PubMed Central

Tao, Wenqian; Ziemer, Katherine S; Gill, Harvinder S

2014-01-01

Aim: This study aimed to develop a novel influenza A vaccine by conjugating the highly conserved extracellular region of the matrix 2 protein (M2e) of influenza A virus to gold nanoparticles (AuNPs) and to test the vaccine in a mouse influenza challenge model. Materials & methods: Citrate-reduced AuNPs (diameter: 12 nm) were synthesized, and characterized by transmission electron microscopy and dynamic light scattering. M2e was conjugated to AuNPs through thiol–gold interactions to form M2e–AuNP conjugates. Particle stability was confirmed by UV–visible spectra, and M2e conjugation was further characterized by x-ray photoelectron spectroscopy. Mice were immunized with M2e–AuNPs with or without CpG (cytosine-guanine rich oligonucleotide) as an adjuvant with appropriate control groups. Sera was collected and M2e-specific immunoglobulin (IgG) was measured, and immunized mice were challenged with PR8-H1N1 influenza virus. Results: M2e-capped AuNPs could be lyophilized and stably resuspended in water. Intranasal vaccination of mice with M2e–AuNP conjugates induced M2e-specific IgG serum antibodies, which significantly increased upon addition of soluble CpG as adjuvant. Upon challenge with lethal PR8, mice vaccinated with M2e-AuNP conjugates were only partially protected, while mice that received soluble CpG as adjuvant in addition to M2e–AuNP were fully protected. Conclusion: Overall, this study demonstrates the potential of using the M2e–AuNP conjugates with CpG as an adjuvant as a platform for developing an influenza A vaccine. PMID:23829488

Intradermal Vaccination With Adjuvanted Ebola Virus Soluble Glycoprotein Subunit Vaccine by Microneedle Patches Protects Mice Against Lethal Ebola Virus Challenge.

PubMed

Liu, Ying; Ye, Ling; Lin, Fang; Gomaa, Yasmine; Flyer, David; Carrion, Ricardo; Patterson, Jean L; Prausnitz, Mark R; Smith, Gale; Glenn, Gregory; Wu, Hua; Compans, Richard W; Yang, Chinglai

2018-06-08

In this study, we investigated immune responses induced by purified Ebola virus (EBOV) soluble glycoprotein (sGP) subunit vaccines via intradermal immunization with microneedle (MN) patches in comparison with intramuscular (IM) injection in mice. Our results showed that MN delivery of EBOV sGP was superior to IM injection in eliciting higher levels and longer lasting antibody responses against EBOV sGP and GP antigens. Moreover, sGP-specific immune responses induced by MN or IM immunizations were effectively augmented by formulating sGP with a saponin-based adjuvant, and they were shown to confer complete protection of mice against lethal mouse-adapted EBOV (MA-EBOV) challenge. In comparison, mice that received sGP without adjuvant by MN or IM immunizations succumbed to lethal MA-EBOV challenge. These results show that immunization with EBOV sGP subunit vaccines with adjuvant by MN patches, which have been shown to provide improved safety and thermal stability, is a promising approach to protect against EBOV infection.

Development of a novel, guinea pig-specific IFN-γ ELISPOT assay and characterization of guinea pig cytomegalovirus GP83-specific cellular immune responses following immunization with a modified vaccinia virus Ankara (MVA)-vectored GP83 vaccine.

PubMed

Gillis, Peter A; Hernandez-Alvarado, Nelmary; Gnanandarajah, Josephine S; Wussow, Felix; Diamond, Don J; Schleiss, Mark R

2014-06-30

The guinea pig (Cavia porcellus) provides a useful animal model for studying the pathogenesis of many infectious diseases, and for preclinical evaluation of vaccines. However, guinea pig models are limited by the lack of immunological reagents required for characterization and quantification of antigen-specific T cell responses. To address this deficiency, an enzyme-linked immunospot (ELISPOT) assay for guinea pig interferon (IFN)-γ was developed to measure antigen/epitope-specific T cell responses to guinea pig cytomegalovirus (GPCMV) vaccines. Using splenocytes harvested from animals vaccinated with a modified vaccinia virus Ankara (MVA) vector encoding the GPCMV GP83 (homolog of human CMV pp65 [gpUL83]) protein, we were able to enumerate and map antigen-specific responses, both in vaccinated as well as GPCMV-infected animals, using a panel of GP83-specific peptides. Several potential immunodominant GP83-specific peptides were identified, including one epitope, LGIVHFFDN, that was noted in all guinea pigs that had a detectable CD8+ response to GP83. Development of a guinea pig IFN-γ ELISPOT should be useful in characterization of additional T cell-specific responses to GPCMV, as well as other pathogens. This information in turn can help focus future experimental evaluation of immunization strategies, both for GPCMV as well as for other vaccine-preventable illnesses studied in the guinea pig model. Copyright © 2014 Elsevier Ltd. All rights reserved.

Determinants of the choice of GP practice registration in England: evidence from a discrete choice experiment.

PubMed

Lagarde, Mylene; Erens, Bob; Mays, Nicholas

2015-04-01

There have been growing concerns that general practitioner (GP) services in England, which are based on registration with a single practice located near the patient's home, are not sufficiently convenient for patients. To inform the decision as to whether to change registration rules allowing patients to register 'out-of-area' and to estimate the demand for this wider choice, we undertook a discrete choice experiment with 1706 respondents. Latent class models were used to analyse preferences for GP practice registration comparing preferences for neighbourhood and non-neighbourhood practices. We find that there is some appetite for registering outside the neighbourhood, but this preference is not uniformly shared across the population. Specifically individuals who are less mobile (e.g. older people and those with caring responsibilities), or satisfied with their local practice are less likely to be interested in registering at a practice outside their neighbourhood. Overall, people feel most strongly about obtaining an appointment with a GP as quickly as possible. Respondents regarded weekend opening as less important than other factors, and particularly less important than extended practice opening hours from Monday to Friday. Assuming a constant demand for GP services, a policy encouraging GP practices to extend their opening hours during the week is likely to decrease the average patient waiting time for an appointment and is likely to be preferred by patients. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Comprehensive Characterization of Reference Standard Lots of HIV-1 Subtype C Gp120 Proteins for Clinical Trials in Southern African Regions

PubMed Central

Wang, Zihao; Lorin, Clarisse; Koutsoukos, Marguerite; Franco, David; Bayat, Babak; Zhang, Ying; Carfi, Andrea; Barnett, Susan W.; Porter, Frederick

2016-01-01

Two HIV-1 subtype C gp120 protein candidates were the selected antigens for several experimental vaccine regimens now under evaluation in HVTN 100 Phase I/II clinical trial aiming to support the start of the HVTN 702 Phase IIb/III trial in southern Africa, which is designed to confirm and extend the partial protection seen against HIV-1 infection in the RV144 Thai trial. Here, we report the comprehensive physicochemical characterization of the gp120 reference materials that are representative of the clinical trial materials. Gp120 proteins were stably expressed in Chinese Hamster Ovary (CHO) cells and subsequently purified and formulated. A panel of analytical techniques was used to characterize the physicochemical properties of the two protein molecules. When formulated in the AS01 Adjuvant System, the bivalent subtype C gp120 antigens elicited 1086.C- and TV1.C-specific binding antibody and CD4+ T cell responses in mice. All the characteristics were highly representative of the Clinical Trial Materials (CTM). Data from this report demonstrate the immunogenicity of the gp120 antigens, provide comprehensive characterization of the molecules, set the benchmark for assessment of current and future CTM lots, and lay the physicochemical groundwork for interpretation of future clinical trial data. PMID:27187483

A prophylactic multivalent vaccine against different filovirus species is immunogenic and provides protection from lethal infections with Ebolavirus and Marburgvirus species in non-human primates.

PubMed

Callendret, Benoit; Vellinga, Jort; Wunderlich, Kerstin; Rodriguez, Ariane; Steigerwald, Robin; Dirmeier, Ulrike; Cheminay, Cedric; Volkmann, Ariane; Brasel, Trevor; Carrion, Ricardo; Giavedoni, Luis D; Patterson, Jean L; Mire, Chad E; Geisbert, Thomas W; Hooper, Jay W; Weijtens, Mo; Hartkoorn-Pasma, Jutta; Custers, Jerome; Grazia Pau, Maria; Schuitemaker, Hanneke; Zahn, Roland

2018-01-01

The search for a universal filovirus vaccine that provides protection against multiple filovirus species has been prompted by sporadic but highly lethal outbreaks of Ebolavirus and Marburgvirus infections. A good prophylactic vaccine should be able to provide protection to all known filovirus species and as an upside potentially protect from newly emerging virus strains. We investigated the immunogenicity and protection elicited by multivalent vaccines expressing glycoproteins (GP) from Ebola virus (EBOV), Sudan virus (SUDV), Taï Forest virus (TAFV) and Marburg virus (MARV). Immune responses against filovirus GP have been associated with protection from disease. The GP antigens were expressed by adenovirus serotypes 26 and 35 (Ad26 and Ad35) and modified Vaccinia virus Ankara (MVA) vectors, all selected for their strong immunogenicity and good safety profile. Using fully lethal NHP intramuscular challenge models, we assessed different vaccination regimens for immunogenicity and protection from filovirus disease. Heterologous multivalent Ad26-Ad35 prime-boost vaccination regimens could give full protection against MARV (range 75%-100% protection) and EBOV (range 50% to 100%) challenge, and partial protection (75%) against SUDV challenge. Heterologous multivalent Ad26-MVA prime-boost immunization gave full protection against EBOV challenge in a small cohort study. The use of such multivalent vaccines did not show overt immune interference in comparison with monovalent vaccines. Multivalent vaccines induced GP-specific antibody responses and cellular IFNγ responses to each GP expressed by the vaccine, and cross-reactivity to TAFV GP was detected in a trivalent vaccine expressing GP from EBOV, SUDV and MARV. In the EBOV challenge studies, higher humoral EBOV GP-specific immune responses (p = 0.0004) were associated with survival from EBOV challenge and less so for cellular immune responses (p = 0.0320). These results demonstrate that it is feasible to generate a

A prophylactic multivalent vaccine against different filovirus species is immunogenic and provides protection from lethal infections with Ebolavirus and Marburgvirus species in non-human primates

PubMed Central

Callendret, Benoit; Vellinga, Jort; Wunderlich, Kerstin; Steigerwald, Robin; Dirmeier, Ulrike; Cheminay, Cedric; Volkmann, Ariane; Brasel, Trevor; Carrion, Ricardo; Giavedoni, Luis D.; Patterson, Jean L.; Mire, Chad E.; Geisbert, Thomas W.; Hooper, Jay W.; Weijtens, Mo; Hartkoorn-Pasma, Jutta; Custers, Jerome; Grazia Pau, Maria; Schuitemaker, Hanneke

2018-01-01

The search for a universal filovirus vaccine that provides protection against multiple filovirus species has been prompted by sporadic but highly lethal outbreaks of Ebolavirus and Marburgvirus infections. A good prophylactic vaccine should be able to provide protection to all known filovirus species and as an upside potentially protect from newly emerging virus strains. We investigated the immunogenicity and protection elicited by multivalent vaccines expressing glycoproteins (GP) from Ebola virus (EBOV), Sudan virus (SUDV), Taï Forest virus (TAFV) and Marburg virus (MARV). Immune responses against filovirus GP have been associated with protection from disease. The GP antigens were expressed by adenovirus serotypes 26 and 35 (Ad26 and Ad35) and modified Vaccinia virus Ankara (MVA) vectors, all selected for their strong immunogenicity and good safety profile. Using fully lethal NHP intramuscular challenge models, we assessed different vaccination regimens for immunogenicity and protection from filovirus disease. Heterologous multivalent Ad26-Ad35 prime-boost vaccination regimens could give full protection against MARV (range 75%-100% protection) and EBOV (range 50% to 100%) challenge, and partial protection (75%) against SUDV challenge. Heterologous multivalent Ad26-MVA prime-boost immunization gave full protection against EBOV challenge in a small cohort study. The use of such multivalent vaccines did not show overt immune interference in comparison with monovalent vaccines. Multivalent vaccines induced GP-specific antibody responses and cellular IFNγ responses to each GP expressed by the vaccine, and cross-reactivity to TAFV GP was detected in a trivalent vaccine expressing GP from EBOV, SUDV and MARV. In the EBOV challenge studies, higher humoral EBOV GP-specific immune responses (p = 0.0004) were associated with survival from EBOV challenge and less so for cellular immune responses (p = 0.0320). These results demonstrate that it is feasible to generate a

Chromium (VI) induced oxidative damage to DNA: increase of urinary 8-hydroxydeoxyguanosine concentrations (8-OHdG) among electroplating workers

PubMed Central

Kuo, H; Chang, S; Wu, K; Wu, F

2003-01-01

Aims: To investigate the concentration of urinary 8-hydroxydeoxyguanosine (8-OHdG) among electroplating workers in Taiwan. Methods: Fifty workers were selected from five chromium (Cr) electroplating plants in central Taiwan. The 20 control subjects were office workers with no previous exposure to Cr. Urinary 8-OHdG concentrations were determined using high performance liquid chromatography with electrochemical detection. Results: Urinary 8-OHdG concentrations among Cr workers (1149.5 pmol/kg/day) were higher than those in the control group (730.2 pmol/kg/day). There was a positive correlation between urinary 8-OHdG concentrations and urinary Cr concentration (r = 0.447, p < 0.01), and urinary 8-OHdG correlated positively with airborne Cr concentration (r = 0.285). Using multiple regression analysis, the factors that affected urinary 8-OHdG concentrations were alcohol, the common cold, and high urinary Cr concentration. There was a high correlation of urinary 8-OHdG with both smoking and drinking, but multiple regression analysis showed that smoking was not a significant factor. Age and gender were also non-significant factors. Conclusion: 8-OHdG, which is an indicator of oxidative DNA damage, was a sensitive biomarker for Cr exposure. PMID:12883020

Development of a gradient elution high-performance liquid chromatography assay with ultraviolet detection for the determination in plasma of the anticancer peptide [Arg6, D-Trp7,9, mePhe8]-substance P (6-11) (antagonist G), its major metabolites and a C-terminal pyrene-labelled conjugate.

PubMed

Cummings, J; MacLellan, A J; Mark, M; Jodrell, D I

1999-09-24

[Arg6, D-Trp7,9 mePhe8]-substance P (6-11), code-named antagonist G, is a novel peptide currently undergoing early clinical trials as an anticancer drug. A sensitive, high efficiency high-performance liquid chromatography (HPLC) method is described for the determination in human plasma of antagonist G and its three major metabolites, deamidated-G (M1), G-minus Met11 (M2) and G[Met11(O)] (M3). Gradient elution was employed using 40 mM ammonium acetate in 0.15% trifluoroacetic acid as buffer A and acetonitrile as solvent B, with a linear gradient increasing from 30 to 100% B over 15 min, together with a microbore analytical column (microBondapak C18, 30 cm X 2 mm I.D.). Detection was by UV at 280 nm and the column was maintained at 40 degrees C. Retention times varied by <1% throughout the day and were as follows: G, 13.0 min; M1, 12.2 min; M2, 11.2 min; M3, 10.8 min, and 18.1 min for a pyrene conjugate of G (G-P). The limit of detection on column (LOD) was 2.5 ng for antagonist G, M1-3 and G-P and the limit of quantitation (LOQ) was 20 ng/ml for G and 100 ng/ml for M1-3. Sample clean-up by solid-phase extraction using C2-bonded 40 microm silica particles (Bond Elut, 1 ml reservoirs) resulted in elimination of interference from plasma constituents. Within-day and between-day precision and accuracy over a broad range of concentrations (100 ng/ml-100 microg/ml) normally varied by < 10%, although at the highest concentrations of M1 and M2 studied (50 microg/ml), increased variability and reduced recovery were observed. The new assay will aid in the clinical development of antagonist G.

Polyubiquitylation of AMF requires cooperation between the gp78 and TRIM25 ubiquitin ligases.

PubMed

Wang, Ying; Ha, Seung-Wook; Zhang, Tianpeng; Kho, Dhong-Hyo; Raz, Avraham; Xie, Youming

2014-04-30

gp78 is a ubiquitin ligase that plays a vital role in endoplasmic reticulum (ER)-associated degradation (ERAD). Here we report that autocrine motility factor (AMF), also known as phosphoglucose isomerase (PGI), is a novel substrate of gp78. We show that polyubiquitylation of AMF requires cooperative interaction between gp78 and the ubiquitin ligase TRIM25 (tripartite motif-containing protein 25). While TRIM25 mediates the initial round of ubiquitylation, gp78 catalyzes polyubiquitylation of AMF. The E4-like activity of gp78 was illustrated by an in vitro polyubiquitylation assay using Ub-DHFR as a model substrate. We further demonstrate that TRIM25 ubiquitylates gp78 and that overexpression of TRIM25 accelerates the degradation of gp78. Our data suggest that TRIM25 not only cooperates with gp78 in polyubiquitylation of AMF but also gauges the steady-state level of gp78. This study uncovers a previously unknown functional link between gp78 and TRIM25 and provides mechanistic insight into gp78-mediated protein ubiquitylation.

Polyubiquitylation of AMF requires cooperation between the gp78 and TRIM25 ubiquitin ligases

PubMed Central

Kho, Dhong-Hyo; Raz, Avraham; Xie, Youming

2014-01-01

gp78 is a ubiquitin ligase that plays a vital role in endoplasmic reticulum (ER)-associated degradation (ERAD). Here we report that autocrine motility factor (AMF), also known as phosphoglucose isomerase (PGI), is a novel substrate of gp78. We show that polyubiquitylation of AMF requires cooperative interaction between gp78 and the ubiquitin ligase TRIM25 (tripartite motif-containing protein 25). While TRIM25 mediates the initial round of ubiquitylation, gp78 catalyzes polyubiquitylation of AMF. The E4-like activity of gp78 was illustrated by an in vitro polyubiquitylation assay using Ub-DHFR as a model substrate. We further demonstrate that TRIM25 ubiquitylates gp78 and that overexpression of TRIM25 accelerates the degradation of gp78. Our data suggest that TRIM25 not only cooperates with gp78 in polyubiquitylation of AMF but also gauges the steady-state level of gp78. This study uncovers a previously unknown functional link between gp78 and TRIM25 and provides mechanistic insight into gp78-mediated protein ubiquitylation. PMID:24810856

Protoberberine alkaloids and their reversal activity of P-gp expressed multidrug resistance (MDR) from the rhizome of Coptis japonica Makino.

PubMed

Min, Yong Deuk; Yang, Min Cheol; Lee, Kyu Ha; Kim, Kyung Ran; Choi, Sang Un; Lee, Kang Ro

2006-09-01

Six protoberberine alkaloids were isolated from the chloroform layer of the rhizome of Coptis japonica Makino (Ranunculaceae). The structures of the isolated compounds were determined to be 6-([1,3]dioxolo[4,5-g]isoquinoline-5-carbonyl)-2,3-dimethoxy-benzoic acid methyl ester (1), oxyberberine (2), 8-oxo-epiberberine (3), 8-oxocoptisine (4), berberine (5) and palmatine (6) by physicochemical and spectroscopic methods. The compound 3 (8-oxo-epiberberine) was first isolated from natural sources. The compounds were tested for cytotoxicity against five tumor cell lines in vitro by SRB method, and also tested for the MDR reversal activities. Compound 4 was of significant P-gp MDR inhibition activity with ED50 value 0.018 microg/mL in MES-SA/DX5 cell and 0.0005 microg/mL in HCT15 cell, respectively.

Selection of GP. Mur antigen-negative RBC for blood recipients with anti-'Mia ' records decreases transfusion reaction rates in Taiwan.

PubMed

Yang, C-A; Lin, J-A; Chang, C-W; Wu, K-H; Yeh, S-P; Ho, C-M; Chang, J-G

2016-10-01

To evaluate the clinical significance of GP. Mur antigen-negative blood selection for transfusion in patients with anti-'Mi a ' records. The GP. Mur RBC phenotype is prevalent (7·3%) in Taiwan. Antibodies against GP. Mur (anti-'Mi a ') are identified in 1·24% of our population, and anti-'Mi a ' screening using GP. Mur RBC has been routine for Taiwan's blood banks. However, due to the lack of commercial antibodies, only cross-matching was used to prevent transfusion of GP. Mur-positive blood to patients with anti-'Mi a ' in most hospitals. There is still a risk of GP. Mur-positive RBC exposure and subsequent anti-'Mi a '-related transfusion reactions. Since February 2014, GP. Mur antigen-negative RBCs identified by reaction with anti-'Mi a '-positive serum were selected for blood recipients with anti-'Mi a ' records. The transfusion reactions between January 2013 and January 2014 were compared with those that occurred between February 2014 and July 2015. The transfusion reaction rate was significantly higher in anti-'Mi a '-positive blood recipients compared to total subjects receiving an RBC transfusion before GP. Mur-negative donor RBC selection. After antigen-negative RBC selection, the transfusion reaction frequency in subjects with anti-'Mi a ' became similar to total blood recipients. IgG form anti-'Mi a ' antibodies were present in all cases of probable anti-'Mi a '-related transfusion reactions. The time required for anti-'Mi a ' boosting after transfusion was around 4-21 days. Selection of GP. Mur-negative RBC for transfusion to patients with anti-'Mi a ' records could decrease the rate of transfusion reaction and antibody boosting. This procedure should be incorporated into blood bank routines in areas where anti-'Mi a ' is prevalent. © 2016 British Blood Transfusion Society.

16 CFR Appendix G8 to Part 305 - Boilers-Electric

Code of Federal Regulations, 2010 CFR

2010-01-01

... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Boilers-Electric G8 Appendix G8 to Part 305 Commercial Practices FEDERAL TRADE COMMISSION REGULATIONS UNDER SPECIFIC ACTS OF CONGRESS RULE CONCERNING... Part 305—Boilers—Electric Manufacturer's rated heating capacities (Btu's/hr.) Range of annual fuel...

16 CFR Appendix G8 to Part 305 - Boilers-Electric

Code of Federal Regulations, 2012 CFR

2012-01-01

... 16 Commercial Practices 1 2012-01-01 2012-01-01 false Boilers-Electric G8 Appendix G8 to Part 305 Commercial Practices FEDERAL TRADE COMMISSION REGULATIONS UNDER SPECIFIC ACTS OF CONGRESS RULE CONCERNING... Part 305—Boilers—Electric Manufacturer's rated heating capacities (Btu's/hr.) Range of annual fuel...

16 CFR Appendix G8 to Part 305 - Boilers-Electric

Code of Federal Regulations, 2013 CFR

2013-01-01

... 16 Commercial Practices 1 2013-01-01 2013-01-01 false Boilers-Electric G8 Appendix G8 to Part 305 Commercial Practices FEDERAL TRADE COMMISSION REGULATIONS UNDER SPECIFIC ACTS OF CONGRESS RULE CONCERNING... Part 305—Boilers—Electric Manufacturer's rated heating capacities (Btu's/hr.) Range of annual fuel...

16 CFR Appendix G8 to Part 305 - Boilers-Electric

Code of Federal Regulations, 2011 CFR

2011-01-01

... 16 Commercial Practices 1 2011-01-01 2011-01-01 false Boilers-Electric G8 Appendix G8 to Part 305 Commercial Practices FEDERAL TRADE COMMISSION REGULATIONS UNDER SPECIFIC ACTS OF CONGRESS RULE CONCERNING... Part 305—Boilers—Electric Manufacturer's rated heating capacities (Btu's/hr.) Range of annual fuel...

Lack of gp130 expression in hepatocytes attenuates tumor progression in the DEN model.

PubMed

Hatting, M; Spannbauer, M; Peng, J; Al Masaoudi, M; Sellge, G; Nevzorova, Y A; Gassler, N; Liedtke, C; Cubero, F J; Trautwein, C

2015-03-05

Chronic liver inflammation is a crucial event in the development and growth of hepatocellular carcinoma (HCC). Compelling evidence has shown that interleukin-6 (IL-6)/gp130-dependent signaling has a fundamental role in liver carcinogenesis. Thus, in the present study we aimed to investigate the role of gp130 in hepatocytes for the initiation and progression of HCC. Hepatocyte-specific gp130 knockout mice (gp130(Δhepa)) and control animals (gp130(f/f)) were treated with diethylnitrosamine (DEN). The role of gp130 for acute injury (0-144 h post treatment), tumor initiation (24 weeks) and progression (40 weeks) was analyzed. After acute DEN-induced liver injury we observed a reduction in the inflammatory response in gp130(Δhepa) animals as reflected by decreased levels of IL-6 and oncostatin M. The loss of gp130 slightly attenuated the initiation of HCC 24 weeks after DEN treatment. In contrast, 40 weeks after DEN treatment, male and female gp130(Δhepa) mice showed smaller tumors and reduced tumor burden, indicating a role for hepatocyte-specific gp130 expression during HCC progression. Oxidative stress and DNA damage were substantially and similarly increased by DEN in both gp130(f/f) and gp130(Δhepa) animals. However, gp130(Δhepa) livers revealed aberrant STAT5 activation and decreased levels of transforming growth factor-β (TGFβ), pSMAD2/3 and SMAD2, whereas phosphorylation of STAT3 at Tyr705 and Ser727 was absent. Our results indicate that gp130 deletion in hepatocytes reduces progression, but not HCC initiation in the DEN model. Gp130 deletion resulted in STAT3 inhibition but increased STAT5 activation and diminished TGF-dependent signaling. Hence, blocking gp130 in hepatocytes might be an interesting therapeutic target to inhibit the growth of HCC.