Sample records for g93a-sod1 mutation present

  1. ALS-associated mutation SOD1G93A leads to abnormal mitochondrial dynamics in osteocytes.

    PubMed

    Wang, Huan; Yi, Jianxun; Li, Xuejun; Xiao, Yajuan; Dhakal, Kamal; Zhou, Jingsong

    2018-01-01

    While the death of motor neuron is a pathological hallmark of amyotrophic lateral sclerosis (ALS), defects in other cell types or organs may also actively contribute to ALS disease progression. ALS patients experience progressive skeletal muscle wasting that may not only exacerbate neuronal degeneration, but likely has a significant impact on bone function. In our previous published study, we have discovered severe bone loss in an ALS mouse model with overexpression of ALS-associated mutation SOD1 G93A (G93A). Here we further provide a mechanistic understanding of the bone loss in ALS animal and cellular models. Combining mitochondrial fluorescent indicators and confocal live cell imaging, we discovered abnormalities in mitochondrial network and dynamics in primary osteocytes derived from the same ALS mouse model G93A. Those mitochondrial defects occur in ALS mice after the onset of neuromuscular symptoms, indicating that mitochondria in bone cells respond to muscle atrophy during ALS disease progression. To examine whether ALS mutation has a direct contribution to mitochondrial dysfunction independent of muscle atrophy, we evaluated mitochondrial morphology and motility in cultured osteocytes (MLO-Y4) with overexpression of mitochondrial targeted SOD1 G93A . Compared with osteocytes overexpressing the wild type SOD1 as a control, the SOD1 G93A osteocytes showed similar defects in mitochondrial network and dynamic as that of the primary osteocytes derived from the ALS mouse model. In addition, we further discovered that overexpression of SOD1 G93A enhanced the expression level of dynamin-related protein 1 (Drp1), a key protein promoting mitochondrial fission activity, and reduced the expression level of optic atrophy protein 1 (OPA1), a key protein related to mitochondrial fusion. A specific mitochondrial fission inhibitor (Mdivi-1) partially reversed the effect of SOD1 G93A on mitochondrial network and dynamics, indicating that SOD1 G93A likely promotes

  2. Molecular chaperone mediated late-stage neuroprotection in the SOD1(G93A) mouse model of amyotrophic lateral sclerosis.

    PubMed

    Novoselov, Sergey S; Mustill, Wendy J; Gray, Anna L; Dick, James R; Kanuga, Naheed; Kalmar, Bernadett; Greensmith, Linda; Cheetham, Michael E

    2013-01-01

    Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disorder characterized by the selective loss of motor neurons in the spinal cord, brain stem, and motor cortex. Mutations in superoxide dismutase (SOD1) are associated with familial ALS and lead to SOD1 protein misfolding and aggregation. Here we show that the molecular chaperone, HSJ1 (DNAJB2), mutations in which cause distal hereditary motor neuropathy, can reduce mutant SOD1 aggregation and improve motor neuron survival in mutant SOD1 models of ALS. Overexpression of human HSJ1a (hHSJ1a) in vivo in motor neurons of SOD1(G93A) transgenic mice ameliorated disease. In particular, there was a significant improvement in muscle force, increased motor unit number and enhanced motor neuron survival. hHSJ1a was present in a complex with SOD1(G93A) and led to reduced SOD1 aggregation at late stages of disease progression. We also observed altered ubiquitin immunoreactivity in the double transgenic animals, suggesting that ubiquitin modification might be important for the observed improvements. In a cell model of SOD1(G93A) aggregation, HSJ1a preferentially bound to mutant SOD1, enhanced SOD1 ubiquitylation and reduced SOD1 aggregation in a J-domain and ubiquitin interaction motif (UIM) dependent manner. Collectively, the data suggest that HSJ1a acts on mutant SOD1 through a combination of chaperone, co-chaperone and pro-ubiquitylation activity. These results show that targeting SOD1 protein misfolding and aggregation in vivo can be neuroprotective and suggest that manipulation of DnaJ molecular chaperones might be useful in the treatment of ALS.

  3. Isolated cytochrome c oxidase deficiency in G93A SOD1 mice overexpressing CCS protein.

    PubMed

    Son, Marjatta; Leary, Scot C; Romain, Nadine; Pierrel, Fabien; Winge, Dennis R; Haller, Ronald G; Elliott, Jeffrey L

    2008-05-02

    G93A SOD1 transgenic mice overexpressing CCS protein develop an accelerated disease course that is associated with enhanced mitochondrial pathology and increased mitochondrial localization of mutant SOD1. Because these results suggest an effect of mutant SOD1 on mitochondrial function, we assessed the enzymatic activities of mitochondrial respiratory chain complexes in the spinal cords of CCS/G93A SOD1 and control mice. CCS/G93A SOD1 mouse spinal cord demonstrates a 55% loss of complex IV (cytochrome c oxidase) activity compared with spinal cord from age-matched non-transgenic or G93A SOD1 mice. In contrast, CCS/G93A SOD1 spinal cord shows no reduction in the activities of complex I, II, or III. Blue native gel analysis further demonstrates a marked reduction in the levels of complex IV but not of complex I, II, III, or V in spinal cords of CCS/G93A SOD1 mice compared with non-transgenic, G93A SOD1, or CCS/WT SOD1 controls. With SDS-PAGE analysis, spinal cords from CCS/G93A SOD1 mice showed significant decreases in the levels of two structural subunits of cytochrome c oxidase, COX1 and COX5b, relative to controls. In contrast, CCS/G93A SOD1 mouse spinal cord showed no reduction in levels of selected subunits from complexes I, II, III, or V. Heme A analyses of spinal cord further support the existence of cytochrome c oxidase deficiency in CCS/G93A SOD1 mice. Collectively, these results establish that CCS/G93A SOD1 mice manifest an isolated complex IV deficiency which may underlie a substantial part of mutant SOD1-induced mitochondrial cytopathy.

  4. Structural and biophysical properties of metal-free pathogenic SOD1 mutants A4V and G93A

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Galaleldeen, Ahmad; Strange, Richard W.; Whitson, Lisa J.

    2010-07-19

    Amyotrophic lateral sclerosis (ALS) is a fatal, progressive neurodegenerative disease characterized by the destruction of motor neurons in the spinal cord and brain. A subset of ALS cases are linked to dominant mutations in copper-zinc superoxide dismutase (SOD1). The pathogenic SOD1 variants A4V and G93A have been the foci of multiple studies aimed at understanding the molecular basis for SOD1-linked ALS. The A4V variant is responsible for the majority of familial ALS cases in North America, causing rapidly progressing paralysis once symptoms begin and the G93A SOD1 variant is overexpressed in often studied murine models of the disease. Here wemore » report the three-dimensional structures of metal-free A4V and of metal-bound and metal-free G93A SOD1. In the metal-free structures, the metal-binding loop elements are observed to be severely disordered, suggesting that these variants may share mechanisms of aggregation proposed previously for other pathogenic SOD1 proteins.« less

  5. Knocking down metabotropic glutamate receptor 1 improves survival and disease progression in the SOD1(G93A) mouse model of amyotrophic lateral sclerosis.

    PubMed

    Milanese, Marco; Giribaldi, Francesco; Melone, Marcello; Bonifacino, Tiziana; Musante, Ilaria; Carminati, Enrico; Rossi, Pia I A; Vergani, Laura; Voci, Adriana; Conti, Fiorenzo; Puliti, Aldamaria; Bonanno, Giambattista

    2014-04-01

    Amyotrophic lateral sclerosis (ALS) is a late-onset fatal neurodegenerative disease reflecting degeneration of upper and lower motoneurons (MNs). The cause of ALS and the mechanisms of neuronal death are still largely obscure, thus impairing the establishment of efficacious therapies. Glutamate (Glu)-mediated excitotoxicity plays a major role in MN degeneration in ALS. We recently demonstrated that the activation of Group I metabotropic Glu autoreceptors, belonging to both type 1 and type 5 receptors (mGluR1 and mGluR5), at glutamatergic spinal cord nerve terminals, produces excessive Glu release in mice over-expressing human superoxide-dismutase carrying the G93A point mutation (SOD1(G93A)), a widely used animal model of human ALS. To establish whether these receptors are implicated in ALS, we generated mice expressing half dosage of mGluR1 in the SOD1(G93A) background (SOD1(G93A)Grm1(crv4/+)), by crossing the SOD1(G93A) mutant mouse with the Grm1(crv4/+) mouse, lacking mGluR1 because of a spontaneous recessive mutation. SOD1(G93A)Grm1(crv4/+) mice showed prolonged survival probability, delayed pathology onset, slower disease progression and improved motor performances compared to SOD1(G93A) mice. These effects were associated to reduction of mGluR5 expression, enhanced number of MNs, decreased astrocyte and microglia activation, normalization of metallothionein and catalase mRNA expression, reduced mitochondrial damage, and decrease of abnormal Glu release in spinal cord of SOD1(G93A)Grm1(crv4/+)compared to SOD1(G93A) mice. These results demonstrate that a lower constitutive level of mGluR1 has a significant positive impact on mice with experimental ALS, thus providing the rationale for future pharmacological approaches to ALS by selectively blocking Group I metabotropic Glu receptors. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  6. Caspase 6 has a protective role in SOD1(G93A) transgenic mice.

    PubMed

    Hogg, Marion C; Mitchem, Mollie R; König, Hans-Georg; Prehn, Jochen H M

    2016-06-01

    In amyotrophic lateral sclerosis (ALS), it has been suggested that the process of neurodegeneration starts at the neuromuscular junction and is propagated back along axons towards motor neurons. Caspase-dependent pathways are well established as a cause of motor neuron death, and recent work in other disease models indicated a role for caspase 6 in axonal degeneration. Therefore we hypothesised that caspase 6 may be involved in motor neuron death in ALS. To investigate the role of caspase 6 in ALS we profiled protein levels of caspase-6 throughout disease progression in the ALS mouse model SOD1(G93A); this did not reveal differences in caspase 6 levels during disease. To investigate the role of caspase 6 further we generated a colony with SOD1(G93A) transgenic mice lacking caspase 6. Analysis of the transgenic SOD1(G93A); Casp6(-/-) revealed an exacerbated phenotype with motor dysfunction occurring earlier and a significantly shortened lifespan when compared to transgenic SOD1(G93A); Casp6(+/+) mice. Immunofluorescence analysis of the neuromuscular junction revealed no obvious difference between caspase 6(+/+) and caspase 6(-/-) in non-transgenic mice, while the SOD1(G93A) transgenic mice showed severe degeneration compared to non-transgenic mice in both genotypes. Our data indicate that caspase-6 does not exacerbate ALS pathogenesis, but may have a protective role. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Pleiotropic activity of systemically delivered angiogenin in the SOD1G93A mouse model.

    PubMed

    Crivello, Martin; O'Riordan, Saidhbhe L; Woods, Ina; Cannon, Sarah; Halang, Luise; Coughlan, Karen S; Hogg, Marion C; Lewandowski, Sebastian A; Prehn, Jochen H M

    2018-05-01

    Loss-of-function mutations in the angiogenin (ANG) gene have been identified in familial and sporadic ALS patients. Previous work from our group identified human ANG (huANG) to protect motoneurons in vitro, and provided proof-of-concept that daily intraperitoneal (i.p.) huANG injections post-symptom onset increased lifespan and delayed disease progression in SOD1 G93A mice. huANG's mechanism of action remains less well understood. Here, we implemented a preclinical in vivo design to validate our previous results, provide pharmacokinetic and protein distribution data after systemic administration, and explore potential pleiotropic activities of huANG in vivo. SOD1 G93A mice (n = 45) and non-transgenic controls (n = 31) were sex- age- and litter-matched according to the 2010 European ALS/MND group guidelines, and treated with huANG (1 μg, i.p., 3 times/week) or vehicle from 90 days on. huANG treatment increased survival and delayed motor dysfunction as assessed by rotarod in SOD1 G93A mice. Increased huANG serum levels were detectable 2 and 24 h after i.p. injection equally in transgenic and non-transgenic mice. Exogenous huANG localized to spinal cord astrocytes, supporting a glia-mediated, paracrine mechanism of action; uptake into endothelial cells was also observed. 1 μg huANG or vehicle were administered from 90 to 115 days of age for histological analysis. Vehicle-treated SOD1 G93A mice showed decreased motoneuron numbers and vascular length per ventral horn area, while huANG treatment resulted in improved vascular network maintenance and motoneuron survival. Our data suggest huANG represents a new class of pleiotropic ALS therapeutic that acts on the spinal cord vasculature and glia to delay motoneuron degeneration and disease progression. Copyright © 2018 Elsevier Ltd. All rights reserved.

  8. Overexpression of human mutated G93A SOD1 changes dynamics of the ER mitochondria calcium cycle specifically in mouse embryonic motor neurons.

    PubMed

    Lautenschläger, Janin; Prell, Tino; Ruhmer, Julia; Weidemann, Lisa; Witte, Otto W; Grosskreutz, Julian

    2013-09-01

    Motor neurons vulnerable to the rapidly progressive deadly neurodegenerative disease amyotrophic lateral sclerosis (ALS) inherently express low amounts of calcium binding proteins (CaBP), likely to allow physiological motor neuron firing frequency modulation. At the same time motor neurons are susceptible to AMPA receptor mediated excitotoxicity and internal calcium deregulation which is not fully understood. We analysed ER mitochondria calcium cycle (ERMCC) dynamics with subsecond resolution in G93A hSOD1 overexpressing motor neurons as a model of ALS using fluorescent calcium imaging. When comparing vulnerable motor neurons and non-motor neurons from G93A hSOD1 mice and their non-transgenic littermates, we found a decelerated cytosolic calcium clearance in the presence of G93A hSOD1. While both non-transgenic as well as G93A hSOD1 motor neurons displayed large mitochondrial calcium uptake by the mitochondrial uniporter (mUP), the mitochondrial calcium extrusion system was altered in the presence of G93A hSOD1. In addition, ER calcium uptake by the sarco-/endoplasmic reticulum ATPase (SERCA) was increased in G93A hSOD1 motor neurons. In survival assays, blocking the mitochondrial sodium calcium exchanger (mNCE) by CGP37157 as well as inhibiting SERCA by cyclopiazonic acid showed protective effects against kainate induced excitotoxicity. Thus, our study shows for the first time that the functional consequence of G93A hSOD1 overexpression in intact motor neurons is indeed a disturbance of the ER mitochondria calcium cycle, and identified two promising targets for therapeutic intervention in the pathology of ALS. Copyright © 2013 Elsevier Inc. All rights reserved.

  9. The effect of amyotrophic lateral sclerosis-linked exogenous SOD1-G93A on electrophysiological properties and intracellular calcium in cultured rat astrocytes.

    PubMed

    Milošević, Milena; Bataveljić, Danijela; Nikolić, Ljiljana; Bijelić, Dunja; Andjus, Pavle

    2016-01-01

    Over 150 mutations in the SOD1 gene that encodes Cu/Zn superoxide dismutase (SOD1) cause 20-25% of familial ALS, albeit without a known gain-of-function mechanism. ALS is also non-cell-autonomous, the interactions between motor neurons and their glial neighbours being implicated in disease progression. The aim here was to investigate the biophysical effects of the exogenous human mutant SOD1-G93A on rat astrocytes in culture. Primary cortical astrocyte cultures were treated with recombinant human apo- mSOD1-G93A vs. wild-type control (wtSOD1) and recorded by patch-clamp and calcium imaging. Results showed that exogenous mSOD1 as well as wtSOD1 induced a decrease of membrane resistance, the effect being persistent (up to 13 min) only for the mutant form. Similarly, whole-cell inward currents in astrocytes were augmented by both wt and mSOD1, but the effect was twice larger and only progressed continuously for the latter. Both forms of SOD1 also induced a rise in intracellular Ca(2+) activity, the effect being dependent on external Ca(2+) and again only persisted with mSOD1, becoming significantly different from wtSOD1 only at longer times (14 min). In conclusion, this study points to membrane permeability and Ca(2+) signalling as processes affected by SOD1-G93A that presents the humoral factor triggering the role of astrocytes in ALS pathophysiology.

  10. Overexpression of CCS in G93A-SOD1 mice leads to accelerated neurological deficits with severe mitochondrial pathology.

    PubMed

    Son, Marjatta; Puttaparthi, Krishna; Kawamata, Hibiki; Rajendran, Bhagya; Boyer, Philip J; Manfredi, Giovanni; Elliott, Jeffrey L

    2007-04-03

    Cu, Zn superoxide dismutase (SOD1) has been detected within spinal cord mitochondria of mutant SOD1 transgenic mice, a model of familial ALS. The copper chaperone for SOD1 (CCS) provides SOD1 with copper, facilitates the conversion of immature apo-SOD1 to a mature holoform, and influences in yeast the cytosolic/mitochondrial partitioning of SOD1. To determine how CCS affects G93A-SOD1-induced disease, we generated transgenic mice overexpressing CCS and crossed them to G93A-SOD1 or wild-type SOD1 transgenic mice. Both CCS transgenic mice and CCS/wild-type-SOD1 dual transgenic mice are neurologically normal. In contrast, CCS/G93A-SOD1 dual transgenic mice develop accelerated neurological deficits, with a mean survival of 36 days, compared with 242 days for G93A-SOD1 mice. Immuno-EM and subcellular fractionation studies on the spinal cord show that G93A-SOD1 is enriched within mitochondria in the presence of CCS overexpression. Our results indicate that CCS overexpression in G93A-SOD1 mice produces severe mitochondrial pathology and accelerates disease course.

  11. Postmitotic Expression of SOD1G93A Gene Affects the Identity of Myogenic Cells and Inhibits Myoblasts Differentiation

    PubMed Central

    Martini, Martina; Dobrowolny, Gabriella; Aucello, Michela; Musarò, Antonio

    2015-01-01

    To determine the role of mutant SOD1 gene (SOD1G93A) on muscle cell differentiation, we derived C2C12 muscle cell lines carrying a stably transfected SOD1G93A gene under the control of a myosin light chain (MLC) promoter-enhancer cassette. Expression of MLC/SOD1G93A in C2C12 cells resulted in dramatic inhibition of myoblast differentiation. Transfected SOD1G93A gene expression in postmitotic skeletal myocytes downregulated the expression of relevant markers of committed and differentiated myoblasts such as MyoD, Myogenin, MRF4, and the muscle specific miRNA expression. The inhibitory effects of SOD1G93A gene on myogenic program perturbed Akt/p70 and MAPK signaling pathways which promote differentiation cascade. Of note, the inhibition of the myogenic program, by transfected SOD1G93A gene expression, impinged also the identity of myogenic cells. Expression of MLC/SOD1G93A in C2C12 myogenic cells promoted a fibro-adipogenic progenitors (FAPs) phenotype, upregulating HDAC4 protein and preventing the myogenic commitment complex BAF60C-SWI/SNF. We thus identified potential molecular mediators of the inhibitory effects of SOD1G93A on myogenic program and disclosed potential signaling, activated by SOD1G93A, that affect the identity of the myogenic cell population. PMID:26491230

  12. Postmitotic Expression of SOD1(G93A) Gene Affects the Identity of Myogenic Cells and Inhibits Myoblasts Differentiation.

    PubMed

    Martini, Martina; Dobrowolny, Gabriella; Aucello, Michela; Musarò, Antonio

    2015-01-01

    To determine the role of mutant SOD1 gene (SOD1(G93A)) on muscle cell differentiation, we derived C2C12 muscle cell lines carrying a stably transfected SOD1(G93A) gene under the control of a myosin light chain (MLC) promoter-enhancer cassette. Expression of MLC/SOD1(G93A) in C2C12 cells resulted in dramatic inhibition of myoblast differentiation. Transfected SOD1(G93A) gene expression in postmitotic skeletal myocytes downregulated the expression of relevant markers of committed and differentiated myoblasts such as MyoD, Myogenin, MRF4, and the muscle specific miRNA expression. The inhibitory effects of SOD1(G93A) gene on myogenic program perturbed Akt/p70 and MAPK signaling pathways which promote differentiation cascade. Of note, the inhibition of the myogenic program, by transfected SOD1(G93A) gene expression, impinged also the identity of myogenic cells. Expression of MLC/SOD1(G93A) in C2C12 myogenic cells promoted a fibro-adipogenic progenitors (FAPs) phenotype, upregulating HDAC4 protein and preventing the myogenic commitment complex BAF60C-SWI/SNF. We thus identified potential molecular mediators of the inhibitory effects of SOD1(G93A) on myogenic program and disclosed potential signaling, activated by SOD1(G93A), that affect the identity of the myogenic cell population.

  13. Gene expression changes in spinal motoneurons of the SOD1(G93A) transgenic model for ALS after treatment with G-CSF.

    PubMed

    Henriques, Alexandre; Kastner, Stefan; Chatzikonstantinou, Eva; Pitzer, Claudia; Plaas, Christian; Kirsch, Friederike; Wafzig, Oliver; Krüger, Carola; Spoelgen, Robert; Gonzalez De Aguilar, Jose-Luis; Gretz, Norbert; Schneider, Armin

    2014-01-01

    Amyotrophic lateral sclerosis (ALS) is an incurable fatal motoneuron disease with a lifetime risk of approximately 1:400. It is characterized by progressive weakness, muscle wasting, and death ensuing 3-5 years after diagnosis. Granulocyte-colony stimulating factor (G-CSF) is a drug candidate for ALS, with evidence for efficacy from animal studies and interesting data from pilot clinical trials. To gain insight into the disease mechanisms and mode of action of G-CSF, we performed gene expression profiling on isolated lumbar motoneurons from SOD1(G93A) mice, the most frequently studied animal model for ALS, with and without G-CSF treatment. Motoneurons from SOD1(G93A) mice present a distinct gene expression profile in comparison to controls already at an early disease stage (11 weeks of age), when treatment was initiated. The degree of deregulation increases at a time where motor symptoms are obvious (15 weeks of age). Upon G-CSF treatment, transcriptomic deregulations of SOD1(G93A) motoneurons were notably restored. Discriminant analysis revealed that SOD1 mice treated with G-CSF has a transcriptom close to presymptomatic SOD1 mice or wild type mice. Some interesting genes modulated by G-CSF treatment relate to neuromuscular function such as CCR4-NOT or Prss12. Our data suggest that G-CSF is able to re-adjust gene expression in symptomatic SOD1(G93A) motoneurons. This provides further arguments for G-CSF as a promising drug candidate for ALS.

  14. Gene expression changes in spinal motoneurons of the SOD1G93A transgenic model for ALS after treatment with G-CSF

    PubMed Central

    Henriques, Alexandre; Kastner, Stefan; Chatzikonstantinou, Eva; Pitzer, Claudia; Plaas, Christian; Kirsch, Friederike; Wafzig, Oliver; Krüger, Carola; Spoelgen, Robert; Gonzalez De Aguilar, Jose-Luis; Gretz, Norbert; Schneider, Armin

    2015-01-01

    Background: Amyotrophic lateral sclerosis (ALS) is an incurable fatal motoneuron disease with a lifetime risk of approximately 1:400. It is characterized by progressive weakness, muscle wasting, and death ensuing 3–5 years after diagnosis. Granulocyte-colony stimulating factor (G-CSF) is a drug candidate for ALS, with evidence for efficacy from animal studies and interesting data from pilot clinical trials. To gain insight into the disease mechanisms and mode of action of G-CSF, we performed gene expression profiling on isolated lumbar motoneurons from SOD1G93A mice, the most frequently studied animal model for ALS, with and without G-CSF treatment. Results: Motoneurons from SOD1G93A mice present a distinct gene expression profile in comparison to controls already at an early disease stage (11 weeks of age), when treatment was initiated. The degree of deregulation increases at a time where motor symptoms are obvious (15 weeks of age). Upon G-CSF treatment, transcriptomic deregulations of SOD1G93A motoneurons were notably restored. Discriminant analysis revealed that SOD1 mice treated with G-CSF has a transcriptom close to presymptomatic SOD1 mice or wild type mice. Some interesting genes modulated by G-CSF treatment relate to neuromuscular function such as CCR4-NOT or Prss12. Conclusions: Our data suggest that G-CSF is able to re-adjust gene expression in symptomatic SOD1G93A motoneurons. This provides further arguments for G-CSF as a promising drug candidate for ALS. PMID:25653590

  15. DNA strand breaks and TDP-43 mislocation are absent in the murine hSOD1G93A model of amyotrophic lateral sclerosis in vivo and in vitro

    PubMed Central

    Witte, Otto W.; Grosskreutz, Julian

    2017-01-01

    Mutations in the human Cu/Zn superoxide dismutase type-1 (hSOD1) gene are common in familial amyotrophic lateral sclerosis (fALS). The pathophysiology has been linked to, e.g., organelle dysfunction, RNA metabolism and oxidative DNA damage conferred by SOD1 malfunction. However, apart from metabolically evoked DNA oxidation, it is unclear whether severe genotoxicity including DNA single-strand breaks (SSBs) and double-strand breaks (DSBs), originates from loss of function of nuclear SOD1 enzyme. Factors that endogenously interfere with DNA integrity and repair complexes in hSOD1-mediated fALS remain similarly unexplored. In this regard, uncontrolled activation of transposable elements (TEs) might contribute to DNA disintegration and neurodegeneration. The aim of this study was to elucidate the role of the fALS-causing hSOD1G93A mutation in the generation of severe DNA damage beyond well-characterized DNA base oxidation. Therefore, DNA damage was assessed in spinal tissue of hSOD1G93A-overexpressing mice and in corresponding motor neuron-enriched cell cultures in vitro. Overexpression of the hSOD1G93A locus did not change the threshold for severe DNA damage per se. We found that levels of SSBs and DSBs were unaltered between hSOD1G93A and control conditions, as demonstrated in post-mitotic motor neurons and in astrocytes susceptible to replication-dependent DNA breakage. Analogously, parameters indicative of DNA damage response processes were not activated in vivo or in vitro. Evidence for a mutation-related elevation in TE activation was not detected, in accordance with the absence of TAR DNA binding protein 43 (TDP-43) proteinopathy in terms of cytoplasmic mislocation or nuclear loss, as nuclear TDP-43 is supposed to silence TEs physiologically. Conclusively, the superoxide dismutase function of SOD1 might not be required to preserve DNA integrity in motor neurons, at least when the function of TDP-43 is unaltered. Our data establish a foundation for further

  16. Implications of fALS Mutations on Sod1 Function and Oligomerization in Cell Models.

    PubMed

    Brasil, Aline A; Magalhães, Rayne S S; De Carvalho, Mariana D C; Paiva, Isabel; Gerhardt, Ellen; Pereira, Marcos D; Outeiro, Tiago F; Eleutherio, Elis C A

    2018-06-01

    Among the familial forms of amyotrophic lateral sclerosis (fALS), 20% are associated with the Cu,Zn-superoxide dismutase (Sod1). fALS is characterized by the accumulation of aggregated proteins and the increase in oxidative stress markers. Here, we used the non-invasive bimolecular fluorescence complementation (BiFC) assay in human H4 cells to investigate the kinetics of aggregation and subcellular localization of Sod1 mutants. We also studied the effect of the different Sod1 mutants to respond against oxidative stress by following the levels of reactive oxygen species (ROS) after treatment with hydrogen peroxide. Our results showed that only 30% of cells transfected with A4VSod1 showed no inclusions while for the other Sod1 mutants tested (L38V, G93A and G93C), this percentage was at least 70%. In addition, we found that 10% of cells transfected with A4VSod1 displayed more than five inclusions per cell and that A4V and G93A Sod1 formed inclusions more rapidly than L38V and G93C Sod1. Expression of WTSod1 significantly decreased the intracellular oxidation levels in comparison with expression of fALS Sod1 mutants, suggesting the mutations induce a functional impairment. All fALS mutations impaired nuclear localization of Sod1, which is important for maintaining genomic stability. Consistently, expression of WTSod1, but not of fALS Sod1 mutants, reduced DNA damage, as measured by the comet assay. Altogether, our study sheds light into the effects of fALS Sod1 mutations on inclusion formation, dynamics, and localization as well as on antioxidant response, opening novel avenues for investigating the role of fALS Sod1 mutations in pathogenesis.

  17. "Preconditioning" with latrepirdine, an adenosine 5'-monophosphate-activated protein kinase activator, delays amyotrophic lateral sclerosis progression in SOD1(G93A) mice.

    PubMed

    Coughlan, Karen S; Mitchem, Mollie R; Hogg, Marion C; Prehn, Jochen H M

    2015-02-01

    Adenosine 5'-monophosphate-activated protein kinase (AMPK) is a master regulator of energy balance. As energy imbalance is documented as a key pathologic feature of amyotrophic lateral sclerosis (ALS), we investigated AMPK as a pharmacologic target in SOD1(G93A) mice. We noted a strong activation of AMPK in lumbar spinal cords of SOD1(G93A) mice. Pharmacologic activation of AMPK has shown protective effects in neuronal "preconditioning" models. We tested the hypothesis that "preconditioning" with a small molecule activator of AMPK, latrepirdine, exerts beneficial effects on disease progression. SOD1(G93A) mice (n = 24 animals per group; sex and litter matched) were treated with latrepirdine (1 μg/kg, intraperitoneal) or vehicle from postnatal day 70 to 120. Treatment with latrepirdine increased AMPK activity in primary mouse motor neuron cultures and in SOD1(G93A) lumbar spinal cords. Mice "preconditioned" with latrepirdine showed a delayed symptom onset and a significant increase in life span (p < 0.01). Our study suggests that "preconditioning" with latrepirdine may represent a possible therapeutic strategy for individuals harboring ALS-associated gene mutations who are at risk for developing ALS. Copyright © 2015 Elsevier Inc. All rights reserved.

  18. Calpastatin inhibits motor neuron death and increases survival of hSOD1(G93A) mice.

    PubMed

    Rao, Mala V; Campbell, Jabbar; Palaniappan, Arti; Kumar, Asok; Nixon, Ralph A

    2016-04-01

    Amyotrophic lateral sclerosis (ALS) is a progressive motor neuron disease with a poorly understood cause and no effective treatment. Given that calpains mediate neurodegeneration in other pathological states and are abnormally activated in ALS, we investigated the possible ameliorative effects of inhibiting calpain over-activation in hSOD1(G93A) transgenic (Tg) mice in vivo by neuron-specific over-expression of calpastatin (CAST), the highly selective endogenous inhibitor of calpains. Our data indicate that over-expression of CAST in hSOD1(G93A) mice, which lowered calpain activation to levels comparable to wild-type mice, inhibited the abnormal breakdown of cytoskeletal proteins (spectrin, MAP2 and neurofilaments), and ameliorated motor axon loss. Disease onset in hSOD1(G93A) /CAST mice compared to littermate hSOD1(G93A) mice is delayed, which accounts for their longer time of survival. We also find that neuronal over-expression of CAST in hSOD1(G93A) transgenic mice inhibited production of putative neurotoxic caspase-cleaved tau and activation of Cdk5, which have been implicated in neurodegeneration in ALS models, and also reduced the formation of SOD1 oligomers. Our data indicate that inhibition of calpain with CAST is neuroprotective in an ALS mouse model. CAST (encoding calpastatin) inhibits hyperactivated calpain to prevent motor neuron disease operating through a cascade of events as indicated in the schematic, with relevance to amyotrophic lateral sclerosis (ALS). We propose that over-expression of CAST in motor neurons of hSOD1(G93A) mice inhibits activation of CDK5, breakdown of cytoskeletal proteins (NFs, MAP2 and Tau) and regulatory molecules (Cam Kinase IV, Calcineurin A), and disease-causing proteins (TDP-43, α-Synuclein and Huntingtin) to prevent neuronal loss and delay neurological deficits. In our experiments, CAST could also inhibit cleavage of Bid, Bax, AIF to prevent mitochondrial, ER and lysosome-mediated cell death mechanisms. Similarly, CAST

  19. Delayed Disease Onset and Extended Survival in the SOD1G93A Rat Model of Amyotrophic Lateral Sclerosis after Suppression of Mutant SOD1 in the Motor Cortex

    PubMed Central

    Thomsen, Gretchen M.; Gowing, Genevieve; Latter, Jessica; Chen, Maximus; Vit, Jean-Philippe; Staggenborg, Kevin; Avalos, Pablo; Alkaslasi, Mor; Ferraiuolo, Laura; Likhite, Shibi; Kaspar, Brian K.

    2014-01-01

    Sporadic amyotrophic lateral sclerosis (ALS) is a fatal disease with unknown etiology, characterized by a progressive loss of motor neurons leading to paralysis and death typically within 3–5 years of onset. Recently, there has been remarkable progress in understanding inherited forms of ALS in which well defined mutations are known to cause the disease. Rodent models in which the superoxide dismutase-1 (SOD1) mutation is overexpressed recapitulate hallmark signs of ALS in patients. Early anatomical changes in mouse models of fALS are seen in the neuromuscular junctions (NMJs) and lower motor neurons, and selective reduction of toxic mutant SOD1 in the spinal cord and muscle of these models has beneficial effects. Therefore, much of ALS research has focused on spinal motor neuron and NMJ aspects of the disease. Here we show that, in the SOD1G93A rat model of ALS, spinal motor neuron loss occurs presymptomatically and before degeneration of ventral root axons and denervation of NMJs. Although overt cell death of corticospinal motor neurons does not occur until disease endpoint, we wanted to establish whether the upper motor neuron might still play a critical role in disease progression. Surprisingly, the knockdown of mutant SOD1 in only the motor cortex of presymptomatic SOD1G93A rats through targeted delivery of AAV9–SOD1–shRNA resulted in a significant delay of disease onset, expansion of lifespan, enhanced survival of spinal motor neurons, and maintenance of NMJs. This datum suggests an early dysfunction and thus an important role of the upper motor neuron in this animal model of ALS and perhaps patients with the disease. PMID:25411487

  20. Delayed disease onset and extended survival in the SOD1G93A rat model of amyotrophic lateral sclerosis after suppression of mutant SOD1 in the motor cortex.

    PubMed

    Thomsen, Gretchen M; Gowing, Genevieve; Latter, Jessica; Chen, Maximus; Vit, Jean-Philippe; Staggenborg, Kevin; Avalos, Pablo; Alkaslasi, Mor; Ferraiuolo, Laura; Likhite, Shibi; Kaspar, Brian K; Svendsen, Clive N

    2014-11-19

    Sporadic amyotrophic lateral sclerosis (ALS) is a fatal disease with unknown etiology, characterized by a progressive loss of motor neurons leading to paralysis and death typically within 3-5 years of onset. Recently, there has been remarkable progress in understanding inherited forms of ALS in which well defined mutations are known to cause the disease. Rodent models in which the superoxide dismutase-1 (SOD1) mutation is overexpressed recapitulate hallmark signs of ALS in patients. Early anatomical changes in mouse models of fALS are seen in the neuromuscular junctions (NMJs) and lower motor neurons, and selective reduction of toxic mutant SOD1 in the spinal cord and muscle of these models has beneficial effects. Therefore, much of ALS research has focused on spinal motor neuron and NMJ aspects of the disease. Here we show that, in the SOD1(G93A) rat model of ALS, spinal motor neuron loss occurs presymptomatically and before degeneration of ventral root axons and denervation of NMJs. Although overt cell death of corticospinal motor neurons does not occur until disease endpoint, we wanted to establish whether the upper motor neuron might still play a critical role in disease progression. Surprisingly, the knockdown of mutant SOD1 in only the motor cortex of presymptomatic SOD1(G93A) rats through targeted delivery of AAV9-SOD1-shRNA resulted in a significant delay of disease onset, expansion of lifespan, enhanced survival of spinal motor neurons, and maintenance of NMJs. This datum suggests an early dysfunction and thus an important role of the upper motor neuron in this animal model of ALS and perhaps patients with the disease. Copyright © 2014 the authors 0270-6474/14/3415587-14$15.00/0.

  1. Genetic Biomarkers for ALS Disease in Transgenic SOD1G93A Mice

    PubMed Central

    Calvo, Ana C.; Manzano, Raquel; Atencia-Cibreiro, Gabriela; Oliván, Sara; Muñoz, María J.; Zaragoza, Pilar; Cordero-Vázquez, Pilar; Esteban-Pérez, Jesús; García-Redondo, Alberto; Osta, Rosario

    2012-01-01

    The pathophysiological mechanisms of both familial and sporadic Amyotrophic Lateral Sclerosis (ALS) are unknown, although growing evidence suggests that skeletal muscle tissue is a primary target of ALS toxicity. Skeletal muscle biopsies were performed on transgenic SOD1G93A mice, a mouse model of ALS, to determine genetic biomarkers of disease longevity. Mice were anesthetized with isoflurane, and three biopsy samples were obtained per animal at the three main stages of the disease. Transcriptional expression levels of seventeen genes, Ankrd1, Calm1, Col19a1, Fbxo32, Gsr, Impa1, Mef2c, Mt2, Myf5, Myod1, Myog, Nnt, Nogo A, Pax7, Rrad, Sln and Snx10, were tested in each muscle biopsy sample. Total RNA was extracted using TRIzol Reagent according to the manufacturer's protocol, and variations in gene expression were assayed by real-time PCR for all of the samples. The Pearson correlation coefficient was used to determine the linear correlation between transcriptional expression levels throughout disease progression and longevity. Consistent with the results obtained from total skeletal muscle of transgenic SOD1G93A mice and 74-day-old denervated mice, five genes (Mef2c, Gsr, Col19a1, Calm1 and Snx10) could be considered potential genetic biomarkers of longevity in transgenic SOD1G93A mice. These results are important because they may lead to the exploration of previously unexamined tissues in the search for new disease biomarkers and even to the application of these findings in human studies. PMID:22412900

  2. Preferential motor unit loss in the SOD1G93A transgenic mouse model of amyotrophic lateral sclerosis

    PubMed Central

    Hegedus, J; Putman, C T; Tyreman, N; Gordon, T

    2008-01-01

    The present study investigated motor unit (MU) loss in a murine model of familial amyotrophic lateral sclerosis (ALS). The fast-twitch tibialis anterior (TA) and medial gastrocnemius (MG) muscles of transgenic SOD1G93A and SOD1WT mice were studied during the presymptomatic phase of disease progression at 60 days of age. Whole muscle maximum isometric twitch and tetanic forces were 80% lower (P < 0.01) in the TA muscles of SOD1G93A compared to SOD1WT mice. Enumeration of total MU numbers within TA muscles showed a 60% reduction (P < 0.01) within SOD1G93A mice (38 ± 7) compared with SOD1WT controls (95 ± 12); this was attributed to a lower proportion of the most forceful fast-fatigable (FF) MU in SOD1G93A mice, as seen by a significant (P < 0.01) leftward shift in the cumulative frequency histogram of single MU forces. Similar patterns of MU loss and corresponding decreases in isometric twitch force were observed in the MG. Immunocytochemical analyses of the entire cross-sectional area (CSA) of serial sections of TA muscles stained with anti-neural cell adhesion molecule (NCAM) and various monoclonal antibodies for myosin heavy chain (MHC) isoforms showed respective 65% (P < 0.01) and 28% (P < 0.05) decreases in the number of innervated IIB and IID/X muscle fibres in SOD1G93A, which paralleled the 60% decrease (P < 0.01) in the force generating capacity of individual fibres. The loss of fast MUs was partially compensated by activity-dependent fast-to-slower fibre type transitions, as determined by increases (P < 0.04) in the CSA and proportion of IIA fibres (from 4% to 14%) and IID/X fibres (from 31% to 39%), and decreases (P < 0.001) in the CSA and proportion of type IIB fibres (from 65% to 44%). We conclude that preferential loss of IIB fibres is incomplete at 60 days of age, and is consistent with a selective albeit gradual loss of FF MUs that is not fully compensated by sprouting of the remaining motoneurons that innervate type IIA or IID/X muscle fibres. Our

  3. Muscle Expression of SOD1G93A Triggers the Dismantlement of Neuromuscular Junction via PKC-Theta.

    PubMed

    Dobrowolny, Gabriella; Martini, Martina; Scicchitano, Bianca Maria; Romanello, Vanina; Boncompagni, Simona; Nicoletti, Carmine; Pietrangelo, Laura; De Panfilis, Simone; Catizone, Angela; Bouchè, Marina; Sandri, Marco; Rudolf, Rüdiger; Protasi, Feliciano; Musarò, Antonio

    2018-04-20

    Neuromuscular junction (NMJ) represents the morphofunctional interface between muscle and nerve. Several chronic pathologies such as aging and neurodegenerative diseases, including muscular dystrophy and amyotrophic lateral sclerosis, display altered NMJ and functional denervation. However, the triggers and the molecular mechanisms underlying the dismantlement of NMJ remain unclear. Here we provide evidence that perturbation in redox signaling cascades, induced by muscle-specific accumulation of mutant SOD1 G93A in transgenic MLC/SOD1 G93A mice, is causally linked to morphological alterations of the neuromuscular presynaptic terminals, high turnover rate of acetylcholine receptor, and NMJ dismantlement. The analysis of potential molecular mechanisms that mediate the toxic activity of SOD1 G93A revealed a causal link between protein kinase Cθ (PKCθ) activation and NMJ disintegration. The study discloses the molecular mechanism that triggers functional denervation associated with the toxic activity of muscle SOD1 G93A expression and suggests the possibility of developing a new strategy to counteract age- and pathology-associated denervation based on pharmacological inhibition of PKCθ activity. Collectively, these data indicate that muscle-specific accumulation of oxidative damage can affect neuromuscular communication and induce NMJ dismantlement through a PKCθ-dependent mechanism. Antioxid. Redox Signal. 28, 1105-1119.

  4. Mechanisms of Enhanced Phrenic Long-Term Facilitation in SOD1G93A Rats

    PubMed Central

    Satriotomo, Irawan; Grebe, Ashley M.

    2017-01-01

    Amyotrophic lateral sclerosis (ALS) is a degenerative motor neuron disease, causing muscle paralysis and death from respiratory failure. Effective means to preserve/restore ventilation are necessary to increase the quality and duration of life in ALS patients. At disease end-stage in a rat ALS model (SOD1G93A), acute intermittent hypoxia (AIH) restores phrenic nerve activity to normal levels via enhanced phrenic long-term facilitation (pLTF). Mechanisms enhancing pLTF in end-stage SOD1G93A rats are not known. Moderate AIH-induced pLTF is normally elicited via cellular mechanisms that require the following: Gq-protein-coupled 5-HT2 receptor activation, new BDNF synthesis, and MEK/ERK signaling (the Q pathway). In contrast, severe AIH elicits pLTF via a distinct mechanism that requires the following: Gs-protein-coupled adenosine 2A receptor activation, new TrkB synthesis, and PI3K/Akt signaling (the S pathway). In end-stage male SOD1G93A rats and wild-type littermates, we investigated relative Q versus S pathway contributions to enhanced pLTF via intrathecal (C4) delivery of small interfering RNAs targeting BDNF or TrkB mRNA, and MEK/ERK (U0126) or PI3 kinase/Akt (PI828) inhibitors. In anesthetized, paralyzed and ventilated rats, moderate AIH-induced pLTF was abolished by siBDNF and UO126, but not siTrkB or PI828, demonstrating that enhanced pLTF occurs via the Q pathway. Although phrenic motor neuron numbers were decreased in end-stage SOD1G93A rats (∼30% survival; p < 0.001), BDNF and phosphorylated ERK expression were increased in spared phrenic motor neurons (p < 0.05), consistent with increased Q-pathway contributions to pLTF. Our results increase understanding of respiratory plasticity and its potential to preserve/restore breathing capacity in ALS. SIGNIFICANCE STATEMENT Since neuromuscular disorders, such as amyotrophic lateral sclerosis (ALS), end life via respiratory failure, the ability to harness respiratory motor plasticity to improve breathing

  5. In-vivo effects of knocking-down metabotropic glutamate receptor 5 in the SOD1G93A mouse model of amyotrophic lateral sclerosis.

    PubMed

    Bonifacino, Tiziana; Cattaneo, Luca; Gallia, Elena; Puliti, Aldamaria; Melone, Marcello; Provenzano, Francesca; Bossi, Simone; Musante, Ilaria; Usai, Cesare; Conti, Fiorenzo; Bonanno, Giambattista; Milanese, Marco

    2017-09-01

    Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disorder due to loss of upper and lower motor neurons (MNs). The mechanisms of neuronal death are largely unknown, thus prejudicing the successful pharmacological treatment. One major cause for MN degeneration in ALS is represented by glutamate(Glu)-mediated excitotoxicity. We have previously reported that activation of Group I metabotropic Glu receptors (mGluR1 and mGluR5) at glutamatergic spinal cord nerve terminals produces abnormal Glu release in the widely studied SOD1 G93A mouse model of ALS. We also demonstrated that halving mGluR1 expression in the SOD1 G93A mouse had a positive impact on survival, disease onset, disease progression, and on a number of cellular and biochemical readouts of ALS. We generated here SOD1 G93A mice with reduced expression of mGluR5 (SOD1 G93A Grm5 -/+ ) by crossing the SOD1 G93A mutant mouse with the mGluR5 heterozigous Grm5 -/+ mouse. SOD1 G93A Grm5 -/+ mice showed prolonged survival probability and delayed pathology onset. These effects were associated to enhanced number of preserved MNs, decreased astrocyte and microglia activation, reduced cytosolic free Ca 2+ concentration, and regularization of abnormal Glu release in the spinal cord of SOD1 G93A Grm5 -/+ mice. Unexpectedly, only male SOD1 G93A Grm5 -/+ mice showed improved motor skills during disease progression vs. SOD1 G93A mice, while SOD1 G93A Grm5 -/+ females did not. These results demonstrate that a lower constitutive level of mGluR5 has a significant positive impact in mice with ALS and support the idea that blocking Group I mGluRs may represent a potentially effective pharmacological approach to the disease. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Distinct roles for motor neuron autophagy early and late in the SOD1G93A mouse model of ALS

    PubMed Central

    Rudnick, Noam D.; Griffey, Christopher J.; Guarnieri, Paolo; Gerbino, Valeria; Wang, Xueyong; Piersaint, Jason A.; Tapia, Juan Carlos; Rich, Mark M.; Maniatis, Tom

    2017-01-01

    Mutations in autophagy genes can cause familial and sporadic amyotrophic lateral sclerosis (ALS). However, the role of autophagy in ALS pathogenesis is poorly understood, in part due to the lack of cell type-specific manipulations of this pathway in animal models. Using a mouse model of ALS expressing mutant superoxide dismutase 1 (SOD1G93A), we show that motor neurons form large autophagosomes containing ubiquitinated aggregates early in disease progression. To investigate whether this response is protective or detrimental, we generated mice in which the critical autophagy gene Atg7 was specifically disrupted in motor neurons (Atg7 cKO). Atg7 cKO mice were viable but exhibited structural and functional defects at a subset of vulnerable neuromuscular junctions. By crossing Atg7 cKO mice to the SOD1G93A mouse model, we found that autophagy inhibition accelerated early neuromuscular denervation of the tibialis anterior muscle and the onset of hindlimb tremor. Surprisingly, however, lifespan was extended in Atg7 cKO; SOD1G93A double-mutant mice. Autophagy inhibition did not prevent motor neuron cell death, but it reduced glial inflammation and blocked activation of the stress-related transcription factor c-Jun in spinal interneurons. We conclude that motor neuron autophagy is required to maintain neuromuscular innervation early in disease but eventually acts in a non–cell-autonomous manner to promote disease progression. PMID:28904095

  7. Scolopendra subspinipes mutilans attenuates neuroinflammation in symptomatic hSOD1G93A mice

    PubMed Central

    2013-01-01

    Background Amyotrophic lateral sclerosis (ALS) is a progressive, adult-onset neurodegenerative disorder characterized by selective motor neuron death in the spinal cord, brainstem, and motor cortex. Neuroinflammation is one of several pathological causes of degenerating motor neurons and is induced by activated microglial cells and astrocytes in ALS. Scolopendra subspinipes mutilans (SSM) is utilized in traditional Chinese and Korean medicine for the treatment of a variety of diseases, such as cancer, apoplexy, and epilepsy. However, the mechanisms underlying the effects of SSM are currently unclear, even though SSM increases immune and antibiotic activity. Methods To determine the effects of SSM on symptomatic hSOD1G93A transgenic mice, SSM (2.5 μℓ/g) was injected bilaterally at the Zusanli (ST36) acupoint three times per week for two weeks. The effects of SSM treatment on anti-neuroinflammation in the brainstem and spinal cord of hSOD1G93A mice were assessed via Nissl and Fluoro-Jade B (FJB) staining, and immunohistochemistry using Iba-1, CD14, HO1, and NQO1 proteins was evaluated by Western blotting. Results In this study, we investigated whether SSM affects neuroinflammation in the spinal cord of symptomatic hSOD1G93A transgenic mice. We found that SSM treatment attenuated the loss of motor neurons and reduced the activation of microglial cells and astrocytes. Furthermore, we demonstrated that SSM administration in this animal model of ALS suppressed oxidative stress in the brainstem and spinal cord by 1.6- and 1.8-fold, respectively. Conclusions Our findings suggest that SSM, which has previously been used in complementary and alternative medicine (CAM), might also be considered as an anti-neuroinflammatory therapy for neurodegenerative diseases. PMID:24168240

  8. Scolopendra subspinipes mutilans attenuates neuroinflammation in symptomatic hSOD1(G93A) mice.

    PubMed

    Cai, MuDan; Choi, Sun-Mi; Song, Bong Keun; Son, Ilhong; Kim, Sungchul; Yang, Eun Jin

    2013-10-29

    Amyotrophic lateral sclerosis (ALS) is a progressive, adult-onset neurodegenerative disorder characterized by selective motor neuron death in the spinal cord, brainstem, and motor cortex. Neuroinflammation is one of several pathological causes of degenerating motor neurons and is induced by activated microglial cells and astrocytes in ALS.Scolopendra subspinipes mutilans (SSM) is utilized in traditional Chinese and Korean medicine for the treatment of a variety of diseases, such as cancer, apoplexy, and epilepsy. However, the mechanisms underlying the effects of SSM are currently unclear, even though SSM increases immune and antibiotic activity. To determine the effects of SSM on symptomatic hSOD1G93A transgenic mice, SSM (2.5 μℓ/g) was injected bilaterally at the Zusanli (ST36) acupoint three times per week for two weeks. The effects of SSM treatment on anti-neuroinflammation in the brainstem and spinal cord of hSOD1G93A mice were assessed via Nissl and Fluoro-Jade B (FJB) staining, and immunohistochemistry using Iba-1, CD14, HO1, and NQO1 proteins was evaluated by Western blotting. In this study, we investigated whether SSM affects neuroinflammation in the spinal cord of symptomatic hSOD1G93A transgenic mice. We found that SSM treatment attenuated the loss of motor neurons and reduced the activation of microglial cells and astrocytes. Furthermore, we demonstrated that SSM administration in this animal model of ALS suppressed oxidative stress in the brainstem and spinal cord by 1.6- and 1.8-fold, respectively. Our findings suggest that SSM, which has previously been used in complementary and alternative medicine (CAM), might also be considered as an anti-neuroinflammatory therapy for neurodegenerative diseases.

  9. Human Glial-Restricted Progenitor Transplantation into Cervical Spinal Cord of the SOD1G93A Mouse Model of ALS

    PubMed Central

    Lepore, Angelo C.; O'Donnell, John; Kim, Andrew S.; Williams, Timothy; Tuteja, Alicia; Rao, Mahendra S.; Kelley, Linda L.; Campanelli, James T.; Maragakis, Nicholas J.

    2011-01-01

    Cellular abnormalities are not limited to motor neurons in amyotrophic lateral sclerosis (ALS). There are numerous observations of astrocyte dysfunction in both humans with ALS and in SOD1G93A rodents, a widely studied ALS model. The present study therapeutically targeted astrocyte replacement in this model via transplantation of human Glial-Restricted Progenitors (hGRPs), lineage-restricted progenitors derived from human fetal neural tissue. Our previous findings demonstrated that transplantation of rodent-derived GRPs into cervical spinal cord ventral gray matter (in order to target therapy to diaphragmatic function) resulted in therapeutic efficacy in the SOD1G93A rat. Those findings demonstrated the feasibility and efficacy of transplantation-based astrocyte replacement for ALS, and also show that targeted multi-segmental cell delivery to cervical spinal cord is a promising therapeutic strategy, particularly because of its relevance to addressing respiratory compromise associated with ALS. The present study investigated the safety and in vivo survival, distribution, differentiation, and potential efficacy of hGRPs in the SOD1G93A mouse. hGRP transplants robustly survived and migrated in both gray and white matter and differentiated into astrocytes in SOD1G93A mice spinal cord, despite ongoing disease progression. However, cervical spinal cord transplants did not result in motor neuron protection or any therapeutic benefits on functional outcome measures. This study provides an in vivo characterization of this glial progenitor cell and provides a foundation for understanding their capacity for survival, integration within host tissues, differentiation into glial subtypes, migration, and lack of toxicity or tumor formation. PMID:21998733

  10. ALS mutant SOD1 interacts with G3BP1 and affects stress granule dynamics.

    PubMed

    Gal, Jozsef; Kuang, Lisha; Barnett, Kelly R; Zhu, Brian Z; Shissler, Susannah C; Korotkov, Konstantin V; Hayward, Lawrence J; Kasarskis, Edward J; Zhu, Haining

    2016-10-01

    Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disease. Mutations in Cu/Zn superoxide dismutase (SOD1) are responsible for approximately 20 % of the familial ALS cases. ALS-causing SOD1 mutants display a gain-of-toxicity phenotype, but the nature of this toxicity is still not fully understood. The Ras GTPase-activating protein-binding protein G3BP1 plays a critical role in stress granule dynamics. Alterations in the dynamics of stress granules have been reported in several other forms of ALS unrelated to SOD1. To our surprise, the mutant G93A SOD1 transgenic mice exhibited pathological cytoplasmic inclusions that co-localized with G3BP1-positive granules in spinal cord motor neurons. The co-localization was also observed in fibroblast cells derived from familial ALS patient carrying SOD1 mutation L144F. Mutant SOD1, unlike wild-type SOD1, interacted with G3BP1 in an RNA-independent manner. Moreover, the interaction is specific for G3BP1 since mutant SOD1 showed little interaction with four other RNA-binding proteins implicated in ALS. The RNA-binding RRM domain of G3BP1 and two particular phenylalanine residues (F380 and F382) are critical for this interaction. Mutant SOD1 delayed the formation of G3BP1- and TIA1-positive stress granules in response to hyperosmolar shock and arsenite treatment in N2A cells. In summary, the aberrant mutant SOD1-G3BP1 interaction affects stress granule dynamics, suggesting a potential link between pathogenic SOD1 mutations and RNA metabolism alterations in ALS.

  11. Imaging of glial cell morphology, SOD1 distribution and elemental composition in the brainstem and hippocampus of the ALS hSOD1G93A rat.

    PubMed

    Stamenković, Stefan; Dučić, Tanja; Stamenković, Vera; Kranz, Alexander; Andjus, Pavle R

    2017-08-15

    Amyotrophic lateral sclerosis (ALS) is a neurodegenerative disorder affecting motor and cognitive domains of the CNS. Mutations in the Cu,Zn-superoxide dismutase (SOD1) cause 20% of familial ALS and provoke formation of intracellular aggregates and copper and zinc unbinding, leading to glial activation and neurodegeneration. Therefore, we investigated glial cell morphology, intracellular SOD1 distribution, and elemental composition in the brainstem and hippocampus of the hSOD1 G93A transgenic rat model of ALS. Immunostaining for astrocytes, microglia and SOD1 revealed glial proliferation and progressive tissue accumulation of SOD1 in both brain regions of ALS rats starting already at the presymptomatic stage. Glial cell morphology analysis in the brainstem of ALS rats revealed astrocyte activation occurring before disease symptoms onset, followed by activation of microglia. Hippocampal ALS astrocytes exhibited an identical reactive profile, while microglial morphology was unchanged. Additionally, ALS brainstem astrocytes demonstrated progressive SOD1 accumulation in the cell body and processes, while microglial SOD1 levels were reduced and its distribution limited to distal cell processes. In the hippocampus both glial cell types exhibited SOD1 accumulation in the cell body. X-ray fluorescence imaging revealed decreased P and increased Ca, Cl, K, Ni, Cu and Zn in the brainstem, and higher levels of Cl, Ni and Cu, but lower levels of Zn in the hippocampus of symptomatic ALS rats. These results bring new insights into the glial response during disease development and progression in motor as well as in non-motor CNS structures, and indicate disturbed tissue elemental homeostasis as a prominent hallmark of disease pathology. Copyright © 2017 IBRO. Published by Elsevier Ltd. All rights reserved.

  12. Soma size and Cav1.3 channel expression in vulnerable and resistant motoneuron populations of the SOD1G93A mouse model of ALS

    PubMed Central

    Shoenfeld, Liza; Westenbroek, Ruth E.; Fisher, Erika; Quinlan, Katharina A.; Tysseling, Vicki M.; Powers, Randall K.; Heckman, Charles J.; Binder, Marc D.

    2014-01-01

    Abstract Although the loss of motoneurons is an undisputed feature of amyotrophic lateral sclerosis (ALS) in man and in its animal models (SOD1 mutant mice), how the disease affects the size and excitability of motoneurons prior to their degeneration is not well understood. This study was designed to test the hypothesis that motoneurons in mutant SOD1G93A mice exhibit an enlargement of soma size (i.e., cross‐sectional area) and an increase in Cav1.3 channel expression at postnatal day 30, well before the manifestation of physiological symptoms that typically occur at p90 (Chiu et al. 1995). We made measurements of spinal and hypoglossal motoneurons vulnerable to degeneration, as well as motoneurons in the oculomotor nucleus that are resistant to degeneration. Overall, we found that the somata of motoneurons in male SOD1G93A mutants were larger than those in wild‐type transgenic males. When females were included in the two groups, significance was lost. Expression levels of the Cav1.3 channels were not differentiated by genotype, sex, or any interaction of the two. These results raise the intriguing possibility of an interaction between male sex steroid hormones and the SOD1 mutation in the etiopathogenesis of ALS. PMID:25107988

  13. Compartmentalization of superoxide dismutase 1 (SOD1G93A) aggregates determines their toxicity

    PubMed Central

    Weisberg, Sarah J.; Lyakhovetsky, Roman; Werdiger, Ayelet-chen; Gitler, Aaron D.; Soen, Yoav; Kaganovich, Daniel

    2012-01-01

    Neurodegenerative diseases constitute a class of illnesses marked by pathological protein aggregation in the brains of affected individuals. Although these disorders are invariably characterized by the degeneration of highly specific subpopulations of neurons, protein aggregation occurs in all cells, which indicates that toxicity arises only in particular cell biological contexts. Aggregation-associated disorders are unified by a common cell biological feature: the deposition of the culprit proteins in inclusion bodies. The precise function of these inclusions remains unclear. The starting point for uncovering the origins of disease pathology must therefore be a thorough understanding of the general cell biological function of inclusions and their potential role in modulating the consequences of aggregation. Here, we show that in human cells certain aggregate inclusions are active compartments. We find that toxic aggregates localize to one of these compartments, the juxtanuclear quality control compartment (JUNQ), and interfere with its quality control function. The accumulation of SOD1G93A aggregates sequesters Hsp70, preventing the delivery of misfolded proteins to the proteasome. Preventing the accumulation of SOD1G93A in the JUNQ by enhancing its sequestration in an insoluble inclusion reduces the harmful effects of aggregation on cell viability. PMID:22967507

  14. Effects of tongue force training on bulbar motor function in the female SOD1-G93A rat model of Amyotrophic Lateral Sclerosis

    PubMed Central

    Ma, Delin; Shuler, Jeffrey M.; Kumar, Aishwarya; Stanford, Quincy R.; Tungtur, Sudheer; Nishimune, Hiroshi; Stanford, John A.

    2016-01-01

    Background The use of exercise in Amyotrophic Lateral Sclerosis (ALS) is controversial. Although moderate exercise appears to be beneficial for limb muscles in ALS, the effects of exercise on bulbar muscles such as the tongue have not been studied. Objective The aim of this study was to determine the effects of tongue force training on bulbar motor function in the SOD1-G93A rat model of ALS. Methods We compared the effects of tongue force training on bulbar motor function and neuromuscular junction (NMJ) innervation in female SOD1-G93A rats and age-matched female wild-type controls. Half of each group underwent afternoon tongue force training sessions, while all rats were tested under minimal force conditions in the mornings. Results Tongue force did not differ between the SOD1-G93A rats and healthy controls during the morning testing sessions, nor was it affected by training. Surprisingly, decreases in tongue motility, the number of licks per session, and body weight were greater in the tongue force-trained SOD1-G93A rats. Forelimb grip force, survival, and denervation of the genioglossus muscle did not differ between the trained and untrained SOD1-G93A rats. Genioglossus innervation was correlated with changes in tongue force but not tongue motility in SOD1-G93A rats at end stage. Conclusions The results indicate a potential deleterious effect of tongue force training on tongue motility in female SOD1-G93A rats. The lack of relationship between genioglossus innervation and tongue motility suggest that factors other than lower motor neuron integrity likely accounted for this effect. PMID:27573800

  15. Presymptomatic electrophysiological tests predict clinical onset and survival in SOD1(G93A) ALS mice.

    PubMed

    Mancuso, Renzo; Osta, Rosario; Navarro, Xavier

    2014-12-01

    We assessed the predictive value of electrophysiological tests as a marker of clinical disease onset and survival in superoxide-dismutase 1 (SOD1)(G93A) mice. We evaluated the accuracy of electrophysiological tests in differentiating transgenic versus wild-type mice. We made a correlation analysis of electrophysiological parameters and the onset of symptoms, survival, and number of spinal motoneurons. Presymptomatic electrophysiological tests show great accuracy in differentiating transgenic versus wild-type mice, with the most sensitive parameter being the tibialis anterior compound muscle action potential (CMAP) amplitude. The CMAP amplitude at age 10 weeks correlated significantly with clinical disease onset and survival. Electrophysiological tests increased their survival prediction accuracy when evaluated at later stages of the disease and also predicted the amount of lumbar spinal motoneuron preservation. Electrophysiological tests predict clinical disease onset, survival, and spinal motoneuron preservation in SOD1(G93A) mice. This is a methodological improvement for preclinical studies. © 2014 Wiley Periodicals, Inc.

  16. Deletion of galectin-3 exacerbates microglial activation and accelerates disease progression and demise in a SOD1G93A mouse model of amyotrophic lateral sclerosis

    PubMed Central

    Lerman, Bruce J; Hoffman, Eric P; Sutherland, Margaret L; Bouri, Khaled; Hsu, Daniel K; Liu, Fu-Tong; Rothstein, Jeffrey D; Knoblach, Susan M

    2012-01-01

    Galectins are pleiotropic carbohydrate-binding lectins involved in inflammation, growth/differentiation, and tissue remodeling. The functional role of galectins in amyotrophic lateral sclerosis (ALS) is unknown. Expression studies revealed increases in galectin-1 mRNA and protein in spinal cords from SOD1G93A mice, and in galectin-3 and -9 mRNAs and proteins in spinal cords of both SOD1G93A mice and sporadic ALS patients. As the increase in galectin-3 appeared in early presymptomatic stages and increased progressively through to end stage of disease in the mouse, it was selected for additional study, where it was found to be mainly expressed by microglia. Galectin-3 antagonists are not selective and do not readily cross the blood–brain barrier; therefore, we generated SOD1G93A/Gal-3−/− transgenic mice to evaluate galectin-3 deletion in a widely used mouse model of ALS. Disease progression, neurological symptoms, survival, and inflammation were assessed to determine the effect of galectin-3 deletion on the SOD1G93A disease phenotype. Galectin-3 deletion did not change disease onset, but resulted in more rapid progression through functionally defined disease stages, more severely impaired neurological symptoms at all stages of disease, and expiration, on average, 25 days earlier than SOD1G93A/Gal-3+/+ cohorts. In addition, microglial staining, as well as TNF-α, and oxidative injury were increased in SOD1G93A/Gal-3−/− mice compared with SOD1G93A/Gal-3+/+ cohorts. These data support an important functional role for microglial galectin-3 in neuroinflammation during chronic neurodegenerative disease. We suggest that elevations in galectin-3 by microglia as disease progresses may represent a protective, anti-inflammatory innate immune response to chronic motor neuron degeneration. PMID:23139902

  17. Palmitoylation of superoxide dismutase 1 (SOD1) is increased for familial amyotrophic lateral sclerosis-linked SOD1 mutants.

    PubMed

    Antinone, Sarah E; Ghadge, Ghanashyam D; Lam, Tukiet T; Wang, Lijun; Roos, Raymond P; Green, William N

    2013-07-26

    Mutations in Cu,Zn-superoxide dismutase (mtSOD1) cause familial amyotrophic lateral sclerosis (FALS), a neurodegenerative disease resulting from motor neuron degeneration. Here, we demonstrate that wild type SOD1 (wtSOD1) undergoes palmitoylation, a reversible post-translational modification that can regulate protein structure, function, and localization. SOD1 palmitoylation was confirmed by multiple techniques, including acyl-biotin exchange, click chemistry, cysteine mutagenesis, and mass spectrometry. Mass spectrometry and cysteine mutagenesis demonstrated that cysteine residue 6 was the primary site of palmitoylation. The palmitoylation of FALS-linked mtSOD1s (A4V and G93A) was significantly increased relative to that of wtSOD1 expressed in HEK cells and a motor neuron cell line. The palmitoylation of FALS-linked mtSOD1s (G93A and G85R) was also increased relative to that of wtSOD1 when assayed from transgenic mouse spinal cords. We found that the level of SOD1 palmitoylation correlated with the level of membrane-associated SOD1, suggesting a role for palmitoylation in targeting SOD1 to membranes. We further observed that palmitoylation occurred predominantly on disulfide-reduced as opposed to disulfide-bonded SOD1, suggesting that immature SOD1 is the primarily palmitoylated species. Increases in SOD1 disulfide bonding and maturation with increased copper chaperone for SOD1 expression caused a decrease in wtSOD1 palmitoylation. Copper chaperone for SOD1 overexpression decreased A4V palmitoylation less than wtSOD1 and had little effect on G93A mtSOD1 palmitoylation. These findings suggest that SOD1 palmitoylation occurs prior to disulfide bonding during SOD1 maturation and that palmitoylation is increased when disulfide bonding is delayed or decreased as observed for several mtSOD1s.

  18. Early Detection of Motor Dysfunction in the SOD1G93A Mouse Model of Amyotrophic Lateral Sclerosis (ALS) Using Home Cage Running Wheels

    PubMed Central

    Bennett, Ellen J.; Mead, Richard J.; Azzouz, Mimoun; Shaw, Pamela J.; Grierson, Andrew J.

    2014-01-01

    The SOD1G93A mouse has been used since 1994 for preclinical testing in amyotrophic lateral sclerosis (ALS). Despite recent genetic advances in our understanding of ALS, transgenic mice expressing mutant SOD1 remain the best available, and most widely used, vertebrate model of the disease. We previously described an optimised and rapid approach for preclinical studies in the SOD1G93A mouse. Here we describe improvements to this approach using home cage running wheels to obtain daily measurements of motor function, with minimal intervention. We show that home cage running wheels detect reductions in motor function at a similar time to the rotarod test, and that the data obtained are less variable allowing the use of smaller groups of animals to obtain satisfactory results. This approach refines use of the SOD1G93A model, and reduces the number of animals undergoing procedures of substantial severity, two central principles of the 3Rs (replacement, reduction and refinement of animal use in research). The small group sizes and rapid timescales enable affordable large-scale therapeutic pre-screening in the SOD1G93A mouse, as well as rapid validation of published positive effects in a second laboratory, one of the major stumbling blocks in ALS preclinical therapy development. PMID:25268710

  19. A Cystine-Rich Whey Supplement (Immunocal®) Delays Disease Onset and Prevents Spinal Cord Glutathione Depletion in the hSOD1G93A Mouse Model of Amyotrophic Lateral Sclerosis

    PubMed Central

    Ross, Erika K.; Winter, Aimee N.; Wilkins, Heather M.; Sumner, Whitney A.; Duval, Nathan; Patterson, David; Linseman, Daniel A.

    2014-01-01

    Depletion of the endogenous antioxidant, glutathione (GSH), underlies progression of the devastating neurodegenerative disease, amyotrophic lateral sclerosis (ALS). Thus, strategies aimed at elevating GSH may yield new therapeutics for ALS. Here, we investigated the effects of a unique non-denatured whey protein supplement, Immunocal®, in the transgenic Gly position 93 to Ala (G93A) mutant hSOD1 (hSOD1G93A) mouse model of ALS. Immunocal® is rich in the GSH precursor, cystine, and is therefore capable of bolstering GSH content. Transgenic hSOD1G93A mice receiving Immunocal® displayed a significant delay in disease onset compared to untreated hSOD1G93A controls. Additionally, Immunocal® treatment significantly decreased the rate of decline in grip strength and prevented disease-associated reductions in whole blood and spinal cord tissue GSH levels in end-stage hSOD1G93A mice. However, Immunocal® did not extend survival, likely due to its inability to preserve the mitochondrial GSH pool in spinal cord. Combination treatment with Immunocal® and the anti-glutamatergic compound, riluzole, delayed disease onset and extended survival in hSOD1G93A mice. These findings demonstrate that sustaining tissue GSH with Immunocal® only modestly delays disease onset and slows the loss of skeletal muscle strength in hSOD1G93A mice. Moreover, the inability of Immunocal® to rescue mitochondrial GSH in spinal cord provides a possible mechanism for its lack of effect on survival and is a limiting factor in the potential utility of this supplement as a therapeutic for ALS. PMID:26785244

  20. The Effects of Bee Venom Acupuncture on the Central Nervous System and Muscle in an Animal hSOD1G93A Mutant

    PubMed Central

    Cai, MuDan; Choi, Sun-Mi; Yang, Eun Jin

    2015-01-01

    Amyotrophic lateral sclerosis (ALS) is caused by the degeneration of lower and upper motor neurons, leading to muscle paralysis and respiratory failure. However, there is no effective drug or therapy to treat ALS. Complementary and alternative medicine (CAM), including acupuncture, pharmacopuncture, herbal medicine, and massage is popular due to the significant limitations of conventional therapy. Bee venom acupuncture (BVA), also known as one of pharmacopunctures, has been used in Oriental medicine to treat inflammatory diseases. The purpose of this study is to investigate the effect of BVA on the central nervous system (CNS) and muscle in symptomatic hSOD1G93A transgenic mice, an animal model of ALS. Our findings show that BVA at ST36 enhanced motor function and decreased motor neuron death in the spinal cord compared to that observed in hSOD1G93A transgenic mice injected intraperitoneally (i.p.) with BV. Furthermore, BV treatment at ST36 eliminated signaling downstream of inflammatory proteins such as TLR4 in the spinal cords of symptomatic hSOD1G93A transgenic mice. However, i.p. treatment with BV reduced the levels of TNF-α and Bcl-2 expression in the muscle hSOD1G93A transgenic mice. Taken together, our findings suggest that BV pharmacopuncture into certain acupoints may act as a chemical stimulant to activate those acupoints and subsequently engage the endogenous immune modulatory system in the CNS in an animal model of ALS. PMID:25781653

  1. Effect of CCS on the Accumulation of FALS SOD1 Mutant-containing Aggregates and on Mitochondrial Translocation of SOD1 Mutants: Implication of a Free Radical Hypothesis

    PubMed Central

    Kim, Ha Kun; Chung, Youn Wook; Chock, P. Boon; Yim, Moon B.

    2011-01-01

    Missense mutations of SOD1 are linked to familial amyotrophic lateral sclerosis (FALS) through a yet-to-be identified toxic-gain-of-function. One of the proposed mechanisms involves enhanced aggregate formation. However, a recent study showed that dual transgenic mice overexpressing both G93A and CCS copper chaperone (G93A/CCS) exhibit no SOD1-positive aggregates yet show accelerated FALS symptoms with enhanced mitochondrial pathology compared to G93A mice. Using a dicistronic mRNA to simultaneously generate hSOD1 mutants, G93A, A4V and G85R, and hCCS in AAV293 cells, we revealed: (i) CCS is degraded primarily via a macroautophagy pathway. It forms a stable heterodimer with inactive G85R, and via its novel copper chaperone-independent molecular chaperone activity facilitates G85R degradation via a macroautophagy-mediated pathway. For active G93A and A4V, CCS catalyzes their maturation to form active and soluble homodimers. (ii) CCS reduces, under non-oxidative conditions, yet facilitates in the presence of H2O2, mitochondrial translocation of inactive SOD1 mutants. These results, together with previous reports showing FALS SOD1 mutants enhanced free radical-generating activity, provide a mechanistic explanation for the observations with G93A/CCS dual transgenic mice and suggest that free radical generation by FALS SOD1, enhanced by CCS, may, in part, be responsible for the FALS SOD1 mutant-linked aggregation, mitochondrial translocation, and degradation. PMID:21354101

  2. Effect of CCS on the accumulation of FALS SOD1 mutant-containing aggregates and on mitochondrial translocation of SOD1 mutants: implication of a free radical hypothesis.

    PubMed

    Kim, Ha Kun; Chung, Youn Wook; Chock, P Boon; Yim, Moon B

    2011-05-15

    Missense mutations of SOD1 are linked to familial amyotrophic lateral sclerosis (FALS) through a yet-to-be identified toxic-gain-of-function. One of the proposed mechanisms involves enhanced aggregate formation. However, a recent study showed that dual transgenic mice overexpressing both G93A and CCS copper chaperone (G93A/CCS) exhibit no SOD1-positive aggregates yet show accelerated FALS symptoms with enhanced mitochondrial pathology compared to G93A mice. Using a dicistronic mRNA to simultaneously generate hSOD1 mutants, G93A, A4V and G85R, and hCCS in AAV293 cells, we revealed: (i) CCS is degraded primarily via a macroautophagy pathway. It forms a stable heterodimer with inactive G85R, and via its novel copper chaperone-independent molecular chaperone activity facilitates G85R degradation via a macroautophagy-mediated pathway. For active G93A and A4V, CCS catalyzes their maturation to form active and soluble homodimers. (ii) CCS reduces, under non-oxidative conditions, yet facilitates in the presence of H(2)O(2), mitochondrial translocation of inactive SOD1 mutants. These results, together with previous reports showing FALS SOD1 mutants enhanced free radical-generating activity, provide a mechanistic explanation for the observations with G93A/CCS dual transgenic mice and suggest that free radical generation by FALS SOD1, enhanced by CCS, may, in part, be responsible for the FALS SOD1 mutant-linked aggregation, mitochondrial translocation, and degradation. Published by Elsevier Inc.

  3. Expression and Distribution of Arylsulfatase B are Closely Associated with Neuron Death in SOD1 G93A Transgenic Mice.

    PubMed

    Zhang, Jie; Liang, Huiting; Zhu, Lei; Gan, Weiming; Tang, Chunyan; Li, Jiao; Xu, Renshi

    2018-02-01

    The known proteins only explained the partial pathogenesis of amyotrophic lateral sclerosis (ALS). Therefore, this study aimed to search the novel proteins possibly involved in ALS. In this study, we analyzed the expression and distribution of the candidate protein arylsulfatase B (ARSB) in the different segments, anatomic regions, and neural cells of spinal cord at the different stages of the wild-type and [Cu/Zn] superoxide dismutase 1 (SOD1) G93A transgenic mice using the fluorescent immunohistochemistry and the western blot. The results revealed that the ARSB was extensively expressed and distributed in the entire spinal cord; the expression and distribution of ARSB was significantly different in the different regions of spinal cord, the anterior horn of gray matter (AHGM) was significantly more than that in the posterior horn of gray matter (PHGM) and significantly more than that in the central canal, and ARSB was mainly distributed in the microglia and neuron cells in the wild-type mice. The expression of ARSB significantly increased in other anatomic regions besides the thoracic PHGM, significantly decreased at the progression stage, occurred in the redistribution from the AHGM and the PHGM to the central canal at the onset and progression stages, and no any alteration of ARSB expression and distribution occurred between the different neural cells in the SOD1 G93A mice compared with the wild-type mice. The increase of ARSB expression and distribution followed with the increased of neuron death. Our data suggested that the abnormal expression and distribution of ARSB were closely associated with the neuron death in the SOD1 G93A transgenic mice.

  4. State of the field: An informatics-based systematic review of the SOD1-G93A amyotrophic lateral sclerosis transgenic mouse model

    PubMed Central

    Kim, Renaid B.; Irvin, Cameron W.; Tilva, Keval R.; Mitchell, Cassie S.

    2016-01-01

    Numerous sub-cellular through system-level disturbances have been identified in over 1300 articles examining the superoxide dismutase-1 guanine 93 to alanine (SOD1-G93A) transgenic mouse amyotrophic lateral sclerosis (ALS) pathophysiology. Manual assessment of such a broad literature base is daunting. We performed a comprehensive informatics-based systematic review or ‘field analysis’ to agnostically compute and map the current state of the field. Text mining of recaptured articles was used to quantify published data topic breadth and frequency. We constructed a nine-category pathophysiological function-based ontology to systematically organize and quantify the field's primary data. Results demonstrated that the distribution of primary research belonging to each category is: systemic measures an motor function, 59%; inflammation, 46%; cellular energetics, 37%; proteomics, 31%; neural excitability, 22%; apoptosis, 20%; oxidative stress, 18%; aberrant cellular chemistry, 14%; axonal transport, 10%. We constructed a SOD1-G93A field map that visually illustrates and categorizes the 85% most frequently assessed sub-topics. Finally, we present the literature-cited significance of frequently published terms and uncover thinly investigated areas. In conclusion, most articles individually examine at least two categories, which is indicative of the numerous underlying pathophysiological interrelationships. An essential future path is examination of cross-category pathophysiological interrelationships and their co-correspondence to homeostatic regulation and disease progression. PMID:25998063

  5. Redox susceptibility of SOD1 mutants is associated with the differential response to CCS over-expression in vivo.

    PubMed

    Son, Marjatta; Fu, Qiao; Puttaparthi, Krishna; Matthews, Christina M; Elliott, Jeffrey L

    2009-04-01

    Over-expression of CCS in G93A SOD1 mice accelerates neurological disease and enhances mitochondrial pathology. We studied the effect of CCS over-expression in transgenic mice expressing G37R, G86R or L126Z SOD1 mutations in order to understand factors which influence mitochondrial dysfunction. Over-expression of CCS markedly decreased survival and produced mitochondrial vacuolation in G37R SOD1 mice but not in G86R or L126Z SOD1 mice. Moreover, CCS/G37R SOD1 spinal cord showed specific reductions in mitochondrial complex IV subunits consistent with an isolated COX deficiency, while no such reductions were detected in CCS/G86R or CCS/L126Z SOD1 mice. CCS over-expression increased the ratio of reduced to oxidized SOD1 monomers in the spinal cords of G37R SOD1 as well as G93A SOD1 mice, but did not influence the redox state of G86R or L126Z SOD1 monomers. The effects of CCS on disease are SOD1 mutation dependent and correlate with SOD1 redox susceptibility.

  6. Degenerative myelopathy in German Shepherd Dog: comparison of two molecular assays for the identification of the SOD1:c.118G>A mutation.

    PubMed

    Capucchio, Maria Teresa; Spalenza, Veronica; Biasibetti, Elena; Bottero, Maria Teresa; Rasero, Roberto; Dalmasso, Alessandra; Sacchi, Paola

    2014-02-01

    Degenerative myelopathy (DM) is a late-onset, slowly progressive degeneration of spinal cord white matter which is reported primarily in large breed dogs. The missense mutation SOD1:c.118G>A is associated with this pathology in several dog breeds, including the German Shepherd Dog (GSD). The aims of the present study were to develop a tool for the rapid screening of the SOD1 mutation site in dogs and to evaluate the association of the polymorphism with DM in the German Shepherd breed. Two different techniques were compared: a minisequencing test and a real-time pcr allelic discrimination assay. Both approaches resulted effective and efficient. A sample of 47 dogs were examined. Ten subjects presented the symptoms of the illness; for one of them the diagnosis was confirmed by postmortem investigations and it resulted to be an A/A homozygote. In another clinically suspected dog, heterozygote A/G, the histopathological examination of the medulla showed moderate axon and myelin degenerative changes. GSD shows a frequency of the mutant allele equal to 0.17, quite high being a high-risk allele. Because canine DM has a late onset in adulthood and homozygous mutant dogs are likely as fertile as other genotypes, the natural selection is mild and the mutant allele may reach high frequencies. A diagnostic test, easy to implement, may contribute to control the gene diffusion in populations. The SOD1:c.118G>A mutation could be a useful marker for breeding strategies intending to reduce the incidence of DM.

  7. Identification of compounds protective against G93A-SOD1 toxicity for the treatment of amyotrophic lateral sclerosis.

    PubMed

    Benmohamed, Radhia; Arvanites, Anthony C; Kim, Jinho; Ferrante, Robert J; Silverman, Richard B; Morimoto, Richard I; Kirsch, Donald R

    2011-03-01

    The underlying cause of amyotrophic lateral sclerosis (ALS), a progressive neurodegenerative disorder, remains unknown. However, there is strong evidence that one pathophysiological mechanism, toxic protein misfolding and/or aggregation, may trigger motor neuron dysfunction and loss. Since the clinical and pathological features of sporadic and familial ALS are indistinguishable, all forms of the disease may be better understood and ultimately treated by studying pathogenesis and therapy in models expressing mutant forms of SOD1. We developed a cellular model in which cell death depended on the expression of G93A-SOD1, a mutant form of superoxide dismutase found in familial ALS patients that produces toxic protein aggregates. This cellular model was optimized for high throughput screening to identify protective compounds from a >50,000 member chemical library. Three novel chemical scaffolds were selected for further study following screen implementation, counter-screening and secondary testing, including studies with purchased analogs. All three scaffolds blocked SOD1 aggregation in high content screening assays and data on the optimization and further characterization of these compounds will be reported separately. These data suggest that optimization of these chemicals scaffolds may produce therapeutic candidates for ALS patients.

  8. Structures of the G85R Variant of SOD1 in Familial Amyotrophic Lateral Sclerosis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cao, Xiaohang; Antonyuk, Svetlana V.; Seetharaman, Sai V.

    2008-07-21

    Mutations in the gene encoding human copper-zinc superoxide dismutase (SOD1) cause a dominant form of the progressive neurodegenerative disease amyotrophic lateral sclerosis. Transgenic mice expressing the human G85R SOD1 variant develop paralytic symptoms concomitant with the appearance of SOD1-enriched proteinaceous inclusions in their neural tissues. The process(es) through which misfolding or aggregation of G85R SOD1 induces motor neuron toxicity is not understood. Here we present structures of the human G85R SOD1 variant determined by single crystal x-ray diffraction. Alterations in structure of the metal-binding loop elements relative to the wild type enzyme suggest a molecular basis for the metal ionmore » deficiency of the G85R SOD1 protein observed in the central nervous system of transgenic mice and in purified recombinant G85R SOD1. These findings support the notion that metal-deficient and/or disulfide-reduced mutant SOD1 species contribute to toxicity in SOD1-linked amyotrophic lateral sclerosis.« less

  9. SIRT1 overexpression ameliorates a mouse model of SOD1-linked amyotrophic lateral sclerosis via HSF1/HSP70i chaperone system.

    PubMed

    Watanabe, Seiji; Ageta-Ishihara, Natsumi; Nagatsu, Shinji; Takao, Keizo; Komine, Okiru; Endo, Fumito; Miyakawa, Tsuyoshi; Misawa, Hidemi; Takahashi, Ryosuke; Kinoshita, Makoto; Yamanaka, Koji

    2014-08-29

    Dominant mutations in superoxide dismutase 1 (SOD1) cause degeneration of motor neurons in a subset of inherited amyotrophic lateral sclerosis (ALS). The pathogenetic process mediated by misfolded and/or aggregated mutant SOD1 polypeptides is hypothesized to be suppressed by protein refolding. This genetic study is aimed to test whether mutant SOD1-mediated ALS pathology recapitulated in mice could be alleviated by overexpressing a longevity-related deacetylase SIRT1 whose substrates include a transcription factor heat shock factor 1 (HSF1), the master regulator of the chaperone system. We established a line of transgenic mice that chronically overexpress SIRT1 in the brain and spinal cord. While inducible HSP70 (HSP70i) was upregulated in the spinal cord of SIRT1 transgenic mice (PrP-Sirt1), no neurological and behavioral alterations were detected. To test hypothetical benefits of SIRT1 overexpression, we crossbred PrP-Sirt1 mice with two lines of ALS model mice: A high expression line that exhibits a severe phenotype (SOD1G93A-H) or a low expression line with a milder phenotype (SOD1G93A-L). The Sirt1 transgene conferred longer lifespan without altering the time of symptomatic onset in SOD1G93A-L. Biochemical analysis of the spinal cord revealed that SIRT1 induced HSP70i expression through deacetylation of HSF1 and that SOD1G93A-L/PrP-Sirt1 double transgenic mice contained less insoluble SOD1 than SOD1G93A-L mice. Parallel experiments showed that Sirt1 transgene could not rescue a more severe phenotype of SOD1G93A-H transgenic mice partly because their HSP70i level had peaked out. The genetic supplementation of SIRT1 can ameliorate a mutant SOD1-linked ALS mouse model partly through the activation of the HSF1/HSP70i chaperone system. Future studies shall include testing potential benefits of pharmacological enhancement of the deacetylation activity of SIRT1 after the onset of the symptom.

  10. Large SOD1 aggregates, unlike trimeric SOD1, do not impact cell viability in a model of amyotrophic lateral sclerosis.

    PubMed

    Zhu, Cheng; Beck, Matthew V; Griffith, Jack D; Deshmukh, Mohanish; Dokholyan, Nikolay V

    2018-05-01

    Aberrant accumulation of misfolded Cu, Zn superoxide dismutase (SOD1) is a hallmark of SOD1-associated amyotrophic lateral sclerosis (ALS), an invariably fatal neurodegenerative disease. While recent discovery of nonnative trimeric SOD1-associated neurotoxicity has suggested a potential pathway for motor neuron impairment, it is yet unknown whether large, insoluble aggregates are cytotoxic. Here we designed SOD1 mutations that specifically stabilize either the fibrillar form or the trimeric state of SOD1. The designed mutants display elevated populations of fibrils or trimers correspondingly, as demonstrated by gel filtration chromatography and electron microscopy. The trimer-stabilizing mutant, G147P, promoted cell death, even more potently in comparison with the aggressive ALS-associated mutants A4V and G93A. In contrast, the fibril-stabilizing mutants, N53I and D101I, positively impacted the survival of motor neuron-like cells. Hence, we conclude the SOD1 oligomer and not the mature form of aggregated fibril is critical for the neurotoxic effects in the model of ALS. The formation of large aggregates is in competition with trimer formation, suggesting that aggregation may be a protective mechanism against formation of toxic oligomeric intermediates.

  11. Multiple intracerebroventricular injections of human umbilical cord mesenchymal stem cells delay motor neurons loss but not disease progression of SOD1G93A mice.

    PubMed

    Sironi, Francesca; Vallarola, Antonio; Violatto, Martina Bruna; Talamini, Laura; Freschi, Mattia; De Gioia, Roberta; Capelli, Chiara; Agostini, Azzurra; Moscatelli, Davide; Tortarolo, Massimo; Bigini, Paolo; Introna, Martino; Bendotti, Caterina

    2017-12-01

    Stem cell therapy is considered a promising approach in the treatment of amyotrophic lateral sclerosis (ALS) and mesenchymal stem cells (MSCs) seem to be the most effective in ALS animal models. The umbilical cord (UC) is a source of highly proliferating fetal MSCs, more easily collectable than other MSCs. Recently we demonstrated that human (h) UC-MSCs, double labeled with fluorescent nanoparticles and Hoechst-33258 and transplanted intracerebroventricularly (ICV) into SOD1G93A transgenic mice, partially migrated into the spinal cord after a single injection. This prompted us to assess the effect of repeated ICV injections of hUC-MSCs on disease progression in SOD1G93A mice. Although no transplanted cells migrated to the spinal cord, a partial but significant protection of motor neurons (MNs) was found in the lumbar spinal cord of hUC-MSCs-treated SOD1G93A mice, accompanied by a shift from a pro-inflammatory (IL-6, IL-1β) to anti-inflammatory (IL-4, IL-10) and neuroprotective (IGF-1) environment in the lumbar spinal cord, probably linked to the activation of p-Akt survival pathway in both motor neurons and reactive astrocytes. However, this treatment neither prevented the muscle denervation nor delayed the disease progression of mice, emphasizing the growing evidence that protecting the motor neuron perikarya is not sufficient to delay the ALS progression. Copyright © 2017. Published by Elsevier B.V.

  12. Axonal Mitochondrial Clusters Containing Mutant SOD1 in Transgenic Models of ALS

    PubMed Central

    Lepanto, Paola; Elizondo, Victoria; Horjales, Sofia; Palacios, Florencia; Martinez-Palma, Laura; Marin, Monica; Beckman, Joseph S.

    2009-01-01

    Abstract We studied the subcellular distribution of mitochondria and superoxide dismutase-1 (SOD1) in whole mounts of microdissected motor axons of rats expressing the ALS-linked SOD1-G93A mutation. The rationale was to determine whether physical interactions between the enzyme and mitochondria were linked to the axonopathy of motor fibers occurring in amyotrophic lateral sclerosis (ALS). Mitochondria and SOD1 displayed a homogeneous distribution along motor axons both in nontransgenic rats and in those overexpressing wild-type SOD1. In contrast, axons from SOD1-G93A rats (older than 35 days) showed accumulation of mitochondria in discrete clusters located at regular intervals. Most of SOD1 immunoreactivity was enriched in these clusters and colocalized with mitochondria, suggesting a recruitment of SOD1-G93A to the organelle. The SOD1/mitochondrial clusters were abundant in motor axons but scarcely seen in sensory axons. Clusters also were stained for neuronal nitric oxide synthase, nitrotyrosine, and cytochrome c. The later also was detected surrounding clusters. Ubiquitin colocalized with clusters only at late stages of the disease. The cytoskeleton was not overtly altered in clusters. These results suggest that mutant SOD1 and defective mitochondria create localized dysfunctional domains in motor axons, which may lead to progressive axonopathy in ALS. Antioxid. Redox Signal. 11, 1535–1545. PMID:19344250

  13. HoxB2 binds mutant SOD1 and is altered in transgenic model of ALS.

    PubMed

    Zhai, Jinbin; Lin, Hong; Canete-Soler, Rafaela; Schlaepfer, William W

    2005-09-15

    Mutations in Cu/Zn superoxide dismutase (SOD1) cause approximately 20% of familial amyotrophic lateral sclerosis by a toxic gain of function; however, the precise mechanisms remain unclear. Here, we report the identification of HoxB2, a homeodomain-containing transcription factor, as a G93A mutant SOD1 interactive protein in a yeast two-hybrid screen. We show that HoxB2 co-precipitates and co-localizes with mutant SOD1 in neuronal cell lines, as well as in brain and spinal cord of G93A mutant SOD1 transgenic mice. Mutagenesis further shows that this interaction is mediated by the central homeodomain of HoxB2. In motor neuron-like NSC-34 cells, overexpression of HoxB2 or its homeodomain decreases the insolubility of mutant SOD1 and inhibits G93A or G86R mutant SOD1-induced neuronal cell death. In human and mouse tissues, we show that expression of HoxB2 persists in adult spinal cord and is primarily localized in nuclei of motor neurons. In G93A transgenic mice, HoxB2 co-localizes with mutant SOD1 and is redistributed to perikarya and proximal neurites of motor neurons. In addition, there is progressive accumulation of HoxB2 and mutant SOD1 as punctate inclusions in the neuropil surrounding motor neurons. Taken together, our findings demonstrate that interaction of HoxB2 with mutant SOD1 occurs in motor neurons of G93A mutant SOD1 transgenic mice and suggest that this interaction may modulate the neurotoxicity of mutant SOD1.

  14. Tempol Moderately Extends Survival in a hSOD1G93A ALS Rat Model by Inhibiting Neuronal Cell Loss, Oxidative Damage and Levels of Non-Native hSOD1G93A Forms

    PubMed Central

    Linares, Edlaine; Seixas, Luciana V.; dos Prazeres, Janaina N.; Ladd, Fernando V. L.; Ladd, Aliny A. B. L.; Coppi, Antonio A.; Augusto, Ohara

    2013-01-01

    Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disease characterized by the progressive dysfunction and death of motor neurons by mechanisms that remain unclear. Evidence indicates that oxidative mechanisms contribute to ALS pathology, but classical antioxidants have not performed well in clinical trials. Cyclic nitroxides are an alternative worth exploring because they are multifunctional antioxidants that display low toxicity in vivo. Here, we examine the effects of the cyclic nitroxide tempol (4-hydroxy-2,2,6,6-tetramethyl piperidine-1-oxyl) on ALS onset and progression in transgenic female rats over-expressing the mutant hSOD1G93A . Starting at 7 weeks of age, a high dose of tempol (155 mg/day/rat) in the rat´s drinking water had marginal effects on the disease onset but decelerated disease progression and extended survival by 9 days. In addition, tempol protected spinal cord tissues as monitored by the number of neuronal cells, and the reducing capability and levels of carbonylated proteins and non-native hSOD1 forms in spinal cord homogenates. Intraperitoneal tempol (26 mg/rat, 3 times/week) extended survival by 17 days. This group of rats, however, diverted to a decelerated disease progression. Therefore, it was inconclusive whether the higher protective effect of the lower i.p. dose was due to higher tempol bioavailability, decelerated disease development or both. Collectively, the results show that tempol moderately extends the survival of ALS rats while protecting their cellular and molecular structures against damage. Thus, the results provide proof that cyclic nitroxides are alternatives worth to be further tested in animal models of ALS. PMID:23405225

  15. Exosomes from NSC-34 Cells Transfected with hSOD1-G93A Are Enriched in miR-124 and Drive Alterations in Microglia Phenotype.

    PubMed

    Pinto, Sara; Cunha, Carolina; Barbosa, Marta; Vaz, Ana R; Brites, Dora

    2017-01-01

    Amyotrophic lateral sclerosis (ALS) is a fatal adult-onset neurodegenerative disorder affecting motor neurons (MNs). Evidences indicate that ALS is a non-cell autonomous disease in which glial cells participate in both disease onset and progression. Exosomal transfer of mutant copper-zinc superoxide dismutase 1 (mSOD1) from cell-to-cell was suggested to contribute to disease dissemination. Data from our group and others showed that exosomes from activated cells contain inflammatory-related microRNAs (inflamma-miRNAs) that recapitulate the donor cell. While glia-derived exosomes and their effects in neurons have been addressed by several studies, only a few investigated the influence of motor neuron (MN)-derived exosomes in other cell function, the aim of the present study. We assessed a set of inflamma-miRs in NSC-34 MN-like cells transfected with mutant SOD1(G93A) and extended the study into their derived exosomes (mSOD1 exosomes). Then, the effects produced by mSOD1 exosomes in the activation and polarization of the recipient N9 microglial cells were investigated. Exosomes in coculture with N9 microglia and NSC-34 cells [either transfected with either wild-type (wt) human SOD1 or mutant SOD1(G93A)] showed to be transferred into N9 cells. Increased miR-124 expression was found in mSOD1 NSC-34 cells and in their derived exosomes. Incubation of mSOD1 exosomes with N9 cells determined a sustained 50% reduction in the cell phagocytic ability. It also caused a persistent NF-kB activation and an acute generation of NO, MMP-2, and MMP-9 activation, as well as upregulation of IL-1β, TNF-α, MHC-II, and iNOS gene expression, suggestive of induced M1 polarization. Marked elevation of IL-10, Arginase 1, TREM2, RAGE, and TLR4 mRNA levels, together with increased miR-124, miR-146a, and miR-155, at 24 h incubation, suggest the switch to mixed M1 and M2 subpopulations in the exosome-treated N9 microglial cells. Exosomes from mSOD1 NSC-34 MNs also enhanced the number of

  16. Interaction between dimer interface residues of native and mutated SOD1 protein: a theoretical study.

    PubMed

    Keerthana, S P; Kolandaivel, P

    2015-04-01

    Cu-Zn superoxide dismutase 1 (SOD1) is a highly conserved bimetallic protein enzyme, used for the scavenging the superoxide radicals (O2 (-)) produced due to aerobic metabolism in the mitochondrial respiratory chain. Over 100 mutations have been identified and found to be in the homodimeric structure of SOD1. The enzyme has to be maintained in its dimeric state for the structural stability and enzymatic activity. From our investigation, we found that the mutations apart from the dimer interface residues are found to affect the dimer stability of protein and hence enhancing the aggregation and misfolding tendency of mutated protein. The homodimeric state of SOD1 is found to be held together by the non-covalent interactions. The molecular dynamics simulation has been used to study the hydrogen bond interactions between the dimer interface residues of the monomers in native and mutated forms of SOD1 in apo- and holo-states. The results obtained by this analysis reveal the fact that the loss of hydrogen bond interactions between the monomers of the dimer is responsible for the reduced stability of the apo- and holo-mutant forms of SOD1. The conformers with dimer interface residues in native and mutated protein obtained by the molecular dynamics simulation is subjected to quantum mechanical study using M052X/6-31G(d) level of theory. The charge transfer between N-H···O interactions in the dimer interface residues were studied. The weak interaction between the monomers of the dimer accounts for the reduced dimerization and enhanced deformation energy in the mutated SOD1 protein.

  17. Muscle Expression of SOD1(G93A) Modulates microRNA and mRNA Transcription Pattern Associated with the Myelination Process in the Spinal Cord of Transgenic Mice.

    PubMed

    Dobrowolny, Gabriella; Bernardini, Camilla; Martini, Martina; Baranzini, Mirko; Barba, Marta; Musarò, Antonio

    2015-01-01

    A crucial system severely affected in several neuromuscular diseases is the loss of effective connection between muscle and nerve, leading to a pathological non-communication between the two tissues. One of the best examples of impaired interplay between muscle and nerve is Amyotrophic Lateral Sclerosis, a neurodegenerative disease characterized by degeneration of motor neurons and muscle atrophy. Increasing evidences suggest that damage to motor neurons is enhanced by alterations in the neighboring non-neuronal cells and indicate that altered skeletal muscle might be the source of signals that impinge motor neuron activity and survival. Here we investigated whether muscle selective expression of SOD1(G93A) mutant gene modulates mRNAs and miRNAs expression at the level of spinal cord of MLC/SOD1(G93A) mice. Using a Taqman array, the Affymetrix Mouse Gene 2.0 ST approach and the MiRwalk 2.0 database, which provides information on miRNA and their predicted target genes, we revealed that muscle specific expression of SOD1(G93A) modulates relevant molecules of the genetic and epigenetic circuitry of myelin homeostasis in spinal cord of transgenic mice. Our study provides insights into the pathophysiological interplay between muscle and nerve and supports the hypothesis that muscle is a source of signals that can either positively or negatively affect the nervous system.

  18. Extra virgin olive oil intake delays the development of amyotrophic lateral sclerosis associated with reduced reticulum stress and autophagy in muscle of SOD1G93A mice.

    PubMed

    Oliván, Sara; Martínez-Beamonte, Roberto; Calvo, Ana C; Surra, Joaquín C; Manzano, Raquel; Arnal, Carmen; Osta, Rosario; Osada, Jesús

    2014-08-01

    Amyotrophic lateral sclerosis is a neurodegenerative disease associated with mutations in antioxidant enzyme Cu/Zn-superoxide dismutase 1. Albeit there is no treatment for this disease, new insights related to an exacerbated lipid metabolism have been reported. In connection with the hypermetabolic lipid status, the hypothesis whether nature of dietary fat might delay the progression of the disease was tested by using a transgenic mouse that overexpresses the human SOD1G93A variant. For this purpose, SOD1G93A mice were assigned randomly to one of the following three experimental groups: (1) a standard chow diet (control, n=21), (2) a chow diet enriched with 20% (w/w) extra virgin olive oil (EVOO, n=22) and (3) a chow diet containing 20% palm oil (palm, n=20). They received the diets for 8 weeks and the progression of the disease was assessed. On the standard chow diet, average plasma cholesterol levels were lower than those mice receiving the high-fat diets. Mice fed an EVOO diet showed a significant higher survival and better motor performance than control mice. EVOO group mice survived longer and showed better motor performance and larger muscle fiber area than animals receiving palm. Moreover, the EVOO-enriched diet improved the muscle status as shown by expression of myogenic factors (Myod1 and Myog) and autophagy markers (LC3 and Beclin1), as well as diminished endoplasmic reticulum (ER) stress through decreasing Atf6 and Grp78. Our results demonstrate that EVOO may be effective in increasing survival rate, improving motor coordination together with a potential amelioration of ER stress, autophagy and muscle damage. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. Kaplan-Meier Meets Chemical Kinetics: Intrinsic Rate of SOD1 Amyloidogenesis Decreased by Subset of ALS Mutations and Cannot Fully Explain Age of Disease Onset.

    PubMed

    Abdolvahabi, Alireza; Shi, Yunhua; Rasouli, Sanaz; Croom, Corbin M; Aliyan, Amir; Martí, Angel A; Shaw, Bryan F

    2017-06-21

    Over 150 mutations in SOD1 (superoxide dismutase-1) cause amyotrophic lateral sclerosis (ALS), presumably by accelerating SOD1 amyloidogenesis. Like many nucleation processes, SOD1 fibrillization is stochastic (in vitro), which inhibits the determination of aggregation rates (and obscures whether rates correlate with patient phenotypes). Here, we diverged from classical chemical kinetics and used Kaplan-Meier estimators to quantify the probability of apo-SOD1 fibrillization (in vitro) from ∼10 3 replicate amyloid assays of wild-type (WT) SOD1 and nine ALS variants. The probability of apo-SOD1 fibrillization (expressed as a Hazard ratio) is increased by certain ALS-linked SOD1 mutations but is decreased or remains unchanged by other mutations. Despite this diversity, Hazard ratios of fibrillization correlated linearly with (and for three mutants, approximately equaled) Hazard ratios of patient survival (R 2 = 0.67; Pearson's r = 0.82). No correlation exists between Hazard ratios of fibrillization and age of initial onset of ALS (R 2 = 0.09). Thus, Hazard ratios of fibrillization might explain rates of disease progression but not onset. Classical kinetic metrics of fibrillization, i.e., mean lag time and propagation rate, did not correlate as strongly with phenotype (and ALS mutations did not uniformly accelerate mean rate of nucleation or propagation). A strong correlation was found, however, between mean ThT fluorescence at lag time and patient survival (R 2 = 0.93); oligomers of SOD1 with weaker fluorescence correlated with shorter survival. This study suggests that SOD1 mutations trigger ALS by altering a property of SOD1 or its oligomers other than the intrinsic rate of amyloid nucleation (e.g., oligomer stability; rates of intercellular propagation; affinity for membrane surfaces; and maturation rate).

  20. Human SOD1 ALS Mutations in a Drosophila Knock-In Model Cause Severe Phenotypes and Reveal Dosage-Sensitive Gain- and Loss-of-Function Components.

    PubMed

    Şahin, Aslı; Held, Aaron; Bredvik, Kirsten; Major, Paxton; Achilli, Toni-Marie; Kerson, Abigail G; Wharton, Kristi; Stilwell, Geoff; Reenan, Robert

    2017-02-01

    Amyotrophic Lateral Sclerosis (ALS) is the most common adult-onset motor neuron disease and familial forms can be caused by numerous dominant mutations of the copper-zinc superoxide dismutase 1 (SOD1) gene. Substantial efforts have been invested in studying SOD1-ALS transgenic animal models; yet, the molecular mechanisms by which ALS-mutant SOD1 protein acquires toxicity are not well understood. ALS-like phenotypes in animal models are highly dependent on transgene dosage. Thus, issues of whether the ALS-like phenotypes of these models stem from overexpression of mutant alleles or from aspects of the SOD1 mutation itself are not easily deconvolved. To address concerns about levels of mutant SOD1 in disease pathogenesis, we have genetically engineered four human ALS-causing SOD1 point mutations (G37R, H48R, H71Y, and G85R) into the endogenous locus of Drosophila SOD1 (dsod) via ends-out homologous recombination and analyzed the resulting molecular, biochemical, and behavioral phenotypes. Contrary to previous transgenic models, we have recapitulated ALS-like phenotypes without overexpression of the mutant protein. Drosophila carrying homozygous mutations rendering SOD1 protein enzymatically inactive (G85R, H48R, and H71Y) exhibited neurodegeneration, locomotor deficits, and shortened life span. The mutation retaining enzymatic activity (G37R) was phenotypically indistinguishable from controls. While the observed mutant dsod phenotypes were recessive, a gain-of-function component was uncovered through dosage studies and comparisons with age-matched dsod null animals, which failed to show severe locomotor defects or nerve degeneration. We conclude that the Drosophila knock-in model captures important aspects of human SOD1-based ALS and provides a powerful and useful tool for further genetic studies. Copyright © 2017 by the Genetics Society of America.

  1. Acquisition of pro-oxidant activity of fALS-linked SOD1 mutants as revealed using circular dichroism and UV-resonance Raman spectroscopy

    NASA Astrophysics Data System (ADS)

    Fujimaki, Nobuhiro; Nishiya, Ken; Miura, Takashi; Nakabayashi, Takakazu

    2016-11-01

    The acquisition of pro-oxidant activity of the mutated form of human Cu, Zn-superoxide dismutase (SOD1) has been investigated to clarify the relationship between mutations in SOD1 and the pathogenesis of amyotrophic lateral sclerosis (ALS). Ala4 → Val (A4V) and Gly93 → Ala (G93A) mutants, which are representative ALS-linked SOD1 mutants, have been found to exhibit both the denaturation and the gain of pro-oxidant activity after incubation in the apo-form at a physiological condition of 37 °C and pH 7.4 and the rebinding of Cu2+. These characteristics are similar to those previously reported for the His43 → Arg (H43R) mutant. UV-resonance Raman spectra indicated that the coordination structure of the Cu-binding site catalyzing the oxidation reaction is the same among the denatured A4V, G93A, and H43R. Since wild-type SOD1 does not exhibit the denaturation in its apo-form at 37 °C and pH 7.4, the instability of the protein structure due to mutation can be considered as a significant factor that induces the denaturation and the subsequent pro-oxidant activity.

  2. Galactooligosaccharide improves the animal survival and alleviates motor neuron death in SOD1G93A mouse model of amyotrophic lateral sclerosis.

    PubMed

    Song, L; Gao, Y; Zhang, X; Le, W

    2013-08-29

    Amyotrophic lateral sclerosis (ALS) is a progressive and devastating neurodegenerative disease caused by selective degeneration and death of motor neurons. So far very limited therapeutic options have emerged to treat this fatal disease. Homocysteine (Hcy) lowering drugs have been suggested to be a palliative therapy of this disease. Folate, Vitamin B12 (VitB12) and Vitamin B6 (VitB6) are important elements involved in the Hcy metabolism and we proposed that medications which could promote the absorption of folate, VitB12 and VitB6 might have benefit for ALS. Galactooligosaccharides (GOS) is a prebiotic which could significantly improve the absorption and syntheses of B Vitamins. To investigate whether GOS could provide neuroprotective effect in ALS, we applied GOS and GOS-rich prebiotic yogurt in SOD1(G93A) mice and assessed their effects on the disease progression of ALS. Our results showed that GOS and prebiotics yogurt administration significantly delayed the disease onset and prolonged the lifespan in SOD1(G93A) mice. Also, these products increased the concentration of folate, VitB12 and reduced the level of Hcy. Moreover, we found that both GOS and prebiotics yogurt attenuated motor neurons loss, improved the atrophy and mitochondrial activity in myocyte. Furthermore, we demonstrated that GOS and GOS-rich prebiotic treatment suppressed the activation of astrocytes and microglia and regulated several inflammatory- and apoptosis-related factors. Our findings suggested that GOS might have therapeutic potential for ALS, and GOS-rich prebiotic yogurt might be considered as a nutritional therapy for this disease. Copyright © 2013 IBRO. All rights reserved.

  3. Mutant SOD1-expressing astrocytes release toxic factors that trigger motoneuron death by inducing hyperexcitability

    PubMed Central

    Fritz, Elsa; Izaurieta, Pamela; Weiss, Alexandra; Mir, Franco R.; Rojas, Patricio; Gonzalez, David; Rojas, Fabiola; Brown, Robert H.; Madrid, Rodolfo

    2013-01-01

    Amyotrophic lateral sclerosis (ALS) is a devastating paralytic disorder caused by dysfunction and degeneration of motoneurons starting in adulthood. Recent studies using cell or animal models document that astrocytes expressing disease-causing mutations of human superoxide dismutase 1 (hSOD1) contribute to the pathogenesis of ALS by releasing a neurotoxic factor(s). Neither the mechanism by which this neurotoxic factor induces motoneuron death nor its cellular site of action has been elucidated. Here we show that acute exposure of primary wild-type spinal cord cultures to conditioned medium derived from astrocytes expressing mutant SOD1 (ACM-hSOD1G93A) increases persistent sodium inward currents (PCNa), repetitive firing, and intracellular calcium transients, leading to specific motoneuron death days later. In contrast to TTX, which paradoxically increased twofold the amplitude of calcium transients and killed motoneurons, reduction of hyperexcitability by other specific (mexiletine) and nonspecific (spermidine and riluzole) blockers of voltage-sensitive sodium (Nav) channels restored basal calcium transients and prevented motoneuron death induced by ACM-hSOD1G93A. These findings suggest that riluzole, the only FDA-approved drug with known benefits for ALS patients, acts by inhibiting hyperexcitability. Together, our data document that a critical element mediating the non-cell-autonomous toxicity of ACM-hSOD1G93A on motoneurons is increased excitability, an observation with direct implications for therapy of ALS. PMID:23486205

  4. Observation of c.260A > G mutation in superoxide dismutase 1 that causes p.Asn86Ser in Iranian amyotrophic lateral sclerosis patient and absence of genotype/phenotype correlation.

    PubMed

    Khani, Marzieh; Alavi, Afagh; Nafissi, Shahriar; Elahi, Elahe

    2015-07-06

    Amyotrophic lateral sclerosis (ALS) is the most common motor neuron disorder in European populations. ALS can be sporadic ALS (SALS) or familial ALS (FALS). Among 20 known ALS genes, mutations in C9orf72 and superoxide dismutase 1 (SOD1) are the most common genetic causes of the disease. Whereas C9orf72 mutations are more common in Western populations, the contribution of SOD1 to ALS in Iran is more than C9orf72. At present, a clear genotype/phenotype correlation for ALS has not been identified. We aimed to perform mutation screening of SOD1 in a newly identified Iranian FALS patient and to assess whether a genotype/phenotype correlation for the identified mutation exists. The five exons of SOD1 and flanking intronic sequences of a FALS proband were screened for mutations by direct sequencing. The clinical features of the proband were assessed by a neuromuscular specialist (SN). The phenotypic presentations were compared to previously reported patients with the same mutation. Heterozygous c.260A > G mutation in SOD1 that causes Asn86Ser was identified in the proband. Age at onset was 34 years and site of the first presentation was in the lower extremities. Comparisons of clinical features of different ALS patients with the same mutation evidenced variable presentations. The c.260A > G mutation in SOD1 that causes Asn86Ser appears to cause ALS with variable clinical presentations.

  5. FUS and TARDBP but Not SOD1 Interact in Genetic Models of Amyotrophic Lateral Sclerosis

    PubMed Central

    Kabashi, Edor; Bercier, Valérie; Lissouba, Alexandra; Liao, Meijiang; Brustein, Edna; Rouleau, Guy A.; Drapeau, Pierre

    2011-01-01

    Mutations in the SOD1 and TARDBP genes have been commonly identified in Amyotrophic Lateral Sclerosis (ALS). Recently, mutations in the Fused in sarcoma gene (FUS) were identified in familial (FALS) ALS cases and sporadic (SALS) patients. Similarly to TDP-43 (coded by TARDBP gene), FUS is an RNA binding protein. Using the zebrafish (Danio rerio), we examined the consequences of expressing human wild-type (WT) FUS and three ALS–related mutations, as well as their interactions with TARDBP and SOD1. Knockdown of zebrafish Fus yielded a motor phenotype that could be rescued upon co-expression of wild-type human FUS. In contrast, the two most frequent ALS–related FUS mutations, R521H and R521C, unlike S57Δ, failed to rescue the knockdown phenotype, indicating loss of function. The R521H mutation caused a toxic gain of function when expressed alone, similar to the phenotype observed upon knockdown of zebrafish Fus. This phenotype was not aggravated by co-expression of both mutant human TARDBP (G348C) and FUS (R521H) or by knockdown of both zebrafish Tardbp and Fus, consistent with a common pathogenic mechanism. We also observed that WT FUS rescued the Tardbp knockdown phenotype, but not vice versa, suggesting that TARDBP acts upstream of FUS in this pathway. In addition we observed that WT SOD1 failed to rescue the phenotype observed upon overexpression of mutant TARDBP or FUS or upon knockdown of Tardbp or Fus; similarly, WT TARDBP or FUS also failed to rescue the phenotype induced by mutant SOD1 (G93A). Finally, overexpression of mutant SOD1 exacerbated the motor phenotype caused by overexpression of mutant FUS. Together our results indicate that TARDBP and FUS act in a pathogenic pathway that is independent of SOD1. PMID:21829392

  6. FUS and TARDBP but not SOD1 interact in genetic models of amyotrophic lateral sclerosis.

    PubMed

    Kabashi, Edor; Bercier, Valérie; Lissouba, Alexandra; Liao, Meijiang; Brustein, Edna; Rouleau, Guy A; Drapeau, Pierre

    2011-08-01

    Mutations in the SOD1 and TARDBP genes have been commonly identified in Amyotrophic Lateral Sclerosis (ALS). Recently, mutations in the Fused in sarcoma gene (FUS) were identified in familial (FALS) ALS cases and sporadic (SALS) patients. Similarly to TDP-43 (coded by TARDBP gene), FUS is an RNA binding protein. Using the zebrafish (Danio rerio), we examined the consequences of expressing human wild-type (WT) FUS and three ALS-related mutations, as well as their interactions with TARDBP and SOD1. Knockdown of zebrafish Fus yielded a motor phenotype that could be rescued upon co-expression of wild-type human FUS. In contrast, the two most frequent ALS-related FUS mutations, R521H and R521C, unlike S57Δ, failed to rescue the knockdown phenotype, indicating loss of function. The R521H mutation caused a toxic gain of function when expressed alone, similar to the phenotype observed upon knockdown of zebrafish Fus. This phenotype was not aggravated by co-expression of both mutant human TARDBP (G348C) and FUS (R521H) or by knockdown of both zebrafish Tardbp and Fus, consistent with a common pathogenic mechanism. We also observed that WT FUS rescued the Tardbp knockdown phenotype, but not vice versa, suggesting that TARDBP acts upstream of FUS in this pathway. In addition we observed that WT SOD1 failed to rescue the phenotype observed upon overexpression of mutant TARDBP or FUS or upon knockdown of Tardbp or Fus; similarly, WT TARDBP or FUS also failed to rescue the phenotype induced by mutant SOD1 (G93A). Finally, overexpression of mutant SOD1 exacerbated the motor phenotype caused by overexpression of mutant FUS. Together our results indicate that TARDBP and FUS act in a pathogenic pathway that is independent of SOD1.

  7. Astrocytes expressing mutant SOD1 and TDP43 trigger motoneuron death that is mediated via sodium channels and nitroxidative stress

    PubMed Central

    Rojas, Fabiola; Cortes, Nicole; Abarzua, Sebastian; Dyrda, Agnieszka; van Zundert, Brigitte

    2013-01-01

    Amyotrophic lateral sclerosis (ALS) is a fatal paralytic disorder caused by dysfunction and degeneration of motor neurons. Multiple disease-causing mutations, including in the genes for SOD1 and TDP-43, have been identified in ALS. Astrocytes expressing mutant SOD1 are strongly implicated in the pathogenesis of ALS: we have shown that media conditioned by astrocytes carrying mutant SOD1G93A contains toxic factor(s) that kill motoneurons by activating voltage-sensitive sodium (Nav) channels. In contrast, a recent study suggests that astrocytes expressing mutated TDP43 contribute to ALS pathology, but do so via cell-autonomous processes and lack non-cell-autonomous toxicity. Here we investigate whether astrocytes that express diverse ALS-causing mutations release toxic factor(s) that induce motoneuron death, and if so, whether they do so via a common pathogenic pathway. We exposed primary cultures of wild-type spinal cord cells to conditioned medium derived from astrocytes (ACM) that express SOD1 (ACM-SOD1G93A and ACM-SOD1G86R) or TDP43 (ACM-TDP43A315T) mutants; we show that such exposure rapidly (within 30–60 min) increases dichlorofluorescein (DCF) fluorescence (indicative of nitroxidative stress) and leads to extensive motoneuron-specific death within a few days. Co-application of the diverse ACMs with anti-oxidants Trolox or esculetin (but not with resveratrol) strongly improves motoneuron survival. We also find that co-incubation of the cultures in the ACMs with Nav channel blockers (including mexiletine, spermidine, or riluzole) prevents both intracellular nitroxidative stress and motoneuron death. Together, our data document that two completely unrelated ALS models lead to the death of motoneuron via non-cell-autonomous processes, and show that astrocytes expressing mutations in SOD1 and TDP43 trigger such cell death through a common pathogenic pathway that involves nitroxidative stress, induced at least in part by Nav channel activity. PMID:24570655

  8. Combined fulminant frontotemporal dementia and amyotrophic lateral sclerosis associated with an I113T SOD1 mutation.

    PubMed

    Katz, Jonathan S; Katzberg, Hans D; Woolley, Susan C; Marklund, Stefan L; Andersen, Peter M

    2012-10-01

    Mutations in the gene for superoxide dismutase type 1 cause amyotrophic lateral sclerosis (ALS), but are not thought to be associated with frontotemporal dementia (FTD). A lack of detailed case reports is one reason, among others, for this skepticism. This case report comments on a patient with familial ALS caused by I113T mutation in the SOD1 gene presenting with progressive cognitive and behavioral decline two years before developing progressive motor degeneration. In conclusion, this case provides evidence that SOD1 mutations can be associated with FTD.

  9. Bee venom effects on ubiquitin proteasome system in hSOD1(G85R)-expressing NSC34 motor neuron cells.

    PubMed

    Kim, Seon Hwy; Jung, So Young; Lee, Kang-Woo; Lee, Sun Hwa; Cai, MuDan; Choi, Sun-Mi; Yang, Eun Jin

    2013-07-18

    Amyotrophic lateral sclerosis (ALS) is a neurodegenerative disease that results from a progressive loss of motor neurons. Familial ALS (fALS) is caused by missense mutations in Cu, Zn-superoxide dismutase 1 (SOD1) that frequently result in the accumulation of mutant protein aggregates that are associated with impairments in the ubiquitin-proteasome system (UPS). UPS impairment has been implicated in many neurological disorders. Bee venom (BV) extracted from honey bees has been used as a traditional medicine for treating inflammatory diseases and has been shown to attenuate the neuroinflammatory events that occur in a symptomatic ALS animal model. NSC34 cells were transiently transfected with a WT or G85R hSOD1-GFP construct for 24 hrs and then stimulated with 2.5 μg/ml BV for 24 hrs. To determine whether a SOD1 mutation affects UPS function in NSC34 cells, we examined proteasome activity and performed western blotting and immunofluorescence using specific antibodies, such as anti-misfolded SOD1, anti-ubiquitin, anti-GRP78, anti-LC3, and anti-ISG15 antibodies. We found that GFP-hSOD1G85R overexpression induced SOD1 inclusions and reduced proteasome activity compared with the overexpression of GFP alone in NSC34 motor neuronal cells. In addition, we also observed that BV treatment restored proteasome activity and reduced the accumulation of ubiquitinated and misfolded SOD1 in GFP-hSOD1G85R-overexpressing NSC34 motor neuronal cells. However, BV treatment did not activate the autophagic pathway in these cells. Our findings suggest that BV may rescue the impairment of the UPS in ALS models.

  10. Copper Homeostasis as a Therapeutic Target in Amyotrophic Lateral Sclerosis with SOD1 Mutations

    PubMed Central

    Tokuda, Eiichi; Furukawa, Yoshiaki

    2016-01-01

    Amyotrophic lateral sclerosis (ALS) is a lethal neurodegenerative disease affecting both upper and lower motor neurons, and currently, there is no cure or effective treatment. Mutations in a gene encoding a ubiquitous antioxidant enzyme, Cu,Zn-superoxide dismutase (SOD1), have been first identified as a cause of familial forms of ALS. It is widely accepted that mutant SOD1 proteins cause the disease through a gain in toxicity but not through a loss of its physiological function. SOD1 is a major copper-binding protein and regulates copper homeostasis in the cell; therefore, a toxicity of mutant SOD1 could arise from the disruption of copper homeostasis. In this review, we will briefly review recent studies implying roles of copper homeostasis in the pathogenesis of SOD1-ALS and highlight the therapeutic interventions focusing on pharmacological as well as genetic regulations of copper homeostasis to modify the pathological process in SOD1-ALS. PMID:27136532

  11. Copper Homeostasis as a Therapeutic Target in Amyotrophic Lateral Sclerosis with SOD1 Mutations.

    PubMed

    Tokuda, Eiichi; Furukawa, Yoshiaki

    2016-04-28

    Amyotrophic lateral sclerosis (ALS) is a lethal neurodegenerative disease affecting both upper and lower motor neurons, and currently, there is no cure or effective treatment. Mutations in a gene encoding a ubiquitous antioxidant enzyme, Cu,Zn-superoxide dismutase (SOD1), have been first identified as a cause of familial forms of ALS. It is widely accepted that mutant SOD1 proteins cause the disease through a gain in toxicity but not through a loss of its physiological function. SOD1 is a major copper-binding protein and regulates copper homeostasis in the cell; therefore, a toxicity of mutant SOD1 could arise from the disruption of copper homeostasis. In this review, we will briefly review recent studies implying roles of copper homeostasis in the pathogenesis of SOD1-ALS and highlight the therapeutic interventions focusing on pharmacological as well as genetic regulations of copper homeostasis to modify the pathological process in SOD1-ALS.

  12. In vivo EPR pharmacokinetic evaluation of the redox status and the blood brain barrier permeability in the SOD1G93A ALS rat model.

    PubMed

    Stamenković, Stefan; Pavićević, Aleksandra; Mojović, Miloš; Popović-Bijelić, Ana; Selaković, Vesna; Andjus, Pavle; Bačić, Goran

    2017-07-01

    Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disorder affecting the motor pathways of the central nervous system. Although a number of pathophysiological mechanisms have been described in the disease, post mortem and animal model studies indicate blood-brain barrier (BBB) disruption and elevated production of reactive oxygen species as major contributors to disease pathology. In this study, the BBB permeability and the brain tissue redox status of the SOD1 G93A ALS rat model in the presymptomatic (preALS) and symptomatic (ALS) stages of the disease were investigated by in vivo EPR spectroscopy using three aminoxyl radicals with different cell membrane and BBB permeabilities, Tempol, 3-carbamoyl proxyl (3CP), and 3-carboxy proxyl (3CxP). Additionally, the redox status of the two brain regions previously implicated in disease pathology, brainstem and hippocampus, was investigated by spectrophotometric biochemical assays. The EPR results indicated that among the three spin probes, 3CP is the most suitable for reporting the intracellular redox status changes, as Tempol was reduced in vivo within minutes (t 1/2 =2.0±0.5min), thus preventing reliable kinetic modeling, whereas 3CxP reduction kinetics gave divergent conclusions, most probably due to its membrane impermeability. It was observed that the reduction kinetics of 3CP in vivo, in the head of preALS and ALS SOD1 G93A rats was altered compared to the controls. Pharmacokinetic modeling of 3CP reduction in vivo, revealed elevated tissue distribution and tissue reduction rate constants indicating an altered brain tissue redox status, and possibly BBB disruption in these animals. The preALS and ALS brain tissue homogenates also showed increased nitrilation, superoxide production, lipid peroxidation and manganese superoxide dismutase activity, and a decreased copper-zinc superoxide dismutase activity. The present study highlights in vivo EPR spectroscopy as a reliable tool for the investigation of

  13. Degenerative myelopathy in the Collie breed: a retrospective immunohistochemical analysis of superoxide dismutase 1 in an affected Rough Collie, and a molecular epidemiological survey of the SOD1: c.118G>A mutation in Japan

    PubMed Central

    KOHYAMA, Moeko; KITAGAWA, Masato; KAMISHINA, Hiroaki; KOBATAKE, Yui; YABUKI, Akira; SAWA, Mariko; KAKITA, Shusaku; YAMATO, Osamu

    2016-01-01

    Canine degenerative myelopathy (DM) is an adult-onset, progressive neurodegenerative disease that occurs in multiple dog breeds. A DM-associated mutation of the canine superoxide dismutase 1 (SOD1) gene, designated as c.118G>A (p.E40K), has been implicated as one of pathogenetic determinants of the disease in many breeds, but it remains to be determined whether the c.118G>A mutation is responsible for development or progression of DM in Collies. Previously, a Rough Collie was diagnosed clinically and histopathologically as having DM in Japan, suggesting the possibility that the Collie breed may be predisposed to DM due to the high frequency of c.118G>A in Japan. In this study, accumulation and aggregate formation of SOD1 protein were retrospectively demonstrated in the spinal cord of the DM-affected dog by immunohistochemical analysis. Furthermore, a molecular epidemiological survey revealed a high carrier rate (27.6%) and mutant allele frequency (0.138) of c.118G>A in a population of Collies in Japan, suggesting that the Collie breed may be predisposed to DM associated with c.118G>A, and the prevention of DM in Collies in Japan should be addressed through epidemiological and genetic testing strategies. PMID:27941298

  14. Intramuscular transplantation of bone marrow cells prolongs the lifespan of SOD1G93A mice and modulates expression of prognosis biomarkers of the disease.

    PubMed

    Rando, Amaya; Pastor, Diego; Viso-León, Mari Carmen; Martínez, Anna; Manzano, Raquel; Navarro, Xavier; Osta, Rosario; Martínez, Salvador

    2018-04-06

    Amyotrophic lateral sclerosis (ALS) is a neurodegenerative disorder characterized by progressive muscle weakness, paralysis and death. There is no effective treatment for ALS and stem cell therapy has arisen as a potential therapeutic approach. SOD1 mutant mice were used to study the potential neurotrophic effect of bone marrow cells grafted into quadriceps femoris muscle. Bone marrow intramuscular transplants resulted in increased longevity with improved motor function and decreased motoneuron degeneration in the spinal cord. Moreover, the increment of the glial-derived neurotrophic factor and neurotrophin 4 observed in the grafted muscles suggests that this partial neuroprotective effect is mediated by neurotrophic factor release at the neuromuscular junction level. Finally, certain neurodegeneration and muscle disease-specific markers, which are altered in the SOD1 G93A mutant mouse and may serve as molecular biomarkers for the early detection of ALS in patients, have been studied with encouraging results. This work demonstrates that stem cell transplantation in the muscle prolonged the lifespan, increased motoneuron survival and slowed disease progression, which was also assessed by genetic expression analysis.

  15. The Overexpression of TDP-43 Protein in the Neuron and Oligodendrocyte Cells Causes the Progressive Motor Neuron Degeneration in the SOD1 G93A Transgenic Mouse Model of Amyotrophic Lateral Sclerosis.

    PubMed

    Lu, Yi; Tang, Chunyan; Zhu, Lei; Li, Jiao; Liang, Huiting; Zhang, Jie; Xu, Renshi

    2016-01-01

    The recent investigation suggested that the TDP-43 protein was closely related to the motor neuron degeneration in amyotrophic lateral sclerosis (ALS), but the pathogenesis contributed to motor neuron degeneration largely remained unknown. Therefore, we detected the alteration of TDP-43 expression and distribution in the adult spinal cord of the SOD1 G93A transgenic mouse model for searching the possible pathogenesis of ALS. We examined the TDP-43 expression and distribution in the different anatomic regions, segments and neural cells in the adult spinal cord at the different stages of the SOD1 wild-type and G93A transgenic model by the fluorescent immunohistochemical technology. We revealed that the amount of TDP-43 positive cell was cervical>lumbar>thoracic segment, that in the ventral horn was more than that in the dorsal horn, a few of TDP-43 protein sparsely expressed and distributed in the other regions, the TDP-43 protein weren't detected in the white matter and the central canal. The TDP-43 protein was mostly expressed and distributed in the nuclear of neuron cells and the cytoplasm of oligodendrocyte cells of the gray matter surrounding the central canal of spinal cord by the granular shape in the SOD1 wild-type and G93A transgenic mice. The amount of TDP-43 positive cell significantly increased at the onset and progression stages of ALS following with the increase of neuron death in spinal cord, particularly in the ventral horn of cervical segment at the progression stage. Our results suggested that the overexpression of TDP-43 protein in the neuron and oligodendrocyte cell causes the progressive motor neuron degeneration in the ALS-like mouse model.

  16. A Phase I, Randomised, First-in-Human Study of an Antisense Oligonucleotide Directed Against SOD1 Delivered Intrathecally in SOD1-Familial ALS Patients

    PubMed Central

    Miller, Timothy; Pestronk, Alan; David, William; Rothstein, Jeffrey; Simpson, Ericka; Appel, Stanley H.; Andres, Patricia L.; Mahoney, Katy; Allred, Peggy; Alexander, Katie; Ostrow, Lyle W.; Schoenfeld, David; Macklin, Eric A.; Norris, Daniel A.; Manousakis, Georgios; Crisp, Matthew; Smith, Richard; Bennett, C.F.; Bishop, Kathie; Cudkowicz, Merit E

    2013-01-01

    Objective To evaluate the safety, tolerability, and pharmacokinetics of an antisense oligonucleotide designed to inhibit SOD1 expression (ISIS 333611) following intrathecal administration in patients with SOD1-related familial amyotrophic lateral sclerosis (ALS). Background Mutations in SOD1 cause 13% of familial ALS. In animal studies, ISIS 333611 delivered to the cerebrospinal fluid (CSF) distributed to the brain and spinal cord, decreased SOD1 mRNA and protein levels in spinal cord tissue, and prolonged survival in the SOD1G93A rat ALS model. Methods In a randomized, placebo controlled Phase 1 trial, ISIS 333611 was delivered by intrathecal infusion using an external pump over 11.5 hours at increasing doses to four cohorts of eight SOD1 positive ALS subjects (randomized 6 drug: 2 placebo/cohort). Subjects were allowed to re-enroll in subsequent cohorts. Safety and tolerability assessments were made during the infusion and periodically over 28 days following the infusion. CSF and plasma drug levels were measured. Findings No dose-limiting toxicities were identified at doses up to 3.0 mg. No safety or tolerability concerns related to ISIS 333611 were identified. There were no serious adverse events (AEs) in ISIS 333611-treated subjects. Re-enrollment and re-dosing of subjects with ISIS 333611 was also well tolerated. Dose-dependent CSF and plasma concentrations were observed. Interpretation In this first clinical study to report intrathecal delivery of an antisense oligonucleotide, ISIS 333611 was well tolerated when administered as an intrathecal infusion in subjects with SOD1 familial ALS. CSF and plasma drug levels were consistent with levels predicted from preclinical studies. These results suggest that antisense oligonucleotide delivery to the central nervous system may be a feasible therapeutic strategy for neurological disorders. Source of funding ALS Association, Muscular Dystrophy Association, Isis Pharmaceuticals PMID:23541756

  17. Fisetin Exerts Antioxidant and Neuroprotective Effects in Multiple Mutant hSOD1 Models of Amyotrophic Lateral Sclerosis by Activating ERK.

    PubMed

    Wang, T H; Wang, S Y; Wang, X D; Jiang, H Q; Yang, Y Q; Wang, Y; Cheng, J L; Zhang, C T; Liang, W W; Feng, H L

    2018-05-21

    Oxidative stress exhibits a central role in the course of amyotrophic lateral sclerosis (ALS), a progressive neurodegenerative disease commonly found to include a copper/zinc superoxide dismutase (SOD1) gene mutation. Fisetin, a natural antioxidant, has shown benefits in varied neurodegenerative diseases. The possible effect of fisetin in ALS has not been clarified as of yet. We investigated whether fisetin affected mutant hSOD1 ALS models. Three different hSOD1-related mutant models were used: Drosophila expressing mutant hSOD1 G85R , hSOD1 G93A NSC34 cells, and transgenic mice. Fisetin treatment provided neuroprotection as demonstrated by an improved survival rate, attenuated motor impairment, reduced ROS damage and regulated redox homeostasis compared with those in controls. Furthermore, fisetin increased the expression of phosphorylated ERK and upregulated antioxidant factors, which were reversed by MEK/ERK inhibition. Finally, fisetin reduced the levels of both mutant and wild-type hSOD1 in vivo and in vitro, as well as the levels of detergent-insoluble hSOD1 proteins. The results indicate that fisetin protects cells from ROS damage and improves the pathological behaviors caused by oxidative stress in disease models related to SOD1 gene mutations probably by activating ERK, thereby providing a potential treatment for ALS. Copyright © 2018 IBRO. Published by Elsevier Ltd. All rights reserved.

  18. Resveratrol Ameliorates Motor Neuron Degeneration and Improves Survival in SOD1G93A Mouse Model of Amyotrophic Lateral Sclerosis

    PubMed Central

    Song, Lin; Zhang, Xiaojie; Li, Jia; Le, Weidong

    2014-01-01

    Resveratrol has recently been used as a supplemental treatment for several neurological and nonneurological diseases. It is not known whether resveratrol has neuroprotective effect on amyotrophic lateral sclerosis (ALS). To assess the effect of resveratrol on the disease, we tested this agent on an ALS model of SOD1G93A transgenic mouse. Rotarod measurement was performed to measure the motor function of the ALS mice. Nissl staining and SMI-32 immunofluorescent staining were used to determine motor neurons survival in the spinal cord of the ALS mice. Hematoxylin-eosin (H&E), succinic dehydrogenase (SDH), and cytochrome oxidase (COX) staining were applied to pathologically analyze the skeletal muscles of the ALS mice. We found that resveratrol treatment significantly delayed the disease onset and prolonged the lifespan of the ALS mice. Furthermore, resveratrol treatment attenuated motor neuron loss, relieved muscle atrophy, and improved mitochondrial function of muscle fibers in the ALS mice. In addition, we demonstrated that resveratrol exerted these neuroprotective effects mainly through increasing the expression of Sirt1, consequently suppressing oxidative stress and downregulating p53 and its related apoptotic pathway. Collectively, our findings suggest that resveratrol might provide a promising therapeutic intervention for ALS. PMID:25057490

  19. Role of disulfide cross-linking of mutant SOD1 in the formation of inclusion-body-like structures.

    PubMed

    Roberts, Brittany L T; Patel, Kinaree; Brown, Hilda H; Borchelt, David R

    2012-01-01

    Pathologic aggregates of superoxide dismutase 1 (SOD1) harboring mutations linked to familial amyotrophic lateral sclerosis (fALS) have been shown to contain aberrant intermolecular disulfide cross-links. In prior studies, we observed that intermolecular bonding was not necessary in the formation of detergent- insoluble SOD1 complexes by mutant SOD1, but we were unable to assess whether this type of bonding may be important for pathologic inclusion formation. In the present study, we visually assess the formation of large inclusions by fusing mutant SOD1 to yellow fluorescent protein (YFP). Experimental constructs possessing mutations at all cysteine residues in SOD1 (sites 6, 57, 111, and 146 to F,S,Y,R or G,S,Y,R, respectively) were shown to maintain a high propensity of inclusion formation despite the inability to form disulfide cross-links. Interestingly, although aggregates form when all cysteines were mutated, double mutants of the ALS mutation C6G with an experimental mutation C111S exhibited low aggregation propensity. Overall, this study is an extension of previous work demonstrating that cysteine residues in mutant SOD1 play a role in modulating aggregation and that intermolecular disulfide bonds are not required to produce large intracellular inclusion-like structures.

  20. Biological effects of CCS in the absence of SOD1 enzyme activation: implications for disease in a mouse model for ALS.

    PubMed

    Proescher, Jody B; Son, Marjatta; Elliott, Jeffrey L; Culotta, Valeria C

    2008-06-15

    The CCS copper chaperone is critical for maturation of Cu, Zn-superoxide dismutase (SOD1) through insertion of the copper co-factor and oxidization of an intra-subunit disulfide. The disulfide helps stabilize the SOD1 polypeptide, which can be particularly important in cases of amyotrophic lateral sclerosis (ALS) linked to misfolding of mutant SOD1. Surprisingly, however, over-expressed CCS was recently shown to greatly accelerate disease in a G93A SOD1 mouse model for ALS. Herein we show that disease in these G93A/CCS mice correlates with incomplete oxidation of the SOD1 disulfide. In the brain and spinal cord, CCS over-expression failed to enhance oxidation of the G93A SOD1 disulfide and if anything, effected some accumulation of disulfide-reduced SOD1. This effect was mirrored in culture with a C244,246S mutant of CCS that has the capacity to interact with SOD1 but can neither insert copper nor oxidize the disulfide. In spite of disulfide effects, there was no evidence for increased SOD1 aggregation. If anything, CCS over-expression prevented SOD1 misfolding in culture as monitored by detergent insolubility. This protection against SOD1 misfolding does not require SOD1 enzyme activation as the same effect was obtained with the C244,246S allele of CCS. In the G93A SOD1 mouse, CCS over-expression was likewise associated with a lack of obvious SOD1 misfolding marked by detergent insolubility. CCS over-expression accelerates SOD1-linked disease without the hallmarks of misfolding and aggregation seen in other mutant SOD1 models. These studies are the first to indicate biological effects of CCS in the absence of SOD1 enzymatic activation.

  1. Acute Traumatic Brain Injury Does Not Exacerbate Amyotrophic Lateral Sclerosis in the SOD1G93A Rat Model1,2,3

    PubMed Central

    Thomsen, Gretchen M.

    2015-01-01

    Abstract Amyotrophic lateral sclerosis (ALS) is a fatal motor neuron disease in which upper and lower motor neurons degenerate, leading to muscle atrophy, paralysis, and death within 3 to 5 years of onset. While a small percentage of ALS cases are genetically linked, the majority are sporadic with unknown origin. Currently, etiological links are associated with disease onset without mechanistic understanding. Of all the putative risk factors, however, head trauma has emerged as a consistent candidate for initiating the molecular cascades of ALS. Here, we test the hypothesis that traumatic brain injury (TBI) in the SOD1 G93A transgenic rat model of ALS leads to early disease onset and shortened lifespan. We demonstrate, however, that a one-time acute focal injury caused by controlled cortical impact does not affect disease onset or survival. Establishing the negligible involvement of a single acute focal brain injury in an ALS rat model increases the current understanding of the disease. Critically, untangling a single focal TBI from multiple mild injuries provides a rationale for scientists and physicians to increase focus on repeat injuries to hopefully pinpoint a contributing cause of ALS. PMID:26464984

  2. Neuronal glucose metabolism is impaired while astrocytic TCA cycling is unaffected at symptomatic stages in the hSOD1G93A mouse model of amyotrophic lateral sclerosis.

    PubMed

    Tefera, Tesfaye W; Borges, Karin

    2018-01-01

    Although alterations in energy metabolism are known in ALS, the specific mechanisms leading to energy deficit are not understood. We measured metabolite levels derived from injected [1- 13 C]glucose and [1,2- 13 C]acetate (i.p.) in cerebral cortex and spinal cord extracts of wild type and hSOD1 G93A mice at onset and mid disease stages using high-pressure liquid chromatography, 1 H and 13 C nuclear magnetic resonance spectroscopy. Levels of spinal and cortical CNS total lactate, [3- 13 C]lactate, total alanine and [3- 13 C]alanine, but not cortical glucose and [1- 13 C]glucose, were reduced mostly at mid stage indicating impaired glycolysis. The [1- 13 C]glucose-derived [4- 13 C]glutamate, [4- 13 C]glutamine and [2- 13 C]GABA amounts were diminished at mid stage in cortex and both time points in spinal cord, suggesting decreased [3- 13 C]pyruvate entry into the TCA cycle. Lack of changes in [1,2- 13 C]acetate-derived [4,5- 13 C]glutamate, [4,5- 13 C]glutamine and [1,2- 13 C]GABA levels indicate unchanged astrocytic 13 C-acetate metabolism. Reduced levels of leucine, isoleucine and valine in CNS suggest compensatory breakdown to refill TCA cycle intermediate levels. Unlabelled, [2- 13 C] and [4- 13 C]GABA concentrations were decreased in spinal cord indicating that impaired glucose metabolism contributes to hyperexcitability and supporting the use of treatments which increase GABA amounts. In conclusion, CNS glucose metabolism is compromised, while astrocytic TCA cycling appears to be normal in the hSOD1 G93A mouse model at symptomatic disease stages.

  3. Reduction in hSOD1 copy number significantly impacts ALS phenotype presentation in G37R (line 29) mice: implications for the assessment of putative therapeutic agents.

    PubMed

    Zwiegers, Pierre; Lee, Grace; Shaw, Christopher A

    2014-08-08

    In vivo animal models of familial amyotrophic lateral sclerosis (fALS) are widely used to delineate the potential role that genetic mutations play in the neurodegenerative process. While these models are extensively used for establishing the safety and efficacy of putative therapeutics during pre-clinical development, effective clinical translation of pharmacological interventions has been largely unsuccessful. In this report we compare a recent cohort of G37R (line 29) mice generated from mating wild-type females with transgenic males obtained commercially to a previous set of offspring produced with transgenic male breeders from a colony established at a local collaborator's facility. Commercially derived progeny presented with a tightly clustered genomic signature for the mutant human superoxide dismutase1 transgene (hSOD1) locus, and exhibited a greater than two-fold reduction in the number of transgene copies present in the genome compared to offspring derived locally. Decrease in transgene levels corresponded with delayed ALS progression and a significant increase in overall lifespan (146%). These results highlight some key challenges inherent to the use of G37R (line 29) animals in pre-clinical studies for the development of ALS therapeutics. Without stringent assessment of mutant SOD1 copy number/protein levels, heterogeneity of transgene levels within cohorts may influence the behavioural and pathological presentation of disease and thus calls to question the validity of any detected therapeutic effects. Nuanced changes in mutant SOD1 copy number that currently remain unreported may undermine research endeavours, delay efforts for clinical translation, and compromise the rigor of animal studies by limiting reproducibility amongst research groups.

  4. Pyrimethamine significantly lowers cerebrospinal fluid Cu/Zn superoxide dismutase in amyotrophic lateral sclerosis patients with SOD1 mutations.

    PubMed

    Lange, Dale J; Shahbazi, Mona; Silani, Vincenzo; Ludolph, Albert C; Weishaupt, Jochen H; Ajroud-Driss, Senda; Fields, Kara G; Remanan, Rahul; Appel, Stanley H; Morelli, Claudia; Doretti, Alberto; Maderna, Luca; Messina, Stefano; Weiland, Ulrike; Marklund, Stefan L; Andersen, Peter M

    2017-06-01

    Cu/Zn superoxide dismutase (SOD1) reduction prolongs survival in SOD1-transgenic animal models. Pyrimethamine produces dose-dependent SOD1 reduction in cell culture systems. A previous phase 1 trial showed pyrimethamine lowers SOD1 levels in leukocytes in patients with SOD1 mutations. This study investigated whether pyrimethamine lowered SOD1 levels in the cerebrospinal fluid (CSF) in patients carrying SOD1 mutations linked to familial amyotrophic lateral sclerosis (fALS/SOD1). A multicenter (5 sites), open-label, 9-month-duration, dose-ranging study was undertaken to determine the safety and efficacy of pyrimethamine to lower SOD1 levels in the CSF in fALS/SOD1. All participants underwent 3 lumbar punctures, blood draw, clinical assessment of strength, motor function, quality of life, and adverse effect assessments. SOD1 levels were measured in erythrocytes and CSF. Pyrimethamine was measured in plasma and CSF. Appel ALS score, ALS Functional Rating Scale-Revised, and McGill Quality of Life Single-Item Scale were measured at screening, visit 6, and visit 9. We enrolled 32 patients; 24 completed 6 visits (18 weeks), and 21 completed all study visits. A linear mixed effects model showed a significant reduction in CSF SOD1 at visit 6 (p < 0.001) with a mean reduction of 13.5% (95% confidence interval [CI] = 8.4-18.5) and at visit 9 (p < 0.001) with a mean reduction of 10.5% (95% CI = 5.2-15.8). Pyrimethamine is safe and well tolerated in ALS. Pyrimethamine is capable of producing a significant reduction in total CSF SOD1 protein content in patients with ALS caused by different SOD1 mutations. Further long-term studies are warranted to assess clinical efficacy. Ann Neurol 2017;81:837-848. © 2017 The Authors. Annals of Neurology published by Wiley Periodicals, Inc. on behalf of American Neurological Association.

  5. The VPAC2 agonist peptide histidine isoleucine (PHI) up-regulates glutamate transport in the corpus callosum of a rat model of amyotrophic lateral sclerosis (hSOD1G93A) by inhibiting caspase-3 mediated inactivation of GLT-1a.

    PubMed

    Goursaud, Stéphanie; Focant, Marylène C; Berger, Julie V; Nizet, Yannick; Maloteaux, Jean-Marie; Hermans, Emmanuel

    2011-10-01

    Degeneration of corpus callosum appears in patients with amyotrophic lateral sclerosis (ALS) before clinical signs of upper motor neuron death. Considering the ALS-associated impairment of astrocytic glutamate uptake, we have characterized the expression and activity of the glutamate transporter isoforms GLT-1a and GLT-1b in the corpus callosum of transgenic rats expressing a mutated form of the human superoxide dismutase 1 (hSOD1(G93A)). We have also studied the effect of peptide histidine isoleucine (PHI), a vasoactive intestinal peptide (VIP)/pituitary adenylate cyclase-activating polypeptide (PACAP) receptor 2 (VPAC(2)) agonist on glutamate transporters both in vivo and in callosal astrocytes. Before the onset of motor symptoms, the expression of both transporter isoforms was correlated with a constitutive activity of caspase-3. This enzyme participates in the down-regulation of GLT-1 in ALS, and here we demonstrated its involvement in the selective degradation of GLT-1a in the white matter. A single stereotactic injection of PHI into the corpus callosum of symptomatic rats decreased caspase-3 activity and promoted GLT-1a expression and uptake activity. Together, with evidence for a reduced expression of prepro-VIP/PHI mRNA in the corpus callosum of transgenic animals, these data shed light on the modulatory role of the VIP/PHI system on the glutamatergic transmission in ALS.

  6. An Analysis of Interactions between Fluorescently-Tagged Mutant and Wild-Type SOD1 in Intracellular Inclusions

    PubMed Central

    Qualls, David A.; Crosby, Keith; Brown, Hilda; Borchelt, David R.

    2013-01-01

    Background By mechanisms yet to be discerned, the co-expression of high levels of wild-type human superoxide dismutase 1 (hSOD1) with variants of hSOD1 encoding mutations linked familial amyotrophic lateral sclerosis (fALS) hastens the onset of motor neuron degeneration in transgenic mice. Although it is known that spinal cords of paralyzed mice accumulate detergent insoluble forms of WT hSOD1 along with mutant hSOD1, it has been difficult to determine whether there is co-deposition of the proteins in inclusion structures. Methodology/Principal Findings In the present study, we use cell culture models of mutant SOD1 aggregation, focusing on the A4V, G37R, and G85R variants, to examine interactions between WT-hSOD1 and misfolded mutant SOD1. In these studies, we fuse WT and mutant proteins to either yellow or red fluorescent protein so that the two proteins can be distinguished within inclusions structures. Conclusions/Significance Although the interpretation of the data is not entirely straightforward because we have strong evidence that the nature of the fused fluorophores affects the organization of the inclusions that form, our data are most consistent with the idea that normal dimeric WT-hSOD1 does not readily interact with misfolded forms of mutant hSOD1. We also demonstrate the monomerization of WT-hSOD1 by experimental mutation does induce the protein to aggregate, although such monomerization may enable interactions with misfolded mutant SOD1. Our data suggest that WT-hSOD1 is not prone to become intimately associated with misfolded mutant hSOD1 within intracellular inclusions that can be generated in cultured cells. PMID:24391857

  7. Screening of SOD1, FUS and TARDBP genes in patients with amyotrophic lateral sclerosis in central-southern China.

    PubMed

    Hou, Lihua; Jiao, Bin; Xiao, Tingting; Zhou, Lu; Zhou, Zhifan; Du, Juan; Yan, Xinxiang; Wang, Junling; Tang, Beisha; Shen, Lu

    2016-09-08

    Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disease affecting motor neurons of the brain, brainstem and spinal cord. To date, mutations in more than 30 genes have been linked to the pathogenesis of ALS. Among them, SOD1, FUS and TARDBP are ranked as the three most common genes associated with ALS. However, no mutation analysis has been reported in central-southern China. In this study, we sequenced SOD1, FUS and TARDBP in a central-southern Chinese cohort of 173 patients with ALS (15 familial ALS and 158 sporadic ALS) to detect mutations. As a result, five missense mutations in SOD1, namely, p.D101N, p.D101G, p.C111Y, p.N86S and p.V87A, were identified in three unrelated familial probands and three sporadic cases; two mutations in FUS were found in two unrelated familial probands, including an insertion mutation (p.P525_Y526insY) and a missense mutation (p.R521H); no variants of TARDBP were observed in patients. Therefore, SOD1 mutations were present in 20.0% of familial ALS patients and 1.9% of sporadic ALS patients, while FUS mutations were responsible for 13.3% of familial ALS cases, and TARDBP mutations were rare in either familial or sporadic ALS cases. This study broadens the known mutational spectrum in patients with ALS and further demonstrates the necessity for genetic screening in ALS patients from central-southern China.

  8. Accumulation of misfolded SOD1 in dorsal root ganglion degenerating proprioceptive sensory neurons of transgenic mice with amyotrophic lateral sclerosis.

    PubMed

    Sábado, Javier; Casanovas, Anna; Tarabal, Olga; Hereu, Marta; Piedrafita, Lídia; Calderó, Jordi; Esquerda, Josep E

    2014-01-01

    Amyotrophic lateral sclerosis (ALS) is an adult-onset progressive neurodegenerative disease affecting upper and lower motoneurons (MNs). Although the motor phenotype is a hallmark for ALS, there is increasing evidence that systems other than the efferent MN system can be involved. Mutations of superoxide dismutase 1 (SOD1) gene cause a proportion of familial forms of this disease. Misfolding and aggregation of mutant SOD1 exert neurotoxicity in a noncell autonomous manner, as evidenced in studies using transgenic mouse models. Here, we used the SOD1(G93A) mouse model for ALS to detect, by means of conformational-specific anti-SOD1 antibodies, whether misfolded SOD1-mediated neurotoxicity extended to neuronal types other than MNs. We report that large dorsal root ganglion (DRG) proprioceptive neurons accumulate misfolded SOD1 and suffer a degenerative process involving the inflammatory recruitment of macrophagic cells. Degenerating sensory axons were also detected in association with activated microglial cells in the spinal cord dorsal horn of diseased animals. As large proprioceptive DRG neurons project monosynaptically to ventral horn MNs, we hypothesise that a prion-like mechanism may be responsible for the transsynaptic propagation of SOD1 misfolding from ventral horn MNs to DRG sensory neurons.

  9. Acylation of Superoxide Dismutase 1 (SOD1) at K122 Governs SOD1-Mediated Inhibition of Mitochondrial Respiration

    PubMed Central

    Banks, Courtney J.; Rodriguez, Nathan W.; Gashler, Kyle R.; Pandya, Rushika R.; Mortenson, Jeffrey B.; Whited, Matthew D.; Soderblom, Erik J.; Thompson, J. Will; Moseley, M. Arthur; Reddi, Amit R.; Tessem, Jeffery S.; Torres, Matthew P.; Bikman, Benjamin T.

    2017-01-01

    ABSTRACT In this study, we employed proteomics to identify mechanisms of posttranslational regulation on cell survival signaling proteins. We focused on Cu-Zn superoxide dismutase (SOD1), which protects cells from oxidative stress. We found that acylation of K122 on SOD1, while not impacting SOD1 catalytic activity, suppressed the ability of SOD1 to inhibit mitochondrial metabolism at respiratory complex I. We found that deacylase depletion increased K122 acylation on SOD1, which blocked the suppression of respiration in a K122-dependent manner. In addition, we found that acyl-mimicking mutations at K122 decreased SOD1 accumulation in mitochondria, initially hinting that SOD1 may inhibit respiration directly within the intermembrane space (IMS). However, surprisingly, we found that forcing the K122 acyl mutants into the mitochondria with an IMS-targeting tag did not recover their ability to suppress respiration. Moreover, we found that suppressing or boosting respiration levels toggled SOD1 in or out of the mitochondria, respectively. These findings place SOD1-mediated inhibition of respiration upstream of its mitochondrial localization. Lastly, deletion-rescue experiments show that a respiration-defective mutant of SOD1 is also impaired in its ability to rescue cells from toxicity caused by SOD1 deletion. Together, these data suggest a previously unknown interplay between SOD1 acylation, metabolic regulation, and SOD1-mediated cell survival. PMID:28739857

  10. Metal-deficient SOD1 in amyotrophic lateral sclerosis.

    PubMed

    Hilton, James B; White, Anthony R; Crouch, Peter J

    2015-05-01

    Mutations to the ubiquitous antioxidant enzyme Cu/Zn superoxide dismutase (SOD1) were the first established genetic cause of the fatal, adult-onset neurodegenerative disease amyotrophic lateral sclerosis (ALS). It is widely accepted that these mutations do not cause ALS via a loss of antioxidant function, but elucidating the alternate toxic gain of function has proven to be elusive. Under physiological conditions, SOD1 binds one copper ion and one zinc ion per monomer to form a highly stable and functional homodimer, but there is now ample evidence to indicate aberrant persistence of SOD1 in an intermediate metal-deficient state may contribute to the protein's involvement in ALS. This review briefly discusses some of the data to support a role for metal-deficient SOD1 in the development of ALS and some of the outcomes from drug development studies that have aimed to modify the symptoms of ALS by targeting the metal state of SOD1. The implications for the metal state of SOD1 in cases of sporadic ALS that do not involve mutant SOD1 are also discussed.

  11. Wildtype motoneurons, ALS-Linked SOD1 mutation and glutamate profoundly modify astrocyte metabolism and lactate shuttling.

    PubMed

    Madji Hounoum, Blandine; Mavel, Sylvie; Coque, Emmanuelle; Patin, Franck; Vourc'h, Patrick; Marouillat, Sylviane; Nadal-Desbarats, Lydie; Emond, Patrick; Corcia, Philippe; Andres, Christian R; Raoul, Cédric; Blasco, Hélène

    2017-04-01

    The selective degeneration of motoneuron that typifies amyotrophic lateral sclerosis (ALS) implicates non-cell-autonomous effects of astrocytes. However, mechanisms underlying astrocyte-mediated neurotoxicity remain largely unknown. According to the determinant role of astrocyte metabolism in supporting neuronal function, we propose to explore the metabolic status of astrocytes exposed to ALS-associated conditions. We found a significant metabolic dysregulation including purine, pyrimidine, lysine, and glycerophospholipid metabolism pathways in astrocytes expressing an ALS-causing mutated superoxide dismutase-1 (SOD1) when co-cultured with motoneurons. SOD1 astrocytes exposed to glutamate revealed a significant modification of the astrocyte metabolic fingerprint. More importantly, we observed that SOD1 mutation and glutamate impact the cellular shuttling of lactate between astrocytes and motoneurons with a decreased in extra- and intra-cellular lactate levels in astrocytes. Based on the emergent strategy of metabolomics, this work provides novel insight for understanding metabolic dysfunction of astrocytes in ALS conditions and opens the perspective of therapeutics targets through focusing on these metabolic pathways. GLIA 2017 GLIA 2017;65:592-605. © 2017 Wiley Periodicals, Inc.

  12. Defining SOD1 ALS natural history to guide therapeutic clinical trial design.

    PubMed

    Bali, Taha; Self, Wade; Liu, Jingxia; Siddique, Teepu; Wang, Leo H; Bird, Thomas D; Ratti, Elena; Atassi, Nazem; Boylan, Kevin B; Glass, Jonathan D; Maragakis, Nicholas J; Caress, James B; McCluskey, Leo F; Appel, Stanley H; Wymer, James P; Gibson, Summer; Zinman, Lorne; Mozaffar, Tahseen; Callaghan, Brian; McVey, April L; Jockel-Balsarotti, Jennifer; Allred, Peggy; Fisher, Elena R; Lopate, Glenn; Pestronk, Alan; Cudkowicz, Merit E; Miller, Timothy M

    2017-02-01

    Understanding the natural history of familial amyotrophic lateral sclerosis (ALS) caused by SOD1 mutations (ALS SOD1 ) will provide key information for optimising clinical trials in this patient population. To establish an updated natural history of ALS SOD1 . Retrospective cohort study from 15 medical centres in North America evaluated records from 175 patients with ALS with genetically confirmed SOD1 mutations, cared for after the year 2000. Age of onset, survival, ALS Functional Rating Scale (ALS-FRS) scores and respiratory function were analysed. Patients with the A4V (Ala-Val) SOD1 mutation (SOD1 A4V ), the largest mutation population in North America with an aggressive disease progression, were distinguished from other SOD1 mutation patients (SOD1 non-A4V ) for analysis. Mean age of disease onset was 49.7±12.3 years (mean±SD) for all SOD1 patients, with no statistical significance between SOD1 A4V and SOD1 non-A4V (p=0.72, Kruskal-Wallis). Total SOD1 patient median survival was 2.7 years. Mean disease duration for all SOD1 was 4.6±6.0 and 1.4±0.7 years for SOD1 A4V . SOD1 A4V survival probability (median survival 1.2 years) was significantly decreased compared with SOD1 non-A4V (median survival 6.8 years; p<0.0001, log-rank). A statistically significant increase in ALS-FRS decline in SOD1 A4V compared with SOD1 non-A4V participants (p=0.02) was observed, as well as a statistically significant increase in ALS-forced vital capacity decline in SOD1 A4V compared with SOD1 non-A4V (p=0.02). SOD1 A4V is an aggressive, but relatively homogeneous form of ALS. These SOD1-specific ALS natural history data will be important for the design and implementation of clinical trials in the ALS SOD1 patient population. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  13. Defining SOD1 ALS natural history to guide therapeutic clinical trial design

    PubMed Central

    Bali, Taha; Self, Wade; Liu, Jingxia; Siddique, Teepu; Wang, Leo H; Bird, Thomas D; Ratti, Elena; Atassi, Nazem; Boylan, Kevin B; Glass, Jonathan D; Maragakis, Nicholas J; Caress, James B; McCluskey, Leo F; Appel, Stanley H; Wymer, James P; Gibson, Summer; Zinman, Lorne; Mozaffar, Tahseen; Callaghan, Brian; McVey, April L; Jockel-Balsarotti, Jennifer; Allred, Peggy; Fisher, Elena R; Lopate, Glenn; Pestronk, Alan; Cudkowicz, Merit E; Miller, Timothy M

    2016-01-01

    Importance Understanding the natural history of familial amyotrophic lateral sclerosis (ALS) caused by SOD1 mutations (ALSSOD1) will provide key information for optimising clinical trials in this patient population. Objective To establish an updated natural history of ALSSOD1. Design, setting and participants Retrospective cohort study from 15 medical centres in North America evaluated records from 175 patients with ALS with genetically confirmed SOD1 mutations, cared for after the year 2000. Main outcomes and measures Age of onset, survival, ALS Functional Rating Scale (ALS-FRS) scores and respiratory function were analysed. Patients with the A4V (Ala-Val) SOD1 mutation (SOD1A4V), the largest mutation population in North America with an aggressive disease progression, were distinguished from other SOD1 mutation patients (SOD1non-A4V) for analysis. Results Mean age of disease onset was 49.7 ±12.3 years (mean±SD) for all SOD1 patients, with no statistical significance between SOD1A4V and SOD1non-A4V (p=0.72, Kruskal-Wallis). Total SOD1 patient median survival was 2.7 years. Mean disease duration for all SOD1 was 4.6±6.0 and 1.4±0.7 years for SOD1A4V. SOD1A4V survival probability (median survival 1.2 years) was significantly decreased compared with SOD1non-A4V (median survival 6.8 years; p<0.0001, log-rank). A statistically significant increase in ALS-FRS decline in SOD1A4V compared with SOD1non-A4V participants (p=0.02) was observed, as well as a statistically significant increase in ALS-forced vital capacity decline in SOD1A4V compared with SOD1non-A4V (p=0.02). Conclusions and relevance SOD1A4V is an aggressive, but relatively homogeneous form of ALS. These SOD1-specific ALS natural history data will be important for the design and implementation of clinical trials in the ALSSOD1 patient population. PMID:27261500

  14. Overexpression of survival motor neuron improves neuromuscular function and motor neuron survival in mutant SOD1 mice.

    PubMed

    Turner, Bradley J; Alfazema, Neza; Sheean, Rebecca K; Sleigh, James N; Davies, Kay E; Horne, Malcolm K; Talbot, Kevin

    2014-04-01

    Spinal muscular atrophy results from diminished levels of survival motor neuron (SMN) protein in spinal motor neurons. Low levels of SMN also occur in models of amyotrophic lateral sclerosis (ALS) caused by mutant superoxide dismutase 1 (SOD1) and genetic reduction of SMN levels exacerbates the phenotype of transgenic SOD1(G93A) mice. Here, we demonstrate that SMN protein is significantly reduced in the spinal cords of patients with sporadic ALS. To test the potential of SMN as a modifier of ALS, we overexpressed SMN in 2 different strains of SOD1(G93A) mice. Neuronal overexpression of SMN significantly preserved locomotor function, rescued motor neurons, and attenuated astrogliosis in spinal cords of SOD1(G93A) mice. Despite this, survival was not prolonged, most likely resulting from SMN mislocalization and depletion of gems in motor neurons of symptomatic mice. Our results reveal that SMN upregulation slows locomotor deficit onset and motor neuron loss in this mouse model of ALS. However, disruption of SMN nuclear complexes by high levels of mutant SOD1, even in the presence of SMN overexpression, might limit its survival promoting effects in this specific mouse model. Studies in emerging mouse models of ALS are therefore warranted to further explore the potential of SMN as a modifier of ALS. Copyright © 2014 Elsevier Inc. All rights reserved.

  15. Overexpression of metallothionein-I, a copper-regulating protein, attenuates intracellular copper dyshomeostasis and extends lifespan in a mouse model of amyotrophic lateral sclerosis caused by mutant superoxide dismutase-1.

    PubMed

    Tokuda, Eiichi; Okawa, Eriko; Watanabe, Shunsuke; Ono, Shin-Ichi

    2014-03-01

    Over 170 mutations in superoxide dismutase-1 (SOD1) cause familial amyotrophic lateral sclerosis (ALS), a lethal motor neuron disease. Although the molecular properties of SOD1 mutants differ considerably, we have recently shown that intracellular copper dyshomeostasis is a common pathogenic feature of different SOD1 mutants. Thus, the potentiation of endogenous copper regulation could be a therapeutic strategy. In this study, we investigated the effects of the overexpression of metallothionein-I (MT-I), a major copper-regulating protein, on the disease course of a mouse model of ALS (SOD1(G93A)). Using double transgenic techniques, we found that the overexpression of MT-I in SOD1(G93A) mice significantly extended the lifespan and slowed disease progression, but the effects on disease onset were modest. Genetically induced MT-I normalized copper dyshomeostasis in the spinal cord without influencing SOD1 enzymatic activity. The overexpression of MT-I in SOD1(G93A) mice markedly attenuated the pathological features of the mice, including the death of motor neurons, the degeneration of ventral root axons, the atrophy of skeletal muscles, and the activation of glial cells. Double transgenic mice also showed a decreased level of SOD1 aggregates within the glial cells of the spinal cord. Furthermore, the overexpression of MT-I in SOD1(G93A) mice reduced the number of spheroid-shaped astrocytes cleaved by active caspase-3. We concluded that therapeutic strategies aimed at the potentiation of copper regulation by MT-I could be of benefit in cases of ALS caused by SOD1 mutations.

  16. In yeast redistribution of Sod1 to the mitochondrial intermembrane space provides protection against respiration derived oxidative stress.

    PubMed

    Klöppel, Christine; Michels, Christine; Zimmer, Julia; Herrmann, Johannes M; Riemer, Jan

    2010-12-03

    The antioxidative enzyme copper-zinc superoxide dismutase (Sod1) is an important cellular defence system against reactive oxygen species (ROS). While the majority of this enzyme is localized to the cytosol, about 1% of the cellular Sod1 is present in the intermembrane space (IMS) of mitochondria. These amounts of mitochondrial Sod1 are increased for certain Sod1 mutants that are linked to the neurodegenerative disease amyotrophic lateral sclerosis (ALS). To date, only little is known about the physiological function of mitochondrial Sod1. Here, we use the model system Saccharomyces cerevisiae to generate cells in which Sod1 is exclusively localized to the IMS. We find that IMS-localized Sod1 can functionally substitute wild type Sod1 and that it even exceeds the protective capacity of wild type Sod1 under conditions of mitochondrial ROS stress. Moreover, we demonstrate that upon expression in yeast cells the common ALS-linked mutant Sod1(G93A) becomes enriched in the mitochondrial fraction and provides an increased protection of cells from mitochondrial oxidative stress. Such an effect cannot be observed for the catalytically inactive mutant Sod1(G85R). Our observations suggest that the targeting of Sod1 to the mitochondrial IMS provides an increased protection against respiration-derived ROS. Copyright © 2010 Elsevier Inc. All rights reserved.

  17. Acute intermittent hypoxia induced phrenic long-term facilitation despite increased SOD1 expression in a rat model of ALS

    PubMed Central

    Nichols, Nicole L.; Satriotomo, Irawan; Harrigan, Daniel J.; Mitchell, Gordon S.

    2015-01-01

    Amyotrophic lateral sclerosis (ALS) is a progressive and fatal neurodegenerative disease characterized by motor neuron death. Since most ALS patients succumb to ventilatory failure from loss of respiratory motor neurons, any effective ALS treatment must preserve and/or restore breathing capacity. In rats over-expressing mutated superoxide dismutase-1 (SOD1G93A), the capacity to increase phrenic motor output is decreased at disease end-stage, suggesting imminent ventilatory failure. Acute intermittent hypoxia (AIH) induces phrenic long-term facilitation (pLTF), a form of spinal respiratory motor plasticity with potential to restore phrenic motor output in clinical disorders that compromise breathing. Since pLTF requires NADPH oxidase activity and reactive oxygen species (ROS) formation, it is blocked by NADPH oxidase inhibition and SOD mimetics in normal rats. Thus, we hypothesized that SOD1G93A (mutant; MT) rats do not express AIH-induced pLTF due to over-expression of active mutant superoxide dismutase-1. AIH-induced pLTF and hypoglossal (XII) LTF were assessed in young, pre-symptomatic and end-stage anesthetized MT rats and age-matched wild-type littermates. Contrary to predictions, pLTF and XII LTF were observed in MT rats at all ages; at end-stage, pLTF was actually enhanced. SOD1 levels were elevated in young and pre-symptomatic MT rats, yet superoxide accumulation in putative phrenic motor neurons (assessed with dihydroethidium) was unchanged; however, superoxide accumulation significantly decreased at end-stage. Thus, compensatory mechanisms appear to maintain ROS homoeostasis until late in disease progression, preserving AIH-induced respiratory plasticity. Following intrathecal injections of an NADPH oxidase inhibitor (apocynin; 600µM; 12µL), pLTF was abolished in pre-symptomatic, but not end-stage MT rats, demonstrating that pLTF is NADPH oxidase dependent in pre-symptomatic, but NADPH oxidase independent in end-stage MT rats. Mechanisms preserving

  18. HSPB1 mutations causing hereditary neuropathy in humans disrupt non-cell autonomous protection of motor neurons.

    PubMed

    Heilman, Patrick L; Song, SungWon; Miranda, Carlos J; Meyer, Kathrin; Srivastava, Amit K; Knapp, Amy; Wier, Christopher G; Kaspar, Brian K; Kolb, Stephen J

    2017-11-01

    Heat shock protein beta-1 (HSPB1), is a ubiquitously expressed, multifunctional protein chaperone. Mutations in HSPB1 result in the development of a late-onset, distal hereditary motor neuropathy type II (dHMN) and axonal Charcot-Marie Tooth disease with sensory involvement (CMT2F). The functional consequences of HSPB1 mutations associated with hereditary neuropathy are unknown. HSPB1 also displays neuroprotective properties in many neuronal disease models, including the motor neuron disease amyotrophic lateral sclerosis (ALS). HSPB1 is upregulated in SOD1-ALS animal models during disease progression, predominately in glial cells. Glial cells are known to contribute to motor neuron loss in ALS through a non-cell autonomous mechanism. In this study, we examined the non-cell autonomous role of wild type and mutant HSPB1 in an astrocyte-motor neuron co-culture model system of ALS. Astrocyte-specific overexpression of wild type HSPB1 was sufficient to attenuate SOD1(G93A) astrocyte-mediated toxicity in motor neurons, whereas, overexpression of mutHSPB1 failed to ameliorate motor neuron toxicity. Expression of a phosphomimetic HSPB1 mutant in SOD1(G93A) astrocytes also reduced toxicity to motor neurons, suggesting that phosphorylation may contribute to HSPB1 mediated-neuroprotection. These data provide evidence that astrocytic HSPB1 expression may play a central role in motor neuron health and maintenance. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Assessment of ligand binding at a site relevant to SOD1 oxidation and aggregation.

    PubMed

    Manjula, Ramu; Wright, Gareth S A; Strange, Richard W; Padmanabhan, Balasundaram

    2018-05-01

    Cu/Zn superoxide dismutase-1 (SOD1) mutations are causative for a subset of amyotrophic lateral sclerosis (ALS) cases. These mutations lead to structural instability, aggregation and ultimately motor neuron death. We have determined crystal structures of SOD1 in complex with a naphthalene-catechol-linked compound which binds with low micro-molar affinity to a site important for oxidative damage-induced aggregation. SOD1 Trp32 oxidation is indeed significantly inhibited by ligand binding. Our work shows how compound linking can be applied successfully to ligand interactions on the SOD1 surface to generate relatively good binding strength. The ligand, positioned in a region important for SOD1 fibrillation, offers the possibility that it, or a similar compound, could prevent the abnormal self-association that drives SOD1 toxicity in ALS. © 2018 Federation of European Biochemical Societies.

  20. An ALS-Associated Mutant SOD1 Rapidly Suppresses KCNT1 (Slack) Na+-Activated K+ Channels in Aplysia Neurons.

    PubMed

    Zhang, Yalan; Ni, Weiming; Horwich, Arthur L; Kaczmarek, Leonard K

    2017-02-22

    Mutations that alter levels of Slack (KCNT1) Na + -activated K + current produce devastating effects on neuronal development and neuronal function. We now find that Slack currents are rapidly suppressed by oligomers of mutant human Cu/Zn superoxide dismutase 1 (SOD1), which are associated with motor neuron toxicity in an inherited form of amyotrophic lateral sclerosis (ALS). We recorded from bag cell neurons of Aplysia californica , a model system to study neuronal excitability. We found that injection of fluorescent wild-type SOD1 (wt SOD1YFP) or monomeric mutant G85R SOD1YFP had no effect on net ionic currents measured under voltage clamp. In contrast, outward potassium currents were significantly reduced by microinjection of mutant G85R SOD1YFP that had been preincubated at 37°C or of cross-linked dimers of G85R SOD1YFP. Reduction of potassium current was also seen with multimeric G85R SOD1YFP of ∼300 kDa or >300 kDa that had been cross-linked. In current clamp recordings, microinjection of cross-linked 300 kDa increased excitability by depolarizing the resting membrane potential, and decreasing the latency of action potentials triggered by depolarization. The effect of cross-linked 300 kDa on potassium current was reduced by removing Na + from the bath solution, or by knocking down levels of Slack using siRNA. It was also prevented by pharmacological inhibition of ASK1 (apoptosis signal-regulating kinase 1) or of c-Jun N-terminal kinase, but not by an inhibitor of p38 mitogen-activated protein kinase. These results suggest that soluble mutant SOD1 oligomers rapidly trigger a kinase pathway that regulates the activity of Na + -activated K + channels in neurons. SIGNIFICANCE STATEMENT Slack Na + -activated K + channels (KCNT1, K Na 1.1) regulate neuronal excitability but are also linked to cytoplasmic signaling pathways that control neuronal protein translation. Mutations that alter the amplitude of these currents have devastating effects on neuronal

  1. Focal dysfunction of the proteasome: a pathogenic factor in a mouse model of amyotrophic lateral sclerosis.

    PubMed

    Kabashi, Edor; Agar, Jeffrey N; Taylor, David M; Minotti, Sandra; Durham, Heather D

    2004-06-01

    Mutations in the Cu/Zn-superoxide dismutase (SOD-1) gene are responsible for a familial form of amyotrophic lateral sclerosis (fALS). The present study demonstrated impaired proteasomal function in the lumbar spinal cord of transgenic mice expressing human SOD-1 with the ALS-causing mutation G93A (SOD-1(G93A)) compared to non-transgenic littermates (LM) and SOD-1(WT) transgenic mice. Chymotrypsin-like activity was decreased as early as 45 days of age. By 75 days, chymotrypsin-, trypsin-, and caspase-like activities of the proteasome were impaired, at about 50% of control activity in lumbar spinal cord, but unchanged in thoracic spinal cord and liver. Both total and specific activities of the proteasome were reduced to a similar extent, indicating that a change in proteasome function, rather than a decrease in proteasome levels, had occurred. Similar decreases of total and specific activities of the proteasome were observed in NIH 3T3 cell lines expressing fALS mutants SOD-1(G93A) and SOD-1(G41S), but not in SOD-1(WT) controls. Although overall levels of proteasome were maintained in spinal cord of SOD-1(G93A) transgenic mice, the level of 20S proteasome was substantially reduced in lumbar spinal motor neurons relative to the surrounding neuropil. It is concluded that impairment of the proteasome is an early event and contributes to ALS pathogenesis.

  2. S-acylation of SOD1, CCS, and a stable SOD1-CCS heterodimer in human spinal cords from ALS and non-ALS subjects.

    PubMed

    Antinone, Sarah E; Ghadge, Ghanashyam D; Ostrow, Lyle W; Roos, Raymond P; Green, William N

    2017-01-25

    Previously, we found that human Cu, Zn-superoxide dismutase (SOD1) is S-acylated (palmitoylated) in vitro and in amyotrophic lateral sclerosis (ALS) mouse models, and that S-acylation increased for ALS-causing SOD1 mutants relative to wild type. Here, we use the acyl resin-assisted capture (acyl-RAC) assay to demonstrate S-acylation of SOD1 in human post-mortem spinal cord homogenates from ALS and non-ALS subjects. Acyl-RAC further revealed that endogenous copper chaperone for SOD1 (CCS) is S-acylated in both human and mouse spinal cords, and in vitro in HEK293 cells. SOD1 and CCS formed a highly stable heterodimer in human spinal cord homogenates that was resistant to dissociation by boiling, denaturants, or reducing agents and was not observed in vitro unless both SOD1 and CCS were overexpressed. Cysteine mutations that attenuate SOD1 maturation prevented the SOD1-CCS heterodimer formation. The degree of S-acylation was highest for SOD1-CCS heterodimers, intermediate for CCS monomers, and lowest for SOD1 monomers. Given that S-acylation facilitates anchoring of soluble proteins to cell membranes, our findings suggest that S-acylation and membrane localization may play an important role in CCS-mediated SOD1 maturation. Furthermore, the highly stable S-acylated SOD1-CCS heterodimer may serve as a long-lived maturation intermediate in human spinal cord.

  3. S-acylation of SOD1, CCS, and a stable SOD1-CCS heterodimer in human spinal cords from ALS and non-ALS subjects

    PubMed Central

    Antinone, Sarah E.; Ghadge, Ghanashyam D.; Ostrow, Lyle W.; Roos, Raymond P.; Green, William N.

    2017-01-01

    Previously, we found that human Cu, Zn-superoxide dismutase (SOD1) is S-acylated (palmitoylated) in vitro and in amyotrophic lateral sclerosis (ALS) mouse models, and that S-acylation increased for ALS-causing SOD1 mutants relative to wild type. Here, we use the acyl resin-assisted capture (acyl-RAC) assay to demonstrate S-acylation of SOD1 in human post-mortem spinal cord homogenates from ALS and non-ALS subjects. Acyl-RAC further revealed that endogenous copper chaperone for SOD1 (CCS) is S-acylated in both human and mouse spinal cords, and in vitro in HEK293 cells. SOD1 and CCS formed a highly stable heterodimer in human spinal cord homogenates that was resistant to dissociation by boiling, denaturants, or reducing agents and was not observed in vitro unless both SOD1 and CCS were overexpressed. Cysteine mutations that attenuate SOD1 maturation prevented the SOD1-CCS heterodimer formation. The degree of S-acylation was highest for SOD1-CCS heterodimers, intermediate for CCS monomers, and lowest for SOD1 monomers. Given that S-acylation facilitates anchoring of soluble proteins to cell membranes, our findings suggest that S-acylation and membrane localization may play an important role in CCS-mediated SOD1 maturation. Furthermore, the highly stable S-acylated SOD1-CCS heterodimer may serve as a long-lived maturation intermediate in human spinal cord. PMID:28120938

  4. Wild-type and mutant SOD1 share an aberrant conformation and a common pathogenic pathway in ALS

    PubMed Central

    Bosco, Daryl A.; Morfini, Gerardo; Karabacak, N. Murat; Song, Yuyu; Gros-Louis, Francois; Pasinelli, Piera; Goolsby, Holly; Fontaine, Benjamin A.; Lemay, Nathan; McKenna-Yasek, Diane; Frosch, Matthew P.; Agar, Jeffery N.; Julien, Jean-Pierre; Brady, Scott T.; Brown, Robert H.

    2010-01-01

    Many mutations confer upon copper/zinc superoxide dismutase-1 (SOD1) one or more toxic function(s) that impair motor neuron viability and cause familial amyotrophic lateral sclerosis (FALS). Using a conformation-specific antibody that detects misfolded SOD1 (C4F6), we demonstrate that oxidized WT-SOD1 and mutant-SOD1 share a conformational epitope that is not present in normal WT-SOD1. In a subset of human sporadic ALS (SALS) cases, motor neurons in the lumbosacral spinal cord displayed striking C4F6 immunoreactivity, denoting the presence of aberrant WT-SOD1 species. Recombinant, oxidized WT-SOD1 and WT-SOD1 immunopurified from SALS tissues inhibited kinesin-based fast axonal transport in a manner similar to FALS-linked mutant SOD1. Studies here suggest that WT-SOD1 can be pathogenic in SALS and identifies an SOD1-dependent pathogenic mechanism common to FALS and SALS. PMID:20953194

  5. A molecular chaperone activity of CCS restores the maturation of SOD1 fALS mutants.

    PubMed

    Luchinat, Enrico; Barbieri, Letizia; Banci, Lucia

    2017-12-12

    Superoxide dismutase 1 (SOD1) is an important metalloprotein for cellular oxidative stress defence, that is mutated in familiar variants of Amyotrophic Lateral Sclerosis (fALS). Some mutations destabilize the apo protein, leading to the formation of misfolded, toxic species. The Copper Chaperone for SOD1 (CCS) transiently interacts with SOD1 and promotes its correct maturation by transferring copper and catalyzing disulfide bond formation. By in vitro and in-cell NMR, we investigated the role of the SOD-like domain of CCS (CCS-D2). We showed that CCS-D2 forms a stable complex with zinc-bound SOD1 in human cells, that has a twofold stabilizing effect: it both prevents the accumulation of unstructured mutant SOD1 and promotes zinc binding. We further showed that CCS-D2 interacts with apo-SOD1 in vitro, suggesting that in cells CCS stabilizes mutant apo-SOD1 prior to zinc binding. Such molecular chaperone function of CCS-D2 is novel and its implications in SOD-linked fALS deserve further investigation.

  6. Unraveling ALS due to SOD1 mutation through the combination of brain and cervical cord MRI.

    PubMed

    Agosta, Federica; Spinelli, Edoardo Gioele; Marjanovic, Ivan V; Stevic, Zorica; Pagani, Elisabetta; Valsasina, Paola; Salak-Djokic, Biljana; Jankovic, Milena; Lavrnic, Dragana; Kostic, Vladimir S; Filippi, Massimo

    2018-02-20

    To explore structural and functional changes of the brain and cervical cord in patients with amyotrophic lateral sclerosis (ALS) due to mutation in the superoxide dismutase ( SOD1 ) gene compared with sporadic ALS. Twenty patients with SOD1 ALS, 11 with sporadic ALS, and 33 healthy controls underwent clinical evaluation and brain MRI. Cortical thickness analysis, diffusion tensor MRI of the corticospinal tracts (CST) and corpus callosum, and resting-state functional connectivity were performed. Patients with ALS also underwent cervical cord MRI to evaluate cord cross-sectional area and magnetization transfer ratio (MTR). Patients with SOD1 ALS showed longer disease duration and slower rate of functional decline relative to those with sporadic ALS. No cortical thickness abnormalities were found in patients with ALS compared with controls. Fractional anisotropy showed that sporadic ALS patients had significant CST damage relative to both healthy controls ( p = 0.001-0.02) and SOD1-related ALS ( p = 0.05), although the latter showed alterations that were intermediate between controls and sporadic ALS. Functional hyperconnectivity of the motor cortex in the sensorimotor network was observed in patients with sporadic ALS relative to controls. Conversely, patients with SOD1 ALS showed lower cord cross-sectional area along the whole cervical cord relative to those with sporadic ALS ( p < 0.001). No cord MTR differences were found between patient groups. Patients with SOD1 ALS showed cervical cord atrophy relative to those with sporadic ALS and a relative preservation of brain motor structural and functional networks. Neurodegeneration in SOD1 ALS is likely to occur primarily in the spinal cord. An objective and accurate estimate of spinal cord damage has potential in the future assessment of preventive SOD1 ALS therapies. © 2018 American Academy of Neurology.

  7. A Drosophila Model for Amyotrophic Lateral Sclerosis Reveals Motor Neuron Damage by Human SOD1*♦

    PubMed Central

    Watson, Melanie R.; Lagow, Robert D.; Xu, Kexiang; Zhang, Bing; Bonini, Nancy M.

    2008-01-01

    Amyotrophic lateral sclerosis (ALS) is a motor neuron disease that leads to loss of motor function and early death. About 5% of cases are inherited, with the majority of identified linkages in the gene encoding copper, zinc-superoxide dismutase (SOD1). Strong evidence indicates that the SOD1 mutations confer dominant toxicity on the protein. To provide new insight into mechanisms of ALS, we have generated and characterized a model for familial ALS in Drosophila with transgenic expression of human SOD1. Expression of wild type or disease-linked (A4V, G85R) mutants of human SOD1 selectively in motor neurons induced progressive climbing deficits. These effects were accompanied by defective neural circuit electrophysiology, focal accumulation of human SOD1 protein in motor neurons, and a stress response in surrounding glia. However, toxicity was not associated with oligomerization of SOD1 and did not lead to neuronal loss. These studies uncover cell-autonomous injury by SOD1 to motor neurons in vivo, as well as non-autonomous effects on glia, and provide the foundation for new insight into injury and protection of motor neurons in ALS. PMID:18596033

  8. Is SOD1 loss of function involved in amyotrophic lateral sclerosis?

    PubMed Central

    Saccon, Rachele A.; Bunton-Stasyshyn, Rosie K. A.; Fisher, Elizabeth M.C.; Fratta, Pietro

    2013-01-01

    Mutations in the gene superoxide dismutase 1 (SOD1) are causative for familial forms of the neurodegenerative disease amyotrophic lateral sclerosis. When the first SOD1 mutations were identified they were postulated to give rise to amyotrophic lateral sclerosis through a loss of function mechanism, but experimental data soon showed that the disease arises from a—still unknown—toxic gain of function, and the possibility that loss of function plays a role in amyotrophic lateral sclerosis pathogenesis was abandoned. Although loss of function is not causative for amyotrophic lateral sclerosis, here we re-examine two decades of evidence regarding whether loss of function may play a modifying role in SOD1–amyotrophic lateral sclerosis. From analysing published data from patients with SOD1–amyotrophic lateral sclerosis, we find a marked loss of SOD1 enzyme activity arising from almost all mutations. We continue to examine functional data from all Sod1 knockout mice and we find obvious detrimental effects within the nervous system with, interestingly, some specificity for the motor system. Here, we bring together historical and recent experimental findings to conclude that there is a possibility that SOD1 loss of function may play a modifying role in amyotrophic lateral sclerosis. This likelihood has implications for some current therapies aimed at knocking down the level of mutant protein in patients with SOD1–amyotrophic lateral sclerosis. Finally, the wide-ranging phenotypes that result from loss of function indicate that SOD1 gene sequences should be screened in diseases other than amyotrophic lateral sclerosis. PMID:23687121

  9. Rilmenidine promotes MTOR-independent autophagy in the mutant SOD1 mouse model of amyotrophic lateral sclerosis without slowing disease progression

    PubMed Central

    Perera, Nirma D.; Sheean, Rebecca K.; Lau, Chew L.; Shin, Yea Seul; Beart, Philip M.; Horne, Malcolm K.; Turner, Bradley J.

    2018-01-01

    ABSTRACT Macroautophagy/autophagy is the main intracellular catabolic pathway in neurons that eliminates misfolded proteins, aggregates and damaged organelles associated with ageing and neurodegeneration. Autophagy is regulated by both MTOR-dependent and -independent pathways. There is increasing evidence that autophagy is compromised in neurodegenerative disorders, which may contribute to cytoplasmic sequestration of aggregation-prone and toxic proteins in neurons. Genetic or pharmacological modulation of autophagy to promote clearance of misfolded proteins may be a promising therapeutic avenue for these disorders. Here, we demonstrate robust autophagy induction in motor neuronal cells expressing SOD1 or TARDBP/TDP-43 mutants linked to amyotrophic lateral sclerosis (ALS). Treatment of these cells with rilmenidine, an anti-hypertensive agent and imidazoline-1 receptor agonist that induces autophagy, promoted autophagic clearance of mutant SOD1 and efficient mitophagy. Rilmenidine administration to mutant SOD1G93A mice upregulated autophagy and mitophagy in spinal cord, leading to reduced soluble mutant SOD1 levels. Importantly, rilmenidine increased autophagosome abundance in motor neurons of SOD1G93A mice, suggesting a direct action on target cells. Despite robust induction of autophagy in vivo, rilmenidine worsened motor neuron degeneration and symptom progression in SOD1G93A mice. These effects were associated with increased accumulation and aggregation of insoluble and misfolded SOD1 species outside the autophagy pathway, and severe mitochondrial depletion in motor neurons of rilmenidine-treated mice. These findings suggest that rilmenidine treatment may drive disease progression and neurodegeneration in this mouse model due to excessive mitophagy, implying that alternative strategies to beneficially stimulate autophagy are warranted in ALS. PMID:28980850

  10. Bid Promotes K63-Linked Polyubiquitination of Tumor Necrosis Factor Receptor Associated Factor 6 (TRAF6) and Sensitizes to Mutant SOD1-Induced Proinflammatory Signaling in Microglia.

    PubMed

    Kinsella, Sinéad; König, Hans-Georg; Prehn, Jochen H M

    2016-01-01

    Mutations in the superoxide dismutase 1 (SOD1) gene contribute to motoneuron degeneration and are evident in 20% of familial amyotrophic lateral sclerosis cases. Mutant SOD1 induces microglial activation through a stimulation of Toll-like receptors 2 and 4 (TLR2 and TLR4). In the present study, we identified the proapoptotic Bcl-2 family protein Bid as a positive regulator of mutant SOD1-induced TLR-nuclear factor-κB (NF-κB) signaling in microglia. bid-deficient primary mouse microglia showed reduced NF-κB signaling in response to TLR4 activation or exposure to conditioned medium derived from SOD1 (G93A) expressing NSC-34 cells. Attenuation of NF-κB signaling in bid-deficient microglia was associated with lower levels of phosphorylated IKKα/β and p65, with a delayed degradation of IκBα and enhanced degradation of Peli1. Upstream of IKK, we found that Bid interacted with, and promoted, the K63-linked polyubiquitination of the E3 ubiquitin ligase tumor necrosis factor receptor associated factor 6 (TRAF6) in microglia. Our study suggests a key role for Bid in the regulation of TLR4-NF-κB proinflammatory signaling during mutant SOD1-induced disease pathology. Bid promotes TLR4-NF-κB signaling by interacting with TRAF6 and promoting TRAF6 K63-linked polyubiquitination in microglia.

  11. Solid-state NMR studies of metal-free SOD1 fibrillar structures.

    PubMed

    Banci, Lucia; Blaževitš, Olga; Cantini, Francesca; Danielsson, Jens; Lang, Lisa; Luchinat, Claudio; Mao, Jiafei; Oliveberg, Mikael; Ravera, Enrico

    2014-06-01

    Copper-zinc superoxide dismutase 1 (SOD1) is present in the protein aggregates deposited in motor neurons of amyotrophic lateral sclerosis (ALS) patients. ALS is a neurodegenerative disease that can be either sporadic (ca. 90%) or familial (fALS). The most widely studied forms of fALS are caused by mutations in the sequence of SOD1. Ex mortuo SOD1 aggregates are usually found to be amorphous. In vitro SOD1, in its immature reduced and apo state, forms fibrillar aggregates. Previous literature data have suggested that a monomeric SOD1 construct, lacking loops IV and VII, (apoSODΔIV-VII), shares the same fibrillization properties of apoSOD1, both proteins having the common structural feature of the central β-barrel. In this work, we show that structural information can be obtained at a site-specific level from solid-state NMR. The residues that are sequentially assignable are found to be located at the putative nucleation site for fibrillar species formation in apoSOD, as detected by other experimental techniques.

  12. Bid Promotes K63-Linked Polyubiquitination of Tumor Necrosis Factor Receptor Associated Factor 6 (TRAF6) and Sensitizes to Mutant SOD1-Induced Proinflammatory Signaling in Microglia123

    PubMed Central

    Kinsella, Sinéad

    2016-01-01

    Mutations in the superoxide dismutase 1 (SOD1) gene contribute to motoneuron degeneration and are evident in 20% of familial amyotrophic lateral sclerosis cases. Mutant SOD1 induces microglial activation through a stimulation of Toll-like receptors 2 and 4 (TLR2 and TLR4). In the present study, we identified the proapoptotic Bcl-2 family protein Bid as a positive regulator of mutant SOD1-induced TLR-nuclear factor-κB (NF-κB) signaling in microglia. bid-deficient primary mouse microglia showed reduced NF-κB signaling in response to TLR4 activation or exposure to conditioned medium derived from SOD1 G93A expressing NSC-34 cells. Attenuation of NF-κB signaling in bid-deficient microglia was associated with lower levels of phosphorylated IKKα/β and p65, with a delayed degradation of IκBα and enhanced degradation of Peli1. Upstream of IKK, we found that Bid interacted with, and promoted, the K63-linked polyubiquitination of the E3 ubiquitin ligase tumor necrosis factor receptor associated factor 6 (TRAF6) in microglia. Our study suggests a key role for Bid in the regulation of TLR4-NF-κB proinflammatory signaling during mutant SOD1-induced disease pathology. Bid promotes TLR4-NF-κB signaling by interacting with TRAF6 and promoting TRAF6 K63-linked polyubiquitination in microglia. PMID:27257617

  13. Riluzole But Not Melatonin Ameliorates Acute Motor Neuron Degeneration and Moderately Inhibits SOD1-Mediated Excitotoxicity Induced Disrupted Mitochondrial Ca2+ Signaling in Amyotrophic Lateral Sclerosis

    PubMed Central

    Jaiswal, Manoj Kumar

    2017-01-01

    Selective motoneurons (MNs) degeneration in the brain stem, hypoglossal motoneurons (HMNs), and the spinal cord resulting in patients paralysis and eventual death are prominent features of amyotrophic lateral sclerosis (ALS). Previous studies have suggested that mitochondrial respiratory impairment, low Ca2+ buffering and homeostasis and excitotoxicity are the pathological phenotypes found in mice, and cell culture models of familial ALS (fALS) linked with Cu/Zn-superoxide dismutase 1 (SOD1) mutation. In our study, we aimed to understand the impact of riluzole and melatonin on excitotoxicity, neuronal protection and Ca2+ signaling in individual HMNs ex vivo in symptomatic adult ALS mouse brain stem slice preparations and in WT and SOD1-G93A transfected SH-SY5Y neuroblastoma cell line using fluorescence microscopy, calcium imaging with high speed charged coupled device camera, together with immunohistochemistry, cell survival assay and histology. In our experiments, riluzole but not melatonin ameliorates MNs degeneration and moderately inhibit excitotoxicity and cell death in SH-SY5YWT or SH-SY5YG93A cell lines induced by complex IV blocker sodium azide. In brain stem slice preparations, riluzole significantly inhibit HMNs cell death induced by inhibiting the mitochondrial electron transport chain by Na-azide. In the HMNs of brainstem slice prepared from adult (14–15 weeks) WT, and corresponding symptomatic SOD1G93A mice, we measured the effect of riluzole and melatonin on [Ca2+]i using fura-2 AM ratiometric calcium imaging in individual MNs. Riluzole caused a significant decrease in [Ca2+]i transients and reversibly inhibited [Ca2+]i transients in Fura-2 AM loaded HMNs exposed to Na-azide in adult symptomatic SOD1G93A mice. On the contrary, melatonin failed to show similar effects in the HMNs of WT and SOD1G93A mice. Intrinsic nicotinamide adenine dinucleotide (NADH) fluorescence, an indicator of mitochondrial metabolism and health in MNs, showed enhanced

  14. Oral treatment with Cu(II)(atsm) increases mutant SOD1 in vivo but protects motor neurons and improves the phenotype of a transgenic mouse model of amyotrophic lateral sclerosis.

    PubMed

    Roberts, Blaine R; Lim, Nastasia K H; McAllum, Erin J; Donnelly, Paul S; Hare, Dominic J; Doble, Philip A; Turner, Bradley J; Price, Katherine A; Lim, Sin Chun; Paterson, Brett M; Hickey, James L; Rhoads, Timothy W; Williams, Jared R; Kanninen, Katja M; Hung, Lin W; Liddell, Jeffrey R; Grubman, Alexandra; Monty, Jean-Francois; Llanos, Roxana M; Kramer, David R; Mercer, Julian F B; Bush, Ashley I; Masters, Colin L; Duce, James A; Li, Qiao-Xin; Beckman, Joseph S; Barnham, Kevin J; White, Anthony R; Crouch, Peter J

    2014-06-04

    Mutations in the metallo-protein Cu/Zn-superoxide dismutase (SOD1) cause amyotrophic lateral sclerosis (ALS) in humans and an expression level-dependent phenotype in transgenic rodents. We show that oral treatment with the therapeutic agent diacetyl-bis(4-methylthiosemicarbazonato)copper(II) [Cu(II)(atsm)] increased the concentration of mutant SOD1 (SOD1G37R) in ALS model mice, but paradoxically improved locomotor function and survival of the mice. To determine why the mice with increased levels of mutant SOD1 had an improved phenotype, we analyzed tissues by mass spectrometry. These analyses revealed most SOD1 in the spinal cord tissue of the SOD1G37R mice was Cu deficient. Treating with Cu(II)(atsm) decreased the pool of Cu-deficient SOD1 and increased the pool of fully metallated (holo) SOD1. Tracking isotopically enriched (65)Cu(II)(atsm) confirmed the increase in holo-SOD1 involved transfer of Cu from Cu(II)(atsm) to SOD1, suggesting the improved locomotor function and survival of the Cu(II)(atsm)-treated SOD1G37R mice involved, at least in part, the ability of the compound to improve the Cu content of the mutant SOD1. This was supported by improved survival of SOD1G37R mice that expressed the human gene for the Cu uptake protein CTR1. Improving the metal content of mutant SOD1 in vivo with Cu(II)(atsm) did not decrease levels of misfolded SOD1. These outcomes indicate the metal content of SOD1 may be a greater determinant of the toxicity of the protein in mutant SOD1-associated forms of ALS than the mutations themselves. Improving the metal content of SOD1 therefore represents a valid therapeutic strategy for treating ALS caused by SOD1. Copyright © 2014 the authors 0270-6474/14/348021-11$15.00/0.

  15. ALS-linked mutant SOD1 proteins promote Aβ aggregates in ALS through direct interaction with Aβ.

    PubMed

    Jang, Ja-Young; Cho, Hyungmin; Park, Hye-Yoon; Rhim, Hyangshuk; Kang, Seongman

    2017-11-04

    Amyotrophic lateral sclerosis (ALS) is a neurodegenerative disease characterized by progressive degeneration of motor neurons. Aggregation of ALS-linked mutant Cu/Zn superoxide dismutase (SOD1) is a hallmark of a subset of familial ALS (fALS). Recently, intracellular amyloid-β (Aβ) is detected in motor neurons of both sporadic and familial ALS. We have previously shown that intracellular Aβ specifically interacts with G93A, an ALS-linked SOD1 mutant. However, little is known about the pathological and biological effect of this interaction in neurons. In this study, we have demonstrated that the Aβ-binding region is exposed on the SOD1 surface through the conformational changes due to misfolding of SOD1. Interestingly, we found that the intracellular aggregation of Aβ is enhanced through the direct interaction of Aβ with the Aβ-binding region exposed to misfolded SOD1. Ultimately, increased Aβ aggregation by this interaction promotes neuronal cell death. Consistent with this result, Aβ aggregates was three-fold higher in the brains of G93A transgenic mice than those of non Tg. Our study provides the first direct evidence that Aβ, an AD-linked factor, is associated to the pathogenesis of ALS and provides molecular clues to understand common aggregation mechanisms in the pathogenesis of neurodegenerative diseases. Furthermore, it will provide new insights into the development of therapeutic approaches for ALS. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Androgens affect muscle, motor neuron, and survival in a mouse model of SOD1-related amyotrophic lateral sclerosis.

    PubMed

    Aggarwal, Tanya; Polanco, Maria J; Scaramuzzino, Chiara; Rocchi, Anna; Milioto, Carmelo; Emionite, Laura; Ognio, Emanuela; Sambataro, Fabio; Galbiati, Mariarita; Poletti, Angelo; Pennuto, Maria

    2014-08-01

    Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disease characterized by selective loss of upper and lower motor neurons and skeletal muscle atrophy. Epidemiologic and experimental evidence suggest the involvement of androgens in ALS pathogenesis, but the mechanism through which androgens modify the ALS phenotype is unknown. Here, we show that androgen ablation by surgical castration extends survival and disease duration of a transgenic mouse model of ALS expressing mutant human SOD1 (hSOD1-G93A). Furthermore, long-term treatment of orchiectomized hSOD1-G93A mice with nandrolone decanoate (ND), an anabolic androgenic steroid, worsened disease manifestations. ND treatment induced muscle fiber hypertrophy but caused motor neuron death. ND negatively affected survival, thereby dissociating skeletal muscle pathology from life span in this ALS mouse model. Interestingly, orchiectomy decreased androgen receptor levels in the spinal cord and muscle, whereas ND treatment had the opposite effect. Notably, stimulation with ND promoted the recruitment of endogenous androgen receptor into biochemical complexes that were insoluble in sodium dodecyl sulfate, a finding consistent with protein aggregation. Overall, our results shed light on the role of androgens as modifiers of ALS pathogenesis via dysregulation of androgen receptor homeostasis. Copyright © 2014 Elsevier Inc. All rights reserved.

  17. Effect of MLH1 -93G>A on gene expression in patients with colorectal cancer.

    PubMed

    Funck, Alexandre; Santos, Juliana C; Silva-Fernandes, Isabelle J L; Rabenhorst, Silvia H B; Martinez, Carlos A R; Ribeiro, Marcelo L

    2014-09-01

    The DNA repair machinery plays a key role in maintaining genomic stability by preventing the emergence of mutations. Furthermore, the -93G>A polymorphism in the MLH1 gene has been associated with an increased risk of developing colorectal cancer. Therefore, the aim of this study was to examine the expression pattern and effect of this polymorphism in normal and tumour samples from patients with colorectal cancer. The MLH1 -93G>A (rs1800734) polymorphism was detected by PCR-RFLP in 49 cases of colorectal cancer. MLH1 expression was investigated using real-time quantitative PCR. The results indicate a significant decrease in MLH1 expression in tumour samples compared to their normal counterparts. The MLH1 gene was also significantly repressed in samples from patients who had some degree of tumour invasion into other organs. Similarly, those patients who were in a more advanced tumour stage (TNM III and IV) exhibited a significant reduction in MLH1 gene expression. Finally, the mutant genotype AA of MLH1 was associated with a significant decrease in the expression of this gene. This finding suggests that this polymorphism could increase the risk of developing colorectal cancer by a defective mismatch repair system, particularly through the loss of MLH1 expression in an allele-specific manner.

  18. Computational investigation of the human SOD1 mutant, Cys146Arg, that directs familial amyotrophic lateral sclerosis.

    PubMed

    Srinivasan, E; Rajasekaran, R

    2017-07-25

    The genetic substitution mutation of Cys146Arg in the SOD1 protein is predominantly found in the Japanese population suffering from familial amyotrophic lateral sclerosis (FALS). A complete study of the biophysical aspects of this particular missense mutation through conformational analysis and producing free energy landscapes could provide an insight into the pathogenic mechanism of ALS disease. In this study, we utilized general molecular dynamics simulations along with computational predictions to assess the structural characterization of the protein as well as the conformational preferences of monomeric wild type and mutant SOD1. Our static analysis, accomplished through multiple programs, predicted the deleterious and destabilizing effect of mutant SOD1. Subsequently, comparative molecular dynamic studies performed on the wild type and mutant SOD1 indicated a loss in the protein conformational stability and flexibility. We observed the mutational consequences not only in local but also in long-range variations in the structural properties of the SOD1 protein. Long-range intramolecular protein interactions decrease upon mutation, resulting in less compact structures in the mutant protein rather than in the wild type, suggesting that the mutant structures are less stable than the wild type SOD1. We also presented the free energy landscape to study the collective motion of protein conformations through principal component analysis for the wild type and mutant SOD1. Overall, the study assisted in revealing the cause of the structural destabilization and protein misfolding via structural characterization, secondary structure composition and free energy landscapes. Hence, the computational framework in our study provides a valuable direction for the search for the cure against fatal FALS.

  19. Carnitine-acylcarnitine translocase deficiency with c.199-10 T>G and novel c.1A>G mutation

    PubMed Central

    Yan, Hui-ming; Hu, Hao; Ahmed, Aisha; Feng, Bing-bing; Liu, Jing; Jia, Zheng-jun; Wang, Hua

    2017-01-01

    Abstract Rationale: Carnitine-acylcarnitine translocate deficiency (CACTD) is a rare and life-threatening, autosomal recessive disorder of fatty acid β-oxidation characterized by hypoketotic hypoglycemia, hyperammonemia, cardiomyopathy, liver dysfunction, and muscle weakness; culminating in early death. To date, CACTD cases screened from the Chinese mainland population, especially patient with compound heterozygote with c.199-10T>G and a novel c.1A>G mutation in the SLC25A20 gene has never been described. Patient concerns: Herein, we report 2 neonatal cases of CACTD identified from the mainland China. These 2 patients were presented with severe metabolic crisis and their clinical conditions deteriorate rapidly and both died of cardiorespiratory collapse in the first week of life. We present the clinical and biochemical features of 2 probands and a brief literature review of previously reported CACTD cases with the c.199-10T>G mutation. Diagnoses: The acylcarnitine profiles by tandem-mass-spectrometry and the mutation analysis of SLC25A20 gene confirmed the diagnosis of CACTD in both patients. Mutation analysis demonstrated that patient No. 1 was homozygous for c.199-10T>G mutation, while patient No. 2 was a compound heterozygote for 2 mutations, a maternally-inherited c.199-10T>G and a paternally-inherited, novel c.1A>G mutation. Interventions: Both patients were treated with an aggressive treatment regimen include high glucose and arginine infusion, respiratory, and circulatory support. Outcomes: The first proband died 3 days after delivery due to sudden cardiac arrest. The second patient's clinical condition, at one time, was improved by high glucose infusion, intravenous arginine, and circulatory support. However, the patient failed to wean from mechanical ventilation. Unfortunately, her parents refused further treatment due to fear of financial burdens. The patient died of congestive heart failure in the 6th day of life. Lessons: We report the first 2 cases of

  20. Differential screening of mutated SOD1 transgenic mice reveals early up-regulation of a fast axonal transport component in spinal cord motor neurons.

    PubMed

    Dupuis, L; de Tapia, M; René, F; Lutz-Bucher, B; Gordon, J W; Mercken, L; Pradier, L; Loeffler, J P

    2000-08-01

    In the present study we analyze the molecular mechanisms underlying motor neuron degeneration in familial amyotrophic lateral sclerosis (FALS). For this, we used a transgenic mouse model expressing the Cu/Zn superoxide dismutase (SOD1) gene with a Gly(86) to Arg (G86R) mutation equivalent to that found in a subset of human FALS. Using an optimized suppression subtractive hybridization method, a cDNA specifically up-regulated during the asymptomatic phase in the lumbar spinal cord of G86R mice was identified by sequence analysis as the KIF3-associated protein (KAP3), a regulator of fast axonal transport. RT-PCR analysis revealed that KAP3 induction was an early event arising long before axonal degeneration. Immunohistochemical studies further revealed that KAP3 protein predominantly accumulates in large motor neurons of the ventral spinal cord. We further demonstrated that KAP3 up-regulation occurs independent of any change in the other components of the kinesin II complex. However, since the ubiquitous KIF1A motor is up-regulated, our results show an early and complex rearrangement of the fast axonal transport machinery in the course of FALS pathology. Copyright 2000 Academic Press.

  1. Marked synergism between mutant SOD1 and glutamate transport inhibition in the induction of motor neuronal degeneration in spinal cord slice cultures.

    PubMed

    Yin, Hong Z; Weiss, John H

    2012-04-11

    Loss of astrocytic glutamate transport capacity in ALS spinal cord supports an excitotoxic contribution to motor neuron (MN) damage in the disease, and dominant gain of function mutations in Cu/Zn superoxide dismutase (SOD1) cause certain familial forms of ALS. We have used organotypic slice cultures from wild type and G93A SOD1 mutant rat spinal cords to examine interactions between excitotoxicity and the presence of mutant SOD1 in the induction of MN degeneration. Slice cultures were prepared from 1 week old pups, and after an additional week in vitro, some were exposed to either a low level (30 μM) of the glutamate uptake inhibitor, trans-pyrrolidine-2,4-dicarboxylic acid (PDC) for 3 weeks, or a higher level (50 μM) for 48 h, followed by histochemical labeling to assess MN injury. In wild type animals these exposures caused relatively little MN degeneration. Similarly, little MN degeneration was seen in slices from SOD1 mutant animals that were not exposed to PDC. However, addition of PDC to SOD1 mutant slices resulted in substantial MN injury, which was markedly attenuated by a Ca2+ permeable AMPA-type (Ca-AMPA) glutamate channel blocker, or by a nitric oxide synthase antagonist. These observations illustrate the utility of the organotypic culture model for the investigation of intracellular interactions underlying MN degeneration in ALS, and support the hypothesis that activation of Ca-AMPA channels on MNs provides a metabolic burden that synergizes with deleterious effects of mutant SOD1 in the induction of MN injury. Copyright © 2012 Elsevier B.V. All rights reserved.

  2. Induction of parkinsonism-related proteins in the spinal motor neurons of transgenic mouse carrying a mutant SOD1 gene.

    PubMed

    Morimoto, Nobutoshi; Nagai, Makiko; Miyazaki, Kazunori; Ohta, Yasuyuki; Kurata, Tomoko; Takehisa, Yasushi; Ikeda, Yoshio; Matsuura, Tohru; Asanuma, Masato; Abe, Koji

    2010-06-01

    Amyotrophic lateral sclerosis is a progressive and fatal disease caused by selective death of motor neurons, and a number of these patients carry mutations in the superoxide dismutase 1 (SOD1) gene involved in ameliorating oxidative stress. Recent studies indicate that oxidative stress and disruption of mitochondrial homeostasis is a common mechanism for motor neuron degeneration in amyotrophic lateral sclerosis and the loss of midbrain dopamine neurons in Parkinson's disease. Therefore, the present study investigated the presence and alterations of familial Parkinson's disease-related proteins, PINK1 and DJ-1, in spinal motor neurons of G93ASOD1 transgenic mouse model of amyotrophic lateral sclerosis. Following onset of disease, PINK1 and DJ-1 protein expression increased in the spinal motor neurons. The activated form of p53 also increased and translocated to the nuclei of spinal motor neurons, followed by increased expression of p53-activated gene 608 (PAG608). This is the first report demonstrating that increased expression of PAG608 correlates with activation of phosphorylated p53 in spinal motor neurons of an amyotrophic lateral sclerosis model. These results provide further evidence of the profound correlations between spinal motor neurons of amyotrophic lateral sclerosis and parkinsonism-related proteins.

  3. Parkin Protects Against Misfolded SOD1 Toxicity by Promoting Its Aggresome Formation and Autophagic Clearance.

    PubMed

    Yung, Cheryl; Sha, Di; Li, Lian; Chin, Lih-Shen

    2016-11-01

    Mutations in Cu/Zn superoxide dismutase (SOD1) cause autosomal dominant amyotrophic lateral sclerosis (ALS), a devastating neurodegenerative disease with no effective treatment. Despite ample evidence indicating involvement of mutation-induced SOD1 protein misfolding and aggregation in ALS pathogenesis, the molecular mechanisms that control cellular management of misfolded, aggregation-prone SOD1 mutant proteins remain unclear. Here, we report that parkin, an E3 ubiquitin-protein ligase which is linked to Parkinson's disease, is a novel regulator of cellular defense against toxicity induced by ALS-associated SOD1 mutant proteins. We find that parkin mediates K63-linked polyubiquitination of SOD1 mutants in cooperation with the UbcH13/Uev1a E2 enzyme and promotes degradation of these misfolded SOD1 proteins by the autophagy-lysosome system. In response to strong proteotoxic stress associated with proteasome impairment, parkin promotes sequestration of misfolded and aggregated SOD1 proteins to form perinuclear aggresomes, regulates positioning of lysosomes around misfolded SOD1 aggresomes, and facilitates aggresome clearance by autophagy. Our findings reveal parkin-mediated cytoprotective mechanisms against misfolded SOD1 toxicity and suggest that enhancing parkin-mediated cytoprotection may provide a novel therapeutic strategy for treating ALS.

  4. Tryptophan 32 potentiates aggregation and cytotoxicity of a copper/zinc superoxide dismutase mutant associated with familial amyotrophic lateral sclerosis.

    PubMed

    Taylor, David M; Gibbs, Bernard F; Kabashi, Edor; Minotti, Sandra; Durham, Heather D; Agar, Jeffrey N

    2007-06-01

    One familial form of the neurodegenerative disease, amyotrophic lateral sclerosis, is caused by gain-of-function mutations in the gene encoding copper/zinc superoxide dismutase (SOD-1). This study provides in vivo evidence that normally occurring oxidative modification to SOD-1 promotes aggregation and toxicity of mutant proteins. The oxidation of Trp-32 was identified as a normal modification being present in both wild-type enzyme and SOD-1 with the disease-causing mutation, G93A, isolated from erythrocytes. Mutating Trp-32 to a residue with a slower rate of oxidative modification, phenylalanine, decreased both the cytotoxicity of mutant SOD-1 and its propensity to form cytoplasmic inclusions in motor neurons of dissociated mouse spinal cord cultures.

  5. In-cell NMR reveals potential precursor of toxic species from SOD1 fALS mutants

    NASA Astrophysics Data System (ADS)

    Luchinat, Enrico; Barbieri, Letizia; Rubino, Jeffrey T.; Kozyreva, Tatiana; Cantini, Francesca; Banci, Lucia

    2014-11-01

    Mutations in the superoxide dismutase 1 (SOD1) gene are related to familial cases of amyotrophic lateral sclerosis (fALS). Here we exploit in-cell NMR to characterize the protein folding and maturation of a series of fALS-linked SOD1 mutants in human cells and to obtain insight into their behaviour in the cellular context, at the molecular level. The effect of various mutations on SOD1 maturation are investigated by changing the availability of metal ions in the cells, and by coexpressing the copper chaperone for SOD1, hCCS. We observe for most of the mutants the occurrence of an unstructured SOD1 species, unable to bind zinc. This species may be a common precursor of potentially toxic oligomeric species, that are associated with fALS. Coexpression of hCCS in the presence of copper restores the correct maturation of the SOD1 mutants and prevents the formation of the unstructured species, confirming that hCCS also acts as a molecular chaperone.

  6. Differences in glutathione S-transferase pi expression in transgenic mice with symptoms of neurodegeneration.

    PubMed

    Kaźmierczak, Beata; Kuźma-Kozakiewicz, Magdalena; Usarek, Ewa; Barańczyk-Kuźma, Anna

    2011-01-01

    Glutathione S-transferase pi (GST pi) is an enzyme involved in cell protection against toxic electrophiles and products of oxidative stress. GST pi expression was studied in transgenic mice hybrids (B6-C3H) with symptoms of neurodegeneration harboring SOD1G93A (SOD1/+), Dync1h1 (Cra1/+) and double (Cra1/SOD1) mutations, at presymptomatic and symptomatic stages (age 70, 140, 365 days) using RT-PCR and Western blotting. The main changes in GST pi expression were observed in mice with the SODG93A mutation. In SOD1/+ and Cra1/SOD1 transgenics, with the exception of cerebellum, the changes in GST pi-mRNA accompanied those in GST pi protein. In brain cortex of both groups the expression was unchanged at the presymptomatic (age 70 days) but was lower at the symptomatic stage (age 140 days) and at both stages in hippocampus and spinal cord of SOD1/+ but not of Cra1/SOD1 mice compared to age-matched wild-type controls. In cerebellum of the presymptomatic and the symptomatic SOD1/+ mice and presymptomatic Cra1/SOD1 mice, the GST pi-mRNA was drastically elevated but the protein level remained unchanged. In Cra1/+ transgenics there were no changes in GST pi expression in any CNS region both on the mRNA and on the protein level. It can be concluded that the SOD1G93A but not the Dync1h1 mutation significantly decreases detoxification efficiency of GST pi in CNS, however the Dync1h1 mutation reduces the effects caused by the SOD1G93A mutation. Despite similarities in neurological symptoms, the differences in GST pi expression between SOD1/+ and Cra1/+ transgenics indicate a distinct pathogenic entity of these two conditions.

  7. Absence of Nrf2 or Its Selective Overexpression in Neurons and Muscle Does Not Affect Survival in ALS-Linked Mutant hSOD1 Mouse Models

    PubMed Central

    Vargas, Marcelo R.; Burton, Neal C.; Gan, Li; Johnson, Delinda A.; Schäfer, Matthias; Werner, Sabine; Johnson, Jeffrey A.

    2013-01-01

    The nuclear factor erythroid 2-related factor 2 (Nrf2) governs the expression of antioxidant and phase II detoxifying enzymes. Nrf2 activation can prevent or reduce cellular damage associated with several types of injury in many different tissues and organs. Dominant mutations in Cu/Zn-superoxide dismutase (SOD1) cause familial forms of amyotrophic lateral sclerosis (ALS), a fatal disorder characterized by the progressive loss of motor neurons and subsequent muscular atrophy. We have previously shown that Nrf2 activation in astrocytes delays neurodegeneration in ALS mouse models. To further investigate the role of Nrf2 in ALS we determined the effect of absence of Nrf2 or its restricted overexpression in neurons or type II skeletal muscle fibers on symptoms onset and survival in mutant hSOD1 expressing mice. We did not observe any detrimental effect associated with the lack of Nrf2 in two different mutant hSOD1 animal models of ALS. However, restricted Nrf2 overexpression in neurons or type II skeletal muscle fibers delayed disease onset but failed to extend survival in hSOD1G93A mice. These results highlight the concept that not only the pharmacological target but also the cell type targeted may be relevant when considering a Nrf2-mediated therapeutic approach for ALS. PMID:23418589

  8. Absence of Nrf2 or its selective overexpression in neurons and muscle does not affect survival in ALS-linked mutant hSOD1 mouse models.

    PubMed

    Vargas, Marcelo R; Burton, Neal C; Kutzke, Jennifer; Gan, Li; Johnson, Delinda A; Schäfer, Matthias; Werner, Sabine; Johnson, Jeffrey A

    2013-01-01

    The nuclear factor erythroid 2-related factor 2 (Nrf2) governs the expression of antioxidant and phase II detoxifying enzymes. Nrf2 activation can prevent or reduce cellular damage associated with several types of injury in many different tissues and organs. Dominant mutations in Cu/Zn-superoxide dismutase (SOD1) cause familial forms of amyotrophic lateral sclerosis (ALS), a fatal disorder characterized by the progressive loss of motor neurons and subsequent muscular atrophy. We have previously shown that Nrf2 activation in astrocytes delays neurodegeneration in ALS mouse models. To further investigate the role of Nrf2 in ALS we determined the effect of absence of Nrf2 or its restricted overexpression in neurons or type II skeletal muscle fibers on symptoms onset and survival in mutant hSOD1 expressing mice. We did not observe any detrimental effect associated with the lack of Nrf2 in two different mutant hSOD1 animal models of ALS. However, restricted Nrf2 overexpression in neurons or type II skeletal muscle fibers delayed disease onset but failed to extend survival in hSOD1(G93A) mice. These results highlight the concept that not only the pharmacological target but also the cell type targeted may be relevant when considering a Nrf2-mediated therapeutic approach for ALS.

  9. Defective mitochondrial dynamics is an early event in skeletal muscle of an amyotrophic lateral sclerosis mouse model.

    PubMed

    Luo, Guo; Yi, Jianxun; Ma, Changling; Xiao, Yajuan; Yi, Frank; Yu, Tian; Zhou, Jingsong

    2013-01-01

    Mitochondria are dynamic organelles that constantly undergo fusion and fission to maintain their normal functionality. Impairment of mitochondrial dynamics is implicated in various neurodegenerative disorders. Amyotrophic lateral sclerosis (ALS) is an adult-onset neuromuscular degenerative disorder characterized by motor neuron death and muscle atrophy. ALS onset and progression clearly involve motor neuron degeneration but accumulating evidence suggests primary muscle pathology may also be involved. Here, we examined mitochondrial dynamics in live skeletal muscle of an ALS mouse model (G93A) harboring a superoxide dismutase mutation (SOD1(G93A)). Using confocal microscopy combined with overexpression of mitochondria-targeted photoactivatable fluorescent proteins, we discovered abnormal mitochondrial dynamics in skeletal muscle of young G93A mice before disease onset. We further demonstrated that similar abnormalities in mitochondrial dynamics were induced by overexpression of mutant SOD1(G93A) in skeletal muscle of normal mice, indicating the SOD1 mutation drives ALS-like muscle pathology in the absence of motor neuron degeneration. Mutant SOD1(G93A) forms aggregates inside muscle mitochondria and leads to fragmentation of the mitochondrial network as well as mitochondrial depolarization. Partial depolarization of mitochondrial membrane potential in normal muscle by carbonyl cyanide p-trifluoromethoxyphenylhydrazone (FCCP) caused abnormalities in mitochondrial dynamics similar to that in the SOD1(G93A) model muscle. A specific mitochondrial fission inhibitor (Mdivi-1) reversed the SOD1(G93A) action on mitochondrial dynamics, indicating SOD1(G93A) likely promotes mitochondrial fission process. Our results suggest that accumulation of mutant SOD1(G93A) inside mitochondria, depolarization of mitochondrial membrane potential and abnormal mitochondrial dynamics are causally linked and cause intrinsic muscle pathology, which occurs early in the course of ALS and may

  10. Mitochondria-associated membrane collapse is a common pathomechanism in SIGMAR1- and SOD1-linked ALS.

    PubMed

    Watanabe, Seiji; Ilieva, Hristelina; Tamada, Hiromi; Nomura, Hanae; Komine, Okiru; Endo, Fumito; Jin, Shijie; Mancias, Pedro; Kiyama, Hiroshi; Yamanaka, Koji

    2016-12-01

    A homozygous mutation in the gene for sigma 1 receptor (Sig1R) is a cause of inherited juvenile amyotrophic lateral sclerosis (ALS16). Sig1R localizes to the mitochondria-associated membrane (MAM), which is an interface of mitochondria and endoplasmic reticulum. However, the role of the MAM in ALS is not fully elucidated. Here, we identified a homozygous p.L95fs mutation of Sig1R as a novel cause of ALS16. ALS-linked Sig1R variants were unstable and incapable of binding to inositol 1,4,5-triphosphate receptor type 3 (IP 3 R3). The onset of mutant Cu/Zn superoxide dismutase (SOD1)-mediated ALS disease in mice was accelerated when Sig1R was deficient. Moreover, either deficiency of Sig1R or accumulation of mutant SOD1 induced MAM disruption, resulting in mislocalization of IP 3 R3 from the MAM, calpain activation, and mitochondrial dysfunction. Our findings indicate that a loss of Sig1R function is causative for ALS16, and collapse of the MAM is a common pathomechanism in both Sig1R- and SOD1-linked ALS Furthermore, our discovery of the selective enrichment of IP 3 R3 in motor neurons suggests that integrity of the MAM is crucial for the selective vulnerability in ALS. © 2016 The Authors. Published under the terms of the CC BY 4.0 license.

  11. Data set for phylogenetic tree and RAMPAGE Ramachandran plot analysis of SODs in Gossypium raimondii and G. arboreum.

    PubMed

    Wang, Wei; Xia, Minxuan; Chen, Jie; Deng, Fenni; Yuan, Rui; Zhang, Xiaopei; Shen, Fafu

    2016-12-01

    The data presented in this paper is supporting the research article "Genome-Wide Analysis of Superoxide Dismutase Gene Family in Gossypium raimondii and G. arboreum" [1]. In this data article, we present phylogenetic tree showing dichotomy with two different clusters of SODs inferred by the Bayesian method of MrBayes (version 3.2.4), "Bayesian phylogenetic inference under mixed models" [2], Ramachandran plots of G. raimondii and G. arboreum SODs, the protein sequence used to generate 3D sructure of proteins and the template accession via SWISS-MODEL server, "SWISS-MODEL: modelling protein tertiary and quaternary structure using evolutionary information." [3] and motif sequences of SODs identified by InterProScan (version 4.8) with the Pfam database, "Pfam: the protein families database" [4].

  12. Glycogen storage disease type 1a in three siblings with the G270V mutation.

    PubMed

    Parvari, R; Isam, J; Moses, S W

    1999-04-01

    Glycogen storage disease type 1a (von Gierke disease, GSD1a) is caused by the deficiency of microsomal glucose-6-phosphatase (G6Pase) activity. The cloning of G6Pase cDNA and characterization of the human G6Pase gene enabled the identification of the mutations causing GSD1a. Here we report on the clinical and biochemical features of three GSD1a siblings of a Muslin Arab family with a G270V mutation. Two older patients presented with an unusually mild clinical and biochemical course.

  13. Haplotype defined by the MLH1-93G/A polymorphism is associated with MLH1 promoter hypermethylation in sporadic colorectal cancers.

    PubMed

    Miyakura, Yasuyuki; Tahara, Makiko; Lefor, Alan T; Yasuda, Yoshikazu; Sugano, Kokichi

    2014-11-24

    Methylation of the MLH1 promoter region has been suggested to be a major mechanism of gene inactivation in sporadic microsatellite instability-positive (MSI-H) colorectal cancers (CRCs). Recently, single-nucleotide polymorphism (SNP) in the MLH1 promoter region (MLH1-93G/A; rs1800734) has been proposed to be associated with MLH1 promoter methylation, loss of MLH1 protein expression and MSI-H tumors. We examined the association of MLH1-93G/A and six other SNPs surrounding MLH1-93G/A with the methylation status in 210 consecutive sporadic CRCs in Japanese patients. Methylation of the MLH1 promoter region was evaluated by Na-bisulfite polymerase chain reaction (PCR)/single-strand conformation polymorphism (SSCP) analysis. The genotype frequencies of SNPs located in the 54-kb region surrounding the MLH1-93G/A SNP were examined by SSCP analysis. Methylation of the MLH1 promoter region was observed in 28.6% (60/210) of sporadic CRCs. The proportions of MLH1-93G/A genotypes A/A, A/G and G/G were 26% (n=54), 51% (n=108) and 23% (n=48), respectively, and they were significantly associated with the methylation status (p=0.01). There were no significant associations between genotype frequency of the six other SNPs and methylation status. The A-allele of MLH1-93G/A was more common in cases with methylation than the G-allele (p=0.0094), especially in females (p=0.0067). In logistic regression, the A/A genotype of the MLH1-93G/A SNP was shown to be the most significant risk factor for methylation of the MLH1 promoter region (odds ratio 2.82, p=0.003). Furthermore, a haplotype of the A-allele of rs2276807 located -47 kb upstream from the MLH1-93G/A SNP and the A-allele of MLH1-93G/A SNP was significantly associated with MLH1 promoter methylation. These results indicate that individuals, and particularly females, carrying the A-allele at the MLH1-93G/A SNP, especially in association with the A-allele of rs2276807, may harbor an increased risk of methylation of the MLH1 promoter

  14. Lack of TNF-alpha receptor type 2 protects motor neurons in a cellular model of amyotrophic lateral sclerosis and in mutant SOD1 mice but does not affect disease progression.

    PubMed

    Tortarolo, Massimo; Vallarola, Antonio; Lidonnici, Dario; Battaglia, Elisa; Gensano, Francesco; Spaltro, Gabriella; Fiordaliso, Fabio; Corbelli, Alessandro; Garetto, Stefano; Martini, Elisa; Pasetto, Laura; Kallikourdis, Marinos; Bonetto, Valentina; Bendotti, Caterina

    2015-10-01

    Changes in the homeostasis of tumor necrosis factor α (TNFα) have been demonstrated in patients and experimental models of amyotrophic lateral sclerosis (ALS). However, the contribution of TNFα to the development of ALS is still debated. TNFα is expressed by glia and neurons and acts through the membrane receptors TNFR1 and TNFR2, which may have opposite effects in neurodegeneration. We investigated the role of TNFα and its receptors in the selective motor neuron death in ALS in vitro and in vivo. TNFR2 expressed by astrocytes and neurons, but not TNFR1, was implicated in motor neuron loss in primary SOD1-G93A co-cultures. Deleting TNFR2 from SOD1-G93A mice, there was partial but significant protection of spinal motor neurons, sciatic nerves, and tibialis muscles. However, no improvement of motor impairment or survival was observed. Since the sciatic nerves of SOD1-G93A/TNFR2-/- mice showed high phospho-TAR DNA-binding protein 43 (TDP-43) accumulation and low levels of acetyl-tubulin, two indices of axonal dysfunction, the lack of symptom improvement in these mice might be due to impaired function of rescued motor neurons. These results indicate the interaction between TNFR2 and membrane-bound TNFα as an innovative pathway involved in motor neuron death. Nevertheless, its inhibition is not sufficient to stop disease progression in ALS mice, underlining the complexity of this pathology. We show evidence of the involvement of neuronal and astroglial TNFR2 in the motor neuron degeneration in ALS. Both concur to cause motor neuron death in primary astrocyte/spinal neuron co-cultures. TNFR2 deletion partially protects motor neurons and sciatic nerves in SOD1-G93A mice but does not improve their symptoms and survival. However, TNFR2 could be a new target for multi-intervention therapies. © 2015 International Society for Neurochemistry.

  15. Single chain variable fragment antibodies block aggregation and toxicity induced by familial ALS-linked mutant forms of SOD1.

    PubMed

    Ghadge, Ghanashyam D; Pavlovic, John D; Koduvayur, Sujatha P; Kay, Brian K; Roos, Raymond P

    2013-08-01

    Approximately 10% of amyotrophic lateral sclerosis (ALS) cases are familial (known as FALS) with an autosomal dominant inheritance pattern, and ~25% of FALS cases are caused by mutations in Cu/Zn superoxide dismutase (SOD1). There is convincing evidence that mutant SOD1 (mtSOD1) kills motor neurons (MNs) because of a gain-of-function toxicity, most likely related to aggregation of mtSOD1. A number of recent reports have suggested that antibodies can be used to treat mtSOD1-induced FALS. To follow up on the use of antibodies as potential therapeutics, we generated single chain fragments of variable region antibodies (scFvs) against SOD1, and then expressed them as 'intrabodies' within a motor neuron cell line. In the present study, we describe isolation of human scFvs that interfere with mtSOD1 in vitro aggregation and toxicity. These scFvs may have therapeutic potential in sporadic ALS, as well as FALS, given that sporadic ALS may also involve abnormalities in the SOD1 protein or activity. Copyright © 2013 Elsevier Inc. All rights reserved.

  16. Novel PSEN1 G209A mutation in early-onset Alzheimer dementia supported by structural prediction.

    PubMed

    An, Seong Soo A; Bagyinszky, Eva; Kim, Hye Ryoun; Seok, Ju-Won; Shin, Hae-Won; Bae, SeunOh; Kim, SangYun; Youn, Young Chul

    2016-05-20

    Three main genes are described as causative genes for early-onset Alzheimer dementia (EOAD): APP, PSEN1 and PSEN2. We describe a woman with EOAD had a novel PSEN1 mutation. A 54-year-old right-handed woman presented 12-year history of progressive memory decline. She was clinically diagnosed as familial Alzheimer's disease due to a PSEN1 mutation. One of two daughters also has the same mutation, G209A in the TM-IV of PS1 protein. Her mother had unspecified dementia that began at the age of 40s. PolyPhen2 and SIFT prediction suggested that G209A might be a damaging variant with high scores. 3D modeling revealed that G209A exchange could result significant changes in the PS1 protein. We report a case of EOAD having probable novel PSEN1 (G209A) mutation verified with structural prediction.

  17. Regulation of Intracellular Copper by Induction of Endogenous Metallothioneins Improves the Disease Course in a Mouse Model of Amyotrophic Lateral Sclerosis.

    PubMed

    Tokuda, Eiichi; Watanabe, Shunsuke; Okawa, Eriko; Ono, Shin-ichi

    2015-04-01

    Mutations in SOD1 cause amyotrophic lateral sclerosis (ALS), an incurable motor neuron disease. The pathogenesis of the disease is poorly understood, but intracellular copper dyshomeostasis has been implicated as a key process in the disease. We recently observed that metallothioneins (MTs) are an excellent target for the modification of copper dyshomeostasis in a mouse model of ALS (SOD1(G93A)). Here, we offer a therapeutic strategy designed to increase the level of endogenous MTs. The upregulation of endogenous MTs by dexamethasone, a synthetic glucocorticoid, significantly improved the disease course and rescued motor neurons in SOD1(G93A) mice, even if the induction was initiated when peak body weight had decreased by 10%. Neuroprotection was associated with the normalization of copper dyshomeostasis, as well as with decreased levels of SOD1(G93A) aggregates. Importantly, these benefits were clearly mediated in a MT-dependent manner, as dexamethasone did not provide any protection when endogenous MTs were abolished from SOD1(G93A) mice. In conclusion, the upregulation of endogenous MTs represents a promising strategy for the treatment of ALS linked to mutant SOD1.

  18. cIAPs promote the proteasomal degradation of mutant SOD1 linked to familial amyotrophic lateral sclerosis.

    PubMed

    Choi, Jin Sun; Kim, Kidae; Lee, Do Hee; Cho, Sayeon; Ha, Jae Du; Park, Byoung Chul; Kim, Sunhong; Park, Sung Goo; Kim, Jeong-Hoon

    2016-11-18

    Although the ubiquitin-proteasome system is believed to play an important role in the pathogenesis of familial amyotrophic lateral sclerosis (FALS), caused by mutations in Cu/Zn-superoxide dismutase 1 (SOD1), the mechanism of how mutant SOD1 protein is regulated in cells is still poorly understood. Here we have demonstrated that cellular inhibitor of apoptosis proteins (cIAPs) are specifically associated with FALS-linked mutant SOD1 (mSOD1) and that this interaction promotes the ubiquitin-dependent proteasomal degradation of mutant SOD1. By utilizing cumate inducible SOD1 cells, we also showed that knock-down or pharmacologic depletion of cIAPs leads to H 2 O 2 induced cytotoxicity in mSOD1 expressing cells. Altogether, our results reveal a novel role of cIAPs in FALS-associated mutant SOD1 regulation. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. SOD1 Function and Its Implications for Amyotrophic Lateral Sclerosis Pathology: New and Renascent Themes.

    PubMed

    Bunton-Stasyshyn, Rosie K A; Saccon, Rachele A; Fratta, Pietro; Fisher, Elizabeth M C

    2015-10-01

    The canonical role of superoxide dismutase 1 (SOD1) is as an antioxidant enzyme protecting the cell from reactive oxygen species toxicity. SOD1 was also the first gene in which mutations were found to be causative for the neurodegenerative disease amyotrophic lateral sclerosis (ALS), more than 20 years ago. ALS is a relentless and incurable mid-life onset disease, which starts with a progressive paralysis and usually leads to death within 3 to 5 years of diagnosis; in the majority of cases, the intellect appears to remain intact while the motor system degenerates. It rapidly became clear that when mutated SOD1 takes on a toxic gain of function in ALS. However, this novel function remains unknown and many cellular systems have been implicated in disease. Now it seems that SOD1 may play a rather larger role in the cell than originally realized, including as a key modulator of glucose signaling (at least so far in yeast) and in RNA binding. Here, we consider some of the new findings for SOD1 in health and disease, which may shed light on how single amino acid changes at sites throughout this protein can cause devastating neurodegeneration in the mammalian motor system. © The Author(s) 2014.

  20. Novel Mutations in HESX1 and PROP1 Genes in Combined Pituitary Hormone Deficiency.

    PubMed

    Avbelj Stefanija, Magdalena; Kotnik, Primož; Bratanič, Nina; Žerjav Tanšek, Mojca; Bertok, Sara; Bratina, Nataša; Battelino, Tadej; Trebušak Podkrajšek, Katarina

    2015-01-01

    The HESX1 gene is essential in forebrain development and pituitary organogenesis, and its mutations are the most commonly identified genetic cause of septo-optic dysplasia (SOD). The PROP1 gene is involved in anterior pituitary cell lineage specification and is commonly implicated in non-syndromic combined pituitary hormone deficiency (CPHD). We aimed to assess the involvement of HESX1 and PROP1 mutations in a cohort of patients with SOD and CPHD. Six patients with sporadic SOD and 16 patients with CPHD from 14 pedigrees were screened for mutations in HESX1 and PROP1 genes by exon sequencing. Half of the CPHD patients had variable associated clinical characteristics, such as hearing loss, orofacial cleft, kidney disorder or developmental delay. Novel variants were evaluated in silico and verified in SNP databases. A novel heterozygous p.Glu102Gly mutation in the HESX1 gene and a novel homozygous p.Arg121Thr mutation in the PROP1 gene were detected in 2 pedigrees with CPHD. A small previously reported deletion in PROP1 c.301_302delAG was detected in a separate patient with CPHD, in heterozygous state. No mutations were identified in patients with SOD. Our results expand the spectrum of mutations implicated in CPHD. The frequency of 15% of the PROP1 mutations in CPHD was low, likely due to the clinical heterogeneity of the cohort. © 2015 S. Karger AG, Basel.

  1. Antioxidant enzymes GSR, SOD1, SOD2, and CAT gene variants and bone mineral density values in postmenopausal women: a genetic association analysis.

    PubMed

    Mlakar, Simona Jurkovic; Osredkar, Josko; Prezelj, Janez; Marc, Janja

    2012-03-01

    Oxidative stress participates in decreasing bone formation and stimulating bone resorption. Furthermore, antioxidant enzymes have been observed to have low protective activity in women with osteoporosis.The aim of the present study was to examine any association of selected gene polymorphisms of the glutathione S-reductase (GSR), superoxide dismutase (SOD1 and SOD2), and catalase (CAT) genes, alone or in combination, with the bone mineral density (BMD) values of femoral neck (fn), lumbar spine (ls), and total hip (th) in Slovenian postmenopausal women. The gene polymorphisms of CAT, GSR, SOD1, and SOD2 genes in 468 postmenopausal women were analyzed using restriction fragment length polymorphism and a fluorescent 5'-exonuclease genotyping method. BMD_fn, BMD_ls, and BMD_th were measured using dual-energy x-ray absorptiometry. Moreover, univariate statistic analysis and two-way analysis of variance for interaction testing were performed. A significant association of BMD_th values (P = 0.027) was found in genotype subgroups of 423-287G>A GSR polymorphism located in the third intron among postmenopausal women. Furthermore, women with at least one G allele showed significantly higher levels of BMD_fn (P = 0.044), BMD_th (P = 0.009), and BMD_ls (P = 0.043) than those that are AA homozygotes. Interestingly, the 423-287G>A_GSR*1154-393T>A_GSR combination was significantly associated with BMD_fn (P = 0.013) and BMD_th (P = 0.002) in postmenopausal women. The results of our study demonstrate for the first time that antioxidant enzyme GSR gene polymorphisms are significantly associated with BMD, suggesting that the A allele of 423-287G>A GSR polymorphism could contribute to decreased BMD values in postmenopausal women.

  2. In vivo kinetic approach reveals slow SOD1 turnover in the CNS

    PubMed Central

    Crisp, Matthew J.; Mawuenyega, Kwasi G.; Patterson, Bruce W.; Reddy, Naveen C.; Chott, Robert; Self, Wade K.; Weihl, Conrad C.; Jockel-Balsarotti, Jennifer; Varadhachary, Arun S.; Bucelli, Robert C.; Yarasheski, Kevin E.; Bateman, Randall J.; Miller, Timothy M.

    2015-01-01

    Therapeutic strategies that target disease-associated transcripts are being developed for a variety of neurodegenerative syndromes. Protein levels change as a function of their half-life, a property that critically influences the timing and application of therapeutics. In addition, both protein kinetics and concentration may play important roles in neurodegeneration; therefore, it is essential to understand in vivo protein kinetics, including half-life. Here, we applied a stable isotope-labeling technique in combination with mass spectrometric detection and determined the in vivo kinetics of superoxide dismutase 1 (SOD1), mutation of which causes amyotrophic lateral sclerosis. Application of this method to human SOD1-expressing rats demonstrated that SOD1 is a long-lived protein, with a similar half-life in both the cerebral spinal fluid (CSF) and the CNS. Additionally, in these animals, the half-life of SOD1 was longest in the CNS when compared with other tissues. Evaluation of this method in human subjects demonstrated successful incorporation of the isotope label in the CSF and confirmed that SOD1 is a long-lived protein in the CSF of healthy individuals. Together, the results of this study provide important insight into SOD1 kinetics and support application of this technique to the design and implementation of clinical trials that target long-lived CNS proteins. PMID:26075819

  3. In vivo kinetic approach reveals slow SOD1 turnover in the CNS.

    PubMed

    Crisp, Matthew J; Mawuenyega, Kwasi G; Patterson, Bruce W; Reddy, Naveen C; Chott, Robert; Self, Wade K; Weihl, Conrad C; Jockel-Balsarotti, Jennifer; Varadhachary, Arun S; Bucelli, Robert C; Yarasheski, Kevin E; Bateman, Randall J; Miller, Timothy M

    2015-07-01

    Therapeutic strategies that target disease-associated transcripts are being developed for a variety of neurodegenerative syndromes. Protein levels change as a function of their half-life, a property that critically influences the timing and application of therapeutics. In addition, both protein kinetics and concentration may play important roles in neurodegeneration; therefore, it is essential to understand in vivo protein kinetics, including half-life. Here, we applied a stable isotope-labeling technique in combination with mass spectrometric detection and determined the in vivo kinetics of superoxide dismutase 1 (SOD1), mutation of which causes amyotrophic lateral sclerosis. Application of this method to human SOD1-expressing rats demonstrated that SOD1 is a long-lived protein, with a similar half-life in both the cerebral spinal fluid (CSF) and the CNS. Additionally, in these animals, the half-life of SOD1 was longest in the CNS when compared with other tissues. Evaluation of this method in human subjects demonstrated successful incorporation of the isotope label in the CSF and confirmed that SOD1 is a long-lived protein in the CSF of healthy individuals. Together, the results of this study provide important insight into SOD1 kinetics and support application of this technique to the design and implementation of clinical trials that target long-lived CNS proteins.

  4. FUS-immunoreactive inclusions are a common feature in sporadic and non-SOD1 familial amyotrophic lateral sclerosis

    PubMed Central

    Deng, Han-Xiang; Zhai, Hong; Bigio, Eileen H.; Yan, Jianhua; Fecto, Faisal; Ajroud, Kaouther; Mishra, Manjari; Ajroud-Driss, Senda; Heller, Scott; Sufit, Robert; Siddique, Nailah; Mugnaini, Enrico; Siddique, Teepu

    2014-01-01

    Objective Amyotrophic lateral sclerosis (ALS) is a fatal disorder of motor neuron degeneration. Most cases of ALS are sporadic (SALS), but about 5-10% of ALS cases are familial (FALS). Recent studies have shown that mutations in FUS are causal in approximately 4-5% of FALS and some apparent SALS cases. The pathogenic mechanism of the mutant FUS-mediated ALS and potential roles of FUS in non-FUS ALS remain to be investigated. Methods Immunostaining was performed on postmortem spinal cords from 78 ALS cases, including SALS (n=52), ALS with dementia (ALS/dementia, n=10) and FALS (n=16). In addition, postmortem brains or spinal cords from 22 cases with or without frontotemporal lobar degeneration (FTLD) were also studied. In total, 100 cases were studied. Results FUS-immunoreactive inclusions were observed in spinal anterior horn neurons in all sporadic and familial ALS cases, except for those with SOD1 mutations. The FUS-containing inclusions were also immunoreactive with antibodies to TDP43, p62 and ubiquitin. A fraction of tested FUS antibodies recognized FUS inclusions and an unusual antigen retrieval appeared to be important for detection of the skein-like FUS inclusions. Interpretation Although mutations in FUS account for only a small fraction of FALS and SALS, our data suggest that FUS protein may be a common component of the cellular inclusions in non-SOD1 ALS and some other neurodegenerative conditions, implying a shared pathogenic pathway underlying SALS, non-SOD1 FALS, ALS/dementia and related disorders. Our data also indicate that SOD1-linked ALS may have a distinct pathogenic pathway from SALS and other types of FALS. PMID:20517935

  5. MLH1-93 G/a polymorphism is associated with MLH1 promoter methylation and protein loss in dysplastic sessile serrated adenomas with BRAFV600E mutation.

    PubMed

    Fennell, Lochlan J; Jamieson, Saara; McKeone, Diane; Corish, Tracie; Rohdmann, Megan; Furner, Tori; Bettington, Mark; Liu, Cheng; Kawamata, Futoshi; Bond, Catherine; Van De Pols, Jolieke; Leggett, Barbara; Whitehall, Vicki

    2018-01-05

    Sessile serrated adenomas with BRAF mutation progress rapidly to cancer following the development of dysplasia (SSAD). Approximately 75% of SSADs methylate the mismatch repair gene MLH1, develop mismatch repair deficiency and the resultant cancers have a good prognosis. The remaining SSADs and BRAF mutant traditional serrated adenomas (TSA) develop into microsatellite stable cancers with a poor prognosis. The reason for this dichotomy is unknown. In this study, we assessed the genotypic frequency of the MLH1-93 polymorphism rs1800734 in SSADs and TSAs to determine if the uncommon variant A allele predisposes to MLH1 promoter hypermethylation. We performed genotyping for the MLH1-93 polymorphism, quantitative methylation specific PCR, and MLH1 immunohistochemistry on 124 SSAD, 128 TSA, 203 BRAF mutant CRCs and 147 control subjects with normal colonoscopy. The minor A allele was significantly associated with a dose dependent increase in methylation at the MLH1 promoter in SSADs (p = 0.022). The AA genotype was only observed in SSADs with MLH1 loss. The A allele was also overrepresented in BRAF mutant cancers with MLH1 loss. Only one of the TSAs showed loss of MLH1 and the overall genotype distribution in TSAs did not differ from controls. The MLH1-93 AA genotype is significantly associated with promoter hypermethylation and MLH1 loss in the context of SSADs. BRAF mutant microsatellite stable colorectal cancers with the AA genotype most likely arise in TSAs since the A allele does not predispose to methylation in this context.

  6. Cellular Redox Systems Impact the Aggregation of Cu,Zn Superoxide Dismutase Linked to Familial Amyotrophic Lateral Sclerosis.

    PubMed

    Álvarez-Zaldiernas, Cristina; Lu, Jun; Zheng, Yujuan; Yang, Hongqian; Blasi, Juan; Solsona, Carles; Holmgren, Arne

    2016-08-12

    Protein misfolding is implicated in neurodegenerative diseases such as ALS, where mutations of superoxide dismutase 1 (SOD1) account for about 20% of the inherited mutations. Human SOD1 (hSOD1) contains four cysteines, including Cys(57) and Cys(146), which have been linked to protein stability and folding via forming a disulfide bond, and Cys(6) and Cys(111) as free thiols. But the roles of the cellular oxidation-reduction (redox) environment in SOD1 folding and aggregation are not well understood. Here we explore the effects of cellular redox systems on the aggregation of hSOD1 proteins. We found that the known hSOD1 mutations G93A and A4V increased the capability of the thioredoxin and glutaredoxin systems to reduce hSOD1 compared with wild-type hSOD1. Treatment with inhibitors of these redox systems resulted in an increase of hSOD1 aggregates in the cytoplasm of cells transfected with mutants but not in cells transfected with wild-type hSOD1 or those containing a secondary C111G mutation. This aggregation may be coupled to changes in the redox state of the G93A and A4V mutants upon mild oxidative stress. These results strongly suggest that the thioredoxin and glutaredoxin systems are the key regulators for hSOD1 aggregation and may play critical roles in the pathogenesis of ALS. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. The identification of HESX1 mutations in Kallmann syndrome

    PubMed Central

    Newbern, Kayce; Natrajan, Nithya; Kim, Hyung-Goo; Chorich, Lynn .P.; Halvorson, Lisa; Cameron, Richard S.; Layman, Lawrence C.

    2013-01-01

    Objective To determine if HESX1 mutations are present in patients with idiopathic hypogonadotropic hypogonadism (IHH)/Kallmann syndrome (KS). HESX1 mutations have previously been characterized in patients with septo-optic dysplasia (SOD), isolated growth hormone deficiency (IGHD), and combined pituitary hormone deficiency (CPHD). We hypothesized that IHH/KS represents a milder phenotypic variant of SOD. Design PCR-based DNA sequencing was performed on 217 well-characterized IHH/KS patients. Putative missense mutations were analyzed by sorting intolerant from tolerant (SIFT) and Clustal Ω. Setting An academic medical center Patients 217 IHH/KS and 192 controls Interventions DNA was extracted from patients and controls; genotype/phenotype comparisons were made Main Outcome Measures DNA sequence of HESX1, SIFT analysis, and ortholog alignment Results Two novel heterozygous missense mutations (p.H42Y and p.V75L) and previously reported heterozygous missense mutation p.Q6H in HESX1 were identified in 3/217 (1.4%) patients. All were males with KS. Both p.Q6H and p.H42Y were predicted to be deleterious by SIFT, while p.V75L was conserved in 8/9 species. No other IHH/KS gene mutations were present. Conclusions HESX1 mutations may cause KS in addition to more severe phenotypes. Our findings expand the phenotypic spectrum of HESX1 mutations in humans, thereby broadening its role in development. PMID:23465708

  8. Genetic Polymorphisms in SOD (rs2070424, rs7880) and CAT (rs7943316, rs1001179) Enzymes Are Associated with Increased Body Fat Percentage and Visceral Fat in an Obese Population from Central Mexico.

    PubMed

    Hernández-Guerrero, César; Hernández-Chávez, Paulina; Romo-Palafox, Inés; Blanco-Melo, Grecia; Parra-Carriedo, Alicia; Pérez-Lizaur, Ana

    2016-07-01

    Oxidative disturbance is an important factor involved in the etiology of comorbidities associated with obesity. Genetic polymorphisms such as SOD1 -251A>G, SOD2 47 C>T, CAT -21A>T and CAT -262 C>T have been described to alter the activity of antioxidant enzymes. The aim of the present work was to analyze the association of the mentioned SNPs with obesity and their relationship with anthropometric and clinical variables in this group. The study included 416 Mexican women (208 normal weight, NW and 208 subjects with obesity, OB). Dietary intake, anthropometric, biochemical and clinical features were evaluated and then analyzed in function of the genotypes. The mutated carriers (GA+GG) of SOD -251 were significantly higher in the OB group (0.24) compared to the NW group (0.08). The other SNPs showed no differences compared with control group. When comparing carrier mutated subjects with obesity vs. wild-type obese participants with the SNPs SOD1 -251, SOD2 47 and CAT -262, the carriers showed a significantly (p <0.05) higher value in body fat percentage. Also, carriers of SOD2 47 and CAT-262 showed significantly higher values (p = 0.002) and (p = 0.01), respectively, when visceral fat was compared between groups. Systolic blood pressure was significantly higher (p = 0.02) in carriers of mutated CAT-21. SOD1 -251A>G is associated with obesity independent of the presence of diabetes or dyslipidemia. Mutated obese carries of SOD1 -251, SOD2 47 and CAT -262 are associated with a higher distribution of fat in comparison with obese wild-type carriers. Copyright © 2016 IMSS. Published by Elsevier Inc. All rights reserved.

  9. Carnitine-acylcarnitine translocase deficiency with c.199-10 T>G and novel c.1A>G mutation: Two case reports and brief literature review.

    PubMed

    Yan, Hui-Ming; Hu, Hao; Ahmed, Aisha; Feng, Bing-Bing; Liu, Jing; Jia, Zheng-Jun; Wang, Hua

    2017-11-01

    Carnitine-acylcarnitine translocate deficiency (CACTD) is a rare and life-threatening, autosomal recessive disorder of fatty acid β-oxidation characterized by hypoketotic hypoglycemia, hyperammonemia, cardiomyopathy, liver dysfunction, and muscle weakness; culminating in early death. To date, CACTD cases screened from the Chinese mainland population, especially patient with compound heterozygote with c.199-10T>G and a novel c.1A>G mutation in the SLC25A20 gene has never been described. Herein, we report 2 neonatal cases of CACTD identified from the mainland China. These 2 patients were presented with severe metabolic crisis and their clinical conditions deteriorate rapidly and both died of cardiorespiratory collapse in the first week of life. We present the clinical and biochemical features of 2 probands and a brief literature review of previously reported CACTD cases with the c.199-10T>G mutation. The acylcarnitine profiles by tandem-mass-spectrometry and the mutation analysis of SLC25A20 gene confirmed the diagnosis of CACTD in both patients. Mutation analysis demonstrated that patient No. 1 was homozygous for c.199-10T>G mutation, while patient No. 2 was a compound heterozygote for 2 mutations, a maternally-inherited c.199-10T>G and a paternally-inherited, novel c.1A>G mutation. Both patients were treated with an aggressive treatment regimen include high glucose and arginine infusion, respiratory, and circulatory support. The first proband died 3 days after delivery due to sudden cardiac arrest. The second patient's clinical condition, at one time, was improved by high glucose infusion, intravenous arginine, and circulatory support. However, the patient failed to wean from mechanical ventilation. Unfortunately, her parents refused further treatment due to fear of financial burdens. The patient died of congestive heart failure in the 6th day of life. We report the first 2 cases of CACTD identified from the mainland China. Apart from a founder mutation c.199-10T>G

  10. A novel mutation in HESX1 causes combined pituitary hormone deficiency without septo optic dysplasia phenotypes.

    PubMed

    Takagi, Masaki; Takahashi, Mai; Ohtsu, Yoshiaki; Sato, Takeshi; Narumi, Satoshi; Arakawa, Hirokazu; Hasegawa, Tomonobu

    2016-04-25

    Heterozygous and/or homozygous HESX1 mutations have been reported to cause isolated growth hormone deficiency (IGHD) or combined pituitary hormone deficiency (CPHD), in association with septo optic dysplasia (SOD). We report a novel heterozygous HESX1 mutation in a CPHD patient without SOD phenotypes. The propositus was a one-year-old Japanese girl. Shortly after birth, she was found to be hypoglycemic. She was diagnosed with central adrenal insufficiency based on low cortisol and ACTH at a time of severe hypoglycemia. Further endocrine studies indicated that the patient also had central hypothyroidism and growth hormone deficiency. Using a next-generation sequencing strategy, we identified a novel heterozygous HESX1 mutation, c.326G>A (p.Arg109Gln). Western blotting and subcellular localization revealed no significant difference between wild type and mutant HESX1. Electrophoretic mobility shift assays showed that the mutant HESX1 abrogated DNA-binding ability. Mutant HESX1 was unable to repress PROP1-mediated activation. In conclusion, this study identified Arg109 as a critical residue in the HESX1 protein and extends our understanding of the phenotypic features, molecular mechanism, and developmental course associated with mutations in HESX1. When multiple genes need to be analyzed for mutations simultaneously, targeted sequence analysis of interesting genomic regions is an attractive approach.

  11. Interference-free determination of sub ng kg-1 levels of long-lived 93Zr in the presence of high concentrations (μg kg-1) of 93Mo and 93Nb using ICP-MS/MS.

    PubMed

    Petrov, Panayot; Russell, Ben; Douglas, David N; Goenaga-Infante, Heidi

    2018-01-01

    Long-lived high abundance radionuclides are of increasing interest with regard to decommissioning of nuclear sites and longer term nuclear waste storage and disposal. In many cases, no routine technique is available for their measurement in nuclear waste and low-level (ng kg -1 ) environmental samples. Recent advances in ICP-MS technology offer attractive features for the selective and sensitive determination of a wide range of long-lived radionuclides. In this work, inductively coupled plasma-tandem mass spectrometry (ICP-MS/MS)-based methodology, suitable for accurate routine determinations of 93 Zr at very low (ng kg -1 ) levels in the presence of high levels (μg kg -1 ) of the isobaric interferents 93 Nb and 93 Mo (often present in nuclear waste samples), is reported for the first time. Additionally, a novel and systematic strategy for method development based on the use of non-radioactive isotopes is proposed. It relies on gas-phase chemical reactions for different molecular ion formation to achieve isobaric interference removal. Using cell gas mixtures of NH 3 /He/H 2 or H 2 /O 2 , and suitable mass shifts, the signal from the 93 Nb and 93 Mo isobaric interferences on 93 Zr were suppressed by up to 5 orders of magnitude. The achieved limit of detection for 93 Zr was 1.3 × 10 -5  Bq g -1 (equivalent to 0.14 ng kg -1 ). The sample analysis time is 2 min, which represents a significant improvement in terms of sample throughput, compared to liquid scintillation counting methods. The method described here can be used for routine measurements of 93 Zr at environmentally relevant levels. It can also be combined with radiometric techniques for use towards the standardisation of 93 Zr measurements. Graphical abstract Interference-free determination of 93 Zr in the presence of high concentrations of isobaric 93 Mo and 93 Nb by ICP-MS/MS.

  12. Base substitution mutations in uridinediphosphate-dependent glycosyltransferase 76G1 gene of Stevia rebaudiana causes the low levels of rebaudioside A: mutations in UGT76G1, a key gene of steviol glycosides synthesis.

    PubMed

    Yang, Yong-Heng; Huang, Su-Zhen; Han, Yu-Lin; Yuan, Hai-Yan; Gu, Chun-Sun; Zhao, Yan-Hai

    2014-07-01

    Steviol glycosides, extracted from the leaves of Stevia rebaudiana (Bert) Bertoni, are calorie-free sugar substitute of natural origin with intensely sweet (Boileau et al., 2012). Stevioside and rebaudioside A are the two main kinds of the diterpenic glycosides. We analyzed the concentration of stevioside and rebaudioside A in Stevia leaves of about 500 samples (hybrid progenies) and discovered a mutation plant "Z05" with very low levels of rebaudioside A. Because UGT76G1, a uridinediphosphate-dependent glycosyltransferases, is responsible for the conversion from stevioside to rebaudioside A (Richman et al., 2005), so mutation identification was done by sequencing the candidate gene, UGT76G1. In this study molecular analysis of two strains revealed a heterozygotic nonsense mutation of c.389T > G (p.L121X) in UGT76G1. Meanwhile, we found some amino acid substitutions significant change the protein structure. And the difference of enzyme activity between two strains proved the lack of functionality of UGT76G1 of the mutation "Z05". So the nonsense mutation and amino acid substitution mutation resulted in the low levels of rebaudioside A. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  13. Import, maturation, and function of SOD1 and its copper chaperone CCS in the mitochondrial intermembrane space.

    PubMed

    Kawamata, Hibiki; Manfredi, Giovanni

    2010-11-01

    Cu, Zn, superoxide dismutase (SOD1) is a ubiquitous enzyme localized in multiple cellular compartments, including mitochondria, where it concentrates in the intermembrane space (IMS). Similar to other small IMS proteins, the import and retention of SOD1 in the IMS is linked to its folding and maturation, involving the formation of critical intra- and intermolecular disulfide bonds. Therefore, the cysteine residues of SOD1 play a fundamental role in its IMS localization. IMS import of SOD1 involves its copper chaperone, CCS, whose mitochondrial distribution is regulated by the Mia40/Erv1 disulfide relay system in a redox-dependent manner: CCS promotes SOD1 maturation and retention in the IMS. The function of SOD1 in the IMS is still unknown, but it is plausible that it serves to remove superoxide released from the mitochondrial respiratory chain. Mutations in SOD1 cause familial amyotrophic lateral sclerosis (ALS), whose pathologic features include mitochondrial bioenergetic dysfunction. Mutant SOD1 localization in the IMS is not dictated by oxygen concentration and the Mia40/Erv1 system, but is primarily dependent on aberrant protein folding and aggregation. Mutant SOD1 localization and aggregation in the IMS might cause the mitochondrial abnormalities observed in familial ALS and could play a significant role in disease pathogenesis.

  14. Association of breast-fed neonatal hyperbilirubinemia with UGT1A1 polymorphisms: 211G>A (G71R) mutation becomes a risk factor under inadequate feeding.

    PubMed

    Sato, Hiroko; Uchida, Toshihiko; Toyota, Kentaro; Kanno, Miyako; Hashimoto, Taeko; Watanabe, Masashi; Nakamura, Tomohiro; Tamiya, Gen; Aoki, Kuraaki; Hayasaka, Kiyoshi

    2013-01-01

    Breastfeeding jaundice is a well-known phenomenon, but its pathogenesis is still unclear. Increased production of bilirubin, impaired hepatic uptake and metabolism of bilirubin, and increased enterohepatic circulation of bilirubin account for most cases of pathological neonatal hyperbilirubinemia. We previously reported that 211G>A (G71R) mutation of the UGT1A1 gene is prevalent in East Asians and is associated with the development of neonatal hyperbilirubinemia. Recently, significant association of G71R mutation with hyperbilirubinemia in breast-fed neonates was reported. We enrolled 401 full-term Japanese infants, who were exclusively breast-fed without supplementation of formula before developing hyperbilirubinemia, and classified them into two groups based on the degree of maximal body weight loss during the neonatal period. We analyzed the sex, gestational age, delivery mode, body weight at birth, maximal body weight loss and genotypes of G71R and (TA)(7) polymorphic mutations of UGT1A1. Statistical analysis revealed that maximal body weight loss during the neonatal period is the only independent risk factor for the development of neonatal hyperbilirubinemia. The effect of G71R mutation on neonatal hyperbilirubinemia is significant in neonates with 5% or greater maximal body weight loss and its influence increases in parallel with the degree of maximal body weight loss. Our study indicates that G71R mutation is a risk factor for neonatal hyperbilirubinemia only in infants with inadequate breastfeeding and suggests that adequate breastfeeding may overcome the genetic predisposing factor, G71R mutation, for the development of neonatal hyperbilirubinemia.

  15. CHEK2 1100delC, IVS2+1G>A and I157T mutations are not present in colorectal cancer cases from Turkish population.

    PubMed

    Bayram, Süleyman; Topaktaş, Mehmet; Akkız, Hikmet; Bekar, Aynur; Akgöllü, Ersin

    2012-10-01

    The cell cycle checkpoint kinase 2 (CHEK2) protein participates in the DNA damage response in many cell types. Germline mutations in CHEK2 (1100delC, IVS2+1G>A and I157T) have been impaired serine/threonine kinase activity and associated with a range of cancer types. This hospital-based case-control study aimed to investigate whether CHEK2 1100delC, IVS2+1G>A and I157T mutations play an important role in the development of colorectal cancer (CRC) in Turkish population. A total of 210 CRC cases and 446 cancer-free controls were genotyped for CHEK2 mutations by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and allele specific-polymerase chain reaction (AS-PCR) methods. We did not find the CHEK2 1100delC, IVS2+1G>A and I157T mutations in any of the Turkish subjects. Our result demonstrate for the first time that CHEK2 1100delC, IVS2+1G>A and I157T mutations have not been agenetic susceptibility factor for CRC in the Turkish population. Overall, our data suggest that genotyping of CHEK2 mutations in clinical settings in the Turkish population should not be recommended. However, independent studies are need to validate our findings in a larger series, as well as in patients of different ethnic origins. Copyright © 2012 Elsevier Ltd. All rights reserved.

  16. [Diabetes mellitus associated with the mitochondrial mutation A3243G: frequency and clinical presentation].

    PubMed

    Salles, João Eduardo N; Kalinin, Larissa Bresgunov; Ferreira, Sandra Roberta G; Kasamatsu, Teresa; Moisés, Regina S

    2007-06-01

    Maternal inherited diabetes and deafness (MIDD) has been related to an A to G transition in the mitochondrial RNA Leu (UUR) at base pair 3243. The prevalence of MIDD in the diabetes population ranges between 0.5-3.0% depending on the ethnic background. To examine the frequency and clinical features of diabetes associated with this mutation in Brazilian patients with glucose intolerance. The study population comprised: 78 type 1 diabetic subjects (group I), 148 patients with type 2 diabetes (group II), 15 patients with either type 1 or type 2 diabetes and hearing loss (group III) and 492 Japanese Brazilians with varying degrees of glucose intolerance. DNA was extracted from peripheral blood leucocytes and the A3243G mutation was determined by PCR amplification and Apa 1 digestion. In some individuals DNA was also extracted from buccal mucosa and hair follicles. The 3243 bp mutation was found in three individuals, all from group III, resulting in a prevalence of 0.4%. These subjects had an early age of diagnosis of diabetes, low or normal body mass index and requirement of insulin therapy. In conclusion MIDD is rare in our population and should be investigate in patients with diabetes and deafness.

  17. R248G cystic fibrosis transmembrane conductance regulator mutation in three siblings presenting with recurrent acute pancreatitis and reproductive issues: a case series.

    PubMed

    Villalona, Seiichi; Glover-López, Guillermo; Ortega-García, Juan Antonio; Moya-Quiles, Rosa; Mondejar-López, Pedro; Martínez-Romero, Maria C; Rigabert-Montiel, Mariano; Pastor-Vivero, María D; Sánchez-Solís, Manuel

    2017-02-15

    Mutational combinations of the cystic fibrosis transmembrane conductance regulator, CFTR, gene have different phenotypic manifestations at the molecular level with varying clinical consequences for individuals possessing such mutations. Reporting cystic fibrosis transmembrane conductance regulator mutations is important in understanding the genotype-phenotype correlations and associated clinical presentations in patients with cystic fibrosis. Understanding the effects of mutations is critical in developing appropriate treatments for individuals affected with cystic fibrosis, non-classic cystic fibrosis, or cystic fibrosis transmembrane conductance regulator-related disorders. This is the first report of related individuals possessing the R248G missense cystic fibrosis transmembrane conductance regulator mutation and we present their associated clinical histories. All three patients are of Spanish descent. Deoxyribonucleic acid analysis revealed that all three siblings possessed a novel c.742A>G mutation, resulting in a p.Arg248Gly (R248G) amino acid change in exon 6 in trans with the known N1303K mutant allele. Case 1 patient is a 39-year-old infertile man presenting with congenital unilateral absence of the vas deferens and recurrent episodes of epigastric pain. Case 2 patient is a 32-year-old woman presenting with periods of infertility, two previous spontaneous abortions, recurrent epigastric pain, and recurrent pancreatitis. Case 3 patient is a 29-year-old woman presenting with recurrent pancreatitis and epigastric pain. We report the genotype-phenotype correlations and clinical manifestations of a novel R248G cystic fibrosis transmembrane conductance regulator mutation: congenital unilateral absence of the vas deferens in males, reduced female fertility, and recurrent acute pancreatitis. In addition, we discuss the possible functional consequences of the mutations at the molecular level.

  18. SOD1 oxidation and formation of soluble aggregates in yeast: Relevance to sporadic ALS development

    PubMed Central

    Martins, Dorival; English, Ann M.

    2014-01-01

    Misfolding and aggregation of copper–zinc superoxide dismutase (Sod1) are observed in neurodegenerative diseases such as amyotrophic lateral sclerosis (ALS). Mutations in Sod1 lead to familial ALS (FALS), which is a late-onset disease. Since oxidative damage to proteins increases with age, it had been proposed that oxidation of Sod1 mutants may trigger their misfolding and aggregation in FALS. However, over 90% of ALS cases are sporadic (SALS) with no obvious genetic component. We hypothesized that oxidation could also trigger the misfolding and aggregation of wild-type Sod1 and sought to confirm this in a cellular environment. Using quiescent, stationary-phase yeast cells as a model for non-dividing motor neurons, we probed for post-translational modification (PTM) and aggregation of wild-type Sod1 extracted from these cells. By size-exclusion chromatography (SEC), we isolated two populations of Sod1 from yeast: a low-molecular weight (LMW) fraction that is catalytically active and a catalytically inactive, high-molecular weight (HMW) fraction. High-resolution mass spectrometric analysis revealed that LMW Sod1 displays no PTMs but HMW Sod1 is oxidized at Cys146 and His71, two critical residues for the stability and folding of the enzyme. HMW Sod1 is also oxidized at His120, a copper ligand, which will promote loss of this catalytic metal cofactor essential for SOD activity. Monitoring the fluorescence of a Sod1-green-fluorescent-protein fusion (Sod1-GFP) extracted from yeast chromosomally expressing this fusion, we find that HMW Sod1-GFP levels increase up to 40-fold in old cells. Thus, we speculate that increased misfolding and inclusion into soluble aggregates is a consequence of elevated oxidative modifications of wild-type Sod1 as cells age. Our observations argue that oxidative damage to wild-type Sod1 initiates the protein misfolding mechanisms that give rise to SALS. PMID:24936435

  19. Contribution of the MLH1 -93G>a promoter polymorphism in modulating susceptibility risk in Malaysian colorectal cancer patients.

    PubMed

    Nizam, Zahary Mohd; Abdul Aziz, Ahmad Aizat; Kaur, Gurjeet; Abu Hassan, Muhammad Radzi; Mohd Sidek, Ahmad Shanwani; Yeh, Lee Yeong; Mazuwin, Maya; Ankathil, Ravindran

    2013-01-01

    Colorectal cancer (CRC) exists in a more common sporadic form and less common hereditary forms, associated with the Lynch syndrome, familial adenomatous polyposis (FAP) and other rare syndromes. Sporadic CRC is believed to arise as a result of close interaction between environmental factors, including dietary and lifestyle habits, and genetic predisposition factors. In contrast, hereditary forms such as those related to the Lynch syndrome result from inheritance of germline mutations of mismatch repair (MMR) genes. However, in certain cases, the influence of low penetrance alleles in familial colorectal cancer susceptibility is also undeniable. To investigate the genotype frequencies of MLH1 promoter polymorphism -93G>A and to determine whether it could play any role in modulating familial and sporadic CRC susceptibility risk. A case-control study comprising of 104 histopathologically confirmed CRC patients as cases (52 sporadic CRC and 52 Lynch syndrome patients) and 104 normal healthy individuals as controls was undertaken. DNA was extracted from peripheral blood and the polymorphism was genotyped employing PCR-RFLP methods. The genotypes were categorized into homozygous wild type, heterozygous and homozygous variants. The risk association between these polymorphisms and CRC susceptibility risk was calculated using binary logistic regression analysis and deriving odds ratios (ORs). When risk association was investigated for all CRC patients as a single group, the heterozygous (G/A) genotype showed a significantly higher risk for CRC susceptibility with an OR of 2.273, (95%CI: 1.133-4.558 and p-value=0.021). When analyzed specifically for the 2 types of CRC, the heterozygous (G/A) genotype showed significantly higher risk for sporadic CRC susceptibility with and OR of 3.714, (95%CI: 1.416-9.740 and p-value=0.008). Despite high OR value was observed for Lynch syndrome (OR: 1.600, 95%CI: 0.715-3.581), the risk was not statistically significant (P=0.253). Our results

  20. A High-Throughput Screening Method for Small-Molecule Inhibitors of the Aberrant Mutant SOD1 and Dynein Complex Interaction

    PubMed Central

    Tang, Xiaohu; Seyb, Kathleen I.; Huang, Mickey; Schuman, Eli R.; Shi, Ping; Zhu, Haining; Glicksman, Marcie A.

    2013-01-01

    Aberrant protein-protein interactions are attractive drug targets in a variety of neurodegenerative diseases due to the common pathology of accumulation of protein aggregates. In amyotrophic lateral sclerosis, mutations in SOD1 cause the formation of aggregates and inclusions that may sequester other proteins and disrupt cellular processes. It has been demonstrated that mutant SOD1, but not wild-type SOD1, interacts with the axonal transport motor dynein and that this interaction contributes to motor neuron cell death, suggesting that disrupting this interaction may be a potential therapeutic target. However, it can be challenging to configure a high-throughput screening (HTS)–compatible assay to detect inhibitors of a protein-protein interaction. Here we describe the development and challenges of an HTS for small-molecule inhibitors of the mutant SOD1-dynein interaction. We demonstrate that the interaction can be formed by coexpressing the A4V mutant SOD1 and dynein intermediate complex in cells and that this interaction can be disrupted by compounds added to the cell lysates. Finally, we show that some of the compounds identified from a pilot screen to inhibit the protein-protein interaction with this method specifically disrupt the interaction between the dynein complex and mtSOD1 but not the dynein complex itself when applied to live cells. PMID:22140121

  1. Superoxide Dismutases, SOD1 and SOD2, Play a Distinct Role in the Fat Body during Pupation in Silkworm Bombyx mori

    PubMed Central

    Nojima, Yosui; Ito, Katsuhiko; Ono, Hiromasa; Nakazato, Takeru; Bono, Hidemasa; Yokoyama, Takeshi; Sato, Ryoichi; Suetsugu, Yoshitaka; Nakamura, Yuki; Yamamoto, Kimiko; Satoh, Jun-ichi; Tabunoki, Hiroko; Fugo, Hajime

    2015-01-01

    One way that aerobic biological systems counteract the generation of reactive oxygen species (ROS) is with superoxide dismutase proteins SOD1 and SOD2 that metabolize superoxide radicals to molecular oxygen and hydrogen peroxide or scavenge oxygen radicals produced by the extensive oxidation-reduction and electron-transport reactions that occur in mitochondria. We characterized SOD1 and SOD2 of Bombyx mori isolated from the fat body of larvae. Immunological analysis demonstrated the presence of BmSOD1 and BmSOD2 in the silk gland, midgut, fat body, Malpighian tubules, testis and ovary from larvae to adults. We found that BmSOD2 had a unique expression pattern in the fat body through the fifth instar larval developmental stage. The anti-oxidative functions of BmSOD1 and BmSOD2 were assessed by exposing larvae to insecticide rotenone or vasodilator isosorbide dinitrate, which is an ROS generator in BmN4 cells; however, exposure to these compounds had no effect on the expression levels of either BmSOD protein. Next, we investigated the physiological role of BmSOD1 and BmSOD2 under environmental oxidative stress, applied through whole-body UV irradiation and assayed using quantitative RT-PCR, immunoblotting and microarray analysis. The mRNA expression level of both BmSOD1 and BmSOD2 was markedly increased but protein expression level was increased only slightly. To examine the differences in mRNA and protein level due to UV irradiation intensity, we performed microarray analysis. Gene set enrichment analysis revealed that genes in the insulin signaling pathway and PPAR signaling pathway were significantly up-regulated after 6 and 12 hours of UV irradiation. Taken together, the activities of BmSOD1 and BmSOD2 may be related to the response to UV irradiation stress in B. mori. These results suggest that BmSOD1 and BmSOD2 modulate environmental oxidative stress in the cell and have a specific role in fat body of B. mori during pupation. PMID:25714339

  2. DJ-1 Is a Copper Chaperone Acting on SOD1 Activation*

    PubMed Central

    Girotto, Stefania; Cendron, Laura; Bisaglia, Marco; Tessari, Isabella; Mammi, Stefano; Zanotti, Giuseppe; Bubacco, Luigi

    2014-01-01

    Lack of oxidative stress control is a common and often prime feature observed in many neurodegenerative diseases. Both DJ-1 and SOD1, proteins involved in familial Parkinson disease and amyotrophic lateral sclerosis, respectively, play a protective role against oxidative stress. Impaired activity and modified expression of both proteins have been observed in different neurodegenerative diseases. A potential cooperative action of DJ-1 and SOD1 in the same oxidative stress response pathway may be suggested based on a copper-mediated interaction between the two proteins reported here. To investigate the mechanisms underlying the antioxidative function of DJ-1 in relation to SOD1 activity, we investigated the ability of DJ-1 to bind copper ions. We structurally characterized a novel copper binding site involving Cys-106, and we investigated, using different techniques, the kinetics of DJ-1 binding to copper ions. The copper transfer between the two proteins was also examined using both fluorescence spectroscopy and specific biochemical assays for SOD1 activity. The structural and functional analysis of the novel DJ-1 copper binding site led us to identify a putative role for DJ-1 as a copper chaperone. Alteration of the coordination geometry of the copper ion in DJ-1 may be correlated to the physiological role of the protein, to a potential failure in metal transfer to SOD1, and to successive implications in neurodegenerative etiopathogenesis. PMID:24567322

  3. Genetic Correction of SOD1 Mutant iPSCs Reveals ERK and JNK Activated AP1 as a Driver of Neurodegeneration in Amyotrophic Lateral Sclerosis.

    PubMed

    Bhinge, Akshay; Namboori, Seema C; Zhang, Xiaoyu; VanDongen, Antonius M J; Stanton, Lawrence W

    2017-04-11

    Although mutations in several genes with diverse functions have been known to cause amyotrophic lateral sclerosis (ALS), it is unknown to what extent causal mutations impinge on common pathways that drive motor neuron (MN)-specific neurodegeneration. In this study, we combined induced pluripotent stem cells-based disease modeling with genome engineering and deep RNA sequencing to identify pathways dysregulated by mutant SOD1 in human MNs. Gene expression profiling and pathway analysis followed by pharmacological screening identified activated ERK and JNK signaling as key drivers of neurodegeneration in mutant SOD1 MNs. The AP1 complex member JUN, an ERK/JNK downstream target, was observed to be highly expressed in MNs compared with non-MNs, providing a mechanistic insight into the specific degeneration of MNs. Importantly, investigations of mutant FUS MNs identified activated p38 and ERK, indicating that network perturbations induced by ALS-causing mutations converge partly on a few specific pathways that are drug responsive and provide immense therapeutic potential. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  4. Disease-associated extracellular loop mutations in the adhesion G protein-coupled receptor G1 (ADGRG1; GPR56) differentially regulate downstream signaling.

    PubMed

    Kishore, Ayush; Hall, Randy A

    2017-06-09

    Mutations to the adhesion G protein-coupled receptor ADGRG1 (G1; also known as GPR56) underlie the neurological disorder bilateral frontoparietal polymicrogyria. Disease-associated mutations in G1 studied to date are believed to induce complete loss of receptor function through disruption of either receptor trafficking or signaling activity. Given that N-terminal truncation of G1 and other adhesion G protein-coupled receptors has been shown to significantly increase the receptors' constitutive signaling, we examined two different bilateral frontoparietal polymicrogyria-inducing extracellular loop mutations (R565W and L640R) in the context of both full-length and N-terminally truncated (ΔNT) G1. Interestingly, we found that these mutations reduced surface expression of full-length G1 but not G1-ΔNT in HEK-293 cells. Moreover, the mutations ablated receptor-mediated activation of serum response factor luciferase, a classic measure of Gα 12/13 -mediated signaling, but had no effect on G1-mediated signaling to nuclear factor of activated T cells (NFAT) luciferase. Given these differential signaling results, we sought to further elucidate the pathway by which G1 can activate NFAT luciferase. We found no evidence that ΔNT activation of NFAT is dependent on Gα q/11 -mediated or β-arrestin-mediated signaling but rather involves liberation of Gβγ subunits and activation of calcium channels. These findings reveal that disease-associated mutations to the extracellular loops of G1 differentially alter receptor trafficking, depending on the presence of the N terminus, and differentially alter signaling to distinct downstream pathways. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. The mitochondrial DNA 10197 G > A mutation causes MELAS/Leigh overlap syndrome presenting with acute auditory agnosia.

    PubMed

    Leng, Yinglin; Liu, Yuhe; Fang, Xiaojing; Li, Yao; Yu, Lei; Yuan, Yun; Wang, Zhaoxia

    2015-04-01

    Mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes/Leigh (MELAS/LS) overlap syndrome is a mitochondrial disorder subtype with clinical and magnetic resonance imaging (MRI) features that are characteristic of both MELAS and Leigh syndrome (LS). Here, we report an MELAS/LS case presenting with cortical deafness and seizures. Cranial MRI revealed multiple lesions involving bilateral temporal lobes, the basal ganglia and the brainstem, which conformed to neuroimaging features of both MELAS and LS. Whole mitochondrial DNA (mtDNA) sequencing and PCR-RFLP revealed a de novo heteroplasmic m.10197 G > A mutation in the NADH dehydrogenase subunit 3 gene (ND3), which was predicted to cause an alanine to threonine substitution at amino acid 47. Although the mtDNA m.10197 G > A mutation has been reported in association with LS, Leber hereditary optic neuropathy and dystonia, it has never been linked with MELAS/LS overlap syndrome. Our patient therefore expands the phenotypic spectrum of the mtDNA m.10197 G > A mutation.

  6. STS-93 Post Flight Presentation

    NASA Technical Reports Server (NTRS)

    1999-01-01

    An overview of Flight STS-93 is presented. The primary objective of the STS-93 mission was to deploy the Advanced X-Ray Astrophysics Facility (AXAF), also known as the Chandra X-ray Observatory. The mission flew on the Columbia Shuttle, on July 22, 1999. This facility is the most sophisticated X-ray observatory ever built. Other payloads on STS-93 were: (1) the Midcourse Space Experiment (MSX), (2) Shuttle Ionospheric Modification with Pulsed Local Exhaust (SIMPLEX), (3) Southwest Ultraviolet Imaging System (SWUIS), (4) Gelation of Sols: Applied Microgravity Research (GOSAMR), Space Tissue Loss-B (STL-B), (5) Light Weight Flexible Solar Array Hinge (LFSAH), (6) Cell Culture Module (CCM), and (7) the Shuttle Amateur Radio Experiment-II (SAREX-II), (8) EarthKam, (9) Plant Growth Investigations in Microgravity (PGIM), (10) Commercial Generic Bioprocessing Apparatus (CGBA), (11) Micro-Electrical Mechanical System (MEMS), and (12) the Biological Research in Canisters (BRIC). The crew was: Eileen M. Collins, Mission Commander, the first female shuttle commander; Jeffrey S. Ashby, Pilot; Steven A. Hawley , Mission Specialist; Catherine G. Coleman, Mission Specialist; Michel Tognini (CNES), Mission Specialist. The video contains views of life aboard the space shuttle. This mission featured both a night launching and a night landing at the Kennedy Space Center.

  7. Identification of a novel COL1A1 frameshift mutation, c.700delG, in a Chinese osteogenesis imperfecta family

    PubMed Central

    Wang, Xiran; Pei, Yu; Dou, Jingtao; Lu, Juming; Li, Jian; Lv, Zhaohui

    2015-01-01

    Osteogenesis imperfecta (OI) is a family of genetic disorders associated with bone loss and fragility. Mutations associated with OI have been found in genes encoding the type I collagen chains. People with OI type I often produce insufficient α1-chain type I collagen because of frameshift, nonsense, or splice site mutations in COL1A1 or COL1A2. This report is of a Chinese daughter and mother who had both experienced two bone fractures. Because skeletal fragility is predominantly inherited, we focused on identifying mutations in COL1A1 and COL1A2 genes. A novel mutation in COL1A1, c.700delG, was detected by genomic DNA sequencing in the mother and daughter, but not in their relatives. The identification of this mutation led to the conclusion that they were affected by mild OI type I. Open reading frame analysis indicated that this frameshift mutation would truncate α1-chain type I collagen at residue p263 (p.E234KfsX264), while the wild-type protein would contain 1,464 residues. The clinical data were consistent with the patients’ diagnosis of mild OI type I caused by haploinsufficiency of α1-chain type I collagen. Combined with previous reports, identification of the novel mutation COL1A1-c.700delG in these patients suggests that additional genetic and environmental factors may influence the severity of OI. PMID:25983617

  8. Comparison of Whole Body SOD1 Knockout with Muscle-Specific SOD1 Knockout Mice Reveals a Role for Nerve Redox Signaling in Regulation of Degenerative Pathways in Skeletal Muscle.

    PubMed

    Sakellariou, Giorgos K; McDonagh, Brian; Porter, Helen; Giakoumaki, Ifigeneia I; Earl, Kate E; Nye, Gareth A; Vasilaki, Aphrodite; Brooks, Susan V; Richardson, Arlan; Van Remmen, Holly; McArdle, Anne; Jackson, Malcolm J

    2018-02-01

    Lack of Cu,Zn-superoxide dismutase (CuZnSOD) in homozygous knockout mice (Sod1 -/- ) leads to accelerated age-related muscle loss and weakness, but specific deletion of CuZnSOD in skeletal muscle (mSod1KO mice) or neurons (nSod1KO mice) resulted in only mild muscle functional deficits and failed to recapitulate the loss of mass and function observed in Sod1 -/- mice. To dissect any underlying cross-talk between motor neurons and skeletal muscle in the degeneration in Sod1 -/- mice, we characterized neuromuscular changes in the Sod1 -/- model compared with mSod1KO mice and examined degenerative molecular mechanisms and pathways in peripheral nerve and skeletal muscle. In contrast to mSod1KO mice, myofiber atrophy in Sod1 -/- mice was associated with increased muscle oxidative damage, neuromuscular junction degeneration, denervation, nerve demyelination, and upregulation of proteins involved in maintenance of myelin sheaths. Proteomic analyses confirmed increased proteasomal activity and adaptive stress responses in muscle of Sod1 -/- mice that were absent in mSod1KO mice. Peripheral nerve from neither Sod1 -/- nor mSod1KO mice showed increased oxidative damage or molecular responses to increased oxidation compared with wild type mice. Differential cysteine (Cys) labeling revealed a specific redox shift in the catalytic Cys residue of peroxiredoxin 6 (Cys47) in the peripheral nerve from Sod1 -/- mice. Innovation and Conclusion: These findings demonstrate that neuromuscular integrity, redox mechanisms, and pathways are differentially altered in nerve and muscle of Sod1 -/- and mSod1KO mice. Results support the concept that impaired redox signaling, rather than oxidative damage, in peripheral nerve plays a key role in muscle loss in Sod1 -/- mice and potentially sarcopenia during aging. Antioxid. Redox Signal. 28, 275-295.

  9. Atomic structure of a toxic, oligomeric segment of SOD1 linked to amyotrophic lateral sclerosis (ALS)

    PubMed Central

    Sangwan, Smriti; Zhao, Anni; Adams, Katrina L.; Jayson, Christina K.; Sawaya, Michael R.; Guenther, Elizabeth L.; Pan, Albert C.; Ngo, Jennifer; Moore, Destaye M.; Soriaga, Angela B.; Do, Thanh D.; Goldschmidt, Lukasz; Nelson, Rebecca; Bowers, Michael T.; Koehler, Carla M.; Shaw, David E.; Novitch, Bennett G.; Eisenberg, David S.

    2017-01-01

    Fibrils and oligomers are the aggregated protein agents of neuronal dysfunction in ALS diseases. Whereas we now know much about fibril architecture, atomic structures of disease-related oligomers have eluded determination. Here, we determine the corkscrew-like structure of a cytotoxic segment of superoxide dismutase 1 (SOD1) in its oligomeric state. Mutations that prevent formation of this structure eliminate cytotoxicity of the segment in isolation as well as cytotoxicity of the ALS-linked mutants of SOD1 in primary motor neurons and in a Danio rerio (zebrafish) model of ALS. Cytotoxicity assays suggest that toxicity is a property of soluble oligomers, and not large insoluble aggregates. Our work adds to evidence that the toxic oligomeric entities in protein aggregation diseases contain antiparallel, out-of-register β-sheet structures and identifies a target for structure-based therapeutics in ALS. PMID:28760994

  10. Novel mutations of MYO7A and USH1G in Israeli Arab families with Usher syndrome type 1.

    PubMed

    Rizel, Leah; Safieh, Christine; Shalev, Stavit A; Mezer, Eedy; Jabaly-Habib, Haneen; Ben-Neriah, Ziva; Chervinsky, Elena; Briscoe, Daniel; Ben-Yosef, Tamar

    2011-01-01

    This study investigated the genetic basis for Usher syndrome type 1 (USH1) in four consanguineous Israeli Arab families. Haplotype analysis for all known USH1 loci was performed in each family. In families for which haplotype analysis was inconclusive, we performed genome-wide homozygosity mapping using a single nucleotide polymorphism (SNP) array. For mutation analysis, specific primers were used to PCR amplify the coding exons of the MYO7A, USH1C, and USH1G genes including intron-exon boundaries. Mutation screening was performed with direct sequencing. A combination of haplotype analysis and genome-wide homozygosity mapping indicated linkage to the USH1B locus in two families, USH1C in one family and USH1G in another family. Sequence analysis of the relevant genes (MYO7A, USH1C, and USH1G) led to the identification of pathogenic mutations in all families. Two of the identified mutations are novel (c.1135-1147dup in MYO7A and c.206-207insC in USH1G). USH1 is a genetically heterogenous condition. Of the five USH1 genes identified to date, USH1C and USH1G are the rarest contributors to USH1 etiology worldwide. It is therefore interesting that two of the four Israeli Arab families reported here have mutations in these two genes. This finding further demonstrates the unique genetic structure of the Israeli population in general, and the Israeli Arab population in particular, which due to high rates of consanguinity segregates many rare autosomal recessive genetic conditions.

  11. The Omega-3 Fatty Acid Eicosapentaenoic Acid Accelerates Disease Progression in a Model of Amyotrophic Lateral Sclerosis

    PubMed Central

    Gladman, Stacy; Biggio, Maria Luigia; Marino, Marianna; Jayasinghe, Maduka; Ullah, Farhan; Dyall, Simon C.; Malaspina, Andrea; Bendotti, Caterina; Michael-Titus, Adina

    2013-01-01

    Amyotrophic lateral sclerosis (ALS) is a progressive fatal neurodegenerative disease characterised by loss of motor neurons that currently has no cure. Omega-3 polyunsaturated fatty acids, such as eicosapentaenoic acid (EPA), have many health benefits including neuroprotective and myoprotective potential. We tested the hypothesis that a high level of dietary EPA could exert beneficial effects in ALS. The dietary exposure to EPA (300 mg/kg/day) in a well-established mouse model of ALS expressing the G93A superoxide dismutase 1 (SOD1) mutation was initiated at a pre-symptomatic or symptomatic stage, and the disease progression was monitored until the end stage. Daily dietary EPA exposure initiated at the disease onset did not significantly alter disease presentation and progression. In contrast, EPA treatment initiated at the pre-symptomatic stage induced a significantly shorter lifespan. In a separate group of animals sacrificed before the end stage, the tissue analysis showed that the vacuolisation detected in G93A-SOD1 mice was significantly increased by exposure to EPA. Although EPA did not alter motor neurone loss, EPA reversed the significant increase in activated microglia and the astrocytic activation seen in G93A-SOD1 mice. The microglia in the spinal cord of G93A-SOD1 mice treated with EPA showed a significant increase in 4-hydroxy-2-hexenal, a highly toxic aldehydic oxidation product of omega-3 fatty acids. These data show that dietary EPA supplementation in ALS has the potential to worsen the condition and accelerate the disease progression. This suggests that great caution should be exerted when considering dietary omega-3 fatty acid supplements in ALS patients. PMID:23620776

  12. Calcium Ions Promote Superoxide Dismutase 1 (SOD1) Aggregation into Non-fibrillar Amyloid

    PubMed Central

    Leal, Sónia S.; Cardoso, Isabel; Valentine, Joan S.; Gomes, Cláudio M.

    2013-01-01

    Imbalance in metal ion homeostasis is a hallmark in neurodegenerative conditions involving protein deposition, and amyotrophic lateral sclerosis (ALS) is no exception. In particular, Ca2+ dysregulation has been shown to correlate with superoxide dismutase-1 (SOD1) aggregation in a cellular model of ALS. Here we present evidence that SOD1 aggregation is enhanced and modulated by Ca2+. We show that at physiological pH, Ca2+ induces conformational changes that increase SOD1 β-sheet content, as probed by far UV CD and attenuated total reflectance-FTIR, and enhances SOD1 hydrophobicity, as probed by ANS fluorescence emission. Moreover, dynamic light scattering analysis showed that Ca2+ boosts the onset of SOD1 aggregation. In agreement, Ca2+ decreases SOD1 critical concentration and nucleation time during aggregation kinetics, as evidenced by thioflavin T fluorescence emission. Attenuated total reflectance FTIR analysis showed that Ca2+ induced aggregates consisting preferentially of antiparallel β-sheets, thus suggesting a modulation effect on the aggregation pathway. Transmission electron microscopy and analysis with conformational anti-fibril and anti-oligomer antibodies showed that oligomers and amyloidogenic aggregates constitute the prevalent morphology of Ca2+-induced aggregates, thus indicating that Ca2+ diverts SOD1 aggregation from fibrils toward amorphous aggregates. Interestingly, the same heterogeneity of conformations is found in ALS-derived protein inclusions. We thus hypothesize that transient variations and dysregulation of cellular Ca2+ levels contribute to the formation of SOD1 aggregates in ALS patients. In this scenario, Ca2+ may be considered as a pathogenic effector in the formation of ALS proteinaceous inclusions. PMID:23861388

  13. Enhanced tethered-flight duration and locomotor activity by overexpression of the human gene SOD1 in Drosophila motorneurons.

    PubMed

    Petrosyan, Agavni; Hsieh, I-Hui; Phillips, John P; Saberi, Kourosh

    2015-03-01

    Mutation of the human gene superoxide dismutase (hSOD1) is associated with the fatal neurodegenerative disease familial amyotrophic lateral sclerosis (Lou Gehrig's disease). Selective overexpression of hSOD1 in Drosophila motorneurons increases lifespan to 140% of normal. The current study was designed to determine resistance to lifespan decline and failure of sensorimotor functions by overexpressing hSOD1 in Drosophila's motorneurons. First, we measured the ability to maintain continuous flight and wingbeat frequency (WBF) as a function of age (5 to 50 days). Flies overexpressing hSOD1 under the D42-GAL4 activator were able to sustain flight significantly longer than controls, with the largest effect observed in the middle stages of life. The hSOD1-expressed line also had, on average, slower wingbeat frequencies in late, but not early life relative to age-matched controls. Second, we examined locomotor (exploratory walking) behavior in late life when flies had lost the ability to fly (age ≥ 60 d). hSOD1-expressed flies showed significantly more robust walking activity relative to controls. Findings show patterns of functional decline dissimilar to those reported for other life-extended lines, and suggest that the hSOD1 gene not only delays death but enhances sensorimotor abilities critical to survival even in late life.

  14. Mitochondrial dynamics and bioenergetic dysfunction is associated with synaptic alterations in mutant SOD1 motor neurons

    PubMed Central

    Magrané, Jordi; Sahawneh, Mary Anne; Przedborski, Serge; Estévez, Álvaro G.; Manfredi, Giovanni

    2012-01-01

    Mutations in Cu,Zn superoxide dismutase (SOD1) cause familial amyotrophic lateral sclerosis (FALS), a rapidly fatal motor neuron disease. Mutant SOD1 has pleiotropic toxic effects on motor neurons, among which mitochondrial dysfunction has been proposed as one of the contributing factors in motor neuron demise. Mitochondria are highly dynamic in neurons; they are constantly reshaped by fusion and move along neurites to localize at sites of high-energy utilization, such as synapses. The finding of abnormal mitochondria accumulation in neuromuscular junctions, where the SOD1-FALS degenerative process is though to initiate, suggests that impaired mitochondrial dynamics in motor neurons may be involved in pathogenesis. We addressed this hypothesis by live imaging microscopy of photo-switchable fluorescent mitoDendra in transgenic rat motor neurons expressing mutant or wild type human SOD1. We demonstrate that mutant SOD1 motor neurons have impaired mitochondrial fusion in axons and cell bodies. Mitochondria also display selective impairment of retrograde axonal transport, with reduced frequency and velocity of movements. Fusion and transport defects are associated with smaller mitochondrial size, decreased mitochondrial density, and defective mitochondrial membrane potential. Furthermore, mislocalization of mitochondria at synapses among motor neurons, in vitro, correlates with abnormal synaptic number, structure, and function. Dynamics abnormalities are specific to mutant SOD1 motor neuron mitochondria, since they are absent in wild type SOD1 motor neurons, they do not involve other organelles, and they are not found in cortical neurons. Taken together, these results suggest that impaired mitochondrial dynamics may contribute to the selective degeneration of motor neurons in SOD1-FALS. PMID:22219285

  15. Transcriptomic indices of fast and slow disease progression in two mouse models of amyotrophic lateral sclerosis.

    PubMed

    Nardo, Giovanni; Iennaco, Raffaele; Fusi, Nicolò; Heath, Paul R; Marino, Marianna; Trolese, Maria C; Ferraiuolo, Laura; Lawrence, Neil; Shaw, Pamela J; Bendotti, Caterina

    2013-11-01

    Amyotrophic lateral sclerosis is heterogeneous with high variability in the speed of progression even in cases with a defined genetic cause such as superoxide dismutase 1 (SOD1) mutations. We reported that SOD1(G93A) mice on distinct genetic backgrounds (C57 and 129Sv) show consistent phenotypic differences in speed of disease progression and life-span that are not explained by differences in human SOD1 transgene copy number or the burden of mutant SOD1 protein within the nervous system. We aimed to compare the gene expression profiles of motor neurons from these two SOD1(G93A) mouse strains to discover the molecular mechanisms contributing to the distinct phenotypes and to identify factors underlying fast and slow disease progression. Lumbar spinal motor neurons from the two SOD1(G93A) mouse strains were isolated by laser capture microdissection and transcriptome analysis was conducted at four stages of disease. We identified marked differences in the motor neuron transcriptome between the two mice strains at disease onset, with a dramatic reduction of gene expression in the rapidly progressive (129Sv-SOD1(G93A)) compared with the slowly progressing mutant SOD1 mice (C57-SOD1(G93A)) (1276 versus 346; Q-value ≤ 0.01). Gene ontology pathway analysis of the transcriptional profile from 129Sv-SOD1(G93A) mice showed marked downregulation of specific pathways involved in mitochondrial function, as well as predicted deficiencies in protein degradation and axonal transport mechanisms. In contrast, the transcriptional profile from C57-SOD1(G93A) mice with the more benign disease course, revealed strong gene enrichment relating to immune system processes compared with 129Sv-SOD1(G93A) mice. Motor neurons from the more benign mutant strain demonstrated striking complement activation, over-expressing genes normally involved in immune cell function. We validated through immunohistochemistry increased expression of the C3 complement subunit and major histocompatibility

  16. EXAFS analysis of a human Cu,Zn SOD isoform focused using non-denaturing gel electrophoresis

    NASA Astrophysics Data System (ADS)

    Chevreux, Sylviane; Solari, Pier Lorenzo; Roudeau, Stéphane; Deves, Guillaume; Alliot, Isabelle; Testemale, Denis; Hazemann, Jean Louis; Ortega, Richard

    2009-11-01

    Isoelectric point isoforms of a metalloprotein, copper-zinc superoxide dismutase (CuZnSOD), separated on electrophoresis gels were analyzed using X-ray Absorption Spectroscopy. Mutations of this protein are involved in familial cases of amyotrophic lateral sclerosis. The toxicity of mutants could be relied to defects in the metallation state. Our purpose is to establish analytical protocols to study metallation state of protein isoforms such as those from CuZnSOD. We previously highlighted differences in the copper oxidation state between CuZnSOD isoforms using XANES. Here, we present the first results for EXAFS analyses performed at Cu and Zn K-edge on the majoritary expressed isoform of human CuZnSOD separated on electrophoresis gels.

  17. A novel WFS1 mutation in a family with dominant low frequency sensorineural hearing loss with normal VEMP and EcochG findings

    PubMed Central

    Bramhall, Naomi F; Kallman, Jeremy C; Verrall, Aimee M; Street, Valerie A

    2008-01-01

    Background Low frequency sensorineural hearing loss (LFSNHL) is an uncommon clinical finding. Mutations within three different identified genes (DIAPH1, MYO7A, and WFS1) are known to cause LFSNHL. The majority of hereditary LFSNHL is associated with heterozygous mutations in the WFS1 gene (wolframin protein). The goal of this study was to use genetic analysis to determine if a small American family's hereditary LFSNHL is linked to a mutation in the WFS1 gene and to use VEMP and EcochG testing to further characterize the family's audiovestibular phenotype. Methods The clinical phenotype of the American family was characterized by audiologic testing, vestibular evoked myogenic potentials (VEMP), and electrocochleography (EcochG) evaluation. Genetic characterization was performed by microsatellite analysis and direct sequencing of WFS1 for mutation detection. Results Sequence analysis of the WFS1 gene revealed a novel heterozygous mutation at c.2054G>C predicting a p.R685P amino acid substitution in wolframin. The c.2054G>C mutation segregates faithfully with hearing loss in the family and is absent in 230 control chromosomes. The p.R685 residue is located within the hydrophilic C-terminus of wolframin and is conserved across species. The VEMP and EcochG findings were normal in individuals segregating the WFS1 c.2054G>C mutation. Conclusion We discovered a novel heterozygous missense mutation in exon 8 of WFS1 predicting a p.R685P amino acid substitution that is likely to underlie the LFSNHL phenotype in the American family. For the first time, we describe VEMP and EcochG findings for individuals segregating a heterozygous WFS1 mutation. PMID:18518985

  18. A novel WFS1 mutation in a family with dominant low frequency sensorineural hearing loss with normal VEMP and EcochG findings.

    PubMed

    Bramhall, Naomi F; Kallman, Jeremy C; Verrall, Aimee M; Street, Valerie A

    2008-06-02

    Low frequency sensorineural hearing loss (LFSNHL) is an uncommon clinical finding. Mutations within three different identified genes (DIAPH1, MYO7A, and WFS1) are known to cause LFSNHL. The majority of hereditary LFSNHL is associated with heterozygous mutations in the WFS1 gene (wolframin protein). The goal of this study was to use genetic analysis to determine if a small American family's hereditary LFSNHL is linked to a mutation in the WFS1 gene and to use VEMP and EcochG testing to further characterize the family's audiovestibular phenotype. The clinical phenotype of the American family was characterized by audiologic testing, vestibular evoked myogenic potentials (VEMP), and electrocochleography (EcochG) evaluation. Genetic characterization was performed by microsatellite analysis and direct sequencing of WFS1 for mutation detection. Sequence analysis of the WFS1 gene revealed a novel heterozygous mutation at c.2054G>C predicting a p.R685P amino acid substitution in wolframin. The c.2054G>C mutation segregates faithfully with hearing loss in the family and is absent in 230 control chromosomes. The p.R685 residue is located within the hydrophilic C-terminus of wolframin and is conserved across species. The VEMP and EcochG findings were normal in individuals segregating the WFS1 c.2054G>C mutation. We discovered a novel heterozygous missense mutation in exon 8 of WFS1 predicting a p.R685P amino acid substitution that is likely to underlie the LFSNHL phenotype in the American family. For the first time, we describe VEMP and EcochG findings for individuals segregating a heterozygous WFS1 mutation.

  19. Oxidative Stress Induced Age Dependent Meibomian Gland Dysfunction in Cu, Zn-Superoxide Dismutase-1 (Sod1) Knockout Mice

    PubMed Central

    Ibrahim, Osama M. A.; Dogru, Murat; Matsumoto, Yukihiro; Igarashi, Ayako; Kojima, Takashi; Wakamatsu, Tais Hitomi; Inaba, Takaaki; Shimizu, Takahiko; Shimazaki, Jun; Tsubota, Kazuo

    2014-01-01

    Purpose The purpose of our study was to investigate alterations in the meibomian gland (MG) in Cu, Zn-Superoxide Dismutase-1 knockout (Sod1 −/−) mouse. Methods Tear function tests [Break up time (BUT) and cotton thread] and ocular vital staining test were performed on Sod1 −/− male mice (n = 24) aged 10 and 50 weeks, and age and sex matched wild–type (+/+) mice (n = 25). Tear and serum samples were collected at sacrifice for inflammatory cytokine assays. MG specimens underwent Hematoxylin and Eosin staining, Mallory staining for fibrosis, Oil Red O lipid staining, TUNEL staining, immunohistochemistry stainings for 4HNE, 8-OHdG and CD45. Transmission electron microscopic examination (TEM) was also performed. Results Corneal vital staining scores in the Sod1 −/− mice were significantly higher compared with the wild type mice throughout the follow-up. Tear and serum IL-6 and TNF-α levels also showed significant elevations in the 10 to 50 week Sod1 −/− mice. Oil Red O staining showed an accumulation of large lipid droplets in the Sod1 −/− mice at 50 weeks. Immunohistochemistry revealed both increased TUNEL and oxidative stress marker stainings of the MG acinar epithelium in the Sod1 −/− mice compared to the wild type mice. Immunohistochemistry staining for CD45 showed increasing inflammatory cell infiltrates from 10 to 50 weeks in the Sod1 −/− mice compared to the wild type mice. TEM revealed prominent mitochondrial changes in 50 week Sod1 −/− mice. Conclusions Our results suggest that reactive oxygen species might play a vital role in the pathogensis of meibomian gland dysfunction. The Sod1 −/− mouse appears to be a promising model for the study of reactive oxygen species associated MG alterations. PMID:25036096

  20. Identification of Bangladeshi domestic cats with GM1 gangliosidosis caused by the c.1448G>C mutation of the feline GLB1 gene: case study.

    PubMed

    Uddin, Mohammad Mejbah; Hossain, Mohammad Alamgir; Rahman, Mohammad Mahbubur; Chowdhury, Morshedul Alam; Tanimoto, Takeshi; Yabuki, Akira; Mizukami, Keijiro; Chang, Hye-Sook; Yamato, Osamu

    2013-01-01

    GM1 gangliosidosis is a fatal, progressive neurodegenerative lysosomal storage disease caused by mutations in the β-galactosidase (GLB1) gene. In feline GM1 gangliosidosis, a pathogenic mutation (c.1448G>C) in the feline GLB1 gene was identified in Siamese cats in the United States and Japan and in Korat cats in Western countries. The present study found the homozygous c.1448G>C mutation in 2 apparent littermate native kittens in Bangladesh that were exhibiting neurological signs. This is the first identification of GM1 gangliosidosis in native domestic cats in Southeast Asia. This pathogenic mutation seems to have been present in the domestic cat population in the Siamese region and may have been transferred to pure breeds such as Siamese and Korat cats originating in this region.

  1. Association of The IDH1 C.395G>A (R132H) Mutation with Histological Type in Malay Brain Tumors

    PubMed

    Mohamed Yusoff, Abdul Aziz; Zulfakhar, Fatin Najwa; Sul’ain, Mohd Dasuki; Idris, Zamzuri; Abdullah, Jafri Malin

    2016-12-01

    Background: Brain tumors, constituting one of the most deadly forms of cancer worldwide, result from the accumulation of multiple genetic and epigenetic alterations in genes and signaling pathways. Isocitrate dehydrogenase enzyme isoform 1 (IDH1) mutations are frequently identified in primary brain tumors and acute myeloid leukemia. Studies on IDH1 gene mutations have been extensively performed in various populations worldwide but not in Malaysia. This work was conducted to study the prevalence of IDH1 c.395G>A (R132H) hotspot mutations in a group of Malaysian patients with brain tumors in order to gain local data for the IDH1 mutation profile in our population. Methods: Mutation analysis of c.395G>A (R132H) of IDH1 was performed in 40 brain tumor specimens by the polymerase chain reaction-restriction fragment length polymorphism method (PCR-RFLP) and then verified by direct sequencing. Associations between the IDH1 c.395G>A (R132H) mutation and clinicopathologic characteristics were also analyzed. Results: The IDH1 c.395G>A (R132H) mutation was detected in 14/40 patients (35%). A significant association was found with histological tumor types, but not with age, gender and race. Conclusions: IDH1 is frequently mutated and associated with histological subtypes in Malay brain tumors. Creative Commons Attribution License

  2. Association of The IDH1 C.395G>A (R132H) Mutation with Histological Type in Malay Brain Tumors

    PubMed Central

    Yusoff, Abdul Aziz Mohamed; Zulfakhar, Fatin Najwa; Sul’ain, Mohd Dasuki; Idris, Zamzuri; Abdullah, Jafri Malin

    2016-01-01

    Background: Brain tumors, constituting one of the most deadly forms of cancer worldwide, result from the accumulation of multiple genetic and epigenetic alterations in genes and signaling pathways. Isocitrate dehydrogenase enzyme isoform 1 (IDH1) mutations are frequently identified in primary brain tumors and acute myeloid leukemia. Studies on IDH1 gene mutations have been extensively performed in various populations worldwide but not in Malaysia. This work was conducted to study the prevalence of IDH1 c.395G>A (R132H) hotspot mutations in a group of Malaysian patients with brain tumors in order to gain local data for the IDH1 mutation profile in our population. Methods: Mutation analysis of c.395G>A (R132H) of IDH1 was performed in 40 brain tumor specimens by the polymerase chain reaction-restriction fragment length polymorphism method (PCR-RFLP) and then verified by direct sequencing. Associations between the IDH1 c.395G>A (R132H) mutation and clinicopathologic characteristics were also analyzed. Results: The IDH1 c.395G>A (R132H) mutation was detected in 14/40 patients (35%). A significant association was found with histological tumor types, but not with age, gender and race. Conclusions: IDH1 is frequently mutated and associated with histological subtypes in Malay brain tumors. PMID:28125199

  3. Adult onset Leigh syndrome with mitochondrial DNA 8344 A>G mutation.

    PubMed

    Han, Jee-Young; Sung, Jung-Joon; Park, Hong-Kyun; Yoon, Byung-Nam; Lee, Kwang-Woo

    2014-11-01

    We report a pedigree of adult-onset Leigh syndrome (LS) with mitochondrial mutation 8344 A>G. A 38-year-old woman presented with optic neuropathy, weakness and cognitive impairment. Family history of optic neuropathy and systemic involvement was suggestive of mitochondrial encephalopathy. Genetic and radiologic studies showed m.8344 A>G mutation with characteristics of LS. To our knowledge this is the first case of adult-onset LS demonstrating the m.8344 A>G mutation. Copyright © 2014 Elsevier Ltd. All rights reserved.

  4. MicroRNA-206: A Potential Circulating Biomarker Candidate for Amyotrophic Lateral Sclerosis

    PubMed Central

    Toivonen, Janne M.; Manzano, Raquel; Oliván, Sara; Zaragoza, Pilar; García-Redondo, Alberto; Osta, Rosario

    2014-01-01

    Amyotrophic lateral sclerosis (ALS) is a lethal motor neuron disease that progressively debilitates neuronal cells that control voluntary muscle activity. Biomarkers are urgently needed to facilitate ALS diagnosis and prognosis, and as indicators of therapeutic response in clinical trials. microRNAs (miRNAs), small posttranscriptional modifiers of gene expression, are frequently altered in disease conditions. Besides their important regulatory role in variety of biological processes, miRNAs can also be released into the circulation by pathologically affected tissues and display remarkable stability in body fluids. In a mouse model of ALS that expresses mutated human superoxide dismutase 1 (SOD1-G93A) skeletal muscle is one of the tissues affected early by mutant SOD1 toxicity. To find biomarkers for ALS, we studied miRNA alterations from skeletal muscle and plasma of SOD1-G93A mice, and subsequently tested the levels of the affected miRNAs in the serum from human ALS patients. Fast-twitch and slow-twitch muscles from symptomatic SOD1-G93A mice (age 90 days) and their control littermates were first studied using miRNA microarrays and then evaluated with quantitative PCR from five age groups from neonatal to the terminal disease stage (10–120 days). Among those miRNA changed in various age/gender/muscle groups (miR-206, -1, -133a, -133b, -145, -21, -24), miR-206 was the only one consistently altered during the course of the disease pathology. In both sexes, mature miR-206 was increased in fast-twitch muscles preferably affected in the SOD1-G93A model, with highest expression towards the most severely affected animals. Importantly, miR-206 was also increased in the circulation of symptomatic animals and in a group of 12 definite ALS patients tested. We conclude that miR-206 is elevated in the circulation of symptomatic SOD1-G93A mice and possibly in human ALS patients. Although larger scale studies on ALS patients are warranted, miR-206 is a promising candidate

  5. The dynamic DNA methylation landscape of the mutL homolog 1 shore is altered by MLH1-93G>A polymorphism in normal tissues and colorectal cancer.

    PubMed

    Savio, Andrea J; Mrkonjic, Miralem; Lemire, Mathieu; Gallinger, Steven; Knight, Julia A; Bapat, Bharat

    2017-01-01

    Colorectal cancers (CRCs) undergo distinct genetic and epigenetic alterations. Expression of mutL homolog 1 ( MLH1 ), a mismatch repair gene that corrects DNA replication errors, is lost in up to 15% of sporadic tumours due to mutation or, more commonly, due to DNA methylation of its promoter CpG island. A single nucleotide polymorphism (SNP) in the CpG island of MLH1 ( MLH1 -93G>A or rs1800734) is associated with CpG island hypermethylation and decreased MLH1 expression in CRC tumours. Further, in peripheral blood mononuclear cell (PBMC) DNA of both CRC cases and non-cancer controls, the variant allele of rs1800734 is associated with hypomethylation at the MLH1 shore, a region upstream of its CpG island that is less dense in CpG sites . To determine whether this genotype-epigenotype association is present in other tissue types, including colorectal tumours, we assessed DNA methylation in matched normal colorectal tissue, tumour, and PBMC DNA from 349 population-based CRC cases recruited from the Ontario Familial Colorectal Cancer Registry. Using the semi-quantitative real-time PCR-based MethyLight assay, MLH1 shore methylation was significantly higher in tumour tissue than normal colon or PBMCs ( P  < 0.01). When shore methylation levels were stratified by SNP genotype, normal colorectal DNA and PBMC DNA were significantly hypomethylated in association with variant SNP genotype ( P  < 0.05). However, this association was lost in tumour DNA. Among distinct stages of CRC, metastatic stage IV CRC tumours incurred significant hypomethylation compared to stage I-III cases, irrespective of genotype status. Shore methylation of MLH1 was not associated with MSI status or promoter CpG island hypermethylation, regardless of genotype. To confirm these results, bisulfite sequencing was performed in matched tumour and normal colorectal specimens from six CRC cases, including two cases per genotype (wildtype, heterozygous, and homozygous variant). Bisulfite sequencing

  6. The anabolic/androgenic steroid nandrolone exacerbates gene expression modifications induced by mutant SOD1 in muscles of mice models of amyotrophic lateral sclerosis

    PubMed Central

    Galbiati, Mariarita; Onesto, Elisa; Zito, Arianna; Crippa, Valeria; Rusmini, Paola; Mariotti, Raffaella; Bentivoglio, Marina; Bendotti, Caterina; Poletti, Angelo

    2012-01-01

    Anabolic/androgenic steroids (AAS) are drugs that enhance muscle mass, and are often illegally utilized in athletes to improve their performances. Recent data suggest that the increased risk for amyotrophic lateral sclerosis (ALS) in male soccer and football players could be linked to AAS abuse. ALS is a motor neuron disease mainly occurring in sporadic (sALS) forms, but some familial forms (fALS) exist and have been linked to mutations in different genes. Some of these, in their wild type (wt) form, have been proposed as risk factors for sALS, i.e. superoxide dismutase 1 (SOD1) gene, whose mutations are causative of about 20% of fALS. Notably, SOD1 toxicity might occur both in motor neurons and in muscle cells. Using gastrocnemius muscles of mice overexpressing human mutant SOD1 (mutSOD1) at different disease stages, we found that the expression of a selected set of genes associated to muscle atrophy, MyoD, myogenin, atrogin-1, and transforming growth factor (TGF)β1, is up-regulated already at the presymptomatic stage. Atrogin-1 gene expression was increased also in mice overexpressing human wtSOD1. Similar alterations were found in axotomized mouse muscles and in cultured ALS myoblast models. In these ALS models, we then evaluated the pharmacological effects of the synthetic AAS nandrolone on the expression of the genes modified in ALS muscle. Nandrolone administration had no effects on MyoD, myogenin, and atrogin-1 expression, but it significantly increased TGFβ1 expression at disease onset. Altogether, these data suggest that, in fALS, muscle gene expression is altered at early stages, and AAS may exacerbate some of the alterations induced by SOD1 possibly acting as a contributing factor also in sALS. PMID:22178654

  7. The anabolic/androgenic steroid nandrolone exacerbates gene expression modifications induced by mutant SOD1 in muscles of mice models of amyotrophic lateral sclerosis.

    PubMed

    Galbiati, Mariarita; Onesto, Elisa; Zito, Arianna; Crippa, Valeria; Rusmini, Paola; Mariotti, Raffaella; Bentivoglio, Marina; Bendotti, Caterina; Poletti, Angelo

    2012-02-01

    Anabolic/androgenic steroids (AAS) are drugs that enhance muscle mass, and are often illegally utilized in athletes to improve their performances. Recent data suggest that the increased risk for amyotrophic lateral sclerosis (ALS) in male soccer and football players could be linked to AAS abuse. ALS is a motor neuron disease mainly occurring in sporadic (sALS) forms, but some familial forms (fALS) exist and have been linked to mutations in different genes. Some of these, in their wild type (wt) form, have been proposed as risk factors for sALS, i.e. superoxide dismutase 1 (SOD1) gene, whose mutations are causative of about 20% of fALS. Notably, SOD1 toxicity might occur both in motor neurons and in muscle cells. Using gastrocnemius muscles of mice overexpressing human mutant SOD1 (mutSOD1) at different disease stages, we found that the expression of a selected set of genes associated to muscle atrophy, MyoD, myogenin, atrogin-1, and transforming growth factor (TGF)β1, is up-regulated already at the presymptomatic stage. Atrogin-1 gene expression was increased also in mice overexpressing human wtSOD1. Similar alterations were found in axotomized mouse muscles and in cultured ALS myoblast models. In these ALS models, we then evaluated the pharmacological effects of the synthetic AAS nandrolone on the expression of the genes modified in ALS muscle. Nandrolone administration had no effects on MyoD, myogenin, and atrogin-1 expression, but it significantly increased TGFβ1 expression at disease onset. Altogether, these data suggest that, in fALS, muscle gene expression is altered at early stages, and AAS may exacerbate some of the alterations induced by SOD1 possibly acting as a contributing factor also in sALS. Copyright © 2011 Elsevier Ltd. All rights reserved.

  8. PROP1 gene mutations in a 36-year-old female presenting with psychosis

    PubMed Central

    Rijal, Tshristi; Jha, Kunal Kishor; Saluja, Harpreet

    2017-01-01

    Summary Combined pituitary hormonal deficiency (CPHD) is a rare disease that results from mutations in genes coding for transcription factors that regulate the differentiation of pituitary cells. PROP1 gene mutations are one of the etiological diagnoses of congenital panhypopituitarism, however symptoms vary depending on phenotypic expression. We present a case of psychosis in a 36-year-old female with congenital panhypopituitarism who presented with paranoia, flat affect and ideas of reference without a delirious mental state, which resolved with hormone replacement and antipsychotics. Further evaluation revealed that she had a homozygous mutation of PROP1 gene. In summary, compliance with hormonal therapy for patients with hypopituitarism appears to be effective for the prevention and treatment of acute psychosis symptoms. Learning points: Patients with PROP1 gene mutation may present with psychosis with no impairment in orientation and memory. There is currently inadequate literature on this topic, and further study on the possible mechanisms of psychosis as a result of endocrine disturbance is required. Compliance with hormonal therapy for patients with hypopituitarism appears to be effective for prevention and treatment of acute psychosis symptoms. PMID:28458894

  9. Decreased mutation frequencies among immunoglobulin G variable region genes during viremic HIV-1 infection.

    PubMed

    Bowers, Elisabeth; Scamurra, Ronald W; Asrani, Anil; Beniguel, Lydie; MaWhinney, Samantha; Keays, Kathryne M; Thurn, Joseph R; Janoff, Edward N

    2014-01-01

    HIV-1 infection is complicated by high rates of opportunistic infections against which specific antibodies contribute to immune defense. Antibody function depends on somatic hypermutation (SHM) of variable regions of immunoglobulin heavy chain genes (VH-D-J). We characterized the frequency of SHM in expressed IgG mRNA immunoglobulin transcripts from control and HIV-1-infected patients. We compared utilization of genes in the most prominent VH family (VH3) and mutation frequencies and patterns of cDNA from VH3-IgG genes from 10 seronegative control subjects and 21 patients with HIV-1 infection (6 without and 15 patients with detectable plasma viremia). Unique IgG VH3 family cDNA sequences (n = 1,565) were PCR amplified, cloned, and sequenced from blood. Sequences were analyzed using online (Vbase) and in-house immunoglobulin alignment resources. Mutation frequencies in the antigen-binding hypervariable complementarity determining regions (CDR1/2) of IgG class-switched B cells were lower among viremic HIV-1-infected patients vs. controls for nucleotides (CDR1/2: 10±5% vs. 13.5±6%, p = 0.03) and amino acids (CDR: 20%±10 vs. 25%±12, p = 0.02) and in structural framework regions. Mutation patterns were similar among groups. The most common VH3 gene, VH3-23, was utilized less frequently among viremic HIV-1-infected patients (p = 0.03), and overall, mutation frequencies were decreased in nearly all VH3 genes compared with controls. B cells from HIV-1-infected patients show decreased mutation frequencies, especially in antigen-binding VH3 CDR genes, and selective defects in gene utilization. Similar mutation patterns suggest defects in the quantity, but not quality, of mutator activity. Lower levels of SHM in IgG class-switched B cells from HIV-1-infected patients may contribute to the increased risk of opportunistic infections and impaired humoral responses to preventative vaccines.

  10. Gaucher disease: A G[sup +1][yields]A[sup +1] IVS2 splice donor site mutation causing exon 2 skipping in the acid [beta]-glucosidase mRNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    He, Guo-Shun; Grabowski, G.A.

    1992-10-01

    Gaucher disease is the most frequent lysosomal storage disease and the most prevalent Jewish genetic disease. About 30 identified missense mutations are causal to the defective activity of acid [beta]-glucosidase in this disease. cDNAs were characterized from a moderately affected 9-year-old Ashkenazi Jewish Gaucher disease type 1 patient whose 80-years-old, enzyme-deficient, 1226G (Asn[sup 370][yields]Ser [N370S]) homozygous grandfather was nearly asymptomatic. Sequence analyses revealed four populations of cDNAs with either the 1226G mutation, an exact exon 2 ([Delta] EX2) deletion, a deletion of exon 2 and the first 115 bp of exon 3 ([Delta] EX2-3), or a completely normal sequence. Aboutmore » 50% of the cDNAs were the [Delta] EX2, the [Delta] EX2-3, and the normal cDNAs, in a ratio of 6:3:1. Specific amplification and characterization of exon 2 and 5[prime] and 3[prime] intronic flanking sequences from the structural gene demonstrated clones with either the normal sequence or with a G[sup +1][yields]A[sup +1] transition at the exon 2/intron 2 boundary. This mutation destroyed the splice donor consensus site (U1 binding site) for mRNA processing. This transition also was present at the corresponding exon/intron boundary of the highly homologous pseudogene. This new mutation, termed [open quotes]IVS2 G[sup +1],[close quotes] is the first in the Ashkenazi Jewish population. The occurrence of this [open quotes]pseudogene[close quotes]-type mutation in the structural gene indicates the role of acid [beta]-glucosidase pseudogene and structural gene rearrangements in the pathogenesis of this disease. 33 refs., 8 figs., 1 tab.« less

  11. Polymorphism of MSH2 Gly322Asp and MLH193G>A in non-familial colon cancer – a case-controlled study

    PubMed Central

    Dziki, Lukasz; Malinowska, Katarzyna; Trzcinski, Radzislaw; Majsterek, Ireneusz; Dziki, Adam

    2017-01-01

    Introduction Our aim was to determine the effect of the single nucleotide polymorphisms (SNP) –93G>A of the MLH1 gene (rs1800734) and Gly322Asp of the MSH2 gene (rs4987188) on the risk of colon cancer (CC) and identify any relationship with clinical factors. Material and methods The study included 144 unrelated patients with sporadic CC (71 males; mean age: 61.7 ±11 years) and 151 control patients (74 males; mean age: 63 ±11 years). DNA was extracted from peripheral blood lymphocytes, and genotypes were determined by polymerase chain reaction-restriction fragment length polymorphism. Results In our population, the homozygous G/G genotype of the –93G>AMLH1 gene increased the risk of sporadic CC (OR = 2.07; 95% CI: 1.11–3.83; p < 0.02). For A/G and A/A genotypes, the MLH1-93G>A polymorphism was significantly more common in women (p = 0.034). The SNP demonstrated differences in allele distribution according to the location of the tumor, i.e. right vs. left side (p = 0.014), and disease recurrence (p = 0.022). Significant differences were found in the occurrence of Gly322Asp of MSH2 with regard to primary and recurrent disease (p = 0.001). Conclusions The –93G>AMLH1 polymorphism plays an important role in evaluating the risk of sporadic CC. It can also be used as an indicator in some patients with left-sided and recurrent tumors. MSH2 Gly322Asp is a potential marker in patients with risk of recurrence. PMID:29181059

  12. Compound Heterozygosity for Hb Alperton (HBB: c.407C>T) and IVS-I-5 (G>C) (HBB: c.92+5G>C) Mutations Presenting as a Moderate Anemia in an Indian Family.

    PubMed

    Godbole, Koumudi G; Ramachandran, Angelina; Karkamkar, Ashwini S; Dalal, Ashwin B

    2018-04-13

    While knowledge of HBB gene mutations is necessary for offering prenatal diagnosis (PND) of β-thalassemia (β-thal), a genotype-phenotype correlation may not always be available for rare variants. We present for the first time, genotype-phenotype correlation for a compound heterozygous status with IVS-I-5 (G>C) (HBB: c.92+5G>C) and HBB: c.407C>T (Hb Alperton) mutations on the HBB gene in an Indian family. Hb Alperton is a very rare hemoglobin (Hb) variant with scant published information about its clinical presentation, especially when accompanied with another HBB gene mutation. Here we provide biochemical as well as clinical details of this variant.

  13. Thermal fluctuations of immature SOD1 lead to separate folding and misfolding pathways

    PubMed Central

    Sekhar, Ashok; Rumfeldt, Jessica AO; Broom, Helen R; Doyle, Colleen M; Bouvignies, Guillaume; Meiering, Elizabeth M; Kay, Lewis E

    2015-01-01

    Amyotrophic lateral sclerosis (ALS) is a progressive neurodegenerative disease involving cytotoxic conformations of Cu, Zn superoxide dismutase (SOD1). A major challenge in understanding ALS disease pathology has been the identification and atomic-level characterization of these conformers. Here, we use a combination of NMR methods to detect four distinct sparsely populated and transiently formed thermally accessible conformers in equilibrium with the native state of immature SOD1 (apoSOD12SH). Structural models of two of these establish that they possess features present in the mature dimeric protein. In contrast, the other two are non-native oligomers in which the native dimer interface and the electrostatic loop mediate the formation of aberrant intermolecular interactions. Our results show that apoSOD12SH has a rugged free energy landscape that codes for distinct kinetic pathways leading to either maturation or non-native association and provide a starting point for a detailed atomic-level understanding of the mechanisms of SOD1 oligomerization. DOI: http://dx.doi.org/10.7554/eLife.07296.001 PMID:26099300

  14. Mutant SOD1 in cell types other than motor neurons and oligodendrocytes accelerates onset of disease in ALS mice

    PubMed Central

    Yamanaka, Koji; Boillee, Severine; Roberts, Elizabeth A.; Garcia, Michael L.; McAlonis-Downes, Melissa; Mikse, Oliver R.; Cleveland, Don W.; Goldstein, Lawrence S. B.

    2008-01-01

    Dominant mutations in ubiquitously expressed superoxide dismutase (SOD1) cause familial ALS by provoking premature death of adult motor neurons. To test whether mutant damage to cell types beyond motor neurons is required for the onset of motor neuron disease, we generated chimeric mice in which all motor neurons and oligodendrocytes expressed mutant SOD1 at a level sufficient to cause fatal, early-onset motor neuron disease when expressed ubiquitously, but did so in a cellular environment containing variable numbers of non-mutant, non-motor neurons. Despite high-level mutant expression within 100% of motor neurons and oligodendrocytes, in most of these chimeras, the presence of WT non-motor neurons substantially delayed onset of motor neuron degeneration, increasing disease-free life by 50%. Disease onset is therefore non-cell autonomous, and mutant SOD1 damage within cell types other than motor neurons and oligodendrocytes is a central contributor to initiation of motor neuron degeneration. PMID:18492803

  15. A novel mutation MT-COIII m.9267G>C and MT-COI m.5913G>A mutation in mitochondrial genes in a Tunisian family with maternally inherited diabetes and deafness (MIDD) associated with sever nephropathy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tabebi, Mouna, E-mail: mouna.biologiste@yahoo.com; Mkaouar-Rebai, Emna; Mnif, Mouna

    Mitochondrial diabetes (MD) is a heterogeneous disorder characterized by a chronic hyperglycemia, maternal transmission and its association with a bilateral hearing impairment. Several studies reported mutations in mitochondrial genes as potentially pathogenic for diabetes, since mitochondrial oxidative phosphorylation plays an important role in glucose-stimulated insulin secretion from beta cells. In the present report, we studied a Tunisian family with mitochondrial diabetes (MD) and deafness associated with nephropathy. The mutational analysis screening revealed the presence of a novel heteroplasmic mutation m.9276G>C in the mitochondrial COIII gene, detected in mtDNA extracted from leukocytes of a mother and her two daughters indicating thatmore » this mutation is maternally transmitted and suggest its implication in the observed phenotype. Bioinformatic tools showed that m.9267G>C mutation (p.A21P) is « deleterious » and it can modify the function and the stability of the MT-COIII protein by affecting the assembly of mitochondrial COX subunits and the translocation of protons then reducing the activity of the respective OXPHOS complexes of ATP synthesis. The nonsynonymous mutation (p.A21P) has not been reported before, it is the first mutation described in the COXIII gene which is related to insulin dependent mitochondrial diabetes and deafness and could be specific to the Tunisian population. The m.9267G>C mutation was present with a nonsynonymous inherited mitochondrial homoplasmic variation MT-COI m.5913 G>A (D4N) responsible of high blood pressure, a clinical feature detected in all explored patients. - Highlights: • MT-COX3 m.9267G>C (p.A21P), heteroplasmic substitution, is not reported in any database. • m.9267G>C can be responsible of the MIDD associated with nephropaty. • This substitution can modify the function and the stability of the MT-CO3 protein. • This substitution can modify MT-CO3 structure (2D and 3D). • MT-COX3 m.9267G>C is

  16. Neuron-specific antioxidant OXR1 extends survival of a mouse model of amyotrophic lateral sclerosis.

    PubMed

    Liu, Kevin X; Edwards, Benjamin; Lee, Sheena; Finelli, Mattéa J; Davies, Ben; Davies, Kay E; Oliver, Peter L

    2015-05-01

    Amyotrophic lateral sclerosis is a devastating neurodegenerative disorder characterized by the progressive loss of spinal motor neurons. While the aetiological mechanisms underlying the disease remain poorly understood, oxidative stress is a central component of amyotrophic lateral sclerosis and contributes to motor neuron injury. Recently, oxidation resistance 1 (OXR1) has emerged as a critical regulator of neuronal survival in response to oxidative stress, and is upregulated in the spinal cord of patients with amyotrophic lateral sclerosis. Here, we tested the hypothesis that OXR1 is a key neuroprotective factor during amyotrophic lateral sclerosis pathogenesis by crossing a new transgenic mouse line that overexpresses OXR1 in neurons with the SOD1(G93A) mouse model of amyotrophic lateral sclerosis. Interestingly, we report that overexpression of OXR1 significantly extends survival, improves motor deficits, and delays pathology in the spinal cord and in muscles of SOD1(G93A) mice. Furthermore, we find that overexpression of OXR1 in neurons significantly delays non-cell-autonomous neuroinflammatory response, classic complement system activation, and STAT3 activation through transcriptomic analysis of spinal cords of SOD1(G93A) mice. Taken together, these data identify OXR1 as the first neuron-specific antioxidant modulator of pathogenesis and disease progression in SOD1-mediated amyotrophic lateral sclerosis, and suggest that OXR1 may serve as a novel target for future therapeutic strategies. © The Author (2015). Published by Oxford University Press on behalf of the Guarantors of Brain.

  17. A novel mouse model of Niemann-Pick type C disease carrying a D1005G-Npc1 mutation comparable to commonly observed human mutations.

    PubMed

    Maue, Robert A; Burgess, Robert W; Wang, Bing; Wooley, Christine M; Seburn, Kevin L; Vanier, Marie T; Rogers, Maximillian A; Chang, Catherine C; Chang, Ta-Yuan; Harris, Brent T; Graber, David J; Penatti, Carlos A A; Porter, Donna M; Szwergold, Benjamin S; Henderson, Leslie P; Totenhagen, John W; Trouard, Theodore P; Borbon, Ivan A; Erickson, Robert P

    2012-02-15

    We have identified a point mutation in Npc1 that creates a novel mouse model (Npc1(nmf164)) of Niemann-Pick type C1 (NPC) disease: a single nucleotide change (A to G at cDNA bp 3163) that results in an aspartate to glycine change at position 1005 (D1005G). This change is in the cysteine-rich luminal loop of the NPC1 protein and is highly similar to commonly occurring human mutations. Genetic and molecular biological analyses, including sequencing the Npc1(spm) allele and identifying a truncating mutation, confirm that the mutation in Npc1(nmf164) mice is distinct from those in other existing mouse models of NPC disease (Npc1(nih), Npc1(spm)). Analyses of lifespan, body and spleen weight, gait and other motor activities, as well as acoustic startle responses all reveal a more slowly developing phenotype in Npc1(nmf164) mutant mice than in mice with the null mutations (Npc1(nih), Npc1(spm)). Although Npc1 mRNA levels appear relatively normal, Npc1(nmf164) brain and liver display dramatic reductions in Npc1 protein, as well as abnormal cholesterol metabolism and altered glycolipid expression. Furthermore, histological analyses of liver, spleen, hippocampus, cortex and cerebellum reveal abnormal cholesterol accumulation, glial activation and Purkinje cell loss at a slower rate than in the Npc1(nih) mouse model. Magnetic resonance imaging studies also reveal significantly less demyelination/dysmyelination than in the null alleles. Thus, although prior mouse models may correspond to the severe infantile onset forms of NPC disease, Npc1(nmf164) mice offer many advantages as a model for the late-onset, more slowly progressing forms of NPC disease that comprise the large majority of human cases.

  18. A novel mouse model of Niemann–Pick type C disease carrying a D1005G-Npc1 mutation comparable to commonly observed human mutations

    PubMed Central

    Maue, Robert A.; Burgess, Robert W.; Wang, Bing; Wooley, Christine M.; Seburn, Kevin L.; Vanier, Marie T.; Rogers, Maximillian A.; Chang, Catherine C.; Chang, Ta-Yuan; Harris, Brent T.; Graber, David J.; Penatti, Carlos A.A.; Porter, Donna M.; Szwergold, Benjamin S.; Henderson, Leslie P.; Totenhagen, John W.; Trouard, Theodore P.; Borbon, Ivan A.; Erickson, Robert P.

    2012-01-01

    We have identified a point mutation in Npc1 that creates a novel mouse model (Npc1nmf164) of Niemann–Pick type C1 (NPC) disease: a single nucleotide change (A to G at cDNA bp 3163) that results in an aspartate to glycine change at position 1005 (D1005G). This change is in the cysteine-rich luminal loop of the NPC1 protein and is highly similar to commonly occurring human mutations. Genetic and molecular biological analyses, including sequencing the Npc1spm allele and identifying a truncating mutation, confirm that the mutation in Npc1nmf164 mice is distinct from those in other existing mouse models of NPC disease (Npc1nih, Npc1spm). Analyses of lifespan, body and spleen weight, gait and other motor activities, as well as acoustic startle responses all reveal a more slowly developing phenotype in Npc1nmf164 mutant mice than in mice with the null mutations (Npc1nih, Npc1spm). Although Npc1 mRNA levels appear relatively normal, Npc1nmf164 brain and liver display dramatic reductions in Npc1 protein, as well as abnormal cholesterol metabolism and altered glycolipid expression. Furthermore, histological analyses of liver, spleen, hippocampus, cortex and cerebellum reveal abnormal cholesterol accumulation, glial activation and Purkinje cell loss at a slower rate than in the Npc1nih mouse model. Magnetic resonance imaging studies also reveal significantly less demyelination/dysmyelination than in the null alleles. Thus, although prior mouse models may correspond to the severe infantile onset forms of NPC disease, Npc1nmf164 mice offer many advantages as a model for the late-onset, more slowly progressing forms of NPC disease that comprise the large majority of human cases. PMID:22048958

  19. Genetic disruption of SOD1 gene causes glucose intolerance and impairs β-cell function.

    PubMed

    Muscogiuri, Giovanna; Salmon, Adam B; Aguayo-Mazzucato, Cristina; Li, Mengyao; Balas, Bogdan; Guardado-Mendoza, Rodolfo; Giaccari, Andrea; Reddick, Robert L; Reyna, Sara M; Weir, Gordon; Defronzo, Ralph A; Van Remmen, Holly; Musi, Nicolas

    2013-12-01

    Oxidative stress has been associated with insulin resistance and type 2 diabetes. However, it is not clear whether oxidative damage is a cause or a consequence of the metabolic abnormalities present in diabetic subjects. The goal of this study was to determine whether inducing oxidative damage through genetic ablation of superoxide dismutase 1 (SOD1) leads to abnormalities in glucose homeostasis. We studied SOD1-null mice and wild-type (WT) littermates. Glucose tolerance was evaluated with intraperitoneal glucose tolerance tests. Peripheral and hepatic insulin sensitivity was quantitated with the euglycemic-hyperinsulinemic clamp. β-Cell function was determined with the hyperglycemic clamp and morphometric analysis of pancreatic islets. Genetic ablation of SOD1 caused glucose intolerance, which was associated with reduced in vivo β-cell insulin secretion and decreased β-cell volume. Peripheral and hepatic insulin sensitivity were not significantly altered in SOD1-null mice. High-fat diet caused glucose intolerance in WT mice but did not further worsen the glucose intolerance observed in standard chow-fed SOD1-null mice. Our findings suggest that oxidative stress per se does not play a major role in the pathogenesis of insulin resistance and demonstrate that oxidative stress caused by SOD1 ablation leads to glucose intolerance secondary to β-cell dysfunction.

  20. Genetic Disruption of SOD1 Gene Causes Glucose Intolerance and Impairs β-Cell Function

    PubMed Central

    Muscogiuri, Giovanna; Salmon, Adam B.; Aguayo-Mazzucato, Cristina; Li, Mengyao; Balas, Bogdan; Guardado-Mendoza, Rodolfo; Giaccari, Andrea; Reddick, Robert L.; Reyna, Sara M.; Weir, Gordon; DeFronzo, Ralph A.; Van Remmen, Holly; Musi, Nicolas

    2013-01-01

    Oxidative stress has been associated with insulin resistance and type 2 diabetes. However, it is not clear whether oxidative damage is a cause or a consequence of the metabolic abnormalities present in diabetic subjects. The goal of this study was to determine whether inducing oxidative damage through genetic ablation of superoxide dismutase 1 (SOD1) leads to abnormalities in glucose homeostasis. We studied SOD1-null mice and wild-type (WT) littermates. Glucose tolerance was evaluated with intraperitoneal glucose tolerance tests. Peripheral and hepatic insulin sensitivity was quantitated with the euglycemic-hyperinsulinemic clamp. β-Cell function was determined with the hyperglycemic clamp and morphometric analysis of pancreatic islets. Genetic ablation of SOD1 caused glucose intolerance, which was associated with reduced in vivo β-cell insulin secretion and decreased β-cell volume. Peripheral and hepatic insulin sensitivity were not significantly altered in SOD1-null mice. High-fat diet caused glucose intolerance in WT mice but did not further worsen the glucose intolerance observed in standard chow–fed SOD1-null mice. Our findings suggest that oxidative stress per se does not play a major role in the pathogenesis of insulin resistance and demonstrate that oxidative stress caused by SOD1 ablation leads to glucose intolerance secondary to β-cell dysfunction. PMID:24009256

  1. Furosemide loading test in a case of homozygous solute carrier family 12, member 1 (SLC12A1) mutation (g.62382825G>A, p.Pro372Leu) in Japanese Black cattle.

    PubMed

    Hasegawa, Kiyotoshi; Sasaki, Shinji; Sakamoto, Yoichi; Takano, Akifumi; Takayama, Megumi; Higashi, Tomoko; Sugimoto, Yoshikazu; Yasuda, Yasuaki

    2017-10-01

    Hydrallantois is the excessive accumulation of fluid in the allantoic cavity in a pregnant animal and is associated with fetal death. We recently identified a recessive missense mutation in the solute carrier family 12, member 1 (SLC12A1) gene (g.62382825G>A, p.Pro372Leu) that is associated with hydrallantois in Japanese Black cattle. Unexpectedly, we found a case of the homozygous risk-allele for SLC12A1 in a calf, using a PCR-based direct DNA sequencing test. The homozygote was outwardly healthy up to 3 months of age and the mother did not exhibit any clinical symptoms of hydrallantois. In order to validate these observations, we performed confirmation tests for the genotype and a diuretic loading test using furosemide, which inhibits the transporter activity of the SLC12A1 protein. The results showed that the calf was really homozygous for the risk-allele. In the homozygous calf, administration of furosemide did not alter urinary Na + or Cl - levels, in contrast to the heterozygote and wild-type calves in which these were significantly increased. These results demonstrate that the SLC12A1 (g.62382825G>A, p.Pro372Leu) is a hypomorphic or loss-of-function mutation and the hydrallantois with this mutation shows incomplete penetrance in Japanese Black cattle. © 2017 Japanese Society of Animal Science.

  2. Identify mutation in amyotrophic lateral sclerosis cases using HaloPlex target enrichment system.

    PubMed

    Liu, Zhi-Jun; Li, Hong-Fu; Tan, Guo-He; Tao, Qing-Qing; Ni, Wang; Cheng, Xue-Wen; Xiong, Zhi-Qi; Wu, Zhi-Ying

    2014-12-01

    To date, at least 18 causative genes have been identified in amyotrophic lateral sclerosis (ALS). Because of the clinical and genetic heterogeneity, molecular diagnosis for ALS faces great challenges. HaloPlex target enrichment system is a new targeted sequencing approach, which can detect already known mutations or candidate genes. We performed this approach to screen 18 causative genes of ALS, including SOD1, SETX, FUS, ANG, TARDBP, ALS2, FIG4, VAPB, OPTN, DAO, VCP, UBQLN2, SPG11, SIGMAR1, DCTN1, SQSTM1, PFN1, and CHMP2B in 8 ALS probands. Using this approach, we got an average of 9.5 synonymous or missense mutations per sample. After validation by Sanger sequencing, we identified 3 documented SOD1 mutations (p.F21C, p.G148D, and p.C147R) and 1 novel DCTN1 p.G59R mutation in 4 probands. The novel DCTN1 mutation appeared to segregate with the disease in the pedigree and was absent in 200 control subjects. The high throughput and efficiency of this approach indicated that it could be applied to diagnose ALS and other inherited diseases with multiple causative genes in clinical practice. Copyright © 2014 Elsevier Inc. All rights reserved.

  3. Glucose-6-phosphate dehydrogenase (G6PD) mutations database: review of the "old" and update of the new mutations.

    PubMed

    Minucci, Angelo; Moradkhani, Kamran; Hwang, Ming Jing; Zuppi, Cecilia; Giardina, Bruno; Capoluongo, Ettore

    2012-03-15

    In the present paper we have updated the G6PD mutations database, including all the last discovered G6PD genetic variants. We underline that the last database has been published by Vulliamy et al. [1] who analytically reported 140 G6PD mutations: along with Vulliamy's database, there are two main sites, such as http://202.120.189.88/mutdb/ and www.LOVD.nl/MR, where almost all G6PD mutations can be found. Compared to the previous mutation reports, in our paper we have included for each mutation some additional information, such as: the secondary structure and the enzyme 3D position involving by mutation, the creation or abolition of a restriction site (with the enzyme involved) and the conservation score associated with each amino acid position. The mutations reported in the present tab have been divided according to the gene's region involved (coding and non-coding) and mutations affecting the coding region in: single, multiple (at least with two bases involved) and deletion. We underline that for the listed mutations, reported in italic, literature doesn't provide all the biochemical or bio-molecular information or the research data. Finally, for the "old" mutations, we tried to verify features previously reported and, when subsequently modified, we updated the specific information using the latest literature data. Copyright © 2012 Elsevier Inc. All rights reserved.

  4. CTT1 overexpression increases life span of calorie-restricted Saccharomyces cerevisiae deficient in Sod1.

    PubMed

    Rona, Germana; Herdeiro, Ricardo; Mathias, Cristiane Juliano; Torres, Fernando Araripe; Pereira, Marcos Dias; Eleutherio, Elis

    2015-06-01

    Studies using different organisms revealed that reducing calorie intake, without malnutrition, known as calorie restriction (CR), increases life span, but its mechanism is still unkown. Using the yeast Saccharomyces cerevisiae as eukaryotic model, we observed that Cu, Zn-superoxide dismutase (Sod1p) is required to increase longevity, as well as to confer protection against lipid and protein oxidation under CR. Old cells of sod1 strain also presented a premature induction of apoptosis. However, when CTT1 (which codes for cytosolic catalase) was overexpressed, sod1 and WT strains showed similar survival rates. Furthermore, CTT1 overexpression decreased lipid peroxidation and delayed the induction of apoptotic process. Superoxide is rapidly converted to hydrogen peroxide by superoxide dismutase, but it also undergoes spontaneous dismutation albeit at a slower rate. However, the quantity of peroxide produced from superoxide in this way is two-fold higher. Peroxide degradation, catalyzed by catalase, is of vital importance, because in the presence of a reducer transition metal peroxide is reduced to the highly reactive hydroxyl radical, which reacts indiscriminately with most cellular constituents. These findings might explain why overexpression of catalase was able to overcome the deficiency of Sod1p, increasing life span in response to CR.

  5. A new mutation in MT-ND1 m.3928G>C p.V208L causes Leigh disease with infantile spasms.

    PubMed

    Wray, Carter D; Friederich, Marisa W; du Sart, Desiree; Pantaleo, Sarah; Smet, Joél; Kucera, Cathlin; Fenton, Laura; Scharer, Gunter; Van Coster, Rudy; Van Hove, Johan L K

    2013-11-01

    New mutations in mitochondrial DNA encoded genes of complex I are rarely reported. An infant developed Leigh disease with infantile spasms. Complex I enzyme activity was deficient and response to increasing coenzyme Q concentrations was reduced. Complex I assembly was intact. A new mutation in MT-ND1 m.3928G>C p.V208L, affecting a conserved amino acid in a critical domain, part of the coenzyme Q binding pocket, was present at high heteroplasmy. The unaffected mother did not carry measurable mutant mitochondrial DNA, but concern remained for gonadal mosaicism. Prenatal testing was possible for a subsequent sibling. The ND1 p.V208L mutation causes Leigh disease. © 2013.

  6. Altered mechanisms underlying the abnormal glutamate release in amyotrophic lateral sclerosis at a pre-symptomatic stage of the disease.

    PubMed

    Bonifacino, Tiziana; Musazzi, Laura; Milanese, Marco; Seguini, Mara; Marte, Antonella; Gallia, Elena; Cattaneo, Luca; Onofri, Franco; Popoli, Maurizio; Bonanno, Giambattista

    2016-11-01

    Abnormal Glu release occurs in the spinal cord of SOD1(G93A) mice, a transgenic animal model for human ALS. Here we studied the mechanisms underlying Glu release in spinal cord nerve terminals of SOD1(G93A) mice at a pre-symptomatic disease stage (30days) and found that the basal release of Glu was more elevated in SOD1(G93A) with respect to SOD1 mice, and that the surplus of release relies on synaptic vesicle exocytosis. Exposure to high KCl or ionomycin provoked Ca(2+)-dependent Glu release that was likewise augmented in SOD1(G93A) mice. Equally, the Ca(2+)-independent hypertonic sucrose-induced Glu release was abnormally elevated in SOD1(G93A) mice. Also in this case, the surplus of Glu release was exocytotic in nature. We could determine elevated cytosolic Ca(2+) levels, increased phosphorylation of Synapsin-I, which was causally related to the abnormal Glu release measured in spinal cord synaptosomes of pre-symptomatic SOD1(G93A) mice, and increased phosphorylation of glycogen synthase kinase-3 at the inhibitory sites, an event that favours SNARE protein assembly. Western blot experiments revealed an increased number of SNARE protein complexes at the nerve terminal membrane, with no changes of the three SNARE proteins and increased expression of synaptotagmin-1 and β-Actin, but not of an array of other release-related presynaptic proteins. These results indicate that the abnormal exocytotic Glu release in spinal cord of pre-symptomatic SOD1(G93A) mice is mainly based on the increased size of the readily releasable pool of vesicles and release facilitation, supported by plastic changes of specific presynaptic mechanisms. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Three new mutations account for the prevalence of glucose 6 phosphate deshydrogenase (G6PD) deficiency in Tunisia.

    PubMed

    Bendaoud, B; Hosni, I; Mosbahi, I; Hafsia, R; Prehu, C; Abbes, S

    2013-04-01

    A previous study on G6PD deficiency carried out on Tunisian population, led to the finding of seven different mutations with the prevalence of G6PD A- variant. This present study reports 23 new unrelated deficient subjects studied at the molecular level to determine the mutation that causes G6PD deficiency. Using PCR-SSCP of coding regions followed by direct sequencing of abnormal pattern, three new mutations were detected. Two of them are polymorphic intronic mutations. The first is IVS-V 655C-->C/T, found in four female subjects with mild deficiency of class III variant. The second is IVS-VIII 43 G-->A, found in three male subjects with mild deficiency of class III variant. The third mutation is in the exon region so that it changes the primary structure of the molecule. It is cited for the first time and named G6PD Tunisia. This variant affects the exon 7 of the gene at genomic position 15435 G→T. Its cDNA position is 93 G→G/T, it changes arg 246 to leu. This mutation was found in one heterozygote female with deficiency of class II who have had hemolytic anemia due to ingestion of fava beans. Finally, G6PD Med variant, reported before in three cases, was also found in five other cases (four heterozygote females and one male hemizygote). These findings first enlarge the spectre of mutations to be ten variant mutations, characterizing the Tunisian population and also contribute with hemoglobin gene research in our laboratory to trace the whole genetic map of Tunisian population. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  8. Copper and Zinc Metallation Status of Copper Zinc Superoxide Dismutase form Amyotrophic Lateral Sclerosis Transgenic Mice

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lelie, H.L.; Miller, L.; Liba, A.

    2010-09-24

    Mutations in the metalloenzyme copper-zinc superoxide dismutase (SOD1) cause one form of familial amyotrophic lateral sclerosis (ALS), and metals are suspected to play a pivotal role in ALS pathology. To learn more about metals in ALS, we determined the metallation states of human wild-type or mutant (G37R, G93A, and H46R/H48Q) SOD1 proteins from SOD1-ALS transgenic mice spinal cords. SOD1 was gently extracted from spinal cord and separated into insoluble (aggregated) and soluble (supernatant) fractions, and then metallation states were determined by HPLC inductively coupled plasma MS. Insoluble SOD1-rich fractions were not enriched in copper and zinc. However, the soluble mutantmore » and WT SOD1s were highly metallated except for the metal-binding-region mutant H46R/H48Q, which did not bind any copper. Due to the stability conferred by high metallation of G37R and G93A, it is unlikely that these soluble SOD1s are prone to aggregation in vivo, supporting the hypothesis that immature nascent SOD1 is the substrate for aggregation. We also investigated the effect of SOD1 overexpression and disease on metal homeostasis in spinal cord cross-sections of SOD1-ALS mice using synchrotron-based x-ray fluorescence microscopy. In each mouse genotype, except for the H46R/H48Q mouse, we found a redistribution of copper between gray and white matters correlated to areas of high SOD1. Interestingly, a disease-specific increase of zinc was observed in the white matter for all mutant SOD1 mice. Together these data provide a picture of copper and zinc in the cell as well as highlight the importance of these metals in understanding SOD1-ALS pathology.« less

  9. A semisynthetic strategy leads to alteration of the backbone amidate ligand in the NiSOD active site

    DOE PAGES

    Campeciño, Julius O.; Dudycz, Lech W.; Tumelty, David; ...

    2015-07-01

    Computational investigations have implicated the amidate ligand in nickel superoxide dismutase (NiSOD) in stabilizing Ni-centered redox catalysis and in preventing cysteine thiolate ligand oxidation. To test these predictions, we have used an experimental approach utilizing a semisynthetic scheme that employs native chemical ligation of a pentapeptide (HCDLP) to recombinant S. coelicolor NiSOD lacking these N-terminal residues, NΔ5-NiSOD. Wild-type enzyme produced in this manner exhibits the characteristic spectral properties of recombinant WT-NiSOD and is as catalytically active. The semisynthetic scheme was also employed to construct a variant where the amidate ligand was converted to a secondary amine, H1*-NiSOD, a novel strategymore » that retains a backbone N-donor atom. The H1*-NiSOD variant was found to have only ~1% of the catalytic activity of the recombinant wild-type enzyme, and had altered spectroscopic properties. X-ray absorption spectroscopy reveals a four-coordinate planar site with N 2S 2-donor ligands, consistent with electronic absorption spectroscopic results indicating that the Ni center in H1*-NiSOD is mostly reduced in the as-isolated sample, as opposed to 50:50 Ni(II)/Ni(III) mixture that is typical for the recombinant wild-type enzyme. The EPR spectrum of as-isolated H1*-NiSOD accounts for ~11% of the Ni in the sample and is similar to WT-NiSOD, but more axial, with g z < g x,y. 14N-hyperfine is observed on g z« less

  10. A novel STXBP1 mutation causes typical Rett syndrome in a Japanese girl.

    PubMed

    Yuge, Kotaro; Iwama, Kazuhiro; Yonee, Chihiro; Matsufuji, Mayumi; Sano, Nozomi; Saikusa, Tomoko; Yae, Yukako; Yamashita, Yushiro; Mizuguchi, Takeshi; Matsumoto, Naomichi; Matsuishi, Toyojiro

    2018-06-01

    Rett syndrome (RTT) is a neurodevelopmental disorder mostly caused by mutations in Methyl-CpG-binding protein 2 (MECP2); however, mutations in various other genes may lead to RTT-like phenotypes. Here, we report the first case of a Japanese girl with RTT caused by a novel syntaxin-binding protein 1 (STXBP1) frameshift mutation (c.60delG, p.Lys21Argfs*16). She showed epilepsy at one year of age, regression of acquired psychomotor abilities thereafter, and exhibited stereotypic hand and limb movements at 3 years of age. Her epilepsy onset was earlier than is typical for RTT patients. However, she fully met the 2010 diagnostic criteria of typical RTT. STXBP1 mutations cause early infantile epileptic encephalopathy (EIEE), various intractable epilepsies, and neurodevelopmental disorders. However, the case described here presented a unique clinical presentation of typical RTT without EIEE and a novel STXBP1 mutation. Copyright © 2018 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

  11. Cardiac abnormalities in patients with mitochondrial DNA mutation 3243A>G.

    PubMed

    Majamaa-Voltti, Kirsi; Peuhkurinen, Keijo; Kortelainen, Marja-Leena; Hassinen, Ilmo E; Majamaa, Kari

    2002-08-01

    Tissues that depend on aerobic energy metabolism suffer most in diseases caused by mutations in mitochondrial DNA (mtDNA). Cardiac abnormalities have been described in many cases, but their frequency and clinical spectrum among patients with mtDNA mutations is unknown. Thirty-nine patients with the 3243A>G mtDNA mutation were examined, methods used included clinical evaluation, electrocardiogram, Holter recording and echocardiography. Autopsy reports on 17 deceased subjects were also reviewed. The degree of 3243A>G mutation heteroplasmy was determined using an Apa I restriction fragment analysis. Better hearing level (BEHL0.5-4 kHz) was used as a measure of the clinical severity of disease. Left ventricular hypertrophy (LVH) was diagnosed in 19 patients (56%) by echocardiography and in six controls (15%) giving an odds ratio of 7.5 (95% confidence interval; 1.74-67). The dimensions of the left ventricle suggested a concentric hypertrophy. Left ventricular systolic or diastolic dysfunction was observed in 11 patients. Holter recording revealed frequent ventricular extrasystoles (>10/h) in five patients. Patients with LVH differed significantly from those without LVH in BEHL0.5-4 kHz, whereas the contribution of age or the degree of the mutant heteroplasmy in skeletal muscle to the risk of LVH was less remarkable. Structural and functional abnormalities of the heart were common in patients with 3243A>G. The risk of LVH was related to the clinical severity of the phenotype, and to a lesser degree to age, suggesting that patients presenting with any symptoms from the mutation should also be evaluated for cardiac abnormalities.

  12. Autophagy and Oxidative Stress in Gliomas with IDH1 Mutations

    PubMed Central

    Gilbert, Misty R.; Liu, Yinxing; Neltner, Janna; Pu, Hong; Morris, Andrew; Sunkara, Manjula; Pittman, Thomas; Kyprianou, Natasha; Horbinski, Craig

    2013-01-01

    IDH1 mutations in gliomas associate with longer survival. Prooxidant and antiproliferative effects of IDH1 mutations and its D-2-hydroxyglutarate (2-HG) product have been described in vitro, but inconsistently observed. It is also unclear whether overexpression of mutant IDH1 in wild-type cells accurately phenocopies the effects of endogenous IDH1-mutations on tumor apoptosis and autophagy. Herein we investigated the effects of 2-HG and mutant IDH1 overexpression on proliferation, apoptosis, oxidative stress, and autophagy in IDH1 wild-type glioma cells, and compared those results with patient-derived tumors. 2-HG reduced viability and proliferation of U87MG and LN18 cells, triggered apoptosis in LN18 cells, and autophagy in U87MG cells. In vitro studies and flank xenografts of U87MG cells overexpressing R132H IDH1 exhibited increased oxidative stress, including increases of both manganese superoxide dismutase (MnSOD) and p62. Patient-derived IDH1-mutant tumors showed no significant differences in apoptosis or autophagy, but showed p62 accumulation and actually trended toward reduced MnSOD expression. These data indicate that mutant IDH1 and 2-HG can induce oxidative stress, autophagy, and apoptosis, but these effects vary greatly according to cell type. PMID:24150401

  13. Transduced human copper chaperone for Cu,Zn-SOD (PEP-1-CCS) protects against neuronal cell death.

    PubMed

    Choi, Soo Hyun; Kim, Dae Won; Kim, So Young; An, Jae Jin; Lee, Sun Hwa; Choi, Hee Soon; Sohn, Eun Jung; Hwang, Seok-Il; Won, Moo Ho; Kang, Tae-Cheon; Kwon, Hyung Joo; Kang, Jung Hoon; Cho, Sung-Woo; Park, Jinseu; Eum, Won Sik; Choi, Soo Young

    2005-12-31

    Reactive oxygen species (ROS) contribute to the development of various human diseases. Cu,Zn-superoxide dismutase (SOD) is one of the major means by which cells counteract the deleterious effects of ROS. SOD activity is dependent upon bound copper ions supplied by its partner metallochaperone protein, copper chaperone for SOD (CCS). In the present study, we investigated the protective effects of PEP-1-CCS against neuronal cell death and ischemic insults. When PEP-1-CCS was added to the culture medium of neuronal cells, it rapidly entered the cells and protected them against paraquat-induced cell death. Moreover, transduced PEP-1-CCS markedly increased endogenous SOD activity in the cells. Immunohistochemical analysis revealed that it prevented neuronal cell death in the hippocampus in response to transient forebrain ischemia. These results suggest that CCS is essential to activate SOD, and that transduction of PEP-1-CCS provides a potential strategy for therapeutic delivery in various human diseases including stroke related to SOD or ROS.

  14. A Recurrent Mutation in CACNA1G Alters Cav3.1 T-Type Calcium-Channel Conduction and Causes Autosomal-Dominant Cerebellar Ataxia

    PubMed Central

    Coutelier, Marie; Blesneac, Iulia; Monteil, Arnaud; Monin, Marie-Lorraine; Ando, Kunie; Mundwiller, Emeline; Brusco, Alfredo; Le Ber, Isabelle; Anheim, Mathieu; Castrioto, Anna; Duyckaerts, Charles; Brice, Alexis; Durr, Alexandra; Lory, Philippe; Stevanin, Giovanni

    2015-01-01

    Hereditary cerebellar ataxias (CAs) are neurodegenerative disorders clinically characterized by a cerebellar syndrome, often accompanied by other neurological or non-neurological signs. All transmission modes have been described. In autosomal-dominant CA (ADCA), mutations in more than 30 genes are implicated, but the molecular diagnosis remains unknown in about 40% of cases. Implication of ion channels has long been an ongoing topic in the genetics of CA, and mutations in several channel genes have been recently connected to ADCA. In a large family affected by ADCA and mild pyramidal signs, we searched for the causative variant by combining linkage analysis and whole-exome sequencing. In CACNA1G, we identified a c.5144G>A mutation, causing an arginine-to-histidine (p.Arg1715His) change in the voltage sensor S4 segment of the T-type channel protein Cav3.1. Two out of 479 index subjects screened subsequently harbored the same mutation. We performed electrophysiological experiments in HEK293T cells to compare the properties of the p.Arg1715His and wild-type Cav3.1 channels. The current-voltage and the steady-state activation curves of the p.Arg1715His channel were shifted positively, whereas the inactivation curve had a higher slope factor. Computer modeling in deep cerebellar nuclei (DCN) neurons suggested that the mutation results in decreased neuronal excitability. Taken together, these data establish CACNA1G, which is highly expressed in the cerebellum, as a gene whose mutations can cause ADCA. This is consistent with the neuropathological examination, which showed severe Purkinje cell loss. Our study further extends our knowledge of the link between calcium channelopathies and CAs. PMID:26456284

  15. Biallelic mutations in GPD1 gene in a Chinese boy mainly presented with obesity, insulin resistance, fatty liver, and short stature.

    PubMed

    Li, Niu; Chang, Guoying; Xu, Yufei; Ding, Yu; Li, Guoqiang; Yu, Tingting; Yao, Ruen; Li, Juan; Shen, Yiping; Wang, Xiumin; Wang, Jian

    2017-12-01

    Biallelic mutations in the GPD1 gene cause a rare autosomal recessive inherited disease known as transient infantile hypertriglyceridemia (OMIM #614480). To date, only five pathogenic variants have been reported in 15 patients from three studies. The clinical symptoms of the affected individuals present a certain degree of heterogeneity. Here, we describe a chinese adolescent patient who mainly presented with obesity, insulin resistance, fatty liver, and short stature. Targeted next-generation sequencing revealed a novel compound heterozygous variant in GPD1 gene (c.220-2A>G and c.820G>A; p.Ala274Thr). In vitro studies demonstrated that the Ala274Thr variant induced a decrease in GPD1 protein expression. Further in vitro investigation of the splicing pattern in a minigene construct in HEK293 cells showed that the c.220-2A>G variant generated an altered transcript with one cryptic splice site in exon 3, resulting in the loss of 69 bases in exon 3 (c.220_288del, p.74_96del). This is the first report involving an Asian who harbored GPD1 mutations. Our work not only expands the mutant spectrum of the GPD1 gene but also provides new insights on its resulting phenotype. © 2017 Wiley Periodicals, Inc.

  16. Leigh Syndrome and the Mitochondrial m.13513G>A Mutation: Expanding the Clinical Spectrum.

    PubMed

    Monlleo-Neila, Laura; Toro, Mireia Del; Bornstein, Belen; Garcia-Arumi, Elena; Sarrias, Axel; Roig-Quilis, Manuel; Munell, Francina

    2013-11-01

    The mitochondrial DNA m.13513G>A mutation in the ND5 subunit gene is a frequent cause of Leigh syndrome. Patients harboring this mutation typically present with ptosis and cardiac conduction abnormalities, particularly Wolff-Parkinson-White syndrome, and have a late clinical onset, which contrasts with the typical infantile form. The authors describe a patient presenting with intrauterine growth retardation and visual impairment at 3 months of age, followed by infantile spasms, severe gastrointestinal dysmotility, and neurological regression. The patient had hyperlactacidemia and bilateral basal ganglia and brainstem lesions on MRI. Although he did not present cardiac conduction abnormalities, his mother had been diagnosed with Wolff-Parkinson-White syndrome. The m.13513G>A mutation was found in the patient's muscle and in several tissues of his mother. The present results expand the phenotype of Leigh syndrome associated with the m.13513G>A mutation, which should be suspected in patients with early-onset mitochondrial encephalopathy with infantile spasms or prominent gastrointestinal smooth muscle involvement.

  17. Mutations in a gene encoding the. cap alpha. subunit of a Saccharomyces cerevisiae G protein indicate a role in mating pheromone signaling

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jahng, K.Y.; Ferguson, J.; Reed, S.I.

    1988-06-01

    Mutations which allowed conjugation by Saccharomyces cerevisiae cells lacking a mating pheromone receptor gene were selected. One of the genes defined by such mutations was isolated from a yeast genomic library by complementation of a temperature-sensitive mutation and is identically to the gene GPA1 (also known as SCG1), recently shown to be highly homologous to gene encoding the ..cap alpha.. subunits of mammalian G proteins. Physiological analysis of temperature-sensitive gpal mutations suggests that the encoded G protein is involved in signaling in response to mating pheromones. Mutational disruption of G-protein activity causes cell-cycle arrest in G/sub 1/, deposition of mating-specificmore » cell surface aggultinins, and induction of pheromone-specific mRNa, all of which are responses to pheromone in wild-type cells. In addition, mutants can conjugate without the benefit of mating pheromone or pheromone receptor. A model is presented where the activated G protein has a negative impact on a constitutive signal which normally keeps the pheromone response repressed.« less

  18. Eukaryotic copper-only superoxide dismutases (SODs): A new class of SOD enzymes and SOD-like protein domains.

    PubMed

    Robinett, Natalie G; Peterson, Ryan L; Culotta, Valeria C

    2018-03-30

    The copper-containing superoxide dismutases (SODs) represent a large family of enzymes that participate in the metabolism of reactive oxygen species by disproportionating superoxide anion radical to oxygen and hydrogen peroxide. Catalysis is driven by the redox-active copper ion, and in most cases, SODs also harbor a zinc at the active site that enhances copper catalysis and stabilizes the protein. Such bimetallic Cu,Zn-SODs are widespread, from the periplasm of bacteria to virtually every organelle in the human cell. However, a new class of copper-containing SODs has recently emerged that function without zinc. These copper-only enzymes serve as extracellular SODs in specific bacteria ( i.e. Mycobacteria), throughout the fungal kingdom, and in the fungus-like oomycetes. The eukaryotic copper-only SODs are particularly unique in that they lack an electrostatic loop for substrate guidance and have an unusual open-access copper site, yet they can still react with superoxide at rates limited only by diffusion. Copper-only SOD sequences similar to those seen in fungi and oomycetes are also found in the animal kingdom, but rather than single-domain enzymes, they appear as tandem repeats in large polypeptides we refer to as CSRPs (copper-only SOD-repeat proteins). Here, we compare and contrast the Cu,Zn versus copper-only SODs and discuss the evolution of copper-only SOD protein domains in animals and fungi. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  19. Vascular physiology and protein disposition in a preclinical model of neurodegeneration.

    PubMed

    Boswell, C Andrew; Mundo, Eduardo E; Johnstone, Bernadette; Ulufatu, Sheila; Schweiger, Michelle G; Bumbaca, Daniela; Fielder, Paul J; Prabhu, Saileta; Khawli, Leslie A

    2013-05-06

    The development of clinically relevant preclinical models that mimic the hallmarks of neurodegenerative disease is an ongoing pursuit in early drug development. In particular, robust physiological characterization of central nervous system (CNS) disease models is necessary to predict drug delivery to target tissues and to correctly interpret pharmacodynamic responses to disease-modifying therapeutic candidates. Efficient drug delivery across the blood-CNS barrier is a particularly daunting task, prompting our strategy to evaluate the biodistribution of five distinct molecular probes in a well-characterized mouse model of neurodegeneration. A transgenic mouse model of amyotrophic lateral sclerosis was selected based on a phenotype resembling clinical symptoms, including loss of motor neurons from the spinal cord and paralysis in one or more limbs, due to expression of a G93A mutant form of human superoxide dismutase (SOD1). The tissue distributions of two proteins, albumin and a representative immunoglobulin G antibody, as well as two blood flow markers, the lipophilic blood flow marker Ceretec (i.e., (99m)Tc-HMPAO) and the polar ionic tracer, rubidium-86 chloride ((86)RbCl), were measured following intravenous injection in SOD1(G93A) and age-matched control mice. The radiopharmaceutical TechneScan PYP was also used to measure the distribution of (99m)Tc-labeled red blood cells as a blood pool marker. Both the antibody and (86)Rb were able to cross the blood-spinal cord barrier in SOD1(G93A) mice to a greater extent than in control mice. Although the biodistribution patterns of antibody, albumin, and RBCs were largely similar, notable differences were detected in muscle and skin. Moreover, vastly different biodistribution patterns were observed for a lipophilic and polar perfusion agent, with SOD1(G93A) mutation resulting in reduced renal filtration rates for the former but not the latter. Overall, the multiprobe strategy provided an opportunity to efficiently

  20. Cardiac abnormalities in patients with mitochondrial DNA mutation 3243A>G

    PubMed Central

    Majamaa-Voltti, Kirsi; Peuhkurinen, Keijo; Kortelainen, Marja-Leena; Hassinen, Ilmo E; Majamaa, Kari

    2002-01-01

    Background Tissues that depend on aerobic energy metabolism suffer most in diseases caused by mutations in mitochondrial DNA (mtDNA). Cardiac abnormalities have been described in many cases, but their frequency and clinical spectrum among patients with mtDNA mutations is unknown. Methods Thirty-nine patients with the 3243A>G mtDNA mutation were examined, methods used included clinical evaluation, electrocardiogram, Holter recording and echocardiography. Autopsy reports on 17 deceased subjects were also reviewed. The degree of 3243A>G mutation heteroplasmy was determined using an Apa I restriction fragment analysis. Better hearing level (BEHL0.5–4 kHz) was used as a measure of the clinical severity of disease. Results Left ventricular hypertrophy (LVH) was diagnosed in 19 patients (56%) by echocardiography and in six controls (15%) giving an odds ratio of 7.5 (95% confidence interval; 1.74–67). The dimensions of the left ventricle suggested a concentric hypertrophy. Left ventricular systolic or diastolic dysfunction was observed in 11 patients. Holter recording revealed frequent ventricular extrasystoles (>10/h) in five patients. Patients with LVH differed significantly from those without LVH in BEHL0.5–4 kHz, whereas the contribution of age or the degree of the mutant heteroplasmy in skeletal muscle to the risk of LVH was less remarkable. Conclusions Structural and functional abnormalities of the heart were common in patients with 3243A>G. The risk of LVH was related to the clinical severity of the phenotype, and to a lesser degree to age, suggesting that patients presenting with any symptoms from the mutation should also be evaluated for cardiac abnormalities. PMID:12150714

  1. A novel homozygous mutation in G6PC3 presenting as cyclic neutropenia and severe congenital neutropenia in the same family.

    PubMed

    Alangari, Abdullah A; Alsultan, Abdulrahman; Osman, Mohamed Elfaki; Anazi, Shamsa; Alkuraya, Fowzan S

    2013-11-01

    Patients with autosomal recessive cyclic neutropenia have no known causative genetic defect yet. Autozygosity mapping on two branches of an extended multiplex consanguineous family presenting with cyclic neutropenia or severe congenital neutropenia to look for candidate gene, followed by candidate gene selection and sequencing. A single autozygous interval on Chr17:33,901,938-45,675,414 that is exclusively shared by the affected members was identified. This interval spans 11.8 Mb and contains 30 genes. Review of these genes highlighted G6PC3 as the most likely candidate given its known role in neutrophil biology. Direct sequencing revealed a novel homozygous mutation (NM_138387.3, c.974T > G, p.Leu325Arg). Two of our patients had associated congenital defects that are known to occur in patients with G6PC3 mutations, including congenital heart disease and intermittent thrombocytopenia. Biallelic G6PC3 defects should be considered in patients with autosomal recessive cyclic neutropenia, especially those with typical associated congenital defects.

  2. Confirmation of the pathogenicity of a mutation p.G337C in the COL1A2 gene associated with osteogenesis imperfecta

    PubMed Central

    Jia, Mingrui; Shi, Ranran; Zhao, Xuli; Fu, Zhijian; Bai, Zhijing; Sun, Tao; Zhao, Xuejun; Wang, Wenbo; Xu, Chao; Yan, Fang

    2017-01-01

    Abstract Mutation analysis as the gold standard is particularly important in diagnosis of osteogenesis imperfecta (OI) and it may be preventable upon early diagnosis. In this study, we aimed to analyze the clinical and genetic materials of an OI pedigree as well as to confirm the deleterious property of the mutation. A pedigree with OI was identified. All family members received careful clinical examinations and blood was drawn for genetic analyses. Genes implicated in OI were screened for mutation. The function and structure of the mutant protein were predicted using bioinformatics analysis. The proband, a 9-month fetus, showed abnormal sonographic images. Disproportionately short and triangular face with blue sclera was noticed at birth. She can barely walk and suffered multiple fractures till 2-year old. Her mother appeared small stature, frequent fractures, blue sclera, and deformity of extremities. A heterozygous missense mutation c.1009G>T (p.G337C) in the COL1A2 gene was identified in her mother and her. Bioinformatics analysis showed p.G337 was well-conserved among multiple species and the mutation probably changed the structure and damaged the function of collagen. We suggest that the mutation p.G337C in the COL1A2 gene is pathogenic for OI by affecting the protein structure and the function of collagen. PMID:28953610

  3. Genetic polymorphisms of antioxidant enzymes CAT and SOD affect the outcome of clinical, biochemical, and anthropometric variables in people with obesity under a dietary intervention.

    PubMed

    Hernández-Guerrero, César; Parra-Carriedo, Alicia; Ruiz-de-Santiago, Diana; Galicia-Castillo, Oscar; Buenrostro-Jáuregui, Mario; Díaz-Gutiérrez, Carmen

    2018-01-01

    Genetic polymorphisms of antioxidant enzymes CAT, GPX, and SOD are involved in the etiology of obesity and its principal comorbidities. The aim of the present study was to analyze the effect of aforementioned SNPs over the output of several variables in people with obesity after a nutritional intervention. The study included 92 Mexican women, which received a dietary intervention by 3 months. Participants were genotyped and stratified into two groups: (1) carriers; mutated homozygous plus heterozygous (CR) and (2) homozygous wild type (WT). A comparison between CR and WT was done in clinical (CV), biochemical (BV), and anthropometric variables (AV), at the beginning and at the end of the intervention. Participants ( n  = 92) showed statistically significant differences ( p  < 0.05) at the end of the nutritional intervention in several CV, BV, and AV. However, two kinds of responses were observed after genotyping participants: (A) CR and WT showed statistically significant differences ( p  < 0.05) in several CV, BV, and AV for the SNPs 599C>T GPX1 (rs1050450), - 251A>G SOD1 (rs2070424), and - 262C>T CAT (rs1001179). (B) Only CR showed statistically changes ( p  < 0.05) in several CV, BV, and AV for the SNPs - 21A>T CAT (rs7943316) and 47C>T SOD2 (rs4880). The dietary intervention effect was statistically significantly between the polymorphisms of 47C>T SOD2 and BMI, SBP, TBARS, total cholesterol, and C-LCL ( p  < 0.05) and between the polymorphisms of - 21A>T CAT (rs7943316) and SBP, DBP, total cholesterol, and atherogenic index ( p  < 0.05). People with obesity display different response in several CV, BV, and AV after a nutritional intervention, depending on the antioxidant genetic background of SOD and CAT enzymes.

  4. Novel mutation in forkhead box G1 (FOXG1) gene in an Indian patient with Rett syndrome.

    PubMed

    Das, Dhanjit Kumar; Jadhav, Vaishali; Ghattargi, Vikas C; Udani, Vrajesh

    2014-03-15

    Rett syndrome (RTT) is a severe neurodevelopmental disorder characterized by the progressive loss of intellectual functioning, fine and gross motor skills and communicative abilities, deceleration of head growth, and the development of stereotypic hand movements, occurring after a period of normal development. The classic form of RTT involves mutation in MECP2 while the involvement of CDKL5 and FOXG1 genes has been identified in atypical RTT phenotype. FOXG1 gene encodes for a fork-head box protein G1, a transcription factor acting primarily as transcriptional repressor through DNA binding in the embryonic telencephalon as well as a number of other neurodevelopmental processes. In this report we have described the molecular analysis of FOXG1 gene in Indian patients with Rett syndrome. FOXG1 gene mutation analysis was done in a cohort of 34 MECP2/CDKL5 mutation negative RTT patients. We have identified a novel mutation (p. D263VfsX190) in FOXG1 gene in a patient with congenital variant of Rett syndrome. This mutation resulted into a frameshift, thereby causing an alteration in the reading frames of the entire coding sequence downstream of the mutation. The start position of the frameshift (Asp263) and amino acid towards the carboxyl terminal end of the protein was found to be well conserved across species using multiple sequence alignment. Since the mutation is located at forkhead binding domain, the resultant mutation disrupts the secondary structure of the protein making it non-functional. This is the first report from India showing mutation in FOXG1 gene in Rett syndrome. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. [Leigh syndrome caused by the mitochondrial DNA G14459A mutation in a Mexican family].

    PubMed

    Gutiérrez, A; Saldaña-Martínez, A; García-Ramírez, R; Rayo-Mares, D; Carreras, M; López-Pérez, M J; Ruiz-Pesini, E; Montoya, J; Montiel-Sosa, J F

    Leigh syndrome is a neurodegenerative and progressive disease that appears usually in childhood due to defects in nuclear or mitochondrial genome. The mutation G14459A in mitochondrial DNA has been associated previously to Leber hereditary optic neuropathy and recently to Leigh syndrome. A 10 months-old Mexican girl diagnosed of Leigh syndrome. Molecular-genetic studies detected the mutation G14459A in a percentage close to homoplasmy and in low heteroplasmy in her mother. The rest of the maternally related family members analyzed were negative. The G14459A mutation, although not very frequently associated to Leigh syndrome, should be analyzed in patients that do not present the most common point mutations.

  6. PREVALENCE OF MUTATIONS IN ELANE, GFI1, HAX1, SBDS, WAS, AND G6PC3 IN PATIENTS WITH SEVERE CONGENITAL NEUTROPENIA

    PubMed Central

    Xia, Jun; Bolyard, Audrey Anna; Rodger, Elin; Stein, Steve; Aprikyan, Andrew A.; Dale, David C.; Link, Daniel C.

    2009-01-01

    SUMMARY Severe congenital neutropenia (SCN) is a genetically heterogeneous syndrome associated with mutations of ELANE (ELA2), HAX1, GFI1, WAS, CSF3R or G6PC3. We investigated the prevalence of mutations of ELANE in a cohort of 162 SCN patients for whom blood or bone marrow samples were submitted to the North American Severe Chronic Neutropenia Tissue Repository. Mutations of ELANE were found in 90 of 162 patients (55.6%). Subsequently, we conducted an analysis of a subset of 73 of these cases utilizing a high throughput sequencing approach to determine the prevalence of other mutations associated with SCN. Among the 73 patients, mutations of ELANE were detected in 28. In the remaining 45 patients with wild type ELANE alleles, 5 patients had mutations: GFI1 (1), SBDS (1), WAS (1) and G6PC3 (2); no mutations of HAX1 were detected. In approximately 40% of our cases, the genetic basis of SCN remains unknown. These data suggest that for genetic diagnosis of SCN, ELANE genotyping should first be performed. In patients without ELANE mutations, other known SCN-associated gene mutations will be found rarely and genotyping can be guided by the clinical features of each patient. PMID:19775295

  7. Glucose-6-Phosphate Dehydrogenase (G6PD) deficiency in Greek newborns: the Mediterranean C563T mutation screening.

    PubMed

    Molou, Elina; Schulpis, Kleopatra H; Thodi, Georgia; Georgiou, Vassiliki; Dotsikas, Yannis; Papadopoulos, Konstantinos; Biti, Sofia; Loukas, Yannis L

    2014-04-01

    Glucose-6-Phosphate Dehydrogenase (G6PD) gene is located at the X-chromosome at Xq28 and the disease is recessively inherited predominantly in males. More than 400 variants have been proposed based on clinical and enzymatic studies. The aim of the current study was to identify C563T mutation in G6PD-deficient newborns and to correlate the enzyme residual activity with the presence of the mutation. Some 1189 full-term neonates aged 3-5 days old were tested for G6PD activity in dried blood spots from Guthrie cards using a commercial kit. DNA extraction from Guthrie cards and mutation identification among the deficient samples were performed with current techniques. A total of 92 (7.7%) newborns were G6PD-deficient. In 46 (50%), the mutation C563T was identified. The residual activity in C563T hemizygote males (n = 28) was statistically significantly lower (1.23 ± 0.93 U/g Hb) than that in non-C563T G6PD-deficient males (n = 25) (4.01 ± 1.20 U/g Hb, p < 0.0001) and in controls (13.6 ± 2.9 U/g Hb, p < 0.0001). In C563T heterozygote females, the estimated enzyme activity was lower than that determined in non-C563T females. Male C563T hemizygotes suffer from G6PD deficiency and severe neonatal jaundice. G6PD activity showed statistically significant correlation with total bilirubin blood levels.

  8. Species-specific activation of Cu/Zn SOD by its CCS copper chaperone in the pathogenic yeast Candida albicans.

    PubMed

    Gleason, Julie E; Li, Cissy X; Odeh, Hana M; Culotta, Valeria C

    2014-06-01

    Candida albicans is a pathogenic yeast of important public health relevance. Virulence of C. albicans requires a copper and zinc containing superoxide dismutase (SOD1), but the biology of C. albicans SOD1 is poorly understood. To this end, C. albicans SOD1 activation was examined in baker's yeast (Saccharomyces cerevisiae), a eukaryotic expression system that has proven fruitful for the study of SOD1 enzymes from invertebrates, plants, and mammals. In spite of the 80% similarity between S. cerevisiae and C. albicans SOD1 molecules, C. albicans SOD1 is not active in S. cerevisiae. The SOD1 appears incapable of productive interactions with the copper chaperone for SOD1 (CCS1) of S. cerevisiae. C. albicans SOD1 contains a proline at position 144 predicted to dictate dependence on CCS1. By mutation of this proline, C. albicans SOD1 gained activity in S. cerevisiae, and this activity was independent of CCS1. We identified a putative CCS1 gene in C. albicans and created heterozygous and homozygous gene deletions at this locus. Loss of CCS1 resulted in loss of SOD1 activity, consistent with its role as a copper chaperone. C. albicans CCS1 also restored activity to C. albicans SOD1 expressed in S. cerevisiae. C. albicans CCS1 is well adapted for activating its partner SOD1 from C. albicans, but not SOD1 from S. cerevisiae. In spite of the high degree of homology between the SOD1 and CCS1 molecules in these two fungal species, there exists a species-specific barrier in CCS-SOD interactions which may reflect the vastly different lifestyles of the pathogenic versus the noninfectious yeast.

  9. Superoxide dismutase 1 mutation in a cellular model of amyotrophic lateral sclerosis shifts energy generation from oxidative phosphorylation to glycolysis.

    PubMed

    Allen, Scott P; Rajan, Sandeep; Duffy, Lynn; Mortiboys, Heather; Higginbottom, Adrian; Grierson, Andrew J; Shaw, Pamela J

    2014-06-01

    Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disorder involving the progressive degeneration of motor neurons in the brain and spinal cord. Mitochondrial dysfunction plays a key role in ALS disease progression and has been observed in several ALS cellular and animal models. Here, we show that fibroblasts isolated from ALS cases with a Cu/Zn superoxide dismutase (SOD1) I113T mutation recapitulate these mitochondrial defects. Using a novel technique, which measures mitochondrial respiration and glycolytic flux simultaneously in living cells, we have shown that SOD1 mutation causes a reduction in mitochondrial respiration and an increase in glycolytic flux. This causes a reduction in adenosine triphosphate produced by oxidative phosphorylation and an increase in adenosine triphosphate produced by glycolysis. Switching the energy source from glucose to galactose caused uncoupling of mitochondria with increased proton leak in SOD1(I113T) fibroblasts. Assessment of the contribution of fatty acid oxidation to total respiration, suggested that fatty acid oxidation is reduced in SOD1 ALS fibroblasts, an effect which can be mimicked by starving the control cells of glucose. These results highlight the importance of understanding the interplay between the major metabolic pathways, which has the potential to lead to strategies to correct the metabolic dysregulation observed in ALS cases. Copyright © 2014 Elsevier Inc. All rights reserved.

  10. High MACC1 expression in combination with mutated KRAS G13 indicates poor survival of colorectal cancer patients.

    PubMed

    Ilm, Katharina; Kemmner, Wolfgang; Osterland, Marc; Burock, Susen; Koch, Gudrun; Herrmann, Pia; Schlag, Peter M; Stein, Ulrike

    2015-02-14

    The metastasis-associated in colon cancer 1 (MACC1) gene has been identified as prognostic biomarker for colorectal cancer (CRC). Here, we aimed at the refinement of risk assessment by separate and combined survival analyses of MACC1 expression with any of the markers KRAS mutated in codon 12 (KRAS G12) or codon 13 (KRAS G13), BRAF V600 mutation and MSI status in a retrospective study of 99 CRC patients with tumors UICC staged I, II and III. We showed that only high MACC1 expression (HR: 6.09, 95% CI: 2.50-14.85, P < 0.001) and KRAS G13 mutation (HR: 5.19, 95% CI: 1.06-25.45, P = 0.042) were independent prognostic markers for shorter metastasis-free survival (MFS). Accordingly, Cox regression analysis revealed that patients with high MACC1 expression and KRAS G13 mutation exhibited the worst prognosis (HR: 14.48, 95% CI: 3.37-62.18, P < 0.001). Patients were classified based on their molecular characteristics into four clusters with significant differences in MFS (P = 0.003) by using the SPSS 2-step cluster function and Kaplan-Meier survival analysis. According to our results, patients with high MACC1 expression and mutated KRAS G13 exhibited the highest risk for metachronous metastases formation. Moreover, we demonstrated that the "Traditional pathway" with an intermediate risk for metastasis formation can be further subdivided by assessing MACC1 expression into a low and high risk group with regard to MFS prognosis. This is the first report showing that identification of CRC patients at high risk for metastasis is possible by assessing MACC1 expression in combination with KRAS G13 mutation.

  11. Mechanistic study on the nuclear modifier gene MSS1 mutation suppressing neomycin sensitivity of the mitochondrial 15S rRNA C1477G mutation in Saccharomyces cerevisiae.

    PubMed

    Zhou, Qiyin; Wang, Wei; He, Xiangyu; Zhu, Xiaoyu; Shen, Yaoyao; Yu, Zhe; Wang, Xuexiang; Qi, Xuchen; Zhang, Xuan; Fan, Mingjie; Dai, Yu; Yang, Shuxu; Yan, Qingfeng

    2014-01-01

    The phenotypic manifestation of mitochondrial DNA (mtDNA) mutations can be modulated by nuclear genes and environmental factors. However, neither the interaction among these factors nor their underlying mechanisms are well understood. The yeast Saccharomyces cerevisiae mtDNA 15S rRNA C1477G mutation (PR) corresponds to the human 12S rRNA A1555G mutation. Here we report that a nuclear modifier gene mss1 mutation suppresses the neomycin-sensitivity phenotype of a yeast C1477G mutant in fermentable YPD medium. Functional assays show that the mitochondrial function of the yeast C1477G mutant was impaired severely in YPD medium with neomycin. Moreover, the mss1 mutation led to a significant increase in the steady-state level of HAP5 (heme activated protein), which greatly up-regulated the expression of glycolytic transcription factors RAP1, GCR1, and GCR2 and thus stimulated glycolysis. Furthermore, the high expression of the key glycolytic enzyme genes HXK2, PFK1 and PYK1 indicated that enhanced glycolysis not only compensated for the ATP reduction from oxidative phosphorylation (OXPHOS) in mitochondria, but also ensured the growth of the mss1(PR) mutant in YPD medium with neomycin. This study advances our understanding of the phenotypic manifestation of mtDNA mutations.

  12. SOD-1 expression in pig coronary arterioles is increased by exercise training.

    PubMed

    Rush, J W; Laughlin, M H; Woodman, C R; Price, E M

    2000-11-01

    Coronary arterioles of exercise-trained (EX) pigs have enhanced nitric oxide (NO.)-dependent dilation. Evidence suggests that the biological half-life of NO. depends in part on the management of the superoxide anion. The purpose of this study was to test the hypothesis that expression of cytosolic copper/zinc-dependent superoxide dismutase (SOD)-1 is increased in coronary arterioles as a result of exercise training. Male Yucatan pigs either remained sedentary (SED, n = 4) or were EX (n = 4) on a motorized treadmill for 16-20 wk. Individual coronary arterioles ( approximately 100-microm unpressurized internal diameter) were dissected and frozen. Coronary arteriole SOD-1 protein (via immunoblots) increased as a result of exercise training (2.16 +/- 0.35 times SED levels) as did SOD-1 enzyme activity (measured via inhibition of pyrogallol autooxidation; approximately 75% increase vs. SED). In addition, SOD-1 mRNA levels (measured via RT-PCR) were higher in EX arterioles (1.68 +/- 0.16 times the SED levels). There were no effects of exercise training on the levels of SOD-2 (mitochondrial), catalase, or p67(phox) proteins. Thus chronic aerobic exercise training selectively increases the levels of SOD-1 mRNA, protein, and enzymatic activity in porcine coronary arterioles. Increased SOD-1 could contribute to the enhanced NO.-dependent dilation previously observed in EX porcine coronary arterioles by improving management of superoxide in the vascular cell environment, thus prolonging the biological half-life of NO.

  13. Peroxisome proliferator activator receptor gamma coactivator-1alpha (PGC-1α) improves motor performance and survival in a mouse model of amyotrophic lateral sclerosis

    PubMed Central

    2011-01-01

    Background Amyotrophic lateral sclerosis (ALS) is a devastating neurodegenerative disease that affects spinal cord and cortical motor neurons. An increasing amount of evidence suggests that mitochondrial dysfunction contributes to motor neuron death in ALS. Peroxisome proliferator-activated receptor gamma co-activator-1α (PGC-1α) is a principal regulator of mitochondrial biogenesis and oxidative metabolism. Results In this study, we examined whether PGC-1α plays a protective role in ALS by using a double transgenic mouse model where PGC-1α is over-expressed in an SOD1 transgenic mouse (TgSOD1-G93A/PGC-1α). Our results indicate that PGC-1α significantly improves motor function and survival of SOD1-G93A mice. The behavioral improvements were accompanied by reduced blood glucose level and by protection of motor neuron loss, restoration of mitochondrial electron transport chain activities and inhibition of stress signaling in the spinal cord. Conclusion Our results demonstrate that PGC-1α plays a beneficial role in a mouse model of ALS, suggesting that PGC-1α may be a potential therapeutic target for ALS therapy. PMID:21771318

  14. A G542X cystic fibrosis mouse model for examining nonsense mutation directed therapies.

    PubMed

    McHugh, Daniel R; Steele, Miarasa S; Valerio, Dana M; Miron, Alexander; Mann, Rachel J; LePage, David F; Conlon, Ronald A; Cotton, Calvin U; Drumm, Mitchell L; Hodges, Craig A

    2018-01-01

    Nonsense mutations are present in 10% of patients with CF, produce a premature termination codon in CFTR mRNA causing early termination of translation, and lead to lack of CFTR function. There are no currently available animal models which contain a nonsense mutation in the endogenous Cftr locus that can be utilized to test nonsense mutation therapies. In this study, we create a CF mouse model carrying the G542X nonsense mutation in Cftr using CRISPR/Cas9 gene editing. The G542X mouse model has reduced Cftr mRNA levels, demonstrates absence of CFTR function, and displays characteristic manifestations of CF mice such as reduced growth and intestinal obstruction. Importantly, CFTR restoration is observed in G542X intestinal organoids treated with G418, an aminoglycoside with translational readthrough capabilities. The G542X mouse model provides an invaluable resource for the identification of potential therapies of CF nonsense mutations as well as the assessment of in vivo effectiveness of these potential therapies targeting nonsense mutations.

  15. New Insights on β-Thalassemia in the Palestinian Population of Gaza: High Frequency and Milder Phenotype Among Homozygous IVS-I-1 (HBB: c.92+1G>A) Patients with High Levels of Hb F.

    PubMed

    Ghoti, Hussam; Fibach, Eitan; Rachmilewitz, Eliezer A; Jeadi, Hisham; Filon, Dvora

    2017-03-01

    β-Thalassemia (β-thal) is a very common disease in the Palestinian population of the Gaza Strip. We studied their mutation frequency and clinical features. Thirteen different mutations were identified. The most common mutation was IVS-I-1 (G>A) (HBB: c.92+1G>A), which was prevalent in 31.5% of the thalassemia alleles studied. The IVS-I-110 (G>A) (HBB: c.93-21G>A) mutation was found in 25.0% of the alleles. Homozygotes for the IVS-I-1 mutation had higher mean hemoglobin (Hb) levels, required less blood transfusions, and lower transferrin saturation than the homozygotes for the IVS-I-110 mutation. This milder phenotype was, most likely, the result of the persistent production of Hb F; it was 9-fold higher in absolute terms (g/dL) and 7.7-fold higher in relative terms (percentage of total Hb). About half of our IVS-I-1 patients carried the XmnI polymorphism, which is known to be associated with elevated Hb F levels.

  16. Canine Degenerative Myelopathy: Biochemical characterization of superoxide dismutase 1 in the first naturally occurring non-human amyotrophic lateral sclerosis model1

    PubMed Central

    Crisp, Matthew J.; Beckett, Jeffrey; Coates, Joan R.; Miller, Timothy M.

    2013-01-01

    Mutations in canine superoxide dismutase 1 (SOD1) have recently been shown to cause canine degenerative myelopathy, a disabling neurodegenerative disorder affecting specific breeds of dogs characterized by progressive motor neuron loss and paralysis until death, or more common, euthanasia. This discovery makes canine degenerative myelopathy the first and only naturally occurring non-human model of amyotrophic lateral sclerosis (ALS), closely paralleling the clinical, pathological, and genetic presentation of its human counterpart, SOD1-mediated familial ALS. To further understand the biochemical role that canine SOD1 plays in this disease and how it may be similar to human SOD1, we characterized the only two SOD1 mutations described in affected dogs to date, E40K and T18S. We show that a detergent-insoluble species of mutant SOD1 is present in spinal cords of affected dogs that increases with disease progression. Our in vitro results indicate that both canine SOD1 mutants form enzymatically active dimers, arguing against a loss of function in affected homozygous animals. Further studies show that these mutants, like most human SOD1 mutants, have an increased propensity to form aggregates in cell culture, with 10-20% of cells possessing visible aggregates. Creation of the E40K mutation in human SOD1 recapitulates the normal enzymatic activity but not the aggregation propensity seen with the canine mutant. Our findings lend strong biochemical support to the toxic role of SOD1 in canine degenerative myelopathy and establish close parallels for the role mutant SOD1 plays in both canine and human disorders. PMID:23707216

  17. Glycogen storage disease type 1a in Israel: biochemical, clinical, and mutational studies.

    PubMed

    Parvari, R; Lei, K J; Bashan, N; Hershkovitz, E; Korman, S H; Barash, V; Lerman-Sagie, T; Mandel, H; Chou, J Y; Moses, S W

    1997-10-31

    Glycogen storage disease type 1a (von Gierke disease, GSD 1a) is caused by the deficiency of microsomal glucose-6-phosphatase (G6Pase) activity which catalyzes the final common step of glycogenolysis and gluconeogenesis. The recent cloning of the G6Pase cDNA and characterization of the human G6Pase gene enabled the characterization of the mutations causing GSD 1a. This, in turn, allows the introduction of a noninvasive DNA-based diagnosis that provides reliable carrier testing and prenatal diagnosis. In this study, we report the biochemical and clinical characteristics as well as mutational analyses of 12 Israeli GSD 1a patients of different families, who represent most GSD 1a patients in Israel. The mutations, G6Pase activity, and glycogen content of 7 of these patients were reported previously. The biochemical data and clinical findings of all patients were similar and compatible with those described in other reports. All 9 Jewish patients, as well as one Muslim Arab patient, presented the R83C mutation. Two Muslim Arab patients had the V166G mutation which was not found in other patients' populations. The V166G mutation, which was introduced into the G6Pase cDNA by site-directed mutagenesis following transient expression in COS-1 cells, was shown to cause complete inactivation of the G6Pase. The characterization of all GSD 1a mutations in the Israeli population lends itself to carrier testing in these families as well as to prenatal diagnosis, which was carried out in 2 families. Since all Ashkenzai Jewish patients harbor the same mutation, our study suggests that DNA-based diagnosis may be used as an initial diagnostic step in Ashkenazi Jews suspected of having GSD 1a, thereby avoiding liver biopsy.

  18. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

    PubMed

    Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

    2017-10-01

    Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

  19. Characterization of the mutations in the glucose-6-phosphatase gene in Israeli patients with glycogen storage disease type 1a: R83C in six Jews and a novel V166G mutation in a Muslim Arab.

    PubMed

    Parvari, R; Moses, S; Hershkovitz, E; Carmi, R; Bashan, N

    1995-01-01

    Glycogen storage disease type 1a (GSD 1a), an autosomal recessive disease, is caused by the inactivity of glucose-6-phosphatase, the gene of which has been recently cloned. We report on the missense mutation C-->T at nucleotide 326 of the G6Pase gene, causing the change of the Arg codon at position 83 into a Cys codon, as the single mutation detected in six Jewish patients. This finding suggests that this mutation might be prevalent among the Jewish population. A new missense mutation T-->G at nucleotide 576 resulting in V166G was found in an Arab Muslim patient. These families may benefit now from pre- and postnatal diagnosis by analysis of DNA from blood and amniotic fluid or chorionic villus cells rather than liver biopsy. No mutations in the G6Pase gene were detected in two GSD 1b patients.

  20. Antitumor activity of alectinib, a selective ALK inhibitor, in an ALK-positive NSCLC cell line harboring G1269A mutation: Efficacy of alectinib against ALK G1269A mutated cells.

    PubMed

    Yoshimura, Yasushi; Kurasawa, Mitsue; Yorozu, Keigo; Puig, Oscar; Bordogna, Walter; Harada, Naoki

    2016-03-01

    Alectinib is a highly selective next-generation anaplastic lymphoma kinase (ALK) inhibitor. Although alectinib shows inhibitory activity against various crizotinib-resistant ALK mutations in studies using cell-free kinase assays and Ba/F3 cell-based assays, it has not been tested for efficacy against non-small cell lung cancer (NSCLC) with the ALK mutations. We conducted in vitro and in vivo investigations into the antitumor activity of alectinib against an ALK-positive NSCLC cell line, SNU-2535, which harbors an ALK G1269A mutation. The clinical efficacy of alectinib against a NSCLC patient harboring ALK G1269A mutation was evaluated in the phase I part of the North American study. Alectinib exhibited antiproliferative activity against SNU-2535 cells in vitro with IC50 of 33.1 nM. Alectinib strongly inhibited phosphorylation of ALK and its downstream signaling molecules ERK1/2, AKT, and STAT3. In a mouse xenograft model, once-daily oral administration of alectinib for 21 days resulted in strong tumor regression. In addition, administration of alectinib for 100 days achieved continuous tumor regression without tumor regrowth in all mice. Notably, eradication of tumor cells was observed in half of the mice. In the clinical study, a patient with ALK G1269A mutation showed partial response to alectinib with a duration of response of 84 days. These results indicated that alectinib has potent antitumor activity against NSCLC cells harboring the crizotinib-resistant mutation ALK G1269A. It is expected that alectinib would provide a valuable therapeutic option for patients with NSCLC having not only native ALK but also crizotinib-resistant ALK mutations.

  1. An unusual case of schwannomatosis with bilateral maxillary sinus schwannomas and a novel SMARCB1 gene mutation.

    PubMed

    Toms, Jamie; Harrison, Jason; Richard, Hope; Childers, Adrienne; Reiter, Evan R; Graham, Robert S

    2016-01-01

    Schwannomas are benign tumors that arise from Schwann cells in the peripheral nervous system. Patients with multiple schwannomas without signs and symptoms of neurofibromatosis Type 1 or 2 have the rare disease schwannomatosis. Tumors in these patients occur along peripheral nerves throughout the body. Mutations of the SMARCB1 gene have been described as one of the predisposing genetic factors in the development of this disease. This report describes a patient who was observed for 6 years after having undergone removal of 7 schwannomas, including bilateral maxillary sinus schwannomas, a tumor that has not been previously reported. Genetic analysis revealed a novel mutation of c.93G>A in exon 1 of the SMARCB1 gene.

  2. A Dominant Mutation in Hexokinase 1 (HK1) Causes Retinitis Pigmentosa

    PubMed Central

    Sullivan, Lori S.; Koboldt, Daniel C.; Bowne, Sara J.; Lang, Steven; Blanton, Susan H.; Cadena, Elizabeth; Avery, Cheryl E.; Lewis, Richard A.; Webb-Jones, Kaylie; Wheaton, Dianna H.; Birch, David G.; Coussa, Razck; Ren, Huanan; Lopez, Irma; Chakarova, Christina; Koenekoop, Robert K.; Garcia, Charles A.; Fulton, Robert S.; Wilson, Richard K.; Weinstock, George M.; Daiger, Stephen P.

    2014-01-01

    Purpose. To identify the cause of retinitis pigmentosa (RP) in UTAD003, a large, six-generation Louisiana family with autosomal dominant retinitis pigmentosa (adRP). Methods. A series of strategies, including candidate gene screening, linkage exclusion, genome-wide linkage mapping, and whole-exome next-generation sequencing, was used to identify a mutation in a novel disease gene on chromosome 10q22.1. Probands from an additional 404 retinal degeneration families were subsequently screened for mutations in this gene. Results. Exome sequencing in UTAD003 led to identification of a single, novel coding variant (c.2539G>A, p.Glu847Lys) in hexokinase 1 (HK1) present in all affected individuals and absent from normal controls. One affected family member carries two copies of the mutation and has an unusually severe form of disease, consistent with homozygosity for this mutation. Screening of additional adRP probands identified four other families (American, Canadian, and Sicilian) with the same mutation and a similar range of phenotypes. The families share a rare 450-kilobase haplotype containing the mutation, suggesting a founder mutation among otherwise unrelated families. Conclusions. We identified an HK1 mutation in five adRP families. Hexokinase 1 catalyzes phosphorylation of glucose to glucose-6-phosphate. HK1 is expressed in retina, with two abundant isoforms expressed at similar levels. The Glu847Lys mutation is located at a highly conserved position in the protein, outside the catalytic domains. We hypothesize that the effect of this mutation is limited to the retina, as no systemic abnormalities in glycolysis were detected. Prevalence of the HK1 mutation in our cohort of RP families is 1%. PMID:25190649

  3. Glycerolipid Headgroups Control Rate and Mechanism of Superoxide Dismutase-1 Aggregation and Accelerate Fibrillization of Slowly Aggregating Amyotrophic Lateral Sclerosis Mutants.

    PubMed

    Rasouli, Sanaz; Abdolvahabi, Alireza; Croom, Corbin M; Plewman, Devon L; Shi, Yunhua; Shaw, Bryan F

    2018-04-20

    Interactions between superoxide dismutase-1 (SOD1) and lipid membranes might be directly involved in the toxicity and intercellular propagation of aggregated SOD1 in amyotrophic lateral sclerosis (ALS), but the chemical details of lipid-SOD1 interactions and their effects on SOD1 aggregation remain unclear. This paper determined the rate and mechanism of nucleation of fibrillar apo-SOD1 catalyzed by liposomal surfaces with identical hydrophobic chains (RCH 2 (O 2 C 18 H 33 ) 2 ), but headgroups of different net charge and hydrophobicity (i.e., R(CH 2 )N + (CH 3 ) 3 , RPO 4 - (CH 2 ) 2 N + (CH 3 ) 3 , and RPO 4 - ). Under semiquiescent conditions (within a 96 well microplate, without a gyrating bead), the aggregation of apo-SOD1 into thioflavin-T-positive (ThT(+)) amyloid fibrils did not occur over 120 h in the absence of liposomal surfaces. Anionic liposomes triggered aggregation of apo-SOD1 into ThT(+) amyloid fibrils; cationic liposomes catalyzed fibrillization but at slower rates and across a narrower lipid concentration; zwitterionic liposomes produced nonfibrillar (amorphous) aggregates. The inability of zwitterionic liposomes to catalyze fibrillization and the dependence of fibrillization rate on anionic lipid concentration suggests that membranes catalyze SOD1 fibrillization by a primary nucleation mechanism. Membrane-catalyzed fibrillization was also examined for eight ALS variants of apo-SOD1, including G37R, G93R, D90A, and E100G apo-SOD1 that nucleate slower than or equal to WT SOD1 in lipid-free, nonquiescent amyloid assays. All ALS variants (with one exception) nucleated faster than WT SOD1 in the presence of anionic liposomes, wherein the greatest acceleratory effects were observed among variants with lower net negative surface charge (G37R, G93R, D90A, E100G). The exception was H46R apo-SOD1, which did not form ThT(+) species.

  4. Computational Analysis of KRAS Mutations: Implications for Different Effects on the KRAS p.G12D and p.G13D Mutations

    PubMed Central

    Liu, Yen-Yi; Hwang, Jenn-Kang; Barrio, Maria Jesus; Rodrigo, Maximiliano; Garcia-Toro, Enrique; Herreros-Villanueva, Marta

    2013-01-01

    Background The issue of whether patients diagnosed with metastatic colorectal cancer who harbor KRAS codon 13 mutations could benefit from the addition of anti-epidermal growth factor receptor therapy remains under debate. The aim of the current study was to perform computational analysis to investigate the structural implications of the underlying mutations caused by c.38G>A (p.G13D) on protein conformation. Methods Molecular dynamics (MD) simulations were performed to understand the plausible structural and dynamical implications caused by c.35G>A (p.G12D) and c.38G>A (p.G13D). The potential of mean force (PMF) simulations were carried out to determine the free energy profiles of the binding processes of GTP interacting with wild-type (WT) KRAS and its mutants (MT). Results Using MD simulations, we observed that the root mean square deviation (RMSD) increased as a function of time for the MT c.35G>A (p.G12D) and MT c.38G>A (p.G13D) when compared with the WT. We also observed that the GTP-binding pocket in the c.35G>A (p.G12D) mutant is more open than that of the WT and the c.38G>A (p.G13D) proteins. Intriguingly, the analysis of atomic fluctuations and free energy profiles revealed that the mutation of c.35G>A (p.G12D) may induce additional fluctuations in the sensitive sites (P-loop, switch I and II regions). Such fluctuations may promote instability in these protein regions and hamper GTP binding. Conclusions Taken together with the results obtained from MD and PMF simulations, the present findings implicate fluctuations at the sensitive sites (P-loop, switch I and II regions). Our findings revealed that KRAS mutations in codon 13 have similar behavior as KRAS WT. To gain a better insight into why patients with metastatic colorectal cancer (mCRC) and the KRAS c.38G>A (p.G13D) mutation appear to benefit from anti-EGFR therapy, the role of the KRAS c.38G>A (p.G13D) mutation in mCRC needs to be further investigated. PMID:23437064

  5. A novel mutation MT-COIII m.9267G>C and MT-COI m.5913G>A mutation in mitochondrial genes in a Tunisian family with maternally inherited diabetes and deafness (MIDD) associated with severe nephropathy.

    PubMed

    Tabebi, Mouna; Mkaouar-Rebai, Emna; Mnif, Mouna; Kallabi, Fakhri; Ben Mahmoud, Afif; Ben Saad, Wafa; Charfi, Nadia; Keskes-Ammar, Leila; Kamoun, Hassen; Abid, Mohamed; Fakhfakh, Faiza

    2015-04-10

    Mitochondrial diabetes (MD) is a heterogeneous disorder characterized by a chronic hyperglycemia, maternal transmission and its association with a bilateral hearing impairment. Several studies reported mutations in mitochondrial genes as potentially pathogenic for diabetes, since mitochondrial oxidative phosphorylation plays an important role in glucose-stimulated insulin secretion from beta cells. In the present report, we studied a Tunisian family with mitochondrial diabetes (MD) and deafness associated with nephropathy. The mutational analysis screening revealed the presence of a novel heteroplasmic mutation m.9276G>C in the mitochondrial COIII gene, detected in mtDNA extracted from leukocytes of a mother and her two daughters indicating that this mutation is maternally transmitted and suggest its implication in the observed phenotype. Bioinformatic tools showed that m.9267G>C mutation (p.A21P) is « deleterious » and it can modify the function and the stability of the MT-COIII protein by affecting the assembly of mitochondrial COX subunits and the translocation of protons then reducing the activity of the respective OXPHOS complexes of ATP synthesis. The nonsynonymous mutation (p.A21P) has not been reported before, it is the first mutation described in the COXIII gene which is related to insulin dependent mitochondrial diabetes and deafness and could be specific to the Tunisian population. The m.9267G>C mutation was present with a nonsynonymous inherited mitochondrial homoplasmic variation MT-COI m.5913 G>A (D4N) responsible of high blood pressure, a clinical feature detected in all explored patients. Copyright © 2015. Published by Elsevier Inc.

  6. The effects of 2% rebamipide ophthalmic solution on the tear functions and ocular surface of the superoxide dismutase-1 (sod1) knockout mice.

    PubMed

    Ohguchi, Takeshi; Kojima, Takashi; Ibrahim, Osama M; Nagata, Taeko; Shimizu, Takahiko; Shirasawa, Takuji; Kawakita, Tetsuya; Satake, Yoshiyuki; Tsubota, Kazuo; Shimazaki, Jun; Ishida, Susumu

    2013-11-21

    To investigate the efficacy of 2% rebamipide ophthalmic solution on the tear functions and ocular surface status of the superoxide dismutase-1(Sod1(-/-)) mice. Two percent Rebamipide ophthalmic solution was applied to 40-week-old male Sod1(-/-) and wild-type (WT) mice four times a day for 2 weeks. We examined the cytokine concentrations in the tear fluid (by CytoBead assay), tear film break-up time, amount of tear production, and expressions of mucins 1, 4, and 5AC, by RT-PCR. We also performed vital staining of the ocular surface, PAS staining for muc5AC, and immunohistochemical stainings for 4-hydroxy-2-nonenal (4-HNE), 8-hydroxy-2'-deoxyguanosine (8-OHdG), in the conjunctiva to compare the results before and after rebamipide instillations. The tear functions and ocular surface epithelial damage scores were significantly worse in the Sod1(-/-) than in the WT mice. Application of 2% rebamipide for 2 weeks significantly improved the tear film break-up time, the amount of tear production, and the corneal epithelial damage scores, which also significantly increased the conjunctival goblet cell density and muc5 mRNA expression, in the Sod1(-/-) mice. The mean IL-6, IL-17, TNF-α, and IFN-γ levels in the tear fluid were reduced significantly along with a significant decrease in the density of cells positive for 4-HNE and 8-OHdG in the conjunctiva. Two percent Rebamipide ophthalmic solution significantly improved the tear stability and corneal epithelial damage, and enhanced the expression of muc5 mRNA on the ocular surface. We also observed anti-inflammatory effects in the tear film together with antioxidative effects in the conjunctiva, suggesting the efficacy of rebamipide in age-related dry eye disease attributable to SOD1 knockout.

  7. Cerebral metabolic abnormalities in A3243G mitochondrial DNA mutation carriers

    PubMed Central

    Weiduschat, Nora; Kaufmann, Petra; Mao, Xiangling; Engelstad, Kristin Marie; Hinton, Veronica; DiMauro, Salvatore; De Vivo, Darryl

    2014-01-01

    Objective: To establish cerebral metabolic features associated with the A3243G mitochondrial DNA mutation with proton magnetic resonance spectroscopic imaging (1H MRSI) and to assess their potential as prognostic biomarkers. Methods: In this prospective cohort study, we investigated 135 clinically heterogeneous A3243G mutation carriers and 30 healthy volunteers (HVs) with 1H MRSI. Mutation carriers included 45 patients with mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes (MELAS); 11 participants who would develop the MELAS syndrome during follow-up (converters); and 79 participants who would not develop the MELAS syndrome during follow-up (nonconverters). The groups were compared with respect to MRSI metabolic indices of 1) anaerobic energy metabolism (lactate), 2) neuronal integrity (N-acetyl-l-aspartate [NAA]), 3) mitochondrial function (NAA; lactate), 4) cell energetics (total creatine), and 5) membrane biosynthesis and turnover (total choline [tCho]). Results: Consistent with prior studies, the patients with MELAS had higher lactate (p < 0.001) and lower NAA levels (p = 0.01) than HVs. Unexpectedly, converters showed higher NAA (p = 0.042), tCho (p = 0.004), and total creatine (p = 0.002), in addition to higher lactate levels (p = 0.032), compared with HVs. Compared with nonconverters, converters had higher tCho (p = 0.015). Clinically, converters and nonconverters did not differ at baseline. Lactate and tCho levels were reliable biomarkers for predicting the risk of individual mutation carriers to develop the MELAS phenotype. Conclusions: 1H MRSI assessment of cerebral metabolism in A3243G mutation carriers shows promise in identifying disease biomarkers as well as individuals at risk of developing the MELAS phenotype. PMID:24477106

  8. Sod1 deficiency reduces incubation time in mouse models of prion disease.

    PubMed

    Akhtar, Shaheen; Grizenkova, Julia; Wenborn, Adam; Hummerich, Holger; Fernandez de Marco, Mar; Brandner, Sebastian; Collinge, John; Lloyd, Sarah E

    2013-01-01

    Prion infections, causing neurodegenerative conditions such as Creutzfeldt-Jakob disease and kuru in humans, scrapie in sheep and BSE in cattle are characterised by prolonged and variable incubation periods that are faithfully reproduced in mouse models. Incubation time is partly determined by genetic factors including polymorphisms in the prion protein gene. Quantitative trait loci studies in mice and human genome-wide association studies have confirmed that multiple genes are involved. Candidate gene approaches have also been used and identified App, Il1-r1 and Sod1 as affecting incubation times. In this study we looked for an association between App, Il1-r1 and Sod1 representative SNPs and prion disease incubation time in the Northport heterogeneous stock of mice inoculated with the Chandler/RML prion strain. No association was seen with App, however, significant associations were seen with Il1-r1 (P = 0.02) and Sod1 (P<0.0001) suggesting that polymorphisms at these loci contribute to the natural variation observed in incubation time. Furthermore, following challenge with Chandler/RML, ME7 and MRC2 prion strains, Sod1 deficient mice showed highly significant reductions in incubation time of 20, 13 and 24%, respectively. No differences were detected in Sod1 expression or activity. Our data confirm the protective role of endogenous Sod1 in prion disease.

  9. Detection of katG and inhA mutations to guide isoniazid and ethionamide use for drug-resistant tuberculosis.

    PubMed

    Bollela, V R; Namburete, E I; Feliciano, C S; Macheque, D; Harrison, L H; Caminero, J A

    2016-08-01

    Depending on the presence of mutations that determine isoniazid (INH) susceptibility (katG and inhA), Mycobacterium tuberculosis may be susceptible to high doses of INH or ethionamide (ETH). To describe the INH resistance profile and association of katG mutation with previous INH treatment and level of drug resistance based on rapid molecular drug susceptibility testing (DST) in southern Brazil and central Mozambique. Descriptive study of 311 isolates from Ribeirão Preto, São Paulo, Brazil (2011-2014) and 155 isolates from Beira, Mozambique (2014-2015). Drug resistance patterns and specific gene mutations were determined using GenoType(®) MTBDRplus. katG gene mutations were detected in 12/22 (54.5%) Brazilian and 32/38 (84.2%) Mozambican isolates. inhA mutations were observed in 9/22 (40.9%) isolates in Brazil and in 4/38 (10.5%) in Mozambique. Both katG and inhA mutations were detected in respectively 1/22 (5%) and 2/38 (5.2%). The difference in the frequency of katG mutations in Brazil and Mozambique was statistically significant (P = 0.04). katG mutations were present in 68.8% (33/48) of patients previously treated with INH and 31.2% (15/48) of patients without previous INH. This difference was not statistically significant (P = 0.223). INH mutations varied geographically; molecular DST can be used to guide and accelerate decision making in the use of ETH or high doses of INH.

  10. Sequestosome 1/p62 links familial ALS mutant SOD1 to LC3 via an ubiquitin-independent mechanism.

    PubMed

    Gal, Jozsef; Ström, Anna-Lena; Kwinter, David M; Kilty, Renée; Zhang, Jiayu; Shi, Ping; Fu, Weisi; Wooten, Marie W; Zhu, Haining

    2009-11-01

    The p62/sequestosome 1 protein has been identified as a component of pathological protein inclusions in neurodegenerative diseases including amyotrophic lateral sclerosis (ALS). P62 has also been implicated in autophagy, a process of mass degradation of intracellular proteins and organelles. Autophagy is a critical pathway for degrading misfolded and/or damaged proteins, including the copper-zinc superoxide dismutase (SOD1) mutants linked to familial ALS. We previously reported that p62 interacted with ALS mutants of SOD1 and that the ubiquitin-association domain of p62 was dispensable for the interaction. In this study, we identified two distinct regions of p62 that were essential to its binding to mutant SOD1: the N-terminal Phox and Bem1 (PB1) domain (residues 1-104) and a separate internal region (residues 178-224) termed here as SOD1 mutant interaction region (SMIR). The PB1 domain is required for appropriate oligomeric status of p62 and the SMIR is the actual region interacting with mutant SOD1. Within the SMIR, the conserved W184, H190 and positively charged R183, R186, K187, and K189 residues are critical to the p62-mutant SOD1 interaction as substitution of these residues with alanine resulted in significantly abolished binding. In addition, SMIR and the p62 sequence responsible for the interaction with LC3, a protein essential for autophagy activation, are independent of each other. In cells lacking p62, the existence of mutant SOD1 in acidic autolysosomes decreased, suggesting that p62 can function as an adaptor between mutant SOD1 and the autophagy machinery. This study provides a novel molecular mechanism by which mutant SOD1 can be recognized by p62 in an ubiquitin-independent fashion and targeted for the autophagy-lysosome degradation pathway.

  11. Nav1.7-A1632G Mutation from a Family with Inherited Erythromelalgia: Enhanced Firing of Dorsal Root Ganglia Neurons Evoked by Thermal Stimuli.

    PubMed

    Yang, Yang; Huang, Jianying; Mis, Malgorzata A; Estacion, Mark; Macala, Lawrence; Shah, Palak; Schulman, Betsy R; Horton, Daniel B; Dib-Hajj, Sulayman D; Waxman, Stephen G

    2016-07-13

    Voltage-gated sodium channel Nav1.7 is a central player in human pain. Mutations in Nav1.7 produce several pain syndromes, including inherited erythromelalgia (IEM), a disorder in which gain-of-function mutations render dorsal root ganglia (DRG) neurons hyperexcitable. Although patients with IEM suffer from episodes of intense burning pain triggered by warmth, the effects of increased temperature on DRG neurons expressing mutant Nav1.7 channels have not been well documented. Here, using structural modeling, voltage-clamp, current-clamp, and multielectrode array recordings, we have studied a newly identified Nav1.7 mutation, Ala1632Gly, from a multigeneration family with IEM. Structural modeling suggests that Ala1632 is a molecular hinge and that the Ala1632Gly mutation may affect channel gating. Voltage-clamp recordings revealed that the Nav1.7-A1632G mutation hyperpolarizes activation and depolarizes fast-inactivation, both gain-of-function attributes at the channel level. Whole-cell current-clamp recordings demonstrated increased spontaneous firing, lower current threshold, and enhanced evoked firing in rat DRG neurons expressing Nav1.7-A1632G mutant channels. Multielectrode array recordings further revealed that intact rat DRG neurons expressing Nav1.7-A1632G mutant channels are more active than those expressing Nav1.7 WT channels. We also showed that physiologically relevant thermal stimuli markedly increase the mean firing frequencies and the number of active rat DRG neurons expressing Nav1.7-A1632G mutant channels, whereas the same thermal stimuli only increase these parameters slightly in rat DRG neurons expressing Nav1.7 WT channels. The response of DRG neurons expressing Nav1.7-A1632G mutant channels upon increase in temperature suggests a cellular basis for warmth-triggered pain in IEM. Inherited erythromelalgia (IEM), a severe pain syndrome characterized by episodes of intense burning pain triggered by warmth, is caused by mutations in sodium channel Nav

  12. Properties of slow- and fast-twitch muscle fibres in a mouse model of amyotrophic lateral sclerosis.

    PubMed

    Atkin, Julie D; Scott, Rachel L; West, Jan M; Lopes, Elizabeth; Quah, Alvin K J; Cheema, Surindar S

    2005-05-01

    This investigation was undertaken to determine if there are altered histological, pathological and contractile properties in presymptomatic or endstage diseased muscle fibres from representative slow-twitch and fast-twitch muscles of SOD1 G93A mice in comparison to wildtype mice. In presymptomatic SOD1 G93A mice, there was no detectable peripheral dysfunction, providing evidence that muscle pathology is secondary to motor neuronal dysfunction. At disease endstage however, single muscle fibre contractile analysis demonstrated that fast-twitch muscle fibres and neuromuscular junctions are preferentially affected by amyotrophic lateral sclerosis-induced denervation, being unable to produce the same levels of force when activated by calcium as muscle fibres from their age-matched controls. The levels of transgenic SOD1 expression, aggregation state and activity were also examined in these muscles but there no was no preference for muscle fibre type. Hence, there is no simple correlation between SOD1 protein expression/activity, and muscle fibre type vulnerability in SOD1 G93A mice.

  13. A novel OPA1 mutation in a Chinese family with autosomal dominant optic atrophy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Juanjuan; Yuan, Yimin; Lin, Bing

    2012-03-23

    Highlights: Black-Right-Pointing-Pointer We report the characterization of a four-generation large Chinese family with ADOA. Black-Right-Pointing-Pointer We find a new heterozygous mutation c.C1198G in OPA1 gene which may be a novel pathogenic mutation in this pedigree. Black-Right-Pointing-Pointer We do not find any mitochondrial DNA mutations associated with optic atrophy. Black-Right-Pointing-Pointer Other factors may also contribute to the phenotypic variability of ADOA in this pedigree. -- Abstract: A large four-generation Chinese family with autosomal dominant optic atrophy (ADOA) was investigated in the present study. Eight of the family members were affected in this pedigree. The affected family members exhibited early-onset and progressivemore » visual impairment, resulting in mild to profound loss of visual acuity. The average age-at-onset was 15.9 years. A new heterozygous mutation c.C1198G was identified by sequence analysis of the 12th exon of the OPA1 gene. This mutation resulted in a proline to alanine substitution at codon 400, which was located in an evolutionarily conserved region. This missense mutation in the GTPase domain was supposed to result in a loss of function for the encoded protein and act through a dominant negative effect. No other mutations associated with optic atrophy were found in our present study. The c.C1198G heterozygous mutation in the OPA1 gene may be a novel key pathogenic mutation in this pedigree with ADOA. Furthermore, additional nuclear modifier genes, environmental factors, and psychological factors may also contribute to the phenotypic variability of ADOA in this pedigree.« less

  14. Synergistic Effects of GhSOD1 and GhCAT1 Overexpression in Cotton Chloroplasts on Enhancing Tolerance to Methyl Viologen and Salt Stresses

    PubMed Central

    Luo, Xiaoli; Wu, Jiahe; Li, Yuanbao; Nan, Zhirun; Guo, Xing; Wang, Yixue; Zhang, Anhong; Wang, Zhian; Xia, Guixian; Tian, Yingchuan

    2013-01-01

    In plants, CuZn superoxide dismutase (CuZnSOD, EC l.15.1.1), ascorbate peroxidase (APX, EC 1.11.1.11), and catalase (CAT, EC l.11.1.6) are important scavengers of reactive oxygen species (ROS) to protect the cell from damage. In the present study, we isolated three homologous genes (GhSOD1, GhAPX1, and GhCAT1) from Gossypium hirsutum. Overexpressing cassettes containing chimeric GhSOD1, GhAPX1, or GhCAT1 were introduced into cotton plants by Agrobacterium transformation, and overexpressed products of these genes were transported into the chloroplasts by transit peptide, as expected. The five types of transgenic cotton plants that overexpressed GhSOD1, GhAPX1, GhCAT1, GhSOD1 and GhAPX1 stack (SAT), and GhSOD1 and GhCAT1 stack (SCT) were developed. Analyses in the greenhouse showed that the transgenic plants had higher tolerance to methyl viologen (MV) and salinity than WT plants. Interestingly, SCT plants suffered no damage under stress conditions. Based on analyses of enzyme activities, electrolyte leakage, chlorophyll content, photochemical yield (Fv/Fm), and biomass accumulation under stresses, the SCT plants that simultaneously overexpressed GhSOD1 and GhCAT1 appeared to benefit from synergistic effects of two genes and exhibited the highest tolerance to MV and salt stress among the transgenic lines, while the SAT plants simultaneously overexpressing GhSOD1 and GhAPX1 did not. In addition, transgenic plants overexpressing antioxidant enzymes in their chloroplasts had higher tolerance to salt stress than those expressing the genes in their cytoplasms, although overall enzyme activities were almost the same. Therefore, the synergistic effects of GhSOD1 and GhCAT1 in chloroplasts provide a new strategy for enhancing stress tolerance to avoid yield loss. PMID:23335985

  15. A systematic comparison of all mutations in hereditary sensory neuropathy type I (HSAN I) reveals that the G387A mutation is not disease associated.

    PubMed

    Hornemann, Thorsten; Penno, Anke; Richard, Stephane; Nicholson, Garth; van Dijk, Fleur S; Rotthier, Annelies; Timmerman, Vincent; von Eckardstein, Arnold

    2009-04-01

    Hereditary sensory neuropathy type 1 (HSAN I) is an autosomal dominant inherited neurodegenerative disorder of the peripheral nervous system associated with mutations in the SPTLC1 subunit of the serine palmitoyltransferase (SPT). Four missense mutations (C133W, C133Y, V144D and G387A) in SPTLC1 were reported to cause HSAN I. SPT catalyses the condensation of Serine and Palmitoyl-CoA, which is the first and rate-limiting step in the de novo synthesis of ceramides. Earlier studies showed that C133W and C133Y mutants have a reduced activity, whereas the impact of the V144D and G387A mutations on the human enzyme was not tested yet. In this paper, we show that none of the HSAN I mutations interferes with SPT complex formation. We demonstrate that also V144D has a reduced SPT activity, however to a lower extent than C133W and C133Y. In contrast, the G387A mutation showed no influence on SPT activity. Furthermore, the growth phenotype of LY-B cells--a SPTLC1 deficient CHO cell line--could be reversed by expressing either the wild-type SPTLC1 or the G387A mutant, but not the C133W mutant. This indicates that the G387A mutation is most likely not directly associated with HSAN I. These findings were genetically confirmed by the identification of a nuclear HSAN family which showed segregation of the G387A variant as a non-synonymous SNP.

  16. Immunization with a DNA vaccine encoding Toxoplasma gondii Superoxide dismutase (TgSOD) induces partial immune protection against acute toxoplasmosis in BALB/c mice.

    PubMed

    Liu, Yuan; Cao, Aiping; Li, Yawen; Li, Xun; Cong, Hua; He, Shenyi; Zhou, Huaiyu

    2017-06-07

    Toxoplasma gondii (T. gondii) is an obligate intracellular protozoan parasite that infects all warm-blooded animals including humans and causes toxoplasmosis. An effective vaccine could be an ideal choice for preventing and controlling toxoplasmosis. T. gondii Superoxide dismutase (TgSOD) might participate in affecting the intracellular growth of both bradyzoite and tachyzoite forms. In the present study, the TgSOD gene was used to construct a DNA vaccine (pEGFP-SOD). TgSOD gene was amplified and inserted into eukaryotic vector pEGFP-C1 and formed the DNA vaccine pEGFP-SOD. Then the BALB/c mice were immunized intramuscularly with the DNA vaccine and those injected with pEGFP-C1, PBS or nothing were treated as controls. Four weeks after the last immunization, all mouse groups followed by challenging intraperitoneally with tachyzoites of T. gondii ME49 strain. Results showed higher levels of total IgG, IgG2α in the sera and interferon gamma (IFN-γ) in the splenocytes from pEGFP-SOD inoculated mice than those unvaccinated, or inoculated with either empty plasmid vector or PBS. The proportions of CD4 + T cells and CD8 + T cells in the spleen from pEGFP-SOD inoculated mice were significantly (p < 0.05) increased compared to control groups. In addition, the survival time of mice immunized with pEGFP-SOD was significantly prolonged as compared to the controls (p < 0.05) although all the mice died. The present study revealed that the DNA vaccine triggered strong humoral and cellular immune responses, and aroused partial protective immunity against acute T. gondii infection in BALB/c mice. The collective data suggests the SOD may be a potential vaccine candidate for further development.

  17. Molecular and biochemical characterization of a unique mutation in CCS, the human copper chaperone to superoxide dismutase.

    PubMed

    Huppke, Peter; Brendel, Cornelia; Korenke, Georg Christoph; Marquardt, Iris; Donsante, Anthony; Yi, Ling; Hicks, Julia D; Steinbach, Peter J; Wilson, Callum; Elpeleg, Orly; Møller, Lisbeth Birk; Christodoulou, John; Kaler, Stephen G; Gärtner, Jutta

    2012-08-01

    Copper (Cu) is a trace metal that readily gains and donates electrons, a property that renders it desirable as an enzyme cofactor but dangerous as a source of free radicals. To regulate cellular Cu metabolism, an elaborate system of chaperones and transporters has evolved, although no human Cu chaperone mutations have been described to date. We describe a child from a consanguineous family who inherited homozygous mutations in the SLC33A1, encoding an acetyl CoA transporter, and in CCS, encoding the Cu chaperone for superoxide dismutase. The CCS mutation, p.Arg163Trp, predicts substitution of a highly conserved arginine residue at position 163, with tryptophan in domain II of CCS, which interacts directly with superoxide dismutase 1 (SOD1). Biochemical analyses of the patient's fibroblasts, mammalian cell transfections, immunoprecipitation assays, and Lys7Δ (CCS homolog) yeast complementation support the pathogenicity of the mutation. Expression of CCS was reduced and binding of CCS to SOD1 impaired. As a result, this mutation causes reduced SOD1 activity and may impair other mechanisms important for normal Cu homeostasis. CCS-Arg163Trp represents the primary example of a human mutation in a gene coding for a Cu chaperone. © 2012 Wiley Periodicals, Inc.

  18. Novel RS1 mutations associated with X-linked juvenile retinoschisis

    PubMed Central

    YI, JUNHUI; LI, SHIQIANG; JIA, XIAOYUN; XIAO, XUESHAN; WANG, PANFENG; GUO, XIANGMING; ZHANG, QINGJIONG

    2012-01-01

    To identify mutations in the retinoschisin (RS1) gene in families with X-linked retinoschisis (XLRS). Twenty families with XLRS were enrolled in this study. All six coding exons and adjacent intronic regions of RS1 were amplified by polymerase chain reaction (PCR). The nucleotide sequences of the amplicons were determined by Sanger sequencing. Ten hemizygous mutations in RS1 were detected in patients from 14 of the 20 families. Four of the ten mutations were novel, including c:176G>A (p:Cys59Tyr) in exon 3, c:531T>G (p:Tyr177X), c:607C>G (p:Pro203Ala) and c:668G>A (p:Cys223Tyr) in exon 6. These four novel mutations were not present in 176 normal individuals. The remaining six were recurrent mutations, including c:214G>A (p:Glu72Lys), c:304C>T (p:Arg102Trp), c:436G>A (p:Glu146Lys), c:544C>T (p:Arg182Cys), c:599G>A (p:Arg200His) and c:644A>T (p:Glu215Val). Our study expanded the mutation spectrum of RS1 and enriches our understanding of the molecular basis of XLRS. PMID:22245991

  19. Novel RS1 mutations associated with X-linked juvenile retinoschisis.

    PubMed

    Yi, Junhui; Li, Shiqiang; Jia, Xiaoyun; Xiao, Xueshan; Wang, Panfeng; Guo, Xiangming; Zhang, Qingjiong

    2012-04-01

    To identify mutations in the retinoschisin (RS1) gene in families with X-linked retinoschisis (XLRS). Twenty families with XLRS were enrolled in this study. All six coding exons and adjacent intronic regions of RS1 were amplified by polymerase chain reaction (PCR). The nucleotide sequences of the amplicons were determined by Sanger sequencing. Ten hemizygous mutations in RS1 were detected in patients from 14 of the 20 families. Four of the ten mutations were novel, including c:176G>A (p:Cys59Tyr) in exon 3, c:531T>G (p:Tyr177X), c:607C>G (p:Pro203Ala) and c:668G>A (p:Cys223Tyr) in exon 6. These four novel mutations were not present in 176 normal individuals. The remaining six were recurrent mutations, including c:214G>A (p:Glu72Lys), c:304C>T (p:Arg102Trp), c:436G>A (p:Glu146Lys), c:544C>T (p:Arg182Cys), c:599G>A (p:Arg200His) and c:644A>T (p:Glu215Val). Our study expanded the mutation spectrum of RS1 and enriches our understanding of the molecular basis of XLRS.

  20. Detection of katG and inhA mutations to guide isoniazid and ethionamide use for drug-resistant tuberculosis

    PubMed Central

    Bollela, V. R.; Namburete, E. I.; Feliciano, C. S.; Macheque, D.; Harrison, L. H.; Caminero, J. A.

    2017-01-01

    SUMMARY BACKGROUND Depending on the presence of mutations that determine isoniazid (INH) susceptibility (katG and inhA), Mycobacterium tuberculosis may be susceptible to high doses of INH or ethionamide (ETH). OBJECTIVE To describe the INH resistance profile and association of katG mutation with previous INH treatment and level of drug resistance based on rapid molecular drug susceptibility testing (DST) in southern Brazil and central Mozambique. DESIGN Descriptive study of 311 isolates from Ribeirão Preto, São Paulo, Brazil (2011–2014) and 155 isolates from Beira, Mozambique (2014–2015). Drug resistance patterns and specific gene mutations were determined using GenoType® MTBDRplus. RESULTS katG gene mutations were detected in 12/22 (54.5%) Brazilian and 32/38 (84.2%) Mozambican isolates. inhA mutations were observed in 9/22 (40.9%) isolates in Brazil and in 4/38 (10.5%) in Mozambique. Both katG and inhA mutations were detected in respectively 1/22 (5%) and 2/38 (5.2%). The difference in the frequency of katG mutations in Brazil and Mozambique was statistically significant (P = 0.04). katG mutations were present in 68.8% (33/48) of patients previously treated with INH and 31.2% (15/48) of patients without previous INH. This difference was not statistically significant (P = 0.223). CONCLUSION INH mutations varied geographically; molecular DST can be used to guide and accelerate decision making in the use of ETH or high doses of INH. PMID:27393546

  1. An activating G{sub s}{alpha} mutation is present in fibrous dysplasia of bone in the McCune-Albright syndrome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shenker, A.; Weinstein, L.S.; Spiegel, A.M.

    1994-09-01

    McCune-Albright syndrome (MAS) is a sporadic disease characterized by polyostotic fibrous dysplasia, cafe-au-lait spots, and multiple endocrinopathies. The etiology of fibrous dysplasia is unknown. Activating mutations of codon 201 in the gene encoding the {alpha}-subunit of G{sub s}, the G-protein that stimulates adenylyl cyclase, have been found in all affected MAS tissues that have been studied. Initial attempts to amplify DNA from decalcified paraffin-embedded bone specimens from frozen surgical bone specimens from five MAS patients using polymerase chain reaction and allele-specific oligonucleotide hybridization. Most of the cells in four specimens of dysplastic bone contained a heterozygous mutation encoding substitution ofmore » Arg{sup 201} of G{sub s}{alpha} with His, but the mutation was barely detectable in peripheral blood specimens from the patients. Only a small amount of mutant allele was detected in a specimen of normal cortical bone from the fifth patient, although this patients had a high proportion of mutation in other, affected tissues. The mosaic distribution of mutant alleles is consistent with an embryological somatic cell mutation of the G{sub s}{alpha} gene in MAS. The presence of an activating mutation of G{sub s}{alpha} in osteoblastic progenitor cells may cause them to exhibit increased proliferation and abnormal differentiation, thereby producing the lesions of fibrous dysplasia. 43 refs., 2 figs.« less

  2. Isolated case of mental retardation and ataxia due to a de novo mitochondrial T8993G mutation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    De Coo, I.F.M.; Smeets, H.J.M.; Oost, B.A. van

    1996-03-01

    Neurogenic muscle weakness, ataxia, and retinitis pigmentosa (NARP) and subacute necrotizing encephalomyelopathy (Leigh disease) are both associated with an alteration of nt 8993 in the mitochondrial ATPase 6 gene. In NARP, the T-to-G transversion at that position changes leucine into arginine. In Leigh syndrome, the same mutation can be found, as can a T-to-C transition, which changes this leucine into proline. Clinical manifestations occur for NARP when {approximately}60%-90% mutated mtDNA is present. In case of Leigh, these percentages usually exceed 95%. It is known that this mutation can segregate very rapidly within pedigrees. Here we report on a sporadic casemore » with mental retardation and ataxia without retinitis pigmentosa in which the T8993G mutation was found. 13 refs., 1 fig.« less

  3. G119S ace-1 mutation conferring insecticide resistance detected in the Culex pipiens complex in Morocco.

    PubMed

    Bkhache, Meriem; Tmimi, Fatim-Zohra; Charafeddine, Omar; Benabdelkrim Filali, Oumama; Lemrani, Meryem; Labbé, Pierrick; Sarih, M'hammed

    2018-06-09

    Arboviruses are controlled through insecticide control of their mosquito vector. However, inconsiderate use of insecticides often results in the selection of resistance in treated populations, so that monitoring is required to optimize their usage. Here, Culex pipiens (West Nile and Rift Valley Fever virus vector) specimens were collected from four Moroccan cities. Levels of susceptibility to the organophosphate (OP) insecticide malathion were assessed using WHO-recommended bioassays. Individual mosquitoes were tested for the presence of the G119S mutation in the ace-1 gene, the main OP-target resistance mutation. Bioassays showed that mosquitoes from Mohammedia were significantly more resistant to malathion than those from Marrakech. Analyzing the ace-1 genotypes in dead and surviving individuals suggested that other resistance mechanisms may be present in Mohammedia. The ace-1 resistance allele frequencies were relatively moderate (<0.4). Their analyses in three Moroccan cities (Tangier, Casablanca and Marrakech) however showed disparities between two coexisting Cx. pipiens forms and revealed that the G119S mutation tends to be more frequent in urban than in rural collections sites. These findings provide a reference assessment of OP resistance in Morocco and should help the health authorities to develop informed and sustainable vector control programs. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  4. Role of copper transport protein Antioxidant-1 in Angiotensin II-induced hypertension: A key regulator of Extracellular SOD

    PubMed Central

    Ozumi, Kiyoshi; Sudhahar, Varadarajan; Kim, Ha Won; Chen, Gin-Fu; Kohno, Takashi; Finney, Lydia; Vogt, Stefan; McKinney, Ronald D.; Ushio-Fukai, Masuko; Fukai, Tohru

    2012-01-01

    Extracellular superoxide dismutase (SOD3) is a secretory copper enzyme involved in protecting angiotensin II (Ang II)-induced hypertension. We previously found that Ang II upregulates SOD3 expression and activity as a counter-regulatory mechanism; however, underlying mechanisms are unclear. Antioxidant-1 (Atox1) is shown to act as a copper-dependent transcription factor as well as copper chaperone for SOD3 in vitro, but its role in Ang II-induced hypertension in vivo is unknown. Here we show that Ang II infusion increases Atox1 expression as well as SOD3 expression and activity in aortas of wild-type mice, which are inhibited in mice lacking Atox1. Accordingly, Ang II increases vascular O2•− production, reduces endothelium-dependent vasodilation and increases vasoconstriction in mesenteric arterioles to a greater extent in Atox1−/− than in wild-type mice. This contributes to augmented hypertensive response to Ang II in Atox1−/− mice. In cultured vascular smooth muscle cells, Ang II promotes translocation of Atox1 to the nucleus, thereby increasing SOD3 transcription by binding to Atox1 responsive element in the SOD3 promoter. Furthermore, Ang II increases Atox1 binding to the copper exporter ATP7A which obtains copper from Atox1 as well as translocation of ATP7A to plasma membranes where it colocalizes with SOD3. As its consequence, Ang II decreases vascular copper levels, which is inhibited in Atox1−/− mice. In summary, Atox1 functions to prevent Ang II-induced endothelial dysfunction and hyper-contraction in resistant vessels as well as hypertension in vivo by reducing extracellular O2•− levels via increasing vascular SOD3 expression and activity. PMID:22753205

  5. Non-native Soluble Oligomers of Cu/Zn Superoxide Dismutase (SOD1) Contain a Conformational Epitope Linked to Cytotoxicity in Amyotrophic Lateral Sclerosis (ALS)

    PubMed Central

    2015-01-01

    Soluble misfolded Cu/Zn superoxide dismutase (SOD1) is implicated in motor neuron death in amyotrophic lateral sclerosis (ALS); however, the relative toxicities of the various non-native species formed by SOD1 as it misfolds and aggregates are unknown. Here, we demonstrate that early stages of SOD1 aggregation involve the formation of soluble oligomers that contain an epitope specific to disease-relevant misfolded SOD1; this epitope, recognized by the C4F6 antibody, has been proposed as a marker of toxic species. Formation of potentially toxic oligomers is likely to be exacerbated by an oxidizing cellular environment, as evidenced by increased oligomerization propensity and C4F6 reactivity when oxidative modification by glutathione is present at Cys-111. These findings suggest that soluble non-native SOD1 oligomers, rather than native-like dimers or monomers, share structural similarity to pathogenic misfolded species found in ALS patients and therefore represent potential cytotoxic agents and therapeutic targets in ALS. PMID:24660965

  6. Novel compound heterozygous Thyroglobulin mutations c.745+1G>A/c.7036+2T>A associated with congenital goiter and hypothyroidism in a Vietnamese family. Identification of a new cryptic 5' splice site in the exon 6.

    PubMed

    Citterio, Cintia E; Morales, Cecilia M; Bouhours-Nouet, Natacha; Machiavelli, Gloria A; Bueno, Elena; Gatelais, Frédérique; Coutant, Regis; González-Sarmiento, Rogelio; Rivolta, Carina M; Targovnik, Héctor M

    2015-03-15

    Several patients were identified with dyshormonogenesis caused by mutations in the thyroglobulin (TG) gene. These defects are inherited in an autosomal recessive manner and affected individuals are either homozygous or compound heterozygous for the mutations. The aim of the present study was to identify new TG mutations in a patient of Vietnamese origin affected by congenital hypothyroidism, goiter and low levels of serum TG. DNA sequencing identified the presence of compound heterozygous mutations in the TG gene: the maternal mutation consists of a novel c.745+1G>A (g.IVS6 + 1G>A), whereas the hypothetical paternal mutation consists of a novel c.7036+2T>A (g.IVS40 + 2T>A). The father was not available for segregation analysis. Ex-vivo splicing assays and subsequent RT-PCR analyses were performed on mRNA isolated from the eukaryotic-cells transfected with normal and mutant expression vectors. Minigene analysis of the c.745+1G>A mutant showed that the exon 6 is skipped during pre-mRNA splicing or partially included by use of a cryptic 5' splice site located to 55 nucleotides upstream of the authentic exon 6/intron 6 junction site. The functional analysis of c.7036+2T>A mutation showed a complete skipping of exon 40. The theoretical consequences of splice site mutations, predicted with the bioinformatics tool NNSplice, Fsplice, SPL, SPLM and MaxEntScan programs were investigated and evaluated in relation with the experimental evidence. These analyses predicted that both mutant alleles would result in the abolition of the authentic splice donor sites. The c.745+1G>A mutation originates two putative truncated proteins of 200 and 1142 amino acids, whereas c.7036+2T>A mutation results in a putative truncated protein of 2277 amino acids. In conclusion, we show that the c.745+1G>A mutation promotes the activation of a new cryptic donor splice site in the exon 6 of the TG gene. The functional consequences of these mutations could be structural changes in the protein

  7. Molecular and biochemical characterization of a unique mutation in CCS, the human copper chaperone to superoxide dismutase

    PubMed Central

    Huppke, Peter; Brendel, Cornelia; Korenke, Georg Christoph; Marquardt, Iris; Donsante, Anthony; Yi, Ling; Hicks, Julia D.; Steinbach, Peter J.; Wilson, Callum; Elpeleg, Orly; Møller, Lisbeth Birk; Christodoulou, John; Kaler, Stephen G.; Gärtner, Jutta

    2012-01-01

    Copper is a trace metal that readily gains and donates electrons, a property that renders it desirable as an enzyme cofactor but dangerous as a source of free radicals. To regulate cellular copper metabolism, an elaborate system of chaperones and transporters has evolved, although no human copper chaperone mutations have been described to date. We describe a child from a consanguineous family who inherited a homozygous mutations in the SLC33A1, encoding an acetyl CoA transporter, and in CCS, encoding the copper chaperone for superoxide dismutase. The CCS mutation, p.Arg163Trp, predicts substitution of a highly conserved arginine residue at position 163 with tryptophan in domain II of CCS, which interacts directly with SOD1. Biochemical analyses of the patient’s fibroblasts, mammalian cell transfections, immunoprecipitation assays, and Lys7Δ (CCS homolog) yeast complementation support the pathogenicity of the mutation. Expression of CCS was reduced and binding of CCS to SOD1 impaired. As a result this mutation causes reduced SOD1 activity and may impair other mechanisms important for normal copper homeostasis. CCS-Arg163Trp represents the primary example of a human mutation in a gene coding for a copper chaperone. PMID:22508683

  8. Cu/Zn superoxide dismutase and the proton ATPase Pma1p of Saccharomyces cerevisiae

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Baron, J. Allen; Chen, Janice S.; Culotta, Valeria C., E-mail: vculott1@jhu.edu

    2015-07-03

    In eukaryotes, the Cu/Zn containing superoxide dismutase (SOD1) plays a critical role in oxidative stress protection as well as in signaling. We recently demonstrated a function for Saccharomyces cerevisiae Sod1p in signaling through CK1γ casein kinases and identified the essential proton ATPase Pma1p as one likely target. The connection between Sod1p and Pma1p was explored further by testing the impact of sod1Δ mutations on cells expressing mutant alleles of Pma1p that alter activity and/or post-translational regulation of this ATPase. We report here that sod1Δ mutations are lethal when combined with the T912D allele of Pma1p in the C-terminal regulatory domain.more » This “synthetic lethality” was reversed by intragenic suppressor mutations in Pma1p, including an A906G substitution that lies within the C-terminal regulatory domain and hyper-activates Pma1p. Surprisingly the effect of sod1Δ mutations on Pma1-T912D is not mediated through the Sod1p signaling pathway involving the CK1γ casein kinases. Rather, Sod1p sustains life of cells expressing Pma1-T912D through oxidative stress protection. The synthetic lethality of sod1Δ Pma1-T912D cells is suppressed by growing cells under low oxygen conditions or by treatments with manganese-based antioxidants. We now propose a model in which Sod1p maximizes Pma1p activity in two ways: one involving signaling through CK1γ casein kinases and an independent role for Sod1p in oxidative stress protection. - Highlights: • In yeast, the anti-oxidant enzyme SOD1 promotes activity of the proton ATPase Pma1p. • Cells expressing a T912D variant of Pma1p are not viable without SOD1. • SOD1 is needed to protect Pma1-T912D expressing cells from severe oxidative damage. • SOD1 activates Pma1p through casein kinase signaling and oxidative stress protection.« less

  9. FUS GENE MUTATIONS IN FAMILIAL AND SPORADIC AMYOTROPHIC LATERAL SCLEROSIS

    PubMed Central

    Rademakers, Rosa; Stewart, Heather; DeJesus-Hernandez, Mariely; Krieger, Charles; Graff-Radford, Neill; Fabros, Marife; Briemberg, Hannah; Cashman, Neil; Eisen, Andrew; Mackenzie, Ian R. A.

    2010-01-01

    Introduction Mutations in the fused in sarcoma (FUS) gene have recently been found to cause familial amyotrophic lateral sclerosis (FALS). Methods We screened FUS in a cohort of 200 ALS patients [32 FALS and 168 sporadic ALS (SALS)]. Results In one FALS proband, we identified a mutation (p.R521C) that was also present in her affected daughter. Their clinical phenotype was remarkably similar and atypical of classic ALS, with symmetric proximal pelvic and pectoral weakness. Distal weakness and upper motor neuron features only developed late. Neuropathological examination demonstrated FUS-immunoreactive neuronal and glial inclusions in the spinal cord and many extramotor regions, but no TDP-43 pathology. We also identified a novel mutation (p.G187S) in one SALS patient. Overall, FUS mutations accounted for 3% of our non-SOD1, non-TARDBP FALS cases and 0.6% of SALS. Discussion This study demonstrates that the phenotype with FUS mutations extends beyond classical ALS. It suggests there are specific clinicogenetic correlations and provides the first detailed neuropathological description. PMID:20544928

  10. Unc93B1 biases Toll-like receptor responses to nucleic acid in dendritic cells toward DNA- but against RNA-sensing.

    PubMed

    Fukui, Ryutaro; Saitoh, Shin-ichiroh; Matsumoto, Fumi; Kozuka-Hata, Hiroko; Oyama, Masaaki; Tabeta, Koichi; Beutler, Bruce; Miyake, Kensuke

    2009-06-08

    Toll-like receptors (TLRs) 3, 7, and 9 recognize microbial nucleic acids in endolysosomes and initiate innate and adaptive immune responses. TLR7/9 in dendritic cells (DCs) also respond to self-derived RNA/DNA, respectively, and drive autoantibody production. Remarkably, TLR7 and 9 appear to have mutually opposing, pathogenic or protective, impacts on lupus nephritis in MRL/lpr mice. Little is known, however, about the contrasting relationship between TLR7 and 9. We show that TLR7 and 9 are inversely linked by Unc93B1, a multiple membrane-spanning endoplasmic reticulum (ER) protein. Complementation cloning with a TLR7-unresponsive but TLR9-responsive cell line revealed that amino acid D34 in Unc93B1 repressed TLR7-mediated responses. D34A mutation rendered Unc93B1-deficient DCs hyperresponsive to TLR7 ligand but hyporesponsive to TLR9 ligand, with TLR3 responses unaltered. Unc93B1 associates with and delivers TLR7/9 from the ER to endolysosomes for ligand recognition. The D34A mutation up-regulates Unc93B1 association with endogenous TLR7 in DCs, whereas Unc93B1 association with TLR9 was down-regulated by the D34A mutation. Consistently, the D34A mutation up-regulated ligand-induced trafficking of TLR7 but down-regulated that of TLR9. Collectively, TLR response to nucleic acids in DCs is biased toward DNA-sensing by Unc93B1.

  11. A Steroidal Saponin from Ophiopogon japonicus Extends the Lifespan of Yeast via the Pathway Involved in SOD and UTH1

    PubMed Central

    Sun, Kaiyue; Cao, Shining; Pei, Liang; Matsuura, Akira; Xiang, Lan; Qi, Jianhua

    2013-01-01

    Nolinospiroside F is a steroidal saponin isolated from Ophiopogon japonicus (O. japonicus). In this study, we found that nolinospiroside F significantly extends the replicative lifespan of K6001 yeast at doses of 1, 3 and 10 μM, indicating that it has an anti-aging effect. This may be attributed to its anti-oxidative effect, as nolinospiroside F could increase yeast survival under oxidative stress conditions and decrease the level of malondialdehyde (MDA), an oxidative stress biomarker. It could also increase anti-oxidative stress genes, SOD1 and SOD2, expression, and the activity of superoxide dismutase (SOD). It increase the activity of SIRT1, an upstream inducer of SOD2 expression. In sod1 and sod2 mutant yeast strains, nolinospiroside F failed to extend their replicative lifespan. These results indicate that SOD participates in the anti-aging effect of nolinospiroside F. Furthermore, nolinospiroside F inhibited the expression of UTH1, a yeast-aging gene that is involved in the oxidative stress of yeast, and failed to extend the replicative lifespan of uth1 or skn7 mutant yeast cells. SKN7 is the transcriptional activator of UTH1. We also demonstrate that SOD and UTH1 regulate each other’s expression. Together, these results suggest that SOD and UTH1 genes are required for and play interactive roles in nolinospiroside F-mediated yeast lifespan extension. PMID:23439553

  12. TFE-induced local unfolding and fibrillation of SOD1: bridging the experiment and simulation studies.

    PubMed

    Kumar, Vijay; Prakash, Amresh; Pandey, Preeti; Lynn, Andrew M; Hassan, Md Imtaiyaz

    2018-05-18

    Misfolding and aggregation of Cu, Zn Superoxide dismutase (SOD1) is involved in the neurodegenerative disease, amyotrophic lateral sclerosis. Many studies have shown that metal-depleted, monomeric form of SOD1 displays substantial local unfolding dynamics and is the precursor for aggregation. Here, we have studied the structure and dynamics of different apo monomeric SOD1 variants associated with unfolding and aggregation in aqueous trifluoroethanol (TFE) through experiments and simulation. TFE induces partially unfolded β-sheet-rich extended conformations in these SOD1 variants, which subsequently develops aggregates with fibril-like characteristics. Fibrillation was achieved more easily in disulfide-reduced monomeric SOD1 when compared with wild-type and mutant monomeric SOD1. At higher concentrations of TFE, a native-like structure with the increase in α-helical content was observed. The molecular dynamics simulation results illustrate distinct structural dynamics for different regions of SOD1 variants and show uniform local unfolding of β-strands. The strands protected by the zinc-binding and electrostatic loops were found to unfold first in 20% (v/v) TFE, leading to a partial unfolding of β-strands 4, 5, and 6 which are prone to aggregation. Our results thus shed light on the role of local unfolding and conformational dynamics in SOD1 misfolding and aggregation. © 2018 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

  13. Sod1 Loss Induces Intrinsic Superoxide Accumulation Leading to p53-Mediated Growth Arrest and Apoptosis

    PubMed Central

    Watanabe, Kenji; Shibuya, Shuichi; Koyama, Hirofumi; Ozawa, Yusuke; Toda, Toshihiko; Yokote, Koutaro; Shimizu, Takahiko

    2013-01-01

    Oxidative damages induced by a redox imbalance cause age-related changes in cells and tissues. Superoxide dismutase (SOD) enzymes play a major role in the antioxidant system and they also catalyze superoxide radicals (O2•−). Since the loss of cytoplasmic SOD (SOD1) resulted in aging-like phenotypes in several types of mouse tissue, SOD1 is essential for the maintenance of tissue homeostasis. To clarify the cellular function of SOD1, we investigated the cellular phenotypes of Sod1-deficient fibroblasts. We demonstrated that Sod1 deficiency impaired proliferation and induced apoptosis associated with O2•− accumulation in the cytoplasm and mitochondria in fibroblasts. Sod1 loss also decreased the mitochondrial membrane potential and led to DNA damage-mediated p53 activation. Antioxidant treatments effectively improved the cellular phenotypes through suppression of both intracellular O2•− accumulation and p53 activation in Sod1-deficient fibroblasts. In vivo experiments revealed that transdermal treatment with a vitamin C derivative significantly reversed the skin thinning commonly associated with the upregulated p53 action in the skin. Our findings revealed that intrinsic O2•− accumulation promoted p53-mediated growth arrest and apoptosis as well as mitochondrial disfunction in the fibroblasts. PMID:23708100

  14. Direct sequencing of FAH gene in Pakistani tyrosinemia type 1 families reveals a novel mutation.

    PubMed

    Ijaz, Sadaqat; Zahoor, Muhammad Yasir; Imran, Muhammad; Afzal, Sibtain; Bhinder, Munir A; Ullah, Ihsan; Cheema, Huma Arshad; Ramzan, Khushnooda; Shehzad, Wasim

    2016-03-01

    Hereditary tyrosinemia type 1 (HT1) is a rare inborn error of tyrosine catabolism with a worldwide prevalence of one out of 100,000 live births. HT1 is clinically characterized by hepatic and renal dysfunction resulting from the deficiency of fumarylacetoacetate hydrolase (FAH) enzyme, caused by recessive mutations in the FAH gene. We present here the first report on identification of FAH mutations in HT1 patients from Pakistan with a novel one. Three Pakistani families, each having one child affected with HT1, were enrolled over a period of 1.5 years. Two of the affected children had died as they were presented late with acute form. All regions of the FAH gene spanning exons and splicing sites were amplified by polymerase chain reaction (PCR) and mutation analysis was carried out by direct sequencing. Results of sequencing were confirmed by restriction fragment length polymorphism (PCR-RFLP) analysis. Three different FAH mutations, one in each family, were found to co-segregate with the disease phenotype. Two of these FAH mutations have been known (c.192G>T and c.1062+5G>A [IVS12+5G>A]), while c.67T>C (p.Ser23Pro) was a novel mutation. The novel variant was not detected in any of 120 chromosomes from normal ethnically matched individuals. Most of the HT1 patients die before they present to hospitals in Pakistan, as is indicated by enrollment of only three families in 1.5 years. Most of those with late clinical presentation do not survive due to delayed diagnosis followed by untimely treatment. This tragic condition advocates the establishment of expanded newborn screening program for HT1 within Pakistan.

  15. A novel mutation of the ACADM gene (c.145C>G) associated with the common c.985A>G mutation on the other ACADM allele causes mild MCAD deficiency: a case report

    PubMed Central

    2010-01-01

    A female patient, with normal familial history, developed at the age of 30 months an episode of diarrhoea, vomiting and lethargy which resolved spontaneously. At the age of 3 years, the patient re-iterated vomiting, was sub-febrile and hypoglycemic, fell into coma, developed seizures and sequels involving right hemi-body. Urinary excretion of hexanoylglycine and suberylglycine was low during this metabolic decompensation. A study of pre- and post-prandial blood glucose and ketones over a period of 24 hours showed a normal glycaemic cycle but a failure to form ketones after 12 hours fasting, suggesting a mitochondrial β-oxidation defect. Total blood carnitine was lowered with unesterified carnitine being half of the lowest control value. A diagnosis of mild MCAD deficiency (MCADD) was based on rates of 1-14C-octanoate and 9, 10-3H-myristate oxidation and of octanoyl-CoA dehydrogenase being reduced to 25% of control values. Other mitochondrial fatty acid oxidation proteins were functionally normal. De novo acylcarnitine synthesis in whole blood samples incubated with deuterated palmitate was also typical of MCADD. Genetic studies showed that the patient was compound heterozygous with a sequence variation in both of the two ACADM alleles; one had the common c.985A>G mutation and the other had a novel c.145C>G mutation. This is the first report for the ACADM gene c.145C>G mutation: it is located in exon 3 and causes a replacement of glutamine to glutamate at position 24 of the mature protein (Q24E). Associated with heterozygosity for c.985A>G mutation, this mutation is responsible for a mild MCADD phenotype along with a clinical story corroborating the emerging literature view that patients with genotypes representing mild MCADD (high residual enzyme activity and low urinary levels of glycine conjugates), similar to some of the mild MCADDs detected by MS/MS newborn screening, may be at risk for disease presentation. PMID:20923556

  16. A Novel Splice-Site Mutation in Angiotensin I-Converting Enzyme (ACE) Gene, c.3691+1G>A (IVS25+1G>A), Causes a Dramatic Increase in Circulating ACE through Deletion of the Transmembrane Anchor

    PubMed Central

    Persu, Alexandre; Lambert, Michel; Deinum, Jaap; Cossu, Marta; de Visscher, Nathalie; Irenge, Leonid; Ambroise, Jerôme; Minon, Jean-Marc; Nesterovitch, Andrew B.; Churbanov, Alexander; Popova, Isolda A.; Danilov, Sergei M.; Danser, A. H. Jan; Gala, Jean-Luc

    2013-01-01

    Background Angiotensin-converting enzyme (ACE) (EC 4.15.1) metabolizes many biologically active peptides and plays a key role in blood pressure regulation and vascular remodeling. Elevated ACE levels are associated with different cardiovascular and respiratory diseases. Methods and Results Two Belgian families with a 8-16-fold increase in blood ACE level were incidentally identified. A novel heterozygous splice site mutation of intron 25 - IVS25+1G>A (c.3691+1G>A) - cosegregating with elevated plasma ACE was identified in both pedigrees. Messenger RNA analysis revealed that the mutation led to the retention of intron 25 and Premature Termination Codon generation. Subjects harboring the mutation were mostly normotensive, had no left ventricular hypertrophy or cardiovascular disease. The levels of renin-angiotensin-aldosterone system components in the mutated cases and wild-type controls were similar, both at baseline and after 50 mg captopril. Compared with non-affected members, quantification of ACE surface expression and shedding using flow cytometry assay of dendritic cells derived from peripheral blood monocytes of affected members, demonstrated a 50% decrease and 3-fold increase, respectively. Together with a dramatic increase in circulating ACE levels, these findings argue in favor of deletion of transmembrane anchor, leading to direct secretion of ACE out of cells. Conclusions We describe a novel mutation of the ACE gene associated with a major familial elevation of circulating ACE, without evidence of activation of the renin-angiotensin system, target organ damage or cardiovascular complications. These data are consistent with the hypothesis that membrane-bound ACE, rather than circulating ACE, is responsible for Angiotensin II generation and its cardiovascular consequences. PMID:23560051

  17. [Lower urinary tract dysfunction and neuropathological findings of the neural circuits controlling micturition in familial amyotrophic lateral sclerosis with L106V mutation in the SOD1 gene].

    PubMed

    Hineno, Akiyo; Oyanagi, Kiyomitsu; Nakamura, Akinori; Shimojima, Yoshio; Yoshida, Kunihiro; Ikeda, Shu-Ichi

    2016-01-01

    We report lower urinary tract dysfunction and neuropathological findings of the neural circuits controlling micturition in the patients with familial amyotrophic lateral sclerosis having L106V mutation in the SOD1 gene. Ten of 20 patients showed lower urinary tract dysfunction and 5 patients developed within 1 year after the onset of weakness. In 8 patients with an artificial respirator, 6 patients showed lower urinary tract dysfunction. Lower urinary tract dysfunction and respiratory failure requiring an artificial respirator occurred simultaneously in 3 patients. Neuronal loss and gliosis were observed in the neural circuits controlling micturition, such as frontal lobe, thalamus, hypothalamus, striatum, periaqueductal gray, ascending spinal tract, lateral corticospinal tract, intermediolateral nucleus and Onufrowicz' nucleus. Lower urinary tract dysfunction, especially storage symptoms, developed about 1 year after the onset of weakness, and the dysfunction occurred simultaneously with artificial respirator use in the patients.

  18. G1738R is a BRCA1 founder mutation in Greek breast/ovarian cancer patients: evaluation of its pathogenicity and inferences on its genealogical history.

    PubMed

    Anagnostopoulos, Theodore; Pertesi, Maroulio; Konstantopoulou, Irene; Armaou, Sofia; Kamakari, Smaragda; Nasioulas, George; Athanasiou, Athanassios; Dobrovic, Alex; Young, Mary-Anne; Goldgar, David; Fountzilas, George; Yannoukakos, Drakoulis

    2008-07-01

    We have performed screening in 287 breast/ovarian cancer families in Greece which has revealed that approximately 12% (8/65) of all index patients-carriers of a deleterious mutation in BRCA1 and BRCA2 genes, contain the base substitution G to A at position 5331 of BRCA1 gene. This generates the amino acid change G1738R for which based on a combination of genetic, in silico and histopathological analysis there are strong suggestions that it is a causative mutation. In this paper, we present further evidence suggesting the pathogenicity of this variant. Forty breast/ovarian cancer patients were reported in 11 Greek families: the above eight living in Greece, two living in Australia and one in USA, all containing G1738R. Twenty of these patients were screened and were all found to be carriers of the same base substitution. In addition, we have detected the same base change in five breast/ovarian cancer patients after screening 475 unselected patient samples with no apparent family history. The mean age of onset for all the above patients was 39.4 and 53.6 years for breast and ovarian cancer cases, respectively. A multi-factorial likelihood model for classification of unclassified variants in BRCA1 and BRCA2 developed previously was applied on G1738R and the odds of it being a deleterious mutation was estimated to be 11470:1. In order to explain the prevalence of this mutation mainly in the Greek population, its genealogical history was examined. DNA samples were collected from 11 carrier families living in Greece, Australia and USA. Screening of eight intragenic SNPs, three intragenic and seven extragenic microsatellite markers and comparison with control individuals, suggested a common origin for the mutation while the time to its most recent common ancestor was estimated to be 11 generations (about 275 years assuming a generational interval of 25 years) with a 1-lod support interval of 4-24 generations (100-600 years). Considering the large degree of genetic

  19. A mutation in sigma-1 receptor causes juvenile amyotrophic lateral sclerosis.

    PubMed

    Al-Saif, Amr; Al-Mohanna, Futwan; Bohlega, Saeed

    2011-12-01

    Amyotrophic lateral sclerosis (ALS) is a neurodegenerative disorder characterized by loss of motor neurons in the brain and spinal cord, leading to muscle weakness and eventually death from respiratory failure. ALS is familial in about 10% of cases, with SOD1 mutations accounting for 20% of familial cases. Here we describe a consanguineous family segregating juvenile ALS in an autosomal recessive pattern and describe the genetic variant responsible for the disorder. We performed homozygosity mapping and direct sequencing to detect the genetic variant and tested the effect of this variant on a motor neuron-like cell line model (NSC34) expressing the wild-type or mutant gene. We identified a shared homozygosity region in affected individuals that spans ~120 kbp on chromosome 9p13.3 containing 9 RefSeq genes. Sequencing the SIGMAR1 gene revealed a mutation affecting a highly conserved amino acid located in the transmembrane domain of the encoded protein, sigma-1 receptor. The mutated protein showed an aberrant subcellular distribution in NSC34 cells. Furthermore, cells expressing the mutant protein were less resistant to apoptosis induced by endoplasmic reticulum stress. Sigma-1 receptors are known to have neuroprotective properties, and recently Sigmar1 knockout mice have been described to have motor deficiency. Our findings emphasize the role of sigma-1 receptors in motor neuron function and disease. Copyright © 2011 American Neurological Association.

  20. Identification of a founder BRCA1 mutation in the Moroccan population.

    PubMed

    Quiles, F; Teulé, À; Martinussen Tandstad, N; Feliubadaló, L; Tornero, E; Del Valle, J; Menéndez, M; Salinas, M; Wethe Rognlien, V; Velasco, A; Izquierdo, A; Capellá, G; Brunet, J; Lázaro, C

    2016-10-01

    Breast cancer (BC) is the most frequent cancer among women in Morocco. However, the role of the most prevalent BC-predisposing genes, BRCA1 and BRCA2, has been largely unexplored. To help define the role of BRCA1 in BC in Morocco, we characterized the first potential BRCA1 founder mutation in this population. Genetic testing of BRCA1 and BRCA2 in BC high-risk families identified mutation BRCA1 c.5309G>T, p.(Gly1770Val) or G1770V in five independent families from Morocco, suggesting a founder effect. To confirm this hypothesis, haplotype construction was performed using seven intragenic and flanking BRCA1 microsatellite markers. Clinical data were also compiled. Clinical data from carriers of mutation G1770V correspond to data from carriers of BRCA1 pathogenic mutations. Microsatellite analysis showed a common haplotype for the five families in a region comprising 1.54 Mb, confirming G1770V as the first specific founder BRCA1 mutation in the Moroccan population. Our findings contribute to a better understanding of BC genetics in the Moroccan population. Nevertheless, comprehensive studies of mutation G1770V in large series of BC patients from Morocco are needed to assess the real prevalence of this mutation and to improve genetic testing and risk assessment in this population. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. Novel compound heterozygous mutations in MYO7A in a Chinese family with Usher syndrome type 1

    PubMed Central

    Liu, Fei; Li, Pengcheng; Liu, Ying; Li, Weirong; Wong, Fulton; Du, Rong; Wang, Lei; Li, Chang; Jiang, Fagang; Tang, Zhaohui

    2013-01-01

    Purpose To identify the disease-causing mutation(s) in a Chinese family with autosomal recessive Usher syndrome type 1 (USH1). Methods An ophthalmic examination and an audiometric test were conducted to ascertain the phenotype of two affected siblings. The microsatellite marker D11S937, which is close to the candidate gene MYO7A (USH1B locus), was selected for genotyping. From the DNA of the proband, all coding exons and exon-intron boundaries of MYO7A were sequenced to identify the disease-causing mutation(s). Restriction fragment length polymorphism (RFLP) analysis was performed to exclude the alternative conclusion that the mutations are non-pathogenic rare polymorphisms. Results Based on severe hearing impairment, unintelligible speech, and retinitis pigmentosa, a clinical diagnosis of Usher syndrome type 1 was made. The genotyping results did not exclude the USH1B locus, which suggested that the MYO7A gene was likely the gene associated with the disease-causing mutation(s) in the family. With direct DNA sequencing of MYO7A, two novel compound heterozygous mutations (c.3742G>A and c.6051+1G>A) of MYO7A were identified in the proband. DNA sequence analysis and RFLP analysis of other family members showed that the mutations cosegregated with the disease. Unaffected members, including the parents, uncle, and sister of the proband, carry only one of the two mutations. The mutations were not present in the controls (100 normal Chinese subjects=200 chromosomes) according to the RFLP analysis. Conclusions In this study, we identified two novel mutations, c.3742G>A (p.E1248K) and c.6051+1G>A (donor splice site mutation in intron 44), of MYO7A in a Chinese non-consanguineous family with USH1. The mutations cosegregated with the disease and most likely cause the phenotype in the two affected siblings who carry these mutations compound heterozygously. Our finding expands the mutational spectrum of MYO7A. PMID:23559863

  2. Novel compound heterozygous mutations in MYO7A in a Chinese family with Usher syndrome type 1.

    PubMed

    Liu, Fei; Li, Pengcheng; Liu, Ying; Li, Weirong; Wong, Fulton; Du, Rong; Wang, Lei; Li, Chang; Jiang, Fagang; Tang, Zhaohui; Liu, Mugen

    2013-01-01

    To identify the disease-causing mutation(s) in a Chinese family with autosomal recessive Usher syndrome type 1 (USH1). An ophthalmic examination and an audiometric test were conducted to ascertain the phenotype of two affected siblings. The microsatellite marker D11S937, which is close to the candidate gene MYO7A (USH1B locus), was selected for genotyping. From the DNA of the proband, all coding exons and exon-intron boundaries of MYO7A were sequenced to identify the disease-causing mutation(s). Restriction fragment length polymorphism (RFLP) analysis was performed to exclude the alternative conclusion that the mutations are non-pathogenic rare polymorphisms. Based on severe hearing impairment, unintelligible speech, and retinitis pigmentosa, a clinical diagnosis of Usher syndrome type 1 was made. The genotyping results did not exclude the USH1B locus, which suggested that the MYO7A gene was likely the gene associated with the disease-causing mutation(s) in the family. With direct DNA sequencing of MYO7A, two novel compound heterozygous mutations (c.3742G>A and c.6051+1G>A) of MYO7A were identified in the proband. DNA sequence analysis and RFLP analysis of other family members showed that the mutations cosegregated with the disease. Unaffected members, including the parents, uncle, and sister of the proband, carry only one of the two mutations. The mutations were not present in the controls (100 normal Chinese subjects=200 chromosomes) according to the RFLP analysis. In this study, we identified two novel mutations, c.3742G>A (p.E1248K) and c.6051+1G>A (donor splice site mutation in intron 44), of MYO7A in a Chinese non-consanguineous family with USH1. The mutations cosegregated with the disease and most likely cause the phenotype in the two affected siblings who carry these mutations compound heterozygously. Our finding expands the mutational spectrum of MYO7A.

  3. Role of mutations G-480 and C-6203 in the attenuation phenotype of Sabin type 1 poliovirus.

    PubMed

    McGoldrick, A; Macadam, A J; Dunn, G; Rowe, A; Burlison, J; Minor, P D; Meredith, J; Evans, D J; Almond, J W

    1995-12-01

    Of the 55 point mutations which distinguish the type 1 poliovirus vaccine strain (Sabin 1) from its neurovirulent progenitor (P1/Mahoney), two have been strongly implicated by previous studies as determinants of the attenuation phenotype. A change of an A to a G at position 480, located within the 5' noncoding region, has been suggested to be the major attenuating mutation, analogous to the mutations at positions 481 and 472 in poliovirus types 2 and 3, respectively. In addition, the change of a U to a C at position 6203, resulting in an amino acid change in the polymerase protein 3D, has also been implicated as a determinant of attenuation, albeit to a lesser extent. To assess the contributions of these mutations to attenuation and temperature sensitivity, reciprocal changes were generated at these positions in infectious cDNA clones of Sabin 1 and P1/Mahoney. Assays in tissue culture and primates indicated that the two mutations make some contribution to the temperature sensitivity of the Sabin 1 strain but that neither is a strong determinant of attenuation.

  4. The unfolding mechanism of monomeric mutant SOD1 by simulated force spectroscopy.

    PubMed

    Habibi, Mona; Rottler, Jörg; Plotkin, Steven S

    2017-11-01

    Mechanical unfolding of mutated apo, disulfide-reduced, monomeric superoxide dismutase 1 protein (SOD1) has been simulated via force spectroscopy techniques, using both an all-atom (AA), explicit solvent model and a coarse-grained heavy-atom Gō (HA-Gō) model. The HA-Gō model was implemented at two different pulling speeds for comparison. The most-common sequence of unfolding in the AA model agrees well with the most-common unfolding sequence of the HA-Gō model, when the same normalized pulling rate was used. Clustering of partially-native structures as the protein unfolds shows that the AA and HA-Gō models both exhibit a dominant pathway for early unfolding, which eventually bifurcates repeatedly to multiple branches after the protein is about half-unfolded. The force-extension curve exhibits multiple force drops, which are concomitant with jumps in the local interaction potential energy between specific β-strands in the protein. These sudden jumps in the potential energy coincide with the dissociation of specific pairs of β-strands, and thus intermediate unfolding events. The most common sequence of β-strand dissociation in the unfolding pathway of the AA model is β-strands 5, 4, 8, 7, 1, 2, then finally β-strands 3 and 6. The observation that β-strand 5 is among the first to unfold here, but the last to unfold in simulations of loop-truncated SOD1, could imply the existence of an evolutionary compensation mechanism, which would stabilize β-strands flanking long loops against their entropic penalty by strengthening intramolecular interactions. This article is part of a Special Issue entitled: Biophysics in Canada, edited by Lewis Kay, John Baenziger, Albert Berghuis and Peter Tieleman. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Functional characterisation of a TLR accessory protein, UNC93B1, in Atlantic salmon (Salmo salar).

    PubMed

    Lee, P T; Zou, J; Holland, J W; Martin, S A M; Scott, C J W; Kanellos, T; Secombes, C J

    2015-05-01

    Toll-like receptors (TLRs) are indispensable components of the innate immune system, which recognise conserved pathogen associated molecular patterns (PAMPs) and induce a series of defensive immune responses to protect the host. Biosynthesis, localisation and activation of TLRs are dependent on TLR accessory proteins. In this study, we identified the accessory protein, UNC93B1, from Atlantic salmon (Salmo salar) whole-genome shotgun (WGS) contigs aided by the conserved gene synteny of genes flanking UNC93B1 in fish, birds and mammals. Phylogenetic analysis showed that salmon UNC93B1 grouped with other vertebrate UNC93B1 molecules, and had highest amino acid identity and similarity to zebrafish UNC93B1. The salmon UNC93B1 gene organisation was also similar in structure to mammalian UNC93B1. Our gene expression studies revealed that salmon UNC93B1 was more highly expressed in spleen, liver and gill tissues but was expressed at a lower level in head kidney tissue in post-smolts relative to parr. Moreover, salmon UNC93B1 mRNA transcripts were up-regulated in vivo in spleen tissue from polyI:C treated salmon and in vitro in polyI:C or IFNγ stimulated Salmon Head Kidney-1 (SHK-1) cells. Initial studies into the functional role of salmon UNC93B1 in fish TLR signalling found that both wild type salmon UNC93B1 and a molecule with a site-directed mutation (H424R) co-immunoprecipitated with salmon TLR19, TLR20a and TLR20d. Overall, these data illustrate the potential importance of UNC93B1 as an accessory protein in fish TLR signalling. Copyright © 2014 Elsevier Ltd. All rights reserved.

  6. ALS-causing profilin-1-mutant forms a non-native helical structure in membrane environments.

    PubMed

    Lim, Liangzhong; Kang, Jian; Song, Jianxing

    2017-11-01

    Despite having physiological functions completely different from superoxide dismutase 1 (SOD1), profilin 1 (PFN1) also carries mutations causing amyotrophic lateral sclerosis (ALS) with a striking similarity to that triggered by SOD1 mutants. Very recently, the C71G-PFN1 has been demonstrated to cause ALS by a gain of toxicity and the acceleration of motor neuron degeneration preceded the accumulation of its aggregates. Here by atomic-resolution NMR determination of conformations and dynamics of WT-PFN1 and C71G-PFN1 in aqueous buffers and in membrane mimetics DMPC/DHPC bicelle and DPC micelle, we deciphered that: 1) the thermodynamic destabilization by C71G transforms PFN1 into coexistence with the unfolded state, which is lacking of any stable tertiary/secondary structures as well as restricted ps-ns backbone motions, thus fundamentally indistinguishable from ALS-causing SOD1 mutants. 2) Most strikingly, while WT-PFN1 only weakly interacts with DMPC/DHPC bicelle without altering the native structure, C71G-PFN1 acquires abnormal capacity in strongly interacting with DMPC/DHPC bicelle and DPC micelle, energetically driven by transforming the highly disordered unfolded state into a non-native helical structure, similar to what has been previously observed on ALS-causing SOD1 mutants. Our results imply that one potential mechanism for C71G-PFN1 to initiate ALS might be the abnormal interaction with membranes as recently established for SOD1 mutants. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Redox Regulation of the Superoxide Dismutases SOD3 and SOD2 in the Pulmonary Circulation.

    PubMed

    Hernandez-Saavedra, Daniel; Swain, Kalin; Tuder, Rubin; Petersen, Steen V; Nozik-Grayck, Eva

    2017-01-01

    When evaluating the role of redox-regulating signaling in pulmonary vascular diseases, it is intriguing to consider the modulation of key antioxidant enzymes like superoxide dismutase (SOD) because SOD isoforms are regulated by redox reactions, and, in turn, modulate downstream redox sensitive processes. The emerging field of redox biology is built upon understanding the regulation and consequences of tightly controlled and specific reduction-oxidation reactions that are critical for diverse cellular processes including cell signaling. Of relevance, both the site of production of specific reactive oxygen and nitrogen species and the site of the antioxidant defenses are highly compartmentalized within the cell. For example, superoxide is generated during oxidative phosphorylation in the mitochondria as well as by a number of enzymatic sources within the cytosol and at the cell membrane. In the pulmonary circulation, these sources include the mitochondrial electron transport chain, NADPH oxidases (NOX1-4, Duox1,2), nitric oxide synthases, and xanthine oxidase; this important topic has been thoroughly reviewed recently [1]. In parallel with these different cellular sites of superoxide production, the three SOD isoforms are also specifically localized to the cytosol (SOD1), mitochondria (SOD2) or extracellular compartment (SOD3). This chapter focuses on the role of redox mechanisms regulating SOD2 and SOD3, with an emphasis on these processes in the setting of pulmonary hypertension.

  8. A novel CYP27B1 mutation causes a feline vitamin D-dependent rickets type IA.

    PubMed

    Grahn, Robert A; Ellis, Melanie R; Grahn, Jennifer C; Lyons, Leslie A

    2012-08-01

    A 12-week-old domestic cat presented at a local veterinary clinic with hypocalcemia and skeletal abnormalities suggestive of rickets. Osteomalacia (rickets) is a disease caused by impaired bone mineralization leading to an increased prevalence of fractures and deformity. Described in a variety of species, rickets is most commonly caused by vitamin D or calcium deficiencies owing to both environmental and or genetic abnormalities. Vitamin D-dependent rickets type 1A (VDDR-1A) is a result of the enzymatic pathway defect caused by mutations in the 25-hydroxyvitamin D(3)-1-alpha-hydroxylase gene [cytochrome P27 B1 (CYP27B1)]. Calcitriol, the active form of vitamin D(3), regulates calcium homeostasis, which requires sufficient dietary calcium availability and correct hormonal function for proper bone growth and maintenance. Patient calcitriol concentrations were low while calcidiol levels were normal suggestive of VDDR-1A. The entire DNA coding sequencing of CYP27B1 was evaluated. The affected cat was wild type for previously identified VDDR-1A causative mutations. However, six novel mutations were identified, one of which was a nonsense mutation at G637T in exon 4. The exon 4 G637T nonsense mutation results in a premature protein truncation, changing a glutamic acid to a stop codon, E213X, likely causing the clinical presentation of rickets. The previously documented genetic mutation resulting in feline VDDR-1A rickets, as well as the case presented in this research, result from novel exon 4 CYP27B1 mutations, thus exon 4 should be the initial focus of future sequencing efforts.

  9. Structural and Molecular Basis of the Peroxynitrite-mediated Nitration and Inactivation of Trypanosoma cruzi Iron-Superoxide Dismutases (Fe-SODs) A and B

    PubMed Central

    Martinez, Alejandra; Peluffo, Gonzalo; Petruk, Ariel A.; Hugo, Martín; Piñeyro, Dolores; Demicheli, Verónica; Moreno, Diego M.; Lima, Analía; Batthyány, Carlos; Durán, Rosario; Robello, Carlos; Martí, Marcelo A.; Larrieux, Nicole; Buschiazzo, Alejandro; Trujillo, Madia; Radi, Rafael; Piacenza, Lucía

    2014-01-01

    Trypanosoma cruzi, the causative agent of Chagas disease, contains exclusively iron-dependent superoxide dismutases (Fe-SODs) located in different subcellular compartments. Peroxynitrite, a key cytotoxic and oxidizing effector biomolecule, reacted with T. cruzi mitochondrial (Fe-SODA) and cytosolic (Fe-SODB) SODs with second order rate constants of 4.6 ± 0.2 × 104 m−1 s−1 and 4.3 ± 0.4 × 104 m−1 s−1 at pH 7.4 and 37 °C, respectively. Both isoforms are dose-dependently nitrated and inactivated by peroxynitrite. Susceptibility of T. cruzi Fe-SODA toward peroxynitrite was similar to that reported previously for Escherichia coli Mn- and Fe-SODs and mammalian Mn-SOD, whereas Fe-SODB was exceptionally resistant to oxidant-mediated inactivation. We report mass spectrometry analysis indicating that peroxynitrite-mediated inactivation of T. cruzi Fe-SODs is due to the site-specific nitration of the critical and universally conserved Tyr35. Searching for structural differences, the crystal structure of Fe-SODA was solved at 2.2 Å resolution. Structural analysis comparing both Fe-SOD isoforms reveals differences in key cysteines and tryptophan residues. Thiol alkylation of Fe-SODB cysteines made the enzyme more susceptible to peroxynitrite. In particular, Cys83 mutation (C83S, absent in Fe-SODA) increased the Fe-SODB sensitivity toward peroxynitrite. Molecular dynamics, electron paramagnetic resonance, and immunospin trapping analysis revealed that Cys83 present in Fe-SODB acts as an electron donor that repairs Tyr35 radical via intramolecular electron transfer, preventing peroxynitrite-dependent nitration and consequent inactivation of Fe-SODB. Parasites exposed to exogenous or endogenous sources of peroxynitrite resulted in nitration and inactivation of Fe-SODA but not Fe-SODB, suggesting that these enzymes play distinctive biological roles during parasite infection of mammalian cells. PMID:24616096

  10. Prevalence of 1691G>A FV mutation in females from Bosnia and Herzegovina - a preliminary report

    PubMed Central

    Yaljevac, Amina; Mehić, Bakir; Kiseljaković, Emina; Ibrulj, Slavka; Garstka, Agnieszka; Adler, Grazyna

    2013-01-01

    Factor V is the liver-synthesized multidomain glycoprotein encoded by a gene localised on chromosome 1q23. The point mutation 1691G>A in this gene results in formation of an altered protein of V Factor resistant to activated protein C (APC) cleavage. This mutation alone is the most frequent cause of inborn thrombophilia and the most widely acknowledged genetic risk factor for venous thrombosis in a Caucasian population. This study was designed to provide the first estimate of the frequency of the allele 1691A FV in the Bosnian female population. The 1691G>A FV mutation was examined by polymerase chain reaction-restriction fragment length polymorphism, in a group of 67 women, mean age of 58.6 years with no history of cardiovascural incident. Our findings revealed an absence of the mutated allele 1691A FV in the studied group. This is the first report on the 1691G>A FV mutation in a population from Bosnia and Herzegovina. Further research is needed to establish prevalence of the mutated allele in the population from Bosnia and Herzegovina. PMID:23448608

  11. Molecular interaction of triclosan with superoxide dismutase (SOD) reveals a potentially toxic mechanism of the antimicrobial agent.

    PubMed

    Mi, Chenyu; Teng, Yue; Wang, Xiaofang; Yu, Hongyan; Huang, Zhenxing; Zong, Wansong; Zou, Luyi

    2018-05-30

    In this article, the interaction mechanism between the superoxide dismutase (SOD) and the triclosan (TCS), a kind of antimicrobial agent which is of widely application with potential effects both on environment and human health, was explored through a series of spectroscopic methods, animal experiment and the molecular docking simulation. The negative free energy change ∆G, enthalpy change (∆H = 162.21 kJmol -1 ) and entropy change (∆S = 615 Jmol -1 K -1 ) demonstrated that TCS could combine with SOD spontaneously through hydrophobic interaction to form a complex. The binding constants of K a293 and K a313 were 1.706 × 10 3 and 1.2 × 10 5 Lmol -1 , respectively. Furthermore, the interaction could also influence the skeleton structure and secondary contents of SOD. The molecular docking analysis revealed the TCS located between two subunits of SOD, and there was a hydrogen bond between TCS and the residue Asn51 of SOD, which influenced the structure of protein and resulted in a decrease of enzyme activity. This work could help understand the interaction mechanism between SOD and TCS. Moreover, it could also be used to consult for toxicity assessment of TCS at molecular level. Copyright © 2018 Elsevier Inc. All rights reserved.

  12. [Two novel pathogenic mutations of GAN gene identified in a patient with giant axonal neuropathy].

    PubMed

    Wang, Juan; Ma, Qingwen; Cai, Qin; Liu, Yanna; Wang, Wei; Ren, Zhaorui

    2016-06-01

    To explore the disease-causing mutations in a patient suspected for giant axonal neuropathy(GAN). Target sequence capture sequencing was used to screen potential mutations in genomic DNA extracted from peripheral blood sample of the patient. Sanger sequencing was applied to confirm the detected mutation. The mutation was verified among 400 GAN alleles from 200 healthy individuals by Sanger sequencing. The function of the mutations was predicted by bioinformatics analysis. The patient was identified as a compound heterozygote carrying two novel pathogenic GAN mutations, i.e., c.778G>T (p.Glu260Ter) and c.277G>A (p.Gly93Arg). Sanger sequencing confirmed that the c.778G>T (p.Glu260Ter) mutation was inherited from his father, while c.277G>A (p.Gly93Arg) was inherited from his mother. The same mutations was not found in the 200 healthy individuals. Bioinformatics analysis predicted that the two mutations probably caused functional abnormality of gigaxonin. Two novel GAN mutations were detected in a patient with GAN. Both mutations are pathogenic and can cause abnormalities of gigaxonin structure and function, leading to pathogenesis of GAN. The results may also offer valuable information for similar diseases.

  13. Effect of rosmarinic acid in motor dysfunction and life span in a mouse model of familial amyotrophic lateral sclerosis.

    PubMed

    Shimojo, Yosuke; Kosaka, Kunio; Noda, Yoshihiro; Shimizu, Takahiko; Shirasawa, Takuji

    2010-03-01

    Amyotrophic lateral sclerosis (ALS) is a late-onset progressive neurodegenerative disease affecting motor neurons. About 2% of patients with the disease are associated with mutations in the gene encoding Cu/Zn superoxide dismutase (SOD1). The purpose of this study is to assess the effect of rosemary extract and its major constituents, rosmarinic acid (RA) and carnosic acid (CA), in human SOD1 G93A transgenic mice, which are well-established mouse models for ALS. The present study demonstrates that intraperitoneal administration of rosemary extract or RA from the presymptomatic stage significantly delayed motor dysfunction in paw grip endurance tests, attenuated the degeneration of motor neurons, and extended the life span of ALS model mice. In addition, RA administration significantly improved the clinical score and suppressed body weight loss compared with a vehicle-treated group. In conclusion, this study provides the first report that rosemary extract and, especially, RA have preventive effects in the mouse model of ALS.

  14. Mutation and virulence assessment of chromosomal genes of Rhodococcus equi 103

    PubMed Central

    Pei, Yanlong; Parreira, Valeria; Nicholson, Vivian M.; Prescott, John F.

    2007-01-01

    Rhodococcus equi can cause severe or fatal pneumonia in foals as well as in immunocompromised animals and humans. Its ability to persist in macrophages is fundamental to how it causes disease, but the basis of this is poorly understood. To examine further the general application of a recently developed system of targeted gene mutation and to assess the importance of different genes in resistance to innate immune defenses, we disrupted the genes encoding high-temperature requirement A (htrA), nitrate reductase (narG), peptidase D (pepD), phosphoribosylaminoimidazole-succinocarboxamide synthase (purC), and superoxide dismutase (sodC) in strain 103 of R. equi using a double-crossover homologous recombination approach. Virulence testing by clearance after intravenous injection in mice showed that the htrA and narG mutants were fully attenuated, the purC and sodC mutants were unchanged, and the pepD mutant was slightly attenuated. Complementation with the pREM shuttle plasmid restored the virulence of the htrA and pepD mutants but not that of the narG mutant. A single-crossover mutation approach was simpler and faster than the double-crossover homologous recombination technique and was used to obtain mutations in 6 other genes potentially involved in virulence (clpB, fadD8, fbpB, glnA1, regX3, and sigF). These mutants were not attenuated in the mouse clearance assay. We were not able to obtain mutants for genes furA, galE, and sigE using the single-crossover mutation approach. In summary, the targeted-mutation system had general applicability but was not always completely successful, perhaps because some genes are essential under the growth conditions used or because the success of mutation depends on the target genes. PMID:17193875

  15. Mutation and virulence assessment of chromosomal genes of Rhodococcus equi 103.

    PubMed

    Pei, Yanlong; Parreira, Valeria; Nicholson, Vivian M; Prescott, John F

    2007-01-01

    Rhodococcus equi can cause severe or fatal pneumonia in foals as well as in immunocompromised animals and humans. Its ability to persist in macrophages is fundamental to how it causes disease, but the basis of this is poorly understood. To examine further the general application of a recently developed system of targeted gene mutation and to assess the importance of different genes in resistance to innate immune defenses, we disrupted the genes encoding high-temperature requirement A (htrA), nitrate reductase (narG), peptidase D (pepD), phosphoribosylaminoimidazole-succinocarboxamide synthase (purC), and superoxide dismutase (sodC) in strain 103 of R. equi using a double-crossover homologous recombination approach. Virulence testing by clearance after intravenous injection in mice showed that the htrA and narG mutants were fully attenuated, the purC and sodC mutants were unchanged, and the pepD mutant was slightly attenuated. Complementation with the pREM shuttle plasmid restored the virulence of the htrA and pepD mutants but not that of the narG mutant. A single-crossover mutation approach was simpler and faster than the double-crossover homologous recombination technique and was used to obtain mutations in 6 other genes potentially involved in virulence (clpB, fadD8, fbpB, glnA1, regX3, and sigF). These mutants were not attenuated in the mouse clearance assay. We were not able to obtain mutants for genesfurA, galE, and sigE using the single-crossover mutation approach. In summary, the targeted-mutation system had general applicability but was not always completely successful, perhaps because some genes are essential under the growth conditions used or because the success of mutation depends on the target genes.

  16. G20210A prothrombin gene mutation identified in patients with venous leg ulcers.

    PubMed

    Jebeleanu, G; Procopciuc, L

    2001-01-01

    The G20210A mutation variant of prothrombin gene is the second most frequent mutation identified in patients with deep venous thrombosis, after factor V Leiden. The risk for developing deep venous thrombosis is high in patients identified as heterozygous for G20210A mutation. In order to identify this polymorphism in the gene coding prothrombin, the 345bp fragment in the 3'- untranslated region of the prothrombin gene was amplified using amplification by polymerase chain reaction and enzymatic digestion by HindIII (restriction endonuclease enzyme). The products of amplification and enzymatic's digestion were analized using agarose gel electrophoresis. We investigated 20 patients with venous leg ulcers and we found 2 heterozygous (10%) for G20210A mutation. None of the patients in the control group had G20210A mutation. Our study confirms the presence of G20210A mutation in the Romanian population. Our study also shows the link between venous leg ulcers and this polymorphism in the prothrombin gene.

  17. Mitochondrial tRNA(Thr) A15951G mutation may not be associated with Leber's Hereditary Optic Neuropathy.

    PubMed

    Zhang, Xi; Yu, Shuaishuai; Tu, Yunhai; Huang, Wenjie

    2016-07-01

    Mutation in mitochondrial DNA (mtDNA) has been found to play an important role in the pathogenesis of Leber's Hereditary Optic Neuropathy (LHON). Three primary mutations, the ND4 G11778A, ND6 T14484C, and ND1 G3460A, have been found to account more than 90% of LHON patients in many families worldwide. In addition to the mutations in genes encoding the respiratory chain complex I, reports concerning the mt-tRNA gene mutations associated with LHON have increased, some pathogenic mutations caused the failure in mt-tRNA metabolism, thereby worsened the mitochondrial dysfunction that is responsible for LHON. Recently, the A15951G mutation in mt-tRNA(Thr) gene has been reported to be a "modified" factor in increasing the penetrance and expressivity of LHON-associated ND4 G11778A mutation in three Chinese families. However, evolutionary conservation analysis of this mutation suggested a poor conservation index and the pathogenicity scoring system showed that this mutation was a neutral polymorphism.

  18. Genetic polymorphisms of superoxide dismutase-1 A251G and catalase C-262T with the risk of colorectal cancer.

    PubMed

    Jamhiri, Iman; Saadat, Iraj; Omidvari, Shahpour

    2017-06-01

    Oxidative stress is significant in numerous types of disease including cancer. To protect cells and organs against reactive oxygen species (ROS), the body has evolved an antioxidant protection system that involved in the detoxification of ROS. Single nucleotide polymorphisms (SNP) of anti-oxidative enzymes may dramatically change the activity of the encoded proteins; therefore, certain alleles can be established as risk factors for some kind of multi-factorial diseases including cancer. In present study we investigate the possible association between polymorphisms of superoxide dismutase 1 ( SOD1 , OMIM: 147450) and catalase ( CAT , OMIM: 115500) genes and the risk of colorectal cancer (CRC). The study included 204 colorectal cancer patients and 239 healthy control group matched for gender and age. Genotyping of SOD1 A251G and CAT C-262T were done by polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP) method. There was no significant association between CAT C-262T polymorphism and susceptibility to CRC (P>0.05). The carries of the G allele of SOD1 significantly showed higher prevalence in CRC patients compared with the control group (OR=1.84, 95% CI=1.13-2.98, P=0.013). We assessed the effect of combination of genotypes of the study polymorphisms on the risk of CRC. We found that the combination of AG+GG ( SOD1 ) and CC ( CAT ) increases the risk of developing CRC (OR=2.38, 95% CI=1.25-4.52, P=0.008).

  19. Genetic polymorphisms of superoxide dismutase-1 A251G and catalase C-262T with the risk of colorectal cancer

    PubMed Central

    Jamhiri, Iman; Saadat, Iraj; Omidvari, Shahpour

    2017-01-01

    Oxidative stress is significant in numerous types of disease including cancer. To protect cells and organs against reactive oxygen species (ROS), the body has evolved an antioxidant protection system that involved in the detoxification of ROS. Single nucleotide polymorphisms (SNP) of anti-oxidative enzymes may dramatically change the activity of the encoded proteins; therefore, certain alleles can be established as risk factors for some kind of multi-factorial diseases including cancer. In present study we investigate the possible association between polymorphisms of superoxide dismutase 1 (SOD1, OMIM: 147450) and catalase (CAT, OMIM: 115500) genes and the risk of colorectal cancer (CRC). The study included 204 colorectal cancer patients and 239 healthy control group matched for gender and age. Genotyping of SOD1 A251G and CAT C-262T were done by polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP) method. There was no significant association between CAT C-262T polymorphism and susceptibility to CRC (P>0.05). The carries of the G allele of SOD1 significantly showed higher prevalence in CRC patients compared with the control group (OR=1.84, 95% CI=1.13-2.98, P=0.013). We assessed the effect of combination of genotypes of the study polymorphisms on the risk of CRC. We found that the combination of AG+GG (SOD1) and CC (CAT) increases the risk of developing CRC (OR=2.38, 95% CI=1.25-4.52, P=0.008). PMID:28775994

  20. Detection of c. -32T>G (IVS1-13T>G) mutation of Pompe disease by real-time PCR in dried blood spot specimen.

    PubMed

    Bobillo Lobato, Joaquin; Sánchez Peral, Blas A; Durán Parejo, Pilar; Jiménez Jiménez, Luis M

    2013-03-15

    Pompe disease, or acid maltase deficiency, is a genetic muscle disorder caused by mutations in the gene encoding the acid alpha-glucosidase (GAA) enzyme, which is essential for the degradation of glycogen to glucose in lysosomes. The wide clinical variability is resulted from genetic heterogeneity, and many different mutations of the GAA gene have been reported. Some of these mutations are associated with specific phenotypes, such as the c. -32T>G (IVS1-13T>G) mutation seen in late-onset Pompe disease. We used a real-time PCR, after genomic DNA extraction isolated from DBS (dried blood spots) and PCR amplification. Our results successfully detected in controls and patients have been 100% concordant with sequencing results. This assay combines simple sample processing and rapid analysis and it allows to detect the patients with a milder form and slower progression of this disease with a high reliability. Copyright © 2013 Elsevier B.V. All rights reserved.

  1. Analysis of fluG mutations that affect light-dependent conidiation in Aspergillus nidulans.

    PubMed Central

    Yager, L N; Lee, H O; Nagle, D L; Zimmerman, J E

    1998-01-01

    Conidiation in Aspergillus nidulans is induced by exposure to red light but can also be induced by blue light in certain mutant strains. We have isolated a mutation in the fluG gene that abolishes responsiveness to red light but does not affect the response to blue light. It has been shown that the veA1 (velvet) mutation allows conidiation to occur in the absence of light. We have identified three other fluG mutations that suppress the veA1 phenotype; these double mutants do not conidiate in the dark. The mutations described here define two new phenotypic classes of fluG alleles that display abnormal responses to light. We have characterized these mutations with respect to their molecular identity and to their effect on fluG transcription. Although it has been shown that fluG is required for the synthesis of an extracellular factor that directs conidiation, we do not detect this factor under conditions that promote conidiation in the veA1 suppressors. Furthermore, extracellular rescue is not observed in fluG deletion strains containing the wild-type veA allele. We propose that a genetic interaction between fluG and veA influences the production of the extracellular signal and regulates the initiation of conidiation. PMID:9691036

  2. Factor V Leiden G1691A and prothrombin G20210A mutations among Palestinian patients with sickle cell disease.

    PubMed

    Samarah, Fekri; Srour, Mahmoud A

    2018-01-01

    Vascular thrombosis is an important pathophysiological aspect of sickle cell disease (SCD). This study aimed to investigate the prevalence and clinical impact of factor V Leiden G1691A (FVL) and prothrombin G20210A mutations among Palestinian sickle cell disease (SCD) patients. A total of 117 SCD patients, including 59 patients with sickle cell anemia (SS), 33 patients with sickle β-thalassemia and 25 individuals with sickle cell trait (AS) were studied. The control group consisted of 118 healthy individuals. FVL and prothrombin G20210A mutations were determined by RFLP PCR. Analysis of the clinical history of SCD patients revealed that seven patients have had vascular complications such as ischemic stroke or deep vein thrombosis. In SCD patients, the inheritance of the FVL mutation showed a significantly higher incidence of pain in joints, chest and abdomen as well as regular dependence on blood transfusion compared to SCD with the wild type. Age- and sex-adjusted logistic regression analysis revealed a significant association between FVL and sickle cell anemia with an odds ratio (OR) of 5.6 (95% confidence intervals [CI] of 1.91-39.4, P  = 0.039) in SS patients. However, increased prevalence of the FVL in AS subjects and sickle β-thalassemia patients was not statistically significant compared to controls (OR 3.97, 95% CI 0.51-28.6, P  = 0.17 and OR 3.59, 95% CI 0.35-41.6, P  = 0.26, respectively). The distribution of prothrombin G20210A mutation among SCD patients compared to controls was not significantly different, thus our findings do not support an association of this mutation with SCD. FVL was more prevalent among SS patients compared to controls and it was associated with higher incidence of disease complications among SCD patients.

  3. Recurrent PRKAR1A mutation in acrodysostosis with hormone resistance.

    PubMed

    Linglart, Agnès; Menguy, Christine; Couvineau, Alain; Auzan, Colette; Gunes, Yasemin; Cancel, Mathilde; Motte, Emmanuelle; Pinto, Graziella; Chanson, Philippe; Bougnères, Pierre; Clauser, Eric; Silve, Caroline

    2011-06-09

    The skeletal dysplasia characteristic of acrodysostosis resembles the Albright's hereditary osteodystrophy seen in patients with pseudohypoparathyroidism type 1a, but defects in the α-stimulatory subunit of the G-protein (GNAS), the cause of pseudohypoparathyroidism type 1a, are not present in patients with acrodysostosis. We report a germ-line mutation in the gene encoding PRKAR1A, the cyclic AMP (cAMP)-dependent regulatory subunit of protein kinase A, in three unrelated patients with acrodysostosis and resistance to multiple hormones. The mutated subunit impairs the protein kinase A response to stimulation by cAMP; this explains our patients' hormone resistance and the similarities of their skeletal abnormalities with those observed in patients with pseudohypoparathyroidism type 1a.

  4. The somatic FAH C.1061C>A change counteracts the frequent FAH c.1062+5G>A mutation and permits U1snRNA-based splicing correction.

    PubMed

    Scalet, Daniela; Sacchetto, Claudia; Bernardi, Francesco; Pinotti, Mirko; van de Graaf, Stan F J; Balestra, Dario

    2018-05-01

    In tyrosinaemia type 1(HT1), a mosaic pattern of fumarylacetoacetase (FAH) immunopositive or immunonegative nodules in liver tissue has been reported in many patients. This aspect is generally explained by a spontaneous reversion of the mutation into a normal genotype. In one HT1 patient carrying the frequent FAH c.1062+5G>A mutation, a second somatic change (c.1061C>A) has been reported in the same allele, and found in immunopositive nodules. Here, we demonstrated that the c.1062+5G>A prevents usage of the exon 12 5' splice site (ss), even when forced by an engineered U1snRNA specifically designed on the FAH 5'ss to strengthen its recognition. Noticeably the new somatic c.1061C>A change, in linkage with the c.1062+5G>A mutation, partially rescues the defective 5'ss and is associated to trace level (~5%) of correct transcripts. Interestingly, this combined genetic condition strongly favored the rescue by the engineered U1snRNA, with correct transcripts reaching up to 60%. Altogether, these findings elucidate the molecular basis of HT1 caused by the frequent FAH c.1062+5G>A mutation, and demonstrate the compensatory effect of the c.1061C>A change in promoting exon definition, thus unraveling a rare mechanism leading to FAH immune-reactive mosaicism.

  5. Mitochondrial G8292A and C8794T mutations in patients with Niemann-Pick disease type C.

    PubMed

    Masserrat, Abbas; Sharifpanah, Fatemeh; Akbari, Leila; Tonekaboni, Seyed Hasan; Karimzadeh, Parvaneh; Asharafi, Mahmood Reza; Mazouei, Safoura; Sauer, Heinrich; Houshmand, Massoud

    2018-07-01

    Niemann-Pick disease type C (NP-C) is a neurovisceral lipid storage disorder. At the cellular level, the disorder is characterized by accumulation of unesterified cholesterol and glycolipids in the lysosomal/late endosomal system. NP-C is transmitted in an autosomal recessive manner and is caused by mutations in either the NPC1 (95% of families) or NPC2 gene. The estimated disease incidence is 1 in 120,000 live births, but this likely represents an underestimate, as the disease may be under-diagnosed due to its highly heterogeneous presentation. Variants of adenosine triphosphatase (ATPase) subunit 6 and ATPase subunit 8 ( ATPase6/8 ) in mitochondrial DNA (mtDNA) have been reported in different types of genetic diseases including NP-C. In the present study, the blood samples of 22 Iranian patients with NP-C and 150 healthy subjects as a control group were analyzed. The DNA of the blood samples was extracted by the salting out method and analyzed for ATPase6/8 mutations using polymerase chain reaction sequencing. Sequence variations in mitochondrial genome samples were determined via the Mitomap database. Analysis of sequencing data confirmed the existence of 11 different single nucleotide polymorphisms (SNPs) in patients with NP-C1. One of the most prevalent polymorphisms was the A8860G variant, which was observed in both affected and non-affected groups and determined to have no significant association with NP-C incidence. Amongst the 11 polymorphisms, only one was identified in the ATPase8 gene, while 9 including A8860G were observed in the ATPase6 gene. Furthermore, two SNPs, G8292A and C8792A, located in the non-coding region of mtDNA and the ATPase6 gene, respectively, exhibited significantly higher prevalence rates in NP-C1 patients compared with the control group (P<0.01). The present study suggests that there may be an association between mitochondrial ATPase6/8 mutations and the incidence of NP-C disease. In addition, the mitochondrial SNPs identified

  6. Chronic pancreatitis associated with the p.G208A variant of PRSS1 gene in a European patient.

    PubMed

    Hegyi, Eszter; Cierna, Iveta; Vavrova, Ludmila; Ilencikova, Denisa; Konecny, Michal; Kovacs, Laszlo

    2014-01-10

    The major etiologic factor of chronic pancreatitis in adults is excessive alcohol consumption, whereas among children structural anomalies, systemic and metabolic disorders, and genetic factors are prevalent. Mutations in the cationic trypsinogen gene (PRSS1) cause hereditary pancreatitis, while mutations in serine protease inhibitor Kazal type 1 (SPINK1), cystic fibrosis transmembrane conductance regulator (CFTR) and chymotrypsin C (CTRC) genes have been shown to associate with chronic pancreatitis as independent risk factors. We present a case of 13-year-old boy with idiopathic chronic pancreatitis. Given the unexplained attacks of pancreatitis since early childhood and despite the negative family history, molecular-genetic analysis of four pancreatitis susceptibility genes (PRSS1, SPINK1, CTRC and CFTR) was performed. The boy was found to carry the c.623G>C (p.G208A) mutation of the PRSS1 gene and the c.180C>T (p.G60G) mutation of the CTRC gene, both in heterozygous state. These mutations are considered as contributing risk factors for chronic pancreatitis. In children with idiopathic chronic pancreatitis genetic causes should be considered, even in absence of positive family history. To the best of our knowledge, this is the first description of a European patient with chronic pancreatitis associated with the p.G208A mutation of PRSS1 gene. This mutation was previously reported only in Asian subjects and is thought to be a unique genetic cause of pancreatitis in Asia.

  7. A novel homozygous mutation IVS6+5G>T in CYP11B1 gene in a Vietnamese patient with 11β-hydroxylase deficiency.

    PubMed

    Nguyen, Thi Phuong Mai; Nguyen, Thu Hien; Ngo, Diem Ngoc; Vu, Chi Dung; Nguyen, Thi Kim Lien; Nong, Van Hai; Nguyen, Huy Hoang

    2015-07-10

    Congenital adrenal hyperplasia (CAH) is an autosomal recessive disease which is characterized by a deficiency of one of the enzymes involved in the synthesis of cortisol from cholesterol by the adrenal cortex. CAH cases arising from impaired 11β-hydroxylase are the second most common form. Mutations in the CYP11B1 gene are the cause of 11β-hydroxylase deficiency. This study was performed on a patient with congenital adrenal hyperplasia and with premature development such as enlarged penis, muscle development, high blood pressure, and bone age equivalent of 5 years old at 2 years of chronological age. Biochemical tests for steroids confirmed the diagnosis of CAH. We used PCR and sequencing to screen for mutations in CYP11B1 gene. Results showed that the patient has a novel homozygous mutation of guanine (G) to thymine (T) in intron 6 (IVS6+5G>T). The analysis of this mutation by MaxEntScan boundary software indicated that this mutant could affect the gene splicing during transcription. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Heterozygous SSBP1 start loss mutation co-segregates with hearing loss and the m.1555A>G mtDNA variant in a large multigenerational family.

    PubMed

    Kullar, Peter J; Gomez-Duran, Aurora; Gammage, Payam A; Garone, Caterina; Minczuk, Michal; Golder, Zoe; Wilson, Janet; Montoya, Julio; Häkli, Sanna; Kärppä, Mikko; Horvath, Rita; Majamaa, Kari; Chinnery, Patrick F

    2018-01-01

    The m.1555A>G mtDNA variant causes maternally inherited deafness, but the reasons for the highly variable clinical penetrance are not known. Exome sequencing identified a heterozygous start loss mutation in SSBP1, encoding the single stranded binding protein 1 (SSBP1), segregating with hearing loss in a multi-generational family transmitting m.1555A>G, associated with mtDNA depletion and multiple deletions in skeletal muscle. The SSBP1 mutation reduced steady state SSBP1 levels leading to a perturbation of mtDNA metabolism, likely compounding the intra-mitochondrial translation defect due to m.1555A>G in a tissue-specific manner. This family demonstrates the importance of rare trans-acting genetic nuclear modifiers in the clinical expression of mtDNA disease. © The Author (2017). Published by Oxford University Press on behalf of the Guarantors of Brain.

  9. Cerebral infarction and femoral venous thrombosis detected in a patient with diabetic ketoacidosis and heterozygous factor V Leiden G1691A and PAI-1 4G/5G mutations.

    PubMed

    Yaroglu Kazanci, Selcen; Yesilbas, Osman; Ersoy, Melike; Kihtir, Hasan Serdar; Yildirim, Hamdi Murat; Sevketoglu, Esra

    2015-09-01

    Cerebral infarction is one of the serious neurological complications of diabetic ketoacidosis (DKA). Especially in patients who are genetically prone to thrombosis, cerebral infarction may develop due to inflammation, dehydration, and hyperviscocity secondary to DKA. A 6-year-old child with DKA is diagnosed with cerebral infarction after respiratory insufficiency, convulsion, and altered level of consciousness. Femoral and external iliac venous thrombosis also developed in a few hours after central femoral catheter had been inserted. Heterozygous type of factor V Leiden and PAI-14G/5G mutation were detected. In patients with DKA, cerebral infarction may be suspected other than cerebral edema when altered level of consciousness, convulsion, and respiratory insufficiency develop and once cerebral infarction occurs the patients should also be evaluated for factor V Leiden and PAI-14G/5G mutation analysis in addition to the other prothrombotic risk factors.

  10. A Novel Nonsense Mutation in Exon 5 of KIND1 Gene in an Iranian Family with Kindler Syndrome.

    PubMed

    Heidari, Mohammad Mehdi; Khatami, Mehri; Kargar, Saeed; Azari, Mojdeh; Hoseinzadeh, Hassan; Fallah, Hamedeh

    2016-06-01

    Kindler syndrome (KS) is an autosomal recessive skin disease characterized by actual blistering, photosensitivity and a progressive poikiloderma. The disorder results from rare mutations in the KIND1 gene. This gene contains 15 exons and expresses two kindlin-1 isoforms. The aim of this investigation was to analyze mutations in the exons 1 to 15 of KIND1 gene in an Iranian family clinically affected with Kindler syndrome. The mutations analysis of 15 coding exons of KIND1 gene was performed with PCR-SSCP and direct sequencing in 14 subjects from one Iranian family clinically affected with Kindler syndrome. We identified eight new nucleotide changes in KIND1 in this family. These changes were found in g.3892delA, g.3951T>C, g.3962T>G, g.4190G>T, g.7497G>A, g.11076T>C, g.11102C>T and g.13177C>T positions. Among them, the g.13177C>T mutation resulting in the formation of a premature stop codon (Q226X) was detected only in seven affected family individuals as homozygous but was not present in 100 unrelated healthy controls. This study suggests that nonsense mutation may lead to incomplete and non-functional protein products and is pathogenic and has meaningful implications for the diagnosis of patients with Kindler syndrome.

  11. Differential effects of phytotherapic preparations in the hSOD1 Drosophila melanogaster model of ALS

    PubMed Central

    De Rose, Francescaelena; Marotta, Roberto; Talani, Giuseppe; Catelani, Tiziano; Solari, Paolo; Poddighe, Simone; Borghero, Giuseppe; Marrosu, Francesco; Sanna, Enrico; Kasture, Sanjay; Acquas, Elio; Liscia, Anna

    2017-01-01

    The present study was aimed at characterizing the effects of Withania somnifera (Wse) and Mucuna pruriens (Mpe) on a Drosophila melanogaster model for Amyotrophic Lateral Sclerosis (ALS). In particular, the effects of Wse and Mpe were assessed following feeding the flies selectively overexpressing the wild human copper, zinc-superoxide dismutase (hSOD1-gain-of-function) in Drosophila motoneurons. Although ALS-hSOD1 mutants showed no impairment in life span, with respect to GAL4 controls, the results revealed impairment of climbing behaviour, muscle electrophysiological parameters (latency and amplitude of ePSPs) as well as thoracic ganglia mitochondrial functions. Interestingly, Wse treatment significantly increased lifespan of hSDO1 while Mpe had not effect. Conversely, both Wse and Mpe significantly rescued climbing impairment, and also latency and amplitude of ePSPs as well as failure responses to high frequency DLM stimulation. Finally, mitochondrial alterations were any more present in Wse- but not in Mpe-treated hSOD1 mutants. Hence, given the role of inflammation in the development of ALS, the high translational impact of the model, the known anti-inflammatory properties of these extracts, and the viability of their clinical use, these results suggest that the application of Wse and Mpe might represent a valuable pharmacological strategy to counteract the progression of ALS and related symptoms. PMID:28102336

  12. Mutation Analysis of IDH1/2 Genes in Unselected De novo Acute Myeloid Leukaemia Patients in India - Identification of A Novel IDH2 Mutation.

    PubMed

    Raveendran, Sureshkumar; Sarojam, Santhi; Vijay, Sangeetha; Geetha, Aswathy Chandran; Sreedharan, Jayadevan; Narayanan, Geetha; Sreedharan, Hariharan

    2015-01-01

    IDH1/2 mutations which result in alternation in DNA methylation pattern are one of the most common methylation associated mutations in Acute myeloid leukaemia. IDH1/2 mutations frequently associated with higher platelet level, normal cytogentics and NPM1 mutations. Here we analyzed IDH1/2 mutations in 200 newly diagnosed unselected Indian adult AML patients and investigated their correlation with clinical, cytogenetic parameters along with cooperating NPM1 mutation. We detected 5.5% and 4% mutations in IDH1/2 genes, respectively. Except IDH2 c.515_516GG>AA mutation, all the other identified mutations were reported mutations. Similar to reported c.515G>A mutation, the novel c.515_516GG>AA mutation replaces 172nd arginine to lysine in the active site of the enzyme. Even though there was a preponderance of IDH1/2 mutations in NK-AML, cytogenetically abnormal patients also harboured IDH1/2 mutations. IDH1 mutations showed significant higher platelet count and NPM1 mutations. IDH2 mutated patients displayed infrequent NPM1 mutations and lower WBC count. All the NPM1 mutations in the IDH1/2 mutated cases showed type A mutation. The present data suggest that IDH1/2 mutations are associated with normal cytogenetics and type A NPM1 mutations in adult Indian AML patients.

  13. Acute quadriplegia in a young man secondary to prothrombin G20210A mutation.

    PubMed

    Sawaya, R; Diken, Z; Mahfouz, R

    2011-08-01

    We present the case of an 18-year-old man, previously healthy, who presented with acute quadriplegia and respiratory failure. Physical examination was compatible with a high cervical anterior spinal cord lesion. We plan to evaluate the cause of such a neurological presentation in a healthy young man. American University Medical Center, Beirut, Lebanon. The patient underwent routine blood hematological and chemistry work-up, hypercoagulable profile studies, genetic profile for thrombophelias, radiographic studies of the brain and cervical cord, cerebrospinal analysis and extensive electrophyisological studies. Magnetic resonance imaging and magnetic resonance angiogram of the brain, carotid and intracranial vessels were normal. Cerebral angiography was normal. Magnetic resonance imaging of the cervical cord revealed lesion of the anterior segment of the cervical cord between C2 and C5 levels. Hypercoagulable profile studies were normal. Electrophysiological studies confirmed an isolated lesion of the descending cortico-spinal tracts. DNA analysis revealed the presence of a G20210A mutation-causing hyperprothrombinemia. We conclude that a G20210A mutation causing-hyperprothrombinemia can cause anterior spinal artery thrombosis and anterior spinal cord infarction with the resultant neurological deficits in otherwise healthy patients.

  14. Reactive oxygen species trigger motoneuron death in non-cell-autonomous models of ALS through activation of c-Abl signaling.

    PubMed

    Rojas, Fabiola; Gonzalez, David; Cortes, Nicole; Ampuero, Estibaliz; Hernández, Diego E; Fritz, Elsa; Abarzua, Sebastián; Martinez, Alexis; Elorza, Alvaro A; Alvarez, Alejandra; Court, Felipe; van Zundert, Brigitte

    2015-01-01

    Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disease in which pathogenesis and death of motor neurons are triggered by non-cell-autonomous mechanisms. We showed earlier that exposing primary rat spinal cord cultures to conditioned media derived from primary mouse astrocyte conditioned media (ACM) that express human SOD1(G93A) (ACM-hSOD1(G93A)) quickly enhances Nav channel-mediated excitability and calcium influx, generates intracellular reactive oxygen species (ROS), and leads to death of motoneurons within days. Here we examined the role of mitochondrial structure and physiology and of the activation of c-Abl, a tyrosine kinase that induces apoptosis. We show that ACM-hSOD1(G93A), but not ACM-hSOD1(WT), increases c-Abl activity in motoneurons, interneurons and glial cells, starting at 60 min; the c-Abl inhibitor STI571 (imatinib) prevents this ACM-hSOD1(G93A)-mediated motoneuron death. Interestingly, similar results were obtained with ACM derived from astrocytes expressing SOD1(G86R) or TDP43(A315T). We further find that co-application of ACM-SOD1(G93A) with blockers of Nav channels (spermidine, mexiletine, or riluzole) or anti-oxidants (Trolox, esculetin, or tiron) effectively prevent c-Abl activation and motoneuron death. In addition, ACM-SOD1(G93A) induces alterations in the morphology of neuronal mitochondria that are related with their membrane depolarization. Finally, we find that blocking the opening of the mitochondrial permeability transition pore with cyclosporine A, or inhibiting mitochondrial calcium uptake with Ru360, reduces ROS production and c-Abl activation. Together, our data point to a sequence of events in which a toxic factor(s) released by ALS-expressing astrocytes rapidly induces hyper-excitability, which in turn increases calcium influx and affects mitochondrial structure and physiology. ROS production, mediated at least in part through mitochondrial alterations, trigger c-Abl signaling and lead to motoneuron death.

  15. Reactive oxygen species trigger motoneuron death in non-cell-autonomous models of ALS through activation of c-Abl signaling

    PubMed Central

    Rojas, Fabiola; Gonzalez, David; Cortes, Nicole; Ampuero, Estibaliz; Hernández, Diego E.; Fritz, Elsa; Abarzua, Sebastián; Martinez, Alexis; Elorza, Alvaro A.; Alvarez, Alejandra; Court, Felipe; van Zundert, Brigitte

    2015-01-01

    Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disease in which pathogenesis and death of motor neurons are triggered by non-cell-autonomous mechanisms. We showed earlier that exposing primary rat spinal cord cultures to conditioned media derived from primary mouse astrocyte conditioned media (ACM) that express human SOD1G93A (ACM-hSOD1G93A) quickly enhances Nav channel-mediated excitability and calcium influx, generates intracellular reactive oxygen species (ROS), and leads to death of motoneurons within days. Here we examined the role of mitochondrial structure and physiology and of the activation of c-Abl, a tyrosine kinase that induces apoptosis. We show that ACM-hSOD1G93A, but not ACM-hSOD1WT, increases c-Abl activity in motoneurons, interneurons and glial cells, starting at 60 min; the c-Abl inhibitor STI571 (imatinib) prevents this ACM-hSOD1G93A-mediated motoneuron death. Interestingly, similar results were obtained with ACM derived from astrocytes expressing SOD1G86R or TDP43A315T. We further find that co-application of ACM-SOD1G93A with blockers of Nav channels (spermidine, mexiletine, or riluzole) or anti-oxidants (Trolox, esculetin, or tiron) effectively prevent c-Abl activation and motoneuron death. In addition, ACM-SOD1G93A induces alterations in the morphology of neuronal mitochondria that are related with their membrane depolarization. Finally, we find that blocking the opening of the mitochondrial permeability transition pore with cyclosporine A, or inhibiting mitochondrial calcium uptake with Ru360, reduces ROS production and c-Abl activation. Together, our data point to a sequence of events in which a toxic factor(s) released by ALS-expressing astrocytes rapidly induces hyper-excitability, which in turn increases calcium influx and affects mitochondrial structure and physiology. ROS production, mediated at least in part through mitochondrial alterations, trigger c-Abl signaling and lead to motoneuron death. PMID:26106294

  16. Leigh disease presenting in utero due to a novel missense mutation in the mitochondrial DNA-ND3.

    PubMed

    Leshinsky-Silver, Esther; Lev, Dorit; Malinger, Gustavo; Shapira, Daniel; Cohen, Sarit; Lerman-Sagie, Tally; Saada, Ann

    2010-05-01

    Leigh syndrome can be caused by defects in both nuclear and mitochondrial genes involved in energy metabolism. Recently, an increasing number of mutations in mitochondrial DNA encoding regions, especially in NADH dehydrogenase (respiratory chain complex I) subunits, have been reported as causative of early onset Leigh syndrome. We describe a patient whose fetal brain ultrasound demonstrated periventricular pseudocyst suggestive of a possible mitochondrial disorder who presented postnatally with Leigh syndrome. A muscle biopsy demonstrated a partial decrease in complex I and pyruvate dehydrogenase (PDH-E1 alpha) activity. Sequencing of the PDH-E1 alpha gene did not reveal any mutation. Sequencing of the mtDNA revealed a novel heteroplasmic G10254A (D66N) mutation in the ND3 gene. This change results in a substitution of aspartic acid to asparagine in a highly conserved domain of the ND3 subunit. The mutation could not be detected in the mother's blood or urine sediment. Blue native gel electrophoresis of muscle mitochondria revealed a normal size, albeit a decreased level of complex I. The G10254A substitution in the mtDNA-ND3 gene is another cause of maternally inherited Leigh syndrome. This case demonstrates that periventricular pseudocysts may be the initial in utero presentation in patients with mitochondrial disorders. We emphasize the importance of screening the mtDNA in pediatric patients as the first step in molecular diagnosis of Leigh syndrome. (c) 2010 Elsevier Inc. All rights reserved.

  17. Canine degenerative myelopathy: biochemical characterization of superoxide dismutase 1 in the first naturally occurring non-human amyotrophic lateral sclerosis model.

    PubMed

    Crisp, Matthew J; Beckett, Jeffrey; Coates, Joan R; Miller, Timothy M

    2013-10-01

    Mutations in canine superoxide dismutase 1 (SOD1) have recently been shown to cause canine degenerative myelopathy, a disabling neurodegenerative disorder affecting specific breeds of dogs characterized by progressive motor neuron loss and paralysis until death, or more common, euthanasia. This discovery makes canine degenerative myelopathy the first and only naturally occurring non-human model of amyotrophic lateral sclerosis (ALS), closely paralleling the clinical, pathological, and genetic presentation of its human counterpart, SOD1-mediated familial ALS. To further understand the biochemical role that canine SOD1 plays in this disease and how it may be similar to human SOD1, we characterized the only two SOD1 mutations described in affected dogs to date, E40K and T18S. We show that a detergent-insoluble species of mutant SOD1 is present in spinal cords of affected dogs that increases with disease progression. Our in vitro results indicate that both canine SOD1 mutants form enzymatically active dimers, arguing against a loss of function in affected homozygous animals. Further studies show that these mutants, like most human SOD1 mutants, have an increased propensity to form aggregates in cell culture, with 10-20% of cells possessing visible aggregates. Creation of the E40K mutation in human SOD1 recapitulates the normal enzymatic activity but not the aggregation propensity seen with the canine mutant. Our findings lend strong biochemical support to the toxic role of SOD1 in canine degenerative myelopathy and establish close parallels for the role mutant SOD1 plays in both canine and human disorders. Copyright © 2013 Elsevier Inc. All rights reserved.

  18. Detection of KatG/inhA Mutation to Guide Isoniazid and Ethionamide Use for Drug-resistant Tuberculosis

    PubMed Central

    Namburete, Evangelina

    2017-01-01

    Abstract Background Both Mozambique and Brazil are countries with a high burden of tuberculosis. Isoniazid (INH) is one of the cornerstones of tuberculosis treatment and, depending on the mutated gene (katG or inhA), the organism may be susceptible to high doses of INH (inhA mutation) or to ethionamide (-Eth-KatG mutation). Methods To analyze isoniazid genotypic resistance profile in Mycobacterium tuberculosis to guide decision making about management of resistant tuberculosis. Descriptive study of 311 M. tuberculosis isolated from Ribeirão Preto, Brazil (2011–2014) and 155 isolates from Beira, Mozambique (2014–2015). Drug resistance patterns and the specific genes mutations were determined using Genotype MTBDRplus (Hain Lifescience GmbH, Germany). Results Mutations in katG gene were detected in 13/22 (59%) of Brazilian and in 32/38 (84.2%) of Mozambican isolates. Unique inhA mutations were observed in 8/22 (36%) isolates in Brazil and 4/38 (10.5%) in Mozambique. Both katG and inhA mutations where detected in 1/22 (5%) and 2/38(5.2%), respectively. katG mutations were more frequent among INH previously treated patients. Conclusion There is a geographical variation of INH mutations and the new molecular tests can be used to guide and accelerate decision making towards the use of ETH or high doses of INH based on detected mutations. Disclosures All authors: No reported disclosures.

  19. Novel mutations in RAG1/2 and ADA genes in Israeli patients presenting with T-B-SCID or Omenn syndrome.

    PubMed

    Dalal, Ilan; Tasher, Diana; Somech, Raz; Etzioni, Amos; Garti, Ben-Zion; Lev, Dorit; Cohen, Sarit; Somekh, Eli; Leshinsky-Silver, Esther

    2011-09-01

    The relative frequency of the different forms of SCID may vary in different countries. The most frequent form in Israel is the autosomal-recessive T-B- SCID or Omenn syndrome while X-linked SCID is rare. We report our immunological and genetic analyses in multicentre study of patients presenting with either T-B- SCID or Omenn syndrome. Among 16 patients, we identified 7 novel mutations in 6 patients. In the RAG1 gene we detected two novel mutations: L454Q and 469 fs-4bpdel. In the RAG 2 gene: 3 novel mutations: D65Y, G157V, and E480X. One T-B- SCID patient was found to be a compound heterozygote for new mutations in the ADA gene: W264X and R235W. Prenatal diagnosis was performed in 8 families while others refused due to religious reasons. Identification of the new mutations expands our knowledge regarding the unique features of SCID phenotype in Israel and may help the families seeking for genetic counseling. Copyright © 2011 Elsevier Inc. All rights reserved.

  20. Colorectal Carcinomas With CpG Island Methylator Phenotype 1 Frequently Contain Mutations in Chromatin Regulators

    PubMed Central

    Tahara, Tomomitsu; Yamamoto, Eiichiro; Madireddi, Priyanka; Suzuki, Hiromu; Maruyama, Reo; Chung, Woonbok; Garriga, Judith; Jelinek, Jaroslav; Yamano, Hiro-o; Sugai, Tamotsu; Kondo, Yutaka; Toyota, Minoru; Issa, Jean-Pierre J.; Estécio, Marcos R. H.

    2014-01-01

    BACKGROUND & AIMS Subgroups of colorectal carcinomas (CRCs) characterized by DNA methylation anomalies are termed CpG island methylator phenotype (CIMP)1, CIMP2, or CIMP-negative. The pathogenesis of CIMP1 colorectal carcinomas, and their effects on patients’ prognoses and responses to treatment, differ from those of other CRCs. We sought to identify genetic somatic alterations associated with CIMP1 CRCs. METHODS We examined genomic DNA samples from 100 primary CRCs, 10 adenomas, and adjacent normal-appearing mucosae from patients undergoing surgery or colonoscopy at 3 tertiary medical centers. We performed exome sequencing of 16 colorectal tumors and their adjacent normal tissues. Extensive comparison with known somatic alterations in CRCs allowed segregation of CIMP1-exclusive alterations. The prevalence of mutations in selected genes was determined from an independent cohort. RESULTS We found that genes that regulate chromatin were mutated in CIMP1 CRCs; the highest rates of mutation were observed in CHD7 and CHD8, which encode members of the chromodomain helicase/adenosine triphosphate—dependent chromatin remodeling family. Somaticmutations in these 2 genes were detected in 5 of 9 CIMP1 CRCs. A prevalence screen showed that nonsilencing mutations in CHD7 and CHD8 occurred significantly more frequently in CIMP1 tumors (18 of 42 [43%]) than in CIMP2 (3 of 34 [9%]; P < .01) or CIMP-negative tumors (2 of 34 [6%]; P < .001). CIMP1 markers had increased binding by CHD7, compared with all genes. Genes altered in patients with CHARGE syndrome (congenital malformations involving the central nervous system, eye, ear, nose, and mediastinal organs) who had CHD7 mutations were also altered in CRCs with mutations in CHD7. CONCLUSIONS Aberrations in chromatin remodeling could contribute to the development of CIMP1 CRCs. A better understanding of the biological determinants of CRCs can be achieved when these tumors are categorized according to their epigenetic status. PMID

  1. Intermittent Hypoxia and Stem Cell Implants Preserve Breathing Capacity in a Rodent Model of Amyotrophic Lateral Sclerosis

    PubMed Central

    Nichols, Nicole L.; Gowing, Genevieve; Satriotomo, Irawan; Nashold, Lisa J.; Dale, Erica A.; Suzuki, Masatoshi; Avalos, Pablo; Mulcrone, Patrick L.; McHugh, Jacalyn

    2013-01-01

    Rationale: Amyotrophic lateral sclerosis (ALS) is a devastating motor neuron disease causing paralysis and death from respiratory failure. Strategies to preserve and/or restore respiratory function are critical for successful treatment. Although breathing capacity is maintained until late in disease progression in rodent models of familial ALS (SOD1G93A rats and mice), reduced numbers of phrenic motor neurons and decreased phrenic nerve activity are observed. Decreased phrenic motor output suggests imminent respiratory failure. Objectives: To preserve or restore phrenic nerve activity in SOD1G93A rats at disease end stage. Methods: SOD1G93A rats were injected with human neural progenitor cells (hNPCs) bracketing the phrenic motor nucleus before disease onset, or exposed to acute intermittent hypoxia (AIH) at disease end stage. Measurements and Main Results: The capacity to generate phrenic motor output in anesthetized rats at disease end stage was: (1) transiently restored by a single presentation of AIH; and (2) preserved ipsilateral to hNPC transplants made before disease onset. hNPC transplants improved ipsilateral phrenic motor neuron survival. Conclusions: AIH-induced respiratory plasticity and stem cell therapy have complementary translational potential to treat breathing deficits in patients with ALS. PMID:23220913

  2. A Mitochondrial DNA A8701G Mutation Associated with Maternally Inherited Hypertension and Dilated Cardiomyopathy in a Chinese Pedigree of a Consanguineous Marriage

    PubMed Central

    Zhu, Ye; Gu, Xiang; Xu, Chao

    2016-01-01

    Background: Cardiovascular diseases, including dilated cardiomyopathy (DCM) and hypertension, are the leading cause of death worldwide. The role of mitochondrial DNA (mtDNA) in the pathogenesis of these diseases has not been completely clarified. In this study, we evaluate whether A8701G mutation is associated with maternally inherited hypertension and DCM in a Chinese pedigree of a consanguineous marriage. Methods: Fourteen subjects in a three-generation Han Chinese family with hypertension and DCM, in which consanguineous marriage was present in the parental generation, were interviewed. We divided all the family members into case (7 maternal members) and control group (7 nonmaternal members) for comparison. Clinical evaluations and sequence analysis of mtDNA were obtained from all participants. Frequency differences between maternal and nonmaternal members were tested to locate the disease-associated mutations. Results: The majority of the family members presented with a maternal inheritance of hypertension and DCM. Sequence analysis of mtDNA in this pedigree identified eight mtDNA mutations. Among the mutations identified, there was only one significant mutation: A8701G (P = 0.005), which is a homoplasmic mitochondrial missense mutation in all the matrilineal relatives. There was no clear evidence for any synergistic effects between A8701G and other mutations. Conclusions: A8701G mutation may act as an inherited risk factor for the matrilineal transmission of hypertension and DCM in conjunction with genetic disorders caused by consanguineous marriage. PMID:26831225

  3. [Identification of an ideal noninvasive method to detect A3243G gene mutation in MELAS syndrome].

    PubMed

    Ma, Yi-nan; Fang, Fang; Yang, Yan-ling; Zhang, Ying; Wang, Song-tao; Xu, Yu-feng; Pei, Pei; Yuan, Yun; Bu, Ding-fang; Qi, Yu

    2008-12-16

    To identify a better non-invasive method to detect the carrier of mitochondrial A3243G mutation, a cause of mitochondrial encephalopathy-lactic acidosis-stroke like episode (MELAS) syndrome. DNA was extracted from the peripheral blood, urine, hair follicle, and saliva of 25 MELAS syndrome patients carrying A3243G mutation and their mothers and other maternal relatives, 33 persons in number, and the muscle tissues from 5 patients obtained by biopsy. A3243G mutation was detected by PCR-RFLP method, and the A3243G mutation ratio was identified by measuring the density of each band and calculation with the software AlphaEase 5.0. A3243G mutations were detected in all tissues of the 25 MELAS patients. The A3243G mutation ratio in urine was 62% +/- 9%, significantly higher than that in the blood [(36% +/- 10%), t = -11.13, P < 0.01]. A3243G mutations were detected in at least one tissue of the 28 maternal relatives. The A3243G mutation rates in their urine samples was 33.0% (5.0% - 70.4%), significantly higher than that in their blood samples [8.0% (0 - 33.3%), z = -4.197, P < 0.01]. There was no significant difference in A3243G mutation ratio among the samples of hair follicle, saliva, and blood. The A3243G mutation ratio in urine is significantly higher than those in blood samples of the patients and their maternal relatives. A noninvasive method, A3243G mutation ratio analysis of urine is superior to that in blood.

  4. Patient derived mutation W257G of PPP2R1A enhances cancer cell migration through SRC-JNK-c-Jun pathway

    PubMed Central

    Jeong, Ae Lee; Han, Sora; Lee, Sunyi; Su Park, Jeong; Lu, Yiling; Yu, Shuangxing; Li, Jane; Chun, Kyung-Hee; Mills, Gordon B.; Yang, Young

    2016-01-01

    Mutation of PPP2R1A has been observed at high frequency in endometrial serous carcinomas but at low frequency in ovarian clear cell carcinoma. However, the biological role of mutation of PPP2R1A in ovarian and endometrial cancer progression remains unclear. In this study, we found that PPP2R1A expression is elevated in high-grade primary tumor patients with papillary serous tumors of the ovary. To determine whether increased levels or mutation of PPP2R1A might contribute to cancer progression, the effects of overexpression or mutation of PPP2R1A on cell proliferation, migration, and PP2A phosphatase activity were investigated using ovarian and endometrial cancer cell lines. Among the mutations, PPP2R1A-W257G enhanced cell migration in vitro through activating SRC-JNK-c-Jun pathway. Overexpression of wild type (WT) PPP2R1A increased its binding ability with B56 regulatory subunits, whereas PPP2R1A-mutations lost the ability to bind to most B56 subunits except B56δ. Total PP2A activity and PPP2R1A-associated PP2Ac activity were significantly increased in cells overexpressing PPP2R1A-WT. In addition, overexpression of PPP2R1A-WT increased cell proliferation in vitro and tumor growth in vivo. PMID:27272709

  5. Effect of the G375C and G346E achondroplasia mutations on FGFR3 activation.

    PubMed

    He, Lijuan; Serrano, Christopher; Niphadkar, Nitish; Shobnam, Nadia; Hristova, Kalina

    2012-01-01

    Two mutations in FGFR3, G380R and G375C are known to cause achondroplasia, the most common form of human dwarfism. The G380R mutation accounts for 98% of the achondroplasia cases, and thus has been studied extensively. Here we study the effect of the G375C mutation on the phosphorylation and the cross-linking propensity of full-length FGFR3 in HEK 293 cells, and we compare the results to previously published results for the G380R mutant. We observe identical behavior of the two achondroplasia mutants in these experiments, a finding which supports a direct link between the severity of dwarfism phenotypes and the level and mechanism of FGFR3 over-activation. The mutations do not increase the cross-linking propensity of FGFR3, contrary to previous expectations that the achondroplasia mutations stabilize the FGFR3 dimers. Instead, the phosphorylation efficiency within un-liganded FGFR3 dimers is increased, and this increase is likely the underlying cause for pathogenesis in achondroplasia. We further investigate the G346E mutation, which has been reported to cause achondroplasia in one case. We find that this mutation does not increase FGFR3 phosphorylation and decreases FGFR3 cross-linking propensity, a finding which raises questions whether this mutation is indeed a genetic cause for human dwarfism.

  6. Effect of the G375C and G346E Achondroplasia Mutations on FGFR3 Activation

    PubMed Central

    He, Lijuan; Serrano, Christopher; Niphadkar, Nitish; Shobnam, Nadia; Hristova, Kalina

    2012-01-01

    Two mutations in FGFR3, G380R and G375C are known to cause achondroplasia, the most common form of human dwarfism. The G380R mutation accounts for 98% of the achondroplasia cases, and thus has been studied extensively. Here we study the effect of the G375C mutation on the phosphorylation and the cross-linking propensity of full-length FGFR3 in HEK 293 cells, and we compare the results to previously published results for the G380R mutant. We observe identical behavior of the two achondroplasia mutants in these experiments, a finding which supports a direct link between the severity of dwarfism phenotypes and the level and mechanism of FGFR3 over-activation. The mutations do not increase the cross-linking propensity of FGFR3, contrary to previous expectations that the achondroplasia mutations stabilize the FGFR3 dimers. Instead, the phosphorylation efficiency within un-liganded FGFR3 dimers is increased, and this increase is likely the underlying cause for pathogenesis in achondroplasia. We further investigate the G346E mutation, which has been reported to cause achondroplasia in one case. We find that this mutation does not increase FGFR3 phosphorylation and decreases FGFR3 cross-linking propensity, a finding which raises questions whether this mutation is indeed a genetic cause for human dwarfism. PMID:22529939

  7. [Leigh syndrome resulting from a de novo mitochondrial DNA mutation (T8993G)].

    PubMed

    Playán, A; Solano-Palacios, A; González de la Rosa, J B; Merino-Arribas, J M; Andreu, A L; López-Pérez, M; Montoya, J

    Several degenerative neurological diseases are caused by mutations in the mitochondrial gene coding for subunit 6 of the ATPase. Thus, NARP (neurogenic weakness, ataxia, and retinitis pigmentosa) and Leigh syndromes are associated to a T8993G mutation when the percentage of mutant mitochondrial DNA is low (60 90%) or high (>90%), respectively. Leigh syndrome is also caused by a second mutation in the same position T8993C. The patient, a boy that died at 6 months, had generalized hypotonia, psychomotor delay, hepatomegaly, choreic movements and hyporreflexia. MRI showed hypodensities in the basal ganglia and brain stem as well as hyperlactacidemia. Molecular genetic analysis of the mitochondrial DNA showed that the patient had the T8993G mutation in a percentage higher than 95%. No mutated DNA was detected in blood of the proband s mother, maternal aunt and grandmother. The point mutation T8993G may occur de novo, at high levels, causing neurodegenerative diseases.

  8. Phenotypic Heterogeneity in a DFNA20/26 family segregating a novel ACTG1 mutation.

    PubMed

    Yuan, Yongyi; Gao, Xue; Huang, Bangqing; Lu, Jingqiao; Wang, Guojian; Lin, Xi; Qu, Yan; Dai, Pu

    2016-02-01

    Genetic factors play an important role in hearing loss, contributing to approximately 60% of cases of congenital hearing loss. Autosomal dominant deafness accounts for approximately 20% of cases of hereditary hearing loss. Diseases with autosomal dominant inheritance often show pleiotropy, different degrees of penetrance, and variable expressivity. A three-generation Chinese family with autosomal dominant nonsyndromic hearing impairment (ADNSHI) was enrolled in this study. Audiometric data and blood samples were collected from the family. In total, 129 known human deafness genes were sequenced using next-generation sequencing (NGS) to identify the responsible gene mutation in the family. Whole Exome Sequencing (WES) was performed to exclude any other variant that cosegregated with the phenotype. The age of onset of the affected family members was the second decade of life. The condition began with high-frequency hearing impairment in all family members excluding III:2. The novel ACTG1 c.638A > G (p.K213R) mutation was found in all affected family members and was not found in the unaffected family members. A heterozygous c.638A > G mutation in ACTG1 and homozygous c.109G > A (p.V37I) mutation in GJB2 were found in III:2, who was born with hearing loss. The WES result concurred with that of targeted sequencing of known deafness genes. The novel mutation p.K213R in ACTG1 was found to be co-segregated with hearing loss and the genetic cause of ADNSHI in this family. A homozygous mutation associated with recessive inheritance only rarely co-acts with a dominant mutation to result in hearing loss in a dominant family. In such cases, the mutations in the two genes, as in ACTG1 and GJB2 in the present study, may result in a more severe phenotype. Targeted sequencing of known deafness genes is one of the best choices to identify the genetic cause in hereditary hearing loss families.

  9. eGFP expression under the Uchl1 promoter labels corticospinal motor neurons and a subpopulation of degeneration resistant spinal motor neurons in ALS mouse models

    NASA Astrophysics Data System (ADS)

    Yasvoina, Marina V.

    Current understanding of basic cellular and molecular mechanisms for motor neuron vulnerability during motor neuron disease initiation and progression is incomplete. The complex cytoarchitecture and cellular heterogeneity of the cortex and spinal cord greatly impedes our ability to visualize, isolate, and study specific neuron populations in both healthy and diseased states. We generated a novel reporter line, the Uchl1-eGFP mouse, in which cortical and spinal components of motor neuron circuitry are genetically labeled with eGFP under the Uchl1 promoter. A series of cellular and anatomical analyses combined with retrograde labeling, molecular marker expression, and electrophysiology were employed to determine identity of eGFP expressing cells in the motor cortex and the spinal cord of novel Uchl1-eGFP reporter mice. We conclude that eGFP is expressed in corticospinal motor neurons (CSMN) in the motor cortex and a subset of S-type alpha and gamma spinal motor neurons (SMN) in the spinal cord. hSOD1G93A and Alsin-/- mice, mouse models for amyotrophic lateral sclerosis (ALS), were bred to Uchl1-eGFP reporter mouse line to investigate the pathophysiology and underlying mechanisms of CSMN degeneration in vivo. Evidence suggests early and progressive degeneration of CSMN and SMN in the hSOD1G93A transgenic mice. We show an early increase of autophagosome formation in the apical dendrites of vulnerable CSMN in hSOD1G93A-UeGFP mice, which is localized to the apical dendrites. In addition, labeling S-type alpha and gamma SMN in the hSOD1G93A-UeGFP mice provide a unique opportunity to study basis of their resistance to degeneration. Mice lacking alsin show moderate clinical phenotype and mild CSMN axon degeneration in the spinal cord, which suggests vulnerability of CSMN. Therefore, we investigated the CSMN cellular and axon defects in aged Alsin-/- mice bred to Uchl1-eGFP reporter mouse line. We show that while CSMN are preserved and lack signs of degeneration, CSMN axons

  10. Identification of new mutations in primary hyperoxaluria type 1 (PH1).

    PubMed

    von Schnakenburg, C; Rumsby, G

    1998-01-01

    Primary hyperoxaluria type 1 (PH1) is caused by deficiency of the hepatic peroxisomal enzyme alanine:glyoxylate aminotransferase (AGT). The AGXT gene, which codes for the 392 amino acid protein, has been mapped to chromosome 2q37.3. In order to identify new mutations in the AGXT gene we studied 79 PH1 patients using single strand conformation polymorphism analysis. In addition to a cluster of new mutations in exon 7 we report five novel mutations in exons 2, 4, 5, 9 and 10. These are T444C, G640A, G690A, 1008-1010delGCG and G1171A. These five new mutations contribute to our knowledge of the AGXT gene. Their possible consequences for PH1 phenotype and enzyme activity are discussed.

  11. Novel mutations in the USH1C gene in Usher syndrome patients.

    PubMed

    Aparisi, María José; García-García, Gema; Jaijo, Teresa; Rodrigo, Regina; Graziano, Claudio; Seri, Marco; Simsek, Tulay; Simsek, Enver; Bernal, Sara; Baiget, Montserrat; Pérez-Garrigues, Herminio; Aller, Elena; Millán, José María

    2010-12-31

    Usher syndrome type I (USH1) is an autosomal recessive disorder characterized by severe-profound sensorineural hearing loss, retinitis pigmentosa, and vestibular areflexia. To date, five USH1 genes have been identified. One of these genes is Usher syndrome 1C (USH1C), which encodes a protein, harmonin, containing PDZ domains. The aim of the present work was the mutation screening of the USH1C gene in a cohort of 33 Usher syndrome patients, to identify the genetic cause of the disease and to determine the relative involvement of this gene in USH1 pathogenesis in the Spanish population. Thirty-three patients were screened for mutations in the USH1C gene by direct sequencing. Some had already been screened for mutations in the other known USH1 genes (myosin VIIA [MYO7A], cadherin-related 23 [CDH23], protocadherin-related 15 [PCDH15], and Usher syndrome 1G [USH1G]), but no mutation was found. Two novel mutations were found in the USH1C gene: a non-sense mutation (p.C224X) and a frame-shift mutation (p.D124TfsX7). These mutations were found in a homozygous state in two unrelated USH1 patients. In the present study, we detected two novel pathogenic mutations in the USH1C gene. Our results suggest that mutations in USH1C are responsible for 1.5% of USH1 disease in patients of Spanish origin (considering the total cohort of 65 Spanish USH1 patients since 2005), indicating that USH1C is a rare form of USH in this population.

  12. Novel mutations in the USH1C gene in Usher syndrome patients

    PubMed Central

    Aparisi, María José; García-García, Gema; Jaijo, Teresa; Rodrigo, Regina; Graziano, Claudio; Seri, Marco; Simsek, Tulay; Simsek, Enver; Bernal, Sara; Baiget, Montserrat; Pérez-Garrigues, Herminio; Millán, José María

    2010-01-01

    Purpose Usher syndrome type I (USH1) is an autosomal recessive disorder characterized by severe-profound sensorineural hearing loss, retinitis pigmentosa, and vestibular areflexia. To date, five USH1 genes have been identified. One of these genes is Usher syndrome 1C (USH1C), which encodes a protein, harmonin, containing PDZ domains. The aim of the present work was the mutation screening of the USH1C gene in a cohort of 33 Usher syndrome patients, to identify the genetic cause of the disease and to determine the relative involvement of this gene in USH1 pathogenesis in the Spanish population. Methods Thirty-three patients were screened for mutations in the USH1C gene by direct sequencing. Some had already been screened for mutations in the other known USH1 genes (myosin VIIA [MYO7A], cadherin-related 23 [CDH23], protocadherin-related 15 [PCDH15], and Usher syndrome 1G [USH1G]), but no mutation was found. Results Two novel mutations were found in the USH1C gene: a non-sense mutation (p.C224X) and a frame-shift mutation (p.D124TfsX7). These mutations were found in a homozygous state in two unrelated USH1 patients. Conclusions In the present study, we detected two novel pathogenic mutations in the USH1C gene. Our results suggest that mutations in USH1C are responsible for 1.5% of USH1 disease in patients of Spanish origin (considering the total cohort of 65 Spanish USH1 patients since 2005), indicating that USH1C is a rare form of USH in this population. PMID:21203349

  13. A new mutation in the calcium-sensing receptor gene causing hypocalcaemia: case report of a father and two sons.

    PubMed

    Schoutteten, M K; Bravenboer, B; Seneca, S; Stouffs, K; Velkeniers, B

    2017-07-01

    Regulation of calcium is mediated by parathyroid hormone (PTH) and 1.25-dihydroxyvitamine D3. The calcium-sensing receptor (CaSR) regulates PTH release by a negative feedback system. Gain-of-function mutations in the CaSR gene reset the calcium-PTH axis, leading to hypocalcaemia. We analysed a family with hypocalcaemia. The proband was a 47-year-old man (index, patient I1), who presented with paraesthesias in both limbs. He has two sons (patient II1 a nd I I2). The probands' lab results showed: serum calcium of 1.95 mmol/l, albumin 41 g/l, phosphate 0.81 mmol/l and PTH 6.6 ng/l (normal 15-65 ng/l). Based on this analysis, we suspected a hereditary form of hypocalcaemia and performed genetic testing by polymerase chain reaction and Sanger sequencing of the coding regions and intron boundaries of the CaSR gene. Genetic analysis revealed a new heterozygous mutation: c.2195A>G, p.(Asn732Ser) in exon 7. The lab results of patient II1 showed: serum calcium of 1.93 mmol/l, phosphate 1.31 mmol/l, albumin 41 g/l, and PTH 24.3 ng/l. His genotype revealed the same activating mutation and, like his father, he also lost his scalp hair at an early adolescent age. Patient II2 is asymptomatic, and has neither biochemical abnormalities, nor the familial CaSR gene mutation. He still has all his scalp hair. 1) The c.2195A>G, p.(Asn732Ser) mutation in exon 7 of the CaSR gene leads to hypocalcaemia, and has not been reported before in the medical literature. 2) Possibly, this mutation is linked to premature baldness.

  14. G6PDdb, an integrated database of glucose-6-phosphate dehydrogenase (G6PD) mutations.

    PubMed

    Kwok, Colin J; Martin, Andrew C R; Au, Shannon W N; Lam, Veronica M S

    2002-03-01

    G6PDdb (http://www.rubic.rdg.ac.uk/g6pd/ or http://www.bioinf.org.uk/g6pd/) is a newly created web-accessible locus-specific mutation database for the human Glucose-6-phosphate dehydrogenase (G6PD) gene. The relational database integrates up-to-date mutational and structural data from various databanks (GenBank, Protein Data Bank, etc.) with biochemically characterized variants and their associated phenotypes obtained from published literature and the Favism website. An automated analysis of the mutations likely to have a significant impact on the structure of the protein has been performed using a recently developed procedure. The database may be queried online and the full results of the analysis of the structural impact of mutations are available. The web page provides a form for submitting additional mutation data and is linked to resources such as the Favism website, OMIM, HGMD, HGVBASE, and the PDB. This database provides insights into the molecular aspects and clinical significance of G6PD deficiency for researchers and clinicians and the web page functions as a knowledge base relevant to the understanding of G6PD deficiency and its management. Copyright 2002 Wiley-Liss, Inc.

  15. Clinical and mutational spectra of 23 Chinese patients with glutaric aciduria type 1.

    PubMed

    Wang, Qiao; Li, Xiyuan; Ding, Yuan; Liu, Yupeng; Song, Jinqing; Yang, Yanling

    2014-10-01

    Glutaric aciduria type 1 (GA1) is a rare neurometabolic disorder caused by glutaryl-CoA dehydrogenase deficiency due to GCDH gene mutations. In this study, the clinical presentation and molecular aspects of 23 Chinese patients (11 males and 12 females) were investigated. All patients were diagnosed by elevated urinary glutaric acid and GCDH gene analysis. Protein-restricted diet supplemented with special formula, l-carnitine and GABA analog were initialed after diagnosis. The clinical and biochemical features were analyzed. Mutational analysis of GCDH was conducted. Clinical manifestations of 23 patients varied from asymptomatic to severe encephalopathy, with notable phenotypic differences between siblings with the same mutations. One case was detected by newborn screening, while 22 Cases were diagnosed between the ages of 5 months and 51 years. 29 mutations in GCDH were identified. Among them, 11 were novel, including seven missense mutations (c.406G > T, C.416C > G, c.442G > A, c.640A > G, c.901G > A, c.979G > A, and c.1207C > T), three frameshift mutations (c.873delC, c.1172-1173insT and c.1282-1285ins71) and one nonsense mutation (c.411C > G). In exon 5, c.553G > A and c.148T > C were found in four alleles (8.7%) and three alleles (6.5%) of the patients, respectively. In 23 Chinese patients with GA1, 11 novel GCDH mutations were identified. This may indicate that the genetic profiles of Chinese patients are different from those of other populations. 23 Chinese GA1 patients with varied clinical manifestations have been reported. 11 novel mutations in their GCDH gene were identified, indicating that the genetic profiles of Chinese GA1 patients differ from those of other populations. Copyright © 2013 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

  16. Mutant Copper-Zinc Superoxide Dismutase (SOD1) Induces Protein Secretion Pathway Alterations and Exosome Release in Astrocytes

    PubMed Central

    Basso, Manuela; Pozzi, Silvia; Tortarolo, Massimo; Fiordaliso, Fabio; Bisighini, Cinzia; Pasetto, Laura; Spaltro, Gabriella; Lidonnici, Dario; Gensano, Francesco; Battaglia, Elisa; Bendotti, Caterina; Bonetto, Valentina

    2013-01-01

    Amyotrophic lateral sclerosis is the most common motor neuron disease and is still incurable. The mechanisms leading to the selective motor neuron vulnerability are still not known. The interplay between motor neurons and astrocytes is crucial in the outcome of the disease. We show that mutant copper-zinc superoxide dismutase (SOD1) overexpression in primary astrocyte cultures is associated with decreased levels of proteins involved in secretory pathways. This is linked to a general reduction of total secreted proteins, except for specific enrichment in a number of proteins in the media, such as mutant SOD1 and valosin-containing protein (VCP)/p97. Because there was also an increase in exosome release, we can deduce that astrocytes expressing mutant SOD1 activate unconventional secretory pathways, possibly as a protective mechanism. This may help limit the formation of intracellular aggregates and overcome mutant SOD1 toxicity. We also found that astrocyte-derived exosomes efficiently transfer mutant SOD1 to spinal neurons and induce selective motor neuron death. We conclude that the expression of mutant SOD1 has a substantial impact on astrocyte protein secretion pathways, contributing to motor neuron pathology and disease spread. PMID:23592792

  17. A girl with West syndrome and autistic features harboring a de novo TBL1XR1 mutation.

    PubMed

    Saitsu, Hirotomo; Tohyama, Jun; Walsh, Tom; Kato, Mitsuhiro; Kobayashi, Yu; Lee, Ming; Tsurusaki, Yoshinori; Miyake, Noriko; Goto, Yu-Ichi; Nishino, Ichizo; Ohtake, Akira; King, Mary-Claire; Matsumoto, Naomichi

    2014-10-01

    Recently, de novo mutations in TBL1XR1 were found in two patients with autism spectrum disorders. Here, we report on a Japanese girl presenting with West syndrome, Rett syndrome-like and autistic features. Her initial development was normal until she developed a series of spasms at 5 months of age. Electroencephalogram at 7 months showed a pattern of hypsarrhythmia, which led to a diagnosis of West syndrome. Stereotypic hand movements appeared at 8 months of age, and autistic features such as deficits in communication, hyperactivity and excitability were observed later, at 4 years and 9 months. Whole exome sequencing of the patient and her parents revealed a de novo TBL1XR1 mutation [c.209 G>A (p.Gly70Asp)] occurring at an evolutionarily conserved amino acid in an F-box-like domain. Our report expands the clinical spectrum of TBL1XR1 mutations to West syndrome with Rett-like features, together with autistic features.

  18. Two novel mutations in the SLC40A1 and HFE genes implicated in iron overload in a Spanish man.

    PubMed

    Del-Castillo-Rueda, Alejandro; Moreno-Carralero, María-Isabel; Alvarez-Sala-Walther, Luis-Antonio; Cuadrado-Grande, Nuria; Enríquez-de-Salamanca, Rafael; Méndez, Manuel; Morán-Jiménez, María-Josefa

    2011-03-01

    The most common form of hemochromatosis is caused by mutations in the HFE gene. Rare forms of the disease are caused by mutations in other genes. We present a patient with hyperferritinemia and iron overload, and facial flushing. Magnetic resonance imaging was performed to measure hepatic iron overload, and a molecular study of the genes involved in iron metabolism was undertaken. The iron overload was similar to that observed in HFE hemochromatosis, and the patient was double heterozygous for two novel mutations, c.-20G>A and c.718A>G (p.K240E), in the HFE and ferroportin (FPN1 or SLC40A1) genes, respectively. Hyperferritinemia and facial flushing improved after phlebotomy. Two of the patient's children were also studied, and the daughter was heterozygous for the mutation in the SLC40A1 gene, although she did not have hyperferritinemia. The patient presented a mild iron overload phenotype probably because of the two novel mutations in the HFE and SLC40A1 genes. © 2011 John Wiley & Sons A/S.

  19. A multiplex method for detection of glucose-6-phosphate dehydrogenase (G6PD) gene mutations.

    PubMed

    Zhang, L; Yang, Y; Liu, R; Li, Q; Yang, F; Ma, L; Liu, H; Chen, X; Yang, Z; Cui, L; He, Y

    2015-12-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common human enzyme defect caused by G6PD gene mutations. This study aimed to develop a cost-effective, multiplex, genotyping method for detecting common mutations in the G6PD gene. We used a SNaPshot approach to genotype multiple G6PD mutations that are common to human populations in South-East Asia. This assay is based on multiplex PCR coupled with primer extension reactions. Different G6PD gene mutations were determined by peak retention time and colors of the primer extension products. We designed PCR primers for multiplex amplification of the G6PD gene fragments and for primer extension reactions to genotype 11 G6PD mutations. DNA samples from a total of 120 unrelated G6PD-deficient individuals from the China-Myanmar border area were used to establish and validate this method. Direct sequencing of the PCR products demonstrated 100% concordance between the SNaPshot and the sequencing results. The SNaPshot method offers a specific and sensitive alternative for simultaneously interrogating multiple G6PD mutations. © 2015 John Wiley & Sons Ltd.

  20. Questions regarding the predictive value of one evolved complex adaptive system for a second: exemplified by the SOD1 mouse.

    PubMed

    Greek, Ray; Hansen, Lawrence A

    2013-11-01

    We surveyed the scientific literature regarding amyotrophic lateral sclerosis, the SOD1 mouse model, complex adaptive systems, evolution, drug development, animal models, and philosophy of science in an attempt to analyze the SOD1 mouse model of amyotrophic lateral sclerosis in the context of evolved complex adaptive systems. Humans and animals are examples of evolved complex adaptive systems. It is difficult to predict the outcome from perturbations to such systems because of the characteristics of complex systems. Modeling even one complex adaptive system in order to predict outcomes from perturbations is difficult. Predicting outcomes to one evolved complex adaptive system based on outcomes from a second, especially when the perturbation occurs at higher levels of organization, is even more problematic. Using animal models to predict human outcomes to perturbations such as disease and drugs should have a very low predictive value. We present empirical evidence confirming this and suggest a theory to explain this phenomenon. We analyze the SOD1 mouse model of amyotrophic lateral sclerosis in order to illustrate this position. Copyright © 2013 The Authors. Published by Elsevier Ltd.. All rights reserved.

  1. Reactive oxygen species on bone mineral density and mechanics in Cu,Zn superoxide dismutase (Sod1) knockout mice

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Smietana, Michael J.; Arruda, Ellen M.; Mechanical Engineering, University of Michigan, 2250 GG Brown, 2350 Hayward, Ann Arbor, MI 48109

    Research highlights: {yields} Reactive oxygen species (ROS) are considered to be a factor in the onset of a number of age-associated conditions, including loss of BMD. {yields} Cu,Zn-superoxide dismutase (Sod1) deficient mice have increased ROS, reduced bone mineral density, decreased bending stiffness, and decreased strength compared to WT controls. {yields} Increased ROS caused by the deficiency of Sod1, may be responsible for the changes in BMD and bone mechanics and therefore represent an appropriate model for studying mechanisms of age-associated bone loss. -- Abstract: Reactive oxygen species (ROS) play a role in a number of degenerative conditions including osteoporosis. Micemore » deficient in Cu,Zn-superoxide dismutase (Sod1) (Sod1{sup -/-} mice) have elevated oxidative stress and decreased muscle mass and strength compared to wild-type mice (WT) and appear to have an accelerated muscular aging phenotype. Thus, Sod1{sup -/-} mice may be a good model for evaluating the effects of free radical generation on diseases associated with aging. In this experiment, we tested the hypothesis that the structural integrity of bone as measured by bending stiffness (EI; N/mm{sup 2}) and strength (MPa) is diminished in Sod1{sup -/-} compared to WT mice. Femurs were obtained from male and female WT and Sod1{sup -/-} mice at 8 months of age and three-point bending tests were used to determine bending stiffness and strength. Bones were also analyzed for bone mineral density (BMD; mg/cc) using micro-computed tomography. Femurs were approximately equal in length across all groups, and there were no significant differences in BMD or EI with respect to gender in either genotype. Although male and female mice demonstrated similar properties within each genotype, Sod1{sup -/-} mice exhibited lower BMD and EI of femurs from both males and females compared with gender matched WT mice. Strength of femurs was also lower in Sod1{sup -/-} mice compared to WT as well as between genders

  2. G protein-coupled receptor mutations and human genetic disease.

    PubMed

    Thompson, Miles D; Hendy, Geoffrey N; Percy, Maire E; Bichet, Daniel G; Cole, David E C

    2014-01-01

    Genetic variations in G protein-coupled receptor genes (GPCRs) disrupt GPCR function in a wide variety of human genetic diseases. In vitro strategies and animal models have been used to identify the molecular pathologies underlying naturally occurring GPCR mutations. Inactive, overactive, or constitutively active receptors have been identified that result in pathology. These receptor variants may alter ligand binding, G protein coupling, receptor desensitization and receptor recycling. Receptor systems discussed include rhodopsin, thyrotropin, parathyroid hormone, melanocortin, follicle-stimulating hormone (FSH), luteinizing hormone, gonadotropin-releasing hormone (GNRHR), adrenocorticotropic hormone, vasopressin, endothelin-β, purinergic, and the G protein associated with asthma (GPRA or neuropeptide S receptor 1 (NPSR1)). The role of activating and inactivating calcium-sensing receptor (CaSR) mutations is discussed in detail with respect to familial hypocalciuric hypercalcemia (FHH) and autosomal dominant hypocalemia (ADH). The CASR mutations have been associated with epilepsy. Diseases caused by the genetic disruption of GPCR functions are discussed in the context of their potential to be selectively targeted by drugs that rescue altered receptors. Examples of drugs developed as a result of targeting GPCRs mutated in disease include: calcimimetics and calcilytics, therapeutics targeting melanocortin receptors in obesity, interventions that alter GNRHR loss from the cell surface in idiopathic hypogonadotropic hypogonadism and novel drugs that might rescue the P2RY12 receptor congenital bleeding phenotype. De-orphanization projects have identified novel disease-associated receptors, such as NPSR1 and GPR35. The identification of variants in these receptors provides genetic reagents useful in drug screens. Discussion of the variety of GPCRs that are disrupted in monogenic Mendelian disorders provides the basis for examining the significance of common

  3. Sonic Hedgehog mutations are not a common cause of congenital hypopituitarism in the absence of complex midline cerebral defects.

    PubMed

    Paulo, Sabrina Soares; Fernandes-Rosa, Fábio L; Turatti, Wendy; Coeli-Lacchini, Fernanda Borchers; Martinelli, Carlos E; Nakiri, Guilherme S; Moreira, Ayrton C; Santos, Antônio C; de Castro, Margaret; Antonini, Sonir R

    2015-04-01

    Sonic Hedgehog (SHH) and GLI2, an obligatory mediator of SHH signal transduction, are holoprosencephaly (HPE)-associated genes essential in pituitary formation. GLI2 variants have been found in patients with congenital hypopituitarism without complex midline cerebral defects (MCD). However, data on the occurrence of SHH mutations in these patients are limited. We screened for SHH and GLI2 mutations or copy number variations (CNV) in patients with congenital hypopituitarism without MCD or with variable degrees of MCD. Detailed data on clinical, laboratory and neuroimaging findings of 115 patients presenting with congenital hypopituitarism without MCD, septo-optic dysplasia or HPE were analysed. The SHH and GLI2 genes were directly sequenced, and the presence of gene CNV was analysed by multiplex ligation-dependent probe amplification (MLPA). Anterior pituitary deficiency was found in 74% and 53% of patients with SOD or HPE, respectively. Diabetes insipidus was common in patients with HPE (47%) but infrequent in patients with congenital hypopituitarism or SOD (7% and 8%, respectively). A single heterozygous nonsense SHH mutation (p.Tyr175Ter) was found in a patient presenting with hypopituitarism and alobar HPE. No other SHH mutations or CNV were found. Nine GLI2 variations (8 missense and 1 frameshift) including a homozygous and a compound heterozygous variation were found in patients with congenital hypopituitarism or SOD, but not in HPE patients. No GLI2 CNV were found. SHH mutations or copy number variations are not a common cause of congenital hypopituitarism in patients without complex midline cerebral defects. GLI2 variants are found in some patients with congenital hypopituitarism without complex midline cerebral defects or septo-optic dysplasia. However, functional analyses of these variants are needed to strengthen genotype-phenotype relationship. © 2014 John Wiley & Sons Ltd.

  4. MELAS syndrome, cardiomyopathy, rhabdomyolysis, and autism associated with the A3260G mitochondrial DNA mutation.

    PubMed

    Connolly, Barbara S; Feigenbaum, Annette S J; Robinson, Brian H; Dipchand, Anne I; Simon, David K; Tarnopolsky, Mark A

    2010-11-12

    The A to G transition mutation at position 3260 of the mitochondrial genome is usually associated with cardiomyopathy and myopathy. One Japanese kindred reported the phenotype of mitochondrial encephalomyopathy, lactic acidosis and stroke-like episodes (MELAS syndrome) in association with the A3260G mtDNA mutation. We describe the first Caucasian cases of MELAS syndrome associated with the A3260G mutation. Furthermore, this mutation was associated with exercise-induced rhabdomyolysis, hearing loss, seizures, cardiomyopathy, and autism in the large kindred. We conclude that the A3260G mtDNA mutation is associated with wide phenotypic heterogeneity with MELAS and other "classical" mitochondrial phenotypes being manifestations. Copyright © 2010 Elsevier Inc. All rights reserved.

  5. Mutation analysis of GM1 gangliosidosis in a Siamese cat from Japan in the 1960s.

    PubMed

    Uddin, Mohammad M; Tanimoto, Takeshi; Yabuki, Akira; Kotani, Takao; Kuwamura, Mitsuru; Chang, Hye-Sook; Yamato, Osamu

    2012-12-01

    GM1 gangliosidosis is a fatal, progressive neurodegenerative lysosomal storage disease caused by mutations of the β-galactosidase (GLB1) gene. In feline GM1 gangliosidosis, a pathogenic mutation (c.1448G>C) of the feline GLB1 gene was identified in Siamese and Korat cats previously diagnosed with the disease in the USA and Italy, respectively. The present study demonstrated the same mutation in a Siamese cat that had been diagnosed with GM1 gangliosidosis in Japan in the 1960s. The mutation was confirmed using DNA extracted from stored paraffin-embedded brain tissue by a direct sequencing method and a polymerase chain reaction-restriction fragment length polymorphism assay. This pathogenic mutation seems to have been distributed around the world.

  6. Distinct clinical and neuropathological features of G51D SNCA mutation cases compared with SNCA duplication and H50Q mutation.

    PubMed

    Kiely, Aoife P; Ling, Helen; Asi, Yasmine T; Kara, Eleanna; Proukakis, Christos; Schapira, Anthony H; Morris, Huw R; Roberts, Helen C; Lubbe, Steven; Limousin, Patricia; Lewis, Patrick A; Lees, Andrew J; Quinn, Niall; Hardy, John; Love, Seth; Revesz, Tamas; Houlden, Henry; Holton, Janice L

    2015-08-27

    We and others have described the neurodegenerative disorder caused by G51D SNCA mutation which shares characteristics of Parkinson's disease (PD) and multiple system atrophy (MSA). The objective of this investigation was to extend the description of the clinical and neuropathological hallmarks of G51D mutant SNCA-associated disease by the study of two additional cases from a further G51D SNCA kindred and to compare the features of this group with a SNCA duplication case and a H50Q SNCA mutation case. All three G51D patients were clinically characterised by parkinsonism, dementia, visual hallucinations, autonomic dysfunction and pyramidal signs with variable age at disease onset and levodopa response. The H50Q SNCA mutation case had a clinical picture that mimicked late-onset idiopathic PD with a good and sustained levodopa response. The SNCA duplication case presented with a clinical phenotype of frontotemporal dementia with marked behavioural changes, pyramidal signs, postural hypotension and transiently levodopa responsive parkinsonism. Detailed post-mortem neuropathological analysis was performed in all cases. All three G51D cases had abundant α-synuclein pathology with characteristics of both PD and MSA. These included widespread cortical and subcortical neuronal α-synuclein inclusions together with small numbers of inclusions resembling glial cytoplasmic inclusions (GCIs) in oligodendrocytes. In contrast the H50Q and SNCA duplication cases, had α-synuclein pathology resembling idiopathic PD without GCIs. Phosphorylated α-synuclein was present in all inclusions types in G51D cases but was more restricted in SNCA duplication and H50Q mutation. Inclusions were also immunoreactive for the 5G4 antibody indicating their highly aggregated and likely fibrillar state. Our characterisation of the clinical and neuropathological features of the present small series of G51D SNCA mutation cases should aid the recognition of this clinico-pathological entity. The

  7. Leber's hereditary optic neuropathy is associated with the mitochondrial ND4 G11696A mutation in five Chinese families

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhou Xiangtian; Wei Qiping; Yang Li

    2006-02-03

    We report here the clinical, genetic, and molecular characterization of five Chinese families with Leber's hereditary optic neuropathy (LHON). Clinical and genetic evaluations revealed the variable severity and age-of-onset in visual impairment in these families. Strikingly, there were extremely low penetrances of visual impairment in these Chinese families. Sequence analysis of the complete mitochondrial genomes in these pedigrees showed the distinct sets of mtDNA polymorphism, in addition to the identical ND4 G11696A mutation associated with LHON. Indeed, this mutation is present in homoplasmy only in the maternal lineage of those pedigrees but not other members of these families. In fact,more » the occurrence of the G11696A mutation in these several genetically unrelated subjects affected by visual impairment strongly indicates that this mutation is involved in the pathogenesis of visual impairment. Furthermore, the N405D in the ND5 and G5820A in the tRNA{sup Cys}, showing high evolutional conservation, may contribute to the phenotypic expression of G11696A mutation in the WZ10 pedigree. However, there was the absence of functionally significant mtDNA mutations in other four Chinese pedigrees carrying the G11696A mutation. Therefore, nuclear modifier gene(s) or environmental factor(s) may play a role in the phenotypic expression of the LHON-associated G11696A mutation in these Chinese pedigrees.« less

  8. Metastatic melanoma cells with BRAF G469A mutation: nab-paclitaxel better than vemurafenib?

    PubMed

    Porcelli, Letizia; Guida, Gabriella; Tommasi, Stefania; Guida, Michele; Azzariti, Amalia

    2015-08-01

    BRAF G469A is a missense mutation within exon 11 of the BRAF gene resulting in a constitutively activated enzyme frequently associated with MAP kinase cascade signaling activation. No evidence currently exists about its role in determining sensitivity/resistance to BRAF inhibitors, utilized in the treatment of patients carrying BRAF V600 mutations, and to chemotherapy. The newly established metastatic melanoma (MM) cell line MO-1 was characterized for its sensitivity to vemurafenib and nab-paclitaxel, both already utilized for the treatment of MM. All analyses were carried out by comparing results with those found in MM cells wild type for BRAF or mutated in V600. In addition, cellular effectors were investigated by ELISA kits, western blotting and flow cytometry. The exposure to vemurafenib inhibited MO-1 cell proliferation at concentrations similar to those obtained in vemurafenib-resistant melanoma models, and an explanation of this sensitivity is the strong activation of Erk1/2 and the low expression of MITF. Nab-paclitaxel strongly reduced proliferation of MO-1 cells perhaps for the very low expression level of PMEL17, transcriptionally regulated by MITF and negatively involved in determining sensitivity to taxanes. Thus, the mutation BRAF G469A in MM might be related to a weak effectiveness of therapy with BRAF inhibitors and a promising therapeutic approach may be with nab-paclitaxel.

  9. The mitochondrial 13513G>A mutation is associated with Leigh disease phenotypes independent of complex I deficiency in muscle.

    PubMed

    Brautbar, Ariel; Wang, Jing; Abdenur, Jose E; Chang, Richard C; Thomas, Janet A; Grebe, Theresa A; Lim, Cynthia; Weng, Shao-Wen; Graham, Brett H; Wong, Lee-Jun

    2008-08-01

    The mitochondrial 13513G>A (D393N) mutation in the ND5 subunit of the respiratory chain complex I was initially described in association with MELAS syndrome. Recent observations have linked this mutation to Leigh disease. We screened for the 13513G>A mutation in a cohort of 265 patients with Leigh and Leigh-like disease. The mutation was found in a total of 5 patients. An additional patient who had clinical presentation consistent with a Leigh-like phenotype but with a normal brain MRI was added to the cohort. None of an additional 88 patients meeting MELAS disease criteria, nor 56 patients with respiratory chain deficiency screened for the 13513G>A were found positive for the mutation. The most frequent clinical manifestations in our patients were hypotonia, ocular and cerebellar involvement. Low mutation heteroplasmy in the range of 20-40% was observed in all 6 patients. This observation is consistent with the previously reported low heteroplasmy of this mutation in some patients with the 13513G>A mutation and complex I deficiency. However, normal complex I activity was observed in two patients in our cohort. As most patients with Leigh-like disease and the 13513G>A mutation have been described with complex I deficiency, this report adds to the previously reported subset of patients with normal respiratory complex function. We conclude that in any patient with Leigh or Leigh-like disease, testing for the 13513G>A mutation is clinically relevant and low mutant loads in blood or muscle may be considered pathogenic, in the presence of normal respiratory chain enzyme activities.

  10. Coexistence of CLCN1 and SCN4A mutations in one family suffering from myotonia.

    PubMed

    Maggi, Lorenzo; Ravaglia, Sabrina; Farinato, Alessandro; Brugnoni, Raffaella; Altamura, Concetta; Imbrici, Paola; Camerino, Diana Conte; Padovani, Alessandro; Mantegazza, Renato; Bernasconi, Pia; Desaphy, Jean-François; Filosto, Massimiliano

    2017-12-01

    Non-dystrophic myotonias are characterized by clinical overlap making it challenging to establish genotype-phenotype correlations. We report clinical and electrophysiological findings in a girl and her father concomitantly harbouring single heterozygous mutations in SCN4A and CLCN1 genes. Functional characterization of N1297S hNav1.4 mutant was performed by patch clamp. The patients displayed a mild phenotype, mostly resembling a sodium channel myotonia. The CLCN1 c.501C>G (p.F167L) mutation has been already described in recessive pedigrees, whereas the SCN4A c.3890A>G (p.N1297S) variation is novel. Patch clamp experiments showed impairment of fast and slow inactivation of the mutated Nav1.4 sodium channel. The present findings suggest that analysis of both SCN4A and CLCN1 genes should be considered in myotonic patients with atypical clinical and neurophysiological features.

  11. Evaluation of Factor V G1691A, prothrombin G20210A, Factor XIII V34L, MTHFR A1298C, MTHFR C677T and PAI-1 4G/5G genotype frequencies of patients subjected to cardiovascular disease (CVD) panel in south-east region of Turkey.

    PubMed

    Oztuzcu, Serdar; Ergun, Sercan; Ulaşlı, Mustafa; Nacarkahya, Gülper; Iğci, Yusuf Ziya; Iğci, Mehri; Bayraktar, Recep; Tamer, Ali; Çakmak, Ecir Ali; Arslan, Ahmet

    2014-06-01

    Cardiovascular disease (CVD) risk factors, such as arterial hypertension, obesity, dyslipidemia or diabetes mellitus, as well as CVDs, including myocardial infarction, coronary artery disease or stroke, are the most prevalent diseases and account for the major causes of death worldwide. In the present study, 4,709 unrelated patients subjected to CVD panel in south-east part of Turkey between the years 2010 and 2013 were enrolled and DNA was isolated from the blood samples of these patients. Mutation analyses were conducted using the real-time polymerase chain reaction method to screen six common mutations (Factor V G1691A, PT G20210A, Factor XIII V34L, MTHFR A1298C and C677T and PAI-1 -675 4G/5G) found in CVD panel. The prevalence of these mutations were 0.57, 0.25, 2.61, 13.78, 9.34 and 24.27 % in homozygous form, respectively. Similarly, the mutation percent of them in heterozygous form were 7.43, 3.44, 24.91, 44.94, 41.09 and 45.66%, respectively. No mutation was detected in 92 (1.95%) patients in total. Because of the fact that this is the first study to screen six common mutations in CVD panel in south-east region of Turkey, it has a considerable value on the diagnosis and treatment of these diseases. Upon the results of the present and previous studied a careful examination for these genetic variants should be carried out in thrombophilia screening programs, particularly in Turkish population.

  12. Uncoupling of Protein Aggregation and Neurodegeneration in a Mouse Amyotrophic Lateral Sclerosis Model.

    PubMed

    Lee, Joo-Yong; Kawaguchi, Yoshiharu; Li, Ming; Kapur, Meghan; Choi, Su Jin; Kim, Hak-June; Park, Song-Yi; Zhu, Haining; Yao, Tso-Pang

    2015-01-01

    Aberrant accumulation of protein aggregates is a pathological hallmark of many neurodegenerative diseases, including amyotrophic lateral sclerosis (ALS). Although a buildup of protein aggregates frequently leads to cell death, whether it is the key pathogenic factor in driving neurodegenerative disease remains controversial. HDAC6, a cytosolic ubiquitin-binding deacetylase, has emerged as an important regulator of ubiquitin-dependent quality control autophagy, a lysosome-dependent degradative system responsible for the disposal of misfolded protein aggregates and damaged organelles. Here, we show that in cell models HDAC6 plays a protective role against multiple disease-associated and aggregation-prone cytosolic proteins by facilitating their degradation. We further show that HDAC6 is required for efficient localization of lysosomes to protein aggregates, indicating that lysosome targeting to autophagic substrates is regulated. Supporting a critical role of HDAC6 in protein aggregate disposal in vivo, genetic ablation of HDAC6 in a transgenic SOD1G93A mouse, a model of ALS, leads to dramatic accumulation of ubiquitinated SOD1G93A protein aggregates. Surprisingly, despite a robust buildup of SOD1G93A aggregates, deletion of HDAC6 only moderately modified the motor phenotypes. These findings indicate that SOD1G93A aggregation is not the only determining factor to drive neurodegeneration in ALS, and that HDAC6 likely modulates neurodegeneration through additional mechanisms beyond protein aggregate clearance. © 2015 S. Karger AG, Basel.

  13. Four novel RS1 gene mutations in Polish patients with X-linked juvenile retinoschisis.

    PubMed

    Skorczyk, Anna; Krawczyński, Maciej R

    2012-01-01

    To determine the clinical features and to identify mutations in the retinoschisis gene (RS1) in ten patients with X-linked retinoschisis (XLRS). Ten male patients from nine Polish families were included in this study. Ophthalmologic examinations, including optical coherence tomography (OCT) and full-field electroretinography (ERG), were performed in all affected boys. The entire coding region encompassing six exons of the RS1 gene was amplified with PCR and directly sequenced in all the patients. All affected individuals showed typical retinoschisis signs and symptoms, and all appeared to have a mutation in the RS1 gene. Seven different mutations were identified, including two novel missense substitutions: c.176G>C (p.Cys59Ser), c.451T>A (p.Tyr151Asp); one novel nonsense substitution: c.218C>A (p.Ser73*); and one novel frameshift mutation: c.354_355delCA (p.Asp118Glufs*2). We also found two missense substitutions that had been previously described: c.214G>A (p.Glu72Lys) and c.626G>T (p.Arg209Leu) and one known splice site mutation in intron 5: c.522+1G>T (IVS5+1G>T). This study provides the first molecular genetic characteristics of patients with juvenile retinoschisis from the previously unexplored Polish population. We investigated the molecular background of XLRS in ten boys. The present study reports for the first time four novel mutations, including two missense substitutions, one nonsense substitution, and one frameshift deletion. One of these substitutions and 2-bp deletion created stop codons. Moreover, we described three substitutions that had been previously reported (one is a splicing mutation). Further genetic characterization of Polish patients with XLRS will be helpful in understanding the worldwide spectrum of RS1 mutations. Despite the mutation heterogeneity found in a small group of our patients, they presented a relatively uniform clinical picture. Identifying the causative mutation is helpful in confirming diagnosis and counseling, but cannot

  14. Four novel RS1 gene mutations in Polish patients with X-linked juvenile retinoschisis

    PubMed Central

    Skorczyk, Anna

    2012-01-01

    Purpose To determine the clinical features and to identify mutations in the retinoschisis gene (RS1) in ten patients with X-linked retinoschisis (XLRS). Methods Ten male patients from nine Polish families were included in this study. Ophthalmologic examinations, including optical coherence tomography (OCT) and full-field electroretinography (ERG), were performed in all affected boys. The entire coding region encompassing six exons of the RS1 gene was amplified with PCR and directly sequenced in all the patients. Results All affected individuals showed typical retinoschisis signs and symptoms, and all appeared to have a mutation in the RS1 gene. Seven different mutations were identified, including two novel missense substitutions: c.176G>C (p.Cys59Ser), c.451T>A (p.Tyr151Asp); one novel nonsense substitution: c.218C>A (p.Ser73*); and one novel frameshift mutation: c.354_355delCA (p.Asp118Glufs*2). We also found two missense substitutions that had been previously described: c.214G>A (p.Glu72Lys) and c.626G>T (p.Arg209Leu) and one known splice site mutation in intron 5: c.522+1G>T (IVS5+1G>T). Conclusions This study provides the first molecular genetic characteristics of patients with juvenile retinoschisis from the previously unexplored Polish population. We investigated the molecular background of XLRS in ten boys. The present study reports for the first time four novel mutations, including two missense substitutions, one nonsense substitution, and one frameshift deletion. One of these substitutions and 2-bp deletion created stop codons. Moreover, we described three substitutions that had been previously reported (one is a splicing mutation). Further genetic characterization of Polish patients with XLRS will be helpful in understanding the worldwide spectrum of RS1 mutations. Despite the mutation heterogeneity found in a small group of our patients, they presented a relatively uniform clinical picture. Identifying the causative mutation is helpful in confirming

  15. The mitochondrial ND1 m.3337G>A mutation associated to multiple mitochondrial DNA deletions in a patient with Wolfram syndrome and cardiomyopathy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mezghani, Najla; Mnif, Mouna; Mkaouar-Rebai, Emna, E-mail: emna_mkaouar@mail2world.com

    Highlights: {yields} We reported a patient with Wolfram syndrome and dilated cardiomyopathy. {yields} We detected the ND1 mitochondrial m.3337G>A mutation in 3 tested tissues (blood leukocytes, buccal mucosa and skeletal muscle). {yields} Long-range PCR amplification revealed the presence of multiple mitochondrial deletions in the skeletal muscle. {yields} The deletions remove several tRNA and protein-coding genes. -- Abstract: Wolfram syndrome (WFS) is a rare hereditary disorder also known as DIDMOAD (diabetes insipidus, diabetes mellitus, optic atrophy, and deafness). It is a heterogeneous disease and full characterization of all clinical and biological features of this disorder is difficult. The wide spectrum ofmore » clinical expression, affecting several organs and tissues, and the similarity in phenotype between patients with Wolfram syndrome and those with certain types of respiratory chain diseases suggests mitochondrial DNA (mtDNA) involvement in Wolfram syndrome patients. We report a Tunisian patient with clinical features of moderate Wolfram syndrome including diabetes, dilated cardiomyopathy and neurological complications. The results showed the presence of the mitochondrial ND1 m.3337G>A mutation in almost homoplasmic form in 3 tested tissues of the proband (blood leukocytes, buccal mucosa and skeletal muscle). In addition, the long-range PCR amplifications revealed the presence of multiple deletions of the mitochondrial DNA extracted from the patient's skeletal muscle removing several tRNA and protein-coding genes. Our study reported a Tunisian patient with clinical features of moderate Wolfram syndrome associated with cardiomyopathy, in whom we detected the ND1 m.3337G>A mutation with mitochondrial multiple deletions.« less

  16. A novel mutation in the TG gene (G2322S) causing congenital hypothyroidism in a Sudanese family: a case report.

    PubMed

    Watanabe, Y; Sharwood, E; Goodwin, B; Creech, M K; Hassan, H Y; Netea, M G; Jaeger, M; Dumitrescu, A; Refetoff, S; Huynh, T; Weiss, R E

    2018-05-02

    Congenital hypothyroidism (CH) has an incidence of approximately 1:3000, but only 15% have mutations in the thyroid hormone synthesis pathways. Genetic analysis allows for the precise diagnosis. A 3-week old girl presented with a large goiter, serum TSH > 100 mIU/L (reference range: 0.7-5.9 mIU/L); free T 4  < 3.2 pmol/L (reference range: 8.7-16 pmol/L); thyroglobulin (TG) 101 μg/L. Thyroid Tc-99 m scan showed increased radiotracer uptake. One brother had CH and both affected siblings have been clinically and biochemically euthyroid on levothyroxine replacement. Another sibling had normal thyroid function. Both Sudanese parents reported non-consanguinity. Peripheral blood DNA from the proposita was subjected to whole exome sequencing (WES). WES identified a novel homozygous missense mutation of the TG gene: c.7021G > A, p.Gly2322Ser, which was subsequently confirmed by Sanger sequencing and present in one allele of both parents. DNA samples from 354 alleles in four Sudanese ethnic groups (Nilotes, Darfurians, Nuba, and Halfawien) failed to demonstrate the presence of the mutant allele. Haplotyping showed a 1.71 centiMorgans stretch of homozygosity in the TG locus suggesting that this mutation occurred identical by descent and the possibility of common ancestry of the parents. The mutation is located in the cholinesterase-like (ChEL) domain of TG. A novel rare missense mutation in the TG gene was identified. The ChEL domain is critical for protein folding and patients with CH due to misfolded TG may present without low serum TG despite the TG gene mutations.

  17. Coinheritance of a novel mutation on the HBA1 gene: c.187delG (p.W62fsX66) [codon 62 (-G) (α1)] with the α212 patchwork allele and Hb S [β6(A3)Glu→Val, GAG>GTG; HBB: c.20A>T].

    PubMed

    Scheps, Karen G; De Paula, Silvia M; Bitsman, Alicia R; Freigeiro, Daniel H; Basack, F Nora; Pennesi, Sandra P; Varela, Viviana

    2013-01-01

    We describe a novel frameshift mutation on the HBA1 gene (c.187delG), causative of α-thalassemia (α-thal) in a Black Cuban family with multiple sequence variants in the HBA genes and the Hb S [β6(A3)Glu→Val, GAG>GTG; HBB: c.20A>T] mutation. The deletion of the first base of codon 62 resulted in a frameshift at amino acid 62 with a putative premature termination codon (PTC) at amino acid 66 on the same exon (p.W62fsX66), which most likely triggers nonsense mediated decay of the resulting mRNA. This study also presents the first report of the α212 patchwork allele in Latin America and the description of two new sequence variants in the HBA2 region (c.-614G>A in the promoter region and c.95+39 C>T on the first intron).

  18. Biallelic PMS2 Mutation and Heterozygous DICER1 Mutation Presenting as Constitutional Mismatch Repair Deficiency With Corpus Callosum Agenesis: Case Report and Review of Literature.

    PubMed

    Cheyuo, Cletus; Radwan, Walid; Ahn, Janice; Gyure, Kymberly; Qaiser, Rabia; Tomboc, Patrick

    2017-10-01

    Constitutional mismatch repair deficiency syndrome is a cancer predisposition syndrome caused by autosomal recessive biallelic (homozygous) germline mutations in the mismatch repair genes (MLH1, MSH2, MSH6, and PMS2). The clinical spectrum includes neoplastic and non-neoplastic manifestations. We present the case of a 7-year-old boy who presented with T-lymphoblastic lymphoma and glioblastoma, together with non-neoplastic manifestations including corpus callosum agenesis, arachnoid cyst, developmental venous anomaly, and hydrocephalus. Gene mutation analysis revealed pathogenic biallelic mutations of PMS2 and heterozygous DICER1 variant predicted to be pathogenic. This report is the first to allude to a possible interaction of the mismatch repair system with DICER1 to cause corpus callosum agenesis.

  19. [Recurrent vascular access trombosis associated with the prothrombin mutation G20210A in a adult patient in haemodialysis].

    PubMed

    Quintana, L F; Coll, E; Monteagudo, I; Collado, S; López-Pedret, J; Cases, A

    2005-01-01

    Vascular access-related complications are a frequent cause of morbidity in haemodialysis patients and generate high costs. We present the case of an adult patient with end-stage renal disease and recurrent vascular access thrombosis associated with the prothrombin mutation G20210A and renal graft intolerance. The clinical expression of this heterozygous gene mutation may have been favoured by inflammatory state, frequent in dialysis patients. In this patient, the inflammatory response associated with the renal graft intolerance would have favored the development of recurrent vascular access thrombosis in a adult heterozygous for prothrombin mutation G20210A. In the case of early dysfunction of haemodialysis vascular access and after ruling out technical problems, it is convenient to carry out a screening for thrombophilia.

  20. Additive Neuroprotective Effects of the Multifunctional Iron Chelator M30 with Enriched Diet in a Mouse Model of Amyotrophic Lateral Sclerosis.

    PubMed

    Golko-Perez, Sagit; Mandel, Silvia; Amit, Tamar; Kupershmidt, Lana; Youdim, Moussa B H; Weinreb, Orly

    2016-02-01

    Amyotrophic lateral sclerosis (ALS) is the most common degenerative disease of the motoneuron system, involving various abnormalities, such as mitochondrial dysfunction, oxidative stress, transitional metal accumulation, neuroinflammation, glutamate excitotoxicity, apoptosis, decreased supply of trophic factors, cytoskeletal abnormalities, and extracellular superoxide dismutase (SOD)-1 toxicity. These multiple disease etiologies implicated in ALS gave rise to the perception that future therapeutic approaches for the disease should be aimed at targeting multiple pathological pathways. In line with this view, we have evaluated in the current study the therapeutic effects of low doses of the novel multifunctional monoamine oxidase (MAO) inhibitor/iron-chelating compound, M30 in combination with high Calorie Energy supplemented Diet (CED) in the SOD1-G93A transgenic mouse model of ALS. Our results demonstrated that the combined administration of M30 with CED produced additive neuroprotective effects on motor performance and increased survival of SOD1-G93A mice. We also found that both M30 and M30/CED regimens caused a significant inhibition of MAO-A and -B activities and decreased the turnover of dopamine in the brain of SOD1-G93A mice. In addition, M30/CED combined treatment resulted in a significant increase in mRNA expression levels of various mitochondrial biogenesis and metabolism regulators, such as peroxisome proliferator-activated receptor-γ (PPARγ)-co activator 1 alpha (PGC-1α), PPARγ, uncoupling protein 1, and insulin receptor in the gastrocnemius muscle of SOD1-G93A mice. These results suggest that a combination of drug/agents with different, but complementary mechanisms may be beneficial in the treatment of ALS.

  1. EGFR G796D mutation mediates resistance to osimertinib.

    PubMed

    Zheng, Di; Hu, Min; Bai, Yu; Zhu, Xuehua; Lu, Xuesong; Wu, Chunyan; Wang, Jiying; Liu, Li; Wang, Zheng; Ni, Jian; Yang, Zhenfan; Xu, Jianfang

    2017-07-25

    Osimertinib is an effective third-generation epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor (TKI) approved in multiple countries and regions for patients with EGFR T790M mutation-positive non-small cell lung cancer (NSCLC). Despite impressive initial tumor responses, development of drug resistance ultimately limits the benefit of this compound. Mechanisms of resistance to osimertinib are just beginning to emerge, such as EGFR C797S and L718Q mutations, BRAF V600E and PIK3CA E545K mutations, as well as ERBB2 and MET amplification. However, a comprehensive view is still missing. In this study, we presented the first case of Chinese NSCLC patient who developed resistance to osimertinib, and discovered de novo EGFR G796D mutation as a potential mechanism. Our findings provided insights into mechanisms of resistance to osimertinib and highlighted tumor heterogeneity and clonal evolution during the development of drug resistance.

  2. EGFR G796D mutation mediates resistance to osimertinib

    PubMed Central

    Bai, Yu; Zhu, Xuehua; Lu, Xuesong; Wu, Chunyan; Wang, Jiying; Liu, Li; Wang, Zheng; Ni, Jian; Yang, Zhenfan; Xu, Jianfang

    2017-01-01

    Osimertinib is an effective third-generation epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor (TKI) approved in multiple countries and regions for patients with EGFR T790M mutation-positive non-small cell lung cancer (NSCLC). Despite impressive initial tumor responses, development of drug resistance ultimately limits the benefit of this compound. Mechanisms of resistance to osimertinib are just beginning to emerge, such as EGFR C797S and L718Q mutations, BRAF V600E and PIK3CA E545K mutations, as well as ERBB2 and MET amplification. However, a comprehensive view is still missing. In this study, we presented the first case of Chinese NSCLC patient who developed resistance to osimertinib, and discovered de novo EGFR G796D mutation as a potential mechanism. Our findings provided insights into mechanisms of resistance to osimertinib and highlighted tumor heterogeneity and clonal evolution during the development of drug resistance. PMID:28572531

  3. Three cases with L1 syndrome and two novel mutations in the L1CAM gene.

    PubMed

    Marín, Rosario; Ley-Martos, Miriam; Gutiérrez, Gema; Rodríguez-Sánchez, Felicidad; Arroyo, Diego; Mora-López, Francisco

    2015-11-01

    Mutations in the L1CAM gene have been identified in the following various X-linked neurological disorders: congenital hydrocephalus; mental retardation, aphasia, shuffling gait, and adducted thumbs (MASA) syndrome; spastic paraplegia; and agenesis of the corpus callosum. These conditions are currently considered different phenotypes of a single entity known as L1 syndrome. We present three families with L1 syndrome. Sequencing of the L1CAM gene allowed the identification of the following mutations involved: a known splicing mutation (c.3531-12G>A) and two novel ones: a missense mutation (c.1754A>C; p.Asp585Ala) and a nonsense mutation (c.3478C>T; p.Gln1160Stop). The number of affected males and carrier females identified in a relatively small population suggests that L1 syndrome may be under-diagnosed. L1 syndrome should be considered in the differential diagnosis of intellectual disability or mental retardation in children, especially when other signs such as hydrocephalus or adducted thumbs are present.

  4. Differences in resistance mutations among HIV-1 non-subtype B infections: a systematic review of evidence (1996–2008)

    PubMed Central

    2009-01-01

    Ninety percent of HIV-1-infected people worldwide harbour non-subtype B variants of HIV-1. Yet knowledge of resistance mutations in non-B HIV-1 and their clinical relevance is limited. Although a few reviews, editorials and perspectives have been published alluding to this lack of data among non-B subtypes, no systematic review has been performed to date. With this in mind, we conducted a systematic review (1996–2008) of all published studies performed on the basis of non-subtype B HIV-1 infections treated with antiretroviral drugs that reported genotype resistance tests. Using an established search string, 50 studies were deemed relevant for this review. These studies reported genotyping data from non-B HIV-1 infections that had been treated with either reverse transcriptase inhibitors or protease inhibitors. While most major resistance mutations in subtype B were also found in non-B subtypes, a few novel mutations in non-B subtypes were recognized. The main differences are reflected in the discoveries that: (i) the non-nucleoside reverse transcriptase inhibitor resistance mutation, V106M, has been seen in subtype C and CRF01_AE, but not in subtype B, (ii) the protease inhibitor mutations L89I/V have been reported in C, F and G subtypes, but not in B, (iii) a nelfinavir selected non-D30N containing pathway predominated in CRF01_AE and CRF02_AG, while the emergence of D30N is favoured in subtypes B and D, (iv) studies on thymidine analog-treated subtype C infections from South Africa, Botswana and Malawi have reported a higher frequency of the K65R resistance mutation than that typically seen with subtype B. Additionally, some substitutions that seem to impact non-B viruses differentially are: reverse transcriptase mutations G196E, A98G/S, and V75M; and protease mutations M89I/V and I93L. Polymorphisms that were common in non-B subtypes and that may contribute to resistance tended to persist or become more frequent after drug exposure. Some, but not all, are

  5. HOGA1 Gene Mutations of Primary Hyperoxaluria Type 3 in Tunisian Patients.

    PubMed

    M'dimegh, Saoussen; Aquaviva-Bourdain, Cécile; Omezzine, Asma; Souche, Geneviéve; M'barek, Ibtihel; Abidi, Kamel; Gargah, Tahar; Abroug, Saoussen; Bouslama, Ali

    2017-05-01

    Primary hyperoxaluria type 3 (PH3) is due to mutations in the recently identified 4-hydroxy-2-oxoglutarate aldolase (HOGA1) gene. PH3 might be the least severe form with a milder phenotype with good preservation of kidney function in most patients. The aim of this study was to report three PH3 cases carrying mutations in HOGA1. Genetic analysis of HOGA1 was performed in patients with a high clinical suspicion of PH after sequencing of AGXT and GRHPR genes, which was negative. Also, a complete AGXT/GRHPR MLPA was performed in these patients in order to detect large deletions/insertions. Two different HOGA1 gene mutations were identified: the p.Pro190Leu in a homozygous state and the p.Gly287Val in two patients in homozygous and heterozygous carriers. The median age at onset of clinical symptoms was 3.93 years. Most of the patients had a positive family history for recurrent urolithiasis. The p.Pro190Leu mutation was reported with impaired renal function at follow-up; however, the p.Gly287Val was presented with normal renal function. All patients were presented with urolithiasis, but only one had a nephrocalcinosis. This study expanded the number of PH3 patients from 63 to 66 cases. The p.Pro190Leu and the p.Gly287Val mutations found in this study can provide a first-line investigation in Tunisian PH1 patients. © 2016 Wiley Periodicals, Inc.

  6. The ABCA4 2588G>C Stargardt mutation: single origin and increasing frequency from South-West to North-East Europe.

    PubMed

    Maugeri, Alessandra; Flothmann, Kris; Hemmrich, Nadine; Ingvast, Sofie; Jorge, Paula; Paloma, Eva; Patel, Reshma; Rozet, Jean-Michel; Tammur, Jaana; Testa, Francesco; Balcells, Susana; Bird, Alan C; Brunner, Han G; Hoyng, Carel B; Metspalu, Andres; Simonelli, Francesca; Allikmets, Rando; Bhattacharya, Shomi S; D'Urso, Michele; Gonzàlez-Duarte, Roser; Kaplan, Josseline; te Meerman, Gerard J; Santos, Rosário; Schwartz, Marianne; Van Camp, Guy; Wadelius, Claes; Weber, Bernhard H F; Cremers, Frans P M

    2002-03-01

    Inherited retinal dystrophies represent the most important cause of vision impairment in adolescence, affecting approximately 1 out of 3000 individuals. Mutations of the photoreceptor-specific gene ABCA4 (ABCR) are a common cause of retinal dystrophy. A number of mutations have been repeatedly reported for this gene, notably the 2588G>C mutation which is frequent in both patients and controls. Here we ascertained the frequency of the 2588G>C mutation in a total of 2343 unrelated random control individuals from 11 European countries and 241 control individuals from the US, as well as in 614 patients with STGD both from Europe and the US. We found an overall carrier frequency of 1 out of 54 in Europe, compared with 1 out of 121 in the US, confirming that the 2588G>C ABCA4 mutation is one of the most frequent autosomal recessive mutations in the European population. Carrier frequencies show an increasing gradient in Europe from South-West to North-East. The lowest carrier frequency, 0 out of 199 (0%), was found in Portugal; the highest, 11 out of 197 (5.5%), was found in Sweden. Haplotype analysis in 16 families segregating the 2588G>C mutation showed four intragenic polymorphisms invariably present in all 16 disease chromosomes and sharing of the same allele for several markers flanking the ABCA4 locus in most of the disease chromosomes. These results indicate a single origin of the 2588G>C mutation which, to our best estimate, occurred between 2400 and 3000 years ago.

  7. Computed tomography correlates with improvement with ivacaftor in cystic fibrosis patients with G551D mutation.

    PubMed

    Sheikh, Shahid I; Long, Frederick R; McCoy, Karen S; Johnson, Terri; Ryan-Wenger, Nancy A; Hayes, Don

    2015-01-01

    Ivacaftor corrects the cystic fibrosis transmembrane conductance regulator (CFTR) gating defect associated with G551D mutation and is quickly becoming an important treatment in patients with cystic fibrosis (CF) due to this genetic mutation. A single-center study was performed in CF patients receiving ivacaftor to evaluate the usefulness of high resolution computed tomography (HRCT) of the chest as a way to gauge response to ivacaftor therapy. Ten patients with CF were enrolled for at least one year before and after starting ivacaftor. At time of enrollment, mean age was 20.9 ± 10.8 (range 10-44) years. There were significant improvements from baseline to 6 months in mean %FVC (93 ± 16 to 99 ± 16) and %FEV1 (79 ± 26 to 87 ± 28) but reverted to baseline at one year. Mean sweat chloride levels decreased significantly from baseline to one year. Mean weight and BMI improved at 6 months. Weight continued to improve with stabilization of BMI at one year. Chest HRCT showed significant improvement at one year in mean modified Brody scores for bronchiectasis, mucous plugging, airway wall thickness, and total Brody scores. Elevated bronchiectasis and airway wall thickness scores correlated significantly with lower %FEV1, while higher airway wall thickness and mucus plugging scores correlated with more pulmonary exacerbations requiring IV and oral antibiotics respectively. Based on our findings, HRCT imaging is a useful tool in monitoring response to ivacaftor therapy that corrects the gating defect associated with the G551D-CFTR mutation. Copyright © 2014 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved.

  8. The 95ΔG mutation in the 5'untranslated region of the norA gene increases efflux activity in Staphylococcus epidermidis isolates.

    PubMed

    García-Gómez, Elizabeth; Jaso-Vera, Marcos E; Juárez-Verdayes, Marco A; Alcántar-Curiel, María D; Zenteno, Juan C; Betanzos-Cabrera, Gabriel; Peralta, Humberto; Rodríguez-Martínez, Sandra; Cancino-Díaz, Mario E; Jan-Roblero, Janet; Cancino-Diaz, Juan C

    2017-02-01

    In the Staphylococcus aureus ATCC25923 strain, the flqB mutation in the 5'untranslated region (5'UTR) of the norA gene causes increased norA mRNA expression and high efflux activity (HEA). The involvement of the norA gene 5'UTR in HEA has not been explored in S. epidermidis; therefore, we examined the function of this region in S. epidermidis clinical isolates. The selection of isolates with HEA was performed based on ethidium bromide (EtBr) MIC values and efflux efficiency (EF) using the semi-automated fluorometric method. The function of the 5'UTR was studied by quantifying the levels of norA expression (RT-qPCR) and by identifying 5'UTR mutations by sequence analysis. Only 10 isolates from a total of 165 (6.1%) had HEA (EtBr MIC = 300 μg/ml and EF ranged from 48.4 to 97.2%). Eight of 10 isolates with HEA had the 5'UTR 95 Δ G mutation. Isolates carrying the 95 Δ G mutation had higher levels of norA expression compared with those that did not. To corroborate that the 95 Δ G mutation is involved in HEA, a strain adapted to EtBr was obtained in vitro. This strain also presented the 95 Δ G mutation and had a high level of norA expression and EF, indicating that the 95 Δ G mutation is important for the HEA phenotype. The 95 Δ G mutation produces a different structure in the Shine-Dalgarno region, which may promote better translation of norA mRNA. To our knowledge, this is the first report to demonstrate the participation of the 5'UTR 95 Δ G mutation of the norA gene in the HEA phenotype of S. epidermidis isolates. Here, we propose that the efflux of EtBr is caused by an increment in the transcription and/or translation of the norA gene. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. SOD1 Overexpression Preserves Baroreflex Control of Heart Rate with an Increase of Aortic Depressor Nerve Function

    PubMed Central

    Hatcher, Jeffrey; Gu, He; Cheng, Zixi (Jack)

    2016-01-01

    Overproduction of reactive oxygen species (ROS), such as the superoxide radical (O2 ∙−), is associated with diseases which compromise cardiac autonomic function. Overexpression of SOD1 may offer protection against ROS damage to the cardiac autonomic nervous system, but reductions of O2 ∙− may interfere with normal cellular functions. We have selected the C57B6SJL-Tg (SOD1)2 Gur/J mouse as a model to determine whether SOD1 overexpression alters cardiac autonomic function, as measured by baroreflex sensitivity (BRS) and aortic depressor nerve (ADN) recordings, as well as evaluation of baseline heart rate (HR) and mean arterial pressure (MAP). Under isoflurane anesthesia, C57 wild-type and SOD1 mice were catheterized with an arterial pressure transducer and measurements of HR and MAP were taken. After establishing a baseline, hypotension and hypertension were induced by injection of sodium nitroprusside (SNP) and phenylephrine (PE), respectively, and ΔHR versus ΔMAP were recorded as a measure of baroreflex sensitivity (BRS). SNP and PE treatment were administered sequentially after a recovery period to measure arterial baroreceptor activation by recording aortic depressor nerve activity. Our findings show that overexpression of SOD1 in C57B6SJL-Tg (SOD1)2 Gur/J mouse preserved the normal HR, MAP, and BRS but enhanced aortic depressor nerve function. PMID:26823951

  10. Determining the Effect of Catechins on SOD1 Conformation and Aggregation by Ion Mobility Mass Spectrometry Combined with Optical Spectroscopy

    NASA Astrophysics Data System (ADS)

    Zhao, Bing; Zhuang, Xiaoyu; Pi, Zifeng; Liu, Shu; Liu, Zhiqiang; Song, Fengrui

    2018-02-01

    The aggregation of Cu,Zn-superoxide dismutase (SOD1) plays an important role in the etiology of amyotrophic lateral sclerosis (ALS). For the disruption of ALS progression, discovering new drugs or compounds that can prevent SOD1 aggregation is important. In this study, ESI-MS was used to investigate the interaction of catechins and SOD1. The noncovalent complex of catechins that interact with SOD1 was found and retained in the gas phase under native ESI-MS condition. The conformation changes of SOD1 after binding with catechins were also explored via traveling wave ion mobility (IM) spectrometry. Epigallocatechin gallate (EGCG) can stabilize SOD1 conformation against unfolding in three catechins. To further evaluate the efficacy of EGCG, we monitored the fluorescence changes of dimer E2,E2,-SOD1(apo-SOD1, E:empty) with and without ligands under denaturation conditions, and found that EGCG can inhibit apo-SOD1 aggregation. In addition, the circular dichroism spectra of the samples showed that EGCG can decrease the β-sheet content of SOD1, which can produce aggregates. These results indicated that orthogonal separation dimension in the gas-phase IM coupled with ESI-MS (ESI-IM-MS) can potentially provide insight into the interaction between SOD1 and small molecules. The advantage is that it dramatically decreases the analysis time. Meantime, optical spectroscopy techniques can be used to confirm ESI-IM-MS results. [Figure not available: see fulltext.

  11. Oxidized/misfolded superoxide dismutase-1: the cause of all amyotrophic lateral sclerosis?

    PubMed

    Kabashi, Edor; Valdmanis, Paul N; Dion, Patrick; Rouleau, Guy A

    2007-12-01

    The identification in 1993 of superoxide dismutase-1 (SOD1) mutations as the cause of 10 to 20% of familial amyotrophic lateral sclerosis cases, which represents 1 to 2% of all amyotrophic lateral sclerosis (ALS) cases, prompted a substantial amount of research into the mechanisms of SOD1-mediated toxicity. Recent experiments have demonstrated that oxidation of wild-type SOD1 leads to its misfolding, causing it to gain many of the same toxic properties as mutant SOD1. In vitro studies of oxidized/misfolded SOD1 and in vivo studies of misfolded SOD1 have indicated that these protein species are selectively toxic to motor neurons, suggesting that oxidized/misfolded SOD1 could lead to ALS even in individuals who do not carry an SOD1 mutation. It has also been reported that glial cells secrete oxidized/misfolded mutant SOD1 to the extracellular environment, where it can trigger the selective death of motor neurons, offering a possible explanation for the noncell autonomous nature of mutant SOD1 toxicity and the rapid progression of disease once the first symptoms develop. Therefore, considering that sporadic (SALS) and familial ALS (FALS) cases are clinically indistinguishable, the toxic properties of mutated SOD1 are similar to that of oxidized/misfolded wild-type SOD1 (wtSOD1), and secreted/extracellular misfolded SOD1 is selectively toxic to motor neurons, we propose that oxidized/misfolded SOD1 is the cause of most forms of classic ALS and should be a prime target for the design of ALS treatments.

  12. Mutations Affecting G-Protein Subunit α11 in Hypercalcemia and Hypocalcemia

    PubMed Central

    Babinsky, Valerie N.; Head, Rosie A.; Cranston, Treena; Rust, Nigel; Hobbs, Maurine R.; Heath, Hunter; Thakker, Rajesh V.

    2013-01-01

    BACKGROUND Familial hypocalciuric hypercalcemia is a genetically heterogeneous disorder with three variants: types 1, 2, and 3. Type 1 is due to loss-of-function mutations of the calcium-sensing receptor, a guanine nucleotide–binding protein (G-protein)–coupled receptor that signals through the G-protein subunit α11 (Gα11). Type 3 is associated with adaptor-related protein complex 2, sigma 1 subunit (AP2S1) mutations, which result in altered calcium-sensing receptor endocytosis. We hypothesized that type 2 is due to mutations effecting Gα11 loss of function, since Gα11 is involved in calcium-sensing receptor signaling, and its gene (GNA11) and the type 2 locus are colocalized on chromosome 19p13.3. We also postulated that mutations effecting Gα11 gain of function, like the mutations effecting calcium-sensing receptor gain of function that cause autosomal dominant hypocalcemia type 1, may lead to hypocalcemia. METHODS We performed GNA11 mutational analysis in a kindred with familial hypocalciuric hypercalcemia type 2 and in nine unrelated patients with familial hypocalciuric hypercalcemia who did not have mutations in the gene encoding the calcium-sensing receptor (CASR) or AP2S1. We also performed this analysis in eight unrelated patients with hypocalcemia who did not have CASR mutations. In addition, we studied the effects of GNA11 mutations on Gα11 protein structure and calcium-sensing receptor signaling in human embryonic kidney 293 (HEK293) cells. RESULTS The kindred with familial hypocalciuric hypercalcemia type 2 had an in-frame deletion of a conserved Gα11 isoleucine (Ile200del), and one of the nine unrelated patients with familial hypocalciuric hypercalcemia had a missense GNA11 mutation (Leu135Gln). Missense GNA11 mutations (Arg181Gln and Phe341Leu) were detected in two unrelated patients with hypocalcemia; they were therefore identified as having autosomal dominant hypocalcemia type 2. All four GNA11 mutations predicted disrupted protein

  13. Characterisation of four novel fibrillin-1 (FBN1) mutations in Marfan syndrome.

    PubMed Central

    Adès, L C; Haan, E A; Colley, A F; Richard, R I

    1996-01-01

    Forty-four percent of the fibrillin-1 gene (FBN1) from 19 unrelated families with Marfan syndrome was screened for putative mutations by single strand conformational polymorphism (SSCP) analysis. Four novel mutations were identified and characterised in five people, three with classical Marfan syndrome (two from one family, and one from an unrelated family), one with a more severe phenotype, and one with neonatal Marfan syndrome. The base substitutions G2113A, G2132A, T3163G, and G3458A result in amino acid substitutions A705T, C711Y, C1055G, and C1152Y, respectively. C711Y, C1055G, and C1152Y lead to replacement of a cysteine by another amino acid; the latter two occur within epidermal growth factor-like motifs in exon 25 and 27, respectively. The A705T mutation occurs at exon 16 adjacent to the GT splice site. The A705T and C711Y mutations, at exon 16 and 17, respectively, are the first documented in the second transforming growth factor-beta 1 binding protein-like motif of FBN1. Images PMID:8863159

  14. A novel cell line generated using the CRISPR/Cas9 technology as universal quality control material for KRAS G12V mutation testing.

    PubMed

    Jia, Shiyu; Zhang, Rui; Lin, Guigao; Peng, Rongxue; Gao, Peng; Han, Yanxi; Fu, Yu; Ding, Jiansheng; Wu, Qisheng; Zhang, Kuo; Xie, Jiehong; Li, Jinming

    2018-06-01

    KRAS mutations are the key indicator for EGFR monoclonal antibody-targeted therapy and acquired drug resistance, and their accurate detection is critical to the clinical decision-making of colorectal cancer. However, no proper quality control material is available for the current detection methods, particularly next-generation sequencing (NGS). The ideal quality control material for NGS needs to provide both the tumor mutation gene and the matched background genomic DNA, which is uncataloged in public databases, to accurately distinguish germline polymorphisms and somatic mutations. We developed a novel KRAS G12V mutant cell line using the clustered regularly interspaced short palindromic repeat (CRISPR)/CRISPR-associated protein 9 (Cas9) technique to make up for the deficiencies in existing quality control material and further validated the feasibility of the cell line as quality control material by amplification refractory mutation system (ARMS), Sanger sequencing, digital PCR (dPCR), and NGS. We verified that the edited cell line specifically had the G12V mutation, and the validation results presented a high consistency among the four methods of detection. The three cell lines screened contained the G12V mutation and the mutation allele fractions of G12V-1, G12V-2, and G12V-3 were 52.01%, 82.06%, and 17.29%, respectively. The novel KRAS G12V cell line generated using the CRISPR/Cas9 gene editing system is suitable as a quality control material for all current detection methods and provides a new direction in the development of quality control material. © 2018 Wiley Periodicals, Inc.

  15. Isocitrate dehydrogenase 1 R132C mutation occurs exclusively in microsatellite stable colorectal cancers with the CpG island methylator phenotype.

    PubMed

    Whitehall, V L J; Dumenil, T D; McKeone, D M; Bond, C E; Bettington, M L; Buttenshaw, R L; Bowdler, L; Montgomery, G W; Wockner, L F; Leggett, B A

    2014-11-01

    The CpG Island Methylator Phenotype (CIMP) is fundamental to an important subset of colorectal cancer; however, its cause is unknown. CIMP is associated with microsatellite instability but is also found in BRAF mutant microsatellite stable cancers that are associated with poor prognosis. The isocitrate dehydrogenase 1 (IDH1) gene causes CIMP in glioma due to an activating mutation that produces the 2-hydroxyglutarate oncometabolite. We therefore examined IDH1 alteration as a potential cause of CIMP in colorectal cancer. The IDH1 mutational hotspot was screened in 86 CIMP-positive and 80 CIMP-negative cancers. The entire coding sequence was examined in 81 CIMP-positive colorectal cancers. Forty-seven cancers varying by CIMP-status and IDH1 mutation status were examined using Illumina 450K DNA methylation microarrays. The R132C IDH1 mutation was detected in 4/166 cancers. All IDH1 mutations were in CIMP cancers that were BRAF mutant and microsatellite stable (4/45, 8.9%). Unsupervised hierarchical cluster analysis identified an IDH1 mutation-like methylation signature in approximately half of the CIMP-positive cancers. IDH1 mutation appears to cause CIMP in a small proportion of BRAF mutant, microsatellite stable colorectal cancers. This study provides a precedent that a single gene mutation may cause CIMP in colorectal cancer, and that this will be associated with a specific epigenetic signature and clinicopathological features.

  16. Mutational analysis of COL1A1 and COL1A2 genes among Estonian osteogenesis imperfecta patients.

    PubMed

    Zhytnik, Lidiia; Maasalu, Katre; Reimann, Ene; Prans, Ele; Kõks, Sulev; Märtson, Aare

    2017-08-15

    Osteogenesis imperfecta (OI) is a rare bone disorder. In 90% of cases, OI is caused by mutations in the COL1A1/2 genes, which code procollagen α1 and α2 chains. The main aim of the current research was to identify the mutational spectrum of COL1A1/2 genes in Estonian patients. The small population size of Estonia provides a unique chance to explore the collagen I mutational profile of 100% of OI families in the country. We performed mutational analysis of peripheral blood gDNA of 30 unrelated Estonian OI patients using Sanger sequencing of COL1A1 and COL1A2 genes, including all intron-exon junctions and 5'UTR and 3'UTR regions, to identify causative OI mutations. We identified COL1A1/2 mutations in 86.67% of patients (26/30). 76.92% of discovered mutations were located in the COL1A1 (n = 20) and 23.08% in the COL1A2 (n = 6) gene. Half of the COL1A1/2 mutations appeared to be novel. The percentage of quantitative COL1A1/2 mutations was 69.23%. Glycine substitution with serine was the most prevalent among missense mutations. All qualitative mutations were situated in the chain domain of pro-α1/2 chains. Our study shows that among the Estonian OI population, the range of collagen I mutations is quite high, which agrees with other described OI cohorts of Northern Europe. The Estonian OI cohort differs due to the high number of quantitative variants and simple missense variants, which are mostly Gly to Ser substitutions and do not extend the chain domain of COL1A1/2 products.

  17. Exercise training regulates SOD-1 and oxidative stress in porcine aortic endothelium.

    PubMed

    Rush, James W E; Turk, James R; Laughlin, M Harold

    2003-04-01

    Vascular oxidative stress contributes to endothelial dysfunction. Aerobic exercise training improves vascular function. The purpose of this study was to test the hypothesis that exercise training would improve the balance of antioxidant to prooxidant enzymes and reduce markers of oxidative stress in aortic endothelial cells (AEC). Female Yucatan miniature pigs either remained sedentary (SED) or were exercise trained (EX) for 16-19 wk. EX pigs had increased AEC SOD-1 protein levels and Cu/Zn SOD activity of the whole aorta compared with SED pigs. Protein levels of other antioxidant enzymes (SOD-2, catalase) were not affected by exercise training. Protein levels of p67(phox), a subunit of the prooxidant enzyme NAD(P)H oxidase, were reduced in EX vs. SED AEC. These EX adaptations were associated with lower AEC malondialdehyde levels and decreased phosphorylation of ERK-1/2. Endothelial nitric oxide synthase protein, protein nitrotyrosine content, and heme oxygenase-1 protein were not different in EX vs. SED pigs. We conclude that chronic aerobic exercise training influenced both antioxidant and prooxidant enzymes and decreased indexes of oxidative stress in AEC. These adaptations may contribute to improved endothelial function with exercise training.

  18. The G matrix under fluctuating correlational mutation and selection.

    PubMed

    Revell, Liam J

    2007-08-01

    Theoretical quantitative genetics provides a framework for reconstructing past selection and predicting future patterns of phenotypic differentiation. However, the usefulness of the equations of quantitative genetics for evolutionary inference relies on the evolutionary stability of the additive genetic variance-covariance matrix (G matrix). A fruitful new approach for exploring the evolutionary dynamics of G involves the use of individual-based computer simulations. Previous studies have focused on the evolution of the eigenstructure of G. An alternative approach employed in this paper uses the multivariate response-to-selection equation to evaluate the stability of G. In this approach, I measure similarity by the correlation between response-to-selection vectors due to random selection gradients. I analyze the dynamics of G under several conditions of correlational mutation and selection. As found in a previous study, the eigenstructure of G is stabilized by correlational mutation and selection. However, over broad conditions, instability of G did not result in a decreased consistency of the response to selection. I also analyze the stability of G when the correlation coefficients of correlational mutation and selection and the effective population size change through time. To my knowledge, no prior study has used computer simulations to investigate the stability of G when correlational mutation and selection fluctuate. Under these conditions, the eigenstructure of G is unstable under some simulation conditions. Different results are obtained if G matrix stability is assessed by eigenanalysis or by the response to random selection gradients. In this case, the response to selection is most consistent when certain aspects of the eigenstructure of G are least stable and vice versa.

  19. A New COL3A1 Mutation in Ehlers-Danlos Syndrome Vascular Type With Different Phenotypes in the Same Family.

    PubMed

    Cortini, Francesca; Marinelli, Barbara; Romi, Silvia; Seresini, Agostino; Pesatori, Angela Cecilia; Seia, Manuela; Montano, Nicola; Bassotti, Alessandra

    2017-04-01

    Vascular Ehlers-Danlos syndrome (vEDS) is a rare and severe connective tissue disorder caused by mutations in the collagen type III alpha I chain ( COL3A1) gene. We describe a pathogenetic heterozygous COL3A1 mutation c.3140 G>A, p. Gly1047Asp, identified using next-generation sequencing, in a 40-year-old Italian female. The genetic test performed on her relatives, which present different clinical phenotypes, confirmed that they carry the same mutation in heterozygous state. This finding confirms that mutations causing vEDS have an incomplete penetrance.

  20. HSJ1-related hereditary neuropathies: novel mutations and extended clinical spectrum.

    PubMed

    Gess, Burkhard; Auer-Grumbach, Michaela; Schirmacher, Anja; Strom, Tim; Zitzelsberger, Manuela; Rudnik-Schöneborn, Sabine; Röhr, Dominik; Halfter, Hartmut; Young, Peter; Senderek, Jan

    2014-11-04

    To determine the nature and frequency of HSJ1 mutations in patients with hereditary motor and hereditary motor and sensory neuropathies. Patients were screened for mutations by genome-wide or targeted linkage and homozygosity studies, whole-exome sequencing, and Sanger sequencing. RNA and protein studies of skin fibroblasts were used for functional characterization. We describe 2 additional mutations in the HSJ1 gene in a cohort of 90 patients with autosomal recessive distal hereditary motor neuropathy (dHMN) and Charcot-Marie-Tooth disease type 2 (CMT2). One family with a dHMN phenotype showed the homozygous splice-site mutation c.229+1G>A, which leads to retention of intron 4 in the HSJ1 messenger RNA with a premature stop codon and loss of protein expression. Another family, presenting with a CMT2 phenotype, carried the homozygous missense mutation c.14A>G (p.Tyr5Cys). This mutation was classified as likely disease-related by several automatic algorithms for prediction of possible impact of an amino acid substitution on the structure and function of proteins. Both mutations cosegregated with autosomal recessive inheritance of the disease and were absent from the general population. Taken together, in our cohort of 90 probands, we confirm that HSJ1 mutations are a rare but detectable cause of autosomal recessive dHMN and CMT2. We provide clinical and functional information on an HSJ1 splice-site mutation and report the detailed phenotype of 2 patients with CMT2, broadening the phenotypic spectrum of HSJ1-related neuropathies. © 2014 American Academy of Neurology.

  1. Advanced age-related denervation and fiber-type grouping in skeletal muscle of SOD1 knockout mice.

    PubMed

    Kostrominova, Tatiana Y

    2010-11-30

    In this study skeletal muscles from 1.5- and 10-month-old Cu/Zn superoxide dismutase (SOD1) homozygous knockout (JLSod1(-/-)) mice obtained from The Jackson Laboratory (C57Bl6/129SvEv background) were compared with muscles from age- and sex-matched heterozygous (JLSod1(+/-)) littermates. The results of this study were compared with previously published data on two different strains of Sod1(-/-) mice: one from Dr. Epstein's laboratory (ELSod1(-/-); C57Bl6 background) and the other from Cephalon, Inc. (CSod1(-/-); 129/CD-1 background). Grouping of succinate dehydrogenase-positive fibers characterized muscles of Sod1(-/-) mice from all three strains. The 10-month-old Sod1(-/-)C and JL mice displayed pronounced denervation of the gastrocnemius muscle, whereas the ELSod1(-/-) mice displayed a small degree of denervation at this age, but developed accelerated age-related denervation later on. Denervation markers were up-regulated in skeletal muscle of 10-month-old JLSod1(-/-) mice. This study is the first to show that metallothionein mRNA and protein expression was up-regulated in the skeletal muscle of 10-month-old JLSod1(-/-) mice and was mostly localized to the small atrophic muscle fibers. In conclusion, all three strains of Sod1(-/-) mice develop accelerated age-related muscle denervation, but the genetic background has significant influence on the progress of denervation. Copyright © 2010 Elsevier Inc. All rights reserved.

  2. Identification of a novel MYO7A mutation in Usher syndrome type 1.

    PubMed

    Cheng, Ling; Yu, Hongsong; Jiang, Yan; He, Juan; Pu, Sisi; Li, Xin; Zhang, Li

    2018-01-05

    Usher syndrome (USH) is an autosomal recessive disease characterized by deafness and retinitis pigmentosa. In view of the high phenotypic and genetic heterogeneity in USH, performing genetic screening with traditional methods is impractical. In the present study, we carried out targeted next-generation sequencing (NGS) to uncover the underlying gene in an USH family (2 USH patients and 15 unaffected relatives). One hundred and thirty-five genes associated with inherited retinal degeneration were selected for deep exome sequencing. Subsequently, variant analysis, Sanger validation and segregation tests were utilized to identify the disease-causing mutations in this family. All affected individuals had a classic USH type I (USH1) phenotype which included deafness, vestibular dysfunction and retinitis pigmentosa. Targeted NGS and Sanger sequencing validation suggested that USH1 patients carried an unreported splice site mutation, c.5168+1G>A, as a compound heterozygous mutation with c.6070C>T (p.R2024X) in the MYO7A gene. A functional study revealed decreased expression of the MYO7A gene in the individuals carrying heterozygous mutations. In conclusion, targeted next-generation sequencing provided a comprehensive and efficient diagnosis for USH1. This study revealed the genetic defects in the MYO7A gene and expanded the spectrum of clinical phenotypes associated with USH1 mutations.

  3. Molecular dynamics simulations and principal component analysis on human laforin mutation W32G and W32G/K87A.

    PubMed

    Srikumar, P S; Rohini, K; Rajesh, Perumbilavil Kaithamanakallam

    2014-06-01

    Mutations in human laforin lead to an autosomal neurodegenerative disorder Lafora disease. In N-terminal carbohydrate binding domain of laforin, two mutations W32G and K87A are reported as highly disease causing laforin mutants. Experimental studies reported that mutations are responsible for the abolishment of glycogen binding which is a critical function of laforin. Our current computational study focused on the role of conformational changes in human laforin structure due to existing single mutation W32G and prepared double mutation W32G/K87A related to loss of glycogen binding. We performed 10 ns molecular dynamics (MD) simulation studies in the Gromacs package for both mutations and analyzed the trajectories. From the results, the global properties like root mean square deviation, root mean square fluctuation, radius of gyration, solvent accessible surface area and hydrogen bonds showed structural changes in atomic level observed in W32G and W32G/K87A laforin mutants. The conformational change induced by mutants influenced the loss of the overall stability of the native laforin. Moreover, the change in overall motion of protein was analyzed by principal component analysis and results showed protein clusters expanded more than native and also change in direction in case of double mutant in conformational space. Overall, our report provides theoretical information on loss of structure-function relationship due to flexible nature of laforin mutants. In conclusion, comparative MD simulation studies support the experimental data on W32G and W32G/K87A related to the lafora disease mechanism on glycogen binding.

  4. Novel insertion mutation in a non-Jewish Caucasian type 1 Gaucher disease patient

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Choy, F.Y.M.; Humphries, M.L.; Ferreira, P.

    1997-01-20

    Gaucher disease is the most prevalent lysosomal storage disorder. It is autosomal recessive, resulting in lysosomal glucocerebrosidase deficiency. Three clinical forms of Gaucher disease have been described: type 1 (nonneuronopathic), type 2 (acute neuronopathic), and type 3 (subacute neuronopathic). We performed PCR-thermal cycle sequence analysis of glucocerebrosidase genomic DNA and identified a novel mutation in a non-Jewish type 1 Gaucher disease patient. It is a C insertion in exon 3 at cDNA nucleotide position 122 and genomic nucleotide position 1626. This mutation causes a frameshift and, subsequently, four of the five codons immediately downstream of the insertion were changed whilemore » the sixth was converted to a stop codon, resulting in premature termination of protein translation. The 122CC insertion abolishes a Cac81 restriction endonuclease cleavage site, allowing a convenient and reliable method for detection using RFLP analysis of PCR-amplified glucocerebrosidase genomic DNA. The mutation in the other Gaucher allele was found to be an A{r_arrow}G substitution at glucocerebrosidase cDNA nucleotide position 1226 that so far has only been reported among type 1 Gaucher disease patients. Since mutation 122CC causes a frameshift and early termination of protein translation, it most likely results in a meaningless transcript and subsequently no residual glucocerebrosidase enzyme activity. We speculate that mutation 122CC may result in a worse prognosis than mutations associated with partial activity. When present in the homozygous form, it could be a lethal allele similar to what has been postulated for the other known insertion mutation, 84GG. Our patient, who is a compound heterozygote 122CC/1226G, has moderately severe type 1 Gaucher disease. Her clinical response to Ceredase{reg_sign} therapy that began 31 months ago has been favorable, though incomplete. 30 refs., 3 figs., 2 tabs.« less

  5. 22 CFR 40.93 - Aliens unlawfully present after previous immigration violation.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 22 Foreign Relations 1 2014-04-01 2014-04-01 false Aliens unlawfully present after previous... TO BOTH NONIMMIGRANTS AND IMMIGRANTS UNDER THE IMMIGRATION AND NATIONALITY ACT, AS AMENDED Aliens Previously Removed § 40.93 Aliens unlawfully present after previous immigration violation. An alien described...

  6. 22 CFR 40.93 - Aliens unlawfully present after previous immigration violation.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 22 Foreign Relations 1 2013-04-01 2013-04-01 false Aliens unlawfully present after previous... TO BOTH NONIMMIGRANTS AND IMMIGRANTS UNDER THE IMMIGRATION AND NATIONALITY ACT, AS AMENDED Aliens Previously Removed § 40.93 Aliens unlawfully present after previous immigration violation. An alien described...

  7. 22 CFR 40.93 - Aliens unlawfully present after previous immigration violation.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 22 Foreign Relations 1 2012-04-01 2012-04-01 false Aliens unlawfully present after previous... TO BOTH NONIMMIGRANTS AND IMMIGRANTS UNDER THE IMMIGRATION AND NATIONALITY ACT, AS AMENDED Aliens Previously Removed § 40.93 Aliens unlawfully present after previous immigration violation. An alien described...

  8. 22 CFR 40.93 - Aliens unlawfully present after previous immigration violation.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 22 Foreign Relations 1 2011-04-01 2011-04-01 false Aliens unlawfully present after previous... TO BOTH NONIMMIGRANTS AND IMMIGRANTS UNDER THE IMMIGRATION AND NATIONALITY ACT, AS AMENDED Aliens Previously Removed § 40.93 Aliens unlawfully present after previous immigration violation. An alien described...

  9. 22 CFR 40.93 - Aliens unlawfully present after previous immigration violation.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Aliens unlawfully present after previous... TO BOTH NONIMMIGRANTS AND IMMIGRANTS UNDER THE IMMIGRATION AND NATIONALITY ACT, AS AMENDED Aliens Previously Removed § 40.93 Aliens unlawfully present after previous immigration violation. An alien described...

  10. Fragment analysis represents a suitable approach for the detection of hotspot c.7541_7542delCT NOTCH1 mutation in chronic lymphocytic leukemia.

    PubMed

    Vavrova, Eva; Kantorova, Barbara; Vonkova, Barbara; Kabathova, Jitka; Skuhrova-Francova, Hana; Diviskova, Eva; Letocha, Ondrej; Kotaskova, Jana; Brychtova, Yvona; Doubek, Michael; Mayer, Jiri; Pospisilova, Sarka

    2017-09-01

    The hotspot c.7541_7542delCT NOTCH1 mutation has been proven to have a negative clinical impact in chronic lymphocytic leukemia (CLL). However, an optimal method for its detection has not yet been specified. The aim of our study was to examine the presence of the NOTCH1 mutation in CLL using three commonly used molecular methods. Sanger sequencing, fragment analysis and allele-specific PCR were compared in the detection of the c.7541_7542delCT NOTCH1 mutation in 201 CLL patients. In 7 patients with inconclusive mutational analysis results, the presence of the NOTCH1 mutation was also confirmed using ultra-deep next generation sequencing. The NOTCH1 mutation was detected in 15% (30/201) of examined patients. Only fragment analysis was able to identify all 30 NOTCH1-mutated patients. Sanger sequencing and allele-specific PCR showed a lower detection efficiency, determining 93% (28/30) and 80% (24/30) of the present NOTCH1 mutations, respectively. Considering these three most commonly used methodologies for c.7541_7542delCT NOTCH1 mutation screening in CLL, we defined fragment analysis as the most suitable approach for detecting the hotspot NOTCH1 mutation. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Primary hyperoxaluria type 1: a cluster of new mutations in exon 7 of the AGXT gene.

    PubMed

    von Schnakenburg, C; Rumsby, G

    1997-06-01

    Primary hyperoxaluria type 1 (PH1) is a severe autosomal recessive inborn error of glyoxylate metabolism caused by deficiency of the hepatic peroxisomal enzyme alanine:glyoxylate aminotransferase. This enzyme is encoded by the AGXT gene on chromosome 2q37.3. DNA samples from 79 PH1 patients were studied using single strand conformation polymorphism analysis to detect sequence variants, which were then characterised by direct sequencing and confirmed by restriction enzyme digestion. Four novel mutations were identified in exon 7 of AGXT: a point mutation T853C, which leads to a predicted Ile244Thr amino acid substitution, occurred in nine patients. Two other mutations in adjacent nucleotides, C819T and G820A, mutated the same codon at residue 233 from arginine to cysteine and histidine, respectively. The fourth mutation, G860A, introduced a stop codon at amino acid residue 246. Enzyme studies in these patients showed that AGT catalytic activity was either very low or absent and that little or no immunoreactive protein was present. Together with a new polymorphism in exon 11 (C1342A) these findings underline the genetic heterogeneity of the AGXT gene. The novel mutation T853C is the second most common mutation found to date with an allelic frequency of 9% and will therefore be of clinical importance for the diagnosis of PH1.

  12. Primary hyperoxaluria type 1: a cluster of new mutations in exon 7 of the AGXT gene.

    PubMed Central

    von Schnakenburg, C; Rumsby, G

    1997-01-01

    Primary hyperoxaluria type 1 (PH1) is a severe autosomal recessive inborn error of glyoxylate metabolism caused by deficiency of the hepatic peroxisomal enzyme alanine:glyoxylate aminotransferase. This enzyme is encoded by the AGXT gene on chromosome 2q37.3. DNA samples from 79 PH1 patients were studied using single strand conformation polymorphism analysis to detect sequence variants, which were then characterised by direct sequencing and confirmed by restriction enzyme digestion. Four novel mutations were identified in exon 7 of AGXT: a point mutation T853C, which leads to a predicted Ile244Thr amino acid substitution, occurred in nine patients. Two other mutations in adjacent nucleotides, C819T and G820A, mutated the same codon at residue 233 from arginine to cysteine and histidine, respectively. The fourth mutation, G860A, introduced a stop codon at amino acid residue 246. Enzyme studies in these patients showed that AGT catalytic activity was either very low or absent and that little or no immunoreactive protein was present. Together with a new polymorphism in exon 11 (C1342A) these findings underline the genetic heterogeneity of the AGXT gene. The novel mutation T853C is the second most common mutation found to date with an allelic frequency of 9% and will therefore be of clinical importance for the diagnosis of PH1. Images PMID:9192270

  13. ATM/RB1 mutations predict shorter overall survival in urothelial cancer.

    PubMed

    Yin, Ming; Grivas, Petros; Emamekhoo, Hamid; Mendiratta, Prateek; Ali, Siraj; Hsu, JoAnn; Vasekar, Monali; Drabick, Joseph J; Pal, Sumanta; Joshi, Monika

    2018-03-30

    Mutations of DNA repair genes, e.g. ATM/RB1 , are frequently found in urothelial cancer (UC) and have been associated with better response to cisplatin-based chemotherapy. Further external validation of the prognostic value of ATM/RB1 mutations in UC can inform clinical decision making and trial designs. In the discovery dataset, ATM/RB1 mutations were present in 24% of patients and were associated with shorter OS (adjusted HR 2.67, 95% CI, 1.45-4.92, p = 0.002). There was a higher mutation load in patients carrying ATM/RB1 mutations (median mutation load: 6.7 versus 5.5 per Mb, p = 0.072). In the validation dataset, ATM/RB1 mutations were present in 22.2% of patients and were non-significantly associated with shorter OS (adjusted HR 1.87, 95% CI, 0.97-3.59, p = 0.06) and higher mutation load (median mutation load: 8.1 versus 7.2 per Mb, p = 0.126). Exome sequencing data of 130 bladder UC patients from The Cancer Genome Atlas (TCGA) dataset were analyzed as a discovery cohort to determine the prognostic value of ATM/RB1 mutations. Results were validated in an independent cohort of 81 advanced UC patients. Cox proportional hazard regression analysis was performed to calculate the hazard ratio (HR) and 95% confidence interval (CI) to compare overall survival (OS). ATM/RB1 mutations may be a biomarker of poor prognosis in unselected UC patients and may correlate with higher mutational load. Further studies are required to determine factors that can further stratify prognosis and evaluate predictive role of ATM/RB1 mutation status to immunotherapy and platinum-based chemotherapy.

  14. Possible association of 3' UTR +357 A>G, IVS11-nt 93 T>C, c.1311 C>T polymorphism with G6PD deficiency.

    PubMed

    Sirdah, Mahmoud M; Shubair, Mohammad E; Al-Kahlout, Mustafa S; Al-Tayeb, Jamal M; Prchal, Josef T; Reading, N Scott

    2017-07-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is a common X-linked inherited enzymopathic disorder affecting more than 500 million people worldwide. It has so far been linked to 217 distinct genetic variants in the exons and exon-intron boundaries of the G6PD gene, giving rise to a wide range of biochemical heterogeneity and clinical manifestations. Reports from different settings suggested the association of intronic and other mutations outside the reading frame of the G6PD gene with reduced enzyme activity and presenting clinical symptoms. The present study aimed to investigate any association of other variations apart of the exonic or exonic intronic boundaries in the development of G6PD deficiency. Sixty-seven unrelated Palestinian children admitted to the pediatric hospital with hemolytic crises due to G6PD deficiency were studied. In our Palestinian cohort of 67 [59 males (M) and 8 females (F)] G6PD-deficient children, previously hospitalized for acute hemolytic anemia due to favism, molecular sequencing of the G6PD gene revealed four cases (3M and 1F) that did not have any of the variants known to cause G6PD deficiency, but the 3' UTR c.*+357A>G (rs1050757) polymorphism in association with IVS 11 (c.1365-13T>C; rs2071429), and c.1311C>T (rs2230037). We now provide an additional evidence form Palestinian G6PD-deficient subjects for a possible role of 3' UTR c.*+357 A>G, c.1365-13T>C, and/or c.1311C>T polymorphism for G6PD deficiency, suggesting that not only a single variation in the exonic or exonic intronic boundaries, but also a haplotype of G6PD should considered as a cause for G6PD deficiency.

  15. Plasminogen activator inhibitor-1 4G/5G polymorphism, factor V Leiden, prothrombin mutations and the risk of VTE recurrence.

    PubMed

    Sundquist, Kristina; Wang, Xiao; Svensson, Peter J; Sundquist, Jan; Hedelius, Anna; Larsson Lönn, Sara; Zöller, Bengt; Memon, Ashfaque A

    2015-11-25

    Plasminogen-activator inhibitor (PAI)-1 is an important inhibitor of the plasminogen/plasmin system. PAI-1 levels are influenced by the 4G/5G polymorphism in the PAI-1 promoter. We investigated the relationship between the PAI-1 polymorphism and VTE recurrence, and its possible modification by factor V Leiden (FVL) and prothrombin (PTM) mutations. Patients (n=1,069) from the Malmö Thrombophilia Study were followed from discontinuation of anticoagulant treatment until diagnosis of VTE recurrence or the end of the study (maximum follow-up 9.8 years). One hundred twenty-seven patients (11.9 %) had VTE recurrence. PAI-1 was genotyped by TaqMan PCR. Cox regression analysis adjusted for age, sex and acquired risk factors of VTE showed no evidence of an association between PAI-1 genotype and risk of VTE recurrence in the study population as a whole. However, by including an interaction term in the analysis we showed that FVL but not PTM modified the effect of PAI-1 genotype: patients with the 4G allele plus FVL had a higher risk of VTE recurrence [hazard ratio (HR) =2.3, 95 % confidence interval (CI) =1.5-3.3] compared to patients with the 4G allele but no FVL (reference group) or FVL irrespective of PAI-1 genotype (HR=1.8, 95 % CI=1.3-2.5). Compared to reference group, 5G allele irrespective of FVL was associated with lower risk of VTE recurrence only when compared with 4G allele together with FVL. In conclusion, FVL has a modifying effect on PAI-1 polymorphism in relation to risk of VTE recurrence. The role of PAI-1 polymorphism as a risk factor of recurrent VTE may be FVL dependent.

  16. Neither Serotonin nor Adenosine-dependent Mechanisms Preserve Ventilatory Capacity in ALS rats

    PubMed Central

    Nichols, N.L.; Johnson, R.A.; Satriotomo, I.; Mitchell, G.S.

    2014-01-01

    In rats over-expressing SOD1G93A, ventilation is preserved despite significant loss of respiratory motor neurons. Thus, unknown forms of compensatory respiratory plasticity may offset respiratory motor neuron cell death. Although mechanisms of such compensation are unknown, other models of respiratory motor plasticity may provide a conceptual guide. Multiple cellular mechanisms give rise to phrenic motor facilitation; one mechanism requires spinal serotonin receptor and NADPH oxidase activity whereas another requires spinal adenosine receptor activation. Here, we studied whether these mechanisms contribute to compensatory respiratory plasticity in SOD1G93A rats. Using plethysmography, we assessed ventilation in end-stage SOD1G93A rats after: 1) serotonin depletion with parachlorophenylalanine (PCPA), 2) serotonin (methysergide) and A2A (MSX-3) receptor inhibition, 3) NADPH oxidase inhibition (apocynin), and 4) combined treatments. The ability to increase ventilation was not decreased by individual or combined treatments; thus, these mechanisms do not maintain breathing capacity at end-stage motor neuron disease. Possible mechanisms giving rise to enhanced breathing capacity with combined treatment in end-stage SOD1G93A rats are discussed. PMID:24681328

  17. Altered Pre-mRNA Splicing Caused by a Novel Intronic Mutation c.1443+5G>A in the Dihydropyrimidinase (DPYS) Gene.

    PubMed

    Nakajima, Yoko; Meijer, Judith; Zhang, Chunhua; Wang, Xu; Kondo, Tomomi; Ito, Tetsuya; Dobritzsch, Doreen; Van Kuilenburg, André B P

    2016-01-12

    Dihydropyrimidinase (DHP) deficiency is an autosomal recessive disease caused by mutations in the DPYS gene. Patients present with highly elevated levels of dihydrouracil and dihydrothymine in their urine, blood and cerebrospinal fluid. The analysis of the effect of mutations in DPYS on pre-mRNA splicing is hampered by the fact that DHP is primarily expressed in liver and kidney cells. The minigene approach can detect mRNA splicing aberrations using cells that do not express the endogenous mRNA. We have used a minigene-based approach to analyze the effects of a presumptive pre-mRNA splicing mutation in two newly identified Chinese pediatric patients with DHP deficiency. Mutation analysis of DPYS showed that both patients were compound heterozygous for a novel intronic mutation c.1443+5G>A in intron 8 and a previously described missense mutation c.1001A>G (p.Q334R) in exon 6. Wild-type and the mutated minigene constructs, containing exons 7, 8 and 9 of DPYS, yielded different splicing products after expression in HEK293 cells. The c.1443+5G>A mutation resulted in altered pre-mRNA splicing of the DPYS minigene construct with full skipping of exon 8. Analysis of the DHP crystal structure showed that the deletion of exon 8 severely affects folding, stability and homooligomerization of the enzyme as well as disruption of the catalytic site. Thus, the analysis suggests that the c.1443+5G>A mutation results in aberrant splicing of the pre-mRNA encoding DHP, underlying the DHP deficiency in two unrelated Chinese patients.

  18. Prevalence of 2314delG mutation in Spanish patients with Usher syndrome type II (USH2).

    PubMed

    Beneyto, M M; Cuevas, J M; Millán, J M; Espinós, C; Mateu, E; González-Cabo, P; Baiget, M; Doménech, M; Bernal, S; Ayuso, C; García-Sandoval, B; Trujillo, M J; Borrego, S; Antiñolo, G; Carballo, M; Nájera, C

    2000-06-01

    The Usher syndrome (USH) is a group of autosomal recessive diseases characterized by congenital sensorineural hearing loss and retinitis pigmentosa. Three clinically distinct forms of Usher syndrome have so far been recognized and can be distinguished from one another by assessing auditory and vestibular function. Usher syndrome type II (USH2) patients have congenital moderate-to-severe nonprogressive hearing loss, retinitis pigmentosa, and normal vestibular function. Genetic linkage studies have revealed genetic heterogeneity among the three types of USH, with the majority of USH2 families showing linkage to the USH2A locus in 1q41. The USH2A gene (MIM 276901) has been identified: three mutations, 2314delG, 2913delG, and 4353-54delC, were initially reported in USH2A patients, the most frequent of which is the 2314delG mutation. It has been reported that this mutation can give rise to typical and atypical USH2 phenotypes. USH2 cases represent 62% of all USH cases in the Spanish population, and 95% of these cases have provided evidence of linkage to the USH2A locus. In the present study, the three reported mutations were analyzed in 59 Spanish families with a diagnosis of USH type II. The 2314delG was the only mutation identified in our population: it was detected in 25% of families and 16% of USH2 chromosomes analyzed. This study attempts to estimate the prevalence of this common mutation in a homogeneous Spanish population.

  19. Identification of biomarkers for the antiangiogenic and antitumour activity of the superoxide dismutase 1 (SOD1) inhibitor tetrathiomolybdate (ATN-224)

    PubMed Central

    Doñate, F; Juarez, J C; Burnett, M E; Manuia, M M; Guan, X; Shaw, D E; Smith, E L P; Timucin, C; Braunstein, M J; Batuman, O A; Mazar, A P

    2008-01-01

    Tetrathiomolybdate (choline salt; ATN-224), a specific, high-affinity copper binder, is currently being evaluated in several phase II cancer trials. ATN-224 inhibits CuZn superoxide dismutase 1 (SOD1) leading to antiangiogenic and antitumour effects. The pharmacodynamics of tetrathiomolybdate has been followed by tracking ceruloplasmin (Cp), a biomarker for systemic copper. However, at least in mice, the inhibition of angiogenesis occurs before a measurable decrease in systemic copper is observed. Thus, the identification and characterisation of other biomarkers to follow the activity of ATN-224 in the clinic is of great interest. Here, we present the preclinical evaluation of two potential biomarkers for the activity of ATN-224: (i) SOD activity measurements in blood cells in mice and (ii) levels of endothelial progenitor cells (EPCs) in bonnet macaques treated with ATN-224. The superoxide dismutase activity in blood cells in mice is rapidly inhibited by ATN-224 treatment at doses at which angiogenesis is maximally inhibited. Furthermore, ATN-224 dosing in bonnet macaques causes a profound and reversible decrease in EPCs without significant toxicity. Thus, both SOD activity measurements and levels of EPCs may be useful biomarkers of the antiangiogenic activity of ATN-224 to be used in its clinical development. PMID:18253124

  20. A CACNA1D mutation in a patient with persistent hyperinsulinaemic hypoglycaemia, heart defects, and severe hypotonia.

    PubMed

    Flanagan, S E; Vairo, F; Johnson, M B; Caswell, R; Laver, T W; Lango Allen, H; Hussain, K; Ellard, S

    2017-06-01

    Congenital hyperinsulinaemic hypoglycaemia (HH) can occur in isolation or it may present as part of a wider syndrome. For approximately 40%-50% of individuals with this condition, sequence analysis of the known HH genes identifies a causative mutation. Identifying the underlying genetic aetiology in the remaining cases is important as a genetic diagnosis will inform on recurrence risk, may guide medical management and will provide valuable insights into β-cell physiology. We sequenced the exome of a child with persistent diazoxide-responsive HH, mild aortic insufficiency, severe hypotonia, and developmental delay as well as the unaffected parents. This analysis identified a de novo mutation, p.G403D, in the proband's CACNA1D gene. CACNA1D encodes the main L-type voltage-gated calcium channel in the pancreatic β-cell, a key component of the insulin secretion pathway. The p.G403D mutation had been reported previously as an activating mutation in an individual with primary hyper-aldosteronism, neuromuscular abnormalities, and transient hypoglycaemia. Sequence analysis of the CACNA1D gene in 60 further cases with HH did not identify a pathogenic mutation. Identification of an activating CACNA1D mutation in a second patient with congenital HH confirms the aetiological role of CACNA1D mutations in this disorder. A genetic diagnosis is important as treatment with a calcium channel blocker may be an option for the medical management of this patient. © 2017 The Authors. Pediatric Diabetes published by John Wiley & Sons Ltd.

  1. Splicing mutation in CYP21 associated with delayed presentation of salt-wasting congenital adrenal hyperplasia

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kohn, B.; Patel, S.V.; Pelczar, J.V.

    1995-07-03

    Patients with salt-wasting congenital adrenal hyperplasia (SW-CAH) most commonly carry an A-G transition at nucleotide 656 (nt 656 A{r_arrow}G), causing abnormal splicing of exons 2 and 3 in CYP21, the gene encoding active steroid 21-hydroxylase. Affected infants are severely deficient in cortisol and aldosterone, and usually come to medical attention during the neonatal period. We report on 2 affected boys, homozygous for the nt 656 mutation, who thrived in early infancy, but suffered salt-wasting crises unusually late in infancy, at 3.5 and 5.5 months, respectively. Laboratory studies at presentation showed hyponatremia, hyperkalemia, dehydration, and acidosis; serum aldosterone was low inmore » spite of markedly elevated plasma renin activity. Basal 17-hydroxyprogesterone levels were only moderately elevated, yet the stimulated levels were more typical of severe, classic CAH due to 21-hydroxylase deficiency. Genomic DNA from the patients was analyzed. Southern blot showed no major deletions or rearrangements. CYP21-specific amplification by polymerase chain reaction, coupled with allele-specific hybridization using wild-type and mutant probes at each of 9 sites for recognized disease-causing mutations, revealed a single, homozygous mutation in each patient: nt 656 A{r_arrow}G. These results were confirmed by sequence analysis. We conclude that the common nt 656 A{r_arrow}G mutation is sometimes associated with delayed phenotypic expression of SW-CAH. We speculate that variable splicing of the mutant CYP21 may modify the clinical manifestation of this disease. 22 refs., 1 fig., 1 tab.« less

  2. Isocitrate dehydrogenase 1 and 2 mutations in cholangiocarcinoma.

    PubMed

    Kipp, Benjamin R; Voss, Jesse S; Kerr, Sarah E; Barr Fritcher, Emily G; Graham, Rondell P; Zhang, Lizhi; Highsmith, W Edward; Zhang, Jun; Roberts, Lewis R; Gores, Gregory J; Halling, Kevin C

    2012-10-01

    Somatic mutations in isocitrate dehydrogenase 1 and 2 genes are common in gliomas and help stratify patients with brain cancer into histologic and molecular subtypes. However, these mutations are considered rare in other solid tumors. The aims of this study were to determine the frequency of isocitrate dehydrogenase 1 and 2 mutations in cholangiocarcinoma and to assess histopathologic differences between specimens with and without an isocitrate dehydrogenase mutation. We sequenced 94 formalin-fixed, paraffin-embedded cholangiocarcinoma (67 intrahepatic and 27 extrahepatic) assessing for isocitrate dehydrogenase 1 (codon 132) and isocitrate dehydrogenase 2 (codons 140 and 172) mutations. Multiple histopathologic characteristics were also evaluated and compared with isocitrate dehydrogenase 1/2 mutation status. Of the 94 evaluated specimens, 21 (22%) had a mutation including 14 isocitrate dehydrogenase 1 and 7 isocitrate dehydrogenase 2 mutations. Isocitrate dehydrogenase mutations were more frequently observed in intrahepatic cholangiocarcinoma than in extrahepatic cholangiocarcinoma (28% versus 7%, respectively; P = .030). The 14 isocitrate dehydrogenase 1 mutations were R132C (n = 9), R132S (n = 2), R132G (n = 2), and R132L (n = 1). The 7 isocitrate dehydrogenase 2 mutations were R172K (n = 5), R172M (n = 1), and R172G (n = 1). Isocitrate dehydrogenase mutations were more frequently observed in tumors with clear cell change (P < .001) and poorly differentiated histology (P = .012). The results of this study show for the first time that isocitrate dehydrogenase 1 and 2 genes are mutated in cholangiocarcinoma. The results of this study are encouraging because it identifies a new potential target for genotype-directed therapeutic trials and may represent a potential biomarker for earlier detection of cholangiocarcinoma in a subset of cases. Copyright © 2012 Elsevier Inc. All rights reserved.

  3. Identification of ALK germline mutation (3605delG) in pediatric anaplastic medulloblastoma.

    PubMed

    Coco, Simona; De Mariano, Marilena; Valdora, Francesca; Servidei, Tiziana; Ridola, Vita; Andolfo, Immacolata; Oberthuer, André; Tonini, Gian Paolo; Longo, Luca

    2012-10-01

    The anaplastic lymphoma kinase (ALK) gene has been found either rearranged or mutated in several neoplasms such as anaplastic large-cell lymphoma, non-small-cell lung cancer, neuroblastoma and anaplastic thyroid cancer. Medulloblastoma (MB) is an embryonic pediatric cancer arising from nervous system, a tissue in which ALK is expressed during embryonic development. We performed an ALK mutation screening in 52 MBs and we found a novel heterozygous germline deletion of a single base in exon 23 (3605delG) in a case with marked anaplasia. This G deletion results in a frameshift mutation producing a premature stop codon in exon 25 of ALK tyrosine kinase domain. We also screened three human MB cell lines without finding any mutation of ALK gene. Quantitative expression analysis of 16 out of 52 samples showed overexpression of ALK mRNA in three MBs. In the present study, we report the first mutation of ALK found in MB. Moreover, a deletion of ALK gene producing a stop codon has not been detected in human tumors up to now. Further investigations are now required to elucidate whether the truncated form of ALK may have a role in signal transduction.

  4. Triheptanoin Protects Motor Neurons and Delays the Onset of Motor Symptoms in a Mouse Model of Amyotrophic Lateral Sclerosis

    PubMed Central

    Barkl-Luke, Mallory E.; Ngo, Shyuan T.; Thomas, Nicola K.; McDonald, Tanya S.; Borges, Karin

    2016-01-01

    There is increasing evidence that energy metabolism is disturbed in Amyotrophic Lateral Sclerosis (ALS) patients and animal models. Treatment with triheptanoin, the triglyceride of heptanoate, is a promising approach to provide alternative fuel to improve oxidative phosphorylation and aid ATP generation. Heptanoate can be metabolized to propionyl-CoA, which after carboxylation can produce succinyl-CoA and thereby re-fill the tricarboxylic acid (TCA) cycle (anaplerosis). Here we tested the hypothesis that treatment with triheptanoin prevents motor neuron loss and delays the onset of disease symptoms in female mice overexpressing the mutant human SOD1G93A (hSOD1G93A) gene. When oral triheptanoin (35% of caloric content) was initiated at P35, motor neuron loss at 70 days of age was attenuated by 33%. In untreated hSOD1G93A mice, the loss of hind limb grip strength began at 16.7 weeks. Triheptanoin maintained hind limb grip strength for 2.8 weeks longer (p<0.01). Loss of balance on the rotarod and reduction of body weight were delayed by 13 and 11 days respectively (both p<0.01). Improved motor function occurred in parallel with alterations in the expression of genes associated with muscle metabolism. In gastrocnemius muscles, the mRNA levels of pyruvate, 2-oxoglutarate and succinate dehydrogenases and methyl-malonyl mutase were reduced by 24–33% in 10 week old hSOD1G93A mice when compared to wild-type mice, suggesting that TCA cycling in skeletal muscle may be slowed in this ALS mouse model at a stage when muscle strength is still normal. At 25 weeks of age, mRNA levels of succinate dehydrogenases, glutamic pyruvic transaminase 2 and the propionyl carboxylase β subunit were reduced by 69–84% in control, but not in triheptanoin treated hSOD1G93A animals. Taken together, our results suggest that triheptanoin slows motor neuron loss and the onset of motor symptoms in ALS mice by improving TCA cycling. PMID:27564703

  5. Atomic structures of corkscrew-forming segments of SOD1 reveal varied oligomer conformations.

    PubMed

    Sangwan, Smriti; Sawaya, Michael R; Murray, Kevin A; Hughes, Michael P; Eisenberg, David S

    2018-02-17

    The aggregation cascade of disease-related amyloidogenic proteins, terminating in insoluble amyloid fibrils, involves intermediate oligomeric states. The structural and biochemical details of these oligomers have been largely unknown. Here we report crystal structures of variants of the cytotoxic oligomer-forming segment residues 28-38 of the ALS-linked protein, SOD1. The crystal structures reveal three different architectures: corkscrew oligomeric structure, nontwisting curved sheet structure and a steric zipper proto-filament structure. Our work highlights the polymorphism of the segment 28-38 of SOD1 and identifies the molecular features of amyloidogenic entities. © 2018 The Protein Society.

  6. Analysis of alkaptonuria (AKU) mutations and polymorphisms reveals that the CCC sequence motif is a mutational hot spot in the homogentisate 1,2 dioxygenase gene (HGO).

    PubMed Central

    Beltrán-Valero de Bernabé, D; Jimenez, F J; Aquaron, R; Rodríguez de Córdoba, S

    1999-01-01

    We recently showed that alkaptonuria (AKU) is caused by loss-of-function mutations in the homogentisate 1,2 dioxygenase gene (HGO). Herein we describe haplotype and mutational analyses of HGO in seven new AKU pedigrees. These analyses identified two novel single-nucleotide polymorphisms (INV4+31A-->G and INV11+18A-->G) and six novel AKU mutations (INV1-1G-->A, W60G, Y62C, A122D, P230T, and D291E), which further illustrates the remarkable allelic heterogeneity found in AKU. Reexamination of all 29 mutations and polymorphisms thus far described in HGO shows that these nucleotide changes are not randomly distributed; the CCC sequence motif and its inverted complement, GGG, are preferentially mutated. These analyses also demonstrated that the nucleotide substitutions in HGO do not involve CpG dinucleotides, which illustrates important differences between HGO and other genes for the occurrence of mutation at specific short-sequence motifs. Because the CCC sequence motifs comprise a significant proportion (34.5%) of all mutated bases that have been observed in HGO, we conclude that the CCC triplet is a mutational hot spot in HGO. PMID:10205262

  7. Prothrombin polymorphism A19911G, factor V HR2 haplotype A4070G, and plasminogen activator-inhibitor-1 polymorphism 4G/5G and the risk of retinal vein occlusion.

    PubMed

    Kuhli-Hattenbach, Claudia; Hellstern, Peter; Nägler, Dorit Karin; Kohnen, Thomas; Hattenbach, Lars-Olof

    2017-01-01

    Thus far, no data has become available to evaluate systematically the prevalences of prothrombin polymorphism A19911G (PT A19911G), factor V HR2 haplotype A4070G (FV A4070G), or plasminogen activator-inhibitor-1 polymorphism 4G/5G (PAI-1 4G/5G) in patients who develop retinal vein occlusion (RVO) without cardiovascular risk factors. We retrospectively evaluated comprehensive thrombophilia data from 42 preselected RVO patients without cardiovascular risk factors. The prevalences of different gene mutations and polymorphisms including factor V Leiden mutation G1691A (FVL), FV A4070G, prothrombin mutation G20210A, PT A19911G, and PAI-1 4G/5G were compared with 241 healthy controls matched for age and sex. A total of 20 patients (47.7%) were found to carry thrombophilic gene polymorphisms including FVL, FV A4070G, and homozygous PT A19911G compared with 72 of 241 controls (29.9%; p = 0.03). Subgroup analysis of patients with a significant personal or family history of thromboembolism revealed a high prevalence of FVL, FV A4070G, and homozygous PT A19911G (p = 0.005). FV A4070G was found to be significantly associated with at least two other heterozygous or one homozygous gene polymorphisms (p = 0.02). Multivariate analysis revealed the presence of FVL (p = 0.0017) and homozygous PT A19911G (p = 0.03) polymorphism as independent risk factors for the development of RVO. Our results indicate that in selected RVO patients screening for thrombophilic gene polymorphisms including FVL, FV A4070G and homozygous PT G19911A may be helpful in a high percentage of cases. Our findings suggest that hereditary thrombophilia associated with RVO is more likely to be multigenic than caused by any single risk factor.

  8. A Hypomorphic RAG1 Mutation Resulting in a Phenotype Resembling Common Variable Immunodeficiency

    PubMed Central

    Abolhassani, Hassan; Wang, Ning; Aghamohammadi, Asghar; Rezaei, Nima; Lee, Yu Nee; Frugoni, Francesco; Notrangelo, Luigi D.; Pan-Hammarström, Qiang; Hammarström, Lennart

    2014-01-01

    Background RAG1 deficiency presents a varied spectrum of combined immunodeficiency, ranging from a T−B−NK+type of disease to a T+B+NK+ phenotype. Objective To assess the genetic background of common variable immunodeficiency (CVID) patients. Methods A patient diagnosed with CVID, who was born in a consanguineous family and thus would be expected to show an autosomal recessive inheritance, was subjected to clinical evaluation, immunological assays, homozygosity gene mapping, exome sequencing, Sanger sequencing and functional analysis. Results The 14-year-old patient, who suffered from liver granuloma, extranodal marginal zone B cell lymphoma and autoimmune neutropenia, is presented with a clinical picture resembling CVID. Genetic analysis of this patient showed a homozygous hypomorphic RAG1 mutation (c.1073 G>A, p.C358Y) with a residual functional capacity of 48% of wild-type protein. Conclusion Our finding broadens the range of disorders associated with RAG1 mutations and may have important therapeutic implications. PMID:24996264

  9. Somatic overgrowth associated with homozygous mutations in both MAN1B1 and SEC23A

    PubMed Central

    Gupta, Swati; Fahiminiya, Somayyeh; Wang, Tracy; Dempsey Nunez, Laura; Rosenblatt, David S.; Gibson, William T.; Gilfix, Brian; Bergeron, John J. M.; Jerome-Majewska, Loydie A.

    2016-01-01

    Using whole-exome sequencing, we identified homozygous mutations in two unlinked genes, SEC23A c.1200G>C (p.M400I) and MAN1B1 c.1000C>T (p.R334C), associated with congenital birth defects in two patients from a consanguineous family. Patients presented with carbohydrate-deficient transferrin, tall stature, obesity, macrocephaly, and maloccluded teeth. The parents were healthy heterozygous carriers for both mutations and an unaffected sibling with tall stature carried the heterozygous mutation in SEC23A only. Mutations in SEC23A are responsible for craniolenticosultura dysplasia (CLSD). CLSD patients are short, have late-closing fontanels, and have reduced procollagen (pro-COL1A1) secretion because of abnormal pro-COL1A1 retention in the endoplasmic reticulum (ER). The mutation we identified in MAN1B1 was previously associated with reduced MAN1B1 protein and congenital disorders of glycosylation (CDG). CDG patients are also short, are obese, and have abnormal glycan remodeling. Molecular analysis of fibroblasts from the family revealed normal levels of SEC23A in all cells and reduced levels of MAN1B1 in cells with heterozygous or homozygous mutations in SEC23A and MAN1B1. Secretion of pro-COL1A1 was increased in fibroblasts from the siblings and patients, and pro-COL1A1 was retained in Golgi of heterozygous and homozygous mutant cells, although intracellular pro-COL1A1 was increased in patient fibroblasts only. We postulate that increased pro-COL1A1 secretion is responsible for tall stature in these patients and an unaffected sibling, and not previously discovered in patients with mutations in either SEC23A or MAN1B1. The patients in this study share biochemical and cellular characteristics consistent with mutations in MAN1B1 and SEC23A, indicating a digenic disease. PMID:27148587

  10. Caprylic Triglyceride as a Novel Therapeutic Approach to Effectively Improve the Performance and Attenuate the Symptoms Due to the Motor Neuron Loss in ALS Disease

    PubMed Central

    Zhao, Wei; Varghese, Merina; Vempati, Prashant; Dzhun, Anastasiya; Cheng, Alice; Wang, Jun; Lange, Dale; Bilski, Amanda; Faravelli, Irene; Pasinetti, Giulio Maria

    2012-01-01

    Amyotrophic lateral sclerosis (ALS) is a neurodegenerative disorder of motor neurons causing progressive muscle weakness, paralysis, and finally death. ALS patients suffer from asthenia and their progressive weakness negatively impacts quality of life, limiting their daily activities. They have impaired energy balance linked to lower activity of mitochondrial electron transport chain enzymes in ALS spinal cord, suggesting that improving mitochondrial function may present a therapeutic approach for ALS. When fed a ketogenic diet, the G93A ALS mouse shows a significant increase in serum ketones as well as a significantly slower progression of weakness and lower mortality rate. In this study, we treated SOD1-G93A mice with caprylic triglyceride, a medium chain triglyceride that is metabolized into ketone bodies and can serve as an alternate energy substrate for neuronal metabolism. Treatment with caprylic triglyceride attenuated progression of weakness and protected spinal cord motor neuron loss in SOD1-G93A transgenic animals, significantly improving their performance even though there was no significant benefit regarding the survival of the ALS transgenic animals. We found that caprylic triglyceride significantly promoted the mitochondrial oxygen consumption rate in vivo. Our results demonstrated that caprylic triglyceride alleviates ALS-type motor impairment through restoration of energy metabolism in SOD1-G93A ALS mice, especially during the overt stage of the disease. These data indicate the feasibility of using caprylic acid as an easily administered treatment with a high impact on the quality of life of ALS patients. PMID:23145119

  11. Caprylic triglyceride as a novel therapeutic approach to effectively improve the performance and attenuate the symptoms due to the motor neuron loss in ALS disease.

    PubMed

    Zhao, Wei; Varghese, Merina; Vempati, Prashant; Dzhun, Anastasiya; Cheng, Alice; Wang, Jun; Lange, Dale; Bilski, Amanda; Faravelli, Irene; Pasinetti, Giulio Maria

    2012-01-01

    Amyotrophic lateral sclerosis (ALS) is a neurodegenerative disorder of motor neurons causing progressive muscle weakness, paralysis, and finally death. ALS patients suffer from asthenia and their progressive weakness negatively impacts quality of life, limiting their daily activities. They have impaired energy balance linked to lower activity of mitochondrial electron transport chain enzymes in ALS spinal cord, suggesting that improving mitochondrial function may present a therapeutic approach for ALS. When fed a ketogenic diet, the G93A ALS mouse shows a significant increase in serum ketones as well as a significantly slower progression of weakness and lower mortality rate. In this study, we treated SOD1-G93A mice with caprylic triglyceride, a medium chain triglyceride that is metabolized into ketone bodies and can serve as an alternate energy substrate for neuronal metabolism. Treatment with caprylic triglyceride attenuated progression of weakness and protected spinal cord motor neuron loss in SOD1-G93A transgenic animals, significantly improving their performance even though there was no significant benefit regarding the survival of the ALS transgenic animals. We found that caprylic triglyceride significantly promoted the mitochondrial oxygen consumption rate in vivo. Our results demonstrated that caprylic triglyceride alleviates ALS-type motor impairment through restoration of energy metabolism in SOD1-G93A ALS mice, especially during the overt stage of the disease. These data indicate the feasibility of using caprylic acid as an easily administered treatment with a high impact on the quality of life of ALS patients.

  12. Increased expression of microRNA-29a in ALS mice: functional analysis of its inhibition.

    PubMed

    Nolan, Katie; Mitchem, Mollie R; Jimenez-Mateos, Eva M; Henshall, David C; Concannon, Caoimhín G; Prehn, Jochen H M

    2014-06-01

    Endoplasmic reticulum (ER) stress has been implicated in a number of neurodegenerative diseases such as amyotrophic lateral sclerosis (ALS). MicroRNAs are small ribonucleic acids which can modulate protein expression by binding to the 3'UTR of target mRNAs. We recently identified increased miR-29a expression in response to ER stress in neurons, with members of the miR-29 family implicated in cancer and neurodegeneration. We found high expression of miR-29a in the mouse brain and spinal cord by quantitative PCR analysis and increased expression of miR-29a in the spinal cord of SOD1(G93A) transgenic mice, a mouse model of familial ALS. In situ hybridisation experiments revealed increased miR-29a expression in the lumbar spinal cord of SOD1(G93A) transgenic mice from postnatal day 70 onward when compared to wild-type mice. miR-29a knockdown was achieved in the CNS in vivo after a single intracerebroventricular injection of a miR-29a-specific antagomir. While analysis of disease progression and motor function could not identify a significant alteration in ALS disease manifestations, a trend towards increased lifespan was observed in male SOD1(G93A) mice. These findings demonstrate that miR-29a may act as a marker for disease progression in SOD1(G93A) mice, and provide first proof-of-concept for a therapeutic modulation of miR-29a function in ALS.

  13. hOGG1 Ser326Cys polymorphism and G:C-to-T:A mutations: no evidence for a role in tobacco-related non small cell lung cancer.

    PubMed

    Hu, Ying Chuan; Ahrendt, Steven A

    2005-04-10

    Human 8-oxoguanine DNA glycosylase 1 (hOGG1) plays a major role in the repair of 8-hydroxyguanine, one of the major forms of DNA damage generated by reactive oxygen species in tobacco smoke. If left unrepaired by hOGG1, 8-hydroxyguanine can produce G:C-to-T:A transversions. Recent studies have suggested that the hOGG1 Ser326Cys polymorphism is associated with both a decrease in enzyme activity and an increased risk of lung cancer. To define the interaction between tobacco carcinogens, hOGG1-mediated DNA repair and DNA damage, we examined the role of the hOGG1 Ser326Cys polymorphism in mutation of the p53 gene in non small cell lung cancer (NSCLC). Tumor and nonneoplastic DNA were collected from 141 cigarette smokers with NSCLC. p53 mutations were detected by direct dideoxy sequencing and/or the GeneChip p53 assay in 74 of the 141 (52%) tumors. hOGG1 codon 326 polymorphisms were identified by polymerase chain reaction-restriction fragment length polymorphism analysis. The distribution of hOGG1 codon 326 genotypes was Ser/Ser, 90 of 141 (64%); Ser/Cys, 45 of 141 (32%); and Cys/Cys, 6 of 141 (4%). p53 mutations were significantly (p = 0.04) less common in NSCLC from patients with codon 326 Ser/Cys or Cys/Cys genotypes (21 of 51; 41%) than in NSCLC from Ser/Ser homozygotes (53 of 90; 59%). The decrease in p53 mutation frequency among carriers of the Cys allele was more evident in lung squamous cell cancer [7 of 17 (41%) for Cys/Cys and Ser/Cys vs. 27 of 38 (71%) for Ser/Ser; p = 0.04] than in nonbronchoalveolar adenocarcinoma [11 of 26 (42%) for Cys/Cys and Ser/Cys vs. 20 of 35 (57%) for Ser/Ser; p = 0.25]. The prevalence of G:C-to-T:A transversions was similar among hOGG1 codon 326 genotypes. In summary, the hOGG1 codon 326 Cys allele was associated with a decrease in p53 mutations and no effect on G:C-to-T:A transversions in NSCLC. This decrease in p53 mutations in vivo is not consistent with a decrease in the repair of 8-hydroxyguanine among carriers of the hOGG1

  14. A novel RLBP1 gene geographical area-related mutation present in a young patient with retinitis punctata albescens.

    PubMed

    Scimone, Concetta; Donato, Luigi; Esposito, Teresa; Rinaldi, Carmela; D'Angelo, Rosalia; Sidoti, Antonina

    2017-08-01

    Autosomal recessive forms of retinitis punctata albescens (RPA) have been described. RPA is characterized by progressive retinal degeneration due to alteration in visual cycle and consequent deposit of photopigments in retinal pigment epithelium. Five loci have been linked to RPA onset. Among these, the retinaldehyde-binding protein 1 gene, RLBP1, is the most frequently involved and several founder mutations were reported. We report results of a genetic molecular investigation performed on a large Sicilian family in which appears a young woman with RPA. The proband is in homozygous condition for a novel RLBP1 single-pair deletion, and her healthy parents, both heterozygous, are not consanguineous. Thenovelc.398delC (p.P133Qfs*258) involves the exon 6 and leads to a premature stop codon, resulting in a truncated protein entirely missing of CRAL-TRIO lipid-binding domain. Pedigree analysis showed other non-consanguineous relatives heterozygous for the same mutation in the family. Extension of mutation research in the native town of the proband revealed its presence also in healthy subjects, in a heterozygous condition. A novel RLBP1 truncating mutation was detected in a young girl affected by RPA. Although her parents are not consanguineous, the mutation was observed in a homozygous condition. Being them native of the same small Sicilian town of Fiumedinisi, the hypothesis of a geographical area-related mutation was assessed and confirmed.

  15. P-loop conformation governed crizotinib resistance in G2032R-mutated ROS1 tyrosine kinase: clues from free energy landscape.

    PubMed

    Sun, Huiyong; Li, Youyong; Tian, Sheng; Wang, Junmei; Hou, Tingjun

    2014-07-01

    Tyrosine kinases are regarded as excellent targets for chemical drug therapy of carcinomas. However, under strong purifying selection, drug resistance usually occurs in the cancer cells within a short term. Many cases of drug resistance have been found to be associated with secondary mutations in drug target, which lead to the attenuated drug-target interactions. For example, recently, an acquired secondary mutation, G2032R, has been detected in the drug target, ROS1 tyrosine kinase, from a crizotinib-resistant patient, who responded poorly to crizotinib within a very short therapeutic term. It was supposed that the mutation was located at the solvent front and might hinder the drug binding. However, a different fact could be uncovered by the simulations reported in this study. Here, free energy surfaces were characterized by the drug-target distance and the phosphate-binding loop (P-loop) conformational change of the crizotinib-ROS1 complex through advanced molecular dynamics techniques, and it was revealed that the more rigid P-loop region in the G2032R-mutated ROS1 was primarily responsible for the crizotinib resistance, which on one hand, impaired the binding of crizotinib directly, and on the other hand, shortened the residence time induced by the flattened free energy surface. Therefore, both of the binding affinity and the drug residence time should be emphasized in rational drug design to overcome the kinase resistance.

  16. A Novel MAPT Mutation, G55R, in a Frontotemporal Dementia Patient Leads to Altered Tau Function

    PubMed Central

    Guzman, Elmer; Barczak, Anna; Chodakowska-Żebrowska, Małgorzata; Barcikowska, Maria; Feinstein, Stuart

    2013-01-01

    Over two dozen mutations in the gene encoding the microtubule associated protein tau cause a variety of neurodegenerative dementias known as tauopathies, including frontotemporal dementia (FTD), PSP, CBD and Pick's disease. The vast majority of these mutations map to the C-terminal region of tau possessing microtubule assembly and microtubule dynamics regulatory activities as well as the ability to promote pathological tau aggregation. Here, we describe a novel and non-conservative tau mutation (G55R) mapping to an alternatively spliced exon encoding part of the N-terminal region of the protein in a patient with the behavioral variant of FTD. Although less well understood than the C-terminal region of tau, the N-terminal region can influence both MT mediated effects as well as tau aggregation. The mutation changes an uncharged glycine to a basic arginine in the midst of a highly conserved and very acidic region. In vitro, 4-repeat G55R tau nucleates microtubule assembly more effectively than wild-type 4-repeat tau; surprisingly, this effect is tau isoform specific and is not observed in a 3-repeat G55R tau versus 3-repeat wild-type tau comparison. In contrast, the G55R mutation has no effect upon the abilities of tau to regulate MT growing and shortening dynamics or to aggregate. Additionally, the mutation has no effect upon kinesin translocation in a microtubule gliding assay. Together, (i) we have identified a novel tau mutation mapping to a mutation deficient region of the protein in a bvFTD patient, and (ii) the G55R mutation affects the ability of tau to nucleate microtubule assembly in vitro in a 4-repeat tau isoform specific manner. This altered capability could markedly affect in vivo microtubule function and neuronal cell biology. We consider G55R to be a candidate mutation for bvFTD since additional criteria required to establish causality are not yet available for assessment. PMID:24086739

  17. A novel de novo mutation in ATP1A3 and childhood-onset schizophrenia

    PubMed Central

    Smedemark-Margulies, Niklas; Brownstein, Catherine A.; Vargas, Sigella; Tembulkar, Sahil K.; Towne, Meghan C.; Shi, Jiahai; Gonzalez-Cuevas, Elisa; Liu, Kevin X.; Bilguvar, Kaya; Kleiman, Robin J.; Han, Min-Joon; Torres, Alcy; Berry, Gerard T.; Yu, Timothy W.; Beggs, Alan H.; Agrawal, Pankaj B.; Gonzalez-Heydrich, Joseph

    2016-01-01

    We describe a child with onset of command auditory hallucinations and behavioral regression at 6 yr of age in the context of longer standing selective mutism, aggression, and mild motor delays. His genetic evaluation included chromosomal microarray analysis and whole-exome sequencing. Sequencing revealed a previously unreported heterozygous de novo mutation c.385G>A in ATP1A3, predicted to result in a p.V129M amino acid change. This gene codes for a neuron-specific isoform of the catalytic α-subunit of the ATP-dependent transmembrane sodium–potassium pump. Heterozygous mutations in this gene have been reported as causing both sporadic and inherited forms of alternating hemiplegia of childhood and rapid-onset dystonia parkinsonism. We discuss the literature on phenotypes associated with known variants in ATP1A3, examine past functional studies of the role of ATP1A3 in neuronal function, and describe a novel clinical presentation associated with mutation of this gene. PMID:27626066

  18. Anatomic & metabolic brain markers of the m.3243A>G mutation: A multi-parametric 7T MRI study.

    PubMed

    Haast, Roy A M; Ivanov, Dimo; IJsselstein, Rutger J T; Sallevelt, Suzanne C E H; Jansen, Jacobus F A; Smeets, Hubert J M; de Coo, Irenaeus F M; Formisano, Elia; Uludağ, Kâmil

    2018-01-01

    One of the most common mitochondrial DNA (mtDNA) mutations, the A to G transition at base pair 3243, has been linked to changes in the brain, in addition to commonly observed hearing problems, diabetes and myopathy. However, a detailed quantitative description of m.3243A>G patients' brains has not been provided so far. In this study, ultra-high field MRI at 7T and volume- and surface-based data analyses approaches were used to highlight morphology (i.e. atrophy)-, microstructure (i.e. myelin and iron concentration)- and metabolism (i.e. cerebral blood flow)-related differences between patients (N = 22) and healthy controls (N = 15). The use of quantitative MRI at 7T allowed us to detect subtle changes of biophysical processes in the brain with high accuracy and sensitivity, in addition to typically assessed lesions and atrophy. Furthermore, the effect of m.3243A>G mutation load in blood and urine epithelial cells on these MRI measures was assessed within the patient population and revealed that blood levels were most indicative of the brain's state and disease severity, based on MRI as well as on neuropsychological data. Morphometry MRI data showed a wide-spread reduction of cortical, subcortical and cerebellar gray matter volume, in addition to significantly enlarged ventricles. Moreover, surface-based analyses revealed brain area-specific changes in cortical thickness (e.g. of the auditory cortex), and in T 1 , T 2 * and cerebral blood flow as a function of mutation load, which can be linked to typically m.3243A>G-related clinical symptoms (e.g. hearing impairment). In addition, several regions linked to attentional control (e.g. middle frontal gyrus), the sensorimotor network (e.g. banks of central sulcus) and the default mode network (e.g. precuneus) were characterized by alterations in cortical thickness, T 1 , T 2 * and/or cerebral blood flow, which has not been described in previous MRI studies. Finally, several hypotheses, based either on vascular

  19. A Mouse Model of Familial ALS Has Increased CNS Levels of Endogenous Ubiquinol9/10 and Does Not Benefit from Exogenous Administration of Ubiquinol10

    PubMed Central

    Lucchetti, Jacopo; Marino, Marianna; Papa, Simonetta; Tortarolo, Massimo; Guiso, Giovanna; Pozzi, Silvia; Bonetto, Valentina; Caccia, Silvio; Beghi, Ettore; Bendotti, Caterina; Gobbi, Marco

    2013-01-01

    Oxidative stress and mitochondrial impairment are the main pathogenic mechanisms of Amyotrophic Lateral Sclerosis (ALS), a severe neurodegenerative disease still lacking of effective therapy. Recently, the coenzyme-Q (CoQ) complex, a key component of mitochondrial function and redox-state modulator, has raised interest for ALS treatment. However, while the oxidized form ubiquinone10 was ineffective in ALS patients and modestly effective in mouse models of ALS, no evidence was reported on the effect of the reduced form ubiquinol10, which has better bioavailability and antioxidant properties. In this study we compared the effects of ubiquinone10 and a new stabilized formulation of ubiquinol10 on the disease course of SOD1G93A transgenic mice, an experimental model of fALS. Chronic treatments (800 mg/kg/day orally) started from the onset of disease until death, to mimic the clinical trials that only include patients with definite ALS symptoms. Although the plasma levels of CoQ10 were significantly increased by both treatments (from <0.20 to 3.0–3.4 µg/mL), no effect was found on the disease progression and survival of SOD1G93A mice. The levels of CoQ10 in the brain and spinal cord of ubiquinone10- or ubiquinol10-treated mice were only slightly higher (≤10%) than the endogenous levels in vehicle-treated mice, indicating poor CNS availability after oral dosing and possibly explaining the lack of pharmacological effects. To further examine this issue, we measured the oxidized and reduced forms of CoQ9/10 in the plasma, brain and spinal cord of symptomatic SOD1G93A mice, in comparison with age-matched SOD1WT. Levels of ubiquinol9/10, but not ubiquinone9/10, were significantly higher in the CNS, but not in plasma, of SOD1G93A mice, suggesting that CoQ redox system might participate in the mechanisms trying to counteract the pathology progression. Therefore, the very low increases of CoQ10 induced by oral treatments in CNS might be not sufficient to provide significant

  20. CHEK2 mutation and risk of prostate cancer: a systematic review and meta-analysis

    PubMed Central

    Wang, Yue; Dai, Bo; Ye, Dingwei

    2015-01-01

    Background: CHEK2 encodes for a G2 checkpoint kinase which plays a critical role in DNA repair. Its mutation confers an increased risk of breast cancer. It has also been suggested to increase risks of prostate cancer, but its involvement with this type of cancer has not been confirmed. Methods: We performed a systematic review and meta-analysis to clarify the association between CHEK2 1100delC, IVS2+1G>A, I157T mutation and risk of Prostate Cancer. A comprehensive, computerized literature search of PubMed until December 27, 2014 was carried out. Eligible studies were included according to specific inclusion criteria. Pooled hazard ratio was estimated using the fixed effects model or random effects model according to heterogeneity between studies. Results: Eight eligible studies were included in the analysis, all were retrospective studies. The overall meta-analysis demonstrated that the CHEK2 1100delC mutation (OR 3.29; 95% confidence interval: 1.85-5.85; P = 0.00) and I157T missense mutation (OR 1.80; 95% confidence interval: 1.51-2.14; P = 0.00) was associated with higher risk of Prostate Cancer, and CHEK2 1100delC mutation is irrelevant to familial aggregation phenomenon of prostate cancer (OR 1.59; 95% confidence interval: 0.79-3.20; P = 0.20). The IVS2+1G>A mutation is also irrelevant to Prostate Cancer (OR = 1.59, 95% CI = 0.93-2.71, P = 0.09). None of the single studies materially altered the original results and no evidence of publication bias was found. Conclusion: CHEK2 1100delC mutation and I157T missense mutation in males indicates higher risk of Prostate Cancer, but there’s no evidence to prove the CHEK2 1100delC mutation was associated with Familial prostate cancer. PMID:26629066

  1. CHEK2 mutation and risk of prostate cancer: a systematic review and meta-analysis.

    PubMed

    Wang, Yue; Dai, Bo; Ye, Dingwei

    2015-01-01

    CHEK2 encodes for a G2 checkpoint kinase which plays a critical role in DNA repair. Its mutation confers an increased risk of breast cancer. It has also been suggested to increase risks of prostate cancer, but its involvement with this type of cancer has not been confirmed. We performed a systematic review and meta-analysis to clarify the association between CHEK2 1100delC, IVS2+1G>A, I157T mutation and risk of Prostate Cancer. A comprehensive, computerized literature search of PubMed until December 27, 2014 was carried out. Eligible studies were included according to specific inclusion criteria. Pooled hazard ratio was estimated using the fixed effects model or random effects model according to heterogeneity between studies. Eight eligible studies were included in the analysis, all were retrospective studies. The overall meta-analysis demonstrated that the CHEK2 1100delC mutation (OR 3.29; 95% confidence interval: 1.85-5.85; P = 0.00) and I157T missense mutation (OR 1.80; 95% confidence interval: 1.51-2.14; P = 0.00) was associated with higher risk of Prostate Cancer, and CHEK2 1100delC mutation is irrelevant to familial aggregation phenomenon of prostate cancer (OR 1.59; 95% confidence interval: 0.79-3.20; P = 0.20). The IVS2+1G>A mutation is also irrelevant to Prostate Cancer (OR = 1.59, 95% CI = 0.93-2.71, P = 0.09). None of the single studies materially altered the original results and no evidence of publication bias was found. CHEK2 1100delC mutation and I157T missense mutation in males indicates higher risk of Prostate Cancer, but there's no evidence to prove the CHEK2 1100delC mutation was associated with Familial prostate cancer.

  2. Altered Pre-mRNA Splicing Caused by a Novel Intronic Mutation c.1443+5G>A in the Dihydropyrimidinase (DPYS) Gene

    PubMed Central

    Nakajima, Yoko; Meijer, Judith; Zhang, Chunhua; Wang, Xu; Kondo, Tomomi; Ito, Tetsuya; Dobritzsch, Doreen; Van Kuilenburg, André B. P.

    2016-01-01

    Dihydropyrimidinase (DHP) deficiency is an autosomal recessive disease caused by mutations in the DPYS gene. Patients present with highly elevated levels of dihydrouracil and dihydrothymine in their urine, blood and cerebrospinal fluid. The analysis of the effect of mutations in DPYS on pre-mRNA splicing is hampered by the fact that DHP is primarily expressed in liver and kidney cells. The minigene approach can detect mRNA splicing aberrations using cells that do not express the endogenous mRNA. We have used a minigene-based approach to analyze the effects of a presumptive pre-mRNA splicing mutation in two newly identified Chinese pediatric patients with DHP deficiency. Mutation analysis of DPYS showed that both patients were compound heterozygous for a novel intronic mutation c.1443+5G>A in intron 8 and a previously described missense mutation c.1001A>G (p.Q334R) in exon 6. Wild-type and the mutated minigene constructs, containing exons 7, 8 and 9 of DPYS, yielded different splicing products after expression in HEK293 cells. The c.1443+5G>A mutation resulted in altered pre-mRNA splicing of the DPYS minigene construct with full skipping of exon 8. Analysis of the DHP crystal structure showed that the deletion of exon 8 severely affects folding, stability and homooligomerization of the enzyme as well as disruption of the catalytic site. Thus, the analysis suggests that the c.1443+5G>A mutation results in aberrant splicing of the pre-mRNA encoding DHP, underlying the DHP deficiency in two unrelated Chinese patients. PMID:26771602

  3. Molecular Cloning, Characterization and Predicted Structure of a Putative Copper-Zinc SOD from the Camel, Camelus dromedarius

    PubMed Central

    Ataya, Farid S.; Fouad, Dalia; Al-Olayan, Ebtsam; Malik, Ajamaluddin

    2012-01-01

    Superoxide dismutase (SOD) is the first line of defense against oxidative stress induced by endogenous and/or exogenous factors and thus helps in maintaining the cellular integrity. Its activity is related to many diseases; so, it is of importance to study the structure and expression of SOD gene in an animal naturally exposed most of its life to the direct sunlight as a cause of oxidative stress. Arabian camel (one humped camel, Camelus dromedarius) is adapted to the widely varying desert climatic conditions that extremely changes during daily life in the Arabian Gulf. Studying the cSOD1 in C. dromedarius could help understand the impact of exposure to direct sunlight and desert life on the health status of such mammal. The full coding region of a putative CuZnSOD gene of C. dromedarius (cSOD1) was amplified by reverse transcription PCR and cloned for the first time (gene bank accession number for nucleotides and amino acids are JF758876 and AEF32527, respectively). The cDNA sequencing revealed an open reading frame of 459 nucleotides encoding a protein of 153 amino acids which is equal to the coding region of SOD1 gene and protein from many organisms. The calculated molecular weight and isoelectric point of cSOD1 was 15.7 kDa and 6.2, respectively. The level of expression of cSOD1 in different camel tissues (liver, kidney, spleen, lung and testis) was examined using Real Time-PCR. The highest level of cSOD1 transcript was found in the camel liver (represented as 100%) followed by testis (45%), kidney (13%), lung (11%) and spleen (10%), using 18S ribosomal subunit as endogenous control. The deduced amino acid sequence exhibited high similarity with Cebus apella (90%), Sus scrofa (88%), Cavia porcellus (88%), Mus musculus (88%), Macaca mulatta (87%), Pan troglodytes (87%), Homo sapiens (87%), Canis familiaris (86%), Bos taurus (86%), Pongo abelii (85%) and Equus caballus (82%). Phylogenetic analysis revealed that cSOD1 is grouped together with S. scrofa. The

  4. Cetuximab treatment for metastatic colorectal cancer with KRAS p.G13D mutations improves progression-free survival

    PubMed Central

    OSUMI, HIROKI; SHINOZAKI, EIJI; OSAKO, MASAHIKO; KAWAZOE, YOSHIMASA; OBA, MASARU; MISAKA, TAKAHARU; GOTO, TAKASHI; KAMO, HITOMI; SUENAGA, MITSUKUNI; KUMEKAWA, YOSUKE; OGURA, MARIKO; OZAKA, MASATO; MATSUSAKA, SATOSHI; CHIN, KEISHO; HATAKE, KIYOHIKO; MIZUNUMA, NOBUYUKI

    2015-01-01

    : HR=0.29; 95% CI: 0.08–1.10; P=0.07; OS: HR=0.23; 95% CI: 0.04–1.54; P=0.13). In conclusion, treatment with cetuximab may be more clinically beneficial in mCRC patients with a KRAS p.G13D mutation, compared with those harboring other mutations. However, further investigation is required to clearly determine the benefits of cetuximab treatment in patients with KRAS p.G13D mutation-positive mCRC. PMID:26623049

  5. Identification of katG Mutations Associated with High-Level Isoniazid Resistance in Mycobacterium tuberculosis▿ †

    PubMed Central

    Ando, Hiroki; Kondo, Yuji; Suetake, Toshinori; Toyota, Emiko; Kato, Seiya; Mori, Toru; Kirikae, Teruo

    2010-01-01

    Isoniazid (INH) is an effective first-line antituberculosis drug. KatG, a catalase-peroxidase, converts INH to an active form in Mycobacterium tuberculosis, and katG mutations are major causes of INH resistance. In the present study, we sequenced katG of 108 INH-resistant M. tuberculosis clinical isolates. Consequently, 9 novel KatG mutants with a single-amino-acid substitution were found. All of these mutants had significantly lower INH oxidase activities than the wild type, and each mutant showed various levels of activity. Isolates having mutations with relatively low activities showed high-level INH resistance. On the basis of our results and known mutations associated with INH resistance, we developed a new hybridization-based line probe assay for rapid detection of INH-resistant M. tuberculosis isolates. PMID:20211896

  6. Rapid detection of G6PD mutations by multicolor melting curve analysis.

    PubMed

    Xia, Zhongmin; Chen, Ping; Tang, Ning; Yan, Tizhen; Zhou, Yuqiu; Xiao, Qizhi; Huang, Qiuying; Li, Qingge

    2016-09-01

    The MeltPro G6PD assay is the first commercial genetic test for glucose-6-phosphate dehydrogenase (G6PD) deficiency. This multicolor melting curve analysis-based real-time PCR assay is designed to genotype 16 G6PD mutations prevalent in the Chinese population. We comprehensively evaluated both the analytical and clinical performances of this assay. All 16 mutations were accurately genotyped, and the standard deviation of the measured Tm was <0.3°C. The limit of detection was 1.0ng/μL human genomic DNA. The assay could be run on four mainstream models of real-time PCR machines. The shortest running time (150min) was obtained with LightCycler 480 II. A clinical study using 763 samples collected from three hospitals indicated that, of 433 samples with reduced G6PD activity, the MeltPro assay identified 423 samples as mutant, yielding a clinical sensitivity of 97.7% (423/433). Of the 117 male samples with normal G6PD activity, the MeltPro assay confirmed that 116 samples were wild type, yielding a clinical specificity of 99.1% (116/117). Moreover, the MeltPro assay demonstrated 100% concordance with DNA sequencing for all targeted mutations. We concluded that the MeltPro G6PD assay is useful as a diagnostic or screening tool for G6PD deficiency in clinical settings. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Novel compound heterozygous SPTA1 mutations in a patient with hereditary elliptocytosis

    PubMed Central

    Ma, Shiyue; Qin, Jinqiu; Wei, Aiqiu; Li, Xiaohong; Qin, Yuanyuan; Liao, Lin; Lin, Faquan

    2018-01-01

    Hereditaryelliptocytosis (HE) is a hereditary hemolytic disease, characterized by the presence of many elliptical erythrocytes in the peripheral blood that is caused by abnormal cytoskeletal proteins in the erythrocyte membrane. In the present study, a novel, causal HE mutation was reported. Routine blood examinations were performed on the proband and their family, and the fluorescence intensity of eosin-5-maleimide (EMA)-labeled erythrocytes was determined via flow cytometry. Subsequently, DNA was extracted from the peripheral blood of the proband and their family members, and amplified by quantitative polymerase chain reaction. The Sanger sequencing approach was used to determine and identify gene mutations, which were verified by matrix-assisted laser desorption-ionization time of flight (MALDI-TOF) mass spectrometry. To exclude genetic polymorphisms, newly identified mutations were subjected to large-scale gene screening using high-resolution melt analysis. Protein expression levels in the erythrocyte membrane of the proband were determined via SDS-PAGE, which demonstrated that, compared with healthy controls, the proband exhibited a reduction in EMA-labeled erythrocytes. In addition, DNA analysis demonstrated that the proband carried three mutations in the spectrin α chain erythrocytic 1 (SPTA1) gene: c.161A>C, c.5572C>G and 6531-12C>T. The corresponding mutant polypeptides were also analyzed by MALDI-TOF mass spectroscopy. SDS-PAGE analysis indicated that the proband exhibited normal levels of erythrocyte membrane proteins. In the present study, a novel HE case with a His54Pro mutation in the SPTA1 gene was reported. The results suggested that the His54Pro mutation influenced the role of erythrocyte membrane proteins without reducing its level of expression. PMID:29484404

  8. Correction of the consequences of mitochondrial 3243A>G mutation in the MT-TL1 gene causing the MELAS syndrome by tRNA import into mitochondria

    PubMed Central

    Karicheva, Olga Z.; Kolesnikova, Olga A.; Schirtz, Tom; Vysokikh, Mikhail Y.; Mager-Heckel, Anne-Marie; Lombès, Anne; Boucheham, Abdeldjalil; Krasheninnikov, Igor A.; Martin, Robert P.; Entelis, Nina; Tarassov, Ivan

    2011-01-01

    Mutations in human mitochondrial DNA are often associated with incurable human neuromuscular diseases. Among these mutations, an important number have been identified in tRNA genes, including 29 in the gene MT-TL1 coding for the tRNALeu(UUR). The m.3243A>G mutation was described as the major cause of the MELAS syndrome (mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes). This mutation was reported to reduce tRNALeu(UUR) aminoacylation and modification of its anti-codon wobble position, which results in a defective mitochondrial protein synthesis and reduced activities of respiratory chain complexes. In the present study, we have tested whether the mitochondrial targeting of recombinant tRNAs bearing the identity elements for human mitochondrial leucyl-tRNA synthetase can rescue the phenotype caused by MELAS mutation in human transmitochondrial cybrid cells. We demonstrate that nuclear expression and mitochondrial targeting of specifically designed transgenic tRNAs results in an improvement of mitochondrial translation, increased levels of mitochondrial DNA-encoded respiratory complexes subunits, and significant rescue of respiration. These findings prove the possibility to direct tRNAs with changed aminoacylation specificities into mitochondria, thus extending the potential therapeutic strategy of allotopic expression to address mitochondrial disorders. PMID:21724600

  9. Correction of the consequences of mitochondrial 3243A>G mutation in the MT-TL1 gene causing the MELAS syndrome by tRNA import into mitochondria.

    PubMed

    Karicheva, Olga Z; Kolesnikova, Olga A; Schirtz, Tom; Vysokikh, Mikhail Y; Mager-Heckel, Anne-Marie; Lombès, Anne; Boucheham, Abdeldjalil; Krasheninnikov, Igor A; Martin, Robert P; Entelis, Nina; Tarassov, Ivan

    2011-10-01

    Mutations in human mitochondrial DNA are often associated with incurable human neuromuscular diseases. Among these mutations, an important number have been identified in tRNA genes, including 29 in the gene MT-TL1 coding for the tRNA(Leu(UUR)). The m.3243A>G mutation was described as the major cause of the MELAS syndrome (mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes). This mutation was reported to reduce tRNA(Leu(UUR)) aminoacylation and modification of its anti-codon wobble position, which results in a defective mitochondrial protein synthesis and reduced activities of respiratory chain complexes. In the present study, we have tested whether the mitochondrial targeting of recombinant tRNAs bearing the identity elements for human mitochondrial leucyl-tRNA synthetase can rescue the phenotype caused by MELAS mutation in human transmitochondrial cybrid cells. We demonstrate that nuclear expression and mitochondrial targeting of specifically designed transgenic tRNAs results in an improvement of mitochondrial translation, increased levels of mitochondrial DNA-encoded respiratory complexes subunits, and significant rescue of respiration. These findings prove the possibility to direct tRNAs with changed aminoacylation specificities into mitochondria, thus extending the potential therapeutic strategy of allotopic expression to address mitochondrial disorders.

  10. FERMT1 promoter mutations in patients with Kindler syndrome.

    PubMed

    Has, C; Chmel, N; Levati, L; Neri, I; Sonnenwald, T; Pigors, M; Godbole, K; Dudhbhate, A; Bruckner-Tuderman, L; Zambruno, G; Castiglia, D

    2015-09-01

    Mutations in the FERMT1 gene, encoding the focal adhesion protein kindlin-1 underlie the Kindler syndrome (KS), an autosomal recessive skin disorder with a phenotype comprising skin blistering, photosensitivity, progressive poikiloderma with extensive skin atrophy, and propensity to skin cancer. The FERMT1 mutational spectrum comprises gross genomic deletions, splice site, nonsense, and frameshift mutations, which are scattered over the coding region spanning exon 2-15. We now report three KS families with mutations affecting the promoter region of FERMT1. Two of these mutations are large deletions (∼38.0 and 1.9 kb in size) and one is a single nucleotide variant (c.-20A>G) within the 5' untranslated region (UTR). Each mutation resulted in loss of gene expression in patient skin or cultured keratinocytes. Reporter assays showed the functional relevance of the genomic regions deleted in our patients for FERMT1 gene transcription and proved the causal role of the c.-20A>G variant in reducing transcriptional activity. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  11. Expanding sialidosis spectrum by genome-wide screening: NEU1 mutations in adult-onset myoclonus.

    PubMed

    Canafoglia, Laura; Robbiano, Angela; Pareyson, Davide; Panzica, Ferruccio; Nanetti, Lorenzo; Giovagnoli, Anna Rita; Venerando, Anna; Gellera, Cinzia; Franceschetti, Silvana; Zara, Federico

    2014-06-03

    To identify the genetic cause of a familial form of late-onset action myoclonus in 2 unrelated patients. Both probands had 2 siblings displaying a similar disorder. Extensive laboratory examinations, including biochemical assessment for urine sialic acid in the 2 probands, were negative. Exome sequencing was performed in the probands using an Illumina platform. Segregation analysis of putative mutations was performed in all family members by standard Sanger sequencing protocols. NEU1 mutations were detected in 3 siblings of each family with prominent cortical myoclonus presenting in the third decade of life and having a mild and slowly progressive course. They did not have macular cherry-red spot and their urinary sialic acid excretion was within normal values. Genetic analysis demonstrated a homozygous mutation in family 1 (c.200G>T, p.S67I) and 2 compound heterozygous mutations in family 2 (c.679G>A, p.G227R; c.913C>T, p.R305C). Our observation indicates that sialidosis should be suspected and the NEU1 gene analyzed in patients with isolated action myoclonus presenting in adulthood in the absence of other typical clinical and laboratory findings. © 2014 American Academy of Neurology.

  12. In vivo levels of S-adenosylmethionine modulate C:G to T:A mutations associated with repeat-induced point mutation in Neurospora crassa.

    PubMed

    Rosa, Alberto Luis; Folco, Hernán Diego; Mautino, Mario Ricardo

    2004-04-14

    In Neurospora crassa, the mutagenic process termed repeat-induced point mutation (RIP) inactivates duplicated DNA sequences during the sexual cycle by the introduction of C:G to T:A transition mutations. In this work, we have used a collection of N. crassa strains exhibiting a wide range of cellular levels of S-adenosylmethionine (AdoMet), the universal donor of methyl groups, to explore whether frequencies of RIP are dependent on the cellular levels of this metabolite. Mutant strains met-7 and eth-1 carry mutations in genes of the AdoMet pathway and have low levels of AdoMet. Wild type strains with high levels of AdoMet were constructed by introducing a chimeric transgene of the AdoMet synthetase (AdoMet-S) gene fused to the constitutive promoter trpC from Aspergillus nidulans. Crosses of these strains against tester duplications of the pan-2 and am genes showed that frequencies of RIP, as well as the total number of C:G to T:A transition mutations found in randomly selected am(RIP) alleles, are inversely correlated to the cellular level of AdoMet. These results indicate that AdoMet modulates the biochemical pathway leading to RIP.

  13. Quantitative Proteomics of Human Fibroblasts with I1061T Mutation in Niemann–Pick C1 (NPC1) Protein Provides Insights into the Disease Pathogenesis*

    PubMed Central

    Rauniyar, Navin; Subramanian, Kanagaraj; Lavallée-Adam, Mathieu; Martínez-Bartolomé, Salvador; Balch, William E.; Yates, John R.

    2015-01-01

    Niemann-Pick type C (NPC) disease is a fatal neurodegenerative disorder characterized by the accumulation of unesterified cholesterol in the late endosomal/lysosomal compartments. Mutations in the NPC1 protein are implicated in 95% of patients with NPC disease. The most prevalent mutation is the missense mutation I1061T that occurs in ∼15–20% of the disease alleles. In our study, an isobaric labeling-based quantitative analysis of proteome of NPC1I1061T primary fibroblasts when compared with wild-type cells identified 281 differentially expressed proteins based on stringent data analysis criteria. Gene ontology enrichment analysis revealed that these proteins play important roles in diverse cellular processes such as protein maturation, energy metabolism, metabolism of reactive oxygen species, antioxidant activity, steroid metabolism, lipid localization, and apoptosis. The relative expression level of a subset of differentially expressed proteins (TOR4A, DHCR24, CLGN, SOD2, CHORDC1, HSPB7, and GAA) was independently and successfully substantiated by Western blotting. We observed that treating NPC1I1061T cells with four classes of seven different compounds that are potential NPC drugs increased the expression level of SOD2 and DHCR24. We have also shown an abnormal accumulation of glycogen in NPC1I1061T fibroblasts possibly triggered by defective processing of lysosomal alpha-glucosidase. Our study provides a starting point for future more focused investigations to better understand the mechanisms by which the reported dysregulated proteins triggers the pathological cascade in NPC, and furthermore, their effect upon therapeutic interventions. PMID:25873482

  14. Bee venom attenuates neuroinflammatory events and extends survival in amyotrophic lateral sclerosis models

    PubMed Central

    2010-01-01

    Background Amyotrophic lateral sclerosis (ALS) is a disease affecting the central nervous system that is either sporadic or familial origin and causing the death of motor neurons. One of the genetic factors contributing to the etiology of ALS is mutant SOD1 (mtSOD1), which induces vulnerability of motor neurons through protein misfolding, mitochondrial dysfunction, oxidative damage, cytoskeletal abnormalities, defective axonal transport, glutamate excitotoxicity, inadequate growth factor signaling, and neuroinflammation. Bee venom has been used in the practice of Oriental medicine and evidence from the literature indicates that BV plays an anti-inflammatory or anti-nociceptive role against inflammatory reactions associated with arthritis and other inflammatory diseases. The purpose of the present study was to determine whether bee venom suppresses motor neuron loss and microglial cell activation in hSOD1G93A mutant mice. Methods Bee venom (BV) was bilaterally injected (subcutaneously) into a 14-week-old (98 day old) male hSOD1G93A animal model at the Zusanli (ST36) acupoint, which is known to mediate an anti-inflammatory effect. For measurement of motor activity, rotarod test was performed and survival statistics were analyzed by Kaplan-Meier survival curves. The effects of BV treatment on anti-neuroinflammation of hSOD1G93A mice were assessed via immunoreactions using Iba 1 as a microglia marker and TNF-α antibody. Activation of ERK, Akt, p38 MAP Kinase (MAPK), and caspase 3 proteins was evaluated by western blotting. Results BV-treated mutant hSOD1 transgenic mice showed a decrease in the expression levels of microglia marker and phospho-p38 MAPK in the spinal cord and brainstem. Interestingly, treatment of BV in symptomatic ALS animals improved motor activity and the median survival of the BV-treated group (139 ± 3.5 days) was 18% greater than control group (117 ± 3.1 days). Furthermore, we found that BV suppressed caspase-3 activity and blocked the defects

  15. SOD1 suppresses maternal hyperglycemia-increased iNOS expression and consequent nitrosative stress in diabetic embryopathy

    PubMed Central

    Weng, Hongbo; Li, Xuezheng; Reece, E. Albert; Yang, Peixin

    2012-01-01

    Objectives Hyperglycemia induces oxidative stress and increases inducible nitric oxide synthase (iNOS) expression. We hypothesized that oxidative stress is responsible for hyperglycemia-induced iNOS expression. Study Design iNOS-luciferase activities, nitrosylated protein, lipidperoxidation markers 4-HNE and MDA were determined in PYS-2 cells exposed to 5 mM glucose or high glucose (25 mM) with or without SOD1 (copper zinc superoxide dismutase 1) treatment. Levels of iNOS protein and mRNA, nitrosylated protein, and cleaved caspase-3 and -8 were assessed in wild-type embryos and SOD1 overexpressing embryos from non-diabetic and diabetic dams. Results SOD1 treatment diminished high glucose-induced oxidative stress, as evidenced by 4-HNE and MDA reductions, and it blocked high glucose-increased iNOS expression, iNOS-luciferase activities, and nitrosylated protein. in vivo SOD1 overexpression suppressed hyperglycemia-increased iNOS expression and nitrosylated protein, and it blocked caspase-3 and -8 cleavage. Conclusions We conclude that oxidative stress induces iNOS expression, nitrosative stress, and apoptosis in diabetic embryopathy. PMID:22425406

  16. SOD1 suppresses maternal hyperglycemia-increased iNOS expression and consequent nitrosative stress in diabetic embryopathy.

    PubMed

    Weng, Hongbo; Li, Xuezheng; Reece, E Albert; Yang, Peixin

    2012-05-01

    Hyperglycemia induces oxidative stress and increases inducible nitric oxide synthase (iNOS) expression. We hypothesized that oxidative stress is responsible for hyperglycemia-induced iNOS expression. iNOS-luciferase activities, nitrosylated protein, and lipid peroxidation markers 4-hydroxynonenal and malondialdehyde were determined in parietal yolk sac-2 cells exposed to 5 mmol/L glucose or high glucose (25 mmol/L) with or without copper zinc superoxide dismutase 1 (SOD1) treatment. Levels of iNOS protein and messenger RNA, nitrosylated protein, and cleaved caspase-3 and -8 were assessed in wild-type embryos and SOD1-overexpressing embryos from nondiabetic and diabetic dams. SOD1 treatment diminished high glucose-induced oxidative stress, as evidenced by 4-hydroxynonenal and malondialdehyde reductions, and it blocked high glucose-increased iNOS expression, iNOS-luciferase activities, and nitrosylated protein. In vivo SOD1 overexpression suppressed hyperglycemia-increased iNOS expression and nitrosylated protein, and it blocked caspase-3 and -8 cleavage. We conclude that oxidative stress induces iNOS expression, nitrosative stress, and apoptosis in diabetic embryopathy. Copyright © 2012 Mosby, Inc. All rights reserved.

  17. SOD1 and DJ-1 Converge at Nrf2 Pathway: A Clue for Antioxidant Therapeutic Potential in Neurodegeneration

    PubMed Central

    Milani, Pamela; Ambrosi, Giulia; Gammoh, Omar; Blandini, Fabio; Cereda, Cristina

    2013-01-01

    Neurodegenerative diseases share diverse pathological features and among these oxidative stress (OS) plays a leading role. Impaired activity and reduced expression of antioxidant proteins have been reported as common events in several aging-associated disorders. In this review paper, we first provide an overview of the involvement of reactive oxygen species- (ROS-) induced oxidative damage in Parkinson's disease (PD) and amyotrophic lateral sclerosis (ALS). Subsequently, we focus on DJ-1 and SOD1 proteins, which are involved in PD and ALS and also exert a prominent role in the interaction between redox homeostasis and neurodegeneration. Interestingly, recent studies demonstrated that DJ-1 and SOD1 are both tightly connected with Nrf2 protein, a transcriptional factor and master regulator of the expression of many antioxidant/detoxification genes. Nrf2 is emerging as a key neuroprotective protein in neurodegenerative diseases, since it helps neuronal cells to cope with toxic insults and OS. We herein summarize the recent literature providing a detailed picture of the promising therapeutic efficacy of Nrf2 natural and synthetic inducers as disease-modifying molecules for the treatment of neurodegenerative diseases. PMID:23983902

  18. Mutations in FUS are the most frequent genetic cause in juvenile sporadic ALS patients of Chinese origin.

    PubMed

    Zou, Zhang-Yu; Liu, Ming-Sheng; Li, Xiao-Guang; Cui, Li-Ying

    2016-01-01

    Juvenile onset ALS is a very rare form of motor neuron disease, with the first symptoms of motor neuron degeneration manifested before 25 years of age. Mutations in the alsin (ALS2), senataxin (SETX), and spatacsin (SPG11) genes have been associated with familial ALS with juvenile onset and slow progression, whereas the genetic architecture of sporadic juvenile ALS remains unclear. We screened mutations in C9orf72, SOD1, FUS, TARDBP, ANG, VCP and PFN1 in 16 juvenile sporadic ALS patients. Four cases (25%) carrying FUS mutations and one individual (6%) harbouring a SOD1 mutation were identified. All cases had an aggressive disease course. Our results suggest that FUS mutations are the most frequent genetic cause in early-onset sporadic ALS patients of Chinese origin. Genetic testing of FUS should be performed in early-onset ALS patients especially those with an aggressive disease course.

  19. P-loop Conformation Governed Crizotinib Resistance in G2032R-Mutated ROS1 Tyrosine Kinase: Clues from Free Energy Landscape

    PubMed Central

    Sun, Huiyong; Li, Youyong; Tian, Sheng; Wang, Junmei; Hou, Tingjun

    2014-01-01

    Tyrosine kinases are regarded as excellent targets for chemical drug therapy of carcinomas. However, under strong purifying selection, drug resistance usually occurs in the cancer cells within a short term. Many cases of drug resistance have been found to be associated with secondary mutations in drug target, which lead to the attenuated drug-target interactions. For example, recently, an acquired secondary mutation, G2032R, has been detected in the drug target, ROS1 tyrosine kinase, from a crizotinib-resistant patient, who responded poorly to crizotinib within a very short therapeutic term. It was supposed that the mutation was located at the solvent front and might hinder the drug binding. However, a different fact could be uncovered by the simulations reported in this study. Here, free energy surfaces were characterized by the drug-target distance and the phosphate-binding loop (P-loop) conformational change of the crizotinib-ROS1 complex through advanced molecular dynamics techniques, and it was revealed that the more rigid P-loop region in the G2032R-mutated ROS1 was primarily responsible for the crizotinib resistance, which on one hand, impaired the binding of crizotinib directly, and on the other hand, shortened the residence time induced by the flattened free energy surface. Therefore, both of the binding affinity and the drug residence time should be emphasized in rational drug design to overcome the kinase resistance. PMID:25033171

  20. PDH E1β deficiency with novel mutations in two patients with Leigh syndrome.

    PubMed

    Quintana, E; Mayr, J A; García Silva, M T; Font, A; Tortoledo, M A; Moliner, S; Ozaez, L; Lluch, M; Cabello, A; Ricoy, J R; Koch, J; Ribes, A; Sperl, W; Briones, P

    2009-12-01

    Most cases of pyruvate dehydrogenase complex (PDHc) deficiency are attributable to mutations in the PDHA1 gene which encodes the E(1)α subunit, with few cases of mutations in the genes for E(3), E3BP (E(3) binding protein), E(2) and E(1)-phosphatase being reported. Only seven patients with deficiency of the E(1)β subunit have been described, with mutations in the PDHB gene in six of them. Clinically they presented with a non-specific encephalomyopathy. We report two patients with new mutations in PDHB and Leigh syndrome. Patient 1 was a boy with neonatal onset of hyperlactataemia, corpus callosum hypoplasia and a convulsive encephalopathy. After neurological deterioration, he died at age 5 months. Autopsy revealed the characteristic features of Leigh syndrome. Patient 2, also a boy, presented a milder clinical course. First symptoms were noticed at age 16 months with muscular hypotonia, lactic acidosis and recurrent episodes of somnolence and transient tetraparesis. MRI revealed bilateral signal hyperintensities in the globus pallidus, midbrain and crura cerebri. PDHc and E(1) activities were deficient in fibroblasts in patient 1; in patient 2 PDHc deficiency was found in skeletal muscle. Mutations in PDHA1 were excluded. Sequencing of PDHB revealed a homozygous point mutation (c.302T>C), causing a predicted amino acid change (p.M101T) in patient 1. Patient 2 is compound heterozygote for mutations c.301A>G (p.M101V) and c.313G>A (p.R105Q). All three mutations appear to destabilize the E(1) enzyme with a decrease of both E(1)α and E(1)β subunits in immunoblot analysis. To our knowledge, these patients with novel PDHB mutations are the first reported with Leigh syndrome.

  1. Engineering of a novel tri-functional enzyme with MnSOD, catalase and cell-permeable activities.

    PubMed

    Luangwattananun, Piriya; Yainoy, Sakda; Eiamphungporn, Warawan; Songtawee, Napat; Bülow, Leif; Ayudhya, Chartchalerm Isarankura Na; Prachayasittikul, Virapong

    2016-04-01

    Cooperative function of superoxide dismutase (SOD) and catalase (CAT), in protection against oxidative stress, is known to be more effective than the action of either single enzyme. Chemical conjugation of the two enzymes resulted in molecules with higher antioxidant activity and therapeutic efficacy. However, chemical methods holds several drawbacks; e.g., loss of enzymatic activity, low homogeneity, time-consuming, and the need of chemical residues removal. Yet, the conjugated enzymes have never been proven to internalize into target cells. In this study, by employing genetic and protein engineering technologies, we reported designing and production of a bi-functional protein with SOD and CAT activities for the first time. To enable cellular internalization, cell penetrating peptide from HIV-1 Tat (TAT) was incorporated. Co-expression of CAT-MnSOD and MnSOD-TAT fusion genes allowed simultaneous self-assembly of the protein sequences into a large protein complex, which is expected to contained one tetrameric structure of CAT, four tetrameric structures of MnSOD and twelve units of TAT. The protein showed cellular internalization and superior protection against paraquat-induced cell death as compared to either complex bi-functional protein without TAT or to native enzymes fused with TAT. This study not only provided an alternative strategy to produce multifunctional protein complex, but also gained an insight into the development of therapeutic agent against oxidative stress-related conditions. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. A FBN1 mutation association with different phenotypes of Marfan syndrome in a Chinese family.

    PubMed

    Li, Yapeng; Xu, Jianhua; Chen, Mingjie; Du, Binbin; Li, Qiaoli; Xing, Qinghe; Zhang, Yanzhou

    2016-09-01

    Previous studies demonstrated that patients with different FBN1 mutations often present more considerable phenotypic variation compared to different members of the related family carrying a same mutation. The purpose of our study was to identify pathogenic mutation and provide more information about genotype-phenotypic correlations in a large Chinese family with Marfan syndrome. 15 related family members from a Chinese 4-generation pedigree with Marfan syndrome underwent physical, ophthalmologic, radiological and cardiovascular examinations. The propositus has De Bakey III aortic dissection and didn't fulfill the revised Ghent criteria for Marfan syndrome. Nine family members have ectopia lentis and their echocardiogram was normal. Five other family members have no evidence of Marfan syndrome. Genomic DNA was isolated from blood leukocytes. The exome sequencing was employed on the propositus, then the Sanger sequencing was conducted for mutation verification in other 14 participants of this family. The causative mutation in FBN1 discovered in the propositus was a known heterozygous missense mutation, c.1633T>G (p.R545C), in exon 14 (NM 000138). This same mutation was also identified in all 9 ectopia lentis patients and one unaffected 8-year-old girl. However, the same mutation was not discovered in other 4 unaffected family members. Our data enhance the information of genotype-phenotype correlation owing to FBN1 mutations. To our current knowledge, we firstly reported that the same FBN1 mutation, c. 1633C>T (Arg545Cys), was detected simultaneously in three different cardinal phenotypes (ectopia lentis, aortic dissection and unaffected) within one family. The unaffected girl with FBN1 mutation may presumably represent a rare case of nonpenetrance. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Amylin S20G mutation in Mexican population.

    PubMed

    Garcia-Gonzalez, Claudia Lorena; Montoya-Fuentes, Hector; Padilla-Rosas, Miguel; Sanchez-Corona, Jose

    2007-04-01

    Diabetes Mellitus type 2 (DM2) is a group of metabolic disorders characterized by defective insulin action or secretion or both with a 10.6% incidence in Mexican Mestizo population, DM2 is also classified within the localized misfolding diseases due to the amyloid pancreatic deposits found in 90% of the DM2 necropsies. The pancreatic amyloid main component is a protein known as human islet amyloid polypeptide (hIAPP) or amylin, the most common mutation is the S20G in Asian population with a polymorphic frequency in DM2 Asian patients. The aim of this study was to search this mutation in Mexican Mestizo general population (104) and DM2 patients (100). This is the first molecular study of hIAPP gene in Mexican population and in which we developed an alternative more effective antisense primer for the analysis of the NFGAILSS region in hIAPP exon 3 critical for the amyloid beta structure formation. We did not find the mutation in any of the 204 analyzed samples, thus the findings show that S20G is not a common mutation in Mexican Mestizo population.

  4. Spinal but not cortical microglia acquire an atypical phenotype with high VEGF, galectin-3 and osteopontin, and blunted inflammatory responses in ALS rats

    PubMed Central

    Nikodemova, Maria; Small, Alissa L.; Smith, Stephanie M.C.; Mitchell, Gordon S.; Watters, Jyoti J.

    2014-01-01

    Activation of microglia, CNS resident immune cells, is a pathological hallmark of amyotrophic lateral sclerosis (ALS), a neurodegenerative disorder affecting motor neurons. Despite evidence that microglia contribute to disease progression, the exact role of these cells in ALS pathology remains unknown. We immunomagnetically isolated microglia from different CNS regions of SOD1G93A rats at three different points in disease progression: presymptomatic, symptom onset and end-stage. We observed no differences in microglial number or phenotype in presymptomatic rats compared to wild-type controls. Although after disease onset there was no macrophage infiltration, there were significant increases in microglial numbers in the spinal cord, but not cortex. At disease end-stage, microglia were characterized by high expression of galectin-3, osteopontin and VEGF, and concomitant downregulated expression of TNFα, IL-6, BDNF and arginase-1. Flow cytometry revealed the presence of at least two phenotypically distinct microglial populations in the spinal cord. Immunohistochemistry showed that galectin-3/osteopontin positive microglia were restricted to the ventral horns of the spinal cord, regions with severe motor neuron degeneration. End-stage SOD1G93A microglia from the cortex, a less affected region, displayed similar gene expression profiles to microglia from wild-type rats, and displayed normal responses to systemic inflammation induced by LPS. On the other hand, end-stage SOD1G93A spinal microglia had blunted responses to systemic LPS suggesting that in addition to their phenotypic changes, they may also be functionally impaired. Thus, after disease onset, microglia acquired unique characteristics that do not conform to typical M1 (inflammatory) or M2 (anti-inflammatory) phenotypes. This transformation was observed only in the most affected CNS regions, suggesting that overexpression of mutated hSOD1 is not sufficient to trigger these changes in microglia. These novel

  5. Peritoneal fluid of women with endometriosis reduces SOD1 in bovine oocytes in vitro maturation.

    PubMed

    Malvezzi, Helena; Da Broi, Michele Gomes; Meola, Juliana; Rosa-E-Silva, Júlio César; Ferriani, Rui Alberto; Navarro, Paula Andrea

    2018-06-01

    Studies have demonstrated oxidative stress in peritoneal fluid (PF) from women with endometriosis and the importance of enzymatic antioxidant machinery to avoid oocyte oxidative damage. Considering that PF constantly surrounds the ovaries and has direct contact with the oocyte at ovulation, we wonder if PF from women with endometriosis may affect antioxidant enzyme gene expression. Thus, the present study aims to evaluate the PF impact from infertile women with minimal and mild endometriosis and from fertile control women without endometriosis on SOD1, CAT, GSR gene's expression in experimental bovine oocytes matured in vitro. Samples of PF were obtained from women who underwent videolaparoscopy-7 infertile with EI/II and 7 fertile without endometriosis. Immature bovine oocytes underwent in vitro maturation in the absence of PF and in the presence of three concentrations (1, 5 and 10%) of PF from fertile and from infertile women with EI/II. After 22 to 24 h of IVM, oocytes were denuded and stored for analysis of SOD1, CAT and GSR by real-time polymerase chain reaction. Oocyte SOD1 expression was significantly lower in the 10% endometriosis group (0.67 ± 0.32) when compared with no-peritoneal fluid (1.05 ± 0.24, p < 0.008) and 10% control groups (1.06 ± 0.22, p < 0.006). These findings raise the possibility of a deleterious influence of PF from women with EI/II on the oocyte, not only after ovulation but also during the maturation process, which could contribute to worsening oocyte quality, being one of the mechanisms related to infertility in patients with endometriosis.

  6. Therapeutic effects of dl-3-n-butylphthalide in a transgenic mouse model of amyotrophic lateral sclerosis.

    PubMed

    Feng, Xin-Hong; Yuan, Wei; Peng, Ying; Liu, Ming-Sheng; Cui, Li-Ying

    2012-05-01

    Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disorder characterized by progressive death of the upper and lower motor neurons. Transgenic mice over-expressing a mutant form of the human SOD1 gene develop an ALS-like phenotype. Currently, there is no effective treatment or drug for the fatal disease. Previous studies reported potent efficacy of dl-3-n-butylphthalide (DL-NBP) for several neurodegenerative disorders and cerebral ischemia. SOD1-G93A mice are a mouse model of ALS. In this study, we investigated the efficacy of DL-NBP on this ALS mouse model. Sixty SOD1-G93A female mice were divided into four groups. The vehicle control group received 0 mg×kg(-1)×d(-1) DL-NBP. The experimental groups received DL-NBP with doses of 30, 60 or 120 mg×kg(-1)×d(-1), respectively. For measurement of motor activity, the hanging wire test and rotarod test were performed. Survival statistics were analyzed by Kaplan-Meier survival curves. The body weight of each mouse was recorded twice per week. The statistical motor unit number estimation (MUNE) technique was used to estimate the number of functioning motor units in gastrocnemius muscle. Muscle morphology was evaluated by hematoxylin and eosin staining. Motor neuron quantitation was performed by Nissl staining and microglia activation was observed by immunohistochemistry. Oral administration of 60 mg×kg(-1)×d(-1)1 DL-NBP significantly prolonged survival ((164.78 ± 16.67) days) of SOD1-G93A mice compared with vehicle control ((140.00 ± 16.89) days). Treating mice with DL-NBP (60 mg×kg(-1)×d(-1)) significantly decreased the progression rate of motor deficits and suppressed body weight reduction. Furthermore, we found that treating SOD1-G93A mice with DL-NBP (60 mg×kg(-1)×d(-1)) slowed the rate of MUNE reduction (P < 0.01). Motor neurons were remarkably preserved in the anterior horns in mice treated with DL-NBP (60 mg×kg(-1)×d(-1)) at the stage of 19 weeks (P < 0.01). Treating mice with DL-NBP (60

  7. Evidence for prehistoric origins of the G2019S mutation in the North African Berber population.

    PubMed

    Ben El Haj, Rafiqua; Salmi, Ayyoub; Regragui, Wafa; Moussa, Ahmed; Bouslam, Naima; Tibar, Houyam; Benomar, Ali; Yahyaoui, Mohamed; Bouhouche, Ahmed

    2017-01-01

    The most common cause of the monogenic form of Parkinson's disease known so far is the G2019S mutation of the leucine-rich repeat kinase 2 (LRRK2) gene. Its frequency varies greatly among ethnic groups and geographic regions ranging from less than 0.1% in Asia to 40% in North Africa. This mutation has three distinct haplotypes; haplotype 1 being the oldest and most common. Recent studies have dated haplotype 1 of the G2019S mutation to about 4000 years ago, but it remains controversial whether the mutation has a Near-Eastern or Moroccan-Berber ancestral origin. To decipher this evolutionary history, we genotyped 10 microsatellite markers spanning a region of 11.27 Mb in a total of 57 unrelated Moroccan PD patients carrying the G2019S mutation for which the Berber or Arab origin was established over 3 generations based on spoken language. We estimated the age of the most recent common ancestor for the 36 Arab-speaking and the 15 Berber-speaking G2019S carriers using the likelihood-based method with a mutation rate of 10-4. Data analysis suggests that the shortest haplotype originated in a patient of Berber ethnicity. The common founder was estimated to have lived 159 generations ago (95% CI 116-224) for Arab patients, and 200 generations ago (95% CI 123-348) for Berber patients. Then, 29 native North African males carrying the mutation were assessed for specific uniparental markers by sequencing the Y-chromosome (E-M81, E-M78, and M-267) and mitochondrial DNA (mtDNA) hypervariable regions (HV1 and HV2) to examine paternal and maternal contributions, respectively. Results showed that the autochthonous genetic component reached 76% for mtDNA (Eurasian and north African haplogroups) and 59% for the Y-chromosome (E-M81 and E-M78), suggesting that the G2019S mutation may have arisen in an autochthonous DNA pool. Therefore, we conclude that LRRK2 G2019S mutation most likely originated in a Berber founder who lived at least 5000 years ago (95% CI 3075-8700).

  8. Changing phenotypic expression in a patient with a mitochondrial encephalopathy due to 13042G>A de novo mutation--a 5 year follow up.

    PubMed

    Schinwelski, M; Kierdaszuk, B; Dulski, J; Tońska, K; Kodroń, A; Sitek, E J; Bartnik, E; Kamińska, A; Kwieciński, H; Sławek, J

    2015-08-01

    Mutations in NADH dehydrogenase (ND) subunits of complex I lead to mitochondrial encephalomyopathies associated with various phenotypes. This report aims to present the patient's clinical symptomatology in the context of a very rare 13042G>A de novo mutation and with an emphasis on changing phenotypic expression and pronounced, long-standing response to levetiracetam.

  9. Detection of a novel silent deletion, a missense mutation and a nonsense mutation in TCOF1.

    PubMed

    Fujioka, Hirotaka; Ariga, Tadashi; Horiuchi, Katsumi; Ishikiriyama, Satoshi; Oyama, Kimie; Otsu, Makoto; Kawashima, Kunihiro; Yamamoto, Yuhei; Sugihara, Tsuneki; Sakiyama, Yukio

    2008-12-01

    Treacher Collins syndrome (TCS) is a disorder of craniofacial development, that is caused by mutations in the TCOF1 gene. TCS is inherited as an autosomal dominant trait, and haploinsufficiency of the TCOF1 gene product treacle is proposed to be etiologically involved. Mutational analysis of the TCOF1 gene was done in 10 patients diagnosed with TCS using single-strand conformation polymorphism and direct sequencing. Among these 10 patients, a novel 9 bp deletion was found, together with a previously reported 2 bp deletion, a novel missense mutation and a novel nonsense mutation in three different families. Familial studies allowed judgment of whether these abnormal findings were responsible for the TCS phenotype, or not. The 9 bp deletion of three amino acids Lys-Glu-Lys (1378-1380), which was located in the nuclear localization domain of treacle, seemed not essential for the treacle function. In contrast, the novel mutation of Ala26Val is considered to affect the LisH domain, an important domain of treacle. All of the mutations thus far detected in exon 5 have resulted in frameshift, but a nonsense mutation was detected (Lys159Stop). The information obtained in the present study provides additional insights into the functional domains of treacle.

  10. A novel missense NDP mutation [p.(Cys93Arg)] with a manifesting carrier in an austrian family with Norrie disease.

    PubMed

    Parzefall, Thomas; Lucas, Trevor; Ritter, Markus; Ludwig, Martin; Ramsebner, Reinhard; Frohne, Alexandra; Schöfer, Christian; Hengstschläger, Markus; Frei, Klemens

    2014-01-01

    Norrie disease is a rare, X-linked genetic syndrome characterized by combined congenital blindness and progressive hearing impairment. Norrie disease is caused by alterations in the NDP gene encoding the growth factor norrin that plays a key role in vascular development and stabilization of the eye, inner ear and brain. We identified a family with 3 affected deafblind males and a single female carrier presenting with a serous retinal detachment but normal hearing. Genetic analysis revealed a novel c.277T>C missense mutation causing the substitution of a hydrophobic cysteine to a hydrophilic arginine [p.(Cys93Arg)] within the highly conserved cysteine knot domain of the norrin protein. These results should expand the scope for amniocentesis and genetic testing for Norrie disease which is gaining in importance due to novel postnatal therapeutic concepts to alleviate the devastating retinal symptoms of Norrie disease. © 2014 S. Karger AG, Basel.

  11. Functional Analysis of the Hsp93/ClpC Chaperone at the Chloroplast Envelope1[OPEN

    PubMed Central

    Tanabe, Noriaki; Clarke, Adrian K.

    2016-01-01

    The Hsp100-type chaperone Hsp93/ClpC has crucial roles in chloroplast biogenesis. In addition to its role in proteolysis in the stroma, biochemical and genetic evidence led to the hypothesis that this chaperone collaborates with the inner envelope TIC complex to power preprotein import. Recently, it was suggested that Hsp93, working together with the Clp proteolytic core, can confer a protein quality control mechanism at the envelope. Thus, the role of envelope-localized Hsp93, and the mechanism by which it participates in protein import, remain unclear. To analyze the function of Hsp93 in protein import independently of its ClpP association, we created a mutant of Hsp93 affecting its ClpP-binding motif (PBM) (Hsp93[P-]), which is essential for the chaperone’s interaction with the Clp proteolytic core. The Hsp93[P-] construct was ineffective at complementing the pale-yellow phenotype of hsp93 Arabidopsis (Arabidopsis thaliana) mutants, indicating that the PBM is essential for Hsp93 function. As expected, the PBM mutation negatively affected the degradation activity of the stromal Clp protease. The mutation also disrupted association of Hsp93 with the Clp proteolytic core at the envelope, without affecting the envelope localization of Hsp93 itself or its association with the TIC machinery, which we demonstrate to be mediated by a direct interaction with Tic110. Nonetheless, Hsp93[P-] expression did not detectably improve the protein import efficiency of hsp93 mutant chloroplasts. Thus, our results do not support the proposed function of Hsp93 in protein import propulsion, but are more consistent with the notion of Hsp93 performing a quality control role at the point of import. PMID:26586836

  12. MELAS syndrome associated with both A3243G-tRNALeu mutation and multiple mitochondrial DNA deletions.

    PubMed

    Aharoni, Sharon; Traves, Teres A; Melamed, Eldad; Cohen, Sarit; Silver, Esther Leshinsky

    2010-09-15

    The syndrome of mitochondrial encephalopathy, lactic acidosis, and stroke-like episode (MELAS) is characterized clinically by recurrent focal neurological deficits, epilepsy, and short stature. The phenotypic spectrum is extremely diverse, with multisystemic organ involvement leading to isolated diabetes, deafness, renal tubulopathy, hypertrophic cardiomyopathy, and retinitis pigmentosa. In 80% of cases, the syndrome is associated with an AG transmission mutation (A3243G) in the tRNALeu gene of the mitochondrial DNA (mtDNA). We describe a woman with a unique combination of the MELAS A3243G mutation and multiple mtDNA deletions with normal POLG sequence. The patient presented with diabetes mellitus, sensorineural deafness, short stature, and mental disorientation. All her three children died in early adolescence. 2010 Elsevier B.V. All rights reserved.

  13. Mutations in the G6PC3 gene cause Dursun syndrome.

    PubMed

    Banka, Siddharth; Newman, William G; Ozgül, R Koksal; Dursun, Ali

    2010-10-01

    Dursun syndrome is a triad of familial primary pulmonary hypertension, leucopenia, and atrial septal defect. Here we demonstrate that mutations in G6PC3 cause Dursun syndrome. Mutations in G6PC3 are known to also cause severe congenital neutropenia type 4. Identification of the genetic basis of Dursun syndrome expands the pre-existing knowledge about the phenotypic effects of mutations in G6PC3. We propose that Dursun syndrome should now be considered as a subset of severe congenital neutropenia type 4 with pulmonary hypertension as an important clinical feature. Copyright © 2010 Wiley-Liss, Inc.

  14. Mutation of CDH23, encoding a new member of the cadherin gene family, causes Usher syndrome type 1D.

    PubMed

    Bolz, H; von Brederlow, B; Ramírez, A; Bryda, E C; Kutsche, K; Nothwang, H G; Seeliger, M; del C-Salcedó Cabrera, M; Vila, M C; Molina, O P; Gal, A; Kubisch, C

    2001-01-01

    Usher syndrome type I (USH1) is an autosomal recessive disorder characterized by congenital sensorineural hearing loss, vestibular dysfunction and visual impairment due to early onset retinitis pigmentosa (RP). So far, six loci (USH1A-USH1F) have been mapped, but only two USH1 genes have been identified: MYO7A for USH1B and the gene encoding harmonin for USH1C. We identified a Cuban pedigree linked to the locus for Usher syndrome type 1D (MIM 601067) within the q2 region of chromosome 10). Affected individuals present with congenital deafness and a highly variable degree of retinal degeneration. Using a positional candidate approach, we identified a new member of the cadherin gene superfamily, CDH23. It encodes a protein of 3,354 amino acids with a single transmembrane domain and 27 cadherin repeats. In the Cuban family, we detected two different mutations: a severe course of the retinal disease was observed in individuals homozygous for what is probably a truncating splice-site mutation (c.4488G-->C), whereas mild RP is present in individuals carrying the homozygous missense mutation R1746Q. A variable expression of the retinal phenotype was seen in patients with a combination of both mutations. In addition, we identified two mutations, Delta M1281 and IVS51+5G-->A, in a German USH1 patient. Our data show that different mutations in CDH23 result in USH1D with a variable retinal phenotype. In an accompanying paper, it is shown that mutations in the mouse ortholog cause disorganization of inner ear stereocilia and deafness in the waltzer mouse.

  15. Mutational Profile of Homozygous β-Thalassemia in Rio de Janeiro, Brazil.

    PubMed

    Carrocini, Gisele C S; Venancio, Larissa P R; Pessoa, Viviani L R; Lobo, Clarisse L C; Bonini-Domingos, Claudia R

    2017-01-01

    β-Thalassemia (β-thal) is a hemolytic anemia that is caused by point mutations in most cases. The Brazilian population is highly heterogeneous and knowledge of the mutations that make up the genotypic profile of individuals can contribute information about the formation of the population and clinical condition of patients. In this study, we evaluated the mutations present in homozygous β-thal patients from Rio de Janeiro, Brazil. We analyzed 24 samples of peripheral blood of patients with homozygous β-thal. To identify the mutations, we carried out allele-specific-polymerase chain reaction (AS-PCR) and DNA sequencing. We found 11 different mutations on the β-globin gene. Among the most frequent mutations observed were HBB: c.92 + 6T>C, followed by HBB: c.93-21G>A, HBB: c.118C>T and HBB: c.92 + 1G>A. We also identified the rare mutation HBB: c.75T>A that was reported in an individual carrying Hb S (HBB: c.20A>T)/β-thal (HBB: c.75T>A) but not in Brazilian thalassemic patients, thus, this is the first report of this mutation in Brazilian β-thal patients. For its multiethnic character, Brazil has different mutations that cause β-thal and that are distributed with different frequencies according to the regions of the country. Our findings contribute to the description of the mutational profile of Brazilian thalassemic patients, showing wide heterogeneity and genetic variability.

  16. High prevalence of factor V Leiden and prothrombin G20101A mutations in Kashmiri patients with venous thromboembolism.

    PubMed

    Shafia, Syed; Zargar, Mahrukh H; Khan, Nabeela; Ahmad, Rehana; Shah, Zafar Amin; Asimi, Ravouf

    2018-05-15

    The genetic variants of the factor V (G1691A), prothrombin (G20210A) and MTHFR (C677T) genes have been widely implicated as inherited risk factors for developing venous thrombosis. This study was undertaken to reveal the frequency of these mutations in Kashmiri patients with venous thromboembolism. A case-control study was designed with 250 VTE patients and 250 healthy controls. The mutations were analysed using ARMS-PCR and PCR-RFLP approach. The factor V Leiden G1691A mutation was found in 17/250 (6.8%) VTE patients and prothrombin G20210A mutation was found in 7/250 (2.8%) VTE patients while no mutation was found in any of the healthy controls. Both the mutations were found to be significantly associated with the increased risk of VTE (p = 0.0001 and 0.0150 respectively) while no association of VTE risk with MTHFR C677T polymorphism was found (p = 0.53). The increased frequency of factor V Leiden G1691A and prothrombin G20210A mutation in VTE patients indicates a significant role of these mutations in the development of VTE in our population. We therefore suggest the routine screening of these two mutations as thrombophilic markers in Kashmiri patients with venous thromboembolism. Copyright © 2018 Elsevier B.V. All rights reserved.

  17. Atypical presentation of Leigh syndrome associated with a Leber hereditary optic neuropathy primary mitochondrial DNA mutation.

    PubMed

    Fruhman, Gary; Landsverk, Megan L; Lotze, Timothy E; Hunter, Jill V; Wangler, Michael F; Adesina, Adekunle M; Wong, Lee-Jun C; Scaglia, Fernando

    2011-06-01

    Leber hereditary optic neuropathy (LHON) is caused by point mutations in mitochondrial DNA (mtDNA), and is characterized by bilateral, painless sub-acute visual loss that develops during the second decade of life. Here we report the case of a five year old girl who presented with clinical and neuroradiological findings reminiscent of Leigh syndrome but carried a mtDNA mutation m.11778G>A (p.R340H) in the MTND4 gene usually observed in patients with LHON. This case is unusual for age of onset, gender, associated neurological findings and evolution, further expanding the clinical spectrum associated with primary LHON mtDNA mutations. Copyright © 2011 Elsevier Inc. All rights reserved.

  18. A novel founder BBS1 mutation explains a unique high prevalence of Bardet-Biedl syndrome in the Faroe Islands.

    PubMed

    Hjortshøj, T Duelund; Grønskov, K; Brøndum-Nielsen, K; Rosenberg, T

    2009-03-01

    Bardet-Biedl syndrome is a multiorgan disease presenting with retinitis pigmentosa leading to blindness. The aim of the study was to investigate the genetic background of Bardet-Biedl syndrome in the Faroe Island. It was hypothesised that a common genetic background for the syndrome would be found. Patients were identified from the files of the Retinitis Pigmentosa Register at the National Eye Clinic, Denmark. The diagnosis of Bardet-Biedl syndrome was verified from medical files. Mutational screening of BBS1, BBS2, BBS4, MKKS and BBS10 was done by denaturing high-performance liquid chromatography. Out of 13 prevalent cases in the Faroe Islands, 10 patients from nine families were included. A novel splice site mutation in BBS1, c.1091+3G>C, was identified, and this was predicted to affect protein function by skipping 16 amino acids. Nine patients were homozygous for this mutation, while one patient was compound heterozygous with a recurrent BBS1 mutation, p.Met390Arg. The patients presented with severe ophthalmic phenotypes, while the systemic manifestations of the disease were apparently milder. A novel BBS1 mutation was identified, most probably a founder mutation, further confirming the Faroe Islands as a genetic isolate. The phenotypic expression of the Faroese patients suggests that different mutations in BBS1 affect various organs differently.

  19. Mutation Spectrum of the ABCA4 Gene in a Greek Cohort with Stargardt Disease: Identification of Novel Mutations and Evidence of Three Prevalent Mutated Alleles

    PubMed Central

    Vassiliki, Kokkinou; George, Koutsodontis; Polixeni, Stamatiou; Christoforos, Giatzakis; Minas, Aslanides Ioannis; Stavrenia, Koukoula; Ioannis, Datseris

    2018-01-01

    Aim To evaluate the frequency and pattern of disease-associated mutations of ABCA4 gene among Greek patients with presumed Stargardt disease (STGD1). Materials and Methods A total of 59 patients were analyzed for ABCA4 mutations using the ABCR400 microarray and PCR-based sequencing of all coding exons and flanking intronic regions. MLPA analysis as well as sequencing of two regions in introns 30 and 36 reported earlier to harbor deep intronic disease-associated variants was used in 4 selected cases. Results An overall detection rate of at least one mutant allele was achieved in 52 of the 59 patients (88.1%). Direct sequencing improved significantly the complete characterization rate, that is, identification of two mutations compared to the microarray analysis (93.1% versus 50%). In total, 40 distinct potentially disease-causing variants of the ABCA4 gene were detected, including six previously unreported potentially pathogenic variants. Among the disease-causing variants, in this cohort, the most frequent was c.5714+5G>A representing 16.1%, while p.Gly1961Glu and p.Leu541Pro represented 15.2% and 8.5%, respectively. Conclusions By using a combination of methods, we completely molecularly diagnosed 48 of the 59 patients studied. In addition, we identified six previously unreported, potentially pathogenic ABCA4 mutations. PMID:29854428

  20. An Intron 9 CYP19 Gene Variant (IVS9+5G>A), Present in an Aromatase-Deficient Girl, Affects Normal Splicing and Is Also Present in Normal Human Steroidogenic Tissues.

    PubMed

    Saraco, Nora; Nesi-Franca, Suzana; Sainz, Romina; Marino, Roxana; Marques-Pereira, Rosana; La Pastina, Julia; Perez Garrido, Natalia; Sandrini, Romolo; Rivarola, Marco Aurelio; de Lacerda, Luiz; Belgorosky, Alicia

    2015-01-01

    Splicing CYP19 gene variants causing aromatase deficiency in 46,XX disorder of sexual development (DSD) patients have been reported in a few cases. A misbalance between normal and aberrant splicing variants was proposed to explain spontaneous pubertal breast development but an incomplete sex maturation progress. The aim of this study was to functionally characterize a novel CYP19A1 intronic homozygote mutation (IVS9+5G>A) in a 46,XX DSD girl presenting spontaneous breast development and primary amenorrhea, and to evaluate similar splicing variant expression in normal steroidogenic tissues. Genomic DNA analysis, splicing prediction programs, splicing assays, and in vitro protein expression and enzyme activity analyses were carried out. CYP19A1 mRNA expression in human steroidogenic tissues was also studied. A novel IVS9+5G>A homozygote mutation was found. In silico analysis predicts the disappearance of the splicing donor site in intron 9, confirmed by patient peripheral leukocyte cP450arom and in vitro studies. Protein analysis showed a shorter and inactive protein. The intron 9 transcript variant was also found in human steroidogenic tissues. The mutation IVS9+5G>A generates a splicing variant that includes intron 9 which is also present in normal human steroidogenic tissues, suggesting that a misbalance between normal and aberrant splicing variants might occur in target tissues, explaining the clinical phenotype in the affected patient. © 2015 S. Karger AG, Basel.

  1. TRPC6 G757D Loss-of-Function Mutation Associates with FSGS

    PubMed Central

    Riehle, Marc; Büscher, Anja K.; Gohlke, Björn-Oliver; Kaßmann, Mario; Kolatsi-Joannou, Maria; Bräsen, Jan H.; Nagel, Mato; Becker, Jan U.; Winyard, Paul; Hoyer, Peter F.; Preissner, Robert; Krautwurst, Dietmar; Gollasch, Maik

    2016-01-01

    FSGS is a CKD with heavy proteinuria that eventually progresses to ESRD. Hereditary forms of FSGS have been linked to mutations in the transient receptor potential cation channel, subfamily C, member 6 (TRPC6) gene encoding a nonselective cation channel. Most of these TRPC6 mutations cause a gain-of-function phenotype, leading to calcium–triggered podocyte cell death, but the underlying molecular mechanisms are unclear. We studied the molecular effect of disease-related mutations using tridimensional in silico modeling of tetrameric TRPC6. Our results indicated that G757 is localized in a domain forming a TRPC6-TRPC6 interface and predicted that the amino acid exchange G757D causes local steric hindrance and disruption of the channel complex. Notably, functional characterization of model interface domain mutants suggested a loss-of-function phenotype. We then characterized 19 human FSGS–related TRPC6 mutations, the majority of which caused gain-of-function mutations. However, five mutations (N125S, L395A, G757D, L780P, and R895L) caused a loss-of-function phenotype. Coexpression of wild-type TRPC6 and TRPC6 G757D, mimicking heterozygosity observed in patients, revealed a dominant negative effect of TRPC6 G757D. Our comprehensive analysis of human disease–causing TRPC6 mutations reveals loss of TRPC6 function as an additional concept of hereditary FSGS and provides molecular insights into the mechanism responsible for the loss-of-function phenotype of TRPC6 G757D in humans. PMID:26892346

  2. Recombinant human manganese superoxide dismutase (rMnSOD): a positive effect on the immunohematological state of mice irradiated with protons

    NASA Astrophysics Data System (ADS)

    Ambesi-Impiombato, Francesco Saverio; Belov, Oleg; Bulinina, Taisia; Ivanov, Alexander; Mancini, Aldo; Borrelli, Antonella; Krasavin, Eugene A.

    Protons represent the largest component of space radiation. In this regard screening of radioprotective drugs capable of increasing radioresistance of astronauts obligatory includes studying these compounds using proton radiation injury models. The recombinant human manganese superoxide dismutase (rMnSOD) had previously demonstrated its efficacy on an in vivo X-ray induced injury model, when multiple intraperitoneal treatments allowed the survival of mice irradiated with doses which were lethal for the control animals (Borrelli A et al. “A recombinant MnSOD is radioprotective for normal cells and radiosensitizing for tumor cells”. Free Radic Biol Med. 2009, 46, 110-6). Using the model of sublethal whole-body irradiation with protons available at Phasotron of Joint Institute for Nuclear Research (Dubna, Russia), we reconstruct the bone-marrow form of the acute radiation sickness to test the radioprotective effect of rMnSOD. Male (CBAxC57Bl6) F1 hybrid SPF mice weighting approximately 24 g were exposed to 171 MeV protons at the dose of 4 Gy. After irradiation, the sixfold daily subcutaneous treatment with rMnSOD has provided a statistically significant acceleration of the recovery of thymus and spleen mass and of the number of leukocytes in mice peripheral blood. In the control, untreated and irradiated mice, these positive effects were not observed even on day 7 after exposure. The number of karyocytes in bone marrow of irradiated mice has even exceeded its basal level in the control group 7 days after irradiation. The rMnSOD-treated group has thus demonstrated a significant hyper-restoration of this characteristic. In the presentation, several possibilities of using of rMnSOD in space medicine will be discussed, taking into account various biomedically relevant effects of this enzyme.

  3. Hypogonadotropic Hypogonadism due to Novel FGFR1 Mutations.

    PubMed

    Akkuş, Gamze; Kotan, Leman Damla; Durmaz, Erdem; Mengen, Eda; Turan, İhsan; Ulubay, Ayça; Gürbüz, Fatih; Yüksel, Bilgin; Tetiker, Tamer; Topaloğlu, A Kemal

    2017-06-01

    The underlying genetic etiology of hypogonadotropic hypogonadism (HH) is heterogeneous. Fibroblast growth factor signaling is pivotal in the ontogeny of gonadotropin-releasing hormone neurons. Loss-of-function mutations in FGFR1 gene cause variable HH phenotypes encompassing pubertal delay to idiopathic HH (IHH) or Kallmann syndrome (KS). As FGFR1 mutations are common, recognizing mutations and associated phenotypes may enhance clinical management. Using a candidate gene approach, we screened 52 IHH/KS patients. We identified three novel (IVS3-1G>C and p.W2X, p.R209C) FGFR1 gene mutations. Despite predictive null protein function, patients from the novel mutation families had normosmic IHH without non-reproductive phenotype. These findings further emphasize the great variability of FGFR1 mutation phenotypes in IHH/KS.

  4. An N-terminal glycine to cysteine mutation in the collagen COL1A1 gene produces moderately severe osteogenesis imperfecta

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wilcox, W.; Scott, L.; Cohn, D.

    Osteogenesis imperfecta (OI) is usually due to mutations in the type I procollagen genes COL1A1 and COL1A2. Point mutations close to the N-terminus are generally milder than those near the C-terminus of the molecule (the gradient hypothesis of collagen mutations). We describe a patient with moderately severe OI due to a mutation in the N-terminal portion of the triple helical domain of the {alpha}1(I) chain. Electrophoretic analysis of collagen isolated from fibroblast cultures suggested the abnormal presence of a cysteine in the N-terminal portion of the {alpha}1(I) chain. Five overlapping DNA fragments amplified from fibroblast RNA were screened for mutationsmore » using single strand conformational polymorphism (SSCP) and heteroduplex analyses. Direct DNA sequence analysis of the single positive fragment demonstrated a G to T transversion, corresponding to a glycine to cysteine substitution at position 226 of the triple helical domain of the {alpha}1(I) chain. The mutation was confirmed by restriction enzyme analysis of amplified genomic DNA. The mutation was not present in fibroblasts from either phenotypically normal parent. Combining this mutation with other reported mutations, glycine to cysteine substitutions at positions 205, 211, 223, and 226 produce a moderately severe phenotype whereas flanking mutations at positions 175 and 382 produce a mild phenotype. This data supports a regional rather than a gradient model of the relationship between the nature and location of type I collagen mutations and OI phenotype.« less

  5. Effectiveness of ivacaftor in cystic fibrosis patients with non-G551D gating mutations.

    PubMed

    Guimbellot, Jennifer; Solomon, George M; Baines, Arthur; Heltshe, Sonya L; VanDalfsen, Jill; Joseloff, Elizabeth; Sagel, Scott D; Rowe, Steven M

    2018-04-20

    The cystic fibrosis transmembrane conductance regulator (CFTR) potentiator ivacaftor is approved for patients with CF with gating and residual function CFTR mutations. We report the results of an observational study investigating its effects in CF patients with non-G551D gating mutations. Patients with non-G551D gating mutations were recruited to an open-label study evaluating ivacaftor. Primary outcomes included: lung function, sweat chloride, weight gain, and quality of life scores. Twenty-one subjects were enrolled and completed 6 months follow-up on ivacaftor; mean age was 25.6 years with 52% <18. Baseline ppFEV 1 was 68% and mean sweat chloride 89.6 mEq/L. Participants experienced significant improvements in ppFEV 1 (mean absolute increase of 10.9% 95% CI = [2.6,19.3], p = 0.0134), sweat chloride (-48.6 95% CI = [-67.4,-29.9], p < 0.0001), and weight (5.1 kg, 95% CI = [2.8, 7.3], p = 0.0002). Patients with non-G551D gating mutations experienced improved lung function, nutritional status, and quality of life. This study supports ongoing use of ivacaftor for patients with these mutations. Copyright © 2018. Published by Elsevier B.V.

  6. Co-occurrence of m.1555A>G and m.11778G>A mitochondrial DNA mutations in two Indian families with strikingly different clinical penetrance of Leber hereditary optic neuropathy

    PubMed Central

    Khan, Nahid Akhtar; Govindaraj, Periyasamy; Jyothi, Vuskamalla; Meena, Angamuthu K

    2013-01-01

    Background Mitochondrial DNA (mtDNA) mutations are known to cause Leber hereditary optic neuropathy (LHON). However, the co-occurrence of double pathogenic mutations with different pathological significance in pedigrees is a rare event. Methods Detailed clinical investigation and complete mtDNA sequencing analysis was performed for two Indian families with LHON. The haplogroup was constructed based on evolutionarily important mtDNA variants. Results We observed the existence of double pathogenic mutations (m.11778G>A and m.1555A>G) in two Indian LHON families, who are from different haplogroup backgrounds (M5a and U2e1), with different clinical penetrance of the disease (visual impairment). The m.11778G>A mutation in the MT-ND4 gene is associated primarily with LHON; whereas, m.1555A>G in the 12S rRNA gene has been reported with aminoglycoside-induced non-syndromic hearing loss. Conclusions The absence of hearing abnormality and widely varying clinical expression of LHON suggest additional nuclear modifier genes, environmental factors, and population heterogeneity might play an important role in the expression of visual impairment in these families. PMID:23805034

  7. Preleukemic and second-hit mutational events in an acute myeloid leukemia patient with a novel germline RUNX1 mutation.

    PubMed

    Ng, Isaac Ks; Lee, Joanne; Ng, Christopher; Kosmo, Bustamin; Chiu, Lily; Seah, Elaine; Mok, Michelle Meng Huang; Tan, Karen; Osato, Motomi; Chng, Wee-Joo; Yan, Benedict; Tan, Lip Kun

    2018-01-01

    Germline mutations in the RUNX1 transcription factor give rise to a rare autosomal dominant genetic condition classified under the entity: Familial Platelet Disorders with predisposition to Acute Myeloid Leukaemia (FPD/AML). While several studies have identified a myriad of germline RUNX1 mutations implicated in this disorder, second-hit mutational events are necessary for patients with hereditary thrombocytopenia to develop full-blown AML. The molecular picture behind this process remains unclear. We describe a patient of Malay descent with an unreported 7-bp germline RUNX1 frameshift deletion, who developed second-hit mutations that could have brought about the leukaemic transformation from a pre-leukaemic state. These mutations were charted through the course of the treatment and stem cell transplant, showing a clear correlation between her clinical presentation and the mutations present. The patient was a 27-year-old Malay woman who presented with AML on the background of hereditary thrombocytopenia affecting her father and 3 brothers. Initial molecular testing revealed the same novel RUNX1 mutation in all 5 individuals. The patient received standard induction, consolidation chemotherapy, and a haploidentical stem cell transplant from her mother with normal RUNX1 profile. Comprehensive genomic analyses were performed at diagnosis, post-chemotherapy and post-transplant. A total of 8 mutations ( RUNX1 , GATA2 , DNMT3A , BCORL1 , BCOR , 2 PHF6 and CDKN2A ) were identified in the pre-induction sample, of which 5 remained ( RUNX1 , DNMT3A , BCORL1 , BCOR and 1 out of 2 PHF6 ) in the post-treatment sample and none were present post-transplant. In brief, the 3 mutations which were lost along with the leukemic cells at complete morphological remission were most likely acquired leukemic driver mutations that were responsible for the AML transformation from a pre-leukemic germline RUNX1 -mutated state. On the contrary, the 5 mutations that persisted post

  8. 32 CFR 93.1 - References.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 32 National Defense 1 2013-07-01 2013-07-01 false References. 93.1 Section 93.1 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE PERSONNEL, MILITARY AND CIVILIAN ACCEPTANCE OF SERVICE OF PROCESS; RELEASE OF OFFICIAL INFORMATION IN LITIGATION; AND TESTIMONY BY NSA PERSONNEL AS...

  9. 32 CFR 93.1 - References.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 32 National Defense 1 2012-07-01 2012-07-01 false References. 93.1 Section 93.1 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE PERSONNEL, MILITARY AND CIVILIAN ACCEPTANCE OF SERVICE OF PROCESS; RELEASE OF OFFICIAL INFORMATION IN LITIGATION; AND TESTIMONY BY NSA PERSONNEL AS...

  10. 32 CFR 93.1 - References.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 32 National Defense 1 2014-07-01 2014-07-01 false References. 93.1 Section 93.1 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE PERSONNEL, MILITARY AND CIVILIAN ACCEPTANCE OF SERVICE OF PROCESS; RELEASE OF OFFICIAL INFORMATION IN LITIGATION; AND TESTIMONY BY NSA PERSONNEL AS...

  11. 32 CFR 93.1 - References.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 32 National Defense 1 2010-07-01 2010-07-01 false References. 93.1 Section 93.1 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE PERSONNEL, MILITARY AND CIVILIAN ACCEPTANCE OF SERVICE OF PROCESS; RELEASE OF OFFICIAL INFORMATION IN LITIGATION; AND TESTIMONY BY NSA PERSONNEL AS...

  12. 32 CFR 93.1 - References.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 32 National Defense 1 2011-07-01 2011-07-01 false References. 93.1 Section 93.1 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE PERSONNEL, MILITARY AND CIVILIAN ACCEPTANCE OF SERVICE OF PROCESS; RELEASE OF OFFICIAL INFORMATION IN LITIGATION; AND TESTIMONY BY NSA PERSONNEL AS...

  13. The novel Tau mutation G335S: clinical, neuropathological and molecular characterization.

    PubMed

    Spina, Salvatore; Murrell, Jill R; Yoshida, Hirotaka; Ghetti, Bernardino; Bermingham, Niamh; Sweeney, Brian; Dlouhy, Stephen R; Crowther, R Anthony; Goedert, Michel; Keohane, Catherine

    2007-04-01

    Mutations in Tau cause the inherited neurodegenerative disease, frontotemporal dementia and Parkinsonism linked to chromosome 17 (FTDP-17). Known coding region mutations cluster in the microtubule-binding region, where they alter the ability of tau to promote microtubule assembly. Depending on the tau isoforms, this region consists of three or four imperfect repeats of 31 or 32 amino acids, each of which contains a characteristic and invariant PGGG motif. Here, we report the novel G335S mutation, which changes the PGGG motif of the third tau repeat to PGGS, in an individual who developed social withdrawal, emotional bluntness and stereotypic behavior at age 22, followed by disinhibition, hyperorality and ideomotor apraxia. Abundant tau-positive inclusions were present in neurons and glia in the frontotemporal cortex, hippocampus and brainstem. Sarkosyl-insoluble tau showed paired helical and straight filaments, as well as more irregular rope-like filaments. The pattern of pathological tau bands was like that of Alzheimer disease. Experimentally, the G335S mutation resulted in a greatly reduced ability of tau to promote microtubule assembly, while having no significant effect on heparin-induced assembly of recombinant tau into filaments.

  14. Dysmorphic Facial Features and Other Clinical Characteristics in Two Patients with PEX1 Gene Mutations

    PubMed Central

    Gunduz, Mehmet

    2016-01-01

    Peroxisomal disorders are a group of genetically heterogeneous metabolic diseases related to dysfunction of peroxisomes. Dysmorphic features, neurological abnormalities, and hepatic dysfunction can be presenting signs of peroxisomal disorders. Here we presented dysmorphic facial features and other clinical characteristics in two patients with PEX1 gene mutation. Follow-up periods were 3.5 years and 1 year in the patients. Case I was one-year-old girl that presented with neurodevelopmental delay, hepatomegaly, bilateral hearing loss, and visual problems. Ophthalmologic examination suggested septooptic dysplasia. Cranial magnetic resonance imaging (MRI) showed nonspecific gliosis at subcortical and periventricular deep white matter. Case II was 2.5-year-old girl referred for investigation of global developmental delay and elevated liver enzymes. Ophthalmologic examination findings were consistent with bilateral nystagmus and retinitis pigmentosa. Cranial MRI was normal. Dysmorphic facial features including broad nasal root, low set ears, downward slanting eyes, downward slanting eyebrows, and epichantal folds were common findings in two patients. Molecular genetic analysis indicated homozygous novel IVS1-2A>G mutation in Case I and homozygous p.G843D (c.2528G>A) mutation in Case II in the PEX1 gene. Clinical findings and developmental prognosis vary in PEX1 gene mutation. Kabuki-like phenotype associated with liver pathology may indicate Zellweger spectrum disorders (ZSD). PMID:27882258

  15. A Detailed Picture of the (93) Minerva Triple System

    NASA Astrophysics Data System (ADS)

    Marchis, F.; Descamps, P.; Dalba, P.; Enriquez, J. E.; Durech, J.; Emery, J. P.; Berthier, J.; Vachier, F.; Merlbourne, J.; Stockton, A. N.; Fassnacht, C. D.; Dupuy, T. J.

    2011-10-01

    We developed an orbital model of the satellites of (93) Minerva based on Keck II AO observations recorded in 2009 and a mutual event between one moon and the primary detected in March 2010. Using new lightcurves we found an approximated ellipsoid shape model for the primary. With a reanalysis of the IRAS data, we derived a preliminary bulk density of 1.5±0.2 g/cc. We will present a detailed analysis of the system, including a 3D shape model of the 93 Minerva primary derived by combining our AO observations, lightcurve, and stellar occultations.

  16. Mutations in the RS1 gene in a Chinese family with X-linked juvenile retinoschisis.

    PubMed

    Hou, Qiaofang; Chu, Yan; Guo, Qiannan; Wu, Dong; Liao, Shixiu

    2012-02-01

    The purpose of our study was to identify the mutations in the retinoschisis 1 (RS1) gene, which was associated with X-linked retinoschisis (XLRS) in a four-generation Chinese family, and to provide the theoretical basis for gene diagnosis and gene therapy. Genomic DNA was extracted from peripheral leukocytes. All six exons and flanking intronic regions were amplified by polymerase chain reaction (PCR), followed by direct sequencing. Through our genetic analysis, one frameshift 573delG mutation was identified in the patients of this four-generation pedigree; however, this mutation was absent in normal or non-carrier subjects. In conclusion, this 573delG mutation is reported in the Chinese population for the first time. This mutation widens the mutational spectrum of RS1 in Asians. Identification of mutations in the RS1 gene and expanded information on clinical manifestations will facilitate early diagnosis, appropriate early therapy, and genetic counseling regarding the prognosis of XLRS.

  17. Prevalence of relevant NS5A resistance-associated substitutions to elbasvir in genotype 1a hepatitis C virus patients in Spain.

    PubMed

    Palladino, Claudia; Esteban-Cartelle, Beatriz; Mate-Cano, Irene; Sánchez-Carrillo, Marta; Resino, Salvador; Briz, Verónica

    2018-05-01

    Resistance-associated substitutions (RASs) to the new HCV NS5A inhibitor elbasvir may limit its efficacy and lead to virological failure in HCV-GT1a-infected patients. There are no data outside clinical trials evaluating their prevalence and impact in grazoprevir/elbasvir in GT1a-infected patients in Spain. A multicentre cross-sectional study of 632 initial patients was conducted. In 13 of these patients, the sample could not be amplified or a consensus sequence by Sanger sequencing could not be performed. Ultimately, 617 HCV-G1a-infected individuals treated at 84 Spanish hospitals from the 17 autonomous communities plus the 2 autonomous cities of Spain were analysed. HCV population sequencing was used to identify RAS to elbasvir and the mutational pattern and drug sensitivity were confirmed by geno2pheno[HCV]. Viruses bearing RASs to elbasvir were present in 6.2% of HCV-G1a infected patients. The most common RASs were the Y93C/H/N and Q30E/H/R (2.4% and 2.3%, respectively). Only 3.4% of the identified RASs to elbasvir conferred reduced susceptibility to elbasvir by geno2pheno[HCV], which exclusively identified the positions Q30H/R (n=7) and Y93C/H/N (n=8) as single mutations and Q30H+Y93H (n=4) and Q30R+Y93H (n=2) as double mutations as the major RASs to elbasvir. A lower prevalence of RASs to elbasvir was observed in our HCV-G1a Spanish cohort than reported previously in clinical trials evaluating patients from the USA. This information may be essential to guide the implementation of grazoprevir/elbasvir in Spain and to manage G1a-infected patients. Copyright © 2017 Elsevier España, S.L.U. and Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

  18. Structure and Functional Characterization of Human Histidine Triad Nucleotide-Binding Protein 1 Mutations Associated with Inherited Axonal Neuropathy with Neuromyotonia.

    PubMed

    Shah, Rachit M; Maize, Kimberly M; West, Harrison T; Strom, Alexander M; Finzel, Barry C; Wagner, Carston R

    2018-05-19

    Inherited peripheral neuropathies are a group of neurodegenerative disorders that clinically affect 1 in 2500 individuals. Recently, genetic mutations in human histidine nucleotide-binding protein 1 (hHint1) have been strongly and most frequently associated with patients suffering from axonal neuropathy with neuromyotonia. However, the correlation between the impact of these mutations on the hHint1 structure, enzymatic activity and in vivo function has remained ambiguous. Here, we provide detailed biochemical characterization of a set of these hHint1 mutations. Our findings indicate that half of the mutations (R37P, G93D and W123*) resulted in a destabilization of the dimeric state and a significant decrease in catalytic activity and HINT1 inhibitor binding affinity. The H112N mutant was found to be dimeric, but devoid of catalytic activity, due to the loss of the catalytically essential histidine; nevertheless, it exhibited high affinity to AMP and a HINT1 inhibitor. In contrast to the active-site mutants, the catalytic activity and dimeric structure of the surface mutants, C84R and G89V, were found to be similar to the wild-type enzyme. Taken together, our results suggest that the pathophysiology of inherited axonal neuropathy with neuromyotonia can be induced by conversion of HINT1 from a homodimer to monomer, by modification of select surface residues or by a significant reduction of the enzyme's catalytic efficiency. Copyright © 2018. Published by Elsevier Ltd.

  19. The effect of mild traumatic brain injury on peripheral nervous system pathology in wild-type mice and the G93A mutant mouse model of motor neuron disease.

    PubMed

    Evans, T M; Jaramillo, C A; Sataranatarajan, K; Watts, L; Sabia, M; Qi, W; Van Remmen, H

    2015-07-09

    Traumatic brain injury (TBI) is associated with a risk of neurodegenerative disease. Some suggest a link between TBI and motor neuron disease (MND), including amyotrophic lateral sclerosis (ALS). To investigate the potential mechanisms linking TBI to MND, we measured motor function and neuropathology following mild-TBI in wild-type and a transgenic model of ALS, G93A mutant mice. Mild-TBI did not alter the lifespan of G93A mice or age of onset; however, rotarod performance was impaired in G93A verses wild-type mice. Grip strength was reduced only in G93A mice after mild-TBI. Increased electromyography (EMG) abnormalities and markers of denervation (AchR, Runx1) indicate that mild-TBI may result in peripheral effects that are exaggerated in G93A mice. Markers of inflammation (cell edema, astrogliosis and microgliosis) were detected at 24 and 72h in the brain and spinal cord in wild-type and G93A mice. Levels of F2-isoprostanes, a marker of oxidative stress, were increased in the spinal cord 24h post mild-TBI in wild-type mice but were not affected by TBI in G93A mice. In summary, our data demonstrate that mild-TBI induces inflammation and oxidative stress and negatively impacts muscle denervation and motor performance, suggesting mild-TBI can potentiate motor neuron pathology and influence the development of MND in mice. Published by Elsevier Ltd.

  20. HAEdb: a novel interactive, locus-specific mutation database for the C1 inhibitor gene.

    PubMed

    Kalmár, Lajos; Hegedüs, Tamás; Farkas, Henriette; Nagy, Melinda; Tordai, Attila

    2005-01-01

    Hereditary angioneurotic edema (HAE) is an autosomal dominant disorder characterized by episodic local subcutaneous and submucosal edema and is caused by the deficiency of the activated C1 esterase inhibitor protein (C1-INH or C1INH; approved gene symbol SERPING1). Published C1-INH mutations are represented in large universal databases (e.g., OMIM, HGMD), but these databases update their data rather infrequently, they are not interactive, and they do not allow searches according to different criteria. The HAEdb, a C1-INH gene mutation database (http://hae.biomembrane.hu) was created to contribute to the following expectations: 1) help the comprehensive collection of information on genetic alterations of the C1-INH gene; 2) create a database in which data can be searched and compared according to several flexible criteria; and 3) provide additional help in new mutation identification. The website uses MySQL, an open-source, multithreaded, relational database management system. The user-friendly graphical interface was written in the PHP web programming language. The website consists of two main parts, the freely browsable search function, and the password-protected data deposition function. Mutations of the C1-INH gene are divided in two parts: gross mutations involving DNA fragments >1 kb, and micro mutations encompassing all non-gross mutations. Several attributes (e.g., affected exon, molecular consequence, family history) are collected for each mutation in a standardized form. This database may facilitate future comprehensive analyses of C1-INH mutations and also provide regular help for molecular diagnostic testing of HAE patients in different centers.

  1. miR-140-5p regulates hypoxia-mediated human pulmonary artery smooth muscle cell proliferation, apoptosis and differentiation by targeting Dnmt1 and promoting SOD2 expression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Yanwei; Xu, Jing, E-mail: xujingdoc@163.com

    miR-140-5p is down-regulated in patients with pulmonary arterial hypertension (PAH) and experimental models of PAH, and inhibits hypoxia-mediated pulmonary artery smooth muscle cell (PASMC) proliferation in vitro. Delivery of synthetic miR-140-5p prevents and treats established, experimental PAH. DNA methyltransferase 1 (Dnmt1) is up-regulated in PAH associated human PASMCs (HPASMCs), which promotes the development of PAH by hypermethylation of CpG islands within the promoter for superoxide dismutase 2 (SOD2) and down-regulating SOD2 expression. We searched for miR-140-5p targets using TargetScan, PicTar and MiRanda tools, and found that Dnmt1 is a potential target of miR-140-5p. Based on these findings, we speculated that miR-140-5pmore » might target Dnmt1 and regulate SOD2 expression to regulate hypoxia-mediated HPASMC proliferation, apoptosis and differentiation. We detected the expression of miR-140-5p, Dnmt1 and SOD2 by quantitative real-time polymerase chain reaction (qRT-PCR) and western blot assays, respectively, and found down-regulation of miR-140-5p and SOD2 and up-regulation of Dnmt1 exist in PAH tissues and hypoxia-mediated HPASMCs. Cell proliferation, apoptosis and differentiation detection showed that miR-140-5p inhibits proliferation and promotes apoptosis and differentiation of HPASMCs in hypoxia, while the effect of Dnmt1 on hypoxia-mediated HPASMCs is reversed. Luciferase assay confirmed that miR-140-5p targets Dnmt1 directly. An inverse correlation is also found between miR-140-5p and Dnmt1 in HPASMCs. In addition, we further investigated whether miR-140-5p and Dnmt1 regulate HPASMC proliferation, apoptosis and differentiation by regulating SOD2 expression, and the results confirmed our speculation. Taken together, these results indicated that miR-140-5p at least partly targets Dnmt1 and regulates SOD2 expression to inhibit proliferation and promote apoptosis and differentiation of HPASMCs in hypoxia. - Highlights: • miR-140-5p and SOD2

  2. Relationship of the superoxide dismutase genes, sodA and sodB, to the iron uptake (/ital fur/) regulon in /ital Escherichia coli/ K-12

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Niederhoffer, E.C.; Naranjo, C.M.; Fee, J.A.

    1988-01-01

    Expression of sodA, as indicated by MnSod activity is normal in /ital fur/ mutants. This suggests that sodA is not a member of the /ital fur/ regulon and that the putative Fe-binding, regulatory protein of sodA, suggested by Moody and Hassan is not the Fur protein. by contrast, expression of sodB, as indicated by FeSod activity, is completely blocked in /ital fur/ mutants and the effect is restored by transformation with a plasmid having a normal /ital fur/ locus. The observations suggest that Fur, either directly or indirectly, controls SodB biosynthesis. Additional observations are described which indicate that SodB andmore » Fur act together in a complicated fashion to control the biosynthesis of enterobactin. 26 refs., 3 tabs.« less

  3. DHPLC-based mutation analysis of ENG and ALK-1 genes in HHT Italian population.

    PubMed

    Lenato, Gennaro M; Lastella, Patrizia; Di Giacomo, Marilena C; Resta, Nicoletta; Suppressa, Patrizia; Pasculli, Giovanna; Sabbà, Carlo; Guanti, Ginevra

    2006-02-01

    Hereditary haemorrhagic telangiectasia (HHT or Rendu-Osler-Weber syndrome) is an autosomal dominant disorder characterized by localized angiodysplasia due to mutations in endoglin, ALK-1 gene, and a still unidentified locus. The lack of highly recurrent mutations, locus heterogeneity, and the presence of mutations in almost all coding exons of the two genes makes the screening for mutations time-consuming and costly. In the present study, we developed a DHPLC-based protocol for mutation detection in ALK1 and ENG genes through retrospective analysis of known sequence variants, 20 causative mutations and 11 polymorphisms, and a prospective analysis on 47 probands with unknown mutation. Overall DHPLC analysis identified the causative mutation in 61 out 66 DNA samples (92.4%). We found 31 different mutations in the ALK1 gene, of which 15 are novel, and 20, of which 12 are novel, in the ENG gene, thus providing for the first time the mutational spectrum in a cohort of Italian HHT patients. In addition, we characterized the splicing pattern of ALK1 gene in lymphoblastoid cells, both in normal controls and in two individuals carrying a mutation in the non-invariant -3 position of the acceptor splice site upstream exon 6 (c.626-3C>G). Functional essay demonstrated the existence, also in normal individuals, of a small proportion of ALK1 alternative splicing, due to exon 5 skipping, and the presence of further aberrant splicing isoforms in the individuals carrying the c.626-3C>G mutation. 2006 Wiley-Liss, Inc.

  4. Prevalence of ESR1 E380Q mutation in tumor tissue and plasma from Japanese breast cancer patients.

    PubMed

    Takeshita, Takashi; Yamamoto, Yutaka; Yamamoto-Ibusuki, Mutsuko; Sueta, Aiko; Tomiguchi, Mai; Murakami, Keiichi; Omoto, Yoko; Iwase, Hirotaka

    2017-11-22

    ESR1 mutations have attracted attention as a potentially important marker and treatment target in endocrine therapy-resistant breast cancer patients. The E380Q mutation, which is one of the ESR1 mutations, is associated with estradiol (E2) hypersensitivity, increased DNA binding to the estrogen response element, and E2-independent constitutive trans-activation activity, but its frequency in ESR1 mutations remains unknown. The present study aimed to investigate the E380Q mutation in comparison with the other representative ESR1 mutations. We screened a total of 62 patients (66 tumor tissues and 69 plasma cell-free DNA (cfDNA)) to detect ESR1 mutations (E380Q, Y537S, Y537N, Y537C, and D538G) using droplet-digital polymerase chain reaction. Plasma was collected at more than two points of the clinical course, in whom changes of ESR1 mutations under treatment were investigated. We detected ESR1 mutations in 21% (12/57) of MBCs. The E380Q ESR1 mutation was found in 16% (2/12) and the other ESR1 LBD mutations were five (41.6%) of Y537S, and four each (33.3%) of D538G, Y537N, and Y537C, in 12 ESR1 mutant breast cancer patients. Five tumors had multiple ESR1 mutations: three had double ESR1 mutations; Y537S/E380Q, Y37S/Y537C, and Y537S/D538G, and two had triple ESR1 mutations; Y537S/Y537N/D538G. In plasma cfDNA analysis, the E380Q mutation was not detected, but increases in other ESR1 mutations were detected in 46.2% (6/13) of MBC patients under treatment. We have shown that there are distinct populations of ESR1 mutations in metastatic tissue and plasma. Each ESR1 mutation may have different clinical significance, and it will be necessary to investigate them all.

  5. Novel mutations in the homogentisate 1,2 dioxygenase gene identified in Jordanian patients with alkaptonuria.

    PubMed

    Al-sbou, Mohammed

    2012-06-01

    This study was conducted to identify mutations in the homogentisate 1,2 dioxygenase gene (HGD) in alkaptonuria patients among Jordanian population. Blood samples were collected from four alkaptonuria patients, four carriers, and two healthy volunteers. DNA was isolated from peripheral blood. All 14 exons of the HGD gene were amplified using the polymerase chain reaction (PCR) technique. The PCR products were then purified and analyzed by sequencing. Five mutations were identified in our samples. Four of them were novel C1273A, T1046G, 551-552insG, T533G and had not been previously reported, and one mutation T847C has been described before. The types of mutations identified were two missense mutations, one splice site mutation, one frameshift mutation, and one polymorphism. We present the first molecular study of the HGD gene in Jordanian alkaptonuria patients. This study provides valuable information about the molecular basis of alkaptonuria in Jordanian population.

  6. Mitochondrial DNA 8993T>G mutation in a child with ornithine transcarbamylase deficiency and leigh syndrome: an unexpected association.

    PubMed

    Henriques, Margarida; Diogo, Luísa; Garcia, Paula; Pratas, João; Simões, Marta; Grazina, Manuela

    2012-08-01

    MC, female, is the third child of a nonconsanguineous Portuguese couple, born after an uneventful pregnancy and delivery. A positive family history of ornithine transcarbamylase deficiency, associated with the IVS8+1 G>A mutation in the ornithine transcarbamylase gene, prompted prenatal diagnosis with identification of the same mutation in the proband. During an episode of Klebsiella pneumoniae sepsis at 1.5 months of age, lactic acidosis and moderate hyperammonemia were noticed. After a short asymptomatic period, progressive neurologic symptoms, with normal ammonemia, persistent hyperlactacidemia, and typical lesions in brain computed tomography (CT) scan led to a diagnosis of Leigh syndrome. Mitochondrial respiratory chain complex V was reduced in the liver. The mtDNA 8993T>G mutation was identified in the liver, muscle, and blood (82%-87% heteroplasmy). She died at 6 months of age. This case represents a benign phenotype of ornithine transcarbamylase deficiency, associated with a severe mitochondrial respiratory chain disorder due to an mtDNA pathogenic mutation.

  7. Novel mutations of TCOF1 gene in European patients with treacher Collins syndrome

    PubMed Central

    2011-01-01

    Background Treacher Collins syndrome (TCS) is one of the most severe autosomal dominant congenital disorders of craniofacial development and shows variable phenotypic expression. TCS is extremely rare, occurring with an incidence of 1 in 50.000 live births. The TCS distinguishing characteristics are represented by down slanting palpebral fissures, coloboma of the eyelid, micrognathia, microtia and other deformity of the ears, hypoplastic zygomatic arches, and macrostomia. Conductive hearing loss and cleft palate are often present. TCS results from mutations in the TCOF1 gene located on chromosome 5, which encodes a serine/alanine-rich nucleolar phospho-protein called Treacle. However, alterations in the TCOF1 gene have been implicated in only 81-93% of TCS cases. Methods In this study, the entire coding regions of the TCOF1 gene, including newly described exons 6A and 16A, were sequenced in 46 unrelated subjects suspected of TCS clinical indication. Results Fifteen mutations were reported, including twelve novel and three already described in 14 sporadic patients and in 3 familial cases. Moreover, seven novel polymorphisms were also described. Most of the mutations characterised were microdeletions spanning one or more nucleotides, in addition to an insertion of one nucleotide in exon 18 and a stop mutation. The deletions and the insertion described cause a premature termination of translation, resulting in a truncated protein. Conclusion This study confirms that almost all the TCOF1 pathogenic mutations fall in the coding region and lead to an aberrant protein. PMID:21951868

  8. Novel mutations of TCOF1 gene in European patients with Treacher Collins syndrome.

    PubMed

    Conte, Chiara; D'Apice, Maria Rosaria; Rinaldi, Fabrizio; Gambardella, Stefano; Sangiuolo, Federica; Novelli, Giuseppe

    2011-09-27

    Treacher Collins syndrome (TCS) is one of the most severe autosomal dominant congenital disorders of craniofacial development and shows variable phenotypic expression. TCS is extremely rare, occurring with an incidence of 1 in 50.000 live births. The TCS distinguishing characteristics are represented by down slanting palpebral fissures, coloboma of the eyelid, micrognathia, microtia and other deformity of the ears, hypoplastic zygomatic arches, and macrostomia. Conductive hearing loss and cleft palate are often present. TCS results from mutations in the TCOF1 gene located on chromosome 5, which encodes a serine/alanine-rich nucleolar phospho-protein called Treacle. However, alterations in the TCOF1 gene have been implicated in only 81-93% of TCS cases. In this study, the entire coding regions of the TCOF1 gene, including newly described exons 6A and 16A, were sequenced in 46 unrelated subjects suspected of TCS clinical indication. Fifteen mutations were reported, including twelve novel and three already described in 14 sporadic patients and in 3 familial cases. Moreover, seven novel polymorphisms were also described. Most of the mutations characterised were microdeletions spanning one or more nucleotides, in addition to an insertion of one nucleotide in exon 18 and a stop mutation. The deletions and the insertion described cause a premature termination of translation, resulting in a truncated protein. This study confirms that almost all the TCOF1 pathogenic mutations fall in the coding region and lead to an aberrant protein.

  9. Muscle MRI in neutral lipid storage disease with myopathy carrying mutation c.187+1G>A.

    PubMed

    Xu, Chunxiao; Zhao, Yawen; Liu, Jing; Zhang, Wei; Wang, Zhaoxia; Yuan, Yun

    2015-06-01

    We describe the clinical and muscle MRI changes in 2 siblings with neutral lipid storage disease with myopathy (NLSDM) carrying the mutation c.187+1G>A. Peripheral blood smears, genetic tests, and muscle biopsies were performed. Thigh MRI was performed to observe fatty replacement, muscle edema, and muscle bulk from axial sections. Both siblings had similar fatty infiltration and edema. T1-weighted images of the gluteus maximus, adductor magnus, semitendinosus, and semimembranosus revealed marked and diffuse fatty infiltration. There was asymmetric involvement in biceps femoris and quadriceps. There was extensive fatty infiltration in the quadriceps, except for the rectus femoris. Gracilis and sartorius were relatively spared. Thigh muscle volume was decreased, while the gracilis and sartorius appeared to show compensatory hypertrophy. Compared with previous reports in NLSDM, MRI changes in this myopathy tended to be more severe. Asymmetry and relatively selective fatty infiltration were characteristics. © 2014 Wiley Periodicals, Inc.

  10. Inhibitors of SOD1 Interaction as an Approach to Slow the Progressive Spread of ALS Symptoms

    DTIC Science & Technology

    2016-07-01

    luciferase enzyme can be split into 2 halves. These 2 halves can be forced to reconstitute an active enzyme if they are brought together by some...force. In our assay, this force is the normal interaction that occurs when 2 individual SOD1 proteins come together to form a normal active enzyme ...Using recombinant DNA, we create fusion proteins of SOD1 and each half of the luciferase enzyme . In the past year, we have characterized and optimized

  11. A specific collagen type II gene (COL2A1) mutation presenting as spondyloperipheral dysplasia

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zabel, B.; Hilbert, K.; Spranger, J.

    1996-05-03

    We report on a patient with a skeletal dysplasia characterized by short stature, spondylo-epiphyseal involvement, and brachydactyly E-like changes. This condition has been described as spondyloperipheral dysplasia and the few published cases suggest autosomal dominant inheritance with considerable clinical variability. We found our sporadic case to be due to a collagen type II defect resulting from a specific COL2A1 mutation. This mutation is the first to be located at the C-terminal outside the helical domain of COL2A1. A frameshift as consequence of a 5 bp duplication in exon 51 leads to a stop codon. The resulting truncated C-propeptide region seemsmore » to affect helix formation and produces changes of chondrocyte morphology, collagen type II fibril structure and cartilage matrix composition. Our case with its distinct phenotype adds another chondrodysplasia to the clinical spectrum of type II collagenopathies. 16 refs., 4 figs.« less

  12. Molecular identification of Nocardia species using the sodA gene: Identificación molecular de especies de Nocardia utilizando el gen sodA.

    PubMed

    Sánchez-Herrera, K; Sandoval, H; Mouniee, D; Ramírez-Durán, N; Bergeron, E; Boiron, P; Sánchez-Saucedo, N; Rodríguez-Nava, V

    2017-09-01

    Currently for bacterial identification and classification the rrs gene encoding 16S rRNA is used as a reference method for the analysis of strains of the genus Nocardia. However, it does not have enough polymorphism to differentiate them at the species level. This fact makes it necessary to search for molecular targets that can provide better identification. The sod A gene (encoding the enzyme superoxide dismutase) has had good results in identifying species of other Actinomycetes. In this study the sod A gene is proposed for the identification and differentiation at the species level of the genus Nocardia. We used 41 type species of various collections; a 386 bp fragment of the sod A gene was amplified and sequenced, and a phylogenetic analysis was performed comparing the genes rrs (1171 bp), hsp 65 (401 bp), sec A1 (494 bp), gyr B (1195 bp) and rpo B (401 bp). The sequences were aligned using the Clustal X program. Evolutionary trees according to the neighbour-joining method were created with the programs Phylo_win and MEGA 6. The specific variability of the sod A genus of the genus Nocardia was analysed. A high phylogenetic resolution, significant genetic variability, and specificity and reliability were observed for the differentiation of the isolates at the species level. The polymorphism observed in the sod A gene sequence contains variable regions that allow the discrimination of closely related Nocardia species. The clear specificity, despite its small size, proves to be of great advantage for use in taxonomic studies and clinical diagnosis of the genus Nocardia.

  13. Exome sequencing identifies a novel homozygous mutation in the phosphate transporter SLC34A1 in hypophosphatemia and nephrocalcinosis.

    PubMed

    Rajagopal, Abbhirami; Braslavsky, Débora; Lu, James T; Kleppe, Soledad; Clément, Florencia; Cassinelli, Hamilton; Liu, David S; Liern, Jose Miguel; Vallejo, Graciela; Bergadá, Ignacio; Gibbs, Richard A; Campeau, Phillipe M; Lee, Brendan H

    2014-11-01

    Two Argentinean siblings (a boy and a girl) from a nonconsanguineous family presented with hypercalcemia, hypercalciuria, hypophosphatemia, low parathyroid hormone (PTH), and nephrocalcinosis. The goal of this study was to identify genetic causes of the clinical findings in the two siblings. Whole exome sequencing was performed to identify disease-causing mutations in the youngest sibling, and a candidate variant was screened in other family members by Sanger sequencing. In vitro experiments were conducted to determine the effects of the mutation that was identified. Affected siblings (2 y.o. female and 10 y.o male) and their parents were included in the study. Informed consent was obtained for genetic studies. A novel homozygous mutation in the gene encoding the renal sodium-dependent phosphate transporter SLC34A1 was identified in both siblings (c.1484G>A, p.Arg495His). In vitro studies showed that the p.Arg495His mutation resulted in decreased phosphate uptake when compared to wild-type SLC34A1. The homozygous G>A transition that results in the substitution of histidine for arginine at position 495 of the renal sodium-dependent phosphate transporter, SLC34A1, is involved in disease pathogenesis in these patients. Our report of the second family with two mutated SLC34A1 alleles expands the known phenotype of this rare condition.

  14. The mutY gene: a mutator locus in Escherichia coli that generates G.C----T.A transversions.

    PubMed Central

    Nghiem, Y; Cabrera, M; Cupples, C G; Miller, J H

    1988-01-01

    We have used a strain with an altered lacZ gene, which reverts to wild type via only certain transversions, to detect transversion-specific mutators in Escherichia coli. Detection relied on a papillation technique that uses a combination of beta-galactosides to reveal blue Lac+ papillae. One class of mutators is specific for the G.C----T.A transversion as determined by the reversion pattern of a set of lacZ mutations and by the distribution of forward nonsense mutations in the lacI gene. The locus responsible for the mutator phenotype is designated mutY and maps near 64 min on the genetic map of E. coli. The mutY locus may act in a similar but reciprocal fashion to the previously characterized mutT locus, which results in A.T----C.G transversions. Images PMID:3128795

  15. A novel missense mutation of the paired box 3 gene in a Turkish family with Waardenburg syndrome type 1

    PubMed Central

    Ozturk, A.Taylan; Adibelli, Hamit; Unal, Nurettin; Tukun, Ajlan

    2013-01-01

    Purpose Screening of mutations in the paired box 3 (PAX3) gene in three generations of a Turkish family with Waardenburg syndrome type 1 (WS1). Methods WS1 was diagnosed in a 13-month-old girl according to the WS Consortium criteria. Detailed family history of the proband revealed eight affected members in three generations. Routine clinical and audiological examination and ophthalmologic evaluation were performed on eight affected and five healthy members of the study family. Dystopia canthorum was detected in all affected patients; however, a brilliant blue iris was present in five patients who also had mild retinal hypopigmentation. Genomic DNA was extracted from the peripheral blood of affected and unaffected individuals in the family as well as 50 unrelated healthy volunteers. All coding exons and adjacent intronic regions of PAX3 were sequenced directly. Results A novel missense heterozygous c.788T>G mutation was identified in eight patients. This nucleotide alteration was not found in unaffected members of the study family or in the 50 unrelated control subjects. The mutation causes V263G amino-acid substitution in the homeodomain of the PAX3 protein, which represents the 45th residue of helix 3. Conclusions We identified a novel missense c.788T>G mutation in PAX3 in a family with Waardenburg syndrome with intrafamilial phenotypic heterogeneity. PMID:23378733

  16. A novel missense mutation of the paired box 3 gene in a Turkish family with Waardenburg syndrome type 1.

    PubMed

    Hazan, Filiz; Ozturk, A Taylan; Adibelli, Hamit; Unal, Nurettin; Tukun, Ajlan

    2013-01-01

    Screening of mutations in the paired box 3 (PAX3) gene in three generations of a Turkish family with Waardenburg syndrome type 1 (WS1). WS1 was diagnosed in a 13-month-old girl according to the WS Consortium criteria. Detailed family history of the proband revealed eight affected members in three generations. Routine clinical and audiological examination and ophthalmologic evaluation were performed on eight affected and five healthy members of the study family. Dystopia canthorum was detected in all affected patients; however, a brilliant blue iris was present in five patients who also had mild retinal hypopigmentation. Genomic DNA was extracted from the peripheral blood of affected and unaffected individuals in the family as well as 50 unrelated healthy volunteers. All coding exons and adjacent intronic regions of PAX3 were sequenced directly. A novel missense heterozygous c.788T>G mutation was identified in eight patients. This nucleotide alteration was not found in unaffected members of the study family or in the 50 unrelated control subjects. The mutation causes V263G amino-acid substitution in the homeodomain of the PAX3 protein, which represents the 45(th) residue of helix 3. We identified a novel missense c.788T>G mutation in PAX3 in a family with Waardenburg syndrome with intrafamilial phenotypic heterogeneity.

  17. Lack of pathogenic mutations in SOS1 gene in phenytoin-induced gingival overgrowth patients.

    PubMed

    Margiotti, Katia; Pascolini, Giulia; Consoli, Federica; Guida, Valentina; Di Bonaventura, Carlo; Giallonardo, Anna Teresa; Pizzuti, Antonio; De Luca, Alessandro

    2017-08-01

    Gingival overgrowth is a side effect associated with some distinct classes of drugs, such as anticonvulsants, immunosuppressants, and calcium channel blockers. One of the main drugs associated with gingival overgrowth is the antiepileptic phenytoin, which affects gingival tissues by altering extracellular matrix metabolism. It has been shown that mutation of human SOS1 gene is responsible for a rare hereditary gingival fibromatosis type 1, a benign gingival overgrowth. The aim of the present study is to evaluate the possible contribution of SOS1 mutation to gingival overgrowth-related phenotype. We selected and screened for mutations a group of 24 epileptic patients who experienced significant gingival overgrowth following phenytoin therapy. Mutation scanning was carried out by denaturing high-performance liquid chromatography analysis of the entire coding region of the SOS1 gene. Novel identified variants were analyzed in-silico by using Alamut Visual mutation interpretation software, and comparison with normal control group was done. Mutation scanning of the entire coding sequence of SOS1 gene identified seven intronic variants and one new exonic substitution (c.138G>A). The seven common intronic variants were not considered to be of pathogenic importance. The exonic substitution c.138G>A was found to be absent in 100 ethnically matched normal control chromosomes, but was not expected to have functional significance based on prediction bioinformatics tools. This study represents the first mutation analysis of the SOS1 gene in phenytoin-induced gingival overgrowth epileptic patients. Present results suggest that obvious pathogenic mutations in the SOS1 gene do not represent a common mechanism underlying phenytoin-induced gingival overgrowth in epileptic patients; other mechanisms are likely to be involved in the pathogenesis of this drug-induced phenotype. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. DNA polymerase θ contributes to the generation of C/G mutations during somatic hypermutation of Ig genes

    PubMed Central

    Masuda, Keiji; Ouchida, Rika; Takeuchi, Arata; Saito, Takashi; Koseki, Haruhiko; Kawamura, Kiyoko; Tagawa, Masatoshi; Tokuhisa, Takeshi; Azuma, Takachika; O-Wang, Jiyang

    2005-01-01

    Somatic hypermutation of Ig variable region genes is initiated by activation-induced cytidine deaminase; however, the activity of multiple DNA polymerases is required to ultimately introduce mutations. DNA polymerase η (Polη) has been implicated in mutations at A/T, but polymerases involved in C/G mutations have not been identified. We have generated mutant mice expressing DNA polymerase (Polθ) specifically devoid of polymerase activity. Compared with WT mice, Polq-inactive (Polq, the gene encoding Polθ) mice exhibited a reduced level of serum IgM and IgG1. The mutant mice mounted relatively normal primary and secondary immune responses to a T-dependent antigen, but the production of high-affinity specific antibodies was partially impaired. Analysis of the JH4 intronic sequences revealed a slight reduction in the overall mutation frequency in Polq-inactive mice. Remarkably, although mutations at A/T were unaffected, mutations at C/G were significantly decreased, indicating an important, albeit not exclusive, role for Polθ activity. The reduction of C/G mutations was particularly focused on the intrinsic somatic hypermutation hotspots and both transitions and transversions were similarly reduced. These findings, together with the recent observation that Polθ efficiently catalyzes the bypass of abasic sites, lead us to propose that Polθ introduces mutations at C/G by replicating over abasic sites generated via uracil-DNA glycosylase. PMID:16172387

  19. CDKN1C mutation affecting the PCNA-binding domain as a cause of familial Russell Silver syndrome.

    PubMed

    Brioude, F; Oliver-Petit, I; Blaise, A; Praz, F; Rossignol, S; Le Jule, M; Thibaud, N; Faussat, A-M; Tauber, M; Le Bouc, Y; Netchine, I

    2013-12-01

    Russell Silver syndrome (RSS) leads to prenatal and postnatal growth retardation. About 55% of RSS patients present a loss-of-methylation of the paternal ICR1 domain on chromosome 11p15. CDKN1C is a cell proliferation inhibitor encoded by an imprinted gene in the 11p15 ICR2 domain. CDKN1C mutations lead to Beckwith Wiedemann syndrome (BWS, overgrowth syndrome) and in IMAGe syndrome which associates growth retardation and adrenal insufficiency. We searched for CDKN1C mutations in a cohort of clinically diagnosed RSS patients with no molecular anomaly. The coding sequence and intron-exon boundaries of CDKN1C were analysed in 97 RSS patients. The impact of CDKN1C variants on the cell cycle in vitro were determined by flow cytometry. Stability of CDKN1C was studied by western immunoblotting after inhibition of translation with cycloheximide. We identified the novel c.836G>[G;T] (p.Arg279Leu) mutation in a familial case of intrauterine growth retardation (IUGR) with RSS phenotype and no evidence of IMAGe. All the RSS patients inherited this mutation from their mothers (consistent with monoallelic expression from the maternal allele of the gene). A mutation of this amino acid (p.Arg279Pro) has been reported in cases of IMAGe. Functional analysis showed that Arg279Leu (RSS) did not affect the cell cycle, whereas the Arg279Pro mutation (IMAGe) led to a gain of function. Arg279Leu (RSS) led to an increased stability which could explain an increased activity of CDKN1C. CDKN1C mutations cause dominant maternally transmitted RSS, completing the molecular mirror with BWS. CDKN1C should be investigated in cases with family history of RSS.

  20. A novel PAX3 mutation in a Japanese boy with Waardenburg syndrome type 1.

    PubMed

    Yoshida, Yu; Doi, Rieko; Adachi, Kaori; Nanba, Eiji; Kodani, Isamu; Ryoke, Kazuo

    2016-01-01

    Waardenburg syndrome type 1 (WS1) is a rare autosomal dominant disorder characterized by hair hypopigmentation, abnormal iris pigmentation, and congenital hearing loss. WS1 is caused by mutations in paired box gene 3 (PAX3). We identified a novel PAX3 mutation (c.1107 C>G, p.Ser369Arg) in a Japanese WS1 patient showing abnormal right iris pigmentation, right-sided congenital hearing loss, synophrys, incomplete left cleft lip, and cryptorchidism.