Production of Dwarf Lettuce by Overexpressing a Pumpkin Gibberellin 20-Oxidase Gene
Niki, Tomoya; Nishijima, Takaaki; Nakayama, Masayoshi; Hisamatsu, Tamotsu; Oyama-Okubo, Naomi; Yamazaki, Hiroko; Hedden, Peter; Lange, Theo; Mander, Lewis N.; Koshioka, Masaji
2001-01-01
We investigated the effect of overexpressing a pumpkin gibberellin (GA) 20-oxidase gene encoding an enzyme that forms predominantly biologically inactive products on GA biosynthesis and plant morphology in transgenic lettuce (Lactuca sativa cv Vanguard) plants. Lettuce was transformed with the pumpkin GA 20-oxidase gene downstream of a strong constitutive promoter cassette (El2–35S-Ω). The transgenic plants in which the pumpkin gene was detected by polymerase chain reaction were dwarfed in the T2 generation, whereas transformants with a normal growth phenotype did not contain the transgene. The result of Southern-blot analysis showed that the transgene was integrated as a single copy; the plants segregated three dwarfs to one normal in the T2 generation, indicating that the transgene was stable and dominant. The endogenous levels of GA1 and GA4 were reduced in the dwarfs, whereas large amounts of GA17 and GA25, which are inactive products of the pumpkin GA 20-oxidase, accumulated in these lines. These results indicate that a functional pumpkin GA 20-oxidase is expressed in the transgenic lettuce, resulting in a diversion of the normal pathway of GA biosynthesis to inactive products. Furthermore, this technique may be useful for controlling plant stature in other agricultural and horticultural species. PMID:11457947
Xu, Y L; Li, L; Wu, K; Peeters, A J; Gage, D A; Zeevaart, J A
1995-07-03
The biosynthesis of gibberellins (GAs) after GA12-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11.-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidase gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA53 to GA44 and GA19 to GA20. The Arabidopsis GA 20-oxidase shares 55% identity and > 80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA5 locus of Arabidopsis. The ga5 semidwarf mutant contains a G-->A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Ara-bidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA4 treatment, suggesting end-product repression in the GA biosynthetic pathway.
Gibberellin 20-oxidase gene OsGA20ox3 regulates plant stature and disease development in rice.
Qin, Xue; Liu, Jun Hua; Zhao, Wen Sheng; Chen, Xu Jun; Guo, Ze Jian; Peng, You Liang
2013-02-01
Gibberellin (GA) 20-oxidase (GA20ox) catalyses consecutive steps of oxidation in the late part of the GA biosynthetic pathway. A T-DNA insertion mutant (17S-14) in rice, with an elongated phenotype, was isolated. Analysis of the flanking sequences of the T-DNA insertion site revealed that an incomplete T-DNA integration resulted in enhanced constitutively expression of downstream OsGA20ox3 in the mutant. The accumulation of bioactive GA(1) and GA(4) were increased in the mutant in comparison with the wild-type plant. Transgenic plants overexpressing OsGA20ox3 showed phenotypes similar to those of the 17S-14 mutant, and the RNA interference (RNAi) lines that had decreased OsGA20ox3 expression exhibited a semidwarf phenotype. Expression of OsGA20ox3 was detected in the leaves and roots of young seedlings, immature panicles, anthers, and pollens, based on β-glucuronidase (GUS) activity staining in transgenic plants expressing the OsGA20ox3 promoter fused to the GUS gene. The OsGA20ox3 RNAi lines showed enhanced resistance against rice pathogens Magnaporthe oryzae (causing rice blast) and Xanthomonas oryzae pv. oryzae (causing bacterial blight) and increased expression of defense-related genes. Conversely, OsGA20ox3-overexpressing plants were more susceptible to these pathogens comparing with the wild-type plants. The susceptibility of wild-type plants to X. oryzae pv. oryzae was increased by exogenous application of GA(3) and decreased by S-3307 treatment. Together, the results provide direct evidence for a critical role of OsGA20ox3 in regulating not only plant stature but also disease resistance in rice.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xu, Yun-Ling; Li, Li; Wu, Keqiang
1995-07-03
The biosynthesis of gibberellins (GAs) after GA{sub 12}-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidasemore » gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA{sub 53} to GA{sub 44} and GA{sub 19} to GA{sub 20}. The Arabidopsis GA 20-oxidase shares 55% identity and >80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA locus of Arabidopsis. The ga5 semidwarf mutant contains a G {yields} A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Arabidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA{sub 4} treatment, suggesting end-product repression in the GA biosynthetic pathway. 28 refs., 6
Withanage, Samanthi Priyanka; Hossain, Md Aktar; Kumar M, Sures; Roslan, Hairul Azman B; Abdullah, Mohammad Puad; Napis, Suhaimi B; Shukor, Nor Aini Ab
2015-06-01
Kenaf (Hibiscus cannabinus L.; Family: Malvaceae), is multipurpose crop, one of the potential alternatives of natural fiber for biocomposite materials. Longer fiber and higher cellulose contents are required for good quality biocomposite materials. However, average length of kenaf fiber (2.6 mm in bast and 1.28 mm in whole plant) is below the critical length (4 mm) for biocomposite production. Present study describes whether fiber length and cellulose content of kenaf plants could be enhanced by increasing GA biosynthesis in plants by overexpressing Arabidopsis thaliana Gibberellic Acid 20 oxidase (AtGA20ox) gene. AtGA20ox gene with intron was overexpressed in kenaf plants under the control of double CaMV 35S promoter, followed by in planta transformation into V36 and G4 varieties of kenaf. The lines with higher levels of bioactive GA (0.3-1.52 ng g(-1) fresh weight) were further characterized for their morphological and biochemical traits including vegetative and reproductive growth, fiber dimension and chemical composition. Positive impact of increased gibberellins on biochemical composition, fiber dimension and their derivative values were demonstrated in some lines of transgenic kenaf including increased cellulose content (91%), fiber length and quality but it still requires further study to confirm the critical level of this particular bioactive GA in transgenic plants.
Withanage, Samanthi Priyanka; Hossain, Md Aktar; Kumar M., Sures; Roslan, Hairul Azman B; Abdullah, Mohammad Puad; Napis, Suhaimi B.; Shukor, Nor Aini Ab.
2015-01-01
Kenaf (Hibiscus cannabinus L.; Family: Malvaceae), is multipurpose crop, one of the potential alternatives of natural fiber for biocomposite materials. Longer fiber and higher cellulose contents are required for good quality biocomposite materials. However, average length of kenaf fiber (2.6 mm in bast and 1.28 mm in whole plant) is below the critical length (4 mm) for biocomposite production. Present study describes whether fiber length and cellulose content of kenaf plants could be enhanced by increasing GA biosynthesis in plants by overexpressing Arabidopsis thaliana Gibberellic Acid 20 oxidase (AtGA20ox) gene. AtGA20ox gene with intron was overexpressed in kenaf plants under the control of double CaMV 35S promoter, followed by in planta transformation into V36 and G4 varieties of kenaf. The lines with higher levels of bioactive GA (0.3–1.52 ng g−1 fresh weight) were further characterized for their morphological and biochemical traits including vegetative and reproductive growth, fiber dimension and chemical composition. Positive impact of increased gibberellins on biochemical composition, fiber dimension and their derivative values were demonstrated in some lines of transgenic kenaf including increased cellulose content (91%), fiber length and quality but it still requires further study to confirm the critical level of this particular bioactive GA in transgenic plants. PMID:26175614
Isolation and expression of three gibberellin 20-oxidase cDNA clones from Arabidopsis.
Phillips, A L; Ward, D A; Uknes, S; Appleford, N E; Lange, T; Huttly, A K; Gaskin, P; Graebe, J E; Hedden, P
1995-07-01
Using degenerate oligonucleotide primers based on a pumpkin (Cucurbita maxima) gibberellin (GA) 20-oxidase sequence, six different fragments of dioxygenase genes were amplified by polymerase chain reaction from arabidopsis thaliana genomic DNA. One of these was used to isolate two different full-length cDNA clones, At2301 and At2353, from shoots of the GA-deficient Arabidopsis mutant ga1-2. A third, related clone, YAP169, was identified in the Database of Expressed Sequence Tags. The cDNA clones were expressed in Escherichia coli as fusion proteins, each of which oxidized GA12 at C-20 to GA15, GA24, and the C19 compound GA9, a precursor of bioactive GAs; the C20 tricarboxylic acid compound GA25 was formed as a minor product. The expression products also oxidized the 13-hydroxylated substrate GA53, but less effectively than GA12. The three cDNAs hybridized to mRNA species with tissue-specific patterns of accumulation, with At2301 being expressed in stems and inflorescences, At2353 in inflorescences and developing siliques, and YAP169 in siliques only. In the floral shoots of the ga1-2 mutant, transcript levels corresponding to each cDNA decreased dramatically after GA3 application, suggesting that GA biosynthesis may be controlled, at least in part, through down-regulation of the expression of the 20-oxidase genes.
Voorend, Wannes; Nelissen, Hilde; Vanholme, Ruben; De Vliegher, Alex; Van Breusegem, Frank; Boerjan, Wout; Roldán-Ruiz, Isabel; Muylle, Hilde; Inzé, Dirk
2016-03-01
Increased biomass yield and quality are of great importance for the improvement of feedstock for the biorefinery. For the production of bioethanol, both stem biomass yield and the conversion efficiency of the polysaccharides in the cell wall to fermentable sugars are of relevance. Increasing the endogenous levels of gibberellic acid (GA) by ectopic expression of GA20-OXIDASE1 (GA20-OX1), the rate-limiting step in GA biosynthesis, is known to affect cell division and cell expansion, resulting in larger plants and organs in several plant species. In this study, we examined biomass yield and quality traits of maize plants overexpressing GA20-OX1 (GA20-OX1). GA20-OX1 plants accumulated more vegetative biomass than control plants in greenhouse experiments, but not consistently over two years of field trials. The stems of these plants were longer but also more slender. Investigation of GA20-OX1 biomass quality using biochemical analyses showed the presence of more cellulose, lignin and cell wall residue. Cell wall analysis as well as expression analysis of lignin biosynthetic genes in developing stems revealed that cellulose and lignin were deposited earlier in development. Pretreatment of GA20-OX1 biomass with NaOH resulted in a higher saccharification efficiency per unit of dry weight, in agreement with the higher cellulose content. On the other hand, the cellulose-to-glucose conversion was slower upon HCl or hot-water pretreatment, presumably due to the higher lignin content. This study showed that biomass yield and quality traits can be interconnected, which is important for the development of future breeding strategies to improve lignocellulosic feedstock for bioethanol production. © 2015 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Divergence and adaptive evolution of the gibberellin oxidase genes in plants.
Huang, Yuan; Wang, Xi; Ge, Song; Rao, Guang-Yuan
2015-09-29
The important phytohormone gibberellins (GAs) play key roles in various developmental processes. GA oxidases (GAoxs) are critical enzymes in GA synthesis pathway, but their classification, evolutionary history and the forces driving the evolution of plant GAox genes remain poorly understood. This study provides the first large-scale evolutionary analysis of GAox genes in plants by using an extensive whole-genome dataset of 41 species, representing green algae, bryophytes, pteridophyte, and seed plants. We defined eight subfamilies under the GAox family, namely C19-GA2ox, C20-GA2ox, GA20ox,GA3ox, GAox-A, GAox-B, GAox-C and GAox-D. Of these, subfamilies GAox-A, GAox-B, GAox-C and GAox-D are described for the first time. On the basis of phylogenetic analyses and characteristic motifs of GAox genes, we demonstrated a rapid expansion and functional divergence of the GAox genes during the diversification of land plants. We also detected the subfamily-specific motifs and potential sites of some GAox genes, which might have evolved under positive selection. GAox genes originated very early-before the divergence of bryophytes and the vascular plants and the diversification of GAox genes is associated with the functional divergence and could be driven by positive selection. Our study not only provides information on the classification of GAox genes, but also facilitates the further functional characterization and analysis of GA oxidases.
Overexpression of 20-Oxidase Confers a Gibberellin-Overproduction Phenotype in Arabidopsis
Huang, Shihshieh; Raman, Anuradha S.; Ream, Joel E.; Fujiwara, Hideji; Cerny, R. Eric; Brown, Sherri M.
1998-01-01
In the gibberellin (GA) biosynthesis pathway, 20-oxidase catalyzes the oxidation and elimination of carbon-20 to give rise to C19-GAs. All bioactive GAs are C19-GAs. We have overexpressed a cDNA encoding 20-oxidase isolated from Arabidopsis seedlings in transgenic Arabidopsis plants. These transgenic plants display a phenotype that may be attributed to the overproduction of GA. The phenotype includes a longer hypocotyl, lighter-green leaves, increased stem elongation, earlier flowering, and decreased seed dormancy. However, the fertility of the transgenic plants is not affected. Increased levels of endogenous GA1, GA9, and GA20 were detected in seedlings of the transgenic line examined. GA4, which is thought to be the predominantly active GA in Arabidopsis, was not present at increased levels in this line. These results suggest that the overexpression of this 20-oxidase increases the levels of some endogenous GAs in transgenic seedlings, which causes the GA-overproduction phenotype. PMID:9808721
Petti, Carloalberto; Hirano, Ko; Stork, Jozsef; DeBolt, Seth
2015-09-01
Here, we show a mechanism for expansion regulation through mutations in the green revolution gene gibberellin20 (GA20)-oxidase and show that GAs control biosynthesis of the plants main structural polymer cellulose. Within a 12,000 mutagenized Sorghum bicolor plant population, we identified a single cellulose-deficient and male gametophyte-dysfunctional mutant named dwarf1-1 (dwf1-1). Through the Sorghum propinquum male/dwf1-1 female F2 population, we mapped dwf1-1 to a frameshift in GA20-oxidase. Assessment of GAs in dwf1-1 revealed ablation of GA. GA ablation was antagonistic to the expression of three specific cellulose synthase genes resulting in cellulose deficiency and growth dwarfism, which were complemented by exogenous bioactive gibberellic acid application. Using quantitative polymerase chain reaction, we found that GA was positively regulating the expression of a subset of specific cellulose synthase genes. To cross reference data from our mapped Sorghum sp. allele with another monocotyledonous plant, a series of rice (Oryza sativa) mutants involved in GA biosynthesis and signaling were isolated, and these too displayed cellulose deficit. Taken together, data support a model whereby suppressed expansion in green revolution GA genes involves regulation of cellulose biosynthesis. © 2015 American Society of Plant Biologists. All Rights Reserved.
Lange, T; Hedden, P; Graebe, J E
1994-01-01
In the biosynthetic pathway to the gibberellins (GAs), carbon-20 is removed by oxidation to give the C19-GAs, which include the biologically active plant hormones. We report the isolation of a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing) EC 1.14.11.-] by screening a cDNA library from developing cotyledons of pumpkin (Cucurbita maxima L.) for expression of this enzyme. When mRNA from either the cotyledons or the endosperm was translated in vitro using rabbit reticulocyte lysates, the products contained GA12 20-oxidase activity. A polyclonal antiserum was raised against the amino acid sequence of a peptide released by tryptic digestion of purified GA 20-oxidase from the endosperm. A cDNA expression library in lambda gt11 was prepared from cotyledon mRNA and screened with the antiserum. The identity of positive clones was confirmed by the demonstration of GA12 20-oxidase activity in single bacteriophage plaques. Recombinant protein from a selected clone catalyzed the three-step conversions of GA12 to GA25 and of GA53 to GA17, as well as the formation of the C19-GAs, GA1, GA9, and GA20, from their respective aldehyde precursors, GA23, GA24, and GA19. The nucleotide sequence of the cDNA insert contains an open reading frame of 1158 nt encoding a protein of 386 amino acid residues. The predicted M(r) (43,321) and pI (5.3) are similar to those determined experimentally for the native GA 20-oxidase. Furthermore, the derived amino acid sequence includes sequences obtained from the N terminus and two tryptic peptides from the native enzyme. It also contains regions that are highly conserved in a group of non-heme Fe-containing dioxygenases. Images PMID:8078921
Sakai, Miho; Sakamoto, Tomoaki; Saito, Tamio; Matsuoka, Makoto; Tanaka, Hiroshi; Kobayashi, Masatomo
2003-04-01
We have cloned two genes for gibberellin (GA) 2-oxidase from rice ( Oryza sativa L.). Expression of OsGA2ox2 was not observed. The other gene, OsGA2ox3, was expressed in every tissue examined and was enhanced by the application of biologically active GA. Recombinant OsGA2ox3 protein catalyzed the metabolism of GA(1) to GA(8) and GA(20) to GA(29)-catabolite. These results indicate that OsGA2ox3 is involved in the homeostatic regulation of the endogenous level of biologically active GA in rice.
Giacomelli, Lisa
2013-01-01
Gibberellins (GAs) are involved in the regulation of flowering and fruit-set in grapes (Vitis vinifera L.), but the molecular mechanisms behind this process are mostly unknown. In this work, the family of grapevine GA oxidases involved in the biosynthesis and deactivation of GAs was characterized. Six putative GA 20-oxidase (GA20ox), three GA 3-oxidase (GA3ox), and eight GA 2-oxidase (GA2ox) proteins, the latter further divided into five C19-GA 2ox and three C20-GA2ox proteins, were identified. Phylogenetic analyses suggest a common origin of the GA3ox and C19-GA2ox groups and challenge previous evolutionary models. In vitro analysis revealed that all GA3ox and GA20ox enzymes prefer substrates of the non-13-hydroxylation pathway. In addition, ectopic expression of GA2ox genes in Arabidopsis thaliana confirmed the activity of their encoded proteins in vivo. The results show that bioactive GA1 accumulates in opening grapevine flowers, whereas at later developmental stages only GA4 is detected in the setting fruit. By studying the expression pattern of the grapevine GA oxidase genes in different organs, and at different stages of flowering and fruit-set, it is proposed that the pool of bioactive GAs is controlled by a fine regulation of the abundance and localization of GA oxidase transcripts. PMID:24006417
Wu, K; Li, L; Gage, D A; Zeevaart, J A
1996-02-01
Spinach (Spinacia oleracea L.) is a long-day (LD) rosette plant in which stem growth under LD conditions is mediated by gibberellins (GAs). Major control points in spinach are the later steps of sequential oxidation and elimination of C-20 of C20-GAs. Degenerate oligonucleotide primers were used to obtain a polymerase chain reaction product from spinach genomic DNA that has a high homology with GA 20-oxidase cDNAs from Cucurbita maxima L. and Arabidopsis thaliana Heynh. This polymerase chain reaction product was used as a probe to isolate a full-length cDNA clone with an open reading frame encoding a putative 43-kD protein of 374 amino acid residues. When this cDNA clone was expressed in Escherichia coli, the fusion protein catalyzed the biosynthetic sequence GA53-->GA44-->GA19-->GA20 and GA19-->GA17. This establishes that in spinach a single protein catalyzes the oxidation and elimination of C-20. Transfer of spinach plants from short day (SD) to LD conditions caused an increase in the level of all GAs of the early-13-hydroxylation pathway, except GA53, with GA20, GA1, and GA8 showing the largest increases. Northern blot analysis indicated that the level of GA 20-oxidase mRNA was higher in plants in LD than in SD conditions, with highest level of expression in the shoot tips and elongating stems. This expression pattern of GA 20-oxidase is consistent with the different levels of GA20, GA1, and GA8 found in spinach plants grown in SD and LD conditions.
Expression Studies of Gibberellin Oxidases in Developing Pumpkin Seeds1
Frisse, Andrea; Pimenta, Maria João; Lange, Theo
2003-01-01
Two cDNA clones, 3-ox and 2-ox, have been isolated from developing pumpkin (Cucurbita maxima) embryos that show significant amino acid homology to gibberellin (GA) 3-oxidases and 2-oxidases, respectively. Recombinant fusion protein of clone 3-ox converted GA12-aldehyde, GA12, GA15, GA24, GA25, and GA9 to GA14-aldehyde, GA14, GA37, GA36, GA13, and GA4, respectively. Recombinant 2-ox protein oxidized GA9, GA4, and GA1 to GA51, GA34, and GA8, respectively. Previously cloned GA 7-oxidase revealed additional 3β-hydroxylation activity of GA12. Transcripts of this gene were identified in endosperm and embryo of the developing seed by quantitative reverse transcriptase-polymerase chain reaction and localized in protoderm, root apical meristem, and quiescent center by in situ hybridization. mRNA of the previously cloned GA 20-oxidase from pumpkin seeds was localized in endosperm and in tissues of protoderm, ground meristem, and cotyledons of the embryo. However, transcripts of the recently cloned GA 20-oxidase from pumpkin seedlings were found all over the embryo, and in tissues of the inner seed coat at the micropylar end. Previously cloned GA 2β,3β-hydroxylase mRNA molecules were specifically identified in endosperm tissue. Finally, mRNA molecules of the 3-ox and 2-ox genes were found in the embryo only. 3-ox transcripts were localized in tissues of cotyledons, protoderm, and inner cell layers of the root apical meristem, and 2-ox transcripts were found in all tissues of the embryo except the root tips. These results indicate tissue-specific GA-biosynthetic pathways operating within the developing seed. PMID:12644672
Jeon, Hyung-Woo; Cho, Jin-Seong; Park, Eung-Jun; Han, Kyung-Hwan; Choi, Young-Im; Ko, Jae-Heung
2016-04-01
Woody biomass has gained popularity as an environmentally friendly, renewable and sustainable resource for liquid fuel production. Here, we demonstrate biotechnological improvement of the quantity and quality of woody biomass by employing developing xylem (DX)-preferential production of gibberellin (GA), a phytohormone that positively regulates stem growth. First, for the proof of concept experiment, we produced transgenic Arabidopsis plants expressing GA20-oxidase, a key enzyme in the production of bioactive GAs, from Pinus densiflora (PdGA20ox1) under the control of either a constitutive 35S promoter, designated 35S::PdGA20ox1, or a DX-specific promoter (originated from poplar), designated DX15::PdGA20ox1. As we hypothesized, both transgenic Arabidopsis plants (35S::PdGA20ox1 and DX15::PdGA20ox1) exhibited an accelerated stem growth that resulted in a large increase of biomass, up to 300% compared to wild-type control plants, together with increased secondary wall thickening and elongation of fibre cells. Next, we applied our concept to the production of transgenic poplar trees. Both transgenic poplar trees (35S::PdGA20ox1 and DX15::PdGA20ox1) showed dramatic increases in biomass, up to 300%, with accelerated stem growth and xylem differentiation. Cell wall monosaccharide composition analysis revealed that in both Arabidopsis and poplar, glucose and xylose contents were significantly increased. However, undesirable phenotypes of 35S::PdGA20ox1 poplar, including poor root growth and leaf development, were found. Interestingly, DX15::PdGA20ox1 poplar resulted in a reduction of undesirable phenotypes. Our results indicate that the controlled production of GAs through a tissue-specific promoter can be utilized as an efficient biotechnological tool for producing enhanced plant biomass, minimizing unwanted effects. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.
Radi, Abeer; Lange, Theo; Niki, Tomoya; Koshioka, Masaji; Lange, Maria João Pimenta
2006-02-01
Immature pumpkin (Cucurbita maxima) seeds contain gibberellin (GA) oxidases with unique catalytic properties resulting in GAs of unknown function for plant growth and development. Overexpression of pumpkin GA 7-oxidase (CmGA7ox) in Arabidopsis (Arabidopsis thaliana) resulted in seedlings with elongated roots, taller plants that flower earlier with only a little increase in bioactive GA4 levels compared to control plants. In the same way, overexpression of the pumpkin GA 3-oxidase1 (CmGA3ox1) resulted in a GA overdose phenotype with increased levels of endogenous GA4. This indicates that, in Arabidopsis, 7-oxidation and 3-oxidation are rate-limiting steps in GA plant hormone biosynthesis that control plant development. With an opposite effect, overexpression of pumpkin seed-specific GA 20-oxidase1 (CmGA20ox1) in Arabidopsis resulted in dwarfed plants that flower late with reduced levels of GA4 and increased levels of physiological inactive GA17 and GA25 and unexpected GA34 levels. Severe dwarfed plants were obtained by overexpression of the pumpkin GA 2-oxidase1 (CmGA2ox1) in Arabidopsis. This dramatic change in phenotype was accompanied by a considerable decrease in the levels of bioactive GA4 and an increase in the corresponding inactivation product GA34 in comparison to control plants. In this study, we demonstrate the potential of four pumpkin GA oxidase-encoding genes to modulate the GA plant hormone pool and alter plant stature and development.
Martínez-Bello, Liliam; Moritz, Thomas; López-Díaz, Isabel
2015-01-01
Gibberellins (GAs) are phytohormones that regulate a wide range of developmental processes in plants. Levels of active GAs are regulated by biosynthetic and catabolic enzymes like the GA 2-oxidases (GA2oxs). In tomato (Solanum lycopersicum L.) C19 GA2oxs are encoded by a small multigenic family of five members with some degree of redundancy. In order to investigate their roles in tomato, the silencing of all five genes in transgenic plants was induced. A significant increase in active GA4 content was found in the ovaries of transgenic plants. In addition, the transgenic unfertilized ovaries were much bigger than wild-type ovaries (about 30 times) and a certain proportion (5–37%) were able to develop parthenocarpically. Among the GA2ox family, genes GA2ox1 and -2 seem to be the most relevant for this phenotype since their expression was induced in unfertilized ovaries and repressed in developing fruits, inversely correlating with ovary growth. Interestingly, transgenic lines exhibited a significant inhibition of branching and a higher content of active GA4 in axillary buds. This phenotype was reverted, in transgenic plants, by the application of paclobutrazol, a GA biosynthesis inhibitor, suggesting a role for GAs as repressors of branching. In summary, this work demonstrates that GA 2-oxidases regulate gibberellin levels in ovaries and axillary buds of tomato plants and their silencing is responsible for parthenocarpic fruit growth and branching inhibition. PMID:26093022
Pearce, Stephen; Huttly, Alison K; Prosser, Ian M; Li, Yi-dan; Vaughan, Simon P; Gallova, Barbora; Patil, Archana; Coghill, Jane A; Dubcovsky, Jorge; Hedden, Peter; Phillips, Andrew L
2015-06-05
The gibberellin (GA) pathway plays a central role in the regulation of plant development, with the 2-oxoglutarate-dependent dioxygenases (2-ODDs: GA20ox, GA3ox, GA2ox) that catalyse the later steps in the biosynthetic pathway of particularly importance in regulating bioactive GA levels. Although GA has important impacts on crop yield and quality, our understanding of the regulation of GA biosynthesis during wheat and barley development remains limited. In this study we identified or assembled genes encoding the GA 2-ODDs of wheat, barley and Brachypodium distachyon and characterised the wheat genes by heterologous expression and transcript analysis. The wheat, barley and Brachypodium genomes each contain orthologous copies of the GA20ox, GA3ox and GA2ox genes identified in rice, with the exception of OsGA3ox1 and OsGA2ox5 which are absent in these species. Some additional paralogs of 2-ODD genes were identified: notably, a novel gene in the wheat B genome related to GA3ox2 was shown to encode a GA 1-oxidase, named as TaGA1ox-B1. This enzyme is likely to be responsible for the abundant 1β-hydroxylated GAs present in developing wheat grains. We also identified a related gene in barley, located in a syntenic position to TaGA1ox-B1, that encodes a GA 3,18-dihydroxylase which similarly accounts for the accumulation of unusual GAs in barley grains. Transcript analysis showed that some paralogs of the different classes of 2-ODD were expressed mainly in a single tissue or at specific developmental stages. In particular, TaGA20ox3, TaGA1ox1, TaGA3ox3 and TaGA2ox7 were predominantly expressed in developing grain. More detailed analysis of grain-specific gene expression showed that while the transcripts of biosynthetic genes were most abundant in the endosperm, genes encoding inactivation and signalling components were more highly expressed in the seed coat and pericarp. The comprehensive expression and functional characterisation of the multigene families encoding the 2-ODD
Radi, Abeer; Lange, Theo; Niki, Tomoya; Koshioka, Masaji; Lange, Maria João Pimenta
2006-01-01
Immature pumpkin (Cucurbita maxima) seeds contain gibberellin (GA) oxidases with unique catalytic properties resulting in GAs of unknown function for plant growth and development. Overexpression of pumpkin GA 7-oxidase (CmGA7ox) in Arabidopsis (Arabidopsis thaliana) resulted in seedlings with elongated roots, taller plants that flower earlier with only a little increase in bioactive GA4 levels compared to control plants. In the same way, overexpression of the pumpkin GA 3-oxidase1 (CmGA3ox1) resulted in a GA overdose phenotype with increased levels of endogenous GA4. This indicates that, in Arabidopsis, 7-oxidation and 3-oxidation are rate-limiting steps in GA plant hormone biosynthesis that control plant development. With an opposite effect, overexpression of pumpkin seed-specific GA 20-oxidase1 (CmGA20ox1) in Arabidopsis resulted in dwarfed plants that flower late with reduced levels of GA4 and increased levels of physiological inactive GA17 and GA25 and unexpected GA34 levels. Severe dwarfed plants were obtained by overexpression of the pumpkin GA 2-oxidase1 (CmGA2ox1) in Arabidopsis. This dramatic change in phenotype was accompanied by a considerable decrease in the levels of bioactive GA4 and an increase in the corresponding inactivation product GA34 in comparison to control plants. In this study, we demonstrate the potential of four pumpkin GA oxidase-encoding genes to modulate the GA plant hormone pool and alter plant stature and development. PMID:16384902
Yan, Jindong; Liao, Xiaoying; He, Reqing; Zhong, Ming; Feng, Panpan; Li, Xinmei; Tang, Dongying; Liu, Xuanming; Zhao, Xiaoying
2017-02-01
Gibberellins (GAs) are endogenous hormones that play an important role in higher plant growth and development. GA2-oxidase (GA2ox) promotes catabolism and inactivation of bioactive GAs or their precursors. In this study, we identified the GA2-oxidase gene, BnGA2ox6, and found it to be highly expressed in the silique and flower. Overexpression of BnGA2ox6 in Arabidopsis resulted in GA-deficiency symptoms, including inhibited elongation of the hypocotyl and stem, delayed seed germination, and late flowering. BnGA2ox6 overexpression reduced silique growth, but had no effect on seed development. Additionally, BnGA2ox6 overexpression enhanced chlorophyll b and total chlorophyll accumulation, and downregulated mRNA expression levels of the CHL1 and RCCR genes, which are involved in the chlorophyll degradation. These findings suggest that BnGA2ox6 regulates plant hight, silique development, flowering and chlorophyll accumulation in transgenic Arabidopsis. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Lange, T
1994-01-01
Gibberellin (GA) 20-oxidase was purified to apparent homogeneity from Cucurbita maxima endosperm by fractionated ammonium-sulphate precipitation, gel-filtration chromatography and anion-exchange and hydrophobic-interaction high-performance liquid chromatography (HPLC). Average purification after the last step was 55-fold with 3.9% of the activity recovered. The purest single fraction was enriched 101-fold with 0.2% overall recovery. Apparent relative molecular mass of the enzyme was 45 kDa, as determined by gel-filtration HPLC and sodium dodecyl sulphate-polyacrylamide gel electrophoresis, indicating that GA 20-oxidase is probably a monomeric enzyme. The purified enzyme degraded on two-dimensional gel electrophoresis, giving two protein spots: a major one corresponding to a molecular mass of 30 kDa and a minor one at 45 kDa. The isoelectric point for both was 5.4. The amino-acid sequences of the amino-terminus of the purified enzyme and of two peptides from a tryptic digest were determined. The purified enzyme catalysed the sequential conversion of [14C]GA12 to [14C]GA15, [14C]GA24 and [14C]GA25, showing that carbon atom 20 was oxidised to the corresponding alcohol, aldehyde and carboxylic acid in three consecutive reactions. [14C]Gibberellin A53 was similarly converted to [14C]GA44, [14C]GA19, [14C]GA17 and small amounts of a fourth product, which was preliminarily identified as [14C]GA20, a C19-gibberellin. All GAs except [14C]GA20 were identified by combined gas chromatography-mass spectrometry. The cofactor requirements in the absence of dithiothreitol were essentially as in its presence (Lange et al., Planta 195, 98-107, 1994), except that ascorbate was essential for enzyme activity and the optimal concentration of catalase was lower.
Karafiatova, Miroslava; Uauy, Cristobal
2018-01-01
Semidwarfing genes have improved crop yield by reducing height, improving lodging resistance, and allowing plants to allocate more assimilates to grain growth. In wheat (Triticum aestivum), the Rht18 semidwarfing gene was identified and deployed in durum wheat before it was transferred into bread wheat, where it was shown to have agronomic potential. Rht18, a dominant and gibberellin (GA) responsive mutant, is genetically and functionally distinct from the widely used GA-insensitive semidwarfing genes Rht-B1b and Rht-D1b. In this study, the Rht18 gene was identified by mutagenizing the semidwarf durum cultivar Icaro (Rht18) and generating mutants with a range of tall phenotypes. Isolating and sequencing chromosome 6A of these “overgrowth” mutants showed that they contained independent mutations in the coding region of GA2oxA9. GA2oxA9 is predicted to encode a GA 2-oxidase that metabolizes GA biosynthetic intermediates into inactive products, effectively reducing the amount of bioactive GA (GA1). Functional analysis of the GA2oxA9 protein demonstrated that GA2oxA9 converts the intermediate GA12 to the inactive metabolite GA110. Furthermore, Rht18 showed higher expression of GA2oxA9 and lower GA content compared with its tall parent. These data indicate that the increased expression of GA2oxA9 in Rht18 results in a reduction of both bioactive GA content and plant height. This study describes a height-reducing mechanism that can generate new genetic diversity for semidwarfism in wheat by combining increased expression with mutations of specific amino acid residues in GA2oxA9. PMID:29545269
Zhang, Songwen; Zhang, Dong; Fan, Sheng; Du, Lisha; Shen, Yawen; Xing, Libo; Li, Youmei; Ma, Juanjuan; Han, Mingyu
2016-10-01
Gibberellins (GAs) reduce apple (Malus domestica) flowering rates; however, the mechanism of their action is not fully understood. To gain a better insight into gibberellin-regulated flowering, here, 5 year-old 'Fuji' apple trees were used to explore the responses of hormones [GA1+3, GA4+7, indole-3-acetic acid (IAA), zeatin-riboside (ZR), and abscisic acid (ABA)], and gibberellin- and flowering-associated genes, to applications of gibberellin acid (GA3) and paclobutrazol (PAC). Results showed that GA3 relatively stimulated vegetative growth and delayed floral induction. Moreover, GA3 spraying significantly affected contents of all endogenous hormones and all the genes tested in at least one time points: the content of endogenous GAs was increased instantly and that of ZR was reduced at 44 days after fullbloom (DAF), which might constitute an unfavorable factor for flower formation; MdKO (ent-kaurene oxidase gene) and MdGA20ox (GA20 oxidase gene) were significantly repressed by a high level of GAs through the negative feedback regulation of GA; additionally, the MdSPLs (SQUAMOSA-PROMOTER BINDING PROTEIN-LIKE) in this study were all significantly repressed by GA3 but promoted by PAC; the expression of MdFT1/2 (FLOWERING LOCUS T), MdSOC1 (SUPPRESSOR OF OVEREXPRESSION OF CONSTANS1) and MdAP1 (APETALA1) in GA3-treated buds changed in the same way, and they were repressed at 44 DAF. We suppose that GA3 spraying disrupts the balance between ZR and GAs, and inhibits floral induction, probably by suppressing MdSPLs and the floral integrators in flower induction, which ultimately contributed to inhibiting flower formation. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Wang, Zeng-Guang; Chai, Guo-Hua; Wang, Zhi-Yao; Tang, Xian-Feng; Sun, Chang-Jiang; Zhou, Gong-Ke; Ma, San-Mei
2013-05-01
Bioactive gibberellins (GAs) are a type of important plant growth regulators, which play the key roles in multiple processes, such as seed germination, leaf expansion, flowering, fruit bearing, and stem development. Its biosynthesis is regulated by a variety of enzymes including gibberellin 3-oxidase that is a key rate-limiting enzyme. In Arabidopsis, gibberellin 3-oxidase consists of four members, of which AtGA3OX1 and AtGA3OX2 are highly expressed in stems, suggesting the potential roles in the stem development played by the two genes. To date, there are few studies on AtGA3OX1 and AtGA3OX2 regulating secondary wall thickening in stems. In this study, we used the atga3ox1atga3ox2 double mutant as the materials to study the effects of AtGA3OX1 and AtGA3OX2 genes on secondary wall thickening in stems. The results indicated that simulations repression of AtGA3OX1 and AtGA3OX2 genes resulted in significantly reduction of secondary wall thickening of fiber cells, but not that of vessel cells. Three main components (cellulose, hemicelluloses, and lignin) were also dramatically suppressed in the double mutants. qRT-PCR analysis demonstrated that the expressions of secondary wall biosynthetic genes and the associated transcription factors were obviously affected in AtGA3OX1 and AtGA3OX2 double mutant. Therefore, we presume that Arabidopsis AtGA3OX1 and AtGA3OX2 genes might activate the expression of these transcription factors, thus regulate secondary wall thickening in stems. Together, our results provide a theoretical basis for enhancing the lodging resistance of food crops and improving the biomass of energy plants by genetically engineering Arabidopsis AtGA3OX homologs.
Feed-back regulation of gibberellin biosynthesis and gene expression in Pisum sativum L.
Martin, D N; Proebsting, W M; Parks, T D; Dougherty, W G; Lange, T; Lewis, M J; Gaskin, P; Hedden, P
1996-01-01
Treatment of tall and dwarf (3 beta-hydroxylase impaired) genotypes of pea (Pisum sativum L.) with the synthetic, highly active gibberellin (GA), 2,2-dimethyl GA4, reduced the shoot contents of C19-GAs, including GA1, and increased the concentration of the C20-GA, GA19. In shoots of the slender (la crys) mutant, the content of C19-GAs was lower and GA19 content was higher than in those of the tall line. Metabolism of GA19 and GA20 in leaves of a severe (na) GA-deficient dwarf mutant was reduced by GA treatment. The results suggest feed-back regulation of the 20-oxidation and 3 beta-hydroxylation reactions. Feed-back regulation of GA 20-oxidation was studied further using a cloned GA 20-oxidase cDNA from pea. The cDNA, Ps074, was isolated using polymerase chain reaction with degenerate oligonucleotide primers based on pumpkin and Arabidopsis 20-oxidase sequences. After expression of this cDNA clone in Escherichia coli, the product oxidized GA12 to GA15, GA24 and the C19-GA, GA9, which was the major product. The 13-hydroxylated substrate GA53 was similarly oxidized, but less effectively than GA12, giving mainly GA44 with low yields of GA19 and GA20. Ps074 hybridized to polyadenylated RNA from expanding shoots of pea. Amounts of this transcript were less in the slender genotype than in the tall line and were reduced in GA-deficient genotypes by treatment with GA3, suggesting that there is feed-back regulation of GA 20-oxidase gene expression.
Shan, Chi; Mei, Zhiling; Duan, Jianli; Chen, Haiying; Feng, Huafeng; Cai, Weiming
2014-01-01
Gibberellin (GA) 2-oxidases play an important role in the GA catabolic pathway through 2β-hydroxylation. There are two classes of GA2oxs, i.e., a larger class of C19-GA2oxs and a smaller class of C20-GA2oxs. In this study, the gene encoding a GA 2-oxidase of rice, Oryza sativa GA 2-oxidase 5 (OsGA2ox5), was cloned and characterized. BLASTP analysis showed that OsGA2ox5 belongs to the C20-GA2oxs subfamily, a subfamily of GA2oxs acting on C20-GAs (GA12, GA53). Subcellular localization of OsGA2ox5-YFP in transiently transformed onion epidermal cells revealed the presence of this protein in both of the nucleus and cytoplasm. Real-time PCR analysis, along with GUS staining, revealed that OsGA2ox5 is expressed in the roots, culms, leaves, sheaths and panicles of rice. Rice plants overexpressing OsGA2ox5 exhibited dominant dwarf and GA-deficient phenotypes, with shorter stems and later development of reproductive organs than the wild type. The dwarfism phenotype was partially rescued by the application of exogenous GA3 at a concentration of 10 µM. Ectopic expression of OsGA2ox5 cDNA in Arabidopsis resulted in a similar phenotype. Real-time PCR assays revealed that both GA synthesis-related genes and GA signaling genes were expressed at higher levels in transgenic rice plants than in wild-type rice; OsGA3ox1, which encodes a key enzyme in the last step of the bioactive GAs synthesis pathway, was highly expressed in transgenic rice. The roots of OsGA2ox5-ox plants exhibited increased starch granule accumulation and gravity responses, revealing a role for GA in root starch granule development and gravity responses. Furthermore, rice and Arabidopsis plants overexpressing OsGA2ox5 were more resistant to high-salinity stress than wild-type plants. These results suggest that OsGA2ox5 plays important roles in GAs homeostasis, development, gravity responses and stress tolerance in rice. PMID:24475234
NASA Astrophysics Data System (ADS)
Cai, Weiming; Shan, Chi
Gibberellin (GA) 2-oxidases play an important role in the GA catabolic pathway through 2b-hydroxylation. There are two classes of GA2oxs, i.e., a larger class of C19-GA2oxs and a smaller class of C20-GA2oxs. In this study, the gene encoding a GA 2-oxidase of rice, Oryza sativa GA 2-oxidase 5 (OsGA2ox5), was cloned and characterized. BLASTP analysis showed that OsGA2ox5 belongs to the C20-GA2oxs subfamily, a subfamily of GA2oxs acting on C20-GAs (GA12, GA53). Subcellular localization of OsGA2ox5-YFP in transiently transformed onion epidermal cells revealed the presence of this protein in both of the nucleus and cytoplasm. Real-time PCR analysis, along with GUS staining, revealed that OsGA2ox5 is expressed in the roots, culms, leaves, sheaths and panicles of rice. Rice plants overexpressing OsGA2ox5 exhibited dominant dwarf and GAdeficient phenotypes, with shorter stems and later development of reproductive organs than the wild type. The dwarfism phenotype was partially rescued by the application of exogenous GA3 at a concentration of 10 mM. Ectopic expression of OsGA2ox5 cDNA in Arabidopsis resulted in a similar phenotype. Real-time PCR assays revealed that both GA synthesis-related genes and GA signaling genes were expressed at higher levels in transgenic rice plants than in wild-type rice; OsGA3ox1, which encodes a key enzyme in the last step of the bioactive GAs synthesis pathway, was highly expressed in transgenic rice. The roots of OsGA2ox5-ox plants exhibited increased starch granule accumulation and gravity responses, revealing a role for GA in root starch granule development and gravity responses. Furthermore, rice and Arabidopsis plants overexpressing OsGA2ox5 were more resistant to high-salinity stress than wild-type plants. These results suggest that OsGA2ox5 plays important roles in GAs homeostasis, development, gravity responses and stress tolerance in rice.
Zhang, Qin; Rao, Xiuwen; Zhang, Lubin; He, Congcong; Yang, Fang; Zhu, Shijiang
2016-01-01
Internal browning (IB), a physiological disorder (PD) that causes severe losses in harvested pineapple, can be induced by exogenous gibberellins (GAs). Over the years, studies have focused on roles of Gibberellin 2-oxidase (GA2oxs), the major GAs catabolic enzyme in plants, in the regulation of changes in morphology or biomass. However, whether GA2oxs could regulate PD has not been reported. Here, a full-length AcGA2ox cDNA was isolated from pineapple, with the putative protein sharing 23.59% to 72.92% identity with GA2oxs from five other plants. Pineapples stored at 5 °C stayed intact, while those stored at 20 °C showed severe IB. Storage at 5 °C enhanced AcGA2ox expression and decreased levels of a GAs (GA4) ‘compared with storage at 20 °C. However, at 20 °C, exogenous application of abscisic acid (ABA) significantly suppressed IB. ABA simultaneously upregulated AcGA2ox and reduced GA4. Ectopic expression of AcGA2ox in Arabidopsis resulted in reduced GA4, lower seed germination, and shorter hypocotyls and roots, all of which were restored by exogenous GA4/7. Moreover, in pineapple, GA4/7 upregulated polyphenol oxidase, while storage at 5 °C and ABA downregulated it. These results strongly suggest the involvement of AcGA2ox in regulation of GAs levels and a role of AcGA2ox in regulating IB. PMID:27982026
Ectopic expression of specific GA2 oxidase mutants promotes yield and stress tolerance in rice.
Lo, Shuen-Fang; Ho, Tuan-Hua David; Liu, Yi-Lun; Jiang, Mirng-Jier; Hsieh, Kun-Ting; Chen, Ku-Ting; Yu, Lin-Chih; Lee, Miin-Huey; Chen, Chi-Yu; Huang, Tzu-Pi; Kojima, Mikiko; Sakakibara, Hitoshi; Chen, Liang-Jwu; Yu, Su-May
2017-07-01
A major challenge of modern agricultural biotechnology is the optimization of plant architecture for enhanced productivity, stress tolerance and water use efficiency (WUE). To optimize plant height and tillering that directly link to grain yield in cereals and are known to be tightly regulated by gibberellins (GAs), we attenuated the endogenous levels of GAs in rice via its degradation. GA 2-oxidase (GA2ox) is a key enzyme that inactivates endogenous GAs and their precursors. We identified three conserved domains in a unique class of C 20 GA2ox, GA2ox6, which is known to regulate the architecture and function of rice plants. We mutated nine specific amino acids in these conserved domains and observed a gradient of effects on plant height. Ectopic expression of some of these GA2ox6 mutants moderately lowered GA levels and reprogrammed transcriptional networks, leading to reduced plant height, more productive tillers, expanded root system, higher WUE and photosynthesis rate, and elevated abiotic and biotic stress tolerance in transgenic rice. Combinations of these beneficial traits conferred not only drought and disease tolerance but also increased grain yield by 10-30% in field trials. Our studies hold the promise of manipulating GA levels to substantially improve plant architecture, stress tolerance and grain yield in rice and possibly in other major crops. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Xu, Y L; Gage, D A; Zeevaart, J A
1997-08-01
Arabidopsis thaliana (L.) Heynh. is a quantitative long-day (LD) rosette plant in which stem growth is mediated by gibberellins (CAs). Application of GAs to plants in short-day (SD) conditions resulted in rapid stem elongation and flower formation, with GA4 and GA9 being equally effective, and GA1 showing lower activity. The effects of photoperiod on the levels of endogenous GAs were measured by combined gas chromatography-mass spectrometry with selected ion monitoring. When plants were transferred from SD to LD conditions there was a slight decrease in the level of GA53 and an increase in the levels of C19-GAs, GA9, GA20, GA1, and GA8, indicating that GA 20-oxidase activity is stimulated in LD conditions. Expression of GA5, which encodes GA 20-oxidase, was highest in elongating stems and was correlated with the rate of stem elongation. By contrast, GA4, which encodes 3 beta-hydroxylase, showed low expression in stems and its expression was not correlated with the rate of stem elongation. We conclude that stem elongation in LD conditions is at least in part due to increased expression of GA5, whereas expression of GA4 is not under photoperiodic control.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Morimoto, Yuji; Murayama, Nobuhiro; Kuwano, Akira
1995-12-18
The polymorphic allele of the monoamine oxidase B (MAO-B) gene detected by polymerase chain reaction (PCR) and single-stranded conformation polymorphism (SSCP) was associated with Parkinson`s disease (PD) in Caucasians. We characterized this polymorphic allele, allele 1, of the MAO-B gene using direct sequencing of PCR products. A single DNA substitution (G-A), resulting gain of Mae III restriction site was detected in intron 13 of the MAO-B gene. The allele associated with PD in Caucasians was twice as frequent as in healthy Japanese, but the association of the allele of the MAO-B gene was not observed in Japanese patients with PD.more » 7 refs., 2 figs., 1 tab.« less
Kumar, Vinod; Hart, Andrew J.; Keerthiraju, Ethiraju R.; Waldron, Paul R.; Tucker, Gregory A.; Greetham, Darren
2015-01-01
Introduction Saccharomyces cerevisiae is the micro-organism of choice for the conversion of fermentable sugars released by the pre-treatment of lignocellulosic material into bioethanol. Pre-treatment of lignocellulosic material releases acetic acid and previous work identified a cytochrome oxidase chaperone gene (COX20) which was significantly up-regulated in yeast cells in the presence of acetic acid. Results A Δcox20 strain was sensitive to the presence of acetic acid compared with the background strain. Overexpressing COX20 using a tetracycline-regulatable expression vector system in a Δcox20 strain, resulted in tolerance to the presence of acetic acid and tolerance could be ablated with addition of tetracycline. Assays also revealed that overexpression improved tolerance to the presence of hydrogen peroxide-induced oxidative stress. Conclusion This is a study which has utilised tetracycline-regulated protein expression in a fermentation system, which was characterised by improved (or enhanced) tolerance to acetic acid and oxidative stress. PMID:26427054
A Single Nucleotide Deletion in Gibberellin20-oxidase1 Causes Alpine Dwarfism in Arabidopsis.
Luo, Yonghai; Dong, Xinwei; Yu, Tianying; Shi, Xuan; Li, Zongyun; Yang, Weicai; Widmer, Alex; Karrenberg, Sophie
2015-07-01
Alpine dwarfism is widely observed in alpine plant populations and often considered a high-altitude adaptation, yet its molecular basis and ecological relevance remain unclear. In this study, we used map-based cloning and field transplant experiments to investigate dwarfism in natural Arabidopsis (Arabidopsis thaliana) accessions collected from the Swiss Alps. A loss-of-function mutation due to a single nucleotide deletion in gibberellin20-oxidase1 (GA5) was identified as the cause of dwarfism in an alpine accession. The mutated allele, ga5-184, was found in two natural Arabidopsis populations collected from one geographic region at high altitude, but was different from all other reported ga5 null alleles, suggesting that this allele has evolved locally. In field transplant experiments, the dwarf accession with ga5-184 exhibited a fitness pattern consistent with adaptation to high altitude. Across a wider array of accessions from the Swiss Alps, plant height decreased with altitude of origin, but fitness patterns in the transplant experiments were variable and general altitudinal adaptation was not evident. In general, our study provides new insights into molecular basis and possible ecological roles of alpine dwarfism, and demonstrates the importance of the GA-signaling pathway for the generation of ecologically relevant variation in higher plants. © 2015 American Society of Plant Biologists. All Rights Reserved.
Condino-Neto, A; Whitney, C; Newburger, P E
1998-11-01
We investigated the effects of dexamethasone or indomethacin on the NADPH oxidase activity, cytochrome b558 content, and expression of genes encoding the components gp91-phox and p47-phox of the NADPH oxidase system in the human monocytic THP-1 cell line, differentiated with IFN-gamma and TNF-alpha, alone or in combination, for up to 7 days. IFN-gamma and TNF-alpha, alone or in combination, caused a significant up-regulation of the NADPH oxidase system as reflected by an enhancement of the PMA-stimulated superoxide release, cytochrome b558 content, and expression of gp91-phox and p47-phox genes on both days 2 and 7 of cell culture. Noteworthy was the tremendous synergism between IFN-gamma and TNF-alpha for all studied parameters. Dexamethasone down-regulated the NADPH oxidase system of cytokine-differentiated THP-1 cells as assessed by an inhibition on the PMA-stimulated superoxide release, cytochrome b558 content, and expression of the gp91-phox and p47-phox genes. The nuclear run-on assays indicated that dexamethasone down-regulated the NADPH oxidase system at least in part by inhibiting the transcription of gp91-phox and p47-phox genes. Indomethacin inhibited only the PMA-stimulated superoxide release of THP-1 cells differentiated with IFN-gamma and TNF-alpha during 7 days. None of the other parameters was affected by indomethacin. We conclude that dexamethasone down-regulates the NADPH oxidase system at least in part by inhibiting the expression of genes encoding the gp91-phox and p47-phox components of the NADPH oxidase system.
Zhou, Yuchan; Underhill, Steven J R
2016-01-01
Breadfruit (Artocarpus altilis) is a traditional staple tree crop in the Oceania. Susceptibility to windstorm damage is a primary constraint on breadfruit cultivation. Significant tree loss due to intense tropical windstorm in the past decades has driven a widespread interest in developing breadfruit with dwarf stature. Gibberellin (GA) is one of the most important determinants of plant height. GA 2-oxidase is a key enzyme regulating the flux of GA through deactivating biologically active GAs in plants. As a first step toward understanding the molecular mechanism of growth regulation in the species, we isolated a cohort of four full-length GA2-oxidase cDNAs, AaGA2ox1- AaGA2ox4 from breadfruit. Sequence analysis indicated the deduced proteins encoded by these AaGA2oxs clustered together under the C19 GA2ox group. Transcripts of AaGA2ox1, AaGA2ox2 and AaGA2ox3 were detected in all plant organs, but exhibited highest level in source leaves and stems. In contrast, transcript of AaGA2ox4 was predominantly expressed in roots and flowers, and displayed very low expression in leaves and stems. AaGA2ox1, AaGA2ox2 and AaGA2ox3, but not AaGA2ox4 were subjected to GA feedback regulation where application of exogenous GA3 or gibberellin biosynthesis inhibitor, paclobutrazol was shown to manipulate the first internode elongation of breadfruit. Treatments of drought or high salinity increased the expression of AaGA2ox1, AaGA2ox2 and AaGA2ox4. But AaGA2ox3 was down-regulated under salt stress. The function of AaGA2oxs is discussed with particular reference to their role in stem elongation and involvement in abiotic stress response in breadfruit. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
Diane Dietrich; Casey Crooks
2009-01-01
A pyranose 2-oxidase gene from the brown-rot basidiomycete Gloeophyllum trabeum was isolated using homology-based degenerate PCR. The gene structure was determined and compared to that of several pyranose 2-oxidases cloned from white-rot fungi. The G. trabeum pyranose 2-oxidase gene consists of 16 coding exons with canonical promoter CAAT and TATA elements in the 5âUTR...
Cloning and Analysis of the Alternative Oxidase Gene of Neurospora Crassa
Li, Q.; Ritzel, R. G.; McLean, LLT.; McIntosh, L.; Ko, T.; Bertrand, H.; Nargang, F. E.
1996-01-01
Mitochondria of Neurospora crassa contain a cyanide-resistant alternative respiratory pathway in addition to the cytochrome pathway. The alternative oxidase is present only when electron flow through the cytochrome chain is restricted. Both genomic and cDNA copies for the alternative oxidase gene have been isolated and analyzed. The sequence of the predicted protein is homologous to that of other species. The mRNA for the alternative oxidase is scarce in wild-type cultures grown under normal conditions, but it is abundant in cultures grown in the presence of chloramphenicol, an inhibitor of mitochondrial protein synthesis, or in mutants deficient in mitochondrial cytochromes. Thus, induction of alternative oxidase appears to be at the transcriptional level. Restriction fragment length polymorphism mapping of the isolated gene demonstrated that it is located in a position corresponding to the aod-1 locus. Sequence analysis of mutant aod-1 alleles reveals mutations affecting the coding sequence of the alternative oxidase. The level of aod-1 mRNA in an aod-2 mutant strain that had been grown in the presence of chloramphenicol was reduced several fold relative to wild-type, supporting the hypothesis that the product of aod-2 is required for optimal expression of aod-1. PMID:8770590
Molecular evolution of the polyamine oxidase gene family in Metazoa
2012-01-01
Background Polyamine oxidase enzymes catalyze the oxidation of polyamines and acetylpolyamines. Since polyamines are basic regulators of cell growth and proliferation, their homeostasis is crucial for cell life. Members of the polyamine oxidase gene family have been identified in a wide variety of animals, including vertebrates, arthropodes, nematodes, placozoa, as well as in plants and fungi. Polyamine oxidases (PAOs) from yeast can oxidize spermine, N1-acetylspermine, and N1-acetylspermidine, however, in vertebrates two different enzymes, namely spermine oxidase (SMO) and acetylpolyamine oxidase (APAO), specifically catalyze the oxidation of spermine, and N1-acetylspermine/N1-acetylspermidine, respectively. Little is known about the molecular evolutionary history of these enzymes. However, since the yeast PAO is able to catalyze the oxidation of both acetylated and non acetylated polyamines, and in vertebrates these functions are addressed by two specialized polyamine oxidase subfamilies (APAO and SMO), it can be hypothesized an ancestral reference for the former enzyme from which the latter would have been derived. Results We analysed 36 SMO, 26 APAO, and 14 PAO homologue protein sequences from 54 taxa including various vertebrates and invertebrates. The analysis of the full-length sequences and the principal domains of vertebrate and invertebrate PAOs yielded consensus primary protein sequences for vertebrate SMOs and APAOs, and invertebrate PAOs. This analysis, coupled to molecular modeling techniques, also unveiled sequence regions that confer specific structural and functional properties, including substrate specificity, by the different PAO subfamilies. Molecular phylogenetic trees revealed a basal position of all the invertebrates PAO enzymes relative to vertebrate SMOs and APAOs. PAOs from insects constitute a monophyletic clade. Two PAO variants sampled in the amphioxus are basal to the dichotomy between two well supported monophyletic clades including
Molecular evolution of the polyamine oxidase gene family in Metazoa.
Polticelli, Fabio; Salvi, Daniele; Mariottini, Paolo; Amendola, Roberto; Cervelli, Manuela
2012-06-20
Polyamine oxidase enzymes catalyze the oxidation of polyamines and acetylpolyamines. Since polyamines are basic regulators of cell growth and proliferation, their homeostasis is crucial for cell life. Members of the polyamine oxidase gene family have been identified in a wide variety of animals, including vertebrates, arthropodes, nematodes, placozoa, as well as in plants and fungi. Polyamine oxidases (PAOs) from yeast can oxidize spermine, N1-acetylspermine, and N1-acetylspermidine, however, in vertebrates two different enzymes, namely spermine oxidase (SMO) and acetylpolyamine oxidase (APAO), specifically catalyze the oxidation of spermine, and N1-acetylspermine/N1-acetylspermidine, respectively. Little is known about the molecular evolutionary history of these enzymes. However, since the yeast PAO is able to catalyze the oxidation of both acetylated and non acetylated polyamines, and in vertebrates these functions are addressed by two specialized polyamine oxidase subfamilies (APAO and SMO), it can be hypothesized an ancestral reference for the former enzyme from which the latter would have been derived. We analysed 36 SMO, 26 APAO, and 14 PAO homologue protein sequences from 54 taxa including various vertebrates and invertebrates. The analysis of the full-length sequences and the principal domains of vertebrate and invertebrate PAOs yielded consensus primary protein sequences for vertebrate SMOs and APAOs, and invertebrate PAOs. This analysis, coupled to molecular modeling techniques, also unveiled sequence regions that confer specific structural and functional properties, including substrate specificity, by the different PAO subfamilies. Molecular phylogenetic trees revealed a basal position of all the invertebrates PAO enzymes relative to vertebrate SMOs and APAOs. PAOs from insects constitute a monophyletic clade. Two PAO variants sampled in the amphioxus are basal to the dichotomy between two well supported monophyletic clades including, respectively, all
Otani, Masahiro; Meguro, Shuhei; Gondaira, Haruka; Hayashi, Megumi; Saito, Misaki; Han, Dong-Sheng; Inthima, Phithak; Supaibulwatana, Kanyaratt; Mori, Shiro; Jikumaru, Yusuke; Kamiya, Yuji; Li, Tuoping; Niki, Tomoya; Nishijima, Takaaki; Koshioka, Masaji; Nakano, Masaru
2013-11-01
Gibberellins (GAs) are the plant hormones that control many aspects of plant growth and development, including stem elongation. Genes encoding enzymes related to the GA biosynthetic and metabolic pathway have been isolated and characterized in many plant species. Gibberellin 2-oxidase (GA2ox) catalyzes bioactive GAs or their immediate precursors to inactive forms; therefore, playing a direct role in determining the levels of bioactive GAs. In the present study, we produced transgenic plants of the liliaceous monocotyledon Tricyrtis sp. overexpressing the GA2ox gene from the linderniaceous dicotyledon Torenia fournieri (TfGA2ox2). All six transgenic plants exhibited dwarf phenotypes, and they could be classified into two classes according to the degree of dwarfism: three plants were moderately dwarf and three were severely dwarf. All of the transgenic plants had small or no flowers, and smaller, rounder and darker green leaves. Quantitative real-time reverse transcription-polymerase chain reaction (PCR) analysis showed that the TfGA2ox2 expression level generally correlated with the degree of dwarfism. The endogenous levels of bioactive GAs, GA1 and GA4, largely decreased in transgenic plants as shown by liquid chromatography-mass spectrometry (LC-MS) analysis, and the level also correlated with the degree of dwarfism. Exogenous treatment of transgenic plants with gibberellic acid (GA3) resulted in an increased shoot length, indicating that the GA signaling pathway might normally function in transgenic plants. Thus, morphological changes in transgenic plants may result from a decrease in the endogenous levels of bioactive GAs. Finally, a possibility of molecular breeding for plant form alteration in liliaceous ornamental plants by genetically engineering the GA metabolic pathway is discussed. Copyright © 2013 Elsevier GmbH. All rights reserved.
May, Michael E; Srour, Ali; Hedges, Lora K; Lightfoot, David A; Phillips, John A; Blakely, Randy D; Kennedy, Craig H
2009-07-01
A functional polymorphism in the promoter of the gene encoding monoamine oxidase A has been associated with problem behavior in various populations. We examined the association of MAOA alleles in adult males with intellectual/developmental disabilities with and without established histories of problem behavior. These data were compared with a gender, ethnicity, and age-matched contrast sample. About 43% (15/35) of adults with intellectual/developmental disabilities and problem behavior possessed the low-efficiency version of the MAOA gene. In comparison, 20% (7/35) of adults with intellectual/developmental disabilities and no problem behavior and 20% (7/35) of the contrast group had the short-allele MAOA polymorphism. Therefore, a common variant in the MAOA gene may be associated with problem behavior in adults with intellectual/developmental disabilities.
Huang, Jian; Tang, Ding; Shen, Yi; Qin, Baoxiang; Hong, Lilan; You, Aiqing; Li, Ming; Wang, Xin; Yu, Hengxiu; Gu, Minghong; Cheng, Zhukuan
2010-01-01
Gibberellin (GA) 2-oxidase plays a key role in the GA catabolic pathway through 2beta-hydroxylation. In the present study, we isolated a CaMV 35S-enhancer activation tagged mutant, H032. This mutant exhibited a dominant dwarf and GA-deficient phenotype, with a final stature that was less than half of its wild-type counterpart. The endogenous bioactive GAs are markedly decreased in the H032 mutant, and application of bioactive GAs (GA(3) or GA(4)) can reverse the dwarf phenotype. The integrated T-DNA was detected 12.8 kb upstream of the OsGA2ox6 in the H032 genome by TAIL-PCR. An increased level of OsGA2ox6 mRNA was detected at a high level in the H032 mutant, which might be due to the enhancer role of the CaMV 35S promoter. RNAi and ectopic expression analysis of OsGA2ox6 indicated that the dwarf trait and the decreased levels of bioactive GAs in the H032 mutant were a result of the up-regulation of the OsGA2ox6 gene. BLASTP analysis revealed that OsGA2ox6 belongs to the class III of GA 2-oxidases, which is a novel type of GA2ox that uses C20-GAs (GA(12) and/or GA(53)) as the substrates. Interestingly, we found that a GA biosynthesis inhibitor, paclobutrazol, positively regulated the OsGA2ox6 gene. Unlike the over-expression of OsGA2ox1, which led to a high rate of seed abortion, the H032 mutant retained normal flowering and seed production. These results indicate that OsGA2ox6 mainly affects plant stature, and the dominant dwarf trait of the H032 mutant can be used as an efficient dwarf resource in rice breeding. Copyright 2010 Institute of Genetics and Developmental Biology and the Genetics Society of China. Published by Elsevier Ltd. All rights reserved.
Cytochrome oxidase subunit II gene in mitochondria of Oenothera has no intron
Hiesel, Rudolf; Brennicke, Axel
1983-01-01
The cytochrome oxidase subunit II gene has been localized in the mitochondrial genome of Oenothera berteriana and the nucleotide sequence has been determined. The coding sequence contains 777 bp and, unlike the corresponding gene in Zea mays, is not interrupted by an intron. No TGA codon is found within the open reading frame. The codon CGG, as in the maize gene, is used in place of tryptophan codons of corresponding genes in other organisms. At position 742 in the Oenothera sequence the TGG of maize is changed into a CGG codon, where Trp is conserved as the amino acid in other organisms. Homologous sequences occur more than once in the mitochondrial genome as several mitochondrial DNA species hybridize with DNA probes of the cytochrome oxidase subunit II gene. ImagesFig. 5. PMID:16453484
Rinne, Päivi L.H.; Paul, Laju K.; Vahala, Jorma; Kangasjärvi, Jaakko; van der Schoot, Christiaan
2016-01-01
Axillary buds (AXBs) of hybrid aspen (Populus tremula×P. tremuloides) contain a developing dwarfed shoot that becomes para-dormant at the bud maturation point. Para-dormant AXBs can grow out after stem decapitation, while dormant AXBs pre-require long-term chilling to release them from dormancy. The latter is mediated by gibberellin (GA)-regulated 1,3-β-glucanases, but it is unknown if GA is also important in the development, activation, and outgrowth of para-dormant AXBs. The present data show that para-dormant AXBs up-regulate GA receptor genes during their maturation, but curtail GA biosynthesis by down-regulating the rate-limiting GIBBERELLIN 3-OXIDASE2 (GA3ox2), which is characteristically expressed in the growing apex. However, decapitation significantly up-regulated GA3ox2 and GA4-responsive 1,3-β-glucanases (GH17-family; α-clade). In contrast, decapitation down-regulated γ-clade 1,3-β-glucanases, which were strongly up-regulated in maturing AXBs concomitant with lipid body accumulation. Overexpression of selected GH17 members in hybrid aspen resulted in characteristic branching patterns. The α-clade member induced an acropetal branching pattern, whereas the γ-clade member activated AXBs in recurrent flushes during transient cessation of apex proliferation. The results support a model in which curtailing the final step in GA biosynthesis dwarfs the embryonic shoot, while high levels of GA precursors and GA receptors keep AXBs poised for growth. GA signaling, induced by decapitation, reinvigorates symplasmic supply routes through GA-inducible 1,3-β-glucanases that hydrolyze callose at sieve plates and plasmodesmata. PMID:27697786
Van Hellemond, J J; Simons, B; Millenaar, F F; Tielens, A G
1998-01-01
The constituents of the respiratory chain are believed to differ among the trypanosomatids; bloodstream stages of African trypanosomes and Phytomonas promastigotes oxidize ubiquinol by a ubiquinol:oxygen oxidoreductase, also known as alternative oxidase, whereas Leishmania spp. oxidize ubiquinol via a classic cytochrome-containing respiratory chain. The molecular basis for this elementary difference in ubiquinol oxidation by the mitochondrial electron-transport chain in distinct trypanosomatids was investigated. The presence of a gene encoding the plant-like alternative oxidase could be demonstrated in Phytomonas and Trypanosoma brucei, trypanosomatids that are known to contain alternative oxidase activity. Our results further demonstrated that Leishmania spp. lack a gene encoding the plant-like alternative oxidase, and therefore, all stages of Leishmania spp. will lack the alternative oxidase protein. The observed fundamental differences between the respiratory chains of distinct members of the trypanosomatid family are thus caused by the presence or absence of a gene encoding the plant-like alternative oxidase.
Hu, Ying-Xiong; Tao, Yan-Bin; Xu, Zeng-Fu
2017-01-01
Gibberellins (GAs) are plant hormones that play fundamental roles in plant growth and development. Gibberellin 2-oxidase (GA2ox) plays a direct role in determining the levels of bioactive GAs by catalyzing bioactive GAs or their immediate precursors to inactive forms. In this study, a GA2ox gene, designated JcGA2ox6, was isolated from Jatropha curcas. JcGA2ox6 is expressed in all tissues of adult Jatropha, with the highest expression level in male flowers and the lowest expression level in young leaves. Overexpression of JcGA2ox6 in Arabidopsis resulted in a typical dwarf phenotype, along with late flowering, smaller leaves and flowers, shorter siliques and smaller seeds. Similarly, when JcGA2ox6 was overexpressed in Jatropha, the transgenic plants exhibited a dwarf phenotype with dark-green leaves and smaller inflorescences, flowers, fruits and seeds. However, the flowering time of Jatropha was not affected by overexpression of JcGA2ox6, unlike that in the transgenic Arabidopsis. Moreover, the number of flowers per inflorescence, the weight of 10 seeds and the seed oil content were significantly decreased in transgenic Jatropha. The results indicated that overexpression of JcGA2ox6 had a great impact on the vegetative and reproductive growth of transgenic Jatropha. Furthermore, we found that the dwarf phenotype of transgenic Jatropha was caused by a decrease in endogenous bioactive GA4, which was correlated with the degree of dwarfism. PMID:29312375
Helliwell, Chris A.; Chandler, Peter M.; Poole, Andrew; Dennis, Elizabeth S.; Peacock, W. James
2001-01-01
We have shown that ent-kaurenoic acid oxidase, a member of the CYP88A subfamily of cytochrome P450 enzymes, catalyzes the three steps of the gibberellin biosynthetic pathway from ent-kaurenoic acid to GA12. A gibberellin-responsive barley mutant, grd5, accumulates ent-kaurenoic acid in developing grains. Three independent grd5 mutants contain mutations in a gene encoding a member of the CYP88A subfamily of cytochrome P450 enzymes, defined by the maize Dwarf3 protein. Mutation of the Dwarf3 gene gives rise to a gibberellin-responsive dwarf phenotype, but the lesion in the gibberellin biosynthesis pathway has not been identified. Arabidopsis thaliana has two CYP88A genes, both of which are expressed. Yeast strains expressing cDNAs encoding each of the two Arabidopsis and the barley CYP88A enzymes catalyze the three steps of the GA biosynthesis pathway from ent-kaurenoic acid to GA12. Sequence comparison suggests that the maize Dwarf3 locus also encodes ent-kaurenoic acid oxidase. PMID:11172076
Multiple Multi-Copper Oxidase Gene Families in Basidiomycetes – What for?
Kües, Ursula; Rühl, Martin
2011-01-01
Genome analyses revealed in various basidiomycetes the existence of multiple genes for blue multi-copper oxidases (MCOs). Whole genomes are now available from saprotrophs, white rot and brown rot species, plant and animal pathogens and ectomycorrhizal species. Total numbers (from 1 to 17) and types of mco genes differ between analyzed species with no easy to recognize connection of gene distribution to fungal life styles. Types of mco genes might be present in one and absent in another fungus. Distinct types of genes have been multiplied at speciation in different organisms. Phylogenetic analysis defined different subfamilies of laccases sensu stricto (specific to Agaricomycetes), classical Fe2+-oxidizing Fet3-like ferroxidases, potential ferroxidases/laccases exhibiting either one or both of these enzymatic functions, enzymes clustering with pigment MCOs and putative ascorbate oxidases. Biochemically best described are laccases sensu stricto due to their proposed roles in degradation of wood, straw and plant litter and due to the large interest in these enzymes in biotechnology. However, biological functions of laccases and other MCOs are generally little addressed. Functions in substrate degradation, symbiontic and pathogenic intercations, development, pigmentation and copper homeostasis have been put forward. Evidences for biological functions are in most instances rather circumstantial by correlations of expression. Multiple factors impede research on biological functions such as difficulties of defining suitable biological systems for molecular research, the broad and overlapping substrate spectrum multi-copper oxidases usually possess, the low existent knowledge on their natural substrates, difficulties imposed by low expression or expression of multiple enzymes, and difficulties in expressing enzymes heterologously. PMID:21966246
Chen, Jingjing; Xie, Jianghui; Duan, Yajie; Hu, Huigang; Hu, Yulin; Li, Weiming
2016-05-27
Dwarfism is one of the most valuable traits in banana breeding because semi-dwarf cultivars show good resistance to damage by wind and rain. Moreover, these cultivars present advantages of convenient cultivation, management, and so on. We obtained a dwarf mutant '8818-1' through EMS (ethyl methane sulphonate) mutagenesis of Williams banana 8818 (Musa spp. AAA group). Our research have shown that gibberellins (GAs) content in 8818-1 false stems was significantly lower than that in its parent 8818 and the dwarf type of 8818-1 could be restored by application of exogenous GA3. Although GA exerts important impacts on the 8818-1 dwarf type, our understanding of the regulation of GA metabolism during banana dwarf mutant development remains limited. Genome-wide screening revealed 36 candidate GA metabolism genes were systematically identified for the first time; these genes included 3 MaCPS, 2 MaKS, 1 MaKO, 2 MaKAO, 10 MaGA20ox, 4 MaGA3ox, and 14 MaGA2ox genes. Phylogenetic tree and conserved protein domain analyses showed sequence conservation and divergence. GA metabolism genes exhibited tissue-specific expression patterns. Early GA biosynthesis genes were constitutively expressed but presented differential regulation in different tissues in Williams banana. GA oxidase family genes were mainly transcribed in young fruits, thus suggesting that young fruits were the most active tissue involved in GA metabolism, followed by leaves, bracts, and finally approximately mature fruits. Expression patterns between 8818 and 8818-1 revealed that MaGA20ox4, MaGA20ox5, and MaGA20ox7 of the MaGA20ox gene family and MaGA2ox7, MaGA2ox12, and MaGA2ox14 of the MaGA2ox gene family exhibited significant differential expression and high-expression levels in false stems. These genes are likely to be responsible for the regulation of GAs content in 8818-1 false stems. Overall, phylogenetic evolution, tissue specificity and differential expression analyses of GA metabolism genes can provide a
Stamen-derived bioactive gibberellin is essential for male flower development of Cucurbita maxima L.
Pimenta Lange, Maria João; Knop, Nicole; Lange, Theo
2012-01-01
Gibberellin (GA) signalling during pumpkin male flower development is highly regulated, including biosynthetic, perception, and transduction pathways. GA 20-oxidases, 3-oxidases, and 2-oxidases catalyse the final part of GA synthesis. Additionally, 7-oxidase initiates this part of the pathway in some cucurbits including Cucurbita maxima L. (pumpkin). Expression patterns for these GA-oxidase-encoding genes were examined by competitive reverse transcription-PCR (RT-PCR) and endogenous GA levels were determined during pumpkin male flower development. In young flowers, GA20ox3 transcript levels are high in stamens, followed by high levels of the GA precursor GA9. Later, just before flower opening, transcript levels for GA3ox3 and GA3ox4 increase in the hypanthium and stamens, respectively. In the stamen, following GA3ox4 expression, bioactive GA4 levels rise dramatically. Accordingly, catabolic GA2ox2 and GA2ox3 transcript levels are low in developing flowers, and increase in mature flowers. Putative GA receptor GID1b and DELLA repressor GAIPb transcript levels do not change in developing flowers, but increase sharply in mature flowers. Emasculation arrests floral development completely and leads to abscission of premature flowers. Application of GA4 (but not of its precursors GA12-aldehyde or GA9) restores normal growth of emasculated flowers. These results indicate that de novo GA4 synthesis in the stamen is under control of GA20ox3 and GA3ox4 genes just before the rapid flower growth phase. Stamen-derived bioactive GA is essential and sufficient for male flower development, including the petal and the pedicel growth. PMID:22268154
Cassán, Fabricio; Bottini, Rubén; Schneider, Gernot; Piccoli, Patricia
2001-01-01
Azospirillum species are plant growth-promotive bacteria whose beneficial effects have been postulated to be partially due to production of phytohormones, including gibberellins (GAs). In this work, Azospirillum brasilense strain Cd and Azospirillum lipoferum strain USA 5b promoted sheath elongation growth of two single gene GA-deficient dwarf rice (Oryza sativa) mutants, dy and dx, when the inoculated seedlings were supplied with [17,17-2H2]GA20-glucosyl ester or [17,17- 2H2]GA20-glucosyl ether. Results of capillary gas chromatography-mass spectrometry analysis show that this growth was due primarily to release of the aglycone [17,17-2H2]GA20 and its subsequent 3β-hydroxylation to [17,17-2H2]GA1 by the microorganism for the dy mutant, and by both the rice plant and microorganism for the dx mutant. PMID:11299384
Reinecke, Dennis M; Wickramarathna, Aruna D; Ozga, Jocelyn A; Kurepin, Leonid V; Jin, Alena L; Good, Allen G; Pharis, Richard P
2013-10-01
Gibberellins (GAs) are key modulators of plant growth and development. PsGA3ox1 (LE) encodes a GA 3β-hydroxylase that catalyzes the conversion of GA20 to biologically active GA1. To further clarify the role of GA3ox expression during pea (Pisum sativum) plant growth and development, we generated transgenic pea lines (in a lele background) with cauliflower mosaic virus-35S-driven expression of PsGA3ox1 (LE). PsGA3ox1 transgene expression led to higher GA1 concentrations in a tissue-specific and development-specific manner, altering GA biosynthesis and catabolism gene expression and plant phenotype. PsGA3ox1 transgenic plants had longer internodes, tendrils, and fruits, larger stipules, and displayed delayed flowering, increased apical meristem life, and altered vascular development relative to the null controls. Transgenic PsGA3ox1 overexpression lines were then compared with lines where endogenous PsGA3ox1 (LE) was introduced, by a series of backcrosses, into the same genetic background (BC LEle). Most notably, the BC LEle plants had substantially longer internodes containing much greater GA1 levels than the transgenic PsGA3ox1 plants. Induction of expression of the GA deactivation gene PsGA2ox1 appears to make an important contribution to limiting the increase of internode GA1 to modest levels for the transgenic lines. In contrast, PsGA3ox1 (LE) expression driven by its endogenous promoter was coordinated within the internode tissue to avoid feed-forward regulation of PsGA2ox1, resulting in much greater GA1 accumulation. These studies further our fundamental understanding of the regulation of GA biosynthesis and catabolism at the tissue and organ level and demonstrate that the timing/localization of GA3ox expression within an organ affects both GA homeostasis and GA1 levels, and thereby growth.
Yang, Chao; Ma, Yamei; Li, Jianxiong
2016-10-01
YABBY genes encode seed plant-specific transcription factors that play pivotal roles in diverse aspects of leaf, shoot, and flower development. Members of the YABBY gene family are primarily expressed in lateral organs in a polar manner and function to specify abaxial cell fate in dicotyledons, but this polar expression is not conserved in monocotyledons. The function of YABBY genes is therefore not well understood in monocotyledons. Here we show that overexpression of the rice (Oryza sativa L.) YABBY4 gene (OsYABBY4) leads to a semi-dwarf phenotype, abnormal development in the uppermost internode, an increased number of floral organs, and insensitivity to gibberellin (GA) treatment. We report on an important role for OsYABBY4 in negative control of the expression of a GA biosynthetic gene by binding to the promoter region of the gibberellin 20-oxidase 2 gene (GA20ox2), which is a direct target of SLR1 (the sole DELLA protein negatively controlling GA responses in rice). OsYABBY4 also suppresses the expression level of SLR1 and interacts with SLR1 protein. The interaction inhibits GA-dependent degradation of SLR1 and therefore leads to GA insensitivity. These data together suggest that OsYABBY4 serves as a DNA-binding intermediate protein for SLR1 and is associated with the GA signaling pathway regulating gene expression during plant growth and development. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Han, Xikun; Hu, Zunsong; Chen, Jing; Huang, Jianfeng; Huang, Chen; Liu, Fangchao; Gu, Charles; Yang, Xueli; Hixson, James E; Lu, Xiangfeng; Wang, Laiyuan; Liu, De-Pei; He, Jiang; Chen, Shufeng; Gu, Dongfeng
2017-04-01
The aim of this study was to comprehensively test the associations of genetic variants of nicotinamide adenine dinucleotide phosphate (NADPH) oxidase-related genes with blood pressure (BP) responses to dietary sodium intervention in a Chinese population. We conducted a 7-day low-sodium intervention followed by a 7-day high-sodium intervention among 1,906 participants in rural China. BP measurements were obtained at baseline and each dietary intervention using a random-zero sphygmomanometer. Linear mixed-effect models were used to assess the additive associations of 63 tag single-nucleotide polymorphisms in 11 NADPH oxidase-related genes with BP responses to dietary sodium intervention. Gene-based analyses were conducted using the truncated product method. The Bonferroni method was used to adjust for multiple testing in all analyses. Systolic BP (SBP) response to high-sodium intervention significantly decreased with the number of minor T allele of marker rs6967221 in RAC1 (P = 4.51 × 10-4). SBP responses (95% confidence interval) for genotypes CC, CT, and TT were 5.03 (4.71, 5.36), 4.20 (3.54, 4.85), and 0.56 (-1.08, 2.20) mm Hg, respectively, during the high-sodium intervention. Gene-based analyses revealed that RAC1 was significantly associated with SBP response to high-sodium intervention (P = 1.00 × 10-6) and diastolic BP response to low-sodium intervention (P = 9.80 × 10-4). These findings suggested that genetic variants of NADPH oxidase-related genes may contribute to the variation of BP responses to sodium intervention in Chinese population. Further replication of these findings is warranted. © American Journal of Hypertension, Ltd 2017. All rights reserved. For Permissions, please email: journals.permissions@oup.com
Huang, P L; Do, Y Y; Huang, F C; Thay, T S; Chang, T W
1997-04-01
A cDNA encoding the banana 1-aminocyclopropane-1-carboxylate (ACC) oxidase has previously been isolated from a cDNA library that was constructed by extracting poly(A)+ RNA from peels of ripening banana. This cDNA, designated as pMAO2, has 1,199 bp and contains an open reading frame of 318 amino acids. In order to identify ripening-related promoters of the banana ACC oxidase gene, pMAO2 was used as a probe to screen a banana genomic library constructed in the lambda EMBL3 vector. The banana ACC oxidase MAO2 gene has four exons and three introns, with all of the boundaries between these introns and exons sharing a consensus dinucleotide sequence of GT-AG. The expression of MAO2 gene in banana begins after the onset of ripening (stage 2) and continuous into later stages of the ripening process. The accumulation of MAO2 mRNA can be induced by 1 microliter/l exogenous ethylene, and it reached steady state level when 100 microliters/l exogenous ethylene was present.
Characterization of two brassinosteroid C-6 oxidase genes in pea.
Jager, Corinne E; Symons, Gregory M; Nomura, Takahito; Yamada, Yumiko; Smith, Jennifer J; Yamaguchi, Shinjiro; Kamiya, Yuji; Weller, James L; Yokota, Takao; Reid, James B
2007-04-01
C-6 oxidation genes play a key role in the regulation of biologically active brassinosteroid (BR) levels in the plant. They control BR activation, which involves the C-6 oxidation of 6-deoxocastasterone (6-DeoxoCS) to castasterone (CS) and in some cases the further conversion of CS to brassinolide (BL). C-6 oxidation is controlled by the CYP85A family of cytochrome P450s, and to date, two CYP85As have been isolated in tomato (Solanum lycopersicum), two in Arabidopsis (Arabidopsis thaliana), one in rice (Oryza sativa), and one in grape (Vitis vinifera). We have now isolated two CYP85As (CYP85A1 and CYP85A6) from pea (Pisum sativum). However, unlike Arabidopsis and tomato, which both contain one BR C-6 oxidase that converts 6-DeoxoCS to CS and one BR C-6 Baeyer-Villiger oxidase that converts 6-DeoxoCS right through to BL, the two BR C-6 oxidases in pea both act principally to convert 6-DeoxoCS to CS. The isolation of these two BR C-6 oxidation genes in pea highlights the species-specific differences associated with C-6 oxidation. In addition, we have isolated a novel BR-deficient mutant, lke, which blocks the function of one of these two BR C-6 oxidases (CYP85A6). The lke mutant exhibits a phenotype intermediate between wild-type plants and previously characterized pea BR mutants (lk, lka, and lkb) and contains reduced levels of CS and increased levels of 6-DeoxoCS. To date, lke is the only mutant identified in pea that blocks the latter steps of BR biosynthesis and it will therefore provide an excellent tool to further examine the regulation of BR biosynthesis and the relative biological activities of CS and BL in pea.
Lo, Shuen-Fang; Yang, Show-Ya; Chen, Ku-Ting; Hsing, Yue-Ie; Zeevaart, Jan A D; Chen, Liang-Jwu; Yu, Su-May
2008-10-01
Gibberellin 2-oxidases (GA2oxs) regulate plant growth by inactivating endogenous bioactive gibberellins (GAs). Two classes of GA2oxs inactivate GAs through 2beta-hydroxylation: a larger class of C(19) GA2oxs and a smaller class of C(20) GA2oxs. In this study, we show that members of the rice (Oryza sativa) GA2ox family are differentially regulated and act in concert or individually to control GA levels during flowering, tillering, and seed germination. Using mutant and transgenic analysis, C(20) GA2oxs were shown to play pleiotropic roles regulating rice growth and architecture. In particular, rice overexpressing these GA2oxs exhibited early and increased tillering and adventitious root growth. GA negatively regulated expression of two transcription factors, O. sativa homeobox 1 and TEOSINTE BRANCHED1, which control meristem initiation and axillary bud outgrowth, respectively, and that in turn inhibited tillering. One of three conserved motifs unique to the C(20) GA2oxs (motif III) was found to be important for activity of these GA2oxs. Moreover, C(20) GA2oxs were found to cause less severe GA-defective phenotypes than C(19) GA2oxs. Our studies demonstrate that improvements in plant architecture, such as semidwarfism, increased root systems and higher tiller numbers, could be induced by overexpression of wild-type or modified C(20) GA2oxs.
Li, Nan; Wang, Yuanlong; Zhu, Ping; Liu, Zhenmin; Guo, Benheng; Ren, Jing
2015-02-01
Lactobacillus casei LC2W is an exopolysaccharide (EPS)-producing strain with probiotic effects. To investigate the regulation mechanism of EPS biosynthesis and to improve EPS production through cofactor engineering, a H₂O-forming NADH oxidase gene was cloned from Streptococcus mutans and overexpressed in L. casei LC2W under the control of constitutive promoter P₂₃. The recombinant strain LC-nox exhibited 0.854 U/mL of NADH oxidase activity, which was elevated by almost 20-fold in comparison with that of wild-type strain. As a result, overexpression of NADH oxidase resulted in a reduction in growth rate. In addition, lactate production was decreased by 22% in recombinant strain. It was proposed that more carbon source was saved and used for the biosynthesis of EPS, the production of which was reached at 219.4 mg/L, increased by 46% compared to that of wild-type strain. This work provided a novel and convenient genetic approach to manipulate metabolic flux and to increase EPS production. To the best of our knowledge, this is the first report which correlates cofactor engineering with EPS production. Copyright © 2015 Elsevier GmbH. All rights reserved.
Shan, Chi; Mei, Zhiling; Duan, Jianli; Chen, Haiying; Feng, Huafeng; Cai, Weiming
2014-01-01
Gibberellin (GA) 2-oxidases play an important role in the GA catabolic pathway through 2β-hydroxylation. There are two classes of GA2oxs, i.e., a larger class of C₁₉-GA2oxs and a smaller class of C₂₀-GA2oxs. In this study, the gene encoding a GA 2-oxidase of rice, Oryza sativa GA 2-oxidase 5 (OsGA2ox5), was cloned and characterized. BLASTP analysis showed that OsGA2ox5 belongs to the C₂₀-GA2oxs subfamily, a subfamily of GA2oxs acting on C₂₀-GAs (GA₁₂, GA₅₃). Subcellular localization of OsGA2ox5-YFP in transiently transformed onion epidermal cells revealed the presence of this protein in both of the nucleus and cytoplasm. Real-time PCR analysis, along with GUS staining, revealed that OsGA2ox5 is expressed in the roots, culms, leaves, sheaths and panicles of rice. Rice plants overexpressing OsGA2ox5 exhibited dominant dwarf and GA-deficient phenotypes, with shorter stems and later development of reproductive organs than the wild type. The dwarfism phenotype was partially rescued by the application of exogenous GA3 at a concentration of 10 µM. Ectopic expression of OsGA2ox5 cDNA in Arabidopsis resulted in a similar phenotype. Real-time PCR assays revealed that both GA synthesis-related genes and GA signaling genes were expressed at higher levels in transgenic rice plants than in wild-type rice; OsGA3ox1, which encodes a key enzyme in the last step of the bioactive GAs synthesis pathway, was highly expressed in transgenic rice. The roots of OsGA2ox5-ox plants exhibited increased starch granule accumulation and gravity responses, revealing a role for GA in root starch granule development and gravity responses. Furthermore, rice and Arabidopsis plants overexpressing OsGA2ox5 were more resistant to high-salinity stress than wild-type plants. These results suggest that OsGA2ox5 plays important roles in GAs homeostasis, development, gravity responses and stress tolerance in rice.
Hirose, Fumiaki; Inagaki, Noritoshi; Takano, Makoto
2013-03-01
In rice seedlings, elongation of leaf sheaths is suppressed by light stimuli. The response is mediated by two classes of photoreceptors, phytochromes and cryptochromes. However, it remains unclear how these photoreceptors interact in the process. Our recent study using phytochrome mutants and novel cryptochrome RNAi lines revealed that cryptochromes and phytochromes function cooperatively, but independently to reduce active GA contents in seedlings in visible light. Blue light captured by cryptochrome 1 (cry1a and cry1b) induces robust expression of GA 2-oxidase genes (OsGA2ox4-7). In parallel, phytochrome B with auxiliary action of phytochrome A mediates repression of GA 20-oxidase genes (OsGA20ox2 and OsGA20ox4). The independent effects cumulatively reduce active GA contents, leading to a suppression of leaf sheath elongation. These regulatory mechanisms are distinct from phytochrome B function in dicots. We discuss reasons why the distinct system appeared in rice, and advantages of the rice system in early photomorphogenesis.
Jakubowicz, Małgorzata; Gałgańska, Hanna; Nowak, Witold; Sadowski, Jan
2010-01-01
In higher plants, copper ions, hydrogen peroxide, and cycloheximide have been recognized as very effective inducers of the transcriptional activity of genes encoding the enzymes of the ethylene biosynthesis pathway. In this report, the transcriptional patterns of genes encoding the 1-aminocyclopropane-1-carboxylate synthases (ACSs), 1-aminocyclopropane-1-carboxylate oxidases (ACOs), ETR1, ETR2, and ERS1 ethylene receptors, phospholipase D (PLD)-α1, -α2, -γ1, and -δ, and respiratory burst oxidase homologue (Rboh)-NADPH oxidase-D and -F in response to these inducers in Brassica oleracea etiolated seedlings are shown. ACS1, ACO1, ETR2, PLD-γ1, and RbohD represent genes whose expression was considerably affected by all of the inducers used. The investigations were performed on the seedlings with (i) ethylene insensitivity and (ii) a reduced level of the PLD-derived phosphatidic acid (PA). The general conclusion is that the expression of ACS1, -3, -4, -5, -7, and -11, ACO1, ETR1, ERS1, and ETR2, PLD-γ 1, and RbohD and F genes is undoubtedly under the reciprocal cross-talk of the ethylene and PAPLD signalling routes; both signals affect it in concerted or opposite ways depending on the gene or the type of stimuli. The results of these studies on broccoli seedlings are in agreement with the hypothesis that PA may directly affect the ethylene signal transduction pathway via an inhibitory effect on CTR1 (constitutive triple response 1) activity. PMID:20581125
Lo, Shuen-Fang; Yang, Show-Ya; Chen, Ku-Ting; Hsing, Yue-Ie; Zeevaart, Jan A.D.; Chen, Liang-Jwu; Yu, Su-May
2008-01-01
Gibberellin 2-oxidases (GA2oxs) regulate plant growth by inactivating endogenous bioactive gibberellins (GAs). Two classes of GA2oxs inactivate GAs through 2β-hydroxylation: a larger class of C19 GA2oxs and a smaller class of C20 GA2oxs. In this study, we show that members of the rice (Oryza sativa) GA2ox family are differentially regulated and act in concert or individually to control GA levels during flowering, tillering, and seed germination. Using mutant and transgenic analysis, C20 GA2oxs were shown to play pleiotropic roles regulating rice growth and architecture. In particular, rice overexpressing these GA2oxs exhibited early and increased tillering and adventitious root growth. GA negatively regulated expression of two transcription factors, O. sativa homeobox 1 and TEOSINTE BRANCHED1, which control meristem initiation and axillary bud outgrowth, respectively, and that in turn inhibited tillering. One of three conserved motifs unique to the C20 GA2oxs (motif III) was found to be important for activity of these GA2oxs. Moreover, C20 GA2oxs were found to cause less severe GA-defective phenotypes than C19 GA2oxs. Our studies demonstrate that improvements in plant architecture, such as semidwarfism, increased root systems and higher tiller numbers, could be induced by overexpression of wild-type or modified C20 GA2oxs. PMID:18952778
Hirose, Fumiaki; Inagaki, Noritoshi; Hanada, Atsushi; Yamaguchi, Shinjiro; Kamiya, Yuji; Miyao, Akio; Hirochika, Hirohiko; Takano, Makoto
2012-01-01
In contrast to a wealth of knowledge about the photoregulation of gibberellin metabolism in dicots, that in monocots remains largely unclear. In this study, we found that a blue light signal triggers reduction of active gibberellin content in rice seedlings with simultaneous repression of two gibberellin 20-oxidase genes (OsGA20ox2 and OsGA20ox4) and acute induction of four gibberellin 2-oxidase genes (OsGA2ox4–OsGA2ox7). For further examination of the regulation of these genes, we established a series of cryptochrome-deficient lines through reverse genetic screening from a Tos17 mutant population and construction of knockdown lines based on an RNA interference technique. By using these lines and phytochrome mutants, we elucidated that cryptochrome 1 (cry1), consisting of two species in rice plants (cry1a and cry1b), is indispensable for robust induction of the GA2ox genes. On the other hand, repression of the GA20ox genes is mediated by phytochromes. In addition, we found that the phytochromes also mediate the repression of a gibberellin 3-oxidase gene (OsGA3ox2) in the light. These results imply that, in rice seedlings, phytochromes mediate the repression of gibberellin biosynthesis capacity, while cry1 mediates the induction of gibberellin inactivation capacity. The cry1 action was demonstrated to be dominant in the reduction of active gibberellin content, but, in rice seedlings, the cumulative effects of these independent actions reduced active gibberellin content in the light. This pathway design in which different types of photoreceptors independently but cooperatively regulate active gibberellin content is unique from the viewpoint of dicot research. This redundancy should provide robustness to the response in rice plants. PMID:22764280
Hirose, Fumiaki; Inagaki, Noritoshi; Hanada, Atsushi; Yamaguchi, Shinjiro; Kamiya, Yuji; Miyao, Akio; Hirochika, Hirohiko; Takano, Makoto
2012-09-01
In contrast to a wealth of knowledge about the photoregulation of gibberellin metabolism in dicots, that in monocots remains largely unclear. In this study, we found that a blue light signal triggers reduction of active gibberellin content in rice seedlings with simultaneous repression of two gibberellin 20-oxidase genes (OsGA20ox2 and OsGA20ox4) and acute induction of four gibberellin 2-oxidase genes (OsGA2ox4-OsGA2ox7). For further examination of the regulation of these genes, we established a series of cryptochrome-deficient lines through reverse genetic screening from a Tos17 mutant population and construction of knockdown lines based on an RNA interference technique. By using these lines and phytochrome mutants, we elucidated that cryptochrome 1 (cry1), consisting of two species in rice plants (cry1a and cry1b), is indispensable for robust induction of the GA2ox genes. On the other hand, repression of the GA20ox genes is mediated by phytochromes. In addition, we found that the phytochromes also mediate the repression of a gibberellin 3-oxidase gene (OsGA3ox2) in the light. These results imply that, in rice seedlings, phytochromes mediate the repression of gibberellin biosynthesis capacity, while cry1 mediates the induction of gibberellin inactivation capacity. The cry1 action was demonstrated to be dominant in the reduction of active gibberellin content, but, in rice seedlings, the cumulative effects of these independent actions reduced active gibberellin content in the light. This pathway design in which different types of photoreceptors independently but cooperatively regulate active gibberellin content is unique from the viewpoint of dicot research. This redundancy should provide robustness to the response in rice plants.
Altered gene expression in early postnatal monoamine oxidase A knockout mice.
Chen, Kevin; Kardys, Abbey; Chen, Yibu; Flink, Stephen; Tabakoff, Boris; Shih, Jean C
2017-08-15
We reported previously that monoamine oxidase (MAO) A knockout (KO) mice show increased serotonin (5-hydroxytryptamine, 5-HT) levels and autistic-like behaviors characterized by repetitive behaviors, and anti-social behaviors. We showed that administration of the serotonin synthesis inhibitor para-chlorophenylalanine (pCPA) from post-natal day 1 (P1) through 7 (P7) in MAO A KO mice reduced the serotonin level to normal and reverses the repetitive behavior. These results suggested that the altered gene expression at P1 and P7 may be important for the autistic-like behaviors seen in MAO A KO mice and was studied here. In this study, Affymetrix mRNA array data for P1 and P7 MAO A KO mice were analyzed using Partek Genomics Suite and Ingenuity Pathways Analysis to identify genes differentially expressed versus wild-type and assess their functions and relationships. The number of significant differentially expressed genes (DEGs) varied with age: P1 (664) and P7 (3307) [false discovery rate (FDR) <0.05, fold-change (FC) >1.5 for autism-linked genes and >2.0 for functionally categorized genes]. Eight autism-linked genes were differentially expressed in P1 (upregulated: NLGN3, SLC6A2; down-regulated: HTR2C, MET, ADSL, MECP2, ALDH5A1, GRIN3B) while four autism-linked genes were differentially expressed at P7 (upregulated: HTR2B; downregulated: GRIN2D, GRIN2B, CHRNA4). Many other genes involved in neurodevelopment, apoptosis, neurotransmission, and cognitive function were differentially expressed at P7 in MAO A KO mice. This result suggests that modulation of these genes by the increased serotonin may lead to neurodevelopmental alteration in MAO A KO mice and results in autistic-like behaviors. Copyright © 2017 Elsevier B.V. All rights reserved.
Reinecke, Dennis M.; Wickramarathna, Aruna D.; Ozga, Jocelyn A.; Kurepin, Leonid V.; Jin, Alena L.; Good, Allen G.; Pharis, Richard P.
2013-01-01
Gibberellins (GAs) are key modulators of plant growth and development. PsGA3ox1 (LE) encodes a GA 3β-hydroxylase that catalyzes the conversion of GA20 to biologically active GA1. To further clarify the role of GA3ox expression during pea (Pisum sativum) plant growth and development, we generated transgenic pea lines (in a lele background) with cauliflower mosaic virus-35S-driven expression of PsGA3ox1 (LE). PsGA3ox1 transgene expression led to higher GA1 concentrations in a tissue-specific and development-specific manner, altering GA biosynthesis and catabolism gene expression and plant phenotype. PsGA3ox1 transgenic plants had longer internodes, tendrils, and fruits, larger stipules, and displayed delayed flowering, increased apical meristem life, and altered vascular development relative to the null controls. Transgenic PsGA3ox1 overexpression lines were then compared with lines where endogenous PsGA3ox1 (LE) was introduced, by a series of backcrosses, into the same genetic background (BC LEle). Most notably, the BC LEle plants had substantially longer internodes containing much greater GA1 levels than the transgenic PsGA3ox1 plants. Induction of expression of the GA deactivation gene PsGA2ox1 appears to make an important contribution to limiting the increase of internode GA1 to modest levels for the transgenic lines. In contrast, PsGA3ox1 (LE) expression driven by its endogenous promoter was coordinated within the internode tissue to avoid feed-forward regulation of PsGA2ox1, resulting in much greater GA1 accumulation. These studies further our fundamental understanding of the regulation of GA biosynthesis and catabolism at the tissue and organ level and demonstrate that the timing/localization of GA3ox expression within an organ affects both GA homeostasis and GA1 levels, and thereby growth. PMID:23979969
Association of monoamine oxidase A gene polymorphism with Alzheimer's disease and Lewy body variant.
Takehashi, Masanori; Tanaka, Seigo; Masliah, Eliezer; Ueda, Kunihiro
2002-07-19
The association between (GT)n dinucleotide repeats in monoamine oxidase gene loci, monoamine oxidase A (MAOA) and B (MAOB), and Parkinson's disease (PD), Alzheimer's disease (AD), and Lewy body variant (LBV) of AD were determined. MAOA-GT polymorphisms were significantly associated with pure AD and LBV. MAOA-GT allele 113 was excessively represented in pure AD and LBV compared with controls. Furthermore, the frequency of females homozygous for MAOA-GT allele 113 was higher in pure AD and LBV than controls by 2.79- and 2.77-fold, respectively. In contrast, there was no association between MAOA-GT or MAOB-GT polymorphisms and PD. These results suggest that polymorphisms within the MAOA gene may have implication in AD pathology shared by pure AD and LBV.
Guerra, Mónica; Machado, Patrícia; Manco, Licínio; Fernandes, Natércia; Miranda, Juliana; Arez, Ana Paula
2015-06-01
TPI1 promoter polymorphisms occur in high prevalence in individuals from African origin. Malaria-patients from Angola and Mozambique were screened for the TPI1 gene promoter variants rs1800200A>G, (-5G>A), rs1800201G>A, (-8G>A), rs1800202T>G, (-24T>G), and for the intron 5 polymorphism rs2071069G>A, (2262G>A). -5G>A and -8G>A variants occur in 47% and 53% in Angola and Mozambique, respectively while -24T>G was monomorphic for the wild-type T allele. Six haplotypes were identified and -8A occurred in 45% of the individuals, especially associated with the GAG haplotype and more frequent in non-severe malaria groups, although not significantly. The arising and dispersion of -5G>A and -8G>A polymorphisms is controversial. Their age was estimated by analyses of two microsatellite loci, CD4 and ATN1, adjacent to TPI1 gene. The -5G>A is older than -8G>A, with an average estimate of approximately 35,000 years. The -8A variant arose in two different backgrounds, suggesting independent mutational events. The first, on the -5G background, may have occurred in East Africa around 20,800 years ago; the second, on the -5A background, may have occurred in West Africa some 7500 years ago. These estimates are within the period of spread of agriculture and the malaria mosquito vector in Africa, which could has been a possible reason for the selection of -8A polymorphism in malaria endemic countries. Copyright © 2015 Elsevier B.V. All rights reserved.
MONOAMINE OXIDASE: From Genes to Behavior
Shih, J. C.; Chen, K.; Ridd, M. J.
2010-01-01
Cloning of MAO (monoamine oxidase) A and B has demonstrated unequivocally that these enzymes are made up of different polypeptides, and our understanding of MAO structure, regulation, and function has been significantly advanced by studies using their cDNA. MAO A and B genes are located on the X-chromosome (Xp11.23) and comprise 15 exons with identical intron-exon organization, which suggests that they are derived from the same ancestral gene. MAO A and B knockout mice exhibit distinct differences in neurotransmitter metabolism and behavior. MAO A knock-out mice have elevated brain levels of serotonin, norephinephrine, and dopamine and manifest aggressive behavior similar to human males with a deletion of MAO A. In contrast, MAO B knock-out mice do not exhibit aggression and only levels of phenylethylamine are increased. Mice lacking MAO B are resistant to the Parkinsongenic neurotoxin, 1-methyl-4-phenyl-1,2,3,6-tetra-hydropyridine. Both MAO A and B knock-out mice show increased reactivity to stress. These knock-out mice are valuable models for investigating the role of monoamines in psychoses and neurodegenerative and stress-related disorders. PMID:10202537
Bongers, Kale S.; Fox, Daniel K.; Kunkel, Steven D.; Stebounova, Larissa V.; Murry, Daryl J.; Pufall, Miles A.; Ebert, Scott M.; Dyle, Michael C.; Bullard, Steven A.; Dierdorff, Jason M.
2014-01-01
Skeletal muscle atrophy is a common and debilitating condition that remains poorly understood at the molecular level. To better understand the mechanisms of muscle atrophy, we used mouse models to search for a skeletal muscle protein that helps to maintain muscle mass and is specifically lost during muscle atrophy. We discovered that diverse causes of muscle atrophy (limb immobilization, fasting, muscle denervation, and aging) strongly reduced expression of the enzyme spermine oxidase. Importantly, a reduction in spermine oxidase was sufficient to induce muscle fiber atrophy. Conversely, forced expression of spermine oxidase increased muscle fiber size in multiple models of muscle atrophy (immobilization, fasting, and denervation). Interestingly, the reduction of spermine oxidase during muscle atrophy was mediated by p21, a protein that is highly induced during muscle atrophy and actively promotes muscle atrophy. In addition, we found that spermine oxidase decreased skeletal muscle mRNAs that promote muscle atrophy (e.g., myogenin) and increased mRNAs that help to maintain muscle mass (e.g., mitofusin-2). Thus, in healthy skeletal muscle, a relatively low level of p21 permits expression of spermine oxidase, which helps to maintain basal muscle gene expression and fiber size; conversely, during conditions that cause muscle atrophy, p21 expression rises, leading to reduced spermine oxidase expression, disruption of basal muscle gene expression, and muscle fiber atrophy. Collectively, these results identify spermine oxidase as an important positive regulator of muscle gene expression and fiber size, and elucidate p21-mediated repression of spermine oxidase as a key step in the pathogenesis of skeletal muscle atrophy. PMID:25406264
Wu, Yuan; Wang, Yun; Mi, Xue-Fei; Shan, Jun-Xiang; Li, Xin-Min; Xu, Jian-Long; Lin, Hong-Xuan
2016-10-01
Cytokinins and gibberellins (GAs) play antagonistic roles in regulating reproductive meristem activity. Cytokinins have positive effects on meristem activity and maintenance. During inflorescence meristem development, cytokinin biosynthesis is activated via a KNOX-mediated pathway. Increased cytokinin activity leads to higher grain number, whereas GAs negatively affect meristem activity. The GA biosynthesis genes GA20oxs are negatively regulated by KNOX proteins. KNOX proteins function as modulators, balancing cytokinin and GA activity in the meristem. However, little is known about the crosstalk among cytokinin and GA regulators together with KNOX proteins and how KNOX-mediated dynamic balancing of hormonal activity functions. Through map-based cloning of QTLs, we cloned a GA biosynthesis gene, Grain Number per Panicle1 (GNP1), which encodes rice GA20ox1. The grain number and yield of NIL-GNP1TQ were significantly higher than those of isogenic control (Lemont). Sequence variations in its promoter region increased the levels of GNP1 transcripts, which were enriched in the apical regions of inflorescence meristems in NIL-GNP1TQ. We propose that cytokinin activity increased due to a KNOX-mediated transcriptional feedback loop resulting from the higher GNP1 transcript levels, in turn leading to increased expression of the GA catabolism genes GA2oxs and reduced GA1 and GA3 accumulation. This rebalancing process increased cytokinin activity, thereby increasing grain number and grain yield in rice. These findings uncover important, novel roles of GAs in rice florescence meristem development and provide new insights into the crosstalk between cytokinin and GA underlying development process.
Gibberellin Regulation of Fruit Set and Growth in Tomato1[W
Serrani, Juan Carlos; Sanjuán, Rafael; Ruiz-Rivero, Omar; Fos, Mariano; García-Martínez, José Luis
2007-01-01
The role of gibberellins (GAs) in tomato (Solanum lycopersicum) fruit development was investigated. Two different inhibitors of GA biosynthesis (LAB 198999 and paclobutrazol) decreased fruit growth and fruit set, an effect reversed by GA3 application. LAB 198999 reduced GA1 and GA8 content, but increased that of their precursors GA53, GA44, GA19, and GA20 in pollinated fruits. This supports the hypothesis that GA1 is the active GA for tomato fruit growth. Unpollinated ovaries developed parthenocarpically in response to GA3 > GA1 = GA4 > GA20, but not to GA19, suggesting that GA 20-oxidase activity was limiting in unpollinated ovaries. This was confirmed by analyzing the effect of pollination on transcript levels of SlCPS, SlGA20ox1, -2, and -3, and SlGA3ox1 and -2, encoding enzymes of GA biosynthesis. Pollination increased transcript content of SlGA20ox1, -2, and -3, and SlCPS, but not of SlGA3ox1 and -2. To investigate whether pollination also altered GA inactivation, full-length cDNA clones of genes encoding enzymes catalyzing GA 2-oxidases (SlGA2ox1, -2, -3, -4, and -5) were isolated and characterized. Transcript levels of these genes did not decrease early after pollination (5-d-old fruits), but transcript content reduction of all of them, mainly of SlGA2ox2, was found later (from 10 d after anthesis). We conclude that pollination mediates fruit set by activating GA biosynthesis mainly through up-regulation of GA20ox. Finally, the phylogenetic reconstruction of the GA2ox family clearly showed the existence of three gene subfamilies, and the phylogenetic position of SlGA2ox1, -2, -3, -4, and -5 was established. PMID:17660355
Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum
Xin, Shan; Tao, Chengcheng; Li, Hongbin
2016-01-01
Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5’-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5’-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5’ truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence
Xin, Shan; Tao, Chengcheng; Li, Hongbin
2016-01-01
Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a
USDA-ARS?s Scientific Manuscript database
Polyphenol oxidase (PPO) enzymatic activity is a major cause in time-dependent discoloration in wheat dough products. The PPO-A1 and PPO-D1 genes have been shown to contribute to wheat kernel PPO activity. However it has been shown that wheat contains multiple PPO genes. Recently a novel PPO gene...
CYP714B1 and CYP714B2 encode gibberellin 13-oxidases that reduce gibberellin activity in rice.
Magome, Hiroshi; Nomura, Takahito; Hanada, Atsushi; Takeda-Kamiya, Noriko; Ohnishi, Toshiyuki; Shinma, Yuko; Katsumata, Takumi; Kawaide, Hiroshi; Kamiya, Yuji; Yamaguchi, Shinjiro
2013-01-29
Bioactive gibberellins (GAs) control many aspects of growth and development in plants. GA(1) has been the most frequently found bioactive GA in various tissues of flowering plants, but the enzymes responsible for GA(1) biosynthesis have not been fully elucidated due to the enzymes catalyzing the 13-hydroxylation step not being identified. Because of the lack of mutants defective in this enzyme, biological significance of GA 13-hydroxylation has been unknown. Here, we report that two cytochrome P450 genes, CYP714B1 and CYP714B2, encode GA 13-oxidase in rice. Transgenic Arabidopsis plants that overexpress CYP714B1 or CYP714B2 show semidwarfism. There was a trend that the levels of 13-OH GAs including GA(1) were increased in these transgenic plants. Functional analysis using yeast or insect cells shows that recombinant CYP714B1 and CYP714B2 proteins can convert GA(12) into GA(53) (13-OH GA(12)) in vitro. Moreover, the levels of 13-OH GAs including GA(1) were decreased, whereas those of 13-H GAs including GA(4) (which is more active than GA(1)) were increased, in the rice cyp714b1 cyp714b2 double mutant. These results indicate that CYP714B1 and CYP714B2 play a predominant role in GA 13-hydroxylation in rice. The double mutant plants appear phenotypically normal until heading, but show elongated uppermost internode at the heading stage. Moreover, CYP714B1 and CYP714B2 expression was up-regulated by exogenous application of bioactive GAs. Our results suggest that GA 13-oxidases play a role in fine-tuning plant growth by decreasing GA bioactivity in rice and that they also participate in GA homeostasis.
Kalaev, V N; Nechaeva, M S; Korneeva, O S; Cherenkov, D A
2015-11-01
The influence of polymorphism of the serotonin transporter and monoamine oxidase A genes, associated with man's aggressiveness on the psycho-emotional state and karyological status of single combat athletes. It was revealed that the carriers of less active ("short"), monoamine oxidase A gene variant have a high motivation to succeed and less rigidity and frustrated, compared to the carriers of more active ("long") version of the gene. Heterozygote carriers of less active ("short") variant of the serotonin transporter gene 5-HTTL had more physical aggression, guilt and were less frustrated compared with carriers of two long alleles. It has been revealed the association of studied genes with the karyological status of athletes. So fighters who are carriers of the short and long alleles of the serotonin transporter gene had more cells with nuclear abnormalities in the buccal epithelium than single combat athletes which both alleles were long.
Systemic Manifestations in Pyridox(am)ine 5'-Phosphate Oxidase Deficiency.
Guerriero, Réjean M; Patel, Archana A; Walsh, Brian; Baumer, Fiona M; Shah, Ankoor S; Peters, Jurriaan M; Rodan, Lance H; Agrawal, Pankaj B; Pearl, Phillip L; Takeoka, Masanori
2017-11-01
Pyridoxine is converted to its biologically active form pyridoxal-5-phosphate (P5P) by the enzyme pyridox(am)ine 5'-phosphate oxidase and serves as a cofactor in nearly 200 reactions in the central nervous system. Pyridox(am)ine 5'-phosphate oxidase deficiency leads to P5P dependent epilepsy, typically a neonatal- or infantile-onset epileptic encephalopathy treatable with P5P or in some cases, pyridoxine. Following identification of retinopathy in a patient with pyridox(am)ine 5'-phosphate oxidase deficiency that was reversible with P5P therapy, we describe the systemic manifestations of pyridox(am)ine 5'-phosphate oxidase deficiency. A series of six patients with homozygous mutations of PNPO, the gene coding pyridox(am)ine 5'-phosphate oxidase, were evaluated in our center over the course of two years for phenotyping of neurological and systemic manifestations. Five of six were born prematurely, three had anemia and failure to thrive, and two had elevated alkaline phosphatase. A movement disorder was observed in two children, and a reversible retinopathy was observed in the most severely affected infant. All patients had neonatal-onset epilepsy and were on a continuum of developmental delay to profound encephalopathy. Electroencephalographic features included background slowing and disorganization, absent sleep features, and multifocal and generalized epileptiform discharges. All the affected probands carried a homozygous PNPO mutation (c.674 G>T, c.686 G>A and c.352G>A). In addition to the well-described epileptic encephalopathy, pyridox(am)ine 5'-phosphate oxidase deficiency causes a range of neurological and systemic manifestations. A movement disorder, developmental delay, and encephalopathy, as well as retinopathy, anemia, and failure to thrive add to the broadening clinical spectrum of P5P dependent epilepsy. Copyright © 2017 Elsevier Inc. All rights reserved.
Choi, K W; Han, O; Lee, H J; Yun, Y C; Moon, Y H; Kim, M; Kuk, Y I; Han, S U; Guh, J O
1998-01-01
In an effort to develop transgenic plants resistant to diphenyl ether herbicides, we introduced the protoporphyrinogen oxidase (EC 1.3.3.4) gene of Bacillus subtilis into tobacco plants. The results from a Northern analysis and leaf disc assay indicate that the expression of the B. subtilis protoporphyrinogen oxidase gene under the cauliflower mosaic virus 35S promoter generated resistance to the diphenyl ether herbicide, oxyfluorfen, in transgenic tobacco plants.
Association between a promoter variant in the monoamine oxidase A gene and schizophrenia.
Jönsson, Erik G; Norton, Nadine; Forslund, Kaj; Mattila-Evenden, Marja; Rylander, Gunnar; Asberg, Marie; Owen, Michael J; Sedvall, Göran C
2003-05-01
Monoaminergic transmission has been implicated in the pathophysiology of schizophrenia. We investigated a putative functional promoter polymorphism in the monoamine oxidase A (MAOA) gene in schizophrenic patients (n=133) and control subjects (n=377). In men, there was an association between the less efficiently transcribed alleles and schizophrenia (chi(2)=4.01, df=1, p<0.05). In women, no significant differences were found. The present results support the involvement of the MAOA gene in men with schizophrenia in the investigated Swedish population but should be interpreted with caution until replicated.
Phytochrome Regulates Gibberellin Biosynthesis during Germination of Photoblastic Lettuce Seeds1
Toyomasu, Tomonobu; Kawaide, Hiroshi; Mitsuhashi, Wataru; Inoue, Yasunori; Kamiya, Yuji
1998-01-01
Germination of lettuce (Lactuca sativa L.) seed is regulated by phytochrome. The requirement for red light is circumvented by the application of gibberellin (GA). We have previously shown that the endogenous content of GA1, the main bioactive GA in lettuce seeds, increases after red-light treatment. To clarify which step of GA1 synthesis is regulated by phytochrome, cDNAs encoding GA 20-oxidases (Ls20ox1 and Ls20ox2, for L. sativa GA 20-oxidase) and 3β-hydroxylases (Ls3h1 and Ls3h2 for L. sativa GA 3β-hydroxylase) were isolated from lettuce seeds by reverse-transcription polymerase chain reaction. Functional analysis of recombinant proteins expressed in Escherichia coli confirmed that the Ls20ox and Ls3h encode GA 20-oxidases and 3β-hydroxylases, respectively. Northern-blot analysis showed that Ls3h1 expression was dramatically induced by red-light treatment within 2 h, and that this effect was canceled by a subsequent far-red-light treatment. Ls3h2 mRNA was not detected in seeds that had been allowed to imbibe under any light conditions. Expression of the two Ls20ox genes was induced by initial imbibition alone in the dark. The level of Ls20ox2 mRNA decreased after the red-light treatment, whereas that of Ls20ox1 was unaffected by light. These results suggest that red light promotes GA1 synthesis in lettuce seeds by inducing Ls3h1 expression via phytochrome action. PMID:9847128
Genetic mapping of new seed-expressed polyphenol oxidase genes in wheat (Triticum aestivum L.).
Beecher, Brian S; Carter, Arron H; See, Deven R
2012-05-01
Polyphenol oxidase (PPO) enzymatic activity is a major cause in time-dependent discoloration in wheat dough products. The PPO-A1 and PPO-D1 genes have been shown to contribute to wheat kernel PPO activity. Recently a novel PPO gene family consisting of the PPO-A2, PPO-B2, and PPO-D2 genes has been identified and shown to be expressed in wheat kernels. In this study, the sequences of these five kernel PPO genes were determined for the spring wheat cultivars Louise and Penawawa. The two cultivars were found to be polymorphic at each of the PPO loci. Three novel alleles were isolated from Louise. The Louise X Penawawa mapping population was used to genetically map all five PPO genes. All map to the long arm of homeologous group 2 chromosomes. PPO-A2 was found to be located 8.9 cM proximal to PPO-A1 on the long arm of chromosome 2A. Similarly, PPO-D1 and PPO-D2 were separated by 10.7 cM on the long arm of chromosome 2D. PPO-B2 mapped to the long arm of chromosome 2B and was the site of a novel QTL for polyphenol oxidase activity. Five other PPO QTL were identified in this study. One QTL corresponds to the previously described PPO-D1 locus, one QTL corresponds to the PPO-D2 locus, whereas the remaining three are located on chromosome 2B.
Huang, ShuoHao; Yao, LiLi; Zhang, JianYun; Huang, LongQuan
2016-08-01
Vitamin B6 comprises six interconvertible pyridine compounds (vitamers), among which pyridoxal 5'-phosphate is a coenzyme involved in a high diversity of biochemical reactions. Humans and animals obtain B6 vitamers from diet, and synthesize pyridoxal 5'-phosphate by pyridoxal kinase and pyridoxine 5'-phosphate oxidase. Currently, little is known on how pyridoxal 5'-phosphate biosynthesis is regulated, and pyridoxal 5'-phosphate is supplied to meet their requirement in terms of cofactor. Bombyx mori is a large silk-secreting insect, in which protein metabolism is most active, and the vitamin B6 demand is high. In this study, we successfully down-regulated the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase by body cavity injection of synthesized double-stranded small interfering RNA to 5th instar larvae of Bombyx mori, and analyzed the gene transcription levels of pyridoxal 5'-phosphate dependent enzymes, phosphoserine aminotransferase and glutamic-oxaloacetic transaminase. Results show that the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase has a greater impact on the gene transcription of enzymes using pyridoxal 5'-phosphate as a cofactor in Bombyx mori. Our study suggests that pyridoxal 5'-phosphate biosynthesis and dynamic balance may be regulated by genetic networks. Copyright © 2016 Elsevier B.V. All rights reserved.
Ono, Sayaka; Morimoto, Norihito; Korenaga, Masataka; Kumazawa, Hideo; Komatsu, Yutaka; Kuge, Itsu; Higashidani, Yoshihumi; Ogura, Katsumi; Sugiura, Tetsuro
2010-11-01
Identification of Diphyllobothrium species has been carried out based on their morphology, especially sexual organs. In addition to these criteria, PCR-based identification methods have been developed recently. A 20 year-old Japanese living in Kochi Prefecture passed tapeworm. He was successfully treated with single dose of gastrografin. We examined the morphologic features of the proglottids and eggs using histology and scanning electron microscope. We also analyzed mitochondrial cytochrome c oxidase subunit 1 (cox1) gene of the proglottids. The causative tapeworm species was identified as D. nihonkaiense based on the results of morphologic features and genetic analysis. We discussed the advantage of PCR-based identification methods of Diphyllobothrium species using cox1 sequence in the clinical laboratory.
USDA-ARS?s Scientific Manuscript database
The enzymatic and biochemical properties of the proteins encoded by five potato cytokinin oxidase/dehydrogenase (CKX)-like genes functionally expressed in yeast and the effects of tuber dormancy progression on StCKX expression and cytokinin metabolism were examined in meristems isolated from field-g...
Schnabel, Guido; Dait, Qun; Paradkar, Manjiri R
2003-10-01
Brown rot, caused by Moniliniafructicola (G Wint) Honey, is a serious disease of peach in all commercial peach production areas in the USA, including South Carolina where it has been primarily controlled by pre-harvest application of 14-alpha demethylation (DMI) fungicides for more than 15 years. Recently, the Qo fungicide azoxystrobin was registered for brown rot control and is currently being investigated for its potential as a DMI fungicide rotation partner because of its different mode of action. In an effort to investigate molecular mechanisms of DMI and Qo fungicide resistance in M fructicola, the ABC transporter gene MfABC1 and the alternative oxidase gene MfAOX1 were cloned to study their potential role in conferring fungicide resistance. The MfABC1 gene was 4380 bp in length and contained one intron of 71 bp. The gene revealed high amino acid homologies with atrB from Aspergillus nidulans (Eidam) Winter, an ABC transporter conferring resistance to many fungicides, including DMI fungicides. MfABC1 gene expression was induced after myclobutanil and propiconazole treatment in isolates with low sensitivity to the same fungicides, and in an isolate with high sensitivity to propiconazole. The results suggest that the MfABC1 gene may be a DMI fungicide resistance determinant in M fructicola. The alternative oxidase gene MfAOX1 from M fructicola was cloned and gene expression was analyzed. The MfAOX1 gene was 1077 bp in length and contained two introns of 54 and 67 bp. The amino acid sequence was 63.8, 63.8 and 57.7% identical to alternative oxidases from Venturia inaequalis (Cooke) Winter, Aspergillus niger van Teighem and A nidulans, respectively. MfAOX1 expression in some but not all M fructicola isolates was induced in mycelia treated with azoxystrobin. Azoxystrobin at 2 microg ml(-1) significantly induced MfAOX1 expression in isolates with low MfAOX1 constitutive expression levels.
Shi, Deng-Ke; Zhu, Jing; Sun, Ze-Hua; Zhang, Guang; Liu, Rui; Zhang, Tian-Jun; Wang, Sheng-Li; Ren, Ang; Zhao, Ming-Wen
2017-10-01
The alternative oxidase (AOX), which forms a branch of the mitochondrial respiratory electron transport pathway, functions to sustain electron flux and alleviate reactive oxygen species (ROS) production. In this article, a homologous AOX gene was identified in Ganoderma lucidum. The coding sequence of the AOX gene in G. lucidum contains 1038 nucleotides and encodes a protein of 39.48 kDa. RNA interference (RNAi) was used to study the function of AOX in G. lucidum, and two silenced strains (AOXi6 and AOXi21) were obtained, showing significant decreases of approximately 60 and 50 %, respectively, in alternative pathway respiratory efficiency compared to WT. The content of ganoderic acid (GA) in the mutant strains AOXi6 and AOXi21 showed significant increases of approximately 42 and 44 %, respectively, compared to WT. Elevated contents of intermediate metabolites in GA biosynthesis and elevated transcription levels of corresponding genes were also observed in the mutant strains AOXi6 and AOXi21. In addition, the intracellular ROS content in strains AOXi6 and AOXi21 was significantly increased, by approximately 1.75- and 1.93-fold, respectively, compared with WT. Furthermore, adding N-acetyl-l-cysteine (NAC), a ROS scavenger, significantly depressed the intracellular ROS content and GA accumulation in AOX-silenced strains. These results indicate that AOX affects GA biosynthesis by regulating intracellular ROS levels. Our research revealed the important role of AOX in the secondary metabolism of G. lucidum.
Yamamura, Yoshimi; Taguchi, Yukari; Ichitani, Kei; Umebara, Io; Ohshita, Ayako; Kurosaki, Fumiya; Lee, Jung-Bum
2018-03-01
Gibberellins (GAs) are ubiquitous diterpenoids in higher plants, whereas some higher plants produce unique species-specific diterpenoids. In GA biosynthesis, ent-kaurene synthase (KS) and ent-kaurene oxidase (KO) are key players which catalyze early step(s) of the cyclization and oxidation reactions. We have studied the functional characterization of gene products of a KS (SdKS) and two KOs (SdKO1 and SdKO2) involved in GA biosynthesis in Scoparia dulcis. Using an in vivo heterologous expression system of Escherichia coli, we found that SdKS catalyzed a cyclization reaction from ent-CPP to ent-kaurene and that the SdKOs oxidized ent-kaurene to ent-kaurenoic acid after modification of the N-terminal region for adaptation to the E. coli expression system. The real-time PCR results showed that the SdKS, SdKO1 and SdKO2 genes were mainly expressed in the root and lateral root systems, which are elongating tissues. Based on these results, we suggest that these three genes may be responsible for the metabolism of GAs in S. dulcis.
Cytokinin oxidase/dehydrogenase genes in barley and wheat: cloning and heterologous expression.
Galuszka, Petr; Frébortová, Jitka; Werner, Tomás; Yamada, Mamoru; Strnad, Miroslav; Schmülling, Thomas; Frébort, Ivo
2004-10-01
The cloning of two novel genes that encode cytokinin oxidase/dehydrogenase (CKX) in barley is described in this work. Transformation of both genes into Arabidopsis and tobacco showed that at least one of the genes codes for a functional enzyme, as its expression caused a cytokinin-deficient phenotype in the heterologous host plants. Additional cloning of two gene fragments, and an in silico search in the public expressed sequence tag clone databases, revealed the presence of at least 13 more members of the CKX gene family in barley and wheat. The expression of three selected barley genes was analyzed by RT-PCR and found to be organ-specific with peak expression in mature kernels. One barley CKX (HvCKX2) was characterized in detail after heterologous expression in tobacco. Interestingly, this enzyme shows a pH optimum at 4.5 and a preference for cytokinin ribosides as substrates, which may indicate its vacuolar targeting. Different substrate specificities, and the pH profiles of cytokinin-degrading enzymes extracted from different barley tissues, are also presented.
Kozubal, M A; Dlakic, M; Macur, R E; Inskeep, W P
2011-03-01
"Metallosphaera yellowstonensis" is a thermoacidophilic archaeon isolated from Yellowstone National Park that is capable of autotrophic growth using Fe(II), elemental S, or pyrite as electron donors. Analysis of the draft genome sequence from M. yellowstonensis strain MK1 revealed seven different copies of heme copper oxidases (subunit I) in a total of five different terminal oxidase complexes, including doxBCEF, foxABCDEFGHIJ, soxABC, and the soxM supercomplex, as well as a novel hypothetical two-protein doxB-like polyferredoxin complex. Other genes found in M. yellowstonensis with possible roles in S and or Fe cycling include a thiosulfate oxidase (tqoAB), a sulfite oxidase (som), a cbsA cytochrome b(558/566), several small blue copper proteins, and a novel gene sequence coding for a putative multicopper oxidase (Mco). Results from gene expression studies, including reverse transcriptase (RT) quantitative PCR (qPCR) of cultures grown autotrophically on either Fe(II), pyrite, or elemental S showed that the fox gene cluster and mco are highly expressed under conditions where Fe(II) is an electron donor. Metagenome sequence and gene expression studies of Fe-oxide mats confirmed the importance of fox genes (e.g., foxA and foxC) and mco under Fe(II)-oxidizing conditions. Protein modeling of FoxC suggests a novel lysine-lysine or lysine-arginine heme B binding domain, indicating that it is likely the cytochrome component of a heterodimer complex with foxG as a ferredoxin subunit. Analysis of mco shows that it encodes a novel multicopper blue protein with two plastocyanin type I copper domains that may play a role in the transfer of electrons within the Fox protein complex. An understanding of metabolic pathways involved in aerobic iron and sulfur oxidation in Sulfolobales has broad implications for understanding the evolution and niche diversification of these thermophiles as well as practical applications in fields such as bioleaching of trace metals from pyritic ores.
ERIC Educational Resources Information Center
May, Michael E.; Srour, Ali; Hedges, Lora K.; Lightfoot, David A.; Phillips, John A., III; Blakely, Randy D.; Kennedy, Craig H.
2009-01-01
A functional polymorphism in the promoter of the gene encoding monoamine oxidase A has been associated with problem behavior in various populations. We examined the association of MAOA alleles in adult males with intellectual/developmental disabilities with and without established histories of problem behavior. These data were compared with a…
Lu, Haiwei; Viswanath, Venkatesh; Ma, Cathleen; ...
2015-11-13
Overexpression of genes that modify gibberellin (GA) metabolism and signaling have been previously shown to produce trees with improved biomass production but highly disturbed development. In order to examine if more subtle types of genetic modification of GA could improve growth rate and modify tree architecture, we transformed a model poplar genotype (Populus tremula × P. alba) with eight genes, including two cisgenes (intact copies of native genes), four intragenes (modified copies of native genes), and two transgenes (from sexually incompatible species), and studied their effects under greenhouse and field conditions. In the greenhouse, four out of the eight testedmore » genes produced a significant and often striking improvement of stem volume, and two constructs significantly modified the proportion of root or shoot biomass. Characterization of GA concentrations in the cisgenic population that had an additional copy of a poplar GA20-oxidase gene showed elevated concentrations of 13-hydroxylated GAs compared to wild-type poplars. In the field, we observed growth improvement for three of the six tested constructs, but it was significantly greater for only one of the constructs, a pRGL:GA20-oxidase intragene. The greenhouse and field responses were highly variable, possibly to due to cross-talk among the GA pathway and other stress response pathways, or due to interactions between the cisgenes and intragenes with highly similar endogenes. Our results indicate that extensive field trials, similar to those required for conventional breeding, will be critical to evaluating the value and pleiotropic effects of GA-modifying genes.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lu, Haiwei; Viswanath, Venkatesh; Ma, Cathleen
Overexpression of genes that modify gibberellin (GA) metabolism and signaling have been previously shown to produce trees with improved biomass production but highly disturbed development. In order to examine if more subtle types of genetic modification of GA could improve growth rate and modify tree architecture, we transformed a model poplar genotype (Populus tremula × P. alba) with eight genes, including two cisgenes (intact copies of native genes), four intragenes (modified copies of native genes), and two transgenes (from sexually incompatible species), and studied their effects under greenhouse and field conditions. In the greenhouse, four out of the eight testedmore » genes produced a significant and often striking improvement of stem volume, and two constructs significantly modified the proportion of root or shoot biomass. Characterization of GA concentrations in the cisgenic population that had an additional copy of a poplar GA20-oxidase gene showed elevated concentrations of 13-hydroxylated GAs compared to wild-type poplars. In the field, we observed growth improvement for three of the six tested constructs, but it was significantly greater for only one of the constructs, a pRGL:GA20-oxidase intragene. The greenhouse and field responses were highly variable, possibly to due to cross-talk among the GA pathway and other stress response pathways, or due to interactions between the cisgenes and intragenes with highly similar endogenes. Our results indicate that extensive field trials, similar to those required for conventional breeding, will be critical to evaluating the value and pleiotropic effects of GA-modifying genes.« less
Cantoro, Renata; Crocco, Carlos Daniel; Benech-Arnold, Roberto Luis; Rodríguez, María Verónica
2013-12-01
The precise adjustment of the timing of dormancy release according to final grain usage is still a challenge for many cereal crops. Grain sorghum [Sorghum bicolor (L.) Moench] shows wide intraspecific variability in dormancy level and susceptibility to pre-harvest sprouting (PHS). Both embryo sensitivity to abscisic acid (ABA) and gibberellin (GA) metabolism play an important role in the expression of dormancy of the developing sorghum grain. In previous works, it was shown that, simultaneously with a greater embryo sensitivity to ABA and higher expression of SbABA-INSENSITIVE 4 (SbABI4) and SbABA-INSENSITIVE 5 (SbABI5), dormant grains accumulate less active GA4 due to a more active GA catabolism. In this work, it is demonstrated that the ABA signalling components SbABI4 and SbABI5 interact in vitro with a fragment of the SbGA 2-OXIDASE 3 (SbGA2ox3) promoter containing an ABA-responsive complex (ABRC). Both transcription factors were able to bind the promoter, although not simultaneously, suggesting that they might compete for the same cis-acting regulatory sequences. A biological role for these interactions in the expression of dormancy of sorghum grains is proposed: either SbABI4 and/or SbABI5 activate transcription of the SbGA2ox3 gene in vivo and promote SbGA2ox3 protein accumulation; this would result in active degradation of GA4, thus preventing germination of dormant grains. A comparative analysis of the 5'-regulatory region of GA2oxs from both monocots and dicots is also presented; conservation of the ABRC in closely related GA2oxs from Brachypodium distachyon and rice suggest that these species might share the same regulatory mechanism as proposed for grain sorghum.
Lu, Lunhui; Zhang, Jiachao; Chen, Anwei; Chen, Ming; Jiang, Min; Yuan, Yujie; Wu, Haipeng; Lai, Mingyong; He, Yibin
2014-01-01
Traditional three-domain fungal and bacterial laccases have been extensively studied for their significance in various biotechnological applications. Growing molecular evidence points to a wide occurrence of more recently recognized two-domain laccase-like multicopper oxidase (LMCO) genes in Streptomyces spp. However, the current knowledge about their ecological role and distribution in natural or artificial ecosystems is insufficient. The aim of this study was to investigate the diversity and composition of Streptomyces two-domain LMCO genes in agricultural waste composting, which will contribute to the understanding of the ecological function of Streptomyces two-domain LMCOs with potential extracellular activity and ligninolytic capacity. A new specific PCR primer pair was designed to target the two conserved copper binding regions of Streptomyces two-domain LMCO genes. The obtained sequences mainly clustered with Streptomyces coelicolor, Streptomyces violaceusniger, and Streptomyces griseus. Gene libraries retrieved from six composting samples revealed high diversity and a rapid succession of Streptomyces two-domain LMCO genes during composting. The obtained sequence types cluster in 8 distinct clades, most of which are homologous with Streptomyces two-domain LMCO genes, but the sequences of clades III and VIII do not match with any reference sequence of known streptomycetes. Both lignocellulose degradation rates and phenol oxidase activity at pH 8.0 in the composting process were found to be positively associated with the abundance of Streptomyces two-domain LMCO genes. These observations provide important clues that Streptomyces two-domain LMCOs are potentially involved in bacterial extracellular phenol oxidase activities and lignocellulose breakdown during agricultural waste composting. PMID:24657870
Edgnülü, Tuba G; Özge, Aynur; Erdal, Nurten; Kuru, Oktay; Erdal, Mehmet E
2014-01-01
Monoamine oxidase (MAO) enzymes play an important role in the etiology of many neurological diseases. Tension type headache (TTH) treatments contain inhibitors for selective re-uptake of serotonin and monoamine oxidase inhibitors. MAO (EC 1.4.3.4) has two isoenzymes known as MAOA and MAOB. A promoter polymorphism of a variable number of tandem repeats (VNTR) in the MAOA gene seems to affect MAOA transcriptional activity in vitro. Also, G/A polymorphism in intron 13 (rs1799836) of the MAOB gene have been previously found to be associated with the variability of MAOB enzyme activity. The aim of our study was to investigate a possible association of monoamine oxidase (MAOA and MAOB) gene polymorphisms in tension type headache. MAO gene polymorphisms were examined in a group of 120 TTH patients and in another 168 unrelated healthy volunteers (control group). MAOA promoter and MAOB intron 13 polymorphisms were genotyped using PCR-based methods. An overall comparison between the genotype of MAOA and MAOB genes and allele frequencies of the patients and the control group did not reveal any statistically significant difference between the patients and the control group (p=0.162). Factors like estrogen dosage, the limited number of male patients and other genes' neurotransmitters involved in the etiology of TTH could be responsible for our non-significant results.
High brightness nonpolar a-plane (11-20) GaN light-emitting diodes
NASA Astrophysics Data System (ADS)
Jung, Sukkoo; Chang, Younghak; Bang, Kyu-Hyun; Kim, Hyung-Gu; Choi, Yoon-Ho; Hwang, Sung-Min; Baik, Kwang Hyeon
2012-02-01
We report on high brightness nonpolar a-plane InGaN/GaN LEDs using patterned lateral overgrowth (PLOG) epitaxy. High crystal-quality and smooth surfaces for a-plane GaN (a-GaN) films were achieved using PLOG with an array of hexagonal SiO2 patterns. The XRC FWHMs of as-grown PLOG a-GaN films were found to be 414 and 317 arcsec (450 and 455 arcsec for planar a-GaN films) along the c-axis and m-axis directions, respectively. Plan-view CL clearly reveals the periodic hexagonal patterns with higher band edge emission intensity, implying that the luminescence properties of a-GaN films lying above the SiO2 mask are improved. The light output powers of a-InGaN/GaN PLOG LEDs were measured to be 7.5 mW and 20 mW at drive currents of 20 mA and 100 mA, respectively. A negligible blue-shift was observed in the peak emission wavelength with increasing drive current up to 100 mA, indicating that there are no strong internal fields in nonpolar a-InGaN/GaN LEDs. We believe that nonpolar a-plane InGaN/GaN LEDs hold promise for efficient nitride emitters if the growth conditions are further optimized.
Nawathean, P; Maslov, D A
2000-08-01
By completing the sequencing of the maxicircle conserved region in the kinetoplast DNA of Phytomonas serpens, we showed that the genes for subunits I and II (COI and COII) of cytochrome c oxidase in this organism were missing. We had previously shown that the genes for cytochrome c oxidase subunit III and apocytochrome b were also missing. These deletions did not affect the structure or expression of the remaining genes. Partial editing of the mRNA for NADH dehydrogenase subunit 8, previously found in strain IG from insects, was complete in two other strains isolated from plants. The appearance of a novel maxicircle gene for MURF2 block I gRNA, which substitutes for the gene missing due to the COII gene deletion, may illustrate a general mechanism for the origin of gRNAs.
Sekeli, Rogayah; Abdullah, Janna Ong; Namasivayam, Parameswari; Muda, Pauziah; Abu Bakar, Umi Kalsom; Yeong, Wee Chien; Pillai, Vilasini
2014-06-19
The purpose of this study was to evaluate the effectiveness of using RNA interference in down regulating the expression of 1-aminocyclopropane-1-carboxylic acid oxidase gene in Eksotika papaya. One-month old embryogenic calli were separately transformed with Agrobacterium strain LBA 4404 harbouring the three different RNAi pOpOff2 constructs bearing the 1-aminocyclopropane-1-carboxylic acid oxidase gene. A total of 176 putative transformed lines were produced from 15,000 calli transformed, selected, then regenerated on medium supplemented with kanamycin. Integration and expression of the targeted gene in putatively transformed lines were verified by PCR and real-time RT-PCR. Confined field evaluation of a total of 31 putative transgenic lines planted showed a knockdown expression of the targeted ACO1 and ACO2 genes in 13 lines, which required more than 8 days to achieve the full yellow colour (Index 6). Fruits harvested from lines pRNAiACO2 L2-9 and pRNAiACO1 L2 exhibited about 20 and 14 days extended post-harvest shelf life to reach Index 6, respectively. The total soluble solids contents of the fruits ranged from 11 to 14° Brix, a range similar to fruits from non-transformed, wild type seed-derived plants.
A novel proteolytic processing of prolysyl oxidase
Atsawasuwan, Phimon; Mochida, Yoshiyuki; Katafuchi, Michitsuna; Tokutomi, Kentaro; Mocanu, Viorel; Parker, Carol E.; Yamauchi, Mitsuo
2012-01-01
Lysyl oxidase (LOX) is an amine oxidase that is critical for the stability of connective tissues. The secreted proLOX is enzymatically quiescent and is activated through proteolytic cleavage between residue Gly162 and Asp163 (residue numbers according to the mouse LOX) by bone morphogenetic protein (BMP)-1 gene products. Here we report a novel processing of proLOX identified in vitro and in vivo. Two forms of mature LOX were identified and characterized by their immunoreactivity to specific antibodies, amine oxidase activity and mass spectrometry. One form was identified as a well characterized BMP-1 processed LOX protein. Another was found to be a truncated form of LOX (tLOX) resulting from the cleavage at the carboxy terminus of Arg192. The tLOX still appeared to retain amine oxidase activity. The results from the proLOX gene deletion and mutation experiments indicated that the processing occurs independent of the cleavage of proLOX by BMP-1 gene products and likely requires the presence of LOX propeptide. These results indicate that proLOX could be processed by two different mechanisms producing two forms of active LOX. PMID:21591931
A novel proteolytic processing of prolysyl oxidase.
Atsawasuwan, Phimon; Mochida, Yoshiyuki; Katafuchi, Michitsuna; Tokutomi, Kentaro; Mocanu, Viorel; Parker, Carol E; Yamauchi, Mitsuo
2011-01-01
Lysyl oxidase (LOX) is an amine oxidase that is critical for the stability of connective tissues. The secreted proLOX is enzymatically quiescent and is activated through proteolytic cleavage between residues Gly(162) and Asp(163) (residue numbers according to the mouse LOX) by bone morphogenetic protein (BMP)-1 gene products. Here we report a novel processing of proLOX identified in vitro and in vivo. Two forms of mature LOX were identified and characterized by their immunoreactivity to specific antibodies, amine oxidase activity, and mass spectrometry. One form was identified as a well-characterized BMP-1 processed LOX protein. Another was found to be a truncated form of LOX resulting from the cleavage at the carboxy terminus of Arg(192). The truncated form of LOX still appeared to retain amine oxidase activity. The results from the proLOX gene deletion and mutation experiments indicated that the processing occurs independent of the cleavage of proLOX by BMP-1 gene products and likely requires the presence of LOX propeptide. These results indicate that proLOX could be processed by two different mechanisms producing two forms of active LOX.
Fine structure of OXI1, the mitochondrial gene coding for subunit II of yeast cytochrome c oxidase.
Weiss-Brummer, B; Guba, R; Haid, A; Schweyen, R J
1979-12-01
Genetic and biochemical studies have been performed with 110 mutants which are defective in cytochrome a·a3 and map in the regions on mit DNA previously designated OXI1 and OXI2. With 88 mutations allocated to OXI1 fine structure mapping was achieved by the analysis of rho (-) deletions. The order of six groups of mutational sites (A 1, A2, B 1, B2, C 1, C2) thus determined was confirmed by oxi i x oxi j recombination analysis.Analysis of mitochondrially translated polypeptides of oxil mutants by SDS-polyacrylamide electrophoresis reveals three classes of mutant patterns: i) similar to wild-tpye (19 mutants); ii) lacking SU II of cytochrome c oxidase (53 mutants); iii) lacking this subunit and exhibiting a single new polypeptide of lower Mr (16 mutants). Mutations of each of these classes are scattered over the OXI1 region without any detectable clustering; this is consistent with the assumption that all oxil mutations studied are within the same gene.New polypeptides observed in oxil mutants of class iii) vary in Mr in the range from 10,500 to 33,000. Those of Mr 17,000 to 33,000 are shown to be antigenically related to subunit II of cytochrome c oxidase. Colinearity is established between the series of new polypeptides of Mr values increasing from 10,500 to 31,500 and the order of the respective mutational sites on the map, e.g. mutations mapping in A 1 generate the smallest and mutations mapping in C2 the largest mutant fragments.From these data we conclude that i) all mutations allocated to the OXI1 region are in the same gene; ii) this gene codes for subunit II of cytochrome c oxidase; iii) the direction of translation is from CAP to 0X12. Out of 19 mutants allocated to OXI2 three exhibit a new polypeptide; these and all the other oxi2 mutants lack subunit III of cytochrome oxidase. This result provides preliminary evidence that the OXI2 region harbours the structural gene for this subunit III.
Inada, Mari; Kihara, Keisuke; Kono, Tomoya; Sudhakaran, Raja; Mekata, Tohru; Sakai, Masahiro; Yoshida, Terutoyo; Itami, Toshiaki
2013-02-01
In many physiological processes, including the innate immune system, free radicals such as nitric oxide (NO) and reactive oxygen species (ROS) play significant roles. In humans, 2 homologs of Dual oxidases (Duox) generate hydrogen peroxide (H(2)O(2)), which is a type of ROS. Here, we report the identification and characterization of a Duox from kuruma shrimp, Marsupenaeus japonicus. The full-length cDNA sequence of the M. japonicus Dual oxidase (MjDuox) gene contains 4695 bp and was generated using reverse transcriptase-polymerase chain reaction (RT-PCR) and random amplification of cDNA ends (RACE). The open reading frame of MjDuox encodes a protein of 1498 amino acids with an estimated mass of 173 kDa. In a homology analysis using amino acid sequences, MjDuox exhibited 69.3% sequence homology with the Duox of the red flour beetle, Tribolium castaneum. A transcriptional analysis revealed that the MjDuox mRNA is highly expressed in the gills of healthy kuruma shrimp. In the gills, MjDuox expression reached its peak 60 h after injection with WSSV and decreased to its normal level at 72 h. In gene knockdown experiments of free radical-generating enzymes, the survival rates decreased during the early stages of a white spot syndrome virus (WSSV) infection following the knockdown of the NADPH oxidase (MjNox) or MjDuox genes. In the present study, the identification, cloning and gene knockdown of the kuruma shrimp MjDuox are reported. Duoxes have been identified in vertebrates and some insects; however, few reports have investigated Duoxes in crustaceans. This study is the first to identify and clone a Dual oxidase from a crustacean species. Copyright © 2012 Elsevier Ltd. All rights reserved.
Isolation and characterization of the pea cytochrome c oxidase Vb gene.
Kubo, Nakao; Arimura, Shin-Ichi; Tsutsumi, Nobuhiro; Kadowaki, Koh-Ichi; Hirai, Masashi
2006-11-01
Three copies of the gene that encodes cytochrome c oxidase subunit Vb were isolated from the pea (PscoxVb-1, PscoxVb-2, and PscoxVb-3). Northern Blot and reverse transcriptase-PCR analyses suggest that all 3 genes are transcribed in the pea. Each pea coxVb gene has an N-terminal extended sequence that can encode a mitochondrial targeting signal, called a presequence. The localization of green fluorescent proteins fused with the presequence strongly suggests the targeting of pea COXVb proteins to mitochondria. Each pea coxVb gene has 5 intron sites within the coding region. These are similar to Arabidopsis and rice, although the intron lengths vary greatly. A phylogenetic analysis of coxVb suggests the occurrence of gene duplication events during angiosperm evolution. In particular, 2 duplication events might have occurred in legumes, grasses, and Solanaceae. A comparison of amino acid sequences in COXVb or its counterpart shows the conservation of several amino acids within a zinc finger motif. Interestingly, a homology search analysis showed that bacterial protein COG4391 and a mitochondrial complex I 13 kDa subunit also have similar amino acid compositions around this motif. Such similarity might reflect evolutionary relationships among the 3 proteins.
Bour, Sandy; Daviaud, Danièle; Gres, Sandra; Lefort, Corinne; Prévot, Danielle; Zorzano, Antonio; Wabitsch, Martin; Saulnier-Blache, Jean-Sébastien; Valet, Philippe; Carpéné, Christian
2007-08-01
A strong induction of semicarbazide-sensitive amine oxidase (SSAO) has previously been reported during murine preadipocyte lineage differentiation but it remains unknown whether this emergence also occurs during adipogenesis in man. Our aim was to compare SSAO and monoamine oxidase (MAO) expression during in vitro differentiation of human preadipocytes and in adipose and stroma-vascular fractions of human fat depots. A human preadipocyte cell strain from a patient with Simpson-Golabi-Behmel syndrome was first used to follow amine oxidase expression during in vitro differentiation. Then, human preadipocytes isolated from subcutaneous adipose tissues were cultured under conditions promoting ex vivo adipose differentiation and tested for MAO and SSAO expression. Lastly, human adipose tissue was separated into mature adipocyte and stroma-vascular fractions for analyses of MAO and SSAO at mRNA, protein and activity levels. Both SSAO and MAO were increased from undifferentiated preadipocytes to lipid-laden cells in all the models: 3T3-F442A and 3T3-L1 murine lineages, human SGBS cell strain or human preadipocytes in primary culture. In human subcutaneous adipose tissue, the adipocyte-enriched fraction exhibited seven-fold higher amine oxidase activity and contained three- to seven-fold higher levels of mRNAs encoded by MAO-A, MAO-B, AOC3 and AOC2 genes than the stroma-vascular fraction. MAO-A and AOC3 genes accounted for the majority of their respective MAO and SSAO activities in human adipose tissue. Most of the SSAO and MAO found in adipose tissue originated from mature adipocytes. Although the mechanism and role of adipogenesis-related increase in amine oxidase expression remain to be established, the resulting elevated levels of amine oxidase activities found in human adipocytes may be of potential interest for therapeutic intervention in obesity.
New splicing-site mutations in the SURF1 gene in Leigh syndrome patients.
Pequignot, M O; Desguerre, I; Dey, R; Tartari, M; Zeviani, M; Agostino, A; Benelli, C; Fouque, F; Prip-Buus, C; Marchant, D; Abitbol, M; Marsac, C
2001-05-04
The gene SURF1 encodes a factor involved in the biogenesis of cytochrome c oxidase, the last complex in the respiratory chain. Mutations of the SURF1 gene result in Leigh syndrome and severe cytochrome c oxidase deficiency. Analysis of seven unrelated patients with cytochrome c oxidase deficiency and typical Leigh syndrome revealed different SURF1 mutations in four of them. Only these four cases had associated demyelinating neuropathy. Three mutations were novel splicing-site mutations that lead to the excision of exon 6. Two different novel heterozygous mutations were found at the same guanine residue at the donor splice site of intron 6; one was a deletion, whereas the other was a transition [588+1G>A]. The third novel splicing-site mutation was a homozygous [516-2_516-1delAG] in intron 5. One patient only had a homozygous polymorphism in the middle of the intron 8 [835+25C>T]. Western blot analysis showed that Surf1 protein was absent in all four patients harboring mutations. Our studies confirm that the SURF1 gene is an important nuclear gene involved in the cytochrome c oxidase deficiency. We also show that Surf1 protein is not implicated in the assembly of other respiratory chain complexes or the pyruvate dehydrogenase complex.
Uncovering DELLA-Independent Gibberellin Responses by Characterizing New Tomato procera Mutants
Livne, Sivan; Lor, Vai S.; Nir, Ido; Eliaz, Natanella; Aharoni, Asaph; Olszewski, Neil E.; Eshed, Yuval; Weiss, David
2015-01-01
Gibberellin (GA) regulates plant development primarily by triggering the degradation/deactivation of the DELLA proteins. However, it remains unclear whether all GA responses are regulated by DELLAs. Tomato (Solanum lycopersicum) has a single DELLA gene named PROCERA (PRO), and its recessive pro allele exhibits constitutive GA activity but retains responsiveness to external GA. In the loss-of-function mutant proΔGRAS, all examined GA developmental responses were considerably enhanced relative to pro and a defect in seed desiccation tolerance was uncovered. As pro, but not proΔGRAS, elongation was promoted by GA treatment, pro may retain residual DELLA activity. In agreement with homeostatic feedback regulation of the GA biosynthetic pathway, we found that GA20oxidase1 expression was suppressed in proΔGRAS and was not affected by exogenous GA3. In contrast, expression of GA2oxidase4 was not affected by the elevated GA signaling in proΔGRAS but was strongly induced by exogenous GA3. Since a similar response was found in Arabidopsis thaliana plants with impaired activity of all five DELLA genes, we suggest that homeostatic GA responses are regulated by both DELLA-dependent and -independent pathways. Transcriptome analysis of GA-treated proΔGRAS leaves suggests that 5% of all GA-regulated genes in tomato are DELLA independent. PMID:26036254
TNF-α -308G/A gene polymorphism in bullous pemphigoid and alopecia areata.
Moravvej, Hamideh; Tabatabaei-Panah, Pardis-Sadat; Ebrahimi, Elaheh; Esmaeili, Nafiseh; Ghaderian, Sayyed Mohammad Hossein; Ludwig, Ralf J; Akbarzadeh, Reza
2018-05-11
TNF-α -308G/A polymorphism has been investigated in few studies for an association with susceptibility to bullous pemphigoid (BP) and alopecia areata (AA). Yet, these findings had so far not been independently replicated, and no data on a possible association of TNFα -308G/A polymorphism with these diseases in Iranian population were available. In the present study, a possible effect of TNF-α -308G/A variation on susceptibility to BP or AA disease was evaluated. Genomic DNA was extracted from the blood of the patients with BP and AA as well as control subjects which genotyped for the TNF-α -308 G/A polymorphism. TNF-α gene expression levels were analyzed by real-time RT-PCR. No association was observed between the TNF-α -308 G/A variation and susceptibility to BP or AA diseases in our Iranian cohort. In contrast to AA patients, expression of TNF-α gene was significantly higher in BP patients compared to control group. TNF-α gene was found to be similarly expressed in mutant and wild-type genotypes. TNF-α -308G/A polymorphism is not associated with the risk to develop of BP and AA in our Iranian cohort. Furthermore, this polymorphism is not contributed to altering the levels of gene expression in both diseases.
Heterologous production and characterization of two glyoxal oxidases from Pycnoporus cinnabarinus
Marianne Daou; François Piumi; Daniel Cullen; Eric Record; Craig B. Faulds
2016-01-01
The genome of the white rot fungus Pycnoporus cinnabarinus includes a large number of genes encoding enzymes implicated in lignin degradation. Among these, three genes are predicted to encode glyoxal oxidase, an enzyme previously isolated from Phanerochaete chrysosporium. The glyoxal oxidase of P. chrysosporium...
The 20 GHz power GaAs FET development
NASA Technical Reports Server (NTRS)
Crandell, M.
1986-01-01
The development of power Field Effect Transistors (FET) operating in the 20 GHz frequency band is described. The major efforts include GaAs FET device development (both 1 W and 2 W devices), and the development of an amplifier module using these devices.
Sugie, Atsushi; Murai, Koji; Takumi, Shigeo
2007-06-01
Mitochondrial alternative oxidase (AOX) is the terminal oxidase responsible for cyanide-insensitive and salicylhydroxamic acid-sensitive respiration in plants. AOX is a key enzyme of the alternative respiration pathway. To study the effects of necrotic cell death on the mitochondrial function, production of reactive oxygen species (ROS), respiration capacities and accumulation patterns of mitochondria-targeted protein-encoding gene transcripts were compared between wild-type, lesion-mimic mutant and hybrid necrosis wheat plants. Around cells with the necrosis symptom, ROS accumulated abundantly in the intercellular spaces. The ratio of the alternative pathway to the cytochrome pathway was markedly enhanced in the necrotic leaves. Transcripts of a wheat AOX gene, Waox1a, were more abundant in a novel lesion-mimic mutant of common wheat than in the wild-type plants. An increased level of the Waox1a transcripts was also observed in hybrid plants containing Ne1 and Ne2 genes. These results indicated that an increase of the wheat AOX transcript level resulted in enhancement of respiration capacity of the alternative pathway in the necrotic cells.
Allam, Mai A; Saker, Mahmoud M
2017-01-01
The overall objective of this work is to optimize the transformation system for date palm as a first step toward production of date palm clones resistant to noxious pests. A construct harboring the cholesterol oxidase (ChoA) gene, which renders plant resistance against insect attack, is introduced into embryogenic date palm callus using the PDS-1000/He particle bombardment system. The process involves the establishment of embryogenic callus cultures as well as immature embryo-derived microcalli that are used as target tissues for shooting and optimization of transformation conditions. This chapter in addition explains molecular and histochemical assays conducted to confirm gene integration and expression.
Uršič, Katarina; Zupanc, Tomaž; Paska, Alja Videtič
2018-04-23
Suicide is a well-defined public health problem and is a complex phenomenon influenced by a number of different risk factors, including genetic ones. Numerous studies have examined serotonin system genes. Monoamine oxidase A (MAO-A) is an outer mitochondrial membrane enzyme which is involved in the metabolic pathway of serotonin degradation. Upstream variable number of tandem repeats (uVNTR) in the promoter region of MAOA gene affects the activity of transcription. In the present study we genotyped MAOA-uVNTR polymorphism in 266 suicide victims and 191 control subjects of Slovenian population, which ranks among the European and world populations with the highest suicide rate. Genotyping was performed with polymerase chain reaction and agarose gel electrophoresis. Using a separate statistical analysis for female and male subjects we determined the differences in genotype distributions of MAOA-uVNTR polymorphism between the studied groups. Statistical analysis showed a trend towards 3R allele and suicide, and associated 3R allele with non-violent suicide method on stratified data (20 suicide victims). This is the first study associating highly suicidal Slovenian population with MAOA-uVNTR polymorphism. Copyright © 2018 Elsevier B.V. All rights reserved.
El Sissy, Azza Hamdy; El Sissy, Maha H; Elmoamly, Shereef
2014-11-01
Factor V Leiden 1691G/A and prothrombin gene 20210G/A mutations are the most common genetic defects leading to thrombosis. This work aimed to study the FV Leiden and the prothrombin gene polymorphism in adult Egyptian patients with acute leukemia and their importance in thrombophilia screening. The study included 76 patients with acute leukemia and 100 healthy controls. Genotyping was done by real-time polymerase chain reaction technique. For factor V Leiden, the frequency of G/A mutation conferred more than 2.5-fold of increased risk of (OR 2.639 95 % CI 1.045-6.669). The frequency of factor V Leiden combined (G/A + A/A) genotypes conferred 2.83-fold of increased risk (OR 2.828, CI 1.13-7.075), The A allele conferred almost threefold increased risk (OR 2.824, 95 % CI 1.175-6.785). Despite higher frequency in patients compared to controls, there was no risk of association between prothrombin gene mutation and acute leukemia in adult Egyptians nor was there between combined genotypes of prothrombin gene mutation and factor V Leiden.
Kita, K; Konishi, K; Anraku, Y
1986-01-01
Two terminal oxidase complexes, cytochrome b-562-o complex and cytochrome b-558-d complex, are isolated in highly purified forms which show ubiquinol oxidase activities. From the result of steady-state kinetics of cytochromes in the membrane and E'm values of purified cytochromes, we propose a branched arrangement of the late exponential phase of aerobic growth, as shown in Fig. 10. Cytochrome b-556 is reduced by several dehydrogenases and the gene for this cytochrome (cybA) is located in the sdh gene cluster. Recently, we found another low-potential b-type cytochrome, cytochrome b-561 (Em' = 20 mV), which is also reduced by dehydrogenases. The position of this new cytochrome in the aerobic respiratory chain is under investigation. Two terminal oxidase complexes branch at the site of ubiquinone-8, and the Km value for oxygen of the purified cytochrome b-558-d complex is about 8-fold lower than that of the purified cytochrome b-562-o complex when ubiquinol-1 is used as substrate. This result is consistent with the idea that the cytochrome b-558-d complex is synthesized as an alternative oxidase for more efficient utilization of oxygen at low oxygen concentration. Thus, E. coli cells can maintain efficient oxidative energy conservation over a wide range of oxygen pressures by simply changing the contents of the two terminal oxidases, each of which functions as a coupling site.
Monoamine Oxidase A Gene (MAOA) Associated with Attitude Towards Longshot Risks
Zhong, Songfa; Israel, Salomon; Xue, Hong; Ebstein, Richard P.; Chew, Soo Hong
2009-01-01
Decision making often entails longshot risks involving a small chance of receiving a substantial outcome. People tend to be risk preferring (averse) when facing longshot risks involving significant gains (losses). This differentiation towards longshot risks underpins the markets for lottery as well as for insurance. Both lottery and insurance have emerged since ancient times and continue to play a useful role in the modern economy. In this study, we observe subjects' incentivized choices in a controlled laboratory setting, and investigate their association with a widely studied, promoter-region repeat functional polymorphism in monoamine oxidase A gene (MAOA). We find that subjects with the high activity (4-repeat) allele are characterized by a preference for the longshot lottery and also less insurance purchasing than subjects with the low activity (3-repeat) allele. This is the first result to link attitude towards longshot risks to a specific gene. It complements recent findings on the neurobiological basis of economic risk taking. PMID:20046877
Isolated sulfite oxidase deficiency.
Rupar, C A; Gillett, J; Gordon, B A; Ramsay, D A; Johnson, J L; Garrett, R M; Rajagopalan, K V; Jung, J H; Bacheyie, G S; Sellers, A R
1996-12-01
Isolated sulfite oxidase (SO) deficiency is an autosomal recessively inherited inborn error of sulfur metabolism. In this report of a ninth patient the clinical history, laboratory results, neuropathological findings and a mutation in the sulfite oxidase gene are described. The data from this patient and previously published patients with isolated sulfite oxidase deficiency and molybdenum cofactor deficiency are summarized to characterize this rare disorder. The patient presented neonatally with intractable seizures and did not progress developmentally beyond the neonatal stage. Dislocated lenses were apparent at 2 months. There was increased urine excretion of sulfite and S-sulfocysteine and a decreased concentration of plasma cystine. A lactic acidemia was present for 6 months. Liver sulfite oxidase activity was not detectable but xanthine dehydrogenase activity was normal. The boy died of respiratory failure at 32 months. Neuropathological findings of cortical necrosis and extensive cavitating leukoencephalopathy were reminiscent of those seen in severe perinatal asphyxia suggesting an etiology of energy deficiency. A point mutation that resulted in a truncated protein missing the molybdenum-binding site has been identified.
Zhang, Yun; Ming, Qing-sen; Yi, Jin-yao; Wang, Xiang; Chai, Qiao-lian; Yao, Shu-qiao
2017-01-01
Gene-environment interactions that moderate aggressive behavior have been identified independently in the serotonin transporter (5-HTT) gene and monoamine oxidase A gene (MAOA). The aim of the present study was to investigate epistasis interactions between MAOA-variable number tandem repeat (VNTR), 5-HTTlinked polymorphism (LPR) and child abuse and the effects of these on aggressive tendencies in a group of otherwise healthy adolescents. A group of 546 Chinese male adolescents completed the Child Trauma Questionnaire and Youth self-report of the Child Behavior Checklist. Buccal cells were collected for DNA analysis. The effects of childhood abuse, MAOA-VNTR, 5-HTTLPR genotypes and their interactive gene-gene-environmental effects on aggressive behavior were analyzed using a linear regression model. The effect of child maltreatment was significant, and a three-way interaction among MAOA-VNTR, 5-HTTLPR and sexual abuse (SA) relating to aggressive behaviors was identified. Chinese male adolescents with high expression of the MAOA-VNTR allele and 5-HTTLPR “SS” genotype exhibited the highest aggression tendencies with an increase in SA during childhood. The findings reported support aggression being a complex behavior involving the synergistic effects of gene-gene-environment interactions. PMID:28203149
Genetics Home Reference: cytochrome c oxidase deficiency
... are caused by mutations in genes found within nuclear DNA; however, in some rare instances, mutations in genes located within mtDNA cause this condition. The genes associated with cytochrome c oxidase deficiency are involved in energy production in mitochondria through a process called oxidative ...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kamli, Majid Rasool; Kim, Jihoe; Pokharel, Smritee
2014-08-08
Highlights: • AOX1 contributes to the formation of myotube. • Silencing of AOX1 reduces myotube formation. • AOX1 regulates MyoG gene expression. • AOX1 contributes to myogenesis via H{sub 2}O{sub 2}. - Abstract: Aldehyde oxidases (AOXs), which catalyze the hydroxylation of heterocycles and oxidation of a wide variety of aldehydic compounds, have been present throughout evolution from bacteria to humans. While humans have only a single functional aldehyde oxidase (AOX1) gene, rodents are endowed with four AOXs; AOX1 and three aldehyde oxidase homologs (AOH1, AOH2 and AOH3). In continuation of our previous study conducted to identify genes differentially expressed duringmore » myogenesis using a microarray approach, we investigated AOX1 with respect to its role in myogenesis to conceptualize how it is regulated in C2C12 cells. The results obtained were validated by silencing of the AOX1 gene. Analysis of their fusion index revealed that formation of myotubes showed a marked reduction of up to 40% in AOX1{sub kd} cells. Expression of myogenin (MYOG), one of the marker genes used to study myogenesis, was also found to be reduced in AOX1{sub kd} cells. AOX1 is an enzyme of pharmacological and toxicological importance that metabolizes numerous xenobiotics to their respective carboxylic acids. Hydrogen peroxide (H{sub 2}O{sub 2}) produced as a by-product in this reaction is considered to be involved as a part of the signaling mechanism during differentiation. An observed reduction in the level of H{sub 2}O{sub 2} among AOX1{sub kd} cells confirmed production of H{sub 2}O{sub 2} in the reaction catalyzed by AOX1. Taken together, these findings suggest that AOX1 acts as a contributor to the process of myogenesis by influencing the level of H{sub 2}O{sub 2}.« less
Identification in Marinomonas mediterranea of a novel quinoprotein with glycine oxidase activity.
Campillo-Brocal, Jonatan Cristian; Lucas-Elio, Patricia; Sanchez-Amat, Antonio
2013-08-01
A novel enzyme with lysine-epsilon oxidase activity was previously described in the marine bacterium Marinomonas mediterranea. This enzyme differs from other l-amino acid oxidases in not being a flavoprotein but containing a quinone cofactor. It is encoded by an operon with two genes lodA and lodB. The first one codes for the oxidase, while the second one encodes a protein required for the expression of the former. Genome sequencing of M. mediterranea has revealed that it contains two additional operons encoding proteins with sequence similarity to LodA. In this study, it is shown that the product of one of such genes, Marme_1655, encodes a protein with glycine oxidase activity. This activity shows important differences in terms of substrate range and sensitivity to inhibitors to other glycine oxidases previously described which are flavoproteins synthesized by Bacillus. The results presented in this study indicate that the products of the genes with different degrees of similarity to lodA detected in bacterial genomes could constitute a reservoir of different oxidases. © 2013 The Authors. Microbiology Open published by John Wiley & Sons Ltd.
Gibberellin Biosynthesis in Developing Pumpkin Seedlings12
Lange, Theo; Kappler, Jeannette; Fischer, Andreas; Frisse, Andrea; Padeffke, Tania; Schmidtke, Sabine; Lange, Maria João Pimenta
2005-01-01
A gibberellin (GA) biosynthetic pathway was discovered operating in root tips of 7-d-old pumpkin (Cucurbita maxima) seedlings. Stepwise analysis of GA metabolism in cell-free systems revealed the conversion of GA12-aldehyde to bioactive GA4 and inactive GA34. Highest levels of endogenous GA4 and GA34 were found in hypocotyls and root tips of 3-d-old seedlings. cDNA molecules encoding two GA oxidases, CmGA20ox3 and CmGA3ox3, were isolated from root tips of 7-d-old LAB150978-treated seedlings. Recombinant CmGA20ox3 fusion protein converted GA12 to GA9, GA24 to GA9, GA14 to GA4, and, less efficiently, GA53 to GA20, and recombinant CmGA3ox3 protein oxidized GA9 to GA4. Transcript profiles were determined for four GA oxidase genes from pumpkin revealing relatively high transcript levels for CmGA7ox in shoot tips and cotyledons, for CmGA20ox3 in shoot tips and hypocotyls, and for CmGA3ox3 in hypocotyls and roots of 3-d-old seedlings. Transcripts of CmGA2ox1 were mainly found in roots of 7-d-old seedlings. In roots of 7-d-old seedlings, transcripts of CmGA7ox, CmGA20ox3, and CmGA3ox3 were localized in the cap and the rhizodermis by in situ hybridization. We conclude that hypocotyls and root tips are important sites of GA biosynthesis in the developing pumpkin seedling. PMID:16126862
Evolution of cytochrome oxidase, an enzyme older than atmospheric oxygen.
Castresana, J; Lübben, M; Saraste, M; Higgins, D G
1994-06-01
Cytochrome oxidase is a key enzyme in aerobic metabolism. All the recorded eubacterial (domain Bacteria) and archaebacterial (Archaea) sequences of subunits 1 and 2 of this protein complex have been used for a comprehensive evolutionary analysis. The phylogenetic trees reveal several processes of gene duplication. Some of these are ancient, having occurred in the common ancestor of Bacteria and Archaea, whereas others have occurred in specific lines of Bacteria. We show that eubacterial quinol oxidase was derived from cytochrome c oxidase in Gram-positive bacteria and that archaebacterial quinol oxidase has an independent origin. A considerable amount of evidence suggests that Proteobacteria (Purple bacteria) acquired quinol oxidase through a lateral gene transfer from Gram-positive bacteria. The prevalent hypothesis that aerobic metabolism arose several times in evolution after oxygenic photosynthesis, is not sustained by two aspects of the molecular data. First, cytochrome oxidase was present in the common ancestor of Archaea and Bacteria whereas oxygenic photosynthesis appeared in Bacteria. Second, an extant cytochrome oxidase in nitrogen-fixing bacteria shows that aerobic metabolism is possible in an environment with a very low level of oxygen, such as the root nodules of leguminous plants. Therefore, we propose that aerobic metabolism in organisms with cytochrome oxidase has a monophyletic and ancient origin, prior to the appearance of eubacterial oxygenic photosynthetic organisms.
Ziegler, Christiane; Wolf, Christiane; Schiele, Miriam A; Feric Bojic, Elma; Kucukalic, Sabina; Sabic Dzananovic, Emina; Goci Uka, Aferdita; Hoxha, Blerina; Haxhibeqiri, Valdete; Haxhibeqiri, Shpend; Kravic, Nermina; Muminovic Umihanic, Mirnesa; Cima Franc, Ana; Jaksic, Nenad; Babic, Romana; Pavlovic, Marko; Warrings, Bodo; Bravo Mehmedbasic, Alma; Rudan, Dusko; Aukst-Margetic, Branka; Kucukalic, Abdulah; Marjanovic, Damir; Babic, Dragan; Bozina, Nada; Jakovljevic, Miro; Sinanovic, Osman; Avdibegovic, Esmina; Agani, Ferid; Dzubur-Kulenovic, Alma; Deckert, Jürgen; Domschke, Katharina
2018-01-01
Abstract Background Posttraumatic stress disorder is characterized by an overactive noradrenergic system conferring core posttraumatic stress disorder symptoms such as hyperarousal and reexperiencing. Monoamine oxidase A is one of the key enzymes mediating the turnover of noradrenaline. Here, DNA methylation of the monoamine oxidase A gene exonI/intronI region was investigated for the first time regarding its role in posttraumatic stress disorder risk and severity. Methods Monoamine oxidase A methylation was analyzed via direct sequencing of sodium bisulfite-treated DNA extracted from blood cells in a total sample of N=652 (441 male) patients with current posttraumatic stress disorder, patients with remitted posttraumatic stress disorder, and healthy probands (comparison group) recruited at 5 centers in Bosnia-Herzegovina, Croatia, and the Republic of Kosovo. Posttraumatic stress disorder severity was measured by means of the Clinician-Administered Posttraumatic Stress Disorder Scale and its respective subscores representing distinct symptom clusters. Results In the male, but not the female sample, patients with current posttraumatic stress disorder displayed hypermethylation of 3 CpGs (CpG3=43656362; CpG12=43656514; CpG13=43656553, GRCh38.p2 Assembly) as compared with remitted Posttraumatic Stress Disorder patients and healthy probands. Symptom severity (Clinician-Administered Posttraumatic Stress Disorder Scale scores) in male patients with current posttraumatic stress disorder significantly correlated with monoamine oxidase A methylation. This applied particularly to symptom clusters related to reexperiencing of trauma (cluster B) and hyperarousal (cluster D). Conclusions The present findings suggest monoamine oxidase A gene hypermethylation, potentially resulting in enhanced noradrenergic signalling, as a disease status and severity marker of current posttraumatic stress disorder in males. If replicated, monoamine oxidase A hypermethylation might serve as a
Ziegler, Christiane; Wolf, Christiane; Schiele, Miriam A; Feric Bojic, Elma; Kucukalic, Sabina; Sabic Dzananovic, Emina; Goci Uka, Aferdita; Hoxha, Blerina; Haxhibeqiri, Valdete; Haxhibeqiri, Shpend; Kravic, Nermina; Muminovic Umihanic, Mirnesa; Cima Franc, Ana; Jaksic, Nenad; Babic, Romana; Pavlovic, Marko; Warrings, Bodo; Bravo Mehmedbasic, Alma; Rudan, Dusko; Aukst-Margetic, Branka; Kucukalic, Abdulah; Marjanovic, Damir; Babic, Dragan; Bozina, Nada; Jakovljevic, Miro; Sinanovic, Osman; Avdibegovic, Esmina; Agani, Ferid; Dzubur-Kulenovic, Alma; Deckert, Jürgen; Domschke, Katharina
2018-05-01
Posttraumatic stress disorder is characterized by an overactive noradrenergic system conferring core posttraumatic stress disorder symptoms such as hyperarousal and reexperiencing. Monoamine oxidase A is one of the key enzymes mediating the turnover of noradrenaline. Here, DNA methylation of the monoamine oxidase A gene exonI/intronI region was investigated for the first time regarding its role in posttraumatic stress disorder risk and severity. Monoamine oxidase A methylation was analyzed via direct sequencing of sodium bisulfite-treated DNA extracted from blood cells in a total sample of N=652 (441 male) patients with current posttraumatic stress disorder, patients with remitted posttraumatic stress disorder, and healthy probands (comparison group) recruited at 5 centers in Bosnia-Herzegovina, Croatia, and the Republic of Kosovo. Posttraumatic stress disorder severity was measured by means of the Clinician-Administered Posttraumatic Stress Disorder Scale and its respective subscores representing distinct symptom clusters. In the male, but not the female sample, patients with current posttraumatic stress disorder displayed hypermethylation of 3 CpGs (CpG3=43656362; CpG12=43656514; CpG13=43656553, GRCh38.p2 Assembly) as compared with remitted Posttraumatic Stress Disorder patients and healthy probands. Symptom severity (Clinician-Administered Posttraumatic Stress Disorder Scale scores) in male patients with current posttraumatic stress disorder significantly correlated with monoamine oxidase A methylation. This applied particularly to symptom clusters related to reexperiencing of trauma (cluster B) and hyperarousal (cluster D). The present findings suggest monoamine oxidase A gene hypermethylation, potentially resulting in enhanced noradrenergic signalling, as a disease status and severity marker of current posttraumatic stress disorder in males. If replicated, monoamine oxidase A hypermethylation might serve as a surrogate marker of a hyperadrenergic subtype of
Luis F. Larrondo; Bernardo Gonzalez; Dan Cullen; Rafael Vicuna
2004-01-01
A cluster of multicopper oxidase genes (mco1, mco2, mco3, mco4) from the lignin-degrading basidiomycete Phanerochaete chrysosporium is described. The four genes share the same transcriptional orientation within a 25 kb region. mco1, mco2 and mco3 are tightly grouped, with intergenic regions of 2.3 and 0.8 kb, respectively, whereas mco4 is located 11 kb upstream of mco1...
Carroll, Matthew B; Smith, Derek M; Shaak, Thomas L
2017-03-01
It remains unclear why the dose of xanthine oxidase inhibitors (XOI) allopurinol or febuxostat varies among patients though they reach similar serum uric acid (SUA) goal. We pursued genomic sequencing of XOI metabolism and clearance genes to identify single-nucleotide polymorphisms (SNPs) relate to differences in XOI dose. Subjects with a diagnosis of Gout based on the 1977 American College of Rheumatology Classification Criteria for the disorder, who were on stable doses of a XOI, and who were at their goal SUA level, were enrolled. The primary outcome was relationship between SNPs in any of these genes to XOI dose. The secondary outcome was relationship between SNPs and change in pre- and post-treatment SUA. We enrolled 100 subjects. The average patient age was 68.6 ± 10.6 years old. Over 80% were men and 77% were Caucasian. One SNP was associated with a higher XOI dose: rs75995567 (p = 0.031). Two SNPs were associated with 300 mg daily of allopurinol: rs11678615 (p = 0.022) and rs3731722 on Aldehyde Oxidase (AO) (His1297Arg) (p = 0.001). Two SNPs were associated with a lower dose of allopurinol: rs1884725 (p = 0.033) and rs34650714 (p = 0.006). For the secondary outcome, rs13415401 was the only SNP related to a smaller mean SUA change. Ten SNPs were identified with a larger change in SUA. Though multiple SNPs were identified in the primary and secondary outcomes of this study, rs3731722 is known to alter catalytic function for some aldehyde oxidase substrates.
Functional expression of amine oxidase from Aspergillus niger (AO-I) in Saccharomyces cerevisiae.
Kolaríková, Katerina; Galuszka, Petr; Sedlárová, Iva; Sebela, Marek; Frébort, Ivo
2009-01-01
The aim of this work was to prepare recombinant amine oxidase from Aspergillus niger after overexpressing in yeast. The yeast expression vector pDR197 that includes a constitutive PMA1 promoter was used for the expression in Saccharomyces cerevisiae. Recombinant amine oxidase was extracted from the growth medium of the yeast, purified to homogeneity and identified by activity assay and MALDI-TOF peptide mass fingerprinting. Similarity search in the newly published A. niger genome identified six genes coding for copper amine oxidase, two of them corresponding to the previously described enzymes AO-I a methylamine oxidase and three other genes coding for FAD amine oxidases. Thus, A. niger possesses an enormous metabolic gear to grow on amine compounds and thus support its saprophytic lifestyle.
The Importance of NADPH Oxidases and Redox Signaling in Angiogenesis
Prieto-Bermejo, Rodrigo; Hernández-Hernández, Angel
2017-01-01
Eukaryotic cells have to cope with the constant generation of reactive oxygen species (ROS). Although the excessive production of ROS might be deleterious for cell biology, there is a plethora of evidence showing that moderate levels of ROS are important for the control of cell signaling and gene expression. The family of the nicotinamide adenine dinucleotide phosphate oxidases (NADPH oxidases or Nox) has evolved to produce ROS in response to different signals; therefore, they fulfil a central role in the control of redox signaling. The role of NADPH oxidases in vascular physiology has been a field of intense study over the last two decades. In this review we will briefly analyze how ROS can regulate signaling and gene expression. We will address the implication of NADPH oxidases and redox signaling in angiogenesis, and finally, the therapeutic possibilities derived from this knowledge will be discussed. PMID:28505091
Zhao, Yan; Gentekaki, Eleni; Yi, Zhenzhen; Lin, Xiaofeng
2013-01-01
The mitochondrial cytochrome c oxidase subunit I (COI) gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp.
Suriyasak, Chetphilin; Harano, Keisuke; Tanamachi, Koichiro; Matsuo, Kazuhiro; Tamada, Aina; Iwaya-Inoue, Mari; Ishibashi, Yushi
2017-09-01
Heat stress during grain filling increases rice grain chalkiness due to increased activity of α-amylase, which hydrolyzes starch. In rice and barley seeds, reactive oxygen species (ROS) produced after imbibition induce α-amylase activity via regulation of gibberellin (GA) and abscisic acid (ABA) levels during seed germination. Here, we examined whether ROS is involved in induction of grain chalkiness by α-amylase in developing rice grains under heat stress. To elucidate the role of ROS in grain chalkiness, we grew post-anthesis rice plants (Oryza sativa L. cv. Koshihikari) under control (25°C) or heat stress (30°C) conditions with or without antioxidant (dithiothreitol) treatment. The developing grains were analyzed for expression of NADPH oxidases, GA biosynthesis genes (OsGA3ox1, OsGA20ox1), ABA catabolism genes (OsABA8'OH1, OsABA8'OH2) and an α-amylase gene (OsAmy3E), endogenous H 2 O 2 content and the grain quality. In grains exposed to heat stress, the expression of NADPH oxidase genes (especially, OsRbohB, OsRbohD, OsRbohF and OsRbohI) and the ROS content increased. Heat stress also increased the expression of OsGA3ox1, OsGA20ox1, OsABA8'OH1, OsABA8'OH2 and OsAmy3E. On the other hand, dithiothreitol treatment reduced the effects of heat stress on the expression of these genes and significantly reduced grain chalkiness induced by heat stress. These results suggest that, similar to cereal seed germination mechanism, ROS produced under heat stress is involved in α-amylase induction in maturating rice grains through GA/ABA metabolism, and consequently caused grain chalkiness. Copyright © 2017 Elsevier GmbH. All rights reserved.
Identification of a p53-response element in the promoter of the proline oxidase gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-05-02
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less
Zhao, Yan; Gentekaki, Eleni; Yi, Zhenzhen; Lin, Xiaofeng
2013-01-01
Background The mitochondrial cytochrome c oxidase subunit I (COI) gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. Methodology/Principal findings We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. Conclusions Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp. PMID:24204730
Pöggeler, Stefanie
2011-04-01
Multicopper oxidases (MCO) catalyze the biological oxidation of various aromatic substrates and have been identified in plants, insects, bacteria, and wood rotting fungi. In nature, they are involved in biodegradation of biopolymers such as lignin and humic compounds, but have also been tested for various industrial applications. In fungi, MCOs have been shown to play important roles during their life cycles, such as in fruiting body formation, pigment formation and pathogenicity. Coprophilous fungi, which grow on the dung of herbivores, appear to encode an unexpectedly high number of enzymes capable of at least partly degrading lignin. This study compared the MCO-coding capacity of the coprophilous filamentous ascomycetes Podospora anserina and Sordaria macrospora with closely related non-coprophilous members of the order Sordariales. An increase of MCO genes in coprophilic members of the Sordariales most probably occurred by gene duplication and horizontal gene transfer events.
Light Regulation of Gibberellin Biosynthesis and Mode of Action.
García-Martinez, José Luis; Gil, Joan
2001-12-01
Some phenotypic effects produced in plants by light are very similar to those induced by hormones. In this review, the light-gibberellin (GA) interaction in germination, de-etiolation, stem growth, and tuber formation (process regulated by GAs) are discussed. Germination of lettuce and Arabidopsis seeds depends on red irradiation (R), which enhances the expression of GA 3-oxidase genes (GA3ox) and leads to an increase in active GA content. De-etiolation of pea seedling alters the expression of GA20ox and GA3ox genes and induces a rapid decrease of GA1 content. Stem growth of green plants is also affected by diverse light irradiation characteristics. Low light intensity increases stem elongation and active GA content in pea and Brassica. Photoperiod controls active GA levels in long-day rosette (spinach and Silene) and in woody plants (Salix and hybrid aspen) by regulating different steps of GA biosynthesis, mainly through transcript levels of GA20ox and GA3ox genes. Light modulation of stem elongation in light-grown plants is controlled by phytochrome, which modifies GA biosynthesis and catabolism (tobacco, potato, cowpea, Arabidopsis) and GA-response (pea, cucumber, Arabidopsis). In Arabidopsis and tobacco, ATH1 (a gene encoding an homeotic transcription factor) is a positive mediator of a phyB-specific signal transduction cascade controlling GA levels by regulating the expression of GA20ox and GA3ox. Tuber formation in potato is controlled by photoperiod (through phyB) and GAs. Inductive short-day conditions alter the diurnal rhythm of GA20ox transcript abundance, and increases the expression of a new protein (PHOR1) that plays a role in the photoperiod-GA interaction.
Identification of a Third Mn(II) Oxidase Enzyme in Pseudomonas putida GB-1
Smesrud, Logan; Tebo, Bradley M.
2016-01-01
ABSTRACT The oxidation of soluble Mn(II) to insoluble Mn(IV) is a widespread bacterial activity found in a diverse array of microbes. In the Mn(II)-oxidizing bacterium Pseudomonas putida GB-1, two Mn(II) oxidase genes, named mnxG and mcoA, were previously identified; each encodes a multicopper oxidase (MCO)-type enzyme. Expression of these two genes is positively regulated by the response regulator MnxR. Preliminary investigation into putative additional regulatory pathways suggested that the flagellar regulators FleN and FleQ also regulate Mn(II) oxidase activity; however, it also revealed the presence of a third, previously uncharacterized Mn(II) oxidase activity in P. putida GB-1. A strain from which both of the Mn(II) oxidase genes and fleQ were deleted exhibited low levels of Mn(II) oxidase activity. The enzyme responsible was genetically and biochemically identified as an animal heme peroxidase (AHP) with domain and sequence similarity to the previously identified Mn(II) oxidase MopA. In the ΔfleQ strain, P. putida GB-1 MopA is overexpressed and secreted from the cell, where it actively oxidizes Mn. Thus, deletion of fleQ unmasked a third Mn(II) oxidase activity in this strain. These results provide an example of an Mn(II)-oxidizing bacterium utilizing both MCO and AHP enzymes. IMPORTANCE The identity of the Mn(II) oxidase enzyme in Pseudomonas putida GB-1 has been a long-standing question in the field of bacterial Mn(II) oxidation. In the current work, we demonstrate that P. putida GB-1 employs both the multicopper oxidase- and animal heme peroxidase-mediated pathways for the oxidation of Mn(II), rendering this model organism relevant to the study of both types of Mn(II) oxidase enzymes. The presence of three oxidase enzymes in P. putida GB-1 deepens the mystery of why microorganisms oxidize Mn(II) while providing the field with the tools necessary to address this question. The initial identification of MopA as a Mn(II) oxidase in this strain required the
Gibberellin induces alpha-amylase gene in seed coat of Ipomoea nil immature seeds.
Nakajima, Masatoshi; Nakayama, Akira; Xu, Zheng-Jun; Yamaguchi, Isomaro
2004-03-01
Two full-length cDNAs encoding gibberellin 3-oxidases, InGA3ox1 and InGA3ox2, were cloned from developing seeds of morning glory (Ipomoea nil (Pharbitis nil) Choisy cv. Violet) with degenerate-PCR and RACEs. The RNA-blot analysis for these clones revealed that the InGA3ox2 gene was organ-specifically expressed in the developing seeds at 6-18 days after anthesis. In situ hybridization showed the signals of InGA3ox2 mRNA in the seed coat, suggesting that active gibberellins (GAs) were synthesized in the tissue, although no active GA was detected there by immunohistochemistry. In situ hybridization analysis for InAmy1 (former PnAmy1) mRNA showed that InAmy1 was also synthesized in the seed coat. Both InGA3ox2 and InAmy1 genes were expressed spatially overlapped without a clear time lag, suggesting that both active GAs and InAmy1 were synthesized almost simultaneously in seed coat and secreted to the integument. These observations support the idea that GAs play an important role in seed development by inducing alpha-amylase.
Mutations in the F-box gene SNEEZY result in decreased arabidopsis GA signaling
USDA-ARS?s Scientific Manuscript database
We previously reported that the SLEEPY1 (SLY1) homolog, F-box gene SNEEZY/SLEEPY2 (SNE/SLY2), can partly replace SLY1 in gibberellin (GA) hormone signaling through interaction with DELLAs RGA and GAI. To determine whether SNE normally functions in GA signaling, we characterized the phenotypes of tw...
R1, a novel repressor of the human monoamine oxidase A.
Chen, Kevin; Ou, Xiao-Ming; Chen, Gao; Choi, Si Ho; Shih, Jean C
2005-03-25
Monoamine oxidase catalyzes the oxidative deamination of a number of neurotransmitters. A deficiency in monoamine oxidase A results in aggressive behavior in both humans and mice. Studies on the regulation of monoamine oxidase A gene expression have shown that the Sp1 family is important for monoamine oxidase A expression. To search for novel transcription factors, the sequences of three Sp1 sites in the monoamine oxidase A core promoter were used in the yeast one-hybrid system to screen a human cDNA library. A novel repressor, R1 (RAM2), has been cloned. The R1 cDNA encodes a protein with 454 amino acids and an open reading frame at the 5'-end. The transfection of R1 in a human neuroblastoma cell line, SK-N-BE (2)-C, inhibited the monoamine oxidase A promoter and enzymatic activity. The degree of inhibition of monoamine oxidase A by R1 correlated with the level of R1 protein expression. R1 was also found to repress monoamine oxidase A promoter activity within a natural chromatin environment. A gel-shift assay indicated that the endogenous R1 protein in SK-N-BE (2)-C cells interacted with the R1 binding sequence. R1 also bound directly to the natural monoamine oxidase A promoter in vivo as shown by chromatin immunoprecipitation assay. Immunocytochemical analysis showed that R1 was expressed in both cytosol and nucleus, which suggested a role for R1 in transcriptional regulation. Northern blot analysis revealed the presence of endogenous R1 mRNA in human brain and peripheral tissues. Taken together, this study shows that R1 is a novel repressor that inhibits monoamine oxidase A gene expression.
Peng, Zeyu; Green, Peter G; Arakane, Yasuyuki; Kanost, Michael R; Gorman, Maureen J
2014-01-01
Typical multicopper oxidases (MCOs) have ten conserved histidines and one conserved cysteine that coordinate four copper atoms. These copper ions are required for oxidase activity. During our studies of insect MCOs, we discovered a gene that we named multicopper oxidase-related protein (MCORP). MCORPs share sequence similarity with MCOs, but lack many of the copper-coordinating residues. We identified MCORP orthologs in many insect species, but not in other invertebrates or vertebrates. We predicted that MCORPs would lack oxidase activity due to the absence of copper-coordinating residues. To test this prediction, we purified recombinant Tribolium castaneum (red flour beetle) MCORP and analyzed its enzymatic activity using a variety of substrates. As expected, no oxidase activity was detected. To study MCORP function in vivo, we analyzed expression profiles of TcMCORP and Anopheles gambiae (African malaria mosquito) MCORP, and assessed RNAi-mediated knockdown phenotypes. We found that both MCORPs are constitutively expressed at a low level in all of the tissues we analyzed. Injection of TcMCORP dsRNA into larvae resulted in 100% mortality prior to adult eclosion, with death occurring mainly during the pharate pupal stage or late pharate adult stage. Injection of TcMCORP dsRNA into pharate pupae resulted in the death of approximately 20% of the treated insects during the pupal to adult transition and a greatly shortened life span for the remaining insects. In addition, knockdown of TcMCORP in females prevented oocyte maturation and, thus, greatly decreased the number of eggs laid. These results indicate that TcMCORP is an essential gene and that its function is required for reproduction. An understanding of the role MCORP plays in insect physiology may help to develop new strategies for controlling insect pests.
Josse, Eve-Marie; Simkin, Andrew J.; Gaffé, Joël; Labouré, Anne-Marie; Kuntz, Marcel; Carol, Pierre
2000-01-01
The Arabidopsis IMMUTANS gene encodes a plastid homolog of the mitochondrial alternative oxidase, which is associated with phytoene desaturation. Upon expression in Escherichia coli, this protein confers a detectable cyanide-resistant electron transport to isolated membranes. In this assay this activity is sensitive to n-propyl-gallate, an inhibitor of the alternative oxidase. This protein appears to be a plastid terminal oxidase (PTOX) that is functionally equivalent to a quinol:oxygen oxidoreductase. This protein was immunodetected in achlorophyllous pepper (Capsicum annuum) chromoplast membranes, and a corresponding cDNA was cloned from pepper and tomato (Lycopersicum esculentum) fruits. Genomic analysis suggests the presence of a single gene in these organisms, the expression of which parallels phytoene desaturase and ζ-carotene desaturase gene expression during fruit ripening. Furthermore, this PTOX gene is impaired in the tomato ghost mutant, which accumulates phytoene in leaves and fruits. These data show that PTOX also participates in carotenoid desaturation in chromoplasts in addition to its role during early chloroplast development. PMID:10938359
Murphy, D L; Sims, K B; Karoum, F; Garrick, N A; de la Chapelle, A; Sankila, E M; Norio, R; Breakefield, X O
1991-01-01
Two individuals with an X-chromosomal deletion were recently found to lack the genes encoding monoamine oxidase type A (MAO-A) and MAO-B. This abnormality was associated with almost total (90%) reductions in the oxidatively deaminated urinary metabolites of the MAO-A substrate, norepinephrine, and with marked (100-fold) increases in an MAO-B substrate, phenylethylamine, confirming systemic functional consequences of the genetic enzyme deficiency. However, urinary concentrations of the deaminated metabolites of dopamine and serotonin (5-HT) were essentially normal. To investigate other deaminating systems besides MAO-A and MAO-B that might produce these metabolites of dopamine and 5-HT, we examined plasma amine oxidase (AO) activity in these two patients and two additional patients with the same X-chromosomal deletion. Normal plasma AO activity was found in all four Norrie disease-deletion patients, in four patients with classic Norrie disease without a chromosomal deletion, and in family members of patients from both groups. Marked plasma amine metabolite abnormalities and essentially absent platelet MAO-B activity were found in all four Norrie disease-deletion patients, but in none of the other subjects in the two comparison groups. These results indicate that plasma AO is encoded by gene(s) independent of those for MAO-A and MAO-B, and raise the possibility that plasma AO, and perhaps the closely related tissue AO, benzylamine oxidase, as well as other atypical AOs or MAOs encoded independently from MAO-A and MAO-B may contribute to the oxidative deamination of dopamine and 5-HT in humans.
Chi, Ming; Bhagwat, Basdeo; Tang, Guiliang; Xiang, Yu
2016-01-01
It is of great importance and interest to develop crop varieties with low polyphenol oxidase (PPO) activity for the food industry because PPO-mediated oxidative browning is a main cause of post-harvest deterioration and quality loss of fresh produce and processed foods. We recently demonstrated that potato tubers with reduced browning phenotypes can be produced by inhibition of the expression of several PPO gene isoforms using artificial microRNA (amiRNA) technology. The approach introduces a single type of 21-nucleotide RNA population to guide silencing of the PPO gene transcripts in potato tissues. Some advantages of the technology are: small RNA molecules are genetically transformed, off-target gene silencing can be avoided or minimized at the stage of amiRNA designs, and accuracy and efficiency of the processes can be detected at every step using molecular biological techniques. Here we describe the methods for transformation and regeneration of potatoes with amiRNA vectors, detection of the expression of amiRNAs, identification of the cleaved product of the target gene transcripts, and assay of the expression level of PPO gene isoforms in potatoes.
Settin, Ahmad; Ismail, Azza; El-Magd, Megahed Abo; El-Baz, Rizk; Kazamel, Amira
2009-01-01
Type 1 diabetes (T1D) is a genetically conditioned autoimmune disease in which cytokines play an important role. Objectives. To check for the association of polymorphisms of cytokine genes with type 1 diabetes. Subjects. This work included 50 cases with T1D and 98 healthy individuals from the Nile Delta region of Egypt. Cases included 20 males and 30 females with a median age of 25 and range of 15-50 years. DNA was amplified using PCR with sequence-specific primers for detection of polymorphisms related to tumor necrosis factor (TNF)-alpha(- 308) (G/A), interleukin (IL)-10(- 1082) (G/A), IL-6(- 174) (G/C), and IL-1Ra (VNTR). Cases with T1D showed significant higher frequency of genotypes of TNF-alpha(- 308) AA (p < 0.001, odds ratio (OR) = 7.91), IL-6-17CC (p < 0.05, OR = 3.36) and IL-1Ra A1A1 (p < 0.05, OR = 3.68) with significant lower frequencies of TNF-alpha(- 308) GA, and IL-1Ra A1A2 genotypes (p < 0.001 and < 0.05, respectively). They also showed significant higher frequency of TNF-alpha(- 308) allele A (p < 0.05, OR = 2.0), IL-1Ra allele A1 (p < 0.05, OR = 2.98) with a significant lower frequency of TNF-alpha(- 308) G allele and IL-1Ra A2 allele (p < 0.05). No significant difference was detected among cases in relation to IL-10(- 1082) (G/A) genotypes or alleles nor in relation to age, sex, consanguinity or family history of the disease. Polymorphisms related to TNF-alpha and IL-1Ra genes may be considered genetic markers for T1D among Egyptians with a potential impact on family counseling and management.
Fos, Mariano; Nuez, Fernando; García-Martínez, José L.
2000-01-01
We investigated the role of gibberellins (GAs) in the effect of pat-2, a recessive mutation that induces facultative parthenocarpic fruit development in tomato (Lycopersicon esculentum Mill.) using near-isogenic lines with two different genetic backgrounds. Unpollinated wild-type Madrigal (MA/wt) and Cuarenteno (CU/wt) ovaries degenerated, but GA3 application induced parthenocarpic fruit growth. On the contrary, parthenocarpic growth of MA/pat-2 and CU/pat-2 fruits, which occurs in the absence of pollination and hormone application, was not affected by GA3. Pollinated MA/wt and parthenocarpic MA/pat-2 ovary development was negated by paclobutrazol, and this inhibitory effect was counteracted by GA3. The main GAs of the early-13-hydroxylation pathway (GA1, GA3, GA8, GA19, GA20, GA29, GA44, GA53, and, tentatively, GA81) and two GAs of the non-13-hydroxylation pathway (GA9 and GA34) were identified in MA/wt ovaries by gas chromatography-selected ion monitoring. GAs were quantified in unpollinated ovaries at flower bud, pre-anthesis, and anthesis. In unpollinated MA/pat-2 and CU/pat-2 ovaries, the GA20 content was much higher (up to 160 times higher) and the GA19 content was lower than in the corresponding non-parthenocarpic ovaries. The application of an inhibitor of 2-oxoglutarate-dependent dioxygenases suggested that GA20 is not active per se. The pat-2 mutation may increase GA 20-oxidase activity in unpollinated ovaries, leading to a higher synthesis of GA20, the precursor of an active GA. PMID:10677440
The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion
2012-01-01
Background Plant polyphenol oxidases (PPOs) are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss) and Glycine max (soybean) each had 11 genes. Populus trichocarpa (poplar) contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae) genomes or Arabidopsis (A. lyrata and A. thaliana). We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic relationships based on
Urwin, Ruth Elizabeth; Nunn, Kenneth Patrick
2005-03-01
The serotonin (5-HT) and norepinephrine (NE) systems are likely involved in the aetiology of anorexia nervosa (AN) as sufferers are premorbidly anxious. Specifically, we hypothesize that genes encoding proteins, which clear 5-HT and NE from the synapse, are prime candidates for affecting susceptibility to AN. Supporting our hypothesis, we earlier showed that the NE transporter (NET) and monoamine oxidase A (MAOA) genes appear to contribute additively to increased risk of developing restricting AN (AN-R). With regard to the MAOA gene, a sequence variant that increases MAOA activity and has suggested association with the anxiety condition, panic disorder was preferentially transmitted from parents to affected children. Here we provide evidence in support of interaction between the MAOA and serotonin transporter (SERT) genes in 114 AN nuclear families (patient with AN plus biological parents). A SERT gene genotype with no apparent individual effect on risk and known to be associated with anxiety is preferentially transmitted to children with AN (chi2 trend=9.457, 1 df, P=0.0021) and AN-R alone (chi2 trend=7.477, 1 df, P=0.0063) when the 'more active' MAOA gene variant is also transmitted. The increased risk of developing the disorder is up to eight times greater than the risk imposed by the MAOA gene variant alone--an example of synergistic epistatic interaction. If independently replicated, our findings to date suggest that we may have identified three genes affecting susceptibility to AN, particularly AN-R: the MAOA, SERT, and NET genes.
Androgen receptor and monoamine oxidase polymorphism in wild bonobos
Garai, Cintia; Furuichi, Takeshi; Kawamoto, Yoshi; Ryu, Heungjin; Inoue-Murayama, Miho
2014-01-01
Androgen receptor gene (AR), monoamine oxidase A gene (MAOA) and monoamine oxidase B gene (MAOB) have been found to have associations with behavioral traits, such as aggressiveness, and disorders in humans. However, the extent to which similar genetic effects might influence the behavior of wild apes is unclear. We examined the loci AR glutamine repeat (ARQ), AR glycine repeat (ARG), MAOA intron 2 dinucleotide repeat (MAin2) and MAOB intron 2 dinucleotide repeat (MBin2) in 32 wild bonobos, Pan paniscus, and compared them with those of chimpanzees, Pan troglodytes, and humans. We found that bonobos were polymorphic on the four loci examined. Both loci MAin2 and MBin2 in bonobos showed a higher diversity than in chimpanzees. Because monoamine oxidase influences aggressiveness, the differences between the polymorphisms of MAin2 and MBin2 in bonobos and chimpanzees may be associated with the differences in aggression between the two species. In order to understand the evolution of these loci and AR, MAOA and MAOB in humans and non-human primates, it would be useful to conduct future studies focusing on the potential association between aggressiveness, and other personality traits, and polymorphisms documented in bonobos. PMID:25606465
Borecky, Jirí; Nogueira, Fábio T S; de Oliveira, Kívia A P; Maia, Ivan G; Vercesi, Aníbal E; Arruda, Paulo
2006-01-01
The simultaneous existence of alternative oxidases and uncoupling proteins in plants has raised the question as to why plants need two energy-dissipating systems with apparently similar physiological functions. A probably complete plant uncoupling protein gene family is described and the expression profiles of this family compared with the multigene family of alternative oxidases in Arabidopsis thaliana and sugarcane (Saccharum sp.) employed as dicot and monocot models, respectively. In total, six uncoupling protein genes, AtPUMP1-6, were recognized within the Arabidopsis genome and five (SsPUMP1-5) in a sugarcane EST database. The recombinant AtPUMP5 protein displayed similar biochemical properties as AtPUMP1. Sugarcane possessed four Arabidopsis AOx1-type orthologues (SsAOx1a-1d); no sugarcane orthologue corresponding to Arabidopsis AOx2-type genes was identified. Phylogenetic and expression analyses suggested that AtAOx1d does not belong to the AOx1-type family but forms a new (AOx3-type) family. Tissue-enriched expression profiling revealed that uncoupling protein genes were expressed more ubiquitously than the alternative oxidase genes. Distinct expression patterns among gene family members were observed between monocots and dicots and during chilling stress. These findings suggest that the members of each energy-dissipating system are subject to different cell or tissue/organ transcriptional regulation. As a result, plants may respond more flexibly to adverse biotic and abiotic conditions, in which oxidative stress is involved.
Dauelsberg, Patricia; Matus, José Tomás; Poupin, María Josefina; Leiva-Ampuero, Andrés; Godoy, Francisca; Vega, Andrea; Arce-Johnson, Patricio
2011-09-15
In the present work, the effect of assisted fertilization on anatomical, morphological and gene expression changes occurring in carpels and during early stages of berry development in Vitis vinifera were studied. Inflorescences were emasculated before capfall, immediately manually pollinated (EP) and fruit development was compared to emasculated but non-pollinated (ENP) and self-pollinated inflorescences (NESP). The diameter of berries derived from pollinated flowers (EP and NESP) was significantly higher than from non-pollinated flowers (ENP) at 21 days after emasculation/pollination (DAE), and a rapid increase in the size of the inner mesocarp, together with the presence of an embryo-like structure, were observed. The expression of gibberellin oxidases (GA20ox and GA2ox), anthranilate synthase (related to auxin synthesis) and cytokinin synthase coding genes was studied to assess the relationship between hormone synthesis and early berry development, while flower patterning genes were analyzed to describe floral transition. Significant expression changes were found for hormone-related genes, suggesting that their expression at early stages of berry development (13 DAE) is related to cell division and differentiation of mesocarp tissue at a later stage (21 DAE). Expression of hormone-related genes also correlates with the expression of VvHB13, a gene related to mesocarp expansion, and with an increased repression of floral patterning genes (PISTILLATA and TM6), which may contribute to prevent floral transition inhibiting fruit growth before fertilization takes place. Copyright © 2011 Elsevier GmbH. All rights reserved.
Reduced mobility and PPC in In(.20)Ga(.80)As / Al(.23)Ga(.77)As HEMT structure
NASA Technical Reports Server (NTRS)
Schacham, S. E.; Mena, Rafael A.; Haugland, Edward J.; Alterovitz, Samuel A.
1992-01-01
Transport properties of a pseudomorphic In(.20)Ga(.80)As/Al(.23)Ga(.77)As High Electron Mobility Transistor (HEMT) structure were measured by Hall and SdH techniques. Two samples of identical structures but with different doping levels were compared. Low temperature mobility measurements as a function of concentration coincides with the onset of second subband occupancy, indicating that the decrease in mobility is due to intersubband scattering. In spite of the low Al content (23 percent), large persistent photoconductivity (PPC) was observed in the highly doped sample only, showing a direct correlation between the PPC and doping concentration of the barrier layer.
Recovery of choline oxidase activity by in vitro recombination of individual segments.
Heinze, Birgit; Hoven, Nina; O'Connell, Timothy; Maurer, Karl-Heinz; Bartsch, Sebastian; Bornscheuer, Uwe T
2008-11-01
Initial attempts to express a choline oxidase from Arthrobacter pascens (APChO-syn) in Escherichia coli starting from a synthetic gene only led to inactive protein. However, activity was regained by the systematic exchange of individual segments of the gene with segments from a choline oxidase-encoding gene from Arthrobacter globiformis yielding a functional chimeric enzyme. Next, a sequence alignment of the exchanged segment with other choline oxidases revealed a mutation in the APChO-syn, showing that residue 200 was a threonine instead of an asparagine, which is, thus, crucial for confering enzyme activity and, hence, provides an explanation for the initial lack of activity. The active recombinant APChO-syn-T200N variant was biochemically characterized showing an optimum at pH 8.0 and at 37 degrees C. Furthermore, the substrate specificity was examined using N,N-dimethylethanolamine, N-methylethanolamine and 3,3-dimethyl-1-butanol.
Liu, Lei
2012-01-01
Complex interspecies interactions occur constantly between oral commensals and the opportunistic pathogen Streptococcus mutans in dental plaque. Previously, we showed that oral commensal Streptococcus oligofermentans possesses multiple enzymes for H2O2 production, especially lactate oxidase (Lox), allowing it to out-compete S. mutans. In this study, through extensive biochemical and genetic studies, we identified a pyruvate oxidase (pox) gene in S. oligofermentans. A pox deletion mutant completely lost Pox activity, while ectopically expressed pox restored activity. Pox was determined to produce most of the H2O2 in the earlier growth phase and log phase, while Lox mainly contributed to H2O2 production in stationary phase. Both pox and lox were expressed throughout the growth phase, while expression of the lox gene increased by about 2.5-fold when cells entered stationary phase. Since lactate accumulation occurred to a large degree in stationary phase, the differential Pox- and Lox-generated H2O2 can be attributed to differential gene expression and substrate availability. Interestingly, inactivation of pox causes a dramatic reduction in H2O2 production from lactate, suggesting a synergistic action of the two oxidases in converting lactate into H2O2. In an in vitro two-species biofilm experiment, the pox mutant of S. oligofermentans failed to inhibit S. mutans even though lox was active. In summary, S. oligofermentans develops a Pox-Lox synergy strategy to maximize its H2O2 formation so as to win the interspecies competition. PMID:22287002
Cloning and characterization of the gene for L-amino acid oxidase in hybrid tilapia.
Shen, Yubang; Fu, Gui Hong; Liu, Feng; Yue, Gen Hua
2015-12-01
Tilapia is the common name for a group of cichlid fishes. Identification of DNA markers significantly associated with important traits in candidate genes may speed up genetic improvement. L-Amino acid oxidase (LAO) plays a crucial role in the innate immune defences of animals. Previously, whether LAO variants were associated with economic traits had not been studied in fish. We characterized the cDNA sequence of the LAO gene of hybrid tilapia (Oreochromis spp.). Its ORF was 1536 bp, encoding a flavoenzyme of 511 amino acids. This gene consisted of seven exons and six introns. Its expression was detected in the intestine, blood, kidney, skin, liver. It was highly expressed in the intestine. After a challenge with a bacterial pathogen, Streptococcus agalactiae, its expression was up-regulated significantly in the liver, intestine and spleen (P < 0.05). We identified one SNP in the genomic sequence of the gene and found that this SNP was associated significantly with body length (P < 0.05), but not with resistance to S. agalactiae. The results of this study suggest that the LAO gene plays an important role in innate immune responses to the bacterial pathogen in tilapia. The investigation of relationship between polymorphism of LAO gene and disease resistance and growth in tilapia showed that one SNP was associated significantly with body length. Further experiments on whether SNPs in the LAO gene are associated with growth in tilapia and other populations could be useful in understanding more functions of the LAO gene.
NASA Astrophysics Data System (ADS)
Ajayan, J.; Nirmal, D.
2017-03-01
In this article, the DC and RF performance of a SiN passivated 20-nm gate length metamorphic high electron mobility transistor (MHEMT) on GaAs substrate with highly doped InGaAs source/drain (S/D) regions have investigated using the Synopsys TCAD tool. The 20-nm enhancement-mode (E-mode) MHEMT device also features δ-doped sheets on either side of the In0.53Ga0.47As/InAs/In0.53Ga0.47As channel which exhibits a transconductance of 3100 mS/mm, cut-off frequency (fT) of 740 GHz and a maximum oscillation frequency (fmax) of 1040 GHz. The threshold voltage of the device is found to be 0.07 V. The room temperature Hall mobilities of the 2-dimensional sheet charge density are measured to be over 12,600 cm2/Vs with a sheet charge density larger than 3.6 × 1012 cm-2. These high-performance E-mode MHEMTs are attractive candidates for sub-millimetre wave applications such as high-resolution radars for space research, remote atmospheric sensing, imaging systems and also for low noise wide bandwidth amplifier for future communication systems.
Si, Ying; Dane, Fenny; Rashotte, Aaron; Kang, Kwonkyoo; Singh, Narendra K.
2010-01-01
A full-length drought-responsive gene Ccrboh, encoding the respiratory burst oxidase homologue (rboh), was cloned in Citrullus colocynthis, a very drought-tolerant cucurbit species. The robh protein, also named NADPH oxidase, is conserved in plants and animals, and functions in the production of reactive oxygen species (ROS). The Ccrboh gene accumulated in a tissue-specific pattern when C. colocynthis was treated with PEG, abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), or NaCl, while the homologous rboh gene did not show any change in C. lanatus var. lanatus, cultivated watermelon, during drought. Grafting experiments were conducted using C. colocynthis or C. lanatus as the rootstock or scion. Results showed that the rootstock significantly affects gene expression in the scion, and some signals might be transported from the root to the shoot. Ccrboh in C. colocynthis was found to function early during plant development, reaching high mRNA transcript levels 3 d after germination. The subcellular location of Ccrboh was investigated by transient expression of the 35S::Ccrboh::GFP fusion construct in protoplasts. The result confirmed that Ccrboh is a transmembrane protein. Our data suggest that Ccrboh might be functionally important during the acclimation of plants to stress and also in plant development. It holds great promise for improving drought tolerance of other cucurbit species. PMID:20181664
Si, Ying; Dane, Fenny; Rashotte, Aaron; Kang, Kwonkyoo; Singh, Narendra K
2010-06-01
A full-length drought-responsive gene Ccrboh, encoding the respiratory burst oxidase homologue (rboh), was cloned in Citrullus colocynthis, a very drought-tolerant cucurbit species. The robh protein, also named NADPH oxidase, is conserved in plants and animals, and functions in the production of reactive oxygen species (ROS). The Ccrboh gene accumulated in a tissue-specific pattern when C. colocynthis was treated with PEG, abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), or NaCl, while the homologous rboh gene did not show any change in C. lanatus var. lanatus, cultivated watermelon, during drought. Grafting experiments were conducted using C. colocynthis or C. lanatus as the rootstock or scion. Results showed that the rootstock significantly affects gene expression in the scion, and some signals might be transported from the root to the shoot. Ccrboh in C. colocynthis was found to function early during plant development, reaching high mRNA transcript levels 3 d after germination. The subcellular location of Ccrboh was investigated by transient expression of the 35S::Ccrboh::GFP fusion construct in protoplasts. The result confirmed that Ccrboh is a transmembrane protein. Our data suggest that Ccrboh might be functionally important during the acclimation of plants to stress and also in plant development. It holds great promise for improving drought tolerance of other cucurbit species.
Expression and Chloroplast Targeting of Cholesterol Oxidase in Transgenic Tobacco Plants
Corbin, David R.; Grebenok, Robert J.; Ohnmeiss, Thomas E.; Greenplate, John T.; Purcell, John P.
2001-01-01
Cholesterol oxidase represents a novel type of insecticidal protein with potent activity against the cotton boll weevil (Anthonomus grandis grandis Boheman). We transformed tobacco (Nicotiana tabacum) plants with the cholesterol oxidase choM gene and expressed cytosolic and chloroplast-targeted versions of the ChoM protein. Transgenic leaf tissues expressing cholesterol oxidase exerted insecticidal activity against boll weevil larvae. Our results indicate that cholesterol oxidase can metabolize phytosterols in vivo when produced cytosolically or when targeted to chloroplasts. The transgenic plants exhibiting cytosolic expression accumulated low levels of saturated sterols known as stanols, and displayed severe developmental aberrations. In contrast, the transgenic plants expressing chloroplast-targeted cholesterol oxidase maintained a greater accumulation of stanols, and appeared phenotypically and developmentally normal. These results are discussed within the context of plant sterol distribution and metabolism. PMID:11457962
Global Transcriptomic Analysis of Targeted Silencing of Two Paralogous ACC Oxidase Genes in Banana
Xia, Yan; Kuan, Chi; Chiu, Chien-Hsiang; Chen, Xiao-Jing; Do, Yi-Yin; Huang, Pung-Ling
2016-01-01
Among 18 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase homologous genes existing in the banana genome there are two genes, Mh-ACO1 and Mh-ACO2, that participate in banana fruit ripening. To better understand the physiological functions of Mh-ACO1 and Mh-ACO2, two hairpin-type siRNA expression vectors targeting both the Mh-ACO1 and Mh-ACO2 were constructed and incorporated into the banana genome by Agrobacterium-mediated transformation. The generation of Mh-ACO1 and Mh-ACO2 RNAi transgenic banana plants was confirmed by Southern blot analysis. To gain insights into the functional diversity and complexity between Mh-ACO1 and Mh-ACO2, transcriptome sequencing of banana fruits using the Illumina next-generation sequencer was performed. A total of 32,093,976 reads, assembled into 88,031 unigenes for 123,617 transcripts were obtained. Significantly enriched Gene Oncology (GO) terms and the number of differentially expressed genes (DEGs) with GO annotation were ‘catalytic activity’ (1327, 56.4%), ‘heme binding’ (65, 2.76%), ‘tetrapyrrole binding’ (66, 2.81%), and ‘oxidoreductase activity’ (287, 12.21%). Real-time RT-PCR was further performed with mRNAs from both peel and pulp of banana fruits in Mh-ACO1 and Mh-ACO2 RNAi transgenic plants. The results showed that expression levels of genes related to ethylene signaling in ripening banana fruits were strongly influenced by the expression of genes associated with ethylene biosynthesis. PMID:27681726
De Meyer, Sofie E; Briscoe, Leah; Martínez-Hidalgo, Pilar; Agapakis, Christina M; de-Los Santos, Paulina Estrada; Seshadri, Rekha; Reeve, Wayne; Weinstock, George; O'Hara, Graham; Howieson, John G; Hirsch, Ann M
2016-08-01
Genome analysis of fourteen mimosoid and four papilionoid beta-rhizobia together with fourteen reference alpha-rhizobia for both nodulation (nod) and nitrogen-fixing (nif/fix) genes has shown phylogenetic congruence between 16S rRNA/MLSA (combined 16S rRNA gene sequencing and multilocus sequence analysis) and nif/fix genes, indicating a free-living diazotrophic ancestry of the beta-rhizobia. However, deeper genomic analysis revealed a complex symbiosis acquisition history in the beta-rhizobia that clearly separates the mimosoid and papilionoid nodulating groups. Mimosoid-nodulating beta-rhizobia have nod genes tightly clustered in the nodBCIJHASU operon, whereas papilionoid-nodulating Burkholderia have nodUSDABC and nodIJ genes, although their arrangement is not canonical because the nod genes are subdivided by the insertion of nif and other genes. Furthermore, the papilionoid Burkholderia spp. contain duplications of several nod and nif genes. The Burkholderia nifHDKEN and fixABC genes are very closely related to those found in free-living diazotrophs. In contrast, nifA is highly divergent between both groups, but the papilionoid species nifA is more similar to alpha-rhizobia nifA than to other groups. Surprisingly, for all Burkholderia, the fixNOQP and fixGHIS genes required for cbb3 cytochrome oxidase production and assembly are missing. In contrast, symbiotic Cupriavidus strains have fixNOQPGHIS genes, revealing a divergence in the evolution of two distinct electron transport chains required for nitrogen fixation within the beta-rhizobia.
NADPH Oxidases in Vascular Pathology
Konior, Anna; Schramm, Agata; Czesnikiewicz-Guzik, Marta
2014-01-01
Abstract Significance: Reactive oxygen species (ROS) play a critical role in vascular disease. While there are many possible sources of ROS, nicotinamide adenine dinucleotide phosphate (NADPH) oxidases play a central role. They are a source of “kindling radicals,” which affect other enzymes, such as nitric oxide synthase endothelial nitric oxide synthase or xanthine oxidase. This is important, as risk factors for atherosclerosis (hypertension, diabetes, hypercholesterolemia, and smoking) regulate the expression and activity of NADPH oxidases in the vessel wall. Recent Advances: There are seven isoforms in mammals: Nox1, Nox2, Nox3, Nox4, Nox5, Duox1 and Duox2. Nox1, Nox2, Nox4, and Nox5 are expressed in endothelium, vascular smooth muscle cells, fibroblasts, or perivascular adipocytes. Other homologues have not been found or are expressed at very low levels; their roles have not been established. Nox1/Nox2 promote the development of endothelial dysfunction, hypertension, and inflammation. Nox4 may have a role in protecting the vasculature during stress; however, when its activity is increased, it may be detrimental. Calcium-dependent Nox5 has been implicated in oxidative damage in human atherosclerosis. Critical Issues: NADPH oxidase-derived ROS play a role in vascular pathology as well as in the maintenance of normal physiological vascular function. We also discuss recently elucidated mechanisms such as the role of NADPH oxidases in vascular protection, vascular inflammation, pulmonary hypertension, tumor angiogenesis, and central nervous system regulation of vascular function and hypertension. Future Directions: Understanding the role of individual oxidases and interactions between homologues in vascular disease is critical for efficient pharmacological regulation of vascular NADPH oxidases in both the laboratory and clinical practice. Antioxid. Redox Signal. 20, 2794–2814. PMID:24180474
Yim, W J; Kim, K Y; Lee, Y W; Sundaram, S P; Lee, Y; Sa, T M
2014-07-15
Biotic stress like pathogenic infection increases ethylene biosynthesis in plants and ethylene inhibitors are known to alleviate the severity of plant disease incidence. This study aimed to reduce the bacterial spot disease incidence in tomato plants caused by Xanthomonas campestris pv. vesicatoria (XCV) by modulating stress ethylene with 1-aminocyclopropane-1-carboxylate (ACC) deaminase activity of Methylobacterium strains. Under greenhouse condition, Methylobacterium strains inoculated and pathogen challenged tomato plants had low ethylene emission compared to pathogen infected ones. ACC accumulation and ACC oxidase (ACO) activity with ACO related gene expression increased in XCV infected tomato plants over Methylobacterium strains inoculated plants. Among the Methylobacterium spp., CBMB12 resulted lowest ACO related gene expression (1.46 Normalized Fold Expression), whereas CBMB20 had high gene expression (3.42 Normalized Fold Expression) in pathogen challenged tomato. But a significant increase in ACO gene expression (7.09 Normalized Fold Expression) was observed in the bacterial pathogen infected plants. In contrast, Methylobacterium strains enhanced β-1,3-glucanase and phenylalanine ammonia-lyase (PAL) enzyme activities in pathogen challenged tomato plants. The respective increase in β-1,3-glucanase related gene expressions due to CBMB12, CBMB15, and CBMB20 strains were 66.3, 25.5 and 10.4% higher over pathogen infected plants. Similarly, PAL gene expression was high with 0.67 and 0.30 Normalized Fold Expression, in pathogen challenged tomato plants inoculated with CBMB12 and CBMB15 strains. The results suggest that ethylene is a crucial factor in bacterial spot disease incidence and that methylobacteria with ACC deaminase activity can reduce the disease severity with ultimate pathogenesis-related protein increase in tomato. Copyright © 2014 Elsevier GmbH. All rights reserved.
Genetics Home Reference: isolated sulfite oxidase deficiency
... Metabolic Disorders (CLIMB) March of Dimes: Amino Acid Metabolism Disorders The Compassionate Friends GeneReviews (1 link) Isolated Sulfite Oxidase Deficiency ClinicalTrials.gov (1 link) ClinicalTrials.gov Scientific Articles on PubMed (1 link) PubMed OMIM (1 link) ...
A Novel (S)-6-Hydroxynicotine Oxidase Gene from Shinella sp. Strain HZN7
Qiu, Jiguo; Wei, Yin; Ma, Yun; Wen, Rongti; Wen, Yuezhong
2014-01-01
Nicotine is an important environmental toxicant in tobacco waste. Shinella sp. strain HZN7 can metabolize nicotine into nontoxic compounds via variations of the pyridine and pyrrolidine pathways. However, the catabolic mechanism of this variant pathway at the gene or enzyme level is still unknown. In this study, two 6-hydroxynicotine degradation-deficient mutants, N7-M9 and N7-W3, were generated by transposon mutagenesis. The corresponding mutant genes, designated nctB and tnp2, were cloned and analyzed. The nctB gene encodes a novel flavin adenine dinucleotide-containing (S)-6-hydroxynicotine oxidase that converts (S)-6-hydroxynicotine into 6-hydroxy-N-methylmyosmine and then spontaneously hydrolyzes into 6-hydroxypseudooxynicotine. The deletion and complementation of the nctB gene showed that this enzyme is essential for nicotine or (S)-6-hydroxynicotine degradation. Purified NctB could also convert (S)-nicotine into N-methylmyosmine, which spontaneously hydrolyzed into pseudooxynicotine. The kinetic constants of NctB toward (S)-6-hydroxynicotine (Km = 0.019 mM, kcat = 7.3 s−1) and nicotine (Km = 2.03 mM, kcat = 0.396 s−1) indicated that (S)-6-hydroxynicotine is the preferred substrate in vivo. NctB showed no activities toward the R enantiomer of nicotine or 6-hydroxynicotine. Strain HZN7 could degrade (R)-nicotine into (R)-6-hydroxynicotine without any further degradation. The tnp2 gene from mutant N7-W3 encodes a putative transposase, and its deletion did not abolish the nicotine degradation activity. This study advances the understanding of the microbial diversity of nicotine biodegradation. PMID:25002425
Genes for cytochrome c oxidase subunit I, URF2, and three tRNAs in Drosophila mitochondrial DNA.
Clary, D O; Wolstenholme, D R
1983-01-01
Genes for URF2, tRNAtrp, tRNAcys, tRNAtyr and cytochrome c oxidase subunit I (COI) have been identified within a sequenced segment of the Drosophila yakuba mtDNA molecule. The five genes are arranged in the order given. Transcription of the tRNAcys and tRNAtyr genes is in the same direction as replication, while transcription of the URF2, tRNAtrp and COI genes is in the opposite direction. A similar arrangement of these genes is found in mammalian mtDNA except that in the latter, the tRNAala and tRNAasn genes are located between the tRNAtrp and tRNAcys genes. Also, a sequence found between the tRNAasn and tRNAcys genes in mammalian mtDNA, which is associated with the initiation of second strand DNA synthesis, is not found in this region of the D. yakuba mtDNA molecule. As the D. yakuba COI gene lacks a standard translation initiation codon, we consider the possibility that the quadruplet ATAA may serve this function. As in other D. yakuba mitochondrial polypeptide genes, AGA codons in the URF2 and COI genes do not correspond in position to arginine-specifying codons in the equivalent genes of mouse and yeast mtDNAs, but do most frequently correspond to serine-specifying codons. PMID:6314262
Effect of GA3 treatment on seed development and seed-related gene expression in grape.
Cheng, Chenxia; Xu, Xiaozhao; Singer, Stacy D; Li, Jun; Zhang, Hongjing; Gao, Min; Wang, Li; Song, Junyang; Wang, Xiping
2013-01-01
The phytohormone gibberellic acid (GA3) is widely used in the table grape industry to induce seedlessness in seeded varieties. However, there is a paucity of information concerning the mechanisms by which GAs induce seedlessness in grapes. In an effort to systematically analyze the cause of this GA3-induced seed abortion, we conducted an in depth characterization of two seeded grape cultivars ('Kyoho' and 'Red Globe'), along with a seedless cultivar ('Thompson Seedless'), following treatment with GA3. In a similar fashion to the seedless control, which exhibited GA3-induced abortion of the seeds 9 days after full bloom (DAF), both 'Kyoho' and 'Red Globe' seeded varieties exhibited complete abortion of the seeds 15 DAF when treated with GA3. Morphological analyses indicated that while fertilization appeared to occur normally following GA3 treatment, as well as in the untreated seedless control cultivar, seed growth eventually ceased. In addition, we found that GA3 application had an effect on redox homeostasis, which could potentially cause cell damage and subsequent seed abortion. Furthermore, we carried out an analysis of antioxidant enzyme activities, as well as transcript levels from various genes believed to be involved in seed development, and found several differences between GA3-treated and untreated controls. Therefore, it seems that the mechanisms driving GA3-induced seedlessness are similar in both seeded and seedless cultivars, and that the observed abortion of seeds may result at least in part from a GA3-induced increase in cell damage caused by reactive oxygen species, a decrease in antioxidant enzymatic activities, and an alteration of the expression of genes related to seed development.
Guo, Chuan-yu; Wu, Guang-heng; Xing, Jin; Li, Wen-qi; Tang, Ding-zhong; Cui, Bai-ming
2013-05-01
A gene encoding a coproporphyrinogen III oxidase mediates disease resistance in plants by the salicylic acid pathway. A number of genes that regulate powdery mildew resistance have been identified in Arabidopsis, such as ENHANCED DISEASE RESISTANCE 1 to 3 (EDR1 to 3). To further study the molecular interactions between the powdery mildew pathogen and Arabidopsis, we isolated and characterized a mutant that exhibited enhanced resistance to powdery mildew. The mutant also showed dramatic powdery mildew-induced cell death as well as growth defects and early senescence in the absence of pathogens. We identified the affected gene by map-based cloning and found that the gene encodes a coproporphyrinogen III oxidase, a key enzyme in the tetrapyrrole biosynthesis pathway, previously known as LESION INITIATION 2 (LIN2). Therefore, we designated the mutant lin2-2. Further studies revealed that the lin2-2 mutant also displayed enhanced resistance to Hyaloperonospora arabidopsidis (H.a.) Noco2. Genetic analysis showed that the lin2-2-mediated disease resistance and spontaneous cell death were dependent on PHYTOALEXIN DEFICIENT 4 (PAD4), SALICYLIC ACID INDUCTION-DEFICIENT 2 (SID2), and NONEXPRESSOR OF PATHOGENESIS-RELATED GENES 1 (NPR1), which are all involved in salicylic acid signaling. Furthermore, the relative expression levels of defense-related genes were induced after powdery mildew infection in the lin2-2 mutant. These data indicated that LIN2 plays an important role in cell death control and defense responses in plants.
Eo, JungWoo; Lee, Hee-Eun; Nam, Gyu-Hwi; Kwon, Yun-Jeong; Choi, Yuri; Choi, Bong-Hwan; Huh, Jae-Won; Kim, Minkyu; Lee, Sang-Eun; Seo, Bohyun; Kim, Heui-Soo
2016-04-15
The monoamine oxidase A (MAOA) gene is an important candidate gene for human behavior that encodes an enzyme regulating the metabolism of key neurotransmitters. The regulatory mechanisms of the MAOA gene in dogs are yet to be elucidated. We measured MAOA gene transcription and analyzed the VNTR genotype and methylation status of the gene promoter region in different dog breeds to determine whether MAOA expression is correlated with the MAOA genotype or epigenetic modification in dogs. We found brain-specific expression of the MAOA gene and different transcription levels in different dog breeds including Beagle, Sapsaree, and German shepherd, and also a robust association of the DNA methylation of the gene promoter with mRNA levels. However, the 90 bp tandem repeats that we observed near the transcription start site were not variable, indicating no correlation with canine MAOA activity. These results show that differential DNA methylation in the MAOA promoter region may affect gene expression by modulating promoter activity. Moreover, the distinctive patterns of MAOA expression and DNA methylation may be involved in breed-specific or individual behavioral characteristics, such as aggression, because behavioral phenotypes are related to different physiological and neuroendocrine responses. Copyright © 2016 Elsevier B.V. All rights reserved.
Liu, Taibo; Wook Kim, Dong; Niitsu, Masaru; Berberich, Thomas; Kusano, Tomonobu
2014-01-01
POLYAMINE OXIDASE 1 (OsPAO1), from rice (Oryza sativa), and POLYAMINE OXIDASE 5 (AtPAO5), from Arabidopsis (Arabidopsis thaliana), are enzymes sharing high identity at the amino acid level and with similar characteristics, such as polyamine specificity and pH preference; furthermore, both proteins localize to the cytosol. A loss-of-function Arabidopsis mutant, Atpao5-2, was hypersensitive to low doses of exogenous thermospermine but this phenotype could be rescued by introduction of the wild-type AtPAO5 gene. Introduction of OsPAO1, under the control of a constitutive promoter, into Atpao5-2 mutants also restored normal thermospermine sensitivity, allowing growth in the presence of low levels of thermospermine, along with a concomitant decrease in thermospermine content in plants. By contrast, introduction of OsPAO3, which encodes a peroxisome-localized polyamine oxidase, into Atpao5-2 plants could not rescue any of the mutant phenotypes in the presence of thermospermine. These results suggest that OsPAO1 is the functional ortholog of AtPAO5.
Gao, Zhaowei; Li, Zhuofu; Zhang, Yuhong; Huang, Huoqing; Li, Mu; Zhou, Liwei; Tang, Yunming; Yao, Bin; Zhang, Wei
2012-03-01
The glucose oxidase (GOD) gene from Penicillium notatum was expressed in Pichia pastoris. The 1,815 bp gene, god-w, encodes 604 amino acids. Recombinant GOD-w had optimal activity at 35-40°C and pH 6.2 and was stable, from pH 3 to 7 maintaining >75% maximum activity after incubation at 50°C for 1 h. GOD-w worked as well as commercial GODs to improve bread making. To achieve high-level expression of recombinant GOD in P. pastoris, 272 nucleotides involving 228 residues were mutated, consistent with the codon bias of P. pastoris. The optimized recombinant GOD-m yielded 615 U ml(-1) (2.5 g protein l(-1)) in a 3 l fermentor--410% higher than GOD-w (148 U ml(-1)), and thus is a low-cost alternative for the bread baking industry.
Exploiting algal NADPH oxidase for biophotovoltaic energy
Anderson, Alexander; Laohavisit, Anuphon; Blaby, Ian K.; ...
2015-01-29
Photosynthetic microbes exhibit light-dependent electron export across the cell membrane, which can generate electricity in biological photovoltaic (BPV) devices. How electrons are exported remains to be determined; the identification of mechanisms would help selection or generation of photosynthetic microbes capable of enhanced electrical output. We show that plasma membrane NADPH oxidase activity is a significant component of light-dependent generation of electricity by the unicellular green alga Chlamydomonas reinhardtii. NADPH oxidases export electrons across the plasma membrane to form superoxide anion from oxygen. The C. reinhardtii mutant lacking the NADPH oxidase encoded by RBO1 is impaired in both extracellular superoxide anionmore » production and current generation in a BPV device. Complementation with the wild-type gene restores both capacities, demonstrating the role of the enzyme in electron export. Monitoring light-dependent extracellular superoxide production with a colorimetric assay is shown to be an effective way of screening for electrogenic potential of candidate algal strains. Furthermore, the results show that algal NADPH oxidases are important for superoxide anion production and open avenues for optimizing the biological component of these devices.« less
Molecular and Biochemical Characterization of a Cytokinin Oxidase from Maize1
Bilyeu, Kristin D.; Cole, Jean L.; Laskey, James G.; Riekhof, Wayne R.; Esparza, Thomas J.; Kramer, Michelle D.; Morris, Roy O.
2001-01-01
It is generally accepted that cytokinin oxidases, which oxidatively remove cytokinin side chains to produce adenine and the corresponding isopentenyl aldehyde, play a major role in regulating cytokinin levels in planta. Partially purified fractions of cytokinin oxidase from various species have been studied for many years, but have yet to clearly reveal the properties of the enzyme or to define its biological significance. Details of the genomic organization of the recently isolated maize (Zea mays) cytokinin oxidase gene (ckx1) and some of its Arabidopsis homologs are now presented. Expression of an intronless ckx1 in Pichia pastoris allowed production of large amounts of recombinant cytokinin oxidase and facilitated detailed kinetic and cofactor analysis and comparison with the native enzyme. The enzyme is a flavoprotein containing covalently bound flavin adenine dinucleotide, but no detectable heavy metals. Expression of the oxidase in maize tissues is described. PMID:11154345
Effect of GA3 Treatment on Seed Development and Seed-Related Gene Expression in Grape
Cheng, Chenxia; Xu, Xiaozhao; Singer, Stacy D.; Li, Jun; Zhang, Hongjing; Gao, Min; Wang, Li; Song, Junyang; Wang, Xiping
2013-01-01
Background The phytohormone gibberellic acid (GA3) is widely used in the table grape industry to induce seedlessness in seeded varieties. However, there is a paucity of information concerning the mechanisms by which GAs induce seedlessness in grapes. Methodology/Principal Findings In an effort to systematically analyze the cause of this GA3-induced seed abortion, we conducted an in depth characterization of two seeded grape cultivars (‘Kyoho’ and ‘Red Globe’), along with a seedless cultivar (‘Thompson Seedless’), following treatment with GA3. In a similar fashion to the seedless control, which exhibited GA3-induced abortion of the seeds 9 days after full bloom (DAF), both ‘Kyoho’ and ‘Red Globe’ seeded varieties exhibited complete abortion of the seeds 15 DAF when treated with GA3. Morphological analyses indicated that while fertilization appeared to occur normally following GA3 treatment, as well as in the untreated seedless control cultivar, seed growth eventually ceased. In addition, we found that GA3 application had an effect on redox homeostasis, which could potentially cause cell damage and subsequent seed abortion. Furthermore, we carried out an analysis of antioxidant enzyme activities, as well as transcript levels from various genes believed to be involved in seed development, and found several differences between GA3-treated and untreated controls. Conclusion Therefore, it seems that the mechanisms driving GA3-induced seedlessness are similar in both seeded and seedless cultivars, and that the observed abortion of seeds may result at least in part from a GA3-induced increase in cell damage caused by reactive oxygen species, a decrease in antioxidant enzymatic activities, and an alteration of the expression of genes related to seed development. PMID:24224035
Y Chromosome Regulation of Autism Susceptibility Genes
2009-06-01
with human -like spontaneous mutation. Neuroreport, 2008. 19(7): p. 739-43. 60. Lin, Y.M., et al., Association analysis of monoamine oxidase A gene and...susceptibility genes, including the monoamine oxidase A (MOAA), mediator complex subunit 12 (MED12), homeobox B1 (HOXB1) gastrin-releasing peptide...autism susceptibility genes, the RET proto- oncogene and monoamine oxidase A (MAOA) gene for detail studies. MAOA deaminates monoamines and is involved
A novel (S)-6-hydroxynicotine oxidase gene from Shinella sp. strain HZN7.
Qiu, Jiguo; Wei, Yin; Ma, Yun; Wen, Rongti; Wen, Yuezhong; Liu, Weiping
2014-09-01
Nicotine is an important environmental toxicant in tobacco waste. Shinella sp. strain HZN7 can metabolize nicotine into nontoxic compounds via variations of the pyridine and pyrrolidine pathways. However, the catabolic mechanism of this variant pathway at the gene or enzyme level is still unknown. In this study, two 6-hydroxynicotine degradation-deficient mutants, N7-M9 and N7-W3, were generated by transposon mutagenesis. The corresponding mutant genes, designated nctB and tnp2, were cloned and analyzed. The nctB gene encodes a novel flavin adenine dinucleotide-containing (S)-6-hydroxynicotine oxidase that converts (S)-6-hydroxynicotine into 6-hydroxy-N-methylmyosmine and then spontaneously hydrolyzes into 6-hydroxypseudooxynicotine. The deletion and complementation of the nctB gene showed that this enzyme is essential for nicotine or (S)-6-hydroxynicotine degradation. Purified NctB could also convert (S)-nicotine into N-methylmyosmine, which spontaneously hydrolyzed into pseudooxynicotine. The kinetic constants of NctB toward (S)-6-hydroxynicotine (Km = 0.019 mM, kcat = 7.3 s(-1)) and nicotine (Km = 2.03 mM, kcat = 0.396 s(-1)) indicated that (S)-6-hydroxynicotine is the preferred substrate in vivo. NctB showed no activities toward the R enantiomer of nicotine or 6-hydroxynicotine. Strain HZN7 could degrade (R)-nicotine into (R)-6-hydroxynicotine without any further degradation. The tnp2 gene from mutant N7-W3 encodes a putative transposase, and its deletion did not abolish the nicotine degradation activity. This study advances the understanding of the microbial diversity of nicotine biodegradation. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Analysis of the cytochrome c oxidase subunit II (COX2) gene in giant panda, Ailuropoda melanoleuca.
Ling, S S; Zhu, Y; Lan, D; Li, D S; Pang, H Z; Wang, Y; Li, D Y; Wei, R P; Zhang, H M; Wang, C D; Hu, Y D
2017-01-23
The giant panda, Ailuropoda melanoleuca (Ursidae), has a unique bamboo-based diet; however, this low-energy intake has been sufficient to maintain the metabolic processes of this species since the fourth ice age. As mitochondria are the main sites for energy metabolism in animals, the protein-coding genes involved in mitochondrial respiratory chains, particularly cytochrome c oxidase subunit II (COX2), which is the rate-limiting enzyme in electron transfer, could play an important role in giant panda metabolism. Therefore, the present study aimed to isolate, sequence, and analyze the COX2 DNA from individuals kept at the Giant Panda Protection and Research Center, China, and compare these sequences with those of the other Ursidae family members. Multiple sequence alignment showed that the COX2 gene had three point mutations that defined three haplotypes, with 60% of the sequences corresponding to haplotype I. The neutrality tests revealed that the COX2 gene was conserved throughout evolution, and the maximum likelihood phylogenetic analysis, using homologous sequences from other Ursidae species, showed clustering of the COX2 sequences of giant pandas, suggesting that this gene evolved differently in them.
Development of a 2.0 eV AlGaInP Solar Cell Grown by OMVPE
DOE Office of Scientific and Technical Information (OSTI.GOV)
Perl, Emmett E.; Simon, John; Geisz, John F.
2015-06-14
AlGaInP solar cells with a bandgap (Eg) of ~2.0 eV are developed for use in next-generation multijunction photovoltaic devices. This material system is of great interest for both space and concentrator photovoltaics due to its high bandgap, which enables the development of high-efficiency five-junction and six-junction devices and is also useful for solar cells operated at elevated temperatures. In this work, we explore the conditions for the Organometallic Vapor Phase Epitaxy (OMVPE) growth of AlGaInP and study their effects on cell performance. A ~2.0 eV AlGaInP solar cell is demonstrated with an open circuit voltage (VOC) of 1.59V, a bandgap-voltagemore » offset (WOC) of 420mV, a fill factor (FF) of 88.0%, and an efficiency of 14.8%. These AlGaInP cells have attained a similar FF, WOC and internal quantum efficiency (IQE) to the best upright GaInP cells grown in our lab to date.« less
Kanno, Yuri; Jordan, Mark C.; Kamiya, Yuji; Seo, Mitsunori; Ayele, Belay T.
2013-01-01
Treatments that promote dormancy release are often correlated with changes in seed hormone content and/or sensitivity. To understand the molecular mechanisms underlying the role of after-ripening (seed dry storage) in triggering hormone related changes and dormancy decay in wheat (Triticum aestivum), temporal expression patterns of genes related to abscisic acid (ABA), gibberellin (GA), jasmonate and indole acetic acid (IAA) metabolism and signaling, and levels of the respective hormones were examined in dormant and after-ripened seeds in both dry and imbibed states. After-ripening mediated developmental switch from dormancy to germination appears to be associated with declines in seed sensitivity to ABA and IAA, which are mediated by transcriptional repressions of PROTEIN PHOSPHATASE 2C, SNF1-RELATED PROTEIN KINASE2, ABA INSENSITIVE5 and LIPID PHOSPHATE PHOSPHTASE2, and AUXIN RESPONSE FACTOR and RELATED TO UBIQUITIN1 genes. Transcriptomic analysis of wheat seed responsiveness to ABA suggests that ABA inhibits the germination of wheat seeds partly by repressing the transcription of genes related to chromatin assembly and cell wall modification, and activating that of GA catabolic genes. After-ripening induced seed dormancy decay in wheat is also associated with the modulation of seed IAA and jasmonate contents. Transcriptional control of members of the ALLENE OXIDE SYNTHASE, 3-KETOACYL COENZYME A THIOLASE, LIPOXYGENASE and 12-OXOPHYTODIENOATE REDUCTASE gene families appears to regulate seed jasmonate levels. Changes in the expression of GA biosynthesis genes, GA 20-OXIDASE and GA 3-OXIDASE, in response to after-ripening implicate this hormone in enhancing dormancy release and germination. These findings have important implications in the dissection of molecular mechanisms underlying regulation of seed dormancy in cereals. PMID:23437172
The monoamine oxidase A gene promoter repeat and prostate cancer risk.
White, Thomas A; Kwon, Erika M; Fu, Rong; Lucas, Jared M; Ostrander, Elaine A; Stanford, Janet L; Nelson, Peter S
2012-11-01
Amine catabolism by monoamine oxidase A (MAOA) contributes to oxidative stress, which plays a role in prostate cancer (PCa) development and progression. An upstream variable-number tandem repeat (uVNTR) in the MAOA promoter influences gene expression and activity, and may thereby affect PCa susceptibility. Caucasian (n = 2,572) men from two population-based case-control studies of PCa were genotyped for the MAOA-VNTR. Logistic regression was used to assess PCa risk in relation to genotype. Common alleles of the MAOA-VNTR were not associated with the relative risk of PCa, nor did the relationship differ by clinical features of the disease. The rare 5-copy variant (frequency: 0.5% in cases; 1.8% in controls), however, was associated with a reduced PCa risk (odds ratio, OR = 0.30, 95% CI 0.13-0.71). A rare polymorphism of the MAOA promoter previously shown to confer low expression was associated with a reduced risk of developing PCa. This novel finding awaits confirmation in other study populations. Copyright © 2012 Wiley Periodicals, Inc.
Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel
1987-01-01
Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332
Zhou, Fasong; Zhang, Ziguo; Gregersen, Per L.; Mikkelsen, Jørn D.; de Neergaard, Eigil; Collinge, David B.; Thordal-Christensen, Hans
1998-01-01
Previously we reported that oxalate oxidase activity increases in extracts of barley (Hordeum vulgare) leaves in response to the powdery mildew fungus (Blumeria [syn. Erysiphe] graminis f.sp. hordei) and proposed this as a source of H2O2 during plant-pathogen interactions. In this paper we show that the N terminus of the major pathogen-response oxalate oxidase has a high degree of sequence identity to previously characterized germin-like oxalate oxidases. Two cDNAs were isolated, pHvOxOa, which represents this major enzyme, and pHvOxOb', representing a closely related enzyme. Our data suggest the presence of only two oxalate oxidase genes in the barley genome, i.e. a gene encoding HvOxOa, which possibly exists in several copies, and a single-copy gene encoding HvOxOb. The use of 3′ end gene-specific probes has allowed us to demonstrate that the HvOxOa transcript accumulates to 6 times the level of the HvOxOb transcript in response to the powdery mildew fungus. The transcripts were detected in both compatible and incompatible interactions with a similar accumulation pattern. The oxalate oxidase is found exclusively in the leaf mesophyll, where it is cell wall located. A model for a signal transduction pathway in which oxalate oxidase plays a central role is proposed for the regulation of the hypersensitive response. PMID:9576772
Involvement of NADH Oxidase in Biofilm Formation in Streptococcus sanguinis
Ge, Xiuchun; Shi, Xiaoli; Shi, Limei; Liu, Jinlin; Stone, Victoria; Kong, Fanxiang; Kitten, Todd; Xu, Ping
2016-01-01
Biofilms play important roles in microbial communities and are related to infectious diseases. Here, we report direct evidence that a bacterial nox gene encoding NADH oxidase is involved in biofilm formation. A dramatic reduction in biofilm formation was observed in a Streptococcus sanguinis nox mutant under anaerobic conditions without any decrease in growth. The membrane fluidity of the mutant bacterial cells was found to be decreased and the fatty acid composition altered, with increased palmitic acid and decreased stearic acid and vaccenic acid. Extracellular DNA of the mutant was reduced in abundance and bacterial competence was suppressed. Gene expression analysis in the mutant identified two genes with altered expression, gtfP and Idh, which were found to be related to biofilm formation through examination of their deletion mutants. NADH oxidase-related metabolic pathways were analyzed, further clarifying the function of this enzyme in biofilm formation. PMID:26950587
Exercise Training, NADPH Oxidase p22phox Gene Polymorphisms, and Hypertension
FEAIRHELLER, DEBORAH L.; BROWN, MICHAEL D.; PARK, JOON-YOUNG; BRINKLEY, TINA E.; BASU, SAMAR; HAGBERG, JAMES M.; FERRELL, ROBERT E.; FENTY-STEWART, NICOLA M.
2010-01-01
Introduction Oxidative stress that is mediated through NADPH oxidase activity plays a role in the pathology of hypertension, and aerobic exercise training reduces NADPH oxidase activity. The involvement of genetic variation in the p22phox (CYBA) subunit genes in individual oxidative stress responses to aerobic exercise training has yet to be examined in Pre and Stage 1 hypertensives. Methods Ninety-four sedentary Pre and Stage 1 hypertensive adults underwent 6 months of aerobic exercise training at a level of 70% V̇O2max to determine whether the CYBA polymorphisms, C242T and A640G, were associated with changes in urinary 8-iso-prostaglandin F2α (8-iso-PGF2α), urinary nitric oxide metabolites (NOx), and plasma total antioxidant capacity (TAC). Results Demographic and subject characteristics were similar among genotype groups for both polymorphisms. At baseline, a significant (P = 0.03) difference among the C2424T genotype groups in 8-iso-PGF2α levels was detected, with the TT homozygotes having the lowest levels and the CC homozygotes having the highest levels. However, no differences were found at baseline between the A640G genotype groups. After 6 months of aerobic exercise training, there was a significant increase in V̇O2max (P < 0.0001) in the entire study population. In addition, there were significant increases in both urinary 8-iso-PGF2α (P = 0.002) and plasma TAC (P = 0.03) levels and a significant decrease in endogenous urinary NOx (P < 0.0001). Overall, aerobic exercise training elicited no significant differences among genotype groups in either CYBA variant for any of the oxidative stress variables. Conclusions We found that compared with CYBA polymorphisms C242T and A640G, it was aerobic exercise training that had the greatest influence on the selected biomarkers; furthermore, our results suggest that the C242T CYBA variant influences baseline levels of urinary 8-iso-PGF2α but not the aerobic exercise-induced responses. PMID:19516159
Bordukalo-Niksic, Tatjana; Stefulj, Jasminka; Matosic, Ana; Mokrovic, Gordana; Cicin-Sain, Lipa
2012-12-30
The combinatory effect of polymorphisms in serotonin transporter and monoamine oxidase-A genes on the aetiopathogenesis of alcoholism was investigated in a sample of 714 individuals. Increased frequency of subjects having three 'suspected' genotypes (5-HTTLPR-LL, STin2-1010 and MAO-A 3-repeat allele) was found among type-2 alcoholic patients (P=0.0189). Results highlight serotonergic/genetic contribution to early-onset alcoholism. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
Identification of NADPH oxidase family members associated with cold stress in strawberry.
Zhang, Yunting; Li, Yali; He, Yuwei; Hu, Wenjie; Zhang, Yong; Wang, Xiaorong; Tang, Haoru
2018-04-01
NADPH oxidase is encoded by a small gene family (Respiratory burst oxidase homologs, Rbohs ) and plays an important role in regulating various biological processes. However, little information about this gene family is currently available for strawberry. In this study, a total of seven Rboh genes were identified from strawberry through genomewide analysis. Gene structure analysis showed the number of exons ranged from 10 to 23, implying that this variation occurred in FvRboh genes by the insertion and distribution of introns; the order and approximate size of exons were relatively conserved. FvRbohC was predicted to localize to the thylakoid membrane of the chloroplast, while other members were computed to localize to the plasma membrane, indicating different functions. Amino acid sequence alignment, conserved domain, and motif analysis showed that all identified FvRbohs had typical features of plant Rbohs. Phylogenetic analysis of Rbohs from strawberry, grape, Arabidopsis, and rice suggested that the FvRbohs could be divided into five subgroups and showed a closer relationship with those from grape and Arabidopsis than those from rice. The expression patterns of FvRboh genes in root, stem, leaf, flower, and fruit revealed robust tissue specificity. The expression levels of FvRbohA and FvRbohD were quickly induced by cold stress, followed by an increase in NADPH oxidase activity, leading to O2- accumulation and triggering the antioxidant reaction by the transient increases in SOD activity. This suggested these two genes may be involved in cold stress and defense responses in strawberry.
Characterization of the cydAB-Encoded Cytochrome bd Oxidase from Mycobacterium smegmatis
Kana, Bavesh D.; Weinstein, Edward A.; Avarbock, David; Dawes, Stephanie S.; Rubin, Harvey; Mizrahi, Valerie
2001-01-01
The cydAB genes from Mycobacterium smegmatis have been cloned and characterized. The cydA and cydB genes encode the two subunits of a cytochrome bd oxidase belonging to the widely distributed family of quinol oxidases found in prokaryotes. The cydD and cydC genes located immediately downstream of cydB encode a putative ATP-binding cassette-type transporter. At room temperature, reduced minus oxidized difference spectra of membranes purified from wild-type M. smegmatis displayed spectral features that are characteristic of the γ-proteobacterial type cytochrome bd oxidase. Inactivation of cydA or cydB by insertion of a kanamycin resistance marker resulted in loss of d-heme absorbance at 631 nm. The d-heme could be restored by transformation of the M. smegmatis cyd mutants with a replicating plasmid carrying the highly homologous cydABDC gene cluster from Mycobacterium tuberculosis. Inactivation of cydA had no effect on the ability of M. smegmatis to exit from stationary phase at 37 or 42°C. The growth rate of the cydA mutant was tested under oxystatic conditions. Although no discernible growth defect was observed under moderately aerobic conditions (9.2 to 37.5 × 102 Pa of pO2 or 5 to 21% air saturation), the mutant displayed a significant growth disadvantage when cocultured with the wild type under extreme microaerophilia (0.8 to 1.7 × 102 Pa of pO2 or 0.5 to 1% air saturation). These observations were in accordance with the two- to threefold increase in cydAB gene expression observed upon reduction of the pO2 of the growth medium from 21 to 0.5% air saturation and with the concomitant increase in d-heme absorbance in spectra of membranes isolated from wild-type M. smegmatis cultured at 1% air saturation. Finally, the cydA mutant displayed a competitive growth disadvantage in the presence of the terminal oxidase inhibitor, cyanide, when cocultured with wild type at 21% air saturation in an oxystat. In conjunction with these findings, our results suggest that
Abnormal behavior associated with a point mutation in the structural gene for monoamine oxidase A
DOE Office of Scientific and Technical Information (OSTI.GOV)
Brunner, H.G.; Nelen, M.; Ropers, H.H.
1993-10-22
Genetic and metabolic studies have been done on a large kindred in which several males are affected by a syndrome of borderline mental retardation and abnormal behavior. The types of behavior that occurred include impulsive aggression, arson, attempted rape, and exhibitionism. Analysis of 24-hour urine samples indicated markedly disturbed monoamine metabolism. This syndrome was associated with a complete and selective deficiency of enzymatic activity of monoamine oxidase A (MAOA). In each of five affected males, a point mutation was identified in the eighth exon of the MAOA structural gene, which changes a glutamine to a termination codon. Thus, isolated completemore » MAOA deficiency in this family is associated with a recognizable behavioral phenotype that includes disturbed regulation of impulsive aggression.« less
Mimura, Manaki; Nagato, Yasuo; Itoh, Jun-Ichi
2012-05-01
Rice PLASTOCHRON 1 (PLA1) and PLA2 genes regulate leaf maturation and plastochron, and their loss-of-function mutants exhibit small organs and rapid leaf emergence. They encode a cytochrome P450 protein CYP78A11 and an RNA-binding protein, respectively. Their homologs in Arabidopsis and maize are also associated with plant development/organ size. Despite the importance of PLA genes in plant development, their molecular functions remain unknown. Here, we investigated how PLA1 and PLA2 genes are related to phytohormones. We found that gibberellin (GA) is the major phytohormone that promotes PLA1 and PLA2 expression. GA induced PLA1 and PLA2 expression, and conversely the GA-inhibitor uniconazole suppressed PLA1 and PLA2 expression. In pla1-4 and pla2-1 seedlings, expression levels of GA biosynthesis genes and the signal transduction gene were similar to those in wild-type seedlings. GA treatment slightly down-regulated the GA biosynthesis gene GA20ox2 and up-regulated the GA-catabolizing gene GA2ox4, whereas the GA biosynthesis inhibitor uniconazole up-regulated GA20ox2 and down-regulated GA2ox4 both in wild-type and pla mutants, suggesting that the GA feedback mechanism is not impaired in pla1 and pla2. To reveal how GA signal transduction affects the expression of PLA1 and PLA2, PLA expression in GA-signaling mutants was examined. In GA-insensitive mutant, gid1 and less-sensitive mutant, Slr1-d1, PLA1 and PLA2 expression was down-regulated. On the other hand, the expression levels of PLA1 and PLA2 were highly enhanced in a GA-constitutive-active mutant, slr1-1, causing ectopic overexpression. These results indicate that both PLA1 and PLA2 act downstream of the GA signal transduction pathway to regulate leaf development.
Arráiz, Nailet; Escalona, Carolina; Prieto, Carem; Bermúdez, Valmore; Mújica, Endrina; Sánchez, María Patricia; Mújica, Andrea
2013-10-19
The polymorphism of the resistin gene (RETN/RSTN) has been associated with metabolic alterations. In this study the association between the 3'UTR +62G>A polymorphism and metabolic syndrome components was evaluated. The population (n=218) was distributed in 3 groups: the control group with no metabolic alterations (n=77), nSMA group with isolated metabolic alterations (n=94) and MS group with metabolic syndrome (n=47). The 3'UTR +62G>A polymorphism was analyzed by PCR-RFLP. Central obesity was the most frequent alteration in both nSMA (56.4%) and MS (91.5%) groups followed by low c-HDL levels in the nSMA group (42.6%) and arterial hypertension in the MS group (85%). The frequency of the +62G/A genotype was 20.2% in the population. The G/A genotype was more frequently found in the MS (38.3%) and nSMA (17%) groups than in the control group (13%). The allelic distribution between the control group (+62G=0.94, +62A=0.06) and MS group (+62G=0.81, +62A=0.19) was significantly different (P=.0001). Significant associations between the G/A genotype and high values of abdominal circumference (P=.047), basal glycemia (P=.02) and systolic arterial pressure (P=.003) were found. The findings suggest the association between the G/A genotype and high values of systolic arterial pressure, basal glycemia and abdominal circumference. This association was independent of the metabolic syndrome context. Copyright © 2012 Elsevier España, S.L. All rights reserved.
Cloning of a phenol oxidase gene from Acremonium murorum and its expression in Aspergillus awamori.
Gouka, R J; van der Heiden, M; Swarthoff, T; Verrips, C T
2001-06-01
Fungal multicopper oxidases have many potential industrial applications, since they perform reactions under mild conditions. We isolated a phenol oxidase from the fungus Acremonium murorum var. murorum that was capable of decolorizing plant chromophores (such as anthocyanins). This enzyme is of interest in laundry-cleaning products because of its broad specificity for chromophores. We expressed an A. murorum cDNA library in Saccharomyces cerevisiae and subsequently identified enzyme-producing yeast colonies based on their ability to decolor a plant chromophore. The cDNA sequence contained an open reading frame of 1,806 bp encoding an enzyme of 602 amino acids. The phenol oxidase was overproduced by Aspergillus awamori as a fusion protein with glucoamylase, cleaved in vivo, and purified from the culture broth by hydrophobic-interaction chromatography. The phenol oxidase is active at alkaline pH (the optimum for syringaldazine is pH 9) and high temperature (optimum, 60 degrees C) and is fully stable for at least 1 h at 60 degrees C under alkaline conditions. These characteristics and the high production level of 0.6 g of phenol oxidase per liter in shake flasks, which is equimolar with the glucoamylase protein levels, make this enzyme suitable for use in processes that occur under alkaline conditions, such as laundry cleaning.
Cloning of a Phenol Oxidase Gene from Acremonium murorum and Its Expression in Aspergillus awamori
Gouka, Robin J.; van der Heiden, Monique; Swarthoff, Ton; Verrips, C. Theo
2001-01-01
Fungal multicopper oxidases have many potential industrial applications, since they perform reactions under mild conditions. We isolated a phenol oxidase from the fungus Acremonium murorum var. murorum that was capable of decolorizing plant chromophores (such as anthocyanins). This enzyme is of interest in laundry-cleaning products because of its broad specificity for chromophores. We expressed an A. murorum cDNA library in Saccharomyces cerevisiae and subsequently identified enzyme-producing yeast colonies based on their ability to decolor a plant chromophore. The cDNA sequence contained an open reading frame of 1,806 bp encoding an enzyme of 602 amino acids. The phenol oxidase was overproduced by Aspergillus awamori as a fusion protein with glucoamylase, cleaved in vivo, and purified from the culture broth by hydrophobic-interaction chromatography. The phenol oxidase is active at alkaline pH (the optimum for syringaldazine is pH 9) and high temperature (optimum, 60°C) and is fully stable for at least 1 h at 60°C under alkaline conditions. These characteristics and the high production level of 0.6 g of phenol oxidase per liter in shake flasks, which is equimolar with the glucoamylase protein levels, make this enzyme suitable for use in processes that occur under alkaline conditions, such as laundry cleaning. PMID:11375170
Li, Juan; Jiang, Jiafu; Qian, Qian; Xu, Yunyuan; Zhang, Cui; Xiao, Jun; Du, Cheng; Luo, Wei; Zou, Guoxing; Chen, Mingluan; Huang, Yunqing; Feng, Yuqi; Cheng, Zhukuan; Yuan, Ming; Chong, Kang
2011-01-01
The kinesins are a family of microtubule-based motor proteins that move directionally along microtubules and are involved in many crucial cellular processes, including cell elongation in plants. Less is known about kinesins directly regulating gene transcription to affect cellular physiological processes. Here, we describe a rice (Oryza sativa) mutant, gibberellin-deficient dwarf1 (gdd1), that has a phenotype of greatly reduced length of root, stems, spikes, and seeds. This reduced length is due to decreased cell elongation and can be rescued by exogenous gibberellic acid (GA3) treatment. GDD1 was cloned by a map-based approach, was expressed constitutively, and was found to encode the kinesin-like protein BRITTLE CULM12 (BC12). Microtubule cosedimentation assays revealed that BC12/GDD1 bound to microtubules in an ATP-dependent manner. Whole-genome microarray analysis revealed the expression of ent-kaurene oxidase (KO2), which encodes an enzyme involved in GA biosynthesis, was downregulated in gdd1. Electrophoretic mobility shift and chromatin immunoprecipitation assays revealed that GDD1 bound to the element ACCAACTTGAA in the KO2 promoter. In addition, GDD1 was shown to have transactivation activity. The level of endogenous GAs was reduced in gdd1, and the reorganization of cortical microtubules was altered. Therefore, BC12/GDD1, a kinesin-like protein with transcription regulation activity, mediates cell elongation by regulating the GA biosynthesis pathway in rice. PMID:21325138
Liu, Shiguo; Wang, Xueqin; Xu, Longqiang; Zheng, Lanlan; Ge, Yinlin; Ma, Xu
2015-02-01
To clarify the association of monoamine oxidase A- variable number of tandem repeat (MAOA-pVNTR) with susceptibility to Tourette's syndrome (TS) in Chinese Han population we discuss the genetic contribution of MAOA-VNTR in 141 TS patients including all their parents in Chinese Han population using transmission disequilibrium test (TDT) design. Our results revealed that no significant association was found in the MAOA gene promoter VNTR polymorphism and TS in Chinese Han population (TDT = 1.515, df = 1, p > 0.05). The negative result may be mainly due to the small sample size, but we don't deny the role of gene coding serotonergic or monoaminergic structures in the etiology of TS.
Carrillo-Barral, Néstor; Matilla, Angel J; Rodríguez-Gacio, María del Carmen; Iglesias-Fernández, Raquel
2014-03-01
The influence of nitrate upon the germination of Sisymbrium officinale seeds is not entirely controlled by after-ripening (AR), a process clearly influenced by nitrate. Recently, we have reported that nitrate affects sensu-stricto germination of non-AR (AR0) seeds by modifying the expression of crucial genes involved in the metabolism of GA and ABA. In this study, we demonstrate that nitrate affects also the germination of AR seeds because: (i) the AR negatively alters the ABA sensitivity being the seed more ABA-sensible as the AR is farthest from optimal (AR0 and AR20 versus AR7); in the presence of diniconazole (DZ), a competitive inhibitor of ABA 8'-hydroxylase, testa rupture is affected while the endosperm rupture is not. (ii) AR7 seed-coat rupture is not inhibited by paclobutrazol (PBZ) suggesting that nitrate can act by a mechanism GA-independent. (iii) The germination process is accelerated by nitrate, most probably by the increase in the expression of SoNCED5, SoCYP707A2 and SoGA3ox2 genes. Taken together, these and previous results demonstrate that nitrate promotes germination of AR and non-AR seeds through transcriptional changes of different genes involved in ABA and GA metabolism. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.
Genes controlling seed dormancy and pre-harvest sprouting in a rice-wheat-barley comparison.
Li, Chengdao; Ni, Peixiang; Francki, Michael; Hunter, Adam; Zhang, Yong; Schibeci, David; Li, Heng; Tarr, Allen; Wang, Jun; Cakir, Mehmet; Yu, Jun; Bellgard, Matthew; Lance, Reg; Appels, Rudi
2004-05-01
Pre-harvest sprouting results in significant economic loss for the grain industry around the world. Lack of adequate seed dormancy is the major reason for pre-harvest sprouting in the field under wet weather conditions. Although this trait is governed by multiple genes it is also highly heritable. A major QTL controlling both pre-harvest sprouting and seed dormancy has been identified on the long arm of barley chromosome 5H, and it explains over 70% of the phenotypic variation. Comparative genomics approaches among barley, wheat and rice were used to identify candidate gene(s) controlling seed dormancy and hence one aspect of pre-harvest sprouting. The barley seed dormancy/pre-harvest sprouting QTL was located in a region that showed good synteny with the terminal end of the long arm of rice chromosome 3. The rice DNA sequences were annotated and a gene encoding GA20-oxidase was identified as a candidate gene controlling the seed dormancy/pre-harvest sprouting QTL on 5HL. This chromosomal region also shared synteny with the telomere region of wheat chromosome 4AL, but was located outside of the QTL reported for seed dormancy in wheat. The wheat chromosome 4AL QTL region for seed dormancy was syntenic to both rice chromosome 3 and 11. In both cases, corresponding QTLs for seed dormancy have been mapped in rice.
Human retina-specific amine oxidase (RAO): cDNA cloning, tissue expression, and chromosomal mapping
DOE Office of Scientific and Technical Information (OSTI.GOV)
Imamura, Yutaka; Kubota, Ryo; Wang, Yimin
In search of candidate genes for hereditary retinal disease, we have employed a subtractive and differential cDNA cloning strategy and isolated a novel retina-specific cDNA. Nucleotide sequence analysis revealed an open reading frame of 2187 bp, which encodes a 729-amino-acid protein with a calculated molecular mass of 80,644 Da. The putative protein contained a conserved domain of copper amine oxidase, which is found in various species from bacteria to mammals. It showed the highest homology to bovine serum amine oxidase, which is believed to control the level of serum biogenic amines. Northern blot analysis of human adult and fetal tissuesmore » revealed that the protein is expressed abundantly and specifically in retina as a 2.7-kb transcript. Thus, we considered this protein a human retina-specific amine oxidase (RAO). The RAO gene (AOC2) was mapped by fluorescence in situ hybridization to human chromosome 17q21. We propose that AOC2 may be a candidate gene for hereditary ocular diseases. 38 refs., 4 figs.« less
Yan, Chunxia; Yan, Zongyun; Wang, Yizheng; Yan, Xiaoyuan; Han, Yuzhen
2014-01-01
The Tudor-SN protein (TSN) is universally expressed and highly conserved in eukaryotes. In Arabidopsis, TSN is reportedly involved in stress adaptation, but the mechanism involved in this adaptation is not understood. Here, we provide evidence that TSN regulates the mRNA levels of GA20ox3, a key enzyme for gibberellin (GA) biosynthesis. The levels of GA20ox3 transcripts decreased in TSN1/TSN2 RNA interference (RNAi) transgenic lines and increased in TSN1 over-expression (OE) transgenic lines. The TSN1 OE lines displayed phenotypes that may be attributed to the overproduction of GA. No obvious defects were observed in the RNAi transgenic lines under normal conditions, but under salt stress conditions these lines displayed slower growth than wild-type (WT) plants. Two mutants of GA20ox3, ga20ox3-1 and -2, also showed slower growth under stress than WT plants. Moreover, a higher accumulation of GA20ox3 transcripts was observed under salt stress. The results of a western blot analysis indicated that higher levels of TSN1 accumulated after salt treatment than under normal conditions. Subcellular localization studies showed that TSN1 was uniformly distributed in the cytoplasm under normal conditions but accumulated in small granules and co-localized with RBP47, a marker protein for stress granules (SGs), in response to salt stress. The results of RNA immunoprecipitation experiments indicated that TSN1 bound GA20ox3 mRNA in vivo. On the basis of these findings, we conclude that TSN is a novel component of plant SGs that regulates growth under salt stress by modulating levels of GA20ox3 mRNA. PMID:25205572
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wuddineh, Wegi A.; Mazarei, Mitra; Zhang, Ji -Yi
High biomass production and wide adaptation has made switchgrass ( Panicum virgatum L.) an important candidate lignocellulosic bioenergy crop. One major limitation of this and other lignocellulosic feedstocks is the recalcitrance of complex carbohydrates to hydrolysis for conversion to biofuels. Lignin is the major contributor to recalcitrance as it limits the accessibility of cell wall carbohydrates to enzymatic breakdown into fermentable sugars. Therefore, genetic manipulation of the lignin biosynthesis pathway is one strategy to reduce recalcitrance. Here, we identified a switchgrass Knotted1 transcription factor, PvKN1, with the aim of genetically engineering switchgrass for reduced biomass recalcitrance for biofuel production. Genemore » expression of the endogenous PvKN1 gene was observed to be highest in young inflorescences and stems. Ectopic overexpression of PvKN1 in switchgrass altered growth, especially in early developmental stages. Transgenic lines had reduced expression of most lignin biosynthetic genes accompanied by a reduction in lignin content suggesting the involvement of PvKN1 in the broad regulation of the lignin biosynthesis pathway. Moreover, the reduced expression of the Gibberellin 20-oxidase (GA20ox) gene in tandem with the increased expression of Gibberellin 2-oxidase (GA2ox) genes in transgenic PvKN1 lines suggest that PvKN1 may exert regulatory effects via modulation of GA signaling. Furthermore, overexpression of PvKN1 altered the expression of cellulose and hemicellulose biosynthetic genes and increased sugar release efficiency in transgenic lines. Our findings demonstrated that switchgrass PvKN1 is a putative ortholog of maize KN1 that is linked to plant lignification and cell wall and development traits as a major regulatory gene. Therefore, targeted overexpression of PvKN1 in bioenergy feedstocks may provide one feasible strategy for reducing biomass recalcitrance and simultaneously improving plant growth characteristics.« less
Wuddineh, Wegi A.; Mazarei, Mitra; Zhang, Ji -Yi; ...
2016-04-28
High biomass production and wide adaptation has made switchgrass ( Panicum virgatum L.) an important candidate lignocellulosic bioenergy crop. One major limitation of this and other lignocellulosic feedstocks is the recalcitrance of complex carbohydrates to hydrolysis for conversion to biofuels. Lignin is the major contributor to recalcitrance as it limits the accessibility of cell wall carbohydrates to enzymatic breakdown into fermentable sugars. Therefore, genetic manipulation of the lignin biosynthesis pathway is one strategy to reduce recalcitrance. Here, we identified a switchgrass Knotted1 transcription factor, PvKN1, with the aim of genetically engineering switchgrass for reduced biomass recalcitrance for biofuel production. Genemore » expression of the endogenous PvKN1 gene was observed to be highest in young inflorescences and stems. Ectopic overexpression of PvKN1 in switchgrass altered growth, especially in early developmental stages. Transgenic lines had reduced expression of most lignin biosynthetic genes accompanied by a reduction in lignin content suggesting the involvement of PvKN1 in the broad regulation of the lignin biosynthesis pathway. Moreover, the reduced expression of the Gibberellin 20-oxidase (GA20ox) gene in tandem with the increased expression of Gibberellin 2-oxidase (GA2ox) genes in transgenic PvKN1 lines suggest that PvKN1 may exert regulatory effects via modulation of GA signaling. Furthermore, overexpression of PvKN1 altered the expression of cellulose and hemicellulose biosynthetic genes and increased sugar release efficiency in transgenic lines. Our findings demonstrated that switchgrass PvKN1 is a putative ortholog of maize KN1 that is linked to plant lignification and cell wall and development traits as a major regulatory gene. Therefore, targeted overexpression of PvKN1 in bioenergy feedstocks may provide one feasible strategy for reducing biomass recalcitrance and simultaneously improving plant growth characteristics.« less
Lü, Peitao; Zhang, Changqing; Liu, Jitao; Liu, Xiaowei; Jiang, Guimei; Jiang, Xinqiang; Khan, Muhammad Ali; Wang, Liangsheng; Hong, Bo; Gao, Junping
2014-05-01
Rose (Rosa hybrida) is one of the most important ornamental plants worldwide; however, senescence of its petals terminates the ornamental value of the flower, resulting in major economic loss. It is known that the hormones abscisic acid (ABA) and ethylene promote petal senescence, while gibberellins (GAs) delay the process. However, the molecular mechanisms underlying the antagonistic effects amongst plant hormones during petal senescence are still unclear. Here we isolated RhHB1, a homeodomain-leucine zipper I transcription factor gene, from rose flowers. Quantitative RT-PCR and GUS reporter analyses showed that RhHB1 was strongly expressed in senescing petals, and its expression was induced by ABA or ethylene in petals. ABA or ethylene treatment clearly accelerated rose petal senescence, while application of the gibberellin GA3 delayed the process. However, silencing of RhHB1 delayed the ABA- or ethylene-mediated senescence, and resulted in higher petal anthocyanin levels and lower expression of RhSAG12. Moreover, treatment with paclobutrazol, an inhibitor of GA biosynthesis, repressed these delays. In addition, silencing of RhHB1 blocked the ABA- or ethylene-induced reduction in expression of the GA20 oxidase encoded by RhGA20ox1, a gene in the GA biosynthetic pathway. Furthermore, RhHB1 directly binds to the RhGA20ox1 promoter, and silencing of RhGA20ox1 promoted petal senescence. Eight senescence-related genes showed substantial differences in expression in petals after treatment with GA3 or paclobutrazol. These results suggest that RhHB1 mediates the antagonistic effect of GAs on ABA and ethylene during rose petal senescence, and that the promotion of petal senescence by ABA or ethylene operates through an RhHB1-RhGA20ox1 regulatory checkpoint. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.
Recessed Slant Gate AlGaN/GaN High Electron Mobility Transistors with 20.9 W/mm at 10 GHz
NASA Astrophysics Data System (ADS)
Pei, Yi; Chu, Rongming; Fichtenbaum, Nicholas A.; Chen, Zhen; Brown, David; Shen, Likun; Keller, Stacia; DenBaars, Steven P.; Mishra, Umesh K.
2007-12-01
A recessed slant gate processing has been used in AlGaN/GaN high electron mobility transistors (HEMTs) to mitigate the electric field, minimize the dispersion and increase the breakdown voltage. More than one order of magnitude of decrease in gate leakage has been observed by recessing the slant gate. For a 0.65 μm gate-length device, an extrinsic fT of 18 GHz and extrinsic fMAX of 52 GHz at a drain bias of 25 V were achieved. At 10 GHz, a state-of-the-art power density of 20.9 W/mm, with a power-added efficiency (PAE) of 40% at a drain bias of 83 V, was demonstrated.
NASA Astrophysics Data System (ADS)
Dudchenko, Oleksandr Ye; Pyeshkova, Viktoriya M.; Soldatkin, Oleksandr O.; Akata, Burcu; Kasap, Berna O.; Soldatkin, Alexey P.; Dzyadevych, Sergei V.
2016-02-01
The application of silicalite for improvement of enzyme adsorption on new stainless steel electrodes is reported. Glucose oxidase (GOx) was immobilized by two methods: cross-linking by glutaraldehyde (GOx-GA) and cross-linking by glutaraldehyde along with GOx adsorption on silicalite-modified electrode (SME) (GOx-SME-GA). The GOx-SME-GA biosensors were characterized by a four- to fivefold higher sensitivity than GOx-GA biosensor. It was concluded that silicalite together with GA sufficiently enhances enzyme adhesion on stainless steel electrodes. The developed GOx-SME-GA biosensors were characterized by good reproducibility of biosensor preparation (relative standard deviation (RSD)—18 %), improved signal reproducibility (RSD of glucose determination was 7 %), and good storage stability (29 % loss of activity after 18-day storage). A series of fruit juices and nectars was analyzed using GOx-SME-GA biosensor for determination of glucose concentration. The obtained results showed good correlation with the data of high-performance liquid chromatography (HPLC) ( R = 0.99).
Batth, Rituraj; Singh, Kapil; Kumari, Sumita; Mustafiz, Ananda
2017-01-01
Abiotic stress and climate change is the major concern for plant growth and crop yield. Abiotic stresses lead to enhanced accumulation of reactive oxygen species (ROS) consequently resulting in cellular damage and major losses in crop yield. One of the major scavengers of ROS is ascorbate (AA) which acts as first line of defense against external oxidants. An enzyme named ascorbate oxidase (AAO) is known to oxidize AA and deleteriously affect the plant system in response to stress. Genome-wide analysis of AAO gene family has led to the identification of five, three, seven, four, and six AAO genes in Oryza sativa, Arabidopsis, Glycine max, Zea mays, and Sorghum bicolor genomes, respectively. Expression profiling of these genes was carried out in response to various abiotic stresses and during various stages of vegetative and reproductive development using publicly available microarray database. Expression analysis in Oryza sativa revealed tissue specific expression of AAO genes wherein few members were exclusively expressed in either root or shoot. These genes were found to be regulated by both developmental cues as well as diverse stress conditions. The qRT-PCR analysis in response to salinity and drought stress in rice shoots revealed OsAAO2 to be the most stress responsive gene. On the other hand, OsAAO3 and OsAAO4 genes showed enhanced expression in roots under salinity/drought stresses. This study provides lead about important stress responsive AAO genes in various crop plants, which could be used to engineer climate resilient crop plants. PMID:28261251
González-Guzmán, Miguel; Abia, David; Salinas, Julio; Serrano, Ramón; Rodríguez, Pedro L.
2004-01-01
The abscisic aldehyde oxidase 3 (AAO3) gene product of Arabidopsis catalyzes the final step in abscisic acid (ABA) biosynthesis. An aao3-1 mutant in a Landsberg erecta genetic background exhibited a wilty phenotype in rosette leaves, whereas seed dormancy was not affected (Seo et al., 2000a). Therefore, it was speculated that a different aldehyde oxidase would be the major contributor to ABA biosynthesis in seeds (Seo et al., 2000a). Through a screening based on germination under high-salt concentration, we isolated two mutants in a Columbia genetic background, initially named sre2-1 and sre2-2 (for salt resistant). Complementation tests with different ABA-deficient mutants indicated that sre2-1 and sre2-2 mutants were allelic to aao3-1, and therefore they were renamed as aao3-2 and aao3-3, respectively. Indeed, molecular characterization of the aao3-2 mutant revealed a T-DNA insertional mutation that abolished the transcription of AAO3 gene, while sequence analysis of AAO3 in aao3-3 mutant revealed a deletion of three nucleotides and several missense mutations. Physiological characterization of aao3-2 and aao3-3 mutants revealed a wilty phenotype and osmotolerance in germination assays. In contrast to aao3-1, both aao3-2 and aao3-3 mutants showed a reduced dormancy. Accordingly, ABA levels were reduced in dry seeds and rosette leaves of both aao3-2 and aao3-3. Taken together, these results indicate that AAO3 gene product plays a major role in seed ABA biosynthesis. PMID:15122034
Wang, Wei; Liu, Ji-Hong
2015-01-25
Polyamine oxidases (PAOs) are FAD-dependent enzymes associated with polyamine catabolism. In plants, increasing evidences support that PAO genes play essential roles in abiotic and biotic stresses response. In this study, six putative PAO genes (CsPAO1-CsPAO6) were unraveled in sweet orange (Citrus sinensis) using the released citrus genome sequences. A total of 203 putative cis-regulatory elements involved in hormone and stress response were predicted in 1.5-kb promoter regions at the upstream of CsPAOs. The CsPAOs can be divided into four major groups, with similar organizations with their counterparts of Arabidopsis thaliana. Transcripts of CsPAOs were detected in leaf, stem, cotyledon, and root, with the highest levels detected in the roots. The CsPAOs displayed various responses to exogenous treatments with polyamines and ABA and were differentially altered by abiotic stresses, including cold, salt, and mannitol. Overexpression of CsPAO3 in tobacco demonstrated that spermidine and spermine were decreased in the transgenic line, while putrescine was significantly enhanced, implying a potential role of this gene in polyamine back conversion. These data provide valuable knowledge for understanding the roles of the PAO genes in the future. Copyright © 2014 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Kang, B. S.; Wang, H. T.; Ren, F.; Pearton, S. J.; Morey, T. E.; Dennis, D. M.; Johnson, J. W.; Rajagopal, P.; Roberts, J. C.; Piner, E. L.; Linthicum, K. J.
2007-12-01
ZnO nanorod-gated AlGaN /GaN high electron mobility transistors (HEMTs) are demonstrated for the detection of glucose. A ZnO nanorod array was selectively grown on the gate area using low temperature hydrothermal decomposition to immobilize glucose oxidase (GOx). The one-dimensional ZnO nanorods provide a large effective surface area with high surface-to-volume ratio and provide a favorable environment for the immobilization of GOx. The AlGaN /GaN HEMT drain-source current showed a rapid response of less than 5s when target glucose in a buffer with a pH value of 7.4 was added to the GOx immobilized on the ZnO nanorod surface. We could detect a wide range of concentrations from 0.5nMto125μM. The sensor exhibited a linear range from 0.5nMto14.5μM and an experiment limit of detection of 0.5nM. This demonstrates the possibility of using AlGaN /GaN HEMTs for noninvasive exhaled breath condensate based glucose detection of diabetic application.
NADPH Oxidase as a Therapeutic Target for Oxalate Induced Injury in Kidneys
Peck, Ammon B.; Khan, Saeed R.
2013-01-01
A major role of the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase family of enzymes is to catalyze the production of superoxides and other reactive oxygen species (ROS). These ROS, in turn, play a key role as messengers in cell signal transduction and cell cycling, but when they are produced in excess they can lead to oxidative stress (OS). Oxidative stress in the kidneys is now considered a major cause of renal injury and inflammation, giving rise to a variety of pathological disorders. In this review, we discuss the putative role of oxalate in producing oxidative stress via the production of reactive oxygen species by isoforms of NADPH oxidases expressed in different cellular locations of the kidneys. Most renal cells produce ROS, and recent data indicate a direct correlation between upregulated gene expressions of NADPH oxidase, ROS, and inflammation. Renal tissue expression of multiple NADPH oxidase isoforms most likely will impact the future use of different antioxidants and NADPH oxidase inhibitors to minimize OS and renal tissue injury in hyperoxaluria-induced kidney stone disease. PMID:23840917
CotA, a Multicopper Oxidase from Bacillus pumilus WH4, Exhibits Manganese-Oxidase Activity
Su, Jianmei; Bao, Peng; Bai, Tenglong; Deng, Lin; Wu, Hui; Liu, Fan; He, Jin
2013-01-01
Multicopper oxidases (MCOs) are a family of enzymes that use copper ions as cofactors to oxidize various substrates. Previous research has demonstrated that several MCOs such as MnxG, MofA and MoxA can act as putative Mn(II) oxidases. Meanwhile, the endospore coat protein CotA from Bacillus species has been confirmed as a typical MCO. To study the relationship between CotA and the Mn(II) oxidation, the cotA gene from a highly active Mn(II)-oxidizing strain Bacillus pumilus WH4 was cloned and overexpressed in Escherichia coli strain M15. The purified CotA contained approximately four copper atoms per molecule and showed spectroscopic properties typical of blue copper oxidases. Importantly, apart from the laccase activities, the CotA also displayed substantial Mn(II)-oxidase activities both in liquid culture system and native polyacrylamide gel electrophoresis. The optimum Mn(II) oxidase activity was obtained at 53°C in HEPES buffer (pH 8.0) supplemented with 0.8 mM CuCl2. Besides, the addition of o-phenanthroline and EDTA both led to a complete suppression of Mn(II)-oxidizing activity. The specific activity of purified CotA towards Mn(II) was 0.27 U/mg. The Km, Vmax and kcat values towards Mn(II) were 14.85±1.17 mM, 3.01×10−6±0.21 M·min−1 and 0.32±0.02 s−1, respectively. Moreover, the Mn(II)-oxidizing activity of the recombinant E. coli strain M15-pQE-cotA was significantly increased when cultured both in Mn-containing K liquid medium and on agar plates. After 7-day liquid cultivation, M15-pQE-cotA resulted in 18.2% removal of Mn(II) from the medium. Furthermore, the biogenic Mn oxides were clearly observed on the cell surfaces of M15-pQE-cotA by scanning electron microscopy. To our knowledge, this is the first report that provides the direct observation of Mn(II) oxidation with the heterologously expressed protein CotA, Therefore, this novel finding not only establishes the foundation for in-depth study of Mn(II) oxidation mechanisms, but also offers a
Reyes-Prieto, Adrián; El-Hafidi, Mohammed; Moreno-Sánchez, Rafael; González-Halphen, Diego
2002-07-01
The presence of an alternative oxidase (AOX) in Polytomella sp., a colorless relative of Chlamydomonas reinhardtii, was explored. Oxygen uptake in Polytomella sp. mitochondria was inhibited by KCN (94%) or antimycin (96%), and the remaining cyanide-resistant respiration was not blocked by the AOX inhibitors salicylhydroxamic acid (SHAM) or n-propylgallate. No stimulation of an AOX activity was found upon addition of either pyruvate, alpha-ketoglutarate, or AMP, or by treatment with DTT. An antibody raised against C. reinhardtii AOX did not recognized any polypeptide band of Polytomella sp. mitochondria in Western blots. Also, PCR experiments and Southern blot analysis failed to identify an Aox gene in this colorless alga. Finally, KCN exposure of cell cultures failed to stimulate an AOX activity. Nevertheless, KCN exposure of Polytomella sp. cells induced diminished mitochondrial respiration (20%) and apparent changes in cytochrome c oxidase affinity towards cyanide. KCN-adapted cells exhibited a significant increase of a-type cytochromes, suggesting accumulation of inactive forms of cytochrome c oxidase. Another effect of KCN exposure was the reduction of the protein/fatty acid ratio of mitochondrial membranes, which may affect the observed respiratory activity. We conclude that Polytomella lacks a plant-like AOX, and that its corresponding gene was probably lost during the divergence of this colorless genus from its close photosynthetic relatives.
Campillo-Brocal, Jonatan C; Chacón-Verdú, María Dolores; Lucas-Elío, Patricia; Sánchez-Amat, Antonio
2015-03-24
L-Amino acid oxidases (LAOs) have been generally described as flavoproteins that oxidize amino acids releasing the corresponding ketoacid, ammonium and hydrogen peroxide. The generation of hydrogen peroxide gives to these enzymes antimicrobial characteristics. They are involved in processes such as biofilm development and microbial competition. LAOs are of great biotechnological interest in different applications such as the design of biosensors, biotransformations and biomedicine. The marine bacterium Marinomonas mediterranea synthesizes LodA, the first known LAO that contains a quinone cofactor. LodA is encoded in an operon that contains a second gene coding for LodB, a protein required for the post-translational modification generating the cofactor. Recently, GoxA, a quinoprotein with sequence similarity to LodA but with a different enzymatic activity (glycine oxidase instead of lysine-ε-oxidase) has been described. The aim of this work has been to study the distribution of genes similar to lodA and/or goxA in sequenced microbial genomes and to get insight into the evolution of this novel family of proteins through phylogenetic analysis. Genes encoding LodA-like proteins have been detected in several bacterial classes. However, they are absent in Archaea and detected only in a small group of fungi of the class Agaromycetes. The vast majority of the genes detected are in a genome region with a nearby lodB-like gene suggesting a specific interaction between both partner proteins. Sequence alignment of the LodA-like proteins allowed the detection of several conserved residues. All of them showed a Cys and a Trp that aligned with the residues that are forming part of the cysteine tryptophilquinone (CTQ) cofactor in LodA. Phylogenetic analysis revealed that LodA-like proteins can be clustered in different groups. Interestingly, LodA and GoxA are in different groups, indicating that those groups are related to the enzymatic activity of the proteins detected. Genome
Biochemical Conservation and Evolution of Germacrene A Oxidase in Asteraceae*
Nguyen, Don Trinh; Göpfert, Jens Christian; Ikezawa, Nobuhiro; MacNevin, Gillian; Kathiresan, Meena; Conrad, Jürgen; Spring, Otmar; Ro, Dae-Kyun
2010-01-01
Sesquiterpene lactones are characteristic natural products in Asteraceae, which constitutes ∼8% of all plant species. Despite their physiological and pharmaceutical importance, the biochemistry and evolution of sesquiterpene lactones remain unexplored. Here we show that germacrene A oxidase (GAO), evolutionarily conserved in all major subfamilies of Asteraceae, catalyzes three consecutive oxidations of germacrene A to yield germacrene A acid. Furthermore, it is also capable of oxidizing non-natural substrate amorphadiene. Co-expression of lettuce GAO with germacrene synthase in engineered yeast synthesized aberrant products, costic acids and ilicic acid, in an acidic condition. However, cultivation in a neutral condition allowed the de novo synthesis of a single novel compound that was identified as germacrene A acid by gas and liquid chromatography and NMR analyses. To trace the evolutionary lineage of GAO in Asteraceae, homologous genes were further isolated from the representative species of three major subfamilies of Asteraceae (sunflower, chicory, and costus from Asteroideae, Cichorioideae, and Carduoideae, respectively) and also from the phylogenetically basal species, Barnadesia spinosa, from Barnadesioideae. The recombinant GAOs from these genes clearly showed germacrene A oxidase activities, suggesting that GAO activity is widely conserved in Asteraceae including the basal lineage. All GAOs could catalyze the three-step oxidation of non-natural substrate amorphadiene to artemisinic acid, whereas amorphadiene oxidase diverged from GAO displayed negligible activity for germacrene A oxidation. The observed amorphadiene oxidase activity in GAOs suggests that the catalytic plasticity is embedded in ancestral GAO enzymes that may contribute to the chemical and catalytic diversity in nature. PMID:20351109
NASA Astrophysics Data System (ADS)
Ritarwan, Kiking; Kadri, Alfansuri; Juwita Sembiring, Rosita
2018-03-01
There is a association of polymorphism in the promoter region of the beta fibrinogen gene -455 G/A with enhancement plasma fibrinogen level. Diabetes mellitus is a risk factor for early neurologic deterioration in acute ischemic stroke. The prothrombotic fibrinogen protein is frequently elevated in patients with diabetes and may be association with poorer prognosis. This study evaluated the association of beta fibrinogen gene -455 G/A promoter polymorphism on modified Ranking Scale of Ischemic Stroke patients treated with diabetic and nondiabetic group. In a Cohort study design comprises 200 consecutive patients diabetic and a nondiabetic who, three months using completed a detailed outcome stroke. Of 200 samples genotype distribution were 27.1% for GG+GA and 0% for AA with diabetic and than 4.4% for GG+GA and 0.05% diabetic patients. Fibrinogen levels were higher in diabetic than nondiabetic group patients (307.7 + 106.3 vs 278 + 84 gr/dl, p=0.002). Fibrinogen level was found to be an independent predictor for diabetic patients. On Genotype GG+GA were associated wth diabetic and nondiabetic group patients. Modified Rankin Scale on day 90 were found associated with diabetic and nondiabetic patients. Conclusion: Elevated fibrinogen level is dose-dependently associated with 90 days outcome severity stroke with diabetic following ischemic stroke
Jiao, J; Gu, G Z; Chen, G S; Li, Y H; Zhang, H L; Yang, Q Y; Xu, X R; Zhou, W H; Wu, H; He, L H; Zheng, Y X; Yu, S F
2017-01-06
Objective: To explore the relationship between mitochondrial 12 S rRNA gene variation, tRNA gene variation and cytochrome oxidase Ⅱ gene point mutations and the risk of noise-induced hearing loss (NIHL). Methods: A nested case-control study was performed that followed a cohort of 7 445 noise-exposed workers in a steel factory in Henan province, China, from January 1, 2006 to December 31, 2015. Subjects whose average hearing threshold was more than 40 dB(A) in high frequency were defined as the case group, and subjects whose average hearing threshold was less than 35 dB(A) in high frequency and less than 25 dB (A) in speech frequency were defined as the control group. Subjects was recruited into the case group ( n =286) and the control group ( n= 286) according to gender, age, job category and time of exposure to noise, and a 1∶1 case-control study was carried out. We genotyped eight single nucleotide polymorphisms in the mitochondrial 12 S rRNA gene, the mitochondrial tRNA gene and the mitochondrial cytochrome oxidase Ⅱ gene using SNPscan high-throughput genotyping technology from the recruited subjects. The relationship between polymorphic sites and NIHL, adjusted for covariates, was analyzed using conditional logistic regression analysis, as were the subgroup data. Results: The average age of the recruited subjects was (40.3±8.1) years and the length of service exposure to noise was (18.6±8.9) years. The range of noise exposed levels and cumulative noise exposure (CNE) was 80.1- 93.4 dB (A) and 86.8- 107.9 dB (A) · year, respectively. For workers exposed to noise at a CNE level<98 dB (A) · year, smokers showed an increased risk of NIHL of 1.88 (1.16-3.05) compared with non-smokers; for workers exposed to noise at a CNE level ≥98 dB(A) · year, smokers showed an increased risk of NIHL of 2.53 (1.49- 4.30) compared with non-smokers. For workers exposed to noise at a CNE level<98 dB (A) · year, the results of univariate analysis and multifactor analysis
Checknita, D; Maussion, G; Labonté, B; Comai, S; Tremblay, R E; Vitaro, F; Turecki, N; Bertazzo, A; Gobbi, G; Côté, G; Turecki, G
2015-03-01
Antisocial personality disorder (ASPD) is characterised by elevated impulsive aggression and increased risk for criminal behaviour and incarceration. Deficient activity of the monoamine oxidase A (MAOA) gene is suggested to contribute to serotonergic system dysregulation strongly associated with impulsive aggression and antisocial criminality. To elucidate the role of epigenetic processes in altered MAOA expression and serotonin regulation in a population of incarcerated offenders with ASPD compared with a healthy non-incarcerated control population. Participants were 86 incarcerated participants with ASPD and 73 healthy controls. MAOA promoter methylation was compared between case and control groups. We explored the functional impact of MAOA promoter methylation on gene expression in vitro and blood 5-HT levels in a subset of the case group. Results suggest that MAOA promoter hypermethylation is associated with ASPD and may contribute to downregulation of MAOA gene expression, as indicated by functional assays in vitro, and regression analysis with whole-blood serotonin levels in offenders with ASPD. These results are consistent with prior literature suggesting MAOA and serotonergic dysregulation in antisocial populations. Our results offer the first evidence suggesting epigenetic mechanisms may contribute to MAOA dysregulation in antisocial offenders. Royal College of Psychiatrists.
Troyano-Suárez, Nuria; del Nogal-Avila, María; Mora, Inés; Sosa, Patricia; López-Ongil, Susana; Rodriguez-Puyol, Diego; Olmos, Gemma; Ruíz-Torres, María Piedad
2015-01-01
Cellular senescence can be prematurely induced by oxidative stress involved in aging. In this work, we were searching for novel intermediaries in oxidative stress-induced senescence, focusing our interest on integrin-linked kinase (ILK), a scaffold protein at cell-extracellular matrix (ECM) adhesion sites, and on the Klotho gene. Cultured renal cells were treated with glucose oxidase (GOx) for long time periods. GOx induced senescence, increasing senescence associated β-galactosidase activity and the expression of p16. In parallel, GOx increased ILK protein expression and activity. Ectopic overexpression of ILK in cells increased p16 expression, even in the absence of GOx, whereas downregulation of ILK inhibited the increase in p16 due to oxidative stress. Additionally, GOx reduced Klotho gene expression and cells overexpressing Klotho protein did not undergo senescence after GOx addition. We demonstrated a direct link between ILK and Klotho since silencing ILK expression in cells and mice increases Klotho expression and reduces p53 and p16 expression in renal cortex. In conclusion, oxidative stress induces cellular senescence in kidney cells by increasing ILK protein expression and activity, which in turn reduces Klotho expression. We hereby present ILK as a novel downregulator of Klotho gene expression. PMID:26583057
Troyano-Suárez, Nuria; del Nogal-Avila, María; Mora, Inés; Sosa, Patricia; López-Ongil, Susana; Rodriguez-Puyol, Diego; Olmos, Gemma; Ruíz-Torres, María Piedad
2015-01-01
Cellular senescence can be prematurely induced by oxidative stress involved in aging. In this work, we were searching for novel intermediaries in oxidative stress-induced senescence, focusing our interest on integrin-linked kinase (ILK), a scaffold protein at cell-extracellular matrix (ECM) adhesion sites, and on the Klotho gene. Cultured renal cells were treated with glucose oxidase (GOx) for long time periods. GOx induced senescence, increasing senescence associated β-galactosidase activity and the expression of p16. In parallel, GOx increased ILK protein expression and activity. Ectopic overexpression of ILK in cells increased p16 expression, even in the absence of GOx, whereas downregulation of ILK inhibited the increase in p16 due to oxidative stress. Additionally, GOx reduced Klotho gene expression and cells overexpressing Klotho protein did not undergo senescence after GOx addition. We demonstrated a direct link between ILK and Klotho since silencing ILK expression in cells and mice increases Klotho expression and reduces p53 and p16 expression in renal cortex. In conclusion, oxidative stress induces cellular senescence in kidney cells by increasing ILK protein expression and activity, which in turn reduces Klotho expression. We hereby present ILK as a novel downregulator of Klotho gene expression.
Niu, Shihui; Yuan, Lu; Zhang, Yuncheng; Chen, Xiaoyang; Li, Wei
2014-12-01
Gibberellins (GAs) are important in the floral regulatory networks of angiosperm plants. Several lines of evidence suggest that GAs also play a pivotal role in conifer male and female cone development. To gain new insights into the GA metabolism pathway in conifer trees and the role of GA metabolism in male and female cone development, we identified GA metabolism genes in Pinus tabuliformis. These included one PtCPS gene, one PtKS gene, one PtKO gene, TWO PtKAO genes, one PtGA20ox gene, two PtGA3ox genes and 12 PtGA2ox genes. According to phylogenetic analysis, the GA biosynthesis pathway evolved after the divergence of mosses from ferns, but the GA-deactivating gene family underwent divided expansion after divergence of the angiosperms from gymnosperms. However, the active sites of all GA metabolism enzymes were conserved during the evolution of land plants. During male and female cone development of P. tabuliformis, the expression of most of the PtGA2ox genes, especially PtGA2ox10, was higher than GA biosynthesis genes. However, the expression of PtKAO1 in cones peaked at a very early developmental stage. The expression pattern of GA metabolism genes indicated that GAs play different roles at the early and late stages of cone development.
The rice YABBY1 gene is involved in the feedback regulation of gibberellin metabolism.
Dai, Mingqiu; Zhao, Yu; Ma, Qian; Hu, Yongfeng; Hedden, Peter; Zhang, Qifa; Zhou, Dao-Xiu
2007-05-01
Gibberellin (GA) biosynthesis is regulated by feedback control providing a mechanism for GA homeostasis in plants. However, regulatory elements involved in the feedback control are not known. In this report, we show that a rice (Oryza sativa) YABBY1 (YAB1) gene had a similar expression pattern as key rice GA biosynthetic genes GA3ox2 and GA20ox2. Overexpression of YAB1 in transgenic rice resulted in a semidwarf phenotype that could be fully rescued by applied GA. Quantification of the endogenous GA content revealed increases of GA(20) and decreases of GA(1) levels in the overexpression plants, in which the transcripts of the biosynthetic gene GA3ox2 were decreased. Cosuppression of YAB1 in transgenic plants induced expression of GA3ox2. The repression of GA3ox2 could be obtained upon treatment by dexamethasone of transgenic plants expressing a YAB1-glucocorticoid receptor fusion. Importantly, we show that YAB1 bound to a GA-responsive element within the GA3ox2 promoter. In addition, the expression of YAB1 was deregulated in GA biosynthesis and signaling mutants and could be either transiently induced by GA or repressed by a GA inhibitor. Finally, either overexpression or cosuppression of YAB1 impaired GA-mediated repression of GA3ox2. These data together suggest that YAB1 is involved in the feedback regulation of GA biosynthesis in rice.
Interleukin-10 -1082 G/A gene polymorphisms in Egyptian children with CAP
Azab, Seham F.; Abdalhady, Mohamed A.; Elsaadany, Hosam F.; Elkomi, Mohamed A.; Elhindawy, Eman M.; Sarhan, Dina T.; Salam, Mohamed M.A.; Allah, Mayy A.N.; Emam, Ahmed A.; Noah, Maha A.; Abdelsalam, Nasser I.; Abdellatif, Sawsan H.; Rass, Anwar A.; Ismail, Sanaa M.; Gheith, Tarek; Aziz, Khalid A.; Hamed, Mohammed E.; Abdelrahman, Hind M.; Ahmed, Ahmed R.; Nabil, Rehab M.; Abdulmaksoud, Rehab S.; Yousef, Hala Y.
2016-01-01
Abstract Community-acquired pneumonia (CAP) is one of the leading causes of death worldwide. Cytokines are involved in the pathogenesis of CAP. To date, only a few studies concerned the association of interleukin-10 (IL-10) gene polymorphisms with CAP. In this study, we aimed to investigate whether the -1082(G/A) polymorphism in the promoter region of the IL-10 gene is involved in susceptibility to and the outcome of CAP, and we also measured the serum level of IL-10 to assess its relation to such polymorphism. This was a case–control study included 100 patients with CAP, and matched with age, gender, and ethnicity of 100 healthy control children. IL-10 -1082(G/A) gene polymorphism was genotyped by polymerase chain reaction-restriction fragment length polymorphism, while the serum IL-10 levels were measured by ELISA method. Compared to the controls subjects, the frequencies of the IL-10 -1082 AA genotype and A allele were observed to be overrepresented in patients with CAP (51%; odds ratio [OR] = 2.8; 95% confidence interval [CI]: 1.5–5.3 for the AA genotype; P < 0.01) and (70%; OR: 1.95; 95% CI: 1.27–3.00 for the A allele; P < 0.01, respectively). We found that patients with the GG genotype had significantly higher serum IL-10 levels (46.7 ± 9.5 pg/mL) compared to those with AG genotype (21.8 ± 4.5 pg/mL) and AA genotype (11.5 ± 3.3 pg/mL); P < 0.01, respectively. Our data revealed a significant positive association between the -1082 GG genotype and susceptibility to severe sepsis, acute respiratory failure, and hospital mortality (OR: 3.8; 95% CI: 1.3–11.2; P < 0.01). We demonstrate for the first time, to the best of our knowledge, that IL-10 -1082 (G/A) gene polymorphism may contribute to susceptibility to CAP in Egyptian children. Moreover, we observed that the presence of a G allele or GG genotype at the -1082 position of the promoter region of the IL-10 gene constitute risk factors for developing severe sepsis
Dick, Gregory J.; Torpey, Justin W.; Beveridge, Terry J.; Tebo, Bradley M.
2008-01-01
Microorganisms catalyze the formation of naturally occurring Mn oxides, but little is known about the biochemical mechanisms of this important biogeochemical process. We used tandem mass spectrometry to directly analyze the Mn(II)-oxidizing enzyme from marine Bacillus spores, identified as an Mn oxide band with an in-gel activity assay. Nine distinct peptides recovered from the Mn oxide band of two Bacillus species were unique to the multicopper oxidase MnxG, and one peptide was from the small hydrophobic protein MnxF. No other proteins were detected in the Mn oxide band, indicating that MnxG (or a MnxF/G complex) directly catalyzes biogenic Mn oxide formation. The Mn(II) oxidase was partially purified and found to be resistant to many proteases and active even at high concentrations of sodium dodecyl sulfate. Comparative analysis of the genes involved in Mn(II) oxidation from three diverse Bacillus species revealed a complement of conserved Cu-binding regions not present in well-characterized multicopper oxidases. Our results provide the first direct identification of a bacterial enzyme that catalyzes Mn(II) oxidation and suggest that MnxG catalyzes two sequential one-electron oxidations from Mn(II) to Mn(III) and from Mn(III) to Mn(IV), a novel type of reaction for a multicopper oxidase. PMID:18165363
Immunological and molecular comparison of polyphenol oxidase in Rosaceae fruit trees.
Haruta, M; Murata, M; Kadokura, H; Homma, S
1999-03-01
An antibody raised against apple polyphenol oxidase (PPO) cross-reacted with PPOs from Japanese pear (Pyrus pyrifolia), pear (Pyrus communis), peach (Prunus persica), Chinese quince (Pseudocydonia sinensis) and Japanese loquat (Eriobotrya japonica). Core fragments (681 bp) of the corresponding PPO genes were amplified and characterized. The deduced protein sequences showed identities of 85.3 to 97.5%. Chlorogenic acid oxidase activity of these PPOs showed higher activities when assayed at pH 4 than at pH 6. These results indicate that PPOs in Rosaceae plants are structurally and enzymatically similar.
Immobilization of glucose oxidase using CoFe2O4/SiO2 nanoparticles as carrier
NASA Astrophysics Data System (ADS)
Wang, Hai; Huang, Jun; Wang, Chao; Li, Dapeng; Ding, Liyun; Han, Yun
2011-04-01
Aminated-CoFe2O4/SiO2 magnetic nanoparticles (NPs) were prepared from primary silica particles using modified StÖber method. Glucose oxidase (GOD) was immobilized on CoFe2O4/SiO2 NPs via cross-linking with glutaraldehyde (GA). The optimal immobilization condition was achieved with 1% (v/v) GA, cross-linking time of 3 h, solution pH of 7.0 and 0.4 mg GOD (in 3.0 mg carrier). The immobilized GOD showed maximal catalytic activity at pH 6.5 and 40 °C. After immobilization, the GOD exhibited improved thermal, storage and operation stability. The immobilized GOD still maintained 80% of its initial activity after the incubation at 50 °C for 25 min, whereas free enzyme had only 20% of initial activity after the same incubation. After kept at 4 °C for 28 days, the immobilized and free enzyme retained 87% and 40% of initial activity, respectively. The immobilized GOD maintained approximately 57% of initial activity after reused 7 times. The KM (Michaelis-Menten constant) values for immobilized GOD and free GOD were 14.6 mM and 27.1 mM, respectively.
Sudden infant death syndrome (SIDS) and polymorphisms in Monoamine oxidase A gene (MAOA): a revisit.
Groß, Maximilian; Bajanowski, Thomas; Vennemann, Mechtild; Poetsch, Micaela
2014-01-01
Literature describes multiple possible links between genetic variations in the neuroadrenergic system and the occurrence of sudden infant death syndrome. The X-chromosomal Monoamine oxidase A (MAOA) is one of the genes with regulatory activity in the noradrenergic and serotonergic neuronal systems and a polymorphism of the promoter which affects the activity of this gene has been proclaimed to contribute significantly to the prevalence of sudden infant death syndrome (SIDS) in three studies from 2009, 2012 and 2013. However, these studies described different significant correlations regarding gender or age of children. Since several studies, suggesting associations between genetic variations and SIDS, were disproved by follow-up analysis, this study was conducted to take a closer look at the MAOA gene and its polymorphisms. The functional MAOA promoter length polymorphism was investigated in 261 SIDS cases and 93 control subjects. Moreover, the allele distribution of 12 coding and non-coding single nucleotide polymorphisms (SNPs) of the MAOA gene was examined in 285 SIDS cases and 93 controls by a minisequencing technique. In contrast to prior studies with fewer individuals, no significant correlations between the occurrence of SIDS and the frequency of allele variants of the promoter polymorphism could be demonstrated, even including the results from the abovementioned previous studies. Regarding the SNPs, three statistically significant associations were observed which had not been described before. This study clearly disproves interactions between MAOA promoter polymorphisms and SIDS, even if variations in single nucleotide polymorphisms of MAOA should be subjected to further analysis to clarify their impact on SIDS.
Barak, S; Nejidat, A; Heimer, Y; Volokita, M
2001-03-01
The roles of light and of the putative plastid signal in glycolate oxidase (GLO) gene expression were investigated in tobacco (Nicotiana tabacum cv. Samsun NN) seedlings during their shift from skotomorphogenic to photomorphogenic development. GLO transcript and enzyme activities were detected in etiolated seedlings. Their respective levels increased three- and six-fold during 96 h of exposure to light. The GLO transcript was almost undetectable in seedlings in which chloroplast development was impaired by photooxidation with the herbicide norflurazon. In transgenic tobacco seedlings, photooxidation inhibited the light-dependent increase in GUS activity when it was placed under the regulation of the GLO promoter P(GLO). However, even under these photooxidative conditions, a continuous increase in GUS activity was observed as compared to etiolated seedlings. When GUS expression was driven by the CaMV 35S promoter (P35S), no apparent difference was observed between etiolated, deetiolated and photooxidized seedlings. These observations indicate that the effects of the putative plastid development signal and light on GUS expression can be separated. Translational yield analysis indicated that the translation of the GUS transcript in P(GLO)::GUS seedlings was enhanced 30-fold over that of the GUS transcript in P35S::GUS seedlings. The overall picture emerging from these results is that in etiolated seedlings GLO transcript, though present at a substantial level, is translated at a low rate. Increased GLO transcription is enhanced, however, in response to signals originating from the developing plastids. GLO gene expression is further enhanced at the translational level by a yet undefined light-dependent mechanism.
Buades-Rotger, Macià; Gallardo-Pujol, David
2014-01-01
Hereditary factors are increasingly attracting the interest of behavioral scientists and practitioners. Our aim in the present article is to introduce some state-of-the-art topics in behavioral genetics, as well as selected findings in the field, in order to illustrate how genetic makeup can modulate the impact of environmental factors. We focus on the most-studied polymorphism to date for antisocial responses to adversity: the monoamine oxidase A gene. Advances, caveats, and promises of current research are reviewed. We also discuss implications for the use of genetic information in applied settings. PMID:25114607
Kolla, Nathan J; Meyer, Jeffrey; Sanches, Marcos; Charbonneau, James
2017-11-30
Impulsivity is a core feature of borderline personality disorder (BPD) and antisocial personality disorder (ASPD) that likely arises from combined genetic and environmental influences. The interaction of the low activity variant of the monoamine oxidase-A (MAOA-L) gene and early childhood adversity has been shown to predict aggression in clinical and non-clinical populations. Although impulsivity is a risk factor for aggression in BPD and ASPD, little research has investigated potential gene-environment (G×E) influences impacting its expression in these conditions. Moreover, G×E interactions may differ by diagnosis. Full factorial analysis of variance was employed to investigate the influence of monoamine oxidase-A (MAO-A) genotype, childhood abuse, and diagnosis on Barratt Impulsiveness Scale-11 (BIS-11) scores in 61 individuals: 20 subjects with BPD, 18 subjects with ASPD, and 23 healthy controls. A group×genotype×abuse interaction was present (F(2,49)=4.4, p =0.018), such that the interaction of MAOA-L and childhood abuse predicted greater BIS-11 motor impulsiveness in BPD. Additionally, BPD subjects reported higher BIS-11 attentional impulsiveness versus ASPD participants (t(1,36)=2.3, p =0.025). These preliminary results suggest that MAOA-L may modulate the impact of childhood abuse on impulsivity in BPD. Results additionally indicate that impulsiveness may be expressed differently in BPD and ASPD.
Mkaouar-Rebai, Emna; Ellouze, Emna; Chamkha, Imen; Kammoun, Fatma; Triki, Chahnez; Fakhfakh, Faiza
2011-01-01
Cytochrome c oxidase is an essential component of the mitochondrial respiratory chain that catalyzes the reduction of molecular oxygen by reduced cytochrome c. In this study, the authors report the second mutation associated with Leigh syndrome in the blood and buccal mucosa of 2 affected members of a Tunisian family. It was a novel heteroplasmic missense mitochondrial mutation at nucleotide 9478 in the gene specifying subunit III of cytochrome c oxidase substituting the valine at position 91 to alanine in a highly conserved amino acid. It was found with a high mutant load in tissues derived from endoderm (buccal mucosa) and mesoderm (blood). However, it was nearly absent in tissue derived from ectoderm (hair follicles). It was absent in 120 healthy controls, and PolyPhen analysis showed that the hydropathy index changed from +1.276 to +0.242, and the number of structures of the 3D protein decreased from 39 to 32.
Wang, Huihui; Liu, Baobao; Li, Hongyan; Zhang, Shicui
2016-01-10
Polyamine oxidases (PAOs) have been identified in a wide variety of animals, as well as in fungi and plant. Generally, plant PAOs oxidize spermine (Spm), spermidine (Spd) and their acetylated derivatives, N(1)-acetylspermine (N(1)-Aspm) and N(1)-acetylspermidine (N(1)-Aspd), while yeast PAOs oxidize Spm, N(1)-Aspm and N(1)-Aspd, but not Spd. By contrast, two different enzymes, namely spermine oxidase (SMO) and acetylpolyamine oxidase (APAO), specifically catalyze the oxidation of Spm and N(1)-Aspm/N(1)-Aspd, respectively. However, our knowledge on the biochemical and structural characterization of PAOs remains rather limited, and their evolutionary history is still enigmatic. In this study, two amphioxus (Branchiostoma japonicum) PAO genes, named Bjpao1 and Bjpao2, were cloned and characterized. Both Bjpao1 and Bjpao2 displayed distinct tissue-specific expression patterns. Notably, rBjPAO1 oxidized both spermine and spermidine, but not N(1)-acetylspermine, whereas rBjPAO2 oxidizes both spermidine and N(1)-acetylspermine, but not spermine. To understand structure-function relationship, the enzymatic activities of mutant BjPAOs that were generated by site-directed mutagenesis and expressed in E. coli were examined, The results indicate that the residues H64, K301 and T460 in rBjPAO1, and H69, K315 and T467 in rBjPAO2 were all involved in substrate binding and enzyme catalytic activity to some extent. Based on our results and those of others, a model depicting the divergent evolution and functional specialization of vertebrate SMO and APAO genes is proposed. Copyright © 2015 Elsevier B.V. All rights reserved.
Stanton, Thad B.; Rosey, Everett L.; Kennedy, Michael J.; Jensen, Neil S.; Bosworth, Brad T.
1999-01-01
Brachyspira (Serpulina) hyodysenteriae, the etiologic agent of swine dysentery, uses the enzyme NADH oxidase to consume oxygen. To investigate possible roles for NADH oxidase in the growth and virulence of this anaerobic spirochete, mutant strains deficient in oxidase activity were isolated and characterized. The cloned NADH oxidase gene (nox; GenBank accession no. U19610) on plasmid pER218 was inactivated by replacing 321 bp of coding sequence with either a gene for chloramphenicol resistance (cat) or a gene for kanamycin resistance (kan). The resulting plasmids, respectively, pCmΔNOX and pKmΔNOX, were used to transform wild-type B. hyodysenteriae B204 cells and generate the antibiotic-resistant strains Nox-Cm and Nox-Km. PCR and Southern hybridization analyses indicated that the chromosomal wild-type nox genes in these strains had been replaced, through allelic exchange, by the inactivated nox gene containing cat or kan. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western immunoblot analysis revealed that both nox mutant cell lysates were missing the 48-kDa Nox protein. Soluble NADH oxidase activity levels in cell lysates of Nox-Cm and Nox-Km were reduced 92 to 96% compared to the activity level in parent strain B204. In an aerotolerance test, cells of both nox mutants were at least 100-fold more sensitive to oxygen exposure than were cells of the wild-type parent strain B204. In swine experimental infections, both nox mutants were less virulent than strain B204 in that fewer animals were colonized by the mutant cells and infected animals displayed mild, transient signs of disease, with no deaths. These results provide evidence that NADH oxidase serves to protect B. hyodysenteriae cells against oxygen toxicity and that the enzyme, in that role, contributes to the pathogenic ability of the spirochete. PMID:10543819
Hu, Yao-Dong; Pang, Hui-Zhong; Li, De-Sheng; Ling, Shan-Shan; Lan, Dan; Wang, Ye; Zhu, Yun; Li, Di-Yan; Wei, Rong-Ping; Zhang, He-Min; Wang, Cheng-Dong
2016-11-05
As the rate-limiting enzyme of the mitochondrial respiratory chain, cytochrome c oxidase (COX) plays a crucial role in biological metabolism. "Living fossil" giant panda (Ailuropoda melanoleuca) is well-known for its special bamboo diet. In an effort to explore functional variation of COX1 in the energy metabolism behind giant panda's low-energy bamboo diet, we looked at genetic variation of COX1 gene in giant panda, and tested for its selection effect. In 1545 base pairs of the gene from 15 samples, 9 positions were variable and 1 mutation leaded to an amino acid sequence change. COX1 gene produces six haplotypes, nucleotide (pi), haplotype diversity (Hd). In addition, the average number of nucleotide differences (k) is 0.001629±0.001036, 0.8083±0.0694 and 2.517, respectively. Also, dN/dS ratio is significantly below 1. These results indicated that giant panda had a low population genetic diversity, and an obvious purifying selection of the COX1 gene which reduces synthesis of ATP determines giant panda's low-energy bamboo diet. Phylogenetic trees based on the COX1 gene were constructed to demonstrate that giant panda is the sister group of other Ursidae. Copyright © 2016 Elsevier B.V. All rights reserved.
Schmetterer, Georg; Valladares, Ana; Pils, Dietmar; Steinbach, Susanne; Pacher, Margit; Muro-Pastor, Alicia M.; Flores, Enrique; Herrero, Antonia
2001-01-01
Three genes, coxB, coxA, and coxC, found in a clone from a gene library of the cyanobacterium Anabaena variabilis strain ATCC 29413, were identified by hybridization with an oligonucleotide specific for aa3-type cytochrome c oxidases. Deletion of these genes from the genome of A. variabilis strain ATCC 29413 FD yielded strain CSW1, which displayed no chemoheterotrophic growth and an impaired cytochrome c oxidase activity. Photoautotrophic growth of CSW1, however, was unchanged, even with dinitrogen as the nitrogen source. A higher cytochrome c oxidase activity was detected in membrane preparations from dinitrogen-grown CSW1 than from nitrate-grown CSW1, but comparable activities of respiratory oxygen uptake were found in the wild type and in CSW1. Our data indicate that the identified cox gene cluster is essential for fructose-dependent growth in the dark, but not for growth on dinitrogen, and that other terminal respiratory oxidases are expressed in this cyanobacterium. Transcription analysis showed that coxBAC constitutes an operon which is expressed from two transcriptional start points. The use of one of them was stimulated by fructose. PMID:11591688
Chung, In-Hyuk; Yoo, Hye Sook; Eah, Jae-Yong; Yoon, Hyun-Kyu; Jung, Jin-Wook; Hwang, Seung Yong; Kim, Chang-Bae
2010-10-01
DNA barcoding with the gene encoding cytochrome c oxidase I (COI) in the mitochondrial genome has been proposed as a standard marker to identify and discover animal species. Some migratory wild birds are suspected of transmitting avian influenza and pose a threat to aircraft safety because of bird strikes. We have previously reported the COI gene sequences of 92 Korean bird species. In the present study, we developed a DNA microarray to identify 17 selected bird species on the basis of nucleotide diversity. We designed and synthesized 19 specific oligonucleotide probes; these probes were arrayed on a silylated glass slide. The length of the probes was 19-24 bps. The COI sequences amplified from the tissues of the selected birds were labeled with a fluorescent probe for microarray hybridization, and unique hybridization patterns were detected for each selected species. These patterns may be considered diagnostic patterns for species identification. This microarray system will provide a sensitive and a high-throughput method for identification of Korean birds.
Huang, San-Yuan; Lin, Wei-Wen; Wan, Fang-Jung; Chang, Ai-Ju; Ko, Huei-Chen; Wang, Tso-Jen; Wu, Pei-Lin; Lu, Ru-Band
2007-05-01
Low monoamine oxidase (MAO) activity and the neurotransmitter dopamine are 2 important factors in the development of alcohol dependence. MAO is an important enzyme associated with the metabolism of biogenic amines. Therefore, the present study investigates whether the association between the dopamine D2 receptor (DRD2) gene and alcoholism is affected by different polymorphisms of the MAO type A (MAOA) gene. A total of 427 Han Chinese men in Taiwan (201 control subjects and 226 with alcoholism) were recruited for the study. Of the subjects with alcoholism, 108 had pure alcohol dependence (ALC) and 118 had both alcohol dependence and anxiety, depression or both (ANX/DEP ALC). All subjects were assessed with the Chinese Version of the Modified Schedule of Affective Disorders and Schizophrenia-Lifetime. Alcohol dependence, anxiety and major depressive disorders were diagnosed according to Diagnostic and Statistical Manual of Mental Disorders, fourth edition criteria. The genetic variant of the DRD2 gene was only associated with the ANX/DEP ALC phenotype, and the genetic variant of the MAOA gene was associated with pure ALC. Subjects carrying the MAOA 3-repeat allele and genotype A1/A1 of the DRD2 were 3.48 times (95% confidence interval = 1.47-8.25) more likely to be ANX/DEP ALC than the subjects carrying the MAOA 3-repeat allele and DRD2 A2/A2 genotype. The MAOA gene may modify the association between the DRD2 gene and ANX/DEP ALC phenotype.
Expression and Characterization of Glucose Oxidase from Aspergillus niger in Yarrowia lipolytica.
Khadivi Derakshan, Fatemeh; Darvishi, Farshad; Dezfulian, Mehrouz; Madzak, Catherine
2017-08-01
Glucose oxidase (GOX) is currently used in clinical, pharmaceutical, food and chemical industries. The aim of this study was expression and characterization of Aspergillus niger glucose oxidase gene in the yeast Yarrowia lipolytica. For the first time, the GOX gene of A. niger was successfully expressed in Y. lipolytica using a mono-integrative vector containing strong hybrid promoter and secretion signal. The highest total glucose oxidase activity was 370 U/L after 7 days of cultivation. An innovative method was used to cell wall disruption in current study, and it could be recommended to use for efficiently cell wall disruption of Y. lipolytica. Optimum pH and temperature for recombinant GOX activity were 5.5 and 37 °C, respectively. A single band with a molecular weight of 80 kDa similar to the native and pure form of A. niger GOX was observed for the recombinant GOX in SDS-PAGE analysis. Y. lipolytica is a suitable and efficient eukaryotic expression system to production of recombinant GOX in compered with other yeast expression systems and could be used to production of pure form of GOX for industrial applications.
Wu, Ying-Hui; Fischer, David F; Swaab, Dick F
2007-09-05
Monoamine oxidase A (MAOA) is involved in the pathogenesis of mood disorders and Alzheimer's disease (AD). MAOA activity and gene expression have been found to be up-regulated in different brain areas of AD patients, including the pineal gland. Increased pineal MAOA activity might contribute to the reduced pineal melatonin production in AD. A promoter polymorphism of a variable number tandem repeats (VNTR) in the MAOA gene shows to affect MAOA transcriptional activity in vitro. Here we examined in 63 aged controls and 44 AD patients the effects of the MAOA-VNTR on MAOA gene expression and activity in the pineal gland as endophenotypes, and on melatonin production. AD patients carrying long MAOA-VNTR genotype (consisting of 3.5- or 4-repeat alleles) showed higher MAOA gene expression and activity than the short-genotyped (i.e., 3-repeat allele) AD patients. Moreover, the AD-related up-regulation of MAOA showed up only among long-genotype bearing subjects. There was no significant effect of the MAOA-VNTR on MAOA activity or gene expression in controls, or on melatonin production in both controls and AD patients. Our data suggest that the MAOA-VNTR affects the activity and gene expression of MAOA in the brain of AD patients, and is involved in the changes of monoamine metabolism.
Filipenko, M L; Beilina, A G; Alekseyenko, O V; Dolgov, V V; Kudryavtseva, N N
2002-04-01
Serotonin transporter and monoamine oxidase (MAO) A are involved in the inactivation of serotonin. The former is responsible for serotonin re-uptake from the synapse, whereas the latter catalyzes serotonin deamination in presynaptic terminals. Expression of serotonin transporter and MAO A genes was investigated in raphe nuclei of midbrain of CBA/Lac male mice with repeated experience of social victories or defeats in 10 daily aggressive confrontations. The amount of cDNA of these genes was evaluated using multiplex RT-PCR. Two independent experiments revealed that the defeated mice were characterized by significantly higher levels of serotonin transporter and MAO A mRNAs than the control and aggressive animals. Increased expression of MAO A and serotonin transporter genes is suggested to reflect the accelerated serotonin degradation in response to activation of the serotonergic system functioning induced by social stress. Significant positive correlation between MAO A and serotonin transporter mRNA levels suggests common pathways of regulation of transcriptional activity of these genes.
Zhao, Xiaoying; Yu, Xuhong; Foo, Eloise; Symons, Gregory M.; Lopez, Javier; Bendehakkalu, Krishnaprasad T.; Xiang, Jing; Weller, James L.; Liu, Xuanming; Reid, James B.; Lin, Chentao
2007-01-01
Cryptochromes mediate blue light-dependent photomorphogenic responses, such as inhibition of hypocotyl elongation. To investigate the underlying mechanism, we analyzed a genetic suppressor, scc7-D (suppressors of cry1cry2), which suppressed the long-hypocotyl phenotype of the cry1cry2 (cryptochrome1/cryptochrome2) mutant in a light-dependent but wavelength-independent manner. scc7-D is a gain-of-expression allele of the GA2ox8 gene encoding a gibberellin (GA)-inactivating enzyme, GA 2-oxidase. Although scc7-D is hypersensitive to light, transgenic seedlings expressing GA2ox at a level higher than scc7-D showed a constitutive photomorphogenic phenotype, confirming a general role of GA2ox and GA in the suppression of hypocotyl elongation. Prompted by this result, we investigated blue light regulation of mRNA expression of the GA metabolic and catabolic genes. We demonstrated that cryptochromes are required for the blue light regulation of GA2ox1, GA20ox1, and GA3ox1 expression in transient induction, continuous illumination, and photoperiodic conditions. The kinetics of cryptochrome induction of GA2ox1 expression and cryptochrome suppression of GA20ox1 or GA3ox1 expression correlate with the cryptochrome-dependent transient reduction of GA4 in etiolated wild-type seedlings exposed to blue light. Therefore we propose that in deetiolating seedlings, cryptochromes mediate blue light regulation of GA catabolic/metabolic genes, which affect GA levels and hypocotyl elongation. Surprisingly, no significant change in the GA4 content was detected in the whole shoot samples of the wild-type or cry1cry2 seedlings grown in the dark or continuous blue light, suggesting that cryptochromes may also regulate GA responsiveness and/or trigger cell- or tissue-specific changes of the level of bioactive GAs. PMID:17644628
NASA Astrophysics Data System (ADS)
Monavarian, M.; Rashidi, A.; Aragon, A. A.; Nami, M.; Oh, S. H.; DenBaars, S. P.; Feezell, D.
2018-05-01
InGaN/GaN light-emitting diodes (LEDs) with large modulation bandwidths are desirable for visible-light communication. Along with modulation speed, the consideration of the internal quantum efficiency (IQE) under operating conditions is also important. Here, we report the modulation characteristics of semipolar (20 2 ¯ 1 ¯ ) InGaN/GaN (LEDs) with single-quantum well (SQW) and multiple-quantum-well (MQW) active regions grown on free-standing semipolar GaN substrates with peak internal quantum efficiencies (IQEs) of 0.93 and 0.73, respectively. The MQW LEDs exhibit on average about 40-80% higher modulation bandwidth, reaching 1.5 GHz at 13 kA/cm2, but about 27% lower peak IQE than the SQW LEDs. We extract the differential carrier lifetimes (DLTs), RC parasitics, and carrier escape lifetimes and discuss their role in the bandwidth and IQE characteristics. A coulomb-enhanced capture process is shown to rapidly reduce the DLT of the MQW LED at high current densities. Auger recombination is also shown to play little role in increasing the speed of the LEDs. Finally, we investigate the trade-offs between the bandwidth and efficiency and introduce the bandwidth-IQE product as a potential figure of merit for optimizing speed and efficiency in InGaN/GaN LEDs.
Mameaux, Sabine; Cockram, James; Thiel, Thomas; Steuernagel, Burkhard; Stein, Nils; Taudien, Stefan; Jack, Peter; Werner, Peter; Gray, John C; Greenland, Andy J; Powell, Wayne
2012-01-01
The genomes of cereals such as wheat (Triticum aestivum) and barley (Hordeum vulgare) are large and therefore problematic for the map-based cloning of agronomicaly important traits. However, comparative approaches within the Poaceae permit transfer of molecular knowledge between species, despite their divergence from a common ancestor sixty million years ago. The finding that null variants of the rice gene cytokinin oxidase/dehydrogenase 2 (OsCKX2) result in large yield increases provides an opportunity to explore whether similar gains could be achieved in other Poaceae members. Here, phylogenetic, molecular and comparative analyses of CKX families in the sequenced grass species rice, brachypodium, sorghum, maize and foxtail millet, as well as members identified from the transcriptomes/genomes of wheat and barley, are presented. Phylogenetic analyses define four Poaceae CKX clades. Comparative analyses showed that CKX phylogenetic groupings can largely be explained by a combination of local gene duplication, and the whole-genome duplication event that predates their speciation. Full-length OsCKX2 homologues in barley (HvCKX2.1, HvCKX2.2) and wheat (TaCKX2.3, TaCKX2.4, TaCKX2.5) are characterized, with comparative analysis at the DNA, protein and genetic/physical map levels suggesting that true CKX2 orthologs have been identified. Furthermore, our analysis shows CKX2 genes in barley and wheat have undergone a Triticeae-specific gene-duplication event. Finally, by identifying ten of the eleven CKX genes predicted to be present in barley by comparative analyses, we show that next-generation sequencing approaches can efficiently determine the gene space of large-genome crops. Together, this work provides the foundation for future functional investigation of CKX family members within the Poaceae. © 2011 National Institute of Agricultural Botany (NIAB). Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell
Effect of MLH1 -93G>A on gene expression in patients with colorectal cancer.
Funck, Alexandre; Santos, Juliana C; Silva-Fernandes, Isabelle J L; Rabenhorst, Silvia H B; Martinez, Carlos A R; Ribeiro, Marcelo L
2014-09-01
The DNA repair machinery plays a key role in maintaining genomic stability by preventing the emergence of mutations. Furthermore, the -93G>A polymorphism in the MLH1 gene has been associated with an increased risk of developing colorectal cancer. Therefore, the aim of this study was to examine the expression pattern and effect of this polymorphism in normal and tumour samples from patients with colorectal cancer. The MLH1 -93G>A (rs1800734) polymorphism was detected by PCR-RFLP in 49 cases of colorectal cancer. MLH1 expression was investigated using real-time quantitative PCR. The results indicate a significant decrease in MLH1 expression in tumour samples compared to their normal counterparts. The MLH1 gene was also significantly repressed in samples from patients who had some degree of tumour invasion into other organs. Similarly, those patients who were in a more advanced tumour stage (TNM III and IV) exhibited a significant reduction in MLH1 gene expression. Finally, the mutant genotype AA of MLH1 was associated with a significant decrease in the expression of this gene. This finding suggests that this polymorphism could increase the risk of developing colorectal cancer by a defective mismatch repair system, particularly through the loss of MLH1 expression in an allele-specific manner.
Xu, Ting; Wang, Ya-Ting; Liang, Wu-Sheng; Yao, Fei; Li, Yong-Hong; Li, Dian-Rong; Wang, Hao; Wang, Zheng-Yi
2013-06-01
Sclerotinia sclerotiorum is a filamentous fungal pathogen that can infect many economically important crops and vegetables. Alternative oxidase is the terminal oxidase of the alternative respiratory pathway in fungal mitochondria. The function of alternative oxidase was investigated in the regulation of sensitivity of S. sclerotiorum to two commercial fungicides, azoxystrobin and procymidone which have different fungitoxic mechanisms. Two isolates of S. sclerotiorum were sensitive to both fungicides. Application of salicylhydroxamic acid, a specific inhibitor of alternative oxidase, significantly increased the values of effective concentration causing 50% mycelial growth inhibition (EC50) of azoxystrobin to both S. sclerotiorum isolates, whereas notably decreased the EC50 values of procymidone. In mycelial respiration assay azoxystrobin displayed immediate inhibitory effect on cytochrome pathway capacity, but had no immediate effect on alternative pathway capacity. In contrast, procymidone showed no immediate impact on capacities of both cytochrome and alternative pathways in the mycelia. However, alternative oxidase encoding gene (aox) transcript and protein levels, alternative respiration pathway capacity of the mycelia were obviously increased by pre-treatment for 24 h with both azoxystrobin and procymidone. These results indicate that alternative oxidase was involved in the regulation of sensitivity of S. sclerotiorum to the fungicides azoxystrobin and procymidone, and that both fungicides could affect aox gene expression and the alternative respiration pathway capacity development in mycelia of this fungal pathogen.
Boden, Scott A.; Weiss, David; Ross, John J.; Davies, Noel W.; Trevaskis, Ben; Chandler, Peter M.; Swain, Steve M.
2014-01-01
EARLY FLOWERING3 (ELF3) is a circadian clock gene that contributes to photoperiod-dependent flowering in plants, with loss-of-function mutants in barley (Hordeum vulgare), legumes, and Arabidopsis thaliana flowering early under noninductive short-day (SD) photoperiods. The barley elf3 mutant displays increased expression of FLOWERING LOCUS T1 (FT1); however, it remains unclear whether this is the only factor responsible for the early flowering phenotype. We show that the early flowering and vegetative growth phenotypes of the barley elf3 mutant are strongly dependent on gibberellin (GA) biosynthesis. Expression of the central GA biosynthesis gene, GA20oxidase2, and production of the bioactive GA, GA1, were significantly increased in elf3 leaves under SDs, relative to the wild type. Inhibition of GA biosynthesis suppressed the early flowering of elf3 under SDs independently of FT1 and was associated with altered expression of floral identity genes at the developing apex. GA is also required for normal flowering of spring barley under inductive photoperiods, with chemical and genetic attenuation of the GA biosynthesis and signaling pathways suppressing inflorescence development under long-day conditions. These findings illustrate that GA is an important floral promoting signal in barley and that ELF3 suppresses flowering under noninductive photoperiods by blocking GA production and FT1 expression. PMID:24781117
NADPH oxidases in the arbuscular mycorrhizal symbiosis.
Belmondo, Simone; Calcagno, Cristina; Genre, Andrea; Puppo, Alain; Pauly, Nicolas; Lanfranco, Luisa
2016-01-01
Plant NADPH oxidases are the major source of reactive oxygen species (ROS) that plays key roles as both signal and stressor in several plant processes, including defense responses against pathogens. ROS accumulation in root cells during arbuscular mycorrhiza (AM) development has raised the interest in understanding how ROS-mediated defense programs are modulated during the establishment of this mutualistic interaction. We have recently analyzed the expression pattern of 5 NADPH oxidase (also called RBOH) encoding genes in Medicago truncatula, showing that only one of them (MtRbohE) is specifically upregulated in arbuscule-containing cells. In line with this result, RNAi silencing of MtRbohE generated a strong alteration in root colonization, with a significant reduction in the number of arbusculated cells. On this basis, we propose that MtRBOHE-mediated ROS production plays a crucial role in the intracellular accommodation of arbuscules.
NADPH oxidases in the arbuscular mycorrhizal symbiosis
Belmondo, Simone; Calcagno, Cristina; Genre, Andrea; Puppo, Alain; Pauly, Nicolas; Lanfranco, Luisa
2016-01-01
ABSTRACT Plant NADPH oxidases are the major source of reactive oxygen species (ROS) that plays key roles as both signal and stressor in several plant processes, including defense responses against pathogens. ROS accumulation in root cells during arbuscular mycorrhiza (AM) development has raised the interest in understanding how ROS-mediated defense programs are modulated during the establishment of this mutualistic interaction. We have recently analyzed the expression pattern of 5 NADPH oxidase (also called RBOH) encoding genes in Medicago truncatula, showing that only one of them (MtRbohE) is specifically upregulated in arbuscule-containing cells. In line with this result, RNAi silencing of MtRbohE generated a strong alteration in root colonization, with a significant reduction in the number of arbusculated cells. On this basis, we propose that MtRBOHE-mediated ROS production plays a crucial role in the intracellular accommodation of arbuscules. PMID:27018627
Patente, Thiago A; Mohammedi, Kamel; Bellili-Muñoz, Naïma; Driss, Fathi; Sanchez, Manuel; Fumeron, Frédéric; Roussel, Ronan; Hadjadj, Samy; Corrêa-Giannella, Maria Lúcia; Marre, Michel; Velho, Gilberto
2015-09-01
Oxidative stress plays a pivotal role in the pathophysiology of diabetic nephropathy, and the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase system is an important source of reactive oxygen species in hyperglycemic conditions in the kidney. Plasma concentration of advanced oxidation protein products (AOPP), a marker of oxidative stress, is increased in patients with diabetic nephropathy. We investigated associations of variants in the CYBA gene, encoding the regulatory subunit p22(phox) of NADPH oxidase, with diabetic nephropathy and plasma AOPP and myeloperoxidase (MPO) concentrations in type 1 diabetic patients. Seven SNPs in the CYBA region were analyzed in 1357 Caucasian subjects with type 1 diabetes from the SURGENE (n=340), GENEDIAB (n=444), and GENESIS (n=573) cohorts. Duration of follow-up was 10, 9, and 6 years, respectively. Cox proportional hazards and logistic regression analyses were used to estimate hazard ratios (HR) or odds ratios (OR) for incidence and prevalence of diabetic nephropathy. The major G-allele of rs9932581 was associated with the incidence of renal events defined as new cases of microalbuminuria or the progression to a more severe stage of nephropathy during follow-up (HR 1.59, 95% CI 1.17-2.18, P=0.003) in SURGENE. The same allele was associated with established/advanced nephropathy (OR 1.52, 95% CI 1.22-1.92, P=0.0001) and with the incidence of end-stage renal disease (ESRD) (HR 2.01, 95% CI 1.30-3.24, P=0.001) in GENEDIAB/GENESIS pooled studies. The risk allele was also associated with higher plasma AOPP concentration in subsets of SURGENE and GENEDIAB, with higher plasma MPO concentration in a subset of GENEDIAB, and with lower estimated glomerular filtration rate (eGFR) in the three cohorts. In conclusion, a functional variant in the promoter of the CYBA gene was associated with lower eGFR and with prevalence and incidence of diabetic nephropathy and ESRD in type 1 diabetic patients. These results are consistent with
Liu, Xi; Dai, Fangyin; Guo, Enen; Li, Kang; Ma, Li; Tian, Ling; Cao, Yang; Zhang, Guozheng; Palli, Subba R.; Li, Sheng
2015-01-01
As revealed in a previous microarray study to identify genes regulated by 20-hydroxyecdysone (20E) and juvenile hormone (JH) in the silkworm, Bombyx mori, E93 expression in the fat body was markedly low prior to the wandering stage but abundant during larval-pupal metamorphosis. Induced by 20E and suppressed by JH, E93 expression follows this developmental profile in multiple silkworm alleles. The reduction of E93 expression by RNAi disrupted 20E signaling and the 20E-induced autophagy, caspase activity, and cell dissociation in the fat body. Reducing E93 expression also decreased the expression of the 20E-induced pupal-specific cuticle protein genes and prevented growth and differentiation of the wing discs. Importantly, the two HTH domains in E93 are critical for inducing the expression of a subset of 20E response genes, including EcR, USP, E74, Br-C, and Atg1. By contrast, the LLQHLL and PLDLSAK motifs in E93 inhibit its transcriptional activity. E93 binds to the EcR-USP complex via a physical association with USP through its LLQHLL motif; and this association is enhanced by 20E-induced EcR-USP interaction, which attenuates the transcriptional activity of E93. E93 acts through the two HTH domains to bind to GAGA-containing motifs present in the Atg1 promoter region for inducing gene expression. In conclusion, E93 transcriptionally modulates 20E signaling to promote Bombyx larval-pupal metamorphosis. PMID:26378227
Liu, Xi; Dai, Fangyin; Guo, Enen; Li, Kang; Ma, Li; Tian, Ling; Cao, Yang; Zhang, Guozheng; Palli, Subba R; Li, Sheng
2015-11-06
As revealed in a previous microarray study to identify genes regulated by 20-hydroxyecdysone (20E) and juvenile hormone (JH) in the silkworm, Bombyx mori, E93 expression in the fat body was markedly low prior to the wandering stage but abundant during larval-pupal metamorphosis. Induced by 20E and suppressed by JH, E93 expression follows this developmental profile in multiple silkworm alleles. The reduction of E93 expression by RNAi disrupted 20E signaling and the 20E-induced autophagy, caspase activity, and cell dissociation in the fat body. Reducing E93 expression also decreased the expression of the 20E-induced pupal-specific cuticle protein genes and prevented growth and differentiation of the wing discs. Importantly, the two HTH domains in E93 are critical for inducing the expression of a subset of 20E response genes, including EcR, USP, E74, Br-C, and Atg1. By contrast, the LLQHLL and PLDLSAK motifs in E93 inhibit its transcriptional activity. E93 binds to the EcR-USP complex via a physical association with USP through its LLQHLL motif; and this association is enhanced by 20E-induced EcR-USP interaction, which attenuates the transcriptional activity of E93. E93 acts through the two HTH domains to bind to GAGA-containing motifs present in the Atg1 promoter region for inducing gene expression. In conclusion, E93 transcriptionally modulates 20E signaling to promote Bombyx larval-pupal metamorphosis. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Rajesh, Deepa; Gurumurthy, Rajesh; Kutty, A V Moideen; Balakrishna, Sharath
2017-03-01
Tumor necrosis factor alpha (TNFα) gene -238G/A polymorphism (rs361525) is associated with psoriasis in several populations worldwide. To the best of our knowledge, there is no information about this polymorphism in Indian psoriatic patients. This study was undertaken to fill the gap in knowledge. This case-control study involved 72 patients with psoriasis vulgaris (PsV) and 72 age and gender matched healthy individuals. TNFα -238G/A polymorphism was genotyped by PCR-RFLP method. TNFα -238A allele was 5 times commoner in PsV patients than in the control group (P = 4.1 × 10 -7 ; odds ratio [OR] = 6.5 [0.95 CI: 2.9-14.6]). Distribution of the genotypes in the two groups showed statistically significant difference in dominant genetic model (P = 2.3 × 10 -7 ) and not in recessive genetic model (P = 2.5 × 10 -1 ). Odds ratio for the occurrence of -238A genotype in PsV patients was 8.8 (0.95 CI: 3.5-20.2). The association showed no major difference when PsV patients were subgrouped into type I and type II categories and tested separately. Subgroup analysis on the basis of disease severity showed higher association with the moderate-severe subgroup (P = 2.4 × 10 -9 , OR 15.4 [0.95 CI: 5.8-41.0]) than with mild subgroup (P = 1.3 × 10 -2 , OR 3.8 [0.95 CI: 1.3-10.9]). Our results indicate that TNFα gene -238G/A polymorphism increases the risk of developing psoriasis vulgaris among Indians. Also, the data show that severity and not the type affects the strength of association in this population. © 2017 The International Society of Dermatology.
Li, Zhong-Jie; Ding, Mei; Pang, Hao; Sun, Xue-Fei; Xing, Jia-Xin; Xuan, Jin-Feng; Wang, Bao-Jie
2013-04-01
To investigate the single nucleotide polymorphisms (SNP) of -855 G/C and -1140 G/A in promoter regions of GRIN1 gene and find their genetic correlation to paranoid schizophrenia as well as their applicable values in forensic medicine. The genetic polymorphisms of -855 G/C and -1140 G/A at the 5' end of GRIN1 gene were detected by PCR restriction fragment length polymorphism and PAGE in 183 healthy unrelated individuals of northern Chinese Han population and 172 patients of paranoid schizophrenia, respectively. The chi2 test was used to identify Hardy-Weinberg equilibrium of the genotype distribution. The differences of genotypes and allelic frequency distributions were compared between the two groups. Distributions of the genotypic frequencies satisfied Hardy-Weinberg equilibrium in both groups. The difference of genotypes was statistically significant between female patient group and female control group in -855 G/C distribution (P < 0.05). The differences of genotypes and allelic frequencies were statistically significant not only between the patient group and the control group but also between female patient group and female control group in -1140 G/A distribution (P < 0.05). The SNP of -1140 G/A in promoter regions of GRIN1 gene might positively correlate to paranoid schizophrenia. The genetic factor of schizophrenia is involved in gender tendency. And it could be useful in forensic identification of schizophrenia.
Cytotoxicity of polyamines to Amoeba proteus: role of polyamine oxidase.
Schenkel, E; Dubois, J G; Helson-Cambier, M; Hanocq, M
1996-02-01
It has been shown that oxidation of polyamines by polyamine oxidases can produce toxic compounds (H2O2, aldehydes, ammonia) and that the polyamine oxidase-polyamine system is implicated, in vitro, in the death of several parasites. Using Amoeba proteus as an in vitro model, we studied the cytotoxicity to these cells of spermine, spermidine, their acetyl derivatives, and their hypothetical precursors. Spermine and N1-acetylspermine were more toxic than emetine, an amoebicidal reference drug. Spermine presented a short-term toxicity, but a 48-h contact time was necessary for the high toxicity of spermidine. The uptake by Amoeba cells of the different polyamines tested was demonstrated. On the other hand, a high polyamine oxidase activity was identified in Amoeba proteus crude extract. Spermine (theoretical 100%) and N1-acetylspermine (64%) were the best substrates at pH 9.5, while spermidine, its acetyl derivatives, and putrescine were very poorly oxidized by this enzyme (3-20%). Spermine oxidase activity was inhibited by phenylhydrazine (nil) and isoniazid (approximately 50%). Mepacrine did not inhibit the enzyme activity at pH 8. Neither monoamine nor diamine oxidase activity (approximately 10%) was found. It must be emphasized that spermine, the best enzyme substrate, is the most toxic polyamine. This finding suggests that knowledge of polyamine oxidase specificity can be used to modulate the cytotoxicity of polyamine derivatives. Amoeba proteus was revealed as a simple model for investigation of the connection between cytotoxicity and enzyme activity.
Rodriguez-R, Luis M; Gunturu, Santosh; Harvey, William T; Rosselló-Mora, Ramon; Tiedje, James M; Cole, James R; Konstantinidis, Konstantinos T
2018-06-14
The small subunit ribosomal RNA gene (16S rRNA) has been successfully used to catalogue and study the diversity of prokaryotic species and communities but it offers limited resolution at the species and finer levels, and cannot represent the whole-genome diversity and fluidity. To overcome these limitations, we introduced the Microbial Genomes Atlas (MiGA), a webserver that allows the classification of an unknown query genomic sequence, complete or partial, against all taxonomically classified taxa with available genome sequences, as well as comparisons to other related genomes including uncultivated ones, based on the genome-aggregate Average Nucleotide and Amino Acid Identity (ANI/AAI) concepts. MiGA integrates best practices in sequence quality trimming and assembly and allows input to be raw reads or assemblies from isolate genomes, single-cell sequences, and metagenome-assembled genomes (MAGs). Further, MiGA can take as input hundreds of closely related genomes of the same or closely related species (a so-called 'Clade Project') to assess their gene content diversity and evolutionary relationships, and calculate important clade properties such as the pangenome and core gene sets. Therefore, MiGA is expected to facilitate a range of genome-based taxonomic and diversity studies, and quality assessment across environmental and clinical settings. MiGA is available at http://microbial-genomes.org/.
Yao, Zhichao; Wang, Ailin; Li, Yushan; Cai, Zhaohui; Lemaitre, Bruno; Zhang, Hongyu
2016-01-01
The guts of metazoans are in permanent contact with the microbial realm that includes beneficial symbionts, nonsymbionts, food-borne microbes and life-threatening pathogens. However, little is known concerning how host immunity affects gut bacterial community. Here, we analyze the role of a dual oxidase gene (BdDuox) in regulating the intestinal bacterial community homeostasis of the oriental fruit fly Bactrocera dorsalis. The results showed that knockdown of BdDuox led to an increased bacterial load, and to a decrease in the relative abundance of Enterobacteriaceae and Leuconostocaceae bacterial symbionts in the gut. The resulting dysbiosis, in turn, stimulates an immune response by activating BdDuox and promoting reactive oxygen species (ROS) production that regulates the composition and structure of the gut bacterial community to normal status by repressing the overgrowth of minor pathobionts. Our results suggest that BdDuox plays a pivotal role in regulating the homeostasis of the gut bacterial community in B. dorsalis. PMID:26565723
Theodorus H. de Koker; Michael D. Mozuch; Daniel Cullen; Jill Gaskell; Philip J. Kersten
2004-01-01
Pyranose 2-oxidase (POX) was recovered from Phanerochaete chrysosporium BKM-F-1767 solid substrate culture using mild extraction conditions and was purified. 13C-nuclear magnetic resonance confirmed production of D- arabino -hexos-2-ulose (glucosone) from D-glucose with the oxidase. Peptide fingerprints generated by liquid chromatography-tandem mass spectrometry of...
ChoG is the main inducible extracellular cholesterol oxidase of Rhodococcus sp. strain CECT3014.
Fernández de Las Heras, Laura; Mascaraque, Victoria; García Fernández, Esther; Navarro-Llorens, Juana María; Perera, Julián; Drzyzga, Oliver
2011-07-20
Cholesterol catabolism has been reported in different bacteria and particularly in several Rhodococcus species, but the genetic of this complex pathway is not yet very well defined. In this work we report the isolation and sequencing of a 9.8 kb DNA fragment of Rhodococcus sp. strain CECT3014, a bacterial strain that we here identify as a Rhodococcus erythropolis strain. In this DNA fragment we found several ORF that are probably involved in steroid catabolism, and choG, a gene encoding a putative cholesterol oxidase whose functional characterization we here report. ChoG protein is a class II cholesterol oxidase with all the structural features of the enzymes of this group. The disruption of the choG gene does not alter the ability of strain CECT3014 cells to grow on cholesterol, but it abolishes the production of extracellular cholesterol oxidase. This later effect is reverted when the mutant cells are transformed with a plasmid expressing choG. We conclude that choG is the gene responsible for the inducible extracellular cholesterol oxidase activity of strain CECT3014. This activity distributes between the cellular membrane and the culture supernatant in a way that suggests it is produced by the same ChoG protein that occurs in two different locations. RT-PCR transcript analysis showed a dual scheme of choG expression: a low constitutive independent transcription, plus a cholesterol induced transcription of choG into a polycistronic kstD-hsd4B-choG mRNA. Copyright © 2010 Elsevier GmbH. All rights reserved.
Sun, Yuhui; Zhang, Jiexu; Yuan, Yanbo; Yu, Xin; Shen, Yan; Xu, Qi
2012-01-01
Monoamine oxidase A (MAOA) is the enzyme responsible for degradation of several monoamines, such as dopamine and serotonin that are considered as being two of the most important neurotransmitters involved in the pathophysiology of schizophrenia. To study a possible role of the MAOA gene in conferring susceptibility to schizophrenia, the present study genotyped the variable number of tandem repeat (VNTR) polymorphism and 41 SNPs across this gene among 555 unrelated patients with paranoid schizophrenia and 567 unrelated healthy controls. Quantitative real-time PCR analysis was employed to quantify expression of MAOA mRNA in 73 drug-free patients. While none of these genotyped DNA markers showed allelic association with paranoid schizophrenia, haplotypic association was found for the VNTR-rs6323, VNTR-rs1137070, and VNTR-rs6323-rs1137070 haplotypes in female subjects. Nevertheless, no significant change of the expression of MAOA mRNA was detected in either female or male patients with paranoid schizophrenia. Our study suggests that the interaction between genetic variants within the MAOA gene may contribute to an increased risk of paranoid schizophrenia, but the precise mechanism needs further investigation. Copyright © 2011 Wiley Periodicals, Inc.
Lee, H J; Lee, S B; Chung, J S; Han, S U; Han, O; Guh, J O; Jeon, J S; An, G; Back, K
2000-06-01
Protoporphyrinogen oxidase (Protox), the penultimate step enzyme of the branch point for the biosynthetic pathway of Chl and hemes, is the target site of action of diphenyl ether (DPE) herbicides. However, Bacillus subtilis Protox is known to be resistant to the herbicides. In order to develop the herbicide-resistant plants, the transgenic rice plants were generated via expression of B. subtilis Protox gene under ubiquitin promoter targeted to the cytoplasm or to the plastid using Agrobacterium-mediated gene transformation. The integration and expression of the transgene were investigated at T0 generation by DNA and RNA blots. Most transgenic rice plants revealed one copy transgene insertion into the rice genome, but some with 3 copies. The expression levels of B. subtilis Protox mRNA appeared to correlate with the copy number. Furthermore, the plastidal transgenic lines exhibited much higher expression of the Protox mRNA than the cytoplasmic transgenic lines. The transgenic plants expressing the B. subtilis Protox gene at T0 generation were found to be resistant to oxyfluorfen when judged by cellular damage with respect to cellular leakage, Chl loss, and lipid peroxidation. The transgenic rice plants targeted to the plastid exhibited higher resistance to the herbicide than the transgenic plants targeted to the cytoplasm. In addition, possible resistance mechanisms in the transgenic plants to DPE herbicides are discussed.
El-Naggar, Noura El-Ahmady; El-Shweihy, Nancy M; El-Ewasy, Sara M
2016-09-20
Due to broad range of clinical and industrial applications of cholesterol oxidase, isolation and screening of bacterial strains producing extracellular form of cholesterol oxidase is of great importance. One hundred and thirty actinomycete isolates were screened for their cholesterol oxidase activity. Among them, a potential culture, strain NEAE-42 is displayed the highest extracellular cholesterol oxidase activity. It was selected and identified as Streptomyces cavourensis strain NEAE-42. The optimization of different process parameters for cholesterol oxidase production by Streptomyces cavourensis strain NEAE-42 using Plackett-Burman experimental design and response surface methodology was carried out. Fifteen variables were screened using Plackett-Burman experimental design. Cholesterol, initial pH and (NH4)2SO4 were the most significant positive independent variables affecting cholesterol oxidase production. Central composite design was chosen to elucidate the optimal concentrations of the selected process variables on cholesterol oxidase production. It was found that, cholesterol oxidase production by Streptomyces cavourensis strain NEAE-42 after optimization process was 20.521U/mL which is higher than result obtained from the basal medium before screening process using Plackett-Burman (3.31 U/mL) with a fold of increase 6.19. The cholesterol oxidase level production obtained in this study (20.521U/mL) by the statistical method is higher than many of the reported values.
NASA Astrophysics Data System (ADS)
Gladysiewicz, M.; Janicki, L.; Misiewicz, J.; Sobanska, M.; Klosek, K.; Zytkiewicz, Z. R.; Kudrawiec, R.
2016-09-01
Polarization engineering of GaN-based heterostructures opens a way to develop advanced transistor heterostructures, although measurement of the electric field in such heterostructures is not a simple task. In this work, contactless electroreflectance (CER) spectroscopy has been applied to measure the electric field in GaN-based heterostructures. For a set of GaN(d = 0, 5, 15, and 30 nm)/AlGaN(20 nm)/GaN(buffer) heterostructures a decrease of electric field in the GaN(cap) layer from 0.66 MV cm-1 to 0.27 MV cm-1 and an increase of the electric field in the AlGaN layer from 0.57 MV cm-1 to 0.99 MV cm-1 have been observed with the increase in the GaN(cap) thickness from 5-30 nm. For a set of GaN(20 nm)/AlGaN(d = 10, 20, 30, and 40 nm)/GaN(buffer) heterostructures a decrease of the electric field in the AlGaN layer from 1.77 MV cm-1 to 0.64 MV cm-1 and an increase of the electric field in the GaN layer from 0.57 MV cm-1 to 0.99 MV cm-1 were observed with the increase in the AlGaN thickness from 10-40 nm. To determine the distribution of the electric field in these heterostructures the Schrödinger and Poisson equations are solved in a self-consistent manner and matched with experimental data. It is shown that the built-in electric field in the GaN(cap) and AlGaN layers obtained from measurements does not reach values of electric field resulting only from polarization effects. The measured electric fields are smaller due to a screening of polarization effects by free carriers, which are inhomogeneously distributed across the heterostructure and accumulate at interfaces. The results clearly demonstrate that CER measurements supported by theoretical calculations are able to determine the electric field distribution in GaN-based heterostructures quantitatively, which is very important for polarization engineering in this material system.
NADPH Oxidase-Dependent Signaling in Endothelial Cells: Role in Physiology and Pathophysiology
Ushio-Fukai, Masuko; Malik, Asrar B.
2009-01-01
Abstract Reactive oxygen species (ROS) including superoxide (O2·−) and hydrogen peroxide (H2O2) are produced endogenously in response to cytokines, growth factors; G-protein coupled receptors, and shear stress in endothelial cells (ECs). ROS function as signaling molecules to mediate various biological responses such as gene expression, cell proliferation, migration, angiogenesis, apoptosis, and senescence in ECs. Signal transduction activated by ROS, “oxidant signaling,” has received intense investigation. Excess amount of ROS contribute to various pathophysiologies, including endothelial dysfunction, atherosclerosis, hypertension, diabetes, and acute respiratory distress syndrome (ARDS). The major source of ROS in EC is a NADPH oxidase. The prototype phagaocytic NADPH oxidase is composed of membrane-bound gp91phox and p22hox, as well as cytosolic subunits such as p47phox, p67phox and small GTPase Rac. In ECs, in addition to all the components of phagocytic NADPH oxidases, homologues of gp91phox (Nox2) including Nox1, Nox4, and Nox5 are expressed. The aim of this review is to provide an overview of the emerging area of ROS derived from NADPH oxidase and oxidant signaling in ECs linked to physiological and pathophysiological functions. Understanding these mechanisms may provide insight into the NADPH oxidase and oxidant signaling components as potential therapeutic targets. Antioxid. Redox Signal. 11, 791–810. PMID:18783313
Jiang, Zhou; Li, Ping; Jiang, Dawei; Wu, Geng; Dong, Hailiang; Wang, Yanhong; Li, Bing; Wang, Yanxin; Guo, Qinghai
2014-01-01
A total of 12 samples were collected from the Tengchong geothermal areas of Yunnan, China, with the goal to assess the arsenite (AsIII) oxidation potential of the extant microbial communities as inferred by the abundance and diversity of the AsIII oxidase large subunit gene aioA relative to geochemical context. Arsenic concentrations were higher (on average 251.68 μg/L) in neutral or alkaline springs than in acidic springs (on average 30.88 μg/L). aioA abundance ranged from 1.63 × 10(1) to 7.08 × 10(3) per ng of DNA and positively correlated with sulfide and the ratios of arsenate (AsV):total dissolved arsenic (AsTot). Based on qPCR estimates of bacterial and archaeal 16S rRNA gene abundance, aioA-harboring organisms comprised as much as ~15% of the total community. Phylogenetically, the major aioA sequences (270 total) in the acidic hot springs (pH 3.3-4.4) were affiliated with Aquificales and Rhizobiales, while those in neutral or alkaline springs (pH 6.6-9.1) were inferred to be primarily bacteria related to Thermales and Burkholderiales. Interestingly, aioA abundance at one site greatly exceeded bacterial 16S rRNA gene abundance, suggesting these aioA genes were archaeal even though phylogenetically these aioA sequences were most similar to the Aquificales. In summary, this study described novel aioA sequences in geothermal features geographically far removed from those in the heavily studied Yellowstone geothermal complex.
Muhammad, Izhar; Jing, Xiu-Qing; Shalmani, Abdullah; Ali, Muhammad; Yi, Shi; Gan, Peng-Fei; Li, Wen-Qiang; Liu, Wen-Ting; Chen, Kun-Ming
2018-05-12
The ferric reduction oxidase (FRO) gene family is involved in various biological processes widely found in plants and may play an essential role in metal homeostasis, tolerance and intricate signaling networks in response to a number of abiotic stresses. Our study describes the identification, characterization and evolutionary relationships of FRO genes families. Here, total 50 FRO genes in Plantae and 15 ‘FRO like’ genes in non-Plantae were retrieved from 16 different species. The entire FRO genes have been divided into seven clades according to close similarity in biological and functional behavior. Three conserved domains were common in FRO genes while in two FROs sub genome have an extra NADPH-Ox domain, separating the function of plant FROs. OsFRO1 and OsFRO7 genes were expressed constitutively in rice plant. Real-time RT-PCR analysis demonstrated that the expression of OsFRO1 was high in flag leaf, and OsFRO7 gene expression was maximum in leaf blade and flag leaf. Both genes showed vigorous expressions level in response to different abiotic and hormones treatments. Moreover, the expression of both genes was also substantial under heavy metal stresses. OsFRO1 gene expression was triggered following 6 h under Zn, Pb, Co and Ni treatments, whereas OsFRO7 gene expression under Fe, Pb and Ni after 12 h, Zn and Cr after 6 h, and Mn and Co after 3 h treatments. These findings suggest the possible involvement of both the genes under abiotic and metal stress and the regulation of phytohormones. Therefore, our current work may provide the foundation for further functional characterization of rice FRO genes family.
Yin, DeLu (Tyler); Urresti, Saioa; Lafond, Mickael; Johnston, Esther M.; Derikvand, Fatemeh; Ciano, Luisa; Berrin, Jean-Guy; Henrissat, Bernard; Walton, Paul H.; Davies, Gideon J.; Brumer, Harry
2015-01-01
Alcohol oxidases, including carbohydrate oxidases, have a long history of research that has generated fundamental biological understanding and biotechnological applications. Despite a long history of study, the galactose 6-oxidase/glyoxal oxidase family of mononuclear copper-radical oxidases, Auxiliary Activity Family 5 (AA5), is currently represented by only very few characterized members. Here we report the recombinant production and detailed structure–function analyses of two homologues from the phytopathogenic fungi Colletotrichum graminicola and C. gloeosporioides, CgrAlcOx and CglAlcOx, respectively, to explore the wider biocatalytic potential in AA5. EPR spectroscopy and crystallographic analysis confirm a common active-site structure vis-à-vis the archetypal galactose 6-oxidase from Fusarium graminearum. Strikingly, however, CgrAlcOx and CglAlcOx are essentially incapable of oxidizing galactose and galactosides, but instead efficiently catalyse the oxidation of diverse aliphatic alcohols. The results highlight the significant potential of prospecting the evolutionary diversity of AA5 to reveal novel enzyme specificities, thereby informing both biology and applications. PMID:26680532
Copper radical oxidases and related extracellular oxidoreductases of wood-decay Agaricomycetes
Phil Kersten; Dan Cullen
2014-01-01
Extracellular peroxide generation, a key component of oxidative lignocellulose degradation, has been attributed to various enzymes including the copper radical oxidases. Encoded by a family of structurally related sequences, the genes are widely distributed among wood decay fungi including three recently completed polypore genomes. In all cases, core catalytic residues...
20-Hydroxyecdysone upregulates Atg genes to induce autophagy in the Bombyx fat body.
Tian, Ling; Ma, Li; Guo, Enen; Deng, Xiaojuan; Ma, Sanyuan; Xia, Qingyou; Cao, Yang; Li, Sheng
2013-08-01
Autophagy is finely regulated at multiple levels and plays crucial roles in development and disease. In the fat body of the silkworm, Bombyx mori, autophagy occurs and Atg gene expression peaks during the nonfeeding molting and pupation stages when the steroid hormone (20-hydroxyecdysone; 20E) is high. Injection of 20E into the feeding larvae upregulated Atg genes and reduced TORC1 activity resulting in autophagy induction in the fat body. Conversely, RNAi knockdown of the 20E receptor partner (USP) or targeted overexpression of a dominant negative mutant of the 20E receptor (EcR (DN) ) in the larval fat body reduced autophagy and downregulated the Atg genes, confirming the importance of 20E-induction of Atg gene expression during pupation. Moreover, in vitro treatments of the larval fat body with 20E upregulated the Atg genes. Five Atg genes were potentially 20E primary-responsive, and a 20E response element was identified in the Atg1 (ortholog of human ULK1) promoter region. Furthermore, RNAi knockdown of 4 key genes (namely Br-C, E74, HR3 and βftz-F1) in the 20E-triggered transcriptional cascade reduced autophagy and downregulated Atg genes to different levels. Taken together, we conclude that in addition to blocking TORC1 activity for autophagosome initiation, 20E upregulates Atg genes to induce autophagy in the Bombyx fat body.
20-hydroxyecdysone upregulates Atg genes to induce autophagy in the Bombyx fat body
Tian, Ling; Ma, Li; Guo, Enen; Deng, Xiaojuan; Ma, Sanyuan; Xia, Qingyou; Cao, Yang; Li, Sheng
2013-01-01
Autophagy is finely regulated at multiple levels and plays crucial roles in development and disease. In the fat body of the silkworm, Bombyx mori, autophagy occurs and Atg gene expression peaks during the nonfeeding molting and pupation stages when the steroid hormone (20-hydroxyecdysone; 20E) is high. Injection of 20E into the feeding larvae upregulated Atg genes and reduced TORC1 activity resulting in autophagy induction in the fat body. Conversely, RNAi knockdown of the 20E receptor partner (USP) or targeted overexpression of a dominant negative mutant of the 20E receptor (EcRDN) in the larval fat body reduced autophagy and downregulated the Atg genes, confirming the importance of 20E-induction of Atg gene expression during pupation. Moreover, in vitro treatments of the larval fat body with 20E upregulated the Atg genes. Five Atg genes were potentially 20E primary-responsive, and a 20E response element was identified in the Atg1 (ortholog of human ULK1) promoter region. Furthermore, RNAi knockdown of 4 key genes (namely Br-C, E74, HR3 and βftz-F1) in the 20E-triggered transcriptional cascade reduced autophagy and downregulated Atg genes to different levels. Taken together, we conclude that in addition to blocking TORC1 activity for autophagosome initiation, 20E upregulates Atg genes to induce autophagy in the Bombyx fat body. PMID:23674061
Zhu, Shifeng; Gao, Feng; Cao, Xuesong; Chen, Mao; Ye, Gongyin; Wei, Chunhong; Li, Yi
2005-12-01
The mechanisms of viral diseases are a major focus of biology. Despite intensive investigations, how a plant virus interacts with host factors to cause diseases remains poorly understood. The Rice dwarf virus (RDV), a member of the genus Phytoreovirus, causes dwarfed growth phenotypes in infected rice (Oryza sativa) plants. The outer capsid protein P2 is essential during RDV infection of insects and thus influences transmission of RDV by the insect vector. However, its role during RDV infection within the rice host is unknown. By yeast two-hybrid and coimmunoprecipitation assays, we report that P2 of RDV interacts with ent-kaurene oxidases, which play a key role in the biosynthesis of plant growth hormones gibberellins, in infected plants. Furthermore, the expression of ent-kaurene oxidases was reduced in the infected plants. The level of endogenous GA1 (a major active gibberellin in rice vegetative tissues) in the RDV-infected plants was lower than that in healthy plants. Exogenous application of GA3 to RDV-infected rice plants restored the normal growth phenotypes. These results provide evidence that the P2 protein of RDV interferes with the function of a cellular factor, through direct physical interactions, that is important for the biosynthesis of a growth hormone leading to symptom expression. In addition, the interaction between P2 and rice ent-kaurene oxidase-like proteins may decrease phytoalexin biosynthesis and make plants more competent for virus replication. Moreover, P2 may provide a novel tool to investigate the regulation of GA metabolism for plant growth and development.
Dijkman, Willem P.
2014-01-01
In the search for useful and renewable chemical building blocks, 5-hydroxymethylfurfural (HMF) has emerged as a very promising candidate, as it can be prepared from sugars. HMF can be oxidized to 2,5-furandicarboxylic acid (FDCA), which is used as a substitute for petroleum-based terephthalate in polymer production. On the basis of a recently identified bacterial degradation pathway for HMF, candidate genes responsible for selective HMF oxidation have been identified. Heterologous expression of a protein from Methylovorus sp. strain MP688 in Escherichia coli and subsequent enzyme characterization showed that the respective gene indeed encodes an efficient HMF oxidase (HMFO). HMFO is a flavin adenine dinucleotide-containing oxidase and belongs to the glucose-methanol-choline-type flavoprotein oxidase family. Intriguingly, the activity of HMFO is not restricted to HMF, as it is active with a wide range of aromatic primary alcohols and aldehydes. The enzyme was shown to be relatively thermostable and active over a broad pH range. This makes HMFO a promising oxidative biocatalyst that can be used for the production of FDCA from HMF, a reaction involving both alcohol and aldehyde oxidations. PMID:24271187
Collins, F A; Murphy, D L; Reiss, A L; Sims, K B; Lewis, J G; Freund, L; Karoum, F; Zhu, D; Maumenee, I H; Antonarakis, S E
1992-01-01
Norrie disease is a rare X-linked recessive disorder characterized by blindness from infancy. The gene for Norrie disease has been localized to Xp11.3. More recently, the genes for monoamine oxidase (MAOA, MAOB) have been mapped to the same region. This study evaluates the clinical, biochemical, and neuropsychiatric data in an affected male and 2 obligate heterozygote females from a single family with a submicroscopic deletion involving Norrie disease and MAO genes. The propositus was a profoundly retarded, blind male; he also had neurologic abnormalities including myoclonus and stereotopy-habit disorder. Both obligate carrier females had a normal IQ. The propositus' mother met diagnostic criteria for "chronic hypomania and schizotypal features." The propositus' MAO activity was undetectable and the female heterozygotes had reduced levels comparable to patients receiving MAO inhibiting antidepressants. MAO substrate and metabolite abnormalities were found in the propositus' plasma and CSF. This study indicates that subtle biochemical and possibly neuropsychiatric abnormalities may be detected in some heterozygotes with the microdeletion in Xp11.3 due to loss of the gene product for the MAO genes; this deletion can also explain some of the complex phenotype of this contiguous gene syndrome in the propositus.
Yin, Jianhua; Jin, Miao; Zhang, Haiyan; Ju, Lili; Zhang, Lili; Gao, Haichun
2015-01-01
Cytochrome c proteins, as enzymes to exchange electrons with substrates or as pure electron carriers to shuttle electrons, play vital roles in bacterial respiration and photosynthesis. In Shewanella oneidensis, a research model for the respiratory diversity, at least 42 c-type cytochromes are predicted to be encoded in the genome and are regarded to be the foundation of its highly branched electron transport pathways. However, only a small number of c-type cytochromes have been extensively studied. In this study, we identify soluble cytochrome c ScyA as an important factor influencing the nitrite resistance of a strain devoid of the bd oxidase by utilizing a newly developed transposon mutagenesis vector, which enables overexpression of the gene(s) downstream of the insertion site. We show that when in overabundance ScyA facilitates growth against nitrite inhibition by enhancing nitrite resistance of the cbb3 oxidase. Based on the data presented in this study, we suggest two possible mechanisms underlying the observed effect of ScyA: (1) ScyA increases electron flow to the cbb3 oxidase; (2) ScyA promotes nitrite resistance of the cbb3 oxidase, possibly by direct interaction. PMID:25417822
NADPH oxidase inhibitors: a patent review.
Kim, Jung-Ae; Neupane, Ganesh Prasad; Lee, Eung Seok; Jeong, Byeong-Seon; Park, Byung Chul; Thapa, Pritam
2011-08-01
NADPH oxidases, a family of multi-subunit enzyme complexes, catalyze the production of reactive oxygen species (ROS), which may contribute to the pathogenesis of a variety of diseases. In addition to the first NADPH oxidase found in phagocytes, four non-phagocytic NADPH oxidase isoforms have been identified, which all differ in their catalytic subunit (Nox1-5) and tissue distribution. This paper provides a comprehensive review of the patent literature on NADPH oxidase inhibitors, small molecule Nox inhibitors, peptides and siRNAs. Since each member of the NADPH oxidase family has great potential as a therapeutic target, several different compounds have been registered as NADPH oxidase inhibitors in the patent literature. As yet, none have gone through clinical trials, and some have not completed preclinical trials, including safety and specificity evaluation. Recently, small molecule pyrazolopyridine and triazolopyrimidine derivatives have been submitted as potent NADPH oxidase inhibitors and reported as first-in-class inhibitors for idiopathic pulmonary fibrosis and acute stroke, respectively. Further clinical efficacy and safety data are warranted to prove their actual clinical utility.
Elias, Ani A; Busov, Victor B; Kosola, Kevin R; Ma, Cathleen; Etherington, Elizabeth; Shevchenko, Olga; Gandhi, Harish; Pearce, David W; Rood, Stewart B; Strauss, Steven H
2012-10-01
Semidwarfism has been used extensively in row crops and horticulture to promote yield, reduce lodging, and improve harvest index, and it might have similar benefits for trees for short-rotation forestry or energy plantations, reclamation, phytoremediation, or other applications. We studied the effects of the dominant semidwarfism transgenes GA Insensitive (GAI) and Repressor of GAI-Like, which affect gibberellin (GA) action, and the GA catabolic gene, GA 2-oxidase, in nursery beds and in 2-year-old high-density stands of hybrid poplar (Populus tremula × Populus alba). Twenty-nine traits were analyzed, including measures of growth, morphology, and physiology. Endogenous GA levels were modified in most transgenic events; GA(20) and GA(8), in particular, had strong inverse associations with tree height. Nearly all measured traits varied significantly among genotypes, and several traits interacted with planting density, including aboveground biomass, root-shoot ratio, root fraction, branch angle, and crown depth. Semidwarfism promoted biomass allocation to roots over shoots and substantially increased rooting efficiency with most genes tested. The increased root proportion and increased leaf chlorophyll levels were associated with changes in leaf carbon isotope discrimination, indicating altered water use efficiency. Semidwarf trees had dramatically reduced growth when in direct competition with wild-type trees, supporting the hypothesis that semidwarfism genes could be effective tools to mitigate the spread of exotic, hybrid, and transgenic plants in wild and feral populations.
Chi, Ming; Bhagwat, Basdeo; Lane, W David; Tang, Guiliang; Su, Yinquan; Sun, Runcang; Oomah, B Dave; Wiersma, Paul A; Xiang, Yu
2014-03-11
Polyphenol oxidase (PPO), often encoded by a multi-gene family, causes oxidative browning, a significant problem in many food products. Low-browning potatoes were produced previously through suppression of PPO gene expression, but the contribution of individual PPO gene isoform to the oxidative browning process was unknown. Here we investigated the contributions of different PPO genes to total PPO protein activity, and the correlations between PPO protein level, PPO activity and tuber tissue browning potential by suppression of all previously characterized potato PPO genes, both individually and in combination using artificial microRNAs (amiRNAs) technology. Survey of the potato genome database revealed 9 PPO-like gene models, named StuPPO1 to StuPPO9 in this report. StuPPO1, StuPPO2, StuPPO3 and StuPPO4 are allelic to the characterized POTP1/P2, POT32, POT33 and POT72, respectively. Fewer ESTs were found to support the transcriptions of StuPPO5 to StuPPO8. StuPPO9 related ESTs were expressed at significant higher levels in pathogen-infected potato tissues. A series of browning phenotypes were obtained by suppressing StuPPO1 to StuPPO4 genes alone and in combination. Down-regulation of one or several of the PPO genes did not usually cause up-regulation of the other PPO genes in the transgenic potato tubers, but resulted in reduced PPO protein levels. The different PPO genes did not contribute equally to the total PPO protein content in the tuber tissues, with StuPPO2 accounting for ~ 55% as the major contributor, followed by StuPPO1, ~ 25-30% and StuPPO3 and StuPPO4 together with less than 15%. Strongly positive correlations between PPO protein level, PPO activity and browning potential were demonstrated in our analysis. Low PPO activity and low-browning potatoes were produced by simultaneous down-regulation of StuPPO2 to StuPPO4, but the greatest reduction occurred when StuPPO1 to StuPPO4 were all suppressed. StuPPO1 to StuPPO4 genes contributed to browning
Oxidase-functionalized Fe(3)O(4) nanoparticles for fluorescence sensing of specific substrate.
Liu, Cheng-Hao; Tseng, Wei-Lung
2011-10-03
This study reports the development of a reusable, single-step system for the detection of specific substrates using oxidase-functionalized Fe(3)O(4) nanoparticles (NPs) as a bienzyme system and using amplex ultrared (AU) as a fluorogenic substrate. In the presence of H(2)O(2), the reaction pH between Fe(3)O(4) NPs and AU was similar to the reaction of oxidase and the substrate. The catalytic activity of Fe(3)O(4) NPs with AU was nearly unchanged following modification with poly(diallyldimethylammonium chloride) (PDDA). Based on these features, we prepared a composite of PDDA-modified Fe(3)O(4) NPs and oxidase for the quantification of specific substrates through the H(2)O(2)-mediated oxidation of AU. By monitoring fluorescence intensity at 587 nm of oxidized AU, the minimum detectable concentrations of glucose, galactose, and choline were found to be 3, 2, and 20 μM using glucose oxidase-Fe(3)O(4), galactose oxidase-Fe(3)O(4), and choline oxidase-Fe(3)O(4) composites, respectively. The identification of glucose in blood was selected as the model to validate the applicability of this proposed method. Copyright © 2011 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Lott, J. A.; Shchukin, V. A.; Ledentsov, N. N.; Stinz, A.; Hopfer, F.; Mutig, A.; Fiol, G.; Bimberg, D.; Blokhin, S. A.; Karachinsky, L. Y.; Novikov, I. I.; Maximov, M. V.; Zakharov, N. D.; Werner, P.
2009-02-01
We report on the modeling, epitaxial growth, fabrication, and characterization of 830-845 nm vertical cavity surface emitting lasers (VCSELs) that employ InAs-GaAs quantum dot (QD) gain elements. The GaAs-based VCSELs are essentially conventional in design, grown by solid-source molecular beam epitaxy, and include top and bottom gradedheterointerface AlGaAs distributed Bragg reflectors, a single selectively-oxidized AlAs waveguiding/current funneling aperture layer, and a quasi-antiwaveguiding microcavity. The active region consists of three sheets of InAs-GaAs submonolayer insertions separated by AlGaAs matrix layers. Compared to QWs the InAs-GaAs insertions are expected to offer higher exciton-dominated modal gain and improved carrier capture and retention, thus resulting in superior temperature stability and resilience to degradation caused by operating at the larger switching currents commonly employed to increase the data rates of modern optical communication systems. We investigate the robustness and temperature performance of our QD VCSEL design by fabricating prototype devices in a high-frequency ground-sourceground contact pad configuration suitable for on-wafer probing. Arrays of VCSELs are produced with precise variations in top mesa diameter from 24 to 36 μm and oxide aperture diameter from 1 to 12 μm resulting in VCSELs that operate in full single-mode, single-mode to multi-mode, and full multi-mode regimes. The single-mode QD VCSELs have room temperature threshold currents below 0.5 mA and peak output powers near 1 mW, whereas the corresponding values for full multi-mode devices range from about 0.5 to 1.5 mA and 2.5 to 5 mW. At 20°C we observe optical transmission at 20 Gb/s through 150 m of OM3 fiber with a bit error ratio better than 10-12, thus demonstrating the great potential of our QD VCSELs for applications in next-generation short-distance optical data communications and interconnect systems.
Jiang, Xiao-hua; Yang, Hui; Yang, Jing-fang; Dong, Xiu-min; Xu, Qun-yuan; Chen, Biao
2003-06-01
To study the association between the polymorphism of human monoamine oxidase type A (MAO-A) gene and Parkinson's disease(PD). Fnu4HI restriction fragment length polymorphism(RFLP) and PCR-RFLP were used to detect the mutation of MAO-A gene. The frequencies of alleles and genotypes at the MAO-A Fnu4HI locus on the X chromosome in different PD group were compared with those of the control group. It was found that the frequencies of G allele in the patients with PD and controls were 0.613 and 0.527 respectively, P=0.039 "the frequencies of TT genotype were 0.303 and 0.415(P=0.014), and the frequencies of GG genotype were 0.564 and 0.451 respectively(P=0.021). When the patients were divided into two groups by age-onset, significant difference in the allelic and genotypic frequencies was observed only between early-onset PD group and control group. And when the PD patients were grouped by sex, significant difference was observed only between male PD group and male control group (the frequencies of G allele being 0.669 and 0.500 respectively, P=0.005). This study revealed significant differences between PD group and control group in allelic and genotypic frequencies. The findings supported the hypothesis about an association between MAO-A gene and PD, suggesting that age at onset of PD and gender predisposition might be related to the putative association, and Fnu4HI SNP be a risk factor for PD.
Bonen, Linda; Boer, Poppo H.; Gray, Michael W.
1984-01-01
We have determined the sequence of the wheat mitochondrial gene for cytochrome oxidase subunit II (COII) and find that its derived protein sequence differs from that of maize at only three amino acid positions. Unexpectedly, all three replacements are non-conservative ones. The wheat COII gene has a highly-conserved intron at the same position as in maize, but the wheat intron is 1.5 times longer because of an insert relative to its maize counterpart. Hybridization analysis of mitochondrial DNA from rye, pea, broad bean and cucumber indicates strong sequence conservation of COII coding sequences among all these higher plants. However, only rye and maize mitochondrial DNA show homology with wheat COII intron sequences and rye alone with intron-insert sequences. We find that a sequence identical to the region of the 5' exon corresponding to the transmembrane domain of the COII protein is present at a second genomic location in wheat mitochondria. These variations in COII gene structure and size, as well as the presence of repeated COII sequences, illustrate at the DNA sequence level, factors which contribute to higher plant mitochondrial DNA diversity and complexity. ImagesFig. 3.Fig. 4.Fig. 5. PMID:16453565
Pils, D; Schmetterer, G
2001-09-25
Synechocystis sp. PCC 6803 contains three respiratory terminal oxidases (RTOs): cytochrome c oxidase (Cox), quinol oxidase (Cyd), and alternate RTO (ARTO). Mutants lacking combinations of the RTOs were used to characterize these key enzymes of respiration. Pentachlorophenol and 2-heptyl-4-hydroxy-quinoline-N-oxide inhibited Cyd completely, but had little effect on electron transport to the other RTOs. KCN inhibited all three RTOs but the in vivo K(I) for Cox and Cyd was quite different (7 vs. 27 microM), as was their affinity for oxygen (K(M) 1.0 vs. 0.35 microM). ARTO has a very low respiratory activity. However, when uptake of 3-O-methylglucose, an active H+ co-transport, was used to monitor energization of the cytoplasmic membrane, ARTO was similarly effective as the other RTOs. As removal of the gene for cytochrome c(553) had the same effects as removal of ARTO genes, we propose that the ARTO might be a second Cox. The possible functions, localization and regulation of the RTOs are discussed.
Zhu, Shifeng; Gao, Feng; Cao, Xuesong; Chen, Mao; Ye, Gongyin; Wei, Chunhong; Li, Yi
2005-01-01
The mechanisms of viral diseases are a major focus of biology. Despite intensive investigations, how a plant virus interacts with host factors to cause diseases remains poorly understood. The Rice dwarf virus (RDV), a member of the genus Phytoreovirus, causes dwarfed growth phenotypes in infected rice (Oryza sativa) plants. The outer capsid protein P2 is essential during RDV infection of insects and thus influences transmission of RDV by the insect vector. However, its role during RDV infection within the rice host is unknown. By yeast two-hybrid and coimmunoprecipitation assays, we report that P2 of RDV interacts with ent-kaurene oxidases, which play a key role in the biosynthesis of plant growth hormones gibberellins, in infected plants. Furthermore, the expression of ent-kaurene oxidases was reduced in the infected plants. The level of endogenous GA1 (a major active gibberellin in rice vegetative tissues) in the RDV-infected plants was lower than that in healthy plants. Exogenous application of GA3 to RDV-infected rice plants restored the normal growth phenotypes. These results provide evidence that the P2 protein of RDV interferes with the function of a cellular factor, through direct physical interactions, that is important for the biosynthesis of a growth hormone leading to symptom expression. In addition, the interaction between P2 and rice ent-kaurene oxidase-like proteins may decrease phytoalexin biosynthesis and make plants more competent for virus replication. Moreover, P2 may provide a novel tool to investigate the regulation of GA metabolism for plant growth and development. PMID:16299167
Yong, Hoi-Sen; Lim, Phaik-Eem; Eamsobhana, Praphathip
2017-01-01
The tephritid fruit fly Zeugodacus tau (Walker) is a polyphagous fruit pest of economic importance in Asia. Studies based on genetic markers indicate that it forms a species complex. We report here (1) the complete mitogenome of Z. tau from Malaysia and comparison with that of China as well as the mitogenome of other congeners, and (2) the relationship of Z. tau taxa from different geographical regions based on sequences of cytochrome c oxidase subunit I gene. The complete mitogenome of Z. tau had a total length of 15631 bp for the Malaysian specimen (ZT3) and 15835 bp for the China specimen (ZT1), with similar gene order comprising 37 genes (13 protein-coding genes—PCGs, 2 rRNA genes, and 22 tRNA genes) and a non-coding A + T-rich control region (D-loop). Based on 13 PCGs and 15 mt-genes, Z. tau NC_027290 (China) and Z. tau ZT1 (China) formed a sister group in the lineage containing also Z. tau ZT3 (Malaysia). Phylogenetic analysis based on partial sequences of cox1 gene indicates that the taxa from China, Japan, Laos, Malaysia, Bangladesh, India, Sri Lanka, and Z. tau sp. A from Thailand belong to Z. tau sensu stricto. A complete cox1 gene (or 13 PCGs or 15 mt-genes) instead of partial sequence is more appropriate for determining phylogenetic relationship. PMID:29216281
[Activation of the alternative oxidase of Yarrowia lipolytica by adenosine 5'-monophosphate].
Medentsev, A G; Arinbasarova, A Iu; Smirnova, N M; Akimenko, V K
2004-01-01
The study of the effect of nucleoside phosphates on the activity of cyanide-resistant oxidase in the mitochondria and the submitochondrial particles of Yarrowia lipolytica showed that adenosine monophosphate (5'-AMP, AMP) did not stimulate the respiration of the intact mitochondria. The incubation of the mitochondria at room temperature (25 degrees C) for 3-5 h or their treatment with ultrasound, phospholipase A, and detergent Triton X-100 at a low temperature inactivated the cyanide-resistant alternative oxidase. The inactivated alternative oxidase could be reactivated by AMP. The reactivating effect of AMP was enhanced by azolectin. Some other nucleoside phosphates also showed reactivating ability in the following descending order. AMP = GMP > GDP > GTP > XMP > IMP. The apparent reaction rate constant Km for AMP upon the reactivation of the alternative oxidase of mitochondria treated with Triton X-100 or incubated at 25 degrees C was 12.5 and 20 microM, respectively. The Km for AMP upon the reactivation of the alternative oxidase of submitochondrial particles was 15 microM. During the incubation of yeast cells under conditions promoting the development of alternative oxidase, the content of adenine nucleotides (AMP, ADP, and ATP) in the cells and their respiration tended to decrease. The subsequent addition of cyanide to the cells activated their respiration, diminished the intracellular content of ATP three times, and augmented the content of AMP five times. These data suggest that the stimulation of cell respiration by cyanide may be due to the activation of alternative oxidase by AMP.
RBM20 Regulates Circular RNA Production From the Titin Gene.
Khan, Mohsin A F; Reckman, Yolan J; Aufiero, Simona; van den Hoogenhof, Maarten M G; van der Made, Ingeborg; Beqqali, Abdelaziz; Koolbergen, Dave R; Rasmussen, Torsten B; van der Velden, Jolanda; Creemers, Esther E; Pinto, Yigal M
2016-10-14
RNA-binding motif protein 20 (RBM20) is essential for normal splicing of many cardiac genes, and loss of RBM20 causes dilated cardiomyopathy. Given its role in splicing, we hypothesized an important role for RBM20 in forming circular RNAs (circRNAs), a novel class of noncoding RNA molecules. To establish the role of RBM20 in the formation of circRNAs in the heart. Here, we performed circRNA profiling on ribosomal depleted RNA from human hearts and identified the expression of thousands of circRNAs, with some of them regulated in disease. Interestingly, we identified 80 circRNAs to be expressed from the titin gene, a gene that is known to undergo highly complex alternative splicing. We show that some of these circRNAs are dynamically regulated in dilated cardiomyopathy but not in hypertrophic cardiomyopathy. We generated RBM20-null mice and show that they completely lack these titin circRNAs. In addition, in a cardiac sample from an RBM20 mutation carrier, titin circRNA production was severely altered. Interestingly, the loss of RBM20 caused only a specific subset of titin circRNAs to be lost. These circRNAs originated from the RBM20-regulated I-band region of the titin transcript. We show that RBM20 is crucial for the formation of a subset of circRNAs that originate from the I-band of the titin gene. We propose that RBM20, by excluding specific exons from the pre-mRNA, provides the substrate to form this class of RBM20-dependent circRNAs. © 2016 American Heart Association, Inc.
Eprintsev, A T; Mal'tseva, E V; Shatskikh, A S; Popov, V N
2011-01-01
The involvement of active oxygen forms in the regulation of the expression of mitochondrial respiratory chain components, which are not related to energy storing, has been in vitro and in vivo studied in Lycopersicum esculentum L. The highest level of transcription of genes encoding alternative oxidase and NADH dehydrogenase has been observed in green tomato leaves. It has been shown that even low H2O2 concentrations activate both aoxlalpha and ndb1 genes, encoding alternative oxidase and external mitochondrial rotenone-insensitive NADH dehydrogenase, respectively. According to our results, in the case of an oxidative stress, alternative oxidase and NADH dehydrogenase are coexpressed in tomato plant tissues, and active oxygen forms serve as the secondary messengers of their coexpression.
Mutations in the SURF1 gene associated with Leigh syndrome and cytochrome C oxidase deficiency.
Péquignot, M O; Dey, R; Zeviani, M; Tiranti, V; Godinot, C; Poyau, A; Sue, C; Di Mauro, S; Abitbol, M; Marsac, C
2001-05-01
Cytochrome c oxidase (COX) deficiency is one of the major causes of Leigh Syndrome (LS), a fatal encephalopathy of infancy or childhood, characterized by symmetrical lesions in the basal ganglia and brainstem. Mutations in the nuclear genes encoding COX subunits have not been found in patients with LS and COX deficiency, but mutations have been identified in SURF1. SURF1 encodes a factor involved in COX biogenesis. To date, 30 different mutations have been reported in 40 unrelated patients. We aim to provide an overview of all known mutations in SURF1, and to propose a common nomenclature. Twelve of the mutations were insertion/deletion mutations in exons 1, 4, 6, 8, and 9; 10 were missense/nonsense mutations in exons 2, 4, 5, 7, and 8; and eight were detected at splicing sites in introns 3 to 7. The most frequent mutation was 312_321del 311_312insAT which was found in 12 patients out of 40. Twenty mutations have been described only once. We also list all polymorphisms discovered to date. Copyright 2001 Wiley-Liss, Inc.
Zhang, Y D; Zhang, Z; Zhou, N F; Jia, W T; Cheng, X G; Wei, X J
2014-08-28
Primary osteoporosis is a common health problem in postmenopausal women. This study aimed to detect the association of the g.19074G>A genetic variant in the osteoprotegerin gene (OPG) with bone mineral density (BMD) and primary osteoporosis. The created restriction site-polymerase chain reaction method was used to investigate the g.19074G>A genetic variant. The BMD of the femoral neck hip, lumbar spine (L2-4), and total hip were assessed by dual-energy X-ray absorptiometry (DEXA) in 856 unrelated Chinese postmenopausal women. We found significant differences in the BMDs of the femoral neck hip, lumbar spine (L2-4), and total hip among different genotypes; individuals with the GG genotype had significantly higher BMDs than those with the GA and AA genotypes (P < 0.05). Our results indicated that the A allele was an increased risk factor for primary osteoporosis and the g.19074G>A genetic variant of the OPG gene was associated with BMD and primary osteoporosis in Chinese postmenopausal women.
Tang, Yuehui; Liu, Kun; Zhang, Ju; Li, Xiaoli; Xu, Kedong; Zhang, Yi; Qi, Jing; Yu, Deshui; Wang, Jian; Li, Chengwei
2017-01-01
Transcription factors of the AP2/ERF family play important roles in plant growth, development, and responses to biotic and abiotic stresses. In this study, a physic nut AP2/ERF gene, JcDREB2 , was functionally characterized. Real-time PCR analysis revealed that JcDREB2 was expressed mainly in the leaf and could be induced by abscisic acid but suppressed by gibberellin (GA) and salt. Transient expression of a JcDREB2-YFP fusion protein in Arabidopsis protoplasts cells suggested that JcDREB2 is localized in the nucleus. Rice plants overexpressing JcDREB2 exhibited dwarf and GA-deficient phenotypes with shorter shoots and roots than those of wild-type plants. The dwarfism phenotype could be rescued by the application of exogenous GA 3 . The expression levels of GA biosynthetic genes including OsGA20ox1 , OsGA20ox2 , OsGA20ox4 , OsGA3ox2, OsCPS1 , OsKO2 , and OsKAO were significantly reduced in plants overexpressing JcDREB2 . Overexpression of JcDREB2 in rice increased sensitivity to salt stress. Increases in the expression levels of several salt-tolerance-related genes in response to salt stress were impaired in JcDREB2 -overexpressing plants. These results demonstrated not only that JcDREB2 influences GA metabolism, but also that it can participate in the regulation of the salt stress response in rice.
Robertson, Aaron; Schaltz, Kyle; Neimanis, Karina; Staples, James F; McDonald, Allison E
2016-10-01
Alternative oxidase (AOX) is a terminal oxidase within the inner mitochondrial membrane (IMM) present in many organisms where it functions in the electron transport system (ETS). AOX directly accepts electrons from ubiquinol and is therefore capable of bypassing ETS Complexes III and IV. The human genome does not contain a gene coding for AOX, so AOX expression has been suggested as a gene therapy for a range of human mitochondrial diseases caused by genetic mutations that render Complex III and/or IV dysfunctional. An effective means of screening mutations amenable to AOX treatment remains to be devised. We have generated such a tool by heterologously expressing AOX from the Pacific oyster (Crassostrea gigas) in the yeast Saccharomyces cerevisiae under the control of a galactose promoter. Our results show that this animal AOX is monomeric and is correctly targeted to yeast mitochondria. Moreover, when expressed in yeast, Pacific oyster AOX is a functional quinol oxidase, conferring cyanide-resistant growth and myxothiazol-resistant oxygen consumption to yeast cells and isolated mitochondria. This system represents a high-throughput screening tool for determining which Complex III and IV genetic mutations in yeast will be amenable to AOX gene therapy. As many human genes are orthologous to those found in yeast, our invention represents an efficient and cost-effective way to evaluate viable research avenues. In addition, this system provides the opportunity to learn more about the localization, structure, and regulation of AOXs from animals that are not easily reared or manipulated in the lab.
Ghaleh, Talaat Dabbaghi; Skandari, Somayeh Saadat; Najafipour, Reza; Rashvand, Zahra; Darabi, Masoud; Sahmani, Mehdi
2018-04-01
Ghrelin hormone has an important role in a wide range of metabolic and non-metabolic processes. Polymorphisms of ghrelin gene could be associated with a large number of diseases. The aim of this study was to evaluate the association of -604G/A and -501A/C polymorphisms in ghrelin and obestatin prepropeptide gene (GHRL) with polycystic ovary syndrome (PCOS) in a sample of Iranian women. One hundred and fifty-two women with PCOS and 162 age-matched apparently healthy women as control group were enrolled in this study. The study subjects were genotyped for polymorphisms in the ghrelin gene using polymerase chain reaction-restriction fragment length polymorphism-based methods. Biochemical parameters, serum prolactin, luteinizing hormone, follicle stimulating hormone, estradiol, and testosterone were estimated by chemiluminescence assay. Serum lipids and lipoproteins were determined by standard enzymatic methods. The association between the risk of PCOS and ghrelin gene polymorphisms was examined using Multivariate analysis. The frequency of the -604G/A and -501A/C polymorphisms was not statistically different between patients and the control group of women (p = 0.12 and p = 0.21, respectively). A significantly higher level of LDL-C was found in the wild-type AA genotype compared with CC genotype of -501A/C polymorphism (p = 0.02). Our findings indicate that neither -604G/A and nor -501A/C polymorphisms of ghrelin gene are associated with PCOS, but suggest a relation between the presence of polymorphic allele of -501A/C polymorphism and LDL-C level in a sample of Iranian women.
Norrie disease gene is distinct from the monoamine oxidase genes.
Sims, K B; Ozelius, L; Corey, T; Rinehart, W B; Liberfarb, R; Haines, J; Chen, W J; Norio, R; Sankila, E; de la Chapelle, A
1989-09-01
The genes for MAO-A and MAO-B appear to be very close to the Norrie disease gene, on the basis of loss and/or disruption of the MAO genes and activities in atypical Norrie disease patients deleted for the DXS7 locus; linkage among the MAO genes, the Norrie disease gene, and the DXS7 locus; and mapping of all these loci to the chromosomal region Xp11. The present study provides evidence that the MAO genes are not disrupted in "classic" Norrie disease patients. Genomic DNA from these "nondeletion" Norrie disease patients did not show rearrangements at the MAOA or DXS7 loci. Normal levels of MAO-A activities, as well as normal amounts and size of the MAO-A mRNA, were observed in cultured skin fibroblasts from these patients, and MAO-B activity in their platelets was normal. Catecholamine metabolites evaluated in plasma and urine were in the control range. Thus, although some atypical Norrie disease patients lack both MAO-A and MAO-B activities, MAO does not appear to be an etiologic factor in classic Norrie disease.
NASA Astrophysics Data System (ADS)
Saini, Basant; Adhikari, Sonachand; Pal, Suchandan; Kapoor, Avinsahi
2017-07-01
The effectiveness of polarization matching layer (PML) between i-InGaN/p-GaN is studied numerically for Ga-face InGaN/GaN p-i-n solar cell at low p-GaN doping (∼5e17 cm-3). The simulations are performed for four InxGa1-xN/GaN heterostructures (x = 10%, 15%, 20% and 25%), thus investigating the impact of PML for low as well as high indium containing absorber regions. Use of PML presents a suitable alternative to counter the effects of polarization-induced electric fields arising at low p-GaN doping density especially for absorber regions with high indium (>10%). It is seen that it not only mitigates the negative effects of polarization-induced electric fields but also reduces the high potential barriers existing at i-InGaN/p-GaN heterojunction. The improvement in photovoltaic properties of the heterostructures even at low p-GaN doping validates this claim.
Whole Genome Association Mapping of Plant Height in Winter Wheat (Triticum aestivum L.)
Zanke, Christine D.; Ling, Jie; Plieske, Jörg; Kollers, Sonja; Ebmeyer, Erhard; Korzun, Viktor; Argillier, Odile; Stiewe, Gunther; Hinze, Maike; Neumann, Kerstin; Ganal, Martin W.; Röder, Marion S.
2014-01-01
The genetic architecture of plant height was investigated in a set of 358 recent European winter wheat varieties plus 14 spring wheat varieties based on field data in eight environments. Genotyping of diagnostic markers revealed the Rht-D1b mutant allele in 58% of the investigated varieties, while the Rht-B1b mutant was only present in 7% of the varieties. Rht-D1 was significantly associated with plant height by using a mixed linear model and employing a kinship matrix to correct for population stratification. Further genotyping data included 732 microsatellite markers, resulting in 770 loci, of which 635 markers were placed on the ITMI map plus a set of 7769 mapped SNP markers genotyped with the 90 k iSELECT chip. When Bonferroni correction was applied, a total of 153 significant marker-trait associations (MTAs) were observed for plant height and the SSR markers (−log10 (P-value) ≥4.82) and 280 (−log10 (P-value) ≥5.89) for the SNPs. Linear regression between the most effective markers and the BLUEs for plant height indicated additive effects for the MTAs of different chromosomal regions. Analysis of syntenic regions in the rice genome revealed closely linked rice genes related to gibberellin acid (GA) metabolism and perception, i.e. GA20 and GA2 oxidases orthologous to wheat chromosomes 1A, 2A, 3A, 3B, 5B, 5D and 7B, ent-kaurenoic acid oxidase orthologous to wheat chromosome 7A, ent-kaurene synthase on wheat chromosome 2B, as well as GA-receptors like DELLA genes orthologous to wheat chromosomes 4B, 4D and 7A and genes of the GID family orthologous to chromosomes 2B and 5B. The data indicated that besides the widely used GA-insensitive dwarfing genes Rht-B1 and Rht-D1 there is a wide spectrum of loci available that could be used for modulating plant height in variety development. PMID:25405621
Targeting NADPH oxidases in vascular pharmacology
Schramm, Agata; Matusik, Paweł; Osmenda, Grzegorz; Guzik, Tomasz J
2012-01-01
Oxidative stress is a molecular dysregulation in reactive oxygen species (ROS) metabolism, which plays a key role in the pathogenesis of atherosclerosis, vascular inflammation and endothelial dysfunction. It is characterized by a loss of nitric oxide (NO) bioavailability. Large clinical trials such as HOPE and HPS have not shown a clinical benefit of antioxidant vitamin C or vitamin E treatment, putting into question the role of oxidative stress in cardiovascular disease. A change in the understanding of the molecular nature of oxidative stress has been driven by the results of these trials. Oxidative stress is no longer perceived as a simple imbalance between the production and scavenging of ROS, but as a dysfunction of enzymes involved in ROS production. NADPH oxidases are at the center of these events, underlying the dysfunction of other oxidases including eNOS uncoupling, xanthine oxidase and mitochondrial dysfunction. Thus NADPH oxidases are important therapeutic targets. Indeed, HMG-CoA reductase inhibitors (statins) as well as drugs interfering with the renin-angiotensin-aldosterone system inhibit NADPH oxidase activation and expression. Angiotensin-converting enzyme (ACE) inhibitors, AT1 receptor antagonists (sartans) and aliskiren, as well as spironolactone or eplerenone, have been discussed. Molecular aspects of NADPH oxidase regulation must be considered, while thinking about novel pharmacological targeting of this family of enzymes consisting of several homologs Nox1, Nox2, Nox3, Nox4 and Nox5 in humans. In order to properly design trials of antioxidant therapies, we must develop reliable techniques for the assessment of local and systemic oxidative stress. Classical antioxidants could be combined with novel oxidase inhibitors. In this review, we discuss NADPH oxidase inhibitors such as VAS2870, VAS3947, GK-136901, S17834 or plumbagin. Therefore, our efforts must focus on generating small molecular weight inhibitors of NADPH oxidases, allowing the
Norrie disease gene is distinct from the monoamine oxidase genes
Sims, Katherine B.; Ozelius, Laurie; Corey, Timothy; Rinehart, William B.; Liberfarb, Ruth; Haines, Jonathan; Chen, Wei Jane; Norio, Reijo; Sankila, Eeva; de la Chapelle, Albert; Murphy, Dennis L.; Gusella, James; Breakefield, Xandra O.
1989-01-01
The genes for MAO-A and MAO-B appear to be very close to the Norrie disease gene, on the basis of loss and /or disruption of the MAO genes and activities in atypical Norrie disease patients deleted for the DXS7 locus; linkage among the MAO genes, the Norrie disease gene, and the DXS7 locus; and mapping of all these loci to the chromosomal region Xp11. The present study provides evidence that the MAO genes are not disrupted in “classic” Norrie disease patients. Genomic DNA from these “nondeletion” Norrie disease patients did not show rearrangements at the MAOA or DXS7 loci. Normal levels of MAO-A activities, as well as normal amounts and size of the MAO-A mRNA, were observed in cultured skin fibroblasts from these patients, and MAO-B activity in their platelets was normal. Catecholamine metabolites evaluated in plasma and urine were in the control range. Thus, although some atypical Norrie disease patients lack both MAO-A and MAO-B activities, MAO does not appear to be an etiologic factor in classic Norrie disease. ImagesFigure 2Figure 3 PMID:2773935
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kusakabe, Kazuhide; Hashimoto, Naoki; Wang, Ke
2016-04-11
The growth kinetics and structural perfection of (InN){sub 1}/(GaN){sub 1–20} short-period superlattices (SPSs) were investigated with their application to ordered alloys in mind. The SPSs were grown on +c-GaN template at 650 °C by dynamic atomic layer epitaxy in conventional plasma-assisted molecular beam epitaxy. It was found that coherent structured InN/GaN SPSs could be fabricated when the thickness of the GaN barrier was 4 ML or above. Below 3 ML, the formation of SPSs was quite difficult owing to the increased strain in the SPS structure caused by the use of GaN as a template. The effective or average In composition of themore » (InN){sub 1}/(GaN){sub 4} SPSs was around 10%, and the corresponding InN coverage in the ∼1 ML-thick InN wells was 50%. It was found that the effective InN coverage in ∼1 ML-thick InN wells could be varied with the growth conditions. In fact, the effective In composition could be increased up to 13.5%, i.e., the corresponding effective InN coverage was about 68%, by improving the capping/freezing speed by increasing the growth rate of the GaN barrier layer.« less
Ovary-derived precursor gibberellin A9 is essential for female flower development in cucumber.
Pimenta Lange, Maria João; Lange, Theo
2016-12-01
Gibberellins (GAs) are hormones that control many aspects of plant development, including flowering. It is well known that stamen is the source of GAs that regulate male and bisexual flower development. However, little is known about the role of GAs in female flower development. In cucumber, high levels of GA precursors are present in ovaries and high levels of bioactive GA 4 are identified in sepals/petals, reflecting the expression of GA 20-oxidase and 3-oxidase in these organs, respectively. Here, we show that the biologically inactive precursor GA 9 moves from ovaries to sepal/petal tissues where it is converted to the bioactive GA 4 necessary for female flower development. Transient expression of a catabolic GA 2-oxidase from pumpkin in cucumber ovaries decreases GA 9 and GA 4 levels and arrests the development of female flowers, and this can be restored by application of GA 9 to petals thus confirming its function. Given that bioactive GAs can promote sex reversion of female flowers, movement of biologically inactive precursors, instead of the hormone itself, might help to maintain floral organ identity, ensuring fruit and seed production. © 2016. Published by The Company of Biologists Ltd.
Qi, Jing; Dong, Zhen; Zhang, Yu-Xing
2015-12-01
The aim of the present study was to genetically modify plantlets of the Chinese yali pear to reduce their expression of ripening-associated 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) and therefore increase the shelf-life of the fruit. Primers were designed with selectivity for the conserved regions of published ACO gene sequences, and yali complementary DNA (cDNA) cloning was performed by reverse transcription quantitative polymerase chain reaction (PCR). The obtained cDNA fragment contained 831 base pairs, encoding 276 amino acid residues, and shared no less than 94% nucleotide sequence identity with other published ACO genes. The cDNA fragment was inversely inserted into a pBI121 expression vector, between the cauliflower mosaic virus 35S promoter and the nopaline synthase terminator, in order to construct the anti‑sense expression vector of the ACO gene; it was transfected into cultured yali plants using Agrobacterium LBA4404. Four independent transgenic lines of pear plantlets were obtained and validated by PCR analysis. A Southern blot assay revealed that there were three transgenic lines containing a single copy of exogenous gene and one line with double copies. The present study provided germplasm resources for the cultivation of novel storage varieties of pears, therefore providing a reference for further applications of anti‑sense RNA technology in the genetic improvement of pears and other fruit.
SZGR 2.0: a one-stop shop of schizophrenia candidate genes
Jia, Peilin; Han, Guangchun; Zhao, Junfei; Lu, Pinyi; Zhao, Zhongming
2017-01-01
SZGR 2.0 is a comprehensive resource of candidate variants and genes for schizophrenia, covering genetic, epigenetic, transcriptomic, translational and many other types of evidence. By systematic review and curation of multiple lines of evidence, we included almost all variants and genes that have ever been reported to be associated with schizophrenia. In particular, we collected ∼4200 common variants reported in genome-wide association studies, ∼1000 de novo mutations discovered by large-scale sequencing of family samples, 215 genes spanning rare and replication copy number variations, 99 genes overlapping with linkage regions, 240 differentially expressed genes, 4651 differentially methylated genes and 49 genes as antipsychotic drug targets. To facilitate interpretation, we included various functional annotation data, especially brain eQTL, methylation QTL, brain expression featured in deep categorization of brain areas and developmental stages and brain-specific promoter and enhancer annotations. Furthermore, we conducted cross-study, cross-data type and integrative analyses of the multidimensional data deposited in SZGR 2.0, and made the data and results available through a user-friendly interface. In summary, SZGR 2.0 provides a one-stop shop of schizophrenia variants and genes and their function and regulation, providing an important resource in the schizophrenia and other mental disease community. SZGR 2.0 is available at https://bioinfo.uth.edu/SZGR/. PMID:27733502
Poyau, A; Buchet, K; Godinot, C
1999-12-03
The human SURF1 gene encoding a protein involved in cytochrome c oxidase (COX) assembly, is mutated in most patients presenting Leigh syndrome associated with COX deficiency. Proteins homologous to the human Surf1 have been identified in nine eukaryotes and six prokaryotes using database alignment tools, structure prediction and/or cDNA sequencing. Their sequence comparison revealed a remarkable Surf1 conservation during evolution and put forward at least four highly conserved domains that should be essential for Surf1 function. In Paracoccus denitrificans, the Surf1 homologue is found in the quinol oxidase operon, suggesting that Surf1 is associated with a primitive quinol oxidase which belongs to the same superfamily as cytochrome oxidase.
Inactivation of 1-aminocyclopropane-1-carboxylate oxidase involves oxidative modifications.
Barlow, J N; Zhang, Z; John, P; Baldwin, J E; Schofield, C J
1997-03-25
1-Aminocyclopropane-1-carboxylate (ACC) oxidase catalyzes the final step in the biosynthesis of the plant signaling molecule ethylene. It is a member of the ferrous iron dependent family of oxidases and dioxygenases and is unusual in that it displays a very short half-life under catalytic conditions, typically less than 20 min, and a requirement for CO2 as an activator. The rates of inactivation of purified, recombinant ACC oxidase from tomato under various combinations of substrates and cofactors were measured. Inactivation was relatively slow in the presence of buffer alone (t1/2 > 1 h), but fast in the presence of ferrous iron and ascorbate (t1/2 approximately 10 min). The rate of iron/ascorbate-mediated inactivation was increased by the addition of ACC, unaffected by the addition of CO2 at saturation (supplied as bicarbonate) but decreased by the addition of catalase or ACC + CO2 at saturation (supplied as bicarbonate). Iron/ascorbate-mediated inactivation was accompanied by partial proteolysis as observed by SDS-PAGE analysis. The fragmentation pattern was altered when ACC was also included, suggesting that ACC can bind to ACC oxidase in the absence of bicarbonate. N-terminal sequencing of fragments resulted in identification of an internal cleavage site which we propose is proximate to active-site bound iron. Thus, ACC oxidase inactivates via relatively slow partial unfolding of the catalytically active conformation, oxidative damage mediated via hydrogen peroxide which is catalase protectable and oxidative damage to the active site which results in partial proteolysis and is not catalase protectable.
Nishitani, Goh; Yoshida, Masaki
2018-06-01
This study was performed in order to develop a primer set for mitochondrial cytochrome c oxidase subunit I (COI) in the DHA-rich microalgae of the genus Aurantiochytrium. The performance of the primer set was tested using 12 Aurantiochytrium strains and other thraustochytrid species. There were no genetic polymorphisms in the mitochondrial sequences from the Aurantiochytrium strains, in contrast to the nuclear 18S rRNA gene sequence. This newly developed primer set amplified sequences from Aurantiochytrium and closely related genera, and may be useful for species identification and clarifying the genetic diversity of Aurantiochytrium in the field.
2014-01-01
Background Polyphenol oxidase (PPO), often encoded by a multi-gene family, causes oxidative browning, a significant problem in many food products. Low-browning potatoes were produced previously through suppression of PPO gene expression, but the contribution of individual PPO gene isoform to the oxidative browning process was unknown. Here we investigated the contributions of different PPO genes to total PPO protein activity, and the correlations between PPO protein level, PPO activity and tuber tissue browning potential by suppression of all previously characterized potato PPO genes, both individually and in combination using artificial microRNAs (amiRNAs) technology. Results Survey of the potato genome database revealed 9 PPO-like gene models, named StuPPO1 to StuPPO9 in this report. StuPPO1, StuPPO2, StuPPO3 and StuPPO4 are allelic to the characterized POTP1/P2, POT32, POT33 and POT72, respectively. Fewer ESTs were found to support the transcriptions of StuPPO5 to StuPPO8. StuPPO9 related ESTs were expressed at significant higher levels in pathogen-infected potato tissues. A series of browning phenotypes were obtained by suppressing StuPPO1 to StuPPO4 genes alone and in combination. Down-regulation of one or several of the PPO genes did not usually cause up-regulation of the other PPO genes in the transgenic potato tubers, but resulted in reduced PPO protein levels. The different PPO genes did not contribute equally to the total PPO protein content in the tuber tissues, with StuPPO2 accounting for ~ 55% as the major contributor, followed by StuPPO1, ~ 25-30% and StuPPO3 and StuPPO4 together with less than 15%. Strongly positive correlations between PPO protein level, PPO activity and browning potential were demonstrated in our analysis. Low PPO activity and low-browning potatoes were produced by simultaneous down-regulation of StuPPO2 to StuPPO4, but the greatest reduction occurred when StuPPO1 to StuPPO4 were all suppressed. Conclusion StuPPO1 to StuPPO4 genes
Hagel, Jillian M.; Beaudoin, Guillaume A. W.; Fossati, Elena; Ekins, Andrew; Martin, Vincent J. J.; Facchini, Peter J.
2012-01-01
Benzylisoquinoline alkaloids are a diverse class of plant specialized metabolites that includes the analgesic morphine, the antimicrobials sanguinarine and berberine, and the vasodilator papaverine. The two-electron oxidation of dihydrosanguinarine catalyzed by dihydrobenzophenanthridine oxidase (DBOX) is the final step in sanguinarine biosynthesis. The formation of the fully conjugated ring system in sanguinarine is similar to the four-electron oxidations of (S)-canadine to berberine and (S)-tetrahydropapaverine to papaverine. We report the isolation and functional characterization of an opium poppy (Papaver somniferum) cDNA encoding DBOX, a flavoprotein oxidase with homology to (S)-tetrahydroprotoberberine oxidase and the berberine bridge enzyme. A query of translated opium poppy stem transcriptome databases using berberine bridge enzyme yielded several candidate genes, including an (S)-tetrahydroprotoberberine oxidase-like sequence selected for heterologous expression in Pichia pastoris. The recombinant enzyme preferentially catalyzed the oxidation of dihydrosanguinarine to sanguinarine but also converted (RS)-tetrahydropapaverine to papaverine and several protoberberine alkaloids to oxidized forms, including (RS)-canadine to berberine. The Km values of 201 and 146 μm for dihydrosanguinarine and the protoberberine alkaloid (S)-scoulerine, respectively, suggested high concentrations of these substrates in the plant. Virus-induced gene silencing to reduce DBOX transcript levels resulted in a corresponding reduction in sanguinarine, dihydrosanguinarine, and papaverine accumulation in opium poppy roots in support of DBOX as a multifunctional oxidative enzyme in BIA metabolism. PMID:23118227
Castillejo, Cristina; Sartor, Ryan; Bialy, Agniezska; Sun, Tai-ping; Estelle, Mark
2012-01-01
Many processes critical to plant growth and development are regulated by the hormone auxin. Auxin responses are initiated through activation of a transcriptional response mediated by the TIR1/AFB family of F-box protein auxin receptors as well as the AUX/IAA and ARF families of transcriptional regulators. However, there is little information on how auxin regulates a specific cellular response. To begin to address this question, we have focused on auxin regulation of cell expansion in the Arabidopsis hypocotyl. We show that auxin-mediated hypocotyl elongation is dependent upon the TIR1/AFB family of auxin receptors and degradation of AUX/IAA repressors. We also use microarray studies of elongating hypocotyls to show that a number of growth-associated processes are activated by auxin including gibberellin biosynthesis, cell wall reorganization and biogenesis, and others. Our studies indicate that GA biosynthesis is required for normal response to auxin in the hypocotyl but that the overall transcriptional auxin output consists of PIF-dependent and -independent genes. We propose that auxin acts independently from and interdependently with PIF and GA pathways to regulate expression of growth-associated genes in cell expansion. PMID:22590525
Khalyfa, Abdelnaby; Capdevila, Oscar Sans; Kheirandish-Gozal, Leila; Khalyfa, Ahamed A.; Kim, Jinkwan
2012-01-01
Abstract Pediatric obstructive sleep apnea (OSA) may lead to neurocognitive dysfunction, but not in everyone affected. The frequencies of NADPH oxidase (NOX) polymorphisms in the p22phox subunit were similar between children with OSA and controls, except for rs6520785 and rs4673, the latter being significantly more frequent among the OSA children without deficits than with deficits (p<0.02). Similarly, 8-hydroxydeoxyguanine urine levels and NOX activity were lower among children without cognitive deficits and particularly among those with the rs4673 polymorphism. Thus, polymorphisms within the NOX gene or its functional subunits may account for important components of the variance in cognitive function deficits associated with OSA in children. Antioxid. Redox Signal. 16, 171–177. PMID:21902598
[Influence of the -866G/A polymorphism of the UCP2 gene on an obese pediatric population].
Zurbano, R; Ochoa, M C; Moreno-Aliaga, M J; Martínez, J A; Marti, A
2006-01-01
In the present study, our objectives were to evaluate the prevalence of -866G/A mutation of UCP2 gene and to study its influence on the phenotype of obese children (11-12 years old) from Navarra. BACKGROUND AND STUDY SETTING: Obesity is a disease with a multifactorial origin that may related be to the presence of mutations and polymorphisms in several candidate genes. The gene of the uncoupling protein UCP2 is one of the most studied ones in relation to obesity because it seems to participate in body composition and several metabolic processes control. Three polymorphisms have been described for this gene: an insertion/deletion of 45 nucleotides, a nucleotide change of guanine for adenine in -866 position, an another change that replaces alanine for valine at amino acid position 55. According to several studies, the -866G allele is related to an increased risk of developing obesity, although the results are contradictory about this association in the literature. The study was carried out on 125 obese children (52% male), aged 11-12 years, selected through the Pediatric Endocrinology Departments of Clínica Universitaria and Hospital Virgen del Camino of Pamplona (Spain), the reported results on this association are contradictory. After checking the inclusion criteria, anthropometrical data (weight, height, BMI, tricipital and subscapular skinfolds) were taken, and the percentage of fat mass was measured by bioelectrical impedance. Besides, plasma levels of total cholesterol, glucose, insulin, and leptin were measured. DNA was extracted from white blood cells to determine the genotype by PCR technique followed by BstUI digestion and further visualization in agarose gel with 2% ethidium bromide. The genetic analysis revealed a 0.404 frequency of the allele A, with a percentage of individuals G/G, G/A, and A/A of 40.0%, 39.2%, and 20.8%, respectively. Carriers of the A allele had a significantly higher sum of tricipital and subscapular folds (p = 0.034). No
SZGR 2.0: a one-stop shop of schizophrenia candidate genes.
Jia, Peilin; Han, Guangchun; Zhao, Junfei; Lu, Pinyi; Zhao, Zhongming
2017-01-04
SZGR 2.0 is a comprehensive resource of candidate variants and genes for schizophrenia, covering genetic, epigenetic, transcriptomic, translational and many other types of evidence. By systematic review and curation of multiple lines of evidence, we included almost all variants and genes that have ever been reported to be associated with schizophrenia. In particular, we collected ∼4200 common variants reported in genome-wide association studies, ∼1000 de novo mutations discovered by large-scale sequencing of family samples, 215 genes spanning rare and replication copy number variations, 99 genes overlapping with linkage regions, 240 differentially expressed genes, 4651 differentially methylated genes and 49 genes as antipsychotic drug targets. To facilitate interpretation, we included various functional annotation data, especially brain eQTL, methylation QTL, brain expression featured in deep categorization of brain areas and developmental stages and brain-specific promoter and enhancer annotations. Furthermore, we conducted cross-study, cross-data type and integrative analyses of the multidimensional data deposited in SZGR 2.0, and made the data and results available through a user-friendly interface. In summary, SZGR 2.0 provides a one-stop shop of schizophrenia variants and genes and their function and regulation, providing an important resource in the schizophrenia and other mental disease community. SZGR 2.0 is available at https://bioinfo.uth.edu/SZGR/. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
The NADPH oxidase Cpnox1 is required for full pathogenicity of the ergot fungus Claviceps purpurea.
Giesbert, Sabine; Schürg, Timo; Scheele, Sandra; Tudzynski, Paul
2008-05-01
The role of reactive oxygen species (ROS) in interactions between phytopathogenic fungi and their hosts is well established. An oxidative burst mainly caused by superoxide formation by membrane-associated NADPH oxidases is an essential element of plant defence reactions. Apart from primary effects, ROS play a major role as a second messenger in host response. Recently, NADPH oxidase (nox)-encoding genes have been identified in filamentous fungi. Functional analyses have shown that these fungal enzymes are involved in sexual differentiation, and there is growing evidence that they also affect developmental programmes involved in fungus-plant interactions. Here we show that in the biotrophic plant pathogen Claviceps purpurea deletion of the cpnox1 gene, probably encoding an NADPH oxidase, has impact on germination of conidia and pathogenicity: Deltacpnox1 mutants can penetrate the host epidermis, but they are impaired in colonization of the plant ovarian tissue. In the few cases where macroscopic signs of infection (honeydew) appear, they are extremely delayed and fully developed sclerotia have never been observed. C. purpurea Nox1 is important for the interaction with its host, probably by directly affecting pathogenic differentiation of the fungus.
Clinical study on gastric cancer susceptibility genes IL-10-1082 and TNF-α.
Yu, T; Lu, Q; Ou, X L; Cao, D Z; Yu, Q
2014-12-19
TNF 308 gene polymorphism and IL-10 polymorphism provided evidence in diagnosing some types of cancer. We aimed to explore the relation of gene polymorphism with gastric cancer. A total of 360 cases of gastric cancer patients were included in the study. The genotypes GG, GA, and AA of the interleukin-10-1082 gene (IL-10-1082) and the tumor necrosis factor-alpha gene (TNF-α) 308 polymorphism were examined by chromogenic detection. Three hundred healthy individuals' gene as control group were also examined. The GA 308 genotype of TNF-α differed significantly between the control group and the gastric cancer group (X(2) = 9.32, P < 0.05). Genotype frequencies of A/A (17.2%), A/G (26.2%), and G/G (9.1%) of the IL-10-1082 gene polymorphism in the gastric cancer group differed significantly compared to those of the control group (X(2) = 20.32, P < 0.05). The IL-10-1082 gene and the GA 308 genotype of the TNF-α gene were found to be susceptibility genes for gastric cancer.
Ceci, Roberta; Duranti, Guglielmo; Leonetti, Alessia; Pietropaoli, Stefano; Spinozzi, Federico; Marcocci, Lucia; Amendola, Roberto; Cecconi, Francesco; Sabatini, Stefania; Mariottini, Paolo; Cervelli, Manuela
2017-02-01
Spermine oxidase oxidizes spermine to produce H 2 O 2 , spermidine, and 3-aminopropanal. It is involved in cell drug response, apoptosis, and in the etiology of several pathologies, including cancer. Spermine oxidase is an important positive regulator of muscle gene expression and fiber size and, when repressed, leads to muscle atrophy. We have generated a transgenic mouse line overexpressing Smox gene in all organs, named Total-Smox. The spermine oxidase overexpression was revealed by β-Gal staining and reverse-transcriptase/PCR analysis, in all tissues analysed. Spermine oxidase activity resulted higher in Total-Smox than controls. Considering the important role of this enzyme in muscle physiology, we have focused our study on skeletal muscle and heart of Total-Smox mice by measuring redox status and oxidative damage. We assessed the redox homeostasis through the analysis of the reduced/oxidized glutathione ratio. Chronic H 2 O 2 production induced by spermine oxidase overexpression leads to a cellular redox state imbalance in both tissues, although they show different redox adaptation. In skeletal muscle, catalase and glutathione S-transferase activities were significantly increased in Total-Smox mice compared to controls. In the heart, no differences were found in CAT activity level, while GST activity decreased compared to controls. The skeletal muscle showed a lower oxidative damage than in the heart, evaluated by lipid peroxidation and protein carbonylation. Altogether, our findings illustrate that skeletal muscle adapts more efficiently than heart to oxidative stress H 2 O 2 -induced. The Total-Smox line is a new genetic model useful to deepen our knowledge on the role of spermine oxidase in muscle atrophy and muscular pathological conditions like dystrophy. Copyright © 2016 Elsevier Inc. All rights reserved.
A Novel Colletotrichum graminicola Raffinose Oxidase in the AA5 Family
Mollerup, Filip; Parikka, Kirsti; Koutaniemi, Sanna; Boer, Harry; Juvonen, Minna; Master, Emma; Tenkanen, Maija; Kruus, Kristiina
2017-01-01
ABSTRACT We describe here the identification and characterization of a copper radical oxidase from auxiliary activities family 5 (AA5_2) that was distinguished by showing preferential activity toward raffinose. Despite the biotechnological potential of carbohydrate oxidases from family AA5, very few members have been characterized. The gene encoding raffinose oxidase from Colletotrichum graminicola (CgRaOx; EC 1.1.3.−) was identified utilizing a bioinformatics approach based on the known modular structure of a characterized AA5_2 galactose oxidase. CgRaOx was expressed in Pichia pastoris, and the purified enzyme displayed the highest activity on the trisaccharide raffinose, whereas the activity on the disaccharide melibiose was three times lower and more than ten times lower activity was detected on d-galactose at a 300 mM substrate concentration. Thus, the substrate preference of CgRaOx was distinguished clearly from the substrate preferences of the known galactose oxidases. The site of oxidation for raffinose was studied by 1H nuclear magnetic resonance and mass spectrometry, and we confirmed that the hydroxyl group at the C-6 position was oxidized to an aldehyde and that in addition uronic acid was produced as a side product. A new electrospray ionization mass spectrometry method for the identification of C-6 oxidized products was developed, and the formation mechanism of the uronic acid was studied. CgRaOx presented a novel activity pattern in the AA5 family. IMPORTANCE Currently, there are only a few characterized members of the CAZy AA5 protein family. These enzymes are interesting from an application point of view because of their ability to utilize the cheap and abundant oxidant O2 without the requirement of complex cofactors such as FAD or NAD(P). Here, we present the identification and characterization of a novel AA5 member from Colletotrichum graminicola. As discussed in the present study, the bioinformatics approach using the modular structure of
Mollerup, Filip; Master, Emma
2015-01-01
Herein, we report the extracellular expression of carbohydrate active fusion enzymes in Pichia pastoris. Particularly, CBM29-1-2 from Piromyces equi was separately fused to the N- and C-terminus of galactose 6-oxidase (GaO, D-galactose: oxygen 6-oxidoreductase, EC 1.1.13.9, CAZy family AA5) from Fusarium graminearum, generating CBM29-GaO and GaO-CBM29, respectively. P. pastoris was transformed with expression vectors encoding GaO, CBM29-GaO and GaO-CBM29, and the fusion proteins were expressed in both shake-flask and 2L bioreactor systems. Volumetric production yields and specific GaO activity increased when expression was performed in a bioreactor system compared to shake-flask cultivation. This was observed for both CBM29-GaO and GaO-CBM29, and is consistent with previous reports of GaO expression in P. pastoris (Spadiut et al., 2010; Anasontzis et al., 2014) [1], [2]. Fusion of CBM29 to the C-terminal of GaO (GaO-CBM29) resulted in a stable uniform protein at the expected calculated size (107 kDa) when analyzed with SDS-PAGE. By comparison, the expression of the N-terminal fusion protein (CBM29-GaO) was low, and two truncated versions of CBM29-GaO were coexpressed with the full-sized protein. Despite differences in protein yield, the specific GaO activity on galactose was not affected by CBM29 fusion to either the N- or C-terminus of the enzyme. A detailed description of the catalytic and physiochemical properties of CBM29-GaO and GaO-CBM29 is available in the parent publication (Mollerup et al., 2015) [3]. PMID:26858983
Guo, Xiaoli; Hou, Xiaomei; Fang, Jun; Wei, Piwei; Xu, Bo; Chen, Mingluan; Feng, Yuqi; Chu, Chengcai
2013-01-01
It has been shown that seed development is regulated by a network of transcription factors in Arabidopsis including LEC1 (LEAFY COTYLEDON1), L1L (LEC1-like) and the B3 domain factors LEC2, FUS3 (FUSCA3) and ABI3 (ABA-INSENSITIVE3); however, molecular and genetic regulation of seed development in cereals is poorly understood. To understand seed development and seed germination in cereals, a large-scale screen was performed using our T–DNA mutant population, and a mutant germination-defective1 (gd1) was identified. In addition to the severe germination defect, the gd1 mutant also shows a dwarf phenotype and abnormal flower development. Molecular and biochemical analyses revealed that GD1 encodes a B3 domain-containing transcription factor with repression activity. Consistent with the dwarf phenotype of gd1, expression of the gibberelic acid (GA) inactivation gene OsGA2ox3 is increased dramatically, accompanied by reduced expression of GA biosynthetic genes including OsGA20ox1, OsGA20ox2 and OsGA3ox2 in gd1, resulting in a decreased endogenous GA4 level. Exogenous application of GA not only induced GD1 expression, but also partially rescued the dwarf phenotype of gd1. Furthermore, GD1 binds to the promoter of OsLFL1, a LEC2/FUS3-like gene of rice, via an RY element, leading to significant up-regulation of OsLFL1 and a large subset of seed maturation genes in the gd1 mutant. Plants over-expressing OsLFL1 partly mimic the gd1 mutant. In addition, expression of GD1 was induced under sugar treatment, and the contents of starch and soluble sugar are altered in the gd1 mutant. These data indicate that GD1 participates directly or indirectly in regulating GA and carbohydrate homeostasis, and further regulates rice seed germination and seedling development. PMID:23581288
The 20 GHz GaAs monolithic power amplifier module development
NASA Technical Reports Server (NTRS)
1984-01-01
The development of a 20 GHz GaAs FET monlithic power amplifier module for advanced communication applications is described. Four-way power combing of four 0.6 W amplifier modules is used as the baseline approach. For this purpose, a monolithic four-way traveling-wave power divider/combiner was developed. Over a 20 GHz bandwidth (10 to 30 GHz), an insertion loss of no more than 1.2 dB was measured for a pair of back-to-back connected divider/combiners. Isolation between output ports is better than 20 dB, and VSWRs are better than 21:1. A distributed amplifier with six 300 micron gate width FETs and gate and drain transmission line tapers has been designed, fabricated, and evaluated for use as an 0.6 W module. This amplifier has achieved state-of-the-art results of 0.5 W output power with at least 4 dB gain across the entire 2 to 21 GHz frequency range. An output power of 2 W was achieved at a measurement frequency of 18 GHz when four distributed amplifiers were power-combined using a pair of traveling-wave divider/combiners. Another approach is the direct common-source cascading of three power FET stages. An output power of up to 2W with 12 dB gain and 20% power-added efficiency has been achieved with this approach (at 17 GHz). The linear gain was 14 dB at 1 W output. The first two stages of the three-stage amplifier have achieved an output power of 1.6 W with 9 dB gain and 26% power-added efficiency at 16 GHz.
Gao, Song; Zhou, Jing; Zhao, Yinzhi; Toselli, Paul; Li, Wande
2013-04-01
Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5'-ACGTG-3') exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10-100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)-treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at -387/-383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation.
Koleoglu, Gun; Goodwin, Paul H; Reyes-Quintana, Mariana; Hamiduzzaman, Mollah Md; Guzman-Novoa, Ernesto
2018-04-01
Circulating hemocytes are responsible for defensive and healing mechanisms in the honey bee, Apis mellifera. Parasitism by the mite Varroa destructor and injection of V. destructor homogenate in buffer, but not buffer injection, showed similar reductions in total hemocyte concentrations in both Africanized and European adult honey bees. This indicated that compounds in V. destructor homogenate can have similar effects as V. destructor parasitism and that the response is not solely due to wounding. Samples from honey bees with different hemocyte concentrations were compared for the expression patterns of hemolectin (AmHml), prophenol oxidase (AmPpo), and class C scavenger receptor (AmSRC-C). Of the genes tested, only the expression of AmPpo correlated well with hemocyte counts for all the treatments, indicating that melanization is associated with those responses. Thus, the expression of AmPpo might be a suitable biomarker for hemocyte counts as part of cellular defenses against injection of buffer or mite compounds and V. destructor parasitism and perhaps other conditions involving healing and immunity.
Blume, B; Grierson, D
1997-10-01
The enzyme ACC oxidase, catalysing the last step in the biosynthesis of the plant hormone ethylene, is encoded by a small multigene family in tomato, comprising three members, LEACO1, LEACO2 and LEACO3. LEACO1 is the major gene expressed during ripening, leaf senescence, and wounding (Barry et al., 1996). To investigate the transcriptional regulation of ACC oxidase gene expression, chimeric fusions between the beta-glucuronidase reporter gene and 97 bp of 5' UTR plus 124, 396 and 1825 bp, respectively, of 5' untranscribed LEACO1 sequence were constructed and introduced into Lycopersicon esculentum (Mill cv. Ailsa Craig) and Nicotiana plumbaginifolia. Analysis of transgenic tomatoes indicated that the region containing nucleotides -124 to +97 of the LEACO1 gene is sufficient to confer a marked increase in GUS activity during fruit ripening, albeit at very low levels. Fusion of 396 and 1825 bp of LEACO1 upstream sequence resulted in strong and specific induction of GUS expression in situations known to be accompanied by enhanced ethylene production. Reporter gene expression was similar to that of the endogenous LEACO1 gene, with major increases especially during fruit ripening, senescence and abscission of leaves and, to a lesser extent, of flowers. Analysis of transgenic N. plumbaginifolia plants confirmed the pattern of LEACO1 promoter activity detected in tomato leaves and flowers. Reporter gene expression was also induced following wounding, treatment with ethylene, and pathogen infection. Histochemical analysis illustrated localized GUS activity in the pericarp of ripening fruit, abscission zones of senescent petioles and unfertilized flowers, and at wound sites. These results demonstrate that ACC oxidase is regulated at the transcriptional level in a wide range of cell types at different developmental stages and in response to several external stimuli.
COI (cytochrome oxidase-I) sequence based studies of Carangid fishes from Kakinada coast, India.
Persis, M; Chandra Sekhar Reddy, A; Rao, L M; Khedkar, G D; Ravinder, K; Nasruddin, K
2009-09-01
Mitochondrial DNA, cytochrome oxidase-1 gene sequences were analyzed for species identification and phylogenetic relationship among the very high food value and commercially important Indian carangid fish species. Sequence analysis of COI gene very clearly indicated that all the 28 fish species fell into five distinct groups, which are genetically distant from each other and exhibited identical phylogenetic reservation. All the COI gene sequences from 28 fishes provide sufficient phylogenetic information and evolutionary relationship to distinguish the carangid species unambiguously. This study proves the utility of mtDNA COI gene sequence based approach in identifying fish species at a faster pace.
Heterologous Production and Characterization of Two Glyoxal Oxidases from Pycnoporus cinnabarinus
Daou, Marianne; Piumi, François; Cullen, Daniel; Record, Eric
2016-01-01
ABSTRACT The genome of the white rot fungus Pycnoporus cinnabarinus includes a large number of genes encoding enzymes implicated in lignin degradation. Among these, three genes are predicted to encode glyoxal oxidase, an enzyme previously isolated from Phanerochaete chrysosporium. The glyoxal oxidase of P. chrysosporium is physiologically coupled to lignin-oxidizing peroxidases via generation of extracellular H2O2 and utilizes an array of aldehydes and α-hydroxycarbonyls as the substrates. Two of the predicted glyoxal oxidases of P. cinnabarinus, GLOX1 (PciGLOX1) and GLOX2 (PciGLOX2), were heterologously produced in Aspergillus niger strain D15#26 (pyrG negative) and purified using immobilized metal ion affinity chromatography, yielding 59 and 5 mg of protein for PciGLOX1 and PciGLOX2, respectively. Both proteins were approximately 60 kDa in size and N-glycosylated. The optimum temperature for the activity of these enzymes was 50°C, and the optimum pH was 6. The enzymes retained most of their activity after incubation at 50°C for 4 h. The highest relative activity and the highest catalytic efficiency of both enzymes occurred with glyoxylic acid as the substrate. The two P. cinnabarinus enzymes generally exhibited similar substrate preferences, but PciGLOX2 showed a broader substrate specificity and was significantly more active on 3-phenylpropionaldehyde. IMPORTANCE This study addresses the poorly understood role of how fungal peroxidases obtain an in situ supply of hydrogen peroxide to enable them to oxidize a variety of organic and inorganic compounds. This cooperative activity is intrinsic in the living organism to control the amount of toxic H2O2 in its environment, thus providing a feed-on-demand scenario, and can be used biotechnologically to supply a cheap source of peroxide for the peroxidase reaction. The secretion of multiple glyoxal oxidases by filamentous fungi as part of a lignocellulolytic mechanism suggests a controlled system, especially as these
Li, Xiao-Hui; Xu, Han-Kun; Mao, Da-Gan; Ma, Da-Jun; Chen, Peng; Yang, Li-Guo
2006-11-01
Excitability, activity and exploration behavior of puppies in a novel open-field were tested in a total of 204 two-month-old German shepherd dog, labrador retriever or English springer spaniel puppies. The polymorphisms of monoamine oxidase B gene (MAOB) were detected by PCR-RFLP. Statistics analysis indicated that genotype and allele frequencies of the polymorphisms were significantly different among three breeds (P < 0.01). With GLM analysis of SAS software, association analysis was conducted between MAOB gene polymorphisms and locomotion and vocalization behavior parameters in the open-field test. The results showed that MAOB gene polymorphisms had a significant effect on walking time, squares crossed, lying time, the times of standing up against walls(P < 0.01 or P < 0.05) and were associated with the times of posture change (P=0.064). Walking time and squares crossed were higher in TT genotype puppies than those in TC and CC puppies (P < 0.05) and the times of posture change and standing up against walls were also higher than those in CC (P < 0.05). In addition, lying time in CC genotype puppies were higher than that in TT (P < 0.05). MAOB had a positive effect on walking time, lying time, squares crossed, the times of posture change, the times of standing up against walls in the three dog breeds that was highly statistically significant (P < 0.01 or P < 0.05). Our results imply that MAOB gene significantly affects the excitability, activity and exploration behavior of puppies in open-field test and TT genotype has favorable effects in these behavior traits.
Elias, Ani A.; Busov, Victor B.; Kosola, Kevin R.; Ma, Cathleen; Etherington, Elizabeth; Shevchenko, Olga; Gandhi, Harish; Pearce, David W.; Rood, Stewart B.; Strauss, Steven H.
2012-01-01
Semidwarfism has been used extensively in row crops and horticulture to promote yield, reduce lodging, and improve harvest index, and it might have similar benefits for trees for short-rotation forestry or energy plantations, reclamation, phytoremediation, or other applications. We studied the effects of the dominant semidwarfism transgenes GA Insensitive (GAI) and Repressor of GAI-Like, which affect gibberellin (GA) action, and the GA catabolic gene, GA 2-oxidase, in nursery beds and in 2-year-old high-density stands of hybrid poplar (Populus tremula × Populus alba). Twenty-nine traits were analyzed, including measures of growth, morphology, and physiology. Endogenous GA levels were modified in most transgenic events; GA20 and GA8, in particular, had strong inverse associations with tree height. Nearly all measured traits varied significantly among genotypes, and several traits interacted with planting density, including aboveground biomass, root-shoot ratio, root fraction, branch angle, and crown depth. Semidwarfism promoted biomass allocation to roots over shoots and substantially increased rooting efficiency with most genes tested. The increased root proportion and increased leaf chlorophyll levels were associated with changes in leaf carbon isotope discrimination, indicating altered water use efficiency. Semidwarf trees had dramatically reduced growth when in direct competition with wild-type trees, supporting the hypothesis that semidwarfism genes could be effective tools to mitigate the spread of exotic, hybrid, and transgenic plants in wild and feral populations. PMID:22904164
Age-related ultrastructural and monoamine oxidase changes in the rat optic nerve.
Taurone, S; Ripandelli, G; Minni, A; Lattanzi, R; Miglietta, S; Pepe, N; Fumagalli, L; Micera, A; Pastore, F S; Artico, M
2016-01-01
The aim of this paper is to study the morphology and the distribution of the monoamine oxidase enzymatic system in the optic nerve of 4 month-old Wistar (young) and 28 month-old Wistar (old) rats. The optic nerve was harvested from 20 young and old rats. The segment of optic nerve was divided longitudinally into two pieces, each 0.1 mm in length. The first piece was used for transmission electron microscopy. The second piece was stained with histochemical reaction for monoamine oxidase. The agerelated changes in the optic nerve of rats include micro-anatomical details, ultrastructure and monoamine oxidase histochemical staining. A strong decrease of the thin nerve fibers and a swelling of the thick ones can be observed in optic nerve fibers of old rats. Increased monoamine oxidase histochemical staining of the optic nerve of aged rats is well demonstrated. The increase of meningeal shealth and the decrease of thin nerve fibers of the optic nerve in old rats are well documented. Morphological, ultrastructural and histochemical changes observed in optic nerve fibers of the old rats show a close relation with aging.
Lambret-Frotté, Julia; Artico, Sinara; Muniz Nardeli, Sarah; Fonseca, Fernando; Brilhante Oliveira-Neto, Osmundo; Grossi-de-Sá, Maria Fatima; Alves-Ferreira, Marcio
2016-01-01
Cotton is one of the most economically important cultivated crops. It is the major source of natural fiber for the textile industry and an important target for genetic modification for both biotic stress and herbicide tolerance. Therefore, the characterization of genes and regulatory regions that might be useful for genetic transformation is indispensable. The isolation and characterization of new regulatory regions is of great importance to drive transgene expression in genetically modified crops. One of the major drawbacks in cotton production is pest damage; therefore, the most promising, cost-effective, and sustainable method for pest control is the development of genetically resistant cotton lines. Considering this scenario, our group isolated and characterized the promoter region of a MCO (multicopper oxidase) from Gossypium hirsutum, named GhAO-like1 (ascorbate oxidase-like1). The quantitative expression, together with the in vivo characterization of the promoter region reveals that GhAO-like1 has a flower- and fruit-specific expression pattern. The GUS activity is mainly observed in stamens, as expected considering that the GhAO-like1 regulatory sequence is enriched in cis elements, which have been characterized as a target of reproductive tissue specific transcription factors. Both histological and quantitative analyses in Arabidopsis thaliana have confirmed flower (mainly in stamens) and fruit expression of GhAO-like1. In the present paper, we isolated and characterized both in silico and in vivo the promoter region of the GhAO-like1 gene. The regulatory region of GhAO-like1 might be useful to confer tissue-specific expression in genetically modified plants.
Short and medium range structures of 80GeSe2–20Ga2Se3 chalcogenide glasses
NASA Astrophysics Data System (ADS)
Petracovschi, Elena; Calvez, Laurent; Cormier, Laurent; Le Coq, David; Du, Jincheng
2018-05-01
The short and medium range structures of 80GeSe2–20Ga2Se3 (or Ge23.5Ga11.8Se64.7) chalcogenide glasses have been studied by combining ab initio molecular dynamics (AIMD) simulations and experimental neutron diffraction studies. The structure factor and total correlation function were calculated from glass structures generated from AIMD simulations and compared with neutron diffraction experiments showing reasonable agreement. The atomic structures of ternary chalcogenide glasses were analyzed in detail, and it was found that gallium atoms are four-fold coordinated by selenium (Se) and form [GaSe4] tetrahedra. Germanium atoms on average also have four-fold coordination, among which Se is 3.5 with the remaining being Ge–Ge homo-nuclear bonds. Ga and Ge tetrahedra link together mainly through corner-sharing and some edge-sharing of Se. No homo-nuclear bonds were observed among Ga atoms or between Ge and Ga. In addition, Se–Se homo-nuclear bonds and Se chains with various lengths were observed. A small fraction of Se atom triclusters that bond to three cations of Ge and Ga were also observed, confirming earlier proposals from 77Se solid state nuclear magnetic resonance studies. Furthermore, the electronic structures of ternary chalcogenide glasses were studied in terms of atomic charge and electronic density of states in order to gain insights into the chemical bonding and electronic properties, as well as to provide an explanation of the observed atomic structures in these ternary chalcogenide glasses.
Kalia, Nitin P.; Hasenoehrl, Erik J.; Ab Rahman, Nurlilah B.; Koh, Vanessa H.; Ang, Michelle L. T.; Sajorda, Dannah R.; Hards, Kiel; Grüber, Gerhard; Alonso, Sylvie; Cook, Gregory M.; Berney, Michael; Pethe, Kevin
2017-01-01
The recent discovery of small molecules targeting the cytochrome bc1:aa3 in Mycobacterium tuberculosis triggered interest in the terminal respiratory oxidases for antituberculosis drug development. The mycobacterial cytochrome bc1:aa3 consists of a menaquinone:cytochrome c reductase (bc1) and a cytochrome aa3-type oxidase. The clinical-stage drug candidate Q203 interferes with the function of the subunit b of the menaquinone:cytochrome c reductase. Despite the affinity of Q203 for the bc1:aa3 complex, the drug is only bacteriostatic and does not kill drug-tolerant persisters. This raises the possibility that the alternate terminal bd-type oxidase (cytochrome bd oxidase) is capable of maintaining a membrane potential and menaquinol oxidation in the presence of Q203. Here, we show that the electron flow through the cytochrome bd oxidase is sufficient to maintain respiration and ATP synthesis at a level high enough to protect M. tuberculosis from Q203-induced bacterial death. Upon genetic deletion of the cytochrome bd oxidase-encoding genes cydAB, Q203 inhibited mycobacterial respiration completely, became bactericidal, killed drug-tolerant mycobacterial persisters, and rapidly cleared M. tuberculosis infection in vivo. These results indicate a synthetic lethal interaction between the two terminal respiratory oxidases that can be exploited for anti-TB drug development. Our findings should be considered in the clinical development of drugs targeting the cytochrome bc1:aa3, as well as for the development of a drug combination targeting oxidative phosphorylation in M. tuberculosis. PMID:28652330
AlGaN/GaN high electron mobility transistors with selective area grown p-GaN gates
NASA Astrophysics Data System (ADS)
Yuliang, Huang; Lian, Zhang; Zhe, Cheng; Yun, Zhang; Yujie, Ai; Yongbing, Zhao; Hongxi, Lu; Junxi, Wang; Jinmin, Li
2016-11-01
We report a selective area growth (SAG) method to define the p-GaN gate of AlGaN/GaN high electron mobility transistors (HEMTs) by metal-organic chemical vapor deposition. Compared with Schottky gate HEMTs, the SAG p-GaN gate HEMTs show more positive threshold voltage (V th) and better gate control ability. The influence of Cp2Mg flux of SAG p-GaN gate on the AlGaN/GaN HEMTs has also been studied. With the increasing Cp2Mg from 0.16 μmol/min to 0.20 μmol/min, the V th raises from -0.67 V to -0.37 V. The maximum transconductance of the SAG HEMT at a drain voltage of 10 V is 113.9 mS/mm while that value of the Schottky HEMT is 51.6 mS/mm. The SAG method paves a promising way for achieving p-GaN gate normally-off AlGaN/GaN HEMTs without dry etching damage. Project supported by the National Natural Sciences Foundation of China (Nos. 61376090, 61306008) and the National High Technology Program of China (No. 2014AA032606).
NASA Astrophysics Data System (ADS)
Yang, Lijuan; Yang, Daibin; Yan, Xiaojing; Cui, Li; Wang, Zhenying; Yuan, Huizhu
2016-11-01
Chilling stress during germination often causes severe injury. In the present study, maize seed germination and shoot growth under chilling stress were negatively correlated with the dose of tebuconazole in an exponential manner as predicted by the model Y = A + B × e(-x/k). Microencapsulation was an effective means of eliminating potential phytotoxic risk. The gibberellins (GAs) contents were higher after microencapsulation treatment than after conventional treatment when the dose of tebuconazole was higher than 0.12 g AI (active ingredient) kg-1 seed. Further analysis indicated that microencapsulation can stimulate ent-kaurene oxidase (KO) activity to some extent, whereas GA 3-oxidase (GA3ox) and GA 2-oxidase (GA2ox) activities remained similar to those in the control. Genes encoding GA metabolic enzymes exhibited different expression patterns. Transcript levels of ZmKO1 increased in the microcapsule treatments compared to the control. Even when incorporated into microcapsules, tebuconazole led to the upregulation of ZmGA3ox1 at doses of less than 0.12 g AI kg-1 seed and to the upregulation of ZmGA3ox2 when the dose was higher than 0.12 g AI kg-1 seed. With increasing doses of microencapsulated tebuconazole, the transcript levels of ZmGA2ox4, ZmGA2ox5 and ZmGA2ox6 exhibited upward trends, whereas the transcript levels of ZmGA2ox7 exhibited a downward trend.
Amber Vanden Wymelenberg; Grzegorz Sabat; Michael Mozuch; Philip J. Kersten; Dan Cullen; Robert A. Blanchette
2006-01-01
The white rot basidiomycete Phanerochaete chrysosporium produces an array of nonspecific extracellular enzymes thought to be involved in lignin degradation, including lignin peroxidases, manganese peroxidases, and the H2O2-generating copper radical oxidase, glyoxal oxidase (GLX). Preliminary analysis of the P. chrysosporium draft genome had identified six sequences...
Interleukin-10 -1082 G/A gene polymorphisms in Egyptian children with CAP: A case-control study.
Azab, Seham F; Abdalhady, Mohamed A; Elsaadany, Hosam F; Elkomi, Mohamed A; Elhindawy, Eman M; Sarhan, Dina T; Salam, Mohamed M A; Allah, Mayy A N; Emam, Ahmed A; Noah, Maha A; Abdelsalam, Nasser I; Abdellatif, Sawsan H; Rass, Anwar A; Ismail, Sanaa M; Gheith, Tarek; Aziz, Khalid A; Hamed, Mohammed E; Abdelrahman, Hind M; Ahmed, Ahmed R; Nabil, Rehab M; Abdulmaksoud, Rehab S; Yousef, Hala Y
2016-06-01
Community-acquired pneumonia (CAP) is one of the leading causes of death worldwide. Cytokines are involved in the pathogenesis of CAP. To date, only a few studies concerned the association of interleukin-10 (IL-10) gene polymorphisms with CAP.In this study, we aimed to investigate whether the -1082(G/A) polymorphism in the promoter region of the IL-10 gene is involved in susceptibility to and the outcome of CAP, and we also measured the serum level of IL-10 to assess its relation to such polymorphism.This was a case-control study included 100 patients with CAP, and matched with age, gender, and ethnicity of 100 healthy control children. IL-10 -1082(G/A) gene polymorphism was genotyped by polymerase chain reaction-restriction fragment length polymorphism, while the serum IL-10 levels were measured by ELISA method.Compared to the controls subjects, the frequencies of the IL-10 -1082 AA genotype and A allele were observed to be overrepresented in patients with CAP (51%; odds ratio [OR] = 2.8; 95% confidence interval [CI]: 1.5-5.3 for the AA genotype; P < 0.01) and (70%; OR: 1.95; 95% CI: 1.27-3.00 for the A allele; P < 0.01, respectively). We found that patients with the GG genotype had significantly higher serum IL-10 levels (46.7 ± 9.5 pg/mL) compared to those with AG genotype (21.8 ± 4.5 pg/mL) and AA genotype (11.5 ± 3.3 pg/mL); P < 0.01, respectively. Our data revealed a significant positive association between the -1082 GG genotype and susceptibility to severe sepsis, acute respiratory failure, and hospital mortality (OR: 3.8; 95% CI: 1.3-11.2; P < 0.01).We demonstrate for the first time, to the best of our knowledge, that IL-10 -1082 (G/A) gene polymorphism may contribute to susceptibility to CAP in Egyptian children. Moreover, we observed that the presence of a G allele or GG genotype at the -1082 position of the promoter region of the IL-10 gene constitute risk factors for developing severe sepsis, acute respiratory
Dirschnabel, Daniela Elisabeth; Nowrousian, Minou; Cano-Domínguez, Nallely; Aguirre, Jesus; Teichert, Ines; Kück, Ulrich
2014-03-01
NADPH oxidase (NOX)-derived reactive oxygen species (ROS) act as signaling determinants that induce different cellular processes. To characterize NOX function during fungal development, we utilized the genetically tractable ascomycete Sordaria macrospora. Genome sequencing of a sterile mutant led us to identify the NADPH oxidase encoding nox1 as a gene required for fruiting body formation, regular hyphal growth, and hyphal fusion. These phenotypes are shared by nor1, lacking the NOX regulator NOR1. Further phenotypic analyses revealed a high correlation between increased ROS production and hyphal fusion deficiencies in nox1 and other sterile mutants. A genome-wide transcriptional profiling analysis of mycelia and isolated protoperithecia from wild type and nox1 revealed that nox1 inactivation affects the expression of genes related to cytoskeleton remodeling, hyphal fusion, metabolism, and mitochondrial respiration. Genetic analysis of nox2, lacking the NADPH oxidase 2 gene, nor1, and transcription factor deletion mutant ste12, revealed a strict melanin-dependent ascospore germination defect, indicating a common genetic pathway for these three genes. We report that gsa3, encoding a G-protein α-subunit, and sac1, encoding cAMP-generating adenylate cyclase, act in a separate pathway during the germination process. The finding that cAMP inhibits ascospore germination in a melanin-dependent manner supports a model in which cAMP inhibits NOX2 activity, thus suggesting a link between both pathways. Our results expand the current knowledge on the role of NOX enzymes in fungal development and provide a frame to define upstream and downstream components of the NOX signaling pathways in fungi.
SPERMINE OXIDASE: AN AMINE OXIDASE WITH SPECIFICITY FOR SPERMINE AND SPERMIDINE
Hirsch, James G.
1953-01-01
Sheep serum and bovine serum contain an enzyme which brings about a rapid oxidative deamination of certain biological amines. This enzyme differs from previously described amine oxidases in several regards and especially in its substrate specificity. Studies thus far indicate that only spermine and the closely related compound spermidine serve as substrates for the enzyme in sheep serum. For this reason, the enzyme has been named spermine oxidase. Spermine oxidase is active in a variety of fluids of various ionic strength and buffer composition. The reaction takes place between pH 6.0 and pH 8.0 with an optimal rate in the vicinity of neutrality. Under certain conditions, the rate of oxygen consumption during the initial phase of the reaction is independent of the concentration of substrate. The diminution in rate observed during the latter phase of the enzymatic attack appears to be due to an alteration in the kinetics at low concentrations of substrate, or to competitive inhibition by a product of the reaction. Carbonyl reagents almost completely block the action of spermine oxidase, while certain amines and the cyanide ion bring about partial inhibition. Thiol reagents and sequestering compounds do not alter the course of the oxidative process. In the presence of low concentrations of mercuric chloride, the sheep serum-spermine system consumes approximately twice as much oxygen as controls containing no mercuric ion. The mechanism by which the mercuric ion stimulates additional oxygen uptake is obscure. PMID:13052805
USDA-ARS?s Scientific Manuscript database
In plants alternative oxidase (AOX) is an important nuclear-encoded enzyme active in the mitochondrial electron-transport chain, transferring electrons from ubiquinol to alternative oxidase instead of the cytochrome pathway to yield ubiquinone and water. AOX protects against unexpected inhibition of...
Richhardt, Janine; Luchterhand, Bettina; Büchs, Jochen
2013-01-01
The obligatory aerobic acetic acid bacterium Gluconobacter oxydans oxidizes a variety of substrates in the periplasm by membrane-bound dehydrogenases, which transfer the reducing equivalents to ubiquinone. Two quinol oxidases, cytochrome bo3 and cytochrome bd, then catalyze transfer of the electrons from ubiquinol to molecular oxygen. In this study, mutants lacking either of these terminal oxidases were characterized. Deletion of the cydAB genes for cytochrome bd had no obvious influence on growth, whereas the lack of the cyoBACD genes for cytochrome bo3 severely reduced the growth rate and the cell yield. Using a respiration activity monitoring system and adjusting different levels of oxygen availability, hints of a low-oxygen affinity of cytochrome bd oxidase were obtained, which were supported by measurements of oxygen consumption in a respirometer. The H+/O ratio of the ΔcyoBACD mutant with mannitol as the substrate was 0.56 ± 0.11 and more than 50% lower than that of the reference strain (1.26 ± 0.06) and the ΔcydAB mutant (1.31 ± 0.16), indicating that cytochrome bo3 oxidase is the main component for proton extrusion via the respiratory chain. Plasmid-based overexpression of cyoBACD led to increased growth rates and growth yields, both in the wild type and the ΔcyoBACD mutant, suggesting that cytochrome bo3 might be a rate-limiting factor of the respiratory chain. PMID:23852873
Choe, Daniel Ewon; Shaw, Daniel S; Hyde, Luke W; Forbes, Erika E
2014-09-01
Although previous studies have shown that interactions between monoamine oxidase A ( MAOA ) genotype and childhood maltreatment predict Caucasian boys' antisocial behavior, the generalizability of this gene-environment interaction to more diverse populations and more common parenting behaviors, such as punitive discipline in early childhood, is not clearly understood. Among 189 low-income men (44% African American, 56% Caucasian) who underwent rigorous assessments of family behavior and social context longitudinally across 20 years, those men with the low activity MAOA allele who experienced more punitive discipline at ages 1.5, 2, and 5 years showed more antisocial behavior from ages 15 through 20 years. Effects of punitive discipline on antisocial behavior differed by caregiver and age at which it occurred, suggesting sensitive periods throughout early childhood in which low MAOA activity elevated boys' vulnerability to harsh parenting and risk for antisocial behavior. This genetic vulnerability to punitive discipline-and not just extreme, maltreatment experiences-may generalize to other male populations at risk for antisocial behavior.
Agostinelli, Enzo; Vianello, Fabio; Magliulo, Giuseppe; Thomas, Thresia; Thomas, T J
2015-01-01
Nanotechnology for cancer gene therapy is an emerging field. Nucleic acids, polyamine analogues and cytotoxic products of polyamine oxidation, generated in situ by an enzyme-catalyzed reaction, can be developed for nanotechnology-based cancer therapeutics with reduced systemic toxicity and improved therapeutic efficacy. Nucleic acid-based gene therapy approaches depend on the compaction of DNA/RNA to nanoparticles and polyamine analogues are excellent agents for the condensation of nucleic acids to nanoparticles. Polyamines and amine oxidases are found in higher levels in tumours compared to that of normal tissues. Therefore, the metabolism of polyamines spermidine and spermine, and their diamine precursor, putrescine, can be targets for antineoplastic therapy since these naturally occurring alkylamines are essential for normal mammalian cell growth. Intracellular polyamine concentrations are maintained at a cell type-specific set point through the coordinated and highly regulated interplay between biosynthesis, transport, and catabolism. In particular, polyamine catabolism involves copper-containing amine oxidases. Several studies showed an important role of these enzymes in developmental and disease-related processes in animals through the control of polyamine homeostasis in response to normal cellular signals, drug treatment, and environmental and/or cellular stress. The production of toxic aldehydes and reactive oxygen species (ROS), H2O2 in particular, by these oxidases suggests a mechanism by which amine oxidases can be exploited as antineoplastic drug targets. The combination of bovine serum amine oxidase (BSAO) and polyamines prevents tumour growth, particularly well if the enzyme has been conjugated with a biocompatible hydrogel polymer. The findings described herein suggest that enzymatically formed cytotoxic agents activate stress signal transduction pathways, leading to apoptotic cell death. Consequently, superparamagnetic nanoparticles or other
Cil, M; Böyükbayram, A E; Kiralp, S; Toppare, L; Yağci, Y
2007-06-01
In this study, glucose oxidase and polyphenol oxidase were immobilized in conducting polymer matrices; polypyrrole and poly(N-(4-(3-thienyl methylene)-oxycarbonyl phenyl) maleimide-co-pyrrole) via electrochemical method. Fourier transform infrared and scanning electron microscope were employed to characterize the copolymer of (N-(4-(3-thienyl methylene)-oxycarbonyl phenyl) maleimide) with pyrrole. Kinetic parameters, maximum reaction rate and Michealis-Menten constant, were determined. Effects of temperature and pH were examined for immobilized enzymes. Also, storage and operational stabilities of enzyme electrodes were investigated. Glucose and polyphenol oxidase enzyme electrodes were used for determination of the glucose amount in orange juices and human serum and phenolic amount in red wines, respectively.
Meenakshi, P; Ramya, S; Shruthi, T; Lavanya, J; Mohammed, H H; Mohammed, S A; Vijayalakshmi, V; Sumanlatha, G
2013-07-01
Tuberculosis (TB) constitutes the major cause of death due to infectious diseases. Cytokines play a major role in defence against Mycobacterium tuberculosis infection. Polymorphisms in the genes encoding various cytokines have been associated with tuberculosis susceptibility. Household contacts (HHC) are at increased risk of developing the disease. In this study, we examined the association of IL-1β and IL-10 cytokine gene polymorphisms with risk of developing tuberculosis in TB patients, their HHC and healthy controls (HC) using JavaStat and SPSS. Multifactor dimensionality reduction (MDR) analyses were performed to explore the potential gene-gene interactions. The genotype and allele frequencies of IL-1β +3954C/T polymorphism did not vary significantly between TB patients and HC. GG (P < 0.005, OR = 0.219 and 95% CI = 0.059-0.735) and GA (P < 0.0001, OR = 2.938 and 95% CI = 1.526-5.696) genotypes of IL-10-1082 G/A polymorphism were found to be significantly associated with patients versus HC. HHC with CC (P < 0.03, OR = 1.833 and 95% CI = 1.1-3.35) genotype in IL-1β and GA (P < 0.0001, OR = 4.612 and 95% CI = 2.225-9.702) genotype in IL-10 were at increased risk of developing tuberculosis. MDR tests revealed high-risk genotypes in IL-1β and IL-10 based on the association model. Our results demonstrate that the polymorphisms of IL-1β and IL-10 genes may be valuable markers to predict the risk for the development of TB in household contacts. © 2013 John Wiley & Sons Ltd.
Macková, Hana; Hronková, Marie; Dobrá, Jana; Turečková, Veronika; Novák, Ondřej; Lubovská, Zuzana; Motyka, Václav; Haisel, Daniel; Hájek, Tomáš; Prášil, Ilja Tom; Gaudinová, Alena; Štorchová, Helena; Ge, Eva; Werner, Tomáš; Schmülling, Thomas; Vanková, Radomíra
2013-01-01
Responses to drought, heat, and combined stress were compared in tobacco (Nicotiana tabacum L.) plants ectopically expressing the cytokinin oxidase/dehydrogenase CKX1 gene of Arabidopsis thaliana L. under the control of either the predominantly root-expressed WRKY6 promoter or the constitutive 35S promoter, and in the wild type. WRKY6:CKX1 plants exhibited high CKX activity in the roots under control conditions. Under stress, the activity of the WRKY6 promoter was down-regulated and the concomitantly reduced cytokinin degradation coincided with raised bioactive cytokinin levels during the early phase of the stress response, which might contribute to enhanced stress tolerance of this genotype. Constitutive expression of CKX1 resulted in an enlarged root system, a stunted, dwarf shoot phenotype, and a low basal level of expression of the dehydration marker gene ERD10B. The high drought tolerance of this genotype was associated with a relatively moderate drop in leaf water potential and a significant decrease in leaf osmotic potential. Basal expression of the proline biosynthetic gene P5CSA was raised. Both wild-type and WRKY6:CKX1 plants responded to heat stress by transient elevation of stomatal conductance, which correlated with an enhanced abscisic acid catabolism. 35S:CKX1 transgenic plants exhibited a small and delayed stomatal response. Nevertheless, they maintained a lower leaf temperature than the other genotypes. Heat shock applied to drought-stressed plants exaggerated the negative stress effects, probably due to the additional water loss caused by a transient stimulation of transpiration. The results indicate that modulation of cytokinin levels may positively affect plant responses to abiotic stress through a variety of physiological mechanisms. PMID:23669573
Ye, Heng; Feng, Jiuhuan; Zhang, Lihua; Zhang, Jinfeng; Mispan, Muhamad S; Cao, Zhuanqin; Beighley, Donn H; Yang, Jianchang; Gu, Xing-You
2015-11-01
Natural variation in seed dormancy is controlled by multiple genes mapped as quantitative trait loci in major crop or model plants. This research aimed to clone and characterize the Seed Dormancy1-2 (qSD1-2) locus associated with endosperm-imposed dormancy and plant height in rice (Oryza sativa). qSD1-2 was delimited to a 20-kb region, which contains OsGA20ox2 and had an additive effect on germination. Naturally occurring or induced loss-of-function mutations of the gibberellin (GA) synthesis gene enhanced seed dormancy and also reduced plant height. Expression of this gene in seeds (including endospermic cells) during early development increased GA accumulation to promote tissue morphogenesis and maturation programs. The mutant allele prevalent in semidwarf cultivars reduced the seed GA content by up to 2-fold at the early stage, which decelerated tissue morphogenesis including endosperm cell differentiation, delayed abscisic acid accumulation by a shift in the temporal distribution pattern, and postponed dehydration, physiological maturity, and germinability development. As the endosperm of developing seeds dominates the moisture equilibrium and desiccation status of the embryo in cereal crops, qSD1-2 is proposed to control primary dormancy by a GA-regulated dehydration mechanism. Allelic distribution of OsGA20ox2, the rice Green Revolution gene, was associated with the indica and japonica subspeciation. However, this research provided no evidence that the primitive indica- and common japonica-specific alleles at the presumably domestication-related locus functionally differentiate in plant height and seed dormancy. Thus, the evolutionary mechanism of this agriculturally important gene remains open for discussion. © 2015 American Society of Plant Biologists. All Rights Reserved.
Igielski, Rafał
2017-01-01
Gibberellins (GAs) are involved in the regulation of numerous developmental processes in plants including zygotic embryogenesis, but their biosynthesis and role during somatic embryogenesis (SE) is mostly unknown. In this study we show that during three week- long induction phase, when cells of leaf explants from non-embryogenic genotype (M9) and embryogenic variant (M9-10a) were forming the callus, all the bioactive gibberellins from non-13-hydroxylation (GA4, GA7) and 13-hydroxylation (GA1, GA5, GA3, GA6) pathways were present, but the contents of only a few of them differed between the tested lines. The GA53 and GA19 substrates synthesized by the 13-hydroxylation pathway accumulated specifically in the M9-10a line after the first week of induction; subsequently, among the bioactive gibberellins detected, only the content of GA3 increased and appeared to be connected with acquisition of embryogenic competence. We fully annotated 20 Medicago truncatula orthologous genes coding the enzymes which catalyze all the known reactions of gibberellin biosynthesis. Our results indicate that, within all the genes tested, expression of only three: MtCPS, MtGA3ox1 and MtGA3ox2, was specific to embryogenic explants and reflected the changes observed in GA53, GA19 and GA3 contents. Moreover, by analyzing expression of MtBBM, SE marker gene, we confirmed the inhibitory effect of manipulation in GAs metabolism, applying exogenous GA3, which not only impaired the production of somatic embryos, but also significantly decreased expression of this gene. PMID:28750086
Liu, Yaju; Xu, Yunyuan; Xiao, Jun; Ma, Qibin; Li, Dan; Xue, Zhen; Chong, Kang
2011-07-01
The A20/AN1 zinc-finger proteins (ZFPs) play pivotal roles in animal immune responses and plant stress responses. From previous gibberellin (GA) microarray data and A20/AN1 ZFP family member association, we chose Oryza sativa dwarf rice with overexpression of gibberellin-induced gene (OsDOG) to examine its function in the GA pathway. OsDOG was induced by gibberellic acid (GA(3)) and repressed by the GA-synthesis inhibitor paclobutrazol. Different transgenic lines with constitutive expression of OsDOG showed dwarf phenotypes due to deficiency of cell elongation. Additional GA(1) and real-time PCR quantitative assay analyses confirmed that the decrease of GA(1) in the overexpression lines resulted from reduced expression of GA3ox2 and enhanced expression of GA2ox1 and GA2ox3. Adding exogenous GA rescued the constitutive expression phenotypes of the transgenic lines. OsDOG has a novel function in regulating GA homeostasis and in negative maintenance of plant cell elongation in rice. Copyright © 2011 Elsevier GmbH. All rights reserved.
Photoluminescence and Band Alignment of Strained GaAsSb/GaAs QW Structures Grown by MBE on GaAs
Sadofyev, Yuri G.; Samal, Nigamananda
2010-01-01
An in-depth optimization of growth conditions and investigation of optical properties including discussions on band alignment of GaAsSb/GaAs quantum well (QW) on GaAs by molecular beam epitaxy (MBE) are reported. Optimal MBE growth temperature of GaAsSb QW is found to be 470 ± 10 °C. GaAsSb/GaAs QW with Sb content ~0.36 has a weak type-II band alignment with valence band offset ratio QV ~1.06. A full width at half maximum (FWHM) of ~60 meV in room temperature (RT) photoluminescence (PL) indicates fluctuation in electrostatic potential to be less than 20 meV. Samples grown under optimal conditions do not exhibit any blue shift of peak in RT PL spectra under varying excitation.
Jeong, Eunjoo; Houn, Thavrak; Kuk, Yongin; Kim, Eun-Seon; Chandru, Hema Kumar; Baik, Myunggi; Back, Kyoungwhan; Guh, Ja-Ock; Han, Oksoo
2003-10-01
In an effort to asses the effect of Val311Met point mutation of Bacillus subtilis protoporphyrinogen oxidase on the resistance to diphenyl ether herbicides, a Val311Met point mutant of B. subtilis protoporphyrinogen oxidase was prepared, heterologously expressed in Escherichia coli, and the purified recombinant Val311Met mutant protoporphyrinogen oxidase was kinetically characterized. The mutant protoporphyrinogen oxidase showed very similar kinetic patterns to wild type protoporphyrinogen oxidase, with slightly decreased activity dependent on pH and the concentrations of NaCl, Tween 20, and imidazole. When oxyfluorfen was used as a competitive inhibitor, the Val311Met mutant protoporphyrinogen oxidase showed an increased inhibition constant about 1.5 times that of wild type protoporphyrinogen oxidase. The marginal increase of the inhibition constant indicates that the Val311Met point mutation in B. subtilis protoporphyrinogen oxidase may not be an important determinant in the mechanism that protects protoporphyrinogen oxidase against diphenyl ether herbicides.
Monoamine Oxidase A: A Novel Target for Progression and Metastasis of Prostate Cancer
2013-10-01
Paik, J.H. 2011. FoxO family members in cancer. Cancer biology & therapy 12:253-259. 31. Myatt, S.S., and Lam , E.W. 2007. The emerging roles of...J.B., Chen, K., Li, Y., Lau , Y.F., and Shih, J.C. 2009. Regulation of monoamine oxidase A by the SRY gene on the Y chromosome. FASEB journal
Ye, Heng; Feng, Jiuhuan; Zhang, Lihua; Zhang, Jinfeng; Mispan, Muhamad S.; Cao, Zhuanqin; Beighley, Donn H.; Yang, Jianchang; Gu, Xing-You
2015-01-01
Natural variation in seed dormancy is controlled by multiple genes mapped as quantitative trait loci in major crop or model plants. This research aimed to clone and characterize the Seed Dormancy1-2 (qSD1-2) locus associated with endosperm-imposed dormancy and plant height in rice (Oryza sativa). qSD1-2 was delimited to a 20-kb region, which contains OsGA20ox2 and had an additive effect on germination. Naturally occurring or induced loss-of-function mutations of the gibberellin (GA) synthesis gene enhanced seed dormancy and also reduced plant height. Expression of this gene in seeds (including endospermic cells) during early development increased GA accumulation to promote tissue morphogenesis and maturation programs. The mutant allele prevalent in semidwarf cultivars reduced the seed GA content by up to 2-fold at the early stage, which decelerated tissue morphogenesis including endosperm cell differentiation, delayed abscisic acid accumulation by a shift in the temporal distribution pattern, and postponed dehydration, physiological maturity, and germinability development. As the endosperm of developing seeds dominates the moisture equilibrium and desiccation status of the embryo in cereal crops, qSD1-2 is proposed to control primary dormancy by a GA-regulated dehydration mechanism. Allelic distribution of OsGA20ox2, the rice Green Revolution gene, was associated with the indica and japonica subspeciation. However, this research provided no evidence that the primitive indica- and common japonica-specific alleles at the presumably domestication-related locus functionally differentiate in plant height and seed dormancy. Thus, the evolutionary mechanism of this agriculturally important gene remains open for discussion. PMID:26373662
Nemec, Petr; Pavkova-Goldbergova, Monika; Gatterova, Jindra; Fojtik, Zdenek; Vasku, Anna; Soucek, Miroslav
2009-08-01
Interleukin-10 (IL-10) is an immunoregulatory cytokine, usually considered to mediate the downregulation of the inflammatory response in rheumatoid arthritis (RA). Some effects of IL-10 are not anti-inflammatory; for example, the activation of B cells to promote autoantibody production. Allelic polymorphisms located in the promoter region of the IL-10 gene may contribute to the regulation of autoantibodies production. To examine the putative association between the -1082 G/A polymorphism in the promoter region of the IL-10 gene and the susceptibility to disease onset and severity of RA, a total of 144 patients with RA diagnosed according to the revised criteria of the American College of Rheumatology for RA were consecutively recruited into the study. Radiographic progression of RA was scored according to the Sharp/van der Heijde method. Serum levels of rheumatoid factors (RFs) were measured by enzyme-linked immunosorbent assay. Polymerase chain reaction amplification was used for the analysis of the promoter polymorphism of the IL-10 gene. We observed significant differences in genotype distribution of the -1082 G/A polymorphism between IgM RF, IgA RF, and IgG RF positive/negative subgroups of RA patients, with higher prevalence of the GG genotype within IgM RF (Pg = 0.006), IgA RF (Pg = 0.05), and IgG RF (Pg = 0.007) negative RA patients. Results obtained in this study provide the evidence of an association between the -1082 G/A polymorphism in the IL-10 gene promoter and the production of RFs in RA patients.
Colmenero, Jordi; Bataller, Ramón; Sancho-Bru, Pau; Domínguez, Marlene; Moreno, Montserrat; Forns, Xavier; Bruguera, Miquel; Arroyo, Vicente; Brenner, David A; Ginès, Pere
2009-10-01
Angiotensin II promotes liver fibrogenesis by stimulating nonphagocytic NADPH oxidase (NOX)-induced oxidative stress. Angiotensin II type 1 (AT1) receptor blockers attenuate experimental liver fibrosis, yet their effects in human liver fibrosis are unknown. We investigated the effects of losartan on hepatic expression of fibrogenic, inflammatory, and NOX genes in patients with chronic hepatitis C (CHC). Fourteen patients with CHC and liver fibrosis received oral losartan (50 mg/day) for 18 mo. Liver biopsies were performed at baseline and after treatment. The degree of inflammation and fibrosis was evaluated by histological analysis (METAVIR). Collagen content was measured by morphometric quantification of Sirius red staining. Overall collagen content and fibrosis stage remained stable in the whole series, yet the fibrosis stage decreased in seven patients. Inflammatory activity improved in seven patients. The effect of losartan on hepatic expression of 31 profibrogenic and inflammatory genes and components of the NOX complex was assessed by quantitative PCR. Losartan treatment was associated with a significant decrease in the expression of several profibrogenic and NOX genes including procollagen alpha1(I) and alpha1(IV), urokinase-type plasminogen activator, metalloproteinase type 2, NOX activator 1 (NOXA-1) and organizer 1 (NOXO-1), and Rac-1. Losartan was well tolerated in all patients and was effective in attenuating the activity of the systemic renin-angiotensin system. No effects on serum liver tests or viral load were observed. We conclude that prolonged administration of losartan, an oral AT1 receptor blocker, is associated with downregulation of NOX components and fibrogenic genes in patients with CHC. Controlled studies are warranted to assess the effect of AT1 receptor blockers in chronic liver injury.
Pietan, Lucas L.; Spradling, Theresa A.
2016-01-01
In animals, mitochondrial DNA (mtDNA) typically occurs as a single circular chromosome with 13 protein-coding genes and 22 tRNA genes. The various species of lice examined previously, however, have shown mitochondrial genome rearrangements with a range of chromosome sizes and numbers. Our research demonstrates that the mitochondrial genomes of two species of chewing lice found on pocket gophers, Geomydoecus aurei and Thomomydoecus minor, are fragmented with the 1,536 base-pair (bp) cytochrome-oxidase subunit I (cox1) gene occurring as the only protein-coding gene on a 1,916–1,964 bp minicircular chromosome in the two species, respectively. The cox1 gene of T. minor begins with an atypical start codon, while that of G. aurei does not. Components of the non-protein coding sequence of G. aurei and T. minor include a tRNA (isoleucine) gene, inverted repeat sequences consistent with origins of replication, and an additional non-coding region that is smaller than the non-coding sequence of other lice with such fragmented mitochondrial genomes. Sequences of cox1 minichromosome clones for each species reveal extensive length and sequence heteroplasmy in both coding and noncoding regions. The highly variable non-gene regions of G. aurei and T. minor have little sequence similarity with one another except for a 19-bp region of phylogenetically conserved sequence with unknown function. PMID:27589589
Sytykiewicz, Hubert
2016-07-22
Plant NADPH oxidases (NOXs) encompass a group of membrane-bound enzymes participating in formation of reactive oxygen species (ROS) under physiological conditions as well as in response to environmental stressors. The purpose of the survey was to unveil the role of NADPH oxidase in pro-oxidative responses of maize (Zea mays L.) seedling leaves exposed to cereal aphids' infestation. The impact of apteral females of bird cherry-oat aphid (Rhopalosiphum padi L.) and grain aphid (Sitobion avenae F.) feeding on expression levels of all four NADPH oxidase genes (rbohA, rbohB, rbohC, rbohD) and total activity of NOX enzyme in maize plants were investigated. In addition, inhibitory effect of diphenylene iodonium (DPI) pre-treatment on NOX activity and hydrogen peroxide content in aphid-stressed maize seedlings was studied. Leaf infestation biotests were accomplished on 14-day-old seedlings representing two aphid-resistant varieties (Ambrozja and Waza) and two aphid-susceptible ones (Tasty Sweet and Złota Karłowa). Insects' attack led to profound upregulation of rbohA and rbohD genes in tested host plants, lower elevations were noted in level of rbohB mRNA, whereas abundance of rbohC transcript was not significantly altered. It was uncovered aphid-induced enhancement of NOX activity in examined plants. Higher increases in expression of all investigated rboh genes and activity of NADPH oxidase occurred in tissues of more resistant maize cultivars than in susceptible ones. Furthermore, DPI treatment resulted in strong reduction of NOX activity and H2O2 accumulation in aphid-infested Z. mays plants, thus evidencing circumstantial role of the enzyme in insect-elicited ROS generation. Copyright © 2016 Elsevier Inc. All rights reserved.
Duan, Li; Qi, Wei; Yan, Xuehai; He, Qiang; Cui, Yue; Wang, Kewei; Li, Dongxiang; Li, Junbai
2009-01-15
Glucose oxidase (GOD) microcapsules held together by cross-linker, glutaraldehyde (GA), are fabricated by the layer-by-layer (LbL) assembly technique. The lipid bilayer containing CF(0)F(1)-ATPase was coated on the outer shell of GOD microcapsules. Driven under the proton gradients produced by catalysis of GOD microcapsules for glucose, ATP is synthesized from ADP and inorganic phosphate catalyzed by the ATPase rotary catalysis. The results show here that ATPase reconstituted on the GOD microcapsules retains its catalytic activity.
Role of Caspase-9 Gene Ex5+32 G>A (rs1052576) Variant in Susceptibility to Primary Brain Tumors.
Ozdogan, Selcuk; Kafadar, Ali; Yilmaz, Seda Gulec; Timirci-Kahraman, Ozlem; Gormus, Uzay; Isbir, Turgay
2017-09-01
This study is the first to evaluate the relationship of caspase-9 (CASP-9) gene polymorphism with the risk for primary brain tumor development. The study group included 43 glioma and 27 meningioma patients and 76 healthy individuals. CASP-9 gene Ex5+32 G>A (rs1052576) polymorphism was analyzed by real-time polymerase chain reaction (RT-PCR). Individuals with the CASP-9 GG genotype had significantly decreased risk of developing a glioma brain tumor (p=0.024). Additionally, the GA genotype was significantly lower in patients with glioma than the control group (p=0.019). A significantly decreased risk of developing glioma was found in the A allele carrier group (p=0.024). However, there was no statistically significant relationship between CASP-9 polymorphism and brain meningioma (p=0.493). CASP-9 (rs1052576) mutant A allele seems to be a protective factor for glioma brain tumor. Future studies with a larger sample size will clarify the possible roles of CASP-9 gene in the etiology and progression of primary brain tumors. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.
Johnson, Kenneth R; Marden, Coleen C; Ward-Bailey, Patricia; Gagnon, Leona H; Bronson, Roderick T; Donahue, Leah Rae
2007-07-01
Dual oxidases generate the hydrogen peroxide needed by thyroid peroxidase for the incorporation of iodine into thyroglobulin, an essential step in thyroid hormone synthesis. Mutations in the human dual oxidase 2 gene, DUOX2, have been shown to underlie several cases of congenital hypothyroidism. We report here the first mouse Duox2 mutation, which provides a new genetic model for studying the specific function of DUOX2 in the thyroid gland and in other organ systems where it is hypothesized to play a role. We mapped the new spontaneous mouse mutation to chromosome 2 and identified it as a T>G base pair change in exon 16 of Duox2. The mutation changes a highly conserved valine to glycine at amino acid position 674 (V674G) and was named "thyroid dyshormonogenesis" (symbol thyd) to signify a defect in thyroid hormone synthesis. Thyroid glands of mutant mice are goitrous and contain few normal follicles, and anterior pituitaries are dysplastic. Serum T(4) in homozygotes is about one-tenth the level of controls and is accompanied by a more than 100-fold increase in TSH. The weight of adult mutant mice is approximately half that of littermate controls, and serum IGF-I is reduced. The cochleae of mutant mice exhibit abnormalities characteristic of hypothyroidism, including a delayed formation of the inner sulcus and tunnel of Corti and an abnormally thickened tectorial membrane. Hearing thresholds of adult mutant mice are on average 50-60 decibels (dB) above those of controls.
Dirschnabel, Daniela Elisabeth; Nowrousian, Minou; Cano-Domínguez, Nallely; Aguirre, Jesus; Teichert, Ines; Kück, Ulrich
2014-01-01
NADPH oxidase (NOX)-derived reactive oxygen species (ROS) act as signaling determinants that induce different cellular processes. To characterize NOX function during fungal development, we utilized the genetically tractable ascomycete Sordaria macrospora. Genome sequencing of a sterile mutant led us to identify the NADPH oxidase encoding nox1 as a gene required for fruiting body formation, regular hyphal growth, and hyphal fusion. These phenotypes are shared by ∆nor1, lacking the NOX regulator NOR1. Further phenotypic analyses revealed a high correlation between increased ROS production and hyphal fusion deficiencies in ∆nox1 and other sterile mutants. A genome-wide transcriptional profiling analysis of mycelia and isolated protoperithecia from wild type and ∆nox1 revealed that nox1 inactivation affects the expression of genes related to cytoskeleton remodeling, hyphal fusion, metabolism, and mitochondrial respiration. Genetic analysis of ∆nox2, lacking the NADPH oxidase 2 gene, ∆nor1, and transcription factor deletion mutant ∆ste12, revealed a strict melanin-dependent ascospore germination defect, indicating a common genetic pathway for these three genes. We report that gsa3, encoding a G-protein α-subunit, and sac1, encoding cAMP-generating adenylate cyclase, act in a separate pathway during the germination process. The finding that cAMP inhibits ascospore germination in a melanin-dependent manner supports a model in which cAMP inhibits NOX2 activity, thus suggesting a link between both pathways. Our results expand the current knowledge on the role of NOX enzymes in fungal development and provide a frame to define upstream and downstream components of the NOX signaling pathways in fungi. PMID:24407906
Choe, Daniel Ewon; Shaw, Daniel S.; Hyde, Luke W.; Forbes, Erika E.
2016-01-01
Although previous studies have shown that interactions between monoamine oxidase A (MAOA) genotype and childhood maltreatment predict Caucasian boys’ antisocial behavior, the generalizability of this gene-environment interaction to more diverse populations and more common parenting behaviors, such as punitive discipline in early childhood, is not clearly understood. Among 189 low-income men (44% African American, 56% Caucasian) who underwent rigorous assessments of family behavior and social context longitudinally across 20 years, those men with the low activity MAOA allele who experienced more punitive discipline at ages 1.5, 2, and 5 years showed more antisocial behavior from ages 15 through 20 years. Effects of punitive discipline on antisocial behavior differed by caregiver and age at which it occurred, suggesting sensitive periods throughout early childhood in which low MAOA activity elevated boys’ vulnerability to harsh parenting and risk for antisocial behavior. This genetic vulnerability to punitive discipline—and not just extreme, maltreatment experiences—may generalize to other male populations at risk for antisocial behavior. PMID:27014508
Chien, Wei Wen; Niogret, Charlène; Jugé, Romain; Lionnard, Loïc; Cornut-Thibaut, Aurélie; Kucharczak, Jérôme; Savina, Ariel; Salles, Gilles; Aouacheria, Abdel
2017-04-01
GA101, also known as obinutuzumab or Gazyva (Gazyvaro), is a glycoengineered type II humanized antibody that targets the CD20 antigen expressed at the surface of B-cells. This novel anti-CD20 antibody is currently assessed in clinical trials with promising results as a single agent or as part of therapeutic combinations for the treatment of B-cell malignancies. Detailed understanding of the mechanisms of GA101-induced cell death is needed to get insight into possible resistance mechanisms occurring in patients. Although multiple in vitro and in vivo mechanisms have been suggested to describe the effects of GA101 on B-cells, currently available data are ambiguous. The aim of our study was to clarify the cellular mechanisms involved in GA101-induced cell death in vitro, and more particularly the respective roles played by lysosomal and mitochondrial membrane permeabilization. Our results confirm previous reports suggesting that GA101 triggers homotypic adhesion and caspase-independent cell death, two processes that are dependent on actin remodeling and involve the production of reactive oxygen species. With respect to lysosomal membrane permeabilization (LMP), our data suggest that lack of specificity of available antibodies directed against cathepsin B may have confounded previously published results, possibly challenging current LMP-driven model of GA101 action mode. Copyright © 2017 Elsevier Ltd. All rights reserved.
Li, Kang; Tian, Ling; Guo, Zhongjian; Guo, Sanyou; Zhang, Jianzhen; Gu, Shi-Hong; Palli, Subba R.; Cao, Yang; Li, Sheng
2016-01-01
The temporal control mechanisms that precisely control animal development remain largely elusive. The timing of major developmental transitions in insects, including molting and metamorphosis, is coordinated by the steroid hormone 20-hydroxyecdysone (20E). 20E involves feedback loops to maintain pulses of ecdysteroid biosynthesis leading to its upsurge, whereas the underpinning molecular mechanisms are not well understood. Using the silkworm Bombyx mori as a model, we demonstrated that E75, the 20E primary response gene, mediates a regulatory loop between ecdysteroid biosynthesis and 20E signaling. E75 isoforms A and C directly bind to retinoic acid receptor-related response elements in Halloween gene promoter regions to induce gene expression thus promoting ecdysteroid biosynthesis and developmental transition, whereas isoform B antagonizes the transcriptional activity of isoform A/C through physical interaction. As the expression of E75 isoforms is differentially induced by 20E, the E75-mediated regulatory loop represents a fine autoregulation of steroidogenesis, which contributes to the precise control of developmental timing. PMID:27365399
DOE Office of Scientific and Technical Information (OSTI.GOV)
Park, Joonghoon; Park, Eok; Ahn, Bong-Hyun
2012-08-15
Oxidative stress is one of the causes of cardiomyopathy. In the present study, NecroXs, novel class of mitochondrial ROS/RNS scavengers, were evaluated for cardioprotection in in vitro and in vivo model, and the putative mechanism of the cardioprotection of NecroX-7 was investigated by global gene expression profiling and subsequent biochemical analysis. NecroX-7 prevented tert-butyl hydroperoxide (tBHP)-induced death of H9C2 rat cardiomyocytes at EC{sub 50} = 0.057 μM. In doxorubicin (DOX)-induced cardiomyopathy in rats, NecroX-7 significantly reduced the plasma levels of creatine kinase (CK-MB) and lactate dehydrogenase (LDH) which were increased by DOX treatment (p < 0.05). Microarray analysis revealed thatmore » 21 genes differentially expressed in tBHP-treated H9C2 cells were involved in ‘Production of reactive oxygen species’ (p = 0.022), and they were resolved by concurrent NecroX-7 treatment. Gene-to-gene networking also identified that NecroX-7 relieved cell death through Ncf1/p47phox and Rac2 modulation. In subsequent biochemical analysis, NecroX-7 inhibited NADPH oxidase (NOX) activity by 53.3% (p < 0.001). These findings demonstrate that NecroX-7, in part, provides substantial protection of cardiomyopathy induced by tBHP or DOX via NOX-mediated cell death. -- Highlights: ► NecroX-7 prevented tert-butyl hydroperoxide-induced in vitro cardiac cell death. ► NecroX-7 ameliorated doxorubicin-induced in vivo cardiomyopathy. ► NecroX-7 prevented oxidative stress and necrosis-enriched transcriptional changes. ► NecroX-7 effectively inhibited NADPH oxidase activation. ► Cardioprotection of Necro-7 was brought on by modulation of NADPH oxidase activity.« less
NASA Astrophysics Data System (ADS)
Schulze, C. S.; Huang, X.; Prohl, C.; Füllert, V.; Rybank, S.; Maddox, S. J.; March, S. D.; Bank, S. R.; Lee, M. L.; Lenz, A.
2016-04-01
The atomic structure and stoichiometry of InAs/InGaAs quantum-dot-in-a-well structures grown on exactly oriented GaP/Si(001) are revealed by cross-sectional scanning tunneling microscopy. An averaged lateral size of 20 nm, heights up to 8 nm, and an In concentration of up to 100% are determined, being quite similar compared with the well-known quantum dots grown on GaAs substrates. Photoluminescence spectra taken from nanostructures of side-by-side grown samples on GaP/Si(001) and GaAs(001) show slightly blue shifted ground-state emission wavelength for growth on GaP/Si(001) with an even higher peak intensity compared with those on GaAs(001). This demonstrates the high potential of GaP/Si(001) templates for integration of III-V optoelectronic components into silicon-based technology.
Mitochondrial Group II Introns, Cytochrome c Oxidase, and Senescence in Podospora anserina†
Begel, Odile; Boulay, Jocelyne; Albert, Beatrice; Dufour, Eric; Sainsard-Chanet, Annie
1999-01-01
Podospora anserina is a filamentous fungus with a limited life span. It expresses a degenerative syndrome called senescence, which is always associated with the accumulation of circular molecules (senDNAs) containing specific regions of the mitochondrial chromosome. A mobile group II intron (α) has been thought to play a prominent role in this syndrome. Intron α is the first intron of the cytochrome c oxidase subunit I gene (COX1). Mitochondrial mutants that escape the senescence process are missing this intron, as well as the first exon of the COX1 gene. We describe here the first mutant of P. anserina that has the α sequence precisely deleted and whose cytochrome c oxidase activity is identical to that of wild-type cells. The integration site of the intron is slightly modified, and this change prevents efficient homing of intron α. We show here that this mutant displays a senescence syndrome similar to that of the wild type and that its life span is increased about twofold. The introduction of a related group II intron into the mitochondrial genome of the mutant does not restore the wild-type life span. These data clearly demonstrate that intron α is not the specific senescence factor but rather an accelerator or amplifier of the senescence process. They emphasize the role that intron α plays in the instability of the mitochondrial chromosome and the link between this instability and longevity. Our results strongly support the idea that in Podospora, “immortality” can be acquired not by the absence of intron α but rather by the lack of active cytochrome c oxidase. PMID:10330149
El-Naggar, Noura El-Ahmady; Deraz, Sahar F; Soliman, Hoda M; El-Deeb, Nehal M; El-Shweihy, Nancy M
2017-03-29
There is an increasing demand on cholesterol oxidase for its various industrial and clinical applications. The current research was focused on extracellular cholesterol oxidase production under submerged fermentation by a local isolate previously identified as Streptomyces aegyptia NEAE 102. The crude enzyme extract was purified by two purification steps, protein precipitation using ammonium sulfate followed by ion exchange chromatography using DEAE Sepharose CL-6B. The kinetic parameters of purified cholesterol oxidase from Streptomyces aegyptia NEAE 102 were studied. The best conditions for maximum cholesterol oxidase activity were found to be 105 min of incubation time, an initial pH of 7 and temperature of 37 °C. The optimum substrate concentration was found to be 0.4 mM. The higher thermal stability behavior of cholesterol oxidase was at 50 °C. Around 63.86% of the initial activity was retained by the enzyme after 20 min of incubation at 50 °C. The apparent molecular weight of the purified enzyme as sized by sodium dodecyl sulphate-polyacryalamide gel electrophoresis was approximately 46 KDa. On DEAE Sepharose CL-6B column cholesterol oxidase was purified to homogeneity with final specific activity of 16.08 U/mg protein and 3.14-fold enhancement. The amino acid analysis of the purified enzyme produced by Streptomyces aegyptia NEAE 102 illustrated that, cholesterol oxidase is composed of 361 residues with glutamic acid as the most represented amino acid with concentration of 11.49 μg/mL. Taking into account the extracellular production, wide pH tolerance, thermal stability and shelf life, cholesterol oxidase produced by Streptomyces aegyptia NEAE 102 suggested that the enzyme could be industrially useful.
NASA Technical Reports Server (NTRS)
Wan, B.; Moreadith, R. W.; Blomqvist, C. G. (Principal Investigator)
1995-01-01
In order to investigate the mechanism(s) governing the striated muscle-specific expression of cytochrome c oxidase VIaH we have characterized the murine gene and analyzed its transcriptional regulatory elements in skeletal myogenic cell lines. The gene is single copy, spans 689 base pairs (bp), and is comprised of three exons. The 5'-ends of transcripts from the gene are heterogeneous, but the most abundant transcript includes a 5'-untranslated region of 30 nucleotides. When fused to the luciferase reporter gene, the 3.5-kilobase 5'-flanking region of the gene directed the expression of the heterologous protein selectively in differentiated Sol8 cells and transgenic mice, recapitulating the pattern of expression of the endogenous gene. Deletion analysis identified a 300-bp fragment sufficient to direct the myotube-specific expression of luciferase in Sol8 cells. The region lacks an apparent TATA element, and sequence motifs predicted to bind NRF-1, NRF-2, ox-box, or PPAR factors known to regulate other nuclear genes encoding mitochondrial proteins are not evident. Mutational analysis, however, identified two cis-elements necessary for the high level expression of the reporter protein: a MEF2 consensus element at -90 to -81 bp and an E-box element at -147 to -142 bp. Additional E-box motifs at closely located positions were mutated without loss of transcriptional activity. The dependence of transcriptional activation of cytochrome c oxidase VIaH on cis-elements similar to those found in contractile protein genes suggests that the striated muscle-specific expression is coregulated by mechanisms that control the lineage-specific expression of several contractile and cytosolic proteins.
Pseudo-bi-enzyme glucose sensor: ZnS hollow spheres and glucose oxidase concerted catalysis glucose.
Shuai, Ying; Liu, Changhua; Wang, Jia; Cui, Xiaoyan; Nie, Ling
2013-06-07
This work creatively uses peroxidase-like ZnS hollow spheres (ZnS HSs) to cooperate with glucose oxidase (GOx) for glucose determinations. This approach is that the ZnS HSs electrocatalytically oxidate the enzymatically generated H2O2 to O2, and then the O2 circularly participates in the previous glucose oxidation by glucose oxidase. Au nanoparticles (AuNPs) and carbon nanotubes (CNTs) are used as electron transfer and enzyme immobilization matrices, respectively. The biosensor of glucose oxidase-carbon nanotubes-Au nanoparticles-ZnS hollow spheres-gold electrode (GOx-CNT-AuNPs-ZnS HSs-GE) exhibits a rapid response, a low detection limit (10 μM), a wide linear range (20 μM to 7 mM) as well as good anti-interference, long-term longevity and reproducibility.
Paulus, Angela; Rossius, Sebastiaan Gijsbertus Hendrik; Dijk, Madelon; de Vries, Simon
2012-03-16
The quinol-linked cytochrome bd oxidases are terminal oxidases in respiration. These oxidases harbor a low spin heme b(558) that donates electrons to a binuclear heme b(595)/heme d center. The reaction with O(2) and subsequent catalytic steps of the Escherichia coli cytochrome bd-I oxidase were investigated by means of ultra-fast freeze-quench trapping followed by EPR and UV-visible spectroscopy. After the initial binding of O(2), the O-O bond is heterolytically cleaved to yield a kinetically competent heme d oxoferryl porphyrin π-cation radical intermediate (compound I) magnetically interacting with heme b(595). Compound I accumulates to 0.75-0.85 per enzyme in agreement with its much higher rate of formation (~20,000 s(-1)) compared with its rate of decay (~1,900 s(-1)). Compound I is next converted to a short lived heme d oxoferryl intermediate (compound II) in a phase kinetically matched to the oxidation of heme b(558) before completion of the reaction. The results indicate that cytochrome bd oxidases like the heme-copper oxidases break the O-O bond in a single four-electron transfer without a peroxide intermediate. However, in cytochrome bd oxidases, the fourth electron is donated by the porphyrin moiety rather than by a nearby amino acid. The production of reactive oxygen species by the cytochrome bd oxidase was below the detection level of 1 per 1000 turnovers. We propose that the two classes of terminal oxidases have mechanistically converged to enzymes in which the O-O bond is broken in a single four-electron transfer reaction to safeguard the cell from the formation of reactive oxygen species.
Quarta, Angela; Mita, Giovanni; Durante, Miriana; Arlorio, Marco; De Paolis, Angelo
2013-07-01
The polyphenol oxidase (PPO) enzyme, which can catalyze the oxidation of phenolics to quinones, has been reported to be involved in undesirable browning in many plant foods. This phenomenon is particularly severe in artichoke heads wounded during the manufacturing process. A full-length cDNA encoding for a putative polyphenol oxidase (designated as CsPPO) along with a 1432 bp sequence upstream of the starting ATG codon was characterized for the first time from [Cynara cardunculus var. scolymus (L.) Fiori]. The 1764 bp CsPPO sequence encodes a putative protein of 587 amino acids with a calculated molecular mass of 65,327 Da and an isoelectric point of 5.50. Analysis of the promoter region revealed the presence of cis-acting elements, some of which are putatively involved in the response to light and wounds. Expression analysis of the gene in wounded capitula indicated that CsPPO was significantly induced after 48 h, even though the browning process had started earlier. This suggests that the early browning event observed in artichoke heads was not directly related to de novo mRNA synthesis. Finally, we provide the complete gene sequence encoding for polyphenol oxidase and the upstream regulative region in artichoke. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
Ines Pisanelli; Magdalena Kujawa; Oliver Spadiut; Roman Kittl; Petr Halada; Jindrich Volc; Michael D. Mozuch; Philip Kersten; Dietmar Haltrich; Clemens Peterbauer
2009-01-01
The presented work reports the isolation and heterologous expression of the p2ox gene encoding the flavoprotein pyranose 2-oxidase (P2Ox) from the basidiomycete Phanerochaete chrysosporium. The p2ox cDNA was inserted into the bacterial expression vector pET21a(+) and successfully expressed in Escherichia coli. We obtained active, fully flavinylated recombinant P2Ox in...
Self-organization of palladium nanoislands on GaN and AlxGa1-xN/GaN heterostructures
NASA Astrophysics Data System (ADS)
Stafiniak, Andrzej; Szymański, Tomasz; Paszkiewicz, Regina
2017-12-01
We report on systematic study on the dewetting process of thin Pd layer and self-organized Pd nano-islands on SiO2, GaN and AlxGa1-xN/GaN heterostructures with various Al content. The influence of factors such as the thickness of metal layer, type of top layer of AlGaN/GaN heterostructures, temperature and time of annealing process on the dimensions, shapes and density of Pd islands was analyzed. Comparing the behavior of self-organization of Pd islands on Al0.25Ga0.75N/GaN and SiO2 we can conclude that solid-state dewetting process on SiO2 occures much faster than on Al0.25Ga0.75N. For substrates with SiO2 this process requires less energy and can arise for thicker layer. On the Al0.25Ga0.75N surface the islands take more crystalline shape which is probably due to surface reconstruction of Pd-Ga alloy thin layer on interface. For thin metal layer the coalescence of islands into larger islands similar to Ostwald ripening mechanism was observed. Greater surface roughness of AlxGa1-xN/GaN heterostructures with higher Al content causes an increase of surface density of islands and the reduction of their sizes which improves the roundness. In case of GaN and AlxGa1-xN layers with Al content lower than 20%, the surface degradation caused by annealing process was observed. Probably, this is due to the decomposition of layers with gallium droplet formation on catalytic metal islands.
Current transport mechanism in graphene/AlGaN/GaN heterostructures with various Al mole fractions
NASA Astrophysics Data System (ADS)
Pandit, Bhishma; Seo, Tae Hoon; Ryu, Beo Deul; Cho, Jaehee
2016-06-01
The current transport mechanism of graphene formed on AlxGa1-xN/GaN heterostructures with various Al mole fractions (x = 0.15, 0.20, 0.30, and 0.40) is investigated. The current-voltage measurement from graphene to AlGaN/GaN shows an excellent rectifying property. The extracted Schottky barrier height of the graphene/AlGaN/GaN contacts increases with the Al mole fraction in AlGaN. However, the current transport mechanism deviates from the Schottky-Mott theory owing to the deterioration of AlGaN crystal quality at high Al mole fractions confirmed by reverse leakage current measurement.
Interrupted reperfusion reduces the activation of NADPH oxidase after cerebral I/R injury.
Shen, Jia; Bai, Xiao-Yin; Qin, Yuan; Jin, Wei-Wei; Zhou, Jing-Yin; Zhou, Ji-Ping; Yan, Ying-Gang; Wang, Qiong; Bruce, Iain C; Chen, Jiang-Hua; Xia, Qiang
2011-06-15
Interrupted reperfusion reduces ischemia/reperfusion (I/R) injury. This study was designed to determine whether NADPH oxidase participates in the neural protection against global I/R injury after interrupted reperfusion. Mice were randomly divided into five groups: sham (sham-operated), I/R (20-min global I/R), RR (I/R+interrupted reperfusion), Apo (I/R+apocynin administration), and RR+Apo. Behavioral tests (pole test, beam walking, and Morris water maze) and Nissl staining were undertaken in all five groups; superoxide levels, expression of gp91(phox) and p47(phox), p47(phox) translocation, and Rac1 activation were measured in the sham, I/R, and RR groups. The motor coordination, bradykinesia, and spatial learning and memory, as well as the neuron survival rates, were better in the RR, Apo, and RR+Apo groups than in the I/R group. The NADPH oxidase-dependent superoxide levels, p47(phox) and gp91(phox) expression, p47(phox) translocation, and Rac1 activation were lower in the RR group than in the I/R group. In conclusion, the neural protective effect of interrupted reperfusion is at least partly mediated by decreasing the expression and assembly of NADPH oxidase and the levels of NADPH oxidase-derived superoxide. The most striking reduction Rac1-GTP in the RR group suggests that interrupted reperfusion also acts on the activation of assembled NADPH oxidase by reducing the availability of Rac1-GTP. Copyright © 2011 Elsevier Inc. All rights reserved.
Al-Shobaili, Hani A; Salem, Tarek A; Alzolibani, Abdullateef A; Robaee, Ahmad Al; Settin, Ahmad A
2012-10-01
Cytokines play an important role in the pathogenesis of acne vulgaris together with other genetic and environmental factors. To check for the association of TNF-α and IL-10 gene polymorphisms with the susceptibility and severity of acne in Saudi patients. Study subjects included 166 Saudi patients (65 males, 101 females) with acne vulgaris. Their mean age±SD was 21.6±5.1 years. These cases were compared to 390 unrelated healthy controls (208 males, 182 females) with a mean age±SD of 20.1±3.3 years. Cases were sub-grouped on the basis of their severity of acne affection into mild, moderate and severe groups. For all participants, genotypic variants of the TNF-α -308 G/A and IL-10 -1082 A/G genes were determined using the real time PCR technique. Frequencies of genotypic variants of the TNF-α -308 polymorphism were significantly different in acne cases compared to controls. Further analysis showed that acne cases had significantly higher frequency of both the GG and AA homozygous forms than controls (73.8% vs. 63.6%, p=0.02, odds ratio=1.6). It was also interestingly noticed that the amount of GG homozygosity was notably higher among female cases than male ones (76.0% vs. 54.7%, p=0.006, odds ratio=2.6) whereas male cases had a higher frequency of AA and GA genotypes than female ones (9.4% and 35.9% vs. 4% and 20% respectively). Differences in the frequencies of IL-10 -1082 genotypic variants were statistically insignificant comparing cases to controls (p=0.3). On the other hand, comparing cases-subgroups in terms of the age of onset of the disease, consanguinity, family history, obesity and acne severity; no statistical significance was observed regarding frequencies of genotypic variants related to the both TNF-α -308 and IL-10 -1082 polymorphisms (>0.05). TNF-α -308 polymorphic variants might be a predisposing factor for acne susceptibility, with no apparent relation to its severity whereas IL-10 -1082 variants showed no association with both acne
Li, Wande
2013-01-01
Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664
Du, Li Chuan; Gao, Ru
2017-07-01
In the Chinese population, gastric cancer (GC) is ranked as the third most common type of cancer. Although the exact etiology of GC development is unclear, several factors, including genetic and environmental, have been identified as risk factors. Variations in cytokine genes and their receptors have been related to a higher risk of GC. A single nucleotide polymorphism in the promoter region of tumor necrosis factor-α (TNF-α) (-308G>A) has been associated with a higher risk of GC and in the present study we evaluated its possible association with GC in a Chinese cohort. In addition, we performed a meta-analysis to draw a firm conclusion about the association between TNF-α gene polymorphisms and GC. We enrolled 400 Chinese GC patients and matched healthy controls hailing from similar geographical areas. The TNF-α -308G/A polymorphism was genotyped by allele-specific polymerase chain reaction (AS-PCR). For the meta-analysis, earlier published articles were searched and eligible studies were included. Prevalence of the heterozygous mutant (GA) and minor allele (A) were significantly higher in GC cases compared to healthy controls (GA: p<0.0001, odds ratio (OR)=4.90; A: p<0.0001, OR=2.84). A total of 36 eligible studies including the present report, encompassing of 8353 GC patients and 12099 controls, were analyzed for the meta-analysis. A significant association of the TNF-α polymorphism (-308G>A) with susceptibility to GC was only found in the Caucasian population (A vs G: p=0.001; AA vs GG: p=0.01; AG vs GG: p<0.0001; AA vs AG+GG: p=0.01; AA+AG vs p=0.003). The results of the present case control study and meta-analysis showed that associations between TNF-a variants with susceptibility to GC development is population and ethnic specific.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Schulze, C. S.; Prohl, C.; Füllert, V.
2016-04-04
The atomic structure and stoichiometry of InAs/InGaAs quantum-dot-in-a-well structures grown on exactly oriented GaP/Si(001) are revealed by cross-sectional scanning tunneling microscopy. An averaged lateral size of 20 nm, heights up to 8 nm, and an In concentration of up to 100% are determined, being quite similar compared with the well-known quantum dots grown on GaAs substrates. Photoluminescence spectra taken from nanostructures of side-by-side grown samples on GaP/Si(001) and GaAs(001) show slightly blue shifted ground-state emission wavelength for growth on GaP/Si(001) with an even higher peak intensity compared with those on GaAs(001). This demonstrates the high potential of GaP/Si(001) templates for integration ofmore » III-V optoelectronic components into silicon-based technology.« less
SEMICONDUCTOR DEVICES: A Ga-doped ZnO transparent conduct layer for GaN-based LEDs
NASA Astrophysics Data System (ADS)
Zhen, Liu; Xiaofeng, Wang; Hua, Yang; Yao, Duan; Yiping, Zeng
2010-09-01
An 8 μm thick Ga-doped ZnO (GZO) film grown by metal-source vapor phase epitaxy was deposited on a GaN-based light-emitting diode (LED) to substitute for the conventional ITO as a transparent conduct layer (TCL). Electroluminescence spectra exhibited that the intensity value of LED emission with a GZO TCL is markedly improved by 23.6% as compared to an LED with an ITO TCL at 20 mA. In addition, the forward voltage of the LED with a GZO TCL at 20 mA is higher than that of the conventional LED. To investigate the reason for the increase of the forward voltage, X-ray photoelectron spectroscopy was performed to analyze the interface properties of the GZO/p-GaN heterojunction. The large valence band offset (2:24 ± 0:21 eV) resulting from the formation of Ga2O3 in the GZO/p-GaN interface was attributed to the increase of the forward voltage.
Sanchez-Amat, Antonio; Solano, Francisco; Lucas-Elío, Patricia
2010-01-01
The identification and study of marine microorganisms with unique physiological traits can be a very powerful tool discovering novel enzymes of possible biotechnological interest. This approach can complement the enormous amount of data concerning gene diversity in marine environments offered by metagenomic analysis, and can help to place the activities associated with those sequences in the context of microbial cellular metabolism and physiology. Accordingly, the detection and isolation of microorganisms that may be a good source of enzymes is of great importance. Marinomonas mediterranea, for example, has proven to be one such useful microorganism. This Gram-negative marine bacterium was first selected because of the unusually high amounts of melanins synthesized in media containing the amino acid l-tyrosine. The study of its molecular biology has allowed the cloning of several genes encoding oxidases of biotechnological interest, particularly in white and red biotechnology. Characterization of the operon encoding the tyrosinase responsible for melanin synthesis revealed that a second gene in that operon encodes a protein, PpoB2, which is involved in copper transfer to tyrosinase. This finding made PpoB2 the first protein in the COG5486 group to which a physiological role has been assigned. Another enzyme of interest described in M. mediterranea is a multicopper oxidase encoding a membrane-associated enzyme that shows oxidative activity on a wide range of substrates typical of both laccases and tyrosinases. Finally, an enzyme very specific for l-lysine, which oxidises this amino acid in epsilon position and that has received a new EC number (1.4.3.20), has also been described for M. mediterranea. Overall, the studies carried out on this bacterium illustrate the power of exploring the physiology of selected microorganisms to discover novel enzymes of biotechnological relevance. PMID:20411113
Meijles, Daniel N.; Fan, Lampson M.; Howlin, Brendan J.; Li, Jian-Mei
2014-01-01
Phagocyte superoxide production by a multicomponent NADPH oxidase is important in host defense against microbial invasion. However inappropriate NADPH oxidase activation causes inflammation. Endothelial cells express NADPH oxidase and endothelial oxidative stress due to prolonged NADPH oxidase activation predisposes many diseases. Discovering the mechanism of NADPH oxidase activation is essential for developing novel treatment of these diseases. The p47phox is a key regulatory subunit of NADPH oxidase; however, due to the lack of full protein structural information, the mechanistic insight of p47phox phosphorylation in NADPH oxidase activation remains incomplete. Based on crystal structures of three functional domains, we generated a computational structural model of the full p47phox protein. Using a combination of in silico phosphorylation, molecular dynamics simulation and protein/protein docking, we discovered that the C-terminal tail of p47phox is critical for stabilizing its autoinhibited structure. Ser-379 phosphorylation disrupts H-bonds that link the C-terminal tail to the autoinhibitory region (AIR) and the tandem Src homology 3 (SH3) domains, allowing the AIR to undergo phosphorylation to expose the SH3 pocket for p22phox binding. These findings were confirmed by site-directed mutagenesis and gene transfection of p47phox−/− coronary microvascular cells. Compared with wild-type p47phox cDNA transfected cells, the single mutation of S379A completely blocked p47phox membrane translocation, binding to p22phox and endothelial O2⨪ production in response to acute stimulation of PKC. p47phox C-terminal tail plays a key role in stabilizing intramolecular interactions at rest. Ser-379 phosphorylation is a molecular switch which initiates p47phox conformational changes and NADPH oxidase-dependent superoxide production by cells. PMID:24970888
Identification and characterization of aldehyde oxidases (AOXs) in the cotton bollworm
NASA Astrophysics Data System (ADS)
Xu, Wei; Liao, Yalin
2017-12-01
Aldehyde oxidases (AOXs) are a family of metabolic enzymes that oxidize aldehydes into carboxylic acids; therefore, they play critical roles in detoxification and degradation of chemicals. By using transcriptomic and genomic approaches, we successfully identified six putative AOX genes (HarmAOX1-6) from cotton bollworm, Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae). In silico expression profile, reverse transcription (RT)-PCR, and quantitative PCR (qPCR) analyses showed that HarmAOX1 is highly expressed in adult antennae, tarsi, and larval mouthparts, so they may play an important role in degrading plant-derived compounds. HarmAOX2 is highly and specifically expressed in adult antennae, suggesting a candidate pheromone-degrading enzyme (PDE) to inactivate the sex pheromone components (Z)-11-hexadecenal and (Z)-9-hexadecenal. RNA sequencing data further demonstrated that a number of host plants they feed on could significantly upregulate the expression levels of HarmAOX1 in larvae. This study improves our understanding of insect aldehyde oxidases and insect-plant interactions.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen, Jr-Tai, E-mail: jrche@ifm.liu.se; Hsu, Chih-Wei; Forsberg, Urban
2015-02-28
Severe surface decomposition of semi-insulating (SI) GaN templates occurred in high-temperature H{sub 2} atmosphere prior to epitaxial growth in a metalorganic chemical vapor deposition system. A two-step heating process with a surface stabilization technique was developed to preserve the GaN template surface. Utilizing the optimized heating process, a high two-dimensional electron gas mobility ∼2000 cm{sup 2}/V·s was obtained in a thin AlGaN/AlN/GaN heterostructure with an only 100-nm-thick GaN spacer layer homoepitaxially grown on the GaN template. This technique was also demonstrated viable for native GaN substrates to stabilize the surface facilitating two-dimensional growth of GaN layers. Very high residual silicon andmore » oxygen concentrations were found up to ∼1 × 10{sup 20 }cm{sup −3} at the interface between the GaN epilayer and the native GaN substrate. Capacitance-voltage measurements confirmed that the residual carbon doping controlled by growth conditions of the GaN epilayer can be used to successfully compensate the donor-like impurities. State-of-the-art structural properties of a high-mobility AlGaN/AlN/GaN heterostructure was then realized on a 1 × 1 cm{sup 2} SI native GaN substrate; the full width at half maximum of the X-ray rocking curves of the GaN (002) and (102) peaks are only 21 and 14 arc sec, respectively. The surface morphology of the heterostructure shows uniform parallel bilayer steps, and no morphological defects were noticeable over the entire epi-wafer.« less
Yeast ERV2p is the first microsomal FAD-linked sulfhydryl oxidase of the Erv1p/Alrp protein family.
Gerber, J; Mühlenhoff, U; Hofhaus, G; Lill, R; Lisowsky, T
2001-06-29
Saccharomyces cerevisiae Erv2p was identified previously as a distant homologue of Erv1p, an essential mitochondrial protein exhibiting sulfhydryl oxidase activity. Expression of the ERV2 (essential for respiration and vegetative growth 2) gene from a high-copy plasmid cannot substitute for the lack of ERV1, suggesting that the two proteins perform nonredundant functions. Here, we show that the deletion of the ERV2 gene or the depletion of Erv2p by regulated gene expression is not associated with any detectable growth defects. Erv2p is located in the microsomal fraction, distinguishing it from the mitochondrial Erv1p. Despite their distinct subcellular localization, the two proteins exhibit functional similarities. Both form dimers in vivo and in vitro, contain a conserved YPCXXC motif in their carboxyl-terminal part, bind flavin adenine dinucleotide (FAD) as a cofactor, and catalyze the formation of disulfide bonds in protein substrates. The catalytic activity, the ability to form dimers, and the binding of FAD are associated with the carboxyl-terminal domain of the protein. Our findings identify Erv2p as the first microsomal member of the Erv1p/Alrp protein family of FAD-linked sulfhydryl oxidases. We propose that Erv2p functions in the generation of microsomal disulfide bonds acting in parallel with Ero1p, the essential, FAD-dependent oxidase of protein disulfide isomerase.
Rathinam, T; Gadde, U; Chapman, H D
2015-07-01
Oocysts of Eimeria spp. were isolated from litter samples obtained from 30 commercial turkey farms. Genomic DNA was extracted from clean oocysts, and polymerase chain amplification of the species-specific cytochrome c oxidase subunit I (COI) gene was performed for five species of turkey Eimeria. The species tested were Eimeria adenoeides, Eimeria meleagrimitis, Eimeria meleagridis, Eimeria dispersa, and Eimeria gallopavonis. All DNA samples were positive for E. meleagrimitis, nine were positive for E. adenoeides, two were positive for E. dispersa, and none for E. meleagridis and E. gallopavonis. E. meleagrimitis occurred as a single species in 21 (70 %) of the farms while 9 (30 %) farms had a mixed species with E. meleagrimitis and E. adenoeides and 2 (7 %) were triple positive with E. meleagrimitis, E. adenoeides, and E. dispersa. This is the first account of the field prevalence of turkey Eimeria species using molecular methods.
Paulus, Angela; Rossius, Sebastiaan Gijsbertus Hendrik; Dijk, Madelon; de Vries, Simon
2012-01-01
The quinol-linked cytochrome bd oxidases are terminal oxidases in respiration. These oxidases harbor a low spin heme b558 that donates electrons to a binuclear heme b595/heme d center. The reaction with O2 and subsequent catalytic steps of the Escherichia coli cytochrome bd-I oxidase were investigated by means of ultra-fast freeze-quench trapping followed by EPR and UV-visible spectroscopy. After the initial binding of O2, the O–O bond is heterolytically cleaved to yield a kinetically competent heme d oxoferryl porphyrin π-cation radical intermediate (compound I) magnetically interacting with heme b595. Compound I accumulates to 0.75–0.85 per enzyme in agreement with its much higher rate of formation (∼20,000 s−1) compared with its rate of decay (∼1,900 s−1). Compound I is next converted to a short lived heme d oxoferryl intermediate (compound II) in a phase kinetically matched to the oxidation of heme b558 before completion of the reaction. The results indicate that cytochrome bd oxidases like the heme-copper oxidases break the O–O bond in a single four-electron transfer without a peroxide intermediate. However, in cytochrome bd oxidases, the fourth electron is donated by the porphyrin moiety rather than by a nearby amino acid. The production of reactive oxygen species by the cytochrome bd oxidase was below the detection level of 1 per 1000 turnovers. We propose that the two classes of terminal oxidases have mechanistically converged to enzymes in which the O–O bond is broken in a single four-electron transfer reaction to safeguard the cell from the formation of reactive oxygen species. PMID:22287551
Quantitation of immunoadsorbed flavoprotein oxidases by luminol-mediated chemiluminescence.
Hinkkanen, A; Maly, F E; Decker, K
1983-04-01
The detection of the flavoenzymes 6-hydroxy-L-nicotine oxidase and 6-hydroxy-D-nicotine oxidase at the sub-femtomol level was achieved by coupling the reaction of the immunoadsorbed proteins to the peroxidase-catalysed oxidation of luminol. The H2O2-producing oxidases retained their full activity when bound to the respective immobilized antibodies. This fact allowed the concentration of the enzymes from very dilute solutions and the quantitative assay of their activities in the microU range. Due to strict stereoselectivity and the absence of immunological cross-reactivity, the two flavoproteins could be determined in the same solution. This method was used to measure the 6-hydroxy-D-nicotine oxidase and 6-hydroxy-L-nicotine oxidase activities in Escherichia coli RR1 and different Arthrobacter strains cultured under non-inducing conditions. The same activity ratio of 6-hydroxy-L-nicotine oxidase/6-hydroxy-D-nicotine oxidase as in D L-nicotine-induced cells of A. oxidans was observed in non-induced wild type and in riboflavin-requiring (rf-) mutant cells of this aerob.
Hao, Yanwei; Huang, Binbin; Jia, Dongyu; Mann, Taylor; Jiang, Xinyi; Qiu, Yuxing; Niitsu, Masaru; Berberich, Thomas; Kusano, Tomonobu; Liu, Taibo
2018-05-15
Polyamines (PAs) are implicated in developmental processes and stress responses of plants. Polyamine oxidases (PAOs), flavin adenine dinucleotide-dependent enzymes that function in PA catabolism, play a critical role. Even though PAO gene families of Arabidopsis and rice have been intensely characterized and their expression in response to developmental and environmental changes has been investigated, little is known about PAOs in tomato (Solanum lycopersicum). We found seven PAO genes in S. lycopersicum and named them SlPAO1∼7. Plant PAOs form four clades in phylogenetic analysis, of which SlPAO1 belongs to clade-I, SlPAO6 and SlPAO7 to clade-III, and the residual four (SlPAO2∼5) to clade-IV, while none belongs to clade-II. All the clade-IV members in tomato also retain the putative peroxisomal-targeting signals in their carboxy termini, suggesting their peroxisome localization. SlPAO1 to SlPAO5 genes consist of 10 exons and 9 introns, while SlPAO6 and SlPAO7 are intronless genes. To address the individual roles of SlPAOs, we analyzed their expression in various tissues and during flowering and fruit development. The expression of SlPAO2∼4 was constitutively high, while that of the other SlPAO members was relatively lower. We further analyzed the expressional changes of SlPAOs upon abiotic stresses, oxidative stresses, phytohormone application, and PA application. Based on the data obtained, we discuss the distinctive roles of SlPAOs. Copyright © 2018 Elsevier GmbH. All rights reserved.
He, Miao; Kratz, Lisa E.; Michel, Joshua J.; Vallejo, Abbe N.; Ferris, Laura; Kelley, Richard I.; Hoover, Jacqueline J.; Jukic, Drazen; Gibson, K. Michael; Wolfe, Lynne A.; Ramachandran, Dhanya; Zwick, Michael E.; Vockley, Jerry
2011-01-01
Defects in cholesterol synthesis result in a wide variety of symptoms, from neonatal lethality to the relatively mild dysmorphic features and developmental delay found in individuals with Smith-Lemli-Opitz syndrome. We report here the identification of mutations in sterol-C4-methyl oxidase–like gene (SC4MOL) as the cause of an autosomal recessive syndrome in a human patient with psoriasiform dermatitis, arthralgias, congenital cataracts, microcephaly, and developmental delay. This gene encodes a sterol-C4-methyl oxidase (SMO), which catalyzes demethylation of C4-methylsterols in the cholesterol synthesis pathway. C4-Methylsterols are meiosis-activating sterols (MASs). They exist at high concentrations in the testis and ovary and play roles in meiosis activation. In this study, we found that an accumulation of MASs in the patient led to cell overproliferation in both skin and blood. SMO deficiency also substantially altered immunocyte phenotype and in vitro function. MASs serve as ligands for liver X receptors α and β (LXRα and LXRβ), which are important in regulating not only lipid transport in the epidermis, but also innate and adaptive immunity. Deficiency of SMO represents a biochemical defect in the cholesterol synthesis pathway, the clinical spectrum of which remains to be defined. PMID:21285510
Neimanis, Karina; Staples, James F; Hüner, Norman P A; McDonald, Allison E
2013-09-10
Alternative oxidase (AOX) is a terminal ubiquinol oxidase present in the respiratory chain of all angiosperms investigated to date, but AOX distribution in other members of the Viridiplantae is less clear. We assessed the taxonomic distribution of AOX using bioinformatics. Multiple sequence alignments compared AOX proteins and examined amino acid residues involved in AOX catalytic function and post-translational regulation. Novel AOX sequences were found in both Chlorophytes and Streptophytes and we conclude that AOX is widespread in the Viridiplantae. AOX multigene families are common in non-angiosperm plants and the appearance of AOX1 and AOX2 subtypes pre-dates the divergence of the Coniferophyta and Magnoliophyta. Residues involved in AOX catalytic function are highly conserved between Chlorophytes and Streptophytes, while AOX post-translational regulation likely differs in these two lineages. We demonstrate experimentally that an AOX gene is present in the moss Physcomitrella patens and that the gene is transcribed. Our findings suggest that AOX will likely exert an influence on plant respiration and carbon metabolism in non-angiosperms such as green algae, bryophytes, liverworts, lycopods, ferns, gnetophytes, and gymnosperms and that further research in these systems is required. Copyright © 2013 Elsevier B.V. All rights reserved.
Xu, Zhaofa; Luo, Jintao; Li, Yu; Ma, Long
2014-01-01
Iodine is an essential trace element for life. Iodide deficiency can lead to defective biosynthesis of thyroid hormones and is a major cause of hypothyroidism and mental retardation. Excess iodide intake, however, has been linked to different thyroidal diseases. How excess iodide causes harmful effects is not well understood. Here, we found that the nematode Caenorhabditis elegans exhibits developmental arrest and other pleiotropic defects when exposed to excess iodide. To identify the responsible genes, we performed a forward genetic screen and isolated 12 mutants that can survive in excess iodide. These mutants define at least four genes, two of which we identified as bli-3 and tsp-15. bli-3 encodes the C. elegans ortholog of the mammalian dual oxidase DUOX1 and tsp-15 encodes the tetraspanin protein TSP-15, which was previously shown to interact with BLI-3. The C. elegans dual oxidase maturation factor DOXA-1 is also required for the arresting effect of excess iodide. Finally, we detected a dramatically increased biogenesis of reactive oxygen species in animals treated with excess iodide, and this effect can be partially suppressed by bli-3 and tsp-15 mutations. We propose that the BLI-3/TSP-15/DOXA-1 dual oxidase complex is required for the toxic pleiotropic effects of excess iodide. PMID:25480962
Lee, Kwang Jae; Chun, Jaeyi; Kim, Sang-Jo; Oh, Semi; Ha, Chang-Soo; Park, Jung-Won; Lee, Seung-Jae; Song, Jae-Chul; Baek, Jong Hyeob; Park, Seong-Ju
2016-03-07
We report the growth of InGaN/GaN multiple quantum wells blue light-emitting diodes (LEDs) on a silicon (111) substrate with an embedded nanoporous (NP) GaN layer. The NP GaN layer is fabricated by electrochemical etching of n-type GaN on the silicon substrate. The crystalline quality of crack-free GaN grown on the NP GaN layer is remarkably improved and the residual tensile stress is also decreased. The optical output power is increased by 120% at an injection current of 20 mA compared with that of conventional LEDs without a NP GaN layer. The large enhancement of optical output power is attributed to the reduction of threading dislocation, effective scattering of light in the LED, and the suppression of light propagation into the silicon substrate by the NP GaN layer.
Erv1p from Saccharomyces cerevisiae is a FAD-linked sulfhydryl oxidase.
Lee, J; Hofhaus, G; Lisowsky, T
2000-07-14
The yeast ERV1 gene encodes a small polypeptide of 189 amino acids that is essential for mitochondrial function and for the viability of the cell. In this study we report the enzymatic activity of this protein as a flavin-linked sulfhydryl oxidase catalyzing the formation of disulfide bridges. Deletion of the amino-terminal part of Erv1p shows that the enzyme activity is located in the 15 kDa carboxy-terminal domain of the protein. This fragment of Erv1p still binds FAD and catalyzes the formation of disulfide bonds but is no longer able to form dimers like the complete protein. The carboxy-terminal fragment contains a conserved CXXC motif that is present in all homologous proteins from yeast to human. Thus Erv1p represents the first FAD-linked sulfhydryl oxidase from yeast and the first of these enzymes that is involved in mitochondrial biogenesis.
Vujcic, Slavoljub; Diegelman, Paula; Bacchi, Cyrus J; Kramer, Debora L; Porter, Carl W
2002-01-01
During polyamine catabolism, spermine and spermidine are first acetylated by spermidine/spermine N(1)-acetyltransferase (SSAT) and subsequently oxidized by polyamine oxidase (PAO) to produce spermidine and putrescine, respectively. In attempting to clone the PAO involved in this back-conversion pathway, we encountered an oxidase that preferentially cleaves spermine in the absence of prior acetylation by SSAT. A BLAST search using maize PAO sequences identified homologous mammalian cDNAs derived from human hepatoma and mouse mammary carcinoma: the encoded proteins differed by 20 amino acids. When either cDNA was transiently transfected into HEK-293 cells, intracellular spermine pools decreased by 75% while spermidine and N (1)-acetylspermidine pools increased, suggesting that spermine was selectively and directly oxidized by the enzyme. Substrate specificity using lysates of oxidase-transfected HEK-293 cells revealed that the newly identified oxidase strongly favoured spermine over N (1)-acetylspermine and that it failed to act on N (1)-acetylspermidine, spermidine or the preferred PAO substrate, N (1), N (12)-diacetylspermine. The PAO inhibitor, MDL-72,527, only partially blocked oxidation of spermine while a previously reported PAO substrate, N (1)-( n -octanesulphonyl)spermine, potently inhibited the reaction. Overall, the data indicate that the enzyme represents a novel mammalian oxidase which, on the basis of substrate specificity, we have designated spermine oxidase in order to distinguish it from the PAO involved in polyamine back-conversion. The identification of an enzyme capable of directly oxidizing spermine to spermidine has important implications for understanding polyamine homoeostasis and for interpreting metabolic and cellular responses to clinically relevant polyamine analogues and inhibitors. PMID:12141946
Cytochrome oxidase assembly does not require catalytically active cytochrome C.
Barrientos, Antoni; Pierre, Danielle; Lee, Johnson; Tzagoloff, Alexander
2003-03-14
Cytochrome c oxidase (COX), the terminal enzyme of the mitochondrial respiratory chain, catalyzes the transfer of electrons from reduced cytochrome c to molecular oxygen. COX assembly requires the coming together of nuclear- and mitochondrial-encoded subunits and the assistance of a large number of nuclear gene products acting at different stages of maturation of the enzyme. In Saccharomyces cerevisiae, expression of cytochrome c, encoded by CYC1 and CYC7, is required not only for electron transfer but also for COX assembly through a still unknown mechanism. We have attempted to distinguish between a functional and structural requirement of cytochrome c in COX assembly. A cyc1/cyc7 double null mutant strain was transformed with the cyc1-166 mutant gene (Schweingruber, M. E., Stewart, J. W., and Sherman, F. (1979) J. Biol. Chem. 254, 4132-4143) that expresses stable but catalytically inactive iso-1-cytochrome c. The COX content of the cyc1/cyc7 double mutant strain harboring non-functional iso-1-cytochrome c has been characterized spectrally, functionally, and immunochemically. The results of these studies demonstrate that cytochrome c plays a structural rather than functional role in assembly of cytochrome c oxidase. In addition to its requirement for COX assembly, cytochrome c also affects turnover of the enzyme. Mutants containing wild type apocytochrome c in mitochondria lack COX, suggesting that only the folded and mature protein is able to promote COX assembly.
Correlation Between Monoamine Oxidase Inhibitors and Anticonvulsants
Dwivedi, Chandradhar; Misra, Radhey S.; Chaudhari, Anshumali; Parmar, Surendra S.
1980-01-01
Monoamine oxidase inhibitory and anticonvulsant properties of 2-substituted styryl-6-bromo-3-(4-ethylbenzoate/4 benzhydrazide)-4-quinazoles are studied. All styryl quinazolone esters except compound number 9 exhibited monoamine oxidase inhibitory properties during oxidative deamination of kynuramine. Corresponding hydrazides were found to have relatively higher activity. All these quinazolones were able to protect against pentylenetetrazol induced seizures. These observations in general do not prove that monoamine oxidase inhibitory properties represent the biochemical basis for the anticonvulsant activity of these compounds. PMID:7420438
Lermontova, Inna; Grimm, Bernhard
2000-01-01
The use of herbicides to control undesirable vegetation has become a universal practice. For the broad application of herbicides the risk of damage to crop plants has to be limited. We introduced a gene into the genome of tobacco (Nicotiana tabacum) plants encoding the plastid-located protoporphyrinogen oxidase of Arabidopsis, the last enzyme of the common tetrapyrrole biosynthetic pathway, under the control of the cauliflower mosaic virus 35S promoter. The transformants were screened for low protoporphyrin IX accumulation upon treatment with the diphenyl ether-type herbicide acifluorfen. Leaf disc incubation and foliar spraying with acifluorfen indicated the lower susceptibility of the transformants against the herbicide. The resistance to acifluorfen is conferred by overexpression of the plastidic isoform of protoporphyrinogen oxidase. The in vitro activity of this enzyme extracted from plastids of selected transgenic lines was at least five times higher than the control activity. Herbicide treatment that is normally inhibitory to protoporphyrinogen IX oxidase did not significantly impair the catalytic reaction in transgenic plants and, therefore, did not cause photodynamic damage in leaves. Therefore, overproduction of protoporphyrinogen oxidase neutralizes the herbicidal action, prevents the accumulation of the substrate protoporphyrinogen IX, and consequently abolishes the light-dependent phytotoxicity of acifluorfen. PMID:10631251
Zhang, Ye; Lan, Hongxia; Shao, Qiaolin; Wang, Ruqin; Chen, Hui; Tang, Haijuan; Zhang, Hongsheng; Huang, Ji
2016-01-01
The plant hormones gibberellins (GA) and abscisic acid (ABA) play important roles in plant development and stress responses. Here we report a novel A20/AN1-type zinc finger protein ZFP185 involved in GA and ABA signaling in the regulation of growth and stress response. ZFP185 was constitutively expressed in various rice tissues. Overexpression of ZFP185 in rice results in a semi-dwarfism phenotype, reduced cell size, and the decrease of endogenous GA3 content. By contrast, higher GA3 content was observed in RNAi plants. The application of exogenous GA3 can fully rescue the semi-dwarfism phenotype of ZFP185 overexpressing plants, suggesting the negative role of ZFP185 in GA biosynthesis. Besides GA, overexpression of ZFP185 decreased ABA content and expression of several ABA biosynthesis-related genes. Moreover, it was found that ZFP185, unlike previously known A20/AN1-type zinc finger genes, increases sensitivity to drought, cold, and salt stresses, implying the negative role of ZFP185 in stress tolerance. ZFP185 was localized in the cytoplasm and lacked transcriptional activation potential. Our study suggests that ZFP185 regulates plant growth and stress responses by affecting GA and ABA biosynthesis in rice. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Cortical enlargement in autism is associated with a functional VNTR in the monoamine oxidase A gene.
Davis, Lea K; Hazlett, Heather C; Librant, Amy L; Nopoulos, Peggy; Sheffield, Val C; Piven, Joesph; Wassink, Thomas H
2008-10-05
Monoamine oxidase A (MAOA) is an enzyme expressed in the brain that metabolizes dopamine, norepinephrine, epinephrine, and serotonin. Abnormalities of serotonin neurotransmission have long been implicated in the psychopathology of autism. A polymorphism exists within the promoter region of the MAOA gene that influences MAOA expression levels so that "low activity" alleles are associated with increased neurotransmitter levels in the brain. Individuals with autism often exhibit elevated serotonin levels. Additional studies indicate that the "low activity" allele may be associated with lower IQ and more severe autistic symptoms. In this study we genotyped the MAOA promoter polymorphism in a group of 29 males (age 2-3 years) with autism and a group of 39 healthy pediatric controls for whom brain MRI data was available. We found a consistent association between the "low activity" allele and larger brain volumes for regions of the cortex in children with autism but not in controls. We did not find evidence for over-transmission of the "low activity" allele in a separate sample of 114 affected sib pair families. Nor did we find any unknown SNPs in yet another sample of 96 probands. Future studies will determine if there is a more severe clinical phenotype associated with both the "low activity" genotype and the larger brain volumes in our sample.
Asymmetric quantum-well structures for AlGaN/GaN/AlGaN resonant tunneling diodes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yang, Lin'an, E-mail: layang@xidian.edu.cn; Li, Yue; Wang, Ying
Asymmetric quantum-well (QW) structures including the asymmetric potential-barrier and the asymmetric potential-well are proposed for AlGaN/GaN/AlGaN resonant tunneling diodes (RTDs). Theoretical investigation gives that an appropriate decrease in Al composition and thickness for emitter barrier as well as an appropriate increase of both for collector barrier can evidently improve the negative-differential-resistance characteristic of RTD. Numerical simulation shows that RTD with a 1.5-nm-thick GaN well sandwiched by a 1.3-nm-thick Al{sub 0.15}Ga{sub 0.85}N emitter barrier and a 1.7-nm-thick Al{sub 0.25}Ga{sub 0.75}N collector barrier can yield the I-V characteristic having the peak current (Ip) and the peak-to-valley current ratio (PVCR) of 0.39 A andmore » 3.6, respectively, about double that of RTD with a 1.5-nm-thick Al{sub 0.2}Ga{sub 0.8}N for both barriers. It is also found that an introduction of InGaN sub-QW into the diode can change the tunneling mode and achieve higher transmission coefficient of electron. The simulation demonstrates that RTD with a 2.8-nm-thick In{sub 0.03}Ga{sub 0.97}N sub-well in front of a 2.0-nm-thick GaN main-well can exhibit the I-V characteristic having Ip and PVCR of 0.07 A and 11.6, about 7 times and double the value of RTD without sub-QW, respectively. The purpose of improving the structure of GaN-based QW is to solve apparent contradiction between the device structure and the device manufacturability of new generation RTDs for sub-millimeter and terahertz applications.« less
Process dependency on threshold voltage of GaN MOSFET on AlGaN/GaN heterostructure
NASA Astrophysics Data System (ADS)
Wang, Qingpeng; Jiang, Ying; Miyashita, Takahiro; Motoyama, Shin-ichi; Li, Liuan; Wang, Dejun; Ohno, Yasuo; Ao, Jin-Ping
2014-09-01
GaN metal-oxide-semiconductor field-effect transistors (MOSFETs) with recessed gate on AlGaN/GaN heterostructure are reported in which the drain and source ohmic contacts were fabricated on the AlGaN/GaN heterostructure and the electron channel was formed on the GaN buffer layer by removing the AlGaN barrier layer. Negative threshold voltages were commonly observed in all devices. To investigate the reasons of the negative threshold voltages, different oxide thickness, etching gas and bias power of inductively-coupled plasma (ICP) system were utilized in the fabrication process of the GaN MOSFETs. It is found that positive charges of around 1 × 1012 q/cm2 exist near the interface at the just threshold condition in both silane- and tetraethylorthosilicate (TEOS)-based devices. It is also found that the threshold voltages do not obviously change with the different etching gas (SiCl4, BCl3 and two-step etching of SiCl4/Cl2) at the same ICP bias power level (20-25 W) and will become deeper when higher bias power is used in the dry recess process which may be related to the much serious ion bombardment damage. Furthermore, X-ray photoelectron spectroscopy (XPS) experiments were done to investigate the surface conditions. It is found that N 1s peaks become lower with higher bias power of the dry etching process. Also, silicon contamination was found and could be removed by HNO3/HF solution. It indicates that the nitrogen vacancies are mainly responsible for the negative threshold voltages rather than the silicon contamination. It demonstrates that optimization of the ICP recess conditions and improvement of the surface condition are still necessary to realize enhancement-mode GaN MOSFETs on AlGaN/GaN heterostructure.
Li, Jianmin; Zhu, Huaqing; Shen, E; Wan, Li; Arnold, J. Malcolm O.; Peng, Tianqing
2010-01-01
OBJECTIVE Our recent study demonstrated that Rac1 and NADPH oxidase activation contributes to cardiomyocyte apoptosis in short-term diabetes. This study was undertaken to investigate if disruption of Rac1 and inhibition of NADPH oxidase would prevent myocardial remodeling in chronic diabetes. RESEARCH DESIGN AND METHODS Diabetes was induced by injection of streptozotocin in mice with cardiomyocyte-specific Rac1 knockout and their wild-type littermates. In a separate experiment, wild-type diabetic mice were treated with vehicle or apocynin in drinking water. Myocardial hypertrophy, fibrosis, endoplasmic reticulum (ER) stress, inflammatory response, and myocardial function were investigated after 2 months of diabetes. Isolated adult rat cardiomyocytes were cultured and stimulated with high glucose. RESULTS In diabetic hearts, NADPH oxidase activation, its subunits' expression, and reactive oxygen species production were inhibited by Rac1 knockout or apocynin treatment. Myocardial collagen deposition and cardiomyocyte cross-sectional areas were significantly increased in diabetic mice, which were accompanied by elevated expression of pro-fibrotic genes and hypertrophic genes. Deficiency of Rac1 or apocynin administration reduced myocardial fibrosis and hypertrophy, resulting in improved myocardial function. These effects were associated with a normalization of ER stress markers' expression and inflammatory response in diabetic hearts. In cultured cardiomyocytes, high glucose–induced ER stress was inhibited by blocking Rac1 or NADPH oxidase. CONCLUSIONS Rac1 via NADPH oxidase activation induces myocardial remodeling and dysfunction in diabetic mice. The role of Rac1 signaling may be associated with ER stress and inflammation. Thus, targeting inhibition of Rac1 and NADPH oxidase may be a therapeutic approach for diabetic cardiomyopathy. PMID:20522592
High temperature superconductor NB3Ga
NASA Technical Reports Server (NTRS)
Vieland, L. J.; Wicklund, A. W.
1973-01-01
The discovery of superconductivity at 20.3 K in the Nb-Ga system by applying chemical vapor deposition (CVD) techniques to the materials preparation problem is reported. Films on ceramic substrates have been grown with superconducting onsets of up to 20.3 K. Critical fields at 4.2 K in excess of 300 kG and alpha's of 1100,000 T-A/sq cm have been obtained. The results confirm that the outstanding properties of Nb-Ga are due to an equilibrium configuration of the system, namely, the stoichiometric A-15 compound Nb3Ga, which is stable at relatively low temperatures. Practical materials preparation problems center on the codeposition of an adjacent Nb5Ga3 phase and the requirement that the deposition temperature be low. Some ternary alloys were also prepared, with part of the Ga replaced by Sn, Sb, Al, or Ge.
Chu, Byung Hwan; Kang, Byoung Sam; Hung, Sheng Chun; Chen, Ke Hung; Ren, Fan; Sciullo, Andrew; Gila, Brent P; Pearton, Stephen J
2010-01-01
Immobilized aluminum gallium nitride (AlGaN)/GaN high electron mobility transistors (HEMTs) have shown great potential in the areas of pH, chloride ion, and glucose detection in exhaled breath condensate (EBC). HEMT sensors can be integrated into a wireless data transmission system that allows for remote monitoring. This technology offers the possibility of using AlGaN/GaN HEMTs for extended investigations of airway pathology of detecting glucose in EBC without the need for clinical visits. HEMT structures, consisting of a 3-microm-thick undoped GaN buffer, 30-A-thick Al(0.3)Ga(0.7)N spacer, and 220-A-thick silicon-doped Al(0.3)Ga(0.7)N cap layer, were used for fabricating the HEMT sensors. The gate area of the pH, chloride ion, and glucose detection was immobilized with scandium oxide (Sc(2)O(3)), silver chloride (AgCl) thin film, and zinc oxide (ZnO) nanorods, respectively. The Sc(2)O(3)-gated sensor could detect the pH of solutions ranging from 3 to 10 with a resolution of approximately 0.1 pH. A chloride ion detection limit of 10(-8) M was achieved with a HEMT sensor immobilized with the AgCl thin film. The drain-source current of the ZnO nanorod-gated AlGaN/GaN HEMT sensor immobilized with glucose oxidase showed a rapid response of less than 5 seconds when the sensor was exposed to the target glucose in a buffer with a pH value of 7.4. The sensor could detect a wide range of concentrations from 0.5 nM to 125 microM. There is great promise for using HEMT-based sensors to enhance the detection sensitivity for glucose detection in EBC. Depending on the immobilized material, HEMT-based sensors can be used for sensing different materials. These electronic detection approaches with rapid response and good repeatability show potential for the investigation of airway pathology. The devices can also be integrated into a wireless data transmission system for remote monitoring applications. This sensor technology could use the exhaled breath condensate to measure the
Chu, Byung Hwan; Kang, Byoung Sam; Hung, Sheng Chun; Chen, Ke Hung; Ren, Fan; Sciullo, Andrew; Gila, Brent P.; Pearton, Stephen J.
2010-01-01
Background Immobilized aluminum gallium nitride (AlGaN)/GaN high electron mobility transistors (HEMTs) have shown great potential in the areas of pH, chloride ion, and glucose detection in exhaled breath condensate (EBC). HEMT sensors can be integrated into a wireless data transmission system that allows for remote monitoring. This technology offers the possibility of using AlGaN/GaN HEMTs for extended investigations of airway pathology of detecting glucose in EBC without the need for clinical visits. Methods HEMT structures, consisting of a 3-μm-thick undoped GaN buffer, 30-Å-thick Al0.3Ga0.7N spacer, and 220-Å-thick silicon-doped Al0.3Ga0.7N cap layer, were used for fabricating the HEMT sensors. The gate area of the pH, chloride ion, and glucose detection was immobilized with scandium oxide (Sc2O3), silver chloride (AgCl) thin film, and zinc oxide (ZnO) nanorods, respectively. Results The Sc2O3-gated sensor could detect the pH of solutions ranging from 3 to 10 with a resolution of ∼0.1 pH. A chloride ion detection limit of 10-8 M was achievedt with a HEMT sensor immobilized with the AgCl thin film. The drain–source current of the ZnO nanorod-gated AlGaN/GaN HEMT sensor immobilized with glucose oxidase showed a rapid response of less than 5 seconds when the sensor was exposed to the target glucose in a buffer with a pH value of 7.4. The sensor could detect a wide range of concentrations from 0.5 nM to 125 μM. Conclusion There is great promise for using HEMT-based sensors to enhance the detection sensitivity for glucose detection in EBC. Depending on the immobilized material, HEMT-based sensors can be used for sensingt different materials. These electronic detection approaches with rapid response and good repeatability show potential for the investigation of airway pathology. The devices can also be integrated into a wireless data transmission system for remote monitoring applications. This sensor technology could use the exhaled breath condensate to
Sacco, James; Ruplin, Andrew; Skonieczny, Paul; Ohman, Michael
2017-01-01
In humans, reduced activity of the enzyme monoamine oxidase type A (MAOA) due to genetic polymorphisms within the MAOA gene leads to increased brain neurotransmitter levels associated with aggression. In order to study MAOA genetic diversity in dogs, we designed a preliminary study whose objectives were to identify novel alleles in functionally important regions of the canine MAOA gene, and to investigate whether the frequencies of these polymorphisms varied between five broad breed groups (ancient, herding, mastiff, modern European, and mountain). Fifty dogs representing these five breed groups were sequenced. A total of eleven polymorphisms were found. Seven were single nucleotide polymorphisms (SNPs; two exonic, two intronic and three in the promoter), while four were repeat intronic variations. The most polymorphic loci were repeat regions in introns 1, 2 (7 alleles) and 10 (3 alleles), while the exonic and the promoter regions were highly conserved. Comparison of the allele frequencies of certain microsatellite polymorphisms among the breed groups indicated a decreasing or increasing trend in the number of repeats at different microsatellite loci, as well as the highest genetic diversity for the ancient breeds and the lowest for the most recent mountain breeds, perhaps attributable to canine domestication and recent breed formation. While a specific promoter SNP (-212A > G) is rare in the dog, it is the major allele in wolves. Replacement of this ancestral allele in domestic dogs may lead to the deletion of heat shock factor binding sites on the MAOA promoter. Dogs exhibit significant variation in certain intronic regions of the MAOA gene, while the coding and promoter regions are well-conserved. Distinct genetic differences were observed between breed groups. Further studies are now required to establish whether such polymorphisms are associated in any way with MAOA level and canine behaviour including aggression.
Cervelli, Manuela; Bellavia, Gabriella; D'Amelio, Marcello; Cavallucci, Virve; Moreno, Sandra; Berger, Joachim; Nardacci, Roberta; Marcoli, Manuela; Maura, Guido; Piacentini, Mauro; Amendola, Roberto; Cecconi, Francesco; Mariottini, Paolo
2013-01-01
Spermine oxidase is a FAD-containing enzyme involved in polyamines catabolism, selectively oxidizing spermine to produce H2O2, spermidine, and 3-aminopropanal. Spermine oxidase is highly expressed in the mouse brain and plays a key role in regulating the levels of spermine, which is involved in protein synthesis, cell division and cell growth. Spermine is normally released by neurons at synaptic sites where it exerts a neuromodulatory function, by specifically interacting with different types of ion channels, and with ionotropic glutamate receptors. In order to get an insight into the neurobiological roles of spermine oxidase and spermine, we have deregulated spermine oxidase gene expression producing and characterizing the transgenic mouse model JoSMOrec, conditionally overexpressing the enzyme in the neocortex. We have investigated the effects of spermine oxidase overexpression in the mouse neocortex by transcript accumulation, immunohistochemical analysis, enzymatic assays and polyamine content in young and aged animals. Transgenic JoSMOrec mice showed in the neocortex a higher H2O2 production in respect to Wild-Type controls, indicating an increase of oxidative stress due to SMO overexpression. Moreover, the response of transgenic mice to excitotoxic brain injury, induced by kainic acid injection, was evaluated by analysing the behavioural phenotype, the immunodistribution of neural cell populations, and the ultrastructural features of neocortical neurons. Spermine oxidase overexpression and the consequently altered polyamine levels in the neocortex affects the cytoarchitecture in the adult and aging brain, as well as after neurotoxic insult. It resulted that the transgenic JoSMOrec mouse line is more sensitive to KA than Wild-Type mice, indicating an important role of spermine oxidase during excitotoxicity. These results provide novel evidences of the complex and critical functions carried out by spermine oxidase and spermine in the mammalian brain. PMID
Chenier, Daniel; Beriault, Robin; Mailloux, Ryan; Baquie, Mathurin; Abramia, Gia; Lemire, Joseph; Appanna, Vasu
2008-01-01
Iron (Fe) is a critical element in all aerobic organisms as it participates in a variety of metabolic networks. In this study, aluminum (Al) and gallium (Ga), two Fe mimetics, severely impeded the ability of the soil microbe Pseudomonas fluorescens to perform oxidative phosphorylation. This was achieved by disrupting the activity and expression of complexes I, II, and IV. These toxic metals also inactivated aconitase (ACN) and fumarase A (FUM A), two tricarboxylic acid cycle enzymes dependent on Fe for their catalytic activity, while FUM C, an Fe-independent enzyme, displayed an increase in activity and expression under these stressed situations. Furthermore, in the Al- and Ga-exposed cells, the activity and expression of an H2O-forming NADH oxidase were markedly increased. The incubation of the Al- and Ga-challenged cells in an Fe-containing medium led to the recovery of the affected enzymatic activities. Taken together, these data provide novel insights into how environmental pollutants such as Al and Ga interfere with cellular Fe metabolism and also illustrate the ability of Pseudomonas fluorescens to modulate metabolic networks to combat this situation. PMID:18469122
Regulation of tyramine oxidase synthesis in Klebsiella aerogenes.
Okamura, H; Murooka, Y; Harada, T
1976-01-01
Tyramine oxidase in Klebsiella aerogenes is highly specific for tyramine, dopamine, octopamine, and norepinephrine, and its synthesis is induced specifically by these compounds. The enzyme is present in a membrane-bound form. The Km value for tyramine is 9 X 10(-4) M. Tyramine oxidase synthesis was subjected to catabolite repression by glucose in the presence of ammonium salts. Addition of cyclic adenosine 3',5'-monophosphate (cAMP) overcame the catabolite repression. A mutant strain, K711, which can produce a high level of beta-galactosidase in the presence of glucose and ammonium chloride, can also synthesize tyramine oxidase and histidase in the presence of inducer in glucose ammonium medium. Catabolite repression of tyramine oxidase synthesis was relieved when the cells were grown under conditions of nitrogen limitation, whereas beta-galactosidase was strongly repressed under these conditions. A cAMP-requiring mutant, MK54, synthesized tyramine oxidase rapidly when tyramine was used as the sole source of nitrogen in the absence of cAMP. However, a glutamine synthetase-constitutive mutant, MK94, failed to synthesize tyramine oxidase in the presence of glucose and ammonium chloride, although it synthesized histidase rapidly under these conditions. These results suggest that catabolite repression of tyramine oxidase synthesis in K. aerogenes is regulated by the intracellular level of cAMP and an unknown cytoplasmic factor that acts independently of cAMP and is formed under conditions of nitrogen limitation. PMID:179974
Electron and proton degradation in /AlGa/As-GaAs solar cells
NASA Technical Reports Server (NTRS)
Loo, R.; Knechtli, R. C.; Kamath, G. S.; Goldhammer, L.; Anspaugh, B.
1978-01-01
Results on radiation damage in (AlGa)As-GaAs solar cells by 1 MeV electron fluences up to 10 to the 16th electrons/sq cm and by 15, 20, 30 and 40 MeV proton fluences up to 5 times 10 to the 11th protons/sq cm are presented. The damage is compared with data on state-of-the-art silicon cells which were irradiated along with the gallium arsenide cells. The theoretical expectation that the junction depth has to be kept relatively shallow, to minimize radiation damage has been verified experimentally. The damage to the GaAs cells as a function of irradiation, is correlated with the change in their spectral response and dark I-V characteristics. The effect of thermal annealing on the (AlGa)As-GaAs solar cells was also investigated. This data is used to predict further avenues of optimization of the GaAs cells.
Role of NADPH Oxidase-4 in Human Endothelial Progenitor Cells
Hakami, Nora Y.; Ranjan, Amaresh K.; Hardikar, Anandwardhan A.; Dusting, Greg J.; Peshavariya, Hitesh M.
2017-01-01
Introduction: Endothelial progenitor cells (EPCs) display a unique ability to promote angiogenesis and restore endothelial function in injured blood vessels. NADPH oxidase 4 (NOX4)-derived hydrogen peroxide (H2O2) serves as a signaling molecule and promotes endothelial cell proliferation and migration as well as protecting against cell death. However, the role of NOX4 in EPC function is not completely understood. Methods: EPCs were isolated from human saphenous vein and mammary artery discarded during bypass surgery. NOX4 gene and protein expression in EPCs were measured by real time-PCR and Western blot analysis respectively. NOX4 gene expression was inhibited using an adenoviral vector expressing human NOX4 shRNA (Ad-NOX4i). H2O2 production was measured by Amplex red assay. EPC migration was evaluated using a transwell migration assay. EPC proliferation and viability were measured using trypan blue counts. Results: Inhibition of NOX4 using Ad-NOX4i reduced Nox4 gene and protein expression as well as H2O2 formation in EPCs. Inhibition of NOX4-derived H2O2 decreased both proliferation and migration of EPCs. Interestingly, pro-inflammatory cytokine tumor necrosis factor alpha (TNFα) decreased NOX4 expression and reduced survival of EPCs. However, the survival of EPCs was further diminished by TNF-α in NOX4-knockdown cells, suggesting that NOX4 has a protective role in EPCs. Conclusion: These findings suggest that NOX4-type NADPH oxidase is important for proliferation and migration functions of EPCs and protects against pro-inflammatory cytokine induced EPC death. These properties of NOX4 may facilitate the efficient function of EPCs which is vital for successful neovascularization. PMID:28386230
Leonovich, O A; Kurales, Iu A; Dutova, T A; Isakova, E P; Deriabina, Iu I; Rabinovich, Ia M
2009-01-01
Two independent mutant strains of methylotrophic yeast Pichia methanolica (mth1 arg1 and mth2 arg4) from the initial line 616 (ade1 ade5) were investigated. The mutant strains possessed defects in genes MTH1 and MTH2 which resulted in the inability to assimilate methanol as a sole carbon source and the increased activity of alcohol oxidase (AO). The function of the AUG2 gene encoding one of the subunits of AO and CTA1, a probable homolog of peroxisomal catalase of Saccharomyces cereviseae, was investigated by analyses of the molecular forms of isoenzymes. It was shown that optimal conditions for the expression of the AUG2 gene on a medium supplemented with 3% of methanol leads to an increasing synthesis of peroxisomal catalase. The mutant mth1 possessed a dominant formation of AO isoform with electrophoretic mobility which is typical for isogenic form 9, the product of the AUG2 gene, and a decreased level of peroxisomal catalase. The restoration of growth of four spontaneous revertants of the mutant mth1 (Rmth1) on the methanol containing medium was accompanied by an increase in activity of AO isogenic form 9 and peroxisomal catalase. The obtained results confirmed the functional continuity of the structural gene AUG2 in mutant mth1. The correlation of activity of peroxisomal catalase and AO isogenic form 1 in different conditions evidenced the existence of common regulatory elements for genes AUG2 and CTA1 in methilotrophic yeast Pichia methanolica.
A survey of genes encoding H2O2-producing GMC oxidoreductases in 10 Polyporales genomes.
Ferreira, Patricia; Carro, Juan; Serrano, Ana; Martínez, Angel T
2015-01-01
The genomes of three representative Polyporales (Bjerkandera adusta, Phlebia brevispora and a member of the Ganoderma lucidum complex) recently were sequenced to expand our knowledge on the diversity and distribution of genes involved in degradation of plant polymers in this Basidiomycota order, which includes most wood-rotting fungi. Oxidases, including members of the glucose-methanol-choline (GMC) oxidoreductase superfamily, play a central role in the above degradative process because they generate extracellular H2O2 acting as the ultimate oxidizer in both white-rot and brown-rot decay. The survey was completed by analyzing the GMC genes in the available genomes of seven more species to cover the four Polyporales clades. First, an in silico search for sequences encoding members of the aryl-alcohol oxidase, glucose oxidase, methanol oxidase, pyranose oxidase, cellobiose dehydrogenase and pyranose dehydrogenase families was performed. The curated sequences were subjected to an analysis of their evolutionary relationships, followed by estimation of gene duplication/reduction history during fungal evolution. Second, the molecular structures of the near one hundred GMC oxidoreductases identified were modeled to gain insight into their structural variation and expected catalytic properties. In contrast to ligninolytic peroxidases, whose genes are present in all white-rot Polyporales genomes and absent from those of brown-rot species, the H2O2-generating oxidases are widely distributed in both fungal types. This indicates that the GMC oxidases provide H2O2 for both ligninolytic peroxidase activity (in white-rot decay) and Fenton attack on cellulose (in brown-rot decay), after the transition between both decay patterns in Polyporales occurred. © 2015 by The Mycological Society of America.
Niwas, Ram; Osama, Khwaja; Khan, Saif; Haque, Shafiul; Tripathi, C. K. M.; Mishra, B. N.
2015-01-01
Cholesterol oxidase (COD) is a bi-functional FAD-containing oxidoreductase which catalyzes the oxidation of cholesterol into 4-cholesten-3-one. The wider biological functions and clinical applications of COD have urged the screening, isolation and characterization of newer microbes from diverse habitats as a source of COD and optimization and over-production of COD for various uses. The practicability of statistical/ artificial intelligence techniques, such as response surface methodology (RSM), artificial neural network (ANN) and genetic algorithm (GA) have been tested to optimize the medium composition for the production of COD from novel strain Streptomyces sp. NCIM 5500. All experiments were performed according to the five factor central composite design (CCD) and the generated data was analysed using RSM and ANN. GA was employed to optimize the models generated by RSM and ANN. Based upon the predicted COD concentration, the model developed with ANN was found to be superior to the model developed with RSM. The RSM-GA approach predicted maximum of 6.283 U/mL COD production, whereas the ANN-GA approach predicted a maximum of 9.93 U/mL COD concentration. The optimum concentrations of the medium variables predicted through ANN-GA approach were: 1.431 g/50 mL soybean, 1.389 g/50 mL maltose, 0.029 g/50 mL MgSO4, 0.45 g/50 mL NaCl and 2.235 ml/50 mL glycerol. The experimental COD concentration was concurrent with the GA predicted yield and led to 9.75 U/mL COD production, which was nearly two times higher than the yield (4.2 U/mL) obtained with the un-optimized medium. This is the very first time we are reporting the statistical versus artificial intelligence based modeling and optimization of COD production by Streptomyces sp. NCIM 5500. PMID:26368924
Pathak, Lakshmi; Singh, Vineeta; Niwas, Ram; Osama, Khwaja; Khan, Saif; Haque, Shafiul; Tripathi, C K M; Mishra, B N
2015-01-01
Cholesterol oxidase (COD) is a bi-functional FAD-containing oxidoreductase which catalyzes the oxidation of cholesterol into 4-cholesten-3-one. The wider biological functions and clinical applications of COD have urged the screening, isolation and characterization of newer microbes from diverse habitats as a source of COD and optimization and over-production of COD for various uses. The practicability of statistical/ artificial intelligence techniques, such as response surface methodology (RSM), artificial neural network (ANN) and genetic algorithm (GA) have been tested to optimize the medium composition for the production of COD from novel strain Streptomyces sp. NCIM 5500. All experiments were performed according to the five factor central composite design (CCD) and the generated data was analysed using RSM and ANN. GA was employed to optimize the models generated by RSM and ANN. Based upon the predicted COD concentration, the model developed with ANN was found to be superior to the model developed with RSM. The RSM-GA approach predicted maximum of 6.283 U/mL COD production, whereas the ANN-GA approach predicted a maximum of 9.93 U/mL COD concentration. The optimum concentrations of the medium variables predicted through ANN-GA approach were: 1.431 g/50 mL soybean, 1.389 g/50 mL maltose, 0.029 g/50 mL MgSO4, 0.45 g/50 mL NaCl and 2.235 ml/50 mL glycerol. The experimental COD concentration was concurrent with the GA predicted yield and led to 9.75 U/mL COD production, which was nearly two times higher than the yield (4.2 U/mL) obtained with the un-optimized medium. This is the very first time we are reporting the statistical versus artificial intelligence based modeling and optimization of COD production by Streptomyces sp. NCIM 5500.
Naddaf, Saied Reza; Oshaghi, Mohammad Ali; Vatandoost, Hassan
2012-12-01
Anopheles fluviatilis, one of the major malaria vectors in Iran, is assumed to be a complex of sibling species. The aim of this study was to evaluate Cytochrome oxidase I (COI) gene alongside 28S-D3 as a diagnostic tool for identification of An. fluviatilis sibling species in Iran. DNA sample belonging to 24 An. fluviatilis mosquitoes from different geographical areas in south and southeastern Iran were used for amplification of COI gene followed by sequencing. The 474-475 bp COI sequences obtained in this study were aligned with 59 similar sequences of An. fluviatilis and a sequence of Anopheles minimus, as out group, from GenBank database. The distances between group and individual sequences were calculated and phylogenetic tree for obtained sequences was generated by using Kimura two parameter (K2P) model of neighbor-joining method. Phylogenetic analysis using COI gene grouped members of Fars Province (central Iran) in two distinct clades separate from other Iranian members representing Hormozgan, Kerman, and Sistan va Baluchestan Provinces. The mean distance between Iranian and Indian individuals was 1.66%, whereas the value between Fars Province individuals and the group comprising individuals from other areas of Iran was 2.06%. Presence of 2.06% mean distance between individuals from Fars Province and those from other areas of Iran is indicative of at least two sibling species in An. fluviatilis mosquitoes of Iran. This finding confirms earlier results based on RAPD-PCR and 28S-D3 analysis.
Immobilization techniques to avoid enzyme loss from oxidase-based biosensors: a one-year study.
House, Jody L; Anderson, Ellen M; Ward, W Kenneth
2007-01-01
Continuous amperometric sensors that measure glucose or lactate require a stable sensitivity, and glutaraldehyde crosslinking has been used widely to avoid enzyme loss. Nonetheless, little data is published on the effectiveness of enzyme immobilization with glutaraldehyde. A combination of electrochemical testing and spectrophotometric assays was used to study the relationship between enzyme shedding and the fabrication procedure. In addition, we studied the relationship between the glutaraldehyde concentration and sensor performance over a period of one year. The enzyme immobilization process by glutaraldehyde crosslinking to glucose oxidase appears to require at least 24-hours at room temperature to reach completion. In addition, excess free glucose oxidase can be removed by soaking sensors in purified water for 20 minutes. Even with the addition of these steps, however, it appears that there is some free glucose oxidase entrapped within the enzyme layer which contributes to a decline in sensitivity over time. Although it reduces the ultimate sensitivity (probably via a change in the enzyme's natural conformation), glutaraldehyde concentration in the enzyme layer can be increased in order to minimize this instability. After exposure of oxidase enzymes to glutaraldehyde, effective crosslinking requires a rinse step and a 24-hour incubation step. In order to minimize the loss of sensor sensitivity over time, the glutaraldehyde concentration can be increased.
Cai, Xiaohong; Qian, Chengrui; Wu, Wenman; Lei, Hang; Ding, Qiulan; Zou, Wei; Xiang, Dong; Wang, Xuefeng
2017-09-01
The amino acid substitutions caused by ABO gene mutations are usually predicted to impact glycosyltransferase's function or its biosynthesis. Here we report an ABO exonic missense mutation that affects B-antigen expression by decreasing the mRNA level of the ABO gene rather than the amino acid change. Serologic studies including plasma total GTB transfer capacity were performed. The exon sequences of the ABO gene were analyzed by Sanger sequencing. B 310 cDNA with c.28G>A (p.G10R) mutation was expressed in HeLa cells and total GTB transfer capacity in cell supernatant was measured. Flow cytometry was performed on these HeLa cells after transfection, and agglutination of Hela-B weak cells was also examined. The mRNA of the ABO gene was analyzed by direct sequencing and real-time reverse transcriptase-polymerase chain reaction. A minigene construct was prepared to evaluate the potential of splicing. While plasma total GTB transfer capacity was undetectable in this B 3 -like individual, the relative percentage of antigen-expressing cells and mean fluorescence index of the B weak red blood cells (RBCs) were 19 and 14% of normal B RBCs, respectively. There was no significant difference of total GTB transfer capacity in cell supernatant and B-antigen expression on cell surfaces between HeLa cells transfected with B 310 cDNA and B cDNA. The mRNA expression level of B 310 in peripheral whole blood was significantly reduced. The amount of splicing is significantly lower in c.28G>A construct compared to that in wild-type construct after transfection in K562 cells. ABO c.28G>A mutation may cause B 3 -like subgroup by affecting RNA splicing of the ABO gene. © 2017 AABB.
dela Peña, Aileen; Leclercq, Isabelle A; Williams, Jacqueline; Farrell, Geoffrey C
2007-02-01
Hepatic oxidative stress is a key feature of metabolic forms of steatohepatitis, but the sources of pro-oxidants are unclear. The NADPH oxidase complex is critical for ROS generation in inflammatory cells; loss of any one component (e.g., gp91phox) renders NADPH oxidase inactive. We tested whether activated inflammatory cells contribute to oxidant stress in steatohepatitis. gp91phox-/- and wildtype (wt) mice were fed a methionine and choline-deficient (MCD) diet. Serum ALT, hepatic triglycerides, histopathology, lipid peroxidation, activation of NF-kappaB, expression of NF-kappaB-regulated genes and macrophage chemokines were measured. After 10 days of MCD dietary feeding, gp91phox-/- and wt mice displayed equivalent hepatocellular injury. After 8 weeks, there were fewer activated macrophages in livers of gp91phox-/- mice than controls, despite similar mRNA levels for MCP and MIP chemokines, but fibrosis was similar. NF-kappaB activation and increased expression of ICAM-1, TNF-alpha and COX-2 mRNA were evident in both genotypes, but in gp91phox-/- mice, expression of these genes was confined to hepatocytes. A functional NADPH oxidase complex does not contribute importantly to oxidative stress in this model and therefore is not obligatory for induction or perpetuation of dietary steatohepatitis.
Vokurková, M; Rauchová, H; Řezáčová, L; Vaněčková, I; Zicha, J
2015-01-01
Hypothalamic paraventricular nucleus (PVN) and rostral ventrolateral medulla (RVLM) play an important role in brain control of blood pressure (BP). One of the important mechanisms involved in the pathogenesis of hypertension is the elevation of reactive oxygen species (ROS) production by nicotine adenine dinucleotide phosphate (NADPH) oxidase. The aim of our present study was to investigate NADPH oxidase-mediated superoxide (O(2)(-)) production and to search for the signs of lipid peroxidation in hypothalamus and medulla oblongata as well as in renal medulla and cortex of hypertensive male rats transgenic for the murine Ren-2 renin gene (Ren-2 TGR) and their age-matched normotensive controls - Hannover Sprague Dawley rats (HanSD). We found no difference in the activity of NADPH oxidase measured as a lucigenin-mediated O(2)(-) production in the hypothalamus and medulla oblongata. However, we observed significantly elevated NADPH oxidase in both renal cortex and medulla of Ren-2 TGR compared with HanSD. Losartan (LOS) treatment (10 mg/kg body weight/day) for 2 months (Ren-2 TGR+LOS) did not change NADPH oxidase-dependent O(2)(-) production in the kidney. We detected significantly elevated indirect markers of lipid peroxidation measured as thiobarbituric acid-reactive substances (TBARS) in Ren-2 TGR, while they were significantly decreased in Ren-2 TGR+LOS. In conclusion, the present study shows increased NADPH oxidase activities in renal cortex and medulla with significantly increased TBARS in renal cortex. No significant changes of NADPH oxidase and markers of lipid peroxidation were detected in the studied brain regions.
NASA Astrophysics Data System (ADS)
Liu, Lihua; Sepehri-Amin, H.; Sasaki, T. T.; Ohkubo, T.; Yano, M.; Sakuma, N.; Kato, A.; Shoji, T.; Hono, K.
2018-05-01
Nd80Ga15Cu5 and Nd62Fe14Ga20Cu4 alloys were used as diffusion sources for the eutectic grain boundary diffusion process, applying to 4 mm-thick Nd-Fe-B hot-deformed magnets. Both samples showed nearly same coercivity of 2.2 T, while the sample processed with Nd62Fe14Ga20Cu4 showed smaller remanence deterioration from 1.50 T to 1.30 T, in contrast to that of the sample processed with Nd80Ga15Cu5 to 1.08 T. Mr/Ms of the initial sample and the samples processed with Nd62Fe14Ga20Cu4 and Nd80Ga15Cu5 were 0.946, 0.934 and 0.917, respectively, suggesting that the sample processed with Nd62Fe14Ga20Cu4 retains stronger c-axis texture after the diffusion process. Nd-rich phases with Ia3 ¯ and fcc structures were observed in the sample processed with Nd80Ga15Cu5, while the Nd-rich phases with the Ia3 ¯ and hcp structures were found in the sample processed with Nd62Fe14Ga20Cu4, all of which are the phases commonly observed in Nd-Fe-B sintered magnets.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pan Xinjuan; Dai Yujie; Li Xing
2011-08-01
Chronic arsenic exposure induces oxidative damage to liver leading to liver fibrosis. We aimed to define the effect of grape seed extract (GSE), an antioxidant dietary supplement, on arsenic-induced liver injury. First, Male Sprague-Dawley rats were exposed to a low level of arsenic in drinking water (30 ppm) with or without GSE (100 mg/kg, every other day by oral gavage) for 12 months and the effect of GSE on arsenic-induced hepatotoxicity was examined. The results from this study revealed that GSE co-treatment significantly attenuated arsenic-induced low antioxidant defense, oxidative damage, proinflammatory cytokines and fibrogenic genes. Moreover, GSE reduced arsenic-stimulated Smad2/3more » phosphorylation and protein levels of NADPH oxidase subunits (Nox2, Nox4 and p47phox). Next, we explored the molecular mechanisms underlying GSE inhibition of arsenic toxicity using cultured rat hepatic stellate cells (HSCs). From the in vitro study, we found that GSE dose-dependently reduced arsenic-stimulated ROS production and NADPH oxidase activities. Both NADPH oxidases flavoprotein inhibitor DPI and Nox4 siRNA blocked arsenic-induced ROS production, whereas Nox4 overexpression suppressed the inhibitory effects of GSE on arsenic-induced ROS production and NADPH oxidase activities, as well as expression of TGF-{beta}1, type I procollagen (Coll-I) and {alpha}-smooth muscle actin ({alpha}-SMA) mRNA. We also observed that GSE dose-dependently inhibited TGF-{beta}1-induced transactivation of the TGF-{beta}-induced smad response element p3TP-Lux, and that forced expression of Smad3 attenuated the inhibitory effects of GSE on TGF-{beta}1-induced mRNA expression of Coll-I and {alpha}-SMA. Collectively, GSE could be a potential dietary therapeutic agent for arsenic-induced liver injury through suppression of NADPH oxidase and TGF-{beta}/Smad activation. - Research Highlights: > GSE attenuated arsenic-induced low antioxidant defense, oxidative damage, proinflammatory cytokines
Involvement of NADH Oxidase in Competition and Endocarditis Virulence in Streptococcus sanguinis
Ge, Xiuchun; Yu, Yang; Zhang, Min; Chen, Lei; Chen, Weihua; Elrami, Fadi; Kong, Fanxiang; Kitten, Todd
2016-01-01
Here, we report for the first time that the Streptococcus sanguinis nox gene encoding NADH oxidase is involved in both competition with Streptococcus mutans and virulence for infective endocarditis. An S. sanguinis nox mutant was found to fail to inhibit the growth of Streptococcus mutans under microaerobic conditions. In the presence of oxygen, the recombinant Nox protein of S. sanguinis could reduce oxygen to water and oxidize NADH to NAD+. The oxidation of NADH to NAD+ was diminished in the nox mutant. The nox mutant exhibited decreased levels of extracellular H2O2; however, the intracellular level of H2O2 in the mutant was increased. Furthermore, the virulence of the nox mutant was attenuated in a rabbit endocarditis model. The nox mutant also was shown to be more sensitive to blood killing, oxidative and acid stresses, and reduced growth in serum. Thus, NADH oxidase contributes to multiple phenotypes related to competitiveness in the oral cavity and systemic virulence. PMID:26930704
Involvement of NADH Oxidase in Competition and Endocarditis Virulence in Streptococcus sanguinis.
Ge, Xiuchun; Yu, Yang; Zhang, Min; Chen, Lei; Chen, Weihua; Elrami, Fadi; Kong, Fanxiang; Kitten, Todd; Xu, Ping
2016-05-01
Here, we report for the first time that the Streptococcus sanguinis nox gene encoding NADH oxidase is involved in both competition with Streptococcus mutans and virulence for infective endocarditis. An S. sanguinis nox mutant was found to fail to inhibit the growth of Streptococcus mutans under microaerobic conditions. In the presence of oxygen, the recombinant Nox protein of S. sanguinis could reduce oxygen to water and oxidize NADH to NAD(+) The oxidation of NADH to NAD(+) was diminished in the nox mutant. The nox mutant exhibited decreased levels of extracellular H2O2; however, the intracellular level of H2O2 in the mutant was increased. Furthermore, the virulence of the nox mutant was attenuated in a rabbit endocarditis model. The nox mutant also was shown to be more sensitive to blood killing, oxidative and acid stresses, and reduced growth in serum. Thus, NADH oxidase contributes to multiple phenotypes related to competitiveness in the oral cavity and systemic virulence. Copyright © 2016 Ge et al.
Lv, Lin; Huo, Ximei; Wen, Luhua; Gao, Zhihong; Khalil-ur-Rehman, Muhammad
2018-01-01
Bud dormancy release is regulated by gibberellins (GAs). DELLA proteins are highly conserved and act as negative regulators in GA signaling pathway. The present study established a relationship between PmRGL2 in Japanese apricot and GA4 levels during dormancy release of floral buds. Overexpression of PmRGL2 in poplar delayed the onset of bud dormancy and resulted in dwarf plants, relative to wild-type trees. PmRGL2 exhibited higher expression during ecodormancy and relatively lower expression during endodormancy. The relative level of GA4 exhibited an increasing trend at the transition from endodormancy to ecodormancy and displayed a similar expression pattern of genes related to GA metabolism, PmGA20ox2, PmGA3ox1, PmGID1b, in both Japanese apricot and transgenic poplar. These results suggests that PmRGL2 acts as an integrator and negative regulator of dormancy via a GA-signaling pathway. Moreover, an interaction between RGL2 and SLY1 in a yeast two hybrid (Y2H) system further suggests that SCF E3 ubiquitin ligases, such as SLY1, may be a critical factor in the regulation of RGL2 through an SCFSLY1-proteasome pathway. Our study demonstrated that PmRGL2 plays a negative role in bud dormancy release by regulating the GA biosynthetic enzymes, GA20ox and GA3ox1 and the GA receptor, GID1b. PMID:29434610
NADPH oxidases of the brain: distribution, regulation, and function.
Infanger, David W; Sharma, Ram V; Davisson, Robin L
2006-01-01
The NADPH oxidase is a multi-subunit enzyme that catalyzes the reduction of molecular oxygen to form superoxide (O(2)(-)). While classically linked to the respiratory burst in neutrophils, recent evidence now shows that O(2)(-) (and associated reactive oxygen species, ROS) generated by NADPH oxidase in nonphagocytic cells serves myriad functions in health and disease. An entire new family of NADPH Oxidase (Nox) homologues has emerged, which vary widely in cell and tissue distribution, as well as in function and regulation. A major concept in redox signaling is that while NADPH oxidase-derived ROS are necessary for normal cellular function, excessive oxidative stress can contribute to pathological disease. This certainly is true in the central nervous system (CNS), where normal NADPH oxidase function appears to be required for processes such as neuronal signaling, memory, and central cardiovascular homeostasis, but overproduction of ROS contributes to neurotoxicity, neurodegeneration, and cardiovascular diseases. Despite implications of NADPH oxidase in normal and pathological CNS processes, still relatively little is known about the mechanisms involved. This paper summarizes the evidence for NADPH oxidase distribution, regulation, and function in the CNS, emphasizing the diversity of Nox isoforms and their new and emerging role in neuro-cardiovascular function. In addition, perspectives for future research and novel therapeutic targets are offered.
Gravity Responsive NADH Oxidase of the Plasma Membrane
NASA Technical Reports Server (NTRS)
Morre, D. James (Inventor)
2002-01-01
A method and apparatus for sensing gravity using an NADH oxidase of the plasma membrane which has been found to respond to unit gravity and low centrifugal g forces. The oxidation rate of NADH supplied to the NADH oxidase is measured and translated to represent the relative gravitational force exerted on the protein. The NADH oxidase of the plasma membrane may be obtained from plant or animal sources or may be produced recombinantly.
Li, Rong; Xin, Shan; Tao, Chengcheng; Jin, Xiang; Li, Hongbin
2017-01-01
Ascorbate oxidase (AO) plays an important role in cell growth through the modulation of reduction/oxidation (redox) control of the apoplast. Here, a cotton (Gossypium hirsutum) apoplastic ascorbate oxidase gene (GhAO1) was obtained from fast elongating fiber tissues. GhAO1 belongs to the multicopper oxidase (MCO) family and includes a signal peptide and several transmembrane regions. Analyses of quantitative real-time polymerase chain reaction (QRT-PCR) and enzyme activity showed that GhAO1 was expressed abundantly in 15-day post-anthesis (dpa) wild-type (WT) fibers in comparison with fuzzless-lintless (fl) mutant ovules. Subcellular distribution analysis in onion cells demonstrated that GhAO1 is localized in the cell wall. In transgenic tobacco bright yellow-2 (BY-2) cells with ectopic overexpression of GhAO1, the enhancement of cell growth with 1.52-fold increase in length versus controls was indicated, as well as the enrichment of both total ascorbate in whole-cells and dehydroascorbate acid (DHA) in apoplasts. In addition, promoted activities of AO and monodehydroascorbate reductase (MDAR) in apoplasts and dehydroascorbate reductase (DHAR) in whole-cells were displayed in transgenic tobacco BY-2 cells. Accumulation of H2O2, and influenced expressions of Ca2+ channel genes with the activation of NtMPK9 and NtCPK5 and the suppression of NtTPC1B were also demonstrated in transgenic tobacco BY-2 cells. Finally, significant induced expression of the tobacco NtAO gene in WT BY-2 cells under indole-3-acetic acid (IAA) treatment appeared; however, the sensitivity of the NtAO gene expression to IAA disappeared in transgenic BY-2 cells, revealing that the regulated expression of the AO gene is under the control of IAA. Taken together, these results provide evidence that GhAO1 plays an important role in fiber cell elongation and may promote cell growth by generating the oxidation of apoplasts, via the auxin-mediated signaling pathway. PMID:28644407
Catalyst-Free Growth of Large Scale Ga2O3 Nanowires
2001-11-01
XRD and TEM analyses indicate that the Ga 20 3 nanowires exhibit a monoclinic structure. PL characteristic of the Ga2O3 nanowires shows a UV emission...using Ga metal and N2 / H 20 reactants. The Ga2O3 nanowires, which have diameters ranging from 60 to 150 nm and lengths of several micrometers, are 133
Immobilization of Pichia pastoris cells containing alcohol oxidase activity
Maleknia, S; Ahmadi, H; Norouzian, D
2011-01-01
Background and Objectives The attempts were made to describe the development of a whole cell immobilization of P. pastoris by entrapping the cells in polyacrylamide gel beads. The alcohol oxidase activity of the whole cell Pichia pastoris was evaluated in comparison with yeast biomass production. Materials and Methods Methylotrophic yeast P. pastoris was obtained from Collection of Standard Microorganisms, Department of Bacterial Vaccines, Pasteur Institute of Iran (CSMPI). Stock culture was maintained on YPD agar plates. Alcohol oxidase was strongly induced by addition of 0.5% methanol as the carbon source. The cells were harvested by centrifugation then permeabilized. Finally the cells were immobilized in polyacrylamide gel beads. The activity of alcohol oxidase was determined by method of Tane et al. Results At the end of the logarithmic phase of cell culture, the alcohol oxidase activity of the whole cell P. Pastoris reached the highest level. In comparison, the alcohol oxidase activity was measured in an immobilized P. pastoris when entrapped in polyacrylamide gel beads. The alcohol oxidase activity of cells was induced by addition of 0.5% methanol as the carbon source. The cells were permeabilized by cetyltrimethylammonium bromide (CTAB) and immobilized. CTAB was also found to increase the gel permeability. Alcohol oxidase activity of immobilized cells was then quantitated by ABTS/POD spectrophotometric method at OD 420. There was a 14% increase in alcohol oxidase activity in immobilized cells as compared with free cells. By addition of 2-butanol as a substrate, the relative activity of alcohol oxidase was significantly higher as compared with other substrates added to the reaction media. Conclusion Immobilization of cells could eliminate lengthy and expensive procedures of enzyme separation and purification, protect and stabilize enzyme activity, and perform easy separation of the enzyme from the reaction media. PMID:22530090
DOE Office of Scientific and Technical Information (OSTI.GOV)
Long, C.M.; Rohrmann, G.F.; Merrill, G.F., E-mail: merrillg@onid.orst.ed
2009-06-05
Open reading frame 92 of the Autographa californica baculovirus (Ac92) is one of about 30 core genes present in all sequenced baculovirus genomes. Computer analyses predicted that the Ac92 encoded protein (called p33) and several of its baculovirus orthologs were related to a family of flavin adenine dinucleotide (FAD)-linked sulfhydryl oxidases. Alignment of these proteins indicated that, although they were highly diverse, a number of amino acids in common with the Erv1p/Alrp family of sulfhydryl oxidases are present. Some of these conserved amino acids are predicted to stack against the isoalloxazine and adenine components of FAD, whereas others are involvedmore » in electron transfer. To investigate this relationship, Ac92 was expressed in bacteria as a His-tagged fusion protein, purified, and characterized both spectrophotometrically and for its enzymatic activity. The purified protein was found to have the color (yellow) and absorption spectrum consistent with it being a FAD-containing protein. Furthermore, it was demonstrated to have sulfhydryl oxidase activity using dithiothreitol and thioredoxin as substrates.« less
Long, C M; Rohrmann, G F; Merrill, G F
2009-06-05
Open reading frame 92 of the Autographa californica baculovirus (Ac92) is one of about 30 core genes present in all sequenced baculovirus genomes. Computer analyses predicted that the Ac92 encoded protein (called p33) and several of its baculovirus orthologs were related to a family of flavin adenine dinucleotide (FAD)-linked sulfhydryl oxidases. Alignment of these proteins indicated that, although they were highly diverse, a number of amino acids in common with the Erv1p/Alrp family of sulfhydryl oxidases are present. Some of these conserved amino acids are predicted to stack against the isoalloxazine and adenine components of FAD, whereas others are involved in electron transfer. To investigate this relationship, Ac92 was expressed in bacteria as a His-tagged fusion protein, purified, and characterized both spectrophotometrically and for its enzymatic activity. The purified protein was found to have the color (yellow) and absorption spectrum consistent with it being a FAD-containing protein. Furthermore, it was demonstrated to have sulfhydryl oxidase activity using dithiothreitol and thioredoxin as substrates.
Hackenberg, Claudia; Kern, Ramona; Hüge, Jan; Stal, Lucas J.; Tsuji, Yoshinori; Kopka, Joachim; Shiraiwa, Yoshihiro; Bauwe, Hermann; Hagemann, Martin
2011-01-01
Glycolate oxidase (GOX) is an essential enzyme involved in photorespiratory metabolism in plants. In cyanobacteria and green algae, the corresponding reaction is catalyzed by glycolate dehydrogenases (GlcD). The genomes of N2-fixing cyanobacteria, such as Nostoc PCC 7120 and green algae, appear to harbor genes for both GlcD and GOX proteins. The GOX-like proteins from Nostoc (No-LOX) and from Chlamydomonas reinhardtii showed high l-lactate oxidase (LOX) and low GOX activities, whereas glycolate was the preferred substrate of the phylogenetically related At-GOX2 from Arabidopsis thaliana. Changing the active site of No-LOX to that of At-GOX2 by site-specific mutagenesis reversed the LOX/GOX activity ratio of No-LOX. Despite its low GOX activity, No-LOX overexpression decreased the accumulation of toxic glycolate in a cyanobacterial photorespiratory mutant and restored its ability to grow in air. A LOX-deficient Nostoc mutant grew normally in nitrate-containing medium but died under N2-fixing conditions. Cultivation under low oxygen rescued this lethal phenotype, indicating that N2 fixation was more sensitive to O2 in the Δlox Nostoc mutant than in the wild type. We propose that LOX primarily serves as an O2-scavenging enzyme to protect nitrogenase in extant N2-fixing cyanobacteria, whereas in plants it has evolved into GOX, responsible for glycolate oxidation during photorespiration. PMID:21828292
Corbin, Cyrielle; Renouard, Sullivan; Lopez, Tatiana; Lamblin, Frédéric; Lainé, Eric; Hano, Christophe
2013-03-15
Pinoresinol lariciresinol reductase 1, encoded by the LuPLR1 gene in flax (Linum usitatissimum L.), is responsible for the biosynthesis of (+)-secoisolariciresinol, a cancer chemopreventive phytoestrogenic lignan accumulated in high amount in the hull of flaxseed. Our recent studies have demonstrated a key role of abscisic acid (ABA) in the regulation of LuPLR1 gene expression and thus of the (+)-secoisolariciresinol synthesis during the flax seedcoat development. It is well accepted that gibberellins (GA) and ABA play antagonistic roles in the regulation of numerous developmental processes; therefore it is of interest to clarify their respective effects on lignan biosynthesis. Herein, using flax cell suspension cultures, we demonstrate that LuPLR1 gene expression and (+)-secoisolariciresinol synthesis are up-regulated by ABA and down-regulated by GA. The LuPLR1 gene promoter analysis and mutation experiments allow us to identify and characterize two important cis-acting sequences (ABRE and MYB2) required for these regulations. These results imply that a cross-talk between ABA and GA signaling orchestrated by transcription factors is involved in the regulation of lignan biosynthesis. This is particularly evidenced in the case of the ABRE cis-regulatory sequence of LuPLR1 gene promoter that appears to be a common target sequence of GA and ABA signals. Copyright © 2012 Elsevier GmbH. All rights reserved.
Crystal Structure of Alcohol Oxidase from Pichia pastoris
Valerius, Oliver; Feussner, Ivo; Ficner, Ralf
2016-01-01
FAD-dependent alcohol oxidases (AOX) are key enzymes of methylotrophic organisms that can utilize lower primary alcohols as sole source of carbon and energy. Here we report the crystal structure analysis of the methanol oxidase AOX1 from Pichia pastoris. The crystallographic phase problem was solved by means of Molecular Replacement in combination with initial structure rebuilding using Rosetta model completion and relaxation against an averaged electron density map. The subunit arrangement of the homo-octameric AOX1 differs from that of octameric vanillyl alcohol oxidase and other dimeric or tetrameric alcohol oxidases, due to the insertion of two large protruding loop regions and an additional C-terminal extension in AOX1. In comparison to other alcohol oxidases, the active site cavity of AOX1 is significantly reduced in size, which could explain the observed preference for methanol as substrate. All AOX1 subunits of the structure reported here harbor a modified flavin adenine dinucleotide, which contains an arabityl chain instead of a ribityl chain attached to the isoalloxazine ring. PMID:26905908
Calcium transport in vesicles energized by cytochrome oxidase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rosier, Randy N.
1979-01-01
Experiments on the reconstitution of cytochrome oxidase into phospholipid vesicles were carried out using techniques of selectivity energizing the suspensions with ascorbate and cytochrome c or ascorbate, PMS, and internally trapped cytochrome c. It was found that the K + selective ionophore valinomycin stimulated the rate of respiration of cytochrome oxidase vesicles regardless of the direction of the K + flux across the vesicle membranes. The stimulation occurred in the presence of protonophoric uncouplers and in the complete absence of potassium or in detergent-lysed suspensions. Gramicidin had similar effects and it was determined that the ionophores acted by specific interactionmore » with cytochrome oxidase rather than by the previously assumed collapse of membrane potentials. When hydrophobic proteins and appropriate coupling factors were incorporated into the cytochrome oxidase, vesicles phosphorylation of ADP could be coupled to the oxidation reaction of cytochrome oxidase. Relatively low P:O, representing poor coupling of the system, were problematical and precluded measurements of protonmotive force. However the system was used to study ion translocation.« less
Assessment of gene order computing methods for Alzheimer's disease
2013-01-01
Background Computational genomics of Alzheimer disease (AD), the most common form of senile dementia, is a nascent field in AD research. The field includes AD gene clustering by computing gene order which generates higher quality gene clustering patterns than most other clustering methods. However, there are few available gene order computing methods such as Genetic Algorithm (GA) and Ant Colony Optimization (ACO). Further, their performance in gene order computation using AD microarray data is not known. We thus set forth to evaluate the performances of current gene order computing methods with different distance formulas, and to identify additional features associated with gene order computation. Methods Using different distance formulas- Pearson distance and Euclidean distance, the squared Euclidean distance, and other conditions, gene orders were calculated by ACO and GA (including standard GA and improved GA) methods, respectively. The qualities of the gene orders were compared, and new features from the calculated gene orders were identified. Results Compared to the GA methods tested in this study, ACO fits the AD microarray data the best when calculating gene order. In addition, the following features were revealed: different distance formulas generated a different quality of gene order, and the commonly used Pearson distance was not the best distance formula when used with both GA and ACO methods for AD microarray data. Conclusion Compared with Pearson distance and Euclidean distance, the squared Euclidean distance generated the best quality gene order computed by GA and ACO methods. PMID:23369541
GaAs Monolithic Microwave Subsystem Technology Base
1980-01-01
To provide a captive source of reliable, high-quality GaAs substrates, a new crystal growth and substrate preparation facility which utilizes a high...Symp. GaAs and Related Compounds, Inst. Phys. Conf. Ser. 24, 6. 20. Wood, Woodcock and Harris (1978) GaAs and Related Compounds, Inst. Phys. Conf
Du, W; Cheng, J; Cheng, Y; Wang, L; He, Y; Wang, Z; Zhang, H
2015-11-01
After-ripening is a common method used for dormancy release in rice. In this study, the rice variety Jiucaiqing (Oryza sativa L. subsp. japonica) was used to determine dormancy release following different after-ripening times (1, 2 and 3 months). Germination speed, germination percentage and seedling emergence increased with after-ripening; more than 95% germination and 85% seedling emergence were observed following 1 month of after-ripening within 10 days of imbibition, compared with <45% germination and 20% seedling emergence in freshly harvested seed. Hence, 3 months of after-ripening could be considered a suitable treatment period for rice dormancy release. Dormancy release by after-ripening is mainly correlated with a rapid decline in ABA content and increase in IAA content during imbibition. Subsequently, GA(1)/ABA, GA(7)/ABA, GA(12)/ABA, GA(20)/ABA and IAA/ABA ratios significantly increased, while GA(3)/ABA, GA(4)/ABA and GAs/IAA ratio significantly decreased in imbibed seeds following 3 months of after-ripening, thereby altering α-amylase activity during seed germination. Peak α-amylase activity occurred at an earlier germination stage in after-ripened seeds than in freshly harvested seeds. Expression of ABA, GA and IAA metabolism genes and dormancy-related genes was regulated by after-ripening time upon imbibition. Expression of OsCYP707A5, OsGA2ox1, OsGA2ox2, OsGA2ox3, OsILR1, OsGH3-2, qLTG3-1 and OsVP1 increased, while expression of Sdr4 decreased in imbibed seeds following 3 months of after-ripening. Dormancy release through after-ripening might be involved in weakening tissues covering the embryo via qLTG3-1 and decreased ABA signalling and sensitivity via Sdr4 and OsVP1. © 2015 German Botanical Society and The Royal Botanical Society of the Netherlands.
ArxA, a new clade of arsenite oxidase within the DMSO reductase family of molybdenum oxidoreductases
Zargar, Kamrun; Conrad, Alison; Bernick, David L.; Lowe, Todd M.; Stolc, Viktor; Hoeft, Shelley; Oremland, Ronald S.; Stolz, John; Saltikov, Chad W.
2012-01-01
Arsenotrophy, growth coupled to autotrophic arsenite oxidation or arsenate respiratory reduction, occurs only in the prokaryotic domain of life. The enzymes responsible for arsenotrophy belong to distinct clades within the DMSO reductase family of molybdenum-containing oxidoreductases: specifically arsenate respiratory reductase, ArrA, and arsenite oxidase, AioA (formerly referred to as AroA and AoxB). A new arsenite oxidase clade, ArxA, represented by the haloalkaliphilic bacterium Alkalilimnicola ehrlichii strain MLHE-1 was also identified in the photosynthetic purple sulfur bacterium Ectothiorhodospira sp. strain PHS-1. A draft genome sequence of PHS-1 was completed and an arx operon similar to MLHE-1 was identified. Gene expression studies showed that arxA was strongly induced with arsenite. Microbial ecology investigation led to the identification of additional arxA-like sequences in Mono Lake and Hot Creek sediments, both arsenic-rich environments in California. Phylogenetic analyses placed these sequences as distinct members of the ArxA clade of arsenite oxidases. ArxA-like sequences were also identified in metagenome sequences of several alkaline microbial mat environments of Yellowstone National Park hot springs. These results suggest that ArxA-type arsenite oxidases appear to be widely distributed in the environment presenting an opportunity for further investigations of the contribution of Arx-dependent arsenotrophy to the arsenic biogeochemical cycle.
Key role of alternative oxidase in lovastatin solid-state fermentation.
Pérez-Sánchez, Ailed; Uribe-Carvajal, Salvador; Cabrera-Orefice, Alfredo; Barrios-González, Javier
2017-10-01
Lovastatin is a commercially important secondary metabolite produced by Aspergillus terreus, either by solid-state fermentation or by submerged fermentation. In a previous work, we showed that reactive oxygen species (ROS) accumulation in idiophase positively regulates lovastatin biosynthetic genes. In addition, it has been found that lovastatin-specific production decreases with aeration in solid-state fermentation (SSF). To study this phenomenon, we determined ROS accumulation during lovastatin SSF, under high and low aeration conditions. Paradoxically, high aeration caused lower ROS accumulation, and this was the underlying reason of the aeration effect on lovastatin production. Looking for a mechanism that is lowering ROS production under those conditions, we studied alternative respiration. The alternative oxidase provides an alternative route for electrons passing through the electron transport chain to reduce oxygen. Here, we showed that an alternative oxidase (AOX) is expressed in SSF, and only during idiophase. It was shown that higher aeration induces higher alternative respiration (AOX activity), and this is a mechanism that limits ROS generation and keeps them within healthy limits and adequate signaling limits for lovastatin production. Indeed, the aox gene was induced in idiophase, i.e., at the time of ROS accumulation. Moreover, exogenous ROS (H 2 O 2 ), added to lovastatin solid-state fermentation, induced higher AOX activity. This suggests that high O 2 availability in SSF generates dangerously high ROS, so alternative respiration is induced in SSF, indirectly favoring lovastatin production. Conversely, alternative respiration was not detected in lovastatin-submerged fermentation (SmF), although exogenous ROS also induced relatively low AOX activity in SmF.
Jamil, Kaiser; Jayaraman, Archana; Ahmad, Javeed; Joshi, Sindhu; Yerra, Shiva Kumar
2017-09-01
Several reports document the role of tumor necrosis factor alpha ( TNF-α ) and lipid metabolism in the context of acute inflammation as a causative factor in obesity-associated insulin resistance and as one of the causative parameter of type 2 diabetes mellitus (T2DM). Our aim was to investigate the association between -308G/A and -238G/A polymorphisms located in the promoter region of the TNF-α gene in T2DM in the Indian population with bioinformatics analysis of TNF-α protein networking with an aim to find new target sites for the treatment of T2DM. Demographics of 100 diabetes patients and 100 healthy volunteers were collected in a structured proforma and 3 ml blood samples were obtained from the study group, after approval of Institutional Ethics Committee of the hospital (IEC). The information on clinical parameters was obtained from medical records. Genomic DNA was extracted; PCR-RFLP was performed using TNF-α primers specific to detect the presence of SNPs. Various bioinformatics tools such as STRING software were used to determine its network with other associated genes. The PCR-RFLP studies showed that among the -238G/A types the GG genotype was 87%, GA genotype was 12% and AA genotype was 1%. Almost a similar pattern of results was obtained with TNF-α -308G/A polymorphism. The results obtained were evaluated statistically to determine the significance. By constructing TNF-α protein interaction network we could analyze ontology and hubness of the network to identify the networking of this gene which may influence the functioning of other genes in promoting T2DM. We could identify new targets in T2DM which may function in association with TNF-α . Through hub analysis of TNF-α protein network we have identified three novel proteins RIPK1, BIRC2 and BIRC3 which may contribute to TNF- mediated T2DM pathogenesis. In conclusion, our study indicated that some of the genotypes of TNF-α -308G/A, -238G/A were not significantly associated to type 2 diabetes
Differences in activity of cytochrome C oxidase in brain between sleep and wakefulness.
Nikonova, Elena V; Vijayasarathy, Camasamudram; Zhang, Lin; Cater, Jacqueline R; Galante, Raymond J; Ward, Stephen E; Avadhani, Narayan G; Pack, Allan I
2005-01-01
oxidase subunit 1 mRNA; COX, cytochrome c oxidase (protein); CREB, cyclic AMP response element binding protein; DNA, deoxyribonucleic acid; EDTA, ethylenediaminetetraacetic acid; EEG, electroencephalography; EMG, electromyography; GABP, GA binding protein; HEPES, 4-(2-hydroxyethyl)piperazine-1-ethanesulfonic acid; mRNA, messenger ribonucleic acid; NADH, nicotinamid adenine dinucleotide, reduced; NDII, NADH dehydrogenase subunit 2 mRNA; NRF, nuclear respiratory factor.
Kobayashi, Jyumpei; Sasaki, Daisuke; Hara, Kiyotaka Y; Hasunuma, Tomohisa; Kondo, Akihiko
2017-03-15
Oxidized glutathione (GSSG) is the preferred form for industrial mass production of glutathione due to its high stability compared with reduced glutathione (GSH). In our previous study, over-expression of the mitochondrial thiol oxidase ERV1 gene was the most effective for high GSSG production in Saccharomyces cerevisiae cells among three types of different thiol oxidase genes. We improved Erv1 enzyme activity for oxidation of GSH and revealed that S32 and N34 residues are critical for the oxidation. Five engineered Erv1 variant proteins containing S32 and/or N34 replacements exhibited 1.7- to 2.4-fold higher in vitro GSH oxidation activity than that of parental Erv1, whereas the oxidation activities of these variants for γ-glutamylcysteine were comparable. According to three-dimensional structures of Erv1 and protein stability assays, S32 and N34 residues interact with nearby residues through hydrogen bonding and greatly contribute to protein stability. These results suggest that increased flexibility by amino acid replacements around the active center decrease inhibitory effects on GSH oxidation. Over-expressions of mutant genes coding these Erv1 variants also increased GSSG and consequently total glutathione production in S. cerevisiae cells. Over-expression of the ERV1 S32A gene was the most effective for GSSG production in S. cerevisiae cells among the parent and other mutant genes, and it increased GSSG production about 1.5-fold compared to that of the parental ERV1 gene. This is the first study demonstrating the pivotal effects of S32 and N34 residues to high GSH oxidation activity of Erv1. Furthermore, in vivo validity of Erv1 variants containing these S32 and N34 replacements were also demonstrated. This study indicates potentials of Erv1 for high GSSG production.
Pacific oyster polyamine oxidase: a protein missing link in invertebrate evolution.
Cervelli, Manuela; Polticelli, Fabio; Angelucci, Emanuela; Di Muzio, Elena; Stano, Pasquale; Mariottini, Paolo
2015-05-01
Polyamine oxidases catalyse the oxidation of polyamines and acetylpolyamines and are responsible for the polyamine interconversion metabolism in animal cells. Polyamine oxidases from yeast can oxidize spermine, N(1)-acetylspermine, and N(1)-acetylspermidine, while in vertebrates two different enzymes, namely spermine oxidase and acetylpolyamine oxidase, specifically catalyse the oxidation of spermine, and N(1)-acetylspermine/N(1)-acetylspermidine, respectively. In this work we proved that the specialized vertebrate spermine and acetylpolyamine oxidases have arisen from an ancestor invertebrate polyamine oxidase with lower specificity for polyamine substrates, as demonstrated by the enzymatic activity of the mollusc polyamine oxidase characterized here. This is the first report of an invertebrate polyamine oxidase, the Pacific oyster Crassostrea gigas (CgiPAO), overexpressed as a recombinant protein. This enzyme was biochemically characterized and demonstrated to be able to oxidase both N(1)-acetylspermine and spermine, albeit with different efficiency. Circular dichroism analysis gave an estimation of the secondary structure content and modelling of the three-dimensional structure of this protein and docking studies highlighted active site features. The availability of this pluripotent enzyme can have applications in crystallographic studies and pharmaceutical biotechnologies, including anticancer therapy as a source of hydrogen peroxide able to induce cancer cell death.
Qi, Zhigang; Smith, Kristina M; Bredeweg, Erin L; Bosnjak, Natasa; Freitag, Michael; Nargang, Frank E
2017-02-09
In Neurospora crassa , blocking the function of the standard mitochondrial electron transport chain results in the induction of an alternative oxidase (AOX). AOX transfers electrons directly from ubiquinol to molecular oxygen. AOX serves as a model of retrograde regulation since it is encoded by a nuclear gene that is regulated in response to signals from mitochondria. The N. crassa transcription factors AOD2 and AOD5 are necessary for the expression of the AOX gene. To gain insight into the mechanism by which these factors function, and to determine if they have roles in the expression of additional genes in N. crassa , we constructed strains expressing only tagged versions of the proteins. Cell fractionation experiments showed that both proteins are localized to the nucleus under both AOX inducing and noninducing conditions. Furthermore, chromatin immunoprecipitation and high throughput sequencing (ChIP-seq) analysis revealed that the proteins are bound to the promoter region of the AOX gene under both conditions. ChIP-seq also showed that the transcription factors bind to the upstream regions of a number of genes that are involved in energy production and metabolism. Dependence on AOD2 and AOD5 for the expression of several of these genes was verified by quantitative PCR. The majority of ChIP-seq peaks observed were enriched for both AOD2 and AOD5. However, we also observed occasional sites where one factor appeared to bind preferentially. The most striking of these was a conserved sequence that bound large amounts of AOD2 but little AOD5. This sequence was found within a 310 bp repeat unit that occurs at several locations in the genome. Copyright © 2017 Qi et al.
El Sayed, S M; Abou El-Magd, R M; Shishido, Y; Chung, S P; Sakai, T; Watanabe, H; Kagami, S; Fukui, K
2012-01-01
Glioma tumors are refractory to conventional treatment. Glioblastoma multiforme is the most aggressive type of primary brain tumors in humans. In this study, we introduce oxidative stress-energy depletion (OSED) therapy as a new suggested treatment for glioblastoma. OSED utilizes D-amino acid oxidase (DAO), which is a promising therapeutic protein that induces oxidative stress and apoptosis through generating hydrogen peroxide (H2O2). OSED combines DAO with 3-bromopyruvate (3BP), a hexokinase II (HK II) inhibitor that interferes with Warburg effect, a metabolic alteration of most tumor cells that is characterized by enhanced aerobic glycolysis. Our data revealed that 3BP induced depletion of energetic capabilities of glioma cells. 3BP induced H2O2 production as a novel mechanism of its action. C6 glioma transfected with DAO and treated with D-serine together with 3BP-sensitized glioma cells to 3BP and decreased markedly proliferation, clonogenic power and viability in a three-dimensional tumor model with lesser effect on normal astrocytes. DAO gene therapy using atelocollagen as an in vivo transfection agent proved effective in a glioma tumor model in Sprague-Dawley (SD) rats, especially after combination with 3BP. OSED treatment was safe and tolerable in SD rats. OSED therapy may be a promising therapeutic modality for glioma.
Wei, Xiao-Qiong; Kong, Qing-Peng; Zhang, Yao; Yang, Yan-Ling; Chang, Xing-Zhi; Qi, Yu; Qi, Zhao-Yue; Xiao, Jiang-Xi; Qin, Jiong; Wu, Xi-Ru
2009-05-01
Leigh syndrome is a genetically heterogeneous disease caused by defects in enzymes involved in aerobic energy metabolism and the Krebs', cycle. Mitonchondrial complex I deficiency is a main cause of Leigh syndrome. In this study, a Chinese child with Leigh syndrome caused by 13513G>A mutation was reported. The proband was the first child of his parents. The previously healthy boy presented with generalized epilepsy at 12 years of age. When he visited Peking University First Hospital at 13 years of age, he had subacute loss of vision in two eyes and temporal defect of visual field in the left eye. He walked with a spastic gait. His blood lactate and pyruvate levels were elevated. Muscle biopsy showed mild lipid accumulation in muscle fiber. An electrocardiogram showed incomplete right bundle branch block. Brain magnetic resonance imaging showed bilateral, symmetrical lesions in the basal ganglia, supporting the diagnosis of Leigh syndrome. 13513G>A mutation was identified by gene analysis in the patient, which led to mitochondrial respiratory chain complex I deficiency. Multivitamins and L-carnitine were administered. At present, the patient is 16 years old and has progressive deterioration with significant muscle weakness and body weight loss. He is absent from school. He has no obvious retardation in intelligence. 13513G>A mutation was first identified by gene analysis in Chinese population with Leigh syndrome. This may be helpful in genetic counseling.
Dilley, David R.; Wang, Zhenyong; Kadirjan-Kalbach, Deena K.; Ververidis, Fillipos; Beaudry, Randolph; Padmanabhan, Kallaithe
2013-01-01
1-Aminocyclopropane-1-carboxylic acid (ACC) oxidase (ACCO) catalyses the final step in ethylene biosynthesis converting ACC to ethylene, cyanide, CO2, dehydroascorbate and water with inputs of Fe(II), ascorbate, bicarbonate (as activators) and oxygen. Cyanide activates ACCO. A ‘nest’ comprising several positively charged amino acid residues from the C-terminal α-helix 11 along with Lys158 and Arg299 are proposed as binding sites for ascorbate and bicarbonate to coordinately activate the ACCO reaction. The binding sites for ACC, bicarbonate and ascorbic acid for Malus domestica ACCO1 include Arg175, Arg244, Ser246, Lys158, Lys292, Arg299 and Phe300. Glutamate 297, Phe300 and Glu301 in α-helix 11 are also important for the ACCO reaction. Our proposed reaction pathway incorporates cyanide as an ACCO/Fe(II) ligand after reaction turnover. The cyanide ligand is likely displaced upon binding of ACC and ascorbate to provide a binding site for oxygen. We propose that ACCO may be involved in the ethylene signal transduction pathway not directly linked to the ACCO reaction. ACC oxidase has significant homology with Lycopersicon esculentum cysteine protease LeCp, which functions as a protease and as a regulator of 1-aminocyclopropane-1-carboxylic acid synthase (Acs2) gene expression. ACC oxidase may play a similar role in signal transduction after post-translational processing. ACC oxidase becomes inactivated by fragmentation and apparently has intrinsic protease and transpeptidase activity. ACC oxidase contains several amino acid sequence motifs for putative protein–protein interactions, phosphokinases and cysteine protease. ACC oxidase is subject to autophosphorylaton in vitro and promotes phosphorylation of some apple fruit proteins in a ripening-dependent manner. PMID:24244837
Zhan, Tao; Zhang, Kai; Chen, Yangyan; Lin, Yongjun; Wu, Gaobing; Zhang, Lili; Yao, Pei; Shao, Zongze; Liu, Ziduo
2013-01-01
Glyphosate, a broad spectrum herbicide widely used in agriculture all over the world, inhibits 5-enolpyruvylshikimate-3-phosphate synthase in the shikimate pathway, and glycine oxidase (GO) has been reported to be able to catalyze the oxidative deamination of various amines and cleave the C-N bond in glyphosate. Here, in an effort to improve the catalytic activity of the glycine oxidase that was cloned from a glyphosate-degrading marine strain of Bacillus cereus (BceGO), we used a bacteriophage T7 lysis-based method for high-throughput screening of oxidase activity and engineered the gene encoding BceGO by directed evolution. Six mutants exhibiting enhanced activity toward glyphosate were screened from two rounds of error-prone PCR combined with site directed mutagenesis, and the beneficial mutations of the six evolved variants were recombined by DNA shuffling. Four recombinants were generated and, when compared with the wild-type BceGO, the most active mutant B3S1 showed the highest activity, exhibiting a 160-fold increase in substrate affinity, a 326-fold enhancement in catalytic efficiency against glyphosate, with little difference between their pH and temperature stabilities. The role of these mutations was explored through structure modeling and molecular docking, revealing that the Arg51 mutation is near the active site and could be an important residue contributing to the stabilization of glyphosate binding, while the role of the remaining mutations is unclear. These results provide insight into the application of directed evolution in optimizing glycine oxidase function and have laid a foundation for the development of glyphosate-tolerant crops. PMID:24223901
Immobilization Techniques to Avoid Enzyme Loss from Oxidase-Based Biosensors: A One-Year Study
House, Jody L.; Anderson, Ellen M.; Ward, W. Kenneth
2007-01-01
Background Continuous amperometric sensors that measure glucose or lactate require a stable sensitivity, and glutaraldehyde crosslinking has been used widely to avoid enzyme loss. Nonetheless, little data is published on the effectiveness of enzyme immobilization with glutaraldehyde. Methods A combination of electrochemical testing and spectrophotometric assays was used to study the relationship between enzyme shedding and the fabrication procedure. In addition, we studied the relationship between the glutaraldehyde concentration and sensor performance over a period of one year. Results The enzyme immobilization process by glutaraldehyde crosslinking to glucose oxidase appears to require at least 24-hours at room temperature to reach completion. In addition, excess free glucose oxidase can be removed by soaking sensors in purified water for 20 minutes. Even with the addition of these steps, however, it appears that there is some free glucose oxidase entrapped within the enzyme layer which contributes to a decline in sensitivity over time. Although it reduces the ultimate sensitivity (probably via a change in the enzyme's natural conformation), glutaraldehyde concentration in the enzyme layer can be increased in order to minimize this instability. Conclusions After exposure of oxidase enzymes to glutaraldehyde, effective crosslinking requires a rinse step and a 24-hour incubation step. In order to minimize the loss of sensor sensitivity over time, the glutaraldehyde concentration can be increased. PMID:19888375
Inhibition of Human Vascular NADPH Oxidase by Apocynin Derived Oligophenols
Mora-Pale, Mauricio; Weïwer, Michel; Yu, Jingjing; Linhardt, Robert J.; Dordick, Jonathan S.
2009-01-01
Enzymatic oxidation of apocynin, which may mimic in vivo metabolism, affords a large number of oligomers (apocynin oxidation products, AOP) that inhibit vascular NADPH oxidase. In vitro studies of NADPH oxidase activity were performed to identify active inhibitors, resulting in a trimer hydroxylated quinone (IIIHyQ) that inhibited NADPH oxidase with an IC50 = 31 nM. Apocynin itself possessed minimal inhibitory activity. NADPH oxidase is believed to be inhibited through prevention of the interaction between two NADPH oxidase subunits, p47phox and p22phox. To that end, while apocynin was unable to block the interaction of his-tagged p47phox with a surface immobilized biotinalyted p22phox peptide, the IIIHyQ product strongly interfered with this interaction (apparent IC50 = 1.6 μM). These results provide evidence that peroxidase-catalyzed AOP, which consist of oligomeric phenols and quinones, inhibit critical interactions that are involved in the assembly and activation of human vascular NADPH oxidase. PMID:19523836
Current status of NADPH oxidase research in cardiovascular pharmacology.
Rodiño-Janeiro, Bruno K; Paradela-Dobarro, Beatriz; Castiñeiras-Landeira, María Isabel; Raposeiras-Roubín, Sergio; González-Juanatey, José R; Alvarez, Ezequiel
2013-01-01
The implications of reactive oxygen species in cardiovascular disease have been known for some decades. Rationally, therapeutic antioxidant strategies combating oxidative stress have been developed, but the results of clinical trials have not been as good as expected. Therefore, to move forward in the design of new therapeutic strategies for cardiovascular disease based on prevention of production of reactive oxygen species, steps must be taken on two fronts, ie, comprehension of reduction-oxidation signaling pathways and the pathophysiologic roles of reactive oxygen species, and development of new, less toxic, and more selective nicotinamide adenine dinucleotide phosphate (NADPH) oxidase inhibitors, to clarify both the role of each NADPH oxidase isoform and their utility in clinical practice. In this review, we analyze the value of NADPH oxidase as a therapeutic target for cardiovascular disease and the old and new pharmacologic agents or strategies to prevent NADPH oxidase activity. Some inhibitors and different direct or indirect approaches are available. Regarding direct NADPH oxidase inhibition, the specificity of NADPH oxidase is the focus of current investigations, whereas the chemical structure-activity relationship studies of known inhibitors have provided pharmacophore models with which to search for new molecules. From a general point of view, small-molecule inhibitors are preferred because of their hydrosolubility and oral bioavailability. However, other possibilities are not closed, with peptide inhibitors or monoclonal antibodies against NADPH oxidase isoforms continuing to be under investigation as well as the ongoing search for naturally occurring compounds. Likewise, some different approaches include inhibition of assembly of the NADPH oxidase complex, subcellular translocation, post-transductional modifications, calcium entry/release, electron transfer, and genetic expression. High-throughput screens for any of these activities could provide new
Current status of NADPH oxidase research in cardiovascular pharmacology
Rodiño-Janeiro, Bruno K; Paradela-Dobarro, Beatriz; Castiñeiras-Landeira, María Isabel; Raposeiras-Roubín, Sergio; González-Juanatey, José R; Álvarez, Ezequiel
2013-01-01
The implications of reactive oxygen species in cardiovascular disease have been known for some decades. Rationally, therapeutic antioxidant strategies combating oxidative stress have been developed, but the results of clinical trials have not been as good as expected. Therefore, to move forward in the design of new therapeutic strategies for cardiovascular disease based on prevention of production of reactive oxygen species, steps must be taken on two fronts, ie, comprehension of reduction-oxidation signaling pathways and the pathophysiologic roles of reactive oxygen species, and development of new, less toxic, and more selective nicotinamide adenine dinucleotide phosphate (NADPH) oxidase inhibitors, to clarify both the role of each NADPH oxidase isoform and their utility in clinical practice. In this review, we analyze the value of NADPH oxidase as a therapeutic target for cardiovascular disease and the old and new pharmacologic agents or strategies to prevent NADPH oxidase activity. Some inhibitors and different direct or indirect approaches are available. Regarding direct NADPH oxidase inhibition, the specificity of NADPH oxidase is the focus of current investigations, whereas the chemical structure-activity relationship studies of known inhibitors have provided pharmacophore models with which to search for new molecules. From a general point of view, small-molecule inhibitors are preferred because of their hydrosolubility and oral bioavailability. However, other possibilities are not closed, with peptide inhibitors or monoclonal antibodies against NADPH oxidase isoforms continuing to be under investigation as well as the ongoing search for naturally occurring compounds. Likewise, some different approaches include inhibition of assembly of the NADPH oxidase complex, subcellular translocation, post-transductional modifications, calcium entry/release, electron transfer, and genetic expression. High-throughput screens for any of these activities could provide new
Nonchev, S; Maconochie, M; Vesque, C; Aparicio, S; Ariza-McNaughton, L; Manzanares, M; Maruthainar, K; Kuroiwa, A; Brenner, S; Charnay, P; Krumlauf, R
1996-09-03
Transient segmentation in the hindbrain is a fundamental morphogenetic phenomenon in the vertebrate embryo, and the restricted expression of subsets of Hox genes in the developing rhombomeric units and their derivatives is linked with regional specification. Here we show that patterning of the vertebrate hindbrain involves the direct upregulation of the chicken and pufferfish group 2 paralogous genes, Hoxb-2 and Hoxa-2, in rhombomeres 3 and 5 (r3 and r5) by the zinc finger gene Krox-20. We identified evolutionarily conserved r3/r5 enhancers that contain high affinity Krox-20. binding sites capable of mediating transactivation by Krox-20. In addition to conservation of binding sites critical for Krox-20 activity in the chicken Hoxa-2 and pufferfish Hoxb-2 genes, the r3/r5 enhancers are also characterized by the presence of a number of identical motifs likely to be involved in cooperative interactions with Krox-20 during the process of hindbrain patterning in vertebrates.
Zhang, De-Huai; Li, Na; Yu, Xuya; Zhao, Peng; Li, Tao; Xu, Jun-Wei
2017-02-01
Ganoderic acids (GAs) in Ganoderma lingzhi exhibit anticancer and antimetastatic activities. GA yields can be potentially improved by manipulating G. lingzhi through genetic engineering. In this study, a putative lanosterol synthase (LS) gene was cloned and overexpressed in G. lingzhi. Results showed that its overexpression (OE) increased the ganoderic acid (GA) content and the accumulation of lanosterol and ergosterol in a submerged G. lingzhi culture. The maximum contents of GA-O, GA-Mk, GA-T, GA-S, GA-Mf, and GA-Me in transgenic strains were 46.6 ± 4.8, 24.3 ± 3.5, 69.8 ± 8.2, 28.9 ± 1.4, 15.4 ± 1.2, and 26.7 ± 3.1 μg/100 mg dry weight, respectively, these values being 6.1-, 2.2-, 3.2-, 4.8-, 2.0-, and 1.9-times higher than those in wild-type strains. In addition, accumulated amounts of lanosterol and ergosterol in transgenic strains were 2.3 and 1.4-fold higher than those in the control strains, respectively. The transcription level of LS was also increased by more than five times in the presence of the G. lingzhi glyceraldehyde-3-phosphate dehydrogenase gene promoter, whereas transcription levels of 3-hydroxy-3-methylglutaryl coenzyme A enzyme and squalene synthase did not change significantly in transgenic strains. This study demonstrated that OE of the homologous LS gene can enhance lanosterol accumulation. A large precursor supply promotes GA biosynthesis. Copyright © 2016 Elsevier Ltd. All rights reserved.
Ahmad, Niaz; Michoux, Franck; Nixon, Peter J.
2012-01-01
Chloroplast transformation provides an inexpensive, easily scalable production platform for expression of recombinant proteins in plants. However, this technology has been largely limited to the production of soluble proteins. Here we have tested the ability of tobacco chloroplasts to express a membrane protein, namely plastid terminal oxidase 1 from the green alga Chlamydomonas reinhardtii (Cr-PTOX1), which is predicted to function as a plastoquinol oxidase. A homoplastomic plant containing a codon-optimised version of the nuclear gene encoding PTOX1, driven by the 16S rRNA promoter and 5′UTR of gene 10 from phage T7, was generated using a particle delivery system. Accumulation of Cr-PTOX1 was shown by immunoblotting and expression in an enzymatically active form was confirmed by using chlorophyll fluorescence to measure changes in the redox state of the plastoquinone pool in leaves. Growth of Cr-PTOX1 expressing plants was, however, more sensitive to high light than WT. Overall our results confirm the feasibility of using plastid transformation as a means of expressing foreign membrane proteins in the chloroplast. PMID:22848578
DOE Office of Scientific and Technical Information (OSTI.GOV)
Busov, Victor
Semidwarfism has been used extensively in row crops and horticulture to promote yield, reduce lodging, and improve harvest index, and it might have similar benefits for trees for short-rotation forestry or energy plantations, reclamation, phytoremediation, or other applications. We studied the effects of the dominant semidwarfism transgenes GA Insensitive (GAI) and Repressor of GAI-Like, which affect gibberellin (GA) action, and the GA catabolic gene, GA 2-oxidase, in nursery beds and in 2-year-old high-density stands of hybrid poplar (Populus tremula - Populus alba). Twenty-nine traits were analyzed, including measures of growth, morphology, and physiology. Endogenous GA levels were modified in mostmore » transgenic events; GA(20) and GA(8), in particular, had strong inverse associations with tree height. Nearly all measured traits varied significantly among genotypes, and several traits interacted with planting density, including aboveground biomass, root-shoot ratio, root fraction, branch angle, and crown depth. Semidwarfism promoted biomass allocation to roots over shoots and substantially increased rooting efficiency with most genes tested. The increased root proportion and increased leaf chlorophyll levels were associated with changes in leaf carbon isotope discrimination, indicating altered water use efficiency. Semidwarf trees had dramatically reduced growth when in direct competition with wild-type trees, supporting the hypothesis that semidwarfism genes could be effective tools to mitigate the spread of exotic, hybrid, and transgenic plants in wild and feral populations. We modified gibberellin (GA) metabolism and signaling in transgenic poplars using dominant transgenes and studied their effects for 3 years under field conditions. The transgenes that we employed either reduced the bioactive GAs, or attenuated their signaling. The majority of transgenic trees had significant and in many cases dramatic changes in height, crown architecture, foliage
Whaley-Connell, Adam; Habibi, Javad; Nistala, Ravi; Cooper, Shawna A; Karuparthi, Poorna R; Hayden, Melvin R; Rehmer, Nathan; DeMarco, Vincent G; Andresen, Bradley T; Wei, Yongzhong; Ferrario, Carlos; Sowers, James R
2008-02-01
Activation of reduced nicotinamide-adenine dinucleotide phosphate (NADPH) oxidase by angiotensin II is integral to the formation of oxidative stress in the vasculature and the kidney. 3-Hydroxy-3-methylglutaryl-coenzyme A reductase inhibition is associated with reductions of oxidative stress in the vasculature and kidney and associated decreases in albuminuria. Effects of 3-hydroxy-3-methylglutaryl-coenzyme A reductase inhibition on oxidative stress in the kidney and filtration barrier integrity are poorly understood. To investigate, we used transgenic TG(mRen2)27 (Ren2) rats, which harbor the mouse renin transgene and renin-angiotensin system activation, and an immortalized murine podocyte cell line. We treated young, male Ren2 and Sprague-Dawley rats with rosuvastatin (20 mg/kg IP) or placebo for 21 days. Compared with controls, we observed increases in systolic blood pressure, albuminuria, renal NADPH oxidase activity, and 3-nitrotryosine staining, with reductions in the rosuvastatin-treated Ren2. Structural changes on light and transmission electron microscopy, consistent with periarteriolar fibrosis and podocyte foot-process effacement, were attenuated with statin treatment. Nephrin expression was diminished in the Ren2 kidney and trended to normalize with statin treatment. Angiotensin II-dependent increases in podocyte NADPH oxidase activity and subunit expression (NOX2, NOX4, Rac, and p22(phox)) and reactive oxygen species generation were decreased after in vitro statin treatment. These data support a role for increased NADPH oxidase activity and subunit expression with resultant reactive oxygen species formation in the kidney and podocyte. Furthermore, statin attenuation of NADPH oxidase activation and reactive oxygen species formation in the kidney/podocyte seems to play roles in the abrogation of oxidative stress-induced filtration barrier injury and consequent albuminuria.
Oxygen activation in flavoprotein oxidases: the importance of being positive.
Gadda, Giovanni
2012-04-03
The oxidation of flavin hydroquinones by O(2) in solution is slow, with second-order rate constants of ~250 M(-1) s(-1). This is due to the obligatory, single-electron transfer that initiates the reaction being thermodynamically unfavored and poorly catalyzed. Notwithstanding considerations of O(2) accessibility to the reaction site, its desolvation and geometry and other factors that can also contribute to further rate acceleration, flavoprotein oxidases must activate O(2) for reaction with flavin hydroquinones to be able to achieve the 100-1000-fold rate enhancements typically observed. Protein positive charges have been identified in glucose oxidase, monomeric sarcosine oxidase, N-methyltryptophan oxidase and fructosamine oxidase that electrostatically stabilize the transition state for the initial single electron transfer that generates the O(2)(-•)/flavin semiquinone radical pair. In choline oxidase despite the presence of three histidines in the active site, the trimethylammonium group of the reaction product provides such an electrostatic stabilization. A nonpolar site proximal to the flavin C(4a) atom in choline oxidase has also been identified, which contributes to the geometry and desolvation of the O(2) reaction site. The relevance of O(2) activation by product charges to other flavoprotein oxidases, such as for example those catalyzing amine oxidations, is discussed in this review. A nonpolar site close to the flavin C(4a) atom and a positive charge is identified through structural analysis in several flavoprotein oxidases. Mutagenesis has disclosed nonpolar sites in O(2)-reducing enzymes that utilize copper/TPQ or iron. It is predicted that classes of O(2)-reducing enzymes utilizing other cofactors also contain a similar catalytic motif.
The First Mammalian Aldehyde Oxidase Crystal Structure
Coelho, Catarina; Mahro, Martin; Trincão, José; Carvalho, Alexandra T. P.; Ramos, Maria João; Terao, Mineko; Garattini, Enrico; Leimkühler, Silke; Romão, Maria João
2012-01-01
Aldehyde oxidases (AOXs) are homodimeric proteins belonging to the xanthine oxidase family of molybdenum-containing enzymes. Each 150-kDa monomer contains a FAD redox cofactor, two spectroscopically distinct [2Fe-2S] clusters, and a molybdenum cofactor located within the protein active site. AOXs are characterized by broad range substrate specificity, oxidizing different aldehydes and aromatic N-heterocycles. Despite increasing recognition of its role in the metabolism of drugs and xenobiotics, the physiological function of the protein is still largely unknown. We have crystallized and solved the crystal structure of mouse liver aldehyde oxidase 3 to 2.9 Å. This is the first mammalian AOX whose structure has been solved. The structure provides important insights into the protein active center and further evidence on the catalytic differences characterizing AOX and xanthine oxidoreductase. The mouse liver aldehyde oxidase 3 three-dimensional structure combined with kinetic, mutagenesis data, molecular docking, and molecular dynamics studies make a decisive contribution to understand the molecular basis of its rather broad substrate specificity. PMID:23019336
Generating disulfides with the quiescin sulfhydryl oxidases
Heckler, Erin J.; Rancy, Pumtiwitt C.; Kodali, Vamsi K.; Thorpe, Colin
2008-01-01
The Quiescin-sulfhydryl oxidase (QSOX) family of flavoenzymes catalyzes the direct and facile insertion of disulfide bonds into unfolded reduced proteins with concomitant reduction of oxygen to hydrogen peroxide. This review discusses the chemical mechanism of these enzymes and the involvement of thioredoxin and flavin-binding domains in catalysis. The variability of CxxC motifs in the QSOX family is highlighted and attention is drawn to the steric factors that may promote efficient thiol/disulfide exchange during oxidative protein folding. The varied cellular location of these multi-domain sulfhydryl oxidases is reviewed and potential intracellular and extracellular roles are summarized. Finally, this review identifies important unresolved questions concerning this ancient family of sulfhydryl oxidases. PMID:17980160
Purification and characterization of polyphenol oxidase from cauliflower (Brassica oleracea L.).
Rahman, Andi Nur Faidah; Ohta, Mayumi; Nakatani, Kazuya; Hayashi, Nobuyuki; Fujita, Shuji
2012-04-11
Polyphenol oxidase (PPO) of cauliflower was purified to 282-fold with a recovery rate of 8.1%, using phloroglucinol as a substrate. The enzyme appeared as a single band on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The estimated molecular weight of the enzyme was 60 and 54 kDa by SDS-PAGE and gel filtration, respectively. The purified enzyme, called phloroglucinol oxidase (PhO), oxidized phloroglucinol (K(m) = 3.3 mM) and phloroglucinolcarboxylic acid. The enzyme also had peroxidase (POD) activity. At the final step, the activity of purified cauliflower POD was 110-fold with a recovery rate of 3.2%. The PhO and POD showed the highest activity at pH 8.0 and 4.0 and were stable in the pH range of 3.0-11.0 and 5.0-8.0 at 5 °C for 20 h, respectively. The optimum temperature was 55 °C for PhO and 20 °C for POD. The most effective inhibitor for PhO was sodium diethyldithiocarbamate at 10 mM (IC(50) = 0.64 and K(i) = 0.15 mM), and the most effective inhibitor for POD was potassium cyanide at 1.0 mM (IC(50) = 0.03 and K(i) = 29 μM).
Staley, Chris A.; Huang, Amy; Nattestad, Maria; Oshiro, Kristin T.; Ray, Laura E.; Mulye, Tejas; Li, Zhiguo Harry; Le, Thu; Stephens, Justin J.; Gomez, Seth R.; Moy, Allison D.; Nguyen, Jackson C.; Franz, Andreas H.; Lin-Cereghino, Joan; Lin-Cereghino, Geoff P.
2012-01-01
Pichia pastoris is a methylotrophic yeast that has been genetically engineered to express over one thousand heterologous proteins valued for industrial, pharmaceutical and basic research purposes. In most cases, the 5′ untranslated region (UTR) of the alcohol oxidase 1 (AOX1) gene is fused to the coding sequence of the recombinant gene for protein expression in this yeast. Because the effect of the AOX1 5′UTR on protein expression is not known, site-directed mutagenesis was performed in order to decrease or increase the length of this region. Both of these types of changes were shown to affect translational efficiency, not transcript stability. While increasing the length of the 5′UTR clearly decreased expression of a β-galactosidase reporter in a proportional manner, a deletion analysis demonstrated that the AOX1 5′UTR contains a complex mixture of both positive and negative cis-acting elements, suggesting that the construction of a synthetic 5′UTR optimized for a higher level of expression may be challenging. PMID:22285974
Shah, Syed Shoaib; Mohyuddin, Aisha; Colonna, Vincenza; Mehdi, Syed Qasim; Ayub, Qasim
2015-08-01
To investigate the association of monoamine oxidase Agene polymorphisms with aggression. The study was conducted in an ethnic community in Lahore, Pakistan, from August 2008 to December 2009 on the basis of data that was collected through a questionnaire between August 2004 and September 2005. It analysed 10 single nucleotide polymorphisms of monoamine oxidase A in unrelated males from the same ethnic background who were administered a Punjabi translation of the Buss and Perry aggression questionnaire. SPSS 13 was used for statistical analysis. Of the total 133 haplotypes studied, 52(39%) were Haplotype A, 58(43.6%) B, 8(6%) C, 3(2.3%) D, 9(6.8%) E and 3(2.3%) F. The six haplotypes were analysed for association with scores of the four subscales of the aggression questionnaire and multivariate analysis of variance showed no significant differences (p>0.05 each) in the error variances of the total scores and scores for three of the sub-scales across the haplotypes. The variance was significantly different only for the anger sub-scale (p<0.05). The association of an extended haplotype with low levels of self-reported aggression in this study should assist in characterisation of functional variants responsible for non-aggressive behaviour in male subjects.
Rahfeld, Peter; Kirsch, Roy; Kugel, Susann; Wielsch, Natalie; Stock, Magdalena; Groth, Marco; Boland, Wilhelm; Burse, Antje
2014-01-01
Larvae of the leaf beetle subtribe Chrysomelina sensu stricto repel their enemies by displaying glandular secretions that contain defensive compounds. These repellents can be produced either de novo (iridoids) or by using plant-derived precursors (e.g. salicylaldehyde). The autonomous production of iridoids, as in Phaedon cochleariae, is the ancestral chrysomeline chemical defence and predates the evolution of salicylaldehyde-based defence. Both biosynthesis strategies include an oxidative step of an alcohol intermediate. In salicylaldehyde-producing species, this step is catalysed by salicyl alcohol oxidases (SAOs) of the glucose-methanol-choline (GMC) oxidoreductase superfamily, but the enzyme oxidizing the iridoid precursor is unknown. Here, we show by in vitro as well as in vivo experiments that P. cochleariae also uses an oxidase from the GMC superfamily for defensive purposes. However, our phylogenetic analysis of chrysomeline GMC oxidoreductases revealed that the oxidase of the iridoid pathway originated from a GMC clade different from that of the SAOs. Thus, the evolution of a host-independent chemical defence followed by a shift to a host-dependent chemical defence in chrysomeline beetles coincided with the utilization of genes from different GMC subfamilies. These findings illustrate the importance of the GMC multi-gene family for adaptive processes in plant–insect interactions. PMID:24943369
DOE Office of Scientific and Technical Information (OSTI.GOV)
Paquette, B.; DeVita, M.; Turala, A.
AlGaAs/GaAs tunnel junctions for use in high concentration multijunction solar cells were designed and grown by chemical beam epitaxy (CBE) using trimethyl aluminium (TMA) as the p-dopant source for the AlGaAs active layer. Controlled hole concentration up to 4⋅10{sup 20} cm{sup −3} was achieved through variation in growth parameters. Fabricated tunnel junctions have a peak tunneling current up to 6140 A/cm{sup 2}. These are suitable for high concentration use and outperform GaAs/GaAs tunnel junctions.
THE PREPARATION AND PROPERTIES OF HIGHLY PURIFIED ASCORBIC ACID OXIDASE
Powers, Wendell H.; Lewis, Stanley; Dawson, Charles R.
1944-01-01
1. A method is described for the preparation of a highly purified ascorbic acid oxidase containing 0.24 per cent copper. 2. Using comparable activity measurements, this oxidase is about one and a half times as active on a dry weight basis as the hitherto most highly purified preparation described by Lovett-Janison and Nelson. The latter contained 0.15 per cent copper. 3. The oxidase activity is proportional to the copper content and the proportionality factor is the same as that reported by Lovett-Janison and Nelson. 4. When dialyzed free of salt, the blue concentrated oxidase solutions precipitate a dark green-blue protein which carries the activity. This may be prevented by keeping the concentrated solutions about 0.1 M in Na2HPO4. 5. When highly diluted for activity measurements the oxidase rapidly loses activity (irreversibly) previous to the measurement, unless the dilution is made with a dilute inert protein (gelatin) solution. Therefore activity values obtained using such gelatin-stabilized dilute solutions of the oxidase run considerably higher than values obtained by the Lovett-Janison and Nelson technique. 6. The effect of pH and substrate concentration on the activity of the purified oxidase in the presence and absence of inert protein was studied. PMID:19873382
Liu, Pu; Zhang, Chao; Ma, Jin-Qi; Zhang, Li-Yuan; Yang, Bo; Tang, Xin-Yu; Huang, Ling; Zhou, Xin-Tong; Lu, Kun; Li, Jia-Na
2018-03-16
Cytokinin oxidase/dehydrogenases (CKXs) play a critical role in the irreversible degradation of cytokinins, thereby regulating plant growth and development. Brassica napus is one of the most widely cultivated oilseed crops worldwide. With the completion of whole-genome sequencing of B. napus , genome-wide identification and expression analysis of the BnCKX gene family has become technically feasible. In this study, we identified 23 BnCKX genes and analyzed their phylogenetic relationships, gene structures, conserved motifs, protein subcellular localizations, and other properties. We also analyzed the expression of the 23 BnCKX genes in the B. napus cultivar Zhong Shuang 11 ('ZS11') by quantitative reverse-transcription polymerase chain reaction (qRT-PCR), revealing their diverse expression patterns. We selected four BnCKX genes based on the results of RNA-sequencing and qRT-PCR and compared their expression in cultivated varieties with extremely long versus short siliques. The expression levels of BnCKX5-1 , 5-2 , 6-1 , and 7-1 significantly differed between the two lines and changed during pod development, suggesting they might play roles in determining silique length and in pod development. Finally, we investigated the effects of treatment with the synthetic cytokinin 6-benzylaminopurine (6-BA) and the auxin indole-3-acetic acid (IAA) on the expression of the four selected BnCKX genes. Our results suggest that regulating BnCKX expression is a promising way to enhance the harvest index and stress resistance in plants.
Amine oxidases as important agents of pathological processes of rhabdomyolysis in rats.
Gudkova, O O; Latyshko, N V; Shandrenko, S G
2016-01-01
In this study we have tested an idea on the important role of amine oxidases (semicarbazide-sensitive amine oxidase, diamine oxidase, polyamine oxidase) as an additional source of oxidative/carbonyl stress under glycerol-induced rhabdomyolysis, since the enhanced formation of reactive oxygen species and reactive carbonyl species in a variety of tissues is linked to various diseases. In our experiments we used the sensitive fluorescent method devised for estimation of amine oxidases activity in the rat kidney and thymus as targeted organs under rhabdomyolysis. We have found in vivo the multiple rises in activity of semicarbazide-sensitive amine oxidase, diamine oxidase, polyamine oxidase (2-4.5 times) in the corresponding cell fractions, whole cells or their lysates at the 3-6th day after glycerol injection. Aberrant antioxidant activities depended on rhabdomyolysis stage and had organ specificity. Additional treatment of animals with metal chelator ‘Unithiol’ adjusted only the activity of antioxidant enzymes but not amine oxidases in both organs. Furthermore the in vitro experiment showed that Fenton reaction (hydrogen peroxide in the presence of iron) products alone had no effect on semicarbazide-sensitive amine oxidase activity in rat liver cell fraction whereas supplementation with methylglyoxal resulted in its significant 2.5-fold enhancement. Combined action of the both agents had additive effect on semicarbazide-sensitive amine oxidase activity. We can assume that biogenic amine and polyamine catabolism by amine oxidases is upregulated by oxidative and carbonyl stress factors directly under rhabdomyolysis progression, and the increase in catabolic products concentration contributes to tissue damage in glycerol-induced acute renal failure and apoptosis stimulation in thymus.
Biddle, Jennifer F.; Siebert, Jason R.; Staunton, Eric; Hegg, Eric L.; Matthysse, Ann G.; Teske, Andreas
2013-01-01
Orange, white, and yellow vacuolated Beggiatoaceae filaments are visually dominant members of microbial mats found near sea floor hydrothermal vents and cold seeps, with orange filaments typically concentrated toward the mat centers. No marine vacuolate Beggiatoaceae are yet in pure culture, but evidence to date suggests they are nitrate-reducing, sulfide-oxidizing bacteria. The nearly complete genome sequence of a single orange Beggiatoa (“Candidatus Maribeggiatoa”) filament from a microbial mat sample collected in 2008 at a hydrothermal site in Guaymas Basin (Gulf of California, Mexico) was recently obtained. From this sequence, the gene encoding an abundant soluble orange-pigmented protein in Guaymas Basin mat samples (collected in 2009) was identified by microcapillary reverse-phase high-performance liquid chromatography (HPLC) nano-electrospray tandem mass spectrometry (μLC–MS-MS) of a pigmented band excised from a denaturing polyacrylamide gel. The predicted protein sequence is related to a large group of octaheme cytochromes whose few characterized representatives are hydroxylamine or hydrazine oxidases. The protein was partially purified and shown by in vitro assays to have hydroxylamine oxidase, hydrazine oxidase, and nitrite reductase activities. From what is known of Beggiatoaceae physiology, nitrite reduction is the most likely in vivo role of the octaheme protein, but future experiments are required to confirm this tentative conclusion. Thus, while present-day genomic and proteomic techniques have allowed precise identification of an abundant mat protein, and its potential activities could be assayed, proof of its physiological role remains elusive in the absence of a pure culture that can be genetically manipulated. PMID:23220958
Malagnac, Fabienne; Lalucque, Hervé; Lepère, Gersende; Silar, Philippe
2004-11-01
NADPH oxidases are enzymes that produce reactive oxygen species (ROS) using electrons derived from intracellular NADPH. In plants and mammals, ROS have been proposed to be second messengers that signal defence responses or cell proliferation. By inactivating PaNox1 and PaNox2, two genes encoding NADPH oxidases, we demonstrate the crucial role of these enzymes in the control of two key steps of the filamentous fungus Podospora anserina life cycle. PaNox1 mutants are impaired in the differentiation of fruiting bodies from their progenitor cells, and the deletion of the PaNox2 gene specifically blocks ascospore germination. Furthermore, we show that PaNox1 likely acts upstream of PaASK1, a MAPKKK previously implicated in stationary phase differentiation and cell degeneration. Using nitro blue tetrazolium (NBT) and diaminobenzidine (DAB) assays, we detect a regulated secretion of both superoxide and peroxide during P. anserina vegetative growth. In addition, two oxidative bursts are shown to occur during fruiting body development and ascospore germination. Analysis of mutants establishes that PaNox1, PaNox2, and PaASK1, as well as a still unknown additional source of ROS, modulate these secretions. Altogether, our data point toward a role for NADPH oxidases in signalling fungal developmental transitions with respect to nutrient availability. These enzymes are conserved in other multicellular eukaryotes, suggesting that early eukaryotes were endowed with a redox network used for signalling purposes.
Zhang, Xiangmei; Wang, Zhangqian; Jan, Saad; Yang, Qian; Wang, Mo
2017-06-05
Huperzine A (HupA) isolated from Huperzia serrata is an important compound used to treat Alzheimer's disease (AD). Recently, HupA was reported in various endophytic fungi, with Colletotrichum gloeosporioides ES026 previously isolated from H. serrata shown to produce HupA. In this study, we performed next-generation sequencing and de novo RNA sequencing of C. gloeosporioides ES026 to elucidate the molecular functions, biological processes, and biochemical pathways of these unique sequences. Gene ontology and Kyoto Encyclopedia of Genes and Genomes assignments allowed annotation of lysine decarboxylase (LDC) and copper amine oxidase (CAO) for their conversion of L-lysine to 5-aminopentanal during HupA biosynthesis. Additionally, we constructed a stable, high-yielding HupA-expression system resulting from the overexpression of CgLDC and CgCAO from the HupA-producing endophytic fungus C. gloeosporioides ES026 in Escherichia coli. Quantitative reverse transcription polymerase chain reaction analysis confirmed CgLDC and CgCAO expression, and quantitative determination of HupA levels was assessed by liquid chromatography high-resolution mass spectrometry, which revealed that elevated expression of CgLDC and CgCAO produced higher yields of HupA than those derived from C. gloeosporioides ES026. These results revealed CgLDC and CgCAO involvement in HupA biosynthesis and their key role in regulating HupA content in C. gloeosporioides ES026.
Li, Caili; Li, Dongqiao; Li, Jiang; Shao, Fenjuan; Lu, Shanfa
2017-01-01
Salvia miltiorrhiza is a well-known material of traditional Chinese medicine. Understanding the regulatory mechanisms of phenolic acid biosynthesis and metabolism are important for S. miltiorrhiza quality improvement. We report here that S. miltiorrhiza contains 19 polyphenol oxidases (PPOs), forming the largest PPO gene family in plant species to our knowledge. Analysis of gene structures and sequence features revealed the conservation and divergence of SmPPOs. SmPPOs were differentially expressed in plant tissues and eight of them were predominantly expressed in phloem and xylem, indicating that some SmPPOs are functionally redundant, whereas the others are associated with different physiological processes. Expression patterns of eighteen SmPPOs were significantly altered under MeJA treatment, and twelve were yeast extract and Ag+-responsive, suggesting the majority of SmPPOs are stress-responsive. Analysis of high-throughput small RNA sequences and degradome data showed that miR1444-mediated regulation of PPOs existing in P. trichocarpa is absent from S. miltiorrhiza. Instead, a subset of SmPPOs was posttranscriptionally regulated by a novel miRNA, termed Smi-miR12112. It indicates the specificity and significance of miRNA-mediated regulation of PPOs. The results shed light on the regulation of SmPPO expression and suggest the complexity of SmPPO-associated phenolic acid biosynthesis and metabolism. PMID:28304398
Li, Caili; Li, Dongqiao; Li, Jiang; Shao, Fenjuan; Lu, Shanfa
2017-03-17
Salvia miltiorrhiza is a well-known material of traditional Chinese medicine. Understanding the regulatory mechanisms of phenolic acid biosynthesis and metabolism are important for S. miltiorrhiza quality improvement. We report here that S. miltiorrhiza contains 19 polyphenol oxidases (PPOs), forming the largest PPO gene family in plant species to our knowledge. Analysis of gene structures and sequence features revealed the conservation and divergence of SmPPOs. SmPPOs were differentially expressed in plant tissues and eight of them were predominantly expressed in phloem and xylem, indicating that some SmPPOs are functionally redundant, whereas the others are associated with different physiological processes. Expression patterns of eighteen SmPPOs were significantly altered under MeJA treatment, and twelve were yeast extract and Ag + -responsive, suggesting the majority of SmPPOs are stress-responsive. Analysis of high-throughput small RNA sequences and degradome data showed that miR1444-mediated regulation of PPOs existing in P. trichocarpa is absent from S. miltiorrhiza. Instead, a subset of SmPPOs was posttranscriptionally regulated by a novel miRNA, termed Smi-miR12112. It indicates the specificity and significance of miRNA-mediated regulation of PPOs. The results shed light on the regulation of SmPPO expression and suggest the complexity of SmPPO-associated phenolic acid biosynthesis and metabolism.
Heterologous expression and characterization of mouse spermine oxidase.
Cervelli, Manuela; Polticelli, Fabio; Federico, Rodolfo; Mariottini, Paolo
2003-02-14
Polyamine oxidases are key enzymes responsible of the polyamine interconversion metabolism in animal cells. Recently, a novel enzyme belonging to this class of enzymes has been characterized for its capability to oxidize preferentially spermine and designated as spermine oxidase. This is a flavin adenine dinucleotide-containing enzyme, and it has been expressed both in vitro and in vivo systems. The primary structure of mouse spermine oxidase (mSMO) was deduced from a cDNA clone (Image Clone 264769) recovered by a data base search utilizing the human counterpart of polyamine oxidases, PAOh1. The open reading frame predicts a 555-amino acid protein with a calculated M(r) of 61,852.30, which shows a 95.1% identity with PAOh1. To understand the biochemical properties of mSMO and its structure/function relationship, the mSMO cDNA has been subcloned and expressed in secreted and secreted-tagged forms into Escherichia coli BL21 DE3 cells. The recombinant enzyme shows an optimal pH value of 8.0 and is able to oxidize rapidly spermine to spermidine and 3-aminopropanal and fails to act upon spermidine and N(1)-acetylpolyamines. The purified recombinant-tagged form enzyme (M(r) approximately 68,000) has K(m) and k(cat) values of 90 microm and 4.5 s(-1), respectively, using spermine as substrate at pH 8.0. Molecular modeling of mSMO protein based on maize polyamine oxidase three-dimensional structure suggests that the general features of maize polyamine oxidase active site are conserved in mSMO.
Liu, Yang; Fang, Jun; Xu, Fan; Chu, Jinfang; Yan, Cunyu; Schläppi, Michael R; Wang, Youping; Chu, Chengcai
2014-06-20
Seed dormancy is an important agronomic trait in cereals. Using deep dormant (N22), medium dormant (ZH11), and non-dormant (G46B) rice cultivars, we correlated seed dormancy phenotypes with abscisic acid (ABA) and gibberellin (GA) metabolism gene expression profiles and phytohormone levels during seed development and imbibition. A time course analysis of ABA and GA content during seed development showed that N22 had a high ABA level at early and middle seed developmental stages, while at late developmental stage it declined to the level of ZH11; however, its ABA/GA ratio maintained at a high level throughout seed development. By contrast, G46B had the lowest ABA content during seed development though at early developmental stage its ABA level was close to that of ZH11, and its ABA/GA ratio peaked at late developmental stage that was at the same level of ZH11. Compared with N22 and G46B, ZH11 had an even and medium ABA level during seed development and its ABA/GA ratio peaked at the middle developmental stage. Moreover, the seed development time-point having high ABA/GA ratio also had relatively high transcript levels for key genes in ABA and GA metabolism pathways across three cultivars. These indicated that the embryo-imposed dormancy has been induced before the late developmental stage and is determined by ABA/GA ratio. A similar analysis during seed imbibition showed that ABA was synthesized in different degrees for the three cultivars. In addition, water uptake assay for intact mature seeds suggested that water could permeate through husk barrier into seed embryo for all three cultivars; however, all three cultivars showed distinct colors by vanillin-staining indicative of the existence of flavans in their husks, which are dormancy inhibition compounds responsible for the husk-imposed dormancy. Copyright © 2014. Published by Elsevier Ltd.
Zhang, Zi-Hui; Tan, Swee Tiam; Liu, Wei; Ju, Zhengang; Zheng, Ke; Kyaw, Zabu; Ji, Yun; Hasanov, Namig; Sun, Xiao Wei; Demir, Hilmi Volkan
2013-02-25
This work reports both experimental and theoretical studies on the InGaN/GaN light-emitting diodes (LEDs) with optical output power and external quantum efficiency (EQE) levels substantially enhanced by incorporating p-GaN/n-GaN/p-GaN/n-GaN/p-GaN (PNPNP-GaN) current spreading layers in p-GaN. Each thin n-GaN layer sandwiched in the PNPNP-GaN structure is completely depleted due to the built-in electric field in the PNPNP-GaN junctions, and the ionized donors in these n-GaN layers serve as the hole spreaders. As a result, the electrical performance of the proposed device is improved and the optical output power and EQE are enhanced.
A transgenic apple callus showing reduced polyphenol oxidase activity and lower browning potential.
Murata, M; Nishimura, M; Murai, N; Haruta, M; Homma, S; Itoh, Y
2001-02-01
Polyphenol oxidase (PPO) is responsible for enzymatic browning of apples. Apples lacking PPO activity might be useful not only for the food industry but also for studies of the metabolism of polyphenols and the function of PPO. Transgenic apple calli were prepared by using Agrobacterium tumefaciens carrying the kanamycin (KM) resistant gene and antisense PPO gene. Four KM-resistant callus lines were obtained from 356 leaf explants. Among these transgenic calli, three calli grew on the medium containing KM at the same rate as non-transgenic callus on the medium without KM. One callus line had an antisense PPO gene, in which the amount and activity of PPO were reduced to half the amount and activity in non-transgenic callus. The browning potential of this line, which was estimated by adding chlorogenic acid, was also half the browning potential of non-transgenic callus.
Xu, Man K.; Gaysina, Darya; Tsonaka, Roula; Morin, Alexandre J. S.; Croudace, Tim J.; Barnett, Jennifer H.; Houwing-Duistermaat, Jeanine; Richards, Marcus; Jones, Peter B.
2017-01-01
Very few molecular genetic studies of personality traits have used longitudinal phenotypic data, therefore molecular basis for developmental change and stability of personality remains to be explored. We examined the role of the monoamine oxidase A gene (MAOA) on extraversion and neuroticism from adolescence to adulthood, using modern latent variable methods. A sample of 1,160 male and 1,180 female participants with complete genotyping data was drawn from a British national birth cohort, the MRC National Survey of Health and Development (NSHD). The predictor variable was based on a latent variable representing genetic variations of the MAOA gene measured by three SNPs (rs3788862, rs5906957, and rs979606). Latent phenotype variables were constructed using psychometric methods to represent cross-sectional and longitudinal phenotypes of extraversion and neuroticism measured at ages 16 and 26. In males, the MAOA genetic latent variable (AAG) was associated with lower extraversion score at age 16 (β = −0.167; CI: −0.289, −0.045; p = 0.007, FDRp = 0.042), as well as greater increase in extraversion score from 16 to 26 years (β = 0.197; CI: 0.067, 0.328; p = 0.003, FDRp = 0.036). No genetic association was found for neuroticism after adjustment for multiple testing. Although, we did not find statistically significant associations after multiple testing correction in females, this result needs to be interpreted with caution due to issues related to x-inactivation in females. The latent variable method is an effective way of modeling phenotype- and genetic-based variances and may therefore improve the methodology of molecular genetic studies of complex psychological traits. PMID:29075213
Xu, Man K; Gaysina, Darya; Tsonaka, Roula; Morin, Alexandre J S; Croudace, Tim J; Barnett, Jennifer H; Houwing-Duistermaat, Jeanine; Richards, Marcus; Jones, Peter B
2017-01-01
Very few molecular genetic studies of personality traits have used longitudinal phenotypic data, therefore molecular basis for developmental change and stability of personality remains to be explored. We examined the role of the monoamine oxidase A gene ( MAOA ) on extraversion and neuroticism from adolescence to adulthood, using modern latent variable methods. A sample of 1,160 male and 1,180 female participants with complete genotyping data was drawn from a British national birth cohort, the MRC National Survey of Health and Development (NSHD). The predictor variable was based on a latent variable representing genetic variations of the MAOA gene measured by three SNPs (rs3788862, rs5906957, and rs979606). Latent phenotype variables were constructed using psychometric methods to represent cross-sectional and longitudinal phenotypes of extraversion and neuroticism measured at ages 16 and 26. In males, the MAOA genetic latent variable (AAG) was associated with lower extraversion score at age 16 (β = -0.167; CI: -0.289, -0.045; p = 0.007, FDRp = 0.042), as well as greater increase in extraversion score from 16 to 26 years (β = 0.197; CI: 0.067, 0.328; p = 0.003, FDRp = 0.036). No genetic association was found for neuroticism after adjustment for multiple testing. Although, we did not find statistically significant associations after multiple testing correction in females, this result needs to be interpreted with caution due to issues related to x-inactivation in females. The latent variable method is an effective way of modeling phenotype- and genetic-based variances and may therefore improve the methodology of molecular genetic studies of complex psychological traits.
Zhang, De-Huai; Jiang, Lu-Xi; Li, Na; Yu, Xuya; Zhao, Peng; Li, Tao; Xu, Jun-Wei
2017-06-14
The squalene epoxidase (SE) gene from the biosynthetic pathway of ganoderic acid (GA) was cloned and overexpressed in Ganoderma lingzhi. The strain that overexpressed the SE produced approximately 2 times more GA molecules than the wild-type (WT) strain. Moreover, SE overexpression upregulated lanosterol synthase gene expression in the biosynthetic pathway. These results indicated that SE stimulates GA accumulation. Then, the SE and 3-hydroxy-3-methylglutaryl coenzyme A (HMGR) genes were simultaneously overexpressed in G. lingzhi. Compared with the individual overexpression of SE or HMGR, the combined overexpression of the two genes further enhanced individual GA production. The overexpressing strain produced maximum GA-T, GA-S, GA-Mk, and GA-Me contents of 90.4 ± 7.5, 35.9 ± 5.4, 6.2 ± 0.5, and 61.8 ± 5.8 μg/100 mg dry weight, respectively. These values were 5.9, 4.5, 2.4, and 5.8 times higher than those produced by the WT strain. This is the first example of the successful manipulation of multiple biosynthetic genes to improve GA content in G. lingzhi.
Putting together a plasma membrane NADH oxidase: a tale of three laboratories.
Löw, Hans; Crane, Frederick L; Morré, D James
2012-11-01
The observation that high cellular concentrations of NADH were associated with low adenylate cyclase activity led to a search for the mechanism of the effect. Since cyclase is in the plasma membrane, we considered the membrane might have a site for NADH action, and that NADH might be oxidized at that site. A test for NADH oxidase showed very low activity, which could be increased by adding growth factors. The plasma membrane oxidase was not inhibited by inhibitors of mitochondrial NADH oxidase such as cyanide, rotenone or antimycin. Stimulation of the plasma membrane oxidase by iso-proterenol or triiodothyronine was different from lack of stimulation in endoplasmic reticulum. After 25 years of research, three components of a trans membrane NADH oxidase have been discovered. Flavoprotein NADH coenzyme Q reductases (NADH cytochrome b reductase) on the inside, coenzyme Q in the middle, and a coenzyme Q oxidase on the outside as a terminal oxidase. The external oxidase segment is a copper protein with unique properties in timekeeping, protein disulfide isomerase and endogenous NADH oxidase activity, which affords a mechanism for control of cell growth by the overall NADH oxidase and the remarkable inhibition of oxidase activity and growth of cancer cells by a wide range of anti-tumor drugs. A second trans plasma membrane electron transport system has been found in voltage dependent anion channel (VDAC), which has NADH ferricyanide reductase activity. This activity must be considered in relation to ferricyanide stimulation of growth and increased VDAC antibodies in patients with autism. Copyright © 2012 Elsevier Ltd. All rights reserved.
Ueguchi-Tanaka, Miyako; Hirano, Ko; Hasegawa, Yasuko; Kitano, Hidemi; Matsuoka, Makoto
2008-09-01
The rice (Oryza sativa) DELLA protein SLR1 acts as a repressor of gibberellin (GA) signaling. GA perception by GID1 causes SLR1 protein degradation involving the F-box protein GID2; this triggers GA-associated responses such as shoot elongation and seed germination. In GA-insensitive and GA biosynthesis mutants, SLENDER RICE1 (SLR1) accumulates to high levels, and the severity of dwarfism is usually correlated with the level of SLR1 accumulation. An exception is the GA-insensitive F-box mutant gid2, which shows milder dwarfism than mutants such as gid1 and cps even though it accumulates higher levels of SLR1. The level of SLR1 protein in gid2 was decreased by loss of GID1 function or treatment with a GA biosynthesis inhibitor, and dwarfism was enhanced. Conversely, overproduction of GID1 or treatment with GA(3) increased the SLR1 level in gid2 and reduced dwarfism. These results indicate that derepression of SLR1 repressive activity can be accomplished by GA and GID1 alone and does not require F-box (GID2) function. Evidence for GA signaling without GID2 was also provided by the expression behavior of GA-regulated genes such as GA-20oxidase1, GID1, and SLR1 in the gid2 mutant. Based on these observations, we propose a model for the release of GA suppression that does not require DELLA protein degradation.
Rice Ovate Family Protein 2 (OFP2) alters hormonal homeostasis and vasculature development.
Schmitz, Aaron J; Begcy, Kevin; Sarath, Gautam; Walia, Harkamal
2015-12-01
OFP (Ovate Family Protein) is a transcription factor family found only in plants. In dicots, OFPs control fruit shape and secondary cell wall biosynthesis. OFPs are also thought to function through interactions with KNOX and BELL transcription factors. Here, we have functionally characterized OsOFP2, a member of the OFP subgroup associated with regulating fruit shape. OsOFP2 was found to localize to the nucleus and to the cytosol. A putative nuclear export signal was identified within the OVATE domain and was required for the localization of OsOFP2 to distinct cytosolic spots. Rice plants overexpressing OsOFP2 were reduced in height and exhibited altered leaf morphology, seed shape, and positioning of vascular bundles in stems. Transcriptome analysis indicated disruptions of genes associated with vasculature development, lignin biosynthesis, and hormone homeostasis. Reduced expression of the gibberellin biosynthesis gene GA 20-oxidase 7 coincided with lower gibberellin content in OsOFP2 overexpression lines. Also, we found that OsOFP2 was expressed in plant vasculature and determined that putative vascular development KNOX and BELL proteins interact with OsOFP2. KNOX and BELL genes are known to suppress gibberellin biosynthesis through GA20ox gene regulation and can restrict lignin biosynthesis. We propose that OsOFP2 could modulate KNOX-BELL function to control diverse aspects of development including vasculature development. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Cao, Gen-Xia; Wu, Xiu-Ming; Dong, Yu-Ming; Li, Zai-Jun; Wang, Guang-Li
2016-07-09
In this study, a simple and amplified colorimetric assay is developed for the detection of the enzymatic activity of glucose oxidase (GOx) based on in situ formation of a photoswitchable oxidase mimetic of PO₄(3-)-capped CdS quantum dots (QDs). GOx catalyzes the oxidation of 1-thio-β-d-glucose to give 1-thio-β-d-gluconic acid which spontaneously hydrolyzes to β-d-gluconic acid and H₂S; the generated H₂S instantly reacts with Cd(2+) in the presence of Na₃PO₄ to give PO₄(3-)-stabilized CdS QDs in situ. Under visible-light (λ ≥ 400 nm) stimulation, the PO₄(3-)-capped CdS QDs are a new style of oxidase mimic derived by producing some active species, such as h⁺, (•)OH, O₂(•-) and a little H₂O₂, which can oxidize the typical substrate (3,3,5,5-tetramethylbenzydine (TMB)) with a color change. Based on the GOx-triggered growth of the oxidase mimetics of PO₄(3-)-capped CdS QDs in situ, we developed a simple and amplified colorimetric assay to probe the enzymatic activity of GOx. The proposed method allowed the detection of the enzymatic activity of GOx over the range from 25 μg/L to 50 mg/L with a low detection limit of 6.6 μg/L. We believe the PO₄(3-)-capped CdS QDs generated in situ with photo-stimulated enzyme-mimicking activity may find wide potential applications in biosensors.
Folmer, O; Black, M; Hoeh, W; Lutz, R; Vrijenhoek, R
1994-10-01
We describe "universal" DNA primers for polymerase chain reaction (PCR) amplification of a 710-bp fragment of the mitochondrial cytochrome c oxidase subunit I gene (COI) from 11 invertebrate phyla: Echinodermata, Mollusca, Annelida, Pogonophora, Arthropoda, Nemertinea, Echiura, Sipuncula, Platyhelminthes, Tardigrada, and Coelenterata, as well as the putative phylum Vestimentifera. Preliminary comparisons revealed that these COI primers generate informative sequences for phylogenetic analyses at the species and higher taxonomic levels.
Ma (马谦), Qian; Hedden, Peter; Zhang (张启发), Qifa
2011-01-01
Despite the accumulation of data on the genetic and molecular understanding of heterosis, there is little information on the regulation of heterosis at the physiological level. In this study, we performed a quantitative analysis of endogenous gibberellin (GA) content and expression profiling of the GA metabolism and signaling genes to investigate the possible relationship between GA signaling and heterosis for seedling development in rice (Oryza sativa). The materials used were an incomplete diallele set of 3 × 3 crosses and the six parents. In the growing shoots of the seedlings at 20 d after sowing, significant positive correlations between the contents of some GA species and performance and heterosis based on shoot dry mass were detected. Expression analyses of GA-related genes by real-time reverse transcription-polymerase chain reaction revealed that 13 out of the 16 GA-related genes examined exhibited significant differential expression among the F1 hybrid and its parents, acting predominantly in the modes of overdominance and positive dominance. Expression levels of nine genes in the hybrids displayed significant positive correlations with the heterosis of shoot dry mass. These results imply that GAs play a positive role in the regulation of heterosis for rice seedling development. In shoots plus root axes of 4-d-old germinating seeds that had undergone the deetiolation, mimicking normal germination in soil, the axis dry mass was positively correlated with the content of GA29 but negatively correlated with that of GA19. Our findings provide supporting evidence for GAs playing an important regulatory role in heterosis for rice seedling development. PMID:21693671
Pang, Jinhuan; Zhu, Yue; Li, Qing; Liu, Jinzhi; Tian, Yingchuan; Liu, Yule; Wu, Jiahe
2013-01-01
Gossypium barbadense is a cultivated cotton species and possesses many desirable traits, including high fiber quality and resistance to pathogens, especially Verticilliumdahliae (a devastating pathogen of Gossypium hirsutum, the main cultivated species). These elite traits are difficult to be introduced into G. hirsutum through classical breeding methods. In addition, genetic transformation of G . barbadense has not been successfully performed. It is therefore important to develop methods for evaluating the function and molecular mechanism of genes in G . barbadense . In this study, we had successfully introduced a virus-induced gene silencing (VIGS) system into three cultivars of G . barbadense by inserting marker genes into the tobacco rattle virus (TRV) vector. After we optimized the VIGS conditions, including light intensity, photoperiod, seedling age and Agrobacterium strain, 100% of plants agroinfiltrated with the GaPDS silencing vector showed white colored leaves. Three other marker genes, GaCLA1, GaANS and GaANR, were employed to further test this VIGS system in G . barbadense . The transcript levels of the endogenous genes in the silenced plants were reduced by more than 99% compared to control plants; these plants presented phenotypic symptoms 2 weeks after inoculation. We introduced a fusing sequence fragment of GaPDS and GaANR gene silencing vectors into a single plant, which resulted in both photobleaching and brownish coloration. The extent of silencing in plants agroinfiltrated with fusing two-gene-silencing vector was consistent with plants harboring a single gene silencing vector. The development of this VIGS system should promote analysis of gene function in G . barbadense , and help to contribute desirable traits for breeding of G . barbadense and G. hirsutum. PMID:24023833
Washio, Tsubasa; Oikawa, Tadao
2018-01-01
We successfully expressed the L-aspartate oxidase homolog gene (accession no: OCC_06611) of Thermococcus litoralis DSM 5473 in the soluble fraction of Escherichia coli BL21 (DE3) using a pET21b vector with 6X His tag at its C-terminus. The gene product (Tl-LASPO) showed L-aspartate oxidase activity in the presence of FAD in vitro, and this report is the first that details an L-aspartate oxidase derived from a Thermococcus species. The homologs of Tl-LASPO existed mainly in archaea, especially in the genus of Thermococcus, Pyrococcus, Sulfolobus, and Halobacteria. The quaternary structure of Tl-LASPO was homotrimeric with a subunit molecular mass of 52 kDa. The enzyme activity of Tl-LASPO increased with temperature up to 70 °C. Tl-LASPO was active from pH 6.0 to 9.0, and its highest activity was at pH 8.0. Tl-LASPO was stable at 80 °C for 1 h. The highest k cat /K m value was observed in assays at 70 °C. Tl-LASPO was highly specific for L-aspartic acid. Tl-LASPO utilized fumaric acid, 2,6-dichlorophenolindophenol, and ferricyanide in addition to FAD as a cofactor under anaerobic conditions. The absorption spectrum of holo-Tl-LASPO exhibited maxima at 380 and 450 nm. The FAD dissociation constant, K d , of the FAD-Tl-LASPO complex was determined to be 5.9 × 10 -9 M.
NADPH oxidases: novel therapeutic targets for neurodegenerative diseases.
Gao, Hui-Ming; Zhou, Hui; Hong, Jau-Shyong
2012-06-01
Oxidative stress is a key pathologic factor in neurodegenerative diseases such as Alzheimer and Parkinson diseases (AD, PD). The failure of free-radical-scavenging antioxidants in clinical trials pinpoints an urgent need to identify and to block major sources of oxidative stress in neurodegenerative diseases. As a major superoxide-producing enzyme complex in activated phagocytes, phagocyte NADPH oxidase (PHOX) is essential for host defense. However, recent preclinical evidence has underscored a pivotal role of overactivated PHOX in chronic neuroinflammation and progressive neurodegeneration. Deficiency in PHOX subunits mitigates neuronal damage induced by diverse insults/stresses relevant to neurodegenerative diseases. More importantly, suppression of PHOX activity correlates with reduced neuronal impairment in models of neurodegenerative diseases. The discovery of PHOX and non-phagocyte NADPH oxidases in astroglia and neurons further reinforces the crucial role of NADPH oxidases in oxidative stress-mediated chronic neurodegeneration. Thus, proper modulation of NADPH oxidase activity might hold therapeutic potential for currently incurable neurodegenerative diseases. Published by Elsevier Ltd.
Yang, Huilin; Peng, Silu; Zhang, Zhibin; Yan, Riming; Wang, Ya; Zhan, Jixun; Zhu, Du
2016-12-01
Huperzine A (HupA) is a drug used for the treatment of Alzheimer's disease. However, the biosynthesis of this medicinally important compound is not well understood. The HupA biosynthetic pathway is thought to be initiated by the decarboxylation of lysine to form cadaverine, which is then converted to 5-aminopentanal by copper amine oxidase (CAO). In this study, we cloned and expressed an SsCAO gene from a HupA-producing endophytic fungus, Shiraia sp. Slf14. Analysis of the deduced protein amino acid sequence showed that it contained the Asp catalytic base, conserved motif Asn-Tyr-Asp/Glu, and three copper-binding histidines. The cDNA of SsCAO was amplified and expressed in Escherichia coli BL21(DE3), from which a 76 kDa protein was obtained. The activity of this enzyme was tested, which provided more information about the SsCAO gene in the endophytic fungus. Gas Chromatograph-Mass Spectrometry (GC-MS) revealed that this SsCAO could accept cadaverine as a substrate to produce 5-aminopentanal, the precursor of HupA. Phylogenetic tree analysis indicated that the SsCAO from Shiraia sp. Slf14 was closely related to Stemphylium lycopersici CAO. This is the first report on the cloning and expression of a CAO gene from HupA-producing endophytic fungi. Functional characterization of this enzyme provides new insights into the biosynthesis of the HupA an anti-Alzheimer's drug. Copyright © 2016 Elsevier Inc. All rights reserved.
O'Neill, P; Fielden, E M; Avigliano, L; Marcozzi, G; Ballini, A; Agrò, F
1984-08-15
The interaction of one-electron reduced metronidazole (ArNO2.-) with native and Type-2-copper-depleted ascorbate oxidase were studied in buffered aqueous solution at pH 6.0 and 7.4 by using the technique of pulse radiolysis. With ArNO2.-, reduction of Type 1 copper of the native enzyme and of the Type-2-copper-depleted ascorbate oxidase occurs via a bimolecular step and at the same rate. Whereas the native protein accepts, in the absence of O2, 6-7 reducing equivalents, Type-2-copper-depleted ascorbate oxidase accepts only 3 reducing equivalents with stoichiometric reduction of Type 1 copper. On reaction of O2.- with ascorbate oxidase under conditions of [O2.-] much greater than [ascorbate oxidase], removal of Type 2 copper results in reduction of all the Type 1 copper atoms, in contrast with reduction of the equivalent of only one Type 1 copper atom in the holoprotein. From observations at 610 nm, the rate of reduction of ascorbate oxidase by O2.- is not dependent on the presence of Type 2 copper. For the holoprotein, no significant optical-absorption changes were observed at 330 nm. It is proposed that electrons enter the protein via Type 1 copper in a rate-determining step followed by a fast intramolecular transfer of electrons within the protein. For the Type-2-copper-depleted protein, intramolecular transfer within the protein, however, is slow or does not occur. In the presence of O2, it is also suggested that re-oxidation of the partially reduced holoprotein occurs at steady state, as inferred from the observations at 330 nm and 610 nm. The role of Type 2 copper in ascorbate oxidase is discussed in terms of its involvement in redistribution of electrons within the protein or structural considerations.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vasil’ev, V. I.; Gagis, G. S., E-mail: galina.gagis@gmail.com; Kuchinskii, V. I.
2015-07-15
Processes are considered in which ultrathin layers of III–V ternary solid solutions are formed via the delivery of Group-V element vapors to GaAs and GaSb semiconductor plates, with solid-phase substitution reactions occurring in the surface layers of these plates. This method can form defect-free GaAs{sup 1–x}P{sup x}, GaAs{sup x}Sb{sup 1–x}, and GaP{sup x}Sb{sup 1–x} layers with thicknesses of 10–20 nm and a content x of the embedded components of up to 0.04.
Genotypes and clinical phenotypes in children with cytochrome-c oxidase deficiency.
Darin, N; Moslemi, A-R; Lebon, S; Rustin, P; Holme, E; Oldfors, A; Tulinius, M
2003-12-01
Cytochrome c oxidase (COX) deficiency has been associated with a wide spectrum of clinical features and may be caused by mutations in different genes of both the mitochondrial and the nuclear DNA. In an attempt to correlate the clinical phenotype with the genotype in 16 childhood cases, mtDNA was analysed for deletion, depletion, and mutations in the three genes encoding COX subunits and the 22 tRNA genes. Furthermore, nuclear DNA was analysed for mutations in the SURF1, SCO2, COX10, and COX17 genes and cases with mtDNA depletion were analysed for mutations in the TK2 gene. SURF1-mutations were identified in three out of four cases with Leigh syndrome while a mutation in the mitochondrial tRNA (trp) gene was identified in the fourth. One case with mtDNA depletion had mutations in the TK2 gene. In two cases with leukoencephalopathy, one case with encephalopathy, five cases with fatal infantile myopathy and cardiomyopathy, two cases with benign infantile myopathy, and one case with mtDNA depletion, no mutations were identified. We conclude that COX deficiency in childhood should be suspected in a wide range of clinical settings and although an increasing number of genetic defects have been identified, the underlying mutations remain unclear in the majority of the cases.
Comparative investigation of InGaP/GaAs/GaAsBi and InGaP/GaAs heterojunction bipolar transistors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wu, Yi-Chen; Tsai, Jung-Hui, E-mail: jhtsai@nknucc.nknu.edu.tw; Chiang, Te-Kuang
2015-10-15
In this article the characteristics of In{sub 0.49}Ga{sub 0.51}P/GaAs/GaAs{sub 0.975}Bi{sub 0.025} and In{sub 0.49}Ga{sub 0.51}P/GaAs heterojunction bipolar transistor (HBTs) are demonstrated and compared by two-dimensional simulated analysis. As compared to the traditional InGaP/GaAs HBT, the studied InGaP/GaAs/GaAsBi HBT exhibits a higher collector current, a lower base-emitter (B–E) turn-on voltage, and a relatively lower collector-emitter offset voltage of only 7 mV. Because the more electrons stored in the base is further increased in the InGaP/GaAs/GaAsBi HBT, it introduces the collector current to increase and the B–E turn-on voltage to decrease for low input power applications. However, the current gain is slightlymore » smaller than the traditional InGaP/GaAs HBT attributed to the increase of base current for the minority carriers stored in the GaAsBi base.« less
Limbach, F.; Gotschke, T.; Stoica, T.; ...
2011-01-01
InGaN/GaN nanowire (NW) heterostructures grown by plasma assisted molecular beam epitaxy were studied in comparison to their GaN and InGaN counterparts. The InGaN/GaN heterostructure NWs are composed of a GaN NW, a thin InGaN shell, and a multifaceted InGaN cap wrapping the top part of the GaN NW. High-resolution transmission electron microscopy (HRTEM) images taken from different parts of a InGaN/GaN NW show a wurtzite structure of the GaN core and the epitaxial InGaN shell around it, while additional crystallographic domains are observed whithin the InGaN cap region. Large changes in the lattice parameter along the wire, from pure GaNmore » to higher In concentration demonstrate the successful growth of a complex InGaN/GaN NW heterostructure. Photoluminescence (PL) spectra of these heterostructure NW ensembles show rather broad and intense emission peak at 2.1 eV. However, μ-PL spectra measured on single NWs reveal a reduced broadening of the visible luminescence. The analysis of the longitudinal optical phonon Raman peak position and its shape reveal a variation in the In content between 20% and 30%, in agreement with the values estimated by PL and HRTEM investigations. The reported studies are important for understanding of the growth and properties of NW heterostructures suitable for applications in optoelectronics and photovoltaics.« less
NASA Astrophysics Data System (ADS)
Limbach, F.; Gotschke, T.; Stoica, T.; Calarco, R.; Sutter, E.; Ciston, J.; Cusco, R.; Artus, L.; Kremling, S.; Höfling, S.; Worschech, L.; Grützmacher, D.
2011-01-01
InGaN/GaN nanowire (NW) heterostructures grown by plasma assisted molecular beam epitaxy were studied in comparison to their GaN and InGaN counterparts. The InGaN/GaN heterostructure NWs are composed of a GaN NW, a thin InGaN shell, and a multifaceted InGaN cap wrapping the top part of the GaN NW. High-resolution transmission electron microscopy (HRTEM) images taken from different parts of a InGaN/GaN NW show a wurtzite structure of the GaN core and the epitaxial InGaN shell around it, while additional crystallographic domains are observed whithin the InGaN cap region. Large changes in the lattice parameter along the wire, from pure GaN to higher In concentration demonstrate the successful growth of a complex InGaN/GaN NW heterostructure. Photoluminescence (PL) spectra of these heterostructure NW ensembles show rather broad and intense emission peak at 2.1 eV. However, μ-PL spectra measured on single NWs reveal a reduced broadening of the visible luminescence. The analysis of the longitudinal optical phonon Raman peak position and its shape reveal a variation in the In content between 20% and 30%, in agreement with the values estimated by PL and HRTEM investigations. The reported studies are important for understanding of the growth and properties of NW heterostructures suitable for applications in optoelectronics and photovoltaics.
Krause, Frank; Scheckhuber, Christian Q; Werner, Alexandra; Rexroth, Sascha; Reifschneider, Nicole H; Dencher, Norbert A; Osiewacz, Heinz D
2004-06-18
To elucidate the molecular basis of the link between respiration and longevity, we have studied the organization of the respiratory chain of a wild-type strain and of two long-lived mutants of the filamentous fungus Podospora anserina. This established aging model is able to respire by either the standard or the alternative pathway. In the latter pathway, electrons are directly transferred from ubiquinol to the alternative oxidase and thus bypass complexes III and IV. We show that the cytochrome c oxidase pathway is organized according to the mammalian "respirasome" model (Schägger, H., and Pfeiffer, K. (2000) EMBO J. 19, 1777-1783). In contrast, the alternative pathway is composed of distinct supercomplexes of complexes I and III (i.e. I(2) and I(2)III(2)), which have not been described so far. Enzymatic analysis reveals distinct functional properties of complexes I and III belonging to either cytochrome c oxidase- or alternative oxidase-dependent pathways. By a gentle colorless-native PAGE, almost all of the ATP synthases from mitochondria respiring by either pathway were preserved in the dimeric state. Our data are of significance for the understanding of both respiratory pathways as well as lifespan control and aging.
Process in manufacturing high efficiency AlGaAs/GaAs solar cells by MO-CVD
NASA Technical Reports Server (NTRS)
Yeh, Y. C. M.; Chang, K. I.; Tandon, J.
1984-01-01
Manufacturing technology for mass producing high efficiency GaAs solar cells is discussed. A progress using a high throughput MO-CVD reactor to produce high efficiency GaAs solar cells is discussed. Thickness and doping concentration uniformity of metal oxide chemical vapor deposition (MO-CVD) GaAs and AlGaAs layer growth are discussed. In addition, new tooling designs are given which increase the throughput of solar cell processing. To date, 2cm x 2cm AlGaAs/GaAs solar cells with efficiency up to 16.5% were produced. In order to meet throughput goals for mass producing GaAs solar cells, a large MO-CVD system (Cambridge Instrument Model MR-200) with a susceptor which was initially capable of processing 20 wafers (up to 75 mm diameter) during a single growth run was installed. In the MR-200, the sequencing of the gases and the heating power are controlled by a microprocessor-based programmable control console. Hence, operator errors can be reduced, leading to a more reproducible production sequence.
In vitro study of 6-mercaptopurine oxidation catalysed by aldehyde oxidase and xanthine oxidase.
Rashidi, Mohammad-Reza; Beedham, Christine; Smith, John S; Davaran, Soodabeh
2007-08-01
In spite of over 40 years of clinical use of 6-mercaptopurine, many aspects of complex pharmacology and metabolism of this drug remain unclear. It is thought that 6-mercaptopurine is oxidized to 6-thiouric acid through 6-thioxanthine or 8-oxo-6-mercaptopurine by one of two molybdenum hydroxylases, xanthine oxidase (XO), however, the role of other molybdenum hydroxylase, aldehyde oxidase (AO), in the oxidation of 6-mercaptopurine and possible interactions of AO substrates and inhibitors has not been investigated in more details. In the present study, the role of AO and XO in the oxidation of 6- mercaptopurine has been investigated. 6-mercaptopurine was incubated with bovine milk xanthine oxidase or partially purified guinea pig liver molybdenum hydroxylase fractions in the absence and presence of XO and AO inhibitor/substrates, and the reactions were monitored by spectrophotometric and HPLC methods. According to the results obtained from the inhibition studies, it is more likely that 6- mercaptopurine is oxidized to 6-thiouric acid via 6-thioxanthine rather than 8-oxo-6-mercaptopurine. The first step which is the rate limiting step is catalyzed solely by XO, whereas both XO and AO are involved in the oxidation of 6-thioxanthine to 6-thiouric acid.
Paumann, Martina; Feichtinger, Markus; Bernroitner, Margit; Goldfuhs, Judith; Jakopitsch, Christa; Furtmüller, Paul G; Regelsberger, Günther; Peschek, Günter A; Obinger, Christian
2004-10-08
Cytochrome c6 is a soluble metalloprotein located in the periplasmic space and the thylakoid lumen of many cyanobacteria and is known to carry electrons from cytochrome b6f to photosystem I. The CuA domain of cytochrome c oxidase, the terminal enzyme which catalyzes the four-electron reduction of molecular oxygen in the respiratory chains of mitochondria and many bacteria, also has a periplasmic location. In order to test whether cytochrome c6 could also function as a donor for cytochrome c oxidase, we investigated the kinetics of the electron transfer between recombinant cytochrome c6 (produced in high yield in Escherichia coli by coexpressing the maturation proteins encoded by the ccmA-H gene cluster) and the recombinant soluble CuA domain (i.e., the donor binding and electron entry site) of subunit II of cytochrome c oxidase from Synechocystis PCC 6803. The forward and the reverse electron transfer reactions were studied by the stopped-flow technique and yielded apparent bimolecular rate constants of (3.3 +/- 0.3) x 10(5) M(-1) s(-1) and (3.9 +/- 0.1) x 10(6) M(-1) s(-1), respectively, in 5 mM potassium phosphate buffer, pH 7, containing 20 mM potassium chloride and 25 degrees C. This corresponds to an equilibrium constant Keq of 0.085 in the physiological direction (DeltarG'0 = 6.1 kJ/mol). The reduction of the CuA fragment by cytochrome c6 is almost independent on ionic strength, which is in contrast to the reaction of the CuA domain with horse heart cytochrome c, which decreases with increasing ionic strength. The findings are discussed with respect to the potential role of cytochrome c6 as mobile electron carrier in both cyanobacterial electron transport pathways. Copyright 2004 Federation of European Biochemical Societies
Nakano, Tadao; Okamoto, Munehiro; Ikeda, Yatsukaho; Hasegawa, Hideo
2006-12-01
Sequences of mitochondrial cytochrome c oxidase subunit 1 (CO1) gene, nuclear internal transcribed spacer 2 (ITS2) region of ribosomal DNA (rDNA), and 5S rDNA of Enterobius vermicularis from captive chimpanzees in five zoos/institutions in Japan were analyzed and compared with those of pinworm eggs from humans in Japan. Three major types of variants appearing in both CO1 and ITS2 sequences, but showing no apparent connection, were observed among materials collected from the chimpanzees. Each one of them was also observed in pinworms in humans. Sequences of 5S rDNA were identical in the materials from chimpanzees and humans. Phylogenetic analysis of CO1 gene revealed three clusters with high bootstrap value, suggesting considerable divergence, presumably correlated with human evolution, has occurred in the human pinworms. The synonymy of E. gregorii with E. vermicularis is supported by the molecular evidence.
Discovery of a Xylooligosaccharide Oxidase from Myceliophthora thermophila C1.
Ferrari, Alessandro R; Rozeboom, Henriëtte J; Dobruchowska, Justyna M; van Leeuwen, Sander S; Vugts, Aniek S C; Koetsier, Martijn J; Visser, Jaap; Fraaije, Marco W
2016-11-04
By inspection of the predicted proteome of the fungus Myceliophthora thermophila C1 for vanillyl-alcohol oxidase (VAO)-type flavoprotein oxidases, a putative oligosaccharide oxidase was identified. By homologous expression and subsequent purification, the respective protein could be obtained. The protein was found to contain a bicovalently bound FAD cofactor. By screening a large number of carbohydrates, several mono- and oligosaccharides could be identified as substrates. The enzyme exhibits a strong substrate preference toward xylooligosaccharides; hence it is named xylooligosaccharide oxidase (XylO). Chemical analyses of the product formed upon oxidation of xylobiose revealed that the oxidation occurs at C1, yielding xylobionate as product. By elucidation of several XylO crystal structures (in complex with a substrate mimic, xylose, and xylobiose), the residues that tune the unique substrate specificity and regioselectivity could be identified. The discovery of this novel oligosaccharide oxidase reveals that the VAO-type flavoprotein family harbors oxidases tuned for specific oligosaccharides. The unique substrate profile of XylO hints at a role in the degradation of xylan-derived oligosaccharides by the fungus M. thermophila C1. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Brummett, Beverly H; Boyle, Stephen H; Siegler, Ilene C; Zuchner, Stephan; Ashley-Koch, Allison; Williams, Redford B
2008-02-01
The monoamine oxidase-A (MAOA) gene plays a vital role in the metabolism of neurotransmitters, e.g, serotonin, norepinephrine, and dopamine. A polymorphism in the promoter region (MAOA-uVNTR) affects transcriptional efficiency. Allelic variation in MAOA-uVNTR has been associated with body mass index (BMI). We extended previous work by examining relations among this polymorphism and serum lipid levels. The sample consisted of 74 males enrolled in a study of caregivers for relatives with dementia. Regression models, adjusted for age, race, group status (caregiver/control), and cholesterol lowering medication (yes/no), were used to examine associations between high verses low MAOA-uVNTR activity alleles and total cholesterol, HDL, LDL, VLDL, LDL/HDL ratio, triglycerides, and BMI. Higher total cholesterol (p<0.03), LDL/HDL ratio (p<0.01), triglycerides (p<0.02), and VLDL (p<0.02) were associated with low activity MAOA-uVNTR alleles. HDL and LDL were modestly related to MAOA-uVNTR activity, however, they did not reach the conventional significance level (p<0.07 and p<0.10, respectively). BMI (p<0.74) was unrelated to MAOA-uVNTR transcription. The present findings suggest that MAOA-uVNTR may influence lipid levels and individuals with less active alleles are at increased health risk.
Rodríguez-García, María Elena; Cotrina-Vinagre, Francisco Javier; Carnicero-Rodríguez, Patricia; Martínez-Azorín, Francisco
2017-07-01
We have developed a new functional complementation approach to clone modifier genes which overexpression is able to suppress the biochemical defects caused by mtDNA mutations (suppressor genes). This strategy consists in transferring human genes into respiratory chain-deficient fibroblasts, followed by a metabolic selection in a highly selective medium. We used a normalized expression cDNA library in an episomal vector (pREP4) to transfect the fibroblasts, and a medium with glutamine and devoid of any carbohydrate source to select metabolically. Growing the patient's fibroblasts in this selective medium, the deficient cells rapidly disappear unless they are rescued by the cDNA of a suppressor gene. The use of an episomal vector allows us to carry out several rounds of transfection/selection (cyclical phenotypic rescue) to enrich the rescue with true clones of suppressor genes. Using fibroblasts from a patient with epileptic encephalopathy with the m.3946G>A (p.E214K) mutation in the MT-ND1 gene, several candidate genes were identified and one of them was characterized functionally. Thus, overexpression of MRPS18C gene (that encode for bS18m protein) suppressed the molecular defects produced by this mtDNA mutation, recovering the complex I activity and reducing the ROS produced by this complex to normal levels. We suggest that modulation of bS18m expression may be an effective therapeutic strategy for the patients with this mutation.