Ectopic Expression of Pumpkin Gibberellin Oxidases Alters Gibberellin Biosynthesis and Development of Transgenic Arabidopsis Plants1

PubMed Central

Radi, Abeer; Lange, Theo; Niki, Tomoya; Koshioka, Masaji; Lange, Maria João Pimenta

2006-01-01

Immature pumpkin (Cucurbita maxima) seeds contain gibberellin (GA) oxidases with unique catalytic properties resulting in GAs of unknown function for plant growth and development. Overexpression of pumpkin GA 7-oxidase (CmGA7ox) in Arabidopsis (Arabidopsis thaliana) resulted in seedlings with elongated roots, taller plants that flower earlier with only a little increase in bioactive GA4 levels compared to control plants. In the same way, overexpression of the pumpkin GA 3-oxidase1 (CmGA3ox1) resulted in a GA overdose phenotype with increased levels of endogenous GA4. This indicates that, in Arabidopsis, 7-oxidation and 3-oxidation are rate-limiting steps in GA plant hormone biosynthesis that control plant development. With an opposite effect, overexpression of pumpkin seed-specific GA 20-oxidase1 (CmGA20ox1) in Arabidopsis resulted in dwarfed plants that flower late with reduced levels of GA4 and increased levels of physiological inactive GA17 and GA25 and unexpected GA34 levels. Severe dwarfed plants were obtained by overexpression of the pumpkin GA 2-oxidase1 (CmGA2ox1) in Arabidopsis. This dramatic change in phenotype was accompanied by a considerable decrease in the levels of bioactive GA4 and an increase in the corresponding inactivation product GA34 in comparison to control plants. In this study, we demonstrate the potential of four pumpkin GA oxidase-encoding genes to modulate the GA plant hormone pool and alter plant stature and development. PMID:16384902

Ectopic expression of GA 2-oxidase 6 from rapeseed (Brassica napus L.) causes dwarfism, late flowering and enhanced chlorophyll accumulation in Arabidopsis thaliana.

PubMed

Yan, Jindong; Liao, Xiaoying; He, Reqing; Zhong, Ming; Feng, Panpan; Li, Xinmei; Tang, Dongying; Liu, Xuanming; Zhao, Xiaoying

2017-02-01

Gibberellins (GAs) are endogenous hormones that play an important role in higher plant growth and development. GA2-oxidase (GA2ox) promotes catabolism and inactivation of bioactive GAs or their precursors. In this study, we identified the GA2-oxidase gene, BnGA2ox6, and found it to be highly expressed in the silique and flower. Overexpression of BnGA2ox6 in Arabidopsis resulted in GA-deficiency symptoms, including inhibited elongation of the hypocotyl and stem, delayed seed germination, and late flowering. BnGA2ox6 overexpression reduced silique growth, but had no effect on seed development. Additionally, BnGA2ox6 overexpression enhanced chlorophyll b and total chlorophyll accumulation, and downregulated mRNA expression levels of the CHL1 and RCCR genes, which are involved in the chlorophyll degradation. These findings suggest that BnGA2ox6 regulates plant hight, silique development, flowering and chlorophyll accumulation in transgenic Arabidopsis. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Purification and partial amino-acid sequence of gibberellin 20-oxidase from Cucurbita maxima L. endosperm.

PubMed

Lange, T

1994-01-01

Gibberellin (GA) 20-oxidase was purified to apparent homogeneity from Cucurbita maxima endosperm by fractionated ammonium-sulphate precipitation, gel-filtration chromatography and anion-exchange and hydrophobic-interaction high-performance liquid chromatography (HPLC). Average purification after the last step was 55-fold with 3.9% of the activity recovered. The purest single fraction was enriched 101-fold with 0.2% overall recovery. Apparent relative molecular mass of the enzyme was 45 kDa, as determined by gel-filtration HPLC and sodium dodecyl sulphate-polyacrylamide gel electrophoresis, indicating that GA 20-oxidase is probably a monomeric enzyme. The purified enzyme degraded on two-dimensional gel electrophoresis, giving two protein spots: a major one corresponding to a molecular mass of 30 kDa and a minor one at 45 kDa. The isoelectric point for both was 5.4. The amino-acid sequences of the amino-terminus of the purified enzyme and of two peptides from a tryptic digest were determined. The purified enzyme catalysed the sequential conversion of [14C]GA12 to [14C]GA15, [14C]GA24 and [14C]GA25, showing that carbon atom 20 was oxidised to the corresponding alcohol, aldehyde and carboxylic acid in three consecutive reactions. [14C]Gibberellin A53 was similarly converted to [14C]GA44, [14C]GA19, [14C]GA17 and small amounts of a fourth product, which was preliminarily identified as [14C]GA20, a C19-gibberellin. All GAs except [14C]GA20 were identified by combined gas chromatography-mass spectrometry. The cofactor requirements in the absence of dithiothreitol were essentially as in its presence (Lange et al., Planta 195, 98-107, 1994), except that ascorbate was essential for enzyme activity and the optimal concentration of catalase was lower.

Rht18 Semidwarfism in Wheat Is Due to Increased GA 2-oxidaseA9 Expression and Reduced GA Content1[OPEN

PubMed Central

Karafiatova, Miroslava; Uauy, Cristobal

2018-01-01

Semidwarfing genes have improved crop yield by reducing height, improving lodging resistance, and allowing plants to allocate more assimilates to grain growth. In wheat (Triticum aestivum), the Rht18 semidwarfing gene was identified and deployed in durum wheat before it was transferred into bread wheat, where it was shown to have agronomic potential. Rht18, a dominant and gibberellin (GA) responsive mutant, is genetically and functionally distinct from the widely used GA-insensitive semidwarfing genes Rht-B1b and Rht-D1b. In this study, the Rht18 gene was identified by mutagenizing the semidwarf durum cultivar Icaro (Rht18) and generating mutants with a range of tall phenotypes. Isolating and sequencing chromosome 6A of these “overgrowth” mutants showed that they contained independent mutations in the coding region of GA2oxA9. GA2oxA9 is predicted to encode a GA 2-oxidase that metabolizes GA biosynthetic intermediates into inactive products, effectively reducing the amount of bioactive GA (GA1). Functional analysis of the GA2oxA9 protein demonstrated that GA2oxA9 converts the intermediate GA12 to the inactive metabolite GA110. Furthermore, Rht18 showed higher expression of GA2oxA9 and lower GA content compared with its tall parent. These data indicate that the increased expression of GA2oxA9 in Rht18 results in a reduction of both bioactive GA content and plant height. This study describes a height-reducing mechanism that can generate new genetic diversity for semidwarfism in wheat by combining increased expression with mutations of specific amino acid residues in GA2oxA9. PMID:29545269

Effect of exogenous GA3 and its inhibitor paclobutrazol on floral formation, endogenous hormones, and flowering-associated genes in 'Fuji' apple (Malus domestica Borkh.).

PubMed

Zhang, Songwen; Zhang, Dong; Fan, Sheng; Du, Lisha; Shen, Yawen; Xing, Libo; Li, Youmei; Ma, Juanjuan; Han, Mingyu

2016-10-01

Gibberellins (GAs) reduce apple (Malus domestica) flowering rates; however, the mechanism of their action is not fully understood. To gain a better insight into gibberellin-regulated flowering, here, 5 year-old 'Fuji' apple trees were used to explore the responses of hormones [GA1+3, GA4+7, indole-3-acetic acid (IAA), zeatin-riboside (ZR), and abscisic acid (ABA)], and gibberellin- and flowering-associated genes, to applications of gibberellin acid (GA3) and paclobutrazol (PAC). Results showed that GA3 relatively stimulated vegetative growth and delayed floral induction. Moreover, GA3 spraying significantly affected contents of all endogenous hormones and all the genes tested in at least one time points: the content of endogenous GAs was increased instantly and that of ZR was reduced at 44 days after fullbloom (DAF), which might constitute an unfavorable factor for flower formation; MdKO (ent-kaurene oxidase gene) and MdGA20ox (GA20 oxidase gene) were significantly repressed by a high level of GAs through the negative feedback regulation of GA; additionally, the MdSPLs (SQUAMOSA-PROMOTER BINDING PROTEIN-LIKE) in this study were all significantly repressed by GA3 but promoted by PAC; the expression of MdFT1/2 (FLOWERING LOCUS T), MdSOC1 (SUPPRESSOR OF OVEREXPRESSION OF CONSTANS1) and MdAP1 (APETALA1) in GA3-treated buds changed in the same way, and they were repressed at 44 DAF. We suppose that GA3 spraying disrupts the balance between ZR and GAs, and inhibits floral induction, probably by suppressing MdSPLs and the floral integrators in flower induction, which ultimately contributed to inhibiting flower formation. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

[Molecular mechanism of AtGA3OX1 and AtGA3OX2 genes affecting secondary wall thickening in stems in Arabidopsis].

PubMed

Wang, Zeng-Guang; Chai, Guo-Hua; Wang, Zhi-Yao; Tang, Xian-Feng; Sun, Chang-Jiang; Zhou, Gong-Ke; Ma, San-Mei

2013-05-01

Bioactive gibberellins (GAs) are a type of important plant growth regulators, which play the key roles in multiple processes, such as seed germination, leaf expansion, flowering, fruit bearing, and stem development. Its biosynthesis is regulated by a variety of enzymes including gibberellin 3-oxidase that is a key rate-limiting enzyme. In Arabidopsis, gibberellin 3-oxidase consists of four members, of which AtGA3OX1 and AtGA3OX2 are highly expressed in stems, suggesting the potential roles in the stem development played by the two genes. To date, there are few studies on AtGA3OX1 and AtGA3OX2 regulating secondary wall thickening in stems. In this study, we used the atga3ox1atga3ox2 double mutant as the materials to study the effects of AtGA3OX1 and AtGA3OX2 genes on secondary wall thickening in stems. The results indicated that simulations repression of AtGA3OX1 and AtGA3OX2 genes resulted in significantly reduction of secondary wall thickening of fiber cells, but not that of vessel cells. Three main components (cellulose, hemicelluloses, and lignin) were also dramatically suppressed in the double mutants. qRT-PCR analysis demonstrated that the expressions of secondary wall biosynthetic genes and the associated transcription factors were obviously affected in AtGA3OX1 and AtGA3OX2 double mutant. Therefore, we presume that Arabidopsis AtGA3OX1 and AtGA3OX2 genes might activate the expression of these transcription factors, thus regulate secondary wall thickening in stems. Together, our results provide a theoretical basis for enhancing the lodging resistance of food crops and improving the biomass of energy plants by genetically engineering Arabidopsis AtGA3OX homologs.

Feed-back regulation of gibberellin biosynthesis and gene expression in Pisum sativum L.

PubMed

Martin, D N; Proebsting, W M; Parks, T D; Dougherty, W G; Lange, T; Lewis, M J; Gaskin, P; Hedden, P

1996-01-01

Treatment of tall and dwarf (3 beta-hydroxylase impaired) genotypes of pea (Pisum sativum L.) with the synthetic, highly active gibberellin (GA), 2,2-dimethyl GA4, reduced the shoot contents of C19-GAs, including GA1, and increased the concentration of the C20-GA, GA19. In shoots of the slender (la crys) mutant, the content of C19-GAs was lower and GA19 content was higher than in those of the tall line. Metabolism of GA19 and GA20 in leaves of a severe (na) GA-deficient dwarf mutant was reduced by GA treatment. The results suggest feed-back regulation of the 20-oxidation and 3 beta-hydroxylation reactions. Feed-back regulation of GA 20-oxidation was studied further using a cloned GA 20-oxidase cDNA from pea. The cDNA, Ps074, was isolated using polymerase chain reaction with degenerate oligonucleotide primers based on pumpkin and Arabidopsis 20-oxidase sequences. After expression of this cDNA clone in Escherichia coli, the product oxidized GA12 to GA15, GA24 and the C19-GA, GA9, which was the major product. The 13-hydroxylated substrate GA53 was similarly oxidized, but less effectively than GA12, giving mainly GA44 with low yields of GA19 and GA20. Ps074 hybridized to polyadenylated RNA from expanding shoots of pea. Amounts of this transcript were less in the slender genotype than in the tall line and were reduced in GA-deficient genotypes by treatment with GA3, suggesting that there is feed-back regulation of GA 20-oxidase gene expression.

OsGA2ox5, a Gibberellin Metabolism Enzyme, Is Involved in Plant Growth, the Root Gravity Response and Salt Stress

PubMed Central

Shan, Chi; Mei, Zhiling; Duan, Jianli; Chen, Haiying; Feng, Huafeng; Cai, Weiming

2014-01-01

Gibberellin (GA) 2-oxidases play an important role in the GA catabolic pathway through 2β-hydroxylation. There are two classes of GA2oxs, i.e., a larger class of C19-GA2oxs and a smaller class of C20-GA2oxs. In this study, the gene encoding a GA 2-oxidase of rice, Oryza sativa GA 2-oxidase 5 (OsGA2ox5), was cloned and characterized. BLASTP analysis showed that OsGA2ox5 belongs to the C20-GA2oxs subfamily, a subfamily of GA2oxs acting on C20-GAs (GA12, GA53). Subcellular localization of OsGA2ox5-YFP in transiently transformed onion epidermal cells revealed the presence of this protein in both of the nucleus and cytoplasm. Real-time PCR analysis, along with GUS staining, revealed that OsGA2ox5 is expressed in the roots, culms, leaves, sheaths and panicles of rice. Rice plants overexpressing OsGA2ox5 exhibited dominant dwarf and GA-deficient phenotypes, with shorter stems and later development of reproductive organs than the wild type. The dwarfism phenotype was partially rescued by the application of exogenous GA3 at a concentration of 10 µM. Ectopic expression of OsGA2ox5 cDNA in Arabidopsis resulted in a similar phenotype. Real-time PCR assays revealed that both GA synthesis-related genes and GA signaling genes were expressed at higher levels in transgenic rice plants than in wild-type rice; OsGA3ox1, which encodes a key enzyme in the last step of the bioactive GAs synthesis pathway, was highly expressed in transgenic rice. The roots of OsGA2ox5-ox plants exhibited increased starch granule accumulation and gravity responses, revealing a role for GA in root starch granule development and gravity responses. Furthermore, rice and Arabidopsis plants overexpressing OsGA2ox5 were more resistant to high-salinity stress than wild-type plants. These results suggest that OsGA2ox5 plays important roles in GAs homeostasis, development, gravity responses and stress tolerance in rice. PMID:24475234

OsGA2ox5, a Gibberellin Metabolism Enzyme, Is Involved in Plant Growth, the Root Gravity Response and Salt Stress

NASA Astrophysics Data System (ADS)

Cai, Weiming; Shan, Chi

Gibberellin (GA) 2-oxidases play an important role in the GA catabolic pathway through 2b-hydroxylation. There are two classes of GA2oxs, i.e., a larger class of C19-GA2oxs and a smaller class of C20-GA2oxs. In this study, the gene encoding a GA 2-oxidase of rice, Oryza sativa GA 2-oxidase 5 (OsGA2ox5), was cloned and characterized. BLASTP analysis showed that OsGA2ox5 belongs to the C20-GA2oxs subfamily, a subfamily of GA2oxs acting on C20-GAs (GA12, GA53). Subcellular localization of OsGA2ox5-YFP in transiently transformed onion epidermal cells revealed the presence of this protein in both of the nucleus and cytoplasm. Real-time PCR analysis, along with GUS staining, revealed that OsGA2ox5 is expressed in the roots, culms, leaves, sheaths and panicles of rice. Rice plants overexpressing OsGA2ox5 exhibited dominant dwarf and GAdeficient phenotypes, with shorter stems and later development of reproductive organs than the wild type. The dwarfism phenotype was partially rescued by the application of exogenous GA3 at a concentration of 10 mM. Ectopic expression of OsGA2ox5 cDNA in Arabidopsis resulted in a similar phenotype. Real-time PCR assays revealed that both GA synthesis-related genes and GA signaling genes were expressed at higher levels in transgenic rice plants than in wild-type rice; OsGA3ox1, which encodes a key enzyme in the last step of the bioactive GAs synthesis pathway, was highly expressed in transgenic rice. The roots of OsGA2ox5-ox plants exhibited increased starch granule accumulation and gravity responses, revealing a role for GA in root starch granule development and gravity responses. Furthermore, rice and Arabidopsis plants overexpressing OsGA2ox5 were more resistant to high-salinity stress than wild-type plants. These results suggest that OsGA2ox5 plays important roles in GAs homeostasis, development, gravity responses and stress tolerance in rice.

Mechanism of internal browning of pineapple: The role of gibberellins catabolism gene (AcGA2ox) and GAs

PubMed Central

Zhang, Qin; Rao, Xiuwen; Zhang, Lubin; He, Congcong; Yang, Fang; Zhu, Shijiang

2016-01-01

Internal browning (IB), a physiological disorder (PD) that causes severe losses in harvested pineapple, can be induced by exogenous gibberellins (GAs). Over the years, studies have focused on roles of Gibberellin 2-oxidase (GA2oxs), the major GAs catabolic enzyme in plants, in the regulation of changes in morphology or biomass. However, whether GA2oxs could regulate PD has not been reported. Here, a full-length AcGA2ox cDNA was isolated from pineapple, with the putative protein sharing 23.59% to 72.92% identity with GA2oxs from five other plants. Pineapples stored at 5 °C stayed intact, while those stored at 20 °C showed severe IB. Storage at 5 °C enhanced AcGA2ox expression and decreased levels of a GAs (GA4) ‘compared with storage at 20 °C. However, at 20 °C, exogenous application of abscisic acid (ABA) significantly suppressed IB. ABA simultaneously upregulated AcGA2ox and reduced GA4. Ectopic expression of AcGA2ox in Arabidopsis resulted in reduced GA4, lower seed germination, and shorter hypocotyls and roots, all of which were restored by exogenous GA4/7. Moreover, in pineapple, GA4/7 upregulated polyphenol oxidase, while storage at 5 °C and ABA downregulated it. These results strongly suggest the involvement of AcGA2ox in regulation of GAs levels and a role of AcGA2ox in regulating IB. PMID:27982026

Ectopic expression of specific GA2 oxidase mutants promotes yield and stress tolerance in rice.

PubMed

Lo, Shuen-Fang; Ho, Tuan-Hua David; Liu, Yi-Lun; Jiang, Mirng-Jier; Hsieh, Kun-Ting; Chen, Ku-Ting; Yu, Lin-Chih; Lee, Miin-Huey; Chen, Chi-Yu; Huang, Tzu-Pi; Kojima, Mikiko; Sakakibara, Hitoshi; Chen, Liang-Jwu; Yu, Su-May

2017-07-01

A major challenge of modern agricultural biotechnology is the optimization of plant architecture for enhanced productivity, stress tolerance and water use efficiency (WUE). To optimize plant height and tillering that directly link to grain yield in cereals and are known to be tightly regulated by gibberellins (GAs), we attenuated the endogenous levels of GAs in rice via its degradation. GA 2-oxidase (GA2ox) is a key enzyme that inactivates endogenous GAs and their precursors. We identified three conserved domains in a unique class of C 20 GA2ox, GA2ox6, which is known to regulate the architecture and function of rice plants. We mutated nine specific amino acids in these conserved domains and observed a gradient of effects on plant height. Ectopic expression of some of these GA2ox6 mutants moderately lowered GA levels and reprogrammed transcriptional networks, leading to reduced plant height, more productive tillers, expanded root system, higher WUE and photosynthesis rate, and elevated abiotic and biotic stress tolerance in transgenic rice. Combinations of these beneficial traits conferred not only drought and disease tolerance but also increased grain yield by 10-30% in field trials. Our studies hold the promise of manipulating GA levels to substantially improve plant architecture, stress tolerance and grain yield in rice and possibly in other major crops. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Gibberellins and stem growth in Arabidopsis thaliana. Effects of photoperiod on expression of the GA4 and GA5 loci.

PubMed

Xu, Y L; Gage, D A; Zeevaart, J A

1997-08-01

Arabidopsis thaliana (L.) Heynh. is a quantitative long-day (LD) rosette plant in which stem growth is mediated by gibberellins (CAs). Application of GAs to plants in short-day (SD) conditions resulted in rapid stem elongation and flower formation, with GA4 and GA9 being equally effective, and GA1 showing lower activity. The effects of photoperiod on the levels of endogenous GAs were measured by combined gas chromatography-mass spectrometry with selected ion monitoring. When plants were transferred from SD to LD conditions there was a slight decrease in the level of GA53 and an increase in the levels of C19-GAs, GA9, GA20, GA1, and GA8, indicating that GA 20-oxidase activity is stimulated in LD conditions. Expression of GA5, which encodes GA 20-oxidase, was highest in elongating stems and was correlated with the rate of stem elongation. By contrast, GA4, which encodes 3 beta-hydroxylase, showed low expression in stems and its expression was not correlated with the rate of stem elongation. We conclude that stem elongation in LD conditions is at least in part due to increased expression of GA5, whereas expression of GA4 is not under photoperiodic control.

Association analysis of a polymorphism of the monoamine oxidase B gene with Parkinson`s disease in a Japanese population

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morimoto, Yuji; Murayama, Nobuhiro; Kuwano, Akira

1995-12-18

The polymorphic allele of the monoamine oxidase B (MAO-B) gene detected by polymerase chain reaction (PCR) and single-stranded conformation polymorphism (SSCP) was associated with Parkinson`s disease (PD) in Caucasians. We characterized this polymorphic allele, allele 1, of the MAO-B gene using direct sequencing of PCR products. A single DNA substitution (G-A), resulting gain of Mae III restriction site was detected in intron 13 of the MAO-B gene. The allele associated with PD in Caucasians was twice as frequent as in healthy Japanese, but the association of the allele of the MAO-B gene was not observed in Japanese patients with PD.more » 7 refs., 2 figs., 1 tab.« less

Expression of Mitochondrial Cytochrome C Oxidase Chaperone Gene (COX20) Improves Tolerance to Weak Acid and Oxidative Stress during Yeast Fermentation

PubMed Central

Kumar, Vinod; Hart, Andrew J.; Keerthiraju, Ethiraju R.; Waldron, Paul R.; Tucker, Gregory A.; Greetham, Darren

2015-01-01

Introduction Saccharomyces cerevisiae is the micro-organism of choice for the conversion of fermentable sugars released by the pre-treatment of lignocellulosic material into bioethanol. Pre-treatment of lignocellulosic material releases acetic acid and previous work identified a cytochrome oxidase chaperone gene (COX20) which was significantly up-regulated in yeast cells in the presence of acetic acid. Results A Δcox20 strain was sensitive to the presence of acetic acid compared with the background strain. Overexpressing COX20 using a tetracycline-regulatable expression vector system in a Δcox20 strain, resulted in tolerance to the presence of acetic acid and tolerance could be ablated with addition of tetracycline. Assays also revealed that overexpression improved tolerance to the presence of hydrogen peroxide-induced oxidative stress. Conclusion This is a study which has utilised tetracycline-regulated protein expression in a fermentation system, which was characterised by improved (or enhanced) tolerance to acetic acid and oxidative stress. PMID:26427054

A Single Nucleotide Deletion in Gibberellin20-oxidase1 Causes Alpine Dwarfism in Arabidopsis.

PubMed

Luo, Yonghai; Dong, Xinwei; Yu, Tianying; Shi, Xuan; Li, Zongyun; Yang, Weicai; Widmer, Alex; Karrenberg, Sophie

2015-07-01

Alpine dwarfism is widely observed in alpine plant populations and often considered a high-altitude adaptation, yet its molecular basis and ecological relevance remain unclear. In this study, we used map-based cloning and field transplant experiments to investigate dwarfism in natural Arabidopsis (Arabidopsis thaliana) accessions collected from the Swiss Alps. A loss-of-function mutation due to a single nucleotide deletion in gibberellin20-oxidase1 (GA5) was identified as the cause of dwarfism in an alpine accession. The mutated allele, ga5-184, was found in two natural Arabidopsis populations collected from one geographic region at high altitude, but was different from all other reported ga5 null alleles, suggesting that this allele has evolved locally. In field transplant experiments, the dwarf accession with ga5-184 exhibited a fitness pattern consistent with adaptation to high altitude. Across a wider array of accessions from the Swiss Alps, plant height decreased with altitude of origin, but fitness patterns in the transplant experiments were variable and general altitudinal adaptation was not evident. In general, our study provides new insights into molecular basis and possible ecological roles of alpine dwarfism, and demonstrates the importance of the GA-signaling pathway for the generation of ecologically relevant variation in higher plants. © 2015 American Society of Plant Biologists. All Rights Reserved.

Dexamethasone but not indomethacin inhibits human phagocyte nicotinamide adenine dinucleotide phosphate oxidase activity by down-regulating expression of genes encoding oxidase components.

PubMed

Condino-Neto, A; Whitney, C; Newburger, P E

1998-11-01

We investigated the effects of dexamethasone or indomethacin on the NADPH oxidase activity, cytochrome b558 content, and expression of genes encoding the components gp91-phox and p47-phox of the NADPH oxidase system in the human monocytic THP-1 cell line, differentiated with IFN-gamma and TNF-alpha, alone or in combination, for up to 7 days. IFN-gamma and TNF-alpha, alone or in combination, caused a significant up-regulation of the NADPH oxidase system as reflected by an enhancement of the PMA-stimulated superoxide release, cytochrome b558 content, and expression of gp91-phox and p47-phox genes on both days 2 and 7 of cell culture. Noteworthy was the tremendous synergism between IFN-gamma and TNF-alpha for all studied parameters. Dexamethasone down-regulated the NADPH oxidase system of cytokine-differentiated THP-1 cells as assessed by an inhibition on the PMA-stimulated superoxide release, cytochrome b558 content, and expression of the gp91-phox and p47-phox genes. The nuclear run-on assays indicated that dexamethasone down-regulated the NADPH oxidase system at least in part by inhibiting the transcription of gp91-phox and p47-phox genes. Indomethacin inhibited only the PMA-stimulated superoxide release of THP-1 cells differentiated with IFN-gamma and TNF-alpha during 7 days. None of the other parameters was affected by indomethacin. We conclude that dexamethasone down-regulates the NADPH oxidase system at least in part by inhibiting the expression of genes encoding the gp91-phox and p47-phox components of the NADPH oxidase system.

Breadfruit (Artocarpus altilis) gibberellin 2-oxidase genes in stem elongation and abiotic stress response.

PubMed

Zhou, Yuchan; Underhill, Steven J R

2016-01-01

Breadfruit (Artocarpus altilis) is a traditional staple tree crop in the Oceania. Susceptibility to windstorm damage is a primary constraint on breadfruit cultivation. Significant tree loss due to intense tropical windstorm in the past decades has driven a widespread interest in developing breadfruit with dwarf stature. Gibberellin (GA) is one of the most important determinants of plant height. GA 2-oxidase is a key enzyme regulating the flux of GA through deactivating biologically active GAs in plants. As a first step toward understanding the molecular mechanism of growth regulation in the species, we isolated a cohort of four full-length GA2-oxidase cDNAs, AaGA2ox1- AaGA2ox4 from breadfruit. Sequence analysis indicated the deduced proteins encoded by these AaGA2oxs clustered together under the C19 GA2ox group. Transcripts of AaGA2ox1, AaGA2ox2 and AaGA2ox3 were detected in all plant organs, but exhibited highest level in source leaves and stems. In contrast, transcript of AaGA2ox4 was predominantly expressed in roots and flowers, and displayed very low expression in leaves and stems. AaGA2ox1, AaGA2ox2 and AaGA2ox3, but not AaGA2ox4 were subjected to GA feedback regulation where application of exogenous GA3 or gibberellin biosynthesis inhibitor, paclobutrazol was shown to manipulate the first internode elongation of breadfruit. Treatments of drought or high salinity increased the expression of AaGA2ox1, AaGA2ox2 and AaGA2ox4. But AaGA2ox3 was down-regulated under salt stress. The function of AaGA2oxs is discussed with particular reference to their role in stem elongation and involvement in abiotic stress response in breadfruit. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

Gene cloning and heterologous expression of pyranose 2-oxidase from the brown-rot fungus, Gloeophyllum trabeum

Treesearch

Diane Dietrich; Casey Crooks

2009-01-01

A pyranose 2-oxidase gene from the brown-rot basidiomycete Gloeophyllum trabeum was isolated using homology-based degenerate PCR. The gene structure was determined and compared to that of several pyranose 2-oxidases cloned from white-rot fungi. The G. trabeum pyranose 2-oxidase gene consists of 16 coding exons with canonical promoter CAAT and TATA elements in the 5’UTR...

Cloning and Analysis of the Alternative Oxidase Gene of Neurospora Crassa

PubMed Central

Li, Q.; Ritzel, R. G.; McLean, LLT.; McIntosh, L.; Ko, T.; Bertrand, H.; Nargang, F. E.

1996-01-01

Mitochondria of Neurospora crassa contain a cyanide-resistant alternative respiratory pathway in addition to the cytochrome pathway. The alternative oxidase is present only when electron flow through the cytochrome chain is restricted. Both genomic and cDNA copies for the alternative oxidase gene have been isolated and analyzed. The sequence of the predicted protein is homologous to that of other species. The mRNA for the alternative oxidase is scarce in wild-type cultures grown under normal conditions, but it is abundant in cultures grown in the presence of chloramphenicol, an inhibitor of mitochondrial protein synthesis, or in mutants deficient in mitochondrial cytochromes. Thus, induction of alternative oxidase appears to be at the transcriptional level. Restriction fragment length polymorphism mapping of the isolated gene demonstrated that it is located in a position corresponding to the aod-1 locus. Sequence analysis of mutant aod-1 alleles reveals mutations affecting the coding sequence of the alternative oxidase. The level of aod-1 mRNA in an aod-2 mutant strain that had been grown in the presence of chloramphenicol was reduced several fold relative to wild-type, supporting the hypothesis that the product of aod-2 is required for optimal expression of aod-1. PMID:8770590

Molecular evolution of the polyamine oxidase gene family in Metazoa

PubMed Central

2012-01-01

Background Polyamine oxidase enzymes catalyze the oxidation of polyamines and acetylpolyamines. Since polyamines are basic regulators of cell growth and proliferation, their homeostasis is crucial for cell life. Members of the polyamine oxidase gene family have been identified in a wide variety of animals, including vertebrates, arthropodes, nematodes, placozoa, as well as in plants and fungi. Polyamine oxidases (PAOs) from yeast can oxidize spermine, N1-acetylspermine, and N1-acetylspermidine, however, in vertebrates two different enzymes, namely spermine oxidase (SMO) and acetylpolyamine oxidase (APAO), specifically catalyze the oxidation of spermine, and N1-acetylspermine/N1-acetylspermidine, respectively. Little is known about the molecular evolutionary history of these enzymes. However, since the yeast PAO is able to catalyze the oxidation of both acetylated and non acetylated polyamines, and in vertebrates these functions are addressed by two specialized polyamine oxidase subfamilies (APAO and SMO), it can be hypothesized an ancestral reference for the former enzyme from which the latter would have been derived. Results We analysed 36 SMO, 26 APAO, and 14 PAO homologue protein sequences from 54 taxa including various vertebrates and invertebrates. The analysis of the full-length sequences and the principal domains of vertebrate and invertebrate PAOs yielded consensus primary protein sequences for vertebrate SMOs and APAOs, and invertebrate PAOs. This analysis, coupled to molecular modeling techniques, also unveiled sequence regions that confer specific structural and functional properties, including substrate specificity, by the different PAO subfamilies. Molecular phylogenetic trees revealed a basal position of all the invertebrates PAO enzymes relative to vertebrate SMOs and APAOs. PAOs from insects constitute a monophyletic clade. Two PAO variants sampled in the amphioxus are basal to the dichotomy between two well supported monophyletic clades including

Molecular evolution of the polyamine oxidase gene family in Metazoa.

PubMed

Polticelli, Fabio; Salvi, Daniele; Mariottini, Paolo; Amendola, Roberto; Cervelli, Manuela

2012-06-20

Polyamine oxidase enzymes catalyze the oxidation of polyamines and acetylpolyamines. Since polyamines are basic regulators of cell growth and proliferation, their homeostasis is crucial for cell life. Members of the polyamine oxidase gene family have been identified in a wide variety of animals, including vertebrates, arthropodes, nematodes, placozoa, as well as in plants and fungi. Polyamine oxidases (PAOs) from yeast can oxidize spermine, N1-acetylspermine, and N1-acetylspermidine, however, in vertebrates two different enzymes, namely spermine oxidase (SMO) and acetylpolyamine oxidase (APAO), specifically catalyze the oxidation of spermine, and N1-acetylspermine/N1-acetylspermidine, respectively. Little is known about the molecular evolutionary history of these enzymes. However, since the yeast PAO is able to catalyze the oxidation of both acetylated and non acetylated polyamines, and in vertebrates these functions are addressed by two specialized polyamine oxidase subfamilies (APAO and SMO), it can be hypothesized an ancestral reference for the former enzyme from which the latter would have been derived. We analysed 36 SMO, 26 APAO, and 14 PAO homologue protein sequences from 54 taxa including various vertebrates and invertebrates. The analysis of the full-length sequences and the principal domains of vertebrate and invertebrate PAOs yielded consensus primary protein sequences for vertebrate SMOs and APAOs, and invertebrate PAOs. This analysis, coupled to molecular modeling techniques, also unveiled sequence regions that confer specific structural and functional properties, including substrate specificity, by the different PAO subfamilies. Molecular phylogenetic trees revealed a basal position of all the invertebrates PAO enzymes relative to vertebrate SMOs and APAOs. PAOs from insects constitute a monophyletic clade. Two PAO variants sampled in the amphioxus are basal to the dichotomy between two well supported monophyletic clades including, respectively, all

Overexpression of the gibberellin 2-oxidase gene from Torenia fournieri induces dwarf phenotypes in the liliaceous monocotyledon Tricyrtis sp.

PubMed

Otani, Masahiro; Meguro, Shuhei; Gondaira, Haruka; Hayashi, Megumi; Saito, Misaki; Han, Dong-Sheng; Inthima, Phithak; Supaibulwatana, Kanyaratt; Mori, Shiro; Jikumaru, Yusuke; Kamiya, Yuji; Li, Tuoping; Niki, Tomoya; Nishijima, Takaaki; Koshioka, Masaji; Nakano, Masaru

2013-11-01

Gibberellins (GAs) are the plant hormones that control many aspects of plant growth and development, including stem elongation. Genes encoding enzymes related to the GA biosynthetic and metabolic pathway have been isolated and characterized in many plant species. Gibberellin 2-oxidase (GA2ox) catalyzes bioactive GAs or their immediate precursors to inactive forms; therefore, playing a direct role in determining the levels of bioactive GAs. In the present study, we produced transgenic plants of the liliaceous monocotyledon Tricyrtis sp. overexpressing the GA2ox gene from the linderniaceous dicotyledon Torenia fournieri (TfGA2ox2). All six transgenic plants exhibited dwarf phenotypes, and they could be classified into two classes according to the degree of dwarfism: three plants were moderately dwarf and three were severely dwarf. All of the transgenic plants had small or no flowers, and smaller, rounder and darker green leaves. Quantitative real-time reverse transcription-polymerase chain reaction (PCR) analysis showed that the TfGA2ox2 expression level generally correlated with the degree of dwarfism. The endogenous levels of bioactive GAs, GA1 and GA4, largely decreased in transgenic plants as shown by liquid chromatography-mass spectrometry (LC-MS) analysis, and the level also correlated with the degree of dwarfism. Exogenous treatment of transgenic plants with gibberellic acid (GA3) resulted in an increased shoot length, indicating that the GA signaling pathway might normally function in transgenic plants. Thus, morphological changes in transgenic plants may result from a decrease in the endogenous levels of bioactive GAs. Finally, a possibility of molecular breeding for plant form alteration in liliaceous ornamental plants by genetically engineering the GA metabolic pathway is discussed. Copyright © 2013 Elsevier GmbH. All rights reserved.

Monoamine oxidase a promoter gene associated with problem behavior in adults with intellectual/developmental disabilities.

PubMed

May, Michael E; Srour, Ali; Hedges, Lora K; Lightfoot, David A; Phillips, John A; Blakely, Randy D; Kennedy, Craig H

2009-07-01

A functional polymorphism in the promoter of the gene encoding monoamine oxidase A has been associated with problem behavior in various populations. We examined the association of MAOA alleles in adult males with intellectual/developmental disabilities with and without established histories of problem behavior. These data were compared with a gender, ethnicity, and age-matched contrast sample. About 43% (15/35) of adults with intellectual/developmental disabilities and problem behavior possessed the low-efficiency version of the MAOA gene. In comparison, 20% (7/35) of adults with intellectual/developmental disabilities and no problem behavior and 20% (7/35) of the contrast group had the short-allele MAOA polymorphism. Therefore, a common variant in the MAOA gene may be associated with problem behavior in adults with intellectual/developmental disabilities.

Activation of gibberellin 2-oxidase 6 decreases active gibberellin levels and creates a dominant semi-dwarf phenotype in rice (Oryza sativa L.).

PubMed

Huang, Jian; Tang, Ding; Shen, Yi; Qin, Baoxiang; Hong, Lilan; You, Aiqing; Li, Ming; Wang, Xin; Yu, Hengxiu; Gu, Minghong; Cheng, Zhukuan

2010-01-01

Gibberellin (GA) 2-oxidase plays a key role in the GA catabolic pathway through 2beta-hydroxylation. In the present study, we isolated a CaMV 35S-enhancer activation tagged mutant, H032. This mutant exhibited a dominant dwarf and GA-deficient phenotype, with a final stature that was less than half of its wild-type counterpart. The endogenous bioactive GAs are markedly decreased in the H032 mutant, and application of bioactive GAs (GA(3) or GA(4)) can reverse the dwarf phenotype. The integrated T-DNA was detected 12.8 kb upstream of the OsGA2ox6 in the H032 genome by TAIL-PCR. An increased level of OsGA2ox6 mRNA was detected at a high level in the H032 mutant, which might be due to the enhancer role of the CaMV 35S promoter. RNAi and ectopic expression analysis of OsGA2ox6 indicated that the dwarf trait and the decreased levels of bioactive GAs in the H032 mutant were a result of the up-regulation of the OsGA2ox6 gene. BLASTP analysis revealed that OsGA2ox6 belongs to the class III of GA 2-oxidases, which is a novel type of GA2ox that uses C20-GAs (GA(12) and/or GA(53)) as the substrates. Interestingly, we found that a GA biosynthesis inhibitor, paclobutrazol, positively regulated the OsGA2ox6 gene. Unlike the over-expression of OsGA2ox1, which led to a high rate of seed abortion, the H032 mutant retained normal flowering and seed production. These results indicate that OsGA2ox6 mainly affects plant stature, and the dominant dwarf trait of the H032 mutant can be used as an efficient dwarf resource in rice breeding. Copyright 2010 Institute of Genetics and Developmental Biology and the Genetics Society of China. Published by Elsevier Ltd. All rights reserved.

Cytochrome oxidase subunit II gene in mitochondria of Oenothera has no intron

PubMed Central

Hiesel, Rudolf; Brennicke, Axel

1983-01-01

The cytochrome oxidase subunit II gene has been localized in the mitochondrial genome of Oenothera berteriana and the nucleotide sequence has been determined. The coding sequence contains 777 bp and, unlike the corresponding gene in Zea mays, is not interrupted by an intron. No TGA codon is found within the open reading frame. The codon CGG, as in the maize gene, is used in place of tryptophan codons of corresponding genes in other organisms. At position 742 in the Oenothera sequence the TGG of maize is changed into a CGG codon, where Trp is conserved as the amino acid in other organisms. Homologous sequences occur more than once in the mitochondrial genome as several mitochondrial DNA species hybridize with DNA probes of the cytochrome oxidase subunit II gene. ImagesFig. 5. PMID:16453484

Axillary buds are dwarfed shoots that tightly regulate GA pathway and GA-inducible 1,3-β-glucanase genes during branching in hybrid aspen

PubMed Central

Rinne, Päivi L.H.; Paul, Laju K.; Vahala, Jorma; Kangasjärvi, Jaakko; van der Schoot, Christiaan

2016-01-01

Axillary buds (AXBs) of hybrid aspen (Populus tremula×P. tremuloides) contain a developing dwarfed shoot that becomes para-dormant at the bud maturation point. Para-dormant AXBs can grow out after stem decapitation, while dormant AXBs pre-require long-term chilling to release them from dormancy. The latter is mediated by gibberellin (GA)-regulated 1,3-β-glucanases, but it is unknown if GA is also important in the development, activation, and outgrowth of para-dormant AXBs. The present data show that para-dormant AXBs up-regulate GA receptor genes during their maturation, but curtail GA biosynthesis by down-regulating the rate-limiting GIBBERELLIN 3-OXIDASE2 (GA3ox2), which is characteristically expressed in the growing apex. However, decapitation significantly up-regulated GA3ox2 and GA4-responsive 1,3-β-glucanases (GH17-family; α-clade). In contrast, decapitation down-regulated γ-clade 1,3-β-glucanases, which were strongly up-regulated in maturing AXBs concomitant with lipid body accumulation. Overexpression of selected GH17 members in hybrid aspen resulted in characteristic branching patterns. The α-clade member induced an acropetal branching pattern, whereas the γ-clade member activated AXBs in recurrent flushes during transient cessation of apex proliferation. The results support a model in which curtailing the final step in GA biosynthesis dwarfs the embryonic shoot, while high levels of GA precursors and GA receptors keep AXBs poised for growth. GA signaling, induced by decapitation, reinvigorates symplasmic supply routes through GA-inducible 1,3-β-glucanases that hydrolyze callose at sieve plates and plasmodesmata. PMID:27697786

A gene encoding the plant-like alternative oxidase is present in Phytomonas but absent in Leishmania spp.

PubMed

Van Hellemond, J J; Simons, B; Millenaar, F F; Tielens, A G

1998-01-01

The constituents of the respiratory chain are believed to differ among the trypanosomatids; bloodstream stages of African trypanosomes and Phytomonas promastigotes oxidize ubiquinol by a ubiquinol:oxygen oxidoreductase, also known as alternative oxidase, whereas Leishmania spp. oxidize ubiquinol via a classic cytochrome-containing respiratory chain. The molecular basis for this elementary difference in ubiquinol oxidation by the mitochondrial electron-transport chain in distinct trypanosomatids was investigated. The presence of a gene encoding the plant-like alternative oxidase could be demonstrated in Phytomonas and Trypanosoma brucei, trypanosomatids that are known to contain alternative oxidase activity. Our results further demonstrated that Leishmania spp. lack a gene encoding the plant-like alternative oxidase, and therefore, all stages of Leishmania spp. will lack the alternative oxidase protein. The observed fundamental differences between the respiratory chains of distinct members of the trypanosomatid family are thus caused by the presence or absence of a gene encoding the plant-like alternative oxidase.

Overexpression of Jatropha Gibberellin 2-oxidase 6 (JcGA2ox6) Induces Dwarfism and Smaller Leaves, Flowers and Fruits in Arabidopsis and Jatropha

PubMed Central

Hu, Ying-Xiong; Tao, Yan-Bin; Xu, Zeng-Fu

2017-01-01

Gibberellins (GAs) are plant hormones that play fundamental roles in plant growth and development. Gibberellin 2-oxidase (GA2ox) plays a direct role in determining the levels of bioactive GAs by catalyzing bioactive GAs or their immediate precursors to inactive forms. In this study, a GA2ox gene, designated JcGA2ox6, was isolated from Jatropha curcas. JcGA2ox6 is expressed in all tissues of adult Jatropha, with the highest expression level in male flowers and the lowest expression level in young leaves. Overexpression of JcGA2ox6 in Arabidopsis resulted in a typical dwarf phenotype, along with late flowering, smaller leaves and flowers, shorter siliques and smaller seeds. Similarly, when JcGA2ox6 was overexpressed in Jatropha, the transgenic plants exhibited a dwarf phenotype with dark-green leaves and smaller inflorescences, flowers, fruits and seeds. However, the flowering time of Jatropha was not affected by overexpression of JcGA2ox6, unlike that in the transgenic Arabidopsis. Moreover, the number of flowers per inflorescence, the weight of 10 seeds and the seed oil content were significantly decreased in transgenic Jatropha. The results indicated that overexpression of JcGA2ox6 had a great impact on the vegetative and reproductive growth of transgenic Jatropha. Furthermore, we found that the dwarf phenotype of transgenic Jatropha was caused by a decrease in endogenous bioactive GA4, which was correlated with the degree of dwarfism. PMID:29312375

The CYP88A cytochrome P450, ent-kaurenoic acid oxidase, catalyzes three steps of the gibberellin biosynthesis pathway

PubMed Central

Helliwell, Chris A.; Chandler, Peter M.; Poole, Andrew; Dennis, Elizabeth S.; Peacock, W. James

2001-01-01

We have shown that ent-kaurenoic acid oxidase, a member of the CYP88A subfamily of cytochrome P450 enzymes, catalyzes the three steps of the gibberellin biosynthetic pathway from ent-kaurenoic acid to GA12. A gibberellin-responsive barley mutant, grd5, accumulates ent-kaurenoic acid in developing grains. Three independent grd5 mutants contain mutations in a gene encoding a member of the CYP88A subfamily of cytochrome P450 enzymes, defined by the maize Dwarf3 protein. Mutation of the Dwarf3 gene gives rise to a gibberellin-responsive dwarf phenotype, but the lesion in the gibberellin biosynthesis pathway has not been identified. Arabidopsis thaliana has two CYP88A genes, both of which are expressed. Yeast strains expressing cDNAs encoding each of the two Arabidopsis and the barley CYP88A enzymes catalyze the three steps of the GA biosynthesis pathway from ent-kaurenoic acid to GA12. Sequence comparison suggests that the maize Dwarf3 locus also encodes ent-kaurenoic acid oxidase. PMID:11172076

Multiple Multi-Copper Oxidase Gene Families in Basidiomycetes – What for?

PubMed Central

Kües, Ursula; Rühl, Martin

2011-01-01

Genome analyses revealed in various basidiomycetes the existence of multiple genes for blue multi-copper oxidases (MCOs). Whole genomes are now available from saprotrophs, white rot and brown rot species, plant and animal pathogens and ectomycorrhizal species. Total numbers (from 1 to 17) and types of mco genes differ between analyzed species with no easy to recognize connection of gene distribution to fungal life styles. Types of mco genes might be present in one and absent in another fungus. Distinct types of genes have been multiplied at speciation in different organisms. Phylogenetic analysis defined different subfamilies of laccases sensu stricto (specific to Agaricomycetes), classical Fe2+-oxidizing Fet3-like ferroxidases, potential ferroxidases/laccases exhibiting either one or both of these enzymatic functions, enzymes clustering with pigment MCOs and putative ascorbate oxidases. Biochemically best described are laccases sensu stricto due to their proposed roles in degradation of wood, straw and plant litter and due to the large interest in these enzymes in biotechnology. However, biological functions of laccases and other MCOs are generally little addressed. Functions in substrate degradation, symbiontic and pathogenic intercations, development, pigmentation and copper homeostasis have been put forward. Evidences for biological functions are in most instances rather circumstantial by correlations of expression. Multiple factors impede research on biological functions such as difficulties of defining suitable biological systems for molecular research, the broad and overlapping substrate spectrum multi-copper oxidases usually possess, the low existent knowledge on their natural substrates, difficulties imposed by low expression or expression of multiple enzymes, and difficulties in expressing enzymes heterologously. PMID:21966246

Genome-wide identification and expression profiling reveal tissue-specific expression and differentially-regulated genes involved in gibberellin metabolism between Williams banana and its dwarf mutant.

PubMed

Chen, Jingjing; Xie, Jianghui; Duan, Yajie; Hu, Huigang; Hu, Yulin; Li, Weiming

2016-05-27

Dwarfism is one of the most valuable traits in banana breeding because semi-dwarf cultivars show good resistance to damage by wind and rain. Moreover, these cultivars present advantages of convenient cultivation, management, and so on. We obtained a dwarf mutant '8818-1' through EMS (ethyl methane sulphonate) mutagenesis of Williams banana 8818 (Musa spp. AAA group). Our research have shown that gibberellins (GAs) content in 8818-1 false stems was significantly lower than that in its parent 8818 and the dwarf type of 8818-1 could be restored by application of exogenous GA3. Although GA exerts important impacts on the 8818-1 dwarf type, our understanding of the regulation of GA metabolism during banana dwarf mutant development remains limited. Genome-wide screening revealed 36 candidate GA metabolism genes were systematically identified for the first time; these genes included 3 MaCPS, 2 MaKS, 1 MaKO, 2 MaKAO, 10 MaGA20ox, 4 MaGA3ox, and 14 MaGA2ox genes. Phylogenetic tree and conserved protein domain analyses showed sequence conservation and divergence. GA metabolism genes exhibited tissue-specific expression patterns. Early GA biosynthesis genes were constitutively expressed but presented differential regulation in different tissues in Williams banana. GA oxidase family genes were mainly transcribed in young fruits, thus suggesting that young fruits were the most active tissue involved in GA metabolism, followed by leaves, bracts, and finally approximately mature fruits. Expression patterns between 8818 and 8818-1 revealed that MaGA20ox4, MaGA20ox5, and MaGA20ox7 of the MaGA20ox gene family and MaGA2ox7, MaGA2ox12, and MaGA2ox14 of the MaGA2ox gene family exhibited significant differential expression and high-expression levels in false stems. These genes are likely to be responsible for the regulation of GAs content in 8818-1 false stems. Overall, phylogenetic evolution, tissue specificity and differential expression analyses of GA metabolism genes can provide a

Stamen-derived bioactive gibberellin is essential for male flower development of Cucurbita maxima L.

PubMed Central

Pimenta Lange, Maria João; Knop, Nicole; Lange, Theo

2012-01-01

Gibberellin (GA) signalling during pumpkin male flower development is highly regulated, including biosynthetic, perception, and transduction pathways. GA 20-oxidases, 3-oxidases, and 2-oxidases catalyse the final part of GA synthesis. Additionally, 7-oxidase initiates this part of the pathway in some cucurbits including Cucurbita maxima L. (pumpkin). Expression patterns for these GA-oxidase-encoding genes were examined by competitive reverse transcription-PCR (RT-PCR) and endogenous GA levels were determined during pumpkin male flower development. In young flowers, GA20ox3 transcript levels are high in stamens, followed by high levels of the GA precursor GA9. Later, just before flower opening, transcript levels for GA3ox3 and GA3ox4 increase in the hypanthium and stamens, respectively. In the stamen, following GA3ox4 expression, bioactive GA4 levels rise dramatically. Accordingly, catabolic GA2ox2 and GA2ox3 transcript levels are low in developing flowers, and increase in mature flowers. Putative GA receptor GID1b and DELLA repressor GAIPb transcript levels do not change in developing flowers, but increase sharply in mature flowers. Emasculation arrests floral development completely and leads to abscission of premature flowers. Application of GA4 (but not of its precursors GA12-aldehyde or GA9) restores normal growth of emasculated flowers. These results indicate that de novo GA4 synthesis in the stamen is under control of GA20ox3 and GA3ox4 genes just before the rapid flower growth phase. Stamen-derived bioactive GA is essential and sufficient for male flower development, including the petal and the pedicel growth. PMID:22268154

Azospirillum brasilense and Azospirillum lipoferum Hydrolyze Conjugates of GA20 and Metabolize the Resultant Aglycones to GA1 in Seedlings of Rice Dwarf Mutants1

PubMed Central

Cassán, Fabricio; Bottini, Rubén; Schneider, Gernot; Piccoli, Patricia

2001-01-01

Azospirillum species are plant growth-promotive bacteria whose beneficial effects have been postulated to be partially due to production of phytohormones, including gibberellins (GAs). In this work, Azospirillum brasilense strain Cd and Azospirillum lipoferum strain USA 5b promoted sheath elongation growth of two single gene GA-deficient dwarf rice (Oryza sativa) mutants, dy and dx, when the inoculated seedlings were supplied with [17,17-2H2]GA20-glucosyl ester or [17,17- 2H2]GA20-glucosyl ether. Results of capillary gas chromatography-mass spectrometry analysis show that this growth was due primarily to release of the aglycone [17,17-2H2]GA20 and its subsequent 3β-hydroxylation to [17,17-2H2]GA1 by the microorganism for the dy mutant, and by both the rice plant and microorganism for the dx mutant. PMID:11299384

Gibberellin 3-oxidase gene expression patterns influence gibberellin biosynthesis, growth, and development in pea.

PubMed

Reinecke, Dennis M; Wickramarathna, Aruna D; Ozga, Jocelyn A; Kurepin, Leonid V; Jin, Alena L; Good, Allen G; Pharis, Richard P

2013-10-01

Gibberellins (GAs) are key modulators of plant growth and development. PsGA3ox1 (LE) encodes a GA 3β-hydroxylase that catalyzes the conversion of GA20 to biologically active GA1. To further clarify the role of GA3ox expression during pea (Pisum sativum) plant growth and development, we generated transgenic pea lines (in a lele background) with cauliflower mosaic virus-35S-driven expression of PsGA3ox1 (LE). PsGA3ox1 transgene expression led to higher GA1 concentrations in a tissue-specific and development-specific manner, altering GA biosynthesis and catabolism gene expression and plant phenotype. PsGA3ox1 transgenic plants had longer internodes, tendrils, and fruits, larger stipules, and displayed delayed flowering, increased apical meristem life, and altered vascular development relative to the null controls. Transgenic PsGA3ox1 overexpression lines were then compared with lines where endogenous PsGA3ox1 (LE) was introduced, by a series of backcrosses, into the same genetic background (BC LEle). Most notably, the BC LEle plants had substantially longer internodes containing much greater GA1 levels than the transgenic PsGA3ox1 plants. Induction of expression of the GA deactivation gene PsGA2ox1 appears to make an important contribution to limiting the increase of internode GA1 to modest levels for the transgenic lines. In contrast, PsGA3ox1 (LE) expression driven by its endogenous promoter was coordinated within the internode tissue to avoid feed-forward regulation of PsGA2ox1, resulting in much greater GA1 accumulation. These studies further our fundamental understanding of the regulation of GA biosynthesis and catabolism at the tissue and organ level and demonstrate that the timing/localization of GA3ox expression within an organ affects both GA homeostasis and GA1 levels, and thereby growth.

The rice YABBY4 gene regulates plant growth and development through modulating the gibberellin pathway.

PubMed

Yang, Chao; Ma, Yamei; Li, Jianxiong

2016-10-01

YABBY genes encode seed plant-specific transcription factors that play pivotal roles in diverse aspects of leaf, shoot, and flower development. Members of the YABBY gene family are primarily expressed in lateral organs in a polar manner and function to specify abaxial cell fate in dicotyledons, but this polar expression is not conserved in monocotyledons. The function of YABBY genes is therefore not well understood in monocotyledons. Here we show that overexpression of the rice (Oryza sativa L.) YABBY4 gene (OsYABBY4) leads to a semi-dwarf phenotype, abnormal development in the uppermost internode, an increased number of floral organs, and insensitivity to gibberellin (GA) treatment. We report on an important role for OsYABBY4 in negative control of the expression of a GA biosynthetic gene by binding to the promoter region of the gibberellin 20-oxidase 2 gene (GA20ox2), which is a direct target of SLR1 (the sole DELLA protein negatively controlling GA responses in rice). OsYABBY4 also suppresses the expression level of SLR1 and interacts with SLR1 protein. The interaction inhibits GA-dependent degradation of SLR1 and therefore leads to GA insensitivity. These data together suggest that OsYABBY4 serves as a DNA-binding intermediate protein for SLR1 and is associated with the GA signaling pathway regulating gene expression during plant growth and development. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Associations Between Genetic Variants of NADPH Oxidase-Related Genes and Blood Pressure Responses to Dietary Sodium Intervention: The GenSalt Study.

PubMed

Han, Xikun; Hu, Zunsong; Chen, Jing; Huang, Jianfeng; Huang, Chen; Liu, Fangchao; Gu, Charles; Yang, Xueli; Hixson, James E; Lu, Xiangfeng; Wang, Laiyuan; Liu, De-Pei; He, Jiang; Chen, Shufeng; Gu, Dongfeng

2017-04-01

The aim of this study was to comprehensively test the associations of genetic variants of nicotinamide adenine dinucleotide phosphate (NADPH) oxidase-related genes with blood pressure (BP) responses to dietary sodium intervention in a Chinese population. We conducted a 7-day low-sodium intervention followed by a 7-day high-sodium intervention among 1,906 participants in rural China. BP measurements were obtained at baseline and each dietary intervention using a random-zero sphygmomanometer. Linear mixed-effect models were used to assess the additive associations of 63 tag single-nucleotide polymorphisms in 11 NADPH oxidase-related genes with BP responses to dietary sodium intervention. Gene-based analyses were conducted using the truncated product method. The Bonferroni method was used to adjust for multiple testing in all analyses. Systolic BP (SBP) response to high-sodium intervention significantly decreased with the number of minor T allele of marker rs6967221 in RAC1 (P = 4.51 × 10-4). SBP responses (95% confidence interval) for genotypes CC, CT, and TT were 5.03 (4.71, 5.36), 4.20 (3.54, 4.85), and 0.56 (-1.08, 2.20) mm Hg, respectively, during the high-sodium intervention. Gene-based analyses revealed that RAC1 was significantly associated with SBP response to high-sodium intervention (P = 1.00 × 10-6) and diastolic BP response to low-sodium intervention (P = 9.80 × 10-4). These findings suggested that genetic variants of NADPH oxidase-related genes may contribute to the variation of BP responses to sodium intervention in Chinese population. Further replication of these findings is warranted. © American Journal of Hypertension, Ltd 2017. All rights reserved. For Permissions, please email: journals.permissions@oup.com

Characterization and expression analysis of a banana gene encoding 1-aminocyclopropane-1-carboxylate oxidase.

PubMed

Huang, P L; Do, Y Y; Huang, F C; Thay, T S; Chang, T W

1997-04-01

A cDNA encoding the banana 1-aminocyclopropane-1-carboxylate (ACC) oxidase has previously been isolated from a cDNA library that was constructed by extracting poly(A)+ RNA from peels of ripening banana. This cDNA, designated as pMAO2, has 1,199 bp and contains an open reading frame of 318 amino acids. In order to identify ripening-related promoters of the banana ACC oxidase gene, pMAO2 was used as a probe to screen a banana genomic library constructed in the lambda EMBL3 vector. The banana ACC oxidase MAO2 gene has four exons and three introns, with all of the boundaries between these introns and exons sharing a consensus dinucleotide sequence of GT-AG. The expression of MAO2 gene in banana begins after the onset of ripening (stage 2) and continuous into later stages of the ripening process. The accumulation of MAO2 mRNA can be induced by 1 microliter/l exogenous ethylene, and it reached steady state level when 100 microliters/l exogenous ethylene was present.

Characterization of two brassinosteroid C-6 oxidase genes in pea.

PubMed

Jager, Corinne E; Symons, Gregory M; Nomura, Takahito; Yamada, Yumiko; Smith, Jennifer J; Yamaguchi, Shinjiro; Kamiya, Yuji; Weller, James L; Yokota, Takao; Reid, James B

2007-04-01

C-6 oxidation genes play a key role in the regulation of biologically active brassinosteroid (BR) levels in the plant. They control BR activation, which involves the C-6 oxidation of 6-deoxocastasterone (6-DeoxoCS) to castasterone (CS) and in some cases the further conversion of CS to brassinolide (BL). C-6 oxidation is controlled by the CYP85A family of cytochrome P450s, and to date, two CYP85As have been isolated in tomato (Solanum lycopersicum), two in Arabidopsis (Arabidopsis thaliana), one in rice (Oryza sativa), and one in grape (Vitis vinifera). We have now isolated two CYP85As (CYP85A1 and CYP85A6) from pea (Pisum sativum). However, unlike Arabidopsis and tomato, which both contain one BR C-6 oxidase that converts 6-DeoxoCS to CS and one BR C-6 Baeyer-Villiger oxidase that converts 6-DeoxoCS right through to BL, the two BR C-6 oxidases in pea both act principally to convert 6-DeoxoCS to CS. The isolation of these two BR C-6 oxidation genes in pea highlights the species-specific differences associated with C-6 oxidation. In addition, we have isolated a novel BR-deficient mutant, lke, which blocks the function of one of these two BR C-6 oxidases (CYP85A6). The lke mutant exhibits a phenotype intermediate between wild-type plants and previously characterized pea BR mutants (lk, lka, and lkb) and contains reduced levels of CS and increased levels of 6-DeoxoCS. To date, lke is the only mutant identified in pea that blocks the latter steps of BR biosynthesis and it will therefore provide an excellent tool to further examine the regulation of BR biosynthesis and the relative biological activities of CS and BL in pea.

A novel class of gibberellin 2-oxidases control semidwarfism, tillering, and root development in rice.

PubMed

Lo, Shuen-Fang; Yang, Show-Ya; Chen, Ku-Ting; Hsing, Yue-Ie; Zeevaart, Jan A D; Chen, Liang-Jwu; Yu, Su-May

2008-10-01

Gibberellin 2-oxidases (GA2oxs) regulate plant growth by inactivating endogenous bioactive gibberellins (GAs). Two classes of GA2oxs inactivate GAs through 2beta-hydroxylation: a larger class of C(19) GA2oxs and a smaller class of C(20) GA2oxs. In this study, we show that members of the rice (Oryza sativa) GA2ox family are differentially regulated and act in concert or individually to control GA levels during flowering, tillering, and seed germination. Using mutant and transgenic analysis, C(20) GA2oxs were shown to play pleiotropic roles regulating rice growth and architecture. In particular, rice overexpressing these GA2oxs exhibited early and increased tillering and adventitious root growth. GA negatively regulated expression of two transcription factors, O. sativa homeobox 1 and TEOSINTE BRANCHED1, which control meristem initiation and axillary bud outgrowth, respectively, and that in turn inhibited tillering. One of three conserved motifs unique to the C(20) GA2oxs (motif III) was found to be important for activity of these GA2oxs. Moreover, C(20) GA2oxs were found to cause less severe GA-defective phenotypes than C(19) GA2oxs. Our studies demonstrate that improvements in plant architecture, such as semidwarfism, increased root systems and higher tiller numbers, could be induced by overexpression of wild-type or modified C(20) GA2oxs.

Improvement of exopolysaccharide production in Lactobacillus casei LC2W by overexpression of NADH oxidase gene.

PubMed

Li, Nan; Wang, Yuanlong; Zhu, Ping; Liu, Zhenmin; Guo, Benheng; Ren, Jing

2015-02-01

Lactobacillus casei LC2W is an exopolysaccharide (EPS)-producing strain with probiotic effects. To investigate the regulation mechanism of EPS biosynthesis and to improve EPS production through cofactor engineering, a H₂O-forming NADH oxidase gene was cloned from Streptococcus mutans and overexpressed in L. casei LC2W under the control of constitutive promoter P₂₃. The recombinant strain LC-nox exhibited 0.854 U/mL of NADH oxidase activity, which was elevated by almost 20-fold in comparison with that of wild-type strain. As a result, overexpression of NADH oxidase resulted in a reduction in growth rate. In addition, lactate production was decreased by 22% in recombinant strain. It was proposed that more carbon source was saved and used for the biosynthesis of EPS, the production of which was reached at 219.4 mg/L, increased by 46% compared to that of wild-type strain. This work provided a novel and convenient genetic approach to manipulate metabolic flux and to increase EPS production. To the best of our knowledge, this is the first report which correlates cofactor engineering with EPS production. Copyright © 2015 Elsevier GmbH. All rights reserved.

OsGA2ox5, a gibberellin metabolism enzyme, is involved in plant growth, the root gravity response and salt stress.

PubMed

Shan, Chi; Mei, Zhiling; Duan, Jianli; Chen, Haiying; Feng, Huafeng; Cai, Weiming

2014-01-01

Gibberellin (GA) 2-oxidases play an important role in the GA catabolic pathway through 2β-hydroxylation. There are two classes of GA2oxs, i.e., a larger class of C₁₉-GA2oxs and a smaller class of C₂₀-GA2oxs. In this study, the gene encoding a GA 2-oxidase of rice, Oryza sativa GA 2-oxidase 5 (OsGA2ox5), was cloned and characterized. BLASTP analysis showed that OsGA2ox5 belongs to the C₂₀-GA2oxs subfamily, a subfamily of GA2oxs acting on C₂₀-GAs (GA₁₂, GA₅₃). Subcellular localization of OsGA2ox5-YFP in transiently transformed onion epidermal cells revealed the presence of this protein in both of the nucleus and cytoplasm. Real-time PCR analysis, along with GUS staining, revealed that OsGA2ox5 is expressed in the roots, culms, leaves, sheaths and panicles of rice. Rice plants overexpressing OsGA2ox5 exhibited dominant dwarf and GA-deficient phenotypes, with shorter stems and later development of reproductive organs than the wild type. The dwarfism phenotype was partially rescued by the application of exogenous GA3 at a concentration of 10 µM. Ectopic expression of OsGA2ox5 cDNA in Arabidopsis resulted in a similar phenotype. Real-time PCR assays revealed that both GA synthesis-related genes and GA signaling genes were expressed at higher levels in transgenic rice plants than in wild-type rice; OsGA3ox1, which encodes a key enzyme in the last step of the bioactive GAs synthesis pathway, was highly expressed in transgenic rice. The roots of OsGA2ox5-ox plants exhibited increased starch granule accumulation and gravity responses, revealing a role for GA in root starch granule development and gravity responses. Furthermore, rice and Arabidopsis plants overexpressing OsGA2ox5 were more resistant to high-salinity stress than wild-type plants. These results suggest that OsGA2ox5 plays important roles in GAs homeostasis, development, gravity responses and stress tolerance in rice.

Differences and similarities in the photoregulation of gibberellin metabolism between rice and dicots.

PubMed

Hirose, Fumiaki; Inagaki, Noritoshi; Takano, Makoto

2013-03-01

In rice seedlings, elongation of leaf sheaths is suppressed by light stimuli. The response is mediated by two classes of photoreceptors, phytochromes and cryptochromes. However, it remains unclear how these photoreceptors interact in the process. Our recent study using phytochrome mutants and novel cryptochrome RNAi lines revealed that cryptochromes and phytochromes function cooperatively, but independently to reduce active GA contents in seedlings in visible light. Blue light captured by cryptochrome 1 (cry1a and cry1b) induces robust expression of GA 2-oxidase genes (OsGA2ox4-7). In parallel, phytochrome B with auxiliary action of phytochrome A mediates repression of GA 20-oxidase genes (OsGA20ox2 and OsGA20ox4). The independent effects cumulatively reduce active GA contents, leading to a suppression of leaf sheath elongation. These regulatory mechanisms are distinct from phytochrome B function in dicots. We discuss reasons why the distinct system appeared in rice, and advantages of the rice system in early photomorphogenesis.

Exogenously induced expression of ethylene biosynthesis, ethylene perception, phospholipase D, and Rboh-oxidase genes in broccoli seedlings

PubMed Central

Jakubowicz, Małgorzata; Gałgańska, Hanna; Nowak, Witold; Sadowski, Jan

2010-01-01

In higher plants, copper ions, hydrogen peroxide, and cycloheximide have been recognized as very effective inducers of the transcriptional activity of genes encoding the enzymes of the ethylene biosynthesis pathway. In this report, the transcriptional patterns of genes encoding the 1-aminocyclopropane-1-carboxylate synthases (ACSs), 1-aminocyclopropane-1-carboxylate oxidases (ACOs), ETR1, ETR2, and ERS1 ethylene receptors, phospholipase D (PLD)-α1, -α2, -γ1, and -δ, and respiratory burst oxidase homologue (Rboh)-NADPH oxidase-D and -F in response to these inducers in Brassica oleracea etiolated seedlings are shown. ACS1, ACO1, ETR2, PLD-γ1, and RbohD represent genes whose expression was considerably affected by all of the inducers used. The investigations were performed on the seedlings with (i) ethylene insensitivity and (ii) a reduced level of the PLD-derived phosphatidic acid (PA). The general conclusion is that the expression of ACS1, -3, -4, -5, -7, and -11, ACO1, ETR1, ERS1, and ETR2, PLD-γ 1, and RbohD and F genes is undoubtedly under the reciprocal cross-talk of the ethylene and PAPLD signalling routes; both signals affect it in concerted or opposite ways depending on the gene or the type of stimuli. The results of these studies on broccoli seedlings are in agreement with the hypothesis that PA may directly affect the ethylene signal transduction pathway via an inhibitory effect on CTR1 (constitutive triple response 1) activity. PMID:20581125

A Novel Class of Gibberellin 2-Oxidases Control Semidwarfism, Tillering, and Root Development in Rice[W

PubMed Central

Lo, Shuen-Fang; Yang, Show-Ya; Chen, Ku-Ting; Hsing, Yue-Ie; Zeevaart, Jan A.D.; Chen, Liang-Jwu; Yu, Su-May

2008-01-01

Gibberellin 2-oxidases (GA2oxs) regulate plant growth by inactivating endogenous bioactive gibberellins (GAs). Two classes of GA2oxs inactivate GAs through 2β-hydroxylation: a larger class of C19 GA2oxs and a smaller class of C20 GA2oxs. In this study, we show that members of the rice (Oryza sativa) GA2ox family are differentially regulated and act in concert or individually to control GA levels during flowering, tillering, and seed germination. Using mutant and transgenic analysis, C20 GA2oxs were shown to play pleiotropic roles regulating rice growth and architecture. In particular, rice overexpressing these GA2oxs exhibited early and increased tillering and adventitious root growth. GA negatively regulated expression of two transcription factors, O. sativa homeobox 1 and TEOSINTE BRANCHED1, which control meristem initiation and axillary bud outgrowth, respectively, and that in turn inhibited tillering. One of three conserved motifs unique to the C20 GA2oxs (motif III) was found to be important for activity of these GA2oxs. Moreover, C20 GA2oxs were found to cause less severe GA-defective phenotypes than C19 GA2oxs. Our studies demonstrate that improvements in plant architecture, such as semidwarfism, increased root systems and higher tiller numbers, could be induced by overexpression of wild-type or modified C20 GA2oxs. PMID:18952778

Cryptochrome and Phytochrome Cooperatively but Independently Reduce Active Gibberellin Content in Rice Seedlings under Light Irradiation

PubMed Central

Hirose, Fumiaki; Inagaki, Noritoshi; Hanada, Atsushi; Yamaguchi, Shinjiro; Kamiya, Yuji; Miyao, Akio; Hirochika, Hirohiko; Takano, Makoto

2012-01-01

In contrast to a wealth of knowledge about the photoregulation of gibberellin metabolism in dicots, that in monocots remains largely unclear. In this study, we found that a blue light signal triggers reduction of active gibberellin content in rice seedlings with simultaneous repression of two gibberellin 20-oxidase genes (OsGA20ox2 and OsGA20ox4) and acute induction of four gibberellin 2-oxidase genes (OsGA2ox4–OsGA2ox7). For further examination of the regulation of these genes, we established a series of cryptochrome-deficient lines through reverse genetic screening from a Tos17 mutant population and construction of knockdown lines based on an RNA interference technique. By using these lines and phytochrome mutants, we elucidated that cryptochrome 1 (cry1), consisting of two species in rice plants (cry1a and cry1b), is indispensable for robust induction of the GA2ox genes. On the other hand, repression of the GA20ox genes is mediated by phytochromes. In addition, we found that the phytochromes also mediate the repression of a gibberellin 3-oxidase gene (OsGA3ox2) in the light. These results imply that, in rice seedlings, phytochromes mediate the repression of gibberellin biosynthesis capacity, while cry1 mediates the induction of gibberellin inactivation capacity. The cry1 action was demonstrated to be dominant in the reduction of active gibberellin content, but, in rice seedlings, the cumulative effects of these independent actions reduced active gibberellin content in the light. This pathway design in which different types of photoreceptors independently but cooperatively regulate active gibberellin content is unique from the viewpoint of dicot research. This redundancy should provide robustness to the response in rice plants. PMID:22764280

Cryptochrome and phytochrome cooperatively but independently reduce active gibberellin content in rice seedlings under light irradiation.

PubMed

Hirose, Fumiaki; Inagaki, Noritoshi; Hanada, Atsushi; Yamaguchi, Shinjiro; Kamiya, Yuji; Miyao, Akio; Hirochika, Hirohiko; Takano, Makoto

2012-09-01

In contrast to a wealth of knowledge about the photoregulation of gibberellin metabolism in dicots, that in monocots remains largely unclear. In this study, we found that a blue light signal triggers reduction of active gibberellin content in rice seedlings with simultaneous repression of two gibberellin 20-oxidase genes (OsGA20ox2 and OsGA20ox4) and acute induction of four gibberellin 2-oxidase genes (OsGA2ox4-OsGA2ox7). For further examination of the regulation of these genes, we established a series of cryptochrome-deficient lines through reverse genetic screening from a Tos17 mutant population and construction of knockdown lines based on an RNA interference technique. By using these lines and phytochrome mutants, we elucidated that cryptochrome 1 (cry1), consisting of two species in rice plants (cry1a and cry1b), is indispensable for robust induction of the GA2ox genes. On the other hand, repression of the GA20ox genes is mediated by phytochromes. In addition, we found that the phytochromes also mediate the repression of a gibberellin 3-oxidase gene (OsGA3ox2) in the light. These results imply that, in rice seedlings, phytochromes mediate the repression of gibberellin biosynthesis capacity, while cry1 mediates the induction of gibberellin inactivation capacity. The cry1 action was demonstrated to be dominant in the reduction of active gibberellin content, but, in rice seedlings, the cumulative effects of these independent actions reduced active gibberellin content in the light. This pathway design in which different types of photoreceptors independently but cooperatively regulate active gibberellin content is unique from the viewpoint of dicot research. This redundancy should provide robustness to the response in rice plants.

Altered gene expression in early postnatal monoamine oxidase A knockout mice.

PubMed

Chen, Kevin; Kardys, Abbey; Chen, Yibu; Flink, Stephen; Tabakoff, Boris; Shih, Jean C

2017-08-15

We reported previously that monoamine oxidase (MAO) A knockout (KO) mice show increased serotonin (5-hydroxytryptamine, 5-HT) levels and autistic-like behaviors characterized by repetitive behaviors, and anti-social behaviors. We showed that administration of the serotonin synthesis inhibitor para-chlorophenylalanine (pCPA) from post-natal day 1 (P1) through 7 (P7) in MAO A KO mice reduced the serotonin level to normal and reverses the repetitive behavior. These results suggested that the altered gene expression at P1 and P7 may be important for the autistic-like behaviors seen in MAO A KO mice and was studied here. In this study, Affymetrix mRNA array data for P1 and P7 MAO A KO mice were analyzed using Partek Genomics Suite and Ingenuity Pathways Analysis to identify genes differentially expressed versus wild-type and assess their functions and relationships. The number of significant differentially expressed genes (DEGs) varied with age: P1 (664) and P7 (3307) [false discovery rate (FDR) <0.05, fold-change (FC) >1.5 for autism-linked genes and >2.0 for functionally categorized genes]. Eight autism-linked genes were differentially expressed in P1 (upregulated: NLGN3, SLC6A2; down-regulated: HTR2C, MET, ADSL, MECP2, ALDH5A1, GRIN3B) while four autism-linked genes were differentially expressed at P7 (upregulated: HTR2B; downregulated: GRIN2D, GRIN2B, CHRNA4). Many other genes involved in neurodevelopment, apoptosis, neurotransmission, and cognitive function were differentially expressed at P7 in MAO A KO mice. This result suggests that modulation of these genes by the increased serotonin may lead to neurodevelopmental alteration in MAO A KO mice and results in autistic-like behaviors. Copyright © 2017 Elsevier B.V. All rights reserved.

Gibberellin 3-oxidase Gene Expression Patterns Influence Gibberellin Biosynthesis, Growth, and Development in Pea1[W][OPEN

PubMed Central

Reinecke, Dennis M.; Wickramarathna, Aruna D.; Ozga, Jocelyn A.; Kurepin, Leonid V.; Jin, Alena L.; Good, Allen G.; Pharis, Richard P.

2013-01-01

Gibberellins (GAs) are key modulators of plant growth and development. PsGA3ox1 (LE) encodes a GA 3β-hydroxylase that catalyzes the conversion of GA20 to biologically active GA1. To further clarify the role of GA3ox expression during pea (Pisum sativum) plant growth and development, we generated transgenic pea lines (in a lele background) with cauliflower mosaic virus-35S-driven expression of PsGA3ox1 (LE). PsGA3ox1 transgene expression led to higher GA1 concentrations in a tissue-specific and development-specific manner, altering GA biosynthesis and catabolism gene expression and plant phenotype. PsGA3ox1 transgenic plants had longer internodes, tendrils, and fruits, larger stipules, and displayed delayed flowering, increased apical meristem life, and altered vascular development relative to the null controls. Transgenic PsGA3ox1 overexpression lines were then compared with lines where endogenous PsGA3ox1 (LE) was introduced, by a series of backcrosses, into the same genetic background (BC LEle). Most notably, the BC LEle plants had substantially longer internodes containing much greater GA1 levels than the transgenic PsGA3ox1 plants. Induction of expression of the GA deactivation gene PsGA2ox1 appears to make an important contribution to limiting the increase of internode GA1 to modest levels for the transgenic lines. In contrast, PsGA3ox1 (LE) expression driven by its endogenous promoter was coordinated within the internode tissue to avoid feed-forward regulation of PsGA2ox1, resulting in much greater GA1 accumulation. These studies further our fundamental understanding of the regulation of GA biosynthesis and catabolism at the tissue and organ level and demonstrate that the timing/localization of GA3ox expression within an organ affects both GA homeostasis and GA1 levels, and thereby growth. PMID:23979969

Association of monoamine oxidase A gene polymorphism with Alzheimer's disease and Lewy body variant.

PubMed

Takehashi, Masanori; Tanaka, Seigo; Masliah, Eliezer; Ueda, Kunihiro

2002-07-19

The association between (GT)n dinucleotide repeats in monoamine oxidase gene loci, monoamine oxidase A (MAOA) and B (MAOB), and Parkinson's disease (PD), Alzheimer's disease (AD), and Lewy body variant (LBV) of AD were determined. MAOA-GT polymorphisms were significantly associated with pure AD and LBV. MAOA-GT allele 113 was excessively represented in pure AD and LBV compared with controls. Furthermore, the frequency of females homozygous for MAOA-GT allele 113 was higher in pure AD and LBV than controls by 2.79- and 2.77-fold, respectively. In contrast, there was no association between MAOA-GT or MAOB-GT polymorphisms and PD. These results suggest that polymorphisms within the MAOA gene may have implication in AD pathology shared by pure AD and LBV.

Triosephosphate isomerase gene promoter variation: -5G/A and -8G/A polymorphisms in clinical malaria groups in two African populations.

PubMed

Guerra, Mónica; Machado, Patrícia; Manco, Licínio; Fernandes, Natércia; Miranda, Juliana; Arez, Ana Paula

2015-06-01

TPI1 promoter polymorphisms occur in high prevalence in individuals from African origin. Malaria-patients from Angola and Mozambique were screened for the TPI1 gene promoter variants rs1800200A>G, (-5G>A), rs1800201G>A, (-8G>A), rs1800202T>G, (-24T>G), and for the intron 5 polymorphism rs2071069G>A, (2262G>A). -5G>A and -8G>A variants occur in 47% and 53% in Angola and Mozambique, respectively while -24T>G was monomorphic for the wild-type T allele. Six haplotypes were identified and -8A occurred in 45% of the individuals, especially associated with the GAG haplotype and more frequent in non-severe malaria groups, although not significantly. The arising and dispersion of -5G>A and -8G>A polymorphisms is controversial. Their age was estimated by analyses of two microsatellite loci, CD4 and ATN1, adjacent to TPI1 gene. The -5G>A is older than -8G>A, with an average estimate of approximately 35,000 years. The -8A variant arose in two different backgrounds, suggesting independent mutational events. The first, on the -5G background, may have occurred in East Africa around 20,800 years ago; the second, on the -5A background, may have occurred in West Africa some 7500 years ago. These estimates are within the period of spread of agriculture and the malaria mosquito vector in Africa, which could has been a possible reason for the selection of -8A polymorphism in malaria endemic countries. Copyright © 2015 Elsevier B.V. All rights reserved.

MONOAMINE OXIDASE: From Genes to Behavior

PubMed Central

Shih, J. C.; Chen, K.; Ridd, M. J.

2010-01-01

Cloning of MAO (monoamine oxidase) A and B has demonstrated unequivocally that these enzymes are made up of different polypeptides, and our understanding of MAO structure, regulation, and function has been significantly advanced by studies using their cDNA. MAO A and B genes are located on the X-chromosome (Xp11.23) and comprise 15 exons with identical intron-exon organization, which suggests that they are derived from the same ancestral gene. MAO A and B knockout mice exhibit distinct differences in neurotransmitter metabolism and behavior. MAO A knock-out mice have elevated brain levels of serotonin, norephinephrine, and dopamine and manifest aggressive behavior similar to human males with a deletion of MAO A. In contrast, MAO B knock-out mice do not exhibit aggression and only levels of phenylethylamine are increased. Mice lacking MAO B are resistant to the Parkinsongenic neurotoxin, 1-methyl-4-phenyl-1,2,3,6-tetra-hydropyridine. Both MAO A and B knock-out mice show increased reactivity to stress. These knock-out mice are valuable models for investigating the role of monoamines in psychoses and neurodegenerative and stress-related disorders. PMID:10202537

Spermine oxidase maintains basal skeletal muscle gene expression and fiber size and is strongly repressed by conditions that cause skeletal muscle atrophy

PubMed Central

Bongers, Kale S.; Fox, Daniel K.; Kunkel, Steven D.; Stebounova, Larissa V.; Murry, Daryl J.; Pufall, Miles A.; Ebert, Scott M.; Dyle, Michael C.; Bullard, Steven A.; Dierdorff, Jason M.

2014-01-01

Skeletal muscle atrophy is a common and debilitating condition that remains poorly understood at the molecular level. To better understand the mechanisms of muscle atrophy, we used mouse models to search for a skeletal muscle protein that helps to maintain muscle mass and is specifically lost during muscle atrophy. We discovered that diverse causes of muscle atrophy (limb immobilization, fasting, muscle denervation, and aging) strongly reduced expression of the enzyme spermine oxidase. Importantly, a reduction in spermine oxidase was sufficient to induce muscle fiber atrophy. Conversely, forced expression of spermine oxidase increased muscle fiber size in multiple models of muscle atrophy (immobilization, fasting, and denervation). Interestingly, the reduction of spermine oxidase during muscle atrophy was mediated by p21, a protein that is highly induced during muscle atrophy and actively promotes muscle atrophy. In addition, we found that spermine oxidase decreased skeletal muscle mRNAs that promote muscle atrophy (e.g., myogenin) and increased mRNAs that help to maintain muscle mass (e.g., mitofusin-2). Thus, in healthy skeletal muscle, a relatively low level of p21 permits expression of spermine oxidase, which helps to maintain basal muscle gene expression and fiber size; conversely, during conditions that cause muscle atrophy, p21 expression rises, leading to reduced spermine oxidase expression, disruption of basal muscle gene expression, and muscle fiber atrophy. Collectively, these results identify spermine oxidase as an important positive regulator of muscle gene expression and fiber size, and elucidate p21-mediated repression of spermine oxidase as a key step in the pathogenesis of skeletal muscle atrophy. PMID:25406264

The QTL GNP1 Encodes GA20ox1, Which Increases Grain Number and Yield by Increasing Cytokinin Activity in Rice Panicle Meristems.

PubMed

Wu, Yuan; Wang, Yun; Mi, Xue-Fei; Shan, Jun-Xiang; Li, Xin-Min; Xu, Jian-Long; Lin, Hong-Xuan

2016-10-01

Cytokinins and gibberellins (GAs) play antagonistic roles in regulating reproductive meristem activity. Cytokinins have positive effects on meristem activity and maintenance. During inflorescence meristem development, cytokinin biosynthesis is activated via a KNOX-mediated pathway. Increased cytokinin activity leads to higher grain number, whereas GAs negatively affect meristem activity. The GA biosynthesis genes GA20oxs are negatively regulated by KNOX proteins. KNOX proteins function as modulators, balancing cytokinin and GA activity in the meristem. However, little is known about the crosstalk among cytokinin and GA regulators together with KNOX proteins and how KNOX-mediated dynamic balancing of hormonal activity functions. Through map-based cloning of QTLs, we cloned a GA biosynthesis gene, Grain Number per Panicle1 (GNP1), which encodes rice GA20ox1. The grain number and yield of NIL-GNP1TQ were significantly higher than those of isogenic control (Lemont). Sequence variations in its promoter region increased the levels of GNP1 transcripts, which were enriched in the apical regions of inflorescence meristems in NIL-GNP1TQ. We propose that cytokinin activity increased due to a KNOX-mediated transcriptional feedback loop resulting from the higher GNP1 transcript levels, in turn leading to increased expression of the GA catabolism genes GA2oxs and reduced GA1 and GA3 accumulation. This rebalancing process increased cytokinin activity, thereby increasing grain number and grain yield in rice. These findings uncover important, novel roles of GAs in rice florescence meristem development and provide new insights into the crosstalk between cytokinin and GA underlying development process.

Gibberellin Regulation of Fruit Set and Growth in Tomato1[W

PubMed Central

Serrani, Juan Carlos; Sanjuán, Rafael; Ruiz-Rivero, Omar; Fos, Mariano; García-Martínez, José Luis

2007-01-01

The role of gibberellins (GAs) in tomato (Solanum lycopersicum) fruit development was investigated. Two different inhibitors of GA biosynthesis (LAB 198999 and paclobutrazol) decreased fruit growth and fruit set, an effect reversed by GA3 application. LAB 198999 reduced GA1 and GA8 content, but increased that of their precursors GA53, GA44, GA19, and GA20 in pollinated fruits. This supports the hypothesis that GA1 is the active GA for tomato fruit growth. Unpollinated ovaries developed parthenocarpically in response to GA3 > GA1 = GA4 > GA20, but not to GA19, suggesting that GA 20-oxidase activity was limiting in unpollinated ovaries. This was confirmed by analyzing the effect of pollination on transcript levels of SlCPS, SlGA20ox1, -2, and -3, and SlGA3ox1 and -2, encoding enzymes of GA biosynthesis. Pollination increased transcript content of SlGA20ox1, -2, and -3, and SlCPS, but not of SlGA3ox1 and -2. To investigate whether pollination also altered GA inactivation, full-length cDNA clones of genes encoding enzymes catalyzing GA 2-oxidases (SlGA2ox1, -2, -3, -4, and -5) were isolated and characterized. Transcript levels of these genes did not decrease early after pollination (5-d-old fruits), but transcript content reduction of all of them, mainly of SlGA2ox2, was found later (from 10 d after anthesis). We conclude that pollination mediates fruit set by activating GA biosynthesis mainly through up-regulation of GA20ox. Finally, the phylogenetic reconstruction of the GA2ox family clearly showed the existence of three gene subfamilies, and the phylogenetic position of SlGA2ox1, -2, -3, -4, and -5 was established. PMID:17660355

Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum

PubMed Central

Xin, Shan; Tao, Chengcheng; Li, Hongbin

2016-01-01

Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5’-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5’-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5’ truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence

Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

PubMed

Xin, Shan; Tao, Chengcheng; Li, Hongbin

2016-01-01

Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a

Genetic Mapping of a new family of Seed-Expressed Polyphenol Oxidase genes in Wheat (Triticum aestivum L.)

USDA-ARS?s Scientific Manuscript database

Polyphenol oxidase (PPO) enzymatic activity is a major cause in time-dependent discoloration in wheat dough products. The PPO-A1 and PPO-D1 genes have been shown to contribute to wheat kernel PPO activity. However it has been shown that wheat contains multiple PPO genes. Recently a novel PPO gene...

CYP714B1 and CYP714B2 encode gibberellin 13-oxidases that reduce gibberellin activity in rice.

PubMed

Magome, Hiroshi; Nomura, Takahito; Hanada, Atsushi; Takeda-Kamiya, Noriko; Ohnishi, Toshiyuki; Shinma, Yuko; Katsumata, Takumi; Kawaide, Hiroshi; Kamiya, Yuji; Yamaguchi, Shinjiro

2013-01-29

Bioactive gibberellins (GAs) control many aspects of growth and development in plants. GA(1) has been the most frequently found bioactive GA in various tissues of flowering plants, but the enzymes responsible for GA(1) biosynthesis have not been fully elucidated due to the enzymes catalyzing the 13-hydroxylation step not being identified. Because of the lack of mutants defective in this enzyme, biological significance of GA 13-hydroxylation has been unknown. Here, we report that two cytochrome P450 genes, CYP714B1 and CYP714B2, encode GA 13-oxidase in rice. Transgenic Arabidopsis plants that overexpress CYP714B1 or CYP714B2 show semidwarfism. There was a trend that the levels of 13-OH GAs including GA(1) were increased in these transgenic plants. Functional analysis using yeast or insect cells shows that recombinant CYP714B1 and CYP714B2 proteins can convert GA(12) into GA(53) (13-OH GA(12)) in vitro. Moreover, the levels of 13-OH GAs including GA(1) were decreased, whereas those of 13-H GAs including GA(4) (which is more active than GA(1)) were increased, in the rice cyp714b1 cyp714b2 double mutant. These results indicate that CYP714B1 and CYP714B2 play a predominant role in GA 13-hydroxylation in rice. The double mutant plants appear phenotypically normal until heading, but show elongated uppermost internode at the heading stage. Moreover, CYP714B1 and CYP714B2 expression was up-regulated by exogenous application of bioactive GAs. Our results suggest that GA 13-oxidases play a role in fine-tuning plant growth by decreasing GA bioactivity in rice and that they also participate in GA homeostasis.

[THE INFLUENCE OF SEROTONIN TRANSPORTER AND MONOAMINE OXIDASE A GENES POLYMORPHISM ON PSYCHO-EMOTION AND KARYOLOGICAL STABILITY OF ATHLETES].

PubMed

Kalaev, V N; Nechaeva, M S; Korneeva, O S; Cherenkov, D A

2015-11-01

The influence of polymorphism of the serotonin transporter and monoamine oxidase A genes, associated with man's aggressiveness on the psycho-emotional state and karyological status of single combat athletes. It was revealed that the carriers of less active ("short"), monoamine oxidase A gene variant have a high motivation to succeed and less rigidity and frustrated, compared to the carriers of more active ("long") version of the gene. Heterozygote carriers of less active ("short") variant of the serotonin transporter gene 5-HTTL had more physical aggression, guilt and were less frustrated compared with carriers of two long alleles. It has been revealed the association of studied genes with the karyological status of athletes. So fighters who are carriers of the short and long alleles of the serotonin transporter gene had more cells with nuclear abnormalities in the buccal epithelium than single combat athletes which both alleles were long.

Systemic Manifestations in Pyridox(am)ine 5'-Phosphate Oxidase Deficiency.

PubMed

Guerriero, Réjean M; Patel, Archana A; Walsh, Brian; Baumer, Fiona M; Shah, Ankoor S; Peters, Jurriaan M; Rodan, Lance H; Agrawal, Pankaj B; Pearl, Phillip L; Takeoka, Masanori

2017-11-01

Pyridoxine is converted to its biologically active form pyridoxal-5-phosphate (P5P) by the enzyme pyridox(am)ine 5'-phosphate oxidase and serves as a cofactor in nearly 200 reactions in the central nervous system. Pyridox(am)ine 5'-phosphate oxidase deficiency leads to P5P dependent epilepsy, typically a neonatal- or infantile-onset epileptic encephalopathy treatable with P5P or in some cases, pyridoxine. Following identification of retinopathy in a patient with pyridox(am)ine 5'-phosphate oxidase deficiency that was reversible with P5P therapy, we describe the systemic manifestations of pyridox(am)ine 5'-phosphate oxidase deficiency. A series of six patients with homozygous mutations of PNPO, the gene coding pyridox(am)ine 5'-phosphate oxidase, were evaluated in our center over the course of two years for phenotyping of neurological and systemic manifestations. Five of six were born prematurely, three had anemia and failure to thrive, and two had elevated alkaline phosphatase. A movement disorder was observed in two children, and a reversible retinopathy was observed in the most severely affected infant. All patients had neonatal-onset epilepsy and were on a continuum of developmental delay to profound encephalopathy. Electroencephalographic features included background slowing and disorganization, absent sleep features, and multifocal and generalized epileptiform discharges. All the affected probands carried a homozygous PNPO mutation (c.674 G>T, c.686 G>A and c.352G>A). In addition to the well-described epileptic encephalopathy, pyridox(am)ine 5'-phosphate oxidase deficiency causes a range of neurological and systemic manifestations. A movement disorder, developmental delay, and encephalopathy, as well as retinopathy, anemia, and failure to thrive add to the broadening clinical spectrum of P5P dependent epilepsy. Copyright © 2017 Elsevier Inc. All rights reserved.

Generation of Resistance to the Diphenyl Ether Herbicide, Oxyfluorfen, via Expression of the Bacillus subtilis Protoporphyrinogen Oxidase Gene in Transgenic Tobacco Plants.

PubMed

Choi, K W; Han, O; Lee, H J; Yun, Y C; Moon, Y H; Kim, M; Kuk, Y I; Han, S U; Guh, J O

1998-01-01

In an effort to develop transgenic plants resistant to diphenyl ether herbicides, we introduced the protoporphyrinogen oxidase (EC 1.3.3.4) gene of Bacillus subtilis into tobacco plants. The results from a Northern analysis and leaf disc assay indicate that the expression of the B. subtilis protoporphyrinogen oxidase gene under the cauliflower mosaic virus 35S promoter generated resistance to the diphenyl ether herbicide, oxyfluorfen, in transgenic tobacco plants.

Association between a promoter variant in the monoamine oxidase A gene and schizophrenia.

PubMed

Jönsson, Erik G; Norton, Nadine; Forslund, Kaj; Mattila-Evenden, Marja; Rylander, Gunnar; Asberg, Marie; Owen, Michael J; Sedvall, Göran C

2003-05-01

Monoaminergic transmission has been implicated in the pathophysiology of schizophrenia. We investigated a putative functional promoter polymorphism in the monoamine oxidase A (MAOA) gene in schizophrenic patients (n=133) and control subjects (n=377). In men, there was an association between the less efficiently transcribed alleles and schizophrenia (chi(2)=4.01, df=1, p<0.05). In women, no significant differences were found. The present results support the involvement of the MAOA gene in men with schizophrenia in the investigated Swedish population but should be interpreted with caution until replicated.

Phytochrome Regulates Gibberellin Biosynthesis during Germination of Photoblastic Lettuce Seeds1

PubMed Central

Toyomasu, Tomonobu; Kawaide, Hiroshi; Mitsuhashi, Wataru; Inoue, Yasunori; Kamiya, Yuji

1998-01-01

Germination of lettuce (Lactuca sativa L.) seed is regulated by phytochrome. The requirement for red light is circumvented by the application of gibberellin (GA). We have previously shown that the endogenous content of GA1, the main bioactive GA in lettuce seeds, increases after red-light treatment. To clarify which step of GA1 synthesis is regulated by phytochrome, cDNAs encoding GA 20-oxidases (Ls20ox1 and Ls20ox2, for L. sativa GA 20-oxidase) and 3β-hydroxylases (Ls3h1 and Ls3h2 for L. sativa GA 3β-hydroxylase) were isolated from lettuce seeds by reverse-transcription polymerase chain reaction. Functional analysis of recombinant proteins expressed in Escherichia coli confirmed that the Ls20ox and Ls3h encode GA 20-oxidases and 3β-hydroxylases, respectively. Northern-blot analysis showed that Ls3h1 expression was dramatically induced by red-light treatment within 2 h, and that this effect was canceled by a subsequent far-red-light treatment. Ls3h2 mRNA was not detected in seeds that had been allowed to imbibe under any light conditions. Expression of the two Ls20ox genes was induced by initial imbibition alone in the dark. The level of Ls20ox2 mRNA decreased after the red-light treatment, whereas that of Ls20ox1 was unaffected by light. These results suggest that red light promotes GA1 synthesis in lettuce seeds by inducing Ls3h1 expression via phytochrome action. PMID:9847128

Genetic mapping of new seed-expressed polyphenol oxidase genes in wheat (Triticum aestivum L.).

PubMed

Beecher, Brian S; Carter, Arron H; See, Deven R

2012-05-01

Polyphenol oxidase (PPO) enzymatic activity is a major cause in time-dependent discoloration in wheat dough products. The PPO-A1 and PPO-D1 genes have been shown to contribute to wheat kernel PPO activity. Recently a novel PPO gene family consisting of the PPO-A2, PPO-B2, and PPO-D2 genes has been identified and shown to be expressed in wheat kernels. In this study, the sequences of these five kernel PPO genes were determined for the spring wheat cultivars Louise and Penawawa. The two cultivars were found to be polymorphic at each of the PPO loci. Three novel alleles were isolated from Louise. The Louise X Penawawa mapping population was used to genetically map all five PPO genes. All map to the long arm of homeologous group 2 chromosomes. PPO-A2 was found to be located 8.9 cM proximal to PPO-A1 on the long arm of chromosome 2A. Similarly, PPO-D1 and PPO-D2 were separated by 10.7 cM on the long arm of chromosome 2D. PPO-B2 mapped to the long arm of chromosome 2B and was the site of a novel QTL for polyphenol oxidase activity. Five other PPO QTL were identified in this study. One QTL corresponds to the previously described PPO-D1 locus, one QTL corresponds to the PPO-D2 locus, whereas the remaining three are located on chromosome 2B.

Direct and indirect effects of RNA interference against pyridoxal kinase and pyridoxine 5'-phosphate oxidase genes in Bombyx mori.

PubMed

Huang, ShuoHao; Yao, LiLi; Zhang, JianYun; Huang, LongQuan

2016-08-01

Vitamin B6 comprises six interconvertible pyridine compounds (vitamers), among which pyridoxal 5'-phosphate is a coenzyme involved in a high diversity of biochemical reactions. Humans and animals obtain B6 vitamers from diet, and synthesize pyridoxal 5'-phosphate by pyridoxal kinase and pyridoxine 5'-phosphate oxidase. Currently, little is known on how pyridoxal 5'-phosphate biosynthesis is regulated, and pyridoxal 5'-phosphate is supplied to meet their requirement in terms of cofactor. Bombyx mori is a large silk-secreting insect, in which protein metabolism is most active, and the vitamin B6 demand is high. In this study, we successfully down-regulated the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase by body cavity injection of synthesized double-stranded small interfering RNA to 5th instar larvae of Bombyx mori, and analyzed the gene transcription levels of pyridoxal 5'-phosphate dependent enzymes, phosphoserine aminotransferase and glutamic-oxaloacetic transaminase. Results show that the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase has a greater impact on the gene transcription of enzymes using pyridoxal 5'-phosphate as a cofactor in Bombyx mori. Our study suggests that pyridoxal 5'-phosphate biosynthesis and dynamic balance may be regulated by genetic networks. Copyright © 2016 Elsevier B.V. All rights reserved.

[Molecular identification of human Diphyllobothrium nihonkaiense using mitochondrial cytochrome c oxidase subunit 1 (cox1) gene sequence].

PubMed

Ono, Sayaka; Morimoto, Norihito; Korenaga, Masataka; Kumazawa, Hideo; Komatsu, Yutaka; Kuge, Itsu; Higashidani, Yoshihumi; Ogura, Katsumi; Sugiura, Tetsuro

2010-11-01

Identification of Diphyllobothrium species has been carried out based on their morphology, especially sexual organs. In addition to these criteria, PCR-based identification methods have been developed recently. A 20 year-old Japanese living in Kochi Prefecture passed tapeworm. He was successfully treated with single dose of gastrografin. We examined the morphologic features of the proglottids and eggs using histology and scanning electron microscope. We also analyzed mitochondrial cytochrome c oxidase subunit 1 (cox1) gene of the proglottids. The causative tapeworm species was identified as D. nihonkaiense based on the results of morphologic features and genetic analysis. We discussed the advantage of PCR-based identification methods of Diphyllobothrium species using cox1 sequence in the clinical laboratory.

Potato tuber cytokinin oxidase/dehydrogenase genes: Biochemical properties, activity, and expression during tuber dormancy progression

USDA-ARS?s Scientific Manuscript database

The enzymatic and biochemical properties of the proteins encoded by five potato cytokinin oxidase/dehydrogenase (CKX)-like genes functionally expressed in yeast and the effects of tuber dormancy progression on StCKX expression and cytokinin metabolism were examined in meristems isolated from field-g...

Cloning and expression analysis of the ATP-binding cassette transporter gene MFABC1 and the alternative oxidase gene MfAOX1 from Monilinia fructicola.

PubMed

Schnabel, Guido; Dait, Qun; Paradkar, Manjiri R

2003-10-01

Brown rot, caused by Moniliniafructicola (G Wint) Honey, is a serious disease of peach in all commercial peach production areas in the USA, including South Carolina where it has been primarily controlled by pre-harvest application of 14-alpha demethylation (DMI) fungicides for more than 15 years. Recently, the Qo fungicide azoxystrobin was registered for brown rot control and is currently being investigated for its potential as a DMI fungicide rotation partner because of its different mode of action. In an effort to investigate molecular mechanisms of DMI and Qo fungicide resistance in M fructicola, the ABC transporter gene MfABC1 and the alternative oxidase gene MfAOX1 were cloned to study their potential role in conferring fungicide resistance. The MfABC1 gene was 4380 bp in length and contained one intron of 71 bp. The gene revealed high amino acid homologies with atrB from Aspergillus nidulans (Eidam) Winter, an ABC transporter conferring resistance to many fungicides, including DMI fungicides. MfABC1 gene expression was induced after myclobutanil and propiconazole treatment in isolates with low sensitivity to the same fungicides, and in an isolate with high sensitivity to propiconazole. The results suggest that the MfABC1 gene may be a DMI fungicide resistance determinant in M fructicola. The alternative oxidase gene MfAOX1 from M fructicola was cloned and gene expression was analyzed. The MfAOX1 gene was 1077 bp in length and contained two introns of 54 and 67 bp. The amino acid sequence was 63.8, 63.8 and 57.7% identical to alternative oxidases from Venturia inaequalis (Cooke) Winter, Aspergillus niger van Teighem and A nidulans, respectively. MfAOX1 expression in some but not all M fructicola isolates was induced in mycelia treated with azoxystrobin. Azoxystrobin at 2 microg ml(-1) significantly induced MfAOX1 expression in isolates with low MfAOX1 constitutive expression levels.

Alternative oxidase impacts ganoderic acid biosynthesis by regulating intracellular ROS levels in Ganoderma lucidum.

PubMed

Shi, Deng-Ke; Zhu, Jing; Sun, Ze-Hua; Zhang, Guang; Liu, Rui; Zhang, Tian-Jun; Wang, Sheng-Li; Ren, Ang; Zhao, Ming-Wen

2017-10-01

The alternative oxidase (AOX), which forms a branch of the mitochondrial respiratory electron transport pathway, functions to sustain electron flux and alleviate reactive oxygen species (ROS) production. In this article, a homologous AOX gene was identified in Ganoderma lucidum. The coding sequence of the AOX gene in G. lucidum contains 1038 nucleotides and encodes a protein of 39.48 kDa. RNA interference (RNAi) was used to study the function of AOX in G. lucidum, and two silenced strains (AOXi6 and AOXi21) were obtained, showing significant decreases of approximately 60 and 50 %, respectively, in alternative pathway respiratory efficiency compared to WT. The content of ganoderic acid (GA) in the mutant strains AOXi6 and AOXi21 showed significant increases of approximately 42 and 44 %, respectively, compared to WT. Elevated contents of intermediate metabolites in GA biosynthesis and elevated transcription levels of corresponding genes were also observed in the mutant strains AOXi6 and AOXi21. In addition, the intracellular ROS content in strains AOXi6 and AOXi21 was significantly increased, by approximately 1.75- and 1.93-fold, respectively, compared with WT. Furthermore, adding N-acetyl-l-cysteine (NAC), a ROS scavenger, significantly depressed the intracellular ROS content and GA accumulation in AOX-silenced strains. These results indicate that AOX affects GA biosynthesis by regulating intracellular ROS levels. Our research revealed the important role of AOX in the secondary metabolism of G. lucidum.

Characterization of ent-kaurene synthase and kaurene oxidase involved in gibberellin biosynthesis from Scoparia dulcis.

PubMed

Yamamura, Yoshimi; Taguchi, Yukari; Ichitani, Kei; Umebara, Io; Ohshita, Ayako; Kurosaki, Fumiya; Lee, Jung-Bum

2018-03-01

Gibberellins (GAs) are ubiquitous diterpenoids in higher plants, whereas some higher plants produce unique species-specific diterpenoids. In GA biosynthesis, ent-kaurene synthase (KS) and ent-kaurene oxidase (KO) are key players which catalyze early step(s) of the cyclization and oxidation reactions. We have studied the functional characterization of gene products of a KS (SdKS) and two KOs (SdKO1 and SdKO2) involved in GA biosynthesis in Scoparia dulcis. Using an in vivo heterologous expression system of Escherichia coli, we found that SdKS catalyzed a cyclization reaction from ent-CPP to ent-kaurene and that the SdKOs oxidized ent-kaurene to ent-kaurenoic acid after modification of the N-terminal region for adaptation to the E. coli expression system. The real-time PCR results showed that the SdKS, SdKO1 and SdKO2 genes were mainly expressed in the root and lateral root systems, which are elongating tissues. Based on these results, we suggest that these three genes may be responsible for the metabolism of GAs in S. dulcis.

Cytokinin oxidase/dehydrogenase genes in barley and wheat: cloning and heterologous expression.

PubMed

Galuszka, Petr; Frébortová, Jitka; Werner, Tomás; Yamada, Mamoru; Strnad, Miroslav; Schmülling, Thomas; Frébort, Ivo

2004-10-01

The cloning of two novel genes that encode cytokinin oxidase/dehydrogenase (CKX) in barley is described in this work. Transformation of both genes into Arabidopsis and tobacco showed that at least one of the genes codes for a functional enzyme, as its expression caused a cytokinin-deficient phenotype in the heterologous host plants. Additional cloning of two gene fragments, and an in silico search in the public expressed sequence tag clone databases, revealed the presence of at least 13 more members of the CKX gene family in barley and wheat. The expression of three selected barley genes was analyzed by RT-PCR and found to be organ-specific with peak expression in mature kernels. One barley CKX (HvCKX2) was characterized in detail after heterologous expression in tobacco. Interestingly, this enzyme shows a pH optimum at 4.5 and a preference for cytokinin ribosides as substrates, which may indicate its vacuolar targeting. Different substrate specificities, and the pH profiles of cytokinin-degrading enzymes extracted from different barley tissues, are also presented.

Terminal oxidase diversity and function in "Metallosphaera yellowstonensis": gene expression and protein modeling suggest mechanisms of Fe(II) oxidation in the sulfolobales.

PubMed

Kozubal, M A; Dlakic, M; Macur, R E; Inskeep, W P

2011-03-01

"Metallosphaera yellowstonensis" is a thermoacidophilic archaeon isolated from Yellowstone National Park that is capable of autotrophic growth using Fe(II), elemental S, or pyrite as electron donors. Analysis of the draft genome sequence from M. yellowstonensis strain MK1 revealed seven different copies of heme copper oxidases (subunit I) in a total of five different terminal oxidase complexes, including doxBCEF, foxABCDEFGHIJ, soxABC, and the soxM supercomplex, as well as a novel hypothetical two-protein doxB-like polyferredoxin complex. Other genes found in M. yellowstonensis with possible roles in S and or Fe cycling include a thiosulfate oxidase (tqoAB), a sulfite oxidase (som), a cbsA cytochrome b(558/566), several small blue copper proteins, and a novel gene sequence coding for a putative multicopper oxidase (Mco). Results from gene expression studies, including reverse transcriptase (RT) quantitative PCR (qPCR) of cultures grown autotrophically on either Fe(II), pyrite, or elemental S showed that the fox gene cluster and mco are highly expressed under conditions where Fe(II) is an electron donor. Metagenome sequence and gene expression studies of Fe-oxide mats confirmed the importance of fox genes (e.g., foxA and foxC) and mco under Fe(II)-oxidizing conditions. Protein modeling of FoxC suggests a novel lysine-lysine or lysine-arginine heme B binding domain, indicating that it is likely the cytochrome component of a heterodimer complex with foxG as a ferredoxin subunit. Analysis of mco shows that it encodes a novel multicopper blue protein with two plastocyanin type I copper domains that may play a role in the transfer of electrons within the Fox protein complex. An understanding of metabolic pathways involved in aerobic iron and sulfur oxidation in Sulfolobales has broad implications for understanding the evolution and niche diversification of these thermophiles as well as practical applications in fields such as bioleaching of trace metals from pyritic ores.

Monoamine Oxidase a Promoter Gene Associated with Problem Behavior in Adults with Intellectual/Developmental Disabilities

ERIC Educational Resources Information Center

May, Michael E.; Srour, Ali; Hedges, Lora K.; Lightfoot, David A.; Phillips, John A., III; Blakely, Randy D.; Kennedy, Craig H.

2009-01-01

A functional polymorphism in the promoter of the gene encoding monoamine oxidase A has been associated with problem behavior in various populations. We examined the association of MAOA alleles in adult males with intellectual/developmental disabilities with and without established histories of problem behavior. These data were compared with a…

Recombinant DNA modification of gibberellin metabolism alters growth rate and biomass allocation in Populus

DOE PAGES

Lu, Haiwei; Viswanath, Venkatesh; Ma, Cathleen; ...

2015-11-13

Overexpression of genes that modify gibberellin (GA) metabolism and signaling have been previously shown to produce trees with improved biomass production but highly disturbed development. In order to examine if more subtle types of genetic modification of GA could improve growth rate and modify tree architecture, we transformed a model poplar genotype (Populus tremula × P. alba) with eight genes, including two cisgenes (intact copies of native genes), four intragenes (modified copies of native genes), and two transgenes (from sexually incompatible species), and studied their effects under greenhouse and field conditions. In the greenhouse, four out of the eight testedmore » genes produced a significant and often striking improvement of stem volume, and two constructs significantly modified the proportion of root or shoot biomass. Characterization of GA concentrations in the cisgenic population that had an additional copy of a poplar GA20-oxidase gene showed elevated concentrations of 13-hydroxylated GAs compared to wild-type poplars. In the field, we observed growth improvement for three of the six tested constructs, but it was significantly greater for only one of the constructs, a pRGL:GA20-oxidase intragene. The greenhouse and field responses were highly variable, possibly to due to cross-talk among the GA pathway and other stress response pathways, or due to interactions between the cisgenes and intragenes with highly similar endogenes. Our results indicate that extensive field trials, similar to those required for conventional breeding, will be critical to evaluating the value and pleiotropic effects of GA-modifying genes.« less

Recombinant DNA modification of gibberellin metabolism alters growth rate and biomass allocation in Populus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lu, Haiwei; Viswanath, Venkatesh; Ma, Cathleen

Overexpression of genes that modify gibberellin (GA) metabolism and signaling have been previously shown to produce trees with improved biomass production but highly disturbed development. In order to examine if more subtle types of genetic modification of GA could improve growth rate and modify tree architecture, we transformed a model poplar genotype (Populus tremula × P. alba) with eight genes, including two cisgenes (intact copies of native genes), four intragenes (modified copies of native genes), and two transgenes (from sexually incompatible species), and studied their effects under greenhouse and field conditions. In the greenhouse, four out of the eight testedmore » genes produced a significant and often striking improvement of stem volume, and two constructs significantly modified the proportion of root or shoot biomass. Characterization of GA concentrations in the cisgenic population that had an additional copy of a poplar GA20-oxidase gene showed elevated concentrations of 13-hydroxylated GAs compared to wild-type poplars. In the field, we observed growth improvement for three of the six tested constructs, but it was significantly greater for only one of the constructs, a pRGL:GA20-oxidase intragene. The greenhouse and field responses were highly variable, possibly to due to cross-talk among the GA pathway and other stress response pathways, or due to interactions between the cisgenes and intragenes with highly similar endogenes. Our results indicate that extensive field trials, similar to those required for conventional breeding, will be critical to evaluating the value and pleiotropic effects of GA-modifying genes.« less

In vitro binding of Sorghum bicolor transcription factors ABI4 and ABI5 to a conserved region of a GA 2-OXIDASE promoter: possible role of this interaction in the expression of seed dormancy.

PubMed

Cantoro, Renata; Crocco, Carlos Daniel; Benech-Arnold, Roberto Luis; Rodríguez, María Verónica

2013-12-01

The precise adjustment of the timing of dormancy release according to final grain usage is still a challenge for many cereal crops. Grain sorghum [Sorghum bicolor (L.) Moench] shows wide intraspecific variability in dormancy level and susceptibility to pre-harvest sprouting (PHS). Both embryo sensitivity to abscisic acid (ABA) and gibberellin (GA) metabolism play an important role in the expression of dormancy of the developing sorghum grain. In previous works, it was shown that, simultaneously with a greater embryo sensitivity to ABA and higher expression of SbABA-INSENSITIVE 4 (SbABI4) and SbABA-INSENSITIVE 5 (SbABI5), dormant grains accumulate less active GA4 due to a more active GA catabolism. In this work, it is demonstrated that the ABA signalling components SbABI4 and SbABI5 interact in vitro with a fragment of the SbGA 2-OXIDASE 3 (SbGA2ox3) promoter containing an ABA-responsive complex (ABRC). Both transcription factors were able to bind the promoter, although not simultaneously, suggesting that they might compete for the same cis-acting regulatory sequences. A biological role for these interactions in the expression of dormancy of sorghum grains is proposed: either SbABI4 and/or SbABI5 activate transcription of the SbGA2ox3 gene in vivo and promote SbGA2ox3 protein accumulation; this would result in active degradation of GA4, thus preventing germination of dormant grains. A comparative analysis of the 5'-regulatory region of GA2oxs from both monocots and dicots is also presented; conservation of the ABRC in closely related GA2oxs from Brachypodium distachyon and rice suggest that these species might share the same regulatory mechanism as proposed for grain sorghum.

Diversity of Two-Domain Laccase-Like Multicopper Oxidase Genes in Streptomyces spp.: Identification of Genes Potentially Involved in Extracellular Activities and Lignocellulose Degradation during Composting of Agricultural Waste

PubMed Central

Lu, Lunhui; Zhang, Jiachao; Chen, Anwei; Chen, Ming; Jiang, Min; Yuan, Yujie; Wu, Haipeng; Lai, Mingyong; He, Yibin

2014-01-01

Traditional three-domain fungal and bacterial laccases have been extensively studied for their significance in various biotechnological applications. Growing molecular evidence points to a wide occurrence of more recently recognized two-domain laccase-like multicopper oxidase (LMCO) genes in Streptomyces spp. However, the current knowledge about their ecological role and distribution in natural or artificial ecosystems is insufficient. The aim of this study was to investigate the diversity and composition of Streptomyces two-domain LMCO genes in agricultural waste composting, which will contribute to the understanding of the ecological function of Streptomyces two-domain LMCOs with potential extracellular activity and ligninolytic capacity. A new specific PCR primer pair was designed to target the two conserved copper binding regions of Streptomyces two-domain LMCO genes. The obtained sequences mainly clustered with Streptomyces coelicolor, Streptomyces violaceusniger, and Streptomyces griseus. Gene libraries retrieved from six composting samples revealed high diversity and a rapid succession of Streptomyces two-domain LMCO genes during composting. The obtained sequence types cluster in 8 distinct clades, most of which are homologous with Streptomyces two-domain LMCO genes, but the sequences of clades III and VIII do not match with any reference sequence of known streptomycetes. Both lignocellulose degradation rates and phenol oxidase activity at pH 8.0 in the composting process were found to be positively associated with the abundance of Streptomyces two-domain LMCO genes. These observations provide important clues that Streptomyces two-domain LMCOs are potentially involved in bacterial extracellular phenol oxidase activities and lignocellulose breakdown during agricultural waste composting. PMID:24657870

Association analysis of the functional MAOA gene promoter and MAOB gene intron 13 polymorphisms in tension type headache patients.

PubMed

Edgnülü, Tuba G; Özge, Aynur; Erdal, Nurten; Kuru, Oktay; Erdal, Mehmet E

2014-01-01

Monoamine oxidase (MAO) enzymes play an important role in the etiology of many neurological diseases. Tension type headache (TTH) treatments contain inhibitors for selective re-uptake of serotonin and monoamine oxidase inhibitors. MAO (EC 1.4.3.4) has two isoenzymes known as MAOA and MAOB. A promoter polymorphism of a variable number of tandem repeats (VNTR) in the MAOA gene seems to affect MAOA transcriptional activity in vitro. Also, G/A polymorphism in intron 13 (rs1799836) of the MAOB gene have been previously found to be associated with the variability of MAOB enzyme activity. The aim of our study was to investigate a possible association of monoamine oxidase (MAOA and MAOB) gene polymorphisms in tension type headache. MAO gene polymorphisms were examined in a group of 120 TTH patients and in another 168 unrelated healthy volunteers (control group). MAOA promoter and MAOB intron 13 polymorphisms were genotyped using PCR-based methods. An overall comparison between the genotype of MAOA and MAOB genes and allele frequencies of the patients and the control group did not reveal any statistically significant difference between the patients and the control group (p=0.162). Factors like estrogen dosage, the limited number of male patients and other genes' neurotransmitters involved in the etiology of TTH could be responsible for our non-significant results.

High brightness nonpolar a-plane (11-20) GaN light-emitting diodes

NASA Astrophysics Data System (ADS)

Jung, Sukkoo; Chang, Younghak; Bang, Kyu-Hyun; Kim, Hyung-Gu; Choi, Yoon-Ho; Hwang, Sung-Min; Baik, Kwang Hyeon

2012-02-01

We report on high brightness nonpolar a-plane InGaN/GaN LEDs using patterned lateral overgrowth (PLOG) epitaxy. High crystal-quality and smooth surfaces for a-plane GaN (a-GaN) films were achieved using PLOG with an array of hexagonal SiO2 patterns. The XRC FWHMs of as-grown PLOG a-GaN films were found to be 414 and 317 arcsec (450 and 455 arcsec for planar a-GaN films) along the c-axis and m-axis directions, respectively. Plan-view CL clearly reveals the periodic hexagonal patterns with higher band edge emission intensity, implying that the luminescence properties of a-GaN films lying above the SiO2 mask are improved. The light output powers of a-InGaN/GaN PLOG LEDs were measured to be 7.5 mW and 20 mW at drive currents of 20 mA and 100 mA, respectively. A negligible blue-shift was observed in the peak emission wavelength with increasing drive current up to 100 mA, indicating that there are no strong internal fields in nonpolar a-InGaN/GaN LEDs. We believe that nonpolar a-plane InGaN/GaN LEDs hold promise for efficient nitride emitters if the growth conditions are further optimized.

The absence of genes for cytochrome c oxidase and reductase subunits in maxicircle kinetoplast DNA of the respiration-deficient plant trypanosomatid Phytomonas serpens.

PubMed

Nawathean, P; Maslov, D A

2000-08-01

By completing the sequencing of the maxicircle conserved region in the kinetoplast DNA of Phytomonas serpens, we showed that the genes for subunits I and II (COI and COII) of cytochrome c oxidase in this organism were missing. We had previously shown that the genes for cytochrome c oxidase subunit III and apocytochrome b were also missing. These deletions did not affect the structure or expression of the remaining genes. Partial editing of the mRNA for NADH dehydrogenase subunit 8, previously found in strain IG from insects, was complete in two other strains isolated from plants. The appearance of a novel maxicircle gene for MURF2 block I gRNA, which substitutes for the gene missing due to the COII gene deletion, may illustrate a general mechanism for the origin of gRNAs.

RNA interference of 1-aminocyclopropane-1-carboxylic acid oxidase (ACO1 and ACO2) genes expression prolongs the shelf life of Eksotika (Carica papaya L.) papaya fruit.

PubMed

Sekeli, Rogayah; Abdullah, Janna Ong; Namasivayam, Parameswari; Muda, Pauziah; Abu Bakar, Umi Kalsom; Yeong, Wee Chien; Pillai, Vilasini

2014-06-19

The purpose of this study was to evaluate the effectiveness of using RNA interference in down regulating the expression of 1-aminocyclopropane-1-carboxylic acid oxidase gene in Eksotika papaya. One-month old embryogenic calli were separately transformed with Agrobacterium strain LBA 4404 harbouring the three different RNAi pOpOff2 constructs bearing the 1-aminocyclopropane-1-carboxylic acid oxidase gene. A total of 176 putative transformed lines were produced from 15,000 calli transformed, selected, then regenerated on medium supplemented with kanamycin. Integration and expression of the targeted gene in putatively transformed lines were verified by PCR and real-time RT-PCR. Confined field evaluation of a total of 31 putative transgenic lines planted showed a knockdown expression of the targeted ACO1 and ACO2 genes in 13 lines, which required more than 8 days to achieve the full yellow colour (Index 6). Fruits harvested from lines pRNAiACO2 L2-9 and pRNAiACO1 L2 exhibited about 20 and 14 days extended post-harvest shelf life to reach Index 6, respectively. The total soluble solids contents of the fruits ranged from 11 to 14° Brix, a range similar to fruits from non-transformed, wild type seed-derived plants.

A novel proteolytic processing of prolysyl oxidase

PubMed Central

Atsawasuwan, Phimon; Mochida, Yoshiyuki; Katafuchi, Michitsuna; Tokutomi, Kentaro; Mocanu, Viorel; Parker, Carol E.; Yamauchi, Mitsuo

2012-01-01

Lysyl oxidase (LOX) is an amine oxidase that is critical for the stability of connective tissues. The secreted proLOX is enzymatically quiescent and is activated through proteolytic cleavage between residue Gly162 and Asp163 (residue numbers according to the mouse LOX) by bone morphogenetic protein (BMP)-1 gene products. Here we report a novel processing of proLOX identified in vitro and in vivo. Two forms of mature LOX were identified and characterized by their immunoreactivity to specific antibodies, amine oxidase activity and mass spectrometry. One form was identified as a well characterized BMP-1 processed LOX protein. Another was found to be a truncated form of LOX (tLOX) resulting from the cleavage at the carboxy terminus of Arg192. The tLOX still appeared to retain amine oxidase activity. The results from the proLOX gene deletion and mutation experiments indicated that the processing occurs independent of the cleavage of proLOX by BMP-1 gene products and likely requires the presence of LOX propeptide. These results indicate that proLOX could be processed by two different mechanisms producing two forms of active LOX. PMID:21591931

A novel proteolytic processing of prolysyl oxidase.

PubMed

Atsawasuwan, Phimon; Mochida, Yoshiyuki; Katafuchi, Michitsuna; Tokutomi, Kentaro; Mocanu, Viorel; Parker, Carol E; Yamauchi, Mitsuo

2011-01-01

Lysyl oxidase (LOX) is an amine oxidase that is critical for the stability of connective tissues. The secreted proLOX is enzymatically quiescent and is activated through proteolytic cleavage between residues Gly(162) and Asp(163) (residue numbers according to the mouse LOX) by bone morphogenetic protein (BMP)-1 gene products. Here we report a novel processing of proLOX identified in vitro and in vivo. Two forms of mature LOX were identified and characterized by their immunoreactivity to specific antibodies, amine oxidase activity, and mass spectrometry. One form was identified as a well-characterized BMP-1 processed LOX protein. Another was found to be a truncated form of LOX resulting from the cleavage at the carboxy terminus of Arg(192). The truncated form of LOX still appeared to retain amine oxidase activity. The results from the proLOX gene deletion and mutation experiments indicated that the processing occurs independent of the cleavage of proLOX by BMP-1 gene products and likely requires the presence of LOX propeptide. These results indicate that proLOX could be processed by two different mechanisms producing two forms of active LOX.

Fine structure of OXI1, the mitochondrial gene coding for subunit II of yeast cytochrome c oxidase.

PubMed

Weiss-Brummer, B; Guba, R; Haid, A; Schweyen, R J

1979-12-01

Genetic and biochemical studies have been performed with 110 mutants which are defective in cytochrome a·a3 and map in the regions on mit DNA previously designated OXI1 and OXI2. With 88 mutations allocated to OXI1 fine structure mapping was achieved by the analysis of rho (-) deletions. The order of six groups of mutational sites (A 1, A2, B 1, B2, C 1, C2) thus determined was confirmed by oxi i x oxi j recombination analysis.Analysis of mitochondrially translated polypeptides of oxil mutants by SDS-polyacrylamide electrophoresis reveals three classes of mutant patterns: i) similar to wild-tpye (19 mutants); ii) lacking SU II of cytochrome c oxidase (53 mutants); iii) lacking this subunit and exhibiting a single new polypeptide of lower Mr (16 mutants). Mutations of each of these classes are scattered over the OXI1 region without any detectable clustering; this is consistent with the assumption that all oxil mutations studied are within the same gene.New polypeptides observed in oxil mutants of class iii) vary in Mr in the range from 10,500 to 33,000. Those of Mr 17,000 to 33,000 are shown to be antigenically related to subunit II of cytochrome c oxidase. Colinearity is established between the series of new polypeptides of Mr values increasing from 10,500 to 31,500 and the order of the respective mutational sites on the map, e.g. mutations mapping in A 1 generate the smallest and mutations mapping in C2 the largest mutant fragments.From these data we conclude that i) all mutations allocated to the OXI1 region are in the same gene; ii) this gene codes for subunit II of cytochrome c oxidase; iii) the direction of translation is from CAP to 0X12. Out of 19 mutants allocated to OXI2 three exhibit a new polypeptide; these and all the other oxi2 mutants lack subunit III of cytochrome oxidase. This result provides preliminary evidence that the OXI2 region harbours the structural gene for this subunit III.

Deciphering of the Dual oxidase (Nox family) gene from kuruma shrimp, Marsupenaeus japonicus: full-length cDNA cloning and characterization.

PubMed

Inada, Mari; Kihara, Keisuke; Kono, Tomoya; Sudhakaran, Raja; Mekata, Tohru; Sakai, Masahiro; Yoshida, Terutoyo; Itami, Toshiaki

2013-02-01

In many physiological processes, including the innate immune system, free radicals such as nitric oxide (NO) and reactive oxygen species (ROS) play significant roles. In humans, 2 homologs of Dual oxidases (Duox) generate hydrogen peroxide (H(2)O(2)), which is a type of ROS. Here, we report the identification and characterization of a Duox from kuruma shrimp, Marsupenaeus japonicus. The full-length cDNA sequence of the M. japonicus Dual oxidase (MjDuox) gene contains 4695 bp and was generated using reverse transcriptase-polymerase chain reaction (RT-PCR) and random amplification of cDNA ends (RACE). The open reading frame of MjDuox encodes a protein of 1498 amino acids with an estimated mass of 173 kDa. In a homology analysis using amino acid sequences, MjDuox exhibited 69.3% sequence homology with the Duox of the red flour beetle, Tribolium castaneum. A transcriptional analysis revealed that the MjDuox mRNA is highly expressed in the gills of healthy kuruma shrimp. In the gills, MjDuox expression reached its peak 60 h after injection with WSSV and decreased to its normal level at 72 h. In gene knockdown experiments of free radical-generating enzymes, the survival rates decreased during the early stages of a white spot syndrome virus (WSSV) infection following the knockdown of the NADPH oxidase (MjNox) or MjDuox genes. In the present study, the identification, cloning and gene knockdown of the kuruma shrimp MjDuox are reported. Duoxes have been identified in vertebrates and some insects; however, few reports have investigated Duoxes in crustaceans. This study is the first to identify and clone a Dual oxidase from a crustacean species. Copyright © 2012 Elsevier Ltd. All rights reserved.

Isolation and characterization of the pea cytochrome c oxidase Vb gene.

PubMed

Kubo, Nakao; Arimura, Shin-Ichi; Tsutsumi, Nobuhiro; Kadowaki, Koh-Ichi; Hirai, Masashi

2006-11-01

Three copies of the gene that encodes cytochrome c oxidase subunit Vb were isolated from the pea (PscoxVb-1, PscoxVb-2, and PscoxVb-3). Northern Blot and reverse transcriptase-PCR analyses suggest that all 3 genes are transcribed in the pea. Each pea coxVb gene has an N-terminal extended sequence that can encode a mitochondrial targeting signal, called a presequence. The localization of green fluorescent proteins fused with the presequence strongly suggests the targeting of pea COXVb proteins to mitochondria. Each pea coxVb gene has 5 intron sites within the coding region. These are similar to Arabidopsis and rice, although the intron lengths vary greatly. A phylogenetic analysis of coxVb suggests the occurrence of gene duplication events during angiosperm evolution. In particular, 2 duplication events might have occurred in legumes, grasses, and Solanaceae. A comparison of amino acid sequences in COXVb or its counterpart shows the conservation of several amino acids within a zinc finger motif. Interestingly, a homology search analysis showed that bacterial protein COG4391 and a mitochondrial complex I 13 kDa subunit also have similar amino acid compositions around this motif. Such similarity might reflect evolutionary relationships among the 3 proteins.

Adipogenesis-related increase of semicarbazide-sensitive amine oxidase and monoamine oxidase in human adipocytes.

PubMed

Bour, Sandy; Daviaud, Danièle; Gres, Sandra; Lefort, Corinne; Prévot, Danielle; Zorzano, Antonio; Wabitsch, Martin; Saulnier-Blache, Jean-Sébastien; Valet, Philippe; Carpéné, Christian

2007-08-01

A strong induction of semicarbazide-sensitive amine oxidase (SSAO) has previously been reported during murine preadipocyte lineage differentiation but it remains unknown whether this emergence also occurs during adipogenesis in man. Our aim was to compare SSAO and monoamine oxidase (MAO) expression during in vitro differentiation of human preadipocytes and in adipose and stroma-vascular fractions of human fat depots. A human preadipocyte cell strain from a patient with Simpson-Golabi-Behmel syndrome was first used to follow amine oxidase expression during in vitro differentiation. Then, human preadipocytes isolated from subcutaneous adipose tissues were cultured under conditions promoting ex vivo adipose differentiation and tested for MAO and SSAO expression. Lastly, human adipose tissue was separated into mature adipocyte and stroma-vascular fractions for analyses of MAO and SSAO at mRNA, protein and activity levels. Both SSAO and MAO were increased from undifferentiated preadipocytes to lipid-laden cells in all the models: 3T3-F442A and 3T3-L1 murine lineages, human SGBS cell strain or human preadipocytes in primary culture. In human subcutaneous adipose tissue, the adipocyte-enriched fraction exhibited seven-fold higher amine oxidase activity and contained three- to seven-fold higher levels of mRNAs encoded by MAO-A, MAO-B, AOC3 and AOC2 genes than the stroma-vascular fraction. MAO-A and AOC3 genes accounted for the majority of their respective MAO and SSAO activities in human adipose tissue. Most of the SSAO and MAO found in adipose tissue originated from mature adipocytes. Although the mechanism and role of adipogenesis-related increase in amine oxidase expression remain to be established, the resulting elevated levels of amine oxidase activities found in human adipocytes may be of potential interest for therapeutic intervention in obesity.

New splicing-site mutations in the SURF1 gene in Leigh syndrome patients.

PubMed

Pequignot, M O; Desguerre, I; Dey, R; Tartari, M; Zeviani, M; Agostino, A; Benelli, C; Fouque, F; Prip-Buus, C; Marchant, D; Abitbol, M; Marsac, C

2001-05-04

The gene SURF1 encodes a factor involved in the biogenesis of cytochrome c oxidase, the last complex in the respiratory chain. Mutations of the SURF1 gene result in Leigh syndrome and severe cytochrome c oxidase deficiency. Analysis of seven unrelated patients with cytochrome c oxidase deficiency and typical Leigh syndrome revealed different SURF1 mutations in four of them. Only these four cases had associated demyelinating neuropathy. Three mutations were novel splicing-site mutations that lead to the excision of exon 6. Two different novel heterozygous mutations were found at the same guanine residue at the donor splice site of intron 6; one was a deletion, whereas the other was a transition [588+1G>A]. The third novel splicing-site mutation was a homozygous [516-2_516-1delAG] in intron 5. One patient only had a homozygous polymorphism in the middle of the intron 8 [835+25C>T]. Western blot analysis showed that Surf1 protein was absent in all four patients harboring mutations. Our studies confirm that the SURF1 gene is an important nuclear gene involved in the cytochrome c oxidase deficiency. We also show that Surf1 protein is not implicated in the assembly of other respiratory chain complexes or the pyruvate dehydrogenase complex.

Uncovering DELLA-Independent Gibberellin Responses by Characterizing New Tomato procera Mutants

PubMed Central

Livne, Sivan; Lor, Vai S.; Nir, Ido; Eliaz, Natanella; Aharoni, Asaph; Olszewski, Neil E.; Eshed, Yuval; Weiss, David

2015-01-01

Gibberellin (GA) regulates plant development primarily by triggering the degradation/deactivation of the DELLA proteins. However, it remains unclear whether all GA responses are regulated by DELLAs. Tomato (Solanum lycopersicum) has a single DELLA gene named PROCERA (PRO), and its recessive pro allele exhibits constitutive GA activity but retains responsiveness to external GA. In the loss-of-function mutant proΔGRAS, all examined GA developmental responses were considerably enhanced relative to pro and a defect in seed desiccation tolerance was uncovered. As pro, but not proΔGRAS, elongation was promoted by GA treatment, pro may retain residual DELLA activity. In agreement with homeostatic feedback regulation of the GA biosynthetic pathway, we found that GA20oxidase1 expression was suppressed in proΔGRAS and was not affected by exogenous GA3. In contrast, expression of GA2oxidase4 was not affected by the elevated GA signaling in proΔGRAS but was strongly induced by exogenous GA3. Since a similar response was found in Arabidopsis thaliana plants with impaired activity of all five DELLA genes, we suggest that homeostatic GA responses are regulated by both DELLA-dependent and -independent pathways. Transcriptome analysis of GA-treated proΔGRAS leaves suggests that 5% of all GA-regulated genes in tomato are DELLA independent. PMID:26036254

TNF-α -308G/A gene polymorphism in bullous pemphigoid and alopecia areata.

PubMed

Moravvej, Hamideh; Tabatabaei-Panah, Pardis-Sadat; Ebrahimi, Elaheh; Esmaeili, Nafiseh; Ghaderian, Sayyed Mohammad Hossein; Ludwig, Ralf J; Akbarzadeh, Reza

2018-05-11

TNF-α -308G/A polymorphism has been investigated in few studies for an association with susceptibility to bullous pemphigoid (BP) and alopecia areata (AA). Yet, these findings had so far not been independently replicated, and no data on a possible association of TNFα -308G/A polymorphism with these diseases in Iranian population were available. In the present study, a possible effect of TNF-α -308G/A variation on susceptibility to BP or AA disease was evaluated. Genomic DNA was extracted from the blood of the patients with BP and AA as well as control subjects which genotyped for the TNF-α -308 G/A polymorphism. TNF-α gene expression levels were analyzed by real-time RT-PCR. No association was observed between the TNF-α -308 G/A variation and susceptibility to BP or AA diseases in our Iranian cohort. In contrast to AA patients, expression of TNF-α gene was significantly higher in BP patients compared to control group. TNF-α gene was found to be similarly expressed in mutant and wild-type genotypes. TNF-α -308G/A polymorphism is not associated with the risk to develop of BP and AA in our Iranian cohort. Furthermore, this polymorphism is not contributed to altering the levels of gene expression in both diseases.

Heterologous production and characterization of two glyoxal oxidases from Pycnoporus cinnabarinus

Treesearch

Marianne Daou; François Piumi; Daniel Cullen; Eric Record; Craig B. Faulds

2016-01-01

The genome of the white rot fungus Pycnoporus cinnabarinus includes a large number of genes encoding enzymes implicated in lignin degradation. Among these, three genes are predicted to encode glyoxal oxidase, an enzyme previously isolated from Phanerochaete chrysosporium. The glyoxal oxidase of P. chrysosporium...

The 20 GHz power GaAs FET development

NASA Technical Reports Server (NTRS)

Crandell, M.

1986-01-01

The development of power Field Effect Transistors (FET) operating in the 20 GHz frequency band is described. The major efforts include GaAs FET device development (both 1 W and 2 W devices), and the development of an amplifier module using these devices.

Alteration of respiration capacity and transcript accumulation level of alternative oxidase genes in necrosis lines of common wheat.

PubMed

Sugie, Atsushi; Murai, Koji; Takumi, Shigeo

2007-06-01

Mitochondrial alternative oxidase (AOX) is the terminal oxidase responsible for cyanide-insensitive and salicylhydroxamic acid-sensitive respiration in plants. AOX is a key enzyme of the alternative respiration pathway. To study the effects of necrotic cell death on the mitochondrial function, production of reactive oxygen species (ROS), respiration capacities and accumulation patterns of mitochondria-targeted protein-encoding gene transcripts were compared between wild-type, lesion-mimic mutant and hybrid necrosis wheat plants. Around cells with the necrosis symptom, ROS accumulated abundantly in the intercellular spaces. The ratio of the alternative pathway to the cytochrome pathway was markedly enhanced in the necrotic leaves. Transcripts of a wheat AOX gene, Waox1a, were more abundant in a novel lesion-mimic mutant of common wheat than in the wild-type plants. An increased level of the Waox1a transcripts was also observed in hybrid plants containing Ne1 and Ne2 genes. These results indicated that an increase of the wheat AOX transcript level resulted in enhancement of respiration capacity of the alternative pathway in the necrotic cells.

Microprojectile Bombardment Transformation of Date Palm Using the Insecticidal Cholesterol Oxidase (ChoA) Gene.

PubMed

Allam, Mai A; Saker, Mahmoud M

2017-01-01

The overall objective of this work is to optimize the transformation system for date palm as a first step toward production of date palm clones resistant to noxious pests. A construct harboring the cholesterol oxidase (ChoA) gene, which renders plant resistance against insect attack, is introduced into embryogenic date palm callus using the PDS-1000/He particle bombardment system. The process involves the establishment of embryogenic callus cultures as well as immature embryo-derived microcalli that are used as target tissues for shooting and optimization of transformation conditions. This chapter in addition explains molecular and histochemical assays conducted to confirm gene integration and expression.

Analysis of promoter polymorphism in monoamine oxidase A (MAOA) gene in completed suicide on Slovenian population.

PubMed

Uršič, Katarina; Zupanc, Tomaž; Paska, Alja Videtič

2018-04-23

Suicide is a well-defined public health problem and is a complex phenomenon influenced by a number of different risk factors, including genetic ones. Numerous studies have examined serotonin system genes. Monoamine oxidase A (MAO-A) is an outer mitochondrial membrane enzyme which is involved in the metabolic pathway of serotonin degradation. Upstream variable number of tandem repeats (uVNTR) in the promoter region of MAOA gene affects the activity of transcription. In the present study we genotyped MAOA-uVNTR polymorphism in 266 suicide victims and 191 control subjects of Slovenian population, which ranks among the European and world populations with the highest suicide rate. Genotyping was performed with polymerase chain reaction and agarose gel electrophoresis. Using a separate statistical analysis for female and male subjects we determined the differences in genotype distributions of MAOA-uVNTR polymorphism between the studied groups. Statistical analysis showed a trend towards 3R allele and suicide, and associated 3R allele with non-violent suicide method on stratified data (20 suicide victims). This is the first study associating highly suicidal Slovenian population with MAOA-uVNTR polymorphism. Copyright © 2018 Elsevier B.V. All rights reserved.

Factor V Leiden 1691G/A and prothrombin gene 20210G/A polymorphisms as prothrombotic markers in adult Egyptian acute leukemia patients.

PubMed

El Sissy, Azza Hamdy; El Sissy, Maha H; Elmoamly, Shereef

2014-11-01

Factor V Leiden 1691G/A and prothrombin gene 20210G/A mutations are the most common genetic defects leading to thrombosis. This work aimed to study the FV Leiden and the prothrombin gene polymorphism in adult Egyptian patients with acute leukemia and their importance in thrombophilia screening. The study included 76 patients with acute leukemia and 100 healthy controls. Genotyping was done by real-time polymerase chain reaction technique. For factor V Leiden, the frequency of G/A mutation conferred more than 2.5-fold of increased risk of (OR 2.639 95 % CI 1.045-6.669). The frequency of factor V Leiden combined (G/A + A/A) genotypes conferred 2.83-fold of increased risk (OR 2.828, CI 1.13-7.075), The A allele conferred almost threefold increased risk (OR 2.824, 95 % CI 1.175-6.785). Despite higher frequency in patients compared to controls, there was no risk of association between prothrombin gene mutation and acute leukemia in adult Egyptians nor was there between combined genotypes of prothrombin gene mutation and factor V Leiden.

Purification and properties of two terminal oxidase complexes of Escherichia coli aerobic respiratory chain.

PubMed

Kita, K; Konishi, K; Anraku, Y

1986-01-01

Two terminal oxidase complexes, cytochrome b-562-o complex and cytochrome b-558-d complex, are isolated in highly purified forms which show ubiquinol oxidase activities. From the result of steady-state kinetics of cytochromes in the membrane and E'm values of purified cytochromes, we propose a branched arrangement of the late exponential phase of aerobic growth, as shown in Fig. 10. Cytochrome b-556 is reduced by several dehydrogenases and the gene for this cytochrome (cybA) is located in the sdh gene cluster. Recently, we found another low-potential b-type cytochrome, cytochrome b-561 (Em' = 20 mV), which is also reduced by dehydrogenases. The position of this new cytochrome in the aerobic respiratory chain is under investigation. Two terminal oxidase complexes branch at the site of ubiquinone-8, and the Km value for oxygen of the purified cytochrome b-558-d complex is about 8-fold lower than that of the purified cytochrome b-562-o complex when ubiquinol-1 is used as substrate. This result is consistent with the idea that the cytochrome b-558-d complex is synthesized as an alternative oxidase for more efficient utilization of oxygen at low oxygen concentration. Thus, E. coli cells can maintain efficient oxidative energy conservation over a wide range of oxygen pressures by simply changing the contents of the two terminal oxidases, each of which functions as a coupling site.

Monoamine Oxidase A Gene (MAOA) Associated with Attitude Towards Longshot Risks

PubMed Central

Zhong, Songfa; Israel, Salomon; Xue, Hong; Ebstein, Richard P.; Chew, Soo Hong

2009-01-01

Decision making often entails longshot risks involving a small chance of receiving a substantial outcome. People tend to be risk preferring (averse) when facing longshot risks involving significant gains (losses). This differentiation towards longshot risks underpins the markets for lottery as well as for insurance. Both lottery and insurance have emerged since ancient times and continue to play a useful role in the modern economy. In this study, we observe subjects' incentivized choices in a controlled laboratory setting, and investigate their association with a widely studied, promoter-region repeat functional polymorphism in monoamine oxidase A gene (MAOA). We find that subjects with the high activity (4-repeat) allele are characterized by a preference for the longshot lottery and also less insurance purchasing than subjects with the low activity (3-repeat) allele. This is the first result to link attitude towards longshot risks to a specific gene. It complements recent findings on the neurobiological basis of economic risk taking. PMID:20046877

Isolated sulfite oxidase deficiency.

PubMed

Rupar, C A; Gillett, J; Gordon, B A; Ramsay, D A; Johnson, J L; Garrett, R M; Rajagopalan, K V; Jung, J H; Bacheyie, G S; Sellers, A R

1996-12-01

Isolated sulfite oxidase (SO) deficiency is an autosomal recessively inherited inborn error of sulfur metabolism. In this report of a ninth patient the clinical history, laboratory results, neuropathological findings and a mutation in the sulfite oxidase gene are described. The data from this patient and previously published patients with isolated sulfite oxidase deficiency and molybdenum cofactor deficiency are summarized to characterize this rare disorder. The patient presented neonatally with intractable seizures and did not progress developmentally beyond the neonatal stage. Dislocated lenses were apparent at 2 months. There was increased urine excretion of sulfite and S-sulfocysteine and a decreased concentration of plasma cystine. A lactic acidemia was present for 6 months. Liver sulfite oxidase activity was not detectable but xanthine dehydrogenase activity was normal. The boy died of respiratory failure at 32 months. Neuropathological findings of cortical necrosis and extensive cavitating leukoencephalopathy were reminiscent of those seen in severe perinatal asphyxia suggesting an etiology of energy deficiency. A point mutation that resulted in a truncated protein missing the molybdenum-binding site has been identified.

Gene-Gene-Environment Interactions of Serotonin Transporter, Monoamine Oxidase A and Childhood Maltreatment Predict Aggressive Behavior in Chinese Adolescents

PubMed Central

Zhang, Yun; Ming, Qing-sen; Yi, Jin-yao; Wang, Xiang; Chai, Qiao-lian; Yao, Shu-qiao

2017-01-01

Gene-environment interactions that moderate aggressive behavior have been identified independently in the serotonin transporter (5-HTT) gene and monoamine oxidase A gene (MAOA). The aim of the present study was to investigate epistasis interactions between MAOA-variable number tandem repeat (VNTR), 5-HTTlinked polymorphism (LPR) and child abuse and the effects of these on aggressive tendencies in a group of otherwise healthy adolescents. A group of 546 Chinese male adolescents completed the Child Trauma Questionnaire and Youth self-report of the Child Behavior Checklist. Buccal cells were collected for DNA analysis. The effects of childhood abuse, MAOA-VNTR, 5-HTTLPR genotypes and their interactive gene-gene-environmental effects on aggressive behavior were analyzed using a linear regression model. The effect of child maltreatment was significant, and a three-way interaction among MAOA-VNTR, 5-HTTLPR and sexual abuse (SA) relating to aggressive behaviors was identified. Chinese male adolescents with high expression of the MAOA-VNTR allele and 5-HTTLPR “SS” genotype exhibited the highest aggression tendencies with an increase in SA during childhood. The findings reported support aggression being a complex behavior involving the synergistic effects of gene-gene-environment interactions. PMID:28203149

Genetics Home Reference: cytochrome c oxidase deficiency

MedlinePlus

... are caused by mutations in genes found within nuclear DNA; however, in some rare instances, mutations in genes located within mtDNA cause this condition. The genes associated with cytochrome c oxidase deficiency are involved in energy production in mitochondria through a process called oxidative ...

Expressional studies of the aldehyde oxidase (AOX1) gene during myogenic differentiation in C2C12 cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kamli, Majid Rasool; Kim, Jihoe; Pokharel, Smritee

2014-08-08

Highlights: • AOX1 contributes to the formation of myotube. • Silencing of AOX1 reduces myotube formation. • AOX1 regulates MyoG gene expression. • AOX1 contributes to myogenesis via H{sub 2}O{sub 2}. - Abstract: Aldehyde oxidases (AOXs), which catalyze the hydroxylation of heterocycles and oxidation of a wide variety of aldehydic compounds, have been present throughout evolution from bacteria to humans. While humans have only a single functional aldehyde oxidase (AOX1) gene, rodents are endowed with four AOXs; AOX1 and three aldehyde oxidase homologs (AOH1, AOH2 and AOH3). In continuation of our previous study conducted to identify genes differentially expressed duringmore » myogenesis using a microarray approach, we investigated AOX1 with respect to its role in myogenesis to conceptualize how it is regulated in C2C12 cells. The results obtained were validated by silencing of the AOX1 gene. Analysis of their fusion index revealed that formation of myotubes showed a marked reduction of up to 40% in AOX1{sub kd} cells. Expression of myogenin (MYOG), one of the marker genes used to study myogenesis, was also found to be reduced in AOX1{sub kd} cells. AOX1 is an enzyme of pharmacological and toxicological importance that metabolizes numerous xenobiotics to their respective carboxylic acids. Hydrogen peroxide (H{sub 2}O{sub 2}) produced as a by-product in this reaction is considered to be involved as a part of the signaling mechanism during differentiation. An observed reduction in the level of H{sub 2}O{sub 2} among AOX1{sub kd} cells confirmed production of H{sub 2}O{sub 2} in the reaction catalyzed by AOX1. Taken together, these findings suggest that AOX1 acts as a contributor to the process of myogenesis by influencing the level of H{sub 2}O{sub 2}.« less

Identification in Marinomonas mediterranea of a novel quinoprotein with glycine oxidase activity.

PubMed

Campillo-Brocal, Jonatan Cristian; Lucas-Elio, Patricia; Sanchez-Amat, Antonio

2013-08-01

A novel enzyme with lysine-epsilon oxidase activity was previously described in the marine bacterium Marinomonas mediterranea. This enzyme differs from other l-amino acid oxidases in not being a flavoprotein but containing a quinone cofactor. It is encoded by an operon with two genes lodA and lodB. The first one codes for the oxidase, while the second one encodes a protein required for the expression of the former. Genome sequencing of M. mediterranea has revealed that it contains two additional operons encoding proteins with sequence similarity to LodA. In this study, it is shown that the product of one of such genes, Marme_1655, encodes a protein with glycine oxidase activity. This activity shows important differences in terms of substrate range and sensitivity to inhibitors to other glycine oxidases previously described which are flavoproteins synthesized by Bacillus. The results presented in this study indicate that the products of the genes with different degrees of similarity to lodA detected in bacterial genomes could constitute a reservoir of different oxidases. © 2013 The Authors. Microbiology Open published by John Wiley & Sons Ltd.

Gibberellin Biosynthesis in Developing Pumpkin Seedlings12

PubMed Central

Lange, Theo; Kappler, Jeannette; Fischer, Andreas; Frisse, Andrea; Padeffke, Tania; Schmidtke, Sabine; Lange, Maria João Pimenta

2005-01-01

A gibberellin (GA) biosynthetic pathway was discovered operating in root tips of 7-d-old pumpkin (Cucurbita maxima) seedlings. Stepwise analysis of GA metabolism in cell-free systems revealed the conversion of GA12-aldehyde to bioactive GA4 and inactive GA34. Highest levels of endogenous GA4 and GA34 were found in hypocotyls and root tips of 3-d-old seedlings. cDNA molecules encoding two GA oxidases, CmGA20ox3 and CmGA3ox3, were isolated from root tips of 7-d-old LAB150978-treated seedlings. Recombinant CmGA20ox3 fusion protein converted GA12 to GA9, GA24 to GA9, GA14 to GA4, and, less efficiently, GA53 to GA20, and recombinant CmGA3ox3 protein oxidized GA9 to GA4. Transcript profiles were determined for four GA oxidase genes from pumpkin revealing relatively high transcript levels for CmGA7ox in shoot tips and cotyledons, for CmGA20ox3 in shoot tips and hypocotyls, and for CmGA3ox3 in hypocotyls and roots of 3-d-old seedlings. Transcripts of CmGA2ox1 were mainly found in roots of 7-d-old seedlings. In roots of 7-d-old seedlings, transcripts of CmGA7ox, CmGA20ox3, and CmGA3ox3 were localized in the cap and the rhizodermis by in situ hybridization. We conclude that hypocotyls and root tips are important sites of GA biosynthesis in the developing pumpkin seedling. PMID:16126862

Evolution of cytochrome oxidase, an enzyme older than atmospheric oxygen.

PubMed

Castresana, J; Lübben, M; Saraste, M; Higgins, D G

1994-06-01

Cytochrome oxidase is a key enzyme in aerobic metabolism. All the recorded eubacterial (domain Bacteria) and archaebacterial (Archaea) sequences of subunits 1 and 2 of this protein complex have been used for a comprehensive evolutionary analysis. The phylogenetic trees reveal several processes of gene duplication. Some of these are ancient, having occurred in the common ancestor of Bacteria and Archaea, whereas others have occurred in specific lines of Bacteria. We show that eubacterial quinol oxidase was derived from cytochrome c oxidase in Gram-positive bacteria and that archaebacterial quinol oxidase has an independent origin. A considerable amount of evidence suggests that Proteobacteria (Purple bacteria) acquired quinol oxidase through a lateral gene transfer from Gram-positive bacteria. The prevalent hypothesis that aerobic metabolism arose several times in evolution after oxygenic photosynthesis, is not sustained by two aspects of the molecular data. First, cytochrome oxidase was present in the common ancestor of Archaea and Bacteria whereas oxygenic photosynthesis appeared in Bacteria. Second, an extant cytochrome oxidase in nitrogen-fixing bacteria shows that aerobic metabolism is possible in an environment with a very low level of oxygen, such as the root nodules of leguminous plants. Therefore, we propose that aerobic metabolism in organisms with cytochrome oxidase has a monophyletic and ancient origin, prior to the appearance of eubacterial oxygenic photosynthetic organisms.

Monoamine Oxidase A Gene Methylation and Its Role in Posttraumatic Stress Disorder: First Evidence from the South Eastern Europe (SEE)-PTSD Study

PubMed Central

Ziegler, Christiane; Wolf, Christiane; Schiele, Miriam A; Feric Bojic, Elma; Kucukalic, Sabina; Sabic Dzananovic, Emina; Goci Uka, Aferdita; Hoxha, Blerina; Haxhibeqiri, Valdete; Haxhibeqiri, Shpend; Kravic, Nermina; Muminovic Umihanic, Mirnesa; Cima Franc, Ana; Jaksic, Nenad; Babic, Romana; Pavlovic, Marko; Warrings, Bodo; Bravo Mehmedbasic, Alma; Rudan, Dusko; Aukst-Margetic, Branka; Kucukalic, Abdulah; Marjanovic, Damir; Babic, Dragan; Bozina, Nada; Jakovljevic, Miro; Sinanovic, Osman; Avdibegovic, Esmina; Agani, Ferid; Dzubur-Kulenovic, Alma; Deckert, Jürgen; Domschke, Katharina

2018-01-01

Abstract Background Posttraumatic stress disorder is characterized by an overactive noradrenergic system conferring core posttraumatic stress disorder symptoms such as hyperarousal and reexperiencing. Monoamine oxidase A is one of the key enzymes mediating the turnover of noradrenaline. Here, DNA methylation of the monoamine oxidase A gene exonI/intronI region was investigated for the first time regarding its role in posttraumatic stress disorder risk and severity. Methods Monoamine oxidase A methylation was analyzed via direct sequencing of sodium bisulfite-treated DNA extracted from blood cells in a total sample of N=652 (441 male) patients with current posttraumatic stress disorder, patients with remitted posttraumatic stress disorder, and healthy probands (comparison group) recruited at 5 centers in Bosnia-Herzegovina, Croatia, and the Republic of Kosovo. Posttraumatic stress disorder severity was measured by means of the Clinician-Administered Posttraumatic Stress Disorder Scale and its respective subscores representing distinct symptom clusters. Results In the male, but not the female sample, patients with current posttraumatic stress disorder displayed hypermethylation of 3 CpGs (CpG3=43656362; CpG12=43656514; CpG13=43656553, GRCh38.p2 Assembly) as compared with remitted Posttraumatic Stress Disorder patients and healthy probands. Symptom severity (Clinician-Administered Posttraumatic Stress Disorder Scale scores) in male patients with current posttraumatic stress disorder significantly correlated with monoamine oxidase A methylation. This applied particularly to symptom clusters related to reexperiencing of trauma (cluster B) and hyperarousal (cluster D). Conclusions The present findings suggest monoamine oxidase A gene hypermethylation, potentially resulting in enhanced noradrenergic signalling, as a disease status and severity marker of current posttraumatic stress disorder in males. If replicated, monoamine oxidase A hypermethylation might serve as a

Monoamine Oxidase A Gene Methylation and Its Role in Posttraumatic Stress Disorder: First Evidence from the South Eastern Europe (SEE)-PTSD Study.

PubMed

Ziegler, Christiane; Wolf, Christiane; Schiele, Miriam A; Feric Bojic, Elma; Kucukalic, Sabina; Sabic Dzananovic, Emina; Goci Uka, Aferdita; Hoxha, Blerina; Haxhibeqiri, Valdete; Haxhibeqiri, Shpend; Kravic, Nermina; Muminovic Umihanic, Mirnesa; Cima Franc, Ana; Jaksic, Nenad; Babic, Romana; Pavlovic, Marko; Warrings, Bodo; Bravo Mehmedbasic, Alma; Rudan, Dusko; Aukst-Margetic, Branka; Kucukalic, Abdulah; Marjanovic, Damir; Babic, Dragan; Bozina, Nada; Jakovljevic, Miro; Sinanovic, Osman; Avdibegovic, Esmina; Agani, Ferid; Dzubur-Kulenovic, Alma; Deckert, Jürgen; Domschke, Katharina

2018-05-01

Posttraumatic stress disorder is characterized by an overactive noradrenergic system conferring core posttraumatic stress disorder symptoms such as hyperarousal and reexperiencing. Monoamine oxidase A is one of the key enzymes mediating the turnover of noradrenaline. Here, DNA methylation of the monoamine oxidase A gene exonI/intronI region was investigated for the first time regarding its role in posttraumatic stress disorder risk and severity. Monoamine oxidase A methylation was analyzed via direct sequencing of sodium bisulfite-treated DNA extracted from blood cells in a total sample of N=652 (441 male) patients with current posttraumatic stress disorder, patients with remitted posttraumatic stress disorder, and healthy probands (comparison group) recruited at 5 centers in Bosnia-Herzegovina, Croatia, and the Republic of Kosovo. Posttraumatic stress disorder severity was measured by means of the Clinician-Administered Posttraumatic Stress Disorder Scale and its respective subscores representing distinct symptom clusters. In the male, but not the female sample, patients with current posttraumatic stress disorder displayed hypermethylation of 3 CpGs (CpG3=43656362; CpG12=43656514; CpG13=43656553, GRCh38.p2 Assembly) as compared with remitted Posttraumatic Stress Disorder patients and healthy probands. Symptom severity (Clinician-Administered Posttraumatic Stress Disorder Scale scores) in male patients with current posttraumatic stress disorder significantly correlated with monoamine oxidase A methylation. This applied particularly to symptom clusters related to reexperiencing of trauma (cluster B) and hyperarousal (cluster D). The present findings suggest monoamine oxidase A gene hypermethylation, potentially resulting in enhanced noradrenergic signalling, as a disease status and severity marker of current posttraumatic stress disorder in males. If replicated, monoamine oxidase A hypermethylation might serve as a surrogate marker of a hyperadrenergic subtype of

Characterization of a multicopper oxidase gene cluster in Phanerochaete chrysosporium and evidence of altered splicing of the mco transcripts

Treesearch

Luis F. Larrondo; Bernardo Gonzalez; Dan Cullen; Rafael Vicuna

2004-01-01

A cluster of multicopper oxidase genes (mco1, mco2, mco3, mco4) from the lignin-degrading basidiomycete Phanerochaete chrysosporium is described. The four genes share the same transcriptional orientation within a 25 kb region. mco1, mco2 and mco3 are tightly grouped, with intergenic regions of 2.3 and 0.8 kb, respectively, whereas mco4 is located 11 kb upstream of mco1...

Genomic sequencing of uric acid metabolizing and clearing genes in relationship to xanthine oxidase inhibitor dose.

PubMed

Carroll, Matthew B; Smith, Derek M; Shaak, Thomas L

2017-03-01

It remains unclear why the dose of xanthine oxidase inhibitors (XOI) allopurinol or febuxostat varies among patients though they reach similar serum uric acid (SUA) goal. We pursued genomic sequencing of XOI metabolism and clearance genes to identify single-nucleotide polymorphisms (SNPs) relate to differences in XOI dose. Subjects with a diagnosis of Gout based on the 1977 American College of Rheumatology Classification Criteria for the disorder, who were on stable doses of a XOI, and who were at their goal SUA level, were enrolled. The primary outcome was relationship between SNPs in any of these genes to XOI dose. The secondary outcome was relationship between SNPs and change in pre- and post-treatment SUA. We enrolled 100 subjects. The average patient age was 68.6 ± 10.6 years old. Over 80% were men and 77% were Caucasian. One SNP was associated with a higher XOI dose: rs75995567 (p = 0.031). Two SNPs were associated with 300 mg daily of allopurinol: rs11678615 (p = 0.022) and rs3731722 on Aldehyde Oxidase (AO) (His1297Arg) (p = 0.001). Two SNPs were associated with a lower dose of allopurinol: rs1884725 (p = 0.033) and rs34650714 (p = 0.006). For the secondary outcome, rs13415401 was the only SNP related to a smaller mean SUA change. Ten SNPs were identified with a larger change in SUA. Though multiple SNPs were identified in the primary and secondary outcomes of this study, rs3731722 is known to alter catalytic function for some aldehyde oxidase substrates.

Functional expression of amine oxidase from Aspergillus niger (AO-I) in Saccharomyces cerevisiae.

PubMed

Kolaríková, Katerina; Galuszka, Petr; Sedlárová, Iva; Sebela, Marek; Frébort, Ivo

2009-01-01

The aim of this work was to prepare recombinant amine oxidase from Aspergillus niger after overexpressing in yeast. The yeast expression vector pDR197 that includes a constitutive PMA1 promoter was used for the expression in Saccharomyces cerevisiae. Recombinant amine oxidase was extracted from the growth medium of the yeast, purified to homogeneity and identified by activity assay and MALDI-TOF peptide mass fingerprinting. Similarity search in the newly published A. niger genome identified six genes coding for copper amine oxidase, two of them corresponding to the previously described enzymes AO-I a methylamine oxidase and three other genes coding for FAD amine oxidases. Thus, A. niger possesses an enormous metabolic gear to grow on amine compounds and thus support its saprophytic lifestyle.

The Importance of NADPH Oxidases and Redox Signaling in Angiogenesis

PubMed Central

Prieto-Bermejo, Rodrigo; Hernández-Hernández, Angel

2017-01-01

Eukaryotic cells have to cope with the constant generation of reactive oxygen species (ROS). Although the excessive production of ROS might be deleterious for cell biology, there is a plethora of evidence showing that moderate levels of ROS are important for the control of cell signaling and gene expression. The family of the nicotinamide adenine dinucleotide phosphate oxidases (NADPH oxidases or Nox) has evolved to produce ROS in response to different signals; therefore, they fulfil a central role in the control of redox signaling. The role of NADPH oxidases in vascular physiology has been a field of intense study over the last two decades. In this review we will briefly analyze how ROS can regulate signaling and gene expression. We will address the implication of NADPH oxidases and redox signaling in angiogenesis, and finally, the therapeutic possibilities derived from this knowledge will be discussed. PMID:28505091

Genetic differentiation of the mitochondrial cytochrome oxidase C subunit I gene in genus Paramecium (Protista, Ciliophora).

PubMed

Zhao, Yan; Gentekaki, Eleni; Yi, Zhenzhen; Lin, Xiaofeng

2013-01-01

The mitochondrial cytochrome c oxidase subunit I (COI) gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp.

Reactive oxygen species induced by heat stress during grain filling of rice (Oryza sativa L.) are involved in occurrence of grain chalkiness.

PubMed

Suriyasak, Chetphilin; Harano, Keisuke; Tanamachi, Koichiro; Matsuo, Kazuhiro; Tamada, Aina; Iwaya-Inoue, Mari; Ishibashi, Yushi

2017-09-01

Heat stress during grain filling increases rice grain chalkiness due to increased activity of α-amylase, which hydrolyzes starch. In rice and barley seeds, reactive oxygen species (ROS) produced after imbibition induce α-amylase activity via regulation of gibberellin (GA) and abscisic acid (ABA) levels during seed germination. Here, we examined whether ROS is involved in induction of grain chalkiness by α-amylase in developing rice grains under heat stress. To elucidate the role of ROS in grain chalkiness, we grew post-anthesis rice plants (Oryza sativa L. cv. Koshihikari) under control (25°C) or heat stress (30°C) conditions with or without antioxidant (dithiothreitol) treatment. The developing grains were analyzed for expression of NADPH oxidases, GA biosynthesis genes (OsGA3ox1, OsGA20ox1), ABA catabolism genes (OsABA8'OH1, OsABA8'OH2) and an α-amylase gene (OsAmy3E), endogenous H 2 O 2 content and the grain quality. In grains exposed to heat stress, the expression of NADPH oxidase genes (especially, OsRbohB, OsRbohD, OsRbohF and OsRbohI) and the ROS content increased. Heat stress also increased the expression of OsGA3ox1, OsGA20ox1, OsABA8'OH1, OsABA8'OH2 and OsAmy3E. On the other hand, dithiothreitol treatment reduced the effects of heat stress on the expression of these genes and significantly reduced grain chalkiness induced by heat stress. These results suggest that, similar to cereal seed germination mechanism, ROS produced under heat stress is involved in α-amylase induction in maturating rice grains through GA/ABA metabolism, and consequently caused grain chalkiness. Copyright © 2017 Elsevier GmbH. All rights reserved.

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Genetic Differentiation of the Mitochondrial Cytochrome Oxidase c Subunit I Gene in Genus Paramecium (Protista, Ciliophora)

PubMed Central

Zhao, Yan; Gentekaki, Eleni; Yi, Zhenzhen; Lin, Xiaofeng

2013-01-01

Background The mitochondrial cytochrome c oxidase subunit I (COI) gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. Methodology/Principal findings We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. Conclusions Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp. PMID:24204730

Evolution of multicopper oxidase genes in coprophilous and non-coprophilous members of the order sordariales.

PubMed

Pöggeler, Stefanie

2011-04-01

Multicopper oxidases (MCO) catalyze the biological oxidation of various aromatic substrates and have been identified in plants, insects, bacteria, and wood rotting fungi. In nature, they are involved in biodegradation of biopolymers such as lignin and humic compounds, but have also been tested for various industrial applications. In fungi, MCOs have been shown to play important roles during their life cycles, such as in fruiting body formation, pigment formation and pathogenicity. Coprophilous fungi, which grow on the dung of herbivores, appear to encode an unexpectedly high number of enzymes capable of at least partly degrading lignin. This study compared the MCO-coding capacity of the coprophilous filamentous ascomycetes Podospora anserina and Sordaria macrospora with closely related non-coprophilous members of the order Sordariales. An increase of MCO genes in coprophilic members of the Sordariales most probably occurred by gene duplication and horizontal gene transfer events.

Light Regulation of Gibberellin Biosynthesis and Mode of Action.

PubMed

García-Martinez, José Luis; Gil, Joan

2001-12-01

Some phenotypic effects produced in plants by light are very similar to those induced by hormones. In this review, the light-gibberellin (GA) interaction in germination, de-etiolation, stem growth, and tuber formation (process regulated by GAs) are discussed. Germination of lettuce and Arabidopsis seeds depends on red irradiation (R), which enhances the expression of GA 3-oxidase genes (GA3ox) and leads to an increase in active GA content. De-etiolation of pea seedling alters the expression of GA20ox and GA3ox genes and induces a rapid decrease of GA1 content. Stem growth of green plants is also affected by diverse light irradiation characteristics. Low light intensity increases stem elongation and active GA content in pea and Brassica. Photoperiod controls active GA levels in long-day rosette (spinach and Silene) and in woody plants (Salix and hybrid aspen) by regulating different steps of GA biosynthesis, mainly through transcript levels of GA20ox and GA3ox genes. Light modulation of stem elongation in light-grown plants is controlled by phytochrome, which modifies GA biosynthesis and catabolism (tobacco, potato, cowpea, Arabidopsis) and GA-response (pea, cucumber, Arabidopsis). In Arabidopsis and tobacco, ATH1 (a gene encoding an homeotic transcription factor) is a positive mediator of a phyB-specific signal transduction cascade controlling GA levels by regulating the expression of GA20ox and GA3ox. Tuber formation in potato is controlled by photoperiod (through phyB) and GAs. Inductive short-day conditions alter the diurnal rhythm of GA20ox transcript abundance, and increases the expression of a new protein (PHOR1) that plays a role in the photoperiod-GA interaction.

Identification of a Third Mn(II) Oxidase Enzyme in Pseudomonas putida GB-1

PubMed Central

Smesrud, Logan; Tebo, Bradley M.

2016-01-01

ABSTRACT The oxidation of soluble Mn(II) to insoluble Mn(IV) is a widespread bacterial activity found in a diverse array of microbes. In the Mn(II)-oxidizing bacterium Pseudomonas putida GB-1, two Mn(II) oxidase genes, named mnxG and mcoA, were previously identified; each encodes a multicopper oxidase (MCO)-type enzyme. Expression of these two genes is positively regulated by the response regulator MnxR. Preliminary investigation into putative additional regulatory pathways suggested that the flagellar regulators FleN and FleQ also regulate Mn(II) oxidase activity; however, it also revealed the presence of a third, previously uncharacterized Mn(II) oxidase activity in P. putida GB-1. A strain from which both of the Mn(II) oxidase genes and fleQ were deleted exhibited low levels of Mn(II) oxidase activity. The enzyme responsible was genetically and biochemically identified as an animal heme peroxidase (AHP) with domain and sequence similarity to the previously identified Mn(II) oxidase MopA. In the ΔfleQ strain, P. putida GB-1 MopA is overexpressed and secreted from the cell, where it actively oxidizes Mn. Thus, deletion of fleQ unmasked a third Mn(II) oxidase activity in this strain. These results provide an example of an Mn(II)-oxidizing bacterium utilizing both MCO and AHP enzymes. IMPORTANCE The identity of the Mn(II) oxidase enzyme in Pseudomonas putida GB-1 has been a long-standing question in the field of bacterial Mn(II) oxidation. In the current work, we demonstrate that P. putida GB-1 employs both the multicopper oxidase- and animal heme peroxidase-mediated pathways for the oxidation of Mn(II), rendering this model organism relevant to the study of both types of Mn(II) oxidase enzymes. The presence of three oxidase enzymes in P. putida GB-1 deepens the mystery of why microorganisms oxidize Mn(II) while providing the field with the tools necessary to address this question. The initial identification of MopA as a Mn(II) oxidase in this strain required the

Gibberellin induces alpha-amylase gene in seed coat of Ipomoea nil immature seeds.

PubMed

Nakajima, Masatoshi; Nakayama, Akira; Xu, Zheng-Jun; Yamaguchi, Isomaro

2004-03-01

Two full-length cDNAs encoding gibberellin 3-oxidases, InGA3ox1 and InGA3ox2, were cloned from developing seeds of morning glory (Ipomoea nil (Pharbitis nil) Choisy cv. Violet) with degenerate-PCR and RACEs. The RNA-blot analysis for these clones revealed that the InGA3ox2 gene was organ-specifically expressed in the developing seeds at 6-18 days after anthesis. In situ hybridization showed the signals of InGA3ox2 mRNA in the seed coat, suggesting that active gibberellins (GAs) were synthesized in the tissue, although no active GA was detected there by immunohistochemistry. In situ hybridization analysis for InAmy1 (former PnAmy1) mRNA showed that InAmy1 was also synthesized in the seed coat. Both InGA3ox2 and InAmy1 genes were expressed spatially overlapped without a clear time lag, suggesting that both active GAs and InAmy1 were synthesized almost simultaneously in seed coat and secreted to the integument. These observations support the idea that GAs play an important role in seed development by inducing alpha-amylase.

Mutations in the F-box gene SNEEZY result in decreased arabidopsis GA signaling

USDA-ARS?s Scientific Manuscript database

We previously reported that the SLEEPY1 (SLY1) homolog, F-box gene SNEEZY/SLEEPY2 (SNE/SLY2), can partly replace SLY1 in gibberellin (GA) hormone signaling through interaction with DELLAs RGA and GAI. To determine whether SNE normally functions in GA signaling, we characterized the phenotypes of tw...

R1, a novel repressor of the human monoamine oxidase A.

PubMed

Chen, Kevin; Ou, Xiao-Ming; Chen, Gao; Choi, Si Ho; Shih, Jean C

2005-03-25

Monoamine oxidase catalyzes the oxidative deamination of a number of neurotransmitters. A deficiency in monoamine oxidase A results in aggressive behavior in both humans and mice. Studies on the regulation of monoamine oxidase A gene expression have shown that the Sp1 family is important for monoamine oxidase A expression. To search for novel transcription factors, the sequences of three Sp1 sites in the monoamine oxidase A core promoter were used in the yeast one-hybrid system to screen a human cDNA library. A novel repressor, R1 (RAM2), has been cloned. The R1 cDNA encodes a protein with 454 amino acids and an open reading frame at the 5'-end. The transfection of R1 in a human neuroblastoma cell line, SK-N-BE (2)-C, inhibited the monoamine oxidase A promoter and enzymatic activity. The degree of inhibition of monoamine oxidase A by R1 correlated with the level of R1 protein expression. R1 was also found to repress monoamine oxidase A promoter activity within a natural chromatin environment. A gel-shift assay indicated that the endogenous R1 protein in SK-N-BE (2)-C cells interacted with the R1 binding sequence. R1 also bound directly to the natural monoamine oxidase A promoter in vivo as shown by chromatin immunoprecipitation assay. Immunocytochemical analysis showed that R1 was expressed in both cytosol and nucleus, which suggested a role for R1 in transcriptional regulation. Northern blot analysis revealed the presence of endogenous R1 mRNA in human brain and peripheral tissues. Taken together, this study shows that R1 is a novel repressor that inhibits monoamine oxidase A gene expression.

A multicopper oxidase-related protein is essential for insect viability, longevity and ovary development.

PubMed

Peng, Zeyu; Green, Peter G; Arakane, Yasuyuki; Kanost, Michael R; Gorman, Maureen J

2014-01-01

Typical multicopper oxidases (MCOs) have ten conserved histidines and one conserved cysteine that coordinate four copper atoms. These copper ions are required for oxidase activity. During our studies of insect MCOs, we discovered a gene that we named multicopper oxidase-related protein (MCORP). MCORPs share sequence similarity with MCOs, but lack many of the copper-coordinating residues. We identified MCORP orthologs in many insect species, but not in other invertebrates or vertebrates. We predicted that MCORPs would lack oxidase activity due to the absence of copper-coordinating residues. To test this prediction, we purified recombinant Tribolium castaneum (red flour beetle) MCORP and analyzed its enzymatic activity using a variety of substrates. As expected, no oxidase activity was detected. To study MCORP function in vivo, we analyzed expression profiles of TcMCORP and Anopheles gambiae (African malaria mosquito) MCORP, and assessed RNAi-mediated knockdown phenotypes. We found that both MCORPs are constitutively expressed at a low level in all of the tissues we analyzed. Injection of TcMCORP dsRNA into larvae resulted in 100% mortality prior to adult eclosion, with death occurring mainly during the pharate pupal stage or late pharate adult stage. Injection of TcMCORP dsRNA into pharate pupae resulted in the death of approximately 20% of the treated insects during the pupal to adult transition and a greatly shortened life span for the remaining insects. In addition, knockdown of TcMCORP in females prevented oocyte maturation and, thus, greatly decreased the number of eggs laid. These results indicate that TcMCORP is an essential gene and that its function is required for reproduction. An understanding of the role MCORP plays in insect physiology may help to develop new strategies for controlling insect pests.

A Plastid Terminal Oxidase Associated with Carotenoid Desaturation during Chromoplast Differentiation1

PubMed Central

Josse, Eve-Marie; Simkin, Andrew J.; Gaffé, Joël; Labouré, Anne-Marie; Kuntz, Marcel; Carol, Pierre

2000-01-01

The Arabidopsis IMMUTANS gene encodes a plastid homolog of the mitochondrial alternative oxidase, which is associated with phytoene desaturation. Upon expression in Escherichia coli, this protein confers a detectable cyanide-resistant electron transport to isolated membranes. In this assay this activity is sensitive to n-propyl-gallate, an inhibitor of the alternative oxidase. This protein appears to be a plastid terminal oxidase (PTOX) that is functionally equivalent to a quinol:oxygen oxidoreductase. This protein was immunodetected in achlorophyllous pepper (Capsicum annuum) chromoplast membranes, and a corresponding cDNA was cloned from pepper and tomato (Lycopersicum esculentum) fruits. Genomic analysis suggests the presence of a single gene in these organisms, the expression of which parallels phytoene desaturase and ζ-carotene desaturase gene expression during fruit ripening. Furthermore, this PTOX gene is impaired in the tomato ghost mutant, which accumulates phytoene in leaves and fruits. These data show that PTOX also participates in carotenoid desaturation in chromoplasts in addition to its role during early chloroplast development. PMID:10938359

Plasma amine oxidase activities in Norrie disease patients with an X-chromosomal deletion affecting monoamine oxidase.

PubMed

Murphy, D L; Sims, K B; Karoum, F; Garrick, N A; de la Chapelle, A; Sankila, E M; Norio, R; Breakefield, X O

1991-01-01

Two individuals with an X-chromosomal deletion were recently found to lack the genes encoding monoamine oxidase type A (MAO-A) and MAO-B. This abnormality was associated with almost total (90%) reductions in the oxidatively deaminated urinary metabolites of the MAO-A substrate, norepinephrine, and with marked (100-fold) increases in an MAO-B substrate, phenylethylamine, confirming systemic functional consequences of the genetic enzyme deficiency. However, urinary concentrations of the deaminated metabolites of dopamine and serotonin (5-HT) were essentially normal. To investigate other deaminating systems besides MAO-A and MAO-B that might produce these metabolites of dopamine and 5-HT, we examined plasma amine oxidase (AO) activity in these two patients and two additional patients with the same X-chromosomal deletion. Normal plasma AO activity was found in all four Norrie disease-deletion patients, in four patients with classic Norrie disease without a chromosomal deletion, and in family members of patients from both groups. Marked plasma amine metabolite abnormalities and essentially absent platelet MAO-B activity were found in all four Norrie disease-deletion patients, but in none of the other subjects in the two comparison groups. These results indicate that plasma AO is encoded by gene(s) independent of those for MAO-A and MAO-B, and raise the possibility that plasma AO, and perhaps the closely related tissue AO, benzylamine oxidase, as well as other atypical AOs or MAOs encoded independently from MAO-A and MAO-B may contribute to the oxidative deamination of dopamine and 5-HT in humans.

Knockdown of Polyphenol Oxidase Gene Expression in Potato (Solanum tuberosum L.) with Artificial MicroRNAs.

PubMed

Chi, Ming; Bhagwat, Basdeo; Tang, Guiliang; Xiang, Yu

2016-01-01

It is of great importance and interest to develop crop varieties with low polyphenol oxidase (PPO) activity for the food industry because PPO-mediated oxidative browning is a main cause of post-harvest deterioration and quality loss of fresh produce and processed foods. We recently demonstrated that potato tubers with reduced browning phenotypes can be produced by inhibition of the expression of several PPO gene isoforms using artificial microRNA (amiRNA) technology. The approach introduces a single type of 21-nucleotide RNA population to guide silencing of the PPO gene transcripts in potato tissues. Some advantages of the technology are: small RNA molecules are genetically transformed, off-target gene silencing can be avoided or minimized at the stage of amiRNA designs, and accuracy and efficiency of the processes can be detected at every step using molecular biological techniques. Here we describe the methods for transformation and regeneration of potatoes with amiRNA vectors, detection of the expression of amiRNAs, identification of the cleaved product of the target gene transcripts, and assay of the expression level of PPO gene isoforms in potatoes.

Gene polymorphisms of TNF-alpha-308 (G/A), IL-10(-1082) (G/A), IL-6(-174) (G/C) and IL-1Ra (VNTR) in Egyptian cases with type 1 diabetes mellitus.

PubMed

Settin, Ahmad; Ismail, Azza; El-Magd, Megahed Abo; El-Baz, Rizk; Kazamel, Amira

2009-01-01

Type 1 diabetes (T1D) is a genetically conditioned autoimmune disease in which cytokines play an important role. Objectives. To check for the association of polymorphisms of cytokine genes with type 1 diabetes. Subjects. This work included 50 cases with T1D and 98 healthy individuals from the Nile Delta region of Egypt. Cases included 20 males and 30 females with a median age of 25 and range of 15-50 years. DNA was amplified using PCR with sequence-specific primers for detection of polymorphisms related to tumor necrosis factor (TNF)-alpha(- 308) (G/A), interleukin (IL)-10(- 1082) (G/A), IL-6(- 174) (G/C), and IL-1Ra (VNTR). Cases with T1D showed significant higher frequency of genotypes of TNF-alpha(- 308) AA (p < 0.001, odds ratio (OR) = 7.91), IL-6-17CC (p < 0.05, OR = 3.36) and IL-1Ra A1A1 (p < 0.05, OR = 3.68) with significant lower frequencies of TNF-alpha(- 308) GA, and IL-1Ra A1A2 genotypes (p < 0.001 and < 0.05, respectively). They also showed significant higher frequency of TNF-alpha(- 308) allele A (p < 0.05, OR = 2.0), IL-1Ra allele A1 (p < 0.05, OR = 2.98) with a significant lower frequency of TNF-alpha(- 308) G allele and IL-1Ra A2 allele (p < 0.05). No significant difference was detected among cases in relation to IL-10(- 1082) (G/A) genotypes or alleles nor in relation to age, sex, consanguinity or family history of the disease. Polymorphisms related to TNF-alpha and IL-1Ra genes may be considered genetic markers for T1D among Egyptians with a potential impact on family counseling and management.

The Gene pat-2, Which Induces Natural Parthenocarpy, Alters the Gibberellin Content in Unpollinated Tomato Ovaries1

PubMed Central

Fos, Mariano; Nuez, Fernando; García-Martínez, José L.

2000-01-01

We investigated the role of gibberellins (GAs) in the effect of pat-2, a recessive mutation that induces facultative parthenocarpic fruit development in tomato (Lycopersicon esculentum Mill.) using near-isogenic lines with two different genetic backgrounds. Unpollinated wild-type Madrigal (MA/wt) and Cuarenteno (CU/wt) ovaries degenerated, but GA3 application induced parthenocarpic fruit growth. On the contrary, parthenocarpic growth of MA/pat-2 and CU/pat-2 fruits, which occurs in the absence of pollination and hormone application, was not affected by GA3. Pollinated MA/wt and parthenocarpic MA/pat-2 ovary development was negated by paclobutrazol, and this inhibitory effect was counteracted by GA3. The main GAs of the early-13-hydroxylation pathway (GA1, GA3, GA8, GA19, GA20, GA29, GA44, GA53, and, tentatively, GA81) and two GAs of the non-13-hydroxylation pathway (GA9 and GA34) were identified in MA/wt ovaries by gas chromatography-selected ion monitoring. GAs were quantified in unpollinated ovaries at flower bud, pre-anthesis, and anthesis. In unpollinated MA/pat-2 and CU/pat-2 ovaries, the GA20 content was much higher (up to 160 times higher) and the GA19 content was lower than in the corresponding non-parthenocarpic ovaries. The application of an inhibitor of 2-oxoglutarate-dependent dioxygenases suggested that GA20 is not active per se. The pat-2 mutation may increase GA 20-oxidase activity in unpollinated ovaries, leading to a higher synthesis of GA20, the precursor of an active GA. PMID:10677440

The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion

PubMed Central

2012-01-01

Background Plant polyphenol oxidases (PPOs) are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss) and Glycine max (soybean) each had 11 genes. Populus trichocarpa (poplar) contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae) genomes or Arabidopsis (A. lyrata and A. thaliana). We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic relationships based on

Epistatic interaction between the monoamine oxidase A and serotonin transporter genes in anorexia nervosa.

PubMed

Urwin, Ruth Elizabeth; Nunn, Kenneth Patrick

2005-03-01

The serotonin (5-HT) and norepinephrine (NE) systems are likely involved in the aetiology of anorexia nervosa (AN) as sufferers are premorbidly anxious. Specifically, we hypothesize that genes encoding proteins, which clear 5-HT and NE from the synapse, are prime candidates for affecting susceptibility to AN. Supporting our hypothesis, we earlier showed that the NE transporter (NET) and monoamine oxidase A (MAOA) genes appear to contribute additively to increased risk of developing restricting AN (AN-R). With regard to the MAOA gene, a sequence variant that increases MAOA activity and has suggested association with the anxiety condition, panic disorder was preferentially transmitted from parents to affected children. Here we provide evidence in support of interaction between the MAOA and serotonin transporter (SERT) genes in 114 AN nuclear families (patient with AN plus biological parents). A SERT gene genotype with no apparent individual effect on risk and known to be associated with anxiety is preferentially transmitted to children with AN (chi2 trend=9.457, 1 df, P=0.0021) and AN-R alone (chi2 trend=7.477, 1 df, P=0.0063) when the 'more active' MAOA gene variant is also transmitted. The increased risk of developing the disorder is up to eight times greater than the risk imposed by the MAOA gene variant alone--an example of synergistic epistatic interaction. If independently replicated, our findings to date suggest that we may have identified three genes affecting susceptibility to AN, particularly AN-R: the MAOA, SERT, and NET genes.

Androgen receptor and monoamine oxidase polymorphism in wild bonobos

PubMed Central

Garai, Cintia; Furuichi, Takeshi; Kawamoto, Yoshi; Ryu, Heungjin; Inoue-Murayama, Miho

2014-01-01

Androgen receptor gene (AR), monoamine oxidase A gene (MAOA) and monoamine oxidase B gene (MAOB) have been found to have associations with behavioral traits, such as aggressiveness, and disorders in humans. However, the extent to which similar genetic effects might influence the behavior of wild apes is unclear. We examined the loci AR glutamine repeat (ARQ), AR glycine repeat (ARG), MAOA intron 2 dinucleotide repeat (MAin2) and MAOB intron 2 dinucleotide repeat (MBin2) in 32 wild bonobos, Pan paniscus, and compared them with those of chimpanzees, Pan troglodytes, and humans. We found that bonobos were polymorphic on the four loci examined. Both loci MAin2 and MBin2 in bonobos showed a higher diversity than in chimpanzees. Because monoamine oxidase influences aggressiveness, the differences between the polymorphisms of MAin2 and MBin2 in bonobos and chimpanzees may be associated with the differences in aggression between the two species. In order to understand the evolution of these loci and AR, MAOA and MAOB in humans and non-human primates, it would be useful to conduct future studies focusing on the potential association between aggressiveness, and other personality traits, and polymorphisms documented in bonobos. PMID:25606465

The plant energy-dissipating mitochondrial systems: depicting the genomic structure and the expression profiles of the gene families of uncoupling protein and alternative oxidase in monocots and dicots.

PubMed

Borecky, Jirí; Nogueira, Fábio T S; de Oliveira, Kívia A P; Maia, Ivan G; Vercesi, Aníbal E; Arruda, Paulo

2006-01-01

The simultaneous existence of alternative oxidases and uncoupling proteins in plants has raised the question as to why plants need two energy-dissipating systems with apparently similar physiological functions. A probably complete plant uncoupling protein gene family is described and the expression profiles of this family compared with the multigene family of alternative oxidases in Arabidopsis thaliana and sugarcane (Saccharum sp.) employed as dicot and monocot models, respectively. In total, six uncoupling protein genes, AtPUMP1-6, were recognized within the Arabidopsis genome and five (SsPUMP1-5) in a sugarcane EST database. The recombinant AtPUMP5 protein displayed similar biochemical properties as AtPUMP1. Sugarcane possessed four Arabidopsis AOx1-type orthologues (SsAOx1a-1d); no sugarcane orthologue corresponding to Arabidopsis AOx2-type genes was identified. Phylogenetic and expression analyses suggested that AtAOx1d does not belong to the AOx1-type family but forms a new (AOx3-type) family. Tissue-enriched expression profiling revealed that uncoupling protein genes were expressed more ubiquitously than the alternative oxidase genes. Distinct expression patterns among gene family members were observed between monocots and dicots and during chilling stress. These findings suggest that the members of each energy-dissipating system are subject to different cell or tissue/organ transcriptional regulation. As a result, plants may respond more flexibly to adverse biotic and abiotic conditions, in which oxidative stress is involved.

Effect of pollination and fertilization on the expression of genes related to floral transition, hormone synthesis and berry development in grapevine.

PubMed

Dauelsberg, Patricia; Matus, José Tomás; Poupin, María Josefina; Leiva-Ampuero, Andrés; Godoy, Francisca; Vega, Andrea; Arce-Johnson, Patricio

2011-09-15

In the present work, the effect of assisted fertilization on anatomical, morphological and gene expression changes occurring in carpels and during early stages of berry development in Vitis vinifera were studied. Inflorescences were emasculated before capfall, immediately manually pollinated (EP) and fruit development was compared to emasculated but non-pollinated (ENP) and self-pollinated inflorescences (NESP). The diameter of berries derived from pollinated flowers (EP and NESP) was significantly higher than from non-pollinated flowers (ENP) at 21 days after emasculation/pollination (DAE), and a rapid increase in the size of the inner mesocarp, together with the presence of an embryo-like structure, were observed. The expression of gibberellin oxidases (GA20ox and GA2ox), anthranilate synthase (related to auxin synthesis) and cytokinin synthase coding genes was studied to assess the relationship between hormone synthesis and early berry development, while flower patterning genes were analyzed to describe floral transition. Significant expression changes were found for hormone-related genes, suggesting that their expression at early stages of berry development (13 DAE) is related to cell division and differentiation of mesocarp tissue at a later stage (21 DAE). Expression of hormone-related genes also correlates with the expression of VvHB13, a gene related to mesocarp expansion, and with an increased repression of floral patterning genes (PISTILLATA and TM6), which may contribute to prevent floral transition inhibiting fruit growth before fertilization takes place. Copyright © 2011 Elsevier GmbH. All rights reserved.

Reduced mobility and PPC in In(.20)Ga(.80)As / Al(.23)Ga(.77)As HEMT structure

NASA Technical Reports Server (NTRS)

Schacham, S. E.; Mena, Rafael A.; Haugland, Edward J.; Alterovitz, Samuel A.

1992-01-01

Transport properties of a pseudomorphic In(.20)Ga(.80)As/Al(.23)Ga(.77)As High Electron Mobility Transistor (HEMT) structure were measured by Hall and SdH techniques. Two samples of identical structures but with different doping levels were compared. Low temperature mobility measurements as a function of concentration coincides with the onset of second subband occupancy, indicating that the decrease in mobility is due to intersubband scattering. In spite of the low Al content (23 percent), large persistent photoconductivity (PPC) was observed in the highly doped sample only, showing a direct correlation between the PPC and doping concentration of the barrier layer.

Recovery of choline oxidase activity by in vitro recombination of individual segments.

PubMed

Heinze, Birgit; Hoven, Nina; O'Connell, Timothy; Maurer, Karl-Heinz; Bartsch, Sebastian; Bornscheuer, Uwe T

2008-11-01

Initial attempts to express a choline oxidase from Arthrobacter pascens (APChO-syn) in Escherichia coli starting from a synthetic gene only led to inactive protein. However, activity was regained by the systematic exchange of individual segments of the gene with segments from a choline oxidase-encoding gene from Arthrobacter globiformis yielding a functional chimeric enzyme. Next, a sequence alignment of the exchanged segment with other choline oxidases revealed a mutation in the APChO-syn, showing that residue 200 was a threonine instead of an asparagine, which is, thus, crucial for confering enzyme activity and, hence, provides an explanation for the initial lack of activity. The active recombinant APChO-syn-T200N variant was biochemically characterized showing an optimum at pH 8.0 and at 37 degrees C. Furthermore, the substrate specificity was examined using N,N-dimethylethanolamine, N-methylethanolamine and 3,3-dimethyl-1-butanol.

Function of the Pyruvate Oxidase-Lactate Oxidase Cascade in Interspecies Competition between Streptococcus oligofermentans and Streptococcus mutans

PubMed Central

Liu, Lei

2012-01-01

Complex interspecies interactions occur constantly between oral commensals and the opportunistic pathogen Streptococcus mutans in dental plaque. Previously, we showed that oral commensal Streptococcus oligofermentans possesses multiple enzymes for H2O2 production, especially lactate oxidase (Lox), allowing it to out-compete S. mutans. In this study, through extensive biochemical and genetic studies, we identified a pyruvate oxidase (pox) gene in S. oligofermentans. A pox deletion mutant completely lost Pox activity, while ectopically expressed pox restored activity. Pox was determined to produce most of the H2O2 in the earlier growth phase and log phase, while Lox mainly contributed to H2O2 production in stationary phase. Both pox and lox were expressed throughout the growth phase, while expression of the lox gene increased by about 2.5-fold when cells entered stationary phase. Since lactate accumulation occurred to a large degree in stationary phase, the differential Pox- and Lox-generated H2O2 can be attributed to differential gene expression and substrate availability. Interestingly, inactivation of pox causes a dramatic reduction in H2O2 production from lactate, suggesting a synergistic action of the two oxidases in converting lactate into H2O2. In an in vitro two-species biofilm experiment, the pox mutant of S. oligofermentans failed to inhibit S. mutans even though lox was active. In summary, S. oligofermentans develops a Pox-Lox synergy strategy to maximize its H2O2 formation so as to win the interspecies competition. PMID:22287002

Cloning and characterization of the gene for L-amino acid oxidase in hybrid tilapia.

PubMed

Shen, Yubang; Fu, Gui Hong; Liu, Feng; Yue, Gen Hua

2015-12-01

Tilapia is the common name for a group of cichlid fishes. Identification of DNA markers significantly associated with important traits in candidate genes may speed up genetic improvement. L-Amino acid oxidase (LAO) plays a crucial role in the innate immune defences of animals. Previously, whether LAO variants were associated with economic traits had not been studied in fish. We characterized the cDNA sequence of the LAO gene of hybrid tilapia (Oreochromis spp.). Its ORF was 1536 bp, encoding a flavoenzyme of 511 amino acids. This gene consisted of seven exons and six introns. Its expression was detected in the intestine, blood, kidney, skin, liver. It was highly expressed in the intestine. After a challenge with a bacterial pathogen, Streptococcus agalactiae, its expression was up-regulated significantly in the liver, intestine and spleen (P < 0.05). We identified one SNP in the genomic sequence of the gene and found that this SNP was associated significantly with body length (P < 0.05), but not with resistance to S. agalactiae. The results of this study suggest that the LAO gene plays an important role in innate immune responses to the bacterial pathogen in tilapia. The investigation of relationship between polymorphism of LAO gene and disease resistance and growth in tilapia showed that one SNP was associated significantly with body length. Further experiments on whether SNPs in the LAO gene are associated with growth in tilapia and other populations could be useful in understanding more functions of the LAO gene.

20-nm enhancement-mode metamorphic GaAs HEMT with highly doped InGaAs source/drain regions for high-frequency applications

NASA Astrophysics Data System (ADS)

Ajayan, J.; Nirmal, D.

2017-03-01

In this article, the DC and RF performance of a SiN passivated 20-nm gate length metamorphic high electron mobility transistor (MHEMT) on GaAs substrate with highly doped InGaAs source/drain (S/D) regions have investigated using the Synopsys TCAD tool. The 20-nm enhancement-mode (E-mode) MHEMT device also features δ-doped sheets on either side of the In0.53Ga0.47As/InAs/In0.53Ga0.47As channel which exhibits a transconductance of 3100 mS/mm, cut-off frequency (fT) of 740 GHz and a maximum oscillation frequency (fmax) of 1040 GHz. The threshold voltage of the device is found to be 0.07 V. The room temperature Hall mobilities of the 2-dimensional sheet charge density are measured to be over 12,600 cm2/Vs with a sheet charge density larger than 3.6 × 1012 cm-2. These high-performance E-mode MHEMTs are attractive candidates for sub-millimetre wave applications such as high-resolution radars for space research, remote atmospheric sensing, imaging systems and also for low noise wide bandwidth amplifier for future communication systems.

Cloning and expression analysis of the Ccrboh gene encoding respiratory burst oxidase in Citrullus colocynthis and grafting onto Citrullus lanatus (watermelon)

PubMed Central

Si, Ying; Dane, Fenny; Rashotte, Aaron; Kang, Kwonkyoo; Singh, Narendra K.

2010-01-01

A full-length drought-responsive gene Ccrboh, encoding the respiratory burst oxidase homologue (rboh), was cloned in Citrullus colocynthis, a very drought-tolerant cucurbit species. The robh protein, also named NADPH oxidase, is conserved in plants and animals, and functions in the production of reactive oxygen species (ROS). The Ccrboh gene accumulated in a tissue-specific pattern when C. colocynthis was treated with PEG, abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), or NaCl, while the homologous rboh gene did not show any change in C. lanatus var. lanatus, cultivated watermelon, during drought. Grafting experiments were conducted using C. colocynthis or C. lanatus as the rootstock or scion. Results showed that the rootstock significantly affects gene expression in the scion, and some signals might be transported from the root to the shoot. Ccrboh in C. colocynthis was found to function early during plant development, reaching high mRNA transcript levels 3 d after germination. The subcellular location of Ccrboh was investigated by transient expression of the 35S::Ccrboh::GFP fusion construct in protoplasts. The result confirmed that Ccrboh is a transmembrane protein. Our data suggest that Ccrboh might be functionally important during the acclimation of plants to stress and also in plant development. It holds great promise for improving drought tolerance of other cucurbit species. PMID:20181664

Cloning and expression analysis of the Ccrboh gene encoding respiratory burst oxidase in Citrullus colocynthis and grafting onto Citrullus lanatus (watermelon).

PubMed

Si, Ying; Dane, Fenny; Rashotte, Aaron; Kang, Kwonkyoo; Singh, Narendra K

2010-06-01

A full-length drought-responsive gene Ccrboh, encoding the respiratory burst oxidase homologue (rboh), was cloned in Citrullus colocynthis, a very drought-tolerant cucurbit species. The robh protein, also named NADPH oxidase, is conserved in plants and animals, and functions in the production of reactive oxygen species (ROS). The Ccrboh gene accumulated in a tissue-specific pattern when C. colocynthis was treated with PEG, abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), or NaCl, while the homologous rboh gene did not show any change in C. lanatus var. lanatus, cultivated watermelon, during drought. Grafting experiments were conducted using C. colocynthis or C. lanatus as the rootstock or scion. Results showed that the rootstock significantly affects gene expression in the scion, and some signals might be transported from the root to the shoot. Ccrboh in C. colocynthis was found to function early during plant development, reaching high mRNA transcript levels 3 d after germination. The subcellular location of Ccrboh was investigated by transient expression of the 35S::Ccrboh::GFP fusion construct in protoplasts. The result confirmed that Ccrboh is a transmembrane protein. Our data suggest that Ccrboh might be functionally important during the acclimation of plants to stress and also in plant development. It holds great promise for improving drought tolerance of other cucurbit species.

Expression and Chloroplast Targeting of Cholesterol Oxidase in Transgenic Tobacco Plants

PubMed Central

Corbin, David R.; Grebenok, Robert J.; Ohnmeiss, Thomas E.; Greenplate, John T.; Purcell, John P.

2001-01-01

Cholesterol oxidase represents a novel type of insecticidal protein with potent activity against the cotton boll weevil (Anthonomus grandis grandis Boheman). We transformed tobacco (Nicotiana tabacum) plants with the cholesterol oxidase choM gene and expressed cytosolic and chloroplast-targeted versions of the ChoM protein. Transgenic leaf tissues expressing cholesterol oxidase exerted insecticidal activity against boll weevil larvae. Our results indicate that cholesterol oxidase can metabolize phytosterols in vivo when produced cytosolically or when targeted to chloroplasts. The transgenic plants exhibiting cytosolic expression accumulated low levels of saturated sterols known as stanols, and displayed severe developmental aberrations. In contrast, the transgenic plants expressing chloroplast-targeted cholesterol oxidase maintained a greater accumulation of stanols, and appeared phenotypically and developmentally normal. These results are discussed within the context of plant sterol distribution and metabolism. PMID:11457962

Global Transcriptomic Analysis of Targeted Silencing of Two Paralogous ACC Oxidase Genes in Banana

PubMed Central

Xia, Yan; Kuan, Chi; Chiu, Chien-Hsiang; Chen, Xiao-Jing; Do, Yi-Yin; Huang, Pung-Ling

2016-01-01

Among 18 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase homologous genes existing in the banana genome there are two genes, Mh-ACO1 and Mh-ACO2, that participate in banana fruit ripening. To better understand the physiological functions of Mh-ACO1 and Mh-ACO2, two hairpin-type siRNA expression vectors targeting both the Mh-ACO1 and Mh-ACO2 were constructed and incorporated into the banana genome by Agrobacterium-mediated transformation. The generation of Mh-ACO1 and Mh-ACO2 RNAi transgenic banana plants was confirmed by Southern blot analysis. To gain insights into the functional diversity and complexity between Mh-ACO1 and Mh-ACO2, transcriptome sequencing of banana fruits using the Illumina next-generation sequencer was performed. A total of 32,093,976 reads, assembled into 88,031 unigenes for 123,617 transcripts were obtained. Significantly enriched Gene Oncology (GO) terms and the number of differentially expressed genes (DEGs) with GO annotation were ‘catalytic activity’ (1327, 56.4%), ‘heme binding’ (65, 2.76%), ‘tetrapyrrole binding’ (66, 2.81%), and ‘oxidoreductase activity’ (287, 12.21%). Real-time RT-PCR was further performed with mRNAs from both peel and pulp of banana fruits in Mh-ACO1 and Mh-ACO2 RNAi transgenic plants. The results showed that expression levels of genes related to ethylene signaling in ripening banana fruits were strongly influenced by the expression of genes associated with ethylene biosynthesis. PMID:27681726

Symbiotic Burkholderia Species Show Diverse Arrangements of nif/fix and nod Genes and Lack Typical High-Affinity Cytochrome cbb3 Oxidase Genes.

PubMed

De Meyer, Sofie E; Briscoe, Leah; Martínez-Hidalgo, Pilar; Agapakis, Christina M; de-Los Santos, Paulina Estrada; Seshadri, Rekha; Reeve, Wayne; Weinstock, George; O'Hara, Graham; Howieson, John G; Hirsch, Ann M

2016-08-01

Genome analysis of fourteen mimosoid and four papilionoid beta-rhizobia together with fourteen reference alpha-rhizobia for both nodulation (nod) and nitrogen-fixing (nif/fix) genes has shown phylogenetic congruence between 16S rRNA/MLSA (combined 16S rRNA gene sequencing and multilocus sequence analysis) and nif/fix genes, indicating a free-living diazotrophic ancestry of the beta-rhizobia. However, deeper genomic analysis revealed a complex symbiosis acquisition history in the beta-rhizobia that clearly separates the mimosoid and papilionoid nodulating groups. Mimosoid-nodulating beta-rhizobia have nod genes tightly clustered in the nodBCIJHASU operon, whereas papilionoid-nodulating Burkholderia have nodUSDABC and nodIJ genes, although their arrangement is not canonical because the nod genes are subdivided by the insertion of nif and other genes. Furthermore, the papilionoid Burkholderia spp. contain duplications of several nod and nif genes. The Burkholderia nifHDKEN and fixABC genes are very closely related to those found in free-living diazotrophs. In contrast, nifA is highly divergent between both groups, but the papilionoid species nifA is more similar to alpha-rhizobia nifA than to other groups. Surprisingly, for all Burkholderia, the fixNOQP and fixGHIS genes required for cbb3 cytochrome oxidase production and assembly are missing. In contrast, symbiotic Cupriavidus strains have fixNOQPGHIS genes, revealing a divergence in the evolution of two distinct electron transport chains required for nitrogen fixation within the beta-rhizobia.

NADPH Oxidases in Vascular Pathology

PubMed Central

Konior, Anna; Schramm, Agata; Czesnikiewicz-Guzik, Marta

2014-01-01

Abstract Significance: Reactive oxygen species (ROS) play a critical role in vascular disease. While there are many possible sources of ROS, nicotinamide adenine dinucleotide phosphate (NADPH) oxidases play a central role. They are a source of “kindling radicals,” which affect other enzymes, such as nitric oxide synthase endothelial nitric oxide synthase or xanthine oxidase. This is important, as risk factors for atherosclerosis (hypertension, diabetes, hypercholesterolemia, and smoking) regulate the expression and activity of NADPH oxidases in the vessel wall. Recent Advances: There are seven isoforms in mammals: Nox1, Nox2, Nox3, Nox4, Nox5, Duox1 and Duox2. Nox1, Nox2, Nox4, and Nox5 are expressed in endothelium, vascular smooth muscle cells, fibroblasts, or perivascular adipocytes. Other homologues have not been found or are expressed at very low levels; their roles have not been established. Nox1/Nox2 promote the development of endothelial dysfunction, hypertension, and inflammation. Nox4 may have a role in protecting the vasculature during stress; however, when its activity is increased, it may be detrimental. Calcium-dependent Nox5 has been implicated in oxidative damage in human atherosclerosis. Critical Issues: NADPH oxidase-derived ROS play a role in vascular pathology as well as in the maintenance of normal physiological vascular function. We also discuss recently elucidated mechanisms such as the role of NADPH oxidases in vascular protection, vascular inflammation, pulmonary hypertension, tumor angiogenesis, and central nervous system regulation of vascular function and hypertension. Future Directions: Understanding the role of individual oxidases and interactions between homologues in vascular disease is critical for efficient pharmacological regulation of vascular NADPH oxidases in both the laboratory and clinical practice. Antioxid. Redox Signal. 20, 2794–2814. PMID:24180474

Real time expression of ACC oxidase and PR-protein genes mediated by Methylobacterium spp. in tomato plants challenged with Xanthomonas campestris pv. vesicatoria.

PubMed

Yim, W J; Kim, K Y; Lee, Y W; Sundaram, S P; Lee, Y; Sa, T M

2014-07-15

Biotic stress like pathogenic infection increases ethylene biosynthesis in plants and ethylene inhibitors are known to alleviate the severity of plant disease incidence. This study aimed to reduce the bacterial spot disease incidence in tomato plants caused by Xanthomonas campestris pv. vesicatoria (XCV) by modulating stress ethylene with 1-aminocyclopropane-1-carboxylate (ACC) deaminase activity of Methylobacterium strains. Under greenhouse condition, Methylobacterium strains inoculated and pathogen challenged tomato plants had low ethylene emission compared to pathogen infected ones. ACC accumulation and ACC oxidase (ACO) activity with ACO related gene expression increased in XCV infected tomato plants over Methylobacterium strains inoculated plants. Among the Methylobacterium spp., CBMB12 resulted lowest ACO related gene expression (1.46 Normalized Fold Expression), whereas CBMB20 had high gene expression (3.42 Normalized Fold Expression) in pathogen challenged tomato. But a significant increase in ACO gene expression (7.09 Normalized Fold Expression) was observed in the bacterial pathogen infected plants. In contrast, Methylobacterium strains enhanced β-1,3-glucanase and phenylalanine ammonia-lyase (PAL) enzyme activities in pathogen challenged tomato plants. The respective increase in β-1,3-glucanase related gene expressions due to CBMB12, CBMB15, and CBMB20 strains were 66.3, 25.5 and 10.4% higher over pathogen infected plants. Similarly, PAL gene expression was high with 0.67 and 0.30 Normalized Fold Expression, in pathogen challenged tomato plants inoculated with CBMB12 and CBMB15 strains. The results suggest that ethylene is a crucial factor in bacterial spot disease incidence and that methylobacteria with ACC deaminase activity can reduce the disease severity with ultimate pathogenesis-related protein increase in tomato. Copyright © 2014 Elsevier GmbH. All rights reserved.

Genetics Home Reference: isolated sulfite oxidase deficiency

MedlinePlus

... Metabolic Disorders (CLIMB) March of Dimes: Amino Acid Metabolism Disorders The Compassionate Friends GeneReviews (1 link) Isolated Sulfite Oxidase Deficiency ClinicalTrials.gov (1 link) ClinicalTrials.gov Scientific Articles on PubMed (1 link) PubMed OMIM (1 link) ...

A Novel (S)-6-Hydroxynicotine Oxidase Gene from Shinella sp. Strain HZN7

PubMed Central

Qiu, Jiguo; Wei, Yin; Ma, Yun; Wen, Rongti; Wen, Yuezhong

2014-01-01

Nicotine is an important environmental toxicant in tobacco waste. Shinella sp. strain HZN7 can metabolize nicotine into nontoxic compounds via variations of the pyridine and pyrrolidine pathways. However, the catabolic mechanism of this variant pathway at the gene or enzyme level is still unknown. In this study, two 6-hydroxynicotine degradation-deficient mutants, N7-M9 and N7-W3, were generated by transposon mutagenesis. The corresponding mutant genes, designated nctB and tnp2, were cloned and analyzed. The nctB gene encodes a novel flavin adenine dinucleotide-containing (S)-6-hydroxynicotine oxidase that converts (S)-6-hydroxynicotine into 6-hydroxy-N-methylmyosmine and then spontaneously hydrolyzes into 6-hydroxypseudooxynicotine. The deletion and complementation of the nctB gene showed that this enzyme is essential for nicotine or (S)-6-hydroxynicotine degradation. Purified NctB could also convert (S)-nicotine into N-methylmyosmine, which spontaneously hydrolyzed into pseudooxynicotine. The kinetic constants of NctB toward (S)-6-hydroxynicotine (Km = 0.019 mM, kcat = 7.3 s−1) and nicotine (Km = 2.03 mM, kcat = 0.396 s−1) indicated that (S)-6-hydroxynicotine is the preferred substrate in vivo. NctB showed no activities toward the R enantiomer of nicotine or 6-hydroxynicotine. Strain HZN7 could degrade (R)-nicotine into (R)-6-hydroxynicotine without any further degradation. The tnp2 gene from mutant N7-W3 encodes a putative transposase, and its deletion did not abolish the nicotine degradation activity. This study advances the understanding of the microbial diversity of nicotine biodegradation. PMID:25002425

Genes for cytochrome c oxidase subunit I, URF2, and three tRNAs in Drosophila mitochondrial DNA.

PubMed Central

Clary, D O; Wolstenholme, D R

1983-01-01

Genes for URF2, tRNAtrp, tRNAcys, tRNAtyr and cytochrome c oxidase subunit I (COI) have been identified within a sequenced segment of the Drosophila yakuba mtDNA molecule. The five genes are arranged in the order given. Transcription of the tRNAcys and tRNAtyr genes is in the same direction as replication, while transcription of the URF2, tRNAtrp and COI genes is in the opposite direction. A similar arrangement of these genes is found in mammalian mtDNA except that in the latter, the tRNAala and tRNAasn genes are located between the tRNAtrp and tRNAcys genes. Also, a sequence found between the tRNAasn and tRNAcys genes in mammalian mtDNA, which is associated with the initiation of second strand DNA synthesis, is not found in this region of the D. yakuba mtDNA molecule. As the D. yakuba COI gene lacks a standard translation initiation codon, we consider the possibility that the quadruplet ATAA may serve this function. As in other D. yakuba mitochondrial polypeptide genes, AGA codons in the URF2 and COI genes do not correspond in position to arginine-specifying codons in the equivalent genes of mouse and yeast mtDNAs, but do most frequently correspond to serine-specifying codons. PMID:6314262

Effect of GA3 treatment on seed development and seed-related gene expression in grape.

PubMed

Cheng, Chenxia; Xu, Xiaozhao; Singer, Stacy D; Li, Jun; Zhang, Hongjing; Gao, Min; Wang, Li; Song, Junyang; Wang, Xiping

2013-01-01

The phytohormone gibberellic acid (GA3) is widely used in the table grape industry to induce seedlessness in seeded varieties. However, there is a paucity of information concerning the mechanisms by which GAs induce seedlessness in grapes. In an effort to systematically analyze the cause of this GA3-induced seed abortion, we conducted an in depth characterization of two seeded grape cultivars ('Kyoho' and 'Red Globe'), along with a seedless cultivar ('Thompson Seedless'), following treatment with GA3. In a similar fashion to the seedless control, which exhibited GA3-induced abortion of the seeds 9 days after full bloom (DAF), both 'Kyoho' and 'Red Globe' seeded varieties exhibited complete abortion of the seeds 15 DAF when treated with GA3. Morphological analyses indicated that while fertilization appeared to occur normally following GA3 treatment, as well as in the untreated seedless control cultivar, seed growth eventually ceased. In addition, we found that GA3 application had an effect on redox homeostasis, which could potentially cause cell damage and subsequent seed abortion. Furthermore, we carried out an analysis of antioxidant enzyme activities, as well as transcript levels from various genes believed to be involved in seed development, and found several differences between GA3-treated and untreated controls. Therefore, it seems that the mechanisms driving GA3-induced seedlessness are similar in both seeded and seedless cultivars, and that the observed abortion of seeds may result at least in part from a GA3-induced increase in cell damage caused by reactive oxygen species, a decrease in antioxidant enzymatic activities, and an alteration of the expression of genes related to seed development.

A mutation in a coproporphyrinogen III oxidase gene confers growth inhibition, enhanced powdery mildew resistance and powdery mildew-induced cell death in Arabidopsis.

PubMed

Guo, Chuan-yu; Wu, Guang-heng; Xing, Jin; Li, Wen-qi; Tang, Ding-zhong; Cui, Bai-ming

2013-05-01

A gene encoding a coproporphyrinogen III oxidase mediates disease resistance in plants by the salicylic acid pathway. A number of genes that regulate powdery mildew resistance have been identified in Arabidopsis, such as ENHANCED DISEASE RESISTANCE 1 to 3 (EDR1 to 3). To further study the molecular interactions between the powdery mildew pathogen and Arabidopsis, we isolated and characterized a mutant that exhibited enhanced resistance to powdery mildew. The mutant also showed dramatic powdery mildew-induced cell death as well as growth defects and early senescence in the absence of pathogens. We identified the affected gene by map-based cloning and found that the gene encodes a coproporphyrinogen III oxidase, a key enzyme in the tetrapyrrole biosynthesis pathway, previously known as LESION INITIATION 2 (LIN2). Therefore, we designated the mutant lin2-2. Further studies revealed that the lin2-2 mutant also displayed enhanced resistance to Hyaloperonospora arabidopsidis (H.a.) Noco2. Genetic analysis showed that the lin2-2-mediated disease resistance and spontaneous cell death were dependent on PHYTOALEXIN DEFICIENT 4 (PAD4), SALICYLIC ACID INDUCTION-DEFICIENT 2 (SID2), and NONEXPRESSOR OF PATHOGENESIS-RELATED GENES 1 (NPR1), which are all involved in salicylic acid signaling. Furthermore, the relative expression levels of defense-related genes were induced after powdery mildew infection in the lin2-2 mutant. These data indicated that LIN2 plays an important role in cell death control and defense responses in plants.

Association of DNA methylation and monoamine oxidase A gene expression in the brains of different dog breeds.

PubMed

Eo, JungWoo; Lee, Hee-Eun; Nam, Gyu-Hwi; Kwon, Yun-Jeong; Choi, Yuri; Choi, Bong-Hwan; Huh, Jae-Won; Kim, Minkyu; Lee, Sang-Eun; Seo, Bohyun; Kim, Heui-Soo

2016-04-15

The monoamine oxidase A (MAOA) gene is an important candidate gene for human behavior that encodes an enzyme regulating the metabolism of key neurotransmitters. The regulatory mechanisms of the MAOA gene in dogs are yet to be elucidated. We measured MAOA gene transcription and analyzed the VNTR genotype and methylation status of the gene promoter region in different dog breeds to determine whether MAOA expression is correlated with the MAOA genotype or epigenetic modification in dogs. We found brain-specific expression of the MAOA gene and different transcription levels in different dog breeds including Beagle, Sapsaree, and German shepherd, and also a robust association of the DNA methylation of the gene promoter with mRNA levels. However, the 90 bp tandem repeats that we observed near the transcription start site were not variable, indicating no correlation with canine MAOA activity. These results show that differential DNA methylation in the MAOA promoter region may affect gene expression by modulating promoter activity. Moreover, the distinctive patterns of MAOA expression and DNA methylation may be involved in breed-specific or individual behavioral characteristics, such as aggression, because behavioral phenotypes are related to different physiological and neuroendocrine responses. Copyright © 2016 Elsevier B.V. All rights reserved.

POLYAMINE OXIDASE 1 from rice (Oryza sativa) is a functional ortholog of Arabidopsis POLYAMINE OXIDASE 5.

PubMed

Liu, Taibo; Wook Kim, Dong; Niitsu, Masaru; Berberich, Thomas; Kusano, Tomonobu

2014-01-01

POLYAMINE OXIDASE 1 (OsPAO1), from rice (Oryza sativa), and POLYAMINE OXIDASE 5 (AtPAO5), from Arabidopsis (Arabidopsis thaliana), are enzymes sharing high identity at the amino acid level and with similar characteristics, such as polyamine specificity and pH preference; furthermore, both proteins localize to the cytosol. A loss-of-function Arabidopsis mutant, Atpao5-2, was hypersensitive to low doses of exogenous thermospermine but this phenotype could be rescued by introduction of the wild-type AtPAO5 gene. Introduction of OsPAO1, under the control of a constitutive promoter, into Atpao5-2 mutants also restored normal thermospermine sensitivity, allowing growth in the presence of low levels of thermospermine, along with a concomitant decrease in thermospermine content in plants. By contrast, introduction of OsPAO3, which encodes a peroxisome-localized polyamine oxidase, into Atpao5-2 plants could not rescue any of the mutant phenotypes in the presence of thermospermine. These results suggest that OsPAO1 is the functional ortholog of AtPAO5.

High-level expression of the Penicillium notatum glucose oxidase gene in Pichia pastoris using codon optimization.

PubMed

Gao, Zhaowei; Li, Zhuofu; Zhang, Yuhong; Huang, Huoqing; Li, Mu; Zhou, Liwei; Tang, Yunming; Yao, Bin; Zhang, Wei

2012-03-01

The glucose oxidase (GOD) gene from Penicillium notatum was expressed in Pichia pastoris. The 1,815 bp gene, god-w, encodes 604 amino acids. Recombinant GOD-w had optimal activity at 35-40°C and pH 6.2 and was stable, from pH 3 to 7 maintaining >75% maximum activity after incubation at 50°C for 1 h. GOD-w worked as well as commercial GODs to improve bread making. To achieve high-level expression of recombinant GOD in P. pastoris, 272 nucleotides involving 228 residues were mutated, consistent with the codon bias of P. pastoris. The optimized recombinant GOD-m yielded 615 U ml(-1) (2.5 g protein l(-1)) in a 3 l fermentor--410% higher than GOD-w (148 U ml(-1)), and thus is a low-cost alternative for the bread baking industry.

Exploiting algal NADPH oxidase for biophotovoltaic energy

DOE PAGES

Anderson, Alexander; Laohavisit, Anuphon; Blaby, Ian K.; ...

2015-01-29

Photosynthetic microbes exhibit light-dependent electron export across the cell membrane, which can generate electricity in biological photovoltaic (BPV) devices. How electrons are exported remains to be determined; the identification of mechanisms would help selection or generation of photosynthetic microbes capable of enhanced electrical output. We show that plasma membrane NADPH oxidase activity is a significant component of light-dependent generation of electricity by the unicellular green alga Chlamydomonas reinhardtii. NADPH oxidases export electrons across the plasma membrane to form superoxide anion from oxygen. The C. reinhardtii mutant lacking the NADPH oxidase encoded by RBO1 is impaired in both extracellular superoxide anionmore » production and current generation in a BPV device. Complementation with the wild-type gene restores both capacities, demonstrating the role of the enzyme in electron export. Monitoring light-dependent extracellular superoxide production with a colorimetric assay is shown to be an effective way of screening for electrogenic potential of candidate algal strains. Furthermore, the results show that algal NADPH oxidases are important for superoxide anion production and open avenues for optimizing the biological component of these devices.« less

Molecular and Biochemical Characterization of a Cytokinin Oxidase from Maize1

PubMed Central

Bilyeu, Kristin D.; Cole, Jean L.; Laskey, James G.; Riekhof, Wayne R.; Esparza, Thomas J.; Kramer, Michelle D.; Morris, Roy O.

2001-01-01

It is generally accepted that cytokinin oxidases, which oxidatively remove cytokinin side chains to produce adenine and the corresponding isopentenyl aldehyde, play a major role in regulating cytokinin levels in planta. Partially purified fractions of cytokinin oxidase from various species have been studied for many years, but have yet to clearly reveal the properties of the enzyme or to define its biological significance. Details of the genomic organization of the recently isolated maize (Zea mays) cytokinin oxidase gene (ckx1) and some of its Arabidopsis homologs are now presented. Expression of an intronless ckx1 in Pichia pastoris allowed production of large amounts of recombinant cytokinin oxidase and facilitated detailed kinetic and cofactor analysis and comparison with the native enzyme. The enzyme is a flavoprotein containing covalently bound flavin adenine dinucleotide, but no detectable heavy metals. Expression of the oxidase in maize tissues is described. PMID:11154345

Effect of GA3 Treatment on Seed Development and Seed-Related Gene Expression in Grape

PubMed Central

Cheng, Chenxia; Xu, Xiaozhao; Singer, Stacy D.; Li, Jun; Zhang, Hongjing; Gao, Min; Wang, Li; Song, Junyang; Wang, Xiping

2013-01-01

Background The phytohormone gibberellic acid (GA3) is widely used in the table grape industry to induce seedlessness in seeded varieties. However, there is a paucity of information concerning the mechanisms by which GAs induce seedlessness in grapes. Methodology/Principal Findings In an effort to systematically analyze the cause of this GA3-induced seed abortion, we conducted an in depth characterization of two seeded grape cultivars (‘Kyoho’ and ‘Red Globe’), along with a seedless cultivar (‘Thompson Seedless’), following treatment with GA3. In a similar fashion to the seedless control, which exhibited GA3-induced abortion of the seeds 9 days after full bloom (DAF), both ‘Kyoho’ and ‘Red Globe’ seeded varieties exhibited complete abortion of the seeds 15 DAF when treated with GA3. Morphological analyses indicated that while fertilization appeared to occur normally following GA3 treatment, as well as in the untreated seedless control cultivar, seed growth eventually ceased. In addition, we found that GA3 application had an effect on redox homeostasis, which could potentially cause cell damage and subsequent seed abortion. Furthermore, we carried out an analysis of antioxidant enzyme activities, as well as transcript levels from various genes believed to be involved in seed development, and found several differences between GA3-treated and untreated controls. Conclusion Therefore, it seems that the mechanisms driving GA3-induced seedlessness are similar in both seeded and seedless cultivars, and that the observed abortion of seeds may result at least in part from a GA3-induced increase in cell damage caused by reactive oxygen species, a decrease in antioxidant enzymatic activities, and an alteration of the expression of genes related to seed development. PMID:24224035

Y Chromosome Regulation of Autism Susceptibility Genes

DTIC Science & Technology

2009-06-01

with human -like spontaneous mutation. Neuroreport, 2008. 19(7): p. 739-43. 60. Lin, Y.M., et al., Association analysis of monoamine oxidase A gene and...susceptibility genes, including the monoamine oxidase A (MOAA), mediator complex subunit 12 (MED12), homeobox B1 (HOXB1) gastrin-releasing peptide...autism susceptibility genes, the RET proto- oncogene and monoamine oxidase A (MAOA) gene for detail studies. MAOA deaminates monoamines and is involved

A novel (S)-6-hydroxynicotine oxidase gene from Shinella sp. strain HZN7.

PubMed

Qiu, Jiguo; Wei, Yin; Ma, Yun; Wen, Rongti; Wen, Yuezhong; Liu, Weiping

2014-09-01

Nicotine is an important environmental toxicant in tobacco waste. Shinella sp. strain HZN7 can metabolize nicotine into nontoxic compounds via variations of the pyridine and pyrrolidine pathways. However, the catabolic mechanism of this variant pathway at the gene or enzyme level is still unknown. In this study, two 6-hydroxynicotine degradation-deficient mutants, N7-M9 and N7-W3, were generated by transposon mutagenesis. The corresponding mutant genes, designated nctB and tnp2, were cloned and analyzed. The nctB gene encodes a novel flavin adenine dinucleotide-containing (S)-6-hydroxynicotine oxidase that converts (S)-6-hydroxynicotine into 6-hydroxy-N-methylmyosmine and then spontaneously hydrolyzes into 6-hydroxypseudooxynicotine. The deletion and complementation of the nctB gene showed that this enzyme is essential for nicotine or (S)-6-hydroxynicotine degradation. Purified NctB could also convert (S)-nicotine into N-methylmyosmine, which spontaneously hydrolyzed into pseudooxynicotine. The kinetic constants of NctB toward (S)-6-hydroxynicotine (Km = 0.019 mM, kcat = 7.3 s(-1)) and nicotine (Km = 2.03 mM, kcat = 0.396 s(-1)) indicated that (S)-6-hydroxynicotine is the preferred substrate in vivo. NctB showed no activities toward the R enantiomer of nicotine or 6-hydroxynicotine. Strain HZN7 could degrade (R)-nicotine into (R)-6-hydroxynicotine without any further degradation. The tnp2 gene from mutant N7-W3 encodes a putative transposase, and its deletion did not abolish the nicotine degradation activity. This study advances the understanding of the microbial diversity of nicotine biodegradation. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Analysis of the cytochrome c oxidase subunit II (COX2) gene in giant panda, Ailuropoda melanoleuca.

PubMed

Ling, S S; Zhu, Y; Lan, D; Li, D S; Pang, H Z; Wang, Y; Li, D Y; Wei, R P; Zhang, H M; Wang, C D; Hu, Y D

2017-01-23

The giant panda, Ailuropoda melanoleuca (Ursidae), has a unique bamboo-based diet; however, this low-energy intake has been sufficient to maintain the metabolic processes of this species since the fourth ice age. As mitochondria are the main sites for energy metabolism in animals, the protein-coding genes involved in mitochondrial respiratory chains, particularly cytochrome c oxidase subunit II (COX2), which is the rate-limiting enzyme in electron transfer, could play an important role in giant panda metabolism. Therefore, the present study aimed to isolate, sequence, and analyze the COX2 DNA from individuals kept at the Giant Panda Protection and Research Center, China, and compare these sequences with those of the other Ursidae family members. Multiple sequence alignment showed that the COX2 gene had three point mutations that defined three haplotypes, with 60% of the sequences corresponding to haplotype I. The neutrality tests revealed that the COX2 gene was conserved throughout evolution, and the maximum likelihood phylogenetic analysis, using homologous sequences from other Ursidae species, showed clustering of the COX2 sequences of giant pandas, suggesting that this gene evolved differently in them.

Development of a 2.0 eV AlGaInP Solar Cell Grown by OMVPE

DOE Office of Scientific and Technical Information (OSTI.GOV)

Perl, Emmett E.; Simon, John; Geisz, John F.

2015-06-14

AlGaInP solar cells with a bandgap (Eg) of ~2.0 eV are developed for use in next-generation multijunction photovoltaic devices. This material system is of great interest for both space and concentrator photovoltaics due to its high bandgap, which enables the development of high-efficiency five-junction and six-junction devices and is also useful for solar cells operated at elevated temperatures. In this work, we explore the conditions for the Organometallic Vapor Phase Epitaxy (OMVPE) growth of AlGaInP and study their effects on cell performance. A ~2.0 eV AlGaInP solar cell is demonstrated with an open circuit voltage (VOC) of 1.59V, a bandgap-voltagemore » offset (WOC) of 420mV, a fill factor (FF) of 88.0%, and an efficiency of 14.8%. These AlGaInP cells have attained a similar FF, WOC and internal quantum efficiency (IQE) to the best upright GaInP cells grown in our lab to date.« less

Regulation of Wheat Seed Dormancy by After-Ripening Is Mediated by Specific Transcriptional Switches That Induce Changes in Seed Hormone Metabolism and Signaling

PubMed Central

Kanno, Yuri; Jordan, Mark C.; Kamiya, Yuji; Seo, Mitsunori; Ayele, Belay T.

2013-01-01

Treatments that promote dormancy release are often correlated with changes in seed hormone content and/or sensitivity. To understand the molecular mechanisms underlying the role of after-ripening (seed dry storage) in triggering hormone related changes and dormancy decay in wheat (Triticum aestivum), temporal expression patterns of genes related to abscisic acid (ABA), gibberellin (GA), jasmonate and indole acetic acid (IAA) metabolism and signaling, and levels of the respective hormones were examined in dormant and after-ripened seeds in both dry and imbibed states. After-ripening mediated developmental switch from dormancy to germination appears to be associated with declines in seed sensitivity to ABA and IAA, which are mediated by transcriptional repressions of PROTEIN PHOSPHATASE 2C, SNF1-RELATED PROTEIN KINASE2, ABA INSENSITIVE5 and LIPID PHOSPHATE PHOSPHTASE2, and AUXIN RESPONSE FACTOR and RELATED TO UBIQUITIN1 genes. Transcriptomic analysis of wheat seed responsiveness to ABA suggests that ABA inhibits the germination of wheat seeds partly by repressing the transcription of genes related to chromatin assembly and cell wall modification, and activating that of GA catabolic genes. After-ripening induced seed dormancy decay in wheat is also associated with the modulation of seed IAA and jasmonate contents. Transcriptional control of members of the ALLENE OXIDE SYNTHASE, 3-KETOACYL COENZYME A THIOLASE, LIPOXYGENASE and 12-OXOPHYTODIENOATE REDUCTASE gene families appears to regulate seed jasmonate levels. Changes in the expression of GA biosynthesis genes, GA 20-OXIDASE and GA 3-OXIDASE, in response to after-ripening implicate this hormone in enhancing dormancy release and germination. These findings have important implications in the dissection of molecular mechanisms underlying regulation of seed dormancy in cereals. PMID:23437172

The monoamine oxidase A gene promoter repeat and prostate cancer risk.

PubMed

White, Thomas A; Kwon, Erika M; Fu, Rong; Lucas, Jared M; Ostrander, Elaine A; Stanford, Janet L; Nelson, Peter S

2012-11-01

Amine catabolism by monoamine oxidase A (MAOA) contributes to oxidative stress, which plays a role in prostate cancer (PCa) development and progression. An upstream variable-number tandem repeat (uVNTR) in the MAOA promoter influences gene expression and activity, and may thereby affect PCa susceptibility. Caucasian (n = 2,572) men from two population-based case-control studies of PCa were genotyped for the MAOA-VNTR. Logistic regression was used to assess PCa risk in relation to genotype. Common alleles of the MAOA-VNTR were not associated with the relative risk of PCa, nor did the relationship differ by clinical features of the disease. The rare 5-copy variant (frequency: 0.5% in cases; 1.8% in controls), however, was associated with a reduced PCa risk (odds ratio, OR = 0.30, 95% CI 0.13-0.71). A rare polymorphism of the MAOA promoter previously shown to confer low expression was associated with a reduced risk of developing PCa. This novel finding awaits confirmation in other study populations. Copyright © 2012 Wiley Periodicals, Inc.

The cytochrome oxidase subunit I and subunit III genes in Oenothera mitochondria are transcribed from identical promoter sequences

PubMed Central

Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel

1987-01-01

Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332

Molecular Characterization of the Oxalate Oxidase Involved in the Response of Barley to the Powdery Mildew Fungus1

PubMed Central

Zhou, Fasong; Zhang, Ziguo; Gregersen, Per L.; Mikkelsen, Jørn D.; de Neergaard, Eigil; Collinge, David B.; Thordal-Christensen, Hans

1998-01-01

Previously we reported that oxalate oxidase activity increases in extracts of barley (Hordeum vulgare) leaves in response to the powdery mildew fungus (Blumeria [syn. Erysiphe] graminis f.sp. hordei) and proposed this as a source of H2O2 during plant-pathogen interactions. In this paper we show that the N terminus of the major pathogen-response oxalate oxidase has a high degree of sequence identity to previously characterized germin-like oxalate oxidases. Two cDNAs were isolated, pHvOxOa, which represents this major enzyme, and pHvOxOb', representing a closely related enzyme. Our data suggest the presence of only two oxalate oxidase genes in the barley genome, i.e. a gene encoding HvOxOa, which possibly exists in several copies, and a single-copy gene encoding HvOxOb. The use of 3′ end gene-specific probes has allowed us to demonstrate that the HvOxOa transcript accumulates to 6 times the level of the HvOxOb transcript in response to the powdery mildew fungus. The transcripts were detected in both compatible and incompatible interactions with a similar accumulation pattern. The oxalate oxidase is found exclusively in the leaf mesophyll, where it is cell wall located. A model for a signal transduction pathway in which oxalate oxidase plays a central role is proposed for the regulation of the hypersensitive response. PMID:9576772

Involvement of NADH Oxidase in Biofilm Formation in Streptococcus sanguinis

PubMed Central

Ge, Xiuchun; Shi, Xiaoli; Shi, Limei; Liu, Jinlin; Stone, Victoria; Kong, Fanxiang; Kitten, Todd; Xu, Ping

2016-01-01

Biofilms play important roles in microbial communities and are related to infectious diseases. Here, we report direct evidence that a bacterial nox gene encoding NADH oxidase is involved in biofilm formation. A dramatic reduction in biofilm formation was observed in a Streptococcus sanguinis nox mutant under anaerobic conditions without any decrease in growth. The membrane fluidity of the mutant bacterial cells was found to be decreased and the fatty acid composition altered, with increased palmitic acid and decreased stearic acid and vaccenic acid. Extracellular DNA of the mutant was reduced in abundance and bacterial competence was suppressed. Gene expression analysis in the mutant identified two genes with altered expression, gtfP and Idh, which were found to be related to biofilm formation through examination of their deletion mutants. NADH oxidase-related metabolic pathways were analyzed, further clarifying the function of this enzyme in biofilm formation. PMID:26950587

Exercise Training, NADPH Oxidase p22phox Gene Polymorphisms, and Hypertension

PubMed Central

FEAIRHELLER, DEBORAH L.; BROWN, MICHAEL D.; PARK, JOON-YOUNG; BRINKLEY, TINA E.; BASU, SAMAR; HAGBERG, JAMES M.; FERRELL, ROBERT E.; FENTY-STEWART, NICOLA M.

2010-01-01

Introduction Oxidative stress that is mediated through NADPH oxidase activity plays a role in the pathology of hypertension, and aerobic exercise training reduces NADPH oxidase activity. The involvement of genetic variation in the p22phox (CYBA) subunit genes in individual oxidative stress responses to aerobic exercise training has yet to be examined in Pre and Stage 1 hypertensives. Methods Ninety-four sedentary Pre and Stage 1 hypertensive adults underwent 6 months of aerobic exercise training at a level of 70% V̇O2max to determine whether the CYBA polymorphisms, C242T and A640G, were associated with changes in urinary 8-iso-prostaglandin F2α (8-iso-PGF2α), urinary nitric oxide metabolites (NOx), and plasma total antioxidant capacity (TAC). Results Demographic and subject characteristics were similar among genotype groups for both polymorphisms. At baseline, a significant (P = 0.03) difference among the C2424T genotype groups in 8-iso-PGF2α levels was detected, with the TT homozygotes having the lowest levels and the CC homozygotes having the highest levels. However, no differences were found at baseline between the A640G genotype groups. After 6 months of aerobic exercise training, there was a significant increase in V̇O2max (P < 0.0001) in the entire study population. In addition, there were significant increases in both urinary 8-iso-PGF2α (P = 0.002) and plasma TAC (P = 0.03) levels and a significant decrease in endogenous urinary NOx (P < 0.0001). Overall, aerobic exercise training elicited no significant differences among genotype groups in either CYBA variant for any of the oxidative stress variables. Conclusions We found that compared with CYBA polymorphisms C242T and A640G, it was aerobic exercise training that had the greatest influence on the selected biomarkers; furthermore, our results suggest that the C242T CYBA variant influences baseline levels of urinary 8-iso-PGF2α but not the aerobic exercise-induced responses. PMID:19516159

Combination of polymorphic variants in serotonin transporter and monoamine oxidase-A genes may influence the risk for early-onset alcoholism.

PubMed

Bordukalo-Niksic, Tatjana; Stefulj, Jasminka; Matosic, Ana; Mokrovic, Gordana; Cicin-Sain, Lipa

2012-12-30

The combinatory effect of polymorphisms in serotonin transporter and monoamine oxidase-A genes on the aetiopathogenesis of alcoholism was investigated in a sample of 714 individuals. Increased frequency of subjects having three 'suspected' genotypes (5-HTTLPR-LL, STin2-1010 and MAO-A 3-repeat allele) was found among type-2 alcoholic patients (P=0.0189). Results highlight serotonergic/genetic contribution to early-onset alcoholism. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Identification of NADPH oxidase family members associated with cold stress in strawberry.

PubMed

Zhang, Yunting; Li, Yali; He, Yuwei; Hu, Wenjie; Zhang, Yong; Wang, Xiaorong; Tang, Haoru

2018-04-01

NADPH oxidase is encoded by a small gene family (Respiratory burst oxidase homologs, Rbohs ) and plays an important role in regulating various biological processes. However, little information about this gene family is currently available for strawberry. In this study, a total of seven Rboh genes were identified from strawberry through genomewide analysis. Gene structure analysis showed the number of exons ranged from 10 to 23, implying that this variation occurred in FvRboh genes by the insertion and distribution of introns; the order and approximate size of exons were relatively conserved. FvRbohC was predicted to localize to the thylakoid membrane of the chloroplast, while other members were computed to localize to the plasma membrane, indicating different functions. Amino acid sequence alignment, conserved domain, and motif analysis showed that all identified FvRbohs had typical features of plant Rbohs. Phylogenetic analysis of Rbohs from strawberry, grape, Arabidopsis, and rice suggested that the FvRbohs could be divided into five subgroups and showed a closer relationship with those from grape and Arabidopsis than those from rice. The expression patterns of FvRboh genes in root, stem, leaf, flower, and fruit revealed robust tissue specificity. The expression levels of FvRbohA and FvRbohD were quickly induced by cold stress, followed by an increase in NADPH oxidase activity, leading to O2- accumulation and triggering the antioxidant reaction by the transient increases in SOD activity. This suggested these two genes may be involved in cold stress and defense responses in strawberry.

Characterization of the cydAB-Encoded Cytochrome bd Oxidase from Mycobacterium smegmatis

PubMed Central

Kana, Bavesh D.; Weinstein, Edward A.; Avarbock, David; Dawes, Stephanie S.; Rubin, Harvey; Mizrahi, Valerie

2001-01-01

The cydAB genes from Mycobacterium smegmatis have been cloned and characterized. The cydA and cydB genes encode the two subunits of a cytochrome bd oxidase belonging to the widely distributed family of quinol oxidases found in prokaryotes. The cydD and cydC genes located immediately downstream of cydB encode a putative ATP-binding cassette-type transporter. At room temperature, reduced minus oxidized difference spectra of membranes purified from wild-type M. smegmatis displayed spectral features that are characteristic of the γ-proteobacterial type cytochrome bd oxidase. Inactivation of cydA or cydB by insertion of a kanamycin resistance marker resulted in loss of d-heme absorbance at 631 nm. The d-heme could be restored by transformation of the M. smegmatis cyd mutants with a replicating plasmid carrying the highly homologous cydABDC gene cluster from Mycobacterium tuberculosis. Inactivation of cydA had no effect on the ability of M. smegmatis to exit from stationary phase at 37 or 42°C. The growth rate of the cydA mutant was tested under oxystatic conditions. Although no discernible growth defect was observed under moderately aerobic conditions (9.2 to 37.5 × 102 Pa of pO2 or 5 to 21% air saturation), the mutant displayed a significant growth disadvantage when cocultured with the wild type under extreme microaerophilia (0.8 to 1.7 × 102 Pa of pO2 or 0.5 to 1% air saturation). These observations were in accordance with the two- to threefold increase in cydAB gene expression observed upon reduction of the pO2 of the growth medium from 21 to 0.5% air saturation and with the concomitant increase in d-heme absorbance in spectra of membranes isolated from wild-type M. smegmatis cultured at 1% air saturation. Finally, the cydA mutant displayed a competitive growth disadvantage in the presence of the terminal oxidase inhibitor, cyanide, when cocultured with wild type at 21% air saturation in an oxystat. In conjunction with these findings, our results suggest that

Abnormal behavior associated with a point mutation in the structural gene for monoamine oxidase A

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brunner, H.G.; Nelen, M.; Ropers, H.H.

1993-10-22

Genetic and metabolic studies have been done on a large kindred in which several males are affected by a syndrome of borderline mental retardation and abnormal behavior. The types of behavior that occurred include impulsive aggression, arson, attempted rape, and exhibitionism. Analysis of 24-hour urine samples indicated markedly disturbed monoamine metabolism. This syndrome was associated with a complete and selective deficiency of enzymatic activity of monoamine oxidase A (MAOA). In each of five affected males, a point mutation was identified in the eighth exon of the MAOA structural gene, which changes a glutamine to a termination codon. Thus, isolated completemore » MAOA deficiency in this family is associated with a recognizable behavioral phenotype that includes disturbed regulation of impulsive aggression.« less

Rice PLASTOCHRON genes regulate leaf maturation downstream of the gibberellin signal transduction pathway.

PubMed

Mimura, Manaki; Nagato, Yasuo; Itoh, Jun-Ichi

2012-05-01

Rice PLASTOCHRON 1 (PLA1) and PLA2 genes regulate leaf maturation and plastochron, and their loss-of-function mutants exhibit small organs and rapid leaf emergence. They encode a cytochrome P450 protein CYP78A11 and an RNA-binding protein, respectively. Their homologs in Arabidopsis and maize are also associated with plant development/organ size. Despite the importance of PLA genes in plant development, their molecular functions remain unknown. Here, we investigated how PLA1 and PLA2 genes are related to phytohormones. We found that gibberellin (GA) is the major phytohormone that promotes PLA1 and PLA2 expression. GA induced PLA1 and PLA2 expression, and conversely the GA-inhibitor uniconazole suppressed PLA1 and PLA2 expression. In pla1-4 and pla2-1 seedlings, expression levels of GA biosynthesis genes and the signal transduction gene were similar to those in wild-type seedlings. GA treatment slightly down-regulated the GA biosynthesis gene GA20ox2 and up-regulated the GA-catabolizing gene GA2ox4, whereas the GA biosynthesis inhibitor uniconazole up-regulated GA20ox2 and down-regulated GA2ox4 both in wild-type and pla mutants, suggesting that the GA feedback mechanism is not impaired in pla1 and pla2. To reveal how GA signal transduction affects the expression of PLA1 and PLA2, PLA expression in GA-signaling mutants was examined. In GA-insensitive mutant, gid1 and less-sensitive mutant, Slr1-d1, PLA1 and PLA2 expression was down-regulated. On the other hand, the expression levels of PLA1 and PLA2 were highly enhanced in a GA-constitutive-active mutant, slr1-1, causing ectopic overexpression. These results indicate that both PLA1 and PLA2 act downstream of the GA signal transduction pathway to regulate leaf development.

[3'UTR +62G>A polymorphism of the RETN gene coding resistin and its association with metabolic syndrome components].

PubMed

Arráiz, Nailet; Escalona, Carolina; Prieto, Carem; Bermúdez, Valmore; Mújica, Endrina; Sánchez, María Patricia; Mújica, Andrea

2013-10-19

The polymorphism of the resistin gene (RETN/RSTN) has been associated with metabolic alterations. In this study the association between the 3'UTR +62G>A polymorphism and metabolic syndrome components was evaluated. The population (n=218) was distributed in 3 groups: the control group with no metabolic alterations (n=77), nSMA group with isolated metabolic alterations (n=94) and MS group with metabolic syndrome (n=47). The 3'UTR +62G>A polymorphism was analyzed by PCR-RFLP. Central obesity was the most frequent alteration in both nSMA (56.4%) and MS (91.5%) groups followed by low c-HDL levels in the nSMA group (42.6%) and arterial hypertension in the MS group (85%). The frequency of the +62G/A genotype was 20.2% in the population. The G/A genotype was more frequently found in the MS (38.3%) and nSMA (17%) groups than in the control group (13%). The allelic distribution between the control group (+62G=0.94, +62A=0.06) and MS group (+62G=0.81, +62A=0.19) was significantly different (P=.0001). Significant associations between the G/A genotype and high values of abdominal circumference (P=.047), basal glycemia (P=.02) and systolic arterial pressure (P=.003) were found. The findings suggest the association between the G/A genotype and high values of systolic arterial pressure, basal glycemia and abdominal circumference. This association was independent of the metabolic syndrome context. Copyright © 2012 Elsevier España, S.L. All rights reserved.

Cloning of a phenol oxidase gene from Acremonium murorum and its expression in Aspergillus awamori.

PubMed

Gouka, R J; van der Heiden, M; Swarthoff, T; Verrips, C T

2001-06-01

Fungal multicopper oxidases have many potential industrial applications, since they perform reactions under mild conditions. We isolated a phenol oxidase from the fungus Acremonium murorum var. murorum that was capable of decolorizing plant chromophores (such as anthocyanins). This enzyme is of interest in laundry-cleaning products because of its broad specificity for chromophores. We expressed an A. murorum cDNA library in Saccharomyces cerevisiae and subsequently identified enzyme-producing yeast colonies based on their ability to decolor a plant chromophore. The cDNA sequence contained an open reading frame of 1,806 bp encoding an enzyme of 602 amino acids. The phenol oxidase was overproduced by Aspergillus awamori as a fusion protein with glucoamylase, cleaved in vivo, and purified from the culture broth by hydrophobic-interaction chromatography. The phenol oxidase is active at alkaline pH (the optimum for syringaldazine is pH 9) and high temperature (optimum, 60 degrees C) and is fully stable for at least 1 h at 60 degrees C under alkaline conditions. These characteristics and the high production level of 0.6 g of phenol oxidase per liter in shake flasks, which is equimolar with the glucoamylase protein levels, make this enzyme suitable for use in processes that occur under alkaline conditions, such as laundry cleaning.

Cloning of a Phenol Oxidase Gene from Acremonium murorum and Its Expression in Aspergillus awamori

PubMed Central

Gouka, Robin J.; van der Heiden, Monique; Swarthoff, Ton; Verrips, C. Theo

2001-01-01

Fungal multicopper oxidases have many potential industrial applications, since they perform reactions under mild conditions. We isolated a phenol oxidase from the fungus Acremonium murorum var. murorum that was capable of decolorizing plant chromophores (such as anthocyanins). This enzyme is of interest in laundry-cleaning products because of its broad specificity for chromophores. We expressed an A. murorum cDNA library in Saccharomyces cerevisiae and subsequently identified enzyme-producing yeast colonies based on their ability to decolor a plant chromophore. The cDNA sequence contained an open reading frame of 1,806 bp encoding an enzyme of 602 amino acids. The phenol oxidase was overproduced by Aspergillus awamori as a fusion protein with glucoamylase, cleaved in vivo, and purified from the culture broth by hydrophobic-interaction chromatography. The phenol oxidase is active at alkaline pH (the optimum for syringaldazine is pH 9) and high temperature (optimum, 60°C) and is fully stable for at least 1 h at 60°C under alkaline conditions. These characteristics and the high production level of 0.6 g of phenol oxidase per liter in shake flasks, which is equimolar with the glucoamylase protein levels, make this enzyme suitable for use in processes that occur under alkaline conditions, such as laundry cleaning. PMID:11375170

Mutation of Rice BC12/GDD1, Which Encodes a Kinesin-Like Protein That Binds to a GA Biosynthesis Gene Promoter, Leads to Dwarfism with Impaired Cell Elongation[W][OA

PubMed Central

Li, Juan; Jiang, Jiafu; Qian, Qian; Xu, Yunyuan; Zhang, Cui; Xiao, Jun; Du, Cheng; Luo, Wei; Zou, Guoxing; Chen, Mingluan; Huang, Yunqing; Feng, Yuqi; Cheng, Zhukuan; Yuan, Ming; Chong, Kang

2011-01-01

The kinesins are a family of microtubule-based motor proteins that move directionally along microtubules and are involved in many crucial cellular processes, including cell elongation in plants. Less is known about kinesins directly regulating gene transcription to affect cellular physiological processes. Here, we describe a rice (Oryza sativa) mutant, gibberellin-deficient dwarf1 (gdd1), that has a phenotype of greatly reduced length of root, stems, spikes, and seeds. This reduced length is due to decreased cell elongation and can be rescued by exogenous gibberellic acid (GA3) treatment. GDD1 was cloned by a map-based approach, was expressed constitutively, and was found to encode the kinesin-like protein BRITTLE CULM12 (BC12). Microtubule cosedimentation assays revealed that BC12/GDD1 bound to microtubules in an ATP-dependent manner. Whole-genome microarray analysis revealed the expression of ent-kaurene oxidase (KO2), which encodes an enzyme involved in GA biosynthesis, was downregulated in gdd1. Electrophoretic mobility shift and chromatin immunoprecipitation assays revealed that GDD1 bound to the element ACCAACTTGAA in the KO2 promoter. In addition, GDD1 was shown to have transactivation activity. The level of endogenous GAs was reduced in gdd1, and the reorganization of cortical microtubules was altered. Therefore, BC12/GDD1, a kinesin-like protein with transcription regulation activity, mediates cell elongation by regulating the GA biosynthesis pathway in rice. PMID:21325138

Family-based association study between monoamine oxidase A (MAOA) gene promoter VNTR polymorphism and Tourette's syndrome in Chinese Han population.

PubMed

Liu, Shiguo; Wang, Xueqin; Xu, Longqiang; Zheng, Lanlan; Ge, Yinlin; Ma, Xu

2015-02-01

To clarify the association of monoamine oxidase A- variable number of tandem repeat (MAOA-pVNTR) with susceptibility to Tourette's syndrome (TS) in Chinese Han population we discuss the genetic contribution of MAOA-VNTR in 141 TS patients including all their parents in Chinese Han population using transmission disequilibrium test (TDT) design. Our results revealed that no significant association was found in the MAOA gene promoter VNTR polymorphism and TS in Chinese Han population (TDT = 1.515, df = 1, p > 0.05). The negative result may be mainly due to the small sample size, but we don't deny the role of gene coding serotonergic or monoaminergic structures in the etiology of TS.

Nitrate affects sensu-stricto germination of after-ripened Sisymbrium officinale seeds by modifying expression of SoNCED5, SoCYP707A2 and SoGA3ox2 genes.

PubMed

Carrillo-Barral, Néstor; Matilla, Angel J; Rodríguez-Gacio, María del Carmen; Iglesias-Fernández, Raquel

2014-03-01

The influence of nitrate upon the germination of Sisymbrium officinale seeds is not entirely controlled by after-ripening (AR), a process clearly influenced by nitrate. Recently, we have reported that nitrate affects sensu-stricto germination of non-AR (AR0) seeds by modifying the expression of crucial genes involved in the metabolism of GA and ABA. In this study, we demonstrate that nitrate affects also the germination of AR seeds because: (i) the AR negatively alters the ABA sensitivity being the seed more ABA-sensible as the AR is farthest from optimal (AR0 and AR20 versus AR7); in the presence of diniconazole (DZ), a competitive inhibitor of ABA 8'-hydroxylase, testa rupture is affected while the endosperm rupture is not. (ii) AR7 seed-coat rupture is not inhibited by paclobutrazol (PBZ) suggesting that nitrate can act by a mechanism GA-independent. (iii) The germination process is accelerated by nitrate, most probably by the increase in the expression of SoNCED5, SoCYP707A2 and SoGA3ox2 genes. Taken together, these and previous results demonstrate that nitrate promotes germination of AR and non-AR seeds through transcriptional changes of different genes involved in ABA and GA metabolism. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Genes controlling seed dormancy and pre-harvest sprouting in a rice-wheat-barley comparison.

PubMed

Li, Chengdao; Ni, Peixiang; Francki, Michael; Hunter, Adam; Zhang, Yong; Schibeci, David; Li, Heng; Tarr, Allen; Wang, Jun; Cakir, Mehmet; Yu, Jun; Bellgard, Matthew; Lance, Reg; Appels, Rudi

2004-05-01

Pre-harvest sprouting results in significant economic loss for the grain industry around the world. Lack of adequate seed dormancy is the major reason for pre-harvest sprouting in the field under wet weather conditions. Although this trait is governed by multiple genes it is also highly heritable. A major QTL controlling both pre-harvest sprouting and seed dormancy has been identified on the long arm of barley chromosome 5H, and it explains over 70% of the phenotypic variation. Comparative genomics approaches among barley, wheat and rice were used to identify candidate gene(s) controlling seed dormancy and hence one aspect of pre-harvest sprouting. The barley seed dormancy/pre-harvest sprouting QTL was located in a region that showed good synteny with the terminal end of the long arm of rice chromosome 3. The rice DNA sequences were annotated and a gene encoding GA20-oxidase was identified as a candidate gene controlling the seed dormancy/pre-harvest sprouting QTL on 5HL. This chromosomal region also shared synteny with the telomere region of wheat chromosome 4AL, but was located outside of the QTL reported for seed dormancy in wheat. The wheat chromosome 4AL QTL region for seed dormancy was syntenic to both rice chromosome 3 and 11. In both cases, corresponding QTLs for seed dormancy have been mapped in rice.

Human retina-specific amine oxidase (RAO): cDNA cloning, tissue expression, and chromosomal mapping

DOE Office of Scientific and Technical Information (OSTI.GOV)

Imamura, Yutaka; Kubota, Ryo; Wang, Yimin

In search of candidate genes for hereditary retinal disease, we have employed a subtractive and differential cDNA cloning strategy and isolated a novel retina-specific cDNA. Nucleotide sequence analysis revealed an open reading frame of 2187 bp, which encodes a 729-amino-acid protein with a calculated molecular mass of 80,644 Da. The putative protein contained a conserved domain of copper amine oxidase, which is found in various species from bacteria to mammals. It showed the highest homology to bovine serum amine oxidase, which is believed to control the level of serum biogenic amines. Northern blot analysis of human adult and fetal tissuesmore » revealed that the protein is expressed abundantly and specifically in retina as a 2.7-kb transcript. Thus, we considered this protein a human retina-specific amine oxidase (RAO). The RAO gene (AOC2) was mapped by fluorescence in situ hybridization to human chromosome 17q21. We propose that AOC2 may be a candidate gene for hereditary ocular diseases. 38 refs., 4 figs.« less

Tudor-SN, a component of stress granules, regulates growth under salt stress by modulating GA20ox3 mRNA levels in Arabidopsis

PubMed Central

Yan, Chunxia; Yan, Zongyun; Wang, Yizheng; Yan, Xiaoyuan; Han, Yuzhen

2014-01-01

The Tudor-SN protein (TSN) is universally expressed and highly conserved in eukaryotes. In Arabidopsis, TSN is reportedly involved in stress adaptation, but the mechanism involved in this adaptation is not understood. Here, we provide evidence that TSN regulates the mRNA levels of GA20ox3, a key enzyme for gibberellin (GA) biosynthesis. The levels of GA20ox3 transcripts decreased in TSN1/TSN2 RNA interference (RNAi) transgenic lines and increased in TSN1 over-expression (OE) transgenic lines. The TSN1 OE lines displayed phenotypes that may be attributed to the overproduction of GA. No obvious defects were observed in the RNAi transgenic lines under normal conditions, but under salt stress conditions these lines displayed slower growth than wild-type (WT) plants. Two mutants of GA20ox3, ga20ox3-1 and -2, also showed slower growth under stress than WT plants. Moreover, a higher accumulation of GA20ox3 transcripts was observed under salt stress. The results of a western blot analysis indicated that higher levels of TSN1 accumulated after salt treatment than under normal conditions. Subcellular localization studies showed that TSN1 was uniformly distributed in the cytoplasm under normal conditions but accumulated in small granules and co-localized with RBP47, a marker protein for stress granules (SGs), in response to salt stress. The results of RNA immunoprecipitation experiments indicated that TSN1 bound GA20ox3 mRNA in vivo. On the basis of these findings, we conclude that TSN is a novel component of plant SGs that regulates growth under salt stress by modulating levels of GA20ox3 mRNA. PMID:25205572

Identification and overexpression of a knotted1-like transcription factor in switchgrass ( Panicum virgatum L.) for lignocellulosic feedstock improvement

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wuddineh, Wegi A.; Mazarei, Mitra; Zhang, Ji -Yi

High biomass production and wide adaptation has made switchgrass ( Panicum virgatum L.) an important candidate lignocellulosic bioenergy crop. One major limitation of this and other lignocellulosic feedstocks is the recalcitrance of complex carbohydrates to hydrolysis for conversion to biofuels. Lignin is the major contributor to recalcitrance as it limits the accessibility of cell wall carbohydrates to enzymatic breakdown into fermentable sugars. Therefore, genetic manipulation of the lignin biosynthesis pathway is one strategy to reduce recalcitrance. Here, we identified a switchgrass Knotted1 transcription factor, PvKN1, with the aim of genetically engineering switchgrass for reduced biomass recalcitrance for biofuel production. Genemore » expression of the endogenous PvKN1 gene was observed to be highest in young inflorescences and stems. Ectopic overexpression of PvKN1 in switchgrass altered growth, especially in early developmental stages. Transgenic lines had reduced expression of most lignin biosynthetic genes accompanied by a reduction in lignin content suggesting the involvement of PvKN1 in the broad regulation of the lignin biosynthesis pathway. Moreover, the reduced expression of the Gibberellin 20-oxidase (GA20ox) gene in tandem with the increased expression of Gibberellin 2-oxidase (GA2ox) genes in transgenic PvKN1 lines suggest that PvKN1 may exert regulatory effects via modulation of GA signaling. Furthermore, overexpression of PvKN1 altered the expression of cellulose and hemicellulose biosynthetic genes and increased sugar release efficiency in transgenic lines. Our findings demonstrated that switchgrass PvKN1 is a putative ortholog of maize KN1 that is linked to plant lignification and cell wall and development traits as a major regulatory gene. Therefore, targeted overexpression of PvKN1 in bioenergy feedstocks may provide one feasible strategy for reducing biomass recalcitrance and simultaneously improving plant growth characteristics.« less

Identification and overexpression of a knotted1-like transcription factor in switchgrass ( Panicum virgatum L.) for lignocellulosic feedstock improvement

DOE PAGES

Wuddineh, Wegi A.; Mazarei, Mitra; Zhang, Ji -Yi; ...

2016-04-28

High biomass production and wide adaptation has made switchgrass ( Panicum virgatum L.) an important candidate lignocellulosic bioenergy crop. One major limitation of this and other lignocellulosic feedstocks is the recalcitrance of complex carbohydrates to hydrolysis for conversion to biofuels. Lignin is the major contributor to recalcitrance as it limits the accessibility of cell wall carbohydrates to enzymatic breakdown into fermentable sugars. Therefore, genetic manipulation of the lignin biosynthesis pathway is one strategy to reduce recalcitrance. Here, we identified a switchgrass Knotted1 transcription factor, PvKN1, with the aim of genetically engineering switchgrass for reduced biomass recalcitrance for biofuel production. Genemore » expression of the endogenous PvKN1 gene was observed to be highest in young inflorescences and stems. Ectopic overexpression of PvKN1 in switchgrass altered growth, especially in early developmental stages. Transgenic lines had reduced expression of most lignin biosynthetic genes accompanied by a reduction in lignin content suggesting the involvement of PvKN1 in the broad regulation of the lignin biosynthesis pathway. Moreover, the reduced expression of the Gibberellin 20-oxidase (GA20ox) gene in tandem with the increased expression of Gibberellin 2-oxidase (GA2ox) genes in transgenic PvKN1 lines suggest that PvKN1 may exert regulatory effects via modulation of GA signaling. Furthermore, overexpression of PvKN1 altered the expression of cellulose and hemicellulose biosynthetic genes and increased sugar release efficiency in transgenic lines. Our findings demonstrated that switchgrass PvKN1 is a putative ortholog of maize KN1 that is linked to plant lignification and cell wall and development traits as a major regulatory gene. Therefore, targeted overexpression of PvKN1 in bioenergy feedstocks may provide one feasible strategy for reducing biomass recalcitrance and simultaneously improving plant growth characteristics.« less

RhHB1 mediates the antagonism of gibberellins to ABA and ethylene during rose (Rosa hybrida) petal senescence.

PubMed

Lü, Peitao; Zhang, Changqing; Liu, Jitao; Liu, Xiaowei; Jiang, Guimei; Jiang, Xinqiang; Khan, Muhammad Ali; Wang, Liangsheng; Hong, Bo; Gao, Junping

2014-05-01

Rose (Rosa hybrida) is one of the most important ornamental plants worldwide; however, senescence of its petals terminates the ornamental value of the flower, resulting in major economic loss. It is known that the hormones abscisic acid (ABA) and ethylene promote petal senescence, while gibberellins (GAs) delay the process. However, the molecular mechanisms underlying the antagonistic effects amongst plant hormones during petal senescence are still unclear. Here we isolated RhHB1, a homeodomain-leucine zipper I transcription factor gene, from rose flowers. Quantitative RT-PCR and GUS reporter analyses showed that RhHB1 was strongly expressed in senescing petals, and its expression was induced by ABA or ethylene in petals. ABA or ethylene treatment clearly accelerated rose petal senescence, while application of the gibberellin GA3 delayed the process. However, silencing of RhHB1 delayed the ABA- or ethylene-mediated senescence, and resulted in higher petal anthocyanin levels and lower expression of RhSAG12. Moreover, treatment with paclobutrazol, an inhibitor of GA biosynthesis, repressed these delays. In addition, silencing of RhHB1 blocked the ABA- or ethylene-induced reduction in expression of the GA20 oxidase encoded by RhGA20ox1, a gene in the GA biosynthetic pathway. Furthermore, RhHB1 directly binds to the RhGA20ox1 promoter, and silencing of RhGA20ox1 promoted petal senescence. Eight senescence-related genes showed substantial differences in expression in petals after treatment with GA3 or paclobutrazol. These results suggest that RhHB1 mediates the antagonistic effect of GAs on ABA and ethylene during rose petal senescence, and that the promotion of petal senescence by ABA or ethylene operates through an RhHB1-RhGA20ox1 regulatory checkpoint. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

Recessed Slant Gate AlGaN/GaN High Electron Mobility Transistors with 20.9 W/mm at 10 GHz

NASA Astrophysics Data System (ADS)

Pei, Yi; Chu, Rongming; Fichtenbaum, Nicholas A.; Chen, Zhen; Brown, David; Shen, Likun; Keller, Stacia; DenBaars, Steven P.; Mishra, Umesh K.

2007-12-01

A recessed slant gate processing has been used in AlGaN/GaN high electron mobility transistors (HEMTs) to mitigate the electric field, minimize the dispersion and increase the breakdown voltage. More than one order of magnitude of decrease in gate leakage has been observed by recessing the slant gate. For a 0.65 μm gate-length device, an extrinsic fT of 18 GHz and extrinsic fMAX of 52 GHz at a drain bias of 25 V were achieved. At 10 GHz, a state-of-the-art power density of 20.9 W/mm, with a power-added efficiency (PAE) of 40% at a drain bias of 83 V, was demonstrated.

Development of Silicalite/Glucose Oxidase-Based Biosensor and Its Application for Glucose Determination in Juices and Nectars

NASA Astrophysics Data System (ADS)

Dudchenko, Oleksandr Ye; Pyeshkova, Viktoriya M.; Soldatkin, Oleksandr O.; Akata, Burcu; Kasap, Berna O.; Soldatkin, Alexey P.; Dzyadevych, Sergei V.

2016-02-01

The application of silicalite for improvement of enzyme adsorption on new stainless steel electrodes is reported. Glucose oxidase (GOx) was immobilized by two methods: cross-linking by glutaraldehyde (GOx-GA) and cross-linking by glutaraldehyde along with GOx adsorption on silicalite-modified electrode (SME) (GOx-SME-GA). The GOx-SME-GA biosensors were characterized by a four- to fivefold higher sensitivity than GOx-GA biosensor. It was concluded that silicalite together with GA sufficiently enhances enzyme adhesion on stainless steel electrodes. The developed GOx-SME-GA biosensors were characterized by good reproducibility of biosensor preparation (relative standard deviation (RSD)—18 %), improved signal reproducibility (RSD of glucose determination was 7 %), and good storage stability (29 % loss of activity after 18-day storage). A series of fruit juices and nectars was analyzed using GOx-SME-GA biosensor for determination of glucose concentration. The obtained results showed good correlation with the data of high-performance liquid chromatography (HPLC) ( R = 0.99).

Transcript Profiling Reveals the Presence of Abiotic Stress and Developmental Stage Specific Ascorbate Oxidase Genes in Plants

PubMed Central

Batth, Rituraj; Singh, Kapil; Kumari, Sumita; Mustafiz, Ananda

2017-01-01

Abiotic stress and climate change is the major concern for plant growth and crop yield. Abiotic stresses lead to enhanced accumulation of reactive oxygen species (ROS) consequently resulting in cellular damage and major losses in crop yield. One of the major scavengers of ROS is ascorbate (AA) which acts as first line of defense against external oxidants. An enzyme named ascorbate oxidase (AAO) is known to oxidize AA and deleteriously affect the plant system in response to stress. Genome-wide analysis of AAO gene family has led to the identification of five, three, seven, four, and six AAO genes in Oryza sativa, Arabidopsis, Glycine max, Zea mays, and Sorghum bicolor genomes, respectively. Expression profiling of these genes was carried out in response to various abiotic stresses and during various stages of vegetative and reproductive development using publicly available microarray database. Expression analysis in Oryza sativa revealed tissue specific expression of AAO genes wherein few members were exclusively expressed in either root or shoot. These genes were found to be regulated by both developmental cues as well as diverse stress conditions. The qRT-PCR analysis in response to salinity and drought stress in rice shoots revealed OsAAO2 to be the most stress responsive gene. On the other hand, OsAAO3 and OsAAO4 genes showed enhanced expression in roots under salinity/drought stresses. This study provides lead about important stress responsive AAO genes in various crop plants, which could be used to engineer climate resilient crop plants. PMID:28261251

Two New Alleles of the abscisic aldehyde oxidase 3 Gene Reveal Its Role in Abscisic Acid Biosynthesis in Seeds1

PubMed Central

González-Guzmán, Miguel; Abia, David; Salinas, Julio; Serrano, Ramón; Rodríguez, Pedro L.

2004-01-01

The abscisic aldehyde oxidase 3 (AAO3) gene product of Arabidopsis catalyzes the final step in abscisic acid (ABA) biosynthesis. An aao3-1 mutant in a Landsberg erecta genetic background exhibited a wilty phenotype in rosette leaves, whereas seed dormancy was not affected (Seo et al., 2000a). Therefore, it was speculated that a different aldehyde oxidase would be the major contributor to ABA biosynthesis in seeds (Seo et al., 2000a). Through a screening based on germination under high-salt concentration, we isolated two mutants in a Columbia genetic background, initially named sre2-1 and sre2-2 (for salt resistant). Complementation tests with different ABA-deficient mutants indicated that sre2-1 and sre2-2 mutants were allelic to aao3-1, and therefore they were renamed as aao3-2 and aao3-3, respectively. Indeed, molecular characterization of the aao3-2 mutant revealed a T-DNA insertional mutation that abolished the transcription of AAO3 gene, while sequence analysis of AAO3 in aao3-3 mutant revealed a deletion of three nucleotides and several missense mutations. Physiological characterization of aao3-2 and aao3-3 mutants revealed a wilty phenotype and osmotolerance in germination assays. In contrast to aao3-1, both aao3-2 and aao3-3 mutants showed a reduced dormancy. Accordingly, ABA levels were reduced in dry seeds and rosette leaves of both aao3-2 and aao3-3. Taken together, these results indicate that AAO3 gene product plays a major role in seed ABA biosynthesis. PMID:15122034

Genome-wide identification and expression analysis of the polyamine oxidase gene family in sweet orange (Citrus sinensis).

PubMed

Wang, Wei; Liu, Ji-Hong

2015-01-25

Polyamine oxidases (PAOs) are FAD-dependent enzymes associated with polyamine catabolism. In plants, increasing evidences support that PAO genes play essential roles in abiotic and biotic stresses response. In this study, six putative PAO genes (CsPAO1-CsPAO6) were unraveled in sweet orange (Citrus sinensis) using the released citrus genome sequences. A total of 203 putative cis-regulatory elements involved in hormone and stress response were predicted in 1.5-kb promoter regions at the upstream of CsPAOs. The CsPAOs can be divided into four major groups, with similar organizations with their counterparts of Arabidopsis thaliana. Transcripts of CsPAOs were detected in leaf, stem, cotyledon, and root, with the highest levels detected in the roots. The CsPAOs displayed various responses to exogenous treatments with polyamines and ABA and were differentially altered by abiotic stresses, including cold, salt, and mannitol. Overexpression of CsPAO3 in tobacco demonstrated that spermidine and spermine were decreased in the transgenic line, while putrescine was significantly enhanced, implying a potential role of this gene in polyamine back conversion. These data provide valuable knowledge for understanding the roles of the PAO genes in the future. Copyright © 2014 Elsevier B.V. All rights reserved.

Enzymatic glucose detection using ZnO nanorods on the gate region of AlGaN /GaN high electron mobility transistors

NASA Astrophysics Data System (ADS)

Kang, B. S.; Wang, H. T.; Ren, F.; Pearton, S. J.; Morey, T. E.; Dennis, D. M.; Johnson, J. W.; Rajagopal, P.; Roberts, J. C.; Piner, E. L.; Linthicum, K. J.

2007-12-01

ZnO nanorod-gated AlGaN /GaN high electron mobility transistors (HEMTs) are demonstrated for the detection of glucose. A ZnO nanorod array was selectively grown on the gate area using low temperature hydrothermal decomposition to immobilize glucose oxidase (GOx). The one-dimensional ZnO nanorods provide a large effective surface area with high surface-to-volume ratio and provide a favorable environment for the immobilization of GOx. The AlGaN /GaN HEMT drain-source current showed a rapid response of less than 5s when target glucose in a buffer with a pH value of 7.4 was added to the GOx immobilized on the ZnO nanorod surface. We could detect a wide range of concentrations from 0.5nMto125μM. The sensor exhibited a linear range from 0.5nMto14.5μM and an experiment limit of detection of 0.5nM. This demonstrates the possibility of using AlGaN /GaN HEMTs for noninvasive exhaled breath condensate based glucose detection of diabetic application.

NADPH Oxidase as a Therapeutic Target for Oxalate Induced Injury in Kidneys

PubMed Central

Peck, Ammon B.; Khan, Saeed R.

2013-01-01

A major role of the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase family of enzymes is to catalyze the production of superoxides and other reactive oxygen species (ROS). These ROS, in turn, play a key role as messengers in cell signal transduction and cell cycling, but when they are produced in excess they can lead to oxidative stress (OS). Oxidative stress in the kidneys is now considered a major cause of renal injury and inflammation, giving rise to a variety of pathological disorders. In this review, we discuss the putative role of oxalate in producing oxidative stress via the production of reactive oxygen species by isoforms of NADPH oxidases expressed in different cellular locations of the kidneys. Most renal cells produce ROS, and recent data indicate a direct correlation between upregulated gene expressions of NADPH oxidase, ROS, and inflammation. Renal tissue expression of multiple NADPH oxidase isoforms most likely will impact the future use of different antioxidants and NADPH oxidase inhibitors to minimize OS and renal tissue injury in hyperoxaluria-induced kidney stone disease. PMID:23840917

CotA, a Multicopper Oxidase from Bacillus pumilus WH4, Exhibits Manganese-Oxidase Activity

PubMed Central

Su, Jianmei; Bao, Peng; Bai, Tenglong; Deng, Lin; Wu, Hui; Liu, Fan; He, Jin

2013-01-01

Multicopper oxidases (MCOs) are a family of enzymes that use copper ions as cofactors to oxidize various substrates. Previous research has demonstrated that several MCOs such as MnxG, MofA and MoxA can act as putative Mn(II) oxidases. Meanwhile, the endospore coat protein CotA from Bacillus species has been confirmed as a typical MCO. To study the relationship between CotA and the Mn(II) oxidation, the cotA gene from a highly active Mn(II)-oxidizing strain Bacillus pumilus WH4 was cloned and overexpressed in Escherichia coli strain M15. The purified CotA contained approximately four copper atoms per molecule and showed spectroscopic properties typical of blue copper oxidases. Importantly, apart from the laccase activities, the CotA also displayed substantial Mn(II)-oxidase activities both in liquid culture system and native polyacrylamide gel electrophoresis. The optimum Mn(II) oxidase activity was obtained at 53°C in HEPES buffer (pH 8.0) supplemented with 0.8 mM CuCl2. Besides, the addition of o-phenanthroline and EDTA both led to a complete suppression of Mn(II)-oxidizing activity. The specific activity of purified CotA towards Mn(II) was 0.27 U/mg. The Km, Vmax and kcat values towards Mn(II) were 14.85±1.17 mM, 3.01×10−6±0.21 M·min−1 and 0.32±0.02 s−1, respectively. Moreover, the Mn(II)-oxidizing activity of the recombinant E. coli strain M15-pQE-cotA was significantly increased when cultured both in Mn-containing K liquid medium and on agar plates. After 7-day liquid cultivation, M15-pQE-cotA resulted in 18.2% removal of Mn(II) from the medium. Furthermore, the biogenic Mn oxides were clearly observed on the cell surfaces of M15-pQE-cotA by scanning electron microscopy. To our knowledge, this is the first report that provides the direct observation of Mn(II) oxidation with the heterologously expressed protein CotA, Therefore, this novel finding not only establishes the foundation for in-depth study of Mn(II) oxidation mechanisms, but also offers a

Characterization of oxidative phosphorylation in the colorless chlorophyte Polytomella sp. Its mitochondrial respiratory chain lacks a plant-like alternative oxidase.

PubMed

Reyes-Prieto, Adrián; El-Hafidi, Mohammed; Moreno-Sánchez, Rafael; González-Halphen, Diego

2002-07-01

The presence of an alternative oxidase (AOX) in Polytomella sp., a colorless relative of Chlamydomonas reinhardtii, was explored. Oxygen uptake in Polytomella sp. mitochondria was inhibited by KCN (94%) or antimycin (96%), and the remaining cyanide-resistant respiration was not blocked by the AOX inhibitors salicylhydroxamic acid (SHAM) or n-propylgallate. No stimulation of an AOX activity was found upon addition of either pyruvate, alpha-ketoglutarate, or AMP, or by treatment with DTT. An antibody raised against C. reinhardtii AOX did not recognized any polypeptide band of Polytomella sp. mitochondria in Western blots. Also, PCR experiments and Southern blot analysis failed to identify an Aox gene in this colorless alga. Finally, KCN exposure of cell cultures failed to stimulate an AOX activity. Nevertheless, KCN exposure of Polytomella sp. cells induced diminished mitochondrial respiration (20%) and apparent changes in cytochrome c oxidase affinity towards cyanide. KCN-adapted cells exhibited a significant increase of a-type cytochromes, suggesting accumulation of inactive forms of cytochrome c oxidase. Another effect of KCN exposure was the reduction of the protein/fatty acid ratio of mitochondrial membranes, which may affect the observed respiratory activity. We conclude that Polytomella lacks a plant-like AOX, and that its corresponding gene was probably lost during the divergence of this colorless genus from its close photosynthetic relatives.

Distribution in microbial genomes of genes similar to lodA and goxA which encode a novel family of quinoproteins with amino acid oxidase activity.

PubMed

Campillo-Brocal, Jonatan C; Chacón-Verdú, María Dolores; Lucas-Elío, Patricia; Sánchez-Amat, Antonio

2015-03-24

L-Amino acid oxidases (LAOs) have been generally described as flavoproteins that oxidize amino acids releasing the corresponding ketoacid, ammonium and hydrogen peroxide. The generation of hydrogen peroxide gives to these enzymes antimicrobial characteristics. They are involved in processes such as biofilm development and microbial competition. LAOs are of great biotechnological interest in different applications such as the design of biosensors, biotransformations and biomedicine. The marine bacterium Marinomonas mediterranea synthesizes LodA, the first known LAO that contains a quinone cofactor. LodA is encoded in an operon that contains a second gene coding for LodB, a protein required for the post-translational modification generating the cofactor. Recently, GoxA, a quinoprotein with sequence similarity to LodA but with a different enzymatic activity (glycine oxidase instead of lysine-ε-oxidase) has been described. The aim of this work has been to study the distribution of genes similar to lodA and/or goxA in sequenced microbial genomes and to get insight into the evolution of this novel family of proteins through phylogenetic analysis. Genes encoding LodA-like proteins have been detected in several bacterial classes. However, they are absent in Archaea and detected only in a small group of fungi of the class Agaromycetes. The vast majority of the genes detected are in a genome region with a nearby lodB-like gene suggesting a specific interaction between both partner proteins. Sequence alignment of the LodA-like proteins allowed the detection of several conserved residues. All of them showed a Cys and a Trp that aligned with the residues that are forming part of the cysteine tryptophilquinone (CTQ) cofactor in LodA. Phylogenetic analysis revealed that LodA-like proteins can be clustered in different groups. Interestingly, LodA and GoxA are in different groups, indicating that those groups are related to the enzymatic activity of the proteins detected. Genome

Biochemical Conservation and Evolution of Germacrene A Oxidase in Asteraceae*

PubMed Central

Nguyen, Don Trinh; Göpfert, Jens Christian; Ikezawa, Nobuhiro; MacNevin, Gillian; Kathiresan, Meena; Conrad, Jürgen; Spring, Otmar; Ro, Dae-Kyun

2010-01-01

Sesquiterpene lactones are characteristic natural products in Asteraceae, which constitutes ∼8% of all plant species. Despite their physiological and pharmaceutical importance, the biochemistry and evolution of sesquiterpene lactones remain unexplored. Here we show that germacrene A oxidase (GAO), evolutionarily conserved in all major subfamilies of Asteraceae, catalyzes three consecutive oxidations of germacrene A to yield germacrene A acid. Furthermore, it is also capable of oxidizing non-natural substrate amorphadiene. Co-expression of lettuce GAO with germacrene synthase in engineered yeast synthesized aberrant products, costic acids and ilicic acid, in an acidic condition. However, cultivation in a neutral condition allowed the de novo synthesis of a single novel compound that was identified as germacrene A acid by gas and liquid chromatography and NMR analyses. To trace the evolutionary lineage of GAO in Asteraceae, homologous genes were further isolated from the representative species of three major subfamilies of Asteraceae (sunflower, chicory, and costus from Asteroideae, Cichorioideae, and Carduoideae, respectively) and also from the phylogenetically basal species, Barnadesia spinosa, from Barnadesioideae. The recombinant GAOs from these genes clearly showed germacrene A oxidase activities, suggesting that GAO activity is widely conserved in Asteraceae including the basal lineage. All GAOs could catalyze the three-step oxidation of non-natural substrate amorphadiene to artemisinic acid, whereas amorphadiene oxidase diverged from GAO displayed negligible activity for germacrene A oxidation. The observed amorphadiene oxidase activity in GAOs suggests that the catalytic plasticity is embedded in ancestral GAO enzymes that may contribute to the chemical and catalytic diversity in nature. PMID:20351109

Polymorphism in beta fibrinogen -455 g/a gene was associated with diabetic in severe ischemic stroke patients

NASA Astrophysics Data System (ADS)

Ritarwan, Kiking; Kadri, Alfansuri; Juwita Sembiring, Rosita

2018-03-01

There is a association of polymorphism in the promoter region of the beta fibrinogen gene -455 G/A with enhancement plasma fibrinogen level. Diabetes mellitus is a risk factor for early neurologic deterioration in acute ischemic stroke. The prothrombotic fibrinogen protein is frequently elevated in patients with diabetes and may be association with poorer prognosis. This study evaluated the association of beta fibrinogen gene -455 G/A promoter polymorphism on modified Ranking Scale of Ischemic Stroke patients treated with diabetic and nondiabetic group. In a Cohort study design comprises 200 consecutive patients diabetic and a nondiabetic who, three months using completed a detailed outcome stroke. Of 200 samples genotype distribution were 27.1% for GG+GA and 0% for AA with diabetic and than 4.4% for GG+GA and 0.05% diabetic patients. Fibrinogen levels were higher in diabetic than nondiabetic group patients (307.7 + 106.3 vs 278 + 84 gr/dl, p=0.002). Fibrinogen level was found to be an independent predictor for diabetic patients. On Genotype GG+GA were associated wth diabetic and nondiabetic group patients. Modified Rankin Scale on day 90 were found associated with diabetic and nondiabetic patients. Conclusion: Elevated fibrinogen level is dose-dependently associated with 90 days outcome severity stroke with diabetic following ischemic stroke

[Investigation into the relationship between mitochondrial 12 S rRNA gene, tRNA gene and cytochrome oxidase Ⅱ gene variations and the risk of noise-induced hearing loss].

PubMed

Jiao, J; Gu, G Z; Chen, G S; Li, Y H; Zhang, H L; Yang, Q Y; Xu, X R; Zhou, W H; Wu, H; He, L H; Zheng, Y X; Yu, S F

2017-01-06

Objective: To explore the relationship between mitochondrial 12 S rRNA gene variation, tRNA gene variation and cytochrome oxidase Ⅱ gene point mutations and the risk of noise-induced hearing loss (NIHL). Methods: A nested case-control study was performed that followed a cohort of 7 445 noise-exposed workers in a steel factory in Henan province, China, from January 1, 2006 to December 31, 2015. Subjects whose average hearing threshold was more than 40 dB(A) in high frequency were defined as the case group, and subjects whose average hearing threshold was less than 35 dB(A) in high frequency and less than 25 dB (A) in speech frequency were defined as the control group. Subjects was recruited into the case group ( n =286) and the control group ( n= 286) according to gender, age, job category and time of exposure to noise, and a 1∶1 case-control study was carried out. We genotyped eight single nucleotide polymorphisms in the mitochondrial 12 S rRNA gene, the mitochondrial tRNA gene and the mitochondrial cytochrome oxidase Ⅱ gene using SNPscan high-throughput genotyping technology from the recruited subjects. The relationship between polymorphic sites and NIHL, adjusted for covariates, was analyzed using conditional logistic regression analysis, as were the subgroup data. Results: The average age of the recruited subjects was (40.3±8.1) years and the length of service exposure to noise was (18.6±8.9) years. The range of noise exposed levels and cumulative noise exposure (CNE) was 80.1- 93.4 dB (A) and 86.8- 107.9 dB (A) · year, respectively. For workers exposed to noise at a CNE level<98 dB (A) · year, smokers showed an increased risk of NIHL of 1.88 (1.16-3.05) compared with non-smokers; for workers exposed to noise at a CNE level ≥98 dB(A) · year, smokers showed an increased risk of NIHL of 2.53 (1.49- 4.30) compared with non-smokers. For workers exposed to noise at a CNE level<98 dB (A) · year, the results of univariate analysis and multifactor analysis

Monoamine oxidase A gene promoter methylation and transcriptional downregulation in an offender population with antisocial personality disorder.

PubMed

Checknita, D; Maussion, G; Labonté, B; Comai, S; Tremblay, R E; Vitaro, F; Turecki, N; Bertazzo, A; Gobbi, G; Côté, G; Turecki, G

2015-03-01

Antisocial personality disorder (ASPD) is characterised by elevated impulsive aggression and increased risk for criminal behaviour and incarceration. Deficient activity of the monoamine oxidase A (MAOA) gene is suggested to contribute to serotonergic system dysregulation strongly associated with impulsive aggression and antisocial criminality. To elucidate the role of epigenetic processes in altered MAOA expression and serotonin regulation in a population of incarcerated offenders with ASPD compared with a healthy non-incarcerated control population. Participants were 86 incarcerated participants with ASPD and 73 healthy controls. MAOA promoter methylation was compared between case and control groups. We explored the functional impact of MAOA promoter methylation on gene expression in vitro and blood 5-HT levels in a subset of the case group. Results suggest that MAOA promoter hypermethylation is associated with ASPD and may contribute to downregulation of MAOA gene expression, as indicated by functional assays in vitro, and regression analysis with whole-blood serotonin levels in offenders with ASPD. These results are consistent with prior literature suggesting MAOA and serotonergic dysregulation in antisocial populations. Our results offer the first evidence suggesting epigenetic mechanisms may contribute to MAOA dysregulation in antisocial offenders. Royal College of Psychiatrists.

Glucose Oxidase Induces Cellular Senescence in Immortal Renal Cells through ILK by Downregulating Klotho Gene Expression

PubMed Central

Troyano-Suárez, Nuria; del Nogal-Avila, María; Mora, Inés; Sosa, Patricia; López-Ongil, Susana; Rodriguez-Puyol, Diego; Olmos, Gemma; Ruíz-Torres, María Piedad

2015-01-01

Cellular senescence can be prematurely induced by oxidative stress involved in aging. In this work, we were searching for novel intermediaries in oxidative stress-induced senescence, focusing our interest on integrin-linked kinase (ILK), a scaffold protein at cell-extracellular matrix (ECM) adhesion sites, and on the Klotho gene. Cultured renal cells were treated with glucose oxidase (GOx) for long time periods. GOx induced senescence, increasing senescence associated β-galactosidase activity and the expression of p16. In parallel, GOx increased ILK protein expression and activity. Ectopic overexpression of ILK in cells increased p16 expression, even in the absence of GOx, whereas downregulation of ILK inhibited the increase in p16 due to oxidative stress. Additionally, GOx reduced Klotho gene expression and cells overexpressing Klotho protein did not undergo senescence after GOx addition. We demonstrated a direct link between ILK and Klotho since silencing ILK expression in cells and mice increases Klotho expression and reduces p53 and p16 expression in renal cortex. In conclusion, oxidative stress induces cellular senescence in kidney cells by increasing ILK protein expression and activity, which in turn reduces Klotho expression. We hereby present ILK as a novel downregulator of Klotho gene expression. PMID:26583057

Glucose Oxidase Induces Cellular Senescence in Immortal Renal Cells through ILK by Downregulating Klotho Gene Expression.

PubMed

Troyano-Suárez, Nuria; del Nogal-Avila, María; Mora, Inés; Sosa, Patricia; López-Ongil, Susana; Rodriguez-Puyol, Diego; Olmos, Gemma; Ruíz-Torres, María Piedad

2015-01-01

Cellular senescence can be prematurely induced by oxidative stress involved in aging. In this work, we were searching for novel intermediaries in oxidative stress-induced senescence, focusing our interest on integrin-linked kinase (ILK), a scaffold protein at cell-extracellular matrix (ECM) adhesion sites, and on the Klotho gene. Cultured renal cells were treated with glucose oxidase (GOx) for long time periods. GOx induced senescence, increasing senescence associated β-galactosidase activity and the expression of p16. In parallel, GOx increased ILK protein expression and activity. Ectopic overexpression of ILK in cells increased p16 expression, even in the absence of GOx, whereas downregulation of ILK inhibited the increase in p16 due to oxidative stress. Additionally, GOx reduced Klotho gene expression and cells overexpressing Klotho protein did not undergo senescence after GOx addition. We demonstrated a direct link between ILK and Klotho since silencing ILK expression in cells and mice increases Klotho expression and reduces p53 and p16 expression in renal cortex. In conclusion, oxidative stress induces cellular senescence in kidney cells by increasing ILK protein expression and activity, which in turn reduces Klotho expression. We hereby present ILK as a novel downregulator of Klotho gene expression.

Isolation and expression profiles of gibberellin metabolism genes in developing male and female cones of Pinus tabuliformis.

PubMed

Niu, Shihui; Yuan, Lu; Zhang, Yuncheng; Chen, Xiaoyang; Li, Wei

2014-12-01

Gibberellins (GAs) are important in the floral regulatory networks of angiosperm plants. Several lines of evidence suggest that GAs also play a pivotal role in conifer male and female cone development. To gain new insights into the GA metabolism pathway in conifer trees and the role of GA metabolism in male and female cone development, we identified GA metabolism genes in Pinus tabuliformis. These included one PtCPS gene, one PtKS gene, one PtKO gene, TWO PtKAO genes, one PtGA20ox gene, two PtGA3ox genes and 12 PtGA2ox genes. According to phylogenetic analysis, the GA biosynthesis pathway evolved after the divergence of mosses from ferns, but the GA-deactivating gene family underwent divided expansion after divergence of the angiosperms from gymnosperms. However, the active sites of all GA metabolism enzymes were conserved during the evolution of land plants. During male and female cone development of P. tabuliformis, the expression of most of the PtGA2ox genes, especially PtGA2ox10, was higher than GA biosynthesis genes. However, the expression of PtKAO1 in cones peaked at a very early developmental stage. The expression pattern of GA metabolism genes indicated that GAs play different roles at the early and late stages of cone development.

The rice YABBY1 gene is involved in the feedback regulation of gibberellin metabolism.

PubMed

Dai, Mingqiu; Zhao, Yu; Ma, Qian; Hu, Yongfeng; Hedden, Peter; Zhang, Qifa; Zhou, Dao-Xiu

2007-05-01

Gibberellin (GA) biosynthesis is regulated by feedback control providing a mechanism for GA homeostasis in plants. However, regulatory elements involved in the feedback control are not known. In this report, we show that a rice (Oryza sativa) YABBY1 (YAB1) gene had a similar expression pattern as key rice GA biosynthetic genes GA3ox2 and GA20ox2. Overexpression of YAB1 in transgenic rice resulted in a semidwarf phenotype that could be fully rescued by applied GA. Quantification of the endogenous GA content revealed increases of GA(20) and decreases of GA(1) levels in the overexpression plants, in which the transcripts of the biosynthetic gene GA3ox2 were decreased. Cosuppression of YAB1 in transgenic plants induced expression of GA3ox2. The repression of GA3ox2 could be obtained upon treatment by dexamethasone of transgenic plants expressing a YAB1-glucocorticoid receptor fusion. Importantly, we show that YAB1 bound to a GA-responsive element within the GA3ox2 promoter. In addition, the expression of YAB1 was deregulated in GA biosynthesis and signaling mutants and could be either transiently induced by GA or repressed by a GA inhibitor. Finally, either overexpression or cosuppression of YAB1 impaired GA-mediated repression of GA3ox2. These data together suggest that YAB1 is involved in the feedback regulation of GA biosynthesis in rice.

Interleukin-10 -1082 G/A gene polymorphisms in Egyptian children with CAP

PubMed Central

Azab, Seham F.; Abdalhady, Mohamed A.; Elsaadany, Hosam F.; Elkomi, Mohamed A.; Elhindawy, Eman M.; Sarhan, Dina T.; Salam, Mohamed M.A.; Allah, Mayy A.N.; Emam, Ahmed A.; Noah, Maha A.; Abdelsalam, Nasser I.; Abdellatif, Sawsan H.; Rass, Anwar A.; Ismail, Sanaa M.; Gheith, Tarek; Aziz, Khalid A.; Hamed, Mohammed E.; Abdelrahman, Hind M.; Ahmed, Ahmed R.; Nabil, Rehab M.; Abdulmaksoud, Rehab S.; Yousef, Hala Y.

2016-01-01

Abstract Community-acquired pneumonia (CAP) is one of the leading causes of death worldwide. Cytokines are involved in the pathogenesis of CAP. To date, only a few studies concerned the association of interleukin-10 (IL-10) gene polymorphisms with CAP. In this study, we aimed to investigate whether the -1082(G/A) polymorphism in the promoter region of the IL-10 gene is involved in susceptibility to and the outcome of CAP, and we also measured the serum level of IL-10 to assess its relation to such polymorphism. This was a case–control study included 100 patients with CAP, and matched with age, gender, and ethnicity of 100 healthy control children. IL-10 -1082(G/A) gene polymorphism was genotyped by polymerase chain reaction-restriction fragment length polymorphism, while the serum IL-10 levels were measured by ELISA method. Compared to the controls subjects, the frequencies of the IL-10 -1082 AA genotype and A allele were observed to be overrepresented in patients with CAP (51%; odds ratio [OR] = 2.8; 95% confidence interval [CI]: 1.5–5.3 for the AA genotype; P < 0.01) and (70%; OR: 1.95; 95% CI: 1.27–3.00 for the A allele; P < 0.01, respectively). We found that patients with the GG genotype had significantly higher serum IL-10 levels (46.7 ± 9.5 pg/mL) compared to those with AG genotype (21.8 ± 4.5 pg/mL) and AA genotype (11.5 ± 3.3 pg/mL); P < 0.01, respectively. Our data revealed a significant positive association between the -1082 GG genotype and susceptibility to severe sepsis, acute respiratory failure, and hospital mortality (OR: 3.8; 95% CI: 1.3–11.2; P < 0.01). We demonstrate for the first time, to the best of our knowledge, that IL-10 -1082 (G/A) gene polymorphism may contribute to susceptibility to CAP in Egyptian children. Moreover, we observed that the presence of a G allele or GG genotype at the -1082 position of the promoter region of the IL-10 gene constitute risk factors for developing severe sepsis

Direct Identification of a Bacterial Manganese(II) Oxidase, the Multicopper Oxidase MnxG, from Spores of Several Different Marine Bacillus Species▿ †

PubMed Central

Dick, Gregory J.; Torpey, Justin W.; Beveridge, Terry J.; Tebo, Bradley M.

2008-01-01

Microorganisms catalyze the formation of naturally occurring Mn oxides, but little is known about the biochemical mechanisms of this important biogeochemical process. We used tandem mass spectrometry to directly analyze the Mn(II)-oxidizing enzyme from marine Bacillus spores, identified as an Mn oxide band with an in-gel activity assay. Nine distinct peptides recovered from the Mn oxide band of two Bacillus species were unique to the multicopper oxidase MnxG, and one peptide was from the small hydrophobic protein MnxF. No other proteins were detected in the Mn oxide band, indicating that MnxG (or a MnxF/G complex) directly catalyzes biogenic Mn oxide formation. The Mn(II) oxidase was partially purified and found to be resistant to many proteases and active even at high concentrations of sodium dodecyl sulfate. Comparative analysis of the genes involved in Mn(II) oxidation from three diverse Bacillus species revealed a complement of conserved Cu-binding regions not present in well-characterized multicopper oxidases. Our results provide the first direct identification of a bacterial enzyme that catalyzes Mn(II) oxidation and suggest that MnxG catalyzes two sequential one-electron oxidations from Mn(II) to Mn(III) and from Mn(III) to Mn(IV), a novel type of reaction for a multicopper oxidase. PMID:18165363

Immunological and molecular comparison of polyphenol oxidase in Rosaceae fruit trees.

PubMed

Haruta, M; Murata, M; Kadokura, H; Homma, S

1999-03-01

An antibody raised against apple polyphenol oxidase (PPO) cross-reacted with PPOs from Japanese pear (Pyrus pyrifolia), pear (Pyrus communis), peach (Prunus persica), Chinese quince (Pseudocydonia sinensis) and Japanese loquat (Eriobotrya japonica). Core fragments (681 bp) of the corresponding PPO genes were amplified and characterized. The deduced protein sequences showed identities of 85.3 to 97.5%. Chlorogenic acid oxidase activity of these PPOs showed higher activities when assayed at pH 4 than at pH 6. These results indicate that PPOs in Rosaceae plants are structurally and enzymatically similar.

Immobilization of glucose oxidase using CoFe2O4/SiO2 nanoparticles as carrier

NASA Astrophysics Data System (ADS)

Wang, Hai; Huang, Jun; Wang, Chao; Li, Dapeng; Ding, Liyun; Han, Yun

2011-04-01

Aminated-CoFe2O4/SiO2 magnetic nanoparticles (NPs) were prepared from primary silica particles using modified StÖber method. Glucose oxidase (GOD) was immobilized on CoFe2O4/SiO2 NPs via cross-linking with glutaraldehyde (GA). The optimal immobilization condition was achieved with 1% (v/v) GA, cross-linking time of 3 h, solution pH of 7.0 and 0.4 mg GOD (in 3.0 mg carrier). The immobilized GOD showed maximal catalytic activity at pH 6.5 and 40 °C. After immobilization, the GOD exhibited improved thermal, storage and operation stability. The immobilized GOD still maintained 80% of its initial activity after the incubation at 50 °C for 25 min, whereas free enzyme had only 20% of initial activity after the same incubation. After kept at 4 °C for 28 days, the immobilized and free enzyme retained 87% and 40% of initial activity, respectively. The immobilized GOD maintained approximately 57% of initial activity after reused 7 times. The KM (Michaelis-Menten constant) values for immobilized GOD and free GOD were 14.6 mM and 27.1 mM, respectively.

Sudden infant death syndrome (SIDS) and polymorphisms in Monoamine oxidase A gene (MAOA): a revisit.

PubMed

Groß, Maximilian; Bajanowski, Thomas; Vennemann, Mechtild; Poetsch, Micaela

2014-01-01

Literature describes multiple possible links between genetic variations in the neuroadrenergic system and the occurrence of sudden infant death syndrome. The X-chromosomal Monoamine oxidase A (MAOA) is one of the genes with regulatory activity in the noradrenergic and serotonergic neuronal systems and a polymorphism of the promoter which affects the activity of this gene has been proclaimed to contribute significantly to the prevalence of sudden infant death syndrome (SIDS) in three studies from 2009, 2012 and 2013. However, these studies described different significant correlations regarding gender or age of children. Since several studies, suggesting associations between genetic variations and SIDS, were disproved by follow-up analysis, this study was conducted to take a closer look at the MAOA gene and its polymorphisms. The functional MAOA promoter length polymorphism was investigated in 261 SIDS cases and 93 control subjects. Moreover, the allele distribution of 12 coding and non-coding single nucleotide polymorphisms (SNPs) of the MAOA gene was examined in 285 SIDS cases and 93 controls by a minisequencing technique. In contrast to prior studies with fewer individuals, no significant correlations between the occurrence of SIDS and the frequency of allele variants of the promoter polymorphism could be demonstrated, even including the results from the abovementioned previous studies. Regarding the SNPs, three statistically significant associations were observed which had not been described before. This study clearly disproves interactions between MAOA promoter polymorphisms and SIDS, even if variations in single nucleotide polymorphisms of MAOA should be subjected to further analysis to clarify their impact on SIDS.

Transcriptional and posttranscriptional regulation of the glycolate oxidase gene in tobacco seedlings.

PubMed

Barak, S; Nejidat, A; Heimer, Y; Volokita, M

2001-03-01

The roles of light and of the putative plastid signal in glycolate oxidase (GLO) gene expression were investigated in tobacco (Nicotiana tabacum cv. Samsun NN) seedlings during their shift from skotomorphogenic to photomorphogenic development. GLO transcript and enzyme activities were detected in etiolated seedlings. Their respective levels increased three- and six-fold during 96 h of exposure to light. The GLO transcript was almost undetectable in seedlings in which chloroplast development was impaired by photooxidation with the herbicide norflurazon. In transgenic tobacco seedlings, photooxidation inhibited the light-dependent increase in GUS activity when it was placed under the regulation of the GLO promoter P(GLO). However, even under these photooxidative conditions, a continuous increase in GUS activity was observed as compared to etiolated seedlings. When GUS expression was driven by the CaMV 35S promoter (P35S), no apparent difference was observed between etiolated, deetiolated and photooxidized seedlings. These observations indicate that the effects of the putative plastid development signal and light on GUS expression can be separated. Translational yield analysis indicated that the translation of the GUS transcript in P(GLO)::GUS seedlings was enhanced 30-fold over that of the GUS transcript in P35S::GUS seedlings. The overall picture emerging from these results is that in etiolated seedlings GLO transcript, though present at a substantial level, is translated at a low rate. Increased GLO transcription is enhanced, however, in response to signals originating from the developing plastids. GLO gene expression is further enhanced at the translational level by a yet undefined light-dependent mechanism.

The role of the monoamine oxidase A gene in moderating the response to adversity and associated antisocial behavior: a review

PubMed Central

Buades-Rotger, Macià; Gallardo-Pujol, David

2014-01-01

Hereditary factors are increasingly attracting the interest of behavioral scientists and practitioners. Our aim in the present article is to introduce some state-of-the-art topics in behavioral genetics, as well as selected findings in the field, in order to illustrate how genetic makeup can modulate the impact of environmental factors. We focus on the most-studied polymorphism to date for antisocial responses to adversity: the monoamine oxidase A gene. Advances, caveats, and promises of current research are reviewed. We also discuss implications for the use of genetic information in applied settings. PMID:25114607

Monoamine Oxidase-A Genetic Variants and Childhood Abuse Predict Impulsiveness in Borderline Personality Disorder.

PubMed

Kolla, Nathan J; Meyer, Jeffrey; Sanches, Marcos; Charbonneau, James

2017-11-30

Impulsivity is a core feature of borderline personality disorder (BPD) and antisocial personality disorder (ASPD) that likely arises from combined genetic and environmental influences. The interaction of the low activity variant of the monoamine oxidase-A (MAOA-L) gene and early childhood adversity has been shown to predict aggression in clinical and non-clinical populations. Although impulsivity is a risk factor for aggression in BPD and ASPD, little research has investigated potential gene-environment (G×E) influences impacting its expression in these conditions. Moreover, G×E interactions may differ by diagnosis. Full factorial analysis of variance was employed to investigate the influence of monoamine oxidase-A (MAO-A) genotype, childhood abuse, and diagnosis on Barratt Impulsiveness Scale-11 (BIS-11) scores in 61 individuals: 20 subjects with BPD, 18 subjects with ASPD, and 23 healthy controls. A group×genotype×abuse interaction was present (F(2,49)=4.4, p =0.018), such that the interaction of MAOA-L and childhood abuse predicted greater BIS-11 motor impulsiveness in BPD. Additionally, BPD subjects reported higher BIS-11 attentional impulsiveness versus ASPD participants (t(1,36)=2.3, p =0.025). These preliminary results suggest that MAOA-L may modulate the impact of childhood abuse on impulsivity in BPD. Results additionally indicate that impulsiveness may be expressed differently in BPD and ASPD.

Molecular-clinical correlation in a family with a novel heteroplasmic Leigh syndrome missense mutation in the mitochondrial cytochrome c oxidase III gene.

PubMed

Mkaouar-Rebai, Emna; Ellouze, Emna; Chamkha, Imen; Kammoun, Fatma; Triki, Chahnez; Fakhfakh, Faiza

2011-01-01

Cytochrome c oxidase is an essential component of the mitochondrial respiratory chain that catalyzes the reduction of molecular oxygen by reduced cytochrome c. In this study, the authors report the second mutation associated with Leigh syndrome in the blood and buccal mucosa of 2 affected members of a Tunisian family. It was a novel heteroplasmic missense mitochondrial mutation at nucleotide 9478 in the gene specifying subunit III of cytochrome c oxidase substituting the valine at position 91 to alanine in a highly conserved amino acid. It was found with a high mutant load in tissues derived from endoderm (buccal mucosa) and mesoderm (blood). However, it was nearly absent in tissue derived from ectoderm (hair follicles). It was absent in 120 healthy controls, and PolyPhen analysis showed that the hydropathy index changed from +1.276 to +0.242, and the number of structures of the 3D protein decreased from 39 to 32.

Identification and biochemical characterization of polyamine oxidases in amphioxus: Implications for emergence of vertebrate-specific spermine and acetylpolyamine oxidases.

PubMed

Wang, Huihui; Liu, Baobao; Li, Hongyan; Zhang, Shicui

2016-01-10

Polyamine oxidases (PAOs) have been identified in a wide variety of animals, as well as in fungi and plant. Generally, plant PAOs oxidize spermine (Spm), spermidine (Spd) and their acetylated derivatives, N(1)-acetylspermine (N(1)-Aspm) and N(1)-acetylspermidine (N(1)-Aspd), while yeast PAOs oxidize Spm, N(1)-Aspm and N(1)-Aspd, but not Spd. By contrast, two different enzymes, namely spermine oxidase (SMO) and acetylpolyamine oxidase (APAO), specifically catalyze the oxidation of Spm and N(1)-Aspm/N(1)-Aspd, respectively. However, our knowledge on the biochemical and structural characterization of PAOs remains rather limited, and their evolutionary history is still enigmatic. In this study, two amphioxus (Branchiostoma japonicum) PAO genes, named Bjpao1 and Bjpao2, were cloned and characterized. Both Bjpao1 and Bjpao2 displayed distinct tissue-specific expression patterns. Notably, rBjPAO1 oxidized both spermine and spermidine, but not N(1)-acetylspermine, whereas rBjPAO2 oxidizes both spermidine and N(1)-acetylspermine, but not spermine. To understand structure-function relationship, the enzymatic activities of mutant BjPAOs that were generated by site-directed mutagenesis and expressed in E. coli were examined, The results indicate that the residues H64, K301 and T460 in rBjPAO1, and H69, K315 and T467 in rBjPAO2 were all involved in substrate binding and enzyme catalytic activity to some extent. Based on our results and those of others, a model depicting the divergent evolution and functional specialization of vertebrate SMO and APAO genes is proposed. Copyright © 2015 Elsevier B.V. All rights reserved.

Isolation, Oxygen Sensitivity, and Virulence of NADH Oxidase Mutants of the Anaerobic Spirochete Brachyspira (Serpulina) hyodysenteriae, Etiologic Agent of Swine Dysentery

PubMed Central

Stanton, Thad B.; Rosey, Everett L.; Kennedy, Michael J.; Jensen, Neil S.; Bosworth, Brad T.

1999-01-01

Brachyspira (Serpulina) hyodysenteriae, the etiologic agent of swine dysentery, uses the enzyme NADH oxidase to consume oxygen. To investigate possible roles for NADH oxidase in the growth and virulence of this anaerobic spirochete, mutant strains deficient in oxidase activity were isolated and characterized. The cloned NADH oxidase gene (nox; GenBank accession no. U19610) on plasmid pER218 was inactivated by replacing 321 bp of coding sequence with either a gene for chloramphenicol resistance (cat) or a gene for kanamycin resistance (kan). The resulting plasmids, respectively, pCmΔNOX and pKmΔNOX, were used to transform wild-type B. hyodysenteriae B204 cells and generate the antibiotic-resistant strains Nox-Cm and Nox-Km. PCR and Southern hybridization analyses indicated that the chromosomal wild-type nox genes in these strains had been replaced, through allelic exchange, by the inactivated nox gene containing cat or kan. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western immunoblot analysis revealed that both nox mutant cell lysates were missing the 48-kDa Nox protein. Soluble NADH oxidase activity levels in cell lysates of Nox-Cm and Nox-Km were reduced 92 to 96% compared to the activity level in parent strain B204. In an aerotolerance test, cells of both nox mutants were at least 100-fold more sensitive to oxygen exposure than were cells of the wild-type parent strain B204. In swine experimental infections, both nox mutants were less virulent than strain B204 in that fewer animals were colonized by the mutant cells and infected animals displayed mild, transient signs of disease, with no deaths. These results provide evidence that NADH oxidase serves to protect B. hyodysenteriae cells against oxygen toxicity and that the enzyme, in that role, contributes to the pathogenic ability of the spirochete. PMID:10543819

Analysis of the cytochrome c oxidase subunit 1 (COX1) gene reveals the unique evolution of the giant panda.

PubMed

Hu, Yao-Dong; Pang, Hui-Zhong; Li, De-Sheng; Ling, Shan-Shan; Lan, Dan; Wang, Ye; Zhu, Yun; Li, Di-Yan; Wei, Rong-Ping; Zhang, He-Min; Wang, Cheng-Dong

2016-11-05

As the rate-limiting enzyme of the mitochondrial respiratory chain, cytochrome c oxidase (COX) plays a crucial role in biological metabolism. "Living fossil" giant panda (Ailuropoda melanoleuca) is well-known for its special bamboo diet. In an effort to explore functional variation of COX1 in the energy metabolism behind giant panda's low-energy bamboo diet, we looked at genetic variation of COX1 gene in giant panda, and tested for its selection effect. In 1545 base pairs of the gene from 15 samples, 9 positions were variable and 1 mutation leaded to an amino acid sequence change. COX1 gene produces six haplotypes, nucleotide (pi), haplotype diversity (Hd). In addition, the average number of nucleotide differences (k) is 0.001629±0.001036, 0.8083±0.0694 and 2.517, respectively. Also, dN/dS ratio is significantly below 1. These results indicated that giant panda had a low population genetic diversity, and an obvious purifying selection of the COX1 gene which reduces synthesis of ATP determines giant panda's low-energy bamboo diet. Phylogenetic trees based on the COX1 gene were constructed to demonstrate that giant panda is the sister group of other Ursidae. Copyright © 2016 Elsevier B.V. All rights reserved.

The coxBAC Operon Encodes a Cytochrome c Oxidase Required for Heterotrophic Growth in the Cyanobacterium Anabaena variabilis Strain ATCC 29413

PubMed Central

Schmetterer, Georg; Valladares, Ana; Pils, Dietmar; Steinbach, Susanne; Pacher, Margit; Muro-Pastor, Alicia M.; Flores, Enrique; Herrero, Antonia

2001-01-01

Three genes, coxB, coxA, and coxC, found in a clone from a gene library of the cyanobacterium Anabaena variabilis strain ATCC 29413, were identified by hybridization with an oligonucleotide specific for aa3-type cytochrome c oxidases. Deletion of these genes from the genome of A. variabilis strain ATCC 29413 FD yielded strain CSW1, which displayed no chemoheterotrophic growth and an impaired cytochrome c oxidase activity. Photoautotrophic growth of CSW1, however, was unchanged, even with dinitrogen as the nitrogen source. A higher cytochrome c oxidase activity was detected in membrane preparations from dinitrogen-grown CSW1 than from nitrate-grown CSW1, but comparable activities of respiratory oxygen uptake were found in the wild type and in CSW1. Our data indicate that the identified cox gene cluster is essential for fructose-dependent growth in the dark, but not for growth on dinitrogen, and that other terminal respiratory oxidases are expressed in this cyanobacterium. Transcription analysis showed that coxBAC constitutes an operon which is expressed from two transcriptional start points. The use of one of them was stimulated by fructose. PMID:11591688

A DNA microarray for identification of selected Korean birds based on mitochondrial cytochrome c oxidase I gene sequences.

PubMed

Chung, In-Hyuk; Yoo, Hye Sook; Eah, Jae-Yong; Yoon, Hyun-Kyu; Jung, Jin-Wook; Hwang, Seung Yong; Kim, Chang-Bae

2010-10-01

DNA barcoding with the gene encoding cytochrome c oxidase I (COI) in the mitochondrial genome has been proposed as a standard marker to identify and discover animal species. Some migratory wild birds are suspected of transmitting avian influenza and pose a threat to aircraft safety because of bird strikes. We have previously reported the COI gene sequences of 92 Korean bird species. In the present study, we developed a DNA microarray to identify 17 selected bird species on the basis of nucleotide diversity. We designed and synthesized 19 specific oligonucleotide probes; these probes were arrayed on a silylated glass slide. The length of the probes was 19-24 bps. The COI sequences amplified from the tissues of the selected birds were labeled with a fluorescent probe for microarray hybridization, and unique hybridization patterns were detected for each selected species. These patterns may be considered diagnostic patterns for species identification. This microarray system will provide a sensitive and a high-throughput method for identification of Korean birds.

Monoamine oxidase-A polymorphisms might modify the association between the dopamine D2 receptor gene and alcohol dependence.

PubMed

Huang, San-Yuan; Lin, Wei-Wen; Wan, Fang-Jung; Chang, Ai-Ju; Ko, Huei-Chen; Wang, Tso-Jen; Wu, Pei-Lin; Lu, Ru-Band

2007-05-01

Low monoamine oxidase (MAO) activity and the neurotransmitter dopamine are 2 important factors in the development of alcohol dependence. MAO is an important enzyme associated with the metabolism of biogenic amines. Therefore, the present study investigates whether the association between the dopamine D2 receptor (DRD2) gene and alcoholism is affected by different polymorphisms of the MAO type A (MAOA) gene. A total of 427 Han Chinese men in Taiwan (201 control subjects and 226 with alcoholism) were recruited for the study. Of the subjects with alcoholism, 108 had pure alcohol dependence (ALC) and 118 had both alcohol dependence and anxiety, depression or both (ANX/DEP ALC). All subjects were assessed with the Chinese Version of the Modified Schedule of Affective Disorders and Schizophrenia-Lifetime. Alcohol dependence, anxiety and major depressive disorders were diagnosed according to Diagnostic and Statistical Manual of Mental Disorders, fourth edition criteria. The genetic variant of the DRD2 gene was only associated with the ANX/DEP ALC phenotype, and the genetic variant of the MAOA gene was associated with pure ALC. Subjects carrying the MAOA 3-repeat allele and genotype A1/A1 of the DRD2 were 3.48 times (95% confidence interval = 1.47-8.25) more likely to be ANX/DEP ALC than the subjects carrying the MAOA 3-repeat allele and DRD2 A2/A2 genotype. The MAOA gene may modify the association between the DRD2 gene and ANX/DEP ALC phenotype.

Expression and Characterization of Glucose Oxidase from Aspergillus niger in Yarrowia lipolytica.

PubMed

Khadivi Derakshan, Fatemeh; Darvishi, Farshad; Dezfulian, Mehrouz; Madzak, Catherine

2017-08-01

Glucose oxidase (GOX) is currently used in clinical, pharmaceutical, food and chemical industries. The aim of this study was expression and characterization of Aspergillus niger glucose oxidase gene in the yeast Yarrowia lipolytica. For the first time, the GOX gene of A. niger was successfully expressed in Y. lipolytica using a mono-integrative vector containing strong hybrid promoter and secretion signal. The highest total glucose oxidase activity was 370 U/L after 7 days of cultivation. An innovative method was used to cell wall disruption in current study, and it could be recommended to use for efficiently cell wall disruption of Y. lipolytica. Optimum pH and temperature for recombinant GOX activity were 5.5 and 37 °C, respectively. A single band with a molecular weight of 80 kDa similar to the native and pure form of A. niger GOX was observed for the recombinant GOX in SDS-PAGE analysis. Y. lipolytica is a suitable and efficient eukaryotic expression system to production of recombinant GOX in compered with other yeast expression systems and could be used to production of pure form of GOX for industrial applications.

A promoter polymorphism in the monoamine oxidase A gene is associated with the pineal MAOA activity in Alzheimer's disease patients.

PubMed

Wu, Ying-Hui; Fischer, David F; Swaab, Dick F

2007-09-05

Monoamine oxidase A (MAOA) is involved in the pathogenesis of mood disorders and Alzheimer's disease (AD). MAOA activity and gene expression have been found to be up-regulated in different brain areas of AD patients, including the pineal gland. Increased pineal MAOA activity might contribute to the reduced pineal melatonin production in AD. A promoter polymorphism of a variable number tandem repeats (VNTR) in the MAOA gene shows to affect MAOA transcriptional activity in vitro. Here we examined in 63 aged controls and 44 AD patients the effects of the MAOA-VNTR on MAOA gene expression and activity in the pineal gland as endophenotypes, and on melatonin production. AD patients carrying long MAOA-VNTR genotype (consisting of 3.5- or 4-repeat alleles) showed higher MAOA gene expression and activity than the short-genotyped (i.e., 3-repeat allele) AD patients. Moreover, the AD-related up-regulation of MAOA showed up only among long-genotype bearing subjects. There was no significant effect of the MAOA-VNTR on MAOA activity or gene expression in controls, or on melatonin production in both controls and AD patients. Our data suggest that the MAOA-VNTR affects the activity and gene expression of MAOA in the brain of AD patients, and is involved in the changes of monoamine metabolism.

Increase in expression of brain serotonin transporter and monoamine oxidase a genes induced by repeated experience of social defeats in male mice.

PubMed

Filipenko, M L; Beilina, A G; Alekseyenko, O V; Dolgov, V V; Kudryavtseva, N N

2002-04-01

Serotonin transporter and monoamine oxidase (MAO) A are involved in the inactivation of serotonin. The former is responsible for serotonin re-uptake from the synapse, whereas the latter catalyzes serotonin deamination in presynaptic terminals. Expression of serotonin transporter and MAO A genes was investigated in raphe nuclei of midbrain of CBA/Lac male mice with repeated experience of social victories or defeats in 10 daily aggressive confrontations. The amount of cDNA of these genes was evaluated using multiplex RT-PCR. Two independent experiments revealed that the defeated mice were characterized by significantly higher levels of serotonin transporter and MAO A mRNAs than the control and aggressive animals. Increased expression of MAO A and serotonin transporter genes is suggested to reflect the accelerated serotonin degradation in response to activation of the serotonergic system functioning induced by social stress. Significant positive correlation between MAO A and serotonin transporter mRNA levels suggests common pathways of regulation of transcriptional activity of these genes.

A Study of Gibberellin Homeostasis and Cryptochrome-Mediated Blue Light Inhibition of Hypocotyl Elongation1[W][OA

PubMed Central

Zhao, Xiaoying; Yu, Xuhong; Foo, Eloise; Symons, Gregory M.; Lopez, Javier; Bendehakkalu, Krishnaprasad T.; Xiang, Jing; Weller, James L.; Liu, Xuanming; Reid, James B.; Lin, Chentao

2007-01-01

Cryptochromes mediate blue light-dependent photomorphogenic responses, such as inhibition of hypocotyl elongation. To investigate the underlying mechanism, we analyzed a genetic suppressor, scc7-D (suppressors of cry1cry2), which suppressed the long-hypocotyl phenotype of the cry1cry2 (cryptochrome1/cryptochrome2) mutant in a light-dependent but wavelength-independent manner. scc7-D is a gain-of-expression allele of the GA2ox8 gene encoding a gibberellin (GA)-inactivating enzyme, GA 2-oxidase. Although scc7-D is hypersensitive to light, transgenic seedlings expressing GA2ox at a level higher than scc7-D showed a constitutive photomorphogenic phenotype, confirming a general role of GA2ox and GA in the suppression of hypocotyl elongation. Prompted by this result, we investigated blue light regulation of mRNA expression of the GA metabolic and catabolic genes. We demonstrated that cryptochromes are required for the blue light regulation of GA2ox1, GA20ox1, and GA3ox1 expression in transient induction, continuous illumination, and photoperiodic conditions. The kinetics of cryptochrome induction of GA2ox1 expression and cryptochrome suppression of GA20ox1 or GA3ox1 expression correlate with the cryptochrome-dependent transient reduction of GA4 in etiolated wild-type seedlings exposed to blue light. Therefore we propose that in deetiolating seedlings, cryptochromes mediate blue light regulation of GA catabolic/metabolic genes, which affect GA levels and hypocotyl elongation. Surprisingly, no significant change in the GA4 content was detected in the whole shoot samples of the wild-type or cry1cry2 seedlings grown in the dark or continuous blue light, suggesting that cryptochromes may also regulate GA responsiveness and/or trigger cell- or tissue-specific changes of the level of bioactive GAs. PMID:17644628

Trade-off between bandwidth and efficiency in semipolar (20 2 ¯ 1 ¯) InGaN/GaN single- and multiple-quantum-well light-emitting diodes

NASA Astrophysics Data System (ADS)

Monavarian, M.; Rashidi, A.; Aragon, A. A.; Nami, M.; Oh, S. H.; DenBaars, S. P.; Feezell, D.

2018-05-01

InGaN/GaN light-emitting diodes (LEDs) with large modulation bandwidths are desirable for visible-light communication. Along with modulation speed, the consideration of the internal quantum efficiency (IQE) under operating conditions is also important. Here, we report the modulation characteristics of semipolar (20 2 ¯ 1 ¯ ) InGaN/GaN (LEDs) with single-quantum well (SQW) and multiple-quantum-well (MQW) active regions grown on free-standing semipolar GaN substrates with peak internal quantum efficiencies (IQEs) of 0.93 and 0.73, respectively. The MQW LEDs exhibit on average about 40-80% higher modulation bandwidth, reaching 1.5 GHz at 13 kA/cm2, but about 27% lower peak IQE than the SQW LEDs. We extract the differential carrier lifetimes (DLTs), RC parasitics, and carrier escape lifetimes and discuss their role in the bandwidth and IQE characteristics. A coulomb-enhanced capture process is shown to rapidly reduce the DLT of the MQW LED at high current densities. Auger recombination is also shown to play little role in increasing the speed of the LEDs. Finally, we investigate the trade-offs between the bandwidth and efficiency and introduce the bandwidth-IQE product as a potential figure of merit for optimizing speed and efficiency in InGaN/GaN LEDs.

Molecular, phylogenetic and comparative genomic analysis of the cytokinin oxidase/dehydrogenase gene family in the Poaceae.

PubMed

Mameaux, Sabine; Cockram, James; Thiel, Thomas; Steuernagel, Burkhard; Stein, Nils; Taudien, Stefan; Jack, Peter; Werner, Peter; Gray, John C; Greenland, Andy J; Powell, Wayne

2012-01-01

The genomes of cereals such as wheat (Triticum aestivum) and barley (Hordeum vulgare) are large and therefore problematic for the map-based cloning of agronomicaly important traits. However, comparative approaches within the Poaceae permit transfer of molecular knowledge between species, despite their divergence from a common ancestor sixty million years ago. The finding that null variants of the rice gene cytokinin oxidase/dehydrogenase 2 (OsCKX2) result in large yield increases provides an opportunity to explore whether similar gains could be achieved in other Poaceae members. Here, phylogenetic, molecular and comparative analyses of CKX families in the sequenced grass species rice, brachypodium, sorghum, maize and foxtail millet, as well as members identified from the transcriptomes/genomes of wheat and barley, are presented. Phylogenetic analyses define four Poaceae CKX clades. Comparative analyses showed that CKX phylogenetic groupings can largely be explained by a combination of local gene duplication, and the whole-genome duplication event that predates their speciation. Full-length OsCKX2 homologues in barley (HvCKX2.1, HvCKX2.2) and wheat (TaCKX2.3, TaCKX2.4, TaCKX2.5) are characterized, with comparative analysis at the DNA, protein and genetic/physical map levels suggesting that true CKX2 orthologs have been identified. Furthermore, our analysis shows CKX2 genes in barley and wheat have undergone a Triticeae-specific gene-duplication event. Finally, by identifying ten of the eleven CKX genes predicted to be present in barley by comparative analyses, we show that next-generation sequencing approaches can efficiently determine the gene space of large-genome crops. Together, this work provides the foundation for future functional investigation of CKX family members within the Poaceae. © 2011 National Institute of Agricultural Botany (NIAB). Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell

Effect of MLH1 -93G>A on gene expression in patients with colorectal cancer.

PubMed

Funck, Alexandre; Santos, Juliana C; Silva-Fernandes, Isabelle J L; Rabenhorst, Silvia H B; Martinez, Carlos A R; Ribeiro, Marcelo L

2014-09-01

The DNA repair machinery plays a key role in maintaining genomic stability by preventing the emergence of mutations. Furthermore, the -93G>A polymorphism in the MLH1 gene has been associated with an increased risk of developing colorectal cancer. Therefore, the aim of this study was to examine the expression pattern and effect of this polymorphism in normal and tumour samples from patients with colorectal cancer. The MLH1 -93G>A (rs1800734) polymorphism was detected by PCR-RFLP in 49 cases of colorectal cancer. MLH1 expression was investigated using real-time quantitative PCR. The results indicate a significant decrease in MLH1 expression in tumour samples compared to their normal counterparts. The MLH1 gene was also significantly repressed in samples from patients who had some degree of tumour invasion into other organs. Similarly, those patients who were in a more advanced tumour stage (TNM III and IV) exhibited a significant reduction in MLH1 gene expression. Finally, the mutant genotype AA of MLH1 was associated with a significant decrease in the expression of this gene. This finding suggests that this polymorphism could increase the risk of developing colorectal cancer by a defective mismatch repair system, particularly through the loss of MLH1 expression in an allele-specific manner.

Involvement of alternative oxidase in the regulation of sensitivity of Sclerotinia sclerotiorum to the fungicides azoxystrobin and procymidone.

PubMed

Xu, Ting; Wang, Ya-Ting; Liang, Wu-Sheng; Yao, Fei; Li, Yong-Hong; Li, Dian-Rong; Wang, Hao; Wang, Zheng-Yi

2013-06-01

Sclerotinia sclerotiorum is a filamentous fungal pathogen that can infect many economically important crops and vegetables. Alternative oxidase is the terminal oxidase of the alternative respiratory pathway in fungal mitochondria. The function of alternative oxidase was investigated in the regulation of sensitivity of S. sclerotiorum to two commercial fungicides, azoxystrobin and procymidone which have different fungitoxic mechanisms. Two isolates of S. sclerotiorum were sensitive to both fungicides. Application of salicylhydroxamic acid, a specific inhibitor of alternative oxidase, significantly increased the values of effective concentration causing 50% mycelial growth inhibition (EC50) of azoxystrobin to both S. sclerotiorum isolates, whereas notably decreased the EC50 values of procymidone. In mycelial respiration assay azoxystrobin displayed immediate inhibitory effect on cytochrome pathway capacity, but had no immediate effect on alternative pathway capacity. In contrast, procymidone showed no immediate impact on capacities of both cytochrome and alternative pathways in the mycelia. However, alternative oxidase encoding gene (aox) transcript and protein levels, alternative respiration pathway capacity of the mycelia were obviously increased by pre-treatment for 24 h with both azoxystrobin and procymidone. These results indicate that alternative oxidase was involved in the regulation of sensitivity of S. sclerotiorum to the fungicides azoxystrobin and procymidone, and that both fungicides could affect aox gene expression and the alternative respiration pathway capacity development in mycelia of this fungal pathogen.

EARLY FLOWERING3 Regulates Flowering in Spring Barley by Mediating Gibberellin Production and FLOWERING LOCUS T Expression[C][W

PubMed Central

Boden, Scott A.; Weiss, David; Ross, John J.; Davies, Noel W.; Trevaskis, Ben; Chandler, Peter M.; Swain, Steve M.

2014-01-01

EARLY FLOWERING3 (ELF3) is a circadian clock gene that contributes to photoperiod-dependent flowering in plants, with loss-of-function mutants in barley (Hordeum vulgare), legumes, and Arabidopsis thaliana flowering early under noninductive short-day (SD) photoperiods. The barley elf3 mutant displays increased expression of FLOWERING LOCUS T1 (FT1); however, it remains unclear whether this is the only factor responsible for the early flowering phenotype. We show that the early flowering and vegetative growth phenotypes of the barley elf3 mutant are strongly dependent on gibberellin (GA) biosynthesis. Expression of the central GA biosynthesis gene, GA20oxidase2, and production of the bioactive GA, GA1, were significantly increased in elf3 leaves under SDs, relative to the wild type. Inhibition of GA biosynthesis suppressed the early flowering of elf3 under SDs independently of FT1 and was associated with altered expression of floral identity genes at the developing apex. GA is also required for normal flowering of spring barley under inductive photoperiods, with chemical and genetic attenuation of the GA biosynthesis and signaling pathways suppressing inflorescence development under long-day conditions. These findings illustrate that GA is an important floral promoting signal in barley and that ELF3 suppresses flowering under noninductive photoperiods by blocking GA production and FT1 expression. PMID:24781117

NADPH oxidases in the arbuscular mycorrhizal symbiosis.

PubMed

Belmondo, Simone; Calcagno, Cristina; Genre, Andrea; Puppo, Alain; Pauly, Nicolas; Lanfranco, Luisa

2016-01-01

Plant NADPH oxidases are the major source of reactive oxygen species (ROS) that plays key roles as both signal and stressor in several plant processes, including defense responses against pathogens. ROS accumulation in root cells during arbuscular mycorrhiza (AM) development has raised the interest in understanding how ROS-mediated defense programs are modulated during the establishment of this mutualistic interaction. We have recently analyzed the expression pattern of 5 NADPH oxidase (also called RBOH) encoding genes in Medicago truncatula, showing that only one of them (MtRbohE) is specifically upregulated in arbuscule-containing cells. In line with this result, RNAi silencing of MtRbohE generated a strong alteration in root colonization, with a significant reduction in the number of arbusculated cells. On this basis, we propose that MtRBOHE-mediated ROS production plays a crucial role in the intracellular accommodation of arbuscules.

NADPH oxidases in the arbuscular mycorrhizal symbiosis

PubMed Central

Belmondo, Simone; Calcagno, Cristina; Genre, Andrea; Puppo, Alain; Pauly, Nicolas; Lanfranco, Luisa

2016-01-01

ABSTRACT Plant NADPH oxidases are the major source of reactive oxygen species (ROS) that plays key roles as both signal and stressor in several plant processes, including defense responses against pathogens. ROS accumulation in root cells during arbuscular mycorrhiza (AM) development has raised the interest in understanding how ROS-mediated defense programs are modulated during the establishment of this mutualistic interaction. We have recently analyzed the expression pattern of 5 NADPH oxidase (also called RBOH) encoding genes in Medicago truncatula, showing that only one of them (MtRbohE) is specifically upregulated in arbuscule-containing cells. In line with this result, RNAi silencing of MtRbohE generated a strong alteration in root colonization, with a significant reduction in the number of arbusculated cells. On this basis, we propose that MtRBOHE-mediated ROS production plays a crucial role in the intracellular accommodation of arbuscules. PMID:27018627

Allelic variations in the CYBA gene of NADPH oxidase and risk of kidney complications in patients with type 1 diabetes.

PubMed

Patente, Thiago A; Mohammedi, Kamel; Bellili-Muñoz, Naïma; Driss, Fathi; Sanchez, Manuel; Fumeron, Frédéric; Roussel, Ronan; Hadjadj, Samy; Corrêa-Giannella, Maria Lúcia; Marre, Michel; Velho, Gilberto

2015-09-01

Oxidative stress plays a pivotal role in the pathophysiology of diabetic nephropathy, and the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase system is an important source of reactive oxygen species in hyperglycemic conditions in the kidney. Plasma concentration of advanced oxidation protein products (AOPP), a marker of oxidative stress, is increased in patients with diabetic nephropathy. We investigated associations of variants in the CYBA gene, encoding the regulatory subunit p22(phox) of NADPH oxidase, with diabetic nephropathy and plasma AOPP and myeloperoxidase (MPO) concentrations in type 1 diabetic patients. Seven SNPs in the CYBA region were analyzed in 1357 Caucasian subjects with type 1 diabetes from the SURGENE (n=340), GENEDIAB (n=444), and GENESIS (n=573) cohorts. Duration of follow-up was 10, 9, and 6 years, respectively. Cox proportional hazards and logistic regression analyses were used to estimate hazard ratios (HR) or odds ratios (OR) for incidence and prevalence of diabetic nephropathy. The major G-allele of rs9932581 was associated with the incidence of renal events defined as new cases of microalbuminuria or the progression to a more severe stage of nephropathy during follow-up (HR 1.59, 95% CI 1.17-2.18, P=0.003) in SURGENE. The same allele was associated with established/advanced nephropathy (OR 1.52, 95% CI 1.22-1.92, P=0.0001) and with the incidence of end-stage renal disease (ESRD) (HR 2.01, 95% CI 1.30-3.24, P=0.001) in GENEDIAB/GENESIS pooled studies. The risk allele was also associated with higher plasma AOPP concentration in subsets of SURGENE and GENEDIAB, with higher plasma MPO concentration in a subset of GENEDIAB, and with lower estimated glomerular filtration rate (eGFR) in the three cohorts. In conclusion, a functional variant in the promoter of the CYBA gene was associated with lower eGFR and with prevalence and incidence of diabetic nephropathy and ESRD in type 1 diabetic patients. These results are consistent with

20-Hydroxyecdysone (20E) Primary Response Gene E93 Modulates 20E Signaling to Promote Bombyx Larval-Pupal Metamorphosis*

PubMed Central

Liu, Xi; Dai, Fangyin; Guo, Enen; Li, Kang; Ma, Li; Tian, Ling; Cao, Yang; Zhang, Guozheng; Palli, Subba R.; Li, Sheng

2015-01-01

As revealed in a previous microarray study to identify genes regulated by 20-hydroxyecdysone (20E) and juvenile hormone (JH) in the silkworm, Bombyx mori, E93 expression in the fat body was markedly low prior to the wandering stage but abundant during larval-pupal metamorphosis. Induced by 20E and suppressed by JH, E93 expression follows this developmental profile in multiple silkworm alleles. The reduction of E93 expression by RNAi disrupted 20E signaling and the 20E-induced autophagy, caspase activity, and cell dissociation in the fat body. Reducing E93 expression also decreased the expression of the 20E-induced pupal-specific cuticle protein genes and prevented growth and differentiation of the wing discs. Importantly, the two HTH domains in E93 are critical for inducing the expression of a subset of 20E response genes, including EcR, USP, E74, Br-C, and Atg1. By contrast, the LLQHLL and PLDLSAK motifs in E93 inhibit its transcriptional activity. E93 binds to the EcR-USP complex via a physical association with USP through its LLQHLL motif; and this association is enhanced by 20E-induced EcR-USP interaction, which attenuates the transcriptional activity of E93. E93 acts through the two HTH domains to bind to GAGA-containing motifs present in the Atg1 promoter region for inducing gene expression. In conclusion, E93 transcriptionally modulates 20E signaling to promote Bombyx larval-pupal metamorphosis. PMID:26378227

20-Hydroxyecdysone (20E) Primary Response Gene E93 Modulates 20E Signaling to Promote Bombyx Larval-Pupal Metamorphosis.

PubMed

Liu, Xi; Dai, Fangyin; Guo, Enen; Li, Kang; Ma, Li; Tian, Ling; Cao, Yang; Zhang, Guozheng; Palli, Subba R; Li, Sheng

2015-11-06

As revealed in a previous microarray study to identify genes regulated by 20-hydroxyecdysone (20E) and juvenile hormone (JH) in the silkworm, Bombyx mori, E93 expression in the fat body was markedly low prior to the wandering stage but abundant during larval-pupal metamorphosis. Induced by 20E and suppressed by JH, E93 expression follows this developmental profile in multiple silkworm alleles. The reduction of E93 expression by RNAi disrupted 20E signaling and the 20E-induced autophagy, caspase activity, and cell dissociation in the fat body. Reducing E93 expression also decreased the expression of the 20E-induced pupal-specific cuticle protein genes and prevented growth and differentiation of the wing discs. Importantly, the two HTH domains in E93 are critical for inducing the expression of a subset of 20E response genes, including EcR, USP, E74, Br-C, and Atg1. By contrast, the LLQHLL and PLDLSAK motifs in E93 inhibit its transcriptional activity. E93 binds to the EcR-USP complex via a physical association with USP through its LLQHLL motif; and this association is enhanced by 20E-induced EcR-USP interaction, which attenuates the transcriptional activity of E93. E93 acts through the two HTH domains to bind to GAGA-containing motifs present in the Atg1 promoter region for inducing gene expression. In conclusion, E93 transcriptionally modulates 20E signaling to promote Bombyx larval-pupal metamorphosis. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Tumor necrosis factor alpha gene promoter -238G/A polymorphism increases the risk of psoriasis vulgaris in Indian patients.

PubMed

Rajesh, Deepa; Gurumurthy, Rajesh; Kutty, A V Moideen; Balakrishna, Sharath

2017-03-01

Tumor necrosis factor alpha (TNFα) gene -238G/A polymorphism (rs361525) is associated with psoriasis in several populations worldwide. To the best of our knowledge, there is no information about this polymorphism in Indian psoriatic patients. This study was undertaken to fill the gap in knowledge. This case-control study involved 72 patients with psoriasis vulgaris (PsV) and 72 age and gender matched healthy individuals. TNFα -238G/A polymorphism was genotyped by PCR-RFLP method. TNFα -238A allele was 5 times commoner in PsV patients than in the control group (P = 4.1 × 10 -7 ; odds ratio [OR] = 6.5 [0.95 CI: 2.9-14.6]). Distribution of the genotypes in the two groups showed statistically significant difference in dominant genetic model (P = 2.3 × 10 -7 ) and not in recessive genetic model (P = 2.5 × 10 -1 ). Odds ratio for the occurrence of -238A genotype in PsV patients was 8.8 (0.95 CI: 3.5-20.2). The association showed no major difference when PsV patients were subgrouped into type I and type II categories and tested separately. Subgroup analysis on the basis of disease severity showed higher association with the moderate-severe subgroup (P = 2.4 × 10 -9 , OR 15.4 [0.95 CI: 5.8-41.0]) than with mild subgroup (P = 1.3 × 10 -2 , OR 3.8 [0.95 CI: 1.3-10.9]). Our results indicate that TNFα gene -238G/A polymorphism increases the risk of developing psoriasis vulgaris among Indians. Also, the data show that severity and not the type affects the strength of association in this population. © 2017 The International Society of Dermatology.

[Correlation between genetic polymorphisms of -855 G/C and -1140 G/A in GRIN1 gene and paranoid schizophrenia].

PubMed

Li, Zhong-Jie; Ding, Mei; Pang, Hao; Sun, Xue-Fei; Xing, Jia-Xin; Xuan, Jin-Feng; Wang, Bao-Jie

2013-04-01

To investigate the single nucleotide polymorphisms (SNP) of -855 G/C and -1140 G/A in promoter regions of GRIN1 gene and find their genetic correlation to paranoid schizophrenia as well as their applicable values in forensic medicine. The genetic polymorphisms of -855 G/C and -1140 G/A at the 5' end of GRIN1 gene were detected by PCR restriction fragment length polymorphism and PAGE in 183 healthy unrelated individuals of northern Chinese Han population and 172 patients of paranoid schizophrenia, respectively. The chi2 test was used to identify Hardy-Weinberg equilibrium of the genotype distribution. The differences of genotypes and allelic frequency distributions were compared between the two groups. Distributions of the genotypic frequencies satisfied Hardy-Weinberg equilibrium in both groups. The difference of genotypes was statistically significant between female patient group and female control group in -855 G/C distribution (P < 0.05). The differences of genotypes and allelic frequencies were statistically significant not only between the patient group and the control group but also between female patient group and female control group in -1140 G/A distribution (P < 0.05). The SNP of -1140 G/A in promoter regions of GRIN1 gene might positively correlate to paranoid schizophrenia. The genetic factor of schizophrenia is involved in gender tendency. And it could be useful in forensic identification of schizophrenia.

Cytotoxicity of polyamines to Amoeba proteus: role of polyamine oxidase.

PubMed

Schenkel, E; Dubois, J G; Helson-Cambier, M; Hanocq, M

1996-02-01

It has been shown that oxidation of polyamines by polyamine oxidases can produce toxic compounds (H2O2, aldehydes, ammonia) and that the polyamine oxidase-polyamine system is implicated, in vitro, in the death of several parasites. Using Amoeba proteus as an in vitro model, we studied the cytotoxicity to these cells of spermine, spermidine, their acetyl derivatives, and their hypothetical precursors. Spermine and N1-acetylspermine were more toxic than emetine, an amoebicidal reference drug. Spermine presented a short-term toxicity, but a 48-h contact time was necessary for the high toxicity of spermidine. The uptake by Amoeba cells of the different polyamines tested was demonstrated. On the other hand, a high polyamine oxidase activity was identified in Amoeba proteus crude extract. Spermine (theoretical 100%) and N1-acetylspermine (64%) were the best substrates at pH 9.5, while spermidine, its acetyl derivatives, and putrescine were very poorly oxidized by this enzyme (3-20%). Spermine oxidase activity was inhibited by phenylhydrazine (nil) and isoniazid (approximately 50%). Mepacrine did not inhibit the enzyme activity at pH 8. Neither monoamine nor diamine oxidase activity (approximately 10%) was found. It must be emphasized that spermine, the best enzyme substrate, is the most toxic polyamine. This finding suggests that knowledge of polyamine oxidase specificity can be used to modulate the cytotoxicity of polyamine derivatives. Amoeba proteus was revealed as a simple model for investigation of the connection between cytotoxicity and enzyme activity.

The Microbial Genomes Atlas (MiGA) webserver: taxonomic and gene diversity analysis of Archaea and Bacteria at the whole genome level.

PubMed

Rodriguez-R, Luis M; Gunturu, Santosh; Harvey, William T; Rosselló-Mora, Ramon; Tiedje, James M; Cole, James R; Konstantinidis, Konstantinos T

2018-06-14

The small subunit ribosomal RNA gene (16S rRNA) has been successfully used to catalogue and study the diversity of prokaryotic species and communities but it offers limited resolution at the species and finer levels, and cannot represent the whole-genome diversity and fluidity. To overcome these limitations, we introduced the Microbial Genomes Atlas (MiGA), a webserver that allows the classification of an unknown query genomic sequence, complete or partial, against all taxonomically classified taxa with available genome sequences, as well as comparisons to other related genomes including uncultivated ones, based on the genome-aggregate Average Nucleotide and Amino Acid Identity (ANI/AAI) concepts. MiGA integrates best practices in sequence quality trimming and assembly and allows input to be raw reads or assemblies from isolate genomes, single-cell sequences, and metagenome-assembled genomes (MAGs). Further, MiGA can take as input hundreds of closely related genomes of the same or closely related species (a so-called 'Clade Project') to assess their gene content diversity and evolutionary relationships, and calculate important clade properties such as the pangenome and core gene sets. Therefore, MiGA is expected to facilitate a range of genome-based taxonomic and diversity studies, and quality assessment across environmental and clinical settings. MiGA is available at http://microbial-genomes.org/.

The dual oxidase gene BdDuox regulates the intestinal bacterial community homeostasis of Bactrocera dorsalis

PubMed Central

Yao, Zhichao; Wang, Ailin; Li, Yushan; Cai, Zhaohui; Lemaitre, Bruno; Zhang, Hongyu

2016-01-01

The guts of metazoans are in permanent contact with the microbial realm that includes beneficial symbionts, nonsymbionts, food-borne microbes and life-threatening pathogens. However, little is known concerning how host immunity affects gut bacterial community. Here, we analyze the role of a dual oxidase gene (BdDuox) in regulating the intestinal bacterial community homeostasis of the oriental fruit fly Bactrocera dorsalis. The results showed that knockdown of BdDuox led to an increased bacterial load, and to a decrease in the relative abundance of Enterobacteriaceae and Leuconostocaceae bacterial symbionts in the gut. The resulting dysbiosis, in turn, stimulates an immune response by activating BdDuox and promoting reactive oxygen species (ROS) production that regulates the composition and structure of the gut bacterial community to normal status by repressing the overgrowth of minor pathobionts. Our results suggest that BdDuox plays a pivotal role in regulating the homeostasis of the gut bacterial community in B. dorsalis. PMID:26565723

Isolation and purification of pyranose 2-oxidase from Phanerochaete chrysosporium and characterization of gene structure and regulation

Treesearch

Theodorus H. de Koker; Michael D. Mozuch; Daniel Cullen; Jill Gaskell; Philip J. Kersten

2004-01-01

Pyranose 2-oxidase (POX) was recovered from Phanerochaete chrysosporium BKM-F-1767 solid substrate culture using mild extraction conditions and was purified. 13C-nuclear magnetic resonance confirmed production of D- arabino -hexos-2-ulose (glucosone) from D-glucose with the oxidase. Peptide fingerprints generated by liquid chromatography-tandem mass spectrometry of...

ChoG is the main inducible extracellular cholesterol oxidase of Rhodococcus sp. strain CECT3014.

PubMed

Fernández de Las Heras, Laura; Mascaraque, Victoria; García Fernández, Esther; Navarro-Llorens, Juana María; Perera, Julián; Drzyzga, Oliver

2011-07-20

Cholesterol catabolism has been reported in different bacteria and particularly in several Rhodococcus species, but the genetic of this complex pathway is not yet very well defined. In this work we report the isolation and sequencing of a 9.8 kb DNA fragment of Rhodococcus sp. strain CECT3014, a bacterial strain that we here identify as a Rhodococcus erythropolis strain. In this DNA fragment we found several ORF that are probably involved in steroid catabolism, and choG, a gene encoding a putative cholesterol oxidase whose functional characterization we here report. ChoG protein is a class II cholesterol oxidase with all the structural features of the enzymes of this group. The disruption of the choG gene does not alter the ability of strain CECT3014 cells to grow on cholesterol, but it abolishes the production of extracellular cholesterol oxidase. This later effect is reverted when the mutant cells are transformed with a plasmid expressing choG. We conclude that choG is the gene responsible for the inducible extracellular cholesterol oxidase activity of strain CECT3014. This activity distributes between the cellular membrane and the culture supernatant in a way that suggests it is produced by the same ChoG protein that occurs in two different locations. RT-PCR transcript analysis showed a dual scheme of choG expression: a low constitutive independent transcription, plus a cholesterol induced transcription of choG into a polycistronic kstD-hsd4B-choG mRNA. Copyright © 2010 Elsevier GmbH. All rights reserved.

Study of a possible role of the monoamine oxidase A (MAOA) gene in paranoid schizophrenia among a Chinese population.

PubMed

Sun, Yuhui; Zhang, Jiexu; Yuan, Yanbo; Yu, Xin; Shen, Yan; Xu, Qi

2012-01-01

Monoamine oxidase A (MAOA) is the enzyme responsible for degradation of several monoamines, such as dopamine and serotonin that are considered as being two of the most important neurotransmitters involved in the pathophysiology of schizophrenia. To study a possible role of the MAOA gene in conferring susceptibility to schizophrenia, the present study genotyped the variable number of tandem repeat (VNTR) polymorphism and 41 SNPs across this gene among 555 unrelated patients with paranoid schizophrenia and 567 unrelated healthy controls. Quantitative real-time PCR analysis was employed to quantify expression of MAOA mRNA in 73 drug-free patients. While none of these genotyped DNA markers showed allelic association with paranoid schizophrenia, haplotypic association was found for the VNTR-rs6323, VNTR-rs1137070, and VNTR-rs6323-rs1137070 haplotypes in female subjects. Nevertheless, no significant change of the expression of MAOA mRNA was detected in either female or male patients with paranoid schizophrenia. Our study suggests that the interaction between genetic variants within the MAOA gene may contribute to an increased risk of paranoid schizophrenia, but the precise mechanism needs further investigation. Copyright © 2011 Wiley Periodicals, Inc.

Transgenic rice plants expressing a Bacillus subtilis protoporphyrinogen oxidase gene are resistant to diphenyl ether herbicide oxyfluorfen.

PubMed

Lee, H J; Lee, S B; Chung, J S; Han, S U; Han, O; Guh, J O; Jeon, J S; An, G; Back, K

2000-06-01

Protoporphyrinogen oxidase (Protox), the penultimate step enzyme of the branch point for the biosynthetic pathway of Chl and hemes, is the target site of action of diphenyl ether (DPE) herbicides. However, Bacillus subtilis Protox is known to be resistant to the herbicides. In order to develop the herbicide-resistant plants, the transgenic rice plants were generated via expression of B. subtilis Protox gene under ubiquitin promoter targeted to the cytoplasm or to the plastid using Agrobacterium-mediated gene transformation. The integration and expression of the transgene were investigated at T0 generation by DNA and RNA blots. Most transgenic rice plants revealed one copy transgene insertion into the rice genome, but some with 3 copies. The expression levels of B. subtilis Protox mRNA appeared to correlate with the copy number. Furthermore, the plastidal transgenic lines exhibited much higher expression of the Protox mRNA than the cytoplasmic transgenic lines. The transgenic plants expressing the B. subtilis Protox gene at T0 generation were found to be resistant to oxyfluorfen when judged by cellular damage with respect to cellular leakage, Chl loss, and lipid peroxidation. The transgenic rice plants targeted to the plastid exhibited higher resistance to the herbicide than the transgenic plants targeted to the cytoplasm. In addition, possible resistance mechanisms in the transgenic plants to DPE herbicides are discussed.

Identification and statistical optimization of fermentation conditions for a newly isolated extracellular cholesterol oxidase-producing Streptomyces cavourensis strain NEAE-42.

PubMed

El-Naggar, Noura El-Ahmady; El-Shweihy, Nancy M; El-Ewasy, Sara M

2016-09-20

Due to broad range of clinical and industrial applications of cholesterol oxidase, isolation and screening of bacterial strains producing extracellular form of cholesterol oxidase is of great importance. One hundred and thirty actinomycete isolates were screened for their cholesterol oxidase activity. Among them, a potential culture, strain NEAE-42 is displayed the highest extracellular cholesterol oxidase activity. It was selected and identified as Streptomyces cavourensis strain NEAE-42. The optimization of different process parameters for cholesterol oxidase production by Streptomyces cavourensis strain NEAE-42 using Plackett-Burman experimental design and response surface methodology was carried out. Fifteen variables were screened using Plackett-Burman experimental design. Cholesterol, initial pH and (NH4)2SO4 were the most significant positive independent variables affecting cholesterol oxidase production. Central composite design was chosen to elucidate the optimal concentrations of the selected process variables on cholesterol oxidase production. It was found that, cholesterol oxidase production by Streptomyces cavourensis strain NEAE-42 after optimization process was 20.521U/mL which is higher than result obtained from the basal medium before screening process using Plackett-Burman (3.31 U/mL) with a fold of increase 6.19. The cholesterol oxidase level production obtained in this study (20.521U/mL) by the statistical method is higher than many of the reported values.

Engineering of electric field distribution in GaN(cap)/AlGaN/GaN heterostructures: theoretical and experimental studies

NASA Astrophysics Data System (ADS)

Gladysiewicz, M.; Janicki, L.; Misiewicz, J.; Sobanska, M.; Klosek, K.; Zytkiewicz, Z. R.; Kudrawiec, R.

2016-09-01

Polarization engineering of GaN-based heterostructures opens a way to develop advanced transistor heterostructures, although measurement of the electric field in such heterostructures is not a simple task. In this work, contactless electroreflectance (CER) spectroscopy has been applied to measure the electric field in GaN-based heterostructures. For a set of GaN(d  =  0, 5, 15, and 30 nm)/AlGaN(20 nm)/GaN(buffer) heterostructures a decrease of electric field in the GaN(cap) layer from 0.66 MV cm-1 to 0.27 MV cm-1 and an increase of the electric field in the AlGaN layer from 0.57 MV cm-1 to 0.99 MV cm-1 have been observed with the increase in the GaN(cap) thickness from 5-30 nm. For a set of GaN(20 nm)/AlGaN(d  =  10, 20, 30, and 40 nm)/GaN(buffer) heterostructures a decrease of the electric field in the AlGaN layer from 1.77 MV cm-1 to 0.64 MV cm-1 and an increase of the electric field in the GaN layer from 0.57 MV cm-1 to 0.99 MV cm-1 were observed with the increase in the AlGaN thickness from 10-40 nm. To determine the distribution of the electric field in these heterostructures the Schrödinger and Poisson equations are solved in a self-consistent manner and matched with experimental data. It is shown that the built-in electric field in the GaN(cap) and AlGaN layers obtained from measurements does not reach values of electric field resulting only from polarization effects. The measured electric fields are smaller due to a screening of polarization effects by free carriers, which are inhomogeneously distributed across the heterostructure and accumulate at interfaces. The results clearly demonstrate that CER measurements supported by theoretical calculations are able to determine the electric field distribution in GaN-based heterostructures quantitatively, which is very important for polarization engineering in this material system.

NADPH Oxidase-Dependent Signaling in Endothelial Cells: Role in Physiology and Pathophysiology

PubMed Central

Ushio-Fukai, Masuko; Malik, Asrar B.

2009-01-01

Abstract Reactive oxygen species (ROS) including superoxide (O2·−) and hydrogen peroxide (H2O2) are produced endogenously in response to cytokines, growth factors; G-protein coupled receptors, and shear stress in endothelial cells (ECs). ROS function as signaling molecules to mediate various biological responses such as gene expression, cell proliferation, migration, angiogenesis, apoptosis, and senescence in ECs. Signal transduction activated by ROS, “oxidant signaling,” has received intense investigation. Excess amount of ROS contribute to various pathophysiologies, including endothelial dysfunction, atherosclerosis, hypertension, diabetes, and acute respiratory distress syndrome (ARDS). The major source of ROS in EC is a NADPH oxidase. The prototype phagaocytic NADPH oxidase is composed of membrane-bound gp91phox and p22hox, as well as cytosolic subunits such as p47phox, p67phox and small GTPase Rac. In ECs, in addition to all the components of phagocytic NADPH oxidases, homologues of gp91phox (Nox2) including Nox1, Nox4, and Nox5 are expressed. The aim of this review is to provide an overview of the emerging area of ROS derived from NADPH oxidase and oxidant signaling in ECs linked to physiological and pathophysiological functions. Understanding these mechanisms may provide insight into the NADPH oxidase and oxidant signaling components as potential therapeutic targets. Antioxid. Redox Signal. 11, 791–810. PMID:18783313

Diversity and abundance of the arsenite oxidase gene aioA in geothermal areas of Tengchong, Yunnan, China.

PubMed

Jiang, Zhou; Li, Ping; Jiang, Dawei; Wu, Geng; Dong, Hailiang; Wang, Yanhong; Li, Bing; Wang, Yanxin; Guo, Qinghai

2014-01-01

A total of 12 samples were collected from the Tengchong geothermal areas of Yunnan, China, with the goal to assess the arsenite (AsIII) oxidation potential of the extant microbial communities as inferred by the abundance and diversity of the AsIII oxidase large subunit gene aioA relative to geochemical context. Arsenic concentrations were higher (on average 251.68 μg/L) in neutral or alkaline springs than in acidic springs (on average 30.88 μg/L). aioA abundance ranged from 1.63 × 10(1) to 7.08 × 10(3) per ng of DNA and positively correlated with sulfide and the ratios of arsenate (AsV):total dissolved arsenic (AsTot). Based on qPCR estimates of bacterial and archaeal 16S rRNA gene abundance, aioA-harboring organisms comprised as much as ~15% of the total community. Phylogenetically, the major aioA sequences (270 total) in the acidic hot springs (pH 3.3-4.4) were affiliated with Aquificales and Rhizobiales, while those in neutral or alkaline springs (pH 6.6-9.1) were inferred to be primarily bacteria related to Thermales and Burkholderiales. Interestingly, aioA abundance at one site greatly exceeded bacterial 16S rRNA gene abundance, suggesting these aioA genes were archaeal even though phylogenetically these aioA sequences were most similar to the Aquificales. In summary, this study described novel aioA sequences in geothermal features geographically far removed from those in the heavily studied Yellowstone geothermal complex.

Comparative in Silico Analysis of Ferric Reduction Oxidase (FRO) Genes Expression Patterns in Response to Abiotic Stresses, Metal and Hormone Applications.

PubMed

Muhammad, Izhar; Jing, Xiu-Qing; Shalmani, Abdullah; Ali, Muhammad; Yi, Shi; Gan, Peng-Fei; Li, Wen-Qiang; Liu, Wen-Ting; Chen, Kun-Ming

2018-05-12

The ferric reduction oxidase (FRO) gene family is involved in various biological processes widely found in plants and may play an essential role in metal homeostasis, tolerance and intricate signaling networks in response to a number of abiotic stresses. Our study describes the identification, characterization and evolutionary relationships of FRO genes families. Here, total 50 FRO genes in Plantae and 15 ‘FRO like’ genes in non-Plantae were retrieved from 16 different species. The entire FRO genes have been divided into seven clades according to close similarity in biological and functional behavior. Three conserved domains were common in FRO genes while in two FROs sub genome have an extra NADPH-Ox domain, separating the function of plant FROs. OsFRO1 and OsFRO7 genes were expressed constitutively in rice plant. Real-time RT-PCR analysis demonstrated that the expression of OsFRO1 was high in flag leaf, and OsFRO7 gene expression was maximum in leaf blade and flag leaf. Both genes showed vigorous expressions level in response to different abiotic and hormones treatments. Moreover, the expression of both genes was also substantial under heavy metal stresses. OsFRO1 gene expression was triggered following 6 h under Zn, Pb, Co and Ni treatments, whereas OsFRO7 gene expression under Fe, Pb and Ni after 12 h, Zn and Cr after 6 h, and Mn and Co after 3 h treatments. These findings suggest the possible involvement of both the genes under abiotic and metal stress and the regulation of phytohormones. Therefore, our current work may provide the foundation for further functional characterization of rice FRO genes family.

Structure–function characterization reveals new catalytic diversity in the galactose oxidase and glyoxal oxidase family

PubMed Central

Yin, DeLu (Tyler); Urresti, Saioa; Lafond, Mickael; Johnston, Esther M.; Derikvand, Fatemeh; Ciano, Luisa; Berrin, Jean-Guy; Henrissat, Bernard; Walton, Paul H.; Davies, Gideon J.; Brumer, Harry

2015-01-01

Alcohol oxidases, including carbohydrate oxidases, have a long history of research that has generated fundamental biological understanding and biotechnological applications. Despite a long history of study, the galactose 6-oxidase/glyoxal oxidase family of mononuclear copper-radical oxidases, Auxiliary Activity Family 5 (AA5), is currently represented by only very few characterized members. Here we report the recombinant production and detailed structure–function analyses of two homologues from the phytopathogenic fungi Colletotrichum graminicola and C. gloeosporioides, CgrAlcOx and CglAlcOx, respectively, to explore the wider biocatalytic potential in AA5. EPR spectroscopy and crystallographic analysis confirm a common active-site structure vis-à-vis the archetypal galactose 6-oxidase from Fusarium graminearum. Strikingly, however, CgrAlcOx and CglAlcOx are essentially incapable of oxidizing galactose and galactosides, but instead efficiently catalyse the oxidation of diverse aliphatic alcohols. The results highlight the significant potential of prospecting the evolutionary diversity of AA5 to reveal novel enzyme specificities, thereby informing both biology and applications. PMID:26680532

Copper radical oxidases and related extracellular oxidoreductases of wood-decay Agaricomycetes

Treesearch

Phil Kersten; Dan Cullen

2014-01-01

Extracellular peroxide generation, a key component of oxidative lignocellulose degradation, has been attributed to various enzymes including the copper radical oxidases. Encoded by a family of structurally related sequences, the genes are widely distributed among wood decay fungi including three recently completed polypore genomes. In all cases, core catalytic residues...

20-Hydroxyecdysone upregulates Atg genes to induce autophagy in the Bombyx fat body.

PubMed

Tian, Ling; Ma, Li; Guo, Enen; Deng, Xiaojuan; Ma, Sanyuan; Xia, Qingyou; Cao, Yang; Li, Sheng

2013-08-01

Autophagy is finely regulated at multiple levels and plays crucial roles in development and disease. In the fat body of the silkworm, Bombyx mori, autophagy occurs and Atg gene expression peaks during the nonfeeding molting and pupation stages when the steroid hormone (20-hydroxyecdysone; 20E) is high. Injection of 20E into the feeding larvae upregulated Atg genes and reduced TORC1 activity resulting in autophagy induction in the fat body. Conversely, RNAi knockdown of the 20E receptor partner (USP) or targeted overexpression of a dominant negative mutant of the 20E receptor (EcR (DN) ) in the larval fat body reduced autophagy and downregulated the Atg genes, confirming the importance of 20E-induction of Atg gene expression during pupation. Moreover, in vitro treatments of the larval fat body with 20E upregulated the Atg genes. Five Atg genes were potentially 20E primary-responsive, and a 20E response element was identified in the Atg1 (ortholog of human ULK1) promoter region. Furthermore, RNAi knockdown of 4 key genes (namely Br-C, E74, HR3 and βftz-F1) in the 20E-triggered transcriptional cascade reduced autophagy and downregulated Atg genes to different levels. Taken together, we conclude that in addition to blocking TORC1 activity for autophagosome initiation, 20E upregulates Atg genes to induce autophagy in the Bombyx fat body.

20-hydroxyecdysone upregulates Atg genes to induce autophagy in the Bombyx fat body

PubMed Central

Tian, Ling; Ma, Li; Guo, Enen; Deng, Xiaojuan; Ma, Sanyuan; Xia, Qingyou; Cao, Yang; Li, Sheng

2013-01-01

Autophagy is finely regulated at multiple levels and plays crucial roles in development and disease. In the fat body of the silkworm, Bombyx mori, autophagy occurs and Atg gene expression peaks during the nonfeeding molting and pupation stages when the steroid hormone (20-hydroxyecdysone; 20E) is high. Injection of 20E into the feeding larvae upregulated Atg genes and reduced TORC1 activity resulting in autophagy induction in the fat body. Conversely, RNAi knockdown of the 20E receptor partner (USP) or targeted overexpression of a dominant negative mutant of the 20E receptor (EcRDN) in the larval fat body reduced autophagy and downregulated the Atg genes, confirming the importance of 20E-induction of Atg gene expression during pupation. Moreover, in vitro treatments of the larval fat body with 20E upregulated the Atg genes. Five Atg genes were potentially 20E primary-responsive, and a 20E response element was identified in the Atg1 (ortholog of human ULK1) promoter region. Furthermore, RNAi knockdown of 4 key genes (namely Br-C, E74, HR3 and βftz-F1) in the 20E-triggered transcriptional cascade reduced autophagy and downregulated Atg genes to different levels. Taken together, we conclude that in addition to blocking TORC1 activity for autophagosome initiation, 20E upregulates Atg genes to induce autophagy in the Bombyx fat body. PMID:23674061

The rice dwarf virus P2 protein interacts with ent-kaurene oxidases in vivo, leading to reduced biosynthesis of gibberellins and rice dwarf symptoms.

PubMed

Zhu, Shifeng; Gao, Feng; Cao, Xuesong; Chen, Mao; Ye, Gongyin; Wei, Chunhong; Li, Yi

2005-12-01

The mechanisms of viral diseases are a major focus of biology. Despite intensive investigations, how a plant virus interacts with host factors to cause diseases remains poorly understood. The Rice dwarf virus (RDV), a member of the genus Phytoreovirus, causes dwarfed growth phenotypes in infected rice (Oryza sativa) plants. The outer capsid protein P2 is essential during RDV infection of insects and thus influences transmission of RDV by the insect vector. However, its role during RDV infection within the rice host is unknown. By yeast two-hybrid and coimmunoprecipitation assays, we report that P2 of RDV interacts with ent-kaurene oxidases, which play a key role in the biosynthesis of plant growth hormones gibberellins, in infected plants. Furthermore, the expression of ent-kaurene oxidases was reduced in the infected plants. The level of endogenous GA1 (a major active gibberellin in rice vegetative tissues) in the RDV-infected plants was lower than that in healthy plants. Exogenous application of GA3 to RDV-infected rice plants restored the normal growth phenotypes. These results provide evidence that the P2 protein of RDV interferes with the function of a cellular factor, through direct physical interactions, that is important for the biosynthesis of a growth hormone leading to symptom expression. In addition, the interaction between P2 and rice ent-kaurene oxidase-like proteins may decrease phytoalexin biosynthesis and make plants more competent for virus replication. Moreover, P2 may provide a novel tool to investigate the regulation of GA metabolism for plant growth and development.

Discovery and Characterization of a 5-Hydroxymethylfurfural Oxidase from Methylovorus sp. Strain MP688

PubMed Central

Dijkman, Willem P.

2014-01-01

In the search for useful and renewable chemical building blocks, 5-hydroxymethylfurfural (HMF) has emerged as a very promising candidate, as it can be prepared from sugars. HMF can be oxidized to 2,5-furandicarboxylic acid (FDCA), which is used as a substitute for petroleum-based terephthalate in polymer production. On the basis of a recently identified bacterial degradation pathway for HMF, candidate genes responsible for selective HMF oxidation have been identified. Heterologous expression of a protein from Methylovorus sp. strain MP688 in Escherichia coli and subsequent enzyme characterization showed that the respective gene indeed encodes an efficient HMF oxidase (HMFO). HMFO is a flavin adenine dinucleotide-containing oxidase and belongs to the glucose-methanol-choline-type flavoprotein oxidase family. Intriguingly, the activity of HMFO is not restricted to HMF, as it is active with a wide range of aromatic primary alcohols and aldehydes. The enzyme was shown to be relatively thermostable and active over a broad pH range. This makes HMFO a promising oxidative biocatalyst that can be used for the production of FDCA from HMF, a reaction involving both alcohol and aldehyde oxidations. PMID:24271187

Clinical, biochemical, and neuropsychiatric evaluation of a patient with a contiguous gene syndrome due to a microdeletion Xp11.3 including the Norrie disease locus and monoamine oxidase (MAOA and MAOB) genes.

PubMed

Collins, F A; Murphy, D L; Reiss, A L; Sims, K B; Lewis, J G; Freund, L; Karoum, F; Zhu, D; Maumenee, I H; Antonarakis, S E

1992-01-01

Norrie disease is a rare X-linked recessive disorder characterized by blindness from infancy. The gene for Norrie disease has been localized to Xp11.3. More recently, the genes for monoamine oxidase (MAOA, MAOB) have been mapped to the same region. This study evaluates the clinical, biochemical, and neuropsychiatric data in an affected male and 2 obligate heterozygote females from a single family with a submicroscopic deletion involving Norrie disease and MAO genes. The propositus was a profoundly retarded, blind male; he also had neurologic abnormalities including myoclonus and stereotopy-habit disorder. Both obligate carrier females had a normal IQ. The propositus' mother met diagnostic criteria for "chronic hypomania and schizotypal features." The propositus' MAO activity was undetectable and the female heterozygotes had reduced levels comparable to patients receiving MAO inhibiting antidepressants. MAO substrate and metabolite abnormalities were found in the propositus' plasma and CSF. This study indicates that subtle biochemical and possibly neuropsychiatric abnormalities may be detected in some heterozygotes with the microdeletion in Xp11.3 due to loss of the gene product for the MAO genes; this deletion can also explain some of the complex phenotype of this contiguous gene syndrome in the propositus.

Regulation of nitrite resistance of the cytochrome cbb3 oxidase by cytochrome c ScyA in Shewanella oneidensis

PubMed Central

Yin, Jianhua; Jin, Miao; Zhang, Haiyan; Ju, Lili; Zhang, Lili; Gao, Haichun

2015-01-01

Cytochrome c proteins, as enzymes to exchange electrons with substrates or as pure electron carriers to shuttle electrons, play vital roles in bacterial respiration and photosynthesis. In Shewanella oneidensis, a research model for the respiratory diversity, at least 42 c-type cytochromes are predicted to be encoded in the genome and are regarded to be the foundation of its highly branched electron transport pathways. However, only a small number of c-type cytochromes have been extensively studied. In this study, we identify soluble cytochrome c ScyA as an important factor influencing the nitrite resistance of a strain devoid of the bd oxidase by utilizing a newly developed transposon mutagenesis vector, which enables overexpression of the gene(s) downstream of the insertion site. We show that when in overabundance ScyA facilitates growth against nitrite inhibition by enhancing nitrite resistance of the cbb3 oxidase. Based on the data presented in this study, we suggest two possible mechanisms underlying the observed effect of ScyA: (1) ScyA increases electron flow to the cbb3 oxidase; (2) ScyA promotes nitrite resistance of the cbb3 oxidase, possibly by direct interaction. PMID:25417822

NADPH oxidase inhibitors: a patent review.

PubMed

Kim, Jung-Ae; Neupane, Ganesh Prasad; Lee, Eung Seok; Jeong, Byeong-Seon; Park, Byung Chul; Thapa, Pritam

2011-08-01

NADPH oxidases, a family of multi-subunit enzyme complexes, catalyze the production of reactive oxygen species (ROS), which may contribute to the pathogenesis of a variety of diseases. In addition to the first NADPH oxidase found in phagocytes, four non-phagocytic NADPH oxidase isoforms have been identified, which all differ in their catalytic subunit (Nox1-5) and tissue distribution. This paper provides a comprehensive review of the patent literature on NADPH oxidase inhibitors, small molecule Nox inhibitors, peptides and siRNAs. Since each member of the NADPH oxidase family has great potential as a therapeutic target, several different compounds have been registered as NADPH oxidase inhibitors in the patent literature. As yet, none have gone through clinical trials, and some have not completed preclinical trials, including safety and specificity evaluation. Recently, small molecule pyrazolopyridine and triazolopyrimidine derivatives have been submitted as potent NADPH oxidase inhibitors and reported as first-in-class inhibitors for idiopathic pulmonary fibrosis and acute stroke, respectively. Further clinical efficacy and safety data are warranted to prove their actual clinical utility.

Green revolution trees: semidwarfism transgenes modify gibberellins, promote root growth, enhance morphological diversity, and reduce competitiveness in hybrid poplar.

PubMed

Elias, Ani A; Busov, Victor B; Kosola, Kevin R; Ma, Cathleen; Etherington, Elizabeth; Shevchenko, Olga; Gandhi, Harish; Pearce, David W; Rood, Stewart B; Strauss, Steven H

2012-10-01

Semidwarfism has been used extensively in row crops and horticulture to promote yield, reduce lodging, and improve harvest index, and it might have similar benefits for trees for short-rotation forestry or energy plantations, reclamation, phytoremediation, or other applications. We studied the effects of the dominant semidwarfism transgenes GA Insensitive (GAI) and Repressor of GAI-Like, which affect gibberellin (GA) action, and the GA catabolic gene, GA 2-oxidase, in nursery beds and in 2-year-old high-density stands of hybrid poplar (Populus tremula × Populus alba). Twenty-nine traits were analyzed, including measures of growth, morphology, and physiology. Endogenous GA levels were modified in most transgenic events; GA(20) and GA(8), in particular, had strong inverse associations with tree height. Nearly all measured traits varied significantly among genotypes, and several traits interacted with planting density, including aboveground biomass, root-shoot ratio, root fraction, branch angle, and crown depth. Semidwarfism promoted biomass allocation to roots over shoots and substantially increased rooting efficiency with most genes tested. The increased root proportion and increased leaf chlorophyll levels were associated with changes in leaf carbon isotope discrimination, indicating altered water use efficiency. Semidwarf trees had dramatically reduced growth when in direct competition with wild-type trees, supporting the hypothesis that semidwarfism genes could be effective tools to mitigate the spread of exotic, hybrid, and transgenic plants in wild and feral populations.

Reduced polyphenol oxidase gene expression and enzymatic browning in potato (Solanum tuberosum L.) with artificial microRNAs.

PubMed

Chi, Ming; Bhagwat, Basdeo; Lane, W David; Tang, Guiliang; Su, Yinquan; Sun, Runcang; Oomah, B Dave; Wiersma, Paul A; Xiang, Yu

2014-03-11

Polyphenol oxidase (PPO), often encoded by a multi-gene family, causes oxidative browning, a significant problem in many food products. Low-browning potatoes were produced previously through suppression of PPO gene expression, but the contribution of individual PPO gene isoform to the oxidative browning process was unknown. Here we investigated the contributions of different PPO genes to total PPO protein activity, and the correlations between PPO protein level, PPO activity and tuber tissue browning potential by suppression of all previously characterized potato PPO genes, both individually and in combination using artificial microRNAs (amiRNAs) technology. Survey of the potato genome database revealed 9 PPO-like gene models, named StuPPO1 to StuPPO9 in this report. StuPPO1, StuPPO2, StuPPO3 and StuPPO4 are allelic to the characterized POTP1/P2, POT32, POT33 and POT72, respectively. Fewer ESTs were found to support the transcriptions of StuPPO5 to StuPPO8. StuPPO9 related ESTs were expressed at significant higher levels in pathogen-infected potato tissues. A series of browning phenotypes were obtained by suppressing StuPPO1 to StuPPO4 genes alone and in combination. Down-regulation of one or several of the PPO genes did not usually cause up-regulation of the other PPO genes in the transgenic potato tubers, but resulted in reduced PPO protein levels. The different PPO genes did not contribute equally to the total PPO protein content in the tuber tissues, with StuPPO2 accounting for ~ 55% as the major contributor, followed by StuPPO1, ~ 25-30% and StuPPO3 and StuPPO4 together with less than 15%. Strongly positive correlations between PPO protein level, PPO activity and browning potential were demonstrated in our analysis. Low PPO activity and low-browning potatoes were produced by simultaneous down-regulation of StuPPO2 to StuPPO4, but the greatest reduction occurred when StuPPO1 to StuPPO4 were all suppressed. StuPPO1 to StuPPO4 genes contributed to browning

Oxidase-functionalized Fe(3)O(4) nanoparticles for fluorescence sensing of specific substrate.

PubMed

Liu, Cheng-Hao; Tseng, Wei-Lung

2011-10-03

This study reports the development of a reusable, single-step system for the detection of specific substrates using oxidase-functionalized Fe(3)O(4) nanoparticles (NPs) as a bienzyme system and using amplex ultrared (AU) as a fluorogenic substrate. In the presence of H(2)O(2), the reaction pH between Fe(3)O(4) NPs and AU was similar to the reaction of oxidase and the substrate. The catalytic activity of Fe(3)O(4) NPs with AU was nearly unchanged following modification with poly(diallyldimethylammonium chloride) (PDDA). Based on these features, we prepared a composite of PDDA-modified Fe(3)O(4) NPs and oxidase for the quantification of specific substrates through the H(2)O(2)-mediated oxidation of AU. By monitoring fluorescence intensity at 587 nm of oxidized AU, the minimum detectable concentrations of glucose, galactose, and choline were found to be 3, 2, and 20 μM using glucose oxidase-Fe(3)O(4), galactose oxidase-Fe(3)O(4), and choline oxidase-Fe(3)O(4) composites, respectively. The identification of glucose in blood was selected as the model to validate the applicability of this proposed method. Copyright © 2011 Elsevier B.V. All rights reserved.

20 Gbit/s error free transmission with ~850 nm GaAs-based vertical cavity surface emitting lasers (VCSELs) containing InAs-GaAs submonolayer quantum dot insertions

NASA Astrophysics Data System (ADS)

Lott, J. A.; Shchukin, V. A.; Ledentsov, N. N.; Stinz, A.; Hopfer, F.; Mutig, A.; Fiol, G.; Bimberg, D.; Blokhin, S. A.; Karachinsky, L. Y.; Novikov, I. I.; Maximov, M. V.; Zakharov, N. D.; Werner, P.

2009-02-01

We report on the modeling, epitaxial growth, fabrication, and characterization of 830-845 nm vertical cavity surface emitting lasers (VCSELs) that employ InAs-GaAs quantum dot (QD) gain elements. The GaAs-based VCSELs are essentially conventional in design, grown by solid-source molecular beam epitaxy, and include top and bottom gradedheterointerface AlGaAs distributed Bragg reflectors, a single selectively-oxidized AlAs waveguiding/current funneling aperture layer, and a quasi-antiwaveguiding microcavity. The active region consists of three sheets of InAs-GaAs submonolayer insertions separated by AlGaAs matrix layers. Compared to QWs the InAs-GaAs insertions are expected to offer higher exciton-dominated modal gain and improved carrier capture and retention, thus resulting in superior temperature stability and resilience to degradation caused by operating at the larger switching currents commonly employed to increase the data rates of modern optical communication systems. We investigate the robustness and temperature performance of our QD VCSEL design by fabricating prototype devices in a high-frequency ground-sourceground contact pad configuration suitable for on-wafer probing. Arrays of VCSELs are produced with precise variations in top mesa diameter from 24 to 36 μm and oxide aperture diameter from 1 to 12 μm resulting in VCSELs that operate in full single-mode, single-mode to multi-mode, and full multi-mode regimes. The single-mode QD VCSELs have room temperature threshold currents below 0.5 mA and peak output powers near 1 mW, whereas the corresponding values for full multi-mode devices range from about 0.5 to 1.5 mA and 2.5 to 5 mW. At 20°C we observe optical transmission at 20 Gb/s through 150 m of OM3 fiber with a bit error ratio better than 10-12, thus demonstrating the great potential of our QD VCSELs for applications in next-generation short-distance optical data communications and interconnect systems.

[Relationship between the Fnu4HI site polymorphism of monoamine oxidase A gene and Parkinson's disease].

PubMed

Jiang, Xiao-hua; Yang, Hui; Yang, Jing-fang; Dong, Xiu-min; Xu, Qun-yuan; Chen, Biao

2003-06-01

To study the association between the polymorphism of human monoamine oxidase type A (MAO-A) gene and Parkinson's disease(PD). Fnu4HI restriction fragment length polymorphism(RFLP) and PCR-RFLP were used to detect the mutation of MAO-A gene. The frequencies of alleles and genotypes at the MAO-A Fnu4HI locus on the X chromosome in different PD group were compared with those of the control group. It was found that the frequencies of G allele in the patients with PD and controls were 0.613 and 0.527 respectively, P=0.039 "the frequencies of TT genotype were 0.303 and 0.415(P=0.014), and the frequencies of GG genotype were 0.564 and 0.451 respectively(P=0.021). When the patients were divided into two groups by age-onset, significant difference in the allelic and genotypic frequencies was observed only between early-onset PD group and control group. And when the PD patients were grouped by sex, significant difference was observed only between male PD group and male control group (the frequencies of G allele being 0.669 and 0.500 respectively, P=0.005). This study revealed significant differences between PD group and control group in allelic and genotypic frequencies. The findings supported the hypothesis about an association between MAO-A gene and PD, suggesting that age at onset of PD and gender predisposition might be related to the putative association, and Fnu4HI SNP be a risk factor for PD.

The wheat cytochrome oxidase subunit II gene has an intron insert and three radical amino acid changes relative to maize

PubMed Central

Bonen, Linda; Boer, Poppo H.; Gray, Michael W.

1984-01-01

We have determined the sequence of the wheat mitochondrial gene for cytochrome oxidase subunit II (COII) and find that its derived protein sequence differs from that of maize at only three amino acid positions. Unexpectedly, all three replacements are non-conservative ones. The wheat COII gene has a highly-conserved intron at the same position as in maize, but the wheat intron is 1.5 times longer because of an insert relative to its maize counterpart. Hybridization analysis of mitochondrial DNA from rye, pea, broad bean and cucumber indicates strong sequence conservation of COII coding sequences among all these higher plants. However, only rye and maize mitochondrial DNA show homology with wheat COII intron sequences and rye alone with intron-insert sequences. We find that a sequence identical to the region of the 5' exon corresponding to the transmembrane domain of the COII protein is present at a second genomic location in wheat mitochondria. These variations in COII gene structure and size, as well as the presence of repeated COII sequences, illustrate at the DNA sequence level, factors which contribute to higher plant mitochondrial DNA diversity and complexity. ImagesFig. 3.Fig. 4.Fig. 5. PMID:16453565

Characterization of three bioenergetically active respiratory terminal oxidases in the cyanobacterium Synechocystis sp. strain PCC 6803.

PubMed

Pils, D; Schmetterer, G

2001-09-25

Synechocystis sp. PCC 6803 contains three respiratory terminal oxidases (RTOs): cytochrome c oxidase (Cox), quinol oxidase (Cyd), and alternate RTO (ARTO). Mutants lacking combinations of the RTOs were used to characterize these key enzymes of respiration. Pentachlorophenol and 2-heptyl-4-hydroxy-quinoline-N-oxide inhibited Cyd completely, but had little effect on electron transport to the other RTOs. KCN inhibited all three RTOs but the in vivo K(I) for Cox and Cyd was quite different (7 vs. 27 microM), as was their affinity for oxygen (K(M) 1.0 vs. 0.35 microM). ARTO has a very low respiratory activity. However, when uptake of 3-O-methylglucose, an active H+ co-transport, was used to monitor energization of the cytoplasmic membrane, ARTO was similarly effective as the other RTOs. As removal of the gene for cytochrome c(553) had the same effects as removal of ARTO genes, we propose that the ARTO might be a second Cox. The possible functions, localization and regulation of the RTOs are discussed.

The Rice Dwarf Virus P2 Protein Interacts with ent-Kaurene Oxidases in Vivo, Leading to Reduced Biosynthesis of Gibberellins and Rice Dwarf Symptoms1

PubMed Central

Zhu, Shifeng; Gao, Feng; Cao, Xuesong; Chen, Mao; Ye, Gongyin; Wei, Chunhong; Li, Yi

2005-01-01

The mechanisms of viral diseases are a major focus of biology. Despite intensive investigations, how a plant virus interacts with host factors to cause diseases remains poorly understood. The Rice dwarf virus (RDV), a member of the genus Phytoreovirus, causes dwarfed growth phenotypes in infected rice (Oryza sativa) plants. The outer capsid protein P2 is essential during RDV infection of insects and thus influences transmission of RDV by the insect vector. However, its role during RDV infection within the rice host is unknown. By yeast two-hybrid and coimmunoprecipitation assays, we report that P2 of RDV interacts with ent-kaurene oxidases, which play a key role in the biosynthesis of plant growth hormones gibberellins, in infected plants. Furthermore, the expression of ent-kaurene oxidases was reduced in the infected plants. The level of endogenous GA1 (a major active gibberellin in rice vegetative tissues) in the RDV-infected plants was lower than that in healthy plants. Exogenous application of GA3 to RDV-infected rice plants restored the normal growth phenotypes. These results provide evidence that the P2 protein of RDV interferes with the function of a cellular factor, through direct physical interactions, that is important for the biosynthesis of a growth hormone leading to symptom expression. In addition, the interaction between P2 and rice ent-kaurene oxidase-like proteins may decrease phytoalexin biosynthesis and make plants more competent for virus replication. Moreover, P2 may provide a novel tool to investigate the regulation of GA metabolism for plant growth and development. PMID:16299167

Complete mitochondrial genome of Zeugodacus tau (Insecta: Tephritidae) and differentiation of Z. tau species complex by mitochondrial cytochrome c oxidase subunit I gene

PubMed Central

Yong, Hoi-Sen; Lim, Phaik-Eem; Eamsobhana, Praphathip

2017-01-01

The tephritid fruit fly Zeugodacus tau (Walker) is a polyphagous fruit pest of economic importance in Asia. Studies based on genetic markers indicate that it forms a species complex. We report here (1) the complete mitogenome of Z. tau from Malaysia and comparison with that of China as well as the mitogenome of other congeners, and (2) the relationship of Z. tau taxa from different geographical regions based on sequences of cytochrome c oxidase subunit I gene. The complete mitogenome of Z. tau had a total length of 15631 bp for the Malaysian specimen (ZT3) and 15835 bp for the China specimen (ZT1), with similar gene order comprising 37 genes (13 protein-coding genes—PCGs, 2 rRNA genes, and 22 tRNA genes) and a non-coding A + T-rich control region (D-loop). Based on 13 PCGs and 15 mt-genes, Z. tau NC_027290 (China) and Z. tau ZT1 (China) formed a sister group in the lineage containing also Z. tau ZT3 (Malaysia). Phylogenetic analysis based on partial sequences of cox1 gene indicates that the taxa from China, Japan, Laos, Malaysia, Bangladesh, India, Sri Lanka, and Z. tau sp. A from Thailand belong to Z. tau sensu stricto. A complete cox1 gene (or 13 PCGs or 15 mt-genes) instead of partial sequence is more appropriate for determining phylogenetic relationship. PMID:29216281

[Activation of the alternative oxidase of Yarrowia lipolytica by adenosine 5'-monophosphate].

PubMed

Medentsev, A G; Arinbasarova, A Iu; Smirnova, N M; Akimenko, V K

2004-01-01

The study of the effect of nucleoside phosphates on the activity of cyanide-resistant oxidase in the mitochondria and the submitochondrial particles of Yarrowia lipolytica showed that adenosine monophosphate (5'-AMP, AMP) did not stimulate the respiration of the intact mitochondria. The incubation of the mitochondria at room temperature (25 degrees C) for 3-5 h or their treatment with ultrasound, phospholipase A, and detergent Triton X-100 at a low temperature inactivated the cyanide-resistant alternative oxidase. The inactivated alternative oxidase could be reactivated by AMP. The reactivating effect of AMP was enhanced by azolectin. Some other nucleoside phosphates also showed reactivating ability in the following descending order. AMP = GMP > GDP > GTP > XMP > IMP. The apparent reaction rate constant Km for AMP upon the reactivation of the alternative oxidase of mitochondria treated with Triton X-100 or incubated at 25 degrees C was 12.5 and 20 microM, respectively. The Km for AMP upon the reactivation of the alternative oxidase of submitochondrial particles was 15 microM. During the incubation of yeast cells under conditions promoting the development of alternative oxidase, the content of adenine nucleotides (AMP, ADP, and ATP) in the cells and their respiration tended to decrease. The subsequent addition of cyanide to the cells activated their respiration, diminished the intracellular content of ATP three times, and augmented the content of AMP five times. These data suggest that the stimulation of cell respiration by cyanide may be due to the activation of alternative oxidase by AMP.

RBM20 Regulates Circular RNA Production From the Titin Gene.

PubMed

Khan, Mohsin A F; Reckman, Yolan J; Aufiero, Simona; van den Hoogenhof, Maarten M G; van der Made, Ingeborg; Beqqali, Abdelaziz; Koolbergen, Dave R; Rasmussen, Torsten B; van der Velden, Jolanda; Creemers, Esther E; Pinto, Yigal M

2016-10-14

RNA-binding motif protein 20 (RBM20) is essential for normal splicing of many cardiac genes, and loss of RBM20 causes dilated cardiomyopathy. Given its role in splicing, we hypothesized an important role for RBM20 in forming circular RNAs (circRNAs), a novel class of noncoding RNA molecules. To establish the role of RBM20 in the formation of circRNAs in the heart. Here, we performed circRNA profiling on ribosomal depleted RNA from human hearts and identified the expression of thousands of circRNAs, with some of them regulated in disease. Interestingly, we identified 80 circRNAs to be expressed from the titin gene, a gene that is known to undergo highly complex alternative splicing. We show that some of these circRNAs are dynamically regulated in dilated cardiomyopathy but not in hypertrophic cardiomyopathy. We generated RBM20-null mice and show that they completely lack these titin circRNAs. In addition, in a cardiac sample from an RBM20 mutation carrier, titin circRNA production was severely altered. Interestingly, the loss of RBM20 caused only a specific subset of titin circRNAs to be lost. These circRNAs originated from the RBM20-regulated I-band region of the titin transcript. We show that RBM20 is crucial for the formation of a subset of circRNAs that originate from the I-band of the titin gene. We propose that RBM20, by excluding specific exons from the pre-mRNA, provides the substrate to form this class of RBM20-dependent circRNAs. © 2016 American Heart Association, Inc.

[Involvement of hydrogen peroxide in the regulation of coexpression of alternative oxidase and rotenone-insensitive NADH dehydrogenase in tomato leaves and calluses].

PubMed

Eprintsev, A T; Mal'tseva, E V; Shatskikh, A S; Popov, V N

2011-01-01

The involvement of active oxygen forms in the regulation of the expression of mitochondrial respiratory chain components, which are not related to energy storing, has been in vitro and in vivo studied in Lycopersicum esculentum L. The highest level of transcription of genes encoding alternative oxidase and NADH dehydrogenase has been observed in green tomato leaves. It has been shown that even low H2O2 concentrations activate both aoxlalpha and ndb1 genes, encoding alternative oxidase and external mitochondrial rotenone-insensitive NADH dehydrogenase, respectively. According to our results, in the case of an oxidative stress, alternative oxidase and NADH dehydrogenase are coexpressed in tomato plant tissues, and active oxygen forms serve as the secondary messengers of their coexpression.

Mutations in the SURF1 gene associated with Leigh syndrome and cytochrome C oxidase deficiency.

PubMed

Péquignot, M O; Dey, R; Zeviani, M; Tiranti, V; Godinot, C; Poyau, A; Sue, C; Di Mauro, S; Abitbol, M; Marsac, C

2001-05-01

Cytochrome c oxidase (COX) deficiency is one of the major causes of Leigh Syndrome (LS), a fatal encephalopathy of infancy or childhood, characterized by symmetrical lesions in the basal ganglia and brainstem. Mutations in the nuclear genes encoding COX subunits have not been found in patients with LS and COX deficiency, but mutations have been identified in SURF1. SURF1 encodes a factor involved in COX biogenesis. To date, 30 different mutations have been reported in 40 unrelated patients. We aim to provide an overview of all known mutations in SURF1, and to propose a common nomenclature. Twelve of the mutations were insertion/deletion mutations in exons 1, 4, 6, 8, and 9; 10 were missense/nonsense mutations in exons 2, 4, 5, 7, and 8; and eight were detected at splicing sites in introns 3 to 7. The most frequent mutation was 312_321del 311_312insAT which was found in 12 patients out of 40. Twenty mutations have been described only once. We also list all polymorphisms discovered to date. Copyright 2001 Wiley-Liss, Inc.

Association of the g.19074G>A genetic variant in the osteoprotegerin gene with bone mineral density in Chinese postmenopausal women.

PubMed

Zhang, Y D; Zhang, Z; Zhou, N F; Jia, W T; Cheng, X G; Wei, X J

2014-08-28

Primary osteoporosis is a common health problem in postmenopausal women. This study aimed to detect the association of the g.19074G>A genetic variant in the osteoprotegerin gene (OPG) with bone mineral density (BMD) and primary osteoporosis. The created restriction site-polymerase chain reaction method was used to investigate the g.19074G>A genetic variant. The BMD of the femoral neck hip, lumbar spine (L2-4), and total hip were assessed by dual-energy X-ray absorptiometry (DEXA) in 856 unrelated Chinese postmenopausal women. We found significant differences in the BMDs of the femoral neck hip, lumbar spine (L2-4), and total hip among different genotypes; individuals with the GG genotype had significantly higher BMDs than those with the GA and AA genotypes (P < 0.05). Our results indicated that the A allele was an increased risk factor for primary osteoporosis and the g.19074G>A genetic variant of the OPG gene was associated with BMD and primary osteoporosis in Chinese postmenopausal women.

JcDREB2, a Physic Nut AP2/ERF Gene, Alters Plant Growth and Salinity Stress Responses in Transgenic Rice.

PubMed

Tang, Yuehui; Liu, Kun; Zhang, Ju; Li, Xiaoli; Xu, Kedong; Zhang, Yi; Qi, Jing; Yu, Deshui; Wang, Jian; Li, Chengwei

2017-01-01

Transcription factors of the AP2/ERF family play important roles in plant growth, development, and responses to biotic and abiotic stresses. In this study, a physic nut AP2/ERF gene, JcDREB2 , was functionally characterized. Real-time PCR analysis revealed that JcDREB2 was expressed mainly in the leaf and could be induced by abscisic acid but suppressed by gibberellin (GA) and salt. Transient expression of a JcDREB2-YFP fusion protein in Arabidopsis protoplasts cells suggested that JcDREB2 is localized in the nucleus. Rice plants overexpressing JcDREB2 exhibited dwarf and GA-deficient phenotypes with shorter shoots and roots than those of wild-type plants. The dwarfism phenotype could be rescued by the application of exogenous GA 3 . The expression levels of GA biosynthetic genes including OsGA20ox1 , OsGA20ox2 , OsGA20ox4 , OsGA3ox2, OsCPS1 , OsKO2 , and OsKAO were significantly reduced in plants overexpressing JcDREB2 . Overexpression of JcDREB2 in rice increased sensitivity to salt stress. Increases in the expression levels of several salt-tolerance-related genes in response to salt stress were impaired in JcDREB2 -overexpressing plants. These results demonstrated not only that JcDREB2 influences GA metabolism, but also that it can participate in the regulation of the salt stress response in rice.

Heterologous expression of the Crassostrea gigas (Pacific oyster) alternative oxidase in the yeast Saccharomyces cerevisiae.

PubMed

Robertson, Aaron; Schaltz, Kyle; Neimanis, Karina; Staples, James F; McDonald, Allison E

2016-10-01

Alternative oxidase (AOX) is a terminal oxidase within the inner mitochondrial membrane (IMM) present in many organisms where it functions in the electron transport system (ETS). AOX directly accepts electrons from ubiquinol and is therefore capable of bypassing ETS Complexes III and IV. The human genome does not contain a gene coding for AOX, so AOX expression has been suggested as a gene therapy for a range of human mitochondrial diseases caused by genetic mutations that render Complex III and/or IV dysfunctional. An effective means of screening mutations amenable to AOX treatment remains to be devised. We have generated such a tool by heterologously expressing AOX from the Pacific oyster (Crassostrea gigas) in the yeast Saccharomyces cerevisiae under the control of a galactose promoter. Our results show that this animal AOX is monomeric and is correctly targeted to yeast mitochondria. Moreover, when expressed in yeast, Pacific oyster AOX is a functional quinol oxidase, conferring cyanide-resistant growth and myxothiazol-resistant oxygen consumption to yeast cells and isolated mitochondria. This system represents a high-throughput screening tool for determining which Complex III and IV genetic mutations in yeast will be amenable to AOX gene therapy. As many human genes are orthologous to those found in yeast, our invention represents an efficient and cost-effective way to evaluate viable research avenues. In addition, this system provides the opportunity to learn more about the localization, structure, and regulation of AOXs from animals that are not easily reared or manipulated in the lab.

Association of -604G/A and -501A/C Ghrelin and Obestatin Prepropeptide Gene Polymorphisms with Polycystic Ovary Syndrome.

PubMed

Ghaleh, Talaat Dabbaghi; Skandari, Somayeh Saadat; Najafipour, Reza; Rashvand, Zahra; Darabi, Masoud; Sahmani, Mehdi

2018-04-01

Ghrelin hormone has an important role in a wide range of metabolic and non-metabolic processes. Polymorphisms of ghrelin gene could be associated with a large number of diseases. The aim of this study was to evaluate the association of -604G/A and -501A/C polymorphisms in ghrelin and obestatin prepropeptide gene (GHRL) with polycystic ovary syndrome (PCOS) in a sample of Iranian women. One hundred and fifty-two women with PCOS and 162 age-matched apparently healthy women as control group were enrolled in this study. The study subjects were genotyped for polymorphisms in the ghrelin gene using polymerase chain reaction-restriction fragment length polymorphism-based methods. Biochemical parameters, serum prolactin, luteinizing hormone, follicle stimulating hormone, estradiol, and testosterone were estimated by chemiluminescence assay. Serum lipids and lipoproteins were determined by standard enzymatic methods. The association between the risk of PCOS and ghrelin gene polymorphisms was examined using Multivariate analysis. The frequency of the -604G/A and -501A/C polymorphisms was not statistically different between patients and the control group of women (p = 0.12 and p = 0.21, respectively). A significantly higher level of LDL-C was found in the wild-type AA genotype compared with CC genotype of -501A/C polymorphism (p = 0.02). Our findings indicate that neither -604G/A and nor -501A/C polymorphisms of ghrelin gene are associated with PCOS, but suggest a relation between the presence of polymorphic allele of -501A/C polymorphism and LDL-C level in a sample of Iranian women.

Norrie disease gene is distinct from the monoamine oxidase genes.

PubMed

Sims, K B; Ozelius, L; Corey, T; Rinehart, W B; Liberfarb, R; Haines, J; Chen, W J; Norio, R; Sankila, E; de la Chapelle, A

1989-09-01

The genes for MAO-A and MAO-B appear to be very close to the Norrie disease gene, on the basis of loss and/or disruption of the MAO genes and activities in atypical Norrie disease patients deleted for the DXS7 locus; linkage among the MAO genes, the Norrie disease gene, and the DXS7 locus; and mapping of all these loci to the chromosomal region Xp11. The present study provides evidence that the MAO genes are not disrupted in "classic" Norrie disease patients. Genomic DNA from these "nondeletion" Norrie disease patients did not show rearrangements at the MAOA or DXS7 loci. Normal levels of MAO-A activities, as well as normal amounts and size of the MAO-A mRNA, were observed in cultured skin fibroblasts from these patients, and MAO-B activity in their platelets was normal. Catecholamine metabolites evaluated in plasma and urine were in the control range. Thus, although some atypical Norrie disease patients lack both MAO-A and MAO-B activities, MAO does not appear to be an etiologic factor in classic Norrie disease.

Polarization compensation at low p-GaN doping density in InGaN/GaN p-i-n solar cells: Effect of InGaN interlayers

NASA Astrophysics Data System (ADS)

Saini, Basant; Adhikari, Sonachand; Pal, Suchandan; Kapoor, Avinsahi

2017-07-01

The effectiveness of polarization matching layer (PML) between i-InGaN/p-GaN is studied numerically for Ga-face InGaN/GaN p-i-n solar cell at low p-GaN doping (∼5e17 cm-3). The simulations are performed for four InxGa1-xN/GaN heterostructures (x = 10%, 15%, 20% and 25%), thus investigating the impact of PML for low as well as high indium containing absorber regions. Use of PML presents a suitable alternative to counter the effects of polarization-induced electric fields arising at low p-GaN doping density especially for absorber regions with high indium (>10%). It is seen that it not only mitigates the negative effects of polarization-induced electric fields but also reduces the high potential barriers existing at i-InGaN/p-GaN heterojunction. The improvement in photovoltaic properties of the heterostructures even at low p-GaN doping validates this claim.

Whole Genome Association Mapping of Plant Height in Winter Wheat (Triticum aestivum L.)

PubMed Central

Zanke, Christine D.; Ling, Jie; Plieske, Jörg; Kollers, Sonja; Ebmeyer, Erhard; Korzun, Viktor; Argillier, Odile; Stiewe, Gunther; Hinze, Maike; Neumann, Kerstin; Ganal, Martin W.; Röder, Marion S.

2014-01-01

The genetic architecture of plant height was investigated in a set of 358 recent European winter wheat varieties plus 14 spring wheat varieties based on field data in eight environments. Genotyping of diagnostic markers revealed the Rht-D1b mutant allele in 58% of the investigated varieties, while the Rht-B1b mutant was only present in 7% of the varieties. Rht-D1 was significantly associated with plant height by using a mixed linear model and employing a kinship matrix to correct for population stratification. Further genotyping data included 732 microsatellite markers, resulting in 770 loci, of which 635 markers were placed on the ITMI map plus a set of 7769 mapped SNP markers genotyped with the 90 k iSELECT chip. When Bonferroni correction was applied, a total of 153 significant marker-trait associations (MTAs) were observed for plant height and the SSR markers (−log10 (P-value) ≥4.82) and 280 (−log10 (P-value) ≥5.89) for the SNPs. Linear regression between the most effective markers and the BLUEs for plant height indicated additive effects for the MTAs of different chromosomal regions. Analysis of syntenic regions in the rice genome revealed closely linked rice genes related to gibberellin acid (GA) metabolism and perception, i.e. GA20 and GA2 oxidases orthologous to wheat chromosomes 1A, 2A, 3A, 3B, 5B, 5D and 7B, ent-kaurenoic acid oxidase orthologous to wheat chromosome 7A, ent-kaurene synthase on wheat chromosome 2B, as well as GA-receptors like DELLA genes orthologous to wheat chromosomes 4B, 4D and 7A and genes of the GID family orthologous to chromosomes 2B and 5B. The data indicated that besides the widely used GA-insensitive dwarfing genes Rht-B1 and Rht-D1 there is a wide spectrum of loci available that could be used for modulating plant height in variety development. PMID:25405621

Targeting NADPH oxidases in vascular pharmacology

PubMed Central

Schramm, Agata; Matusik, Paweł; Osmenda, Grzegorz; Guzik, Tomasz J

2012-01-01

Oxidative stress is a molecular dysregulation in reactive oxygen species (ROS) metabolism, which plays a key role in the pathogenesis of atherosclerosis, vascular inflammation and endothelial dysfunction. It is characterized by a loss of nitric oxide (NO) bioavailability. Large clinical trials such as HOPE and HPS have not shown a clinical benefit of antioxidant vitamin C or vitamin E treatment, putting into question the role of oxidative stress in cardiovascular disease. A change in the understanding of the molecular nature of oxidative stress has been driven by the results of these trials. Oxidative stress is no longer perceived as a simple imbalance between the production and scavenging of ROS, but as a dysfunction of enzymes involved in ROS production. NADPH oxidases are at the center of these events, underlying the dysfunction of other oxidases including eNOS uncoupling, xanthine oxidase and mitochondrial dysfunction. Thus NADPH oxidases are important therapeutic targets. Indeed, HMG-CoA reductase inhibitors (statins) as well as drugs interfering with the renin-angiotensin-aldosterone system inhibit NADPH oxidase activation and expression. Angiotensin-converting enzyme (ACE) inhibitors, AT1 receptor antagonists (sartans) and aliskiren, as well as spironolactone or eplerenone, have been discussed. Molecular aspects of NADPH oxidase regulation must be considered, while thinking about novel pharmacological targeting of this family of enzymes consisting of several homologs Nox1, Nox2, Nox3, Nox4 and Nox5 in humans. In order to properly design trials of antioxidant therapies, we must develop reliable techniques for the assessment of local and systemic oxidative stress. Classical antioxidants could be combined with novel oxidase inhibitors. In this review, we discuss NADPH oxidase inhibitors such as VAS2870, VAS3947, GK-136901, S17834 or plumbagin. Therefore, our efforts must focus on generating small molecular weight inhibitors of NADPH oxidases, allowing the

Norrie disease gene is distinct from the monoamine oxidase genes

PubMed Central

Sims, Katherine B.; Ozelius, Laurie; Corey, Timothy; Rinehart, William B.; Liberfarb, Ruth; Haines, Jonathan; Chen, Wei Jane; Norio, Reijo; Sankila, Eeva; de la Chapelle, Albert; Murphy, Dennis L.; Gusella, James; Breakefield, Xandra O.

1989-01-01

The genes for MAO-A and MAO-B appear to be very close to the Norrie disease gene, on the basis of loss and /or disruption of the MAO genes and activities in atypical Norrie disease patients deleted for the DXS7 locus; linkage among the MAO genes, the Norrie disease gene, and the DXS7 locus; and mapping of all these loci to the chromosomal region Xp11. The present study provides evidence that the MAO genes are not disrupted in “classic” Norrie disease patients. Genomic DNA from these “nondeletion” Norrie disease patients did not show rearrangements at the MAOA or DXS7 loci. Normal levels of MAO-A activities, as well as normal amounts and size of the MAO-A mRNA, were observed in cultured skin fibroblasts from these patients, and MAO-B activity in their platelets was normal. Catecholamine metabolites evaluated in plasma and urine were in the control range. Thus, although some atypical Norrie disease patients lack both MAO-A and MAO-B activities, MAO does not appear to be an etiologic factor in classic Norrie disease. ImagesFigure 2Figure 3 PMID:2773935

Growth kinetics and structural perfection of (InN){sub 1}/(GaN){sub 1–20} short-period superlattices on +c-GaN template in dynamic atomic layer epitaxy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kusakabe, Kazuhide; Hashimoto, Naoki; Wang, Ke

2016-04-11

The growth kinetics and structural perfection of (InN){sub 1}/(GaN){sub 1–20} short-period superlattices (SPSs) were investigated with their application to ordered alloys in mind. The SPSs were grown on +c-GaN template at 650 °C by dynamic atomic layer epitaxy in conventional plasma-assisted molecular beam epitaxy. It was found that coherent structured InN/GaN SPSs could be fabricated when the thickness of the GaN barrier was 4 ML or above. Below 3 ML, the formation of SPSs was quite difficult owing to the increased strain in the SPS structure caused by the use of GaN as a template. The effective or average In composition of themore » (InN){sub 1}/(GaN){sub 4} SPSs was around 10%, and the corresponding InN coverage in the ∼1 ML-thick InN wells was 50%. It was found that the effective InN coverage in ∼1 ML-thick InN wells could be varied with the growth conditions. In fact, the effective In composition could be increased up to 13.5%, i.e., the corresponding effective InN coverage was about 68%, by improving the capping/freezing speed by increasing the growth rate of the GaN barrier layer.« less

Ovary-derived precursor gibberellin A9 is essential for female flower development in cucumber.

PubMed

Pimenta Lange, Maria João; Lange, Theo

2016-12-01

Gibberellins (GAs) are hormones that control many aspects of plant development, including flowering. It is well known that stamen is the source of GAs that regulate male and bisexual flower development. However, little is known about the role of GAs in female flower development. In cucumber, high levels of GA precursors are present in ovaries and high levels of bioactive GA 4 are identified in sepals/petals, reflecting the expression of GA 20-oxidase and 3-oxidase in these organs, respectively. Here, we show that the biologically inactive precursor GA 9 moves from ovaries to sepal/petal tissues where it is converted to the bioactive GA 4 necessary for female flower development. Transient expression of a catabolic GA 2-oxidase from pumpkin in cucumber ovaries decreases GA 9 and GA 4 levels and arrests the development of female flowers, and this can be restored by application of GA 9 to petals thus confirming its function. Given that bioactive GAs can promote sex reversion of female flowers, movement of biologically inactive precursors, instead of the hormone itself, might help to maintain floral organ identity, ensuring fruit and seed production. © 2016. Published by The Company of Biologists Ltd.

Complementary DNA cloning of the pear 1-aminocyclopropane-1-carboxylic acid oxidase gene and agrobacterium-mediated anti-sense genetic transformation.

PubMed

Qi, Jing; Dong, Zhen; Zhang, Yu-Xing

2015-12-01

The aim of the present study was to genetically modify plantlets of the Chinese yali pear to reduce their expression of ripening-associated 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) and therefore increase the shelf-life of the fruit. Primers were designed with selectivity for the conserved regions of published ACO gene sequences, and yali complementary DNA (cDNA) cloning was performed by reverse transcription quantitative polymerase chain reaction (PCR). The obtained cDNA fragment contained 831 base pairs, encoding 276 amino acid residues, and shared no less than 94% nucleotide sequence identity with other published ACO genes. The cDNA fragment was inversely inserted into a pBI121 expression vector, between the cauliflower mosaic virus 35S promoter and the nopaline synthase terminator, in order to construct the anti‑sense expression vector of the ACO gene; it was transfected into cultured yali plants using Agrobacterium LBA4404. Four independent transgenic lines of pear plantlets were obtained and validated by PCR analysis. A Southern blot assay revealed that there were three transgenic lines containing a single copy of exogenous gene and one line with double copies. The present study provided germplasm resources for the cultivation of novel storage varieties of pears, therefore providing a reference for further applications of anti‑sense RNA technology in the genetic improvement of pears and other fruit.

SZGR 2.0: a one-stop shop of schizophrenia candidate genes

PubMed Central

Jia, Peilin; Han, Guangchun; Zhao, Junfei; Lu, Pinyi; Zhao, Zhongming

2017-01-01

SZGR 2.0 is a comprehensive resource of candidate variants and genes for schizophrenia, covering genetic, epigenetic, transcriptomic, translational and many other types of evidence. By systematic review and curation of multiple lines of evidence, we included almost all variants and genes that have ever been reported to be associated with schizophrenia. In particular, we collected ∼4200 common variants reported in genome-wide association studies, ∼1000 de novo mutations discovered by large-scale sequencing of family samples, 215 genes spanning rare and replication copy number variations, 99 genes overlapping with linkage regions, 240 differentially expressed genes, 4651 differentially methylated genes and 49 genes as antipsychotic drug targets. To facilitate interpretation, we included various functional annotation data, especially brain eQTL, methylation QTL, brain expression featured in deep categorization of brain areas and developmental stages and brain-specific promoter and enhancer annotations. Furthermore, we conducted cross-study, cross-data type and integrative analyses of the multidimensional data deposited in SZGR 2.0, and made the data and results available through a user-friendly interface. In summary, SZGR 2.0 provides a one-stop shop of schizophrenia variants and genes and their function and regulation, providing an important resource in the schizophrenia and other mental disease community. SZGR 2.0 is available at https://bioinfo.uth.edu/SZGR/. PMID:27733502

Sequence conservation from human to prokaryotes of Surf1, a protein involved in cytochrome c oxidase assembly, deficient in Leigh syndrome.

PubMed

Poyau, A; Buchet, K; Godinot, C

1999-12-03

The human SURF1 gene encoding a protein involved in cytochrome c oxidase (COX) assembly, is mutated in most patients presenting Leigh syndrome associated with COX deficiency. Proteins homologous to the human Surf1 have been identified in nine eukaryotes and six prokaryotes using database alignment tools, structure prediction and/or cDNA sequencing. Their sequence comparison revealed a remarkable Surf1 conservation during evolution and put forward at least four highly conserved domains that should be essential for Surf1 function. In Paracoccus denitrificans, the Surf1 homologue is found in the quinol oxidase operon, suggesting that Surf1 is associated with a primitive quinol oxidase which belongs to the same superfamily as cytochrome oxidase.

Inactivation of 1-aminocyclopropane-1-carboxylate oxidase involves oxidative modifications.

PubMed

Barlow, J N; Zhang, Z; John, P; Baldwin, J E; Schofield, C J

1997-03-25

1-Aminocyclopropane-1-carboxylate (ACC) oxidase catalyzes the final step in the biosynthesis of the plant signaling molecule ethylene. It is a member of the ferrous iron dependent family of oxidases and dioxygenases and is unusual in that it displays a very short half-life under catalytic conditions, typically less than 20 min, and a requirement for CO2 as an activator. The rates of inactivation of purified, recombinant ACC oxidase from tomato under various combinations of substrates and cofactors were measured. Inactivation was relatively slow in the presence of buffer alone (t1/2 > 1 h), but fast in the presence of ferrous iron and ascorbate (t1/2 approximately 10 min). The rate of iron/ascorbate-mediated inactivation was increased by the addition of ACC, unaffected by the addition of CO2 at saturation (supplied as bicarbonate) but decreased by the addition of catalase or ACC + CO2 at saturation (supplied as bicarbonate). Iron/ascorbate-mediated inactivation was accompanied by partial proteolysis as observed by SDS-PAGE analysis. The fragmentation pattern was altered when ACC was also included, suggesting that ACC can bind to ACC oxidase in the absence of bicarbonate. N-terminal sequencing of fragments resulted in identification of an internal cleavage site which we propose is proximate to active-site bound iron. Thus, ACC oxidase inactivates via relatively slow partial unfolding of the catalytically active conformation, oxidative damage mediated via hydrogen peroxide which is catalase protectable and oxidative damage to the active site which results in partial proteolysis and is not catalase protectable.

A New Primer Set to Amplify the Mitochondrial Cytochrome C Oxidase Subunit I (COI) Gene in the DHA-Rich Microalgae, the Genus Aurantiochytrium.

PubMed

Nishitani, Goh; Yoshida, Masaki

2018-06-01

This study was performed in order to develop a primer set for mitochondrial cytochrome c oxidase subunit I (COI) in the DHA-rich microalgae of the genus Aurantiochytrium. The performance of the primer set was tested using 12 Aurantiochytrium strains and other thraustochytrid species. There were no genetic polymorphisms in the mitochondrial sequences from the Aurantiochytrium strains, in contrast to the nuclear 18S rRNA gene sequence. This newly developed primer set amplified sequences from Aurantiochytrium and closely related genera, and may be useful for species identification and clarifying the genetic diversity of Aurantiochytrium in the field.

Reduced polyphenol oxidase gene expression and enzymatic browning in potato (Solanum tuberosum L.) with artificial microRNAs

PubMed Central

2014-01-01

Background Polyphenol oxidase (PPO), often encoded by a multi-gene family, causes oxidative browning, a significant problem in many food products. Low-browning potatoes were produced previously through suppression of PPO gene expression, but the contribution of individual PPO gene isoform to the oxidative browning process was unknown. Here we investigated the contributions of different PPO genes to total PPO protein activity, and the correlations between PPO protein level, PPO activity and tuber tissue browning potential by suppression of all previously characterized potato PPO genes, both individually and in combination using artificial microRNAs (amiRNAs) technology. Results Survey of the potato genome database revealed 9 PPO-like gene models, named StuPPO1 to StuPPO9 in this report. StuPPO1, StuPPO2, StuPPO3 and StuPPO4 are allelic to the characterized POTP1/P2, POT32, POT33 and POT72, respectively. Fewer ESTs were found to support the transcriptions of StuPPO5 to StuPPO8. StuPPO9 related ESTs were expressed at significant higher levels in pathogen-infected potato tissues. A series of browning phenotypes were obtained by suppressing StuPPO1 to StuPPO4 genes alone and in combination. Down-regulation of one or several of the PPO genes did not usually cause up-regulation of the other PPO genes in the transgenic potato tubers, but resulted in reduced PPO protein levels. The different PPO genes did not contribute equally to the total PPO protein content in the tuber tissues, with StuPPO2 accounting for ~ 55% as the major contributor, followed by StuPPO1, ~ 25-30% and StuPPO3 and StuPPO4 together with less than 15%. Strongly positive correlations between PPO protein level, PPO activity and browning potential were demonstrated in our analysis. Low PPO activity and low-browning potatoes were produced by simultaneous down-regulation of StuPPO2 to StuPPO4, but the greatest reduction occurred when StuPPO1 to StuPPO4 were all suppressed. Conclusion StuPPO1 to StuPPO4 genes

Characterization of a Flavoprotein Oxidase from Opium Poppy Catalyzing the Final Steps in Sanguinarine and Papaverine Biosynthesis*

PubMed Central

Hagel, Jillian M.; Beaudoin, Guillaume A. W.; Fossati, Elena; Ekins, Andrew; Martin, Vincent J. J.; Facchini, Peter J.

2012-01-01

Benzylisoquinoline alkaloids are a diverse class of plant specialized metabolites that includes the analgesic morphine, the antimicrobials sanguinarine and berberine, and the vasodilator papaverine. The two-electron oxidation of dihydrosanguinarine catalyzed by dihydrobenzophenanthridine oxidase (DBOX) is the final step in sanguinarine biosynthesis. The formation of the fully conjugated ring system in sanguinarine is similar to the four-electron oxidations of (S)-canadine to berberine and (S)-tetrahydropapaverine to papaverine. We report the isolation and functional characterization of an opium poppy (Papaver somniferum) cDNA encoding DBOX, a flavoprotein oxidase with homology to (S)-tetrahydroprotoberberine oxidase and the berberine bridge enzyme. A query of translated opium poppy stem transcriptome databases using berberine bridge enzyme yielded several candidate genes, including an (S)-tetrahydroprotoberberine oxidase-like sequence selected for heterologous expression in Pichia pastoris. The recombinant enzyme preferentially catalyzed the oxidation of dihydrosanguinarine to sanguinarine but also converted (RS)-tetrahydropapaverine to papaverine and several protoberberine alkaloids to oxidized forms, including (RS)-canadine to berberine. The Km values of 201 and 146 μm for dihydrosanguinarine and the protoberberine alkaloid (S)-scoulerine, respectively, suggested high concentrations of these substrates in the plant. Virus-induced gene silencing to reduce DBOX transcript levels resulted in a corresponding reduction in sanguinarine, dihydrosanguinarine, and papaverine accumulation in opium poppy roots in support of DBOX as a multifunctional oxidative enzyme in BIA metabolism. PMID:23118227

Hypocotyl Transcriptome Reveals Auxin Regulation of Growth-Promoting Genes through GA-Dependent and -Independent Pathways

PubMed Central

Castillejo, Cristina; Sartor, Ryan; Bialy, Agniezska; Sun, Tai-ping; Estelle, Mark

2012-01-01

Many processes critical to plant growth and development are regulated by the hormone auxin. Auxin responses are initiated through activation of a transcriptional response mediated by the TIR1/AFB family of F-box protein auxin receptors as well as the AUX/IAA and ARF families of transcriptional regulators. However, there is little information on how auxin regulates a specific cellular response. To begin to address this question, we have focused on auxin regulation of cell expansion in the Arabidopsis hypocotyl. We show that auxin-mediated hypocotyl elongation is dependent upon the TIR1/AFB family of auxin receptors and degradation of AUX/IAA repressors. We also use microarray studies of elongating hypocotyls to show that a number of growth-associated processes are activated by auxin including gibberellin biosynthesis, cell wall reorganization and biogenesis, and others. Our studies indicate that GA biosynthesis is required for normal response to auxin in the hypocotyl but that the overall transcriptional auxin output consists of PIF-dependent and -independent genes. We propose that auxin acts independently from and interdependently with PIF and GA pathways to regulate expression of growth-associated genes in cell expansion. PMID:22590525

Cognitive Function in Prepubertal Children with Obstructive Sleep Apnea: A Modifying Role for NADPH Oxidase p22 Subunit Gene Polymorphisms?

PubMed Central

Khalyfa, Abdelnaby; Capdevila, Oscar Sans; Kheirandish-Gozal, Leila; Khalyfa, Ahamed A.; Kim, Jinkwan

2012-01-01

Abstract Pediatric obstructive sleep apnea (OSA) may lead to neurocognitive dysfunction, but not in everyone affected. The frequencies of NADPH oxidase (NOX) polymorphisms in the p22phox subunit were similar between children with OSA and controls, except for rs6520785 and rs4673, the latter being significantly more frequent among the OSA children without deficits than with deficits (p<0.02). Similarly, 8-hydroxydeoxyguanine urine levels and NOX activity were lower among children without cognitive deficits and particularly among those with the rs4673 polymorphism. Thus, polymorphisms within the NOX gene or its functional subunits may account for important components of the variance in cognitive function deficits associated with OSA in children. Antioxid. Redox Signal. 16, 171–177. PMID:21902598

[Influence of the -866G/A polymorphism of the UCP2 gene on an obese pediatric population].

PubMed

Zurbano, R; Ochoa, M C; Moreno-Aliaga, M J; Martínez, J A; Marti, A

2006-01-01

In the present study, our objectives were to evaluate the prevalence of -866G/A mutation of UCP2 gene and to study its influence on the phenotype of obese children (11-12 years old) from Navarra. BACKGROUND AND STUDY SETTING: Obesity is a disease with a multifactorial origin that may related be to the presence of mutations and polymorphisms in several candidate genes. The gene of the uncoupling protein UCP2 is one of the most studied ones in relation to obesity because it seems to participate in body composition and several metabolic processes control. Three polymorphisms have been described for this gene: an insertion/deletion of 45 nucleotides, a nucleotide change of guanine for adenine in -866 position, an another change that replaces alanine for valine at amino acid position 55. According to several studies, the -866G allele is related to an increased risk of developing obesity, although the results are contradictory about this association in the literature. The study was carried out on 125 obese children (52% male), aged 11-12 years, selected through the Pediatric Endocrinology Departments of Clínica Universitaria and Hospital Virgen del Camino of Pamplona (Spain), the reported results on this association are contradictory. After checking the inclusion criteria, anthropometrical data (weight, height, BMI, tricipital and subscapular skinfolds) were taken, and the percentage of fat mass was measured by bioelectrical impedance. Besides, plasma levels of total cholesterol, glucose, insulin, and leptin were measured. DNA was extracted from white blood cells to determine the genotype by PCR technique followed by BstUI digestion and further visualization in agarose gel with 2% ethidium bromide. The genetic analysis revealed a 0.404 frequency of the allele A, with a percentage of individuals G/G, G/A, and A/A of 40.0%, 39.2%, and 20.8%, respectively. Carriers of the A allele had a significantly higher sum of tricipital and subscapular folds (p = 0.034). No

SZGR 2.0: a one-stop shop of schizophrenia candidate genes.

PubMed

Jia, Peilin; Han, Guangchun; Zhao, Junfei; Lu, Pinyi; Zhao, Zhongming

2017-01-04

SZGR 2.0 is a comprehensive resource of candidate variants and genes for schizophrenia, covering genetic, epigenetic, transcriptomic, translational and many other types of evidence. By systematic review and curation of multiple lines of evidence, we included almost all variants and genes that have ever been reported to be associated with schizophrenia. In particular, we collected ∼4200 common variants reported in genome-wide association studies, ∼1000 de novo mutations discovered by large-scale sequencing of family samples, 215 genes spanning rare and replication copy number variations, 99 genes overlapping with linkage regions, 240 differentially expressed genes, 4651 differentially methylated genes and 49 genes as antipsychotic drug targets. To facilitate interpretation, we included various functional annotation data, especially brain eQTL, methylation QTL, brain expression featured in deep categorization of brain areas and developmental stages and brain-specific promoter and enhancer annotations. Furthermore, we conducted cross-study, cross-data type and integrative analyses of the multidimensional data deposited in SZGR 2.0, and made the data and results available through a user-friendly interface. In summary, SZGR 2.0 provides a one-stop shop of schizophrenia variants and genes and their function and regulation, providing an important resource in the schizophrenia and other mental disease community. SZGR 2.0 is available at https://bioinfo.uth.edu/SZGR/. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

The NADPH oxidase Cpnox1 is required for full pathogenicity of the ergot fungus Claviceps purpurea.

PubMed

Giesbert, Sabine; Schürg, Timo; Scheele, Sandra; Tudzynski, Paul

2008-05-01

The role of reactive oxygen species (ROS) in interactions between phytopathogenic fungi and their hosts is well established. An oxidative burst mainly caused by superoxide formation by membrane-associated NADPH oxidases is an essential element of plant defence reactions. Apart from primary effects, ROS play a major role as a second messenger in host response. Recently, NADPH oxidase (nox)-encoding genes have been identified in filamentous fungi. Functional analyses have shown that these fungal enzymes are involved in sexual differentiation, and there is growing evidence that they also affect developmental programmes involved in fungus-plant interactions. Here we show that in the biotrophic plant pathogen Claviceps purpurea deletion of the cpnox1 gene, probably encoding an NADPH oxidase, has impact on germination of conidia and pathogenicity: Deltacpnox1 mutants can penetrate the host epidermis, but they are impaired in colonization of the plant ovarian tissue. In the few cases where macroscopic signs of infection (honeydew) appear, they are extremely delayed and fully developed sclerotia have never been observed. C. purpurea Nox1 is important for the interaction with its host, probably by directly affecting pathogenic differentiation of the fungus.

Clinical study on gastric cancer susceptibility genes IL-10-1082 and TNF-α.

PubMed

Yu, T; Lu, Q; Ou, X L; Cao, D Z; Yu, Q

2014-12-19

TNF 308 gene polymorphism and IL-10 polymorphism provided evidence in diagnosing some types of cancer. We aimed to explore the relation of gene polymorphism with gastric cancer. A total of 360 cases of gastric cancer patients were included in the study. The genotypes GG, GA, and AA of the interleukin-10-1082 gene (IL-10-1082) and the tumor necrosis factor-alpha gene (TNF-α) 308 polymorphism were examined by chromogenic detection. Three hundred healthy individuals' gene as control group were also examined. The GA 308 genotype of TNF-α differed significantly between the control group and the gastric cancer group (X(2) = 9.32, P < 0.05). Genotype frequencies of A/A (17.2%), A/G (26.2%), and G/G (9.1%) of the IL-10-1082 gene polymorphism in the gastric cancer group differed significantly compared to those of the control group (X(2) = 20.32, P < 0.05). The IL-10-1082 gene and the GA 308 genotype of the TNF-α gene were found to be susceptibility genes for gastric cancer.

Adaptive responses of heart and skeletal muscle to spermine oxidase overexpression: Evaluation of a new transgenic mouse model.

PubMed

Ceci, Roberta; Duranti, Guglielmo; Leonetti, Alessia; Pietropaoli, Stefano; Spinozzi, Federico; Marcocci, Lucia; Amendola, Roberto; Cecconi, Francesco; Sabatini, Stefania; Mariottini, Paolo; Cervelli, Manuela

2017-02-01

Spermine oxidase oxidizes spermine to produce H 2 O 2 , spermidine, and 3-aminopropanal. It is involved in cell drug response, apoptosis, and in the etiology of several pathologies, including cancer. Spermine oxidase is an important positive regulator of muscle gene expression and fiber size and, when repressed, leads to muscle atrophy. We have generated a transgenic mouse line overexpressing Smox gene in all organs, named Total-Smox. The spermine oxidase overexpression was revealed by β-Gal staining and reverse-transcriptase/PCR analysis, in all tissues analysed. Spermine oxidase activity resulted higher in Total-Smox than controls. Considering the important role of this enzyme in muscle physiology, we have focused our study on skeletal muscle and heart of Total-Smox mice by measuring redox status and oxidative damage. We assessed the redox homeostasis through the analysis of the reduced/oxidized glutathione ratio. Chronic H 2 O 2 production induced by spermine oxidase overexpression leads to a cellular redox state imbalance in both tissues, although they show different redox adaptation. In skeletal muscle, catalase and glutathione S-transferase activities were significantly increased in Total-Smox mice compared to controls. In the heart, no differences were found in CAT activity level, while GST activity decreased compared to controls. The skeletal muscle showed a lower oxidative damage than in the heart, evaluated by lipid peroxidation and protein carbonylation. Altogether, our findings illustrate that skeletal muscle adapts more efficiently than heart to oxidative stress H 2 O 2 -induced. The Total-Smox line is a new genetic model useful to deepen our knowledge on the role of spermine oxidase in muscle atrophy and muscular pathological conditions like dystrophy. Copyright © 2016 Elsevier Inc. All rights reserved.

A Novel Colletotrichum graminicola Raffinose Oxidase in the AA5 Family

PubMed Central

Mollerup, Filip; Parikka, Kirsti; Koutaniemi, Sanna; Boer, Harry; Juvonen, Minna; Master, Emma; Tenkanen, Maija; Kruus, Kristiina

2017-01-01

ABSTRACT We describe here the identification and characterization of a copper radical oxidase from auxiliary activities family 5 (AA5_2) that was distinguished by showing preferential activity toward raffinose. Despite the biotechnological potential of carbohydrate oxidases from family AA5, very few members have been characterized. The gene encoding raffinose oxidase from Colletotrichum graminicola (CgRaOx; EC 1.1.3.−) was identified utilizing a bioinformatics approach based on the known modular structure of a characterized AA5_2 galactose oxidase. CgRaOx was expressed in Pichia pastoris, and the purified enzyme displayed the highest activity on the trisaccharide raffinose, whereas the activity on the disaccharide melibiose was three times lower and more than ten times lower activity was detected on d-galactose at a 300 mM substrate concentration. Thus, the substrate preference of CgRaOx was distinguished clearly from the substrate preferences of the known galactose oxidases. The site of oxidation for raffinose was studied by 1H nuclear magnetic resonance and mass spectrometry, and we confirmed that the hydroxyl group at the C-6 position was oxidized to an aldehyde and that in addition uronic acid was produced as a side product. A new electrospray ionization mass spectrometry method for the identification of C-6 oxidized products was developed, and the formation mechanism of the uronic acid was studied. CgRaOx presented a novel activity pattern in the AA5 family. IMPORTANCE Currently, there are only a few characterized members of the CAZy AA5 protein family. These enzymes are interesting from an application point of view because of their ability to utilize the cheap and abundant oxidant O2 without the requirement of complex cofactors such as FAD or NAD(P). Here, we present the identification and characterization of a novel AA5 member from Colletotrichum graminicola. As discussed in the present study, the bioinformatics approach using the modular structure of

Influence of a family 29 carbohydrate binding module on the recombinant production of galactose oxidase in Pichia pastoris

PubMed Central

Mollerup, Filip; Master, Emma

2015-01-01

Herein, we report the extracellular expression of carbohydrate active fusion enzymes in Pichia pastoris. Particularly, CBM29-1-2 from Piromyces equi was separately fused to the N- and C-terminus of galactose 6-oxidase (GaO, D-galactose: oxygen 6-oxidoreductase, EC 1.1.13.9, CAZy family AA5) from Fusarium graminearum, generating CBM29-GaO and GaO-CBM29, respectively. P. pastoris was transformed with expression vectors encoding GaO, CBM29-GaO and GaO-CBM29, and the fusion proteins were expressed in both shake-flask and 2L bioreactor systems. Volumetric production yields and specific GaO activity increased when expression was performed in a bioreactor system compared to shake-flask cultivation. This was observed for both CBM29-GaO and GaO-CBM29, and is consistent with previous reports of GaO expression in P. pastoris (Spadiut et al., 2010; Anasontzis et al., 2014) [1], [2]. Fusion of CBM29 to the C-terminal of GaO (GaO-CBM29) resulted in a stable uniform protein at the expected calculated size (107 kDa) when analyzed with SDS-PAGE. By comparison, the expression of the N-terminal fusion protein (CBM29-GaO) was low, and two truncated versions of CBM29-GaO were coexpressed with the full-sized protein. Despite differences in protein yield, the specific GaO activity on galactose was not affected by CBM29 fusion to either the N- or C-terminus of the enzyme. A detailed description of the catalytic and physiochemical properties of CBM29-GaO and GaO-CBM29 is available in the parent publication (Mollerup et al., 2015) [3]. PMID:26858983

The rice GERMINATION DEFECTIVE 1, encoding a B3 domain transcriptional repressor, regulates seed germination and seedling development by integrating GA and carbohydrate metabolism

PubMed Central

Guo, Xiaoli; Hou, Xiaomei; Fang, Jun; Wei, Piwei; Xu, Bo; Chen, Mingluan; Feng, Yuqi; Chu, Chengcai

2013-01-01

It has been shown that seed development is regulated by a network of transcription factors in Arabidopsis including LEC1 (LEAFY COTYLEDON1), L1L (LEC1-like) and the B3 domain factors LEC2, FUS3 (FUSCA3) and ABI3 (ABA-INSENSITIVE3); however, molecular and genetic regulation of seed development in cereals is poorly understood. To understand seed development and seed germination in cereals, a large-scale screen was performed using our T–DNA mutant population, and a mutant germination-defective1 (gd1) was identified. In addition to the severe germination defect, the gd1 mutant also shows a dwarf phenotype and abnormal flower development. Molecular and biochemical analyses revealed that GD1 encodes a B3 domain-containing transcription factor with repression activity. Consistent with the dwarf phenotype of gd1, expression of the gibberelic acid (GA) inactivation gene OsGA2ox3 is increased dramatically, accompanied by reduced expression of GA biosynthetic genes including OsGA20ox1, OsGA20ox2 and OsGA3ox2 in gd1, resulting in a decreased endogenous GA4 level. Exogenous application of GA not only induced GD1 expression, but also partially rescued the dwarf phenotype of gd1. Furthermore, GD1 binds to the promoter of OsLFL1, a LEC2/FUS3-like gene of rice, via an RY element, leading to significant up-regulation of OsLFL1 and a large subset of seed maturation genes in the gd1 mutant. Plants over-expressing OsLFL1 partly mimic the gd1 mutant. In addition, expression of GD1 was induced under sugar treatment, and the contents of starch and soluble sugar are altered in the gd1 mutant. These data indicate that GD1 participates directly or indirectly in regulating GA and carbohydrate homeostasis, and further regulates rice seed germination and seedling development. PMID:23581288

The 20 GHz GaAs monolithic power amplifier module development

NASA Technical Reports Server (NTRS)

1984-01-01

The development of a 20 GHz GaAs FET monlithic power amplifier module for advanced communication applications is described. Four-way power combing of four 0.6 W amplifier modules is used as the baseline approach. For this purpose, a monolithic four-way traveling-wave power divider/combiner was developed. Over a 20 GHz bandwidth (10 to 30 GHz), an insertion loss of no more than 1.2 dB was measured for a pair of back-to-back connected divider/combiners. Isolation between output ports is better than 20 dB, and VSWRs are better than 21:1. A distributed amplifier with six 300 micron gate width FETs and gate and drain transmission line tapers has been designed, fabricated, and evaluated for use as an 0.6 W module. This amplifier has achieved state-of-the-art results of 0.5 W output power with at least 4 dB gain across the entire 2 to 21 GHz frequency range. An output power of 2 W was achieved at a measurement frequency of 18 GHz when four distributed amplifiers were power-combined using a pair of traveling-wave divider/combiners. Another approach is the direct common-source cascading of three power FET stages. An output power of up to 2W with 12 dB gain and 20% power-added efficiency has been achieved with this approach (at 17 GHz). The linear gain was 14 dB at 1 W output. The first two stages of the three-stage amplifier have achieved an output power of 1.6 W with 9 dB gain and 26% power-added efficiency at 16 GHz.

Hypoxia-response element (HRE)-directed transcriptional regulation of the rat lysyl oxidase gene in response to cobalt and cadmium.

PubMed

Gao, Song; Zhou, Jing; Zhao, Yinzhi; Toselli, Paul; Li, Wande

2013-04-01

Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5'-ACGTG-3') exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10-100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)-treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at -387/-383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation.

Varroa destructor parasitism reduces hemocyte concentrations and prophenol oxidase gene expression in bees from two populations.

PubMed

Koleoglu, Gun; Goodwin, Paul H; Reyes-Quintana, Mariana; Hamiduzzaman, Mollah Md; Guzman-Novoa, Ernesto

2018-04-01

Circulating hemocytes are responsible for defensive and healing mechanisms in the honey bee, Apis mellifera. Parasitism by the mite Varroa destructor and injection of V. destructor homogenate in buffer, but not buffer injection, showed similar reductions in total hemocyte concentrations in both Africanized and European adult honey bees. This indicated that compounds in V. destructor homogenate can have similar effects as V. destructor parasitism and that the response is not solely due to wounding. Samples from honey bees with different hemocyte concentrations were compared for the expression patterns of hemolectin (AmHml), prophenol oxidase (AmPpo), and class C scavenger receptor (AmSRC-C). Of the genes tested, only the expression of AmPpo correlated well with hemocyte counts for all the treatments, indicating that melanization is associated with those responses. Thus, the expression of AmPpo might be a suitable biomarker for hemocyte counts as part of cellular defenses against injection of buffer or mite compounds and V. destructor parasitism and perhaps other conditions involving healing and immunity.

Expression of ACC oxidase promoter-GUS fusions in tomato and Nicotiana plumbaginifolia regulated by developmental and environmental stimuli.

PubMed

Blume, B; Grierson, D

1997-10-01

The enzyme ACC oxidase, catalysing the last step in the biosynthesis of the plant hormone ethylene, is encoded by a small multigene family in tomato, comprising three members, LEACO1, LEACO2 and LEACO3. LEACO1 is the major gene expressed during ripening, leaf senescence, and wounding (Barry et al., 1996). To investigate the transcriptional regulation of ACC oxidase gene expression, chimeric fusions between the beta-glucuronidase reporter gene and 97 bp of 5' UTR plus 124, 396 and 1825 bp, respectively, of 5' untranscribed LEACO1 sequence were constructed and introduced into Lycopersicon esculentum (Mill cv. Ailsa Craig) and Nicotiana plumbaginifolia. Analysis of transgenic tomatoes indicated that the region containing nucleotides -124 to +97 of the LEACO1 gene is sufficient to confer a marked increase in GUS activity during fruit ripening, albeit at very low levels. Fusion of 396 and 1825 bp of LEACO1 upstream sequence resulted in strong and specific induction of GUS expression in situations known to be accompanied by enhanced ethylene production. Reporter gene expression was similar to that of the endogenous LEACO1 gene, with major increases especially during fruit ripening, senescence and abscission of leaves and, to a lesser extent, of flowers. Analysis of transgenic N. plumbaginifolia plants confirmed the pattern of LEACO1 promoter activity detected in tomato leaves and flowers. Reporter gene expression was also induced following wounding, treatment with ethylene, and pathogen infection. Histochemical analysis illustrated localized GUS activity in the pericarp of ripening fruit, abscission zones of senescent petioles and unfertilized flowers, and at wound sites. These results demonstrate that ACC oxidase is regulated at the transcriptional level in a wide range of cell types at different developmental stages and in response to several external stimuli.

COI (cytochrome oxidase-I) sequence based studies of Carangid fishes from Kakinada coast, India.

PubMed

Persis, M; Chandra Sekhar Reddy, A; Rao, L M; Khedkar, G D; Ravinder, K; Nasruddin, K

2009-09-01

Mitochondrial DNA, cytochrome oxidase-1 gene sequences were analyzed for species identification and phylogenetic relationship among the very high food value and commercially important Indian carangid fish species. Sequence analysis of COI gene very clearly indicated that all the 28 fish species fell into five distinct groups, which are genetically distant from each other and exhibited identical phylogenetic reservation. All the COI gene sequences from 28 fishes provide sufficient phylogenetic information and evolutionary relationship to distinguish the carangid species unambiguously. This study proves the utility of mtDNA COI gene sequence based approach in identifying fish species at a faster pace.

Heterologous Production and Characterization of Two Glyoxal Oxidases from Pycnoporus cinnabarinus

PubMed Central

Daou, Marianne; Piumi, François; Cullen, Daniel; Record, Eric

2016-01-01

ABSTRACT The genome of the white rot fungus Pycnoporus cinnabarinus includes a large number of genes encoding enzymes implicated in lignin degradation. Among these, three genes are predicted to encode glyoxal oxidase, an enzyme previously isolated from Phanerochaete chrysosporium. The glyoxal oxidase of P. chrysosporium is physiologically coupled to lignin-oxidizing peroxidases via generation of extracellular H2O2 and utilizes an array of aldehydes and α-hydroxycarbonyls as the substrates. Two of the predicted glyoxal oxidases of P. cinnabarinus, GLOX1 (PciGLOX1) and GLOX2 (PciGLOX2), were heterologously produced in Aspergillus niger strain D15#26 (pyrG negative) and purified using immobilized metal ion affinity chromatography, yielding 59 and 5 mg of protein for PciGLOX1 and PciGLOX2, respectively. Both proteins were approximately 60 kDa in size and N-glycosylated. The optimum temperature for the activity of these enzymes was 50°C, and the optimum pH was 6. The enzymes retained most of their activity after incubation at 50°C for 4 h. The highest relative activity and the highest catalytic efficiency of both enzymes occurred with glyoxylic acid as the substrate. The two P. cinnabarinus enzymes generally exhibited similar substrate preferences, but PciGLOX2 showed a broader substrate specificity and was significantly more active on 3-phenylpropionaldehyde. IMPORTANCE This study addresses the poorly understood role of how fungal peroxidases obtain an in situ supply of hydrogen peroxide to enable them to oxidize a variety of organic and inorganic compounds. This cooperative activity is intrinsic in the living organism to control the amount of toxic H2O2 in its environment, thus providing a feed-on-demand scenario, and can be used biotechnologically to supply a cheap source of peroxide for the peroxidase reaction. The secretion of multiple glyoxal oxidases by filamentous fungi as part of a lignocellulolytic mechanism suggests a controlled system, especially as these

[Association between the canine monoamine oxidase B (MAOB) gene polymorphisms and behavior of puppies in open-field test].

PubMed

Li, Xiao-Hui; Xu, Han-Kun; Mao, Da-Gan; Ma, Da-Jun; Chen, Peng; Yang, Li-Guo

2006-11-01

Excitability, activity and exploration behavior of puppies in a novel open-field were tested in a total of 204 two-month-old German shepherd dog, labrador retriever or English springer spaniel puppies. The polymorphisms of monoamine oxidase B gene (MAOB) were detected by PCR-RFLP. Statistics analysis indicated that genotype and allele frequencies of the polymorphisms were significantly different among three breeds (P < 0.01). With GLM analysis of SAS software, association analysis was conducted between MAOB gene polymorphisms and locomotion and vocalization behavior parameters in the open-field test. The results showed that MAOB gene polymorphisms had a significant effect on walking time, squares crossed, lying time, the times of standing up against walls(P < 0.01 or P < 0.05) and were associated with the times of posture change (P=0.064). Walking time and squares crossed were higher in TT genotype puppies than those in TC and CC puppies (P < 0.05) and the times of posture change and standing up against walls were also higher than those in CC (P < 0.05). In addition, lying time in CC genotype puppies were higher than that in TT (P < 0.05). MAOB had a positive effect on walking time, lying time, squares crossed, the times of posture change, the times of standing up against walls in the three dog breeds that was highly statistically significant (P < 0.01 or P < 0.05). Our results imply that MAOB gene significantly affects the excitability, activity and exploration behavior of puppies in open-field test and TT genotype has favorable effects in these behavior traits.

Green Revolution Trees: Semidwarfism Transgenes Modify Gibberellins, Promote Root Growth, Enhance Morphological Diversity, and Reduce Competitiveness in Hybrid Poplar1[C][W][OA

PubMed Central

Elias, Ani A.; Busov, Victor B.; Kosola, Kevin R.; Ma, Cathleen; Etherington, Elizabeth; Shevchenko, Olga; Gandhi, Harish; Pearce, David W.; Rood, Stewart B.; Strauss, Steven H.

2012-01-01

Semidwarfism has been used extensively in row crops and horticulture to promote yield, reduce lodging, and improve harvest index, and it might have similar benefits for trees for short-rotation forestry or energy plantations, reclamation, phytoremediation, or other applications. We studied the effects of the dominant semidwarfism transgenes GA Insensitive (GAI) and Repressor of GAI-Like, which affect gibberellin (GA) action, and the GA catabolic gene, GA 2-oxidase, in nursery beds and in 2-year-old high-density stands of hybrid poplar (Populus tremula × Populus alba). Twenty-nine traits were analyzed, including measures of growth, morphology, and physiology. Endogenous GA levels were modified in most transgenic events; GA20 and GA8, in particular, had strong inverse associations with tree height. Nearly all measured traits varied significantly among genotypes, and several traits interacted with planting density, including aboveground biomass, root-shoot ratio, root fraction, branch angle, and crown depth. Semidwarfism promoted biomass allocation to roots over shoots and substantially increased rooting efficiency with most genes tested. The increased root proportion and increased leaf chlorophyll levels were associated with changes in leaf carbon isotope discrimination, indicating altered water use efficiency. Semidwarf trees had dramatically reduced growth when in direct competition with wild-type trees, supporting the hypothesis that semidwarfism genes could be effective tools to mitigate the spread of exotic, hybrid, and transgenic plants in wild and feral populations. PMID:22904164

Age-related ultrastructural and monoamine oxidase changes in the rat optic nerve.

PubMed

Taurone, S; Ripandelli, G; Minni, A; Lattanzi, R; Miglietta, S; Pepe, N; Fumagalli, L; Micera, A; Pastore, F S; Artico, M

2016-01-01

The aim of this paper is to study the morphology and the distribution of the monoamine oxidase enzymatic system in the optic nerve of 4 month-old Wistar (young) and 28 month-old Wistar (old) rats. The optic nerve was harvested from 20 young and old rats. The segment of optic nerve was divided longitudinally into two pieces, each 0.1 mm in length. The first piece was used for transmission electron microscopy. The second piece was stained with histochemical reaction for monoamine oxidase. The agerelated changes in the optic nerve of rats include micro-anatomical details, ultrastructure and monoamine oxidase histochemical staining. A strong decrease of the thin nerve fibers and a swelling of the thick ones can be observed in optic nerve fibers of old rats. Increased monoamine oxidase histochemical staining of the optic nerve of aged rats is well demonstrated. The increase of meningeal shealth and the decrease of thin nerve fibers of the optic nerve in old rats are well documented. Morphological, ultrastructural and histochemical changes observed in optic nerve fibers of the old rats show a close relation with aging.

Promoter isolation and characterization of GhAO-like1, a Gossypium hirsutum gene similar to multicopper oxidases that is highly expressed in reproductive organs.

PubMed

Lambret-Frotté, Julia; Artico, Sinara; Muniz Nardeli, Sarah; Fonseca, Fernando; Brilhante Oliveira-Neto, Osmundo; Grossi-de-Sá, Maria Fatima; Alves-Ferreira, Marcio

2016-01-01

Cotton is one of the most economically important cultivated crops. It is the major source of natural fiber for the textile industry and an important target for genetic modification for both biotic stress and herbicide tolerance. Therefore, the characterization of genes and regulatory regions that might be useful for genetic transformation is indispensable. The isolation and characterization of new regulatory regions is of great importance to drive transgene expression in genetically modified crops. One of the major drawbacks in cotton production is pest damage; therefore, the most promising, cost-effective, and sustainable method for pest control is the development of genetically resistant cotton lines. Considering this scenario, our group isolated and characterized the promoter region of a MCO (multicopper oxidase) from Gossypium hirsutum, named GhAO-like1 (ascorbate oxidase-like1). The quantitative expression, together with the in vivo characterization of the promoter region reveals that GhAO-like1 has a flower- and fruit-specific expression pattern. The GUS activity is mainly observed in stamens, as expected considering that the GhAO-like1 regulatory sequence is enriched in cis elements, which have been characterized as a target of reproductive tissue specific transcription factors. Both histological and quantitative analyses in Arabidopsis thaliana have confirmed flower (mainly in stamens) and fruit expression of GhAO-like1. In the present paper, we isolated and characterized both in silico and in vivo the promoter region of the GhAO-like1 gene. The regulatory region of GhAO-like1 might be useful to confer tissue-specific expression in genetically modified plants.

Short and medium range structures of 80GeSe2–20Ga2Se3 chalcogenide glasses

NASA Astrophysics Data System (ADS)

Petracovschi, Elena; Calvez, Laurent; Cormier, Laurent; Le Coq, David; Du, Jincheng

2018-05-01

The short and medium range structures of 80GeSe2–20Ga2Se3 (or Ge23.5Ga11.8Se64.7) chalcogenide glasses have been studied by combining ab initio molecular dynamics (AIMD) simulations and experimental neutron diffraction studies. The structure factor and total correlation function were calculated from glass structures generated from AIMD simulations and compared with neutron diffraction experiments showing reasonable agreement. The atomic structures of ternary chalcogenide glasses were analyzed in detail, and it was found that gallium atoms are four-fold coordinated by selenium (Se) and form [GaSe4] tetrahedra. Germanium atoms on average also have four-fold coordination, among which Se is 3.5 with the remaining being Ge–Ge homo-nuclear bonds. Ga and Ge tetrahedra link together mainly through corner-sharing and some edge-sharing of Se. No homo-nuclear bonds were observed among Ga atoms or between Ge and Ga. In addition, Se–Se homo-nuclear bonds and Se chains with various lengths were observed. A small fraction of Se atom triclusters that bond to three cations of Ge and Ga were also observed, confirming earlier proposals from 77Se solid state nuclear magnetic resonance studies. Furthermore, the electronic structures of ternary chalcogenide glasses were studied in terms of atomic charge and electronic density of states in order to gain insights into the chemical bonding and electronic properties, as well as to provide an explanation of the observed atomic structures in these ternary chalcogenide glasses.

Exploiting the synthetic lethality between terminal respiratory oxidases to kill Mycobacterium tuberculosis and clear host infection

PubMed Central

Kalia, Nitin P.; Hasenoehrl, Erik J.; Ab Rahman, Nurlilah B.; Koh, Vanessa H.; Ang, Michelle L. T.; Sajorda, Dannah R.; Hards, Kiel; Grüber, Gerhard; Alonso, Sylvie; Cook, Gregory M.; Berney, Michael; Pethe, Kevin

2017-01-01

The recent discovery of small molecules targeting the cytochrome bc1:aa3 in Mycobacterium tuberculosis triggered interest in the terminal respiratory oxidases for antituberculosis drug development. The mycobacterial cytochrome bc1:aa3 consists of a menaquinone:cytochrome c reductase (bc1) and a cytochrome aa3-type oxidase. The clinical-stage drug candidate Q203 interferes with the function of the subunit b of the menaquinone:cytochrome c reductase. Despite the affinity of Q203 for the bc1:aa3 complex, the drug is only bacteriostatic and does not kill drug-tolerant persisters. This raises the possibility that the alternate terminal bd-type oxidase (cytochrome bd oxidase) is capable of maintaining a membrane potential and menaquinol oxidation in the presence of Q203. Here, we show that the electron flow through the cytochrome bd oxidase is sufficient to maintain respiration and ATP synthesis at a level high enough to protect M. tuberculosis from Q203-induced bacterial death. Upon genetic deletion of the cytochrome bd oxidase-encoding genes cydAB, Q203 inhibited mycobacterial respiration completely, became bactericidal, killed drug-tolerant mycobacterial persisters, and rapidly cleared M. tuberculosis infection in vivo. These results indicate a synthetic lethal interaction between the two terminal respiratory oxidases that can be exploited for anti-TB drug development. Our findings should be considered in the clinical development of drugs targeting the cytochrome bc1:aa3, as well as for the development of a drug combination targeting oxidative phosphorylation in M. tuberculosis. PMID:28652330

AlGaN/GaN high electron mobility transistors with selective area grown p-GaN gates

NASA Astrophysics Data System (ADS)

Yuliang, Huang; Lian, Zhang; Zhe, Cheng; Yun, Zhang; Yujie, Ai; Yongbing, Zhao; Hongxi, Lu; Junxi, Wang; Jinmin, Li

2016-11-01

We report a selective area growth (SAG) method to define the p-GaN gate of AlGaN/GaN high electron mobility transistors (HEMTs) by metal-organic chemical vapor deposition. Compared with Schottky gate HEMTs, the SAG p-GaN gate HEMTs show more positive threshold voltage (V th) and better gate control ability. The influence of Cp2Mg flux of SAG p-GaN gate on the AlGaN/GaN HEMTs has also been studied. With the increasing Cp2Mg from 0.16 μmol/min to 0.20 μmol/min, the V th raises from -0.67 V to -0.37 V. The maximum transconductance of the SAG HEMT at a drain voltage of 10 V is 113.9 mS/mm while that value of the Schottky HEMT is 51.6 mS/mm. The SAG method paves a promising way for achieving p-GaN gate normally-off AlGaN/GaN HEMTs without dry etching damage. Project supported by the National Natural Sciences Foundation of China (Nos. 61376090, 61306008) and the National High Technology Program of China (No. 2014AA032606).

The role of gibberellins in improving the resistance of tebuconazole-coated maize seeds to chilling stress by microencapsulation

NASA Astrophysics Data System (ADS)

Yang, Lijuan; Yang, Daibin; Yan, Xiaojing; Cui, Li; Wang, Zhenying; Yuan, Huizhu

2016-11-01

Chilling stress during germination often causes severe injury. In the present study, maize seed germination and shoot growth under chilling stress were negatively correlated with the dose of tebuconazole in an exponential manner as predicted by the model Y = A + B × e(-x/k). Microencapsulation was an effective means of eliminating potential phytotoxic risk. The gibberellins (GAs) contents were higher after microencapsulation treatment than after conventional treatment when the dose of tebuconazole was higher than 0.12 g AI (active ingredient) kg-1 seed. Further analysis indicated that microencapsulation can stimulate ent-kaurene oxidase (KO) activity to some extent, whereas GA 3-oxidase (GA3ox) and GA 2-oxidase (GA2ox) activities remained similar to those in the control. Genes encoding GA metabolic enzymes exhibited different expression patterns. Transcript levels of ZmKO1 increased in the microcapsule treatments compared to the control. Even when incorporated into microcapsules, tebuconazole led to the upregulation of ZmGA3ox1 at doses of less than 0.12 g AI kg-1 seed and to the upregulation of ZmGA3ox2 when the dose was higher than 0.12 g AI kg-1 seed. With increasing doses of microencapsulated tebuconazole, the transcript levels of ZmGA2ox4, ZmGA2ox5 and ZmGA2ox6 exhibited upward trends, whereas the transcript levels of ZmGA2ox7 exhibited a downward trend.

Structure, organization, and transcriptional regulation of a family of copper radical oxidase genes in the lignin-degrading basidiomycete Phanerochaete chrysosporium

Treesearch

Amber Vanden Wymelenberg; Grzegorz Sabat; Michael Mozuch; Philip J. Kersten; Dan Cullen; Robert A. Blanchette

2006-01-01

The white rot basidiomycete Phanerochaete chrysosporium produces an array of nonspecific extracellular enzymes thought to be involved in lignin degradation, including lignin peroxidases, manganese peroxidases, and the H2O2-generating copper radical oxidase, glyoxal oxidase (GLX). Preliminary analysis of the P. chrysosporium draft genome had identified six sequences...

Interleukin-10 -1082 G/A gene polymorphisms in Egyptian children with CAP: A case-control study.

PubMed

Azab, Seham F; Abdalhady, Mohamed A; Elsaadany, Hosam F; Elkomi, Mohamed A; Elhindawy, Eman M; Sarhan, Dina T; Salam, Mohamed M A; Allah, Mayy A N; Emam, Ahmed A; Noah, Maha A; Abdelsalam, Nasser I; Abdellatif, Sawsan H; Rass, Anwar A; Ismail, Sanaa M; Gheith, Tarek; Aziz, Khalid A; Hamed, Mohammed E; Abdelrahman, Hind M; Ahmed, Ahmed R; Nabil, Rehab M; Abdulmaksoud, Rehab S; Yousef, Hala Y

2016-06-01

Community-acquired pneumonia (CAP) is one of the leading causes of death worldwide. Cytokines are involved in the pathogenesis of CAP. To date, only a few studies concerned the association of interleukin-10 (IL-10) gene polymorphisms with CAP.In this study, we aimed to investigate whether the -1082(G/A) polymorphism in the promoter region of the IL-10 gene is involved in susceptibility to and the outcome of CAP, and we also measured the serum level of IL-10 to assess its relation to such polymorphism.This was a case-control study included 100 patients with CAP, and matched with age, gender, and ethnicity of 100 healthy control children. IL-10 -1082(G/A) gene polymorphism was genotyped by polymerase chain reaction-restriction fragment length polymorphism, while the serum IL-10 levels were measured by ELISA method.Compared to the controls subjects, the frequencies of the IL-10 -1082 AA genotype and A allele were observed to be overrepresented in patients with CAP (51%; odds ratio [OR] = 2.8; 95% confidence interval [CI]: 1.5-5.3 for the AA genotype; P < 0.01) and (70%; OR: 1.95; 95% CI: 1.27-3.00 for the A allele; P < 0.01, respectively). We found that patients with the GG genotype had significantly higher serum IL-10 levels (46.7 ± 9.5 pg/mL) compared to those with AG genotype (21.8 ± 4.5 pg/mL) and AA genotype (11.5 ± 3.3 pg/mL); P < 0.01, respectively. Our data revealed a significant positive association between the -1082 GG genotype and susceptibility to severe sepsis, acute respiratory failure, and hospital mortality (OR: 3.8; 95% CI: 1.3-11.2; P < 0.01).We demonstrate for the first time, to the best of our knowledge, that IL-10 -1082 (G/A) gene polymorphism may contribute to susceptibility to CAP in Egyptian children. Moreover, we observed that the presence of a G allele or GG genotype at the -1082 position of the promoter region of the IL-10 gene constitute risk factors for developing severe sepsis, acute respiratory

New insights into the roles of NADPH oxidases in sexual development and ascospore germination in Sordaria macrospora.

PubMed

Dirschnabel, Daniela Elisabeth; Nowrousian, Minou; Cano-Domínguez, Nallely; Aguirre, Jesus; Teichert, Ines; Kück, Ulrich

2014-03-01

NADPH oxidase (NOX)-derived reactive oxygen species (ROS) act as signaling determinants that induce different cellular processes. To characterize NOX function during fungal development, we utilized the genetically tractable ascomycete Sordaria macrospora. Genome sequencing of a sterile mutant led us to identify the NADPH oxidase encoding nox1 as a gene required for fruiting body formation, regular hyphal growth, and hyphal fusion. These phenotypes are shared by nor1, lacking the NOX regulator NOR1. Further phenotypic analyses revealed a high correlation between increased ROS production and hyphal fusion deficiencies in nox1 and other sterile mutants. A genome-wide transcriptional profiling analysis of mycelia and isolated protoperithecia from wild type and nox1 revealed that nox1 inactivation affects the expression of genes related to cytoskeleton remodeling, hyphal fusion, metabolism, and mitochondrial respiration. Genetic analysis of nox2, lacking the NADPH oxidase 2 gene, nor1, and transcription factor deletion mutant ste12, revealed a strict melanin-dependent ascospore germination defect, indicating a common genetic pathway for these three genes. We report that gsa3, encoding a G-protein α-subunit, and sac1, encoding cAMP-generating adenylate cyclase, act in a separate pathway during the germination process. The finding that cAMP inhibits ascospore germination in a melanin-dependent manner supports a model in which cAMP inhibits NOX2 activity, thus suggesting a link between both pathways. Our results expand the current knowledge on the role of NOX enzymes in fungal development and provide a frame to define upstream and downstream components of the NOX signaling pathways in fungi.

SPERMINE OXIDASE: AN AMINE OXIDASE WITH SPECIFICITY FOR SPERMINE AND SPERMIDINE

PubMed Central

Hirsch, James G.

1953-01-01

Sheep serum and bovine serum contain an enzyme which brings about a rapid oxidative deamination of certain biological amines. This enzyme differs from previously described amine oxidases in several regards and especially in its substrate specificity. Studies thus far indicate that only spermine and the closely related compound spermidine serve as substrates for the enzyme in sheep serum. For this reason, the enzyme has been named spermine oxidase. Spermine oxidase is active in a variety of fluids of various ionic strength and buffer composition. The reaction takes place between pH 6.0 and pH 8.0 with an optimal rate in the vicinity of neutrality. Under certain conditions, the rate of oxygen consumption during the initial phase of the reaction is independent of the concentration of substrate. The diminution in rate observed during the latter phase of the enzymatic attack appears to be due to an alteration in the kinetics at low concentrations of substrate, or to competitive inhibition by a product of the reaction. Carbonyl reagents almost completely block the action of spermine oxidase, while certain amines and the cyanide ion bring about partial inhibition. Thiol reagents and sequestering compounds do not alter the course of the oxidative process. In the presence of low concentrations of mercuric chloride, the sheep serum-spermine system consumes approximately twice as much oxygen as controls containing no mercuric ion. The mechanism by which the mercuric ion stimulates additional oxygen uptake is obscure. PMID:13052805

Cucumber possesses a single terminal alternative oxidase gene that is upregulated by cold stress and in the mosaic (MSC) mitochondrial mutants

USDA-ARS?s Scientific Manuscript database

In plants alternative oxidase (AOX) is an important nuclear-encoded enzyme active in the mitochondrial electron-transport chain, transferring electrons from ubiquinol to alternative oxidase instead of the cytochrome pathway to yield ubiquinone and water. AOX protects against unexpected inhibition of...

Evidence for a Key Role of Cytochrome bo3 Oxidase in Respiratory Energy Metabolism of Gluconobacter oxydans

PubMed Central

Richhardt, Janine; Luchterhand, Bettina; Büchs, Jochen

2013-01-01

The obligatory aerobic acetic acid bacterium Gluconobacter oxydans oxidizes a variety of substrates in the periplasm by membrane-bound dehydrogenases, which transfer the reducing equivalents to ubiquinone. Two quinol oxidases, cytochrome bo3 and cytochrome bd, then catalyze transfer of the electrons from ubiquinol to molecular oxygen. In this study, mutants lacking either of these terminal oxidases were characterized. Deletion of the cydAB genes for cytochrome bd had no obvious influence on growth, whereas the lack of the cyoBACD genes for cytochrome bo3 severely reduced the growth rate and the cell yield. Using a respiration activity monitoring system and adjusting different levels of oxygen availability, hints of a low-oxygen affinity of cytochrome bd oxidase were obtained, which were supported by measurements of oxygen consumption in a respirometer. The H+/O ratio of the ΔcyoBACD mutant with mannitol as the substrate was 0.56 ± 0.11 and more than 50% lower than that of the reference strain (1.26 ± 0.06) and the ΔcydAB mutant (1.31 ± 0.16), indicating that cytochrome bo3 oxidase is the main component for proton extrusion via the respiratory chain. Plasmid-based overexpression of cyoBACD led to increased growth rates and growth yields, both in the wild type and the ΔcyoBACD mutant, suggesting that cytochrome bo3 might be a rate-limiting factor of the respiratory chain. PMID:23852873

Interactions Between Monoamine Oxidase A and Punitive Discipline in African American and Caucasian Men's Antisocial Behavior.

PubMed

Choe, Daniel Ewon; Shaw, Daniel S; Hyde, Luke W; Forbes, Erika E

2014-09-01

Although previous studies have shown that interactions between monoamine oxidase A ( MAOA ) genotype and childhood maltreatment predict Caucasian boys' antisocial behavior, the generalizability of this gene-environment interaction to more diverse populations and more common parenting behaviors, such as punitive discipline in early childhood, is not clearly understood. Among 189 low-income men (44% African American, 56% Caucasian) who underwent rigorous assessments of family behavior and social context longitudinally across 20 years, those men with the low activity MAOA allele who experienced more punitive discipline at ages 1.5, 2, and 5 years showed more antisocial behavior from ages 15 through 20 years. Effects of punitive discipline on antisocial behavior differed by caregiver and age at which it occurred, suggesting sensitive periods throughout early childhood in which low MAOA activity elevated boys' vulnerability to harsh parenting and risk for antisocial behavior. This genetic vulnerability to punitive discipline-and not just extreme, maltreatment experiences-may generalize to other male populations at risk for antisocial behavior.

Nanoparticle strategies for cancer therapeutics: Nucleic acids, polyamines, bovine serum amine oxidase and iron oxide nanoparticles (Review).

PubMed

Agostinelli, Enzo; Vianello, Fabio; Magliulo, Giuseppe; Thomas, Thresia; Thomas, T J

2015-01-01

Nanotechnology for cancer gene therapy is an emerging field. Nucleic acids, polyamine analogues and cytotoxic products of polyamine oxidation, generated in situ by an enzyme-catalyzed reaction, can be developed for nanotechnology-based cancer therapeutics with reduced systemic toxicity and improved therapeutic efficacy. Nucleic acid-based gene therapy approaches depend on the compaction of DNA/RNA to nanoparticles and polyamine analogues are excellent agents for the condensation of nucleic acids to nanoparticles. Polyamines and amine oxidases are found in higher levels in tumours compared to that of normal tissues. Therefore, the metabolism of polyamines spermidine and spermine, and their diamine precursor, putrescine, can be targets for antineoplastic therapy since these naturally occurring alkylamines are essential for normal mammalian cell growth. Intracellular polyamine concentrations are maintained at a cell type-specific set point through the coordinated and highly regulated interplay between biosynthesis, transport, and catabolism. In particular, polyamine catabolism involves copper-containing amine oxidases. Several studies showed an important role of these enzymes in developmental and disease-related processes in animals through the control of polyamine homeostasis in response to normal cellular signals, drug treatment, and environmental and/or cellular stress. The production of toxic aldehydes and reactive oxygen species (ROS), H2O2 in particular, by these oxidases suggests a mechanism by which amine oxidases can be exploited as antineoplastic drug targets. The combination of bovine serum amine oxidase (BSAO) and polyamines prevents tumour growth, particularly well if the enzyme has been conjugated with a biocompatible hydrogel polymer. The findings described herein suggest that enzymatically formed cytotoxic agents activate stress signal transduction pathways, leading to apoptotic cell death. Consequently, superparamagnetic nanoparticles or other

Various applications of immobilized glucose oxidase and polyphenol oxidase in a conducting polymer matrix.

PubMed

Cil, M; Böyükbayram, A E; Kiralp, S; Toppare, L; Yağci, Y

2007-06-01

In this study, glucose oxidase and polyphenol oxidase were immobilized in conducting polymer matrices; polypyrrole and poly(N-(4-(3-thienyl methylene)-oxycarbonyl phenyl) maleimide-co-pyrrole) via electrochemical method. Fourier transform infrared and scanning electron microscope were employed to characterize the copolymer of (N-(4-(3-thienyl methylene)-oxycarbonyl phenyl) maleimide) with pyrrole. Kinetic parameters, maximum reaction rate and Michealis-Menten constant, were determined. Effects of temperature and pH were examined for immobilized enzymes. Also, storage and operational stabilities of enzyme electrodes were investigated. Glucose and polyphenol oxidase enzyme electrodes were used for determination of the glucose amount in orange juices and human serum and phenolic amount in red wines, respectively.

Association of IL-1β +3954 C/T and IL-10-1082 G/A cytokine gene polymorphisms with susceptibility to tuberculosis.

PubMed

Meenakshi, P; Ramya, S; Shruthi, T; Lavanya, J; Mohammed, H H; Mohammed, S A; Vijayalakshmi, V; Sumanlatha, G

2013-07-01

Tuberculosis (TB) constitutes the major cause of death due to infectious diseases. Cytokines play a major role in defence against Mycobacterium tuberculosis infection. Polymorphisms in the genes encoding various cytokines have been associated with tuberculosis susceptibility. Household contacts (HHC) are at increased risk of developing the disease. In this study, we examined the association of IL-1β and IL-10 cytokine gene polymorphisms with risk of developing tuberculosis in TB patients, their HHC and healthy controls (HC) using JavaStat and SPSS. Multifactor dimensionality reduction (MDR) analyses were performed to explore the potential gene-gene interactions. The genotype and allele frequencies of IL-1β +3954C/T polymorphism did not vary significantly between TB patients and HC. GG (P < 0.005, OR = 0.219 and 95% CI = 0.059-0.735) and GA (P < 0.0001, OR = 2.938 and 95% CI = 1.526-5.696) genotypes of IL-10-1082 G/A polymorphism were found to be significantly associated with patients versus HC. HHC with CC (P < 0.03, OR = 1.833 and 95% CI = 1.1-3.35) genotype in IL-1β and GA (P < 0.0001, OR = 4.612 and 95% CI = 2.225-9.702) genotype in IL-10 were at increased risk of developing tuberculosis. MDR tests revealed high-risk genotypes in IL-1β and IL-10 based on the association model. Our results demonstrate that the polymorphisms of IL-1β and IL-10 genes may be valuable markers to predict the risk for the development of TB in household contacts. © 2013 John Wiley & Sons Ltd.

Enhanced drought and heat stress tolerance of tobacco plants with ectopically enhanced cytokinin oxidase/dehydrogenase gene expression

PubMed Central

Macková, Hana; Hronková, Marie; Dobrá, Jana; Turečková, Veronika; Novák, Ondřej; Lubovská, Zuzana; Motyka, Václav; Haisel, Daniel; Hájek, Tomáš; Prášil, Ilja Tom; Gaudinová, Alena; Štorchová, Helena; Ge, Eva; Werner, Tomáš; Schmülling, Thomas; Vanková, Radomíra

2013-01-01

Responses to drought, heat, and combined stress were compared in tobacco (Nicotiana tabacum L.) plants ectopically expressing the cytokinin oxidase/dehydrogenase CKX1 gene of Arabidopsis thaliana L. under the control of either the predominantly root-expressed WRKY6 promoter or the constitutive 35S promoter, and in the wild type. WRKY6:CKX1 plants exhibited high CKX activity in the roots under control conditions. Under stress, the activity of the WRKY6 promoter was down-regulated and the concomitantly reduced cytokinin degradation coincided with raised bioactive cytokinin levels during the early phase of the stress response, which might contribute to enhanced stress tolerance of this genotype. Constitutive expression of CKX1 resulted in an enlarged root system, a stunted, dwarf shoot phenotype, and a low basal level of expression of the dehydration marker gene ERD10B. The high drought tolerance of this genotype was associated with a relatively moderate drop in leaf water potential and a significant decrease in leaf osmotic potential. Basal expression of the proline biosynthetic gene P5CSA was raised. Both wild-type and WRKY6:CKX1 plants responded to heat stress by transient elevation of stomatal conductance, which correlated with an enhanced abscisic acid catabolism. 35S:CKX1 transgenic plants exhibited a small and delayed stomatal response. Nevertheless, they maintained a lower leaf temperature than the other genotypes. Heat shock applied to drought-stressed plants exaggerated the negative stress effects, probably due to the additional water loss caused by a transient stimulation of transpiration. The results indicate that modulation of cytokinin levels may positively affect plant responses to abiotic stress through a variety of physiological mechanisms. PMID:23669573

Map-Based Cloning of Seed Dormancy1-2 Identified a Gibberellin Synthesis Gene Regulating the Development of Endosperm-Imposed Dormancy in Rice.

PubMed

Ye, Heng; Feng, Jiuhuan; Zhang, Lihua; Zhang, Jinfeng; Mispan, Muhamad S; Cao, Zhuanqin; Beighley, Donn H; Yang, Jianchang; Gu, Xing-You

2015-11-01

Natural variation in seed dormancy is controlled by multiple genes mapped as quantitative trait loci in major crop or model plants. This research aimed to clone and characterize the Seed Dormancy1-2 (qSD1-2) locus associated with endosperm-imposed dormancy and plant height in rice (Oryza sativa). qSD1-2 was delimited to a 20-kb region, which contains OsGA20ox2 and had an additive effect on germination. Naturally occurring or induced loss-of-function mutations of the gibberellin (GA) synthesis gene enhanced seed dormancy and also reduced plant height. Expression of this gene in seeds (including endospermic cells) during early development increased GA accumulation to promote tissue morphogenesis and maturation programs. The mutant allele prevalent in semidwarf cultivars reduced the seed GA content by up to 2-fold at the early stage, which decelerated tissue morphogenesis including endosperm cell differentiation, delayed abscisic acid accumulation by a shift in the temporal distribution pattern, and postponed dehydration, physiological maturity, and germinability development. As the endosperm of developing seeds dominates the moisture equilibrium and desiccation status of the embryo in cereal crops, qSD1-2 is proposed to control primary dormancy by a GA-regulated dehydration mechanism. Allelic distribution of OsGA20ox2, the rice Green Revolution gene, was associated with the indica and japonica subspeciation. However, this research provided no evidence that the primitive indica- and common japonica-specific alleles at the presumably domestication-related locus functionally differentiate in plant height and seed dormancy. Thus, the evolutionary mechanism of this agriculturally important gene remains open for discussion. © 2015 American Society of Plant Biologists. All Rights Reserved.

Gene expression and metabolite profiling of gibberellin biosynthesis during induction of somatic embryogenesis in Medicago truncatula Gaertn

PubMed Central

Igielski, Rafał

2017-01-01

Gibberellins (GAs) are involved in the regulation of numerous developmental processes in plants including zygotic embryogenesis, but their biosynthesis and role during somatic embryogenesis (SE) is mostly unknown. In this study we show that during three week- long induction phase, when cells of leaf explants from non-embryogenic genotype (M9) and embryogenic variant (M9-10a) were forming the callus, all the bioactive gibberellins from non-13-hydroxylation (GA4, GA7) and 13-hydroxylation (GA1, GA5, GA3, GA6) pathways were present, but the contents of only a few of them differed between the tested lines. The GA53 and GA19 substrates synthesized by the 13-hydroxylation pathway accumulated specifically in the M9-10a line after the first week of induction; subsequently, among the bioactive gibberellins detected, only the content of GA3 increased and appeared to be connected with acquisition of embryogenic competence. We fully annotated 20 Medicago truncatula orthologous genes coding the enzymes which catalyze all the known reactions of gibberellin biosynthesis. Our results indicate that, within all the genes tested, expression of only three: MtCPS, MtGA3ox1 and MtGA3ox2, was specific to embryogenic explants and reflected the changes observed in GA53, GA19 and GA3 contents. Moreover, by analyzing expression of MtBBM, SE marker gene, we confirmed the inhibitory effect of manipulation in GAs metabolism, applying exogenous GA3, which not only impaired the production of somatic embryos, but also significantly decreased expression of this gene. PMID:28750086

OsDOG, a gibberellin-induced A20/AN1 zinc-finger protein, negatively regulates gibberellin-mediated cell elongation in rice.

PubMed

Liu, Yaju; Xu, Yunyuan; Xiao, Jun; Ma, Qibin; Li, Dan; Xue, Zhen; Chong, Kang

2011-07-01

The A20/AN1 zinc-finger proteins (ZFPs) play pivotal roles in animal immune responses and plant stress responses. From previous gibberellin (GA) microarray data and A20/AN1 ZFP family member association, we chose Oryza sativa dwarf rice with overexpression of gibberellin-induced gene (OsDOG) to examine its function in the GA pathway. OsDOG was induced by gibberellic acid (GA(3)) and repressed by the GA-synthesis inhibitor paclobutrazol. Different transgenic lines with constitutive expression of OsDOG showed dwarf phenotypes due to deficiency of cell elongation. Additional GA(1) and real-time PCR quantitative assay analyses confirmed that the decrease of GA(1) in the overexpression lines resulted from reduced expression of GA3ox2 and enhanced expression of GA2ox1 and GA2ox3. Adding exogenous GA rescued the constitutive expression phenotypes of the transgenic lines. OsDOG has a novel function in regulating GA homeostasis and in negative maintenance of plant cell elongation in rice. Copyright © 2011 Elsevier GmbH. All rights reserved.

Photoluminescence and Band Alignment of Strained GaAsSb/GaAs QW Structures Grown by MBE on GaAs

PubMed Central

Sadofyev, Yuri G.; Samal, Nigamananda

2010-01-01

An in-depth optimization of growth conditions and investigation of optical properties including discussions on band alignment of GaAsSb/GaAs quantum well (QW) on GaAs by molecular beam epitaxy (MBE) are reported. Optimal MBE growth temperature of GaAsSb QW is found to be 470 ± 10 °C. GaAsSb/GaAs QW with Sb content ~0.36 has a weak type-II band alignment with valence band offset ratio QV ~1.06. A full width at half maximum (FWHM) of ~60 meV in room temperature (RT) photoluminescence (PL) indicates fluctuation in electrostatic potential to be less than 20 meV. Samples grown under optimal conditions do not exhibit any blue shift of peak in RT PL spectra under varying excitation.

A point mutation of valine-311 to methionine in Bacillus subtilis protoporphyrinogen oxidase does not greatly increase resistance to the diphenyl ether herbicide oxyfluorfen.

PubMed

Jeong, Eunjoo; Houn, Thavrak; Kuk, Yongin; Kim, Eun-Seon; Chandru, Hema Kumar; Baik, Myunggi; Back, Kyoungwhan; Guh, Ja-Ock; Han, Oksoo

2003-10-01

In an effort to asses the effect of Val311Met point mutation of Bacillus subtilis protoporphyrinogen oxidase on the resistance to diphenyl ether herbicides, a Val311Met point mutant of B. subtilis protoporphyrinogen oxidase was prepared, heterologously expressed in Escherichia coli, and the purified recombinant Val311Met mutant protoporphyrinogen oxidase was kinetically characterized. The mutant protoporphyrinogen oxidase showed very similar kinetic patterns to wild type protoporphyrinogen oxidase, with slightly decreased activity dependent on pH and the concentrations of NaCl, Tween 20, and imidazole. When oxyfluorfen was used as a competitive inhibitor, the Val311Met mutant protoporphyrinogen oxidase showed an increased inhibition constant about 1.5 times that of wild type protoporphyrinogen oxidase. The marginal increase of the inhibition constant indicates that the Val311Met point mutation in B. subtilis protoporphyrinogen oxidase may not be an important determinant in the mechanism that protects protoporphyrinogen oxidase against diphenyl ether herbicides.

Monoamine Oxidase A: A Novel Target for Progression and Metastasis of Prostate Cancer

DTIC Science & Technology

2013-10-01

Paik, J.H. 2011. FoxO family members in cancer. Cancer biology & therapy 12:253-259. 31. Myatt, S.S., and Lam , E.W. 2007. The emerging roles of...J.B., Chen, K., Li, Y., Lau , Y.F., and Shih, J.C. 2009. Regulation of monoamine oxidase A by the SRY gene on the Y chromosome. FASEB journal

Map-Based Cloning of Seed Dormancy1-2 Identified a Gibberellin Synthesis Gene Regulating the Development of Endosperm-Imposed Dormancy in Rice1

PubMed Central

Ye, Heng; Feng, Jiuhuan; Zhang, Lihua; Zhang, Jinfeng; Mispan, Muhamad S.; Cao, Zhuanqin; Beighley, Donn H.; Yang, Jianchang; Gu, Xing-You

2015-01-01

Natural variation in seed dormancy is controlled by multiple genes mapped as quantitative trait loci in major crop or model plants. This research aimed to clone and characterize the Seed Dormancy1-2 (qSD1-2) locus associated with endosperm-imposed dormancy and plant height in rice (Oryza sativa). qSD1-2 was delimited to a 20-kb region, which contains OsGA20ox2 and had an additive effect on germination. Naturally occurring or induced loss-of-function mutations of the gibberellin (GA) synthesis gene enhanced seed dormancy and also reduced plant height. Expression of this gene in seeds (including endospermic cells) during early development increased GA accumulation to promote tissue morphogenesis and maturation programs. The mutant allele prevalent in semidwarf cultivars reduced the seed GA content by up to 2-fold at the early stage, which decelerated tissue morphogenesis including endosperm cell differentiation, delayed abscisic acid accumulation by a shift in the temporal distribution pattern, and postponed dehydration, physiological maturity, and germinability development. As the endosperm of developing seeds dominates the moisture equilibrium and desiccation status of the embryo in cereal crops, qSD1-2 is proposed to control primary dormancy by a GA-regulated dehydration mechanism. Allelic distribution of OsGA20ox2, the rice Green Revolution gene, was associated with the indica and japonica subspeciation. However, this research provided no evidence that the primitive indica- and common japonica-specific alleles at the presumably domestication-related locus functionally differentiate in plant height and seed dormancy. Thus, the evolutionary mechanism of this agriculturally important gene remains open for discussion. PMID:26373662

Association of the -1082 G/A promoter polymorphism of interleukin-10 gene with the autoantibodies production in patients with rheumatoid arthritis.

PubMed

Nemec, Petr; Pavkova-Goldbergova, Monika; Gatterova, Jindra; Fojtik, Zdenek; Vasku, Anna; Soucek, Miroslav

2009-08-01

Interleukin-10 (IL-10) is an immunoregulatory cytokine, usually considered to mediate the downregulation of the inflammatory response in rheumatoid arthritis (RA). Some effects of IL-10 are not anti-inflammatory; for example, the activation of B cells to promote autoantibody production. Allelic polymorphisms located in the promoter region of the IL-10 gene may contribute to the regulation of autoantibodies production. To examine the putative association between the -1082 G/A polymorphism in the promoter region of the IL-10 gene and the susceptibility to disease onset and severity of RA, a total of 144 patients with RA diagnosed according to the revised criteria of the American College of Rheumatology for RA were consecutively recruited into the study. Radiographic progression of RA was scored according to the Sharp/van der Heijde method. Serum levels of rheumatoid factors (RFs) were measured by enzyme-linked immunosorbent assay. Polymerase chain reaction amplification was used for the analysis of the promoter polymorphism of the IL-10 gene. We observed significant differences in genotype distribution of the -1082 G/A polymorphism between IgM RF, IgA RF, and IgG RF positive/negative subgroups of RA patients, with higher prevalence of the GG genotype within IgM RF (Pg = 0.006), IgA RF (Pg = 0.05), and IgG RF (Pg = 0.007) negative RA patients. Results obtained in this study provide the evidence of an association between the -1082 G/A polymorphism in the IL-10 gene promoter and the production of RFs in RA patients.

Effects of losartan on hepatic expression of nonphagocytic NADPH oxidase and fibrogenic genes in patients with chronic hepatitis C.

PubMed

Colmenero, Jordi; Bataller, Ramón; Sancho-Bru, Pau; Domínguez, Marlene; Moreno, Montserrat; Forns, Xavier; Bruguera, Miquel; Arroyo, Vicente; Brenner, David A; Ginès, Pere

2009-10-01

Angiotensin II promotes liver fibrogenesis by stimulating nonphagocytic NADPH oxidase (NOX)-induced oxidative stress. Angiotensin II type 1 (AT1) receptor blockers attenuate experimental liver fibrosis, yet their effects in human liver fibrosis are unknown. We investigated the effects of losartan on hepatic expression of fibrogenic, inflammatory, and NOX genes in patients with chronic hepatitis C (CHC). Fourteen patients with CHC and liver fibrosis received oral losartan (50 mg/day) for 18 mo. Liver biopsies were performed at baseline and after treatment. The degree of inflammation and fibrosis was evaluated by histological analysis (METAVIR). Collagen content was measured by morphometric quantification of Sirius red staining. Overall collagen content and fibrosis stage remained stable in the whole series, yet the fibrosis stage decreased in seven patients. Inflammatory activity improved in seven patients. The effect of losartan on hepatic expression of 31 profibrogenic and inflammatory genes and components of the NOX complex was assessed by quantitative PCR. Losartan treatment was associated with a significant decrease in the expression of several profibrogenic and NOX genes including procollagen alpha1(I) and alpha1(IV), urokinase-type plasminogen activator, metalloproteinase type 2, NOX activator 1 (NOXA-1) and organizer 1 (NOXO-1), and Rac-1. Losartan was well tolerated in all patients and was effective in attenuating the activity of the systemic renin-angiotensin system. No effects on serum liver tests or viral load were observed. We conclude that prolonged administration of losartan, an oral AT1 receptor blocker, is associated with downregulation of NOX components and fibrogenic genes in patients with CHC. Controlled studies are warranted to assess the effect of AT1 receptor blockers in chronic liver injury.

The Mitochondrial Cytochrome Oxidase Subunit I Gene Occurs on a Minichromosome with Extensive Heteroplasmy in Two Species of Chewing Lice, Geomydoecus aurei and Thomomydoecus minor

PubMed Central

Pietan, Lucas L.; Spradling, Theresa A.

2016-01-01

In animals, mitochondrial DNA (mtDNA) typically occurs as a single circular chromosome with 13 protein-coding genes and 22 tRNA genes. The various species of lice examined previously, however, have shown mitochondrial genome rearrangements with a range of chromosome sizes and numbers. Our research demonstrates that the mitochondrial genomes of two species of chewing lice found on pocket gophers, Geomydoecus aurei and Thomomydoecus minor, are fragmented with the 1,536 base-pair (bp) cytochrome-oxidase subunit I (cox1) gene occurring as the only protein-coding gene on a 1,916–1,964 bp minicircular chromosome in the two species, respectively. The cox1 gene of T. minor begins with an atypical start codon, while that of G. aurei does not. Components of the non-protein coding sequence of G. aurei and T. minor include a tRNA (isoleucine) gene, inverted repeat sequences consistent with origins of replication, and an additional non-coding region that is smaller than the non-coding sequence of other lice with such fragmented mitochondrial genomes. Sequences of cox1 minichromosome clones for each species reveal extensive length and sequence heteroplasmy in both coding and noncoding regions. The highly variable non-gene regions of G. aurei and T. minor have little sequence similarity with one another except for a 19-bp region of phylogenetically conserved sequence with unknown function. PMID:27589589

Deciphering the role of NADPH oxidase in complex interactions between maize (Zea mays L.) genotypes and cereal aphids.

PubMed

Sytykiewicz, Hubert

2016-07-22

Plant NADPH oxidases (NOXs) encompass a group of membrane-bound enzymes participating in formation of reactive oxygen species (ROS) under physiological conditions as well as in response to environmental stressors. The purpose of the survey was to unveil the role of NADPH oxidase in pro-oxidative responses of maize (Zea mays L.) seedling leaves exposed to cereal aphids' infestation. The impact of apteral females of bird cherry-oat aphid (Rhopalosiphum padi L.) and grain aphid (Sitobion avenae F.) feeding on expression levels of all four NADPH oxidase genes (rbohA, rbohB, rbohC, rbohD) and total activity of NOX enzyme in maize plants were investigated. In addition, inhibitory effect of diphenylene iodonium (DPI) pre-treatment on NOX activity and hydrogen peroxide content in aphid-stressed maize seedlings was studied. Leaf infestation biotests were accomplished on 14-day-old seedlings representing two aphid-resistant varieties (Ambrozja and Waza) and two aphid-susceptible ones (Tasty Sweet and Złota Karłowa). Insects' attack led to profound upregulation of rbohA and rbohD genes in tested host plants, lower elevations were noted in level of rbohB mRNA, whereas abundance of rbohC transcript was not significantly altered. It was uncovered aphid-induced enhancement of NOX activity in examined plants. Higher increases in expression of all investigated rboh genes and activity of NADPH oxidase occurred in tissues of more resistant maize cultivars than in susceptible ones. Furthermore, DPI treatment resulted in strong reduction of NOX activity and H2O2 accumulation in aphid-infested Z. mays plants, thus evidencing circumstantial role of the enzyme in insect-elicited ROS generation. Copyright © 2016 Elsevier Inc. All rights reserved.

Proton gradients produced by glucose oxidase microcapsules containing motor F0F1-ATPase for continuous ATP biosynthesis.

PubMed

Duan, Li; Qi, Wei; Yan, Xuehai; He, Qiang; Cui, Yue; Wang, Kewei; Li, Dongxiang; Li, Junbai

2009-01-15

Glucose oxidase (GOD) microcapsules held together by cross-linker, glutaraldehyde (GA), are fabricated by the layer-by-layer (LbL) assembly technique. The lipid bilayer containing CF(0)F(1)-ATPase was coated on the outer shell of GOD microcapsules. Driven under the proton gradients produced by catalysis of GOD microcapsules for glucose, ATP is synthesized from ADP and inorganic phosphate catalyzed by the ATPase rotary catalysis. The results show here that ATPase reconstituted on the GOD microcapsules retains its catalytic activity.

Role of Caspase-9 Gene Ex5+32 G>A (rs1052576) Variant in Susceptibility to Primary Brain Tumors.

PubMed

Ozdogan, Selcuk; Kafadar, Ali; Yilmaz, Seda Gulec; Timirci-Kahraman, Ozlem; Gormus, Uzay; Isbir, Turgay

2017-09-01

This study is the first to evaluate the relationship of caspase-9 (CASP-9) gene polymorphism with the risk for primary brain tumor development. The study group included 43 glioma and 27 meningioma patients and 76 healthy individuals. CASP-9 gene Ex5+32 G>A (rs1052576) polymorphism was analyzed by real-time polymerase chain reaction (RT-PCR). Individuals with the CASP-9 GG genotype had significantly decreased risk of developing a glioma brain tumor (p=0.024). Additionally, the GA genotype was significantly lower in patients with glioma than the control group (p=0.019). A significantly decreased risk of developing glioma was found in the A allele carrier group (p=0.024). However, there was no statistically significant relationship between CASP-9 polymorphism and brain meningioma (p=0.493). CASP-9 (rs1052576) mutant A allele seems to be a protective factor for glioma brain tumor. Future studies with a larger sample size will clarify the possible roles of CASP-9 gene in the etiology and progression of primary brain tumors. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

Congenital hypothyroidism, dwarfism, and hearing impairment caused by a missense mutation in the mouse dual oxidase 2 gene, Duox2.

PubMed

Johnson, Kenneth R; Marden, Coleen C; Ward-Bailey, Patricia; Gagnon, Leona H; Bronson, Roderick T; Donahue, Leah Rae

2007-07-01

Dual oxidases generate the hydrogen peroxide needed by thyroid peroxidase for the incorporation of iodine into thyroglobulin, an essential step in thyroid hormone synthesis. Mutations in the human dual oxidase 2 gene, DUOX2, have been shown to underlie several cases of congenital hypothyroidism. We report here the first mouse Duox2 mutation, which provides a new genetic model for studying the specific function of DUOX2 in the thyroid gland and in other organ systems where it is hypothesized to play a role. We mapped the new spontaneous mouse mutation to chromosome 2 and identified it as a T>G base pair change in exon 16 of Duox2. The mutation changes a highly conserved valine to glycine at amino acid position 674 (V674G) and was named "thyroid dyshormonogenesis" (symbol thyd) to signify a defect in thyroid hormone synthesis. Thyroid glands of mutant mice are goitrous and contain few normal follicles, and anterior pituitaries are dysplastic. Serum T(4) in homozygotes is about one-tenth the level of controls and is accompanied by a more than 100-fold increase in TSH. The weight of adult mutant mice is approximately half that of littermate controls, and serum IGF-I is reduced. The cochleae of mutant mice exhibit abnormalities characteristic of hypothyroidism, including a delayed formation of the inner sulcus and tunnel of Corti and an abnormally thickened tectorial membrane. Hearing thresholds of adult mutant mice are on average 50-60 decibels (dB) above those of controls.

New Insights Into the Roles of NADPH Oxidases in Sexual Development and Ascospore Germination in Sordaria macrospora

PubMed Central