Sample records for gag-specific immunity induced

  1. Cyclophilin A as a potential genetic adjuvant to improve HIV-1 Gag DNA vaccine immunogenicity by eliciting broad and long-term Gag-specific cellular immunity in mice.

    PubMed

    Hou, Jue; Zhang, Qicheng; Liu, Zheng; Wang, Shuhui; Li, Dan; Liu, Chang; Liu, Ying; Shao, Yiming

    2016-01-01

    Previous research has shown that host Cyclophilin A (CyPA) can promote dendritic cell maturation and the subsequent innate immune response when incorporated into an HIV-1 Gag protein to circumvent the resistance of dendritic cells to HIV-1 infection. This led us to hypothesize that CyPA may improve HIV-1 Gag-specific vaccine immunogenicity via binding with Gag antigen. The adjuvant effect of CyPA was evaluated using a DNA vaccine with single or dual expression cassettes. Mouse studies indicated that CyPA specifically and markedly promoted HIV-1 Gag-specific cellular immunity but not an HIV-1 Env-specific cellular response. The Gag/CyPA dual expression cassettes stimulated a greater Gag-specific cellular immune response, than Gag immunization alone. Furthermore, CyPA induced a broad Gag-specific T cell response and strong cellular immunity that lasted up to 5 months. In addition, CyPA skewed to cellular rather than humoral immunity. To investigate the mechanisms of the adjuvant effect, site-directed mutagenesis in CyPA, including active site residues H54Q and F60A resulted in mutants that were co-expressed with Gag in dual cassettes. The immune response to this vaccine was analyzed in vivo. Interestingly, the wild type CyPA markedly increased Gag cellular immunity, but the H54Q and F60A mutants drastically reduced CyPA adjuvant activation. Therefore, we suggest that the adjuvant effect of CyPA was based on Gag-CyPA-specific interactions. Herein, we report that Cyclophilin A can augment HIV-1 Gag-specific cellular immunity as a genetic adjuvant in multiplex DNA immunization strategies, and that activity of this adjuvant is specific, broad, long-term, and based on Gag-CyPA interaction.

  2. Mucosal Immunization with Newcastle Disease Virus Vector Coexpressing HIV-1 Env and Gag Proteins Elicits Potent Serum, Mucosal, and Cellular Immune Responses That Protect against Vaccinia Virus Env and Gag Challenges.

    PubMed

    Khattar, Sunil K; Manoharan, Vinoth; Bhattarai, Bikash; LaBranche, Celia C; Montefiori, David C; Samal, Siba K

    2015-07-21

    Newcastle disease virus (NDV) avirulent strain LaSota was used to coexpress gp160 Env and p55 Gag from a single vector to enhance both Env-specific and Gag-specific immune responses. The optimal transcription position for both Env and Gag genes in the NDV genome was determined by generating recombinant NDV (rNDV)-Env-Gag (gp160 located between the P and M genes and Gag between the HN and L genes), rNDV-Gag-Env (Gag located between the P and M genes and gp160 between the HN and L genes), rNDV-Env/Gag (gp160 followed by Gag located between the P and M genes), and rNDV-Gag/Env (Gag followed by gp160 located between the P and M genes). All the recombinant viruses replicated at levels similar to those seen with parental NDV in embryonated chicken eggs and in chicken fibroblast cells. Both gp160 and Gag proteins were expressed at high levels in cell culture, with gp160 found to be incorporated into the envelope of NDV. The Gag and Env proteins expressed by all the recombinants except rNDV-Env-Gag self-assembled into human immunodeficiency virus type 1 (HIV-1) virus-like particles (VLPs). Immunization of guinea pigs by the intranasal route with these rNDVs produced long-lasting Env- and Gag-specific humoral immune responses. The Env-specific humoral and mucosal immune responses and Gag-specific humoral immune responses were higher in rNDV-Gag/Env and rNDV-Env/Gag than in the other recombinants. rNDV-Gag/Env and rNDV-Env/Gag were also more efficient in inducing cellular as well as protective immune responses to challenge with vaccinia viruses expressing HIV-1 Env and Gag in mice. These results suggest that vaccination with a single rNDV coexpressing Env and Gag represents a promising strategy to enhance immunogenicity and protective efficacy against HIV. A safe and effective vaccine that can induce both systemic and mucosal immune responses is needed to control HIV-1. In this study, we showed that coexpression of Env and Gag proteins of HIV-1 performed using a single

  3. Regulation of HIV-Gag Expression and Targeting to the Endolysosomal/Secretory Pathway by the Luminal Domain of Lysosomal-Associated Membrane Protein (LAMP-1) Enhance Gag-Specific Immune Response

    PubMed Central

    Lucas, Carolina Gonçalves de Oliveira; Rigato, Paula Ordonhez; Gonçalves, Jorge Luiz Santos; Sato, Maria Notomi; Maciel, Milton; Peçanha, Ligia Maria Torres; August, J. Thomas; de Azevedo Marques, Ernesto Torres; de Arruda, Luciana Barros

    2014-01-01

    We have previously demonstrated that a DNA vaccine encoding HIV-p55gag in association with the lysosomal associated membrane protein-1 (LAMP-1) elicited a greater Gag-specific immune response, in comparison to a DNA encoding the native gag. In vitro studies have also demonstrated that LAMP/Gag was highly expressed and was present in MHCII containing compartments in transfected cells. In this study, the mechanisms involved in these processes and the relative contributions of the increased expression and altered traffic for the enhanced immune response were addressed. Cells transfected with plasmid DNA constructs containing p55gag attached to truncated sequences of LAMP-1 showed that the increased expression of gag mRNA required p55gag in frame with at least 741 bp of the LAMP-1 luminal domain. LAMP luminal domain also showed to be essential for Gag traffic through lysosomes and, in this case, the whole sequence was required. Further analysis of the trafficking pathway of the intact LAMP/Gag chimera demonstrated that it was secreted, at least in part, associated with exosome-like vesicles. Immunization of mice with LAMP/gag chimeric plasmids demonstrated that high expression level alone can induce a substantial transient antibody response, but targeting of the antigen to the endolysosomal/secretory pathways was required for establishment of cellular and memory response. The intact LAMP/gag construct induced polyfunctional CD4+ T cell response, which presence at the time of immunization was required for CD8+ T cell priming. LAMP-mediated targeting to endolysosomal/secretory pathway is an important new mechanistic element in LAMP-mediated enhanced immunity with applications to the development of novel anti-HIV vaccines and to general vaccinology field. PMID:24932692

  4. Mucosal Immunization with Newcastle Disease Virus Vector Coexpressing HIV-1 Env and Gag Proteins Elicits Potent Serum, Mucosal, and Cellular Immune Responses That Protect against Vaccinia Virus Env and Gag Challenges

    PubMed Central

    Khattar, Sunil K.; Manoharan, Vinoth; Bhattarai, Bikash; LaBranche, Celia C.; Montefiori, David C.

    2015-01-01

    ABSTRACT Newcastle disease virus (NDV) avirulent strain LaSota was used to coexpress gp160 Env and p55 Gag from a single vector to enhance both Env-specific and Gag-specific immune responses. The optimal transcription position for both Env and Gag genes in the NDV genome was determined by generating recombinant NDV (rNDV)-Env-Gag (gp160 located between the P and M genes and Gag between the HN and L genes), rNDV-Gag-Env (Gag located between the P and M genes and gp160 between the HN and L genes), rNDV-Env/Gag (gp160 followed by Gag located between the P and M genes), and rNDV-Gag/Env (Gag followed by gp160 located between the P and M genes). All the recombinant viruses replicated at levels similar to those seen with parental NDV in embryonated chicken eggs and in chicken fibroblast cells. Both gp160 and Gag proteins were expressed at high levels in cell culture, with gp160 found to be incorporated into the envelope of NDV. The Gag and Env proteins expressed by all the recombinants except rNDV-Env-Gag self-assembled into human immunodeficiency virus type 1 (HIV-1) virus-like particles (VLPs). Immunization of guinea pigs by the intranasal route with these rNDVs produced long-lasting Env- and Gag-specific humoral immune responses. The Env-specific humoral and mucosal immune responses and Gag-specific humoral immune responses were higher in rNDV-Gag/Env and rNDV-Env/Gag than in the other recombinants. rNDV-Gag/Env and rNDV-Env/Gag were also more efficient in inducing cellular as well as protective immune responses to challenge with vaccinia viruses expressing HIV-1 Env and Gag in mice. These results suggest that vaccination with a single rNDV coexpressing Env and Gag represents a promising strategy to enhance immunogenicity and protective efficacy against HIV. PMID:26199332

  5. Immunization of neonatal mice with LAMP/p55 HIV gag DNA elicits robust immune responses that last to adulthood

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ordonhez Rigato, Paula; Maciel, Milton; Goldoni, Adriana Leticia

    2010-10-10

    Successful T cell priming in early postnatal life that can generate effective long-lasting responses until adulthood is critical in HIV vaccination strategies because it prevents early sexual initiation and breastfeeding transmission of HIV. A chimeric DNA vaccine encoding p55 HIV gag associated with lysosome-associated membrane protein 1 (LAMP-1; which drives the antigen to the MIIC compartment), has been used to enhance cellular and humoral antigen-specific responses in adult mice and macaques. Herein, we investigated LAMP-1/gag vaccine immunogenicity in the neonatal period in mice and its ability to generate long-lasting effects. Neonatal vaccination with chimeric LAMP/gag generated stronger Gag-specific immune responses,more » as measured by the breadth of the Gag peptide-specific IFN-{gamma}, proliferative responsiveness, cytokine production and antibody production, all of which revealed activation of CD4+ T cells as well as the generation of a more robust CTL response compared to gag vaccine alone. To induce long-lived T and B cell memory responses, it was necessary to immunize neonates with the chimeric LAMP/gag DNA vaccine. The LAMP/gag DNA vaccine strategy could be particularly useful for generating an anti-HIV immune response in the early postnatal period capable of inducing long-term immunological memory.« less

  6. Maternal LAMP/p55gagHIV-1 DNA immunization induces in utero priming and a long-lasting immune response in vaccinated neonates.

    PubMed

    Rigato, Paula Ordonhez; Maciel, Milton; Goldoni, Adriana Letícia; Piubelli, Orlando Guerra; Orii, Noemia Mie; Marques, Ernesto Torres; August, Joseph Thomas; Duarte, Alberto José da Silva; Sato, Maria Notomi

    2012-01-01

    Infants born to HIV-infected mothers are at high risk of becoming infected during gestation or the breastfeeding period. A search is thus warranted for vaccine formulations that will prevent mother-to-child HIV transmission. The LAMP/gag DNA chimeric vaccine encodes the HIV-1 p55gag fused to the lysosome-associated membrane protein-1 (LAMP-1) and has been shown to enhance anti-Gag antibody (Ab) and cellular immune responses in adult and neonatal mice; such a vaccine represents a new concept in antigen presentation. In this study, we evaluated the effect of LAMP/gag DNA immunization on neonates either before conception or during pregnancy. LAMP/gag immunization of BALB/c mice before conception by the intradermal route led to the transfer of anti-Gag IgG1 Ab through the placenta and via breastfeeding. Furthermore, there were an increased percentage of CD4+CD25+Foxp3+T cells in the spleens of neonates. When offspring were immunized with LAMP/gag DNA, the anti-Gag Ab response and the Gag-specific IFN-γ-secreting cells were decreased. Inhibition of anti-Gag Ab production and cellular responses were not observed six months after immunization, indicating that maternal immunization did not interfere with the long-lasting memory response in offspring. Injection of purified IgG in conjunction with LAMP/gag DNA immunization decreased humoral and cytotoxic T-cell responses. LAMP/gag DNA immunization by intradermal injection prior to conception promoted the transfer of Ab, leading to a diminished response to Gag without interfering with the development of anti-Gag T- and B-cell memory. Finally, we assessed responses after one intravenous injection of LAMP/gag DNA during the last five days of pregnancy. The intravenous injection led to in utero immunization. In conclusion, DNA vaccine enconding LAMP-1 with Gag and other HIV-1 antigens should be considered in the development of a protective vaccine for the maternal/fetal and newborn periods.

  7. Maternal LAMP/p55gagHIV-1 DNA Immunization Induces In Utero Priming and a Long-Lasting Immune Response in Vaccinated Neonates

    PubMed Central

    Rigato, Paula Ordonhez; Maciel, Milton; Goldoni, Adriana Letícia; Piubelli, Orlando Guerra; Orii, Noemia Mie; Marques, Ernesto Torres; August, Joseph Thomas; Duarte, Alberto José da Silva; Sato, Maria Notomi

    2012-01-01

    Infants born to HIV-infected mothers are at high risk of becoming infected during gestation or the breastfeeding period. A search is thus warranted for vaccine formulations that will prevent mother-to-child HIV transmission. The LAMP/gag DNA chimeric vaccine encodes the HIV-1 p55gag fused to the lysosome-associated membrane protein-1 (LAMP-1) and has been shown to enhance anti-Gag antibody (Ab) and cellular immune responses in adult and neonatal mice; such a vaccine represents a new concept in antigen presentation. In this study, we evaluated the effect of LAMP/gag DNA immunization on neonates either before conception or during pregnancy. LAMP/gag immunization of BALB/c mice before conception by the intradermal route led to the transfer of anti-Gag IgG1 Ab through the placenta and via breastfeeding. Furthermore, there were an increased percentage of CD4+CD25+Foxp3+T cells in the spleens of neonates. When offspring were immunized with LAMP/gag DNA, the anti-Gag Ab response and the Gag-specific IFN-γ-secreting cells were decreased. Inhibition of anti-Gag Ab production and cellular responses were not observed six months after immunization, indicating that maternal immunization did not interfere with the long-lasting memory response in offspring. Injection of purified IgG in conjunction with LAMP/gag DNA immunization decreased humoral and cytotoxic T-cell responses. LAMP/gag DNA immunization by intradermal injection prior to conception promoted the transfer of Ab, leading to a diminished response to Gag without interfering with the development of anti-Gag T- and B-cell memory. Finally, we assessed responses after one intravenous injection of LAMP/gag DNA during the last five days of pregnancy. The intravenous injection led to in utero immunization. In conclusion, DNA vaccine enconding LAMP-1 with Gag and other HIV-1 antigens should be considered in the development of a protective vaccine for the maternal/fetal and newborn periods. PMID:22355381

  8. Evaluation of humoral, mucosal, and cellular immune responses following co-immunization of HIV-1 Gag and Env proteins expressed by Newcastle disease virus

    PubMed Central

    Khattar, Sunil K; Palaniyandi, Senthilkumar; Samal, Sweety; LaBranche, Celia C; Montefiori, David C; Zhu, Xiaoping; Samal, Siba K

    2015-01-01

    The combination of multiple HIV antigens in a vaccine can broaden antiviral immune responses. In this study, we used NDV vaccine strain LaSota to generate rNDV (rLaSota/optGag) expressing human codon optimized p55 Gag protein of HIV-1. We examined the effect of co-immunization of rLaSota/optGag with rNDVs expressing different forms of Env protein gp160, gp120, gp140L [a version of gp140 that lacked cytoplasmic tail and contained complete membrane-proximal external region (MPER)] and gp140S (a version of gp140 that lacked cytoplasmic tail and distal half of MPER) on magnitude and breadth of humoral, mucosal and cellular immune responses in guinea pigs and mice. Our results showed that inclusion of rLaSota/optGag with rNDVs expressing different forms of Env HIV Gag did not affect the Env-specific humoral and mucosal immune responses in guinea pigs and that the potent immune responses generated against Env persisted for at least 13 weeks post immunization. The highest Env-specific humoral and mucosal immune responses were observed with gp140S+optGag group. The neutralizing antibody responses against HIV strains BaL.26 and MN.3 induced by gp140S+optGag and gp160+optGag were higher than those elicited by other groups. Inclusion of Gag with gp160, gp140S and gp140L enhanced the level of Env-specific IFN-γ-producing CD8+ T cells in mice. Inclusion of Gag with gp160 and gp140L also resulted in increased Env-specific CD4+ T cells. The level of Gag-specific CD8+ and CD4+ T cells was also enhanced in mice immunized with Gag along with gp140S and gp120. These results indicate lack of antigen interference in a vaccine containing rNDVs expressing Env and Gag proteins. PMID:25695657

  9. Induction of strong anti-HIV cellular immunity by a combination of Clostridium perfringens expressing HIV gag and virus like particles.

    PubMed

    Pegu, Poonam; Helmus, Ruth; Gupta, Phalguni; Tarwater, Patrick; Caruso, Lori; Shen, Chengli; Ross, Ted; Chen, Yue

    2011-12-01

    The lower gastrointestinal tract is a major mucosal site of HIV entry and initial infection. Thus, the induction of strong cellular immune responses at this mucosal site will be an important feature of an effective HIV vaccine. We have used a novel prime-boost vaccination approach to induce immune responses at mucosal sites. Orally delivered recombinant Clostridium perfringens expressing HIV-1 gag (Cp-Gag) was evaluated for induction of HIV-1 Gag specific T cell responses in a prime-boost model with intranasal inoculation of HIV-1 virus like particles (VLP). HIV-1 specific cellular immune responses in both the effector (Lamina propria) and inductive sites (Peyer's patches) of the gastrointestinal (GI) tract were significantly higher in mice immunized using Cp-Gag and VLPs in a prime-boost approach compared to mice immunized with either Cp-Gag or VLPs alone. Such cellular immune response was found to be mediated by both CD8(+) and CD4(+) T cells. Such a strong mucosal immune response could be very useful in developing a mucosal vaccine against HIV-1.

  10. Post-translational intracellular trafficking determines the type of immune response elicited by DNA vaccines expressing Gag antigen of Human Immunodeficiency Virus Type 1 (HIV-1).

    PubMed

    Wallace, Aaron; West, Kim; Rothman, Alan L; Ennis, Francis A; Lu, Shan; Wang, Shixia

    2013-10-01

    In the current study, immune responses induced by Gag DNA vaccines with different designs were evaluated in Balb/C mice. The results demonstrated that the DNA vaccine with the full length wild type gag gene (Wt-Gag) mainly produced Gag antigens intracellularly and induced a higher level of cell-mediated immune (CMI) responses, as measured by IFN-gamma ELISPOT, intracellular cytokine staining (ICS), and cytotoxic T lymphocytes (CTL) assays against a dominant CD8(+) T cell epitope (AMQMLKETI). In contrast, the addition of a tissue plasminogen activator (tPA) leader sequence significantly improved overall Gag protein expression/secretion and Gag-specific antibody responses; however, Gag-specific CMI responses were decreased. The mutation of zinc-finger motif changed Gag protein expression patterns and reduced the ability to generate both CMI and antibody responses against Gag. These findings indicate that the structure and post-translational processing of antigens expressed by DNA vaccines play a critical role in eliciting optimal antibody or CMI responses.

  11. [Immune response induced by HIV DNA vaccine combined with recombinant adeno-associated virus].

    PubMed

    Liu, Yan-zheng; Zhou, Ling; Wang, Qi; Ye, Shu-qing; Li, Hong-xia; Zeng, Yi

    2004-09-01

    HIV-1 DNA vaccine and recombinant adeno-associated virus (rAAV) expressing gagV3 gene of HIV-1 subtype B were constructed and BALB/c mice were immunized by vaccination regimen consisting of consecutive priming with DNA vaccine and boosting with rAAV vaccine; the CTL and antibody response were detected and compared with those induced by DNA vaccine or rAAV vaccine separately. HIV-1 subtype B gagV3 gene was inserted into the polyclonal site of plasmid pCI-neo, DNA vaccine pCI-gagV3 was thereby constructed; pCI-gagV3 was transfected into p815 cells, G-418-resistant cells were obtained through screening transfected cells with G418, the expression of HIV-1 antigen in G-418-resistant cells was detected by EIA; BALB/c mice were immunized with pCI-gagV3 and the immune response was tested; BALB/c mouse immunized with pCI-gagV3 and combined with rAAV expressing the same gagV3 genes were tested for antibody level in sera by EIA method and cytotoxicity response by LDH method. pCI-gagV3 could express HIV-1 gene in p815 cells; pCI-gagV3 could induce HIV-1 specific humoral and cell-mediated immune response in BALB/c mice. The HIV-1 specific antibody level was 1/20; when the ratio of effector cells: target cells was 50:1, the average specific cytotoxicity was 41.7%; there was no evident increase in the antibody level induced by pCI-gagV3 combined with rAAV, but there was increase in CTL response, the average specific cytotoxicity was 61.3% when effector cells: target cells ratio was 50:1. HIV-1 specific cytotoxicity in BALB/c mice can be increased by immunization of BALB/c mice with DNA vaccine combined with rAAV vaccine.

  12. Identification of a gag-encoded cytotoxic T-lymphocyte epitope from FBL-3 leukemia shared by Friend, Moloney, and Rauscher murine leukemia virus-induced tumors.

    PubMed Central

    Chen, W; Qin, H; Chesebro, B; Cheever, M A

    1996-01-01

    FBL-3 is a highly immunogenic murine leukemia of C57BL/6 origin induced by Friend murine leukemia virus (MuLV). Immunization of C57BL/6 mice with FBL-3 readily elicits CD8+ cytotoxic T lymphocytes (CTL) capable of lysing FBL-3 as well as syngeneic leukemias induced by Moloney and Rauscher MuLV. The aim of this current study was to identify the immunogenic epitope(s) recognized by the FBL-3-specific CD8+ CTL. A series of FBL-3-specific CD8+ CTL clones were generated from C57BL/6 mice immunized to FBL-3. The majority of CTL clones (32 of 38) were specific for F-MuLV gag-encoded antigen. By using a series of recombinant vaccinia viruses expressing full-length and truncated F-MuLV gag genes, the antigenic epitope recognized by the FBL-3 gag-specific CTL clones, as well as by bulk-cultured CTL from spleens of mice immune to FBL-3, was localized to the leader sequence of gPr80gag protein. The precise amino acid sequence of the CTL epitope in the leader sequence was identified as CCLCLTVFL (positions 85-93) by examining lysis of targets incubated with a series of synthetic leader sequence peptides. No evidence of other CTL epitopes in the gPr80gag or Pr65gag core virion structural polyproteins was found. The identity of CCLCLTVFL as the target peptide was validated by showing that immunization with the peptide elicited CTL that lysed FBL-3. The CTL elicited by the Gag peptide also specifically lysed syngeneic leukemia cells induced by Moloney and Rauscher MuLV (MBL-2 and RBL-5). The transmembrane peptide was shown to be the major gag-encoded antigenic epitope recognized by bulk-cultured CTL derived from C57BL/6 mice immunized to MBL-2 or RBL-5. Thus, the CTL epitope of FBL-3 is localized to the transmembrane anchor domain of the nonstructural Gag polyprotein and is shared by leukemia/lymphoma cell lines induced by Friend, Moloney, and Rauscher MuLV. PMID:8892898

  13. Oral Immunization with a Recombinant Lactococcus lactis-Expressing HIV-1 Antigen on Group A Streptococcus Pilus Induces Strong Mucosal Immunity in the Gut.

    PubMed

    Chamcha, Venkateswarlu; Jones, Andrew; Quigley, Bernard R; Scott, June R; Amara, Rama Rao

    2015-11-15

    The induction of a potent humoral and cellular immune response in mucosal tissue is important for the development of an effective HIV vaccine. Most of the current HIV vaccines under development use the i.m. route for immunization, which is relatively poor in generating potent and long-lived mucosal immune responses. In this article, we explore the ability of an oral vaccination with a probiotic organism, Lactococcus lactis, to elicit HIV-specific immune responses in the mucosal and systemic compartments of BALB/c mice. We expressed the HIV-1 Gag-p24 on the tip of the T3 pilus of Streptococcus pyogenes as a fusion to the Cpa protein (LL-Gag). After four monthly LL-Gag oral immunizations, we observed strong Gag-specific IgG and IgA responses in serum, feces, and vaginal secretions. However, the Gag-specific CD8 T cell responses in the blood were at or below our detection limit. After an i.m. modified vaccinia Ankara/Gag boost, we observed robust Gag-specific CD8 T cell responses both in systemic and in mucosal tissues, including intraepithelial and lamina propria lymphocytes of the small intestine, Peyer's patches, and mesenteric lymph nodes. Consistent with strong immunogenicity, the LL-Gag induced activation of CD11c(+) CD11b(+) dendritic cells in the Peyer's patches after oral immunization. Our results demonstrate that oral immunization with L. lactis expressing an Ag on the tip of the group A Streptococcus pilus serves as an excellent vaccine platform to induce strong mucosal humoral and cellular immunity against HIV. Copyright © 2015 by The American Association of Immunologists, Inc.

  14. A dendritic cell targeted vaccine induces long-term HIV-specific immunity within the gastrointestinal tract.

    PubMed

    Ruane, D; Do, Y; Brane, L; Garg, A; Bozzacco, L; Kraus, T; Caskey, M; Salazar, A; Trumpheller, C; Mehandru, S

    2016-09-01

    Despite significant therapeutic advances for HIV-1 infected individuals, a preventative HIV-1 vaccine remains elusive. Studies focusing on early transmission events, including the observation that there is a profound loss of gastrointestinal (GI) CD4(+) T cells during acute HIV-1 infection, highlight the importance of inducing HIV-specific immunity within the gut. Here we report on the generation of cellular and humoral immune responses in the intestines by a mucosally administered, dendritic cell (DC) targeted vaccine. Our results show that nasally delivered α-CD205-p24 vaccine in combination with polyICLC, induced polyfunctional immune responses within naso-pulmonary lymphoid sites that disseminated widely to systemic and mucosal (GI tract and the vaginal epithelium) sites. Qualitatively, while α-CD205-p24 prime-boost immunization generated CD4(+) T-cell responses, heterologous prime-boost immunization with α-CD205-p24 and NYVAC gag-p24 generated high levels of HIV-specific CD4(+) and CD8(+) T cells within the GI tract. Finally, DC-targeting enhanced the amplitude and longevity of vaccine-induced immune responses in the GI tract. This is the first report of a nasally delivered, DC-targeted vaccine to generate HIV-specific immune responses in the GI tract and will potentially inform the design of preventative approaches against HIV-1 and other mucosal infections.

  15. Central nervous system-specific consequences of simian immunodeficiency virus Gag escape from major histocompatability complex class I-mediated control

    PubMed Central

    Beck, Sarah E.; Queen, Suzanne E.; Viscidi, Raphael; Johnson, Darius; Kent, Stephen J.; Adams, Robert J.; Tarwater, Patrick M.; Mankowski, Joseph L.

    2016-01-01

    In the fourth decade of the HIV epidemic, the relationship between host immunity and HIV central nervous system (CNS) disease remains incompletely understood. Using a simian immunodeficiency virus (SIV)/macaque model, we examined CNS outcomes in pigtailed macaques expressing the MHC class I allele Mane-A1*084:01 which confers resistance to SIV-induced CNS disease and induces the prototypic viral escape mutation Gag K165R. Insertion of gag K165R into the neurovirulent clone SIV/17E-Fr reduced viral replication in vitro compared to SIV/17E-Fr. We also found lower CSF, but not plasma, viral loads in macaques inoculated with SIV/17E-Fr K165R versus those inoculated with wildtype. Although escape mutation K165R was genotypically stable in plasma, it rapidly reverted to wildtype Gag KP9 in both CSF and in microglia cultures. We induced robust Gag KP9-specific CTL tetramer responses by vaccinating Mane-A*084:01-positive pigtailed macaques with a Gag KP9 virus-like particle (VLP) vaccine. Upon SIV/17E-Fr challenge, vaccinated animals had lower SIV RNA in CSF compared to unvaccinated controls, but showed no difference in plasma viral loads. These data clearly demonstrate that viral fitness in the CNS is distinct from the periphery and underscores the necessity of understanding the consequences of viral escape in CNS disease with the advent of new therapeutic vaccination strategies. PMID:26727909

  16. Central nervous system-specific consequences of simian immunodeficiency virus Gag escape from major histocompatibility complex class I-mediated control.

    PubMed

    Beck, Sarah E; Queen, Suzanne E; Viscidi, Raphael; Johnson, Darius; Kent, Stephen J; Adams, Robert J; Tarwater, Patrick M; Mankowski, Joseph L

    2016-08-01

    In the fourth decade of the HIV epidemic, the relationship between host immunity and HIV central nervous system (CNS) disease remains incompletely understood. Using a simian immunodeficiency virus (SIV)/macaque model, we examined CNS outcomes in pigtailed macaques expressing the MHC class I allele Mane-A1*084:01 which confers resistance to SIV-induced CNS disease and induces the prototypic viral escape mutation Gag K165R. Insertion of gag K165R into the neurovirulent clone SIV/17E-Fr reduced viral replication in vitro compared to SIV/17E-Fr. We also found lower cerebrospinal fluid (CSF), but not plasma, viral loads in macaques inoculated with SIV/17E-Fr K165R versus those inoculated with wildtype. Although escape mutation K165R was genotypically stable in plasma, it rapidly reverted to wildtype Gag KP9 in both CSF and in microglia cultures. We induced robust Gag KP9-specific CTL tetramer responses by vaccinating Mane-A*084:01-positive pigtailed macaques with a Gag KP9 virus-like particle (VLP) vaccine. Upon SIV/17E-Fr challenge, vaccinated animals had lower SIV RNA in CSF compared to unvaccinated controls, but showed no difference in plasma viral loads. These data clearly demonstrate that viral fitness in the CNS is distinct from the periphery and underscores the necessity of understanding the consequences of viral escape in CNS disease with the advent of new therapeutic vaccination strategies.

  17. Induction of complex immune responses and strong protection against retrovirus challenge by adenovirus-based immunization depends on the order of vaccine delivery.

    PubMed

    Kaulfuß, Meike; Wensing, Ina; Windmann, Sonja; Hrycak, Camilla Patrizia; Bayer, Wibke

    2017-02-06

    In the Friend retrovirus mouse model we developed potent adenovirus-based vaccines that were designed to induce either strong Friend virus GagL 85-93 -specific CD8 + T cell or antibody responses, respectively. To optimize the immunization outcome we evaluated vaccination strategies using combinations of these vaccines. While the vaccines on their own confer strong protection from a subsequent Friend virus challenge, the simple combination of the vaccines for the establishment of an optimized immunization protocol did not result in a further improvement of vaccine effectivity. We demonstrate that the co-immunization with GagL 85-93 /leader-gag encoding vectors together with envelope-encoding vectors abrogates the induction of GagL 85-93 -specific CD8 + T cells, and in successive immunization protocols the immunization with the GagL 85-93 /leader-gag encoding vector had to precede the immunization with an envelope encoding vector for the efficient induction of GagL 85-93 -specific CD8 + T cells. Importantly, the antibody response to envelope was in fact enhanced when the mice were adenovirus-experienced from a prior immunization, highlighting the expedience of this approach. To circumvent the immunosuppressive effect of envelope on immune responses to simultaneously or subsequently administered immunogens, we developed a two immunizations-based vaccination protocol that induces strong immune responses and confers robust protection of highly Friend virus-susceptible mice from a lethal Friend virus challenge.

  18. Characterization of Glycosaminoglycan (GAG) Sulfatases from the Human Gut Symbiont Bacteroides thetaiotaomicron Reveals the First GAG-specific Bacterial Endosulfatase*

    PubMed Central

    Ulmer, Jonathan E.; Vilén, Eric Morssing; Namburi, Ramesh Babu; Benjdia, Alhosna; Beneteau, Julie; Malleron, Annie; Bonnaffé, David; Driguez, Pierre-Alexandre; Descroix, Karine; Lassalle, Gilbert; Le Narvor, Christine; Sandström, Corine; Spillmann, Dorothe; Berteau, Olivier

    2014-01-01

    Despite the importance of the microbiota in human physiology, the molecular bases that govern the interactions between these commensal bacteria and their host remain poorly understood. We recently reported that sulfatases play a key role in the adaptation of a major human commensal bacterium, Bacteroides thetaiotaomicron, to its host (Benjdia, A., Martens, E. C., Gordon, J. I., and Berteau, O. (2011) J. Biol. Chem. 286, 25973–25982). We hypothesized that sulfatases are instrumental for this bacterium, and related Bacteroides species, to metabolize highly sulfated glycans (i.e. mucins and glycosaminoglycans (GAGs)) and to colonize the intestinal mucosal layer. Based on our previous study, we investigated 10 sulfatase genes induced in the presence of host glycans. Biochemical characterization of these potential sulfatases allowed the identification of GAG-specific sulfatases selective for the type of saccharide residue and the attachment position of the sulfate group. Although some GAG-specific bacterial sulfatase activities have been described in the literature, we report here for the first time the identity and the biochemical characterization of four GAG-specific sulfatases. Furthermore, contrary to the current paradigm, we discovered that B. thetaiotaomicron possesses an authentic GAG endosulfatase that is active at the polymer level. This type of sulfatase is the first one to be identified in a bacterium. Our study thus demonstrates that bacteria have evolved more sophisticated and diverse GAG sulfatases than anticipated and establishes how B. thetaiotaomicron, and other major human commensal bacteria, can metabolize and potentially tailor complex host glycans. PMID:25002587

  19. HIV-1 Gag p17 presented as virus-like particles on the E2 scaffold from Geobacillus stearothermophilus induces sustained humoral and cellular immune responses in the absence of IFN{gamma} production by CD4+ T cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Caivano, Antonella; Doria-Rose, Nicole A.; Dept. of Molecular and Cell Biology, University of Washington, Seattle, WA 98124-6108

    2010-11-25

    We have constructed stable virus-like particles displaying the HIV-1 Gag(p17) protein as an N-terminal fusion with an engineered protein domain from the Geobacillus stearothermophilus pyruvate dehydrogenase subunit E2. Mice immunized with the Gag(p17)-E2 60-mer scaffold particles mounted a strong and sustained antibody response. Antibodies directed to Gag(p17) were boosted significantly with additional immunizations, while anti-E2 responses reached a plateau. The isotype of the induced antibodies was biased towards IgG1, and the E2-primed CD4+ T cells did not secrete IFN{gamma}. Using transgenic mouse model systems, we demonstrated that CD8+ T cells primed with E2 particles were able to exert lytic activitymore » and produce IFN{gamma}. These results show that the E2 scaffold represents a powerful vaccine delivery system for whole antigenic proteins or polyepitope engineered proteins, evoking antibody production and antigen specific CTL activity even in the absence of IFN{gamma}-producing CD4+ T cells.« less

  20. Novel HIV IL-4R antagonist vaccine strategy can induce both high avidity CD8 T and B cell immunity with greater protective efficacy.

    PubMed

    Jackson, Ronald J; Worley, Matthew; Trivedi, Shubhanshi; Ranasinghe, Charani

    2014-09-29

    We have established that the efficacy of a heterologous poxvirus vectored HIV vaccine, fowlpox virus (FPV)-HIV gag/pol prime followed by attenuated vaccinia virus (VV)-HIV gag/pol booster immunisation, is strongly influenced by the cytokine milieu at the priming vaccination site, with endogenous IL-13 detrimental to the quality of the HIV specific CD8+ T cell response induced. We have now developed a novel HIV vaccine that co-expresses a C-terminal deletion mutant of the mouse IL-4, deleted for the essential tyrosine (Y119) required for signalling. In our vaccine system, the mutant IL-4C118 can bind to IL-4 type I and II receptors with high affinity, and transiently prevent the signalling of both IL-4 and IL-13 at the vaccination site. When this IL-4C118 adjuvanted vaccine was used in an intranasal rFPV/intramuscular rVV prime-boost immunisation strategy, greatly enhanced mucosal/systemic HIV specific CD8+ T cells with higher functional avidity, expressing IFN-γ, TNF-α and IL-2 and greater protective efficacy were detected. Surprisingly, the IL-4C118 adjuvanted vaccines also induced robust long-lived HIV gag-specific serum antibody responses, specifically IgG1 and IgG2a. The p55-gag IgG2a responses induced were of a higher magnitude relative to the IL-13Rα2 adjuvant vaccine. More interestingly, our recently tested IL-13Rα2 adjuvanted vaccine which only inhibited IL-13 activity, even though induced excellent high avidity HIV-specific CD8+ T cells, had a detrimental impact on the induction of gag-specific IgG2a antibody immunity. Our observations suggest that (i) IL-4 cell-signalling in the absence of IL-13 retarded gag-specific antibody isotype class switching, or (ii) IL-13Rα2 signalling was involved in inducing good gag-specific B cell immunity. Thus, we believe our novel IL-4R antagonist adjuvant strategy offers great promise not only for HIV-1 vaccines, but also against a range of chronic infections where sustained high quality mucosal and systemic T and B

  1. Prime-boost vaccination with heterologous live vectors encoding SIV gag and multimeric HIV-1 gp160 protein: efficacy against repeated mucosal R5 clade C SHIV challenges

    PubMed Central

    Lakhashe, Samir K.; Velu, Vijayakumar; Sciaranghella, Gaia; Siddappa, Nagadenahalli B.; DiPasquale, Janet M.; Hemashettar, Girish; Yoon, John K.; Rasmussen, Robert A.; Yang, Feng; Lee, Sandra J.; Montefiori, David C.; Novembre, Francis J.; Villinger, François; Amara, Rama Rao; Kahn, Maria; Hu, Shiu-Lok; Li, Sufen; Li, Zhongxia; Frankel, Fred R.; Robert-Guroff, Marjorie; Johnson, Welkin E.; Lieberman, Judy; Ruprecht, Ruth M.

    2011-01-01

    We sought to induce primate immunodeficiency virus-specific cellular and neutralizing antibody (nAb) responses in rhesus macaques (RM) through a bimodal vaccine approach. RM were immunized intragastrically (i.g.) with the live-attenuated Listeria monocytogenes (Lm) vector Lmdd-BdopSIVgag encoding SIVmac239 gag. SIV Gag-specific cellular responses were boosted by intranasal and intratracheal administration of replication-competent adenovirus (Ad5hr-SIVgag) encoding the same gag. To broaden antiviral immunity, the RM were immunized with multimeric HIV clade C (HIV-C) gp160 and HIV Tat. SIV Gag-specific cellular immune responses and HIV-1 nAb developed in some RM. The animals were challenged intrarectally with five low doses of R5 SHIV-1157ipEL-p, encoding a heterologous HIV-C Env (22.1% divergent to the Env immunogen). All five controls became viremic. One out of ten vaccinees was completely protected and another had low peak viremia. Sera from the completely and partially protected RM neutralized the challenge virus >90%; these RM also had strong SIV Gag-specific proliferation of CD8+ T cells. Peak and area under the curve of plasma viremia (during acute phase) among vaccinees was lower than for controls, but did not attain significance. The completely protected RM showed persistently low numbers of the α4β7-expressing CD4+ T cells; the latter have been implicated as preferential virus targets in-vivo. Thus, vaccine-induced immune responses and relatively lower numbers of potential target cells were associated with protection. PMID:21693155

  2. Prime-boost vaccination with heterologous live vectors encoding SIV gag and multimeric HIV-1 gp160 protein: efficacy against repeated mucosal R5 clade C SHIV challenges.

    PubMed

    Lakhashe, Samir K; Velu, Vijayakumar; Sciaranghella, Gaia; Siddappa, Nagadenahalli B; Dipasquale, Janet M; Hemashettar, Girish; Yoon, John K; Rasmussen, Robert A; Yang, Feng; Lee, Sandra J; Montefiori, David C; Novembre, Francis J; Villinger, François; Amara, Rama Rao; Kahn, Maria; Hu, Shiu-Lok; Li, Sufen; Li, Zhongxia; Frankel, Fred R; Robert-Guroff, Marjorie; Johnson, Welkin E; Lieberman, Judy; Ruprecht, Ruth M

    2011-08-05

    We sought to induce primate immunodeficiency virus-specific cellular and neutralizing antibody (nAb) responses in rhesus macaques (RM) through a bimodal vaccine approach. RM were immunized intragastrically (i.g.) with the live-attenuated Listeria monocytogenes (Lm) vector Lmdd-BdopSIVgag encoding SIVmac239 gag. SIV Gag-specific cellular responses were boosted by intranasal and intratracheal administration of replication-competent adenovirus (Ad5hr-SIVgag) encoding the same gag. To broaden antiviral immunity, the RM were immunized with multimeric HIV clade C (HIV-C) gp160 and HIV Tat. SIV Gag-specific cellular immune responses and HIV-1 nAb developed in some RM. The animals were challenged intrarectally with five low doses of R5 SHIV-1157ipEL-p, encoding a heterologous HIV-C Env (22.1% divergent to the Env immunogen). All five controls became viremic. One out of ten vaccinees was completely protected and another had low peak viremia. Sera from the completely and partially protected RM neutralized the challenge virus > 90%; these RM also had strong SIV Gag-specific proliferation of CD8⁺ T cells. Peak and area under the curve of plasma viremia (during acute phase) among vaccinees was lower than for controls, but did not attain significance. The completely protected RM showed persistently low numbers of the α4β7-expressing CD4⁺ T cells; the latter have been implicated as preferential virus targets in vivo. Thus, vaccine-induced immune responses and relatively lower numbers of potential target cells were associated with protection. Copyright © 2011 Elsevier Ltd. All rights reserved.

  3. Enhancement of Gag-specific but reduction of Env- and Pol-specific CD8+ T cell responses by simian immunodeficiency virus nonstructural proteins in mice.

    PubMed

    Zhang, Yinfeng; Sun, Caijun; Feng, Liqiang; Xiao, Lijun; Chen, Ling

    2012-04-01

    Accessory and regulatory proteins (nonstructural proteins) have received increasing attention as components in novel HIV/SIV vaccine design. However, the complicated interactions between nonstructural proteins and structural proteins remain poorly understood, especially their effects on immunogenicity. In this study, the immunogenicity of structural proteins in the presence and absence of nonstructural proteins was compared. First, a series of recombinant plasmids and adenoviral vectors carrying various SIVmac239 nonstructural and structural genes was constructed. Then mice were primed with DNA plasmids and boosted with corresponding Ad5 vectors of different combinations, and the resulting immune responses were measured. Our results demonstrated that when the individual Gag, Pol, or Env gene products were coimmunized with the whole repertoire of nonstructural proteins, the Gag-specific CD8(+) T response was greatly enhanced, while the Env- and Pol-specific CD8(+) T responses were significantly reduced. The same pattern was not observed in CD4(+) T cell responses. Antibody responses against both the Gag and Env proteins were elicited more effectively when these structural antigens were immunized together with nonstructural antigens. These findings may provide helpful insights into the development of novel HIV/SIV vaccines.

  4. HIV Controllers Exhibit Enhanced Frequencies of Major Histocompatibility Complex Class II Tetramer+ Gag-Specific CD4+ T Cells in Chronic Clade C HIV-1 Infection.

    PubMed

    Laher, Faatima; Ranasinghe, Srinika; Porichis, Filippos; Mewalal, Nikoshia; Pretorius, Karyn; Ismail, Nasreen; Buus, Søren; Stryhn, Anette; Carrington, Mary; Walker, Bruce D; Ndung'u, Thumbi; Ndhlovu, Zaza M

    2017-04-01

    Immune control of viral infections is heavily dependent on helper CD4 + T cell function. However, the understanding of the contribution of HIV-specific CD4 + T cell responses to immune protection against HIV-1, particularly in clade C infection, remains incomplete. Recently, major histocompatibility complex (MHC) class II tetramers have emerged as a powerful tool for interrogating antigen-specific CD4 + T cells without relying on effector functions. Here, we defined the MHC class II alleles for immunodominant Gag CD4 + T cell epitopes in clade C virus infection, constructed MHC class II tetramers, and then used these to define the magnitude, function, and relation to the viral load of HIV-specific CD4 + T cell responses in a cohort of untreated HIV clade C-infected persons. We observed significantly higher frequencies of MHC class II tetramer-positive CD4 + T cells in HIV controllers than progressors ( P = 0.0001), and these expanded Gag-specific CD4 + T cells in HIV controllers showed higher levels of expression of the cytolytic proteins granzymes A and B. Importantly, targeting of the immunodominant Gag41 peptide in the context of HLA class II DRB1*1101 was associated with HIV control ( r = -0.5, P = 0.02). These data identify an association between HIV-specific CD4 + T cell targeting of immunodominant Gag epitopes and immune control, particularly the contribution of a single class II MHC-peptide complex to the immune response against HIV-1 infection. Furthermore, these results highlight the advantage of the use of class II tetramers in evaluating HIV-specific CD4 + T cell responses in natural infections. IMPORTANCE Increasing evidence suggests that virus-specific CD4 + T cells contribute to the immune-mediated control of clade B HIV-1 infection, yet there remains a relative paucity of data regarding the role of HIV-specific CD4 + T cells in shaping adaptive immune responses in individuals infected with clade C, which is responsible for the majority of HIV

  5. HIV Controllers Exhibit Enhanced Frequencies of Major Histocompatibility Complex Class II Tetramer+ Gag-Specific CD4+ T Cells in Chronic Clade C HIV-1 Infection

    PubMed Central

    Laher, Faatima; Ranasinghe, Srinika; Porichis, Filippos; Mewalal, Nikoshia; Pretorius, Karyn; Ismail, Nasreen; Buus, Søren; Stryhn, Anette; Carrington, Mary; Walker, Bruce D.; Ndung'u, Thumbi

    2017-01-01

    ABSTRACT Immune control of viral infections is heavily dependent on helper CD4+ T cell function. However, the understanding of the contribution of HIV-specific CD4+ T cell responses to immune protection against HIV-1, particularly in clade C infection, remains incomplete. Recently, major histocompatibility complex (MHC) class II tetramers have emerged as a powerful tool for interrogating antigen-specific CD4+ T cells without relying on effector functions. Here, we defined the MHC class II alleles for immunodominant Gag CD4+ T cell epitopes in clade C virus infection, constructed MHC class II tetramers, and then used these to define the magnitude, function, and relation to the viral load of HIV-specific CD4+ T cell responses in a cohort of untreated HIV clade C-infected persons. We observed significantly higher frequencies of MHC class II tetramer-positive CD4+ T cells in HIV controllers than progressors (P = 0.0001), and these expanded Gag-specific CD4+ T cells in HIV controllers showed higher levels of expression of the cytolytic proteins granzymes A and B. Importantly, targeting of the immunodominant Gag41 peptide in the context of HLA class II DRB1*1101 was associated with HIV control (r = −0.5, P = 0.02). These data identify an association between HIV-specific CD4+ T cell targeting of immunodominant Gag epitopes and immune control, particularly the contribution of a single class II MHC-peptide complex to the immune response against HIV-1 infection. Furthermore, these results highlight the advantage of the use of class II tetramers in evaluating HIV-specific CD4+ T cell responses in natural infections. IMPORTANCE Increasing evidence suggests that virus-specific CD4+ T cells contribute to the immune-mediated control of clade B HIV-1 infection, yet there remains a relative paucity of data regarding the role of HIV-specific CD4+ T cells in shaping adaptive immune responses in individuals infected with clade C, which is responsible for the majority of HIV

  6. Preferential Targeting of Conserved Gag Regions after Vaccination with a Heterologous DNA Prime-Modified Vaccinia Virus Ankara Boost HIV-1 Vaccine Regimen.

    PubMed

    Bauer, Asli; Podola, Lilli; Mann, Philipp; Missanga, Marco; Haule, Antelmo; Sudi, Lwitiho; Nilsson, Charlotta; Kaluwa, Bahati; Lueer, Cornelia; Mwakatima, Maria; Munseri, Patricia J; Maboko, Leonard; Robb, Merlin L; Tovanabutra, Sodsai; Kijak, Gustavo; Marovich, Mary; McCormack, Sheena; Joseph, Sarah; Lyamuya, Eligius; Wahren, Britta; Sandström, Eric; Biberfeld, Gunnel; Hoelscher, Michael; Bakari, Muhammad; Kroidl, Arne; Geldmacher, Christof

    2017-09-15

    Prime-boost vaccination strategies against HIV-1 often include multiple variants for a given immunogen for better coverage of the extensive viral diversity. To study the immunologic effects of this approach, we characterized breadth, phenotype, function, and specificity of Gag-specific T cells induced by a DNA-prime modified vaccinia virus Ankara (MVA)-boost vaccination strategy, which uses mismatched Gag immunogens in the TamoVac 01 phase IIa trial. Healthy Tanzanian volunteers received three injections of the DNA-SMI vaccine encoding a subtype B and AB-recombinant Gag p37 and two vaccinations with MVA-CMDR encoding subtype A Gag p55 Gag-specific T-cell responses were studied in 42 vaccinees using fresh peripheral blood mononuclear cells. After the first MVA-CMDR boost, vaccine-induced gamma interferon-positive (IFN-γ + ) Gag-specific T-cell responses were dominated by CD4 + T cells ( P < 0.001 compared to CD8 + T cells) that coexpressed interleukin-2 (IL-2) (66.4%) and/or tumor necrosis factor alpha (TNF-α) (63.7%). A median of 3 antigenic regions were targeted with a higher-magnitude median response to Gag p24 regions, more conserved between prime and boost, compared to those of regions within Gag p15 (not primed) and Gag p17 (less conserved; P < 0.0001 for both). Four regions within Gag p24 each were targeted by 45% to 74% of vaccinees upon restimulation with DNA-SMI-Gag matched peptides. The response rate to individual antigenic regions correlated with the sequence homology between the MVA- and DNA Gag-encoded immunogens ( P = 0.04, r 2 = 0.47). In summary, after the first MVA-CMDR boost, the sequence-mismatched DNA-prime MVA-boost vaccine strategy induced a Gag-specific T-cell response that was dominated by polyfunctional CD4 + T cells and that targeted multiple antigenic regions within the conserved Gag p24 protein. IMPORTANCE Genetic diversity is a major challenge for the design of vaccines against variable viruses. While including multiple variants for a

  7. Safety and immunogenicity of adenovirus-vectored near-consensus HIV type 1 clade B gag vaccines in healthy adults.

    PubMed

    Harro, Clayton D; Robertson, Michael N; Lally, Michelle A; O'Neill, Lori D; Edupuganti, Srilatha; Goepfert, Paul A; Mulligan, Mark J; Priddy, Frances H; Dubey, Sheri A; Kierstead, Lisa S; Sun, Xiao; Casimiro, Danilo R; DiNubile, Mark J; Shiver, John W; Leavitt, Randi Y; Mehrotra, Devan V

    2009-01-01

    Vaccines inducing pathogen-specific cell-mediated immunity are being developed using attenuated adenoviral (Ad) vectors. We report the results of two independent Phase I trials of similar replication-deficient Ad5 vaccines containing a near-consensus HIV-1 clade B gag transgene. Healthy HIV-uninfected adults were enrolled in two separate, multicenter, dose-escalating, blinded, placebo-controlled studies to assess the safety and immunogenicity of a three-dose homologous regimen of Ad5 and MRKAd5 HIV-1 gag vaccines given on day 1, week 4, and week 26. Adverse events were collected for 29 days following each intradeltoid injection. The primary immunogenicity endpoint was the proportion of subjects with a positive unfractionated Gag-specific IFN-gamma ELISPOT response measured 4 weeks after the last dose (week 30). Analyses were performed after combining data for each dose group from both protocols, stratifying by baseline Ad5 titers. Overall, 252 subjects were randomized to receive either vaccine or placebo, including 229 subjects (91%) who completed the study through week 30. Tolerability and immunogenicity did not appear to differ between the Ad5 and MRKAd5 vaccines. The frequency of injection-site reactions was dose dependent. Systemic adverse events were also dose dependent and more frequent in subjects with baseline Ad5 titers <200 versus > or =200, especially after the first dose. The percent of ELISPOT responders and the ELISPOT geometric means overall were significantly higher for all four vaccine doses studied compared to placebo, and were generally higher in vaccine recipients with baseline Ad5 titers <200 versus > or = 200. Ad5 titers increased after vaccination in a dose-dependent fashion. Both Ad5-vectored HIV-1 vaccines were generally well tolerated and induced cell-mediated immune responses against HIV Gag-peptides in the majority of healthy adults with baseline Ad5 titers <200. Preexistent and/or vaccine-induced immunity to the Ad5 vector may dampen

  8. Safety and Immunogenicity of Adenovirus-Vectored Near-Consensus HIV Type 1 Clade B gag Vaccines in Healthy Adults

    PubMed Central

    Robertson, Michael N.; Lally, Michelle A.; O'Neill, Lori D.; Edupuganti, Srilatha; Goepfert, Paul A.; Mulligan, Mark J.; Priddy, Frances H.; Dubey, Sheri A.; Kierstead, Lisa S.; Sun, Xiao; Casimiro, Danilo R.; DiNubile, Mark J.; Shiver, John W.; Leavitt, Randi Y.; Mehrotra, Devan V.

    2009-01-01

    Abstract Vaccines inducing pathogen-specific cell-mediated immunity are being developed using attenuated adenoviral (Ad) vectors. We report the results of two independent Phase I trials of similar replication-deficient Ad5 vaccines containing a near-consensus HIV-1 clade B gag transgene. Healthy HIV-uninfected adults were enrolled in two separate, multicenter, dose-escalating, blinded, placebo-controlled studies to assess the safety and immunogenicity of a three-dose homologous regimen of Ad5 and MRKAd5 HIV-1 gag vaccines given on day 1, week 4, and week 26. Adverse events were collected for 29 days following each intradeltoid injection. The primary immunogenicity endpoint was the proportion of subjects with a positive unfractionated Gag-specific IFN-γ ELISPOT response measured 4 weeks after the last dose (week 30). Analyses were performed after combining data for each dose group from both protocols, stratifying by baseline Ad5 titers. Overall, 252 subjects were randomized to receive either vaccine or placebo, including 229 subjects (91%) who completed the study through week 30. Tolerability and immunogenicity did not appear to differ between the Ad5 and MRKAd5 vaccines. The frequency of injection-site reactions was dose dependent. Systemic adverse events were also dose dependent and more frequent in subjects with baseline Ad5 titers <200 versus ≥200, especially after the first dose. The percent of ELISPOT responders and the ELISPOT geometric means overall were significantly higher for all four vaccine doses studied compared to placebo, and were generally higher in vaccine recipients with baseline Ad5 titers <200 versus ≥200. Ad5 titers increased after vaccination in a dose-dependent fashion. Both Ad5-vectored HIV-1 vaccines were generally well tolerated and induced cell-mediated immune responses against HIV Gag-peptides in the majority of healthy adults with baseline Ad5 titers <200. Preexistent and/or vaccine-induced immunity to the Ad5 vector may dampen the

  9. Nedd4-Mediated Increase in HIV-1 Gag and Env Proteins and Immunity following DNA-Vaccination of BALB/c Mice

    PubMed Central

    Lewis, Brad; Whitney, Stephen; Hudacik, Lauren; Galmin, Lindsey; Huaman, Maria Cecilia; Cristillo, Anthony D.

    2014-01-01

    The late assembly domain of many viruses is critical for budding. Within these domains, encoded in viral structural proteins, are the conserved motifs PTAP, PPxY and YPxL. These sequences are the key determinants for association of viral proteins with intracellular molecules such as Tsg101, Nedd4 and AIP1/ALIX. While roles for Tsg101 and AIP1/ALIX in HIV-1 budding have been well established, less is known about the role of Nedd4. Recent studies, however, have identified a function for Nedd4-like protein in HIV-1 release. In this study, we investigated post-transcriptional changes of Nedd4 following SHIVSF162P3 infection of rhesus macaques, its role on HIV-1 p24 and gp120 levels in vitro and its potential as an immune modulator in HIV vaccination of BALB/c mice. Increased Nedd4 protein levels were noted in both CD4+ and CD8+ T cells following SHIVSF162P3-infection of naïve macaques. Transient co-transfection studies in 293 cells with HXB2 and Nedd4 demonstrated a Nedd4-mediated increase in p24 and gp120 levels. This increase was found to be dependent on the Ca2+/calmodulin-regulated phospholipid binding C2 domain and not ubiquitin ligase activity or HIV LTR activity. Co-transfection of Nedd4 with plasmid DNA expressing Gag or Env was further shown to augment both intracellular and extracellular Gag or Env proteins. To assess the potential of Nedd4 as an immune modulator, BALB/c mice were immunized intramuscularly with plasmid DNA encoding HIV gag, env and Nedd4. Nedd4 co-administration was found to increase serum anti-p24 but not anti-gp120 antibodies. Nedd4 co-injection was found to have no affect on Gag- or Env-specific IFNγ but had a trend of increased Gag-specific IL-6, IL-17A and TNFα that was not seen following Env stimulation. Based on our initial findings, Nedd4-mediated changes in HIV protein levels and its potential use in HIV-1 vaccine development warrants further investigation. PMID:24614057

  10. Nedd4-mediated increase in HIV-1 Gag and Env proteins and immunity following DNA-vaccination of BALB/c mice.

    PubMed

    Lewis, Brad; Whitney, Stephen; Hudacik, Lauren; Galmin, Lindsey; Huaman, Maria Cecilia; Cristillo, Anthony D

    2014-01-01

    The late assembly domain of many viruses is critical for budding. Within these domains, encoded in viral structural proteins, are the conserved motifs PTAP, PPxY and YPxL. These sequences are the key determinants for association of viral proteins with intracellular molecules such as Tsg101, Nedd4 and AIP1/ALIX. While roles for Tsg101 and AIP1/ALIX in HIV-1 budding have been well established, less is known about the role of Nedd4. Recent studies, however, have identified a function for Nedd4-like protein in HIV-1 release. In this study, we investigated post-transcriptional changes of Nedd4 following SHIVSF162P3 infection of rhesus macaques, its role on HIV-1 p24 and gp120 levels in vitro and its potential as an immune modulator in HIV vaccination of BALB/c mice. Increased Nedd4 protein levels were noted in both CD4+ and CD8+ T cells following SHIVSF162P3-infection of naïve macaques. Transient co-transfection studies in 293 cells with HXB2 and Nedd4 demonstrated a Nedd4-mediated increase in p24 and gp120 levels. This increase was found to be dependent on the Ca2+/calmodulin-regulated phospholipid binding C2 domain and not ubiquitin ligase activity or HIV LTR activity. Co-transfection of Nedd4 with plasmid DNA expressing Gag or Env was further shown to augment both intracellular and extracellular Gag or Env proteins. To assess the potential of Nedd4 as an immune modulator, BALB/c mice were immunized intramuscularly with plasmid DNA encoding HIV gag, env and Nedd4. Nedd4 co-administration was found to increase serum anti-p24 but not anti-gp120 antibodies. Nedd4 co-injection was found to have no affect on Gag- or Env-specific IFNγ but had a trend of increased Gag-specific IL-6, IL-17A and TNFα that was not seen following Env stimulation. Based on our initial findings, Nedd4-mediated changes in HIV protein levels and its potential use in HIV-1 vaccine development warrants further investigation.

  11. HIV Gag protein conjugated to a Toll-like receptor 7/8 agonist improves the magnitude and quality of Th1 and CD8+ T cell responses in nonhuman primates

    NASA Astrophysics Data System (ADS)

    Wille-Reece, Ulrike; Flynn, Barbara J.; Loré, Karin; Koup, Richard A.; Kedl, Ross M.; Mattapallil, Joseph J.; Weiss, Walter R.; Roederer, Mario; Seder, Robert A.

    2005-10-01

    Induction and maintenance of antibody and T cell responses will be critical for developing a successful vaccine against HIV. A rational approach for generating such responses is to design vaccines or adjuvants that have the capacity to activate specific antigen-presenting cells. In this regard, dendritic cells (DCs) are the most potent antigen-presenting cells for generating primary T cell responses. Here, we report that Toll-like receptor (TLR) agonists and ligands that activate DCs in vitro influence the magnitude and quality of the cellular immune response in nonhuman primates (NHPs) when administered with HIV Gag protein. NHPs immunized with HIV Gag protein and a TLR7/8 agonist or a TLR9 ligand [CpG oligodeoxynucleotides (CpG ODN)] had significantly increased Gag-specific T helper 1 and antibody responses, compared with animals immunized with HIV Gag protein alone. Importantly, conjugating the HIV Gag protein to the TLR7/8 agonist (Gag-TLR7/8 conjugate) dramatically enhanced the magnitude and altered the quality of the T helper 1 response, compared with animals immunized with HIV Gag protein and the TLR7/8 agonist or CpG ODN. Furthermore, immunization with the Gag-TLR7/8 conjugate vaccine elicited Gag-specific CD8+ T responses. Collectively, our results show that conjugating HIV Gag protein to a TLR7/8 agonist is an effective way to elicit broad-based adaptive immunity in NHPs. This type of vaccine formulation should have utility in preventive or therapeutic vaccines in which humoral and cellular immunity is required. vaccine | dendritic cell | cross-presentation | cellular immunity

  12. Genetically modified anthrax lethal toxin safely delivers whole HIV protein antigens into the cytosol to induce T cell immunity

    NASA Astrophysics Data System (ADS)

    Lu, Yichen; Friedman, Rachel; Kushner, Nicholas; Doling, Amy; Thomas, Lawrence; Touzjian, Neal; Starnbach, Michael; Lieberman, Judy

    2000-07-01

    Bacillus anthrax lethal toxin can be engineered to deliver foreign proteins to the cytosol for antigen presentation to CD8 T cells. Vaccination with modified toxins carrying 8-9 amino acid peptide epitopes induces protective immunity in mice. To evaluate whether large protein antigens can be used with this system, recombinant constructs encoding several HIV antigens up to 500 amino acids were produced. These candidate HIV vaccines are safe in animals and induce CD8 T cells in mice. Constructs encoding gag p24 and nef stimulate gag-specific CD4 proliferation and a secondary cytotoxic T lymphocyte response in HIV-infected donor peripheral blood mononuclear cells in vitro. These results lay the foundation for future clinical vaccine studies.

  13. A study of vaccine-induced immune pressure on breakthrough infections in the Phambili phase 2b HIV-1 vaccine efficacy trial

    PubMed Central

    Rolland, M.; Magaret, C.A.; Rademeyer, C.; Fiore-Gartland, A.; Edlefsen, P.T.; DeCamp, A.; Ahmed, H.; Ngandu, N.; Larsen, B.B.; Frahm, N.; Marais, J.; Thebus, R.; Geraghty, D.; Hural, J.; Corey, L.; Kublin, J.; Gray, G.; McElrath, M.J.; Mullins, J.I.; Gilbert, P.B.; Williamson, C.

    2016-01-01

    Introduction The Merck Adenovirus-5 Gag/Pol/Nef HIV-1 subtype-B vaccine evaluated in predominately subtype B epidemic regions (Step Study), while not preventing infection, exerted vaccine-induced immune pressure on HIV-1 breakthrough infections. Here we investigated if the same vaccine exerted immune pressure when tested in the Phambili Phase 2b study in a subtype C epidemic. Materials and methods A sieve analysis, which compares breakthrough viruses from placebo and vaccine arms, was performed on 277 near full-length genomes generated from 23 vaccine and 20 placebo recipients. Vaccine coverage was estimated by computing the percentage of 9-mers that were exact matches to the vaccine insert. Results There was significantly greater protein distances from the vaccine immunogen sequence in Gag (p = 0.045) and Nef (p = 0.021) in viruses infecting vaccine recipients compared to placebo recipients. Twenty-seven putative sites of vaccine-induced pressure were identified (p < 0.05) in Gag (n = 10), Pol (n = 7) and Nef (n = 10), although they did not remain significant after adjustment for multiple comparisons. We found the epitope sieve effect in Step was driven by HLA A*02:01; an allele which was found in low frequency in Phambili participants compared to Step participants. Furthermore, the coverage of the vaccine against subtype C Phambili viruses was 31%, 46% and 14% for Gag, Pol and Nef, respectively, compared to subtype B Step virus coverage of 56%, 61% and 26%, respectively. Discussion This study presents evidence of sieve effects in Gag and Nef; however could not confirm effects on specific amino acid sites. We propose that this weaker signal of vaccine immune pressure detected in the Phambili study compared to the Step study may have been influenced by differences in host genetics (HLA allele frequency) and reduced impact of vaccine-induced immune responses due to mismatch between the viral subtype in the vaccine and infecting subtypes. PMID:27756485

  14. Characterization of the gag/fusion protein encoded by the defective Duplan retrovirus inducing murine acquired immunodeficiency syndrome.

    PubMed Central

    Huang, M; Jolicoeur, P

    1990-01-01

    Murine acquired immunodeficiency syndrome is induced by a defective retrovirus. Sequencing of this defective viral genome revealed a long open reading frame which encodes a putative gag/fusion protein, N-MA-p12-CA-NC-COOH, (D. C. Aziz, Z. Hanna, and P. Jolicoeur, Nature (London) 338:505-508, 1989). We raised a specific antibody to the unique p12 domain of this gag fusion precursor, Pr60gag. We found that Pr60gag was indeed encoded by the defective viral genome both in cell-free translation reticulocyte extracts and in infected mouse fibroblasts. Pr60gag was found to be myristylated, phosphorylated, and attached to the cell membrane, like other helper murine leukemia virus (MuLV) gag precursors. Pr60gag was not substantially cleaved within the nonproducer cells and was not released from these cells. However, in the presence of helper MuLV proteins, it formed phenotypically mixed particles. In these particles, Pr60gag was only partially cleaved. In helper MuLV-producing cells harboring the defective virus, a gag-related p40 intermediate was generated both intracellularly and extracellularly. In these cells, Pr60gag appeared to behave as a dominant negative mutant, interfering with proper cleavage of helper Pr65gag. Our data indicate that Pr60gag is a major (and possibly the only) gene product of the defective murine acquired immunodeficiency syndrome virus and is likely to harbor some determinants of pathogenicity of this virus. Images PMID:2243376

  15. Immune tolerance improves the efficacy of enzyme replacement therapy in canine mucopolysaccharidosis I

    PubMed Central

    Dickson, Patricia; Peinovich, Maryn; McEntee, Michael; Lester, Thomas; Le, Steven; Krieger, Aimee; Manuel, Hayden; Jabagat, Catherine; Passage, Merry; Kakkis, Emil D.

    2008-01-01

    Mucopolysaccharidoses (MPSs) are lysosomal storage diseases caused by a deficit in the enzymes needed for glycosaminoglycan (GAG) degradation. Enzyme replacement therapy with recombinant human α-l-iduronidase successfully reduces lysosomal storage in canines and humans with iduronidase-deficient MPS I, but therapy usually also induces antibodies specific for the recombinant enzyme that could reduce its efficacy. To understand the potential impact of α-l-iduronidase–specific antibodies, we studied whether inducing antigen-specific immune tolerance to iduronidase could improve the effectiveness of recombinant iduronidase treatment in canines. A total of 24 canines with MPS I were either tolerized to iduronidase or left nontolerant. All canines received i.v. recombinant iduronidase at the FDA-approved human dose or a higher dose for 9–44 weeks. Nontolerized canines developed iduronidase-specific antibodies that proportionally reduced in vitro iduronidase uptake. Immune-tolerized canines achieved increased tissue enzyme levels at either dose in most nonreticular tissues and a greater reduction in tissue GAG levels, lysosomal pathology, and urinary GAG excretion. Tolerized MPS I dogs treated with the higher dose received some further benefit in the reduction of GAGs in tissues, urine, and the heart valve. Therefore, immune tolerance to iduronidase improved the efficacy of enzyme replacement therapy with recombinant iduronidase in canine MPS I and could potentially improve outcomes in patients with MPS I and other lysosomal storage diseases. PMID:18654665

  16. Retroviral Gag protein-RNA interactions: Implications for specific genomic RNA packaging and virion assembly.

    PubMed

    Olson, Erik D; Musier-Forsyth, Karin

    2018-03-31

    Retroviral Gag proteins are responsible for coordinating many aspects of virion assembly. Gag possesses two distinct nucleic acid binding domains, matrix (MA) and nucleocapsid (NC). One of the critical functions of Gag is to specifically recognize, bind, and package the retroviral genomic RNA (gRNA) into assembling virions. Gag interactions with cellular RNAs have also been shown to regulate aspects of assembly. Recent results have shed light on the role of MA and NC domain interactions with nucleic acids, and how they jointly function to ensure packaging of the retroviral gRNA. Here, we will review the literature regarding RNA interactions with NC, MA, as well as overall mechanisms employed by Gag to interact with RNA. The discussion focuses on human immunodeficiency virus type-1, but other retroviruses will also be discussed. A model is presented combining all of the available data summarizing the various factors and layers of selection Gag employs to ensure specific gRNA packaging and correct virion assembly. Copyright © 2018 Elsevier Ltd. All rights reserved.

  17. Characterization of Gag and Nef-specific ELISpot-based CTL responses in HIV-1 infected Indian individuals.

    PubMed

    Mendiratta, Sanjay; Vajpayee, Madhu; Malhotra, Uma; Kaushik, Shweta; Dar, Lalit; Mojumdar, Kamalika; Chauhan, Neeraj Kumar; Sreenivas, Vishnubhatla

    2009-02-01

    Cytotoxic T lymphocyte (CTL) responses to Gag have been most frequently linked to control of viremia whereas CTL responses to Nef have direct relationship with viral load. IFN-gamma ELISpot assay was used to screen CTL responses at single peptide level directed at HIV-1 subtype C Gag and Nef proteins in 30 antiretroviral therapy naive HIV-1 infected Indian individuals. PBMCs from 73.3% and 90% of the study population showed response to Gag and Nef antigens, respectively. The magnitude of Gag-specific CTL responses was inversely correlated with plasma viral load (r = -0.45, P = 0.001), whereas magnitude of Nef-specific responses was directly correlated (r = 0.115). Thirteen immunodominant regions (6 in Gag, 7 in Nef) were identified in the current study. The identification of Gag and Nef-specific responses across HIV-1 infected Indian population and targeting epitopes from multiple immunodominant regions may provide useful insight into the designing of new immunotherapy and vaccines.

  18. Dissection of specific binding of HIV-1 Gag to the 'packaging signal' in viral RNA.

    PubMed

    Comas-Garcia, Mauricio; Datta, Siddhartha Ak; Baker, Laura; Varma, Rajat; Gudla, Prabhakar R; Rein, Alan

    2017-07-20

    Selective packaging of HIV-1 genomic RNA (gRNA) requires the presence of a cis -acting RNA element called the 'packaging signal' (Ψ). However, the mechanism by which Ψ promotes selective packaging of the gRNA is not well understood. We used fluorescence correlation spectroscopy and quenching data to monitor the binding of recombinant HIV-1 Gag protein to Cy5-tagged 190-base RNAs. At physiological ionic strength, Gag binds with very similar, nanomolar affinities to both Ψ-containing and control RNAs. We challenged these interactions by adding excess competing tRNA; introducing mutations in Gag; or raising the ionic strength. These modifications all revealed high specificity for Ψ. This specificity is evidently obscured in physiological salt by non-specific, predominantly electrostatic interactions. This nonspecific activity was attenuated by mutations in the MA, CA, and NC domains, including CA mutations disrupting Gag-Gag interaction. We propose that gRNA is selectively packaged because binding to Ψ nucleates virion assembly with particular efficiency.

  19. Role of a GAG Hinge in the Nucleotide-induced Conformational Change Governing Nucleotide Specificity by T7 DNA Polymerase*

    PubMed Central

    Jin, Zhinan; Johnson, Kenneth A.

    2011-01-01

    A nucleotide-induced change in DNA polymerase structure governs the kinetics of polymerization by high fidelity DNA polymerases. Mutation of a GAG hinge (G542A/G544A) in T7 DNA polymerase resulted in a 1000-fold slower rate of conformational change, which then limited the rate of correct nucleotide incorporation. Rates of misincorporation were comparable to that seen for wild-type enzyme so that the net effect of the mutation was a large decrease in fidelity. We demonstrate that a presumably modest change from glycine to alanine 20 Å from the active site can severely restrict the flexibility of the enzyme structure needed to recognize and incorporate correct substrates with high specificity. These results emphasize the importance of the substrate-induced conformational change in governing nucleotide selectivity by accelerating the incorporation of correct base pairs but not mismatches. PMID:20978284

  20. Public clonotype usage identifies protective Gag-specific CD8+ T cell responses in SIV infection

    PubMed Central

    Asher, Tedi E.; Wilson, Nancy A.; Nason, Martha C.; Brenchley, Jason M.; Metzler, Ian S.; Venturi, Vanessa; Gostick, Emma; Chattopadhyay, Pratip K.; Roederer, Mario; Davenport, Miles P.; Watkins, David I.; Douek, Daniel C.

    2009-01-01

    Despite the pressing need for an AIDS vaccine, the determinants of protective immunity to HIV remain concealed within the complexity of adaptive immune responses. We dissected immunodominant virus-specific CD8+ T cell populations in Mamu-A*01+ rhesus macaques with primary SIV infection to elucidate the hallmarks of effective immunity at the level of individual constituent clonotypes, which were identified according to the expression of distinct T cell receptors (TCRs). The number of public clonotypes, defined as those that expressed identical TCR β-chain amino acid sequences and recurred in multiple individuals, contained within the acute phase CD8+ T cell population specific for the biologically constrained Gag CM9 (CTPYDINQM; residues 181–189) epitope correlated negatively with the virus load set point. This independent molecular signature of protection was confirmed in a prospective vaccine trial, in which clonotype engagement was governed by the nature of the antigen rather than the context of exposure and public clonotype usage was associated with enhanced recognition of epitope variants. Thus, the pattern of antigen-specific clonotype recruitment within a protective CD8+ T cell population is a prognostic indicator of vaccine efficacy and biological outcome in an AIDS virus infection. PMID:19349463

  1. HIV-1 vaccine-specific responses induced by Listeria vector vaccines are maintained in mice subsequently infected with a model helminth parasite, Schistosoma mansoni.

    PubMed

    Shollenberger, Lisa M; Bui, Cac T; Paterson, Yvonne; Nyhoff, Lindsay; Harn, Donald A

    2013-11-19

    In areas co-endemic for helminth parasites and HIV/AIDS, infants are often administered vaccines prior to infection with immune modulatory helminth parasites. Systemic Th2 biasing and immune suppression caused by helminth infection reduces cell-mediated responses to vaccines such as tetanus toxoid and BCG. Therefore, we asked if infection with helminthes post-vaccination, alters already established vaccine induced immune responses. In our model, mice are vaccinated against HIV-1 Gag using a Listeria vaccine vector (Lm-Gag) in a prime-boost manner, then infected with the human helminth parasite Schistosoma mansoni. This allows us to determine if established vaccine responses are maintained or altered after helminth infection. Our second objective asked if helminth infection post-vaccination alters the recipient's ability to respond to a second boost. Here we compared responses between uninfected mice, schistosome infected mice, and infected mice that were given an anthelminthic, which occurred coincident with the boost or four weeks prior, as well as comparing to un-boosted mice. We report that HIV-1 vaccine-specific responses generated by Listeria vector HIV-1 vaccines are maintained following subsequent chronic schistosome infection, providing further evidence that Listeria vector vaccines induce potent vaccine-specific responses that can withstand helminth infection. We also were able to demonstrate that administration of a second Listeria boost, which markedly enhanced the immune response, was minimally impacted by schistosome infection, or anthelminthic therapy. Surprisingly, we also observed enhanced antibody responses to HIV Gag in vaccinated mice subsequently infected with schistosomes. Copyright © 2013 Elsevier Ltd. All rights reserved.

  2. Subtype-Specific Differences in Gag-Protease-Driven Replication Capacity Are Consistent with Intersubtype Differences in HIV-1 Disease Progression.

    PubMed

    Kiguoya, Marion W; Mann, Jaclyn K; Chopera, Denis; Gounder, Kamini; Lee, Guinevere Q; Hunt, Peter W; Martin, Jeffrey N; Ball, T Blake; Kimani, Joshua; Brumme, Zabrina L; Brockman, Mark A; Ndung'u, Thumbi

    2017-07-01

    There are marked differences in the spread and prevalence of HIV-1 subtypes worldwide, and differences in clinical progression have been reported. However, the biological reasons underlying these differences are unknown. Gag-protease is essential for HIV-1 replication, and Gag-protease-driven replication capacity has previously been correlated with disease progression. We show that Gag-protease replication capacity correlates significantly with that of whole isolates ( r = 0.51; P = 0.04), indicating that Gag-protease is a significant contributor to viral replication capacity. Furthermore, we investigated subtype-specific differences in Gag-protease-driven replication capacity using large well-characterized cohorts in Africa and the Americas. Patient-derived Gag-protease sequences were inserted into an HIV-1 NL4-3 backbone, and the replication capacities of the resulting recombinant viruses were measured in an HIV-1-inducible reporter T cell line by flow cytometry. Recombinant viruses expressing subtype C Gag-proteases exhibited substantially lower replication capacities than those expressing subtype B Gag-proteases ( P < 0.0001); this observation remained consistent when representative Gag-protease sequences were engineered into an HIV-1 subtype C backbone. We identified Gag residues 483 and 484, located within the Alix-binding motif involved in virus budding, as major contributors to subtype-specific replicative differences. In East African cohorts, we observed a hierarchy of Gag-protease-driven replication capacities, i.e., subtypes A/C < D < intersubtype recombinants ( P < 0.0029), which is consistent with reported intersubtype differences in disease progression. We thus hypothesize that the lower Gag-protease-driven replication capacity of subtypes A and C slows disease progression in individuals infected with these subtypes, which in turn leads to greater opportunity for transmission and thus increased prevalence of these subtypes. IMPORTANCE HIV-1 subtypes

  3. HIV/AIDS Vaccine Candidates Based on Replication-Competent Recombinant Poxvirus NYVAC-C-KC Expressing Trimeric gp140 and Gag-Derived Virus-Like Particles or Lacking the Viral Molecule B19 That Inhibits Type I Interferon Activate Relevant HIV-1-Specific B and T Cell Immune Functions in Nonhuman Primates

    PubMed Central

    García-Arriaza, Juan; Perdiguero, Beatriz; Heeney, Jonathan L.; Seaman, Michael S.; Montefiori, David C.; Yates, Nicole L.; Tomaras, Georgia D.; Ferrari, Guido; Foulds, Kathryn E.; Roederer, Mario; Self, Steven G.; Borate, Bhavesh; Gottardo, Raphael; Phogat, Sanjay; Tartaglia, Jim; Barnett, Susan W.; Burke, Brian; Cristillo, Anthony D.; Weiss, Deborah E.; Lee, Carter; Kibler, Karen V.; Jacobs, Bertram L.; Wagner, Ralf; Ding, Song; Pantaleo, Giuseppe

    2017-01-01

    ABSTRACT The nonreplicating attenuated poxvirus vector NYVAC expressing clade C(CN54) HIV-1 Env(gp120) and Gag-Pol-Nef antigens (NYVAC-C) showed limited immunogenicity in phase I clinical trials. To enhance the capacity of the NYVAC vector to trigger broad humoral responses and a more balanced activation of CD4+ and CD8+ T cells, here we compared the HIV-1-specific immunogenicity elicited in nonhuman primates immunized with two replicating NYVAC vectors that have been modified by the insertion of the K1L and C7L vaccinia virus host range genes and express the clade C(ZM96) trimeric HIV-1 gp140 protein or a Gag(ZM96)-Pol-Nef(CN54) polyprotein as Gag-derived virus-like particles (termed NYVAC-C-KC). Additionally, one NYVAC-C-KC vector was generated by deleting the viral gene B19R, an inhibitor of the type I interferon response (NYVAC-C-KC-ΔB19R). An immunization protocol mimicking that of the RV144 phase III clinical trial was used. Two groups of macaques received two doses of the corresponding NYVAC-C-KC vectors (weeks 0 and 4) and booster doses with NYVAC-C-KC vectors plus the clade C HIV-1 gp120 protein (weeks 12 and 24). The two replicating NYVAC-C-KC vectors induced enhanced and similar HIV-1-specific CD4+ and CD8+ T cell responses, similar levels of binding IgG antibodies, low levels of IgA antibodies, and high levels of antibody-dependent cellular cytotoxicity responses and HIV-1-neutralizing antibodies. Small differences within the NYVAC-C-KC-ΔB19R group were seen in the magnitude of CD4+ and CD8+ T cells, the induction of some cytokines, and the neutralization of some HIV-1 isolates. Thus, replication-competent NYVAC-C-KC vectors acquired relevant immunological properties as vaccine candidates against HIV/AIDS, and the viral B19 molecule exerts some control of immune functions. IMPORTANCE It is of special importance to find a safe and effective HIV/AIDS vaccine that can induce strong and broad T cell and humoral immune responses correlating with HIV-1

  4. Complement is a central mediator of radiotherapy-induced tumor-specific immunity and clinical response.

    PubMed

    Surace, Laura; Lysenko, Veronika; Fontana, Andrea Orlando; Cecconi, Virginia; Janssen, Hans; Bicvic, Antonela; Okoniewski, Michal; Pruschy, Martin; Dummer, Reinhard; Neefjes, Jacques; Knuth, Alexander; Gupta, Anurag; van den Broek, Maries

    2015-04-21

    Radiotherapy induces DNA damage and cell death, but recent data suggest that concomitant immune stimulation is an integral part of the therapeutic action of ionizing radiation. It is poorly understood how radiotherapy supports tumor-specific immunity. Here we report that radiotherapy induced tumor cell death and transiently activated complement both in murine and human tumors. The local production of pro-inflammatory anaphylatoxins C3a and C5a was crucial to the tumor response to radiotherapy and concomitant stimulation of tumor-specific immunity. Dexamethasone, a drug frequently given during radiotherapy, limited complement activation and the anti-tumor effects of the immune system. Overall, our findings indicate that anaphylatoxins are key players in radiotherapy-induced tumor-specific immunity and the ensuing clinical responses. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. Correlation between urinary GAG and anti-idursulfase ERT neutralizing antibodies during treatment with NICIT immune tolerance regimen: A case report☆,☆☆

    PubMed Central

    Kim, Sarah; Whitley, Chester B.; Jarnes Utz, Jeanine R.

    2018-01-01

    Introduction Antibodies to intravenous idursulfase enzyme replacement therapy (ERT) for patients with Hunter syndrome (mucopolysaccharidosis type II, MPS II) can have a harmful clinical impact, including both increasing risk of infusion reactions and inhibiting therapeutic activity. Thus, failure to monitor anti-idursulfase antibodies and neutralizing antibodies, and delays in reporting results, may postpone critical clinical decisions. Hypothesis Urinary glycosaminoglycan (GAG) levels may be used as a biomarker for anti-idursulfase antibodies and neutralizing antibodies to improve timeliness in monitoring and managing ERT. Methods This is a case report describing a patient with MPS II with high levels of neutralizing antibodies and worsened clinical status who was treated for five years with a non-immunosuppressive and non-cytotoxic immune tolerance (NICIT) regimen, consisting of intravenous immune globulin and frequent infusions of idursulfase. Neutralizing antibodies and total anti-idursulfase antibodies were measured by two different methods, the direct 1,9-dimethylmethylene blue (DMB) assay and cetylpyridinium chloride carbazole-borate (CPC) assay. Results Neutralizing antibodies, measured as percent inhibition of enzyme activity and also by total neutralizing antibody titer, were correlated with quantitative urinary GAG measured by DMB assay (p = 0.026, p = 0.0067), and quantitative urinary GAG by CPC assay with percent inhibition of enzyme activity by neutralizing antibodies (p = 0.0475). The NICIT regimen showed a sustained immune tolerance after five years and was well-tolerated. Conclusions Urinary GAG, measured by DMB assay, may be a biomarker for anti-idursulfase neutralizing antibodies and is useful for managing immune tolerance regimens for patients with MPS II who have high levels of anti-idursulfase neutralizing antibodies. This study highlights the importance of regular and frequent monitoring of urinary GAG in patients with MPS II who are

  6. Selection of HLA-B57-associated Gag A146P mutant by HLA-B∗48:01-restricted Gag140-147-specific CTLs in chronically HIV-1-infected Japanese.

    PubMed

    Naruto, Takuya; Murakoshi, Hayato; Chikata, Takayuki; Koyanagi, Madoka; Kawashima, Yuka; Gatanaga, Hiroyuki; Oka, Shinichi; Takiguchi, Masafumi

    2011-08-01

    We previously showed the possibility that Gag A146P, which is an escape mutant from HLA-B∗57-restricted CTLs, was selected by HLA-B∗48:01-restricted Gag138-147(LI10)-specific CTLs in a Japanese cohort in which HLA-B∗57 individuals were not detected. We herein demonstrated Gag140-147(GI8) to be the optimal epitope rather than LI10 and that GI8-specific T cells failed to recognize the A146P mutant virus-infected cells. The sequence analysis of Gag146 in 261 chronically HIV-1-infected Japanese showed the accumulation of the A146P mutation in HLA-B∗48:01(+) individuals. These findings together indicate that the A146P mutant is accumulating in Japanese by selection by GI8-specific CTLs. Copyright © 2011 Institut Pasteur. Published by Elsevier SAS. All rights reserved.

  7. Generation, Characterization and Application of Antibodies Directed against HERV-H Gag Protein in Colorectal Samples.

    PubMed

    Mullins, Christina S; Hühns, Maja; Krohn, Mathias; Peters, Sven; Cheynet, Valérie; Oriol, Guy; Guillotte, Michèle; Ducrot, Sandrine; Mallet, François; Linnebacher, Michael

    2016-01-01

    A substantial part of the human genome originates from transposable elements, remnants of ancient retroviral infections. Roughly 8% of the human genome consists of about 400,000 LTR elements including human endogenous retrovirus (HERV) sequences. Mainly, the interplay between epigenetic and post-transcriptional mechanisms is thought to silence HERV expression in most physiological contexts. Interestingly, aberrant reactivation of several HERV-H loci appears specific to colorectal carcinoma (CRC). The expression of HERV-H Gag proteins (Gag-H) was assessed using novel monoclonal mouse anti Gag-H antibodies. In a flow cytometry screen four antibody clones were tested on a panel of primary CRC cell lines and the most well performing ones were subsequently validated in western blot analysis. Finally, Gag-H protein expression was analyzed by immune histology on cell line cytospins and on clinical samples. There, we found a heterogeneous staining pattern with no background staining of endothelial, stromal and infiltrating immune cells but diffuse staining of the cytoplasm for positive tumor and normal crypt cells of the colonic epithelium. Taken together, the Gag-H antibody clone(s) present a valuable tool for staining of cells with colonic origin and thus form the basis for future more detailed investigations. The observed Gag-H protein staining in colonic epithelium crypt cells demands profound analyses of a potential role for Gag-H in the normal physiology of the human gut.

  8. Robust immunity to an auxotrophic Mycobacterium bovis BCG-VLP prime-boost HIV vaccine candidate in a nonhuman primate model.

    PubMed

    Chege, Gerald K; Burgers, Wendy A; Stutz, Helen; Meyers, Ann E; Chapman, Rosamund; Kiravu, Agano; Bunjun, Rubina; Shephard, Enid G; Jacobs, William R; Rybicki, Edward P; Williamson, Anna-Lise

    2013-05-01

    We previously reported that a recombinant pantothenate auxotroph of Mycobacterium bovis BCG expressing human immunodeficiency virus type 1 (HIV-1) subtype C Gag (rBCGpan-Gag) efficiently primes the mouse immune system for a boost with a recombinant modified vaccinia virus Ankara (rMVA) vaccine. In this study, we further evaluated the immunogenicity of rBCGpan-Gag in a nonhuman primate model. Two groups of chacma baboons were primed or mock primed twice with either rBCGpan-Gag or a control BCG. Both groups were boosted with HIV-1 Pr55(gag) virus-like particles (Gag VLPs). The magnitude and breadth of HIV-specific cellular responses were measured using a gamma interferon (IFN-γ) enzyme-linked immunosorbent spot (ELISPOT) assay, and the cytokine profiles and memory phenotypes of T cells were evaluated by polychromatic flow cytometry. Gag-specific responses were detected in all animals after the second inoculation with rBCGpan-Gag. Boosting with Gag VLPs significantly increased the magnitude and breadth of the responses in the baboons that were primed with rBCGpan-Gag. These responses targeted an average of 12 Gag peptides per animal, compared to an average of 3 peptides per animal for the mock-primed controls. Robust responses of Gag-specific polyfunctional T cells capable of simultaneously producing IFN-γ, tumor necrosis alpha (TNF-α), and interleukin-2 (IL-2) were detected in the rBCGpan-Gag-primed animals. Gag-specific memory T cells were skewed toward a central memory phenotype in both CD4(+) and CD8(+) T cell populations. These data show that the rBCGpan-Gag prime and Gag VLP boost vaccine regimen is highly immunogenic, inducing a broad and polyfunctional central memory T cell response. This report further indicates the feasibility of developing a BCG-based HIV vaccine that is safe for childhood HIV immunization.

  9. Epitope Specificity Delimits the Functional Capabilities of Vaccine-Induced CD8 T Cell Populations

    PubMed Central

    Hill, Brenna J.; Darrah, Patricia A.; Ende, Zachary; Ambrozak, David R.; Quinn, Kylie M.; Darko, Sam; Gostick, Emma; Wooldridge, Linda; van den Berg, Hugo A.; Venturi, Vanessa; Larsen, Martin; Davenport, Miles P.; Seder, Robert A.

    2014-01-01

    Despite progress toward understanding the correlates of protective T cell immunity in HIV infection, the optimal approach to Ag delivery by vaccination remains uncertain. We characterized two immunodominant CD8 T cell populations generated in response to immunization of BALB/c mice with a replication-deficient adenovirus serotype 5 vector expressing the HIV-derived Gag and Pol proteins at equivalent levels. The Gag-AI9/H-2Kd epitope elicited high-avidity CD8 T cell populations with architecturally diverse clonotypic repertoires that displayed potent lytic activity in vivo. In contrast, the Pol-LI9/H-2Dd epitope elicited motif-constrained CD8 T cell repertoires that displayed lower levels of physical avidity and lytic activity despite equivalent measures of overall clonality. Although low-dose vaccination enhanced the functional profiles of both epitope-specific CD8 T cell populations, greater polyfunctionality was apparent within the Pol-LI9/H-2Dd specificity. Higher proportions of central memory-like cells were present after low-dose vaccination and at later time points. However, there were no noteworthy phenotypic differences between epitope-specific CD8 T cell populations across vaccine doses or time points. Collectively, these data indicate that the functional and phenotypic properties of vaccine-induced CD8 T cell populations are sensitive to dose manipulation, yet constrained by epitope specificity in a clonotype-dependent manner. PMID:25348625

  10. Primary Human Immunodeficiency Virus Type 1 (HIV-1) Infection during HIV-1 Gag Vaccination▿

    PubMed Central

    Balamurugan, Arumugam; Lewis, Martha J.; Kitchen, Christina M. R.; Robertson, Michael N.; Shiver, John W.; Daar, Eric S.; Pitt, Jacqueline; Ali, Ayub; Ng, Hwee L.; Currier, Judith S.; Yang, Otto O.

    2008-01-01

    Vaccination for human immunodeficiency virus type 1 (HIV-1) remains an elusive goal. Whether an unsuccessful vaccine might not only fail to provoke detectable immune responses but also could actually interfere with subsequent natural immunity upon HIV-1 infection is unknown. We performed detailed assessment of an HIV-1 gag DNA vaccine recipient (subject 00015) who was previously uninfected but sustained HIV-1 infection before completing a vaccination trial and another contemporaneously acutely infected individual (subject 00016) with the same strain of HIV-1. Subject 00015 received the vaccine at weeks 0, 4, and 8 and was found to have been acutely HIV-1 infected around the time of the third vaccination. Subject 00016 was a previously HIV-1-seronegative sexual contact who had symptoms of acute HIV-1 infection approximately 2 weeks earlier than subject 00015 and demonstrated subsequent seroconversion. Both individuals reached an unusually low level of chronic viremia (<1,000 copies/ml) without treatment. Subject 00015 had no detectable HIV-1-specific cytotoxic T-lymphocyte (CTL) responses until a borderline response was noted at the time of the third vaccination. The magnitude and breadth of Gag-specific CTL responses in subject 00015 were similar to those of subject 00016 during early chronic infection. Viral sequences from gag, pol, and nef confirmed the common source of HIV-1 between these individuals. The diversity and divergence of sequences in subjects 00015 and 00016 were similar, indicating similar immune pressure on these proteins (including Gag). As a whole, the data suggested that while the gag DNA vaccine did not prime detectable early CTL responses in subject 00015, vaccination did not appreciably impair his ability to contain viremia at levels similar to those in subject 00016. PMID:18199650

  11. Recombinant yellow fever vaccine virus 17D expressing simian immunodeficiency virus SIVmac239 gag induces SIV-specific CD8+ T-cell responses in rhesus macaques.

    PubMed

    Bonaldo, Myrna C; Martins, Mauricio A; Rudersdorf, Richard; Mudd, Philip A; Sacha, Jonah B; Piaskowski, Shari M; Costa Neves, Patrícia C; Veloso de Santana, Marlon G; Vojnov, Lara; Capuano, Saverio; Rakasz, Eva G; Wilson, Nancy A; Fulkerson, John; Sadoff, Jerald C; Watkins, David I; Galler, Ricardo

    2010-04-01

    Here we describe a novel vaccine vector for expressing human immunodeficiency virus (HIV) antigens. We show that recombinant attenuated yellow fever vaccine virus 17D expressing simian immunodeficiency virus SIVmac239 Gag sequences can be used as a vector to generate SIV-specific CD8(+) T-cell responses in the rhesus macaque. Priming with recombinant BCG expressing SIV antigens increased the frequency of these SIV-specific CD8(+) T-cell responses after recombinant YF17D boosting. These recombinant YF17D-induced SIV-specific CD8(+) T cells secreted several cytokines, were largely effector memory T cells, and suppressed viral replication in CD4(+) T cells.

  12. Polyfunctional analysis of Gag and Nef specific CD8+ T-cell responses in HIV-1 infected Indian individuals.

    PubMed

    Mendiratta, Sanjay; Vajpayee, Madhu; Mojumdar, Kamalika; Chauhan, Neeraj K; Sreenivas, Vishnubhatla

    2011-02-01

    Polyfunctional CD8+ T-cells have been described as most competent in controlling viral replication. We studied the impact of antigen persistence on the polyfunctional immune responses of CD8+ T-lymphocytes to HIV Gag and Nef peptides and polyclonal stimuli in 40 ART naïve HIV infected individuals and analyzed the alterations in T-cell functionality in early and late stages of infection. Significantly elevated level of global response and polyfunctional profile of CD8+ T-cells were observed to polyclonal stimulation, than HIV specific antigens in chronically infected individuals. However no key differences were observed in CD8+ T-cell functional profile in any of the 15 unique subsets for Gag and Nef specific antigens. The subjects in early stage of infection (defined as a gap of 6 months or less between seroconversion and enrolment and with no apparent clinical symptoms) had a higher degree of response functionality (4+ or 3+ different functions simultaneously) than in the late stage infection (defined as time duration since seroconversion greater than 6 months). The data suggest that persistence of antigen during chronic infection leads to functional impairment of HIV specific responses. Copyright © 2010 Elsevier Ltd. All rights reserved.

  13. Decorin GAG synthesis and TGF-β signaling mediate Ox-LDL-induced mineralization of human vascular smooth muscle cells.

    PubMed

    Yan, Jianyun; Stringer, Sally E; Hamilton, Andrew; Charlton-Menys, Valentine; Götting, Christian; Müller, Benjamin; Aeschlimann, Daniel; Alexander, M Yvonne

    2011-03-01

    Decorin and oxidized low-density lipoprotein (Ox-LDL) independently induce osteogenic differentiation of vascular smooth muscle cells (VSMCs). We aimed to determine whether decorin glycosaminoglycan (GAG) chain synthesis contributes to Ox-LDL-induced differentiation and calcification of human VSMCs in vitro. Human VSMCs treated with Ox-LDL to induce oxidative stress showed increased alkaline phosphatase (ALP) activity, accelerated mineralization, and a difference in both decorin GAG chain biosynthesis and CS/DS structure compared with untreated controls. Ox-LDL increased mRNA abundance of both xylosyltransferase (XT)-I, the key enzyme responsible for GAG chain biosynthesis and Msx2, a marker of osteogenic differentiation. Furthermore, downregulation of XT-I expression using small interfering RNA blocked Ox-LDL-induced VSMC mineralization. Adenoviral-mediated overexpression of decorin, but not a mutated unglycanated form, accelerated mineralization of VSMCs, suggesting GAG chain addition on decorin is crucial for the process of differentiation. The decorin-induced VSMC osteogenic differentiation involved activation of the transforming growth factor (TGF)-β pathway, because it was attenuated by blocking of TGF-β receptor signaling and because decorin overexpression potentiated phosphorylation of the downstream signaling molecule smad2. These studies provide direct evidence that oxidative stress-mediated decorin GAG chain synthesis triggers TGF-β signaling and mineralization of VSMCs in vitro.

  14. Generation, Characterization and Application of Antibodies Directed against HERV-H Gag Protein in Colorectal Samples

    PubMed Central

    Mullins, Christina S.; Hühns, Maja; Krohn, Mathias; Peters, Sven; Cheynet, Valérie; Oriol, Guy; Guillotte, Michèle; Ducrot, Sandrine; Mallet, François; Linnebacher, Michael

    2016-01-01

    Introduction A substantial part of the human genome originates from transposable elements, remnants of ancient retroviral infections. Roughly 8% of the human genome consists of about 400,000 LTR elements including human endogenous retrovirus (HERV) sequences. Mainly, the interplay between epigenetic and post-transcriptional mechanisms is thought to silence HERV expression in most physiological contexts. Interestingly, aberrant reactivation of several HERV-H loci appears specific to colorectal carcinoma (CRC). Results The expression of HERV-H Gag proteins (Gag-H) was assessed using novel monoclonal mouse anti Gag-H antibodies. In a flow cytometry screen four antibody clones were tested on a panel of primary CRC cell lines and the most well performing ones were subsequently validated in western blot analysis. Finally, Gag-H protein expression was analyzed by immune histology on cell line cytospins and on clinical samples. There, we found a heterogeneous staining pattern with no background staining of endothelial, stromal and infiltrating immune cells but diffuse staining of the cytoplasm for positive tumor and normal crypt cells of the colonic epithelium. Conclusion Taken together, the Gag-H antibody clone(s) present a valuable tool for staining of cells with colonic origin and thus form the basis for future more detailed investigations. The observed Gag-H protein staining in colonic epithelium crypt cells demands profound analyses of a potential role for Gag-H in the normal physiology of the human gut. PMID:27119520

  15. Fusion of Epstein-Barr virus nuclear antigen-1-derived glycine-alanine repeat to trans-dominant HIV-1 Gag increases inhibitory activities and survival of transduced cells in vivo.

    PubMed

    Hammer, Diana; Wild, Jens; Ludwig, Christine; Asbach, Benedikt; Notka, Frank; Wagner, Ralf

    2008-06-01

    Trans-dominant human immunodeficiency virus type 1 (HIV-1) Gag derivatives have been shown to efficiently inhibit late steps of HIV-1 replication in vitro by interfering with Gag precursor assembly, thus ranking among the interesting candidates for gene therapy approaches. However, efficient antiviral activities of corresponding transgenes are likely to be counteracted in particular by cell-mediated host immune responses toward the transgene-expressing cells. To decrease this potential immunogenicity, a 24-amino acid Gly-Ala (GA) stretch derived from Epstein-Barr virus nuclear antigen-1 (EBNA1) and known to overcome proteasomal degradation was fused to a trans-dominant Gag variant (sgD1). To determine the capacity of this fusion polypeptide to repress viral replication, PM-1 cells were transduced with sgD1 and GAsgD1 transgenes, using retroviral gene transfer. Challenge of stably transfected permissive cell lines with various viral strains indicated that N-terminal GA fusion even enhanced the inhibitory properties of sgD1. Further studies revealed that the GA stretch increased protein stability by blocking proteasomal degradation of Gag proteins. Immunization of BALB/c mice with a DNA vaccine vector expressing sgD1 induced substantial Gag-specific immune responses that were, however, clearly diminished in the presence of GA. Furthermore, recognition of cells expressing the GA-fused transgene by CD8(+) T cells was drastically reduced, both in vitro and in vivo, resulting in prolonged survival of the transduced cells in recipient mice.

  16. HIV-1 adenoviral vector vaccines expressing multi-trimeric BAFF and 4-1BBL enhance T cell mediated anti-viral immunity.

    PubMed

    Kanagavelu, Saravana; Termini, James M; Gupta, Sachin; Raffa, Francesca N; Fuller, Katherine A; Rivas, Yaelis; Philip, Sakhi; Kornbluth, Richard S; Stone, Geoffrey W

    2014-01-01

    Adenoviral vectored vaccines have shown considerable promise but could be improved by molecular adjuvants. Ligands in the TNF superfamily (TNFSF) are potential adjuvants for adenoviral vector (Ad5) vaccines based on their central role in adaptive immunity. Many TNFSF ligands require aggregation beyond the trimeric state (multi-trimerization) for optimal biological function. Here we describe Ad5 vaccines for HIV-1 Gag antigen (Ad5-Gag) adjuvanted with the TNFSF ligands 4-1BBL, BAFF, GITRL and CD27L constructed as soluble multi-trimeric proteins via fusion to Surfactant Protein D (SP-D) as a multimerization scaffold. Mice were vaccinated with Ad5-Gag combined with Ad5 expressing one of the SP-D-TNFSF constructs or single-chain IL-12p70 as adjuvant. To evaluate vaccine-induced protection, mice were challenged with vaccinia virus expressing Gag (vaccinia-Gag) which is known to target the female genital tract, a major route of sexually acquired HIV-1 infection. In this system, SP-D-4-1BBL or SP-D-BAFF led to significantly reduced vaccinia-Gag replication when compared to Ad5-Gag alone. In contrast, IL-12p70, SP-D-CD27L and SP-D-GITRL were not protective. Histological examination following vaccinia-Gag challenge showed a dramatic lymphocytic infiltration into the uterus and ovaries of SP-D-4-1BBL and SP-D-BAFF-treated animals. By day 5 post challenge, proinflammatory cytokines in the tissue were reduced, consistent with the enhanced control over viral replication. Splenocytes had no specific immune markers that correlated with protection induced by SP-D-4-1BBL and SP-D-BAFF versus other groups. IL-12p70, despite lack of anti-viral efficacy, increased the total numbers of splenic dextramer positive CD8+ T cells, effector memory T cells, and effector Gag-specific CD8+ T cells, suggesting that these markers are poor predictors of anti-viral immunity in this model. In conclusion, soluble multi-trimeric 4-1BBL and BAFF adjuvants led to strong protection from vaccinia-Gag

  17. HIV-1 subtype A gag variability and epitope evolution.

    PubMed

    Abidi, Syed Hani; Kalish, Marcia L; Abbas, Farhat; Rowland-Jones, Sarah; Ali, Syed

    2014-01-01

    The aim of this study was to examine the course of time-dependent evolution of HIV-1 subtype A on a global level, especially with respect to the dynamics of immunogenic HIV gag epitopes. We used a total of 1,893 HIV-1 subtype A gag sequences representing a timeline from 1985 through 2010, and 19 different countries in Africa, Europe and Asia. The phylogenetic relationship of subtype A gag and its epidemic dynamics was analysed through a Maximum Likelihood tree and Bayesian Skyline plot, genomic variability was measured in terms of G → A substitutions and Shannon entropy, and the time-dependent evolution of HIV subtype A gag epitopes was examined. Finally, to confirm observations on globally reported HIV subtype A sequences, we analysed the gag epitope data from our Kenyan, Pakistani, and Afghan cohorts, where both cohort-specific gene epitope variability and HLA restriction profiles of gag epitopes were examined. The most recent common ancestor of the HIV subtype A epidemic was estimated to be 1956 ± 1. A period of exponential growth began about 1980 and lasted for approximately 7 years, stabilized for 15 years, declined for 2-3 years, then stabilized again from about 2004. During the course of evolution, a gradual increase in genomic variability was observed that peaked in 2005-2010. We observed that the number of point mutations and novel epitopes in gag also peaked concurrently during 2005-2010. It appears that as the HIV subtype A epidemic spread globally, changing population immunogenetic pressures may have played a role in steering immune-evolution of this subtype in new directions. This trend is apparent in the genomic variability and epitope diversity of HIV-1 subtype A gag sequences.

  18. Recombinant modified vaccinia virus Ankara–simian immunodeficiency virus gag pol elicits cytotoxic T lymphocytes in rhesus monkeys detected by a major histocompatibility complex class I/peptide tetramer

    PubMed Central

    Seth, Aruna; Ourmanov, Ilnour; Kuroda, Marcelo J.; Schmitz, Jörn E.; Carroll, Miles W.; Wyatt, Linda S.; Moss, Bernard; Forman, Meryl A.; Hirsch, Vanessa M.; Letvin, Norman L.

    1998-01-01

    The utility of modified vaccinia virus Ankara (MVA) as a vector for eliciting AIDS virus-specific cytotoxic T lymphocytes (CTL) was explored in the simian immunodeficiency virus (SIV)/rhesus monkey model. After two intramuscular immunizations with recombinant MVA-SIVSM gag pol, the monkeys developed a Gag epitope-specific CTL response readily detected in peripheral blood lymphocytes by using a functional killing assay. Moreover, those immunizations also elicited a population of CD8+ T lymphocytes in the peripheral blood that bound a specific major histocompatibility complex class I/peptide tetramer. These Gag epitope-specific CD8+ T lymphocytes also were demonstrated by using both functional and tetramer-binding assays in lymph nodes of the immunized monkeys. These observations suggest that MVA may prove a useful vector for an HIV-1 vaccine. They also suggest that tetramer staining may be a useful technology for monitoring CTL generation in vaccine trials in nonhuman primates and in humans. PMID:9707609

  19. Plasmacytoid dendritic cell and functional HIV Gag p55-specific T cells before treatment interruption can inform set-point plasma HIV viral load after treatment interruption in chronically suppressed HIV-1(+) patients.

    PubMed

    Papasavvas, Emmanouil; Foulkes, Andrea; Yin, Xiangfan; Joseph, Jocelin; Ross, Brian; Azzoni, Livio; Kostman, Jay R; Mounzer, Karam; Shull, Jane; Montaner, Luis J

    2015-07-01

    The identification of immune correlates of HIV control is important for the design of immunotherapies that could support cure or antiretroviral therapy (ART) intensification-related strategies. ART interruptions may facilitate this task through exposure of an ART partially reconstituted immune system to endogenous virus. We investigated the relationship between set-point plasma HIV viral load (VL) during an ART interruption and innate/adaptive parameters before or after interruption. Dendritic cell (DC), natural killer (NK) cell and HIV Gag p55-specific T-cell functional responses were measured in paired cryopreserved peripheral blood mononuclear cells obtained at the beginning (on ART) and at set-point of an open-ended interruption from 31 ART-suppressed chronically HIV-1(+) patients. Spearman correlation and linear regression modeling were used. Frequencies of plasmacytoid DC (pDC), and HIV Gag p55-specific CD3(+)  CD4(-)  perforin(+)  IFN-γ(+) cells at the beginning of interruption associated negatively with set-point plasma VL. Inclusion of both variables with interaction into a model resulted in the best fit (adjusted R(2)  = 0·6874). Frequencies of pDC or HIV Gag p55-specific CD3(+)  CD4(-)  CSFE(lo)  CD107a(+) cells at set-point associated negatively with set-point plasma VL. The dual contribution of pDC and anti-HIV T-cell responses to viral control, supported by our models, suggests that these variables may serve as immune correlates of viral control and could be integrated in cure or ART-intensification strategies. © 2015 John Wiley & Sons Ltd.

  20. Preparation of BFV Gag antiserum and preliminary study on cellular distribution of BFV.

    PubMed

    Wang, Jian; Guo, Hong-yan; Jia, Rui; Xu, Xuan; Tan, Juan; Geng, Yun-qi; Qiao, Wen-tao

    2010-04-01

    Viruses (e.g. Human immunodeficiency virus, Human simplex virus and Prototype foamy virus) are obligate intracellular parasites and therefore depend on the cellular machinery for cellular trafficking. Bovine foamy virus (BFV) is a member of the Spumaretrovirinae subfamily of Retroviruses, however, details of its cellular trafficking remain unknown. In this study, we cloned the BFV gag gene into prokaryotic expression vector pET28a and purified the denaturalized Gag protein. The protein was used to immunize BALB/c mouse to produce antiserum, which could specifically recognize the BFV Gag protein in BFV-infected cells through western blot assay. Additionally, these results demonstrated that both the optimal and suboptimal cleavage of Gag protein occur in BFV-infected cells. Subsequently, the Gag antiserum was used to investigate subcellular localization of BFV. In immunofluorescence microscopy assays, colocalization microtubules (MTs) and assembling viral particles were clearly observed, which implied that BFV may transport along cellular MTs in host cells. Furthermore, MTs-depolymerizing assay indicated MTs were required for the efficient replication of BFV. In conclusion, our study suggests that BFV has evolved the mechanism to hijack the cellular cytoskeleton for its replication.

  1. [Effect of vitamine A on mice immune response induced by specific periodontal pathogenic bacteria-immunization].

    PubMed

    Lin, Xiao-Ping; Zhou, Xiao-Jia; Liu, Hong-Li; DU, Li-Li; Toshihisa, Kawai

    2010-12-01

    The aim of this study was to investigate the effect of vitamine-A deficiency on the induction of specific periodontal pathogenic bacteria A. actinomycetetemcomitans(Aa) immunization. BALB/c mice were fed with vitamine A-depleted diet or control regular diet throughout the whole experiment period. After 2 weeks, immunized formalin-killed Aa to build immunized models, 6 weeks later, sacrificed to determine specific antibody-IgG, IgM and sub-class IgG antibody titers in serum, and concentration of IL-10, IFN-γ, TNF-α and RANKL in T cell supernatant were measured by ELISA and T cell proliferation was measured by cintilography. SPSS 11.5 software package was used for statistical analysis. The levels of whole IgG and IgM antibody which were immunized by Aa significantly elevated, non-immune group was unable to produce any antibody. Compared with Aa immunized+RD group, the level of whole IgG in Aa immunized+VAD group was significantly higher (P<0.05); The levels of IgG2a increased obviously, whereas the levels of IgG1 subtype antibody conspicuous decreased, with a significant difference (P<0.05). Aa immunized group could induce body to produce a strong specific T-cell immune response, but Aa immunized+VAD group had a higher T cell proliferate response compared with Aa immunized+RD group, with a statistically significant difference (P<0.05); The expression of RANKL, IFN-γ and TNF-α supernatant increased, while the expression of IL-10 decreased (P<0.05). The lack of vitamin-A diet can increase the immunized mice's susceptibility to periodontal pathogenic bacteria and trigger or aggravate immune inflammatory response. Adequate vitamin A is an important factor in maintaining body health. Supported by Natural Science Foundation of Liaoning Province (Grant No.20092139) and Science and Technology Program of Shenyang Municipality (Grant No.F10-149-9-32).

  2. Strain-Specific Protective Effect of the Immunity Induced by Live Malarial Sporozoites under Chloroquine Cover

    PubMed Central

    Wijayalath, Wathsala; Cheesman, Sandra; Tanabe, Kazuyuki; Handunnetti, Shiroma; Carter, Richard; Pathirana, Sisira

    2012-01-01

    The efficacy of a whole-sporozoite malaria vaccine would partly be determined by the strain-specificity of the protective responses against malarial sporozoites and liver-stage parasites. Evidence from previous reports were inconsistent, where some studies have shown that the protective immunity induced by irradiated or live sporozoites in rodents or humans were cross-protective and in others strain-specific. In the present work, we have studied the strain-specificity of live sporozoite-induced immunity using two genetically and immunologically different strains of Plasmodium cynomolgi, Pc746 and PcCeylon, in toque monkeys. Two groups of monkeys were immunized against live sporozoites of either the Pc746 (n = 5), or the PcCeylon (n = 4) strain, by the bites of 2–4 sporozoite-infected Anopheles tessellates mosquitoes per monkey under concurrent treatments with chloroquine and primaquine to abrogate detectable blood infections. Subsequently, a group of non-immunized monkeys (n = 4), and the two groups of immunized monkeys were challenged with a mixture of sporozoites of the two strains by the bites of 2–5 infective mosquitoes from each strain per monkey. In order to determine the strain-specificity of the protective immunity, the proportions of parasites of the two strains in the challenge infections were quantified using an allele quantification assay, Pyrosequencing™, based on a single nucleotide polymorphism (SNP) in the parasites’ circumsporozoite protein gene. The Pyrosequencing™ data showed that a significant reduction of parasites of the immunizing strain in each group of strain-specifically immunized monkeys had occurred, indicating a stronger killing effect on parasites of the immunizing strain. Thus, the protective immunity developed following a single, live sporozoite/chloroquine immunization, acted specifically against the immunizing strain and was, therefore, strain-specific. As our experiment does not allow us to determine the

  3. Induction of pneumococcal polysaccharide-specific mucosal immune responses by oral immunization.

    PubMed

    VanCott, J L; Kobayashi, T; Yamamoto, M; Pillai, S; McGhee, J R; Kiyono, H

    1996-04-01

    Liposome and cholera toxin (CT) are considered to be effective antigen delivery vehicles and adjuvants for mucosal vaccines. The effect of these antigen delivery systems on adjuvant responses to mucosally administered pneumococcal polysaccharide (Pnup) was investigated in this study. Both mucosal (e.g. oral) and systemic (i.p.) immunization of mice with purified preparations of Pnup type 23F induced antigen-specific IgM responses in sera. Interestingly, oral immunization of as little as 10 micrograms of Pnup type 23F was sufficient to induce systemic IgM responses. Pnup-specific IgM antibodies peaked by day 7 and no booster responses were evident after a second dose on day 14. In order to examine whether IgG and IgA Pnup-specific immune responses are induced by mucosal immunization, the mucosal adjuvant CT was mixed with Pnup type 23 as an oral vaccine. Co-oral administration of CT and Pnup type 23F resulted in the induction of Pnup-specific faecal IgA antibodies. These results were confirmed by detecting antigen-specific IgA-spot-forming cells in mononuclear cell suspensions prepared from the intestine of immunized mice. These findings suggest that oral immunization with Pnup in the presence of mucosal adjuvants, such as CT, could induce Pnup-specific IgA responses whereas Pnup alone did not. In an attempt to further enhance antigen-specific antibody responses, Pnup type 23F was encapsulated in liposomes and used as mucosal vaccine. However, immunogenicity of Pnup was not improved.

  4. Polymicrobial sepsis and non-specific immunization induce adaptive immunosuppression to a similar degree.

    PubMed

    Schmoeckel, Katrin; Mrochen, Daniel M; Hühn, Jochen; Pötschke, Christian; Bröker, Barbara M

    2018-01-01

    Sepsis is frequently complicated by a state of profound immunosuppression, in its extreme form known as immunoparalysis. We have studied the role of the adaptive immune system in the murine acute peritonitis model. To read out adaptive immunosuppression, we primed post-septic and control animals by immunization with the model antigen TNP-ovalbumin in alum, and measured the specific antibody-responses via ELISA and ELISpot assay as well as T-cell responses in a proliferation assay after restimulation. Specific antibody titers, antibody affinity and plasma cell counts in the bone marrow were reduced in post-septic animals. The antigen-induced splenic proliferation was also impaired. The adaptive immunosuppression was positively correlated with an overwhelming general antibody response to the septic insult. Remarkably, antigen "overload" by non-specific immunization induced a similar degree of adaptive immunosuppression in the absence of sepsis. In both settings, depletion of regulatory T cells before priming reversed some parameters of the immunosuppression. In conclusion, our data show that adaptive immunosuppression occurs independent of profound systemic inflammation and life-threatening illness.

  5. Polymicrobial sepsis and non-specific immunization induce adaptive immunosuppression to a similar degree

    PubMed Central

    Hühn, Jochen; Pötschke, Christian

    2018-01-01

    Sepsis is frequently complicated by a state of profound immunosuppression, in its extreme form known as immunoparalysis. We have studied the role of the adaptive immune system in the murine acute peritonitis model. To read out adaptive immunosuppression, we primed post-septic and control animals by immunization with the model antigen TNP-ovalbumin in alum, and measured the specific antibody-responses via ELISA and ELISpot assay as well as T-cell responses in a proliferation assay after restimulation. Specific antibody titers, antibody affinity and plasma cell counts in the bone marrow were reduced in post-septic animals. The antigen-induced splenic proliferation was also impaired. The adaptive immunosuppression was positively correlated with an overwhelming general antibody response to the septic insult. Remarkably, antigen “overload” by non-specific immunization induced a similar degree of adaptive immunosuppression in the absence of sepsis. In both settings, depletion of regulatory T cells before priming reversed some parameters of the immunosuppression. In conclusion, our data show that adaptive immunosuppression occurs independent of profound systemic inflammation and life-threatening illness. PMID:29415028

  6. HDAC inhibition induces HIV-1 protein and enables immune-based clearance following latency reversal

    PubMed Central

    Wu, Guoxin; Swanson, Michael; Talla, Aarthi; Graham, Donald; Strizki, Julie; Gorman, Daniel; Barnard, Richard J.O.; Blair, Wade; Søgaard, Ole S.; Tolstrup, Martin; Østergaard, Lars; Rasmussen, Thomas A.; Sekaly, Rafick-Pierre; Archin, Nancie M.; Hazuda, Daria J.; Howell, Bonnie J.

    2017-01-01

    Promising therapeutic approaches for eradicating HIV include transcriptional activation of provirus from latently infected cells using latency-reversing agents (LRAs) and immune-mediated clearance to purge reservoirs. Accurate detection of cells capable of producing viral antigens and virions, and the measurement of clearance of infected cells, is essential to assessing therapeutic efficacy. Here, we apply enhanced methodology extending the sensitivity limits for the rapid detection of subfemtomolar HIV gag p24 capsid protein in CD4+ T cells from ART-suppressed HIV+ individuals, and we show viral protein induction following treatment with LRAs. Importantly, we demonstrate that clinical administration of histone deacetylase inhibitors (HDACis; vorinostat and panobinostat) induced HIV gag p24, and ex vivo stimulation produced sufficient viral antigen to elicit immune-mediated cell killing using anti-gp120/CD3 bispecific antibody. These findings extend beyond classical nucleic acid endpoints, which are confounded by the predominance of mutated, defective proviruses and, of paramount importance, enable assessment of cells making HIV protein that can now be targeted by immunological approaches. PMID:28814661

  7. Vaccination directed against the human endogenous retrovirus-K (HERV-K) gag protein slows HERV-K gag expressing cell growth in a murine model system.

    PubMed

    Kraus, Benjamin; Fischer, Katrin; Sliva, Katja; Schnierle, Barbara S

    2014-03-26

    Human endogenous retroviruses (HERVs) are remnants of ancestral infections and chromosomally integrated in all cells of an individual, are transmitted only vertically and are defective in viral replication. However enhanced expression of HERV-K accompanied by the emergence of anti-HERV-K-directed immune responses has been observed inter-alia in HIV-infected individuals and tumor patients. Therefore HERV-K might serve as a tumor-specific antigen or even as a constant target for the development of an HIV vaccine. To verify our hypothesis, we tested the immunogenicity of HERV-K Gag by using a recombinant vaccinia virus (MVA-HKcon) expressing the HERV-K Gag protein and established an animal model to test its vaccination efficacy. Murine renal carcinoma cells (Renca) were genetically altered to express E. coli beta-galactosidase (RLZ cells) and the HERV-K Gag protein (RLZ-HKGag cells). Subcutaneous application of RLZ-HKGag cells into syngenic BALB/c mice resulted in the formation of local tumors in MVA vaccinated mice. MVA-HKcon vaccination reduced the tumor growth. Furthermore, intravenous injection of RLZ-HKGag cells led to the formation of pulmonary metastases. Vaccination of tumor-bearing mice with MVA-HKcon drastically reduced the number of pulmonary RLZ-HKGag tumor nodules compared to vaccination with wild-type MVA. The data demonstrate that HERV-K Gag is a useful target for vaccine development and might offer new treatment opportunities for cancer patients.

  8. Live attenuated measles vaccine expressing HIV-1 Gag virus like particles covered with gp160DELTAV1V2 is strongly immunogenic

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Guerbois, Mathilde; Moris, Arnaud; Combredet, Chantal

    Although a live attenuated HIV vaccine is not currently considered for safety reasons, a strategy inducing both T cells and neutralizing antibodies to native assembled HIV-1 particles expressed by a replicating virus might mimic the advantageous characteristics of live attenuated vaccine. To this aim, we generated a live attenuated recombinant measles vaccine expressing HIV-1 Gag virus-like particles (VLPs) covered with gp160DELTAV1V2 Env protein. The measles-HIV virus replicated efficiently in cell culture and induced the intense budding of HIV particles covered with Env. In mice sensitive to MV infection, this recombinant vaccine stimulated high levels of cellular and humoral immunity tomore » both MV and HIV with neutralizing activity. The measles-HIV virus infected human professional antigen-presenting cells, such as dendritic cells and B cells, and induced efficient presentation of HIV-1 epitopes and subsequent activation of human HIV-1 Gag-specific T cell clones. This candidate vaccine will be next tested in non-human primates. As a pediatric vaccine, it might protect children and adolescents simultaneously from measles and HIV.« less

  9. Differences in Env and Gag protein expression patterns and epitope availability in feline immunodeficiency virus infected PBMC compared to infected and transfected feline model cell lines.

    PubMed

    Roukaerts, Inge D M; Grant, Chris K; Theuns, Sebastiaan; Christiaens, Isaura; Acar, Delphine D; Van Bockstael, Sebastiaan; Desmarets, Lowiese M B; Nauwynck, Hans J

    2017-01-02

    Env and Gag are key components of the FIV virion that are targeted to the plasma membrane for virion assembly. They are both important stimulators and targets of anti-FIV immunity. To investigate and compare the expression pattern and antigenic changes of Gag and Env in various research models, infected PBMC (the natural FIV host cells) and GFox, and transfected CrFK were stained over time with various Env and Gag specific MAbs. In FIV infected GFox and PBMC, Env showed changes in epitope availability for antibody binding during processing and trafficking, which was not seen in transfected CrFK. Interestingly, epitopes exposed on intracellular Env and Env present on the plasma membrane of CrFK and GFox seem to be hidden on plasma membrane expressed Env of FIV infected PBMC. A kinetic follow up of Gag and Env expression showed a polarization of both Gag and Env expression to specific sites at the plasma membrane of PBMC, but not in other cell lines. In conclusion, mature trimeric cell surface expressed Env might be antigenically distinct from intracellular monomeric Env in PBMC and might possibly be unrecognizable by feline humoral immunity. In addition, Env expression is restricted to a small area on the plasma membrane and co-localizes with a large moiety of Gag, which may represent a preferred FIV budding site, or initiation of virological synapses with direct cell-to-cell virus transmission. Copyright © 2016. Published by Elsevier B.V.

  10. Improved genetic stability of recombinant yellow fever 17D virus expressing a lentiviral Gag gene fragment.

    PubMed

    de Santana, Marlon G Veloso; Neves, Patrícia C C; dos Santos, Juliana Ribeiro; Lima, Noemia S; dos Santos, Alexandre A C; Watkins, David I; Galler, Ricardo; Bonaldo, Myrna C

    2014-03-01

    We have previously designed a method to construct viable recombinant Yellow Fever (YF) 17D viruses expressing heterologous polypeptides including part of the Simian Immunodeficiency Virus (SIV) Gag protein. However, the expressed region, encompassing amino acid residues from 45 to 269, was genetically unstable. In this study, we improved the genetic stability of this recombinant YF 17D virus by introducing mutations in the IRES element localized at the 5' end of the SIV gag gene. The new stable recombinant virus elicited adaptive immune responses similar to those induced by the original recombinant virus. It is, therefore, possible to increase recombinant stability by removing functional motifs from the insert that may have deleterious effects on recombinant YF viral fitness. Copyright © 2014 Elsevier Inc. All rights reserved.

  11. Deletion of Specific Immune-Modulatory Genes from Modified Vaccinia Virus Ankara-Based HIV Vaccines Engenders Improved Immunogenicity in Rhesus Macaques

    PubMed Central

    O'Mara, Leigh A.; Gangadhara, Sailaja; McQuoid, Monica; Zhang, Xiugen; Zheng, Rui; Gill, Kiran; Verma, Meena; Yu, Tianwei; Johnson, Brent; Li, Bing; Derdeyn, Cynthia A.; Ibegbu, Chris; Altman, John D.; Hunter, Eric; Feinberg, Mark B.

    2012-01-01

    Modified vaccinia virus Ankara (MVA) is a safe, attenuated orthopoxvirus that is being developed as a vaccine vector but has demonstrated limited immunogenicity in several early-phase clinical trials. Our objective was to rationally improve the immunogenicity of MVA-based HIV/AIDS vaccines via the targeted deletion of specific poxvirus immune-modulatory genes. Vaccines expressing codon-optimized HIV subtype C consensus Env and Gag antigens were generated from MVA vector backbones that (i) harbor simultaneous deletions of four viral immune-modulatory genes, encoding an interleukin-18 (IL-18) binding protein, an IL-1β receptor, a dominant negative Toll/IL-1 signaling adapter, and CC-chemokine binding protein (MVAΔ4-HIV); (ii) harbor a deletion of an additional (fifth) viral gene, encoding uracil-DNA glycosylase (MVAΔ5-HIV); or (iii) represent the parental MVA backbone as a control (MVA-HIV). We performed head-to-head comparisons of the cellular and humoral immune responses that were elicited by these vectors during homologous prime-boost immunization regimens utilizing either high-dose (2 × 108 PFU) or low-dose (1 × 107 PFU) intramuscular immunization of rhesus macaques. At all time points, a majority of the HIV-specific T cell responses, elicited by all vectors, were directed against Env, rather than Gag, determinants, as previously observed with other vector systems. Both modified vectors elicited up to 6-fold-higher frequencies of HIV-specific CD8 and CD4 T cell responses and up to 25-fold-higher titers of Env (gp120)-specific binding (nonneutralizing) antibody responses that were relatively transient in nature. While the correlates of protection against HIV infection remain incompletely defined, our results indicate that the rational deletion of specific genes from MVA vectors can positively alter their cellular and humoral immunogenicity profiles in nonhuman primates. PMID:22973033

  12. Polyomavirus-Specific Cellular Immunity: From BK-Virus-Specific Cellular Immunity to BK-Virus-Associated Nephropathy?

    PubMed Central

    Dekeyser, Manon; François, Hélène; Beaudreuil, Séverine; Durrbach, Antoine

    2015-01-01

    In renal transplantation, BK-virus (BKV)-associated nephropathy has emerged as a major complication, with a prevalence of 1–10% and graft loss in >50% of cases. BKV is a member of the polyomavirus family and rarely induces apparent clinical disease in the general population. However, replication of polyomaviruses, associated with significant organ disease, is observed in patients with acquired immunosuppression. Monitoring of specific immunity combined with viral load could be used to individually assess the risk of viral reactivation and virus control. We review the current knowledge on BKV-specific cellular immunity and, more specifically, in immunocompromised patients. In the future, immune-based therapies could allow us to treat and prevent BKV-associated nephropathy. PMID:26136745

  13. Proteolytic Processing and Assembly of gag and gag-pol Proteins of TED, a Baculovirus-Associated Retrotransposon of the Gypsy Family

    PubMed Central

    Hajek, Kathryn L.; Friesen, Paul D.

    1998-01-01

    TED (transposable element D) is an env-containing member of the gypsy family of retrotransposons that represents a possible retrovirus of invertebrates. This lepidopteran (moth) retroelement contains gag and pol genes that encode proteins capable of forming viruslike particles (VLP) with reverse transcriptase. Since VLP are likely intermediates in TED transposition, we investigated the roles of gag and pol in TED capsid assembly and maturation. By using constructed baculovirus vectors and TED Gag-specific antiserum, we show that the principal translation product of gag (Pr55gag) is cleaved to produce a single VLP structural protein, p37gag. Replacement of Asp436 within the retrovirus-like active site of the pol-encoded protease (PR) abolished Pr55gag cleavage and demonstrated the requirement for PR in capsid processing. As shown by expression of an in-frame fusion of TED gag and pol, PR is derived from the Gag-Pol polyprotein Pr195gag-pol. The PR cleavage site within Pr55gag was mapped to a position near the junction of a basic, nucleocapsid-like domain and a C-terminal acidic domain. Once released by cleavage, the C-terminal fragment was not detected. This acidic fragment was dispensable for VLP assembly, as demonstrated by the formation of VLP by C-terminal Pr55gag truncation proteins and replacement of the acidic domain with a heterologous protein. In contrast, C-terminal deletions that extended into the adjacent nucleocapsid-like domain of Pr55gag abolished VLP recovery and demonstrated that this central region contributes to VLP assembly or stability, or both. Collectively, these data suggest that the single TED protein p37gag provides both capsid and nucleocapsid functions. TED may therefore use a simple processing strategy for VLP assembly and genome packaging. PMID:9765414

  14. Proteolytic processing and assembly of gag and gag-pol proteins of TED, a baculovirus-associated retrotransposon of the gypsy family.

    PubMed

    Hajek, K L; Friesen, P D

    1998-11-01

    TED (transposable element D) is an env-containing member of the gypsy family of retrotransposons that represents a possible retrovirus of invertebrates. This lepidopteran (moth) retroelement contains gag and pol genes that encode proteins capable of forming viruslike particles (VLP) with reverse transcriptase. Since VLP are likely intermediates in TED transposition, we investigated the roles of gag and pol in TED capsid assembly and maturation. By using constructed baculovirus vectors and TED Gag-specific antiserum, we show that the principal translation product of gag (Pr55(gag)) is cleaved to produce a single VLP structural protein, p37(gag). Replacement of Asp436 within the retrovirus-like active site of the pol-encoded protease (PR) abolished Pr55(gag) cleavage and demonstrated the requirement for PR in capsid processing. As shown by expression of an in-frame fusion of TED gag and pol, PR is derived from the Gag-Pol polyprotein Pr195(gag-pol). The PR cleavage site within Pr55(gag) was mapped to a position near the junction of a basic, nucleocapsid-like domain and a C-terminal acidic domain. Once released by cleavage, the C-terminal fragment was not detected. This acidic fragment was dispensable for VLP assembly, as demonstrated by the formation of VLP by C-terminal Pr55(gag) truncation proteins and replacement of the acidic domain with a heterologous protein. In contrast, C-terminal deletions that extended into the adjacent nucleocapsid-like domain of Pr55(gag) abolished VLP recovery and demonstrated that this central region contributes to VLP assembly or stability, or both. Collectively, these data suggest that the single TED protein p37(gag) provides both capsid and nucleocapsid functions. TED may therefore use a simple processing strategy for VLP assembly and genome packaging.

  15. Immunosuppression in Early Postnatal Days Induces Persistent and Allergen-Specific Immune Tolerance to Asthma in Adult Mice

    PubMed Central

    Chen, Yan; Zhang, Jin; Lu, Yong; Wang, Libo

    2015-01-01

    Bronchial asthma is a chronic airway inflammatory condition with high morbidity, and effective treatments for asthma are limited. Allergen-specific immunotherapy can only induce peripheral immune tolerance and is not sustainable. Exploring new therapeutic strategies is of great clinical importance. Recombinant adenovirus (rAdV) was used as a vector to make cells expressing cytotoxic T lymphocyte-associated antigen-4-immunoglobulin (CTLA4Ig) a soluble CTLA4 immunoglobulin fusion protein. Dendritic cells (DCs) were modified using the rAdVs together with allergens. Then these modified DCs were transplanted to mice before allergen sensitization. The persistence and specificity of immune tolerance were evaluated in mice challenged with asthma allergens at 3 and 7 months. DCs modified by CTLA4Ig showed increased IL-10 secretion, decreased IL-12 secretion, and T cell stimulation in vitro. Mice treated with these DCs in the early neonatal period developed tolerance against the allergens that were used to induce asthma in the adult stage. Asthma symptoms, lung damage, airway reactivity, and inflammatory response all improved. Humoral immunity indices showed that this therapeutic strategy strongly suppressed mice immune responses and was maintained for as long as 7 months. Furthermore, allergen cross-sensitization and challenge experiments demonstrated that this immune tolerance was allergen-specific. Treatment with CTLA4Ig modified DCs in the early neonatal period, inducing persistent and allergen-specific immune tolerance to asthma in adult mice. Our results suggest that it may be possible to develop a vaccine for asthma. PMID:25860995

  16. Incorporation of chimeric gag protein into retroviral particles.

    PubMed Central

    Weldon, R A; Erdie, C R; Oliver, M G; Wills, J W

    1990-01-01

    The product of the Rous sarcoma virus (RSV) gag gene, Pr76gag, is a polyprotein precursor which is cleaved by the viral protease to yield the major structural proteins of the virion during particle assembly in avian host cells. We have recently shown that myristylated forms of the RSV Gag protein can induce particle formation with very high efficiency when expressed in mammalian cells (J. W. Wills, R. C. Craven, and J. A. Achacoso, J. Virol. 63:4331-4343, 1989). We made use of this mammalian system to examine the abilities of foreign antigens to be incorporated into particles when fused directly to the myristylated Gag protein. Our initial experiments showed that removal of various portions of the viral protease located at the carboxy terminus of the RSV Gag protein did not disrupt particle formation. We therefore chose this region for coupling of iso-1-cytochrome c from Saccharomyces cerevisiae to Gag. This was accomplished by constructing an in-frame fusion of the CYC1 and gag coding sequences at a common restriction endonuclease site. Expression of the chimeric gene resulted in synthesis of the Gag-cytochrome fusion protein and its release into the cell culture medium. The chimeric particles were readily purified by simple centrifugation, and transmission electron microscopy of cells that produced them revealed a morphology similar to that of immature type C retrovirions. Images PMID:2166812

  17. Nucleic acid chaperone activity of retroviral Gag proteins.

    PubMed

    Rein, Alan

    2010-01-01

    Retrovirus particles in which the Gag protein has not yet been cleaved by the viral protease are termed immature particles. The viral RNA within these particles shows clear evidence of the action of a nucleic acid chaperone (NAC): the genomic RNA is dimeric, and a cellular tRNA molecule is annealed, by its 3' 18 nucleotides, to a complementary stretch in the viral RNA, in preparation for priming reverse transcription in the next round of infection. It seems very likely that the NAC that has catalyzed dimerization and tRNA annealing is the NC domain of the Gag protein itself. However, neither the dimeric linkage nor the tRNA:viral RNA complex has the same structure as those in mature virus particles: thus the conformational effects of Gag within the particles are not equivalent to those of the free NC protein present in mature particles. It is not known whether these dissimilarities reflect intrinsic differences in the NAC activities of Gag and NC, or limitations on Gag imposed by the structure of the immature particle. Analysis of the interactions of recombinant Gag proteins with nucleic acids is complicated by the fact that they result in assembly of virus-like particles. Nevertheless, the available data indicates that the affinity of Gag for nucleic acids can be considerably higher than that of free NC. This enhanced affinity may be due to contributions of the matrix domain, a positively charged region at the N-terminus of Gag; interactions of neighboring Gag molecules with each other may also increase the affinity due to cooperativity of the binding. Recombinant HIV-1 Gag protein clearly exhibits NAC activity. In two well-studied experimental systems, Gag was more efficient than NC, as its NAC effects could be detected at a significantly lower molar ratio of protein to nucleotide than with NC. In one system, binding of nucleic acid by the matrix domain of Gag retarded the Gag-induced annealing of two RNAs; this effect could be ameliorated by the competitive

  18. Infection-specific phosphorylation of glutamyl-prolyl tRNA synthetase induces antiviral immunity

    PubMed Central

    Lee, Eun-Young; Lee, Hyun-Cheol; Kim, Hyun-Kwan; Jang, Song Yee; Park, Seong-Jun; Kim, Yong-Hoon; Kim, Jong Hwan; Hwang, Jungwon; Kim, Jae-Hoon; Kim, Tae-Hwan; Arif, Abul; Kim, Seon-Young; Choi, Young-Ki; Lee, Cheolju; Lee, Chul-Ho; Jung, Jae U; Fox, Paul L; Kim, Sunghoon; Lee, Jong-Soo; Kim, Myung Hee

    2016-01-01

    The mammalian cytoplasmic multi-tRNA synthetase complex (MSC) is a depot system that regulates non-translational cellular functions. Here we found that the MSC component glutamyl-prolyl-tRNA synthetase (EPRS) switched its function following viral infection and exhibited potent antiviral activity. Infection-specific phosphorylation of EPRS at Ser990 induced its dissociation from the MSC, after which it was guided to the antiviral signaling pathway, where it interacted with PCBP2, a negative regulator of mitochondrial antiviral signaling protein (MAVS) that is critical for antiviral immunity. This interaction blocked PCBP2-mediated ubiquitination of MAVS and ultimately suppressed viral replication. EPRS-haploid (Eprs+/−) mice showed enhanced viremia and inflammation and delayed viral clearance. This stimulus-inducible activation of MAVS by EPRS suggests an unexpected role for the MSC as a regulator of immune responses to viral infection. PMID:27595231

  19. HCV-specific immune responses induced by CIGB-230 in combination with IFN-α plus ribavirin

    PubMed Central

    Amador-Cañizares, Yalena; Martínez-Donato, Gillian; Álvarez-Lajonchere, Liz; Vasallo, Claudia; Dausá, Mariacarla; Aguilar-Noriega, Daylen; Valenzuela, Carmen; Raíces, Ivette; Dubuisson, Jean; Wychowski, Czeslaw; Cinza-Estévez, Zurina; Castellanos, Marlén; Núñez, Magdalys; Armas, Anny; González, Yaimé; Revé, Ismariley; Guerra, Ivis; Pérez Aguiar, Ángel; Dueñas-Carrera, Santiago

    2014-01-01

    AIM: To analyze hepatitis C virus (HCV)-specific immune responses in chronically infected patients under triple therapy with interferon-α (IFN-α) plus ribavirin and CIGB-230. METHODS: CIGB-230 was administered in different schedules with respect to IFN-α plus ribavirin therapy. Paired serum and peripheral blood mononuclear cells (PBMC) samples from baseline and end of treatment were analyzed. The HCV-specific humoral response was tested by enzyme-linked immunosorbent assay, neutralizing antibodies were evaluated by cell culture HCV neutralization assays, PBMC proliferation was assayed by carboxyfluorescein succinimidyl ester staining and IFN-γ secretion was assessed by enzyme-linked immunospot. Data on virological and histological response and their association with immune variables are also provided. RESULTS: From week 12 to week 48, all groups of patients showed a significant reduction in mean leukocyte counts. Statistically significant reductions in antibody titers were frequent, but only individuals immunized with CIGB-230 as early add-on treatment sustained the core-IgG response, and the neutralizing antibody response was enhanced only in patients receiving CIGB-230. Cell-mediated immune responses also tended to decline, but significant reductions in IFN-γ secretion and total absence of core-specific lymphoproliferation were exclusive of the control group. Only CIGB-230-immunized individuals showed de novo induced lymphoproliferative responses against the structural antigens. Importantly, it was demonstrated that the quality of the CIGB-230-induced immune response depended on the number of doses and timing of administration in relation to the antiviral therapy. Specifically, the administration of 6 doses of CIGB-230 as late add-on to therapy increased the neutralizing antibody activity and the de novo core-specific IFN-γ secretion, both of which were associated with the sustained virological response. CONCLUSION: CIGB-230, combined with IFN

  20. Atomic description of the immune complex involved in heparin-induced thrombocytopenia

    DOE PAGES

    Cai, Zheng; Yarovoi, Serge V.; Zhu, Zhiqiang; ...

    2015-09-22

    Heparin-induced thrombocytopenia (HIT) is an autoimmune thrombotic disorder caused by immune complexes containing platelet factor 4 (PF4), antibodies to PF4 and heparin or cellular glycosaminoglycans (GAGs). Here we solve the crystal structures of the: (1) PF4 tetramer/fondaparinux complex, (2) PF4 tetramer/KKO-Fab complex (a murine monoclonal HIT-like antibody) and (3) PF4 monomer/RTO-Fab complex (a non-HIT anti-PF4 monoclonal antibody). Fondaparinux binds to the ‘closed’ end of the PF4 tetramer and stabilizes its conformation. This interaction in turn stabilizes the epitope for KKO on the ‘open’ end of the tetramer. Fondaparinux and KKO thereby collaborate to ‘stabilize’ the ternary pathogenic immune complex. Bindingmore » of RTO to PF4 monomers prevents PF4 tetramerization and inhibits KKO and human HIT IgG-induced platelet activation and platelet aggregation in vitro, and thrombus progression in vivo. Lastly, the atomic structures provide a basis to develop new diagnostics and non-anticoagulant therapeutics for HIT.« less

  1. A Phase I Double Blind, Placebo-Controlled, Randomized Study of the Safety and Immunogenicity of an Adjuvanted HIV-1 Gag-Pol-Nef Fusion Protein and Adenovirus 35 Gag-RT-Int-Nef Vaccine in Healthy HIV-Uninfected African Adults

    PubMed Central

    Omosa-Manyonyi, Gloria; Mpendo, Juliet; Ruzagira, Eugene; Kilembe, William; Chomba, Elwyn; Roman, François; Bourguignon, Patricia; Koutsoukos, Marguerite; Collard, Alix; Voss, Gerald; Laufer, Dagna; Stevens, Gwynn; Hayes, Peter; Clark, Lorna; Cormier, Emmanuel; Dally, Len; Barin, Burc; Ackland, Jim; Syvertsen, Kristen; Zachariah, Devika; Anas, Kamaal; Sayeed, Eddy; Lombardo, Angela; Gilmour, Jill; Cox, Josephine; Fast, Patricia; Priddy, Frances

    2015-01-01

    Background Sequential prime-boost or co-administration of HIV vaccine candidates based on an adjuvanted clade B p24, RT, Nef, p17 fusion protein (F4/AS01) plus a non-replicating adenovirus 35 expressing clade A Gag, RT, Int and Nef (Ad35-GRIN) may lead to a unique immune profile, inducing both strong T-cell and antibody responses. Methods In a phase 1, double-blind, placebo-controlled trial, 146 healthy adult volunteers were randomized to one of four regimens: heterologous prime-boost with two doses of F4/AS01E or F4/AS01B followed by Ad35-GRIN; Ad35-GRIN followed by two doses of F4/AS01B; or three co-administrations of Ad35-GRIN and F4/AS01B. T cell and antibody responses were measured. Results The vaccines were generally well-tolerated, and did not cause serious adverse events. The response rate, by IFN-γ ELISPOT, was greater when Ad35-GRIN was the priming vaccine and in the co-administration groups. F4/AS01 induced CD4+ T-cells expressing primarily CD40L and IL2 +/- TNF-α, while Ad35-GRIN induced predominantly CD8+ T-cells expressing IFN-γ +/- IL2 or TNF-α. Viral inhibition was induced after Ad35-GRIN vaccination, regardless of the regimen. Strong F4-specific antibody responses were induced. Immune responses persisted at least a year after the last vaccination. The complementary response profiles, characteristic of each vaccine, were both expressed after co-administration. Conclusion Co-administration of an adjuvanted protein and an adenovirus vector showed an acceptable safety and reactogenicity profile and resulted in strong, multifunctional and complementary HIV-specific immune responses. Trial Registration ClinicalTrials.gov NCT01264445 PMID:25961283

  2. A heterologous prime-boosting strategy with replicating Vaccinia virus vectors and plant-produced HIV-1 Gag/dgp41 virus-like particles

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Meador, Lydia R.

    Showing modest efficacy, the RV144 HIV-1 vaccine clinical trial utilized a non-replicating canarypox viral vector and a soluble gp120 protein boost. Here we built upon the RV144 strategy by developing a novel combination of a replicating, but highly-attenuated Vaccinia virus vector, NYVAC-KC, and plant-produced HIV-1 virus-like particles (VLPs). Both components contained the full-length Gag and a membrane anchored truncated gp41 presenting the membrane proximal external region with its conserved broadly neutralizing epitopes in the pre-fusion conformation. We tested different prime/boost combinations of these components in mice and showed that the group primed with NYVAC-KC and boosted with both the viralmore » vectors and plant-produced VLPs have the most robust Gag-specific CD8 T cell responses, at 12.7% of CD8 T cells expressing IFN-γ in response to stimulation with five Gag epitopes. The same immunization group elicited the best systemic and mucosal antibody responses to Gag and dgp41 with a bias towards IgG1. - Highlights: • We devised a prime/boost anti HIV-1 vaccination strategy modeled after RV144. • We used plant-derived virus-like particles (VLPs) consisting of Gag and dgp41. • We used attenuated, replicating vaccinia virus vectors expressing the same antigens. • The immunogens elicited strong cellular and humoral immune responses.« less

  3. Isotype Diversification of IgG Antibodies to HIV Gag Proteins as a Therapeutic Vaccination Strategy for HIV Infection

    PubMed Central

    French, Martyn A.; Abudulai, Laila N.; Fernandez, Sonia

    2013-01-01

    The development of vaccines to treat and prevent human immunodeficiency virus (HIV) infection has been hampered by an incomplete understanding of “protective” immune responses against HIV. Natural control of HIV-1 infection is associated with T-cell responses against HIV-1 Gag proteins, particularly CD8+ T-cell responses restricted by “protective” HLA-B alleles, but other immune responses also contribute to immune control. These immune responses appear to include IgG antibodies to HIV-1 Gag proteins, interferon-α-dependant natural killer (NK) cell responses and plasmacytoid dendritic cell (pDC) responses. Here, it is proposed that isotype diversification of IgG antibodies against HIV-1 Gag proteins, to include IgG2, as well as IgG3 and IgG1 antibodies, will broaden the function of the antibody response and facilitate accessory cell responses against HIV-1 by NK cells and pDCs. We suggest that this should be investigated as a vaccination strategy for HIV-1 infection. PMID:26344116

  4. Isotype Diversification of IgG Antibodies to HIV Gag Proteins as a Therapeutic Vaccination Strategy for HIV Infection.

    PubMed

    French, Martyn A; Abudulai, Laila N; Fernandez, Sonia

    2013-08-09

    The development of vaccines to treat and prevent human immunodeficiency virus (HIV) infection has been hampered by an incomplete understanding of "protective" immune responses against HIV. Natural control of HIV-1 infection is associated with T-cell responses against HIV-1 Gag proteins, particularly CD8⁺ T-cell responses restricted by "protective" HLA-B alleles, but other immune responses also contribute to immune control. These immune responses appear to include IgG antibodies to HIV-1 Gag proteins, interferon-a-dependant natural killer (NK) cell responses and plasmacytoid dendritic cell (pDC) responses. Here, it is proposed that isotype diversification of IgG antibodies against HIV-1 Gag proteins, to include IgG2, as well as IgG3 and IgG1 antibodies, will broaden the function of the antibody response and facilitate accessory cell responses against HIV-1 by NK cells and pDCs. We suggest that this should be investigated as a vaccination strategy for HIV-1 infection.

  5. Gag-Positive Reservoir Cells Are Susceptible to HIV-Specific Cytotoxic T Lymphocyte Mediated Clearance In Vitro and Can Be Detected In Vivo

    PubMed Central

    Graf, Erin H.; Pace, Matthew J.; Peterson, Bennett A.; Lynch, Lindsay J.; Chukwulebe, Steve B.; Mexas, Angela M.; Shaheen, Farida; Martin, Jeffrey N.; Deeks, Steven G.; Connors, Mark; Migueles, Stephen A.; O’Doherty, Una

    2013-01-01

    Resting CD4+ T cells infected with HIV persist in the presence of suppressive anti-viral therapy (ART) and are barriers to a cure. One potential curative approach, therapeutic vaccination, is fueled by recognition of the ability of a subset of elite controllers (EC) to control virus without therapy due to robust anti-HIV immune responses. Controllers have low levels of integrated HIV DNA and low levels of replication competent virus, suggesting a small reservoir. As our recent data indicates some reservoir cells can produce HIV proteins (termed GPR cells for Gag-positive reservoir cells), we hypothesized that a fraction of HIV-expressing resting CD4+ T cells could be efficiently targeted and cleared in individuals who control HIV via anti-HIV cytotoxic T lymphocytes (CTL). To test this we examined if superinfected resting CD4+ T cells from EC express HIV Gag without producing infectious virus and the susceptibility of these cells to CTL. We found that resting CD4+ T cells expressed HIV Gag and were cleared by autologous CD8+ T cells from EC. Importantly, we found the extent of CTL clearance in our in vitro assay correlates with in vivo reservoir size and that a population of Gag expressing resting CD4+ T cells exists in vivo in patients well controlled on therapy. PMID:23951263

  6. Viral load and clinical disease enhancement associated with a lentivirus cytotoxic T lymphocyte vaccine regimen

    PubMed Central

    Mealey, Robert H.; Leib, Steven R.; Littke, Matt H.; Wagner, Bettina; Horohov, David W.; McGuire, Travis C.

    2009-01-01

    Effective DNA-based vaccines against lentiviruses will likely induce CTL against conserved viral proteins. Equine infectious anemia virus (EIAV) infects horses worldwide, and serves as a useful model for lentiviral immune control. Although attenuated live EIAV vaccines have induced protective immune responses, DNA-based vaccines have not. In particular, DNA-based vaccines have had limited success in inducing CTL responses against intracellular pathogens in the horse. We hypothesized that priming with a codon-optimized plasmid encoding EIAV Gag p15/p26 with co-administration of a plasmid encoding an equine IL-2/IgG fusion protein as a molecular adjuvant, followed by boosting with a vaccinia vector expressing Gag p15/p26, would induce protective Gag-specific CTL responses. Although the regimen induced Gag-specific CTL in four of seven vaccinated horses, CTL were not detected until after the vaccinia boost, and protective effects were not observed in EIAV challenged vaccinates. Unexpectedly, vaccinates had significantly higher viral loads and more severe clinical disease, associated with the presence of vaccine-induced CTL. It was concluded that 1.) further optimization of the timing and route of DNA immunization was needed for efficient CTL priming in vivo, 2.) co-administration of the IL-2/IgG plasmid did not enhance CTL priming by the Gag p15/p26 plasmid, 3.) vaccinia vectors are useful for lentivirus-specific CTL induction in the horse, 4.) Gag-specific CTL alone are either insufficient or a more robust Gag-specific CTL response is needed to limit EIAV viremia and clinical disease, and 5.) CTL-inducing vaccines lacking envelope immunogens can result in lentiviral disease enhancement. Although the mechanisms for enhancement associated with this vaccine regimen remain to be elucidated, these results have important implications for development of lentivirus T cell vaccines. PMID:19368787

  7. Microwave ablation combined with OK-432 induces Th1-type response and specific antitumor immunity in a murine model of breast cancer.

    PubMed

    Li, Li; Wang, Wei; Pan, Hong; Ma, Ge; Shi, Xinyi; Xie, Hui; Liu, Xiaoan; Ding, Qiang; Zhou, Wenbin; Wang, Shui

    2017-01-31

    Minimally invasive therapies, such as microwave ablation (MWA), are widely used for the treatment of solid tumors. Previous studies suggest that MWA is feasible for the treatment of small breast cancer, and thermal ablation may induce adaptive antitumor immunity. However, the induced immune responses are mostly weak, and the immunomodulation effects of MWA in breast cancer are unclear. Immunostimulant OK-432 can induce tumor-specific T-cell responses and may augment the immunity induced by MWA. We treated 4T1 breast cancer bearing BALB/c mice with MWA, OK-432, MWA plus OK-432, or left without treatment. Survival time was evaluated with the Kaplan-Meyer method comparing survival curves by log-rank test. On day 25 after ablation, surviving mice received tumor rechallenge, and the rechallenged tumor volumes were calculated every 5 days. Immunohistochemistry and flow cytometry were used to evaluate the T-cell immune responses in ablated tissues and spleens. The tumor-specific immunity was assessed by enzyme-linked immunospot assays. Besides, the cytokine patterns were identified from enzyme-linked immunosorbent assay. Microwave ablation plus OK-432 resulted in longer survival than single treatment and protect most surviving mice from tumor rechallenge. Both local and systemic T-cell responses were induced by MWA and were further enhanced by subsequent administration of OK-432. Moreover, the combination of MWA and OK-432 induced stronger tumor-specific immune responses than MWA alone. In addition, OK-432 and MWA synergistically promoted the production of Th1-type but not Th2-type cytokines, and polarized T-cell responses to Th1-dominant state. The T-cell immune responses were activated by MWA in breast cancer. Furthermore, the combination of MWA and OK-432 induced Th1-type response and elicited specific antitumor immunity.

  8. Comparative Analysis of the Magnitude, Quality, Phenotype and Protective Capacity of SIV Gag-Specific CD8+ T Cells Following Human-, Simian- and Chimpanzee-Derived Recombinant Adenoviral Vector Immunisation

    PubMed Central

    Quinn, Kylie M.; Costa, Andreia Da; Yamamoto, Ayako; Berry, Dana; Lindsay, Ross W.B.; Darrah, Patricia A.; Wang, Lingshu; Cheng, Cheng; Kong, Wing-Pui; Gall, Jason G.D.; Nicosia, Alfredo; Folgori, Antonella; Colloca, Stefano; Cortese, Riccardo; Gostick, Emma; Price, David A.; Gomez, Carmen E.; Esteban, Mariano; Wyatt, Linda S.; Moss, Bernard; Morgan, Cecilia; Roederer, Mario; Bailer, Robert T.; Nabel, Gary J.; Koup, Richard A.; Seder, Robert A.

    2013-01-01

    Recombinant adenoviral vectors (rAds) are the most potent recombinant vaccines for eliciting CD8+ T cell-mediated immunity in humans; however, prior exposure from natural adenoviral infection can decrease such responses. Here we show low seroreactivity in humans against simian- (sAd11, sAd16), or chimpanzee-derived (chAd3, chAd63) compared to human-derived (rAd5, rAd28, rAd35) vectors across multiple geographic regions. We then compared the magnitude, quality, phenotype and protective capacity of CD8+ T cell responses in mice vaccinated with rAds encoding SIV Gag. Using a dose range (1 × 107 to 109 PU), we defined a hierarchy among rAd vectors based on the magnitude and protective capacity of CD8+ T cell responses, from most to least as: rAd5 and chAd3, rAd28 and sAd11, chAd63, sAd16, and rAd35. Selection of rAd vector or dose could modulate the proportion and/or frequency of IFNγ+TNFα+IL-2+ and KLRG1+CD127- CD8+ T cells, but strikingly ~30–80% of memory CD8+ T cells co-expressed CD127 and KLRG1. To further optimise CD8+ T cell responses, we assessed rAds as part of prime-boost regimens. Mice primed with rAds and boosted with NYVAC generated Gag-specific responses that approached ~60% of total CD8+ T cells at peak. Alternatively, priming with DNA or rAd28 and boosting with rAd5 or chAd3 induced robust and equivalent CD8+ T cell responses compared to prime or boost alone. Collectively, these data provide the immunologic basis for using specific rAd vectors alone or as part of prime-boost regimens to induce CD8+ T cells for rapid effector function or robust long-term memory, respectively. PMID:23390298

  9. Solution Properties of Murine Leukemia Virus Gag Protein: Differences from HIV-1 Gag

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Datta, Siddhartha A.K.; Zuo, Xiaobing; Clark, Patrick K.

    2012-05-09

    Immature retrovirus particles are assembled from the multidomain Gag protein. In these particles, the Gag proteins are arranged radially as elongated rods. We have previously characterized the properties of HIV-1 Gag in solution. In the absence of nucleic acid, HIV-1 Gag displays moderately weak interprotein interactions, existing in monomer-dimer equilibrium. Neutron scattering and hydrodynamic studies suggest that the protein is compact, and biochemical studies indicate that the two ends can approach close in three-dimensional space, implying the need for a significant conformational change during assembly. We now describe the properties of the Gag protein of Moloney murine leukemia virus (MLV),more » a gammaretrovirus. We found that this protein is very different from HIV-1 Gag: it has much weaker protein-protein interaction and is predominantly monomeric in solution. This has allowed us to study the protein by small-angle X-ray scattering and to build a low-resolution molecular envelope for the protein. We found that MLV Gag is extended in solution, with an axial ratio of {approx}7, comparable to its dimensions in immature particles. Mutational analysis suggests that runs of prolines in its matrix and p12 domains and the highly charged stretch at the C terminus of its capsid domain all contribute to this extended conformation. These differences between MLV Gag and HIV-1 Gag and their implications for retroviral assembly are discussed.« less

  10. Live-Attenuated Lentivirus Immunization Modulates Innate Immunity and Inflammation while Protecting Rhesus Macaques from Vaginal Simian Immunodeficiency Virus Challenge

    PubMed Central

    Genescà, Meritxell; Ma, Zhong-Min; Wang, Yichuan; Assaf, Basel; Qureshi, Huma; Fritts, Linda; Huang, Ying; McChesney, Michael B.

    2012-01-01

    Immunization with attenuated lentiviruses is the only reliable method of protecting rhesus macaques (RM) from vaginal challenge with pathogenic simian immunodeficiency virus (SIV). CD8+ lymphocyte depletion prior to SIVmac239 vaginal challenge demonstrated that a modest, Gag-specific CD8+ T cell response induced by immunization with simian-human immunodeficiency virus 89.6 (SHIV89.6) protects RM. Although CD8+ T cells are required for protection, there is no anamnestic expansion of SIV-specific CD8+ T cells in any tissues except the vagina after challenge. Further, SHIV immunization increased the number of viral target cells in the vagina and cervix, suggesting that the ratio of target cells to antiviral CD8+ T cells was not a determinant of protection. We hypothesized that persistent replication of the attenuated vaccine virus modulates inflammatory responses and limits T cell activation and expansion by inducing immunoregulatory T cell populations. We found that attenuated SHIV infection decreased the number of circulating plasmacytoid dendritic cells, suppressed T cell activation, decreased mRNA levels of proinflammatory mediators, and increased mRNA levels of immunoregulatory molecules. Three days after SIV vaginal challenge, SHIV-immunized RM had significantly more T regulatory cells in the vagina than the unimmunized RM. By day 14 postchallenge, immune activation and inflammation were characteristic of unimmunized RM but were minimal in SHIV-immunized RM. Thus, a modest vaccine-induced CD8+ T cell response in the context of immunoregulatory suppression of T cell activation may protect against vaginal HIV transmission. PMID:22696662

  11. Vaccination with a feline immunodeficiency virus multiepitopic peptide induces cell-mediated and humoral immune responses in cats, but does not confer protection.

    PubMed Central

    Flynn, J N; Cannon, C A; Neil, J C; Jarrett, O

    1997-01-01

    Cats were immunized with a 46-residue multiepitopic synthetic peptide of feline immunodeficiency virus (FIV) comprising immunodominant epitopes present in the third variable domain of the envelope glycoprotein, transmembrane glycoprotein (TM), and p24 Gag core protein, using Quil A as an adjuvant. All vaccinated cats developed a humoral response which recognized the synthetic peptide immunogen and the intact viral core and envelope proteins. A FIV Gag- and Env-specific effector cytotoxic T-lymphocyte response was also detected in the peripheral blood of vaccinated cats, which peaked at week 30. This response appeared to be major histocompatibility complex restricted. Epitope mapping studies revealed that both the cellular and humoral immune responses were directed principally to a peptide within the TM glycoprotein, CNQNQFFCK. However, vaccination did not confer protection when cats were challenged with the Petaluma isolate of FIV at week 35. PMID:9311839

  12. Roles of Gag-RNA interactions in HIV-1 virus assembly deciphered by single-molecule localization microscopy.

    PubMed

    Yang, Yantao; Qu, Na; Tan, Jie; Rushdi, Muaz N; Krueger, Christopher J; Chen, Antony K

    2018-06-11

    During HIV-1 assembly, the retroviral structural protein Gag forms an immature capsid, containing thousands of Gag molecules, at the plasma membrane (PM). Interactions between Gag nucleocapsid (NC) and viral RNA (vRNA) are thought to drive assembly, but the exact roles of these interactions have remained poorly understood. Since previous studies have shown that Gag dimer- or trimer-forming mutants (Gag ZiL ) lacking an NC domain can form immature capsids independent of RNA binding, it is often hypothesized that vRNA drives Gag assembly by inducing Gag to form low-ordered multimers, but is dispensable for subsequent assembly. In this study, we examined the role of vRNA in HIV-1 assembly by characterizing the distribution and mobility of Gag and Gag NC mutants at the PM using photoactivated localization microscopy (PALM) and single-particle tracking PALM (spt-PALM). We showed that both Gag and Gag ZiL assembly involve a similar basic assembly unit, as expected. Unexpectedly, the two proteins underwent different subsequent assembly pathways, with Gag cluster density increasing asymptotically, while Gag ZiL cluster density increased linearly. Additionally, the directed movement of Gag, but not Gag ZiL , was maintained at a constant speed, suggesting that the two proteins experience different external driving forces. Assembly was abolished when Gag was rendered monomeric by NC deletion. Collectively, these results suggest that, beyond inducing Gag to form low-ordered multimer basic assembly units, vRNA is essential in scaffolding and maintaining the stability of the subsequent assembly process. This finding should advance the current understanding of HIV-1 and, potentially, other retroviruses. Copyright © 2018 the Author(s). Published by PNAS.

  13. Mechanism study of tumor-specific immune responses induced by laser immunotherapy

    NASA Astrophysics Data System (ADS)

    Li, Xiaosong; Zhou, Feifan; Le, Henry; Wolf, Roman F.; Howard, Eric; Nordquist, Robert E.; Hode, Tomas; Liu, Hong; Chen, Wei R.

    2011-03-01

    Laser immunotherapy (LIT) has shown its efficacy against late-stage, metastatic cancers, both in pre-clinical studies and clinical pilot trials. However, the possible mechanism of LIT is still not fully understood. In our previous studies, we have shown that LIT induces tumor-specific antibodies that strongly bind to the target tumors. Tumor resistance in cured animals demonstrated long-term immunological effect of LIT. Successful transfer of adoptive immunity using spleen cells from LIT-cured animals indicated a long-term immunological memory of the host system. In clinical trials for the treatment of late-stage melanoma patients and breast cancer patients, the similar long-term, systemic effects have also been observed. To further study the immunological mechanism of LIT, immuno-histochemical analysis of patient tumor samples has performed before and after LIT treatment. Our results showed strong evidence that LIT significantly increases the infiltration of immune cells in the target tumors. Specifically, LIT appeared to drive the infiltrating immune cell populations in the direction of CD4, CD8 and CD68 T-cells. It is possible that activation and enhancement of both humeral and cellular arms of the host immune system are achievable by the treatment of LIT. These special features of LIT have contributed to the success of patient treatment. The underlying mechanism of LIT appears to be an in-situ autologous whole-cell cancer vaccination, using all components of tumors as sources of tumor antigens. Our preliminary mechanistic studies and future in-depth studies will contribute to the understanding and development of LIT as an effective modality for the treatment of late stage cancer patients who are facing severely limited options.

  14. Improved motor performance in Dyt1 ΔGAG heterozygous knock-in mice by cerebellar Purkinje-cell specific Dyt1 conditional knocking-out.

    PubMed

    Yokoi, Fumiaki; Dang, Mai Tu; Li, Yuqing

    2012-05-01

    Early-onset generalized torsion dystonia (dystonia 1) is an inherited movement disorder caused by mutations in DYT1 (TOR1A), which codes for torsinA. Most patients have a 3-base pair deletion (ΔGAG) in one allele of DYT1, corresponding to a loss of a glutamic acid residue (ΔE) in the C-terminal region of the protein. Functional alterations in basal ganglia circuits and the cerebellum have been reported in dystonia. Pharmacological manipulations or mutations in genes that result in functional alterations of the cerebellum have been reported to have dystonic symptoms and have been used as phenotypic rodent models. Additionally, structural lesions in the abnormal cerebellar circuits, such as cerebellectomy, have therapeutic effects in these models. A previous study has shown that the Dyt1 ΔGAG heterozygous knock-in (KI) mice exhibit motor deficits in the beam-walking test. Both Dyt1 ΔGAG heterozygous knock-in (KI) and Dyt1 Purkinje cell-specific knockout (Dyt1 pKO) mice exhibit dendritic alterations of cerebellar Purkinje cells. Here, Dyt1 pKO mice exhibited significantly less slip numbers in the beam-walking test, suggesting better motor performance than control littermates, and normal gait. Furthermore, Dyt1 ΔGAG KI/Dyt1 pKO double mutant mice exhibited significantly lower numbers of slips than Dyt1 ΔGAG heterozygous KI mice, suggesting Purkinje-cell specific knockout of Dyt1 wild-type (WT) allele in Dyt1 ΔGAG heterozygous KI mice rescued the motor deficits. The results suggest that molecular lesions of torsinA in Purkinje cells by gene therapy or intervening in the signaling pathway downstream of the cerebellar Purkinje cells may rescue motor symptoms in dystonia 1. Copyright © 2012 Elsevier B.V. All rights reserved.

  15. Improved motor performance in Dyt1 ΔGAG heterozygous knock-in mice by cerebellar Purkinje-cell specific Dyt1 conditional knocking-out

    PubMed Central

    Yokoi, Fumiaki; Dang, Mai Tu; Li, Yuqing

    2012-01-01

    Early-onset generalized torsion dystonia (dystonia 1) is an inherited movement disorder caused by mutations in DYT1 (TOR1A), which codes for torsinA. Most patients have a 3-base pair deletion (ΔGAG) in one allele of DYT1, corresponding to a loss of a glutamic acid residue (ΔE) in the C-terminal region of the protein. Functional alterations in basal ganglia circuits and the cerebellum have been reported in dystonia. Pharmacological manipulations or mutations in genes that result in functional alterations of the cerebellum have been reported to have dystonic symptoms and have been used as phenotypic rodent models. Additionally, structural lesions in the abnormal cerebellar circuits, such as cerebellectomy, have therapeutic effects in these models. A previous study has shown that the Dyt1 ΔGAG heterozygous knock-in (KI) mice exhibit motor deficits in the beam-walking test. Both Dyt1 ΔGAG heterozygous knock-in (KI) and Dyt1 Purkinje cell-specific knockout (Dyt1 pKO) mice exhibit dendritic alterations of cerebellar Purkinje cells. Here, Dyt1 pKO mice exhibited significantly less slip numbers in the beam-walking test, suggesting better motor performance than control littermates, and normal gait. Furthermore, Dyt1 ΔGAG KI/Dyt1 pKO double mutant mice exhibited significantly lower numbers of slips than Dyt1 ΔGAG heterozygous KI mice, suggesting Purkinje-cell specific knockout of Dyt1 wild-type (WT) allele in Dyt1 ΔGAG heterozygous KI mice rescued the motor deficits. The results suggest that molecular lesions of torsinA in Purkinje cells by gene therapy or intervening in the signaling pathway downstream of the cerebellar Purkinje cells may rescue motor symptoms in dystonia 1. PMID:22391119

  16. Human endogenous retrovirus K Gag coassembles with HIV-1 Gag and reduces the release efficiency and infectivity of HIV-1.

    PubMed

    Monde, Kazuaki; Contreras-Galindo, Rafael; Kaplan, Mark H; Markovitz, David M; Ono, Akira

    2012-10-01

    Human endogenous retroviruses (HERVs), which are remnants of ancestral retroviruses integrated into the human genome, are defective in viral replication. Because activation of HERV-K and coexpression of this virus with HIV-1 have been observed during HIV-1 infection, it is conceivable that HERV-K could affect HIV-1 replication, either by competition or by cooperation, in cells expressing both viruses. In this study, we found that the release efficiency of HIV-1 Gag was 3-fold reduced upon overexpression of HERV-K(CON) Gag. In addition, we observed that in cells expressing Gag proteins of both viruses, HERV-K(CON) Gag colocalized with HIV-1 Gag at the plasma membrane. Furthermore, HERV-K(CON) Gag was found to coassemble with HIV-1 Gag, as demonstrated by (i) processing of HERV-K(CON) Gag by HIV-1 protease in virions, (ii) coimmunoprecipitation of virion-associated HERV-K(CON) Gag with HIV-1 Gag, and (iii) rescue of a late-domain-defective HERV-K(CON) Gag by wild-type (WT) HIV-1 Gag. Myristylation-deficient HERV-K(CON) Gag localized to nuclei, suggesting cryptic nuclear trafficking of HERV-K Gag. Notably, unlike WT HERV-K(CON) Gag, HIV-1 Gag failed to rescue myristylation-deficient HERV-K(CON) Gag to the plasma membrane. Efficient colocalization and coassembly of HIV-1 Gag and HERV-K Gag also required nucleocapsid (NC). These results provide evidence that HIV-1 Gag heteromultimerizes with HERV-K Gag at the plasma membrane, presumably through NC-RNA interaction. Intriguingly, HERV-K Gag overexpression reduced not only HIV-1 release efficiency but also HIV-1 infectivity in a myristylation- and NC-dependent manner. Altogether, these results indicate that Gag proteins of endogenous retroviruses can coassemble with HIV-1 Gag and modulate the late phase of HIV-1 replication.

  17. An Essential Role of INI1/hSNF5 Chromatin Remodeling Protein in HIV-1 Posttranscriptional Events and Gag/Gag-Pol Stability

    PubMed Central

    La Porte, Annalena; Cano, Jennifer; Wu, Xuhong; Mitra, Doyel

    2016-01-01

    ABSTRACT INI1/hSNF5/SMARCB1/BAF47 is an HIV-specific integrase (IN)-binding protein that influences HIV-1 transcription and particle production. INI1 binds to SAP18 (Sin3a-associated protein, 18 kDa), and both INI1 and SAP18 are incorporated into HIV-1 virions. To determine the significance of INI1 and the INI1-SAP18 interaction during HIV-1 replication, we isolated a panel of SAP18-interaction-defective (SID)-INI1 mutants using a yeast reverse two-hybrid screen. The SID-INI1 mutants, which retained the ability to bind to IN, cMYC, and INI1 but were impaired for binding to SAP18, were tested for their effects on HIV-1 particle production. SID-INI1 dramatically reduced the intracellular Gag/Gag-Pol protein levels and, in addition, decreased viral particle production. The SID-INI1-mediated effects were less dramatic in trans complementation assays using IN deletion mutant viruses with Vpr-reverse transcriptase (RT)-IN. SID-INI1 did not inhibit long-terminal-repeat (LTR)-mediated transcription, but it marginally decreased the steady-state gag RNA levels, suggesting a posttranscriptional effect. Pulse-chase analysis indicated that in SID-INI1-expressing cells, the pr55Gag levels decreased rapidly. RNA interference analysis indicated that small hairpin RNA (shRNA)-mediated knockdown of INI1 reduced the intracellular Gag/Gag-Pol levels and further inhibited HIV-1 particle production. These results suggest that SID-INI1 mutants inhibit multiple stages of posttranscriptional events of HIV-1 replication, including intracellular Gag/Gag-Pol RNA and protein levels, which in turn inhibits assembly and particle production. Interfering INI1 leads to a decrease in particle production and Gag/Gag-Pol protein levels. Understanding the role of INI1 and SAP18 in HIV-1 replication is likely to provide novel insight into the stability of Gag/Gag-Pol, which may lead to the development of novel therapeutic strategies to inhibit HIV-1 late events. IMPORTANCE Significant gaps exist in our

  18. The Greek version of the Gagging Assessment Scale in children and adolescents: psychometric properties, prevalence of gagging, and the association between gagging and dental fear.

    PubMed

    Katsouda, Maria; Provatenou, Efthymia; Arapostathis, Konstantinos; Coolidge, Trilby; Kotsanos, Nikolaos

    2017-03-01

    No studies assessing the association between gagging and dental fear are available in pediatric samples. To assess the psychometric properties of the Greek version of the Gagging Assessment Scale (GAS), to explore the prevalence of gagging, and to evaluate the relationship between gagging and dental fear in a pediatric sample. A total of 849 8- and 14-year-old children filled out a questionnaire consisting of demographic items, the Greek version of the GAS, and the Greek Children's Fear Survey Schedule Dental Subscale (CFSS-DS); the older children also completed the Greek version of the Modified Dental Anxiety Scale (MDAS). The short form of dentist part of the Gagging Problem Assessment (GPA-de-c/SF) was used to objectively assess gagging. A total of 51 children (6.0%) demonstrated gagging on the GPA-de-c/SF. Children rated as gaggers on the GPA-de-c/SF had significantly higher GAS scores. There were no relationships between GPA-de-c/SF and the CFSS-DS or MDAS. The GAS ratings were significantly correlated with the CFSS-DS (rho = 0.420, P < 0.001) and MDAS (rho = 0.429, P < 0.001). The internal consistency was good (Cronbach's alpha = 0.697). The GAS demonstrated good psychometric properties. Dental fear was correlated with the self-report gagging assessment, but not with the objective gagging assessment. © 2016 BSPD, IAPD and John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  19. Heparin (GAG-hed) inhibits LCR activity of human papillomavirus type 18 by decreasing AP1 binding.

    PubMed

    Villanueva, Rita; Morales-Peza, Néstor; Castelán-Sánchez, Irma; García-Villa, Enrique; Tapia, Rocio; Cid-Arregui, Angel; García-Carrancá, Alejandro; López-Bayghen, Esther; Gariglio, Patricio

    2006-08-31

    High risk HPVs are causative agents of anogenital cancers. Viral E6 and E7 genes are continuously expressed and are largely responsible for the oncogenic activity of these viruses. Transcription of the E6 and E7 genes is controlled by the viral Long Control Region (LCR), plus several cellular transcription factors including AP1 and the viral protein E2. Within the LCR, the binding and activity of the transcription factor AP1 represents a key regulatory event in maintaining E6/E7 gene expression and uncontrolled cell proliferation. Glycosaminoglycans (GAGs), such as heparin, can inhibit tumour growth; they have also shown antiviral effects and inhibition of AP1 transcriptional activity. The purpose of this study was to test the heparinoid GAG-hed, as a possible antiviral and antitumoral agent in an HPV18 positive HeLa cell line. Using in vivo and in vitro approaches we tested GAG-hed effects on HeLa tumour cell growth, cell proliferation and on the expression of HPV18 E6/E7 oncogenes. GAG-hed effects on AP1 binding to HPV18-LCR-DNA were tested by EMSA. We were able to record the antitumoral effect of GAG-hed in vivo by using as a model tumours induced by injection of HeLa cells into athymic female mice. The antiviral effect of GAG-hed resulted in the inhibition of LCR activity and, consequently, the inhibition of E6 and E7 transcription. A specific diminishing of cell proliferation rates was observed in HeLa but not in HPV-free colorectal adenocarcinoma cells. Treated HeLa cells did not undergo apoptosis but the percentage of cells in G2/M phase of the cell cycle was increased. We also detected that GAG-hed prevents the binding of the transcription factor AP1 to the LCR. Direct interaction of GAG-hed with the components of the AP1 complex and subsequent interference with its ability to correctly bind specific sites within the viral LCR may contribute to the inhibition of E6/E7 transcription and cell proliferation. Our data suggest that GAG-hed could have antitumoral

  20. Altered Gag Polyprotein Cleavage Specificity of Feline Immunodeficiency Virus/Human Immunodeficiency Virus Mutant Proteases as Demonstrated in a Cell-Based Expression System

    PubMed Central

    Lin, Ying-Chuan; Brik, Ashraf; de Parseval, Aymeric; Tam, Karen; Torbett, Bruce E.; Wong, Chi-Huey; Elder, John H.

    2006-01-01

    We have used feline immunodeficiency virus (FIV) protease (PR) as a mutational system to study the molecular basis of substrate-inhibitor specificity for lentivirus PRs, with a focus on human immunodeficiency virus type 1 (HIV-1) PR. Our previous mutagenesis studies demonstrated that discrete substitutions in the active site of FIV PR with structurally equivalent residues of HIV-1 PR dramatically altered the specificity of the mutant PRs in in vitro analyses. Here, we have expanded these studies to analyze the specificity changes in each mutant FIV PR expressed in the context of the natural Gag-Pol polyprotein ex vivo. Expression mutants were prepared in which 4 to 12 HIV-1-equivalent substitutions were made in FIV PR, and cleavage of each Gag-Pol polyprotein was then assessed in pseudovirions from transduced cells. The findings demonstrated that, as with in vitro analyses, inhibitor specificities of the mutants showed increased HIV-1 PR character when analyzed against the natural substrate. In addition, all of the mutant PRs still processed the FIV polyprotein but the apparent order of processing was altered relative to that observed with wild-type FIV PR. Given the importance of the order in which Gag-Pol is processed, these findings likely explain the failure to produce infectious FIVs bearing these mutations. PMID:16873240

  1. Chimeric epitope vaccine against Leptospira interrogans infection and induced specific immunity in guinea pigs.

    PubMed

    Lin, Xu'ai; Xiao, Guohui; Luo, Dongjiao; Kong, Liangliang; Chen, Xu; Sun, Dexter; Yan, Jie

    2016-10-14

    Leptospirosis is an important reemerging zoonosis, with more than half a million cases reported annually, and is caused by pathogenic Leptospira species. Development of a universal vaccine is one of the major strategic goals to overcome the disease burden of leptospirosis. In this study, a chimeric multi-epitope protein-based vaccine was designed and tested for its potency to induce a specific immune response and provide protection against L. interrogans infection. The protein, containing four repeats of six T- and B-cell combined epitopes from the leptospiral outer membrane proteins, OmpL1, LipL32 and LipL21, was expressed and purified. Western blot analysis showed that the recombinant protein (named r4R) mainly expressed in a soluble pattern, and reacted with antibodies raised in rabbit against heat-killed Leptospira and in guinea pigs against the r4R vaccine. Microscopic agglutination tests showed that r4R antisera was immunological cross-reactive with a range of Chinese standard reference strains of Leptospira belonging to different serogroups. In guinea pigs, the r4R vaccine induced a Th1-biased immune response, as reflected by the IgG2a/IgG1 ratio and cytokine production of stimulated splenocytes derived from immunized animals. Finally, r4R-immunized guinea pigs showed increased survival of lethal Leptospira challenges compared with PBS-immunized animals and tissue damage and leptospiral colonization of the kidney were reduced. The multi-epitope chimeric r4R protein is a promising antigen for the development of a universal cross-reactive vaccine against leptospirosis.

  2. ML1419c peptide immunization induces Mycobacterium leprae-specific HLA-A*0201-restricted CTL in vivo with potential to kill live mycobacteria.

    PubMed

    Geluk, Annemieke; van den Eeden, Susan J F; Dijkman, Karin; Wilson, Louis; Kim, Hee Jin; Franken, Kees L M C; Spencer, John S; Pessolani, Maria C V; Pereira, Geraldo M B; Ottenhoff, Tom H M

    2011-08-01

    MHC class I-restricted CD8(+) T cells play an important role in protective immunity against mycobacteria. Previously, we showed that p113-121, derived from Mycobacterium leprae protein ML1419c, induced significant IFN-γ production by CD8(+) T cells in 90% of paucibacillary leprosy patients and in 80% of multibacillary patients' contacts, demonstrating induction of M. leprae-specific CD8(+) T cell immunity. In this work, we studied the in vivo role and functional profile of ML1419c p113-121-induced T cells in HLA-A*0201 transgenic mice. Immunization with 9mer or 30mer covering the p113-121 sequence combined with TLR9 agonist CpG induced HLA-A*0201-restricted, M. leprae-specific CD8(+) T cells as visualized by p113-121/HLA-A*0201 tetramers. Most CD8(+) T cells produced IFN-γ, but distinct IFN-γ(+)/TNF-α(+) populations were detected simultaneously with significant secretion of CXCL10/IFN-γ-induced protein 10, CXCL9/MIG, and VEGF. Strikingly, peptide immunization also induced high ML1419c-specific IgG levels, strongly suggesting that peptide-specific CD8(+) T cells provide help to B cells in vivo, as CD4(+) T cells were undetectable. An additional important characteristic of p113-121-specific CD8(+) T cells was their capacity for in vivo killing of p113-121-labeled, HLA-A*0201(+) splenocytes. The cytotoxic function of p113-121/HLA-A*0201-specific CD8(+) T cells extended into direct killing of splenocytes infected with live Mycobacterium smegmatis expressing ML1419c: both 9mer and 30mer induced CD8(+) T cells that reduced the number of ML1419c-expressing mycobacteria by 95%, whereas no reduction occurred using wild-type M. smegmatis. These data, combined with previous observations in Brazilian cohorts, show that ML1419c p113-121 induces potent CD8(+) T cells that provide protective immunity against M. leprae and B cell help for induction of specific IgG, suggesting its potential use in diagnostics and as a subunit (vaccine) for M. leprae infection.

  3. Induced antiviral innate immunity in Drosophila.

    PubMed

    Lamiable, Olivier; Imler, Jean-Luc

    2014-08-01

    Immunity to viral infections in the model organism Drosophila melanogaster involves both RNA interference and additional induced responses. The latter include not only cellular mechanisms such as programmed cell death and autophagy, but also the induction of a large set of genes, some of which contribute to the control of viral replication and resistance to infection. This induced response to infection is complex and involves both virus-specific and cell-type specific mechanisms. We review here recent developments, from the sensing of viral infection to the induction of signaling pathways and production of antiviral effector molecules. Our current understanding, although still partial, validates the Drosophila model of antiviral induced immunity for insect pests and disease vectors, as well as for mammals. Copyright © 2014 Elsevier Ltd. All rights reserved.

  4. Nucleotide sequence of the gag gene and gag-pol junction of feline leukemia virus.

    PubMed Central

    Laprevotte, I; Hampe, A; Sherr, C J; Galibert, F

    1984-01-01

    The nucleotide sequence of the gag gene of feline leukemia virus and its flanking sequences were determined and compared with the corresponding sequences of two strains of feline sarcoma virus and with that of the Moloney strain of murine leukemia virus. A high degree of nucleotide sequence homology between the feline leukemia virus and murine leukemia virus gag genes was observed, suggesting that retroviruses of domestic cats and laboratory mice have a common, proximal evolutionary progenitor. The predicted structure of the complete feline leukemia virus gag gene precursor suggests that the translation of nonglycosylated and glycosylated gag gene polypeptides is initiated at two different AUG codons. These initiator codons fall in the same reading frame and are separated by a 222-base-pair segment which encodes an amino terminal signal peptide. The nucleotide sequence predicts the order of amino acids in each of the individual gag-coded proteins (p15, p12, p30, p10), all of which derive from the gag gene precursor. Stable stem-and-loop secondary structures are proposed for two regions of viral RNA. The first falls within sequences at the 5' end of the viral genome, together with adjacent palindromic sequences which may play a role in dimer linkage of RNA subunits. The second includes coding sequences at the gag-pol junction and is proposed to be involved in translation of the pol gene product. Sequence analysis of the latter region shows that the gag and pol genes are translated in different reading frames. Classical consensus splice donor and acceptor sequences could not be localized to regions which would permit synthesis of the expected gag-pol precursor protein. Alternatively, we suggest that the pol gene product (RNA-dependent DNA polymerase) could be translated by a frameshift suppressing mechanism which could involve cleavage modification of stems and loops in a manner similar to that observed in tRNA processing. PMID:6328019

  5. Antiviral activity of recombinant ankyrin targeted to the capsid domain of HIV-1 Gag polyprotein

    PubMed Central

    2012-01-01

    Background Ankyrins are cellular mediators of a number of essential protein-protein interactions. Unlike intrabodies, ankyrins are composed of highly structured repeat modules characterized by disulfide bridge-independent folding. Artificial ankyrin molecules, designed to target viral components, might act as intracellular antiviral agents and contribute to the cellular immunity against viral pathogens such as HIV-1. Results A phage-displayed library of artificial ankyrins was constructed, and screened on a polyprotein made of the fused matrix and capsid domains (MA-CA) of the HIV-1 Gag precursor. An ankyrin with three modules named AnkGAG1D4 (16.5 kDa) was isolated. AnkGAG1D4 and MA-CA formed a protein complex with a stoichiometry of 1:1 and a dissociation constant of Kd ~ 1 μM, and the AnkGAG1D4 binding site was mapped to the N-terminal domain of the CA, within residues 1-110. HIV-1 production in SupT1 cells stably expressing AnkGAG1D4 in both N-myristoylated and non-N-myristoylated versions was significantly reduced compared to control cells. AnkGAG1D4 expression also reduced the production of MLV, a phylogenetically distant retrovirus. The AnkGAG1D4-mediated antiviral effect on HIV-1 was found to occur at post-integration steps, but did not involve the Gag precursor processing or cellular trafficking. Our data suggested that the lower HIV-1 progeny yields resulted from the negative interference of AnkGAG1D4-CA with the Gag assembly and budding pathway. Conclusions The resistance of AnkGAG1D4-expressing cells to HIV-1 suggested that the CA-targeted ankyrin AnkGAG1D4 could serve as a protein platform for the design of a novel class of intracellular inhibitors of HIV-1 assembly based on ankyrin-repeat modules. PMID:22348230

  6. Critical Role of the HTLV-1 Capsid N-Terminal Domain for Gag-Gag Interactions and Virus Particle Assembly.

    PubMed

    Martin, Jessica L; Mendonça, Luiza; Marusinec, Rachel; Zuczek, Jennifer; Angert, Isaac; Blower, Ruth J; Mueller, Joachim D; Perilla, Juan R; Zhang, Wei; Mansky, Louis M

    2018-04-25

    The retroviral Gag protein is the main structural protein responsible for virus particle assembly and release. Like human immunodeficiency virus type 1 (HIV-1) Gag, human T-cell leukemia virus type 1 (HTLV-1) has a structurally conserved capsid (CA) domain, including a β-hairpin turn and a centralized coiled-coil-like structure of six α helices in the CA amino-terminal domain (NTD) as well as four α-helices in the CA carboxy-terminal domain (CTD). CA drives Gag oligomerization, which is critical for both immature Gag lattice formation and particle production. The HIV-1 CA CTD has previously been shown to be a primary determinant for CA-CA interactions, and while both the HTLV-1 CA NTD and CTD have been implicated in Gag-Gag interactions, our recent observations have implicated the HTLV-1 CA NTD as encoding key determinants that dictate particle morphology. Here, we have conducted alanine-scanning mutagenesis in the HTLV-1 CA NTD nucleotide-encoding sequences spanning the loop regions and amino acids at the beginning and ends of α-helices due to their structural dissimilarity from the HIV-1 CA NTD structure. We analyzed both Gag subcellular distribution and efficiency of particle production for these mutants. We discovered several important residues (i.e., M17, Q47/F48, and Y61). Modeling implicated that these residues reside at the dimer interface (i.e., M17 and Y61) or at the trimer interface (i.e., Q47/F48). Taken together, these observations highlight the critical role of the HTLV-1 CA NTD in Gag-Gag interactions and particle assembly, which is, to the best of our knowledge, in contrast to HIV-1 and other retroviruses. Importance Retrovirus particle assembly and release from infected cells is driven by the Gag structural protein. Gag-Gag interactions, which form an oligomeric lattice structure at a particle budding site, are essential to the biogenesis of an infectious virus particle. The capsid (CA) domain of Gag is generally thought to possess the key

  7. NC-Mediated Nucleolar Localization of Retroviral Gag Proteins

    PubMed Central

    Lochmann, Timothy L.; Bann, Darrin V.; Ryan, Eileen P.; Beyer, Andrea R.; Mao, Annie; Cochrane, Alan

    2012-01-01

    The assembly and release of retrovirus particles from the cell membrane is directed by the Gag polyprotein. The Gag protein of Rous sarcoma virus (RSV) traffics through the nucleus prior to plasma membrane localization. We previously reported that nuclear localization of RSV Gag is linked to efficient packaging of viral genomic RNA, however the intranuclear activities of RSV Gag are not well understood. To gain insight into the properties of the RSV Gag protein within the nucleus, we examined the subnuclear localization and dynamic trafficking of RSV Gag. Restriction of RSV Gag to the nucleus by mutating its nuclear export signal (NES) in the p10 domain or interfering with CRM1-mediated nuclear export of Gag by leptomycin B (LMB) treatment led to the accumulation of Gag in nucleoli and discrete nucleoplasmic foci. Retention of RSV Gag in nucleoli was reduced with cis-expression of the 5′ untranslated RU5 region of the viral RNA genome, suggesting the psi (ψ packaging signal may alter the subnuclear localization of Gag. Fluorescence recovery after photobleaching (FRAP) demonstrated that the nucleolar fraction of Gag was highly mobile, indicating that the there was rapid exchange with Gag proteins in the nucleoplasm. RSV Gag is targeted to nucleoli by a nucleolar localization signal (NoLS) in the NC domain, and similarly, the human immunodeficiency virus type 1 (HIV-1) NC protein also contains an NoLS consisting of basic residues. Interestingly, co-expression of HIV-1 NC or Rev with HIV-1 Gag resulted in accumulation of Gag in nucleoli. Moreover, a subpopulation of HIV-1 Gag was detected in the nucleoli of HeLa cells stably expressing the entire HIV-1 genome in a Rev-dependent fashion. These findings suggest that the RSV and HIV-1 Gag proteins undergo nucleolar trafficking in the setting of viral infection. PMID:23036987

  8. Specific Humoral Immune Response Induced by Propionibacterium acnes Can Prevent Actinobacillus pleuropneumoniae Infection in Mice

    PubMed Central

    Yang, Feng; Ma, Qiuyue; Huang, Jing; Ji, Qun; Zhai, Ruidong; Wang, Lei; Wang, Yu; Li, Linxi; Sun, Changjiang; Feng, Xin; Han, Wenyu

    2014-01-01

    Porcine contagious pleuropneumonia, caused by Actinobacillus pleuropneumoniae, has a major impact on economics, ecology, and animal welfare in the pig-rearing industry. Propionibacterium acnes, a facultative anaerobic Gram-positive corynebacterium, exists widely in normal healthy adult animals. We have shown previously that P. acnes can prevent A. pleuropneumoniae infections in mice and pigs. To elucidate the mechanism of this effect and to identify novel A. pleuropneumoniae vaccines, the role of anti-P. acnes antibodies in preventing infection was analyzed by indirect immunofluorescence and opsonophagocytosis assays in vitro. The role of the specific humoral immune response induced by P. acnes was confirmed in a B cell depletion mouse model. The survival rates of mice challenged with A. pleuropneumoniae exhibited a highly significant positive rank correlation with the levels of anti-P. acnes antibodies. The specific antibodies induced by P. acnes had the ability to combine with A. pleuropneumoniae and increase opsonization of A. pleuropneumoniae for phagocytosis. Furthermore, analysis in the murine B cell depletion model confirmed that the humoral immune response induced by P. acnes played an important role in resistance to A. pleuropneumoniae infection. In this study, we further elucidated the reasons that P. acnes can prevent A. pleuropneumoniae infection, which provides useful evidence for the development of heterologous vaccines for the control of porcine contagious pleuropneumonia. PMID:24429068

  9. Dendritic cells pulsed with a tumor-specific peptide induce long-lasting immunity and are effective against murine intracerebral melanoma.

    PubMed

    Heimberger, Amy B; Archer, Gary E; Crotty, Laura E; McLendon, Roger E; Friedman, Allan H; Friedman, Henry S; Bigner, Darell D; Sampson, John H

    2002-01-01

    Dendritic cells (DCs) are specialized cells of the immune system that are capable of generating potent immune responses that are active even within the "immunologically privileged" central nervous system. However, immune responses generated by DCs have also been demonstrated to produce clinically significant autoimmunity. Targeting the epidermal growth factor receptor variant III (EGFRvIII), which is a mutation specific to tumor tissue, could eliminate this risk. The purpose of this study was to demonstrate that DC-based immunizations directed solely against this tumor-specific antigen, which is commonly found on tumors that originate within or metastasize to the brain, could be efficacious. C3H mice were vaccinated with DCs mixed with a keyhole limpet hemocyanin conjugate of the tumor-specific peptide, PEP-3, which spans the EGFRvIII mutation, or the random-sequence peptide, PEP-1, and were intracerebrally challenged with a syngeneic melanoma expressing a murine homologue of EGFRvIII. Systemic immunization with DCs mixed with PEP-3-keyhole limpet hemocyanin generated antigen-specific immunity. Among mice challenged with intracerebral tumors, this resulted in an approximately 600% increase in the median survival time (>300 d, P < 0.0016), relative to control values. Sixty-three percent of mice treated with DCs mixed with the tumor-specific peptide survived in the long term and 100% survived rechallenge with tumor, indicating that antitumor immunological memory was also induced. In a murine melanoma model, immunization with DCs mixed with tumor-specific peptide results in an antigen-specific immunological response that recognizes the EGFRvIII mutation, has potent antitumor efficacy against intracerebral tumors that express EGFRvIII, and results in long-lasting antitumor immunity.

  10. Immunization with recombinantly expressed glycan antigens from Schistosoma mansoni induces glycan-specific antibodies against the parasite

    PubMed Central

    Prasanphanich, Nina Salinger; Luyai, Anthony E; Song, Xuezheng; Heimburg-Molinaro, Jamie; Mandalasi, Msano; Mickum, Megan; Smith, David F; Nyame, A Kwame; Cummings, Richard D

    2014-01-01

    Schistosomiasis caused by infection with parasitic helminths of Schistosoma spp. is a major global health problem due to inadequate treatment and lack of a vaccine. The immune response to schistosomes includes glycan antigens, which could be valuable diagnostic markers and vaccine targets. However, no precedent exists for how to design vaccines targeting eukaryotic glycoconjugates. The di- and tri-saccharide motifs LacdiNAc (GalNAcβ1,4GlcNAc; LDN) and fucosylated LacdiNAc (GalNAcβ1,4(Fucα1-3)GlcNAc; LDNF) are the basis for several important schistosome glycan antigens. They occur in monomeric form or as repeating units (poly-LDNF) and as part of a variety of different glycoconjugates. Because chemical synthesis and conjugation of such antigens is exceedingly difficult, we sought to develop a recombinant expression system for parasite glycans. We hypothesized that presentation of parasite glycans on the cell surface would induce glycan-specific antibodies. We generated Chinese hamster ovary (CHO) Lec8 cell lines expressing poly-LDN (L8-GT) and poly-LDNF (L8-GTFT) abundantly on their membrane glycoproteins. Sera from Schistosoma mansoni-infected mice were highly cross-reactive with the cells and with cell-surface N-glycans. Immunizing mice with L8-GT and L8-GTFT cells induced glycan-specific antibodies. The L8-GTFT cells induced a sustained booster response, with antibodies that bound to S. mansoni lysates and recapitulated the exquisite specificity of the anti-parasite response for particular presentations of LDNF antigen. In summary, this recombinant expression system promotes successful generation of antibodies to the glycans of S. mansoni, and it can be adapted to study the role of glycan antigens and anti-glycan immune responses in many other infections and pathologies. PMID:24727440

  11. Modulation of innate and adaptive cellular immunity relevant to HIV-1 vaccine design by seminal plasma.

    PubMed

    Selva, Kevin J; Kent, Stephen J; Parsons, Matthew S

    2017-01-28

    Mucosal exposure to HIV-1 infection generally occurs in the presence of semen. Immunomodulation by seminal plasma is well described in the reproductive biology literature. Little is known, however, about the impact of seminal plasma on innate and adaptive anti-HIV-1 cellular immunity. The study investigated the effects of seminal plasma on immune responses considered important for prophylactic HIV-1 vaccine development, namely innate and adaptive cellular immunity mediated by natural killer (NK) cells and T cells, respectively. The ability of seminal plasma to modulate direct, antibody-dependent and cytokine-stimulated NK cell activation was assessed utilizing intracellular cytokine staining. Direct and antibody-dependent cellular cytotoxicity was assessed using lactate dehydrogenase release assays. The effects of seminal plasma on T-cell activation upon stimulation with staphylococcus enterotoxin B or HIV-1 Gag peptides were assessed by intracellular cytokine staining. The impact of seminal plasma on redirected cytolysis mediated by T cells was measured using lactate dehydrogenase release assays. Both direct and antibody-dependent NK cell activation were dramatically impaired by the presence of either HIV-1-uninfected or HIV-1-infected seminal plasma in a dose-dependent manner. Additionally, seminal plasma suppressed both direct and antibody-dependent NK cell-mediated cytolysis, including anti-HIV-1 antibody-dependent cytolysis of gp120-pulsed CEM.NKr-CCR5 cells. Finally, seminal plasma attenuated both HIV-1 Gag-specific and staphylococcus enterotoxin B-induced CTL activation. Semen contains potent immunosuppressors of both NK cell and CD8 T-cell-mediated anti-HIV-1 immune responses. This could impede attempts to provide vaccine-induced immunity to HIV-1.

  12. Structural interactions between retroviral Gag proteins examined by cysteine cross-linking.

    PubMed Central

    Hansen, M S; Barklis, E

    1995-01-01

    We have examined structural interactions between Gag proteins within Moloney murine leukemia virus (M-MuLV) particles by making use of the cysteine-specific cross-linking agents iodine and bis-maleimido hexane. Virion-associated wild-type M-MuLV Pr65Gag proteins in immature particles were intermolecularly cross-linked at cysteines to form Pr65Gag oligomers, from dimers to pentamers or hexamers. Following a systematic approach of cysteine-to-serine mutagenesis, we have shown that cross-linking of Pr65Gag occurred at cysteines of the nucleocapsid (NC) Cys-His motif, suggesting that the Cys-His motifs within virus particles are packed in close proximity. The M-MuLV Pr65Gag protein did not cross-link to the human immunodeficiency virus Pr55Gag protein when the two molecules were coexpressed, indicating either that they did not coassemble or that heterologous Gag proteins were not in close enough proximity to be cross-linked. Using an assembly-competent, protease-minus, cysteine-minus Pr65Gag protein as a template, novel cysteine residues were generated in the M-MuLV capsid domain major homology region (MHR). Cross-linking of proteins containing MHR cysteines showed above-background levels of Gag-Gag dimers but also identified a novel cellular factor, present in virions, that cross-linked to MHR residues. Although the NC cysteine mutation was compatible with M-MuLV particle assembly, deletions of the NC domain were not tolerated. These results suggest that the Cys-His motif is held in close proximity within immature M-MuLV particles by interactions between CA domains and/or non-Cys-His motif domains of the NC. PMID:7815493

  13. In vivo modification of retroviral gag gene-encoded polyproteins by myristic acid.

    PubMed Central

    Schultz, A M; Oroszlan, S

    1983-01-01

    It has recently been shown by mass spectral analysis (Henderson et al., Proc. Natl. Acad. Sci. U.S.A. 80:339-343, 1983) that the p15gag protein of murine leukemia viruses contains a novel post-translational modification, an amino-terminal myristyl (tetradecanoyl) amide. In this report we show that p15gag is the only structural protein to contain this fatty acid. In addition, the gag precursor polyproteins of type B, C, and D retroviruses have been examined for the presence of myristic acid by metabolic labeling and immunoprecipitation studies. In a panel of mammalian type C retroviruses we found that the precursor polyprotein Pr65gag homologs, but not the glycosylated forms (gPr80gag homologs), were specifically labeled after a 5-min incubation of infected cells with [3H]myristic acid. The gag precursor polyprotein was also labeled in mouse mammary tumor virus and in Mason-Pfizer monkey virus, but Pr76gag of Rous sarcoma virus failed to incorporate [3H]myristate. Under similar conditions, [3H]palmitate was not found to be incorporated into any viral gag proteins. Thus, myristylation appears to be a common feature of mammalian type B, C, and D retroviruses but not of avian retroviruses. Images PMID:6302307

  14. Exosomes carring gag/env of ALV-J possess negative effect on immunocytes.

    PubMed

    Wang, Guihua; Wang, Zhenzhen; Zhuang, Pingping; Zhao, Xiaomin; Cheng, Ziqiang

    2017-11-01

    J subgroup avian leukosis virus (ALV-J) is an exogenous retrovirus of avian. A key feature of ALV-J infection is leading to severe immunosuppressive characteristic of diseases. Viral components of retrovirus were reported closely associated with immunosuppression, and several similarities between exosomes and retrovirus preparations have lead to the hypotheses of retrovirus hijacker exosomes pathway. In this study, we purified exosomes from DF-1 cells infected and uninfected by ALV-J. Electron microscopy and mass spectrometry (MS) analysis showed that ALV-J not only increased the production of exosomes from ALV-J infected DF-1 cells (Exo-J) but also stimulated some proteins expression, especially ALV-J components secreted in exosomes. Immunosuppressive domain peptide (ISD) of envelope subunit transmembrane (TM) and gag of ALV-J were secreted in Exo-J. It has been reported that HIV gag was budded from endosome-like domains of the T cell plasma membrane. But env protein was first detected in exosomes from retrovirus infected cells. We found that Exo-J caused negative effects on splenocytes in a dose-dependant manner by flow cytometric analysis. And low dose of Exo-J activated immune activity of splenocytes, while high dose possessed immunosuppressive properties. Interestingly, Exo-J has no significant effects on the immunosuppression induced by ALV-J, and the immunosuppressive effects induced by Exo-J lower than that by ALV-J. Taken together, our data indicated that Exo-J supplied a microenvironment for the replication and transformation of ALV-J. Copyright © 2017. Published by Elsevier Ltd.

  15. Migration of antigen-presenting B cells from peripheral to mucosal lymphoid tissues may induce intestinal antigen-specific IgA following parenteral immunization.

    PubMed

    Coffin, S E; Clark, S L; Bos, N A; Brubaker, J O; Offit, P A

    1999-09-15

    Parenterally administered immunizations have long been used to induce protection from mucosal pathogens such as Bordetella pertussis and influenza virus. We previously found that i.m. inoculation of mice with the intestinal pathogen, rotavirus, induced virus-specific Ab production by intestinal lymphocytes. We have now used adoptive transfer studies to identify the cell types responsible for the generation of virus-specific Ab production by gut-associated lymphoid tissue (GALT) after i.m. immunization. Three days after i.m. immunization with rotavirus, cells obtained from the draining peripheral lymph nodes of donor mice were transferred into naive recipient mice. We found that intestinal lymphocytes produced rotavirus-specific Igs (IgM, IgA, and IgG) 2 wk after transfer of either unfractionated cells, or unfractionated cells rendered incapable of cellular division by mitomycin C treatment. Additional studies demonstrated that rotavirus-specific IgA, but not IgG, was produced by intestinal lymphocytes after transfer of purified B cells. Ig allotype analysis revealed that rotavirus-specific IgA was produced by intestinal B cells of recipient origin, suggesting that migration of Ag-presenting B cells from peripheral lymphoid tissues to GALT may contribute to the generation of mucosal IgA responses after parenteral immunization. Strategies that promote Ag uptake and presentation by B cells may enhance mucosal IgA production following parenteral immunization.

  16. Structure of glycosylated and unglycosylated gag polyproteins of Rauscher murine leukemia virus: carbohydrate attachment sites.

    PubMed Central

    Schultz, A M; Lockhart, S M; Rabin, E M; Oroszlan, S

    1981-01-01

    The structural relationships among the gag polyproteins Pr65gag, Pr75gag, and gPr80gag of Rauscher murine leukemia virus were studied by endoglycosidase H digestion and formic acid cleavage. Fragments were identified by precipitation with specific antisera to constituent virion structural proteins followed by one-dimensional mapping. Endoglycosidase H reduced the size of gPr80gag to that of Pr75gag. By comparing fragments of gPr80gag and the apoprotein Pr75gag, the former was shown to contain two mannose-rich oligosaccharide units. By comparing fragments of Pr65gag and Pr75gag, the latter was shown to differ from Pr65gag at the amino terminus by the presence of a leader peptide approximately 7,000 daltons in size. The internal and carboxyl-terminal peptides of the two unglycosylated polyproteins were not detectably different. The location of the two N-linked carbohydrate chains in gPr80gag has been specified. One occurs in the carboxyl-terminal half of the polyprotein at asparagine177 of the p30 sequence and the other is found in a 23,000-dalton fragment located in the amino-terminal region of gPr80gag and containing the additional amino acid sequences not found in Pr65gag plus a substantial portion of p15. Images PMID:7241663

  17. Hyperthermic treatment at 56 °C induces tumour-specific immune protection in a mouse model of prostate cancer in both prophylactic and therapeutic immunization regimens.

    PubMed

    De Sanctis, Francesco; Sandri, Sara; Martini, Matteo; Mazzocco, Marta; Fiore, Alessandra; Trovato, Rosalinda; Garetto, Stefano; Brusa, Davide; Ugel, Stefano; Sartoris, Silvia

    2018-06-14

    Most active cancer immunotherapies able to induce a long-lasting protection against tumours are based on the activation of tumour-specific cytotoxic T lymphocytes (CTLs). Cell death by hyperthermia induces apoptosis followed by secondary necrosis, with the production of factors named "danger associated molecular pattern" (DAMP) molecules (DAMPs), that activate dendritic cells (DCs) to perform antigen uptake, processing and presentation, followed by CTLs cross priming. In many published studies, hyperthermia treatment of tumour cells is performed at 42-45 °C; these temperatures mainly promote cell surface expression of DAMPs. Treatment at 56 °C of tumour cells was shown to induce DAMPs secretion rather than their cell surface expression, improving DC activation and CTL cross priming in vitro. Thus we tested the relevance of this finding in vivo on the generation of a tumour-specific memory immune response, in the TRAMP-C2 mouse prostate carcinoma transplantable model. TRAMP-C2 tumour cells treated at 56 °C were able not only to activate DCs in vitro but also to trigger a tumour-specific CTL-dependent immune response in vivo. Prophylactic vaccination with 56 °C-treated TRAMP-C2 tumour cells alone provided protection against TRAMP-C2 tumour growth in vivo, whilst in the therapeutic regimen, control of tumour growth was achieved combining immunization with adjuvant chemotherapy. Copyright © 2018 Elsevier Ltd. All rights reserved.

  18. Plant Immunity Inducer Development and Application.

    PubMed

    Dewen, Qiu; Yijie, Dong; Yi, Zhang; Shupeng, Li; Fachao, Shi

    2017-05-01

    Plant immunity inducers represent a new and rapidly developing field in plant-protection research. In this paper, we discuss recent research on plant immunity inducers and their development and applications in China. Plant immunity inducers include plant immunity-inducing proteins, chitosan oligosaccharides, and microbial inducers. These compounds and microorganisms can trigger defense responses and confer disease resistance in plants. We also describe the mechanisms of plant immunity inducers and how they promote plant health. Furthermore, we summarize the current situation in plant immunity inducer development in China and the global marketplace. Finally, we also deeply analyze the development trends and application prospects of plant immunity inducers in environmental protection and food safety.

  19. Two ribosome recruitment sites direct multiple translation events within HIV1 Gag open reading frame.

    PubMed

    Deforges, Jules; de Breyne, Sylvain; Ameur, Melissa; Ulryck, Nathalie; Chamond, Nathalie; Saaidi, Afaf; Ponty, Yann; Ohlmann, Theophile; Sargueil, Bruno

    2017-07-07

    In the late phase of the HIV virus cycle, the unspliced genomic RNA is exported to the cytoplasm for the necessary translation of the Gag and Gag-pol polyproteins. Three distinct translation initiation mechanisms ensuring Gag production have been described with little rationale for their multiplicity. The Gag-IRES has the singularity to be located within Gag ORF and to directly interact with ribosomal 40S. Aiming at elucidating the specificity and the relevance of this interaction, we probed HIV-1 Gag-IRES structure and developed an innovative integrative modelling strategy to take into account all the gathered information. We propose a novel Gag-IRES secondary structure strongly supported by all experimental data. We further demonstrate the presence of two regions within Gag-IRES that independently and directly interact with the ribosome. Importantly, these binding sites are functionally relevant to Gag translation both in vitro and ex vivo. This work provides insight into the Gag-IRES molecular mechanism and gives compelling evidence for its physiological importance. It allows us to propose original hypotheses about the IRES physiological role and conservation among primate lentiviruses. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Interactions between HIV-1 Gag and Viral RNA Genome Enhance Virion Assembly.

    PubMed

    Dilley, Kari A; Nikolaitchik, Olga A; Galli, Andrea; Burdick, Ryan C; Levine, Louis; Li, Kelvin; Rein, Alan; Pathak, Vinay K; Hu, Wei-Shau

    2017-08-15

    Most HIV-1 virions contain two copies of full-length viral RNA, indicating that genome packaging is efficient and tightly regulated. However, the structural protein Gag is the only component required for the assembly of noninfectious viruslike particles, and the viral RNA is dispensable in this process. The mechanism that allows HIV-1 to achieve such high efficiency of genome packaging when a packageable viral RNA is not required for virus assembly is currently unknown. In this report, we examined the role of HIV-1 RNA in virus assembly and found that packageable HIV-1 RNA enhances particle production when Gag is expressed at levels similar to those in cells containing one provirus. However, such enhancement is diminished when Gag is overexpressed, suggesting that the effects of viral RNA can be replaced by increased Gag concentration in cells. We also showed that the specific interactions between Gag and viral RNA are required for the enhancement of particle production. Taken together, these studies are consistent with our previous hypothesis that specific dimeric viral RNA-Gag interactions are the nucleation event of infectious virion assembly, ensuring that one RNA dimer is packaged into each nascent virion. These studies shed light on the mechanism by which HIV-1 achieves efficient genome packaging during virus assembly. IMPORTANCE Retrovirus assembly is a well-choreographed event, during which many viral and cellular components come together to generate infectious virions. The viral RNA genome carries the genetic information to new host cells, providing instructions to generate new virions, and therefore is essential for virion infectivity. In this report, we show that the specific interaction of the viral RNA genome with the structural protein Gag facilitates virion assembly and particle production. These findings resolve the conundrum that HIV-1 RNA is selectively packaged into virions with high efficiency despite being dispensable for virion assembly

  1. Nucleic acid-induced antiviral immunity in invertebrates: an evolutionary perspective.

    PubMed

    Wang, Pei-Hui; Weng, Shao-Ping; He, Jian-Guo

    2015-02-01

    Nucleic acids derived from viral pathogens are typical pathogen associated molecular patterns (PAMPs). In mammals, the recognition of viral nucleic acids by pattern recognition receptors (PRRs), which include Toll-like receptors (TLRs) and retinoic acid-inducible gene (RIG)-I-like receptors (RLRs), induces the release of inflammatory cytokines and type I interferons (IFNs) through the activation of nuclear factor κB (NF-κB) and interferon regulatory factor (IRF) 3/7 pathways, triggering the host antiviral state. However, whether nucleic acids can induce similar antiviral immunity in invertebrates remains ambiguous. Several studies have reported that nucleic acid mimics, especially dsRNA mimic poly(I:C), can strongly induce non-specific antiviral immune responses in insects, shrimp, and oyster. This behavior shows multiple similarities to the hallmarks of mammalian IFN responses. In this review, we highlight the current understanding of nucleic acid-induced antiviral immunity in invertebrates. We also discuss the potential recognition and regulatory mechanisms that confer non-specific antiviral immunity on invertebrate hosts. Copyright © 2014 Elsevier Ltd. All rights reserved.

  2. Insect immunity shows specificity in protection upon secondary pathogen exposure.

    PubMed

    Sadd, Ben M; Schmid-Hempel, Paul

    2006-06-20

    Immunological memory in vertebrates, conferring lasting specific protection after an initial pathogen exposure, has implications for a broad spectrum of evolutionary, epidemiological, and medical phenomena . However, the existence of specificity in protection upon secondary pathogen exposure in invertebrates remains controversial . To separate this functional phenomenon from a particular mechanism, we refer to it as specific immune priming. We investigate the presence of specific immune priming in workers of the social insect Bombus terrestris. Using three bacterial pathogens, we test whether a prior homologous pathogen exposure gives a benefit in terms of long-term protection against a later challenge, over and above a heterologous combination. With a reciprocally designed initial and second-exposure protocol (i.e., all combinations of bacteria were tested), we demonstrate, even several weeks after the clearance of a first exposure, increased protection and narrow specificity upon secondary exposure. This demonstrates that the invertebrate immune system is functionally capable of unexpectedly specific and durable induced protection. Ultimately, despite general broad differences between vertebrates and invertebrates, the ability of both immune systems to show specificity in protection suggests that their immune defenses have found comparable solutions to similar selective pressures over evolutionary time.

  3. Repurposing Ospemifene for Potentiating an Antigen-Specific Immune Response

    PubMed Central

    Kao, Chiao-Jung; Wurz, Gregory T.; Lin, Yi-Chen; Vang, Daniel P.; Phong, Brian; DeGregorio, Michael W.

    2016-01-01

    Objective Ospemifene, an estrogen receptor agonist/antagonist approved for treatment of dyspareunia and vaginal dryness in postmenopausal women, has potential new indications as an immune modulator. The overall objective of the present series of preclinical studies was to evaluate the immunomodulatory activity of ospemifene in combination with a peptide cancer vaccine. Methods Immune regulating effects, mechanism of action and structure activity relationships of ospemifene and related compounds were evaluated by examining expression of T cell activating cytokines in vitro, and antigen-specific immune response and cytotoxic T-lymphocyte activity in vivo. The effects of ospemifene (OSP) on the immune response to a peptide cancer vaccine (PV) were evaluated following chronic [control (n=22); OSP 50 mg/kg (n=16); PV (n=6); OSP+PV (n=11)], intermittent [control (n=10); OSP 10 and 50 mg/kg (n=11); PV (n=11); combination treatment (n=11 each dose)] and pretreatment [control; OSP 100 mg/kg; PV 100 µg; combination treatment (n=8 all groups)] ospemifene oral dosing schedules in a total of 317 mixed-sex tumor-bearing and non-tumor-bearing mice. Results The results showed that ospemifene induced expression of the key TH1 cytokines interferon gamma and interleukin-2 in vitro, which may be mediated by stimulating T cells through phosphoinositide 3-kinase and calmodulin signaling pathways. In combination with an antigen-specific peptide cancer vaccine, ospemifene increased antigen-specific immune response and increased cytotoxic T-lymphocyte activity in tumor-bearing and non-tumor-bearing mice. The pretreatment, intermittent, and chronic dosing schedules of ospemifene activate naïve T cells, modulate antigen-induced tolerance and reduce tumor-associated, pro-inflammatory cytokines, respectively. Conclusions Taken together, ospemifene’s dose response and schedule-dependent immune modulating activity offers a method of tailoring and augmenting the efficacy of previously failed

  4. Perturbation of Human T-Cell Leukemia Virus Type 1 Particle Morphology by Differential Gag Co-Packaging

    PubMed Central

    Angert, Isaac; Cao, Sheng; Berk, Serkan; Zhang, Wei; Mueller, Joachim D.

    2017-01-01

    Human T-cell leukemia virus type 1 (HTLV-1) is an important cancer-causing human retrovirus that has infected approximately 15 million individuals worldwide. Many aspects of HTLV-1 replication, including virus particle structure and assembly, are poorly understood. Group-specific antigen (Gag) proteins labeled at the carboxy terminus with a fluorophore protein have been used extensively as a surrogate for fluorescence studies of retroviral assembly. How these tags affect Gag stoichiometry and particle morphology has not been reported in detail. In this study, we used an HTLV-1 Gag expression construct with the yellow fluorescence protein (YFP) fused to the carboxy-terminus as a surrogate for the HTLV-1 Gag-Pol to assess the effects of co-packaging of Gag and a Gag-YFP on virus-like particle (VLP) morphology and analyzed particles by cryogenic transmission electron microscopy (cryo-TEM). Scanning transmission electron microscopy (STEM) and fluorescence fluctuation spectroscopy (FFS) were also used to determine the Gag stoichiometry. We found that ratios of 3:1 (Gag:Gag-YFP) or greater resulted in a particle morphology indistinguishable from that of VLPs produced with the untagged HTLV-1 Gag, i.e., a mean diameter of ~113 nm and a mass of 220 MDa as determined by cryo-TEM and STEM, respectively. Furthermore, FFS analysis indicated that HTLV-1 Gag-YFP was incorporated into VLPs in a predictable manner at the 3:1 Gag:Gag-YFP ratio. Both STEM and FFS analyses found that the Gag copy number in VLPs produced with a 3:1 ratio of Gag:Gag-YFP was is in the range of 1500–2000 molecules per VLP. The observations made in this study indicate that biologically relevant Gag–Gag interactions occur between Gag and Gag-YFP at ratios of 3:1 or higher and create a Gag lattice structure in VLPs that is morphologically indistinguishable from that of VLPs produced with just untagged Gag. This information is useful for the quantitative analysis of Gag–Gag interactions that occur

  5. Species-Specific Immunity Induced by Infection with Entamoeba histolytica and Entamoeba moshkovskii in Mice

    PubMed Central

    Shimokawa, Chikako; Culleton, Richard; Imai, Takashi; Suzue, Kazutomo; Hirai, Makoto; Taniguchi, Tomoyo; Kobayashi, Seiki; Hisaeda, Hajime; Hamano, Shinjiro

    2013-01-01

    Entamoeba histolytica, the parasitic amoeba responsible for amoebiasis, causes approximately 100,000 deaths every year. There is currently no vaccine against this parasite. We have previously shown that intracecal inoculation of E. histolytica trophozoites leads to chronic and non-healing cecitis in mice. Entamoeba moshkovskii, a closely related amoeba, also causes diarrhea and other intestinal disorders in this model. Here, we investigated the effect of infection followed by drug-cure of these species on the induction of immunity against homologous or heterologous species challenge. Mice were infected with E. histolytica or E. moshkovskii and treated with metronidazole 14 days later. Re-challenge with E. histolytica or E. moshkovskii was conducted seven or 28 days following confirmation of the clearance of amoebae, and the degree of protection compared to non-exposed control mice was evaluated. We show that primary infection with these amoebae induces a species-specific immune response which protects against challenge with the homologous, but not a heterologous species. These findings pave the way, therefore, for the identification of novel amoebae antigens that may become the targets of vaccines and provide a useful platform to investigate host protective immunity to Entamoeba infections. PMID:24312397

  6. Synchronized HIV assembly by tunable PIP2 changes reveals PIP2 requirement for stable Gag anchoring

    PubMed Central

    Mücksch, Frauke; Laketa, Vibor; Müller, Barbara; Schultz, Carsten; Kräusslich, Hans-Georg

    2017-01-01

    HIV-1 assembles at the plasma membrane (PM) of infected cells. PM association of the main structural protein Gag depends on its myristoylated MA domain and PM PI(4,5)P2. Using a novel chemical biology tool that allows rapidly tunable manipulation of PI(4,5)P2 levels in living cells, we show that depletion of PI(4,5)P2 completely prevents Gag PM targeting and assembly site formation. Unexpectedly, PI(4,5)P2 depletion also caused loss of pre-assembled Gag lattices from the PM. Subsequent restoration of PM PI(4,5)P2 reinduced assembly site formation even in the absence of new protein synthesis, indicating that the dissociated Gag molecules remained assembly competent. These results reveal an important role of PI(4,5)P2 for HIV-1 morphogenesis beyond Gag recruitment to the PM and suggest a dynamic equilibrium of Gag-lipid interactions. Furthermore, they establish an experimental system that permits synchronized induction of HIV-1 assembly leading to induced production of infectious virions by targeted modulation of Gag PM targeting. DOI: http://dx.doi.org/10.7554/eLife.25287.001 PMID:28574338

  7. GM-CSF-Induced Regulatory T cells Selectively Inhibit Anti-Acetylcholine Receptor-Specific Immune Responses in Experimental Myasthenia Gravis

    PubMed Central

    Sheng, Jian Rong; Muthusamy, Thiruppathi; Prabahakar, Bellur S.; Meriggioli, Matthew N.

    2011-01-01

    We and others have demonstrated the ability of granulocyte-macrophage colony-stimulating factor (GM-CSF) to suppress autoimmunity by increasing the number of CD4+CD25+ regulatory T cells (Tregs). In the current study, we have explored the critical role of induced antigen specific Tregs in the therapeutic effects of GM-CSF in murine experimental autoimmune myasthenia gravis (EAMG). Specifically, we show that Tregs from GM-CSF treated EAMG mice (GM-CSF/AChR-induced-Tregs) adoptively transferred into animals with EAMG suppressed clinical disease more potently than equal numbers of Tregs from either GM-CSF untreated EAMG mice or healthy mice treated with GM-CSF. In addition, GM-CSF/AChR-induced-Tregs selectively suppressed antigen specific T cell proliferation induced by AChR relative to that induced by an irrelevant self antigen, (thyroglobulin) and failed to significantly alter T cell proliferation in response to an exogenous antigen (ovalbumin). These results are consistent with the hypothesized mechanism of action of GM-CSF involving the mobilization of tolerogenic dendritic cell precursors which, upon antigen (AChR) capture, suppress the anti-AChR immune response through the induction/expansion of AChR-specific Tregs. PMID:22099723

  8. Immune-driven recombination and loss of control after HIV superinfection.

    PubMed

    Streeck, Hendrik; Li, Bin; Poon, Art F Y; Schneidewind, Arne; Gladden, Adrianne D; Power, Karen A; Daskalakis, Demetre; Bazner, Suzane; Zuniga, Rosario; Brander, Christian; Rosenberg, Eric S; Frost, Simon D W; Altfeld, Marcus; Allen, Todd M

    2008-08-04

    After acute HIV infection, CD8(+) T cells are able to control viral replication to a set point. This control is often lost after superinfection, although the mechanism behind this remains unclear. In this study, we illustrate in an HLA-B27(+) subject that loss of viral control after HIV superinfection coincides with rapid recombination events within two narrow regions of Gag and Env. Screening for CD8(+) T cell responses revealed that each of these recombination sites (approximately 50 aa) encompassed distinct regions containing two immunodominant CD8 epitopes (B27-KK10 in Gag and Cw1-CL9 in Env). Viral escape and the subsequent development of variant-specific de novo CD8(+) T cell responses against both epitopes were illustrative of the significant immune selection pressures exerted by both responses. Comprehensive analysis of the kinetics of CD8 responses and viral evolution indicated that the recombination events quickly facilitated viral escape from both dominant WT- and variant-specific responses. These data suggest that the ability of a superinfecting strain of HIV to overcome preexisting immune control may be related to its ability to rapidly recombine in critical regions under immune selection pressure. These data also support a role for cellular immune pressures in driving the selection of new recombinant forms of HIV.

  9. Control of Viremia and Prevention of AIDS following Immunotherapy of SIV-Infected Macaques with Peptide-Pulsed Blood

    PubMed Central

    De Rose, Robert; Fernandez, Caroline S.; Smith, Miranda Z.; Batten, C. Jane; Alcântara, Sheilajen; Peut, Vivienne; Rollman, Erik; Loh, Liyen; Mason, Rosemarie D.; Wilson, Kim; Law, Matthew G.; Handley, Amanda J.; Kent, Stephen J.

    2008-01-01

    Effective immunotherapies for HIV are needed. Drug therapies are life-long with significant toxicities. Dendritic-cell based immunotherapy approaches are promising but impractical for widespread use. A simple immunotherapy, reinfusing fresh autologous blood cells exposed to overlapping SIV peptides for 1 hour ex vivo, was assessed for the control of SIVmac251 replication in 36 pigtail macaques. An initial set of four immunizations was administered under antiretroviral cover and a booster set of three immunizations administered 6 months later. Vaccinated animals were randomized to receive Gag peptides alone or peptides spanning all nine SIV proteins. High-level, SIV-specific CD4 and CD8 T-cell immunity was induced following immunization, both during antiretroviral cover and without. Virus levels were durably ∼10-fold lower for 1 year in immunized animals compared to controls, and a significant delay in AIDS-related mortality resulted. Broader immunity resulted following immunizations with peptides spanning all nine SIV proteins, but the responses to Gag were weaker in comparison to animals only immunized with Gag. No difference in viral outcome occurred in animals immunized with all SIV proteins compared to animals immunized against Gag alone. Peptide-pulsed blood cells are an immunogenic and effective immunotherapy in SIV-infected macaques. Our results suggest Gag alone is an effective antigen for T-cell immunotherapy. Fresh blood cells pulsed with overlapping Gag peptides is proceeding into trials in HIV-infected humans. PMID:18451982

  10. Mother-to-Child HIV Transmission Bottleneck Selects for Consensus Virus with Lower Gag-Protease-Driven Replication Capacity

    PubMed Central

    Naidoo, Vanessa L.; Mann, Jaclyn K.; Noble, Christie; Adland, Emily; Carlson, Jonathan M.; Thomas, Jake; Brumme, Chanson J.; Thobakgale-Tshabalala, Christina F.; Brumme, Zabrina L.; Goulder, Philip J. R.

    2017-01-01

    ABSTRACT In the large majority of cases, HIV infection is established by a single variant, and understanding the characteristics of successfully transmitted variants is relevant to prevention strategies. Few studies have investigated the viral determinants of mother-to-child transmission. To determine the impact of Gag-protease-driven viral replication capacity on mother-to-child transmission, the replication capacities of 148 recombinant viruses encoding plasma-derived Gag-protease from 53 nontransmitter mothers, 48 transmitter mothers, and 47 infected infants were assayed in an HIV-1-inducible green fluorescent protein reporter cell line. All study participants were infected with HIV-1 subtype C. There was no significant difference in replication capacities between the nontransmitter (n = 53) and transmitter (n = 44) mothers (P = 0.48). Infant-derived Gag-protease NL4-3 recombinant viruses (n = 41) were found to have a significantly lower Gag-protease-driven replication capacity than that of viruses derived from the mothers (P < 0.0001 by a paired t test). High percent similarities to consensus subtype C Gag, p17, p24, and protease sequences were also found in the infants (n = 28) in comparison to their mothers (P = 0.07, P = 0.002, P = 0.03, and P = 0.02, respectively, as determined by a paired t test). These data suggest that of the viral quasispecies found in mothers, the HIV mother-to-child transmission bottleneck favors the transmission of consensus-like viruses with lower viral replication capacities. IMPORTANCE Understanding the characteristics of successfully transmitted HIV variants has important implications for preventative interventions. Little is known about the viral determinants of HIV mother-to-child transmission (MTCT). We addressed the role of viral replication capacity driven by Gag, a major structural protein that is a significant determinant of overall viral replicative ability and an important target of the host immune response, in the MTCT

  11. Lack of a significant impact of Gag-Protease-mediated HIV-1 replication capacity on clinical parameters in treatment-naive Japanese individuals.

    PubMed

    Sakai, Keiko; Chikata, Takayuki; Brumme, Zabrina L; Brumme, Chanson J; Gatanaga, Hiroyuki; Gatanag, Hiroyuki; Oka, Shinichi; Takiguchi, Masafumi

    2015-11-19

    HLA class I-associated escape mutations in HIV-1 Gag can reduce viral replication, suggesting that associated fitness costs could impact HIV-1 disease progression. Previous studies in North American and African cohorts have reported reduced Gag-Protease mediated viral replication capacity (Gag-Pro RC) in individuals expressing protective HLA class I alleles including HLA-B*57:01, B*27:05, and B*81:01. These studies also reported significant positive associations between Gag-Pro RCs and plasma viral load (pVL). However, these HLA alleles are virtually absent in Japan, and the importance of Gag as an immune target is not clearly defined in this population. We generated chimeric NL4-3 viruses carrying patient-derived Gag-Protease from 306 treatment-naive Japanese individuals chronically infected with HIV-1 subtype B. We analyzed associations between Gag-Pro RC and clinical markers of HIV-1 infection and host HLA expression. We observed no significant correlation between Gag-Pro RC and pVL in Japan in the overall cohort. However, upon exclusion of individuals expressing Japanese protective alleles HLA-B*52:01 and B*67:01, Gag-Pro RC correlated positively with pVL and negatively with CD4 T-cell count. Our results thus contrast with studies from other global cohorts reporting significantly lower Gag-Pro RC among persons expressing protective HLA alleles, and positive relationships between Gag-Pro RC and pVL in the overall study populations. We also identified five amino acids in Gag-Protease significantly associated with Gag-Pro RC, whose effects on RC were confirmed by site-directed mutagenesis. However, of the four mutations that decreased Gag-Pro RC, none were associated with reductions in pVL in Japan though two were associated with lower pVL in North America. These data indicate that Gag fitness does not affect clinical outcomes in subjects with protective HLA class I alleles as well as the whole Japanese population. Moreover, the impact of Gag fitness costs on HIV

  12. Distinct binding interactions of HIV-1 Gag to Psi and non-Psi RNAs: implications for viral genomic RNA packaging.

    PubMed

    Webb, Joseph A; Jones, Christopher P; Parent, Leslie J; Rouzina, Ioulia; Musier-Forsyth, Karin

    2013-08-01

    Despite the vast excess of cellular RNAs, precisely two copies of viral genomic RNA (gRNA) are selectively packaged into new human immunodeficiency type 1 (HIV-1) particles via specific interactions between the HIV-1 Gag and the gRNA psi (ψ) packaging signal. Gag consists of the matrix (MA), capsid, nucleocapsid (NC), and p6 domains. Binding of the Gag NC domain to ψ is necessary for gRNA packaging, but the mechanism by which Gag selectively interacts with ψ is unclear. Here, we investigate the binding of NC and Gag variants to an RNA derived from ψ (Psi RNA), as well as to a non-ψ region (TARPolyA). Binding was measured as a function of salt to obtain the effective charge (Zeff) and nonelectrostatic (i.e., specific) component of binding, Kd(1M). Gag binds to Psi RNA with a dramatically reduced Kd(1M) and lower Zeff relative to TARPolyA. NC, GagΔMA, and a dimerization mutant of Gag bind TARPolyA with reduced Zeff relative to WT Gag. Mutations involving the NC zinc finger motifs of Gag or changes to the G-rich NC-binding regions of Psi RNA significantly reduce the nonelectrostatic component of binding, leading to an increase in Zeff. These results show that Gag interacts with gRNA using different binding modes; both the NC and MA domains are bound to RNA in the case of TARPolyA, whereas binding to Psi RNA involves only the NC domain. Taken together, these results suggest a novel mechanism for selective gRNA encapsidation.

  13. How HIV-1 Gag assembles in cells: putting together pieces of the puzzle

    PubMed Central

    Lingappa, Jaisri R; Reed, Jonathan C; Tanaka, Motoko; Chutiraka, Kasana; Robinson, Bridget A

    2014-01-01

    During the late stage of the viral life cycle, HIV-1 Gag assembles into a spherical immature capsid, and undergoes budding, release, and maturation. Here we review events involved in immature capsid assembly from the perspective of five different approaches used to study this process: mutational analysis, structural studies, assembly of purified recombinant Gag, assembly of newly-translated Gag in a cell-free system, and studies in cells using biochemical and imaging techniques. We summarize key findings obtained using each approach, point out where there is consensus, and highlight unanswered questions. Particular emphasis is placed on reconciling data suggesting that Gag assembles by two different paths, depending on the assembly environment. Specifically, in assembly systems that lack cellular proteins, high concentrations of Gag can spontaneously assemble using purified nucleic acid as a scaffold. However, in the more complex intracellular environment, barriers that limit self-assembly are present in the form of cellular proteins, organelles, host defenses, and the absence of free nucleic acid. To overcome these barriers and promote efficient immature capsid formation in an unfavorable environment, Gag appears to utilize an energy-dependent, host-catalyzed, pathway of assembly intermediates in cells. Overall, we show how data obtained using a variety of techniques has led to our current understanding of HIV assembly. PMID:25066606

  14. Induction of antigen-specific immunity by pH-sensitive carbonate apatite as a potent vaccine carrier

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hebishima, Takehisa; Tada, Seiichi; Takeshima, Shin-nosuke

    Highlights: Black-Right-Pointing-Pointer To develop effective vaccine, we examined the effects of CO{sub 3}Ap as an antigen carrier. Black-Right-Pointing-Pointer OVA contained in CO{sub 3}Ap was taken up by BMDCs more effectively than free OVA. Black-Right-Pointing-Pointer OVA-immunized splenocytes was activated by OVA contained in CO{sub 3}Ap effectively. Black-Right-Pointing-Pointer OVA contained in CO{sub 3}Ap induced strong OVA-specific immune responses to C57BL/6 mice. Black-Right-Pointing-Pointer CO{sub 3}Ap is promising antigen carrier for the achievement of effective vaccine. -- Abstract: The ability of carbonate apatite (CO{sub 3}Ap) to enhance antigen-specific immunity was examined in vitro and in vivo to investigate its utility as a vaccine carrier.more » Murine bone marrow-derived dendritic cells took up ovalbumin (OVA) containing CO{sub 3}Ap more effectively than free OVA. Interestingly, mice immunized with OVA-containing CO{sub 3}Ap produced OVA-specific antibodies more effectively than mice immunized with free OVA. Furthermore, immunization of C57BL/6 mice with OVA-containing CO{sub 3}Ap induced the proliferation and antigen-specific production of IFN-{gamma} by splenocytes more strongly than immunization with free OVA. Moreover, no significant differences were detected in the induction of delayed-type hypersensitivity responses, an immune reaction involving an antigen-specific, cell-mediated immune response between OVA-containing CO{sub 3}Ap and OVA-containing alumina salt (Alum), suggesting that CO{sub 3}Ap induced cell-mediated immune response to the same degree as Alum, which is commonly used for clinical applications. This study is the first to demonstrate the induction of antigen-specific immune responses in vivo by CO{sub 3}Ap.« less

  15. Specific insertions of zinc finger domains into Gag-Pol yield engineered retroviral vectors with selective integration properties

    PubMed Central

    Lim, Kwang-il; Klimczak, Ryan; Yu, Julie H.; Schaffer, David V.

    2010-01-01

    Retroviral vectors offer benefits of efficient delivery and stable gene expression; however, their clinical use raises the concerns of insertional mutagenesis and potential oncogenesis due to genomic integration preferences in transcriptional start sites (TSS). We have shifted the integration preferences of retroviral vectors by generating a library of viral variants with a DNA-binding domain inserted at random positions throughout murine leukemia virus Gag-Pol, then selecting for variants that are viable and exhibit altered integration properties. We found seven permissive zinc finger domain (ZFD) insertion sites throughout Gag-Pol, including within p12, reverse transcriptase, and integrase. Comprehensive genome integration analysis showed that several ZFD insertions yielded retroviral vector variants with shifted integration patterns that did not favor TSS. Furthermore, integration site analysis revealed selective integration for numerous mutants. For example, two retroviral variants with a given ZFD at appropriate positions in Gag-Pol strikingly integrated primarily into four common sites out of 3.1 × 109 possible human genome locations (P = 4.6 × 10-29). Our findings demonstrate that insertion of DNA-binding motifs into multiple locations in Gag-Pol can make considerable progress toward engineering safer retroviral vectors that integrate into a significantly narrowed pool of sites on human genome and overcome the preference for TSS. PMID:20616052

  16. Utility of Clostridium difficile toxin B for inducing anti-tumor immunity.

    PubMed

    Huang, Tuxiong; Li, Shan; Li, Guangchao; Tian, Yuan; Wang, Haiying; Shi, Lianfa; Perez-Cordon, Gregorio; Mao, Li; Wang, Xiaoning; Wang, Jufang; Feng, Hanping

    2014-01-01

    Clostridium difficile toxin B (TcdB) is a key virulence factor of bacterium and induces intestinal inflammatory disease. Because of its potent cytotoxic and proinflammatory activities, we investigated the utility of TcdB in developing anti-tumor immunity. TcdB induced cell death in mouse colorectal cancer CT26 cells, and the intoxicated cells stimulated the activation of mouse bone marrow-derived dendritic cells and subsequent T cell activation in vitro. Immunization of BALB/c mice with toxin-treated CT26 cells elicited potent anti-tumor immunity that protected mice from a lethal challenge of the same tumor cells and rejected pre-injected tumors. The anti-tumor immunity generated was cell-mediated, long-term, and tumor-specific. Further experiments demonstrated that the intact cell bodies were important for the immunogenicity since lysing the toxin-treated tumor cells reduced their ability to induce antitumor immunity. Finally, we showed that TcdB is able to induce potent anti-tumor immunity in B16-F10 melanoma model. Taken together, these data demonstrate the utility of C. difficile toxin B for developing anti-tumor immunity.

  17. Tsg101 regulates PI(4,5)P2/Ca2+ signaling for HIV-1 Gag assembly

    PubMed Central

    Ehrlich, Lorna S.; Medina, Gisselle N.; Photiadis, Sara; Whittredge, Paul B.; Watanabe, Susan; Taraska, Justin W.; Carter, Carol A.

    2014-01-01

    Our previous studies identified the 1,4,5-inositol trisphosphate receptor (IP3R), a channel mediating release of Ca2+ from ER stores, as a cellular factor differentially associated with HIV-1 Gag that might facilitate ESCRT function in virus budding. Channel opening requires activation that is initiated by binding of 1,4,5-triphosphate (IP3), a product of phospholipase C (PLC)-mediated PI(4,5)P2 hydrolysis. The store emptying that follows stimulates store refilling which requires intact PI(4,5)P2. Raising cytosolic Ca2+ promotes viral particle production and our studies indicate that IP3R and the ER Ca2+ store are the physiological providers of Ca2+ for Gag assembly and release. Here, we show that Gag modulates ER store gating and refilling. Cells expressing Gag exhibited a higher cytosolic Ca2+ level originating from the ER store than control cells, suggesting that Gag induced release of store Ca2+. This property required the PTAP motif in Gag that recruits Tsg101, an ESCRT-1 component. Consistent with cytosolic Ca2+ elevation, Gag accumulation at the plasma membrane was found to require continuous IP3R activation. Like other IP3R channel modulators, Gag was detected in physical proximity to the ER and to endogenous IP3R, as indicated respectively by total internal reflection fluorescence (TIRF) and immunoelectron microscopy (IEM) or indirect immunofluorescence. Reciprocal co-immunoprecipitation suggested that Gag and IP3R proximity is favored when the PTAP motif in Gag is intact. Gag expression was also accompanied by increased PI(4,5)P2 accumulation at the plasma membrane, a condition favoring store refilling capacity. Supporting this notion, Gag particle production was impervious to treatment with 2-aminoethoxydiphenyl borate, an inhibitor of a refilling coupling interaction. In contrast, particle production by a Gag mutant lacking the PTAP motif was reduced. We conclude that a functional PTAP L domain, and by inference Tsg101 binding, confers Gag with an

  18. Passive Antibody Administration (Immediate Immunity) as a Specific Defense Against Biological Weapons

    PubMed Central

    2002-01-01

    The potential threat of biological warfare with a specific agent is proportional to the susceptibility of the population to that agent. Preventing disease after exposure to a biological agent is partially a function of the immunity of the exposed individual. The only available countermeasure that can provide immediate immunity against a biological agent is passive antibody. Unlike vaccines, which require time to induce protective immunity and depend on the host’s ability to mount an immune response, passive antibody can theoretically confer protection regardless of the immune status of the host. Passive antibody therapy has substantial advantages over antimicrobial agents and other measures for postexposure prophylaxis, including low toxicity and high specific activity. Specific antibodies are active against the major agents of bioterrorism, including anthrax, smallpox, botulinum toxin, tularemia, and plague. This article proposes a biological defense initiative based on developing, producing, and stockpiling specific antibody reagents that can be used to protect the population against biological warfare threats. PMID:12141970

  19. A DNA prime-oral Listeria boost vaccine in rhesus macaques induces a SIV-specific CD8 T cell mucosal response characterized by high levels of α4β7 integrin and an effector memory phenotype

    PubMed Central

    Neeson, Paul; Boyer, Jean; Kumar, Sanjeev; Lewis, Mark G.; Veazey, Lennox MattiasRon; Weiner, David; Paterson, Yvonne

    2006-01-01

    In this study in Rhesus macaques, we tested whether IL-12 or IL-15 in a DNA prime-oral Listeria boost amplifies the SIV-Gag specific CD8 mucosal response. SIV-specific CD8 T cells were demonstrated in the peripheral blood (PB) in all test vaccine groups, but not the control group. SIV Gag-specific CD8 T cells in the PB expressed α4β7 integrin, the gut-homing receptor; a minor subset co-express αEβ7 integrin. SIV Gag-specific CD8 T cells were also detected in the gut tissue, intraepithelial (IEL) and lamina propria lymphocytes (LPL) of the duodenum and ileum. These cells were characterized by high levels of β7 integrin expression and a predominance of the effector memory phenotype. Neither Il-12 nor IL-15 amplified the frequency of SIV-specific CD8 T cells in the gut. Thus, the DNA prime oral Listeria boost strategy induced a mucosal SIV-Gag specific CD8 T cell response characterized by expression of the α4β7 integrin gut-homing receptor. PMID:16904153

  20. Cytoplasmic utilization of human immunodeficiency virus type 1 genomic RNA is not dependent on a nuclear interaction with gag.

    PubMed

    Grewe, Bastian; Hoffmann, Bianca; Ohs, Inga; Blissenbach, Maik; Brandt, Sabine; Tippler, Bettina; Grunwald, Thomas; Uberla, Klaus

    2012-03-01

    In some retroviruses, such as Rous sarcoma virus and prototype foamy virus, Gag proteins are known to shuttle between the nucleus and the cytoplasm and are implicated in nuclear export of the viral genomic unspliced RNA (gRNA) for subsequent encapsidation. A similar function has been proposed for human immunodeficiency virus type 1 (HIV-1) Gag based on the identification of nuclear localization and export signals. However, the ability of HIV-1 Gag to transit through the nucleus has never been confirmed. In addition, the lentiviral Rev protein promotes efficient nuclear gRNA export, and previous reports indicate a cytoplasmic interaction between Gag and gRNA. Therefore, functional effects of HIV-1 Gag on gRNA and its usage were explored. Expression of gag in the absence of Rev was not able to increase cytoplasmic gRNA levels of subgenomic, proviral, or lentiviral vector constructs, and gene expression from genomic reporter plasmids could not be induced by Gag provided in trans. Furthermore, Gag lacking the reported nuclear localization and export signals was still able to mediate an efficient packaging process. Although small amounts of Gag were detectable in the nuclei of transfected cells, a Crm1-dependent nuclear export signal in Gag could not be confirmed. Thus, our study does not provide any evidence for a nuclear function of HIV-1 Gag. The encapsidation process of HIV-1 therefore clearly differs from that of Rous sarcoma virus and prototype foamy virus.

  1. Endophilins interact with Moloney murine leukemia virus Gag and modulate virion production

    PubMed Central

    Wang, Margaret Q; Kim, Wankee; Gao, Guangxia; Torrey, Ted A; Morse, Herbert C; De Camilli, Pietro; Goff, Stephen P

    2004-01-01

    Background The retroviral Gag protein is the central player in the process of virion assembly at the plasma membrane, and is sufficient to induce the formation and release of virus-like particles. Recent evidence suggests that Gag may co-opt the host cell's endocytic machinery to facilitate retroviral assembly and release. Results A search for novel partners interacting with the Gag protein of the Moloney murine leukemia virus (Mo-MuLV) via the yeast two-hybrid protein-protein interaction assay resulted in the identification of endophilin 2, a component of the machinery involved in clathrin-mediated endocytosis. We demonstrate that endophilin interacts with the matrix or MA domain of the Gag protein of Mo-MuLV, but not of human immunodeficiency virus, HIV. Both exogenously expressed and endogenous endophilin are incorporated into Mo-MuLV viral particles. Titration experiments suggest that the binding sites for inclusion of endophilin into viral particles are limited and saturable. Knock-down of endophilin with small interfering RNA (siRNA) had no effect on virion production, but overexpression of endophilin and, to a lesser extent, of several fragments of the protein, result in inhibition of Mo-MuLV virion production, but not of HIV virion production. Conclusions This study shows that endophilins interact with Mo-MuLV Gag and affect virion production. The findings imply that endophilin is another component of the large complex that is hijacked by retroviruses to promote virion production. PMID:14659004

  2. Toll-Like Receptor 7 Agonist GS-9620 Induces HIV Expression and HIV-Specific Immunity in Cells from HIV-Infected Individuals on Suppressive Antiretroviral Therapy.

    PubMed

    Tsai, Angela; Irrinki, Alivelu; Kaur, Jasmine; Cihlar, Tomas; Kukolj, George; Sloan, Derek D; Murry, Jeffrey P

    2017-04-15

    Antiretroviral therapy can suppress HIV replication to undetectable levels but does not eliminate latent HIV, thus necessitating lifelong therapy. Recent efforts to target this persistent reservoir have focused on inducing the expression of latent HIV so that infected cells may be recognized and eliminated by the immune system. Toll-like receptor (TLR) activation stimulates antiviral immunity and has been shown to induce HIV from latently infected cells. Activation of TLR7 leads to the production of several stimulatory cytokines, including type I interferons (IFNs). In this study, we show that the selective TLR7 agonist GS-9620 induced HIV in peripheral blood mononuclear cells (PBMCs) from HIV-infected individuals on suppressive antiretroviral therapy. GS-9620 increased extracellular HIV RNA 1.5- to 2-fold through a mechanism that required type I IFN signaling. GS-9620 also activated HIV-specific T cells and enhanced antibody-mediated clearance of HIV-infected cells. Activation by GS-9620 in combination with HIV peptide stimulation increased CD8 T cell degranulation, production of intracellular cytokines, and cytolytic activity. T cell activation was again dependent on type I IFNs produced by plasmacytoid dendritic cells. GS-9620 induced phagocytic cell maturation and improved effector-mediated killing of HIV-infected CD4 T cells by the HIV envelope-specific broadly neutralizing antibody PGT121. Collectively, these data show that GS-9620 can activate HIV production and improve the effector functions that target latently infected cells. GS-9620 may effectively complement orthogonal therapies designed to stimulate antiviral immunity, such as therapeutic vaccines or broadly neutralizing antibodies. Clinical studies are under way to determine if GS-9620 can target HIV reservoirs. IMPORTANCE Though antiretroviral therapies effectively suppress viral replication, they do not eliminate integrated proviral DNA. This stable intermediate of viral infection is persistently

  3. Toll-Like Receptor 7 Agonist GS-9620 Induces HIV Expression and HIV-Specific Immunity in Cells from HIV-Infected Individuals on Suppressive Antiretroviral Therapy

    PubMed Central

    Tsai, Angela; Irrinki, Alivelu; Kaur, Jasmine; Cihlar, Tomas; Kukolj, George

    2017-01-01

    ABSTRACT Antiretroviral therapy can suppress HIV replication to undetectable levels but does not eliminate latent HIV, thus necessitating lifelong therapy. Recent efforts to target this persistent reservoir have focused on inducing the expression of latent HIV so that infected cells may be recognized and eliminated by the immune system. Toll-like receptor (TLR) activation stimulates antiviral immunity and has been shown to induce HIV from latently infected cells. Activation of TLR7 leads to the production of several stimulatory cytokines, including type I interferons (IFNs). In this study, we show that the selective TLR7 agonist GS-9620 induced HIV in peripheral blood mononuclear cells (PBMCs) from HIV-infected individuals on suppressive antiretroviral therapy. GS-9620 increased extracellular HIV RNA 1.5- to 2-fold through a mechanism that required type I IFN signaling. GS-9620 also activated HIV-specific T cells and enhanced antibody-mediated clearance of HIV-infected cells. Activation by GS-9620 in combination with HIV peptide stimulation increased CD8 T cell degranulation, production of intracellular cytokines, and cytolytic activity. T cell activation was again dependent on type I IFNs produced by plasmacytoid dendritic cells. GS-9620 induced phagocytic cell maturation and improved effector-mediated killing of HIV-infected CD4 T cells by the HIV envelope-specific broadly neutralizing antibody PGT121. Collectively, these data show that GS-9620 can activate HIV production and improve the effector functions that target latently infected cells. GS-9620 may effectively complement orthogonal therapies designed to stimulate antiviral immunity, such as therapeutic vaccines or broadly neutralizing antibodies. Clinical studies are under way to determine if GS-9620 can target HIV reservoirs. IMPORTANCE Though antiretroviral therapies effectively suppress viral replication, they do not eliminate integrated proviral DNA. This stable intermediate of viral infection is

  4. Trafficking receptor signatures define blood plasmablasts responding to tissue-specific immune challenge

    PubMed Central

    Seong, Yekyung; Lazarus, Nicole H.; Sutherland, Lusijah; Habtezion, Aida; Abramson, Tzvia; He, Xiao-Song; Greenberg, Harry B.

    2017-01-01

    Antibody-secreting cells are generated in regional lymphoid tissues and traffic as plasmablasts (PBs) via lymph and blood to target sites for local immunity. We used multiparameter flow cytometry to define PB trafficking programs (TPs, combinations of adhesion molecules and chemoattractant receptors) and their imprinting in patients in response to localized infection or immune insults. TPs enriched after infection or autoimmune inflammation of mucosae correlate with sites of immune response or symptoms, with different TPs imprinted during small intestinal, colon, throat, and upper respiratory immune challenge. PBs induced after intramuscular or intradermal influenza vaccination, including flu-specific antibody–secreting cells, display TPs characterized by the lack of mucosal homing receptors. PBs of healthy donors display diverse mucosa-associated TPs, consistent with homeostatic immune activity. Identification of TP signatures of PBs may facilitate noninvasive monitoring of organ-specific immune responses. PMID:28352656

  5. Intranasal Administration of a Therapeutic HIV Vaccine (Vacc-4x) Induces Dose-Dependent Systemic and Mucosal Immune Responses in a Randomized Controlled Trial

    PubMed Central

    Brekke, Kristin; Lind, Andreas; Holm-Hansen, Carol; Haugen, Inger Lise; Sørensen, Birger; Sommerfelt, Maja; Kvale, Dag

    2014-01-01

    Background Vacc-4x, a Gag p24-based therapeutic HIV vaccine, has been shown to reduce viral load set-points after intradermal administration. In this randomized controlled pilot study we investigate intranasal administration of Vacc-4x with Endocine as adjuvant. Methods Safety and immunogenicity were tested in patients on effective ART. They were randomized to low, medium or high dose Vacc-4x or adjuvant alone, administered four times at weekly intervals with no booster. Vacc-4x-specific T cell responses were measured in vitro by proliferation and in vivo by a single DTH skin test at the end of study. Nasal and rectal mucosal secretions were analyzed for Vacc-4x-specific antibodies by ELISA. Immune regulation induced by Vacc-4x was assessed by functional blockade of the regulatory cytokines IL-10 and TGF-β. Results Vacc-4x proliferative T cell responses increased only among the vaccinated (p≤0.031). The low dose group showed the greatest increase in Vacc-4x CD8+T cell responses (p = 0.037) and developed larger DTH (p = 0.005) than the adjuvant group. Rectal (distal) Vacc-4x IgA and IgG antibodies also increased (p = 0.043) in this group. In contrast, the high dose generated higher nasal (local) Vacc-4x IgA (p = 0.028) and serum IgG (p = 0.030) antibodies than the adjuvant. Irrespective of dose, increased Vacc-4x CD4+T cell responses were associated with low proliferation (r = −0.82, p<0.001) and high regulation (r = 0.61, p = 0.010) at baseline. Conclusion Intranasal administration of Vacc-4x with Endocine was safe and induced dose-dependent vaccine-specific T cell responses and both mucosal and systemic humoral responses. The clinical significance of dose, immune regulation and mucosal immunity warrants further investigation. Trial Registration ClinicalTrials.gov NCT01473810 PMID:25398137

  6. Early Gag Immunodominance of the HIV-Specific T-Cell Response during Acute/Early Infection Is Associated with Higher CD8+ T-Cell Antiviral Activity and Correlates with Preservation of the CD4+ T-Cell Compartment

    PubMed Central

    Ghiglione, Yanina; Falivene, Juliana; Socias, María Eugenia; Laufer, Natalia; Coloccini, Romina Soledad; Rodriguez, Ana María; Ruiz, María Julia; Pando, María Ángeles; Giavedoni, Luis David; Cahn, Pedro; Sued, Omar; Salomon, Horacio; Gherardi, María Magdalena

    2013-01-01

    The important role of the CD8+ T-cell response on HIV control is well established. Moreover, the acute phase of infection represents a proper scenario to delineate the antiviral cellular functions that best correlate with control. Here, multiple functional aspects (specificity, ex vivo viral inhibitory activity [VIA] and polyfunctionality) of the HIV-specific CD8+ T-cell subset arising early after infection, and their association with disease progression markers, were examined. Blood samples from 44 subjects recruited within 6 months from infection (primary HIV infection [PHI] group), 16 chronically infected subjects, 11 elite controllers (EC), and 10 healthy donors were obtained. Results indicated that, although Nef dominated the anti-HIV response during acute/early infection, a higher proportion of early anti-Gag T cells correlated with delayed progression. Polyfunctional HIV-specific CD8+ T cells were detected at early time points but did not associate with virus control. Conversely, higher CD4+ T-cell set points were observed in PHI subjects with higher HIV-specific CD8+ T-cell VIA at baseline. Importantly, VIA levels correlated with the magnitude of the anti-Gag cellular response. The advantage of Gag-specific cells may result from their enhanced ability to mediate lysis of infected cells (evidenced by a higher capacity to degranulate and to mediate VIA) and to simultaneously produce IFN-γ. Finally, Gag immunodominance was associated with elevated plasma levels of interleukin 2 (IL-2) and macrophage inflammatory protein 1β (MIP-1β). All together, this study underscores the importance of CD8+ T-cell specificity in the improved control of disease progression, which was related to the capacity of Gag-specific cells to mediate both lytic and nonlytic antiviral mechanisms at early time points postinfection. PMID:23616666

  7. Adjuvanting a Simian Immunodeficiency Virus Vaccine with Toll-Like Receptor Ligands Encapsulated in Nanoparticles Induces Persistent Antibody Responses and Enhanced Protection in TRIM5α Restrictive Macaques.

    PubMed

    Kasturi, Sudhir Pai; Kozlowski, Pamela A; Nakaya, Helder I; Burger, Matheus C; Russo, Pedro; Pham, Mathew; Kovalenkov, Yevgeniy; Silveira, Eduardo L V; Havenar-Daughton, Colin; Burton, Samantha L; Kilgore, Katie M; Johnson, Mathew J; Nabi, Rafiq; Legere, Traci; Sher, Zarpheen Jinnah; Chen, Xuemin; Amara, Rama R; Hunter, Eric; Bosinger, Steven E; Spearman, Paul; Crotty, Shane; Villinger, Francois; Derdeyn, Cynthia A; Wrammert, Jens; Pulendran, Bali

    2017-02-15

    Our previous work has shown that antigens adjuvanted with ligands specific for Toll-like receptor 4 (TLR4) and TLR7/8 encapsulated in poly(lactic-co-glycolic) acid (PLGA)-based nanoparticles (NPs) induce robust and durable immune responses in mice and macaques. We investigated the efficacy of these NP adjuvants in inducing protective immunity against simian immunodeficiency virus (SIV). Rhesus macaques (RMs) were immunized with NPs containing TLR4 and TLR7/8 agonists mixed with soluble recombinant SIVmac239-derived envelope (Env) gp140 and Gag p55 (protein) or with virus-like particles (VLPs) containing SIVmac239 Env and Gag. NP-adjuvanted vaccines induced robust innate responses, antigen-specific antibody responses of a greater magnitude and persistence, and enhanced plasmablast responses compared to those achieved with alum-adjuvanted vaccines. NP-adjuvanted vaccines induced antigen-specific, long-lived plasma cells (LLPCs), which persisted in the bone marrow for several months after vaccination. NP-adjuvanted vaccines induced immune responses that were associated with enhanced protection against repeated low-dose, intravaginal challenges with heterologous SIVsmE660 in animals that carried TRIM5α restrictive alleles. The protection induced by immunization with protein-NP correlated with the prechallenge titers of Env-specific IgG antibodies in serum and vaginal secretions. However, no such correlate was apparent for immunization with VLP-NP or alum as the adjuvant. Transcriptional profiling of peripheral blood mononuclear cells isolated within the first few hours to days after primary vaccination revealed that NP-adjuvanted vaccines induced a molecular signature similar to that induced by the live attenuated yellow fever viral vaccine. This systems approach identified early blood transcriptional signatures that correlate with Env-specific antibody responses in vaginal secretions and protection against infection. These results demonstrate the adjuvanticity of the

  8. Sex-specific consequences of an induced immune response on reproduction in a moth.

    PubMed

    Barthel, Andrea; Staudacher, Heike; Schmaltz, Antje; Heckel, David G; Groot, Astrid T

    2015-12-16

    Immune response induction benefits insects in combatting infection by pathogens. However, organisms have a limited amount of resources available and face the dilemma of partitioning resources between immunity and other life-history traits. Since males and females differ in their life histories, sex-specific resource investment strategies to achieve an optimal immune response following an infection can be expected. We investigated immune response induction of females and males of Heliothis virescens in response to the entomopathogenic bacterium Serratia entomophila, and its effects on mating success and the female sexual signal. We found that females had higher expression levels of immune-related genes after bacterial challenge than males. However, males maintained a higher baseline expression of immune-related genes than females. The increased investment in immunity of female moths was negatively correlated with mating success and the female sexual signal. Male mating success was unaffected by bacterial challenge. Our results show that the sexes differed in their investment strategies: females invested in immune defense after a bacterial challenge, indicating facultative immune deployment, whereas males had higher baseline immunity than females, indicating immune maintenance. Interestingly, these differences in investment were reflected in the mate choice assays. As female moths are the sexual signallers, females need to invest resources in their attractiveness. However, female moths appeared to invest in immunity at the cost of reproductive effort.

  9. Hydrodynamic and Membrane Binding Properties of Purified Rous Sarcoma Virus Gag Protein

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dick, Robert A.; Datta, Siddhartha A. K.; Nanda, Hirsh

    2016-05-06

    Previously, no retroviral Gag protein has been highly purified in milligram quantities and in a biologically relevant and active form. We have purified Rous sarcoma virus (RSV) Gag protein and in parallel several truncation mutants of Gag and have studied their biophysical properties and membrane interactionsin vitro. RSV Gag is unusual in that it is not naturally myristoylated. From its ability to assemble into virus-like particlesin vitro, we infer that RSV Gag is biologically active. By size exclusion chromatography and small-angle X-ray scattering, Gag in solution appears extended and flexible, in contrast to previous reports on unmyristoylated HIV-1 Gag, whichmore » is compact. However, by neutron reflectometry measurements of RSV Gag bound to a supported bilayer, the protein appears to adopt a more compact, folded-over conformation. At physiological ionic strength, purified Gag binds strongly to liposomes containing acidic lipids. This interaction is stimulated by physiological levels of phosphatidylinositol-(4,5)-bisphosphate [PI(4,5)P2] and by cholesterol. However, unlike HIV-1 Gag, RSV Gag shows no sensitivity to acyl chain saturation. In contrast with full-length RSV Gag, the purified MA domain of Gag binds to liposomes only weakly. Similarly, both an N-terminally truncated version of Gag that is missing the MA domain and a C-terminally truncated version that is missing the NC domain bind only weakly. These results imply that NC contributes to membrane interactionin vitro, either by directly contacting acidic lipids or by promoting Gag multimerization. Retroviruses like HIV assemble at and bud from the plasma membrane of cells. Assembly requires the interaction between thousands of Gag molecules to form a lattice. Previous work indicated that lattice formation at the plasma membrane is influenced by the conformation of monomeric HIV. We have extended this work to the more tractable RSV Gag. Our results show that RSV Gag is highly flexible and can adopt

  10. Effects of pre-existing orthopoxvirus-specific immunity on the performance of Modified Vaccinia virus Ankara-based influenza vaccines.

    PubMed

    Altenburg, Arwen F; van Trierum, Stella E; de Bruin, Erwin; de Meulder, Dennis; van de Sandt, Carolien E; van der Klis, Fiona R M; Fouchier, Ron A M; Koopmans, Marion P G; Rimmelzwaan, Guus F; de Vries, Rory D

    2018-04-24

    The replication-deficient orthopoxvirus modified vaccinia virus Ankara (MVA) is a promising vaccine vector against various pathogens and has an excellent safety record. However, pre-existing vector-specific immunity is frequently suggested to be a drawback of MVA-based vaccines. To address this issue, mice were vaccinated with MVA-based influenza vaccines in the presence or absence of orthopoxvirus-specific immunity. Importantly, protective efficacy of an MVA-based influenza vaccine against a homologous challenge was not impaired in the presence of orthopoxvirus-specific pre-existing immunity. Nonetheless, orthopoxvirus-specific pre-existing immunity reduced the induction of antigen-specific antibodies under specific conditions and completely prevented induction of antigen-specific T cell responses by rMVA-based vaccination. Notably, antibodies induced by vaccinia virus vaccination, both in mice and humans, were not capable of neutralizing MVA. Thus, when using rMVA-based vaccines it is important to consider the main correlate of protection induced by the vaccine, the vaccine dose and the orthopoxvirus immune status of vaccine recipients.

  11. Natural and cross-inducible anti-SIV antibodies in Mauritian cynomolgus macaques

    PubMed Central

    Li, Hongzhao; Nykoluk, Mikaela; Li, Lin; Liu, Lewis R.; Omange, Robert W.; Soule, Geoff; Schroeder, Lukas T.; Toledo, Nikki; Kashem, Mohammad Abul; Correia-Pinto, Jorge F.; Liang, Binhua; Schultz-Darken, Nancy; Alonso, Maria J.; Whitney, James B.; Plummer, Francis A.

    2017-01-01

    Cynomolgus macaques are an increasingly important nonhuman primate model for HIV vaccine research. SIV-free animals without pre-existing anti-SIV immune responses are generally needed to evaluate the effect of vaccine-induced immune responses against the vaccine epitopes. Here, in order to select such animals for vaccine studies, we screened 108 naïve female Mauritian cynomolgus macaques for natural (baseline) antibodies to SIV antigens using a Bio-Plex multiplex system. The antigens included twelve 20mer peptides overlapping the twelve SIV protease cleavage sites (-10/+10), respectively (PCS peptides), and three non-PCS Gag or Env peptides. Natural antibodies to SIV antigens were detected in subsets of monkeys. The antibody reactivity to SIV was further confirmed by Western blot using purified recombinant SIV Gag and Env proteins. As expected, the immunization of monkeys with PCS antigens elicited anti-PCS antibodies. However, unexpectedly, antibodies to non-PCS peptides were also induced, as shown by both Bio-Plex and Western blot analyses, while the non-PCS peptides do not share sequence homology with PCS peptides. The presence of natural and vaccine cross-inducible SIV antibodies in Mauritian cynomolgus macaques should be considered in animal selection, experimental design and result interpretation, for their best use in HIV vaccine research. PMID:28982126

  12. Nuclear localization of foamy virus Gag precursor protein.

    PubMed Central

    Schliephake, A W; Rethwilm, A

    1994-01-01

    All foamy viruses give rise to a strong nuclear staining when infected cells are reacted with sera from infected hosts. This nuclear fluorescence distinguishes foamy viruses from all other retroviruses. The experiments reported here indicate that the foamy virus Gag precursor protein is transiently located in the nuclei of infected cells and this is the likely reason for the typical foamy virus nuclear fluorescence. By using the vaccinia virus expression system, a conserved basic sequence motif in the nucleocapsid domain of foamy virus Gag proteins was identified to be responsible for the nuclear transport of the gag precursor molecule. This motif was also found to be able to direct a heterologous protein, the Gag protein of human immunodeficiency virus, into the nucleus. Images PMID:8035493

  13. Heterologous prime-boost regimens with a recombinant chimpanzee adenoviral vector and adjuvanted F4 protein elicit polyfunctional HIV-1-specific T-Cell responses in macaques.

    PubMed

    Lorin, Clarisse; Vanloubbeeck, Yannick; Baudart, Sébastien; Ska, Michaël; Bayat, Babak; Brauers, Geoffroy; Clarinval, Géraldine; Donner, Marie-Noëlle; Marchand, Martine; Koutsoukos, Marguerite; Mettens, Pascal; Cohen, Joe; Voss, Gerald

    2015-01-01

    HIV-1-specific CD4+ and CD8+ T lymphocytes are important for HIV-1 replication control. F4/AS01 consists of F4 recombinant fusion protein (containing clade B Gag/p24, Pol/RT, Nef and Gag/p17) formulated in AS01 Adjuvant System, and was shown to induce F4-specific polyfunctional CD4+ T-cell responses in humans. While replication-incompetent recombinant HIV-1/SIV antigen-expressing human adenoviral vectors can elicit high-frequency antigen-specific CD8+ T-cell responses, their use is hampered by widespread pre-existing immunity to human serotypes. Non-human adenovirus serotypes associated with lower prevalence may offer an alternative strategy. We evaluated the immunogenicity of AdC7-GRN ('A'), a recombinant chimpanzee adenovirus type 7 vector expressing clade B Gag, RT and Nef, and F4/AS01 ('P'), when delivered intramuscularly in homologous (PP or AA) and heterologous (AAPP or PPAA) prime-boost regimens, in macaques and mice. Vaccine-induced HIV-1-antigen-specific T cells in peripheral blood (macaques), liver, spleen, and intestinal and genital mucosa (mice) were characterized by intracellular cytokine staining. Vaccine-specific IgG antibodies (macaques) were detected using ELISA. In macaques, only the heterologous prime-boost regimens induced polyfunctional, persistent and balanced CD4+ and CD8+ T-cell responses specific to each HIV-1 vaccine antigen. AdC7-GRN priming increased the polyfunctionality of F4/AS01-induced CD4+ T cells. Approximately 50% of AdC7-GRN-induced memory CD8+ T cells exhibited an effector-memory phenotype. HIV-1-specific antibodies were detected with each regimen. In mice, antigen-specific CD4+ and CD8+ T-cell responses were detected in the mucosal and systemic anatomical compartments assessed. When administered in heterologous prime-boost regimens, AdC7-GRN and F4/AS01 candidate vaccines acted complementarily in inducing potent and persistent peripheral blood HIV-1-specific CD4+ and CD8+ T-cell responses and antibodies in macaques. Besides

  14. Heterologous Prime-Boost Regimens with a Recombinant Chimpanzee Adenoviral Vector and Adjuvanted F4 Protein Elicit Polyfunctional HIV-1-Specific T-Cell Responses in Macaques

    PubMed Central

    Lorin, Clarisse; Vanloubbeeck, Yannick; Baudart, Sébastien; Ska, Michaël; Bayat, Babak; Brauers, Geoffroy; Clarinval, Géraldine; Donner, Marie-Noëlle; Marchand, Martine; Koutsoukos, Marguerite; Mettens, Pascal; Cohen, Joe; Voss, Gerald

    2015-01-01

    HIV-1-specific CD4+ and CD8+ T lymphocytes are important for HIV-1 replication control. F4/AS01 consists of F4 recombinant fusion protein (containing clade B Gag/p24, Pol/RT, Nef and Gag/p17) formulated in AS01 Adjuvant System, and was shown to induce F4-specific polyfunctional CD4+ T-cell responses in humans. While replication-incompetent recombinant HIV-1/SIV antigen-expressing human adenoviral vectors can elicit high-frequency antigen-specific CD8+ T-cell responses, their use is hampered by widespread pre-existing immunity to human serotypes. Non-human adenovirus serotypes associated with lower prevalence may offer an alternative strategy. We evaluated the immunogenicity of AdC7-GRN (‘A’), a recombinant chimpanzee adenovirus type 7 vector expressing clade B Gag, RT and Nef, and F4/AS01 (‘P’), when delivered intramuscularly in homologous (PP or AA) and heterologous (AAPP or PPAA) prime-boost regimens, in macaques and mice. Vaccine-induced HIV-1-antigen-specific T cells in peripheral blood (macaques), liver, spleen, and intestinal and genital mucosa (mice) were characterized by intracellular cytokine staining. Vaccine-specific IgG antibodies (macaques) were detected using ELISA. In macaques, only the heterologous prime-boost regimens induced polyfunctional, persistent and balanced CD4+ and CD8+ T-cell responses specific to each HIV-1 vaccine antigen. AdC7-GRN priming increased the polyfunctionality of F4/AS01-induced CD4+ T cells. Approximately 50% of AdC7-GRN-induced memory CD8+ T cells exhibited an effector-memory phenotype. HIV-1-specific antibodies were detected with each regimen. In mice, antigen-specific CD4+ and CD8+ T-cell responses were detected in the mucosal and systemic anatomical compartments assessed. When administered in heterologous prime-boost regimens, AdC7-GRN and F4/AS01 candidate vaccines acted complementarily in inducing potent and persistent peripheral blood HIV-1-specific CD4+ and CD8+ T-cell responses and antibodies in macaques

  15. Broad and potent immune responses to a low dose intradermal HIV-1 DNA boosted with HIV-1 recombinant MVA among healthy adults in Tanzania☆,☆☆

    PubMed Central

    Bakari, Muhammad; Aboud, Said; Nilsson, Charlotta; Francis, Joel; Buma, Deus; Moshiro, Candida; Aris, Eric A.; Lyamuya, Eligius F.; Janabi, Mohamed; Godoy-Ramirez, Karina; Joachim, Agricola; Polonis, Victoria R.; Bråve, Andreas; Earl, Patricia; Robb, Merlin; Marovich, Mary; Wahren, Britta; Pallangyo, Kisali; Biberfeld, Gunnel; Mhalu, Fred; Sandström, Eric

    2016-01-01

    Background We conducted a phase I/II randomized placebo-controlled trial with the aim of exploring whether priming with a low intradermal dose of a multiclade, multigene HIV-1 DNA vaccine could improve the immunogenicity of the same vaccine given intramuscularly prior to boosting with a heterologous HIV-1 MVA among healthy adults in Dar es Salaam, Tanzania. Methods Sixty HIV-uninfected volunteers were randomized to receive DNA plasmid vaccine 1 mg intradermally (id), n = 20, or 3.8 mg intramuscularly (im), n = 20, or placebo, n = 20, using a needle-free injection device. DNA plasmids encoding HIV-1 genes gp160 subtype A, B, C; rev B; p17/p24 gag A, B and Rtmut B were given at weeks 0, 4 and 12. Recombinant MVA (108 pfu) expressing HIV-1 Env, Gag, Pol of CRF01_AE or placebo was administered im at month 9 and 21. Results The vaccines were well tolerated. Two weeks after the third HIV-DNA injection, 22/38 (58%) vaccinees had IFN-γ ELISpot responses to Gag. Two weeks after the first HIV-MVA boost all 35 (100%) vaccinees responded to Gag and 31 (89%) to Env. Two to four weeks after the second HIV-MVA boost, 28/29 (97%) vaccinees had IFN-γ ELISpot responses, 27 (93%) to Gag and 23 (79%) to Env. The id-primed recipients had significantly higher responses to Env than im recipients. Intracellular cytokine staining for Gag-specific IFN-γ/IL-2 production showed both CD8+ and CD4+ T cell responses. All vaccinees had HIV-specific lymphoproliferative responses. All vaccinees reacted in diagnostic HIV serological tests and 26/29 (90%) had antibodies against gp160 after the second HIV-MVA boost. Furthermore, while all of 29 vaccinee sera were negative for neutralizing antibodies against clade B, C and CRF01 AE pseudoviruses in the TZM-bl neutralization assay, in a PBMC assay, the response rate ranged from 31% to 83% positives, depending upon the clade B or CRF01_AE virus tested. This vaccine approach is safe and highly immunogenic. Low dose, id HIV-DNA priming elicited higher

  16. Nucleocapsid promotes localization of HIV-1 gag to uropods that participate in virological synapses between T cells.

    PubMed

    Llewellyn, G Nicholas; Hogue, Ian B; Grover, Jonathan R; Ono, Akira

    2010-10-28

    T cells adopt a polarized morphology in lymphoid organs, where cell-to-cell transmission of HIV-1 is likely frequent. However, despite the importance of understanding virus spread in vivo, little is known about the HIV-1 life cycle, particularly its late phase, in polarized T cells. Polarized T cells form two ends, the leading edge at the front and a protrusion called a uropod at the rear. Using multiple uropod markers, we observed that HIV-1 Gag localizes to the uropod in polarized T cells. Infected T cells formed contacts with uninfected target T cells preferentially via HIV-1 Gag-containing uropods compared to leading edges that lack plasma-membrane-associated Gag. Cell contacts enriched in Gag and CD4, which define the virological synapse (VS), are also enriched in uropod markers. These results indicate that Gag-laden uropods participate in the formation and/or structure of the VS, which likely plays a key role in cell-to-cell transmission of HIV-1. Consistent with this notion, a myosin light chain kinase inhibitor, which disrupts uropods, reduced virus particle transfer from infected T cells to target T cells. Mechanistically, we observed that Gag copatches with antibody-crosslinked uropod markers even in non-polarized cells, suggesting an association of Gag with uropod-specific microdomains that carry Gag to uropods. Finally, we determined that localization of Gag to the uropod depends on higher-order clustering driven by its NC domain. Taken together, these results support a model in which NC-dependent Gag accumulation to uropods establishes a preformed platform that later constitutes T-cell-T-cell contacts at which HIV-1 virus transfer occurs.

  17. Attenuated Listeria monocytogenes vectors overcome suppressive plasma factors during HIV infection to stimulate myeloid dendritic cells to promote adaptive immunity and reactivation of latent virus.

    PubMed

    Miller, Elizabeth A; Spadaccia, Meredith R; Norton, Thomas; Demmler, Morgan; Gopal, Ramya; O'Brien, Meagan; Landau, Nathaniel; Dubensky, Thomas W; Lauer, Peter; Brockstedt, Dirk G; Bhardwaj, Nina

    2015-01-01

    HIV-1 infection is characterized by myeloid dendritic cell (DC) dysfunction, which blunts the responsiveness to vaccine adjuvants. We previously showed that nonviral factors in HIV-seropositive plasma are partially responsible for mediating this immune suppression. In this study we investigated recombinant Listeria monocytogenes (Lm) vectors, which naturally infect and potently activate DCs from seronegative donors, as a means to overcome DC dysfunction associated with HIV infection. Monocyte-derived DCs were cocultured with plasma from HIV-infected donors (HIV-moDCs) to induce a dysregulated state and infected with an attenuated, nonreplicative vaccine strain of Lm expressing full length clade B consensus gag (KBMA Lm-gag). Lm infection stimulated cytokine secretion [interleukin (IL)-12p70, tumor necrosis factor (TNF)-α, and IL-6] and Th-1 skewing of allogeneic naive CD4 T cells by HIV-moDCs, in contrast to the suppressive effects observed by HIV plasma on moDCs on toll-like receptor ligand stimulation. Upon coculture of "killed" but metabolically active (KBMA) Lm-gag-infected moDCs from HIV-infected donors with autologous cells, expansion of polyfunctional, gag-specific CD8(+) T cells was observed. Reactivation of latent proviruses by moDCs following Lm infection was also observed in models of HIV latency in a TNF-α-dependent manner. These findings reveal the unique ability of Lm vectors to contend with dysregulation of HIV-moDCs, while simultaneously possessing the capacity to activate latent virus. Concurrent stimulation of innate and adaptive immunity and disruption of latency may be an approach to reduce the pool of latently infected cells during HIV infection. Further study of Lm vectors as part of therapeutic vaccination and eradication strategies may advance this evolving field.

  18. Vaccine-induced, simian immunodeficiency virus-specific CD8+ T cells reduce virus replication but do not protect from simian immunodeficiency virus disease progression.

    PubMed

    Engram, Jessica C; Dunham, Richard M; Makedonas, George; Vanderford, Thomas H; Sumpter, Beth; Klatt, Nichole R; Ratcliffe, Sarah J; Garg, Seema; Paiardini, Mirko; McQuoid, Monica; Altman, John D; Staprans, Silvija I; Betts, Michael R; Garber, David A; Feinberg, Mark B; Silvestri, Guido

    2009-07-01

    Our limited understanding of the interaction between primate lentiviruses and the host immune system complicates the design of an effective HIV/AIDS vaccine. To identify immunological correlates of protection from SIV disease progression, we immunized two groups of five rhesus macaques (RMs) with either modified vaccinia Ankara (MVA) or MVADeltaudg vectors that expressed SIVmac239 Gag and Tat. Both vectors raised a SIV-specific CD8(+) T cell response, with a magnitude that was greater in mucosal tissues than in peripheral blood. After challenge with SIVmac239, all vaccinated RMs showed mucosal and systemic CD8(+) T cell recall responses that appeared faster and were of greater magnitude than those in five unvaccinated control animals. All vaccinated RMs showed a approximately 1-log lower peak and early set-point SIV viral load than the unvaccinated animals, and then, by 8 wk postchallenge, exhibited levels of viremia similar to the controls. We observed a significant direct correlation between the magnitude of postchallenge SIV-specific CD8(+) T cell responses and SIV viral load. However, vaccinated RMs showed no protection from either systemic or mucosal CD4(+) T cell depletion and no improved survival. The observation that vaccine-induced, SIV-specific CD8(+) T cells that partially control SIVmac239 virus replication fail to protect from immunological or clinical progression of SIV infection underscores both the complexity of AIDS pathogenesis and the challenges of properly assessing the efficacy of candidate AIDS vaccines.

  19. Priming-boosting vaccination with recombinant Mycobacterium bovis bacillus Calmette-Guérin and a nonreplicating vaccinia virus recombinant leads to long-lasting and effective immunity.

    PubMed

    Ami, Yasushi; Izumi, Yasuyuki; Matsuo, Kazuhiro; Someya, Kenji; Kanekiyo, Masaru; Horibata, Shigeo; Yoshino, Naoto; Sakai, Koji; Shinohara, Katsuaki; Matsumoto, Sohkichi; Yamada, Takeshi; Yamazaki, Shudo; Yamamoto, Naoki; Honda, Mitsuo

    2005-10-01

    Virus-specific T-cell responses can limit immunodeficiency virus type 1 (HIV-1) transmission and prevent disease progression and so could serve as the basis for an affordable, safe, and effective vaccine in humans. To assess their potential for a vaccine, we used Mycobacterium bovis bacillus Calmette-Guérin (BCG)-Tokyo and a replication-deficient vaccinia virus strain (DIs) as vectors to express full-length gag from simian immunodeficiency viruses (SIVs) (rBCG-SIVgag and rDIsSIVgag). Cynomolgus macaques were vaccinated with either rBCG-SIVgag dermally as a single modality or in combination with rDIsSIVgag intravenously. When cynomologus macaques were primed with rBCG-SIVgag and then boosted with rDIsSIVgag, high levels of gamma interferon (IFN-gamma) spot-forming cells specific for SIV Gag were induced. This combination regimen elicited effective protective immunity against mucosal challenge with pathogenic simian-human immunodeficiency virus for the 1 year the macaques were under observation. Antigen-specific intracellular IFN-gamma activity was similarly induced in each of the macaques with the priming-boosting regimen. Other groups receiving the opposite combination or the single-modality vaccines were not effectively protected. These results suggest that a recombinant M. bovis BCG-based vector may have potential as an HIV/AIDS vaccine when administered in combination with a replication-deficient vaccinia virus DIs vector in a priming-boosting strategy.

  20. HIV-1 Gag as an Antiviral Target: Development of Assembly and Maturation Inhibitors.

    PubMed

    Spearman, Paul

    2016-01-01

    HIV-1 Gag is the master orchestrator of particle assembly. The central role of Gag at multiple stages of the HIV lifecycle has led to efforts to develop drugs that directly target Gag and prevent the formation and release of infectious particles. Until recently, however, only the catalytic site protease inhibitors have been available to inhibit late stages of HIV replication. This review summarizes the current state of development of antivirals that target Gag or disrupt late events in the retrovirus lifecycle such as maturation of the viral capsid. Maturation inhibitors represent an exciting new series of antiviral compounds, including those that specifically target CA-SP1 cleavage and the allosteric integrase inhibitors that inhibit maturation by a completely different mechanism. Numerous small molecules and peptides targeting CA have been studied in attempts to disrupt steps in assembly. Efforts to target CA have recently gained considerable momentum from the development of small molecules that bind CA and alter capsid stability at the post-entry stage of the lifecycle. Efforts to develop antivirals that inhibit incorporation of genomic RNA or to inhibit late budding events remain in preliminary stages of development. Overall, the development of novel antivirals targeting Gag and the late stages in HIV replication appears much closer to success than ever, with the new maturation inhibitors leading the way.

  1. Oral immunization of mice with transgenic tomato fruit expressing respiratory syncytial virus-F protein induces a systemic immune response.

    PubMed

    Sandhu, J S; Krasnyanski, S F; Domier, L L; Korban, S S; Osadjan, M D; Buetow, D E

    2000-04-01

    Respiratory syncytial virus (RSV) is one of the most important pathogens of infancy and early childhood. Here a fruit-based edible subunit vaccine against RSV was developed by expressing the RSV fusion (F) protein gene in transgenic tomato plants. The F-gene was expressed in ripening tomato fruit under the control of the fruit-specific E8 promoter. Oral immunization of mice with ripe transgenic tomato fruits led to the induction of both serum and mucosal RSV-F specific antibodies. The ratio of immunoglobulin subclasses produced in response to immunization suggested that a type 1 T-helper cell immune response was preferentially induced. Serum antibodies showed an increased titer when the immunized mice were exposed to inactivated RSV antigen.

  2. [Functional analysis of Grp and Iris, the gag and env domesticated errantivirus genes, in the Drosophila melanogaster genome].

    PubMed

    Makhnovskii, P A; Kuzmin, I V; Nefedova, L N; Kima, A I

    2016-01-01

    Drosophila melanogaster is the only invertebrate that contains endogenous retroviruses, which are called errantiviruses. Two domesticated genes, Grp and Iris, which originate from errantivirus gag and env, respectively, have been found in the D. melanogaster genome. The functions performed by the genes in Drosophila are still unclear. To identify the functions of domesticated gag and env in the D. melanogaster genome, expression of Iris and Grp was studied in strains differing by the presence or absence of the functional gypsy errantivirus. In addition, the expression levels were measured after injection of gram-positive and gram-negative bacteria, which activate different immune response pathways, and exposure to various abiotic stress factors. The presence of functional D. melanogaster retrovirus gypsy was found to increase the Grp expression level in somatic tissues of the carcass, while exerting no effect on the Iris expression level. Activation of the immune response in D. melanogaster by bacteria Bacillus cereus increased the Grp expression level and did not affect Iris expression. As for the effects of abiotic stress factors (oxidative stress, starvation, and heat and cold stress), the Grp expression level increased in response to starvation in D. melanogaster females, and the Iris expression level was downregulated in heat shock and oxidative stress. Based on the findings, Grp was assumed to play a direct role in the immune response in D. melanogaster; Iris is not involved in immune responses, but and apparently performs a cell function that is inhibited in stress.

  3. Immunization of mice with baculovirus-derived recombinant SV40 large tumour antigen induces protective tumour immunity to a lethal challenge with SV40-transformed cells.

    PubMed Central

    Shearer, M H; Bright, R K; Lanford, R E; Kennedy, R C

    1993-01-01

    In this study, we examined the humoral immune responses and in vivo tumour immunity induced by baculovirus recombinant simian virus 40 (SV40) large tumour antigen (rSV40 T-ag). BALB/c mice immunized with rSV40 T-ag produced antibody responses that recognized SV40 large tumour antigen (T-ag) by ELISA. Analysis of these anti-SV40 T-ag responses indicated that the antibodies recognized epitopes associated with both the carboxy and amino terminus of SV40 T-ag. This pattern of SV40 T-ag epitope recognition was similar to that observed in anti-SV40 T-ag responses induced by inoculation with irradiated SV40-transformed cells. Mice immunized with either rSV40 T-ag or with the inactivated transformed cells were protected from a subsequent in vivo lethal tumour challenge with live SV40-transformed cells. These studies suggest that humoral immune responses induced by rSV40 T-ag are similar in epitope specificity to that induced by inactivated SV40-transformed cells. In addition, recombinant tumour-specific antigens from papovaviruses, such as SV40, can be used to induce tumour immunity which protects from a subsequent lethal tumour challenge. This study may provide insight into the use of recombinant tumour antigens as putative tumour vaccines and in the development of active immunotherapeutic strategies for treating virus-induced cancers. PMID:7679059

  4. Induction of Mucosal and Systemic Immunity to a Recombinant Simian Immunodeficiency Viral Protein

    NASA Astrophysics Data System (ADS)

    Lehner, T.; Bergmeier, L. A.; Panagiotidi, C.; Tao, L.; Brookes, R.; Klavinskis, L. S.; Walker, P.; Walker, J.; Ward, R. G.; Hussain, L.; Gearing, A. J. H.; Adams, S. E.

    1992-11-01

    Heterosexual transmission through the cervico-vaginal mucosa is the principal route of human immunodeficiency virus (HIV) infection in Africa and is increasing in the United States and Europe. Vaginal immunization with simian immunodeficiency virus (SIV) had not yet been studied in nonhuman primates. Immune responses in macaques were investigated by stimulation of the genital and gut-associated lymphoid tissue with a recombinant, particulate SIV antigen. Vaginal, followed by oral, administration of the vaccine elicited three types of immunity: (i) gag protein p27-specific, secretory immunoglobulin A (IgA) and immunoglobulin G (IgG) in the vaginal fluid, (ii) specific CD4^+ T cell proliferation and helper function in B cell p27-specific IgA synthesis in the genital lymph nodes, and (iii) specific serum IgA and IgG, with CD4^+ T cell proliferative and helper functions in the circulating blood.

  5. The thermodynamics of Pr55Gag-RNA interaction regulate the assembly of HIV

    PubMed Central

    Waddington, Lynne; Hijnen, Marcel; Velkov, Tony; McKinstry, William J.

    2017-01-01

    The interactions that occur during HIV Pr55Gag oligomerization and genomic RNA packaging are essential elements that facilitate HIV assembly. However, mechanistic details of these interactions are not clearly defined. Here, we overcome previous limitations in producing large quantities of full-length recombinant Pr55Gag that is required for isothermal titration calorimetry (ITC) studies, and we have revealed the thermodynamic properties of HIV assembly for the first time. Thermodynamic analysis showed that the binding between RNA and HIV Pr55Gag is an energetically favourable reaction (ΔG<0) that is further enhanced by the oligomerization of Pr55Gag. The change in enthalpy (ΔH) widens sequentially from: (1) Pr55Gag-Psi RNA binding during HIV genome selection; to (2) Pr55Gag-Guanosine Uridine (GU)-containing RNA binding in cytoplasm/plasma membrane; and then to (3) Pr55Gag-Adenosine(A)-containing RNA binding in immature HIV. These data imply the stepwise increments of heat being released during HIV biogenesis may help to facilitate the process of viral assembly. By mimicking the interactions between A-containing RNA and oligomeric Pr55Gag in immature HIV, it was noted that a p6 domain truncated Pr50Gag Δp6 is less efficient than full-length Pr55Gag in this thermodynamic process. These data suggest a potential unknown role of p6 in Pr55Gag-Pr55Gag oligomerization and/or Pr55Gag-RNA interaction during HIV assembly. Our data provide direct evidence on how nucleic acid sequences and the oligomeric state of Pr55Gag regulate HIV assembly. PMID:28222188

  6. Modeling the dynamics and kinetics of HIV-1 Gag during viral assembly.

    PubMed

    Tomasini, Michael D; Johnson, Daniel S; Mincer, Joshua S; Simon, Sanford M

    2018-01-01

    We report a computational model for the assembly of HIV-1 Gag into immature viral particles at the plasma membrane. To reproduce experimental structural and kinetic properties of assembly, a process occurring on the order of minutes, a coarse-grained representation consisting of a single particle per Gag molecule is developed. The model uses information relating the functional interfaces implicated in Gag assembly, results from cryo electron-tomography, and biophysical measurements from fluorescence microscopy, such as the dynamics of Gag assembly at single virions. These experimental constraints eliminated many classes of potential interactions, and narrowed the model to a single interaction scheme with two non-equivalent interfaces acting to form Gags into a hexamer, and a third interface acting to link hexamers together. This model was able to form into a hexameric structure with correct lattice spacing and reproduced biologically relevant growth rates. We explored the effect of genomic RNA seeding punctum growth, finding that RNA may be a factor in locally concentrating Gags to initiate assembly. The simulation results infer that completion of assembly cannot be governed simply by Gag binding kinetics. However the addition of membrane curvature suggests that budding of the virion from the plasma membrane could factor into slowing incorporation of Gag at an assembly site resulting in virions of the same size and number of Gag molecules independent of Gag concentration or the time taken to complete assembly. To corroborate the results of our simulation model, we developed an analytic model for Gag assembly finding good agreement with the simulation results.

  7. Modeling the dynamics and kinetics of HIV-1 Gag during viral assembly

    PubMed Central

    Tomasini, Michael D.; Johnson, Daniel S.; Mincer, Joshua S.

    2018-01-01

    We report a computational model for the assembly of HIV-1 Gag into immature viral particles at the plasma membrane. To reproduce experimental structural and kinetic properties of assembly, a process occurring on the order of minutes, a coarse-grained representation consisting of a single particle per Gag molecule is developed. The model uses information relating the functional interfaces implicated in Gag assembly, results from cryo electron-tomography, and biophysical measurements from fluorescence microscopy, such as the dynamics of Gag assembly at single virions. These experimental constraints eliminated many classes of potential interactions, and narrowed the model to a single interaction scheme with two non-equivalent interfaces acting to form Gags into a hexamer, and a third interface acting to link hexamers together. This model was able to form into a hexameric structure with correct lattice spacing and reproduced biologically relevant growth rates. We explored the effect of genomic RNA seeding punctum growth, finding that RNA may be a factor in locally concentrating Gags to initiate assembly. The simulation results infer that completion of assembly cannot be governed simply by Gag binding kinetics. However the addition of membrane curvature suggests that budding of the virion from the plasma membrane could factor into slowing incorporation of Gag at an assembly site resulting in virions of the same size and number of Gag molecules independent of Gag concentration or the time taken to complete assembly. To corroborate the results of our simulation model, we developed an analytic model for Gag assembly finding good agreement with the simulation results. PMID:29677208

  8. Characterization of a small (25-kilodalton) derivative of the Rous sarcoma virus Gag protein competent for particle release.

    PubMed Central

    Weldon, R A; Wills, J W

    1993-01-01

    Retroviral Gag proteins have the ability to induce budding and particle release from the plasma membrane when expressed in the absence of all of the other virus-encoded components; however, the locations of the functional domains within the Gag protein that are important for this process are poorly understood. It was shown previously that the protease sequence of the Rous sarcoma virus (RSV) Gag protein can be replaced with a foreign polypeptide, iso-1-cytochrome c from a yeast, without disrupting particle assembly (R. A. Weldon, Jr., C. R. Erdie, M. G. Oliver, and J. W. Wills, J. Virol. 64:4169-4179, 1990). An unexpected product of the chimeric gag gene is a small, Gag-related protein named p25C. This product was of interest because of its high efficiency of packaging into particles. The goal of the experiments described here was to determine the mechanism by which p25C is synthesized and packaged into particles. The results demonstrate that it is not the product of proteolytic processing of the Gag-cytochrome precursor but is derived from an unusual spliced mRNA. cDNA clones of the spliced mRNA were obtained, and each expressed a product of approximately 25 kDa, designated p25M1, which was released into the growth medium in membrane-enclosed particles that were much lighter than authentic retrovirions as measured in sucrose density gradients. DNA sequencing revealed that the clones encode the first 180 of the 701 amino acids of the RSV Gag protein and no residues from iso-1-cytochrome c. This suggested that a domain in the carboxy-terminal half of Gag is important for the packaging of Gag proteins into dense arrays within the particles. In support of this hypothesis, particles of the correct density were obtained when a small segment from the carboxy terminus of the RSV Gag protein (residues 417 to 584) was included on the end of p25. Images PMID:8394460

  9. Outer membrane vesicles of Gallibacterium anatis induce protective immunity in egg-laying hens.

    PubMed

    Pors, Susanne E; Pedersen, Ida J; Skjerning, Ragnhild Bager; Thøfner, Ida C N; Persson, Gry; Bojesen, Anders M

    2016-11-15

    Gallibacterium anatis causes infections in the reproductive tract of egg-laying hens and induce increased mortality and decreased egg production. New prophylactic measures are needed in order to improve animal welfare and production efficiency. Bacterial outer membrane vesicles (OMVs) have previously shown promising results in protection against infections and we hypothesized that OMVs could serve as an immunogen to protect egg-laying hens against G. anatis. To investigate the immunogenic potential of G. anatis OMVs, two in vivo studies in egg-laying hens were made. The trials assessedthe degree of protection provided by immunization with G. anatis OMV against challenge and the IgY responses in serum after immunization and challenge, respectively. A total of 64 egg-laying hens were included in the trials. OMVs for immunization were produced and purified from a high-producing G. anatis ΔtolR mutant. Challenge was done with G. anatis 12656-12 and evaluated by scoring lesions and bacterial re-isolation rates from peritoneum. Finally, levels of OMV-specific IgY in sera were assayed by ELISA. Immunization with OMVs decreased the lesions scores significantly, while the bacterial re-isolation remained unchanged. Furthermore, a high OMV-specific IgY response was induced by immunization and subsequent challenge of the hens. The results strongly indicate that immunization with G. anatis OMVs provides significant protection against G. anatis challenge and induces specific antibody responses with high titers of OMV-specific IgY in serum. The results therefore show great promise for OMV based vaccines aiming at providing protecting against G. anatis in egg-laying hens. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. The dimer interfaces of protease and extra-protease domains influence the activation of protease and the specificity of GagPol cleavage.

    PubMed

    Pettit, Steven C; Gulnik, Sergei; Everitt, Lori; Kaplan, Andrew H

    2003-01-01

    Activation of the human immunodeficiency virus type 1 (HIV-1) protease is an essential step in viral replication. As is the case for all retroviral proteases, enzyme activation requires the formation of protease homodimers. However, little is known about the mechanisms by which retroviral proteases become active within their precursors. Using an in vitro expression system, we have examined the determinants of activation efficiency and the order of cleavage site processing for the protease of HIV-1 within the full-length GagPol precursor. Following activation, initial cleavage occurs between the viral p2 and nucleocapsid proteins. This is followed by cleavage of a novel site located in the transframe domain. Mutational analysis of the dimer interface of the protease produced differential effects on activation and specificity. A subset of mutations produced enhanced cleavage at the amino terminus of the protease, suggesting that, in the wild-type precursor, cleavages that liberate the protease are a relatively late event. Replacement of the proline residue at position 1 of the protease dimer interface resulted in altered cleavage of distal sites and suggests that this residue functions as a cis-directed specificity determinant. In summary, our studies indicate that interactions within the protease dimer interface help determine the order of precursor cleavage and contribute to the formation of extended-protease intermediates. Assembly domains within GagPol outside the protease domain also influence enzyme activation.

  11. Poorly expressed endogenous ecotropic provirus of DBA/2 mice encodes a mutant Pr65gag protein that is not myristylated.

    PubMed Central

    Copeland, N G; Jenkins, N A; Nexø, B; Schultz, A M; Rein, A; Mikkelsen, T; Jørgensen, P

    1988-01-01

    DBA/2 mice carry a single endogenous ecotropic murine leukemia provirus designated Emv-3. Although this provirus appears to be nondefective by genomic restriction enzyme mapping, weanling mice do not produce virus and only about one-third of adult mice ever express virus. 5-Iododeoxyuridine and 5-azacytidine, two potent inducers of ecotropic virus expression, are relatively ineffective at inducing Emv-3 expression. However, the chemical carcinogen 7,12-dimethylbenz(a)anthracene can induce ecotropic virus expression in approximately 95% of treated DBA/2 mice. Previous experiments involving DNA transfection and marker rescue analysis of molecularly cloned Emv-3 DNA suggested that Emv-3 carries a small defect(s) in the gag gene, not detectable by restriction enzyme mapping, that inhibits virus expression in vivo and in vitro. Using a combination of approaches, including DNA sequencing, peptide mapping, and metabolic labeling of cells with [3H]myristate, we have demonstrated that the defect in Emv-3 most likely results from a single nucleotide substitution within the gene for p15gag that inhibits myristylation of the Pr65gag N terminus. Myristylation of Pr65gag is thought to be required for this protein to associate with the plasma membrane and is essential for virus particle formation. These results provide a conceptual framework for understanding how Emv-3 expression is regulated during development and after chemical induction. Images PMID:2826810

  12. Newborn Mice Vaccination with BCG.HIVA222 + MVA.HIVA Enhances HIV-1-Specific Immune Responses: Influence of Age and Immunization Routes

    PubMed Central

    Saubi, Narcís; Im, Eung-Jun; Fernández-Lloris, Raquel; Gil, Olga; Cardona, Pere-Joan; Gatell, Josep Maria; Hanke, Tomáš; Joseph, Joan

    2011-01-01

    We have evaluated the influence of age and immunization routes for induction of HIV-1- and M. tuberculosis-specific immune responses after neonatal (7 days old) and adult (7 weeks old) BALB/c mice immunization with BCG.HIVA222 prime and MVA.HIVA boost. The specific HIV-1 cellular immune responses were analyzed in spleen cells. The body weight of the newborn mice was weekly recorded. The frequencies of HIV-specific CD8+ T cells producing IFN-γ were higher in adult mice vaccinated intradermally and lower in adult and newborn mice vaccinated subcutaneously. In all cases the IFN-γ production was significantly higher when mice were primed with BCG.HIVA222 compared with BCGwt. When the HIV-specific CTL activity was assessed, the frequencies of specific killing were higher in newborn mice than in adults. The prime-boost vaccination regimen which includes BCG.HIVA222 and MVA.HIVA was safe when inoculated to newborn mice. The administration of BCG.HIVA222 to newborn mice is safe and immunogenic and increased the HIV-specific responses induced by MVA.HIVA vaccine. It might be a good model for infant HIV and Tuberculosis bivalent vaccine. PMID:21603216

  13. Deciphering the role of the Gag-Pol ribosomal frameshift signal in HIV-1 RNA genome packaging.

    PubMed

    Nikolaitchik, Olga A; Hu, Wei-Shau

    2014-04-01

    A key step of retroviral replication is packaging of the viral RNA genome during virus assembly. Specific packaging is mediated by interactions between the viral protein Gag and elements in the viral RNA genome. In HIV-1, similar to most retroviruses, the packaging signal is located within the 5' untranslated region and extends into the gag-coding region. A recent study reported that a region including the Gag-Pol ribosomal frameshift signal plays an important role in HIV-1 RNA packaging; deletions or mutations that affect the RNA structure of this signal lead to drastic decreases (10- to 50-fold) in viral RNA packaging and virus titer. We examined here the role of the ribosomal frameshift signal in HIV-1 RNA packaging by studying the RNA packaging and virus titer in the context of proviruses. Three mutants with altered ribosomal frameshift signal, either through direct deletion of the signal, mutation of the 6U slippery sequence, or alterations of the secondary structure were examined. We found that RNAs from all three mutants were packaged efficiently, and they generate titers similar to that of a virus containing the wild-type ribosomal frameshift signal. We conclude that although the ribosomal frameshift signal plays an important role in regulating the replication cycle, this RNA element is not directly involved in regulating RNA encapsidation. To generate infectious viruses, HIV-1 must package viral RNA genome during virus assembly. The specific HIV-1 genome packaging is mediated by interactions between the structural protein Gag and elements near the 5' end of the viral RNA known as packaging signal. In this study, we examined whether the Gag-Pol ribosomal frameshift signal is important for HIV-1 RNA packaging as recently reported. Our results demonstrated that when Gag/Gag-Pol is supplied in trans, none of the tested ribosomal frameshift signal mutants has defects in RNA packaging or virus titer. These studies provide important information on how HIV-1

  14. Deciphering the Role of the Gag-Pol Ribosomal Frameshift Signal in HIV-1 RNA Genome Packaging

    PubMed Central

    Nikolaitchik, Olga A.

    2014-01-01

    ABSTRACT A key step of retroviral replication is packaging of the viral RNA genome during virus assembly. Specific packaging is mediated by interactions between the viral protein Gag and elements in the viral RNA genome. In HIV-1, similar to most retroviruses, the packaging signal is located within the 5′ untranslated region and extends into the gag-coding region. A recent study reported that a region including the Gag-Pol ribosomal frameshift signal plays an important role in HIV-1 RNA packaging; deletions or mutations that affect the RNA structure of this signal lead to drastic decreases (10- to 50-fold) in viral RNA packaging and virus titer. We examined here the role of the ribosomal frameshift signal in HIV-1 RNA packaging by studying the RNA packaging and virus titer in the context of proviruses. Three mutants with altered ribosomal frameshift signal, either through direct deletion of the signal, mutation of the 6U slippery sequence, or alterations of the secondary structure were examined. We found that RNAs from all three mutants were packaged efficiently, and they generate titers similar to that of a virus containing the wild-type ribosomal frameshift signal. We conclude that although the ribosomal frameshift signal plays an important role in regulating the replication cycle, this RNA element is not directly involved in regulating RNA encapsidation. IMPORTANCE To generate infectious viruses, HIV-1 must package viral RNA genome during virus assembly. The specific HIV-1 genome packaging is mediated by interactions between the structural protein Gag and elements near the 5′ end of the viral RNA known as packaging signal. In this study, we examined whether the Gag-Pol ribosomal frameshift signal is important for HIV-1 RNA packaging as recently reported. Our results demonstrated that when Gag/Gag-Pol is supplied in trans, none of the tested ribosomal frameshift signal mutants has defects in RNA packaging or virus titer. These studies provide important

  15. Mobility of human immunodeficiency virus type 1 Pr55Gag in living cells.

    PubMed

    Gomez, Candace Y; Hope, Thomas J

    2006-09-01

    Human immunodeficiency virus type 1 (HIV-1) assembly requires the converging of thousands of structural proteins on cellular membranes to form a tightly packed immature virion. The Gag polyprotein contains all of the determinants important for viral assembly and must move around in the cell in order to form particles. This work has focused on Gag mobility in order to provide more insights into the dynamics of particle assembly. Key to these studies was the use of several fluorescently labeled Gag derivatives. We used fluorescence recovery after photobleaching as well as photoactivation to determine Gag mobility. Upon expression, Gag can be localized diffusely in the cytoplasm, associated with the plasma membrane, or in virus-like particles (VLPs). Here we show that Gag VLPs are primarily localized in the plasma membrane and do not colocalize with CD63. We have shown using full-length Gag as well as truncation mutants fused to green fluorescent protein that Gag is highly mobile in live cells when it is not assembled into VLPs. Results also showed that this mobility is highly dependent upon cholesterol. When cholesterol is depleted from cells expressing Gag, mobility is significantly decreased. Once cholesterol was replenished, Gag mobility returned to wild-type levels. Taken together, results from these mobility studies suggest that Gag is highly mobile and that as the assembly process proceeds, mobility decreases. These studies also suggest that Gag assembly must occur in cholesterol-rich domains in the plasma membrane.

  16. Strain-specific protective immunity following vaccination against experimental Trypanosoma cruzi infection.

    PubMed

    Haolla, Filipe A; Claser, Carla; de Alencar, Bruna C G; Tzelepis, Fanny; de Vasconcelos, José Ronnie; de Oliveira, Gabriel; Silvério, Jaline C; Machado, Alexandre V; Lannes-Vieira, Joseli; Bruna-Romero, Oscar; Gazzinelli, Ricardo T; dos Santos, Ricardo Ribeiro; Soares, Milena B P; Rodrigues, Mauricio M

    2009-09-18

    Immunisation with Amastigote Surface Protein 2 (asp-2) and trans-sialidase (ts) genes induces protective immunity in highly susceptible A/Sn mice, against infection with parasites of the Y strain of Trypanosoma cruzi. Based on immunological and biological strain variations in T. cruzi parasites, our goal was to validate our vaccination results using different parasite strains. Due to the importance of the CD8(+) T cells in protective immunity, we initially determined which strains expressed the immunodominant H-2K(k)-restricted epitope TEWETGQI. We tested eight strains, four of which elicited immune responses to this epitope (Y, G, Colombian and Colombia). We selected the Colombian and Colombia strains for our studies. A/Sn mice were immunised with different regimens using both T. cruzi genes (asp-2 and ts) simultaneously and subsequently challenged with blood trypomastigotes. Immune responses before the challenge were confirmed by the presence of specific antibodies and peptide-specific T cells. Genetic vaccination did not confer protective immunity against acute infection with a lethal dose of the Colombian strain. In contrast, we observed a drastic reduction in parasitemia and a significant increase in survival, following challenge with an otherwise lethal dose of the Colombia strain. In many surviving animals with late-stage chronic infection, we observed alterations in the heart's electrical conductivity, compared to naive mice. In summary, we concluded that immunity against T. cruzi antigens, similar to viruses and bacteria, may be strain-specific and have a negative impact on vaccine development.

  17. Priming T-cell responses with recombinant measles vaccine vector in a heterologous prime-boost setting in non-human primates.

    PubMed

    Bolton, Diane L; Santra, Sampa; Swett-Tapia, Cindy; Custers, Jerome; Song, Kaimei; Balachandran, Harikrishnan; Mach, Linh; Naim, Hussein; Kozlowski, Pamela A; Lifton, Michelle; Goudsmit, Jaap; Letvin, Norman; Roederer, Mario; Radošević, Katarina

    2012-09-07

    Licensed live attenuated virus vaccines capable of expressing transgenes from other pathogens have the potential to reduce the number of childhood immunizations by eliciting robust immunity to multiple pathogens simultaneously. Recombinant attenuated measles virus (rMV) derived from the Edmonston Zagreb vaccine strain was engineered to express simian immunodeficiency virus (SIV) Gag protein for the purpose of evaluating the immunogenicity of rMV as a vaccine vector in rhesus macaques. rMV-Gag immunization alone elicited robust measles-specific humoral and cellular responses, but failed to elicit transgene (Gag)-specific immune responses, following aerosol or intratracheal/intramuscular delivery. However, when administered as a priming vaccine to a heterologous boost with recombinant adenovirus serotype 5 expressing the same transgene, rMV-Gag significantly enhanced Gag-specific T lymphocyte responses following rAd5 immunization. Gag-specific humoral responses were not enhanced, however, which may be due to either the transgene or the vector. Cellular response priming by rMV against the transgene was highly effective even when using a suboptimal dose of rAd5 for the boost. These data demonstrate feasibility of using rMV as a priming component of heterologous prime-boost vaccine regimens for pathogens requiring strong cellular responses. Copyright © 2012 Elsevier Ltd. All rights reserved.

  18. Interaction of Bacteriophages with the Immune System: Induction of Bacteriophage-Specific Antibodies.

    PubMed

    Dąbrowska, Krystyna

    2018-01-01

    In all cases when a bacteriophage makes direct contact with a mammalian organism, it may challenge the mammalian immunological system. Its major consequence is production of antibodies specific to the bacteriophage. Here we present protocols applicable in studies of bacteriophage ability to induce specific antibodies. The protocols have been divided into three parts: purification, immunization, and detection (ELISA).

  19. Mapping of the self-interaction domains in the simian immunodeficiency virus Gag polyprotein.

    PubMed

    Rauddi, María L; Mac Donald, Cecilia L; Affranchino, José L; González, Silvia A

    2011-03-01

    To gain a better understanding of the assembly process in simian immunodeficiency virus (SIV), we first established the conditions under which recombinant SIV Gag lacking the C-terminal p6 domain (SIV GagΔp6) assembled in vitro into spherical particles. Based on the full multimerization capacity of SIV GagΔp6, and to identify the Gag sequences involved in homotypic interactions, we next developed a pull-down assay in which a panel of histidine-tagged SIV Gag truncation mutants was tested for its ability to associate in vitro with GST-SIVGagΔp6. Removal of the nucleocapsid (NC) domain from Gag impaired its ability to interact with GST-SIVGagΔp6. However, this Gag mutant consisting of the matrix (MA) and capsid (CA) domains still retained 50% of the wild-type binding activity. Truncation of SIV Gag from its N-terminus yielded markedly different results. The Gag region consisting of the CA and NC was significantly more efficient than wild-type Gag at interacting in vitro with GST-SIVGagΔp6. Notably, a small Gag subdomain containing the C-terminal third of the CA and the entire NC not only bound to GST-SIVGagΔp6 in vitro at wild-type levels, but also associated in vivo with full-length Gag and was recruited into extracellular particles. Interestingly, when the mature Gag products were analyzed, the MA and NC interacted with GST-SIVGagΔp6 with efficiencies representing 20% and 40%, respectively, of the wild-type value, whereas the CA failed to bind to GST-SIVGagΔp6, despite being capable of self-associating into multimeric complexes.

  20. Spatiotemporally restricted arenavirus replication induces immune surveillance and type I interferon-dependent tumour regression

    PubMed Central

    Kalkavan, Halime; Sharma, Piyush; Kasper, Stefan; Helfrich, Iris; Pandyra, Aleksandra A.; Gassa, Asmae; Virchow, Isabel; Flatz, Lukas; Brandenburg, Tim; Namineni, Sukumar; Heikenwalder, Mathias; Höchst, Bastian; Knolle, Percy A.; Wollmann, Guido; von Laer, Dorothee; Drexler, Ingo; Rathbun, Jessica; Cannon, Paula M.; Scheu, Stefanie; Bauer, Jens; Chauhan, Jagat; Häussinger, Dieter; Willimsky, Gerald; Löhning, Max; Schadendorf, Dirk; Brandau, Sven; Schuler, Martin; Lang, Philipp A.; Lang, Karl S.

    2017-01-01

    Immune-mediated effector molecules can limit cancer growth, but lack of sustained immune activation in the tumour microenvironment restricts antitumour immunity. New therapeutic approaches that induce a strong and prolonged immune activation would represent a major immunotherapeutic advance. Here we show that the arenaviruses lymphocytic choriomeningitis virus (LCMV) and the clinically used Junin virus vaccine (Candid#1) preferentially replicate in tumour cells in a variety of murine and human cancer models. Viral replication leads to prolonged local immune activation, rapid regression of localized and metastatic cancers, and long-term disease control. Mechanistically, LCMV induces antitumour immunity, which depends on the recruitment of interferon-producing Ly6C+ monocytes and additionally enhances tumour-specific CD8+ T cells. In comparison with other clinically evaluated oncolytic viruses and to PD-1 blockade, LCMV treatment shows promising antitumoural benefits. In conclusion, therapeutically administered arenavirus replicates in cancer cells and induces tumour regression by enhancing local immune responses. PMID:28248314

  1. A correlate of HIV-1 control consisting of both innate and adaptive immune parameters best predicts viral load by multivariable analysis in HIV-1 infected viremic controllers and chronically-infected non-controllers.

    PubMed

    Tomescu, Costin; Liu, Qin; Ross, Brian N; Yin, Xiangfan; Lynn, Kenneth; Mounzer, Karam C; Kostman, Jay R; Montaner, Luis J

    2014-01-01

    HIV-1 infected viremic controllers maintain durable viral suppression below 2000 copies viral RNA/ml without anti-retroviral therapy (ART), and the immunological factor(s) associated with host control in presence of low but detectable viral replication are of considerable interest. Here, we utilized a multivariable analysis to identify which innate and adaptive immune parameters best correlated with viral control utilizing a cohort of viremic controllers (median 704 viral RNA/ml) and non-controllers (median 21,932 viral RNA/ml) that were matched for similar CD4+ T cell counts in the absence of ART. We observed that HIV-1 Gag-specific CD8+ T cell responses were preferentially targeted over Pol-specific responses in viremic controllers (p = 0.0137), while Pol-specific responses were positively associated with viral load (rho = 0.7753, p = 0.0001, n = 23). Viremic controllers exhibited significantly higher NK and plasmacytoid dendritic cells (pDC) frequency as well as retained expression of the NK CD16 receptor and strong target cell-induced NK cell IFN-gamma production compared to non-controllers (p<0.05). Despite differences in innate and adaptive immune function however, both viremic controllers (p<0.05) and non-controller subjects (p<0.001) exhibited significantly increased CD8+ T cell activation and spontaneous NK cell degranulation compared to uninfected donors. Overall, we identified that a combination of innate (pDC frequency) and adaptive (Pol-specific CD8+ T cell responses) immune parameters best predicted viral load (R2 = 0.5864, p = 0.0021, n = 17) by a multivariable analysis. Together, this data indicates that preferential Gag-specific over Pol-specific CD8+ T cell responses along with a retention of functional innate subsets best predict host control over viral replication in HIV-1 infected viremic controllers compared to chronically-infected non-controllers.

  2. Dimerization of the SP1 Region of HIV-1 Gag Induces a Helical Conformation and Association into Helical Bundles: Implications for Particle Assembly.

    PubMed

    Datta, Siddhartha A K; Clark, Patrick K; Fan, Lixin; Ma, Buyong; Harvin, Demetria P; Sowder, Raymond C; Nussinov, Ruth; Wang, Yun-Xing; Rein, Alan

    2016-02-15

    HIV-1 immature particle (virus-like particle [VLP]) assembly is mediated largely by interactions between the capsid (CA) domains of Gag molecules but is facilitated by binding of the nucleocapsid (NC) domain to nucleic acid. We previously investigated the role of SP1, a "spacer" between CA and NC, in VLP assembly. We found that small changes in SP1 drastically disrupt assembly and that a peptide representing the sequence around the CA-SP1 junction is helical at high but not low concentrations. We suggested that by virtue of such a concentration-dependent change, this region could act as a molecular switch to activate HIV-1 Gag for VLP assembly. A leucine zipper domain can replace NC in Gag and still lead to the efficient assembly of VLPs. We find that SP1 mutants also disrupt assembly by these Gag-Zip proteins and have now studied a small fragment of this Gag-Zip protein, i.e., the CA-SP1 junction region fused to a leucine zipper. Dimerization of the zipper places SP1 at a high local concentration, even at low total concentrations. In this context, the CA-SP1 junction region spontaneously adopts a helical conformation, and the proteins associate into tetramers. Tetramerization requires residues from both CA and SP1. The data suggest that once this region becomes helical, its propensity to self-associate could contribute to Gag-Gag interactions and thus to particle assembly. There is complete congruence between CA/SP1 sequences that promote tetramerization when fused to zippers and those that permit the proper assembly of full-length Gag; thus, equivalent interactions apparently participate in VLP assembly and in SP1-Zip tetramerization. Assembly of HIV-1 Gag into virus-like particles (VLPs) appears to require an interaction with nucleic acid, but replacement of its principal nucleic acid-binding domain with a dimerizing leucine zipper domain leads to the assembly of RNA-free VLPs. It has not been clear how dimerization triggers assembly. Results here show that the

  3. Dimerization of the SP1 Region of HIV-1 Gag Induces a Helical Conformation and Association into Helical Bundles: Implications for Particle Assembly

    PubMed Central

    Clark, Patrick K.; Fan, Lixin; Ma, Buyong; Harvin, Demetria P.; Sowder, Raymond C.; Nussinov, Ruth; Wang, Yun-Xing

    2015-01-01

    ABSTRACT HIV-1 immature particle (virus-like particle [VLP]) assembly is mediated largely by interactions between the capsid (CA) domains of Gag molecules but is facilitated by binding of the nucleocapsid (NC) domain to nucleic acid. We previously investigated the role of SP1, a “spacer” between CA and NC, in VLP assembly. We found that small changes in SP1 drastically disrupt assembly and that a peptide representing the sequence around the CA-SP1 junction is helical at high but not low concentrations. We suggested that by virtue of such a concentration-dependent change, this region could act as a molecular switch to activate HIV-1 Gag for VLP assembly. A leucine zipper domain can replace NC in Gag and still lead to the efficient assembly of VLPs. We find that SP1 mutants also disrupt assembly by these Gag-Zip proteins and have now studied a small fragment of this Gag-Zip protein, i.e., the CA-SP1 junction region fused to a leucine zipper. Dimerization of the zipper places SP1 at a high local concentration, even at low total concentrations. In this context, the CA-SP1 junction region spontaneously adopts a helical conformation, and the proteins associate into tetramers. Tetramerization requires residues from both CA and SP1. The data suggest that once this region becomes helical, its propensity to self-associate could contribute to Gag-Gag interactions and thus to particle assembly. There is complete congruence between CA/SP1 sequences that promote tetramerization when fused to zippers and those that permit the proper assembly of full-length Gag; thus, equivalent interactions apparently participate in VLP assembly and in SP1-Zip tetramerization. IMPORTANCE Assembly of HIV-1 Gag into virus-like particles (VLPs) appears to require an interaction with nucleic acid, but replacement of its principal nucleic acid-binding domain with a dimerizing leucine zipper domain leads to the assembly of RNA-free VLPs. It has not been clear how dimerization triggers assembly

  4. T-cell receptor transfer for boosting HIV-1-specific T-cell immunity in HIV-1-infected patients.

    PubMed

    Mummert, Christiane; Hofmann, Christian; Hückelhoven, Angela G; Bergmann, Silke; Mueller-Schmucker, Sandra M; Harrer, Ellen G; Dörrie, Jan; Schaft, Niels; Harrer, Thomas

    2016-09-10

    Strategies to cure HIV-1 infection require the eradication of viral reservoirs. An innovative approach for boosting the cytotoxic T-lymphocyte response is the transfer of T-cell receptors (TCRs). Previously, we have shown that electroporation of TCR-encoding mRNA is able to reprogram CD8 T cells derived from healthy donors. So far, it is unknown whether the transfer of HIV-1-specific TCRs is capable to reprogram CD8 T cells of HIV-1-infected patients. To assess the efficiency of TCR-transfer by mRNA electroporation and the functionality of reprogramed T cells in HIV-1-infected patients, we performed an in-vitro analysis of TCR-transfer into T cells from HIV-1-infected patients in various stages of disease and from healthy controls. Peripheral blood mononuclear cells from 16 HIV-1-infected patients (nine HLA-A02-positive, seven HLA-A02-negative) and from five healthy controls were electroporated with mRNA-constructs encoding TCRs specific for the HLA-A02/HIV-1-gag p17 epitope SLYNTVATL (SL9). Functionality of the TCRs was measured by γIFN-ELISpot assays. SL9/TCR transfection into peripheral blood mononuclear cells from both HLA-A02-positive and HLA-A02-negative HIV-1-infected patients and from healthy blood donors reprogramed T cells for recognition of SL9-presenting HLA-A02-positive cells in γIFN-ELISpot assays. SL9/TCR-transfer into T cells from an immunodeficient AIDS patient could induce recognition of SL9-expressing target cells only after reversion of T-cell dysfunction by antiretroviral therapy. The transfer of HIV-1-p17-specific TCRs into T cells is functional both in HIV-1-infected patients as well as in healthy blood donors. TCR-transfer is a promising method to boost the immune system against HIV-1.

  5. GVHD prevents NK-cell-dependent leukemia and virus-specific innate immunity.

    PubMed

    Bunting, Mark D; Varelias, Antiopi; Souza-Fonseca-Guimaraes, Fernando; Schuster, Iona S; Lineburg, Katie E; Kuns, Rachel D; Fleming, Peter; Locke, Kelly R; Huntington, Nicholas D; Blazar, Bruce R; Lane, Steven W; Tey, Siok-Keen; MacDonald, Kelli P A; Smyth, Mark J; Degli-Esposti, Mariapia A; Hill, Geoffrey R

    2017-02-02

    Allogeneic bone marrow transplantation (allo-BMT) is a curative therapy for hematological malignancies, but is associated with significant complications, principally graft-versus-host disease (GVHD) and opportunistic infections. Natural killer (NK) cells mediate important innate immunity that provides a temporal bridge until the reconstruction of adaptive immunity. Here, we show that the development of GVHD after allo-BMT prevented NK-cell reconstitution, particularly within the maturing M1 and M2 NK-cell subsets in association with exaggerated activation, apoptosis, and autophagy. Donor T cells were critical in this process by limiting the availability of interleukin 15 (IL-15), and administration of IL-15/IL-15Rα or immune suppression with rapamycin could restore NK-cell reconstitution. Importantly, the NK-cell defect induced by GVHD resulted in the failure of NK-cell-dependent in vivo cytotoxicity and graft-versus-leukemia effects. Control of cytomegalovirus infection after allo-BMT was also impaired during GVHD. Thus, during GVHD, donor T cells compete with NK cells for IL-15 thereby inducing profound defects in NK-cell reconstitution that compromise both leukemia and pathogen-specific immunity. © 2017 by The American Society of Hematology.

  6. Chimeric SV40 virus-like particles induce specific cytotoxicity and protective immunity against influenza A virus without the need of adjuvants

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kawano, Masaaki; Morikawa, Katsuma; Suda, Tatsuya

    Virus-like particles (VLPs) are a promising vaccine platform due to the safety and efficiency. However, it is still unclear whether polyomavirus-based VLPs are useful for this purpose. Here, we attempted to evaluate the potential of polyomavirus VLPs for the antiviral vaccine using simian virus 40 (SV40). We constructed chimeric SV40-VLPs carrying an HLA-A{sup ⁎}02:01-restricted, cytotoxic T lymphocyte (CTL) epitope derived from influenza A virus. HLA-A{sup ⁎}02:01-transgenic mice were then immunized with the chimeric SV40-VLPs. The chimeric SV40-VLPs effectively induced influenza-specific CTLs and heterosubtypic protection against influenza A viruses without the need of adjuvants. Because DNase I treatment of the chimericmore » SV40-VLPs did not disrupt CTL induction, the intrinsic adjuvant property may not result from DNA contaminants in the VLP preparation. In addition, immunization with the chimeric SV40-VLPs generated long-lasting memory CTLs. We here propose that the chimeric SV40-VLPs harboring an epitope may be a promising CTL-based vaccine platform with self-adjuvant properties. - Highlights: • We constructed chimeric SV40-VLPs carrying an influenza virus-derived CTL epitope. • Chimeric SV40-VLPs induce influenza-specific CTLs in mice without adjuvants. • Chimeric SV40-VLPs induce heterosubtypic protection against influenza A viruses. • Chimeric SV40-VLPs induce long-lasting memory CTLs. • Chimeric SV40-VLPs is a promising vaccine platform with self-adjuvant properties.« less

  7. Immunization with Outer Membrane Vesicles Displaying Designer Glycotopes Yields Class-Switched, Glycan-Specific Antibodies

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Valentine, Jenny L.; Chen, Linxiao; Perregaux, Emily C.

    The development of antibodies against specific glycan epitopes poses a significant challenge due to difficulties obtaining desired glycans at sufficient quantity and purity, and the fact that glycans are usually weakly immunogenic. To address this challenge, we leveraged the potent immunostimulatory activity of bacterial outer membrane vesicles (OMVs) to deliver designer glycan epitopes to the immune system. This approach involved heterologous expression of two clinically important glycans, namely polysialic acid (PSA) and Thomsen-Friedenreich antigen (T antigen) in hypervesiculating strains of non-pathogenic Escherichia coli. The resulting glycOMVs displayed structural mimics of PSA or T antigen on their surfaces, and induced highmore » titers of glycan-specific IgG antibodies following immunization in mice. In the case of PSA glycOMVs, serum antibodies potently killed Neisseria meningitidis serogroup B (MenB), whose outer capsule is PSA, in a serum bactericidal assay. These findings demonstrate the potential of glycOMVs for inducing class-switched, humoral immune responses against glycan antigens.« less

  8. Immunization with Outer Membrane Vesicles Displaying Designer Glycotopes Yields Class-Switched, Glycan-Specific Antibodies

    DOE PAGES

    Valentine, Jenny L.; Chen, Linxiao; Perregaux, Emily C.; ...

    2016-06-23

    The development of antibodies against specific glycan epitopes poses a significant challenge due to difficulties obtaining desired glycans at sufficient quantity and purity, and the fact that glycans are usually weakly immunogenic. To address this challenge, we leveraged the potent immunostimulatory activity of bacterial outer membrane vesicles (OMVs) to deliver designer glycan epitopes to the immune system. This approach involved heterologous expression of two clinically important glycans, namely polysialic acid (PSA) and Thomsen-Friedenreich antigen (T antigen) in hypervesiculating strains of non-pathogenic Escherichia coli. The resulting glycOMVs displayed structural mimics of PSA or T antigen on their surfaces, and induced highmore » titers of glycan-specific IgG antibodies following immunization in mice. In the case of PSA glycOMVs, serum antibodies potently killed Neisseria meningitidis serogroup B (MenB), whose outer capsule is PSA, in a serum bactericidal assay. These findings demonstrate the potential of glycOMVs for inducing class-switched, humoral immune responses against glycan antigens.« less

  9. Potential of Equine Herpesvirus 1 as a Vector for Immunization

    PubMed Central

    Trapp, Sascha; von Einem, Jens; Hofmann, Helga; Köstler, Josef; Wild, Jens; Wagner, Ralf; Beer, Martin; Osterrieder, Nikolaus

    2005-01-01

    Key problems using viral vectors for vaccination and gene therapy are antivector immunity, low transduction efficiencies, acute toxicity, and limited capacity to package foreign genetic information. It could be demonstrated that animal and human cells were efficiently transduced with equine herpesvirus 1 (EHV-1) reconstituted from viral DNA maintained and manipulated in Escherichia coli. Between 13 and 23% of primary human CD3+, CD4+, CD8+, CD11b+, and CD19+ cells and more than 70% of CD4+ MT4 cells or various human tumor cell lines (MeWo, Huh7, HeLa, 293T, or H1299) could be transduced with one infectious unit of EHV-1 per cell. After intranasal instillation of EHV-1 into mice, efficient transgene expression in lungs was detectable. Successful immunization using EHV-1 was shown after delivery of the human immunodeficiency virus type 1 Pr55gag precursor by the induction of a Gag-specific CD8+ immune response in mice. Because EHV-1 was not neutralized by human sera containing high titers of antibodies directed against human herpesviruses 1 to 5, it is concluded that this animal herpesvirus has enormous potential as a vaccine vector, because it is able to efficiently transduce a variety of animal and human cells, has high DNA packaging capacity, and can conveniently be maintained and manipulated in prokaryotic cells. PMID:15827159

  10. Post-translational modification of Rauscher leukemia virus precursor polyproteins encoded by the gag gene.

    PubMed Central

    Schultz, A M; Rabin, E H; Oroszlan, S

    1979-01-01

    Post-translational modifications of retrovirus gag gene-encoded polyproteins include proteolytic cleavage, phosphorylation, and glycosylation. To study the sequence of these events, we labeled JLS-V9 cells chronically infected with Rauscher murine leukemia virus in pulse-chase experiments with the radioactive precursors [35S]methionine, [14C]mannose, [3H]glucosamine, and [32P]phosphate. Newly synthesized gag polyproteins which incorporated label, and the modified products derived from them, were identified by immunoprecipitation of cell lysates with anti-p30 rabbit serum, followed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and autoradiography. Pulse-chase experiments were carried out in the presence as well as in the absence of tunicamycin, an inhibitor of glycosylation. Among the three major polyproteins synthesized in the absence of tunicamycin, two were found to be glycosylated but not phosphorylated. These were designated gPr80gag and gP94gag. Both shared identical [35S]methionine peptides with Pr65gag and p30. Of the two nonglycosylated precursors, Pr65gag and Pr75gag, only Pr65gag was found to be detectably phosphorylated, and Pr75gag could be readily identified only when glycosylation was inhibited. On the basis of these results, a scheme for the post-translational modification of gag polyproteins is proposed. According to this scheme the gag gene-encoded polyproteins are processed from a common precursor, Pr75gag, by two divergent pathways: one leading through the intermediate Pr65gag to internal virion components via cleavage and phosphorylation and the other via tunicamycin-sensitive mannosylation to the intermediate gPr80gag, which is further glycosylated to yield cell surface polyprotein gP94gag. Images PMID:480454

  11. Replication-defective Friend murine leukemia virus particles containing uncleaved gag polyproteins and decreased levels of envelope glycoprotein.

    PubMed Central

    Collins, J K; Chesebro, B

    1981-01-01

    An erythroleukemia cell clone, 7C, which failed to produce reverse transcriptase-containing virions or infectious virus, was found to produce noninfectious virus particles by gradient banding of [3H]leucine- and [3H]uridine-labeled virions. The RNA from the 7C virus was shown to consist of the normal 70S size component, which converted to 35S upon heat denaturation. In contrast, the 7C virion proteins showed multiple defects. Analysis of the virion proteins by gel electrophoresis demonstrated that the pr65 gag precursor was incorporated into the 7C virus and that the processing of this precursor was severely diminished. Polymerase proteins pr180gag-pol and pr120pol were also detected in virions, and a third possible polymerase protein, p70, was reduced in size compared to its normal counterpart, p80. Incorporation of the viral gp70 glycoprotein into particles was also reduced 10-fold, despite synthesis and incorporation of gp70 into the 7C cell membrane in normal amounts. Pulse-chase analysis of the synthesis of the viral gag and env proteins in 7C cells showed greatly reduced amounts of pr180gag-pol, pr65gag, p80gag, and p42gag, whereas pr90env, gp70, and spleen focus-forming virus-specific gp55 were synthesized and processed normally. These results suggested that at least one defect in 7C virus was impaired cleavage of gag or pol proteins or both, most likely due to a lack of the appropriate viral protease, and that this lack of cleavage might affect incorporation of gp70 into virus particles. Images PMID:6163868

  12. Immunotherapy of murine retrovirus-induced acquired immunodeficiency by CD4 T regulatory cell depletion and PD-1 blockade.

    PubMed

    Li, Wen; Green, William R

    2011-12-01

    LP-BM5 retrovirus induces a complex disease featuring an acquired immunodeficiency syndrome termed murine AIDS (MAIDS) in susceptible strains of mice, such as C57BL/6 (B6). CD4 T helper effector cells are required for MAIDS induction and progression of viral pathogenesis. CD8 T cells are not needed for viral pathogenesis, but rather, are essential for protection from disease in resistant strains, such as BALB/c. We have discovered an immunodominant cytolytic T lymphocyte (CTL) epitope encoded in a previously unrecognized LP-BM5 retroviral alternative (+1 nucleotide [nt]) gag translational open reading frame. CTLs specific for this cryptic gag epitope are the basis of protection from LP-BM5-induced immunodeficiency in BALB/c mice, and the inability of B6 mice to mount an anti-gag CTL response appears critical to the initiation and progression of LP-BM5-induced MAIDS. However, uninfected B6 mice primed by LP-BM5-induced tumors can generate CTL responses to an LP-BM5 retrovirus infection-associated epitope(s) that is especially prevalent on such MAIDS tumor cells, indicating the potential to mount a protective CD8 T-cell response. Here, we utilized this LP-BM5 retrovirus-induced disease system to test whether modulation of normal immune down-regulatory mechanisms can alter retroviral pathogenesis. Thus, following in vivo depletion of CD4 T regulatory (Treg) cells and/or selective interruption of PD-1 negative signaling in the CD8 T-cell compartment, retroviral pathogenesis was significantly decreased, with the combined treatment of CD4 Treg cell depletion and PD-1 blockade working in a synergistic fashion to substantially reduce the induction of MAIDS.

  13. The retrotransposon Tf1 assembles virus-like particles that contain excess Gag relative to integrase because of a regulated degradation process.

    PubMed

    Atwood, A; Lin, J H; Levin, H L

    1996-01-01

    The retrotransposon Tf1, isolated from Schizosaccharomyces pombe, contains a single open reading frame with sequences encoding Gag, protease, reverse transcriptase, and integrase (IN). Tf1 has previously been shown to possess significant transposition activity. Although Tf1 proteins do assemble into virus-like particles, the assembly does not require readthrough of a translational reading frame shift or stop codon, common mechanisms used by retroelements to express Gag in molar excess of the polymerase proteins. This study was designed to determine if Tf1 particles contain equal amounts of Gag and polymerase proteins or whether they contain the typical molar excess of Gag. After using two separate methods to calibrate the strength of our antibodies, we found that both S. pombe extracts and partially purified Tf1 particles contained a 26-fold molar excess of Gag relative to IN. Knowing that Gag and IN are derived from the same Tf1 primary translation product, we concluded that the excess Gag most likely resulted from specific degradation of IN. We obtained evidence of regulated IN degradation in comparisons of Tf1 protein extracted from log-phase cells and that extracted from stationary-phase cells. The log-phase cells contained equal molar amounts of Gag and IN, whereas cells approaching stationary phase rapidly degraded IN, leaving an excess of Gag. Analysis of the reverse transcripts indicated that the bulk of reverse transcription occurred within the particles that possess a molar excess of Gag.

  14. Mutational analysis of the gag-pol junction of Moloney murine leukemia virus: requirements for expression of the gag-pol fusion protein.

    PubMed Central

    Felsenstein, K M; Goff, S P

    1992-01-01

    The gag-pol polyprotein of the murine and feline leukemia viruses is expressed by translational readthrough of a UAG terminator codon at the 3' end of the gag gene. To explore the cis-acting sequence requirements for the readthrough event in vivo, we generated a library of mutants of the Moloney murine leukemia virus with point mutations near the terminator codon and tested the mutant viral DNAs for the ability to direct synthesis of the gag-pol fusion protein and formation of infectious virus. The analysis showed that sequences 3' to the terminator are necessary and sufficient for the process. The results do not support a role for one proposed stem-loop structure that includes the terminator but are consistent with the involvement of another stem-loop 3' to the terminator. One mutant, containing two compensatory changes in this stem structure, was temperature sensitive for replication and for formation of the gag-pol protein. The results suggest that RNA sequence and structure are critical determinants of translational readthrough in vivo. Images PMID:1404606

  15. HIV-1 Antibody Neutralization Breadth Is Associated with Enhanced HIV-Specific CD4+ T Cell Responses

    PubMed Central

    Soghoian, Damien Z.; Lindqvist, Madelene; Ghebremichael, Musie; Donaghey, Faith; Carrington, Mary; Seaman, Michael S.; Kaufmann, Daniel E.; Walker, Bruce D.

    2015-01-01

    ABSTRACT Antigen-specific CD4+ T helper cell responses have long been recognized to be a critical component of effective vaccine immunity. CD4+ T cells are necessary to generate and maintain humoral immune responses by providing help to antigen-specific B cells for the production of antibodies. In HIV infection, CD4+ T cells are thought to be necessary for the induction of Env-specific broadly neutralizing antibodies. However, few studies have investigated the role of HIV-specific CD4+ T cells in association with HIV neutralizing antibody activity in vaccination or natural infection settings. Here, we conducted a comprehensive analysis of HIV-specific CD4+ T cell responses in a cohort of 34 untreated HIV-infected controllers matched for viral load, with and without neutralizing antibody breadth to a panel of viral strains. Our results show that the breadth and magnitude of Gag-specific CD4+ T cell responses were significantly higher in individuals with neutralizing antibodies than in those without neutralizing antibodies. The breadth of Gag-specific CD4+ T cell responses was positively correlated with the breadth of neutralizing antibody activity. Furthermore, the breadth and magnitude of gp41-specific, but not gp120-specific, CD4+ T cell responses were significantly elevated in individuals with neutralizing antibodies. Together, these data suggest that robust Gag-specific CD4+ T cells and, to a lesser extent, gp41-specific CD4+ T cells may provide important intermolecular help to Env-specific B cells that promote the generation or maintenance of Env-specific neutralizing antibodies. IMPORTANCE One of the earliest discoveries related to CD4+ T cell function was their provision of help to B cells in the development of antibody responses. Yet little is known about the role of CD4+ T helper responses in the setting of HIV infection, and no studies to date have evaluated the impact of HIV-specific CD4+ T cells on the generation of antibodies that can neutralize

  16. The Dimer Interfaces of Protease and Extra-Protease Domains Influence the Activation of Protease and the Specificity of GagPol Cleavage

    PubMed Central

    Pettit, Steven C.; Gulnik, Sergei; Everitt, Lori; Kaplan, Andrew H.

    2003-01-01

    Activation of the human immunodeficiency virus type 1 (HIV-1) protease is an essential step in viral replication. As is the case for all retroviral proteases, enzyme activation requires the formation of protease homodimers. However, little is known about the mechanisms by which retroviral proteases become active within their precursors. Using an in vitro expression system, we have examined the determinants of activation efficiency and the order of cleavage site processing for the protease of HIV-1 within the full-length GagPol precursor. Following activation, initial cleavage occurs between the viral p2 and nucleocapsid proteins. This is followed by cleavage of a novel site located in the transframe domain. Mutational analysis of the dimer interface of the protease produced differential effects on activation and specificity. A subset of mutations produced enhanced cleavage at the amino terminus of the protease, suggesting that, in the wild-type precursor, cleavages that liberate the protease are a relatively late event. Replacement of the proline residue at position 1 of the protease dimer interface resulted in altered cleavage of distal sites and suggests that this residue functions as a cis-directed specificity determinant. In summary, our studies indicate that interactions within the protease dimer interface help determine the order of precursor cleavage and contribute to the formation of extended-protease intermediates. Assembly domains within GagPol outside the protease domain also influence enzyme activation. PMID:12477841

  17. Antiviral Innate Immune Activation in HIV-Infected Adults Negatively Affects H1/IC31-Induced Vaccine-Specific Memory CD4+ T Cells

    PubMed Central

    Schindler, Tobias; Kagina, Benjamin M.; Zhang, Jitao David; Lukindo, Tedson; Mpina, Maxmillian; Bang, Peter; Kromann, Ingrid; Hoff, Søren T.; Andersen, Peter; Reither, Klaus; Churchyard, Gavin J.; Certa, Ulrich

    2015-01-01

    Tuberculosis (TB) remains a global health problem, with vaccination being a necessary strategy for disease containment and elimination. A TB vaccine should be safe and immunogenic as well as efficacious in all affected populations, including HIV-infected individuals. We investigated the induction and maintenance of vaccine-induced memory CD4+ T cells following vaccination with the subunit vaccine H1/IC31. H1/IC31 was inoculated twice on study days 0 and 56 among HIV-infected adults with CD4+ lymphocyte counts of >350 cells/mm3. Whole venous blood stimulation was conducted with the H1 protein, and memory CD4+ T cells were analyzed using intracellular cytokine staining and polychromatic flow cytometry. We identified high responders, intermediate responders, and nonresponders based on detection of interleukin-2 (IL-2), tumor necrosis factor alpha (TNF-α), and gamma interferon (IFN-γ) expressing central (TCM) and effector memory CD4+ T cells (TEM) 182 days after the first immunization. Amplicon-based transcript quantification using next-generation sequencing was performed to identify differentially expressed genes that correlated with vaccine-induced immune responses. Genes implicated in resolution of inflammation discriminated the responders from the nonresponders 3 days after the first inoculation. The volunteers with higher expression levels of genes involved in antiviral innate immunity at baseline showed impaired H1-specific TCM and TEM maintenance 6 months after vaccination. Our study showed that in HIV-infected volunteers, expression levels of genes involved in the antiviral innate immune response affected long-term maintenance of H1/IC31 vaccine-induced cellular immunity. (The clinical trial was registered in the Pan African Clinical Trials Registry [PACTR] with the identifier PACTR201105000289276.) PMID:25924764

  18. Activation of c-myb by 5' retrovirus promoter insertion in myeloid neoplasms is dependent upon an intact alternative splice donor site (SD') in gag

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ramirez, Jean Marie; Houzet, Laurent; Koller, Richard

    2004-12-20

    Alternative splicing in Mo-MuLV recruits a splice donor site, SD', within the gag that is required for optimal replication in vitro. Remarkably, this SD' site was also found to be utilized for production of oncogenic gag-myb fusion RNA in 100% of murine-induced myeloid leukemia (MML) in pristane-treated BALB/c mice. Therefore, we investigated the influence of silent mutations of SD' in this model. Although there was no decrease in the overall incidence of disease, there was a decrease in the incidence of myeloid leukemia with a concomitant increase in lymphoid leukemia. Importantly, there was a complete lack of myeloid tumors associatedmore » with 5' insertional mutagenic activation of c-myb, suggesting the specific requirement of the SD' site in this mechanism.« less

  19. Novel chimeric virus-like particles vaccine displaying MERS-CoV receptor-binding domain induce specific humoral and cellular immune response in mice.

    PubMed

    Wang, Chong; Zheng, Xuexing; Gai, Weiwei; Wong, Gary; Wang, Hualei; Jin, Hongli; Feng, Na; Zhao, Yongkun; Zhang, Weijiao; Li, Nan; Zhao, Guoxing; Li, Junfu; Yan, Jinghua; Gao, Yuwei; Hu, Guixue; Yang, Songtao; Xia, Xianzhu

    2017-04-01

    Middle East respiratory syndrome coronavirus (MERS-CoV) has continued spreading since its emergence in 2012 with a mortality rate of 35.6%, and is a potential pandemic threat. Prophylactics and therapies are urgently needed to address this public health problem. We report here the efficacy of a vaccine consisting of chimeric virus-like particles (VLP) expressing the receptor binding domain (RBD) of MERS-CoV. In this study, a fusion of the canine parvovirus (CPV) VP2 structural protein gene with the RBD of MERS-CoV can self-assemble into chimeric, spherical VLP (sVLP). sVLP retained certain parvovirus characteristics, such as the ability to agglutinate pig erythrocytes, and structural morphology similar to CPV virions. Immunization with sVLP induced RBD-specific humoral and cellular immune responses in mice. sVLP-specific antisera from these animals were able to prevent pseudotyped MERS-CoV entry into susceptible cells, with neutralizing antibody titers reaching 1: 320. IFN-γ, IL-4 and IL-2 secreting cells induced by the RBD were detected in the splenocytes of vaccinated mice by ELISpot. Furthermore, mice inoculated with sVLP or an adjuvanted sVLP vaccine elicited T-helper 1 (Th1) and T-helper 2 (Th2) cell-mediated immunity. Our study demonstrates that sVLP displaying the RBD of MERS-CoV are promising prophylactic candidates against MERS-CoV in a potential outbreak situation. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Genetic diversity in the feline leukemia virus gag gene.

    PubMed

    Kawamura, Maki; Watanabe, Shinya; Odahara, Yuka; Nakagawa, So; Endo, Yasuyuki; Tsujimoto, Hajime; Nishigaki, Kazuo

    2015-06-02

    Feline leukemia virus (FeLV) belongs to the Gammaretrovirus genus and is horizontally transmitted among cats. FeLV is known to undergo recombination with endogenous retroviruses already present in the host during FeLV-subgroup A infection. Such recombinant FeLVs, designated FeLV-subgroup B or FeLV-subgroup D, can be generated by transduced endogenous retroviral env sequences encoding the viral envelope. These recombinant viruses have biologically distinct properties and may mediate different disease outcomes. The generation of such recombinant viruses resulted in structural diversity of the FeLV particle and genetic diversity of the virus itself. FeLV env diversity through mutation and recombination has been studied, while gag diversity and its possible effects are less well understood. In this study, we investigated recombination events in the gag genes of FeLVs isolated from naturally infected cats and reference isolates. Recombination and phylogenetic analyses indicated that the gag genes often contain endogenous FeLV sequences and were occasionally replaced by entire endogenous FeLV gag genes. Phylogenetic reconstructions of FeLV gag sequences allowed for classification into three distinct clusters, similar to those previously established for the env gene. Analysis of the recombination junctions in FeLV gag indicated that these variants have similar recombination patterns within the same genotypes, indicating that the recombinant viruses were horizontally transmitted among cats. It remains to be investigated whether the recombinant sequences affect the molecular mechanism of FeLV transmission. These findings extend our understanding of gammaretrovirus evolutionary patterns in the field. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Oral immunization of mice with plant-derived fimbrial adhesin FaeG induces systemic and mucosal K88ad enterotoxigenic Escherichia coli-specific immune responses.

    PubMed

    Liang, Wanqi; Huang, Yahong; Yang, Xinghong; Zhou, Zhiai; Pan, Aihu; Qian, Bingjun; Huang, Cheng; Chen, Jianxiu; Zhang, Dabing

    2006-04-01

    The importance of adhesins in pathogenicity has resulted in them being useful targets in the defense against bacterial infections. To produce edible vaccines against piglet diarrhea caused by enterotoxigenic Escherichia coli (ETEC), plants were genetically engineered to produce recombinant fimbrial adhesin FaeG. To evaluate the efficacy of the edible vaccine FaeG in mice, the soluble protein extracts were examined by about 15 microg recombinant FaeG for each oral immunization dose per mouse. After four doses of vaccination, both IgG and IgA antibodies specific to K88ad fimbriae were elicited in serum, and specific IgA antibodies were also evoked in feces of the immunized mice. Moreover, visible K88ad ETEC agglutination by the specific serum from the immunized mice was observed, implying the antibody was highly specific and effective. Results from an in vitro villous-adhesion assay further confirmed that serum antibodies of the immunized mice could inhibit K88ad ETEC from adhering to pig intestinal receptors, further demonstrating the oral immune efficacy of the plant-derived FaeG. This study provides a promising, noninvasive method for vaccinating swine by feeding supplements of transgenic plant. Moreover, the low cost and ease of delivery of this edible ETEC vaccine will facilitate its application in economically disadvantaged regions.

  2. Three-Year Durability of Immune Responses Induced by HIV-DNA and HIV-Modified Vaccinia Virus Ankara and Effect of a Late HIV-Modified Vaccinia Virus Ankara Boost in Tanzanian Volunteers.

    PubMed

    Joachim, Agricola; Munseri, Patricia J; Nilsson, Charlotta; Bakari, Muhammad; Aboud, Said; Lyamuya, Eligius F; Tecleab, Teghesti; Liakina, Valentina; Scarlatti, Gabriella; Robb, Merlin L; Earl, Patricia L; Moss, Bernard; Wahren, Britta; Mhalu, Fred; Ferrari, Guido; Sandstrom, Eric; Biberfeld, Gunnel

    2017-08-01

    We explored the duration of immune responses and the effect of a late third HIV-modified vaccinia virus Ankara (MVA) boost in HIV-DNA primed and HIV-MVA boosted Tanzanian volunteers. Twenty volunteers who had previously received three HIV-DNA and two HIV-MVA immunizations were given a third HIV-MVA immunization 3 years after the second HIV-MVA boost. At the time of the third HIV-MVA, 90% of the vaccinees had antibodies to HIV-1 subtype C gp140 (median titer 200) and 85% to subtype B gp160 (median titer 100). The majority of vaccinees had detectable antibody-dependent cellular cytotoxicity (ADCC)-mediating antibodies, 70% against CRF01_AE virus-infected cells (median titer 239) and 84% against CRF01_AE gp120-coated cells (median titer 499). A high proportion (74%) of vaccinees had IFN-γ ELISpot responses, 63% to Gag and 42% to Env, 3 years after the second HIV-MVA boost. After the third HIV-MVA, there was an increase in Env-binding antibodies and ADCC-mediating antibodies relative to the response seen at the time of the third HIV-MVA vaccination, p < .0001 and p < .05, respectively. The frequency of IFN-γ ELISpot responses increased to 95% against Gag or Env and 90% to both Gag and Env, p = .064 and p = .002, respectively. In conclusion, the HIV-DNA prime/HIV-MVA boost regimen elicited potent antibody and cellular immune responses with remarkable durability, and a third HIV-MVA immunization significantly boosted both antibody and cellular immune responses relative to the levels detected at the time of the third HIV-MVA, but not to higher levels than after the second HIV-MVA.

  3. Measles virus-induced suppression of immune responses.

    PubMed

    Griffin, Diane E

    2010-07-01

    Measles is an important cause of child mortality that has a seemingly paradoxical interaction with the immune system. In most individuals, the immune response is successful in eventually clearing measles virus (MV) infection and in establishing life-long immunity. However, infection is also associated with persistence of viral RNA and several weeks of immune suppression, including loss of delayed type hypersensitivity responses and increased susceptibility to secondary infections. The initial T-cell response includes CD8+ and T-helper 1 CD4+ T cells important for control of infectious virus. As viral RNA persists, there is a shift to a T-helper 2 CD4+ T-cell response that likely promotes B-cell maturation and durable antibody responses but may suppress macrophage activation and T-helper 1 responses to new infections. Suppression of mitogen-induced lymphocyte proliferation can be induced by lymphocyte infection with MV or by lymphocyte exposure to a complex of the hemagglutinin and fusion surface glycoproteins without infection. Dendritic cells (DCs) are susceptible to infection and can transmit infection to lymphocytes. MV-infected DCs are unable to stimulate a mixed lymphocyte reaction and can induce lymphocyte unresponsiveness through expression of MV glycoproteins. Thus, multiple factors may contribute both to measles-induced immune suppression and to the establishment of durable protective immunity.

  4. The catalytic A1 domains of cholera toxin and heat-labile enterotoxin are potent DNA adjuvants that evoke mixed Th1/Th17 cellular immune responses

    PubMed Central

    Bagley, Kenneth; Xu, Rong; Ota-Setlik, Ayuko; Egan, Michael; Schwartz, Jennifer; Fouts, Timothy

    2015-01-01

    DNA encoded adjuvants are well known for increasing the magnitude of cellular and/or humoral immune responses directed against vaccine antigens. DNA adjuvants can also tune immune responses directed against vaccine antigens to better protect against infection of the target organism. Two potent DNA adjuvants that have unique abilities to tune immune responses are the catalytic A1 domains of Cholera Toxin (CTA1) and Heat-Labile Enterotoxin (LTA1). Here, we have characterized the adjuvant activities of CTA1 and LTA1 using HIV and SIV genes as model antigens. Both of these adjuvants enhanced the magnitude of antigen-specific cellular immune responses on par with those induced by the well-characterized cytokine adjuvants IL-12 and GM-CSF. CTA1 and LTA1 preferentially enhanced cellular responses to the intracellular antigen SIVmac239-gag over those for the secreted HIVBaL-gp120 antigen. IL-12, GM-CSF and electroporation did the opposite suggesting differences in the mechanisms of actions of these diverse adjuvants. Combinations of CTA1 or LTA1 with IL-12 or GM-CSF generated additive and better balanced cellular responses to both of these antigens. Consistent with observations made with the holotoxin and the CTA1-DD adjuvant, CTA1 and LTA1 evoked mixed Th1/Th17 cellular immune responses. Together, these results show that CTA1 and LTA1 are potent DNA vaccine adjuvants that favor the intracellular antigen gag over the secreted antigen gp120 and evoke mixed Th1/Th17 responses against both of these antigens. The results also indicate that achieving a balanced immune response to multiple intracellular and extracellular antigens delivered via DNA vaccination may require combining adjuvants that have different and complementary mechanisms of action. PMID:26042527

  5. CXCR6 is a marker for protective antigen-specific cells in the lungs after intranasal immunization against Mycobacterium tuberculosis.

    PubMed

    Lee, Lian Ni; Ronan, Edward O; de Lara, Catherine; Franken, Kees L M C; Ottenhoff, Tom H M; Tchilian, Elma Z; Beverley, Peter C L

    2011-08-01

    Convincing correlates of protective immunity against tuberculosis have been elusive. In BALB/c mice, intranasal immunization with a replication-deficient recombinant adenovirus expressing Mycobacterium tuberculosis antigen 85A (adenovirus-85A) induces protective lower respiratory tract immunity against pulmonary challenge with Mycobacterium tuberculosis, while intradermal immunization with adenovirus-85A does not. Here we report that intranasal immunization with adenovirus-85A induces expression of the chemokine receptor CXCR6 on lung CD8 T lymphocytes, which is maintained for at least 3 months. CXCR6-positive antigen-specific T cell numbers are increased among bronchoalveolar lavage-recoverable cells. Similarly, intranasal immunization with recombinant antigen 85A with adjuvant induces CXCR6 expression on lung CD4 cells in BALB/c and C57BL/6 mice, while a synthetic ESAT6(1-20) peptide with adjuvant induces CXCR6 expression in C57BL/6 mice. Parenteral immunization fails to do so. Upregulation of CXCR6 is accompanied by a transient elevation of serum CXCL16 after intranasal immunization, and lung cells cultured ex vivo from mice immunized intranasally show increased production of CXCL16. Administration of CXCL16 and cognate antigen intranasally to mice previously immunized parenterally increases the number of antigen-specific T lymphocytes in the bronchoalveolar lavage-recoverable population, which mediates inhibition of the early growth of Mycobacterium tuberculosis after challenge. We conclude that expression of CXCR6 on lung T lymphocytes is a correlate of local protective immunity against Mycobacterium tuberculosis after intranasal immunization and that CXCR6 and CXCL16 play an important role in the localization of T cells within lung tissue and the bronchoalveolar lavage-recoverable compartment.

  6. CXCR6 Is a Marker for Protective Antigen-Specific Cells in the Lungs after Intranasal Immunization against Mycobacterium tuberculosis▿

    PubMed Central

    Lee, Lian Ni; Ronan, Edward O.; de Lara, Catherine; Franken, Kees L. M. C.; Ottenhoff, Tom H. M.; Tchilian, Elma Z.; Beverley, Peter C. L.

    2011-01-01

    Convincing correlates of protective immunity against tuberculosis have been elusive. In BALB/c mice, intranasal immunization with a replication-deficient recombinant adenovirus expressing Mycobacterium tuberculosis antigen 85A (adenovirus-85A) induces protective lower respiratory tract immunity against pulmonary challenge with Mycobacterium tuberculosis, while intradermal immunization with adenovirus-85A does not. Here we report that intranasal immunization with adenovirus-85A induces expression of the chemokine receptor CXCR6 on lung CD8 T lymphocytes, which is maintained for at least 3 months. CXCR6-positive antigen-specific T cell numbers are increased among bronchoalveolar lavage-recoverable cells. Similarly, intranasal immunization with recombinant antigen 85A with adjuvant induces CXCR6 expression on lung CD4 cells in BALB/c and C57BL/6 mice, while a synthetic ESAT61–20 peptide with adjuvant induces CXCR6 expression in C57BL/6 mice. Parenteral immunization fails to do so. Upregulation of CXCR6 is accompanied by a transient elevation of serum CXCL16 after intranasal immunization, and lung cells cultured ex vivo from mice immunized intranasally show increased production of CXCL16. Administration of CXCL16 and cognate antigen intranasally to mice previously immunized parenterally increases the number of antigen-specific T lymphocytes in the bronchoalveolar lavage-recoverable population, which mediates inhibition of the early growth of Mycobacterium tuberculosis after challenge. We conclude that expression of CXCR6 on lung T lymphocytes is a correlate of local protective immunity against Mycobacterium tuberculosis after intranasal immunization and that CXCR6 and CXCL16 play an important role in the localization of T cells within lung tissue and the bronchoalveolar lavage-recoverable compartment. PMID:21628524

  7. Nasal immunization with M cell-targeting ligand-conjugated ApxIIA toxin fragment induces protective immunity against Actinobacillus pleuropneumoniae infection in a murine model.

    PubMed

    Park, Jisang; Seo, Ki-Weon; Kim, Sae-Hae; Lee, Ha-Yan; Kim, Bumseok; Lim, Chae Woong; Kim, Jin-Hee; Yoo, Han Sang; Jang, Yong-Suk

    2015-05-15

    Actinobacillus pleuropneumoniae is the causative agent of porcine pleuropneumonia and severe economic loss in the swine industry has been caused by the infection. Therefore, the development of an effective vaccine against the bacteria is necessary. ApxII toxin, among several virulence factors expressed by the bacteria, is considered to be a promising vaccine candidate because ApxII toxin not only accompanies cytotoxic and hemolytic activities, but is also expressed in all 15 serotypes of bacteria except serotypes 10 and 14. In this study, we identified the peptide ligand capable of targeting the ligand-conjugated ApxIIA #5 fragment antigen to nasopharynx-associated lymphoid tissue. It was found that nasal immunization with ligand-conjugated ApxIIA #5 induced efficient mucosal and systemic immune responses measured at the levels of antigen-specific antibodies, cytokine-secreting cells after antigen exposure, and antigen-specific lymphocyte proliferation. More importantly, the nasal immunization induced protective immunity against nasal challenge infection of the bacteria, which was confirmed by histopathological studies and bacterial clearance after challenge infection. Collectively, we confirmed that the ligand capable of targeting the ligand-conjugated antigen to nasopharynx-associated lymphoid tissue can be used as an effective nasal vaccine adjuvant to induce protective immunity against A. pleuropneumoniae infection. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Oral Combination Vaccine, Comprising Bifidobacterium Displaying Hepatitis C Virus Nonstructural Protein 3 and Interferon-α, Induces Strong Cellular Immunity Specific to Nonstructural Protein 3 in Mice.

    PubMed

    Kitagawa, Koichi; Omoto, Chika; Oda, Tsugumi; Araki, Ayame; Saito, Hiroki; Shigemura, Katsumi; Katayama, Takane; Hotta, Hak; Shirakawa, Toshiro

    2017-04-01

    We previously generated an oral hepatitis C virus (HCV) vaccine using Bifidobacterium displaying the HCV nonstructural protein 3 (NS3) polypeptide. NS3-specific cellular immunity is important for viral clearance and recovery from HCV infection. In this study, we enhanced the cellular immune responses induced by our oral HCV vaccine, Bifidobacterium longum 2165 (B. longum 2165), by combining interferon-α (IFN-α) as an adjuvant with the vaccine in a mouse experimental model. IFN-α is a widely used cytokine meeting the standard of care (SOC) for HCV infection and plays various immunoregulatory roles. We treated C57BL/6N mice with B. longum 2165 every other day and/or IFN-α twice a week for a month and then analyzed the immune responses using spleen cells. We determined the induction of NS3-specific cellular immunity by cytokine quantification, intracellular cytokine staining, and a cytotoxic T lymphocyte (CTL) assay targeting EL4 tumor cells expressing NS3/4A protein (EL4-NS3/4A). We also treated mice bearing EL4-NS3/4A tumor with the combination therapy in vivo. The results confirmed that the combination therapy of B. longum 2165 and IFN-α induced significantly higher IFN-γ secretion, higher population of CD4 + T and CD8 + T cells secreting IFN-γ, and higher CTL activity against EL4-NS3/4A cells compared with the control groups of phosphate-buffered saline, B. longum 2165 alone, and IFN-α alone (p < 0.05). We also confirmed that the combination therapy strongly enhanced tumor growth inhibitory effects in vivo with no serious adverse effects (p < 0.05). These results suggest that the combination of B. longum 2165 and IFN-α could induce a strong cellular immunity specific to NS3 protein as a combination therapy augmenting the current SOC immunotherapy against chronic HCV infection.

  9. Manipulating the antigen-specific immune response by the hydrophobicity of amphiphilic poly(γ-glutamic acid) nanoparticles.

    PubMed

    Shima, Fumiaki; Akagi, Takami; Uto, Tomofumi; Akashi, Mitsuru

    2013-12-01

    The new generation vaccines are safe but poorly immunogenic, and thus they require the use of adjuvants. However, conventional vaccine adjuvants fail to induce potent cellular immunity, and their toxicity and side-effects hinder the clinical use. Therefore, a vaccine adjuvant which is safe and can induce an antigen-specific cellular immunity-biased immune response is urgently required. In the development of nanoparticle-based vaccine adjuvants, the hydrophobicity is one of the most important factors. It could control the interaction between the encapsulated antigens and/or nanoparticles with immune cells. In this study, nanoparticles (NPs) composed of amphiphilic poly(γ-glutamic acid)-graft-L-phenylalanine ethyl ester (γ-PGA-Phe) with various grafting degrees of hydrophobic side chains were prepared to evaluate the effect of hydrophobicity of vaccine carriers on the antigen encapsulation behavior, cellular uptake, activation of dendritic cells (DCs), and induction of antigen-specific cellular immunity-biased immune responses. These NPs could efficiently encapsulate antigens, and the uptake amount of the encapsulated antigen by DCs was dependent on the hydrophobicity of γ-PGA-Phe NPs. Moreover, the activation potential of the DCs and the induction of antigen-specific cellular immunity were correlated with the hydrophobicity of γ-PGA-Phe NPs. By controlling the hydrophobicity of antigen-encapsulated γ-PGA-Phe NPs, the activation potential of DCs was able to manipulate about 5 to 30-hold than the conventional vaccine, and the cellular immunity was about 10 to 40-hold. These results suggest that the hydrophobicity of NPs is a key factor for changing the interaction between NPs and immune cells, and thus the induction of cellular immunity-biased immune response could be achieved by controlling the hydrophobicity of them. Copyright © 2013 Elsevier Ltd. All rights reserved.

  10. Maternal immunity enhances systemic recall immune responses upon oral immunization of piglets with F4 fimbriae.

    PubMed

    Nguyen, Ut V; Melkebeek, Vesna; Devriendt, Bert; Goetstouwers, Tiphanie; Van Poucke, Mario; Peelman, Luc; Goddeeris, Bruno M; Cox, Eric

    2015-06-23

    F4 enterotoxigenic Escherichia coli (ETEC) cause diarrhoea and mortality in piglets leading to severe economic losses. Oral immunization of piglets with F4 fimbriae induces a protective intestinal immune response evidenced by an F4-specific serum and intestinal IgA response. However, successful oral immunization of pigs with F4 fimbriae in the presence of maternal immunity has not been demonstrated yet. In the present study we aimed to evaluate the effect of maternal immunity on the induction of a systemic immune response upon oral immunization of piglets. Whereas F4-specific IgG and IgA could be induced by oral immunization of pigs without maternal antibodies and by intramuscular immunization of pigs with maternal antibodies, no such response was seen in the orally immunized animals with maternal antibodies. Since maternal antibodies can mask an antibody response, we also looked by ELIspot assays for circulating F4-specific antibody secreting cells (ASCs). Enumerating the F4-specific ASCs within the circulating peripheral blood mononuclear cells, and the number of F4-specific IgA ASCs within the circulating IgA(+) B-cells revealed an F4-specific immune response in the orally immunized animals with maternal antibodies. Interestingly, results suggest a more robust IgA booster response by oral immunization of pigs with than without maternal antibodies. These results demonstrate that oral immunization of piglets with F4-specific maternal antibodies is feasible and that these maternal antibodies seem to enhance the secondary systemic immune response. Furthermore, our ELIspot assay on enriched IgA(+) B-cells could be used as a screening procedure to optimize mucosal immunization protocols in pigs with maternal immunity.

  11. Indoleamine 2,3-dioxygenase specific, cytotoxic T cells as immune regulators.

    PubMed

    Sørensen, Rikke Baek; Hadrup, Sine Reker; Svane, Inge Marie; Hjortsø, Mads Christian; Thor Straten, Per; Andersen, Mads Hald

    2011-02-17

    Indoleamine 2,3-dioxygenase (IDO) is an immunoregulatory enzyme that is implicated in suppressing T-cell immunity in normal and pathologic settings. Here, we describe that spontaneous cytotoxic T-cell reactivity against IDO exists not only in patients with cancer but also in healthy persons. We show that the presence of such IDO-specific CD8(+) T cells boosted T-cell immunity against viral or tumor-associated antigens by eliminating IDO(+) suppressive cells. This had profound effects on the balance between interleukin-17 (IL-17)-producing CD4(+) T cells and regulatory T cells. Furthermore, this caused an increase in the production of the proinflammatory cytokines IL-6 and tumor necrosis factor-α while decreasing the IL-10 production. Finally, the addition of IDO-inducing agents (ie, the TLR9 ligand cytosine-phosphate-guanosine, soluble cytotoxic T lymphocyte-associated antigen 4, or interferon γ) induced IDO-specific T cells among peripheral blood mononuclear cells from patients with cancer as well as healthy donors. In the clinical setting, IDO may serve as an important and widely applicable target for immunotherapeutic strategies in which IDO plays a significant regulatory role. We describe for the first time effector T cells with a general regulatory function that may play a vital role for the mounting or maintaining of an effective adaptive immune response. We suggest terming such effector T cells "supporter T cells."

  12. [Physical restraints and gagging in unnatural death].

    PubMed

    Grellner, W; Madea, B

    1993-01-01

    Practices of binding and gagging can be found in different types of unnatural death; three case reports concerning fatal autoeroticism, suicide and homicide are presented. In such cases investigations are usually concentrated on the question whether binding and gagging could be carried out by the persons themselves. Loosely bound final loops, especially of the hands, missing local haemorrhages and the discovery of binding instructions support the assumption of self-binding. Accompanying injuries and the entire situation must be taken into special consideration.

  13. Subcellular Localization of HIV-1 gag-pol mRNAs Regulates Sites of Virion Assembly

    PubMed Central

    Becker, Jordan T.

    2017-01-01

    ABSTRACT Full-length unspliced human immunodeficiency virus type 1 (HIV-1) RNAs serve dual roles in the cytoplasm as mRNAs encoding the Gag and Gag-Pol capsid proteins as well as genomic RNAs (gRNAs) packaged by Gag into virions undergoing assembly at the plasma membrane (PM). Because Gag is sufficient to drive the assembly of virus-like particles even in the absence of gRNA binding, whether viral RNA trafficking plays an active role in the native assembly pathway is unknown. In this study, we tested the effects of modulating the cytoplasmic abundance or distribution of full-length viral RNAs on Gag trafficking and assembly in the context of single cells. Increasing full-length viral RNA abundance or distribution had little-to-no net effect on Gag assembly competency when provided in trans. In contrast, artificially tethering full-length viral RNAs or surrogate gag-pol mRNAs competent for Gag synthesis to non-PM membranes or the actin cytoskeleton severely reduced net virus particle production. These effects were explained, in large part, by RNA-directed changes to Gag's distribution in the cytoplasm, yielding aberrant subcellular sites of virion assembly. Interestingly, RNA-dependent disruption of Gag trafficking required either of two cis-acting RNA regulatory elements: the 5′ packaging signal (Psi) bound by Gag during genome encapsidation or, unexpectedly, the Rev response element (RRE), which regulates the nuclear export of gRNAs and other intron-retaining viral RNAs. Taken together, these data support a model for native infection wherein structural features of the gag-pol mRNA actively compartmentalize Gag to preferred sites within the cytoplasm and/or PM. IMPORTANCE The spatial distribution of viral mRNAs within the cytoplasm can be a crucial determinant of efficient translation and successful virion production. Here we provide direct evidence that mRNA subcellular trafficking plays an important role in regulating the assembly of human immunodeficiency

  14. Subcellular Localization of HIV-1 gag-pol mRNAs Regulates Sites of Virion Assembly.

    PubMed

    Becker, Jordan T; Sherer, Nathan M

    2017-03-15

    Full-length unspliced human immunodeficiency virus type 1 (HIV-1) RNAs serve dual roles in the cytoplasm as mRNAs encoding the Gag and Gag-Pol capsid proteins as well as genomic RNAs (gRNAs) packaged by Gag into virions undergoing assembly at the plasma membrane (PM). Because Gag is sufficient to drive the assembly of virus-like particles even in the absence of gRNA binding, whether viral RNA trafficking plays an active role in the native assembly pathway is unknown. In this study, we tested the effects of modulating the cytoplasmic abundance or distribution of full-length viral RNAs on Gag trafficking and assembly in the context of single cells. Increasing full-length viral RNA abundance or distribution had little-to-no net effect on Gag assembly competency when provided in trans In contrast, artificially tethering full-length viral RNAs or surrogate gag-pol mRNAs competent for Gag synthesis to non-PM membranes or the actin cytoskeleton severely reduced net virus particle production. These effects were explained, in large part, by RNA-directed changes to Gag's distribution in the cytoplasm, yielding aberrant subcellular sites of virion assembly. Interestingly, RNA-dependent disruption of Gag trafficking required either of two cis -acting RNA regulatory elements: the 5' packaging signal (Psi) bound by Gag during genome encapsidation or, unexpectedly, the Rev response element (RRE), which regulates the nuclear export of gRNAs and other intron-retaining viral RNAs. Taken together, these data support a model for native infection wherein structural features of the gag-pol mRNA actively compartmentalize Gag to preferred sites within the cytoplasm and/or PM. IMPORTANCE The spatial distribution of viral mRNAs within the cytoplasm can be a crucial determinant of efficient translation and successful virion production. Here we provide direct evidence that mRNA subcellular trafficking plays an important role in regulating the assembly of human immunodeficiency virus type 1

  15. Solution Properties of Murine Leukemia Virus Gag Protein: Differences from HIV-1 Gag▿

    PubMed Central

    Datta, Siddhartha A. K.; Zuo, Xiaobing; Clark, Patrick K.; Campbell, Stephen J.; Wang, Yun-Xing; Rein, Alan

    2011-01-01

    Immature retrovirus particles are assembled from the multidomain Gag protein. In these particles, the Gag proteins are arranged radially as elongated rods. We have previously characterized the properties of HIV-1 Gag in solution. In the absence of nucleic acid, HIV-1 Gag displays moderately weak interprotein interactions, existing in monomer-dimer equilibrium. Neutron scattering and hydrodynamic studies suggest that the protein is compact, and biochemical studies indicate that the two ends can approach close in three-dimensional space, implying the need for a significant conformational change during assembly. We now describe the properties of the Gag protein of Moloney murine leukemia virus (MLV), a gammaretrovirus. We found that this protein is very different from HIV-1 Gag: it has much weaker protein-protein interaction and is predominantly monomeric in solution. This has allowed us to study the protein by small-angle X-ray scattering and to build a low-resolution molecular envelope for the protein. We found that MLV Gag is extended in solution, with an axial ratio of ∼7, comparable to its dimensions in immature particles. Mutational analysis suggests that runs of prolines in its matrix and p12 domains and the highly charged stretch at the C terminus of its capsid domain all contribute to this extended conformation. These differences between MLV Gag and HIV-1 Gag and their implications for retroviral assembly are discussed. PMID:21917964

  16. Prime-boost immunization by both DNA vaccine and oncolytic adenovirus expressing GM-CSF and shRNA of TGF-β2 induces anti-tumor immune activation

    PubMed Central

    Choi, Hye Jin; Joo, Yeonsoo; Kim, Joo-Hang; Song, Jae J.

    2017-01-01

    A successful DNA vaccine for the treatment of tumors should break established immune tolerance to tumor antigen. However, due to the relatively low immunogenicity of DNA vaccines, compared to other kinds of vaccines using live virus or protein, a recombinant viral vector was used to enhance humoral and cellular immunity. In the current study, we sought to develop a novel anti-cancer agent as a complex of DNA and oncolytic adenovirus for the treatment of malignant melanoma in the C57BL/6 mouse model. MART1, a human melanoma-specific tumor antigen, was used to induce an increased immune reaction, since a MART1-protective response is required to overcome immune tolerance to the melanoma antigen MelanA. Because GM-CSF is a potent inducer of anti-tumor immunity and TGF-β2 is involved in tumor survival and host immune suppression, mouse GM-CSF (mGM-CSF) and shRNA of mouse TGF-β2 (shmTGF-β2) genes were delivered together with MART1 via oncolytic adenovirus. MART1 plasmid was also used for antigen-priming. To compare the anti-tumor effect of oncolytic adenovirus expressing both mGM-CSF and shmTGF-β2 (AdGshT) with that of oncolytic adenovirus expressing mGM-CSF only (AdG), each virus was intratumorally injected into melanoma-bearing C57BL/6 mice. As a result, mice that received AdGshT showed delayed tumor growth than those that received AdG. Heterologous prime-boost immunization was combined with oncolytic AdGshT and MART1 expression to result in further delayed tumor growth. This regression is likely due to the following 4 combinations: MART1-derived mouse melanoma antigen-specific immune reaction, immune stimulation by mGM-CSF/shmTGF-β2, tumor growth inhibition by shmTGF-β2, and tumor cell-specific lysis via an oncolytic adenovirus. Immune activation was mainly induced by mature tumor-infiltrating dendritic cell (TIDC) and lowered regulatory T cells in tumor-infiltrating lymphocytes (TIL). Taken together, these findings demonstrate that human MART1 induces a mouse

  17. Prime-boost immunization by both DNA vaccine and oncolytic adenovirus expressing GM-CSF and shRNA of TGF-β2 induces anti-tumor immune activation.

    PubMed

    Kim, So Young; Kang, Dongxu; Choi, Hye Jin; Joo, Yeonsoo; Kim, Joo-Hang; Song, Jae J

    2017-02-28

    A successful DNA vaccine for the treatment of tumors should break established immune tolerance to tumor antigen. However, due to the relatively low immunogenicity of DNA vaccines, compared to other kinds of vaccines using live virus or protein, a recombinant viral vector was used to enhance humoral and cellular immunity. In the current study, we sought to develop a novel anti-cancer agent as a complex of DNA and oncolytic adenovirus for the treatment of malignant melanoma in the C57BL/6 mouse model. MART1, a human melanoma-specific tumor antigen, was used to induce an increased immune reaction, since a MART1-protective response is required to overcome immune tolerance to the melanoma antigen MelanA. Because GM-CSF is a potent inducer of anti-tumor immunity and TGF-β2 is involved in tumor survival and host immune suppression, mouse GM-CSF (mGM-CSF) and shRNA of mouse TGF-β2 (shmTGF-β2) genes were delivered together with MART1 via oncolytic adenovirus. MART1 plasmid was also used for antigen-priming. To compare the anti-tumor effect of oncolytic adenovirus expressing both mGM-CSF and shmTGF-β2 (AdGshT) with that of oncolytic adenovirus expressing mGM-CSF only (AdG), each virus was intratumorally injected into melanoma-bearing C57BL/6 mice. As a result, mice that received AdGshT showed delayed tumor growth than those that received AdG. Heterologous prime-boost immunization was combined with oncolytic AdGshT and MART1 expression to result in further delayed tumor growth. This regression is likely due to the following 4 combinations: MART1-derived mouse melanoma antigen-specific immune reaction, immune stimulation by mGM-CSF/shmTGF-β2, tumor growth inhibition by shmTGF-β2, and tumor cell-specific lysis via an oncolytic adenovirus. Immune activation was mainly induced by mature tumor-infiltrating dendritic cell (TIDC) and lowered regulatory T cells in tumor-infiltrating lymphocytes (TIL). Taken together, these findings demonstrate that human MART1 induces a mouse

  18. Infection-Induced Interaction between the Mosquito Circulatory and Immune Systems

    PubMed Central

    King, Jonas G.; Hillyer, Julián F.

    2012-01-01

    Insects counter infection with innate immune responses that rely on cells called hemocytes. Hemocytes exist in association with the insect's open circulatory system and this mode of existence has likely influenced the organization and control of anti-pathogen immune responses. Previous studies reported that pathogens in the mosquito body cavity (hemocoel) accumulate on the surface of the heart. Using novel cell staining, microdissection and intravital imaging techniques, we investigated the mechanism of pathogen accumulation in the pericardium of the malaria mosquito, Anopheles gambiae, and discovered a novel insect immune tissue, herein named periostial hemocytes, that sequesters pathogens as they flow with the hemolymph. Specifically, we show that there are two types of endocytic cells that flank the heart: periostial hemocytes and pericardial cells. Resident periostial hemocytes engage in the rapid phagocytosis of pathogens, and during the course of a bacterial or Plasmodium infection, circulating hemocytes migrate to the periostial regions where they bind the cardiac musculature and each other, and continue the phagocytosis of invaders. Periostial hemocyte aggregation occurs in a time- and infection dose-dependent manner, and once this immune process is triggered, the number of periostial hemocytes remains elevated for the lifetime of the mosquito. Finally, the soluble immune elicitors peptidoglycan and β-1,3-glucan also induce periostial hemocyte aggregation, indicating that this is a generalized and basal immune response that is induced by diverse immune stimuli. These data describe a novel insect cellular immune response that fundamentally relies on the physiological interaction between the insect circulatory and immune systems. PMID:23209421

  19. Assessing immune competence in pigs by immunization with tetanus toxoid.

    PubMed

    Gimsa, U; Tuchscherer, A; Gimsa, J; Tuchscherer, M

    2018-01-01

    Immune competence can be tested by challenging organisms with a set of infectious agents. However, disease control requirements impose restrictions on the infliction of infections upon domestic pigs. Alternatively, vaccinations induce detectable immune responses that reflect immune competence. Here, we tested this approach with tetanus toxoid (TT) in young domestic pigs. To optimize the vaccination protocol, we immunized the pigs with a commercial TT vaccine at the age of 21 or 35 days. Booster immunizations were performed either 14 or 21 days later. TT-specific antibodies in plasma as well as lymphoproliferative responses were determined both 7 and 14 days after booster immunization using ELISA and lymphocyte transformation tests, respectively. In addition, general IgG and IgM plasma concentrations and mitogen-induced proliferation were measured. The highest TT-specific antibody responses were detected when blood samples were collected 1 week after a booster immunization conducted 21 days after primary immunization. The pigs' age at primary immunization did not have a significant influence on TT-specific antibody responses. Similarly, the TT-specific proliferative responses were highest when blood samples were collected 1 week after booster immunization, while age and time of primary and booster immunization were irrelevant in our setup. While general IgG and IgM plasma levels were highly age dependent, there were no significant age effects for TT-specific immune responses. In addition, mitogen-induced proliferation was independent of immunization as well as blood sampling protocols. In summary, our model of TT vaccination provides an interesting approach for the assessment of immune competence in young pigs. The detected vaccination effects were not biased by age, even though our data were acquired from immune systems that were under development during our tests.

  20. Trimethoprim-Sulfamethoxazole Prophylaxis During Live Malaria Sporozoite Immunization Induces Long-Lived, Homologous, and Heterologous Protective Immunity Against Sporozoite Challenge.

    PubMed

    Hobbs, Charlotte V; Anderson, Charles; Neal, Jillian; Sahu, Tejram; Conteh, Solomon; Voza, Tatiana; Langhorne, Jean; Borkowsky, William; Duffy, Patrick E

    2017-01-01

    Trimethoprim-sulfamethoxazole (TMP-SMX) is widely used in malaria-endemic areas in human immunodeficiency virus (HIV)-infected children and HIV-uninfected, HIV-exposed children as opportunistic infection prophylaxis. Despite the known effects that TMP-SMX has in reducing clinical malaria, its impact on development of malaria-specific immunity in these children remains poorly understood. Using rodent malaria models, we previously showed that TMP-SMX, at prophylactic doses, can arrest liver stage development of malaria parasites and speculated that TMP-SMX prophylaxis during repeated malaria exposures would induce protective long-lived sterile immunity targeting pre-erythrocytic stage parasites in mice. Using the same models, we now demonstrate that repeated exposures to malaria parasites during TMP-SMX administration induces stage-specific and long-lived pre-erythrocytic protective anti-malarial immunity, mediated primarily by CD8 + T-cells. Given the HIV infection and malaria coepidemic in sub-Saharan Africa, clinical studies aimed at determining the optimum duration of TMP-SMX prophylaxis in HIV-infected or HIV-exposed children must account for the potential anti-infection immunity effect of TMP-SMX prophylaxis. Published by Oxford University Press for the Infectious Diseases Society of America 2016. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  1. Kill: boosting HIV-specific immune responses.

    PubMed

    Trautmann, Lydie

    2016-07-01

    Increasing evidence suggests that purging the latent HIV reservoir in virally suppressed individuals will require both the induction of viral replication from its latent state and the elimination of these reactivated HIV-infected cells ('Shock and Kill' strategy). Boosting potent HIV-specific CD8 T cells is a promising way to achieve an HIV cure. Recent studies provided the rationale for developing immune interventions to increase the numbers, function and location of HIV-specific CD8 T cells to purge HIV reservoirs. Multiple approaches are being evaluated including very early suppression of HIV replication in acute infection, adoptive cell transfer, therapeutic vaccination or use of immunomodulatory molecules. New assays to measure the killing and antiviral function of induced HIV-specific CD8 T cells have been developed to assess the efficacy of these new approaches. The strategies combining HIV reactivation and immunobased therapies to boost HIV-specific CD8 T cells can be tested in in-vivo and in-silico models to accelerate the design of new clinical trials. New immunobased strategies are explored to boost HIV-specific CD8 T cells able to purge the HIV-infected cells with the ultimate goal of achieving spontaneous control of viral replication without antiretroviral treatment.

  2. Kill: Boosting HIV-specific immune responses

    PubMed Central

    Trautmann, Lydie

    2016-01-01

    Purpose of review Increasing evidences suggest that purging the latent HIV reservoir in virally-suppressed individuals will require both the induction of viral replication from its latent state and the elimination of these reactivated HIV infected cells (“Shock and Kill” strategy). Boosting potent HIV-specific CD8 T cells is a promising way to achieve an HIV cure. Recent findings Recent studies provided the rationale for developing immune interventions to increase the numbers, function and location of HIV-specific CD8 T cells to purge HIV reservoirs. Multiple approaches are being evaluated including very early suppression of HIV replication in acute infection, adoptive cell transfer, therapeutic vaccination or use of immunomodulatory molecules. New assays to measure the killing and antiviral function of induced HIV-specific CD8 T cells have been developed to assess the efficacy of these new approaches. The strategies combining HIV reactivation and immunobased therapies to boost HIV-specific CD8 T cells can be tested in in vivo and in silico models to accelerate the design of new clinical trials. Summary New immunobased strategies are explored to boost HIV-specific CD8 T cells able to purge the HIV-infected cells with the ultimate goal of achieving spontaneous control of viral replication without antiretroviral treatment. PMID:27054280

  3. Tumor cell apoptosis induces tumor-specific immunity in a CC chemokine receptor 1- and 5-dependent manner in mice.

    PubMed

    Iida, Noriho; Nakamoto, Yasunari; Baba, Tomohisa; Kakinoki, Kaheita; Li, Ying-Yi; Wu, Yu; Matsushima, Kouji; Kaneko, Shuichi; Mukaida, Naofumi

    2008-10-01

    The first step in the generation of tumor immunity is the migration of dendritic cells (DCs) to the apoptotic tumor, which is presumed to be mediated by various chemokines. To clarify the roles of chemokines, we induced apoptosis using suicide gene therapy and investigated the immune responses following tumor apoptosis. We injected mice with a murine hepatoma cell line, BNL 1ME A.7R.1 (BNL), transfected with HSV-thymidine kinase (tk) gene and then treated the animals with ganciclovir (GCV). GCV treatment induced massive tumor cell apoptosis accompanied with intratumoral DC infiltration. Tumor-infiltrating DCs expressed chemokine receptors CCR1 and CCR5, and T cells and macrophages expressed CCL3, a ligand for CCR1 and CCR5. Moreover, tumor apoptosis increased the numbers of DCs migrating into the draining lymph nodes and eventually generated a specific cytotoxic cell population against BNL cells. Although GCV completely eradicated HSV-tk-transfected BNL cells in CCR1-, CCR5-, or CCL3-deficient mice, intratumoral and intranodal DC infiltration and the subsequent cytotoxicity generation were attenuated in these mice. When parental cells were injected again after complete eradication of primary tumors by GCV treatment, the wild-type mice completely rejected the rechallenged cells, but the deficient mice exhibited impairment in rejection. Thus, we provide definitive evidence indicating that CCR1 and CCR5 and their ligand CCL3 play a crucial role in the regulation of intratumoral DC accumulation and the subsequent establishment of tumor immunity following induction of tumor apoptosis by suicide genes.

  4. Immunoglobulin GM and KM genes and measles vaccine-induced humoral immunity.

    PubMed

    Ovsyannikova, Inna G; Larrabee, Beth R; Schaid, Daniel J; Poland, Gregory A

    2017-10-04

    Identifying genetic polymorphisms that explain variations in humoral immunity to live measles virus vaccine is of great interest. Immunoglobulin GM (heavy chain) and KM (light chain) allotypes are genetic markers known to be associated with susceptibility to several infectious diseases. We assessed associations between GM and KM genotypes and measles vaccine humoral immunity (neutralizing antibody titers) in a combined cohort (n=1796) of racially diverse healthy individuals (age 18-41years). We did not discover any significant associations between GM and/or KM genotypes and measles vaccine-induced neutralizing antibody titers. African-American subjects had higher neutralizing antibody titers than Caucasians (1260mIU/mL vs. 740mIU/mL, p=7.10×10 -13 ), and those titers remained statistically significant (p=1.68×10 -09 ) after adjusting for age at enrollment and time since last vaccination. There were no statistically significant sex-specific differences in measles-induced neutralizing antibody titers in our study (p=0.375). Our data indicate a surprising lack of evidence for an association between GM and KM genotypes and measles-specific neutralizing antibody titers, despite the importance of these immune response genes. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. RRE-dependent HIV-1 Env RNA effects on Gag protein expression, assembly and release

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    López, Claudia S., E-mail: lopezcl@ohsu.edu; Sloan, Rachel; Cylinder, Isabel

    The HIV-1 Gag proteins are translated from the full-length HIV-1 viral RNA (vRNA), whereas the envelope (Env) protein is translated from incompletely spliced Env mRNAs. Nuclear export of vRNAs and Env mRNAs is mediated by the Rev accessory protein which binds to the rev-responsive element (RRE) present on these RNAs. Evidence has shown there is a direct or indirect interaction between the Gag protein, and the cytoplasmic tail (CT) of the Env protein. Our current work shows that env gene expression impacts HIV-1 Gag expression and function in two ways. At the protein level, full-length Env expression altered Gag proteinmore » expression, while Env CT-deletion proteins did not. At the RNA level, RRE-containing Env mRNA expression reduced Gag expression, processing, and virus particle release from cells. Our results support models in which Gag is influenced by the Env CT, and Env mRNAs compete with vRNAs for nuclear export. - Highlights: • At the protein level, full-length HIV-1 Env alters Gag protein expression. • HIV-1 Env RNA expression reduces Gag levels and virus release. • Env RNA effects on Gag are dependent on the RRE. • RRE-containing Env RNAs compete with vRNAs for nuclear export.« less

  6. Identification of the protease cleavage sites in a reconstituted Gag polyprotein of an HERV-K(HML-2) element

    PubMed Central

    2011-01-01

    Background The human genome harbors several largely preserved HERV-K(HML-2) elements. Although this retroviral family comes closest of all known HERVs to producing replication competent virions, mutations acquired during their chromosomal residence have rendered them incapable of expressing infectious particles. This also holds true for the HERV-K113 element that has conserved open reading frames (ORFs) for all its proteins in addition to a functional LTR promoter. Uncertainty concerning the localization and impact of post-insertional mutations has greatly hampered the functional characterization of these ancient retroviruses and their proteins. However, analogous to other betaretroviruses, it is known that HERV-K(HML-2) virions undergo a maturation process during or shortly after release from the host cell. During this process, the subdomains of the Gag polyproteins are released by proteolytic cleavage, although the nature of the mature HERV-K(HML-2) Gag proteins and the exact position of the cleavage sites have until now remained unknown. Results By aligning the amino acid sequences encoded by the gag-pro-pol ORFs of HERV-K113 with the corresponding segments from 10 other well-preserved human specific elements we identified non-synonymous post-insertional mutations that have occurred in this region of the provirus. Reversion of these mutations and a partial codon optimization facilitated the large-scale production of maturation-competent HERV-K113 virus-like particles (VLPs). The Gag subdomains of purified mature VLPs were separated by reversed-phase high-pressure liquid chromatography and initially characterized using specific antibodies. Cleavage sites were identified by mass spectrometry and N-terminal sequencing and confirmed by mutagenesis. Our results indicate that the gag gene product Pr74Gag of HERV-K(HML-2) is processed to yield p15-MA (matrix), SP1 (spacer peptide of 14 amino acids), p15, p27-CA (capsid), p10-NC (nucleocapsid) and two C

  7. Identification of the protease cleavage sites in a reconstituted Gag polyprotein of an HERV-K(HML-2) element.

    PubMed

    George, Maja; Schwecke, Torsten; Beimforde, Nadine; Hohn, Oliver; Chudak, Claudia; Zimmermann, Anja; Kurth, Reinhard; Naumann, Dieter; Bannert, Norbert

    2011-05-09

    The human genome harbors several largely preserved HERV-K(HML-2) elements. Although this retroviral family comes closest of all known HERVs to producing replication competent virions, mutations acquired during their chromosomal residence have rendered them incapable of expressing infectious particles. This also holds true for the HERV-K113 element that has conserved open reading frames (ORFs) for all its proteins in addition to a functional LTR promoter. Uncertainty concerning the localization and impact of post-insertional mutations has greatly hampered the functional characterization of these ancient retroviruses and their proteins. However, analogous to other betaretroviruses, it is known that HERV-K(HML-2) virions undergo a maturation process during or shortly after release from the host cell. During this process, the subdomains of the Gag polyproteins are released by proteolytic cleavage, although the nature of the mature HERV-K(HML-2) Gag proteins and the exact position of the cleavage sites have until now remained unknown. By aligning the amino acid sequences encoded by the gag-pro-pol ORFs of HERV-K113 with the corresponding segments from 10 other well-preserved human specific elements we identified non-synonymous post-insertional mutations that have occurred in this region of the provirus. Reversion of these mutations and a partial codon optimization facilitated the large-scale production of maturation-competent HERV-K113 virus-like particles (VLPs). The Gag subdomains of purified mature VLPs were separated by reversed-phase high-pressure liquid chromatography and initially characterized using specific antibodies. Cleavage sites were identified by mass spectrometry and N-terminal sequencing and confirmed by mutagenesis. Our results indicate that the gag gene product Pr74Gag of HERV-K(HML-2) is processed to yield p15-MA (matrix), SP1 (spacer peptide of 14 amino acids), p15, p27-CA (capsid), p10-NC (nucleocapsid) and two C-terminally encoded glutamine- and

  8. Compendium of Immune Signatures Identifies Conserved and Species-Specific Biology in Response to Inflammation.

    PubMed

    Godec, Jernej; Tan, Yan; Liberzon, Arthur; Tamayo, Pablo; Bhattacharya, Sanchita; Butte, Atul J; Mesirov, Jill P; Haining, W Nicholas

    2016-01-19

    Gene-expression profiling has become a mainstay in immunology, but subtle changes in gene networks related to biological processes are hard to discern when comparing various datasets. For instance, conservation of the transcriptional response to sepsis in mouse models and human disease remains controversial. To improve transcriptional analysis in immunology, we created ImmuneSigDB: a manually annotated compendium of ∼5,000 gene-sets from diverse cell states, experimental manipulations, and genetic perturbations in immunology. Analysis using ImmuneSigDB identified signatures induced in activated myeloid cells and differentiating lymphocytes that were highly conserved between humans and mice. Sepsis triggered conserved patterns of gene expression in humans and mouse models. However, we also identified species-specific biological processes in the sepsis transcriptional response: although both species upregulated phagocytosis-related genes, a mitosis signature was specific to humans. ImmuneSigDB enables granular analysis of transcriptomic data to improve biological understanding of immune processes of the human and mouse immune systems. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Immune Escape Mutations Detected within HIV-1 Epitopes Associated with Viral Control During Treatment Interruption

    PubMed Central

    Schweighardt, Becky; Wrin, Terri; Meiklejohn, Duncan A.; Spotts, Gerald; Petropoulos, Christos J.; Nixon, Douglas F.; Hecht, Frederick M.

    2010-01-01

    We analyzed immune responses in chronically HIV-infected individuals who took part in a treatment interruption (TI) trial designed for patients who initiated anti-retroviral therapy within 6 months of seroconversion. In the two subjects that exhibited the best viral control, we detected CD8+ T cell responses against 1-2 Gag epitopes during the early weeks of TI and a subsequent increase in the number of epitopes recognized by the later time points. Each of these subjects developed mutations within the epitopes targeted by the highest magnitude responses. In the subject with the worst viral control, we detected responses against two Gag epitopes throughout the entire TI and no Gag mutations. The magnitude of these responses increased dramatically with time, greatly exceeding those detected in the virologic controllers. The highest levels of contemporaneous autologous neutralizing antibody activity were detected in the virologic controllers, and a subsequent escape mutation developed within the envelope gene of one controller that abrogated the response. These data suggest that immune escape mutations are a sign of viral control during TI, and that the absence of immune escape mutations in the presence of high-levels of viral replication indicates the lack of an effective host immune response. PMID:19910798

  10. Management of exaggerated gag reflex in dental patients using intravenous sedation with dexmedetomidine.

    PubMed

    Reshetnikov, Aleksei P; Kasatkin, Anton A; Urakov, Aleksandr L; Baimurzin, Dmitrii Y

    2017-01-01

    Pharmacological sedation is one of the effective ways of prevention of gag reflex development in patients experiencing anxiety and fright before dental treatment. We are reporting a case where we could successfully eliminate exaggerated gag reflex (intravenous [IV] Gagging Severity Index) in a dental patient using IV sedation with dexmedetomidine. IV administration of dexmedetomidine provided elimination of gag reflex at a depth of sedation for the patient with the Richmond Agitation-Sedation Scale score of -2 and -1. The patient received dexmedetomidine 1.0 μg/kg for 10 min and then a continuous infusion of dexmedetomidine 0.4 μg/kg/h. The use of dexmedetomidine for sedation may be an alternative to other pharmacological agents in patients with dental anxiety accompanied by exaggerated gag reflex.

  11. Oral rice-based vaccine induces passive and active immunity against enterotoxigenic E. coli-mediated diarrhea in pigs.

    PubMed

    Takeyama, Natsumi; Yuki, Yoshikazu; Tokuhara, Daisuke; Oroku, Kazuki; Mejima, Mio; Kurokawa, Shiho; Kuroda, Masaharu; Kodama, Toshiaki; Nagai, Shinya; Ueda, Susumu; Kiyono, Hiroshi

    2015-09-22

    Enterotoxigenic Escherichia coli (ETEC) causes severe diarrhea in both neonatal and weaned pigs. Because the cholera toxin B subunit (CTB) has a high level of amino acid identity to the ETEC heat-labile toxin (LT) B-subunit (LTB), we selected MucoRice-CTB as a vaccine candidate against ETEC-induced pig diarrhea. When pregnant sows were orally immunized with MucoRice-CTB, increased amounts of antigen-specific IgG and IgA were produced in their sera. CTB-specific IgG was secreted in the colostrum and transferred passively to the sera of suckling piglets. IgA antibodies in the colostrum and milk remained high with a booster dose after farrowing. Additionally, when weaned minipigs were orally immunized with MucoRice-CTB, production of CTB-specific intestinal SIgA, as well as systemic IgG and IgA, was induced. To evaluate the cross-protective effect of MucoRice-CTB against ETEC diarrhea, intestinal loop assay with ETEC was conducted. The fluid volume accumulated in the loops of minipigs immunized with MucoRice-CTB was significantly lower than that in control minipigs, indicating that MucoRice-CTB-induced cross-reactive immunity could protect weaned pigs from diarrhea caused by ETEC. MucoRice-CTB could be a candidate oral vaccine for inducing both passive and active immunity to protect both suckling and weaned piglets from ETEC diarrhea. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. Analysis of the primary structure of the long terminal repeat and the gag and pol genes of the human spumaretrovirus.

    PubMed Central

    Maurer, B; Bannert, H; Darai, G; Flügel, R M

    1988-01-01

    The nucleotide sequence of the human spumaretrovirus (HSRV) genome was determined. The 5' long terminal repeat region was analyzed by strong stop cDNA synthesis and S1 nuclease mapping. The length of the RU5 region was determined and found to be 346 nucleotides long. The 5' long terminal repeat is 1,123 base pairs long and is bound by an 18-base-pair primer-binding site complementary to the 3' end of mammalian lysine-1,2-specific tRNA. Open reading frames for gag and pol genes were identified. Surprisingly, the HSRV gag protein does not contain the cysteine motif of the nucleic acid-binding proteins found in and typical of all other retroviral gag proteins; instead the HSRV gag gene encodes a strongly basic protein reminiscent of those of hepatitis B virus and retrotransposons. The carboxy-terminal part of the HSRV gag gene products encodes a protease domain. The pol gene overlaps the gag gene and is postulated to be synthesized as a gag/pol precursor via translational frameshifting analogous to that of Rous sarcoma virus, with 7 nucleotides immediately upstream of the termination codons of gag conserved between the two viral genomes. The HSRV pol gene is 2,730 nucleotides long, and its deduced protein sequence is readily subdivided into three well-conserved domains, the reverse transcriptase, the RNase H, and the integrase. Although the degree of homology of the HSRV reverse transcriptase domain is highest to that of murine leukemia virus, the HSRV genomic organization is more similar to that of human and simian immunodeficiency viruses. The data justify classifying the spumaretroviruses as a third subfamily of Retroviridae. Images PMID:2451755

  13. Pineal-adrenal-immune system relationship under thermal stress: effect on physiological, endocrine, and non-specific immune response in goats.

    PubMed

    Sejian, Veerasamy; Srivastava, Rajendra Swaroop

    2010-12-01

    The purpose of the investigation was to observe the pineal-adrenal-immune system relationships and their influence on non-specific immune response in female goats under short-term thermal stress. Six female goats had been exposed to 40°C and 60% relative humidity in the psychrometric chamber for 17 days. Blood samples were obtained on days 0 and 10 to establish control and thermal stress effects, respectively. Chemical adrenalectomy was achieved by injecting metyrapone (100 mg/kg body weight) followed by exogenous melatonin treatment (0.1 mg/kg body weight) from 11th to 17th day of experiment. Thermal stress significantly (P≤0.05) altered the physiological responses. Metyrapone and melatonin treatment significantly (P≤0.05) reduced the thermal-stress-induced increase in plasma concentrations of cortisol and corticosterone while significantly (P≤0.05) increased the plasma melatonin on days 11 and 17. Furthermore, these treatments significantly (P<0.05) increased the phagocytic activity of neutrophils as compared to both control and thermal exposure values from 11-17 days of experiment. The data generated from this study help us to understand the functional relationship between pineal, adrenal, and immune system, and how this relationship modifies the non-specific immune response for the well being of goats during thermal stress.

  14. A Functional Toll-Interacting Protein Variant Is Associated with Bacillus Calmette-Guérin-Specific Immune Responses and Tuberculosis.

    PubMed

    Shah, Javeed A; Musvosvi, Munyaradzi; Shey, Muki; Horne, David J; Wells, Richard D; Peterson, Glenna J; Cox, Jeffery S; Daya, Michelle; Hoal, Eileen G; Lin, Lin; Gottardo, Raphael; Hanekom, Willem A; Scriba, Thomas J; Hatherill, Mark; Hawn, Thomas R

    2017-08-15

    The molecular mechanisms that regulate tuberculosis susceptibility and bacillus Calmette-Guérin (BCG)-induced immunity are mostly unknown. However, induction of the adaptive immune response is a critical step in host control of Mycobacterium tuberculosis. Toll-interacting protein (TOLLIP) is a ubiquitin-binding protein that regulates innate immune responses, including Toll-like receptor signaling, which initiate adaptive immunity. TOLLIP variation is associated with susceptibility to tuberculosis, but the mechanism by which it regulates tuberculosis immunity is poorly understood. To identify functional TOLLIP variants and evaluate the role of TOLLIP variation on innate and adaptive immune responses to mycobacteria and susceptibility to tuberculosis. We used human cellular immunology approaches to characterize the role of a functional TOLLIP variant on monocyte mRNA expression and M. tuberculosis-induced monocyte immune functions. We also examined the association of TOLLIP variation with BCG-induced T-cell responses and susceptibility to latent tuberculosis infection. We identified a functional TOLLIP promoter region single-nucleotide polymorphism, rs5743854, which was associated with decreased TOLLIP mRNA expression in infant monocytes. After M. tuberculosis infection, TOLLIP-deficient monocytes demonstrated increased IL-6, increased nitrite, and decreased bacterial replication. The TOLLIP-deficiency G/G genotype was associated with decreased BCG-specific IL-2 + CD4 + T-cell frequency and proliferation. This genotype was also associated with increased susceptibility to latent tuberculosis infection. TOLLIP deficiency is associated with decreased BCG-specific T-cell responses and increased susceptibility to tuberculosis. We hypothesize that the heightened antibacterial monocyte responses after vaccination of TOLLIP-deficient infants are responsible for decreased BCG-specific T-cell responses. Activating TOLLIP may provide a novel adjuvant strategy for BCG

  15. Expanded functions for a family of plant intracellular immune receptors beyond specific recognition of pathogen effectors

    PubMed Central

    Bonardi, Vera; Tang, Saijun; Stallmann, Anna; Roberts, Melinda; Cherkis, Karen; Dangl, Jeffery L.

    2011-01-01

    Plants and animals deploy intracellular immune receptors that perceive specific pathogen effector proteins and microbial products delivered into the host cell. We demonstrate that the ADR1 family of Arabidopsis nucleotide-binding leucine-rich repeat (NB-LRR) receptors regulates accumulation of the defense hormone salicylic acid during three different types of immune response: (i) ADRs are required as “helper NB-LRRs” to transduce signals downstream of specific NB-LRR receptor activation during effector-triggered immunity; (ii) ADRs are required for basal defense against virulent pathogens; and (iii) ADRs regulate microbial-associated molecular pattern-dependent salicylic acid accumulation induced by infection with a disarmed pathogen. Remarkably, these functions do not require an intact P-loop motif for at least one ADR1 family member. Our results suggest that some NB-LRR proteins can serve additional functions beyond canonical, P-loop–dependent activation by specific virulence effectors, extending analogies between intracellular innate immune receptor function from plants and animals. PMID:21911370

  16. Immunotherapy with a HER2-Targeting Listeria Induces HER2-Specific Immunity and Demonstrates Potential Therapeutic Effects in a Phase I Trial in Canine Osteosarcoma.

    PubMed

    Mason, Nicola J; Gnanandarajah, Josephine S; Engiles, Julie B; Gray, Falon; Laughlin, Danielle; Gaurnier-Hausser, Anita; Wallecha, Anu; Huebner, Margie; Paterson, Yvonne

    2016-09-01

    Recombinant Listeria vaccines induce tumor-specific T-cell responses that eliminate established tumors and prevent metastatic disease in murine cancer models. We used dogs with HER2/neu(+) appendicular osteosarcoma, a well-recognized spontaneous model for pediatric osteosarcoma, to determine whether a highly attenuated, recombinant Listeria monocytogenes expressing a chimeric human HER2/neu fusion protein (ADXS31-164) could safely induce HER2/neu-specific immunity and prevent metastatic disease. Eighteen dogs that underwent limb amputation or salvage surgery and adjuvant chemotherapy were enrolled in a phase I dose escalation clinical trial and received either 2 × 10(8), 5 × 10(8), 1 × 10(9), or 3.3 × 10(9) CFU of ADXS31-164 intravenously every 3 weeks for 3 administrations. Only low-grade, transient toxicities were observed. ADXS31-164 broke peripheral tolerance and induced antigen-specific IFNγ responses against the intracellular domain of HER2/neu in 15 of 18 dogs within 6 months of treatment. Furthermore, ADXS31-164 reduced the incidence of metastatic disease and significantly increased duration of survival time and 1-, 2-, and 3-year survival rates when compared with a historical control group with HER2/neu(+) appendicular osteosarcoma treated with amputation and chemotherapy alone. These findings demonstrate that ADXS31-164 administered in the setting of minimal residual disease can induce HER2/neu-specific immunity and may reduce the incidence of metastatic disease and prolong overall survival in a clinically relevant, spontaneous, large animal model of cancer. These findings, therefore, have important translational relevance for children with osteosarcoma and adults with other HER2/neu(+) cancers. Clin Cancer Res; 22(17); 4380-90. ©2016 AACR. ©2016 American Association for Cancer Research.

  17. Intranasal immunization with protective antigen of Bacillus anthracis induces a long-term immunological memory response.

    PubMed

    Woo, Sun-Je; Kang, Seok-Seong; Park, Sung-Moo; Yang, Jae Seung; Song, Man Ki; Yun, Cheol-Heui; Han, Seung Hyun

    2015-10-01

    Although intranasal vaccination has been shown to be effective for the protection against inhalational anthrax, establishment of long-term immunity has yet to be achieved. Here, we investigated whether intranasal immunization with recombinant protective antigen (rPA) of Bacillus anthracis induces immunological memory responses in the mucosal and systemic compartments. Intranasal immunization with rPA plus cholera toxin (CT) sustained PA-specific antibody responses for 6 months in lung, nasal washes, and vaginal washes as well as serum. A significant induction of PA-specific memory B cells was observed in spleen, cervical lymph nodes (CLNs) and lung after booster immunization. Furthermore, intranasal immunization with rPA plus CT remarkably generated effector memory CD4(+) T cells in the lung. PA-specific CD4(+) T cells preferentially increased the expression of Th1- and Th17-type cytokines in lung, but not in spleen or CLNs. Collectively, the intranasal immunization with rPA plus CT promoted immunologic memory responses in the mucosal and systemic compartments, providing long-term immunity. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. Photodynamic therapy can induce non-specific protective immunity against a bacterial infection

    NASA Astrophysics Data System (ADS)

    Tanaka, Masamitsu; Mroz, Pawel; Dai, Tianhong; Kinoshita, Manabu; Morimoto, Yuji; Hamblin, Michael R.

    2012-03-01

    Photodynamic therapy (PDT) for cancer is known to induce an immune response against the tumor, in addition to its well-known direct cell-killing and vascular destructive effects. PDT is becoming increasingly used as a therapy for localized infections. However there has not to date been a convincing report of an immune response being generated against a microbial pathogen after PDT in an animal model. We have studied PDT as a therapy for bacterial arthritis caused by Staphylococcus aureus infection in the mouse knee. We had previously found that PDT of an infection caused by injection of MRSA (5X107 CFU) into the mouse knee followed 3 days later by 1 μg of Photofrin and 635- nm diode laser illumination with a range of fluences within 5 minutes, gave a biphasic dose response. The greatest reduction of MRSA CFU was seen with a fluence of 20 J/cm2, whereas lower antibacterial efficacy was observed with fluences that were either lower or higher. We then tested the hypothesis that the host immune response mediated by neutrophils was responsible for most of the beneficial antibacterial effect. We used bioluminescence imaging of luciferase expressing bacteria to follow the progress of the infection in real time. We found similar results using intra-articular methylene blue and red light, and more importantly, that carrying out PDT of the noninfected joint and subsequently injecting bacteria after PDT led to a significant protection from infection. Taken together with substantial data from studies using blocking antibodies we believe that the pre-conditioning PDT regimen recruits and stimulates neutrophils into the infected joint which can then destroy bacteria that are subsequently injected and prevent infection.

  19. Beneficial immune modulatory effects of a specific nutritional combination in a murine model for cancer cachexia

    PubMed Central

    Faber, J; Vos, P; Kegler, D; van Norren, K; Argilés, J M; Laviano, A; Garssen, J; van Helvoort, A

    2008-01-01

    The majority of patients with advanced cancer are recognised by impaired immune competence influenced by several factors, including the type and stage of the tumour and the presence of cachexia. Recently, a specific nutritional combination containing fish oil, specific oligosaccharide mixture, high protein content and leucine has been developed aimed to support the immune system of cancer patients in order to reduce the frequency and severity of (infectious) complications. In a recently modified animal model cachexia is induced by inoculation of C26 tumour cells in mice. In a pre-cachectic state, no effect was observed on contact hypersensitivity, a validated in vivo method to measure Th1-mediated immune function, after adding the individual nutritional ingredients to the diet of tumour-bearing mice. However, the complete mixture resulted in significantly improved Th1 immunity. Moreover, in a cachectic state, the complete mixture reduced plasma levels of pro-inflammatory cytokines and beneficially affected ex vivo immune function. Accordingly, the combination of the nutritional ingredients is required to obtain a synergistic effect, leading to a reduced inflammatory state and improved immune competence. From this, it can be concluded that the specific nutritional combination has potential as immune-supporting nutritional intervention to reduce the risk of (infectious) complications in cancer patients. PMID:19018259

  20. Intradermal HIV-1 DNA Immunization Using Needle-Free Zetajet Injection Followed by HIV-Modified Vaccinia Virus Ankara Vaccination Is Safe and Immunogenic in Mozambican Young Adults: A Phase I Randomized Controlled Trial.

    PubMed

    Viegas, Edna Omar; Tembe, Nelson; Nilsson, Charlotta; Meggi, Bindiya; Maueia, Cremildo; Augusto, Orvalho; Stout, Richard; Scarlatti, Gabriella; Ferrari, Guido; Earl, Patricia L; Wahren, Britta; Andersson, Sören; Robb, Merlin L; Osman, Nafissa; Biberfeld, Gunnel; Jani, Ilesh; Sandström, Eric

    2017-11-27

    We assessed the safety and immunogenicity of HIV-DNA priming using Zetajet™, a needle-free device intradermally followed by intramuscular HIV-MVA boosts, in 24 healthy Mozambicans. Volunteers were randomized to receive three immunizations of 600 μg (n = 10; 2 × 0.1 ml) or 1,200 μg (n = 10; 2 × 0.2 ml) of HIV-DNA (3 mg/ml), followed by two boosts of 10 8 pfu HIV-MVA. Four subjects received placebo saline injections. Vaccines and injections were safe and well tolerated with no difference between the two priming groups. After three HIV-DNA immunizations, IFN-γ ELISpot responses to Gag were detected in 9/17 (53%) vaccinees, while none responded to Envelope (Env). After the first HIV-MVA, the overall response rate to Gag and/or Env increased to 14/15 (93%); 14/15 (93%) to Gag and 13/15 (87%) to Env. There were no significant differences between the immunization groups in frequency of response to Gag and Env or magnitude of Gag responses. Env responses were significantly higher in the higher dose group (median 420 vs. 157.5 SFC/million peripheral blood mononuclear cell, p = .014). HIV-specific antibodies to subtype C gp140 and subtype B gp160 were elicited in all vaccinees after the second HIV-MVA, without differences in titers between the groups. Neutralizing antibody responses were not detected. Two (13%) of 16 vaccinees, one in each of the priming groups, exhibited antibodies mediating antibody-dependent cellular cytotoxicity to CRF01_AE. In conclusion, HIV-DNA vaccine delivered intradermally in volumes of 0.1-0.2 ml using Zetajet was safe and well tolerated. Priming with the 1,200 μg dose of HIV-DNA generated higher magnitudes of ELISpot responses to Env.

  1. Synthetic MUC1 Antitumor Vaccine with Incorporated 2,3-Sialyl-T Carbohydrate Antigen Inducing Strong Immune Responses with Isotype Specificity.

    PubMed

    Straßburger, David; Glaffig, Markus; Stergiou, Natascha; Bialas, Sabrina; Besenius, Pol; Schmitt, Edgar; Kunz, Horst

    2018-04-06

    The endothelial glycoprotein MUC1 is known to underlie alterations in cancer by means of aberrant glycosylation accompanied by changes in morphology. The heavily shortened glycans induce a collapse of the peptide backbone and enable accessibility of the latter to immune cells, rendering it a tumor-associated antigen. Synthetic vaccines based on MUC1 tandem repeat motifs, comprising tumor-associated 2,3-sialyl-T antigen, conjugated to the immunostimulating tetanus toxoid, are reported herein. Immunization with these vaccines in a simple water/oil emulsion produced a strong immune response in mice to which stimulation with complete Freund's adjuvant (CFA) was not superior. In both cases, high levels of IgG1 and IgG2a/b were induced in C57BL/6 mice. Additional glycosylation in the immunodominant PDTRP domain led to improved binding of the induced antisera to MCF-7 breast tumor cells, compared with that of the monoglycosylated peptide vaccine. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Parasite-specific immune response in adult Drosophila melanogaster: a genomic study

    PubMed Central

    Roxström-Lindquist, Katarina; Terenius, Olle; Faye, Ingrid

    2004-01-01

    Insects of the order Diptera are vectors for parasitic diseases such as malaria, sleeping sickness and leishmania. In the search for genes encoding proteins involved in the antiparasitic response, we have used the protozoan parasite Octosporea muscaedomesticae for oral infections of adult Drosophila melanogaster. To identify parasite-specific response molecules, other flies were exposed to virus, bacteria or fungi in parallel. Analysis of gene expression patterns after 24 h of microbial challenge, using Affymetrix oligonucleotide microarrays, revealed a high degree of microbe specificity. Many serine proteases, key intermediates in the induction of insect immune responses, were uniquely expressed following infection of the different organisms. Several lysozyme genes were induced in response to Octosporea infection, while in other treatments they were not induced or downregulated. This suggests that lysozymes are important in antiparasitic defence. PMID:14749722

  3. How Can Hypnodontics Manage Severe Gag Reflex for Root Canal Therapy? A Case Report

    PubMed Central

    Ramazani, Mohsen; zarenejad, Nafiseh; Parirokh, Masoud; Zahedpasha, Samir

    2016-01-01

    In endodontics, severe involuntary gagging can have a severe impact on treatment procedure. There are many ways to ease the gag reflex, one of which is hypnosis. A 34-year-old male was referred for root canal treatment of a molar tooth. He had not received any dental treatments for the past nine years due to fear of severe gag reflex. Three hypnotic sessions based upon eye fixation, progressive muscle relaxation and guided imagery techniques were spent for psychosomatic management. The gag reflex was controlled and reduced to a normal level, and the required dental treatments including root canal therapy and restoration were performed successfully. This report shows that hypnosis can control gag reflex for dental treatments. PMID:27141226

  4. Toxoplasma gondii Antigen-Pulsed-Dendritic Cell-Derived Exosomes Induce a Protective Immune Response against T. gondii Infection

    PubMed Central

    Aline, Fleur; Bout, Daniel; Amigorena, Sébastian; Roingeard, Philippe; Dimier-Poisson, Isabelle

    2004-01-01

    It was previously demonstrated that immunizing mice with spleen dendritic cells (DCs) that had been pulsed ex vivo with Toxoplasma gondii antigens triggers a systemic Th1-biased specific immune response and induces protection against infection. T. gondii can cause severe sequelae in the fetuses of mothers who acquire the infection during pregnancy, as well as life-threatening neuropathy in immunocompromised patients, in particular those with AIDS. Here, we investigate the efficacy of a novel cell-free vaccine composed of DC exosomes, which are secreted antigen-presenting vesicles that express functional major histocompatibility complex class I and II and T-cell-costimulatory molecules. They have already been shown to induce potent antitumor immune responses. We investigated the potential of DC2.4 cell line-derived exosomes to induce protective immunity against toxoplasmosis. Our data show that most adoptively transferred T. gondii-pulsed DC-derived exosomes were transferred to the spleen, elicited a strong systemic Th1-modulated Toxoplasma-specific immune response in vivo, and conferred good protection against infection. These findings support the possibility that DC-derived exosomes can be used for T. gondii immunoprophylaxis and for immunoprophylaxis against many other pathogens. PMID:15213158

  5. Trans-packaging of human immunodeficiency virus type 1 genome into Gag virus-like particles in Saccharomyces cerevisiae.

    PubMed

    Tomo, Naoki; Goto, Toshiyuki; Morikawa, Yuko

    2013-03-26

    Yeast is recognized as a generally safe microorganism and is utilized for the production of pharmaceutical products, including vaccines. We previously showed that expression of human immunodeficiency virus type 1 (HIV-1) Gag protein in Saccharomyces cerevisiae spheroplasts released Gag virus-like particles (VLPs) extracellularly, suggesting that the production system could be used in vaccine development. In this study, we further establish HIV-1 genome packaging into Gag VLPs in a yeast cell system. The nearly full-length HIV-1 genome containing the entire 5' long terminal repeat, U3-R-U5, did not transcribe gag mRNA in yeast. Co-expression of HIV-1 Tat, a transcription activator, did not support the transcription. When the HIV-1 promoter U3 was replaced with the promoter for the yeast glyceraldehyde-3-phosphate dehydrogenase gene, gag mRNA transcription was restored, but no Gag protein expression was observed. Co-expression of HIV-1 Rev, a factor that facilitates nuclear export of gag mRNA, did not support the protein synthesis. Progressive deletions of R-U5 and its downstream stem-loop-rich region (SL) to the gag start ATG codon restored Gag protein expression, suggesting that a highly structured noncoding RNA generated from the R-U5-SL region had an inhibitory effect on gag mRNA translation. When a plasmid containing the HIV-1 genome with the R-U5-SL region was coexpressed with an expression plasmid for Gag protein, the HIV-1 genomic RNA was transcribed and incorporated into Gag VLPs formed by Gag protein assembly, indicative of the trans-packaging of HIV-1 genomic RNA into Gag VLPs in a yeast cell system. The concentration of HIV-1 genomic RNA in Gag VLPs released from yeast was approximately 500-fold higher than that in yeast cytoplasm. The deletion of R-U5 to the gag gene resulted in the failure of HIV-1 RNA packaging into Gag VLPs, indicating that the packaging signal of HIV-1 genomic RNA present in the R-U5 to gag region functions similarly in yeast cells

  6. Low-dose radiation induces Drosophila innate immunity through Toll pathway activation.

    PubMed

    Seong, Ki Moon; Kim, Cha Soon; Lee, Byung-Sub; Nam, Seon Young; Yang, Kwang Hee; Kim, Ji-Young; Park, Joong-Jean; Min, Kyung-Jin; Jin, Young-Woo

    2012-01-01

    Numerous studies report that exposing certain organisms to low-dose radiation induces beneficial effects on lifespan, tumorigenesis, and immunity. By analyzing survival after bacterial infection and antimicrobial peptide gene expression in irradiated flies, we demonstrate that low-dose irradiation of Drosophila enhances innate immunity. Low-dose irradiation of flies significantly increased resistance against gram-positive and gram-negative bacterial infections, as well as expression of several antimicrobial peptide genes. Additionally, low-dose irradiation also resulted in a specific increase in expression of key proteins of the Toll signaling pathway and phosphorylated forms of p38 and JNK. These results indicate that innate immunity is activated after low-dose irradiation through Toll signaling pathway in Drosophila.

  7. Injury-induced immune responses in Hydra.

    PubMed

    Wenger, Yvan; Buzgariu, Wanda; Reiter, Silke; Galliot, Brigitte

    2014-08-01

    The impact of injury-induced immune responses on animal regenerative processes is highly variable, positive or negative depending on the context. This likely reflects the complexity of the innate immune system that behaves as a sentinel in the transition from injury to regeneration. Early-branching invertebrates with high regenerative potential as Hydra provide a unique framework to dissect how injury-induced immune responses impact regeneration. A series of early cellular events likely require an efficient immune response after amputation, as antimicrobial defence, epithelial cell stretching for wound closure, migration of interstitial progenitors toward the wound, cell death, phagocytosis of cell debris, or reconstruction of the extracellular matrix. The analysis of the injury-induced transcriptomic modulations of 2636 genes annotated as immune genes in Hydra identified 43 genes showing an immediate/early pulse regulation in all regenerative contexts examined. These regulations point to an enhanced cytoprotection via ROS signaling (Nrf, C/EBP, p62/SQSMT1-l2), TNFR and TLR signaling (TNFR16-like, TRAF2l, TRAF5l, jun, fos-related, SIK2, ATF1/CREB, LRRC28, LRRC40, LRRK2), proteasomal activity (p62/SQSMT1-l1, Ced6/Gulf, NEDD8-conjugating enzyme Ubc12), stress proteins (CRYAB1, CRYAB2, HSP16.2, DnaJB9, HSP90a1), all potentially regulating NF-κB activity. Other genes encoding immune-annotated proteins such as NPYR4, GTPases, Swap70, the antiproliferative BTG1, enzymes involved in lipid metabolism (5-lipoxygenase, ACSF4), secreted clotting factors, secreted peptidases are also pulse regulated upon bisection. By contrast, metalloproteinases and antimicrobial peptide genes largely follow a context-dependent regulation, whereas the protease inhibitor α2macroglobulin gene exhibits a sustained up-regulation. Hence a complex immune response to injury is linked to wound healing and regeneration in Hydra. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights

  8. A Temporospatial Map That Defines Specific Steps at Which Critical Surfaces in the Gag MA and CA Domains Act during Immature HIV-1 Capsid Assembly in Cells

    PubMed Central

    Robinson, Bridget A.; Reed, Jonathan C.; Geary, Clair D.; Swain, J. Victor

    2014-01-01

    ABSTRACT During HIV-1 assembly, Gag polypeptides target to the plasma membrane, where they multimerize to form immature capsids that undergo budding and maturation. Previous mutational analyses identified residues within the Gag matrix (MA) and capsid (CA) domains that are required for immature capsid assembly, and structural studies showed that these residues are clustered on four exposed surfaces in Gag. Exactly when and where the three critical surfaces in CA function during assembly are not known. Here, we analyzed how mutations in these four critical surfaces affect the formation and stability of assembly intermediates in cells expressing the HIV-1 provirus. The resulting temporospatial map reveals that critical MA residues act during membrane targeting, residues in the C-terminal CA subdomain (CA-CTD) dimer interface are needed for the stability of the first membrane-bound assembly intermediate, CA-CTD base residues are necessary for progression past the first membrane-bound intermediate, and residues in the N-terminal CA subdomain (CA-NTD) stabilize the last membrane-bound intermediate. Importantly, we found that all four critical surfaces act while Gag is associated with the cellular facilitators of assembly ABCE1 and DDX6. When correlated with existing structural data, our findings suggest the following model: Gag dimerizes via the CA-CTD dimer interface just before or during membrane targeting, individual CA-CTD hexamers form soon after membrane targeting, and the CA-NTD hexameric lattice forms just prior to capsid release. This model adds an important new dimension to current structural models by proposing the potential order in which key contacts within the immature capsid lattice are made during assembly in cells. IMPORTANCE While much is known about the structure of the completed HIV-1 immature capsid and domains of its component Gag proteins, less is known about the sequence of events leading to formation of the HIV-1 immature capsid. Here we used

  9. Influence of a cocoa-enriched diet on specific immune response in ovalbumin-sensitized rats.

    PubMed

    Pérez-Berezo, Teresa; Ramiro-Puig, Emma; Pérez-Cano, Francisco J; Castellote, Cristina; Permanyer, Joan; Franch, Angels; Castell, Margarida

    2009-03-01

    Previous studies in young rats have reported the impact of 3 weeks of high cocoa intake on healthy immune status. The present article describes the effects of a longer-term cocoa-enriched diet (9 weeks) on the specific immune response to ovalbumin (OVA) in adult Wistar rats. At 4 weeks after immunization, control rats produced anti-OVA antibodies, which, according their amount and isotype, were arranged as follows: IgG1 > IgG2a > IgM > IgG2b > IgG2c. Both cocoa diets studied (4% and 10%) down-modulated OVA-specific antibody levels of IgG1 (main subclass associated with the Th2 immune response in rats), IgG2a, IgG2c and IgM isotypes. Conversely, cocoa-fed rats presented equal or higher levels of anti-OVA IgG2b antibodies (subclass linked to the Th1 response). Spleen and lymph node cells from OVA-immunized control and cocoa-fed animals proliferated similarly under OVA stimulation. However, spleen cells from cocoa-fed animals showed decreased interleukin-4 secretion (main Th2 cytokine), and lymph node cells from the same rats displayed higher interferon-gamma secretion (main Th1 cytokine). These changes were accompanied by a reduction in the number of anti-OVA IgG-secreting cells in spleen. In conclusion, cocoa diets induced attenuation of antibody synthesis that may be attributable to specific down-regulation of the Th2 immune response.

  10. DNA-MVA-protein vaccination of rhesus macaques induces HIV-specific immunity in mucosal-associated lymph nodes and functional antibodies.

    PubMed

    Chege, Gerald K; Burgers, Wendy A; Müller, Tracey L; Gray, Clive M; Shephard, Enid G; Barnett, Susan W; Ferrari, Guido; Montefiori, David; Williamson, Carolyn; Williamson, Anna-Lise

    2017-02-07

    Successful future HIV vaccines are expected to generate an effective cellular and humoral response against the virus in both the peripheral blood and mucosal compartments. We previously reported the development of DNA-C and MVA-C vaccines based on HIV-1 subtype C and demonstrated their immunogenicity when given in a DNA prime-MVA boost combination in a nonhuman primate model. In the current study, rhesus macaques previously vaccinated with a DNA-C and MVA-C vaccine regimen were re-vaccinated 3.5years later with MVA-C followed by a protein vaccine based on HIV-1 subtype C envelope formulated with MF59 adjuvant (gp140Env/MF59), and finally a concurrent boost with both vaccines. A single MVA-C re-vaccination elicited T cell responses in all animals similar to previous peak responses, with 4/7 demonstrating responses >1000 SFU/10 6 PBMC. In contrast to an Env/MF59-only vaccine, concurrent boosting with MVA-C and Env/MF59 induced HIV-specific cellular responses in multiple mucosal associated lymph nodes in 6/7 animals, with high magnitude responses in some animals. Both vaccine regimens induced high titer Env-specific antibodies with ADCC activity, as well as neutralization of Tier 1 viruses and modest Tier 2 neutralization. These data demonstrate the feasibility of inducing HIV-specific immunity in the blood and mucosal sites of viral entry by means of DNA and poxvirus-vectored vaccines, in combination with a HIV envelope-based protein vaccine. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  11. Platelet activating factor receptor binding plays a critical role in jet fuel-induced immune suppression.

    PubMed

    Ramos, Gerardo; Kazimi, Nasser; Nghiem, Dat X; Walterscheid, Jeffrey P; Ullrich, Stephen E

    2004-03-15

    Applying military jet fuel (JP-8) or commercial jet fuel (Jet-A) to the skin of mice suppresses the immune response in a dose-dependent manner. The release of biological response modifiers, particularly prostaglandin E2 (PGE2), is a critical step in activating immune suppression. Previous studies have shown that injecting selective cyclooxygenase-2 inhibitors into jet fuel-treated mice blocks immune suppression. Because the inflammatory phospholipid mediator, platelet-activating factor (PAF), up-regulates cyclooxygenase-2 production and PGE2 synthesis by keratinocytes, we tested the hypothesis that PAF-receptor binding plays a role in jet fuel-induced immune suppression. Treating keratinocyte cultures with PAF and/or jet fuel (JP-8 and Jet-A) stimulates PGE2 secretion. Jet fuel-induced PGE2 production was suppressed by treating the keratinocytes with specific PAF-receptor antagonists. Injecting mice with PAF, or treating the skin of the mice with JP-8, or Jet-A, induced immune suppression. Jet fuel-induced immune suppression was blocked when the jet fuel-treated mice were injected with PAF-receptor antagonists before treatment. Jet fuel treatment has been reported to activate oxidative stress and treating the mice with anti-oxidants (Vitamins C, or E or beta-hydroxy toluene), before jet fuel application, interfered with immune suppression. These findings confirm previous studies showing that PAF-receptor binding can modulate immune function. Furthermore, they suggest that PAF-receptor binding may be an early event in the induction of immune suppression by immunotoxic environmental agents that target the skin.

  12. Ebola Virus Glycoprotein Induces an Innate Immune Response In vivo via TLR4

    PubMed Central

    Lai, Chih-Yun; Strange, Daniel P.; Wong, Teri Ann S.; Lehrer, Axel T.; Verma, Saguna

    2017-01-01

    Ebola virus (EBOV), a member of the Filoviridae family, causes the most severe form of viral hemorrhagic fever. Although no FDA licensed vaccine or treatment against Ebola virus disease (EVD) is currently available, Ebola virus glycoprotein (GP) is the major antigen used in all candidate Ebola vaccines. Recent reports of protection as quickly as within 6 days of administration of the rVSV-based vaccine expressing EBOV GP before robust humoral responses were generated suggests that the innate immune responses elicited early after vaccination may contribute to the protection. However, the innate immune responses induced by EBOV GP in the absence of viral vectors or adjuvants have not been fully characterized in vivo. Our recent studies demonstrated that immunization with highly purified recombinant GP in the absence of adjuvants induced a robust IgG response and partial protection against EBOV infection suggesting that GP alone can induce protective immunity. In this study we investigated the early immune response to purified EBOV GP alone in vitro and in vivo. We show that GP was efficiently internalized by antigen presenting cells and subsequently induced production of key inflammatory cytokines. In vivo, immunization of mice with EBOV GP triggered the production of key Th1 and Th2 innate immune cytokines and chemokines, which directly governed the recruitment of CD11b+ macrophages and CD11c+ dendritic cells to the draining lymph nodes (DLNs). Pre-treatment of mice with a TLR4 antagonist inhibited GP-induced cytokine production and recruitment of immune cells to the DLN. EBOV GP also upregulated the expression of costimulatory molecules in bone marrow derived macrophages suggesting its ability to enhance APC stimulatory capacity, which is critical for the induction of effective antigen-specific adaptive immunity. Collectively, these results provide the first in vivo evidence that early innate immune responses to EBOV GP are mediated via the TLR4 pathway and are

  13. Periodontitis induced by Porphyromonas gingivalis drives periodontal microbiota dysbiosis and insulin resistance via an impaired adaptive immune response

    PubMed Central

    Blasco-Baque, Vincent; Garidou, Lucile; Pomié, Céline; Escoula, Quentin; Loubieres, Pascale; Le Gall-David, Sandrine; Lemaitre, Mathieu; Nicolas, Simon; Klopp, Pascale; Waget, Aurélie; Azalbert, Vincent; Colom, André; Bonnaure-Mallet, Martine; Kemoun, Philippe; Serino, Matteo; Burcelin, Rémy

    2017-01-01

    Objective To identify a causal mechanism responsible for the enhancement of insulin resistance and hyperglycaemia following periodontitis in mice fed a fat-enriched diet. Design We set-up a unique animal model of periodontitis in C57Bl/6 female mice by infecting the periodontal tissue with specific and alive pathogens like Porphyromonas gingivalis (Pg), Fusobacterium nucleatum and Prevotella intermedia. The mice were then fed with a diabetogenic/non-obesogenic fat-enriched diet for up to 3 months. Alveolar bone loss, periodontal microbiota dysbiosis and features of glucose metabolism were quantified. Eventually, adoptive transfer of cervical (regional) and systemic immune cells was performed to demonstrate the causal role of the cervical immune system. Results Periodontitis induced a periodontal microbiota dysbiosis without mainly affecting gut microbiota. The disease concomitantly impacted on the regional and systemic immune response impairing glucose metabolism. The transfer of cervical lymph-node cells from infected mice to naive recipients guarded against periodontitis-aggravated metabolic disease. A treatment with inactivated Pg prior to the periodontal infection induced specific antibodies against Pg and protected the mouse from periodontitis-induced dysmetabolism. Finally, a 1-month subcutaneous chronic infusion of low rates of lipopolysaccharides from Pg mimicked the impact of periodontitis on immune and metabolic parameters. Conclusions We identified that insulin resistance in the high-fat fed mouse is enhanced by pathogen-induced periodontitis. This is caused by an adaptive immune response specifically directed against pathogens and associated with a periodontal dysbiosis. PMID:26838600

  14. Vaccination with Gag, Vif, and Nef gene fragments affords partial control of viral replication after mucosal challenge with SIVmac239.

    PubMed

    Martins, Mauricio A; Wilson, Nancy A; Piaskowski, Shari M; Weisgrau, Kim L; Furlott, Jessica R; Bonaldo, Myrna C; Veloso de Santana, Marlon G; Rudersdorf, Richard A; Rakasz, Eva G; Keating, Karen D; Chiuchiolo, Maria J; Piatak, Michael; Allison, David B; Parks, Christopher L; Galler, Ricardo; Lifson, Jeffrey D; Watkins, David I

    2014-07-01

    Broadly targeted cellular immune responses are thought to be important for controlling replication of human and simian immunodeficiency viruses (HIV and SIV). However, eliciting such responses by vaccination is complicated by immunodominance, the preferential targeting of only a few of the many possible epitopes of a given antigen. This phenomenon may be due to the coexpression of dominant and subdominant epitopes by the same antigen-presenting cell and may be overcome by distributing these sequences among several different vaccine constructs. Accordingly, we tested whether vaccinating rhesus macaques with "minigenes" encoding fragments of Gag, Vif, and Nef resulted in broadened cellular responses capable of controlling SIV replication. We delivered these minigenes through combinations of recombinant Mycobacterium bovis BCG (rBCG), electroporated recombinant DNA (rDNA) along with an interleukin-12 (IL-12)-expressing plasmid (EP rDNA plus pIL-12), yellow fever vaccine virus 17D (rYF17D), and recombinant adenovirus serotype 5 (rAd5). Although priming with EP rDNA plus pIL-12 increased the breadth of vaccine-induced T-cell responses, this effect was likely due to the improved antigen delivery afforded by electroporation rather than modulation of immunodominance. Indeed, Mamu-A*01(+) vaccinees mounted CD8(+) T cells directed against only one subdominant epitope, regardless of the vaccination regimen. After challenge with SIVmac239, vaccine efficacy was limited to a modest reduction in set point in some of the groups and did not correlate with standard T-cell measurements. These findings suggest that broad T-cell responses elicited by conventional vectors may not be sufficient to substantially contain AIDS virus replication. Immunodominance poses a major obstacle to the generation of broadly targeted, HIV-specific cellular responses by vaccination. Here we attempted to circumvent this phenomenon and thereby broaden the repertoire of SIV-specific cellular responses by

  15. Dendritic cell-tumor coculturing vaccine can induce antitumor immunity through both NK and CTL interaction.

    PubMed

    Kim, K D; Choi, S C; Kim, A; Choe, Y K; Choe, I S; Lim, J S

    2001-11-01

    Immunization of dendritic cells (DC) pulsed with tumor antigen can activate tumor-specific cytotoxic T lymphocytes (CTL) that are responsible for protection and regression. We show here that immunization with bone marrow-derived DC cocultured with tumor cells can induce a protective immunity against challenges to viable tumor cells. In this study, we further investigated the mechanism by which the antitumor activity was induced. Immunization of mice with DC cocultured with murine colon carcinoma. CT-26 cells, augmented CTL activity against the tumor cells. Concomitantly, an increase in natural killer (NK) cell activity was also detected in the same mice. When DC were fixed with paraformaldehyde prior to coculturing with tumor cells, most of the CTL and NK cell activity diminished, indicating that DC are involved in the process of presenting the tumor antigen(s) to CTL. NK cell depletion in vivo produced markedly low tumor-specific CTL activity responsible for tumor prevention. In addition, RT-PCR analysis confirmed the high expression of INF-gamma mRNA in splenocytes after vaccination with DC cocultured with tumors, but low expression in splenocytes from NK-depleted mice. Most importantly, the tumor protective effect rendered to DC by the coculturing with CT-26 cells was not observed in NK-depleted mice, which suggests that DC can induce an antitumor immune response by enhancing NK cell-dependent CTL activation. Collectively, our results indicate that NK cells are required during the priming of cytotoxic T-cell response by DC-based tumor vaccine and seem to delineate a mechanism by which DC vaccine can provide the desired immunity.

  16. Human Foamy Virus Capsid Formation Requires an Interaction Domain in the N Terminus of Gag

    PubMed Central

    Tobaly-Tapiero, Joelle; Bittoun, Patricia; Giron, Marie-Lou; Neves, Manuel; Koken, Marcel; Saïb, Ali; de Thé, Hugues

    2001-01-01

    Retroviral Gag expression is sufficient for capsid assembly, which occurs through interaction between distinct Gag domains. Human foamy virus (HFV) capsids assemble within the cytoplasm, although their budding, which mainly occurs in the endoplasmic reticulum, requires the presence of homologous Env. Yet little is known about the molecular basis of HFV Gag precursor assembly. Using fusions between HFV Gag and a nuclear reporter protein, we have identified a strong interaction domain in the N terminus of HFV Gag which is predicted to contain a conserved coiled-coil motif. Deletion within this region in an HFV provirus abolishes viral production through inhibition of capsid assembly. PMID:11287585

  17. Transport and processing of the Rous sarcoma virus Gag protein in the endoplasmic reticulum.

    PubMed Central

    Krishna, N K; Weldon, R A; Wills, J W

    1996-01-01

    The Gag proteins of replication-competent retroviruses direct budding at the plasma membrane and are cleaved by the viral protease (PR) just before or very soon after particle release. In contrast, defective retroviruses that bud into the endoplasmic reticulum (ER) have been found, and morphologically these appear to contain uncleaved Gag proteins. From this, it has been proposed that activation of PR may depend upon a host factor found only at the plasma membrane. However, if Gag proteins were cleaved by PR before the particle could pinch off the ER membrane, then the only particles that would remain visible are those that packaged smaller-than-normal amounts of PR, and these would have an immature morphology. To distinguish between these two hypotheses, we made use of the Rous sarcoma virus (RSV) Gag protein, the PR of RSV IS included on each Gag molecule. To target Gag to the ER, a signal peptide was installed at its amino terminus in place of the plasma membrane-binding domain. An intervening, hydrophobic, transmembrane anchor was included to keep Gag extended into the cytoplasm. We found that PR-mediated processing occurred, although the cleavage products were rapidly degraded. When the anchor was removed, allowing the entire protein to be inserted into the lumen of the ER, Gag processing occurred with a high level of efficiency, and the cleavage products were quite stable. Thus, PR activation does not require targeting of Gag molecules to the plasma membrane. Unexpectedly, molecules lacking the transmembrane anchor were rapidly secreted from the cell in a nonmembrane-enclosed form and in a manner that was very sensitive to brefeldin A and monensin. In contrast, the wild-type RSV and Moloney murine leukemia virus Gag proteins were completely insensitive to these inhibitors, suggesting that the normal mechanism of transport to the plasma membrane does not require interactions with the secretory pathway. PMID:8627676

  18. Detection of HIV-1 p24 Gag in plasma by a nanoparticle-based bio-barcode-amplification method.

    PubMed

    Kim, Eun-Young; Stanton, Jennifer; Korber, Bette T M; Krebs, Kendall; Bogdan, Derek; Kunstman, Kevin; Wu, Samuel; Phair, John P; Mirkin, Chad A; Wolinsky, Steven M

    2008-06-01

    Detection of HIV-1 in patients is limited by the sensitivity and selectivity of available tests. The nanotechnology-based bio-barcode-amplification method offers an innovative approach to detect specific HIV-1 antigens from diverse HIV-1 subtypes. We evaluated the efficacy of this protein-detection method in detecting HIV-1 in men enrolled in the Chicago component of the Multicenter AIDS Cohort Study (MACS). The method relies on magnetic microparticles with antibodies that specifically bind the HIV-1 p24 Gag protein and nanoparticles that are encoded with DNA and antibodies that can sandwich the target protein captured by the microparticle-bound antibodies. The aggregate sandwich structures are magnetically separated from solution, and treated to remove the conjugated barcode DNA. The DNA barcodes (hundreds per target) were identified by a nanoparticle-based detection method that does not rely on PCR. Of 112 plasma samples from HIV-1-infected subjects, 111 were positive for HIV-1 p24 Gag protein (range: 0.11-71.5 ng/ml of plasma) by the bio-barcode-amplification method. HIV-1 p24 Gag protein was detected in only 23 out of 112 men by the conventional ELISA. A total of 34 uninfected subjects were negative by both tests. Thus, the specificity of the bio-barcode-amplification method was 100% and the sensitivity 99%. The bio-barcode-amplification method detected HIV-1 p24 Gag protein in plasma from all study subjects with less than 200 CD4(+) T cells/microl of plasma (100%) and 19 out of 20 (95%) HIV-1-infected men who had less than 50 copies/ml of plasma of HIV-1 RNA. In a separate group of 60 diverse international isolates, representative of clades A, B, C and D and circulating recombinant forms CRF01_AE and CRF02_AG, the bio-barcode-amplification method identified the presence of virus correctly. The bio-barcode-amplification method was superior to the conventional ELISA assay for the detection of HIV-1 p24 Gag protein in plasma with a breadth of coverage for diverse

  19. Immune Modulatory Effects of IL-22 on Allergen-Induced Pulmonary Inflammation

    PubMed Central

    Fang, Ping; Zhou, Li; Zhou, Yuqi; Kolls, Jay K.; Zheng, Tao; Zhu, Zhou

    2014-01-01

    IL-22 is a Th17/Th22 cytokine that is increased in asthma. However, recent animal studies showed controversial findings in the effects of IL-22 in allergic asthma. To determine the role of IL-22 in ovalbumin-induced allergic inflammation we generated inducible lung-specific IL-22 transgenic mice. Transgenic IL-22 expression and signaling activity in the lung were determined. Ovalbumin (OVA)-induced pulmonary inflammation, immune responses, and airway hyperresponsiveness (AHR) were examined and compared between IL-22 transgenic mice and wild type controls. Following doxycycline (Dox) induction, IL-22 protein was readily detected in the large (CC10 promoter) and small (SPC promoter) airway epithelial cells. IL-22 signaling was evidenced by phosphorylated STAT3. After OVA sensitization and challenge, compared to wild type littermates, IL-22 transgenic mice showed decreased eosinophils in the bronchoalveolar lavage (BAL), and in lung tissue, decreased mucus metaplasia in the airways, and reduced AHR. Among the cytokines and chemokines examined, IL-13 levels were reduced in the BAL fluid as well as in lymphocytes from local draining lymph nodes of IL-22 transgenic mice. No effect was seen on the levels of serum total or OVA-specific IgE or IgG. These findings indicate that IL-22 has immune modulatory effects on pulmonary inflammatory responses in allergen-induced asthma. PMID:25254361

  20. Complete Freund's adjuvant induces experimental autoimmune myocarditis by enhancing IL-6 production during initiation of the immune response.

    PubMed

    Fontes, Jillian A; Barin, Jobert G; Talor, Monica V; Stickel, Natalie; Schaub, Julie; Rose, Noel R; Čiháková, Daniela

    2017-06-01

    Complete Freund's Adjuvant (CFA) emulsified with an antigen is a widely used method to induce autoimmune disease in animal models, yet the contribution of CFA to the immune response is not well understood. We compared the effectiveness of CFA with Incomplete Freund's Adjuvant (IFA) or TiterMax Gold Adjuvant (TMax) in experimental autoimmune myocarditis (EAM) in male mice. EAM was induced in A/J, BALB/c, and IL6KO BALB/c male mice by injection of the myocarditogenic peptide in CFA, IFA, or TMax on days 0 and 7. EAM severity was analyzed by histology on day 21. In addition, specific flow cytometry outcomes were evaluated on day 21. Only mice immunized with CFA and myocarditogenic peptide on both days 0 and 7 developed substantial myocarditis as measured by histology. We observed a significantly increased level of IL6 in the spleen 3 days after CFA immunization. In the spleen and heart on day 21, there was an expansion of myeloid cells in CFA-immunized mice, as compared to IFA or TMax-immunized animals. Recombinant IL-6 at the time of IFA immunization partially restored susceptibility of the mice to EAM. We also treated EAM-resistant IL-6 knockout mice with recombinant IL-6 around the time of the first immunization, on days -1 to 2, completely restoring disease susceptibility, showing that the requirement for IL-6 coincides with primary immunization. Examining APC populations in the lymph node draining the immunization site evidenced the contribution of IL-6 to the CFA-dependence of EAM was through controlling local dendritic cell (DC) trafficking. CFA used with myocarditogenic peptide twice is required to induce EAM in both A/J and Balb/c mice. Although IFA and TiterMax induce antibody responses, only CFA preferentially induced autoantigen-specific responses. CFA expands monocytes in the heart and in the spleen. IL-6 signaling is required during short window around primary immunization to induce EAM. In addition, IL-6 deficient mice resistance to EAM could be

  1. HIV-1 maturation inhibitor bevirimat stabilizes the immature Gag lattice.

    PubMed

    Keller, Paul W; Adamson, Catherine S; Heymann, J Bernard; Freed, Eric O; Steven, Alasdair C

    2011-02-01

    Maturation of nascent virions, a key step in retroviral replication, involves cleavage of the Gag polyprotein by the viral protease into its matrix (MA), capsid (CA), and nucleocapsid (NC) components and their subsequent reorganization. Bevirimat (BVM) defines a new class of antiviral drugs termed maturation inhibitors. BVM acts by blocking the final cleavage event in Gag processing, the separation of CA from its C-terminal spacer peptide 1 (SP1). Prior evidence suggests that BVM binds to Gag assembled in immature virions, preventing the protease from accessing the CA-SP1 cleavage site. To investigate this hypothesis, we used cryo-electron tomography to examine the structures of (noninfectious) HIV-1 viral particles isolated from BVM-treated cells. We find that these particles contain an incomplete shell of density underlying the viral envelope, with a hexagonal honeycomb structure similar to the Gag lattice of immature HIV but lacking the innermost, NC-related, layer. We conclude that the shell represents a remnant of the immature Gag lattice that has been processed, except at the CA-SP1 sites, but has remained largely intact. We also compared BVM-treated particles with virions formed by the mutant CA5, in which cleavage between CA and SP1 is also blocked. Here, we find a thinner CA-related shell with no visible evidence of honeycomb organization, indicative of an altered conformation and further suggesting that binding of BVM stabilizes the immature lattice. In both cases, the observed failure to assemble mature capsids correlates with the loss of infectivity.

  2. Breast milk immune complexes are potent inducers of oral tolerance in neonates and prevent asthma development.

    PubMed

    Mosconi, E; Rekima, A; Seitz-Polski, B; Kanda, A; Fleury, S; Tissandie, E; Monteiro, R; Dombrowicz, D D; Julia, V; Glaichenhaus, N; Verhasselt, V

    2010-09-01

    Allergic asthma is a chronic lung disease resulting from an inappropriate T helper (Th)-2 response to environmental antigens. Early tolerance induction is an attractive approach for primary prevention of asthma. Here, we found that breastfeeding by antigen-sensitized mothers exposed to antigen aerosols during lactation induced a robust and long-lasting antigen-specific protection from asthma. Protection was more profound and persistent than the one induced by antigen-exposed non-sensitized mothers. Milk from antigen-exposed sensitized mothers contained antigen-immunoglobulin (Ig) G immune complexes that were transferred to the newborn through the neonatal Fc receptor resulting in the induction of antigen-specific FoxP3(+) CD25(+) regulatory T cells. The induction of oral tolerance by milk immune complexes did not require the presence of transforming growth factor-beta in milk in contrast to tolerance induced by milk-borne free antigen. Furthermore, neither the presence of IgA in milk nor the expression of the inhibitory FcgammaRIIb in the newborn was required for tolerance induction. This study provides new insights on the mechanisms of tolerance induction in neonates and highlights that IgG immune complexes found in breast milk are potent inducers of oral tolerance. These observations may pave the way for the identification of key factors for primary prevention of immune-mediated diseases such as asthma.

  3. Distinct pathways of humoral and cellular immunity induced with the mucosal administration of a nanoemulsion adjuvant.

    PubMed

    Bielinska, Anna U; Makidon, Paul E; Janczak, Katarzyna W; Blanco, Luz P; Swanson, Benjamin; Smith, Douglas M; Pham, Tiffany; Szabo, Zsuzsanna; Kukowska-Latallo, Jolanta F; Baker, James R

    2014-03-15

    Nasal administration of an oil-in-water nanoemulsion (NE) adjuvant W805EC produces potent systemic and mucosal, Th-1- and Th-17-balanced cellular responses. However, its molecular mechanism of action has not been fully characterized and is of particular interest because NE does not contain specific ligands for innate immune receptors. In these studies, we demonstrate that W805EC NE adjuvant activates innate immunity, induces specific gene transcription, and modulates NF-κB activity via TLR2 and TLR4 by a mechanism that appears to be distinct from typical TLR agonists. Nasal immunization with NE-based vaccine showed that the TLR2, TLR4, and MyD88 pathways and IL-12 and IL-12Rβ1 expression are not required for an Ab response, but they are essential for the induction of balanced Th-1 polarization and Th-17 cellular immunity. NE adjuvant induces MHC class II, CD80, and CD86 costimulatory molecule expression and dendritic cell maturation. Further, upon immunization with NE, adjuvant mice deficient in the CD86 receptor had normal Ab responses but significantly reduced Th-1 cellular responses, whereas animals deficient in both CD80 and CD86 or lacking CD40 failed to produce either humoral or cellular immunity. Overall, our data show that intranasal administration of Ag with NE induces TLR2 and TLR4 activation along with a MyD88-independent Ab response and a MyD88-dependent Th-1 and Th-17 cell-mediated immune response. These findings suggest that the unique properties of NE adjuvant may offer novel opportunities for understanding previously unrecognized mechanisms of immune activation important for generating effective mucosal and systemic immune responses.

  4. Small heat shock protein 27: An effective adjuvant for enhancement of HIV-1 Nef antigen-specific immunity.

    PubMed

    Milani, Alireza; Bolhassani, Azam; Shahbazi, Sepideh; Motevalli, Fatemeh; Sadat, Seyed Mehdi; Soleymani, Sepehr

    2017-11-01

    Novel vaccine modalities have been designed to improve the efficiency of vaccines against HIV infections. In this way, the HIV-1 Nef protein has been known as an attractive antigenic candidate in therapeutic vaccine development. Moreover, the endogenous adjuvants such as heat shock proteins (HSPs) and high mobility group box 1 protein (HMGB1) have been suggested effectively to induce antigen-specific humoral and cellular immune responses. In this study, different Nef DNA and protein constructs were produced in eukaryotic and prokaryotic expression systems, and their immunostimulatory properties were evaluated using small heat shock protein 27 (Hsp27) and the HMGB1-derived peptide (Hp91) in a mouse model. Generally, our results indicated that the Hsp27-Nef fusion DNA or protein could significantly elicit higher humoral and cellular immune responses than Nef DNA or protein, respectively. Analysis of the immune responses demonstrated that the Hsp27-Nef fusion protein, and also the mixture of Nef and Hp91 significantly enhanced the Nef-specific T cell responses. Indeed, these regimens induced high levels of IgG2a and IFN-γ directed toward Th1 responses and also Granzyme B secretion as compared to other immunization strategies. The immunostimulatory properties of Freund's adjuvant were significantly less than Hsp27 and Hp91 peptide in various immunization strategies. These findings showed that the use of Hsp27 and Hp91 in protein strategy could improve HIV-1 Nef-specific B- and T-cell immune responses, and also represent a promising HIV-1 vaccine candidate in future. Copyright © 2017 European Federation of Immunological Societies. Published by Elsevier B.V. All rights reserved.

  5. The Use of an Alternative Extraoral Periapical Technique for Patients with Severe Gag Reflex

    PubMed Central

    e Silva, Mauro Henrique Chagas; Santos, Mariane Floriano Lopes; de Lima, Carolina Oliveira; Campos, Celso Neiva

    2016-01-01

    Gag reflex is a physiologic mechanism that promotes contraction of the muscles of the tongue and pharyngeal walls. Different factors, including intraoral radiographic films and sensors, may trigger this reflex. Patients with severe gag reflex may not be able to tolerate the presence of intraoral radiographic films or sensors during root canal therapy (RCT). This factor may prevent an appropriate intraoral radiograph, which is important in RCT. Different approaches have been used to facilitate dental procedures in patients suffering from severe gag reflex. The use of an extraoral radiographic technique is an alternative method to obtain working length confirmation in patients with severe gag reflex. In this report of 2 cases, the use of an extraoral radiographic technique as an alternative approach during RCT in patients with severe gag reflex associated with phobic behavior and trismus was successfully demonstrated. PMID:27547474

  6. Reversing Breast Cancer-Induced Immune Suppression

    DTIC Science & Technology

    2013-01-01

    MDSC use to facilitate immune suppression. Nrf2 protects cells against inflammation and is stabilized in response to inflammation , hypoxia, and... inflammation -induced and conventional MDSC transport of cystine. SASP has no effect on tumor growth, metastatic disease, MDSC accumulation, or MDSC...anti-tumor immunity. It has been demonstrated that inflammation enhances xC- expression on MDSC, but higher xC- expression does not enhance the

  7. MRKAd5 HIV-1 Gag/Pol/Nef Vaccine-Induced T-Cell Responses Inadequately Predict Distance of Breakthrough HIV-1 Sequences to the Vaccine or Viral Load

    PubMed Central

    Janes, Holly; Frahm, Nicole; DeCamp, Allan; Rolland, Morgane; Gabriel, Erin; Wolfson, Julian; Hertz, Tomer; Kallas, Esper; Goepfert, Paul; Friedrich, David P.; Corey, Lawrence; Mullins, James I.; McElrath, M. Juliana; Gilbert, Peter

    2012-01-01

    Background The sieve analysis for the Step trial found evidence that breakthrough HIV-1 sequences for MRKAd5/HIV-1 Gag/Pol/Nef vaccine recipients were more divergent from the vaccine insert than placebo sequences in regions with predicted epitopes. We linked the viral sequence data with immune response and acute viral load data to explore mechanisms for and consequences of the observed sieve effect. Methods Ninety-one male participants (37 placebo and 54 vaccine recipients) were included; viral sequences were obtained at the time of HIV-1 diagnosis. T-cell responses were measured 4 weeks post-second vaccination and at the first or second week post-diagnosis. Acute viral load was obtained at RNA-positive and antibody-negative visits. Findings Vaccine recipients had a greater magnitude of post-infection CD8+ T cell response than placebo recipients (median 1.68% vs 1.18%; p = 0·04) and greater breadth of post-infection response (median 4.5 vs 2; p = 0·06). Viral sequences for vaccine recipients were marginally more divergent from the insert than placebo sequences in regions of Nef targeted by pre-infection immune responses (p = 0·04; Pol p = 0·13; Gag p = 0·89). Magnitude and breadth of pre-infection responses did not correlate with distance of the viral sequence to the insert (p>0·50). Acute log viral load trended lower in vaccine versus placebo recipients (estimated mean 4·7 vs 5·1) but the difference was not significant (p = 0·27). Neither was acute viral load associated with distance of the viral sequence to the insert (p>0·30). Interpretation Despite evidence of anamnestic responses, the sieve effect was not well explained by available measures of T-cell immunogenicity. Sequence divergence from the vaccine was not significantly associated with acute viral load. While point estimates suggested weak vaccine suppression of viral load, the result was not significant and more viral load data would be needed to detect suppression. PMID

  8. Replication-Competent Simian Immunodeficiency Virus (SIV) Gag Escape Mutations Archived in Latent Reservoirs during Antiretroviral Treatment of SIV-Infected Macaques▿

    PubMed Central

    Queen, Suzanne E.; Mears, Brian M.; Kelly, Kathleen M.; Dorsey, Jamie L.; Liao, Zhaohao; Dinoso, Jason B.; Gama, Lucio; Adams, Robert J.; Zink, M. Christine; Clements, Janice E.; Kent, Stephen J.; Mankowski, Joseph L.

    2011-01-01

    In response to pressure exerted by major histocompatibility complex (MHC) class I-mediated CD8+ T cell control, human immunodeficiency virus (HIV) escape mutations often arise in immunodominant epitopes recognized by MHC class I alleles. While the current standard of care for HIV-infected patients is treatment with highly active antiretroviral therapy (HAART), suppression of viral replication in these patients is not absolute and latently infected cells persist as lifelong reservoirs. To determine whether HIV escape from MHC class I-restricted CD8+ T cell control develops during HAART treatment and then enters latent reservoirs in the periphery and central nervous system (CNS), with the potential to emerge as replication-competent virus, we tracked the longitudinal development of the simian immunodeficiency virus (SIV) Gag escape mutation K165R in HAART-treated SIV-infected pigtailed macaques. Key findings of these studies included: (i) SIV Gag K165R escape mutations emerged in both plasma and cerebrospinal fluid (CSF) during the decaying phase of viremia after HAART initiation before suppression of viral replication, (ii) SIV K165R Gag escape mutations were archived in latent proviral DNA reservoirs, including the brain in animals receiving HAART that suppressed viral replication, and (iii) replication-competent SIV Gag K165R escape mutations were present in the resting CD4+ T cell reservoir in HAART-treated SIV-infected macaques. Despite early administration of aggressive antiretroviral treatment, HIV immune escape from CD8+ T cell control can still develop during the decaying phases of viremia and then persist in latent reservoirs, including the brain, with the potential to emerge if HAART therapy is interrupted. PMID:21715484

  9. The potential of immunostimulatory CpG DNA for inducing immunity against genital herpes: opportunities and challenges.

    PubMed

    Harandi, Ali M

    2004-07-01

    Herpes simplex virus type 2 (HSV-2) invades human genital tract mucosa and following local replications can be rapidly transmitted via peripheral nerve axons to the sacral ganglia where it can establish latency. Reactivation of the latent viral reservoir results in recurrent ulcers in the genital region. Innate immunity, the first line of defence during both primary and recurrent genital herpes infections, is crucial during the period of acute infection to limit early virus replication and to facilitate the development of an appropriate specific acquired immunity. Recent developments in immunology reveal that the mammalian innate immune systems use Toll-like receptor (TLR) to specifically sense evolutionary conserved molecules such as bacterial DNA in pathogens. Recently, local-vaginal delivery of CpG containing oligodeoxynucleotide (ODN), a synthetic mimic of bacterial DNA, holds substantial promise as a strong inducer of innate immunity against genital herpes infections in the animal models of the disease. These preclinical observations provide a scientific ground work for introduction of this novel intervention strategy to clinic. This review aims to highlight recent developments and future challenges in use of immunostimulatory CpG ODN for inducing immunity against genital herpes infection and disease.

  10. Involvement of the Rac1-IRSp53-Wave2-Arp2/3 Signaling Pathway in HIV-1 Gag Particle Release in CD4 T Cells

    PubMed Central

    Thomas, Audrey; Mariani-Floderer, Charlotte; López-Huertas, Maria Rosa; Gros, Nathalie; Hamard-Péron, Elise; Favard, Cyril; Ohlmann, Theophile; Alcamí, José

    2015-01-01

    ABSTRACT During HIV-1 assembly, the Gag viral proteins are targeted and assemble at the inner leaflet of the cell plasma membrane. This process could modulate the cortical actin cytoskeleton, located underneath the plasma membrane, since actin dynamics are able to promote localized membrane reorganization. In addition, activated small Rho GTPases are known for regulating actin dynamics and membrane remodeling. Therefore, the modulation of such Rho GTPase activity and of F-actin by the Gag protein during virus particle formation was considered. Here, we studied the implication of the main Rac1, Cdc42, and RhoA small GTPases, and some of their effectors, in this process. The effect of small interfering RNA (siRNA)-mediated Rho GTPases and silencing of their effectors on Gag localization, Gag membrane attachment, and virus-like particle production was analyzed by immunofluorescence coupled to confocal microscopy, membrane flotation assays, and immunoblot assays, respectively. In parallel, the effect of Gag expression on the Rac1 activation level was monitored by G-LISA, and the intracellular F-actin content in T cells was monitored by flow cytometry and fluorescence microscopy. Our results revealed the involvement of activated Rac1 and of the IRSp53-Wave2-Arp2/3 signaling pathway in HIV-1 Gag membrane localization and particle release in T cells as well as a role for actin branching and polymerization, and this was solely dependent on the Gag viral protein. In conclusion, our results highlight a new role for the Rac1-IRSp53-Wave2-Arp2/3 signaling pathway in the late steps of HIV-1 replication in CD4 T lymphocytes. IMPORTANCE During HIV-1 assembly, the Gag proteins are targeted and assembled at the inner leaflet of the host cell plasma membrane. Gag interacts with specific membrane phospholipids that can also modulate the regulation of cortical actin cytoskeleton dynamics. Actin dynamics can promote localized membrane reorganization and thus can be involved in

  11. Protective specific immunity induced by cyclophosphamide plus tumor necrosis factor alpha combination treatment of EL4-lymphoma-bearing C57BL/6 mice.

    PubMed

    Krawczyk, C M; Verstovsek, S; Ujházy, P; Maccubbin, D; Ehrke, M J

    1995-06-01

    A combination treatment protocol initiated 12 days after tumor injection, when the tumor was large, by administering cyclophosphamide (CY, 150 or 250 mg/kg) intraperitoneally followed by intravenous tumor necrosis factor alpha (TNF alpha, 1000 units injection) on days 13, 16, 18, 21, and 23, resulted in about 60% long-term survival (i.e., survival for at least 60 days) in the syngeneic C57BL/6 mouse/EL4 lymphoma model system. The establishment of a specific antitumor immune memory and its possible therapeutic relevance was verified by reinjecting 60-day survivors with EL4 cells; all 60-day survivors that had received the combination treatments rejected the implants and survived for a further 60 days. Thymic cellularity was reduced during treatment and its recovery appeared to correlate with long-term survival and immunity. Thymocytes from mice treated with the combination were found to express significant levels of specific anti-EL4 cytolytic activity following a 4-day stimulation culture with X-irradiated EL4 cells and low concentrations of interleukin-2. This response could not be generated with thymocytes from naive animals. In each case the effect seen with the combination of a moderate CY dose (150 mg/kg) with TNF alpha was better than that seen with either dose of CY alone and equal to or better than that seen with the higher dose of CY combined with TNF alpha. These results indicate that treatment with a single moderate dose of CY in combination with TNF alpha is effective against a large, established tumor in this murine model. Furthermore, all the long-term survivors induced by this treatment developed protective immunity against reimplanted tumor and demonstrated a long-term specific immune memory in the thymus.

  12. Bag the gag rule. Poll indicates most Americans think global gag rule is wrong.

    PubMed

    Ernst, J; Farmer, A

    2000-09-01

    According to studies conducted by the Rand Corporation and the District of Columbia-based Center for Development and Population Activities, conservative and liberal Americans alike overwhelmingly support foreign assistance to international family planning programs. In addition, the 1998 poll shows that 92% of Americans believe that couples have the right to family planning, and a slight majority support government funding of legal overseas abortion services. Despite such evidence, members of the House Representative voted to restrict foreign family planning organizations that receive federal money from using their own non-US funds to provide abortion services overseas. To this effect, foreign family planning organizations and other concerned agencies argued that such a restriction undermines the objectives of the US and effectively denies access to desperately needed support to millions of women worldwide. In particular, organizations like the Center for Reproductive Law and Policy are lobbying lawmakers to strike the gag rule language from the final appropriations bill that will reach US President Clinton's desk, as well as to increase family planning funding levels. However, Clinton has indicated a veto if congress does pass gag rule legislation for the second year in a row.

  13. Multimodality vaccination against clade C SHIV: partial protection against mucosal challenges with a heterologous tier 2 virus.

    PubMed

    Lakhashe, Samir K; Byrareddy, Siddappa N; Zhou, Mingkui; Bachler, Barbara C; Hemashettar, Girish; Hu, Shiu-Lok; Villinger, Francois; Else, James G; Stock, Shannon; Lee, Sandra J; Vargas-Inchaustegui, Diego A; Cofano, Egidio Brocca; Robert-Guroff, Marjorie; Johnson, Welkin E; Polonis, Victoria R; Forthal, Donald N; Loret, Erwann P; Rasmussen, Robert A; Ruprecht, Ruth M

    2014-11-12

    We sought to test whether vaccine-induced immune responses could protect rhesus macaques (RMs) against upfront heterologous challenges with an R5 simian-human immunodeficiency virus, SHIV-2873Nip. This SHIV strain exhibits many properties of transmitted HIV-1, such as tier 2 phenotype (relatively difficult to neutralize), exclusive CCR5 tropism, and gradual disease progression in infected RMs. Since no human AIDS vaccine recipient is likely to encounter an HIV-1 strain that exactly matches the immunogens, we immunized the RMs with recombinant Env proteins heterologous to the challenge virus. For induction of immune responses against Gag, Tat, and Nef, we explored a strategy of immunization with overlapping synthetic peptides (OSP). The immune responses against Gag and Tat were finally boosted with recombinant proteins. The vaccinees and a group of ten control animals were given five low-dose intrarectal (i.r.) challenges with SHIV-2873Nip. All controls and seven out of eight vaccinees became systemically infected; there was no significant difference in viremia levels of vaccinees vs. controls. Prevention of viremia was observed in one vaccinee which showed strong boosting of virus-specific cellular immunity during virus exposures. The protected animal showed no challenge virus-specific neutralizing antibodies in the TZM-bl or A3R5 cell-based assays and had low-level ADCC activity after the virus exposures. Microarray data strongly supported a role for cellular immunity in the protected animal. Our study represents a case of protection against heterologous tier 2 SHIV-C by vaccine-induced, virus-specific cellular immune responses. Copyright © 2014 Elsevier Ltd. All rights reserved.

  14. Lipid biosensor interactions with wild type and matrix deletion HIV-1 Gag proteins.

    PubMed

    Barklis, Eric; Staubus, August O; Mack, Andrew; Harper, Logan; Barklis, Robin Lid; Alfadhli, Ayna

    2018-05-01

    The matrix (MA) domain of the HIV-1 precursor Gag protein (PrGag) has been shown interact with the HIV-1 envelope (Env) protein, and to direct PrGag proteins to plasma membrane (PM) assembly sites by virtue of its affinity to phosphatidylinositol-4,5-bisphosphate (PI[4,5]P2). Unexpectedly, HIV-1 viruses with large MA deletions (ΔMA) have been shown to be conditionally infectious as long as they are matched with Env truncation mutant proteins or alternative viral glycoproteins. To characterize the interactions of wild type (WT) and ΔMA Gag proteins with PI(4,5)P2 and other acidic phospholipids, we have employed a set of lipid biosensors as probes. Our investigations showed marked differences in WT and ΔMA Gag colocalization with biosensors, effects on biosensor release, and association of biosensors with virus-like particles. These results demonstrate an alternative approach to the analysis of viral protein-lipid associations, and provide new data as to the lipid compositions of HIV-1 assembly sites. Copyright © 2018 Elsevier Inc. All rights reserved.

  15. Terminal-Repeat Retrotransposons with GAG Domain in Plant Genomes: A New Testimony on the Complex World of Transposable Elements

    PubMed Central

    Chaparro, Cristian; Gayraud, Thomas; de Souza, Rogerio Fernandes; Domingues, Douglas Silva; Akaffou, Sélastique; Laforga Vanzela, Andre Luis; de Kochko, Alexandre; Rigoreau, Michel; Crouzillat, Dominique; Hamon, Serge; Hamon, Perla; Guyot, Romain

    2015-01-01

    A novel structure of nonautonomous long terminal repeat (LTR) retrotransposons called terminal repeat with GAG domain (TR-GAG) has been described in plants, both in monocotyledonous, dicotyledonous and basal angiosperm genomes. TR-GAGs are relatively short elements in length (<4 kb) showing the typical features of LTR-retrotransposons. However, they carry only one open reading frame coding for the GAG precursor protein involved for instance in transposition, the assembly, and the packaging of the element into the virus-like particle. GAG precursors show similarities with both Copia and Gypsy GAG proteins, suggesting evolutionary relationships of TR-GAG elements with both families. Despite the lack of the enzymatic machinery required for their mobility, strong evidences suggest that TR-GAGs are still active. TR-GAGs represent ubiquitous nonautonomous structures that could be involved in the molecular diversities of plant genomes. PMID:25573958

  16. The role of cytokines in immune changes induced by spaceflight

    NASA Technical Reports Server (NTRS)

    Sonnenfeld, G.; Miller, E. S.

    1993-01-01

    It has become apparent that spaceflight alters many immune responses. Among the regulatory components of the immune response that have been shown to be affected by spaceflight is the cytokine network. Spaceflight, as well as model systems of spaceflight, have been shown to affect the production and action of various cytokines including interferons, interleukins, colony stimulating factors, and tumor necrosis factors. These changes have been shown not to involve a general shutdown of the cytokine network but, rather, to involve selective alterations of specific cytokine functions by spaceflight. The full breadth of changes in cytokines induced by spaceflight, as well as mechanisms, duration, adaptation, reversibility, and significance to resistance to infection and neoplastic diseases, remains to be established.

  17. Intersubtype Differences in the Effect of a Rare p24 Gag Mutation on HIV-1 Replicative Fitness

    PubMed Central

    Chopera, Denis R.; Cotton, Laura A.; Zawaira, Alexander; Mann, Jaclyn K.; Ngandu, Nobubelo K.; Ntale, Roman; Carlson, Jonathan M.; Mlisana, Koleka; Woodman, Zenda; de Assis Rosa, Debra; Martin, Eric; Miura, Toshiyuki; Pereyra, Florencia; Walker, Bruce D.; Gray, Clive M.; Martin, Darren P.; Ndung'u, Thumbi; Brockman, Mark A.; Karim, Salim Abdool

    2012-01-01

    Certain immune-driven mutations in HIV-1, such as those arising in p24Gag, decrease viral replicative capacity. However, the intersubtype differences in the replicative consequences of such mutations have not been explored. In HIV-1 subtype B, the p24Gag M250I mutation is a rare variant (0.6%) that is enriched among elite controllers (7.2%) (P = 0.0005) and appears to be a rare escape variant selected by HLA-B58 supertype alleles (P < 0.01). In contrast, in subtype C, it is a relatively common minor polymorphic variant (10 to 15%) whose appearance is not associated with a particular HLA allele. Using site-directed mutant viruses, we demonstrate that M250I reduces in vitro viral replicative capacity in both subtype B and subtype C sequences. However, whereas in subtype C downstream compensatory mutations at p24Gag codons 252 and 260 reduce the adverse effects of M250I, fitness costs in subtype B appear difficult to restore. Indeed, patient-derived subtype B sequences harboring M250I exhibited in vitro replicative defects, while those from subtype C did not. The structural implications of M250I were predicted by protein modeling to be greater in subtype B versus C, providing a potential explanation for its lower frequency and enhanced replicative defects in subtype B. In addition to accounting for genetic differences between HIV-1 subtypes, the design of cytotoxic-T-lymphocyte-based vaccines may need to account for differential effects of host-driven viral evolution on viral fitness. PMID:23015721

  18. Immunization with the conjugate vaccine Vi-CRM₁₉₇ against Salmonella typhi induces Vi-specific mucosal and systemic immune responses in mice.

    PubMed

    Fiorino, Fabio; Ciabattini, Annalisa; Rondini, Simona; Pozzi, Gianni; Martin, Laura B; Medaglini, Donata

    2012-09-21

    Typhoid fever is a public health problem, especially among young children in developing countries. To address this need, a glycoconjugate vaccine Vi-CRM₁₉₇, composed of the polysaccharide antigen Vi covalently conjugated to the non-toxic mutant of diphtheria toxin CRM₁₉₇, is under development. Here, we assessed the antibody and cellular responses, both local and systemic, following subcutaneous injection of Vi-CRM₁₉₇. The glycoconjugate elicited Vi-specific serum IgG titers significantly higher than unconjugated Vi, with prevalence of IgG1 that persisted for at least 60 days after immunization. Vi-specific IgG, but not IgA, were present in intestinal washes. Lymphocytes proliferation after restimulation with Vi-CRM₁₉₇ was observed in spleen and mesenteric lymph nodes. These data confirm the immunogenicity of Vi-CRM₁₉₇ and demonstrate that the vaccine-specific antibody and cellular immune responses are present also in the intestinal tract, thus strengthening the suitability of Vi-CRM₁₉₇ as a promising candidate vaccine against Salmonella Typhi. Copyright © 2012 Elsevier Ltd. All rights reserved.

  19. Polymorphisms in the Wilms Tumor Gene Are Associated With Interindividual Variations in Rubella Virus-Specific Cellular Immunity After Measles-Mumps-Rubella II Vaccination.

    PubMed

    Voigt, Emily A; Haralambieva, Iana H; Larrabee, Beth L; Kennedy, Richard B; Ovsyannikova, Inna G; Schaid, Daniel J; Poland, Gregory A

    2018-01-30

    Rubella vaccination induces widely variable immune responses in vaccine recipients. While rubella vaccination is effective at inducing immunity to rubella infection in most subjects, up to 5% of individuals do not achieve or maintain long-term protective immunity. To expand upon our previous work identifying genetic polymorphisms that are associated with these interindividual differences in humoral immunity to rubella virus, we performed a genome-wide association study in a large cohort of 1843 subjects to discover single-nucleotide polymorphisms (SNPs) associated with rubella virus-specific cellular immune responses. We identified SNPs in the Wilms tumor protein gene (WT1) that were significantly associated (P < 5 × 10-8) with interindividual variations in rubella-specific interleukin 6 secretion from subjects' peripheral blood mononuclear cells postvaccination. No SNPs were found to be significantly associated with variations in rubella-specific interferon-γ secretion. Our findings demonstrate that genetic polymorphisms in the WT1 gene in subjects of European ancestry are associated with interindividual differences in rubella virus-specific cellular immunity after measles-mumps-rubella II vaccination. © The Author(s) 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

  20. Age- and gender-related alteration in plasma advanced oxidation protein products (AOPP) and glycosaminoglycan (GAG) concentrations in physiological ageing.

    PubMed

    Komosinska-Vassev, Katarzyna; Olczyk, Pawel; Winsz-Szczotka, Katarzyna; Kuznik-Trocha, Kornelia; Klimek, Katarzyna; Olczyk, Krystyna

    2012-02-13

    The authors studied the role of increased oxidative stress in the development of oxidative protein damage and extracellular matrix (ECM) components in ageing. The age- and gender-associated disturbances in connective tissue metabolism were evaluated by the plasma chondroitin sulphated glycosaminoglycans (CS-GAG) and non-sulphated GAG-hyaluronan (HA) measurements. Plasma concentration of advanced oxidation protein products (AOPP) was analysed in order to assess oxidative protein damage and evaluate the possible deleterious role of oxidative phenomenon on tissue proteoglycans' metabolism during the physiological ageing process. Sulphated and non-sulphated GAGs as well as AOPP were quantified in plasma samples from 177 healthy volunteers. A linear age-related decline of plasma CS-GAG level was found in this study (r=-0.46; p<0.05). In contrast, HA concentrations rise gradually with age (r=0.44; p<0.05) in plasma samples. For both ECM components, the observed differences were not gender-specific. A strong age-dependent relationship has been shown in regard to AOPP. AOPP levels significantly increased with age (r=0.63; p<0.05), equally strongly in both men (r=0.69; p<0.05) and women (r=0.57; p<0.05) during physiological ageing. A significant correlation was found between the concentrations of AOPP and both CS-GAG (r=-0.31; p<0.05) and HA (r=0.33; p<0.05). Proceeding with age changes in the ECM are reflected by CS-GAG and HA plasma levels. Strong correlations between AOPP and ECM components indicate that oxidative stress targets protein and non-protein components of the connective tissue matrix during human ageing.

  1. Dynamic of Immune Response induced in Hepatitis B Surface Antigen-transgenic Mice Immunized with a Novel Therapeutic Formulation

    PubMed Central

    Almeida, Freya M Freyre; Blanco, Aracelys; Trujillo, Heidy; Hernández, Dunia; García, Daymir; Alba, José S; Abad, Matilde López; Merino, Nelson; Lobaina, Yadira

    2016-01-01

    ABSTRACT The development of therapeutic vaccines against chronic hepatitis B requires the capacity of the formulation to subvert a tolerated immune response as well as the evaluation of histopathological damage resulting from the treatment. In the present study, the dynamicity of induced immune response to hepatitis B surface antigen (HBsAg) was evaluated in transgenic mice that constitutively express the HBsAg gene (HBsAg-tg mice). After immunization with a vaccine candidate containing both surface (HBsAg) and core (HBcAg) antigens of hepatitis B virus (HBV), the effect of vaccination on clearance of circulating HBsAg and the potential histological alterations were examined. Transgenic (tg) and non-transgenic (Ntg) mice were immunized by intranasal (IN) and subcutaneous (SC) routes simultaneously. A control group received phosphate-buffered saline (PBS) by IN route and aluminum by SC route. Positive responses, at both humoral and cellular levels, were obtained after five immunizations in HBsAg-tg mice. Such responses were delayed and of lower intensity in tg mice, compared to vaccinated Ntg mice. Serum IgG response was characterized by a similar IgG subclass pattern. Even when HBsAg-specific CD8+ T cell responses were clearly detectable by gamma-interferon ELISPOT assay, histopathological alterations were not detected in any organ, including the liver and kidneys. Our study demonstrated, that it is possible to subvert the immune tolerance against HBsAg in tg mice, opening a window for new studies to optimize the schedule, dose, and formulation to improve the immune response to the therapeutic vaccine candidate. These results can be considered a safety proof to support clinical developments for the formulation under study. How to cite this article Freyre FM, Blanco A, Trujillo H, Hernández D, García D, Alba JS, Lopez M, Merino N, Lobaina Y, Aguilar JC. Dynamic of Immune Response induced in Hepatitis B Surface Antigen-transgenic Mice Immunized with a Novel

  2. Emergence and Kinetics of Simian Immunodeficiency Virus-Specific CD8+ T Cells in the Intestines of Macaques during Primary Infection

    PubMed Central

    Veazey, Ronald S.; Gauduin, Marie-Claire; Mansfield, Keith G.; Tham, Irene C.; Altman, John D.; Lifson, Jeffrey D.; Lackner, Andrew A.; Johnson, R. Paul

    2001-01-01

    In this report, three Mamu-A*01+ rhesus macaques were examined to compare the emergence of simian immunodeficiency virus (SIV)-specific CD8+ T cells in the intestines and blood in early SIV infection using a major histocompatibility complex class I tetramer complexed with the Gag181–189 peptide. Fourteen days after intravenous inoculation with SIVmac251, large numbers of SIV Gag181–189-specific CD8+ T cells were detected in the intestinal mucosa (3.1 to 11.5% of CD3+ CD8+ lymphocytes) as well as in the blood (3.1 to 13.4%) of all three macaques. By 21 days postinoculation, levels of tetramer-binding cells had dropped in both the intestines and blood. At day 63, however, levels of SIV Gag181–189-specific CD8+ T cells in the intestines had rebounded in all three macaques to levels that were higher (8.6 to 18.7%) than those at day 21. In contrast, percentages of tetramer-binding cells in the peripheral blood remained comparatively stable (2.5 to 4.5%) at this time point. In summary, SIV Gag181–189-specific CD8+ T cells appeared in both the intestinal mucosa and peripheral blood at a comparable rate and magnitude in primary SIV infection. Given that the intestine is a major site of early viral replication as well as the site where most of the total body lymphocyte pool resides, these data indicate that it is also an early and important site of development of antiviral immune responses. PMID:11581423

  3. Improved Innate and Adaptive Immunostimulation by Genetically Modified HIV-1 Protein Expressing NYVAC Vectors

    PubMed Central

    Quakkelaar, Esther D.; Redeker, Anke; Haddad, Elias K.; Harari, Alexandre; McCaughey, Stella Mayo; Duhen, Thomas; Filali-Mouhim, Abdelali; Goulet, Jean-Philippe; Loof, Nikki M.; Ossendorp, Ferry; Perdiguero, Beatriz; Heinen, Paul; Gomez, Carmen E.; Kibler, Karen V.; Koelle, David M.; Sékaly, Rafick P.; Sallusto, Federica; Lanzavecchia, Antonio; Pantaleo, Giuseppe; Esteban, Mariano; Tartaglia, Jim; Jacobs, Bertram L.; Melief, Cornelis J. M.

    2011-01-01

    Attenuated poxviruses are safe and capable of expressing foreign antigens. Poxviruses are applied in veterinary vaccination and explored as candidate vaccines for humans. However, poxviruses express multiple genes encoding proteins that interfere with components of the innate and adaptive immune response. This manuscript describes two strategies aimed to improve the immunogenicity of the highly attenuated, host-range restricted poxvirus NYVAC: deletion of the viral gene encoding type-I interferon-binding protein and development of attenuated replication-competent NYVAC. We evaluated these newly generated NYVAC mutants, encoding HIV-1 env, gag, pol and nef, for their ability to stimulate HIV-specific CD8 T-cell responses in vitro from blood mononuclear cells of HIV-infected subjects. The new vectors were evaluated and compared to the parental NYVAC vector in dendritic cells (DCs), RNA expression arrays, HIV gag expression and cross-presentation assays in vitro. Deletion of type-I interferon-binding protein enhanced expression of interferon and interferon-induced genes in DCs, and increased maturation of infected DCs. Restoration of replication competence induced activation of pathways involving antigen processing and presentation. Also, replication-competent NYVAC showed increased Gag expression in infected cells, permitting enhanced cross-presentation to HIV-specific CD8 T cells and proliferation of HIV-specific memory CD8 T-cells in vitro. The recombinant NYVAC combining both modifications induced interferon-induced genes and genes involved in antigen processing and presentation, as well as increased Gag expression. This combined replication-competent NYVAC is a promising candidate for the next generation of HIV vaccines. PMID:21347234

  4. Contact-induced mitochondrial polarization supports HIV-1 virological synapse formation.

    PubMed

    Groppelli, Elisabetta; Starling, Shimona; Jolly, Clare

    2015-01-01

    Rapid HIV-1 spread between CD4 T lymphocytes occurs at retrovirus-induced immune cell contacts called virological synapses (VS). VS are associated with striking T cell polarization and localized virus budding at the site of contact that facilitates cell-cell spread. In addition to this, spatial clustering of organelles, including mitochondria, to the contact zone has been previously shown. However, whether cell-cell contact specifically induces dynamic T cell remodeling during VS formation and what regulates this process remain unclear. Here, we report that contact between an HIV-1-infected T cell and an uninfected target T cell specifically triggers polarization of mitochondria concomitant with recruitment of the major HIV-1 structural protein Gag to the site of cell-cell contact. Using fixed and live-cell imaging, we show that mitochondrial and Gag polarization in HIV-1-infected T cells occurs within minutes of contact with target T cells, requires the formation of stable cell-cell contacts, and is an active, calcium-dependent process. We also find that perturbation of mitochondrial polarization impairs cell-cell spread of HIV-1 at the VS. Taken together, these data suggest that HIV-1-infected T cells are able to sense and respond to contact with susceptible target cells and undergo dynamic cytoplasmic remodeling to create a synaptic environment that supports efficient HIV-1 VS formation between CD4 T lymphocytes. HIV-1 remains one of the major global health challenges of modern times. The capacity of HIV-1 to cause disease depends on the virus's ability to spread between immune cells, most notably CD4 T lymphocytes. Cell-cell transmission is the most efficient way of HIV-1 spread and occurs at the virological synapse (VS). The VS forms at the site of contact between an infected cell and an uninfected cell and is characterized by polarized assembly and budding of virions and clustering of cellular organelles, including mitochondria. Here, we show that cell

  5. DNA vaccines targeting the encoded antigens to dendritic cells induce potent antitumor immunity in mice.

    PubMed

    Cao, Jun; Jin, Yiqi; Li, Wei; Zhang, Bin; He, Yang; Liu, Hongqiang; Xia, Ning; Wei, Huafeng; Yan, Jian

    2013-08-14

    Although DNA vaccine holds a great potential for cancer immunotherapy, effective long-lasting antitumoral immunity sufficient to induce durable responses in cancer patients remains to be achieved. Considering the pivotal role of dendritic cells (DC) in the antigen processing and presentation, we prepared DC-targeting DNA vaccines by fusing tumor-associated antigen HER2/neu ectodomain to single chain antibody fragment (scFv) from NLDC-145 antibody specific for DC-restricted surface molecule DEC-205 (scFvNLDC-145), and explored its antitumoral efficacy and underlying mechanisms in mouse breast cancer models. In vivo targeting assay demonstrated that scFvNLDC-145 specifically delivered DNA vaccine-encoded antigen to DC. Compared with untargeted HER2/neu DNA vaccines, vaccination with scFvNLDC-145-HER2/neu markedly promoted the HER2/neu-specific cellular and humoral immune responses with long-lasting immune memory, resulting in effective protection against challenge of HER2/neu-positive D2F2/E2 breast tumor while ineffective in parental HER2/neu-negative D2F2 breast tumor. More importantly, in combination with temporary depletion of regulatory T cells (Treg) by low-dose cyclophosphamide, vaccination with scFvNLDC-145-HER2/neu induced the regression of established D2F2/E2 breast tumor and significantly retarded the development of spontaneous mammary carcinomas in transgenic BALB-neuT mice. Our findings demonstrate that DC-targeted DNA vaccines for in vivo direct delivery of tumor antigens to DC could induce potent antigen-specific cellular and humoral immune responses and, if additional combination with systemic Treg depletion, was able to elicit an impressively therapeutic antitumoral activity, providing a rationale for further development of this approach for cancer treatment.

  6. Transcriptomic analysis reveals tomato genes whose expression is induced specifically during effector-triggered immunity and identifies the Epk1 protein kinase which is required for the host response to three bacterial effector proteins.

    PubMed

    Pombo, Marina A; Zheng, Yi; Fernandez-Pozo, Noe; Dunham, Diane M; Fei, Zhangjun; Martin, Gregory B

    2014-01-01

    Plants have two related immune systems to defend themselves against pathogen attack. Initially,pattern-triggered immunity is activated upon recognition of microbe-associated molecular patterns by pattern recognition receptors. Pathogenic bacteria deliver effector proteins into the plant cell that interfere with this immune response and promote disease. However, some plants express resistance proteins that detect the presence of specific effectors leading to a robust defense response referred to as effector-triggered immunity. The interaction of tomato with Pseudomonas syringae pv. tomato is an established model system for understanding the molecular basis of these plant immune responses. We apply high-throughput RNA sequencing to this pathosystem to identify genes whose expression changes specifically during pattern-triggered or effector-triggered immunity. We then develop reporter genes for each of these responses that will enable characterization of the host response to the large collection of P. s. pv. tomato strains that express different combinations of effectors. Virus-induced gene silencing of 30 of the effector-triggered immunity-specific genes identifies Epk1 which encodes a predicted protein kinase from a family previously unknown to be involved in immunity. Knocked-down expression of Epk1 compromises effector-triggered immunity triggered by three bacterial effectors but not by effectors from non-bacterial pathogens. Epistasis experiments indicate that Epk1 acts upstream of effector-triggered immunity-associated MAP kinase signaling. Using RNA-seq technology we identify genes involved in specific immune responses. A functional genomics screen led to the discovery of Epk1, a novel predicted protein kinase required for plant defense activation upon recognition of three different bacterial effectors.

  7. Inflammation promotes oral squamous carcinoma immune evasion via induced programmed death ligand-1 surface expression.

    PubMed

    Lu, Wanlu; Lu, Libing; Feng, Yun; Chen, Jiao; Li, Yan; Kong, Xiangli; Chen, Sixiu; Li, Xiaoyu; Chen, Qianming; Zhang, Ping

    2013-05-01

    The association between inflammation and cancer provides a new target for tumor biotherapy. The inflammatory cells and molecules within the tumor microenvironment have decisive dual roles in antitumor immunity and immune evasion. In the present study, phytohemagglutinin (PHA) was used to stimulate peripheral blood mononuclear cells (PBMCs) to simulate the tumor inflammatory microenvironment. The effect of immune cells and inflammatory cytokines on the surface expression of programmed cell death-1 ligand 1 (PD-L1) and tumor immune evasion was investigated using flow cytometry (FCM) and an in vivo xenotransplantation model. Based on the data, PHA-activated, but not resting, immune cells were able to promote the surface expression of PD-L1 in Tca8113 oral squamous carcinoma cells via the secretion of inflammatory cytokines, but not by cell-cell contact. The majority of the inflammatory cytokines had no significant effect on the proliferation, cell cycle progression and apoptosis of the Tca8113 cells, although they each induced the expression of PD-L1 in a dose-dependent manner. In total, 99% of the Tca8113 cells expressed PD-L1 following treatment with the supernatant of PHA-stimulated PBMCs. The PHA-supernatant pretreated Tca8113 cells unusually induced Tca8113 antigen-specific CD8 + T cell apoptosis in vitro and the evasion of antigen-specific T cell attraction in a nude mouse tumor-bearing model. These results indicate a new mechanism for the promotion of tumor immune evasion by the tumor inflammatory microenvironment.

  8. Inflammation promotes oral squamous carcinoma immune evasion via induced programmed death ligand-1 surface expression

    PubMed Central

    LU, WANLU; LU, LIBING; FENG, YUN; CHEN, JIAO; LI, YAN; KONG, XIANGLI; CHEN, SIXIU; LI, XIAOYU; CHEN, QIANMING; ZHANG, PING

    2013-01-01

    The association between inflammation and cancer provides a new target for tumor biotherapy. The inflammatory cells and molecules within the tumor microenvironment have decisive dual roles in antitumor immunity and immune evasion. In the present study, phytohemagglutinin (PHA) was used to stimulate peripheral blood mononuclear cells (PBMCs) to simulate the tumor inflammatory microenvironment. The effect of immune cells and inflammatory cytokines on the surface expression of programmed cell death-1 ligand 1 (PD-L1) and tumor immune evasion was investigated using flow cytometry (FCM) and an in vivo xenotransplantation model. Based on the data, PHA-activated, but not resting, immune cells were able to promote the surface expression of PD-L1 in Tca8113 oral squamous carcinoma cells via the secretion of inflammatory cytokines, but not by cell-cell contact. The majority of the inflammatory cytokines had no significant effect on the proliferation, cell cycle progression and apoptosis of the Tca8113 cells, although they each induced the expression of PD-L1 in a dose-dependent manner. In total, 99% of the Tca8113 cells expressed PD-L1 following treatment with the supernatant of PHA-stimulated PBMCs. The PHA-supernatant pretreated Tca8113 cells unusually induced Tca8113 antigen-specific CD8+ T cell apoptosis in vitro and the evasion of antigen-specific T cell attraction in a nude mouse tumor-bearing model. These results indicate a new mechanism for the promotion of tumor immune evasion by the tumor inflammatory microenvironment PMID:23761816

  9. Periodontitis induced by Porphyromonas gingivalis drives periodontal microbiota dysbiosis and insulin resistance via an impaired adaptive immune response.

    PubMed

    Blasco-Baque, Vincent; Garidou, Lucile; Pomié, Céline; Escoula, Quentin; Loubieres, Pascale; Le Gall-David, Sandrine; Lemaitre, Mathieu; Nicolas, Simon; Klopp, Pascale; Waget, Aurélie; Azalbert, Vincent; Colom, André; Bonnaure-Mallet, Martine; Kemoun, Philippe; Serino, Matteo; Burcelin, Rémy

    2017-05-01

    To identify a causal mechanism responsible for the enhancement of insulin resistance and hyperglycaemia following periodontitis in mice fed a fat-enriched diet. We set-up a unique animal model of periodontitis in C57Bl/6 female mice by infecting the periodontal tissue with specific and alive pathogens like Porphyromonas gingivalis ( Pg ), Fusobacterium nucleatum and Prevotella intermedia . The mice were then fed with a diabetogenic/non-obesogenic fat-enriched diet for up to 3 months. Alveolar bone loss, periodontal microbiota dysbiosis and features of glucose metabolism were quantified. Eventually, adoptive transfer of cervical (regional) and systemic immune cells was performed to demonstrate the causal role of the cervical immune system. Periodontitis induced a periodontal microbiota dysbiosis without mainly affecting gut microbiota. The disease concomitantly impacted on the regional and systemic immune response impairing glucose metabolism. The transfer of cervical lymph-node cells from infected mice to naive recipients guarded against periodontitis-aggravated metabolic disease. A treatment with inactivated Pg prior to the periodontal infection induced specific antibodies against Pg and protected the mouse from periodontitis-induced dysmetabolism. Finally, a 1-month subcutaneous chronic infusion of low rates of lipopolysaccharides from Pg mimicked the impact of periodontitis on immune and metabolic parameters. We identified that insulin resistance in the high-fat fed mouse is enhanced by pathogen-induced periodontitis. This is caused by an adaptive immune response specifically directed against pathogens and associated with a periodontal dysbiosis. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  10. Involvement of the Rac1-IRSp53-Wave2-Arp2/3 Signaling Pathway in HIV-1 Gag Particle Release in CD4 T Cells.

    PubMed

    Thomas, Audrey; Mariani-Floderer, Charlotte; López-Huertas, Maria Rosa; Gros, Nathalie; Hamard-Péron, Elise; Favard, Cyril; Ohlmann, Theophile; Alcamí, José; Muriaux, Delphine

    2015-08-01

    During HIV-1 assembly, the Gag viral proteins are targeted and assemble at the inner leaflet of the cell plasma membrane. This process could modulate the cortical actin cytoskeleton, located underneath the plasma membrane, since actin dynamics are able to promote localized membrane reorganization. In addition, activated small Rho GTPases are known for regulating actin dynamics and membrane remodeling. Therefore, the modulation of such Rho GTPase activity and of F-actin by the Gag protein during virus particle formation was considered. Here, we studied the implication of the main Rac1, Cdc42, and RhoA small GTPases, and some of their effectors, in this process. The effect of small interfering RNA (siRNA)-mediated Rho GTPases and silencing of their effectors on Gag localization, Gag membrane attachment, and virus-like particle production was analyzed by immunofluorescence coupled to confocal microscopy, membrane flotation assays, and immunoblot assays, respectively. In parallel, the effect of Gag expression on the Rac1 activation level was monitored by G-LISA, and the intracellular F-actin content in T cells was monitored by flow cytometry and fluorescence microscopy. Our results revealed the involvement of activated Rac1 and of the IRSp53-Wave2-Arp2/3 signaling pathway in HIV-1 Gag membrane localization and particle release in T cells as well as a role for actin branching and polymerization, and this was solely dependent on the Gag viral protein. In conclusion, our results highlight a new role for the Rac1-IRSp53-Wave2-Arp2/3 signaling pathway in the late steps of HIV-1 replication in CD4 T lymphocytes. During HIV-1 assembly, the Gag proteins are targeted and assembled at the inner leaflet of the host cell plasma membrane. Gag interacts with specific membrane phospholipids that can also modulate the regulation of cortical actin cytoskeleton dynamics. Actin dynamics can promote localized membrane reorganization and thus can be involved in facilitating Gag assembly

  11. Cross-reactivity of anti-HIV-1 T cell immune responses among the major HIV-1 clades in HIV-1-positive individuals from 4 continents.

    PubMed

    Coplan, Paul M; Gupta, Swati B; Dubey, Sheri A; Pitisuttithum, Punnee; Nikas, Alex; Mbewe, Bernard; Vardas, Efthyia; Schechter, Mauro; Kallas, Esper G; Freed, Dan C; Fu, Tong-Ming; Mast, Christopher T; Puthavathana, Pilaipan; Kublin, James; Brown Collins, Kelly; Chisi, John; Pendame, Richard; Thaler, Scott J; Gray, Glenda; Mcintyre, James; Straus, Walter L; Condra, Jon H; Mehrotra, Devan V; Guess, Harry A; Emini, Emilio A; Shiver, John W

    2005-05-01

    The genetic diversity of human immunodeficiency virus type 1 (HIV-1) raises the question of whether vaccines that include a component to elicit antiviral T cell immunity based on a single viral genetic clade could provide cellular immune protection against divergent HIV-1 clades. Therefore, we quantified the cross-clade reactivity, among unvaccinated individuals, of anti-HIV-1 T cell responses to the infecting HIV-1 clade relative to other major circulating clades. Cellular immune responses to HIV-1 clades A, B, and C were compared by standardized interferon- gamma enzyme-linked immunospot assays among 250 unvaccinated individuals, infected with diverse HIV-1 clades, from Brazil, Malawi, South Africa, Thailand, and the United States. Cross-clade reactivity was evaluated by use of the ratio of responses to heterologous versus homologous (infecting) clades of HIV-1. Cellular immune responses were predominantly focused on viral Gag and Nef proteins. Cross-clade reactivity of cellular immune responses to HIV-1 clade A, B, and C proteins was substantial for Nef proteins (ratio, 0.97 [95% confidence interval, 0.89-1.05]) and lower for Gag proteins (ratio, 0.67 [95% confidence interval, 0.62-0.73]). The difference in cross-clade reactivity to Nef and Gag proteins was significant (P<.0001). Cross-clade reactivity of cellular immune responses can be substantial but varies by viral protein.

  12. Structure of a Spumaretrovirus Gag Central Domain Reveals an Ancient Retroviral Capsid

    PubMed Central

    Dutta, Moumita; Pollard, Dominic J.; Goldstone, David C.; Ramos, Andres; Müllers, Erik; Stirnnagel, Kristin; Stanke, Nicole; Lindemann, Dirk; Taylor, William R.; Rosenthal, Peter B.

    2016-01-01

    The Spumaretrovirinae, or foamy viruses (FVs) are complex retroviruses that infect many species of monkey and ape. Despite little sequence homology, FV and orthoretroviral Gag proteins perform equivalent functions, including genome packaging, virion assembly, trafficking and membrane targeting. However, there is a paucity of structural information for FVs and it is unclear how disparate FV and orthoretroviral Gag molecules share the same function. To probe the functional overlap of FV and orthoretroviral Gag we have determined the structure of a central region of Gag from the Prototype FV (PFV). The structure comprises two all α-helical domains NtDCEN and CtDCEN that although they have no sequence similarity, we show they share the same core fold as the N- (NtDCA) and C-terminal domains (CtDCA) of archetypal orthoretroviral capsid protein (CA). Moreover, structural comparisons with orthoretroviral CA align PFV NtDCEN and CtDCEN with NtDCA and CtDCA respectively. Further in vitro and functional virological assays reveal that residues making inter-domain NtDCEN—CtDCEN interactions are required for PFV capsid assembly and that intact capsid is required for PFV reverse transcription. These data provide the first information that relates the Gag proteins of Spuma and Orthoretrovirinae and suggests a common ancestor for both lineages containing an ancient CA fold. PMID:27829070

  13. Synthesis and assembly of retrovirus Gag precursors into immature capsids in vitro.

    PubMed Central

    Sakalian, M; Parker, S D; Weldon, R A; Hunter, E

    1996-01-01

    The assembly of retroviral particles is mediated by the product of the gag gene; no other retroviral gene products are necessary for this process. While most retroviruses assemble their capsids at the plasma membrane, viruses of the type D class preassemble immature capsids within the cytoplasm of infected cells. This has allowed us to determine whether immature capsids of the prototypical type D retrovirus, Mason-Pfizer monkey virus (M-PMV), can assemble in a cell-free protein synthesis system. We report here that assembly of M-PMV Gag precursor proteins can occur in this in vitro system. Synthesized particles sediment in isopycnic gradients to the appropriate density and in thin-section electron micrographs have a size and appearance consistent with those of immature retrovirus capsids. The in vitro system described in this report appears to faithfully mimic the process of assembly which occurs in the host cell cytoplasm, since M-PMV gag mutants defective in in vivo assembly also fail to assemble in vitro. Likewise, the Gag precursor proteins of retroviruses that undergo type C morphogenesis, Rous sarcoma virus and human immunodeficiency virus, which do not preassemble capsids in vivo, fail to assemble particles in this system. Additionally, we demonstrate, with the use of anti-Gag antibodies, that this cell-free system can be utilized for analysis in vitro of potential inhibitors of retrovirus assembly. PMID:8648705

  14. Construction of recombinant Lactobacillus casei efficiently surface displayed and secreted porcine parvovirus VP2 protein and comparison of the immune responses induced by oral immunization.

    PubMed

    Yigang, X U; Yijing, L I

    2008-05-01

    Lactobacillus casei ATCC 393 was selected as a bacterial carrier for the development of mucosal vaccine against porcine parvovirus (PPV) infection. The PPV major structural polypeptide VP2 was used as the model parvovirus antigen. Two inducible expression systems, namely pPG611.1 of the cell-surface expression system and pPG612.1 of the secretion expression system based on the xylose operon promoter were used to express the VP2 protein. The immunogenicity of recombinant strains producing VP2 protein in two cellular locations, cell-surface exposed and secreted, was compared to each other by immunizing mice through the intragastric administration. The two types of constructs were able to induce strong specific immune responses against VP2 via intragastric administration and maximum titres of IgA and IgG were attained on days 46 post oral immunization, while the highest antibody levels were obtained with the strain producing the VP2 protein in extracellular milieu. The induced antibodies demonstrated neutralizing effects on PPV infection.

  15. Induction of protective immunity against toxoplasmosis in mice by immunization with Toxoplasma gondii RNA.

    PubMed

    Dimier-Poisson, Isabelle; Aline, Fleur; Bout, Daniel; Mévélec, Marie-Noëlle

    2006-03-06

    Toxoplasma gondii enters the mucosal surfaces of the host, and so immunity at these sites is of major interest. Due to the compartmentalization of the immune response, systemic immunization does not induce high levels of immunity at mucosal surfaces. Intranasal immunization has been shown to be very effective in inducing both systemic and mucosal immune responses. Immunization with mRNA can induce both humoral and cell-mediated immune responses, both of which are important in conferring immunity to T. gondii. The efficacy of RNA vaccination by the nasal route with T. gondii RNA was evaluated. We assessed the percentage of cumulative survival after an oral challenge with a lethal dose of T. gondii cysts (40 cysts), and the number of brain cysts following a challenge with a sublethal dose of T. gondii 76 K cysts (15 cysts). Vaccinated mice were found to be significantly better protected than non-immunized mice after a challenge with a lethal dose of cysts; and a challenge with a sublethal dose also resulted in fewer brain cysts than in non-immunized mice. Sera and intestinal secretions of immunized mice recognized T. gondii antigens, suggesting that a specific humoral immune response may occur. Moreover, a specific lymphoproliferative response observed in cervical lymph nodes may confer protection. These preliminary findings suggest that RNA vaccination by a mucosal route could be feasible.

  16. Chimeric SV40 virus-like particles induce specific cytotoxicity and protective immunity against influenza A virus without the need of adjuvants.

    PubMed

    Kawano, Masaaki; Morikawa, Katsuma; Suda, Tatsuya; Ohno, Naohito; Matsushita, Sho; Akatsuka, Toshitaka; Handa, Hiroshi; Matsui, Masanori

    2014-01-05

    Virus-like particles (VLPs) are a promising vaccine platform due to the safety and efficiency. However, it is still unclear whether polyomavirus-based VLPs are useful for this purpose. Here, we attempted to evaluate the potential of polyomavirus VLPs for the antiviral vaccine using simian virus 40 (SV40). We constructed chimeric SV40-VLPs carrying an HLA-A*02:01-restricted, cytotoxic T lymphocyte (CTL) epitope derived from influenza A virus. HLA-A*02:01-transgenic mice were then immunized with the chimeric SV40-VLPs. The chimeric SV40-VLPs effectively induced influenza-specific CTLs and heterosubtypic protection against influenza A viruses without the need of adjuvants. Because DNase I treatment of the chimeric SV40-VLPs did not disrupt CTL induction, the intrinsic adjuvant property may not result from DNA contaminants in the VLP preparation. In addition, immunization with the chimeric SV40-VLPs generated long-lasting memory CTLs. We here propose that the chimeric SV40-VLPs harboring an epitope may be a promising CTL-based vaccine platform with self-adjuvant properties. © 2013 Elsevier Inc. All rights reserved.

  17. Gammaretroviral pol sequences act in cis to direct polysome loading and NXF1/NXT-dependent protein production by gag-encoded RNA.

    PubMed

    Bartels, Hanni; Luban, Jeremy

    2014-09-12

    All retroviruses synthesize essential proteins via alternatively spliced mRNAs. Retrovirus genera, though, exploit different mechanisms to coordinate the synthesis of proteins from alternatively spliced mRNAs. The best studied of these retroviral, post-transcriptional effectors are the trans-acting Rev protein of lentiviruses and the cis-acting constitutive transport element (CTE) of the betaretrovirus Mason-Pfizer monkey virus (MPMV). How members of the gammaretrovirus genus translate protein from unspliced RNA has not been elucidated. The mechanism by which two gammaretroviruses, XMRV and MLV, synthesize the Gag polyprotein (Pr65Gag) from full-length, unspliced mRNA was investigated here. The yield of Pr65Gag from a gag-only expression plasmid was found to be at least 30-fold less than that from an otherwise isogenic gag-pol expression plasmid. A frameshift mutation disrupting the pol open reading frame within the gag-pol expression plasmid did not decrease Pr65Gag production and 398 silent nucleotide changes engineered into gag rendered Pr65Gag synthesis pol-independent. These results are consistent with pol-encoded RNA acting in cis to promote Pr65Gag translation. Two independently-acting pol fragments were identified by screening 17 pol deletion mutations. To determine the mechanism by which pol promoted Pr65Gag synthesis, gag RNA in total and cytoplasmic fractions was quantitated by northern blot and by RT-PCR. The pol sequences caused, maximally, three-fold increase in total or cytoplasmic gag mRNA. Instead, pol sequences increased gag mRNA association with polyribosomes ~100-fold, a magnitude sufficient to explain the increase in Pr65Gag translation efficiency. The MPMV CTE, an NXF1-binding element, substituted for pol in promoting Pr65Gag synthesis. A pol RNA stem-loop resembling the CTE promoted Pr65Gag synthesis. Over-expression of NXF1 and NXT, host factors that bind to the MPMV CTE, synergized with pol to promote gammaretroviral gag RNA loading onto

  18. Mucosal Immunization with High-Mobility Group Box 1 in Chitosan Enhances DNA Vaccine-Induced Protection against Coxsackievirus B3-Induced Myocarditis

    PubMed Central

    Wang, Maowei; Yue, Yan; Dong, Chunsheng; Li, Xiaoyun; Xu, Wei

    2013-01-01

    Coxsackievirus B3 (CVB3), a small single-stranded RNA virus, belongs to the Picornaviridae family. Its infection is the most common cause of myocarditis, with no vaccine available. Gastrointestinal mucosa is the major entry port for CVB3; therefore, the induction of local immunity in mucosal tissues may help control initial viral infections and alleviate subsequent myocardial injury. Here we evaluated the ability of high-mobility group box 1 (HMGB1) encapsulated in chitosan particles to enhance the mucosal immune responses induced by the CVB3-specific mucosal DNA vaccine chitosan-pVP1. Mice were intranasally coimmunized with 4 doses of chitosan-pHMGB1 and chitosan-pVP1 plasmids, at 2-week intervals, and were challenged with CVB3 4 weeks after the last immunization. Compared with chitosan-pVP1 immunization alone, coimmunization with chitosan-pHMGB1 significantly (P < 0.05) enhanced CVB3-specific fecal secretory IgA levels and promoted mucosal T cell immune responses. In accordance, reduced severity of myocarditis was observed in coimmunized mice, as evidenced by significantly (P < 0.05) reduced viral loads, decreased myocardial injury, and increased survival rates. Flow cytometric analysis indicated that HMGB1 enhanced dendritic cell (DC) recruitment to mesenteric lymph nodes and promoted DC maturation, which might partly account for its mucosal adjuvant effect. This strategy may represent a promising approach to candidate vaccines against CVB3-induced myocarditis. PMID:24027262

  19. Circulating TFH cells, serological memory, and tissue compartmentalization shape human influenza-specific B cell immunity.

    PubMed

    Koutsakos, Marios; Wheatley, Adam K; Loh, Liyen; Clemens, E Bridie; Sant, Sneha; Nüssing, Simone; Fox, Annette; Chung, Amy W; Laurie, Karen L; Hurt, Aeron C; Rockman, Steve; Lappas, Martha; Loudovaris, Thomas; Mannering, Stuart I; Westall, Glen P; Elliot, Michael; Tangye, Stuart G; Wakim, Linda M; Kent, Stephen J; Nguyen, Thi H O; Kedzierska, Katherine

    2018-02-14

    Immunization with the inactivated influenza vaccine (IIV) remains the most effective strategy to combat seasonal influenza infections. IIV activates B cells and T follicular helper (T FH ) cells and thus engenders antibody-secreting cells and serum antibody titers. However, the cellular events preceding generation of protective immunity in humans are inadequately understood. We undertook an in-depth analysis of B cell and T cell immune responses to IIV in 35 healthy adults. Using recombinant hemagglutinin (rHA) probes to dissect the quantity, phenotype, and isotype of influenza-specific B cells against A/California09-H1N1, A/Switzerland-H3N2, and B/Phuket, we showed that vaccination induced a three-pronged B cell response comprising a transient CXCR5 - CXCR3 + antibody-secreting B cell population, CD21 hi CD27 + memory B cells, and CD21 lo CD27 + B cells. Activation of circulating T FH cells correlated with the development of both CD21 lo and CD21 hi memory B cells. However, preexisting antibodies could limit increases in serum antibody titers. IIV had no marked effect on CD8 + , mucosal-associated invariant T, γδ T, and natural killer cell activation. In addition, vaccine-induced B cells were not maintained in peripheral blood at 1 year after vaccination. We provide a dissection of rHA-specific B cells across seven human tissue compartments, showing that influenza-specific memory (CD21 hi CD27 + ) B cells primarily reside within secondary lymphoid tissues and the lungs. Our study suggests that a rational design of universal vaccines needs to consider circulating T FH cells, preexisting serological memory, and tissue compartmentalization for effective B cell immunity, as well as to improve targeting cellular T cell immunity. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  20. Radiation-Induced Immune Modulation in Prostate Cancer

    DTIC Science & Technology

    2008-01-01

    cancers. 15. SUBJECT TERMS Radiation, Dendritic Cells , Cytokines, PSA 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT 18...radiation is more than a cytotoxic agent. Our recent study has shown that radiation modulates the immune system by affecting dendritic cell (DC...translate radiation-induced tumor cell death into generation of tumor immunity in the hope of optimizing therapy for localized and disseminated prostate

  1. Vaccine delivery to the oral cavity using coated microneedles induces systemic and mucosal immunity

    PubMed Central

    Ma, Yunzhe; Tao, Wenqian; Krebs, Shelly J.; Sutton, William F.; Haigwood, Nancy L.; Gill, Harvinder S.

    2014-01-01

    Purpose The objective of this study is to evaluate the feasibility of using coated microneedles to deliver vaccines into the oral cavity to induce systemic and mucosal immune responses. Method Microneedles were coated with sulforhodamine, ovalbumin and two HIV antigens. Coated microneedles were inserted into the inner lower lip and dorsal surface of the tongue of rabbits. Histology was used to confirm microneedle insertion, and systemic and mucosal immune responses were characterized by measuring antigen-specific immunoglobulin G (IgG) in serum and immunoglobulin A (IgA) in saliva, respectively. Results Histological evaluation of tissues shows that coated microneedles can penetrate the lip and tongue to deliver coatings. Using ovalbumin as a model antigen it was found that the lip and the tongue are equally immunogenic sites for vaccination. Importantly, both sites also induced a significant (p < 0.05) secretory IgA in saliva compared to pre-immune saliva. Microneedle-based oral cavity vaccination was also compared to the intramuscular route using two HIV antigens, a virus-like particle and a DNA vaccine. Microneedle-based delivery to the oral cavity and the intramuscular route exhibited similar (p > 0.05) yet significant (p < 0.05) levels of antigen-specific IgG in serum. However, only the microneedle-based oral cavity vaccination group stimulated a significantly higher (p < 0.05) antigen-specific IgA response in saliva, but not intramuscular injection. Conclusion In conclusion, this study provides a novel method using microneedles to induce systemic IgG and secretory IgA in saliva, and could offer a versatile technique for oral mucosal vaccination. PMID:24623480

  2. Mucosal Vaccination Overcomes the Barrier to Recombinant Vaccinia Immunization Caused by Preexisting Poxvirus Immunity

    NASA Astrophysics Data System (ADS)

    Belyakov, Igor M.; Moss, Bernard; Strober, Warren; Berzofsky, Jay A.

    1999-04-01

    Overcoming preexisting immunity to vaccinia virus in the adult population is a key requirement for development of otherwise potent recombinant vaccinia vaccines. Based on our observation that s.c. immunization with vaccinia induces cellular and antibody immunity to vaccinia only in systemic lymphoid tissue and not in mucosal sites, we hypothesized that the mucosal immune system remains naive to vaccinia and therefore amenable to immunization with recombinant vaccinia vectors despite earlier vaccinia exposure. We show that mucosal immunization of vaccinia-immune BALB/c mice with recombinant vaccinia expressing HIV gp160 induced specific serum antibody and strong HIV-specific cytotoxic T lymphocyte responses. These responses occurred not only in mucosal but also in systemic lymphoid tissue, whereas systemic immunization was ineffective under these circumstances. In this context, intrarectal immunization was more effective than intranasal immunization. Boosting with a second dose of recombinant vaccinia was also more effective via the mucosal route. The systemic HIV-specific cytotoxic T lymphocyte response was enhanced by coadministration of IL-12 at the mucosal site. These results also demonstrate the independent compartmentalization of the mucosal versus systemic immune systems and the asymmetric trafficking of lymphocytes between them. This approach to circumvent previous vaccinia immunity may be useful for induction of protective immunity against infectious diseases and cancer in the sizable populations with preexisting immunity to vaccinia from smallpox vaccination.

  3. [Involvement of cellular immunity and humoral immunity in mixed allergy induced by trichloroethylene].

    PubMed

    Xu, Xinyun; Li, Xueyu; Liu, Yuefeng

    2014-12-01

    To investigate whether cellular immunity and humoral immunity are involved in trichlorethylene (TCE)-induced mixed allergy, then provide the scientific basis for the mechanism of this disease. Guinea pigs and rats were tested for this study by application of guinea pig maximization test (GPMT), the animals were randomly divided into negative control, positive control and TCE treatment groups. Animals of these groups were administrated with olive oil, 2, 4-dinitrochlorobenzene (DNCB), and TCE, respectively, by intradermal injection. After TCE administration, rat peripheral blood samples were collected by flow cytometry to detect lymphocytes CD3⁺, CD4⁺, CD8⁺. Guinea pig peripheral blood samples were collected to detect the levels of IgG, IgA, IgM, C3, C4, and the spleens were taken out from guinea pigs after various treatment, mRNA expression of GATA3, T-bet, CTLA4 and Foxp3 in lymphocytes of guinea pig spleen was detected by real-time fluorescent PCR assay. Additionally, TCE allergic dermatitis patients were selected for the study, the peripheral blood samples were collected from the TCE patients group and control group, quantitative PCR was applied to detect mRNA expression of immune-related genes Foxp3, GATA3, CTLA4, T-bet. TCE induced obvious skin allergic reaction in guinea pigs, the sensitization rate was 83.3%, IgG levels in TCE group and positive control increased significantly. Additionally, mRNA expression levels of GATA3, T-bet, CTLA4 significantly elevated in TCE group and positive control, but Foxp3 mRNA levels decreased. The lymphocytes CD3⁺ ratio in TCE group and positive control of rats was higher than that in negative control, we found that there was no statistical difference of CD4⁺, CD8⁺, CD4⁺/CD8⁺ between TCE group and negative control of rats. The mRNA expression levels of Foxp3, GATA3, CTLA4 in TCE patients increased by 115%, 97%, 241%, respectively as compared with the control, T-bet levels decreased by 47%when compared with the

  4. Intranasal immunization with novel EspA-Tir-M fusion protein induces protective immunity against enterohemorrhagic Escherichia coli O157:H7 challenge in mice.

    PubMed

    Lin, Ruqin; Zhu, Bo; Zhang, Yiduo; Bai, Yang; Zhi, Fachao; Long, Beiguo; Li, Yawen; Wu, Yuhua; Wu, Xianbo; Fan, Hongying

    2017-04-01

    Enterohemorrhagic Escherichia coli (EHEC) O157:H7 causes hemorrhagic colitis and hemolytic uremic syndrome in humans. Due to the risks associated with antibiotic treatment against EHEC O157:H7 infection, vaccines represent a promising method for prevention of EHEC O157:H7 infection. Therefore, we constructed the novel bivalent antigen EspA-Tir-M as a candidate EHEC O157:H7 subunit vaccine. We then evaluated the immunogenicity of this novel EHEC O157:H7 subunit vaccine. Immune responses to the fusion protein administered by intranasal and subcutaneous routes were compared in mice. Results showed higher levels of specific mucosal and systemic antibody responses induced by intranasal as compared to subcutaneous immunization. Intranasal immunization enhanced the concentration of interleukin-4, interleukin-10, and interferon-γ, while subcutaneous immunization enhanced only the latter two. In addition, intranasal immunization protected against EHEC O157:H7 colonization and infection in mice at a rate of 90%.Histopathological analysis revealed that vaccination reduced colon damage, especially when administered intranasally. In contrast, subcutaneous immunization elicited a weak immune response and exhibited a low protection rate. These findings demonstrate that intranasal immunization with the fusion protein induces both humoral and cellular immune (Th1/Th2) responses in mice. The novel EspA-Tir-M novel fusion protein therefore represents a promising subunit vaccine against EHEC O157:H7 infection. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Nod2 is required for antigen-specific humoral responses against antigens orally delivered using a recombinant Lactobacillus vaccine platform

    PubMed Central

    Bumgardner, Sara A.; Zhang, Lin; LaVoy, Alora S.; Frank, Chad B.; Kajikawa, Akinobu; Klaenhammer, Todd R.

    2018-01-01

    Safe and efficacious orally-delivered mucosal vaccine platforms are desperately needed to combat the plethora of mucosally transmitted pathogens. Lactobacillus spp. have emerged as attractive candidates to meet this need and are known to activate the host innate immune response in a species- and strain-specific manner. For selected bacterial isolates and mutants, we investigated the role of key innate immune pathways required for induction of innate and subsequent adaptive immune responses. Co-culture of murine macrophages with L. gasseri (strain NCK1785), L. acidophilus (strain NCFM), or NCFM-derived mutants—NCK2025 and NCK2031—elicited an M2b-like phenotype associated with TH2 skewing and immune regulatory function. For NCFM, this M2b phenotype was dependent on expression of lipoteichoic acid and S layer proteins. Through the use of macrophage genetic knockouts, we identified Toll-like receptor 2 (TLR2), the cytosolic nucleotide-binding oligomerization domain containing 2 (NOD2) receptor, and the inflammasome-associated caspase-1 as contributors to macrophage activation, with NOD2 cooperating with caspase-1 to induce inflammasome derived interleukin (IL)-1β in a pyroptosis-independent fashion. Finally, utilizing an NCFM-based mucosal vaccine platform with surface expression of human immunodeficiency virus type 1 (HIV-1) Gag or membrane proximal external region (MPER), we demonstrated that NOD2 signaling is required for antigen-specific mucosal and systemic humoral responses. We show that lactobacilli differentially utilize innate immune pathways and highlight NOD2 as a key mediator of macrophage function and antigen-specific humoral responses to a Lactobacillus acidophilus mucosal vaccine platform. PMID:29734365

  6. Recombinant Lactobacillus plantarum induces immune responses to cancer testis antigen NY-ESO-1 and maturation of dendritic cells

    PubMed Central

    Mobergslien, Anne; Vasovic, Vlada; Mathiesen, Geir; Fredriksen, Lasse; Westby, Phuong; Eijsink, Vincent GH; Peng, Qian; Sioud, Mouldy

    2015-01-01

    Given their safe use in humans and inherent adjuvanticity, Lactic Acid Bacteria may offer several advantages over other mucosal delivery strategies for cancer vaccines. The objective of this study is to evaluate the immune responses in mice after oral immunization with Lactobacillus (L) plantarum WCFS1 expressing a cell-wall anchored tumor antigen NY-ESO-1. And to investigate the immunostimulatory potency of this new candidate vaccine on human dendritic cells (DCs). L. plantarum displaying NY-ESO-1 induced NY-ESO-1 specific antibodies and T-cell responses in mice. By contrast, L. plantarum displaying conserved proteins such as heat shock protein-27 and galectin-1, did not induce immunity, suggesting that immune tolerance to self-proteins cannot be broken by oral administration of L. plantarum. With respect to immunomodulation, immature DCs incubated with wild type or L. plantarum-NY-ESO-1 upregulated the expression of co-stimulatory molecules and secreted a large amount of interleukin (IL)-12, TNF-α, but not IL-4. Moreover, they upregulated the expression of immunosuppressive factors such as IL-10 and indoleamine 2,3-dioxygenase. Although L. plantarum-matured DCs expressed inhibitory molecules, they stimulated allogeneic T cells in-vitro. Collectively, the data indicate that L. plantarum-NY-ESO-1 can evoke antigen-specific immunity upon oral administration and induce DC maturation, raising the potential of its use in cancer immunotherapies. PMID:26185907

  7. Reversing Breast Cancer-Induced Immune Suppression

    DTIC Science & Technology

    2014-01-01

    same oxidative radicals that MDSC use to facilitate immune suppression. Nrf2 protects cells against inflammation and is stabilized in response to... inflammation , hypoxia, and other factors that are known inducers of MDSC. Since Nrf2 regulates antioxidant response and apoptosis, I hypothesize that... inflammation -induced and conventional MDSC transport of cystine. SASP has no effect on tumor growth, metastatic disease, MDSC accumulation, or MDSC suppressive

  8. Measuring the binding stoichiometry of HIV-1 Gag to very-low-density oligonucleotide surfaces using surface plasmon resonance spectroscopy.

    PubMed

    Stephen, Andrew G; Datta, Siddhartha A K; Worthy, Karen M; Bindu, Lakshman; Fivash, Matthew J; Turner, Kevin B; Fabris, Daniele; Rein, Alan; Fisher, Robert J

    2007-09-01

    The interaction of the HIV Gag polyprotein with nucleic acid is a critical step in the assembly of viral particles. The Gag polyprotein is composed of the matrix (MA), capsid (CA), and nucleocapsid (NC) domains. The NC domain is required for nucleic acid interactions, and the CA domain is required for Gag-Gag interactions. Previously, we have investigated the binding of the NC protein to d(TG)(n) oligonucleotides using surface plasmon resonance (SPR) spectroscopy. We found a single NC protein is able to bind to more than one immobilized oligonucleotide, provided that the oligonucleotides are close enough together. As NC is believed to be the nucleic acid binding domain of Gag, we might expect Gag to show the same complex behavior. We wished to analyze the stoichiometry of Gag binding to oligonucleotides without this complication due to tertiary complex formation. We have therefore analyzed Gag binding to extremely low oligonucleotide density on SPR chips. Such low densities of oligonucleotides are difficult to accurately quantitate. We have determined by Fourier transform ion cyclotron (FTICR) mass spectrometry that four molecules of NC bind to d(TG)(10) (a 20-base oligonucleotide). We developed a method of calibrating low-density surfaces using NC calibration injections. Knowing the maximal response and the stoichiometry of binding, we can precisely determine the amount of oligonucleotide immobilized at these very-low-density surfaces (<1 Response Unit). Using this approach, we have measured the binding of Gag to d(TG)(10). Gag binds to a 20-mer with a stoichiometry of greater than 4. This suggests that once Gag is bound to the immobilized oligonucleotide, additional Gag molecules can bind to this complex.

  9. Diets Supplemented with 1% Egg White Induce Oral Desensitization and Immune Tolerance in an Egg White-Specific Allergic Mouse Model.

    PubMed

    Maeta, Akihiro; Matsushima, Marin; Katahira, Risako; Sakamoto, Natsumi; Takahashi, Kyoko

    2018-05-30

    The objective of this study was to determine the required concentration of egg white (EW) in the diet to induce oral desensitization and/or immune tolerance within 4 weeks of oral immunotherapy (OIT) in an EW allergic mouse model. Female BALB/c mice were systemically sensitized to EW by intraperitoneal injections and subsequently subjected to oral allergen gavage. Sensitized mice were provided 4 weeks of OIT by supplementing with 0 (non-OIT), 0.01, 0.1, or 1% EW in a 20% casein diet. Nonsensitized mice served as the nonallergy group. We performed oral and intraperitoneal EW challenges, assessed vascular permeability in the dorsal skin, and measured allergic biomarkers. The change in rectal temperature after oral challenge was not significantly different between the nonallergy and 1% EW groups, and the frequency of diarrhea in the 1% EW group was lower than that in the non-OIT group. The levels of plasma ovomucoid-specific IgE, IgA, and IgG2a in the 1% EW group at the study endpoint were significantly lower than those in the non-OIT group. IFN-γ and IL-10 secretions of spleen lymphocytes in the 1% EW group were significantly higher than those in the non-OIT group, and the percentage of CD4+Foxp3+ cells in the 1% EW group was higher than that in the non-OIT group. These results suggested that diet supplemented with 1% EW can induce oral desensitization and immune tolerance in the EW allergic mouse model. © 2018 S. Karger AG, Basel.

  10. Analysis of Bovine Leukemia Virus Gag Membrane Targeting and Late Domain Function

    PubMed Central

    Wang, Huating; Norris, Kendra M.; Mansky, Louis M.

    2002-01-01

    Assembly of retrovirus-like particles only requires the expression of the Gag polyprotein precursor. We have exploited this in the development of a model system for studying the virus particle assembly pathway for bovine leukemia virus (BLV). BLV is closely related to the human T-cell leukemia viruses (HTLVs), and all are members of the Deltaretrovirus genus of the Retroviridae family. Overexpression of a BLV Gag polyprotein containing a carboxy-terminal influenza virus hemagglutinin (HA) epitope tag in mammalian cells led to the robust production of virus-like particles (VLPs). Site-directed mutations were introduced into HA-tagged Gag to test the usefulness of this model system for studying certain aspects of the virus assembly pathway. First, mutations that disrupted the amino-terminal glycine residue that is important for Gag myristylation led to a drastic reduction in VLP production. Predictably, the nature of the VLP production defect was correlated to Gag membrane localization. Second, mutation of the PPPY motif (located in the MA domain) greatly reduced VLP production in the absence of the viral protease. This reduction in VLP production was more severe in the presence of an active viral protease. Examination of particles by electron microscopy revealed an abundance of particles that began to pinch off from the plasma membrane but were not completely released from the cell surface, indicating that the PPPY motif functions as a late domain (L domain). PMID:12134053

  11. Foamy virus reverse transcriptase is expressed independently from the Gag protein.

    PubMed Central

    Enssle, J; Jordan, I; Mauer, B; Rethwilm, A

    1996-01-01

    In the foamy virus (FV) subgroup of retroviruses the pol genes are located in the +1 reading frame relative to the gag genes and possess potential ATG initiation codons in their 5' regions. This genome organization suggests either a + 1 ribosomal frameshift to generate a Gag-Pol fusion protein, similar to all other retroviruses studied so far, or new initiation of Pol translation, as used by pararetroviruses, to express the Pol protein. By using a genetic approach we have ruled out the former possibility and provide evidence for the latter. Two down-mutations (M53 and M54) of the pol ATG codon were found to abolish replication and Pol protein expression of the human FV isolate. The introduction of a new ATG in mutation M55, 3' to the down-mutated ATG of mutation M53, restored replication competence, indicating that the pol ATG functions as a translational initiation codon. Two nonsense mutants (M56 and M57), which functionally separated gag and pol with respect to potential frame-shifting sites, were also replication-competent, providing further genetic evidence that FVs express the Pol protein independently from Gag. Our results show that during a particular step of the replication cycle, FVs differ fundamentally from all other retroviruses. Images Fig. 3 PMID:8633029

  12. [Mechanisms of retroviral immunosuppressive domain-induced immune modulation].

    PubMed

    Blinov, V M; Krasnov, G S; Shargunov, A V; Shurdov, M A; Zverev, V V

    2013-01-01

    Immunosuppressive domains (ISD) of viral envelope glycoproteins provide highly pathogenic phenotypes of various retroviruses. ISD interaction with immune cells leads to an inhibition of a response. In the 1980s it was shown that the fragment of ISD comprising of 17 amino acids (named CKS-17) is carrying out such immune modulation. However the underlying mechanisms were not known. The years of thorough research allowed to identify the regulation of Ras-Raf-MEK-MAPK and PI3K-AKT-mTOR cellular pathways as a result of ISD interaction with immune cells. By the way, this leads to decrease of secretion of stimulatory cytokines (e.g., IL-12) and increase of inhibitory, anti-inflammatory ones (e.g., IL-10). One of the receptor tyrosine kinases inducing signal in these pathways acts as the primary target of ISD while other key regulators--cAMP and diacylglycerol (DAG), act as secondary messengers of signal transduction. Immunosuppressive-like domains can be found not only in retroviruses; the presence of ISD within Ebola viral envelope glycoproteins caused extremely hard clinical course of virus-induced hemorrhagic fever. A number of retroviral-origin fragments encoding ISD can be found in the human genome. These regions are expressed in the placenta within genes of syncytins providing a tolerance of mother's immune system to an embryo. The present review is devoted to molecular aspects of retroviral ISD-induced modulation of host immune system.

  13. Cross-species malaria immunity induced by chemically attenuated parasites

    PubMed Central

    Good, Michael F.; Reiman, Jennifer M.; Rodriguez, I. Bibiana; Ito, Koichi; Yanow, Stephanie K.; El-Deeb, Ibrahim M.; Batzloff, Michael R.; Stanisic, Danielle I.; Engwerda, Christian; Spithill, Terry; Hoffman, Stephen L.; Lee, Moses; McPhun, Virginia

    2013-01-01

    Vaccine development for the blood stages of malaria has focused on the induction of antibodies to parasite surface antigens, most of which are highly polymorphic. An alternate strategy has evolved from observations that low-density infections can induce antibody-independent immunity to different strains. To test this strategy, we treated parasitized red blood cells from the rodent parasite Plasmodium chabaudi with seco-cyclopropyl pyrrolo indole analogs. These drugs irreversibly alkylate parasite DNA, blocking their ability to replicate. After administration in mice, DNA from the vaccine could be detected in the blood for over 110 days and a single vaccination induced profound immunity to different malaria parasite species. Immunity was mediated by CD4+ T cells and was dependent on the red blood cell membrane remaining intact. The human parasite, Plasmodium falciparum, could also be attenuated by treatment with seco-cyclopropyl pyrrolo indole analogs. These data demonstrate that vaccination with chemically attenuated parasites induces protective immunity and provide a compelling rationale for testing a blood-stage parasite-based vaccine targeting human Plasmodium species. PMID:23863622

  14. Targeting Mycobacterium tuberculosis Antigens to Dendritic Cells via the DC-Specific-ICAM3-Grabbing-Nonintegrin Receptor Induces Strong T-Helper 1 Immune Responses

    PubMed Central

    Velasquez, Lis Noelia; Stüve, Philipp; Gentilini, Maria Virginia; Swallow, Maxine; Bartel, Judith; Lycke, Nils Yngve; Barkan, Daniel; Martina, Mariana; Lujan, Hugo D.; Kalay, Hakan; van Kooyk, Yvette; Sparwasser, Tim D.; Berod, Luciana

    2018-01-01

    Tuberculosis remains a major global health problem and efforts to develop a more effective vaccine have been unsuccessful so far. Targeting antigens (Ags) to dendritic cells (DCs) in vivo has emerged as a new promising vaccine strategy. In this approach, Ags are delivered directly to DCs via antibodies that bind to endocytic cell-surface receptors. Here, we explored DC-specific-ICAM3-grabbing-nonintegrin (DC-SIGN) targeting as a potential vaccine against tuberculosis. For this, we made use of the hSIGN mouse model that expresses human DC-SIGN under the control of the murine CD11c promoter. We show that in vitro and in vivo delivery of anti-DC-SIGN antibodies conjugated to Ag85B and peptide 25 of Ag85B in combination with anti-CD40, the fungal cell wall component zymosan, and the cholera toxin-derived fusion protein CTA1-DD induces strong Ag-specific CD4+ T-cell responses. Improved anti-mycobacterial immunity was accompanied by increased frequencies of Ag-specific IFN-γ+ IL-2+ TNF-α+ polyfunctional CD4+ T cells in vaccinated mice compared with controls. Taken together, in this study we provide the proof of concept that the human DC-SIGN receptor can be efficiently exploited for vaccine purposes to promote immunity against mycobacterial infections. PMID:29662482

  15. Waning of vaccine-induced immunity to measles in kidney transplanted children.

    PubMed

    Rocca, Salvatore; Santilli, Veronica; Cotugno, Nicola; Concato, Carlo; Manno, Emma Concetta; Nocentini, Giulia; Macchiarulo, Giulia; Cancrini, Caterina; Finocchi, Andrea; Guzzo, Isabella; Dello Strologo, Luca; Palma, Paolo

    2016-09-01

    Vaccine-preventable diseases are a significant cause of morbidity and mortality in solid organ transplant recipients who undergo immunosuppression after transplantation. Data on immune responses and long-term maintenance after vaccinations in such population are still limited.We cross-sectionally evaluated the maintenance of immune response to measles vaccine in kidney transplanted children on immunosuppressive therapy. Measles-specific enzyme-linked immunosorbent assay and B-cell enzyme-linked immunosorbent spot were performed in 74 kidney transplant patients (Tps) and in 23 healthy controls (HCs) previously vaccinated and tested for humoral protection against measles. The quality of measles antibody response was measured by avidity test. B-cell phenotype, investigated via flow cytometry, was further correlated to the ability of Tps to maintain protective humoral responses to measles over time.We observed the loss of vaccine-induced immunity against measles in 19% of Tps. Nonseroprotected children showed signs of impaired B-cell distribution as well as immune senescence and lower antibody avidity. We further reported as time elapsed between vaccination and transplantation, as well as the vaccine administration during dialysis are clinical factors affecting the maintenance of the immune memory response against measles.Tps present both quantitative and qualitative alterations in the maintenance of protective immunity to measles vaccine. Prospective studies are needed to optimize the vaccination schedules in kidney transplant recipients in order to increase the immunization coverage over time in this population.

  16. Preexisting Salmonella-specific immunity interferes with the subsequent development of immune responses against the Salmonella strains delivering H9N2 hemagglutinin.

    PubMed

    Hajam, Irshad Ahmed; Lee, John Hwa

    2017-06-01

    Recombinant Salmonella strains expressing foreign heterologous antigens have been extensively studied as promising live vaccine delivery vehicles. In this study, we constructed attenuated smooth (S-HA) and rough (R-HA) Salmonella strains expressing hemagglutinin (HA) of H9N2, a low pathogenic avian influenza A virus. We then investigated the HA-specific immune responses following oral immunization with either S-HA or R-HA strain in chicken model. We further examined the effects of the preexisting anti-Salmonella immunity on the subsequent elicitation of the HA and the Salmonella ompA specific immune responses. Our results showed that primary immunization with either the S-HA or the R-HA strain elicited comparable HA-specific immune responses and the responses were significantly (p<0.05) higher compared to the Salmonella vector control. When chickens were pre-immunized with the smooth Salmonella carrier alone and then vaccinated with either S-HA or R-HA strain 3, 6 and 9 weeks later, respectively, significant reductions were seen for HA-specific immune responses at week 6, a point which corresponded to the peak of the primary Salmonella-specific antibody responses. No reductions were seen at week 3 and 9, albeit, the HA-specific immune responses were boosted at week 9, a point which corresponded to the lowest primary Salmonella-specific antibody responses. The ompA recall responses remain refractory at week 3 and 6 following deliberate immunization with the carrier strain, but were significantly (p<0.05) increased at week 9 post-primary immunization. We conclude that preexisting anti-Salmonella immunity inhibits antigen-specific immune responses and this effect could be avoided by carefully selecting the time point when carrier-specific immune responses are relatively low. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Immunostimulatory Oligodeoxynucleotides Containing the CpG Motif are Effective as Immune Adjuvants in Tumor Antigen Immunization

    NASA Astrophysics Data System (ADS)

    Weiner, George J.; Liu, Hsin-Ming; Wooldridge, James E.; Dahle, Christopher E.; Krieg, Arthur M.

    1997-09-01

    Recent advances in our understanding of the immune response are allowing for the logical design of new approaches to cancer immunization. One area of interest is the development of new immune adjuvants. Immunostimulatory oligodeoxynucleotides containing the CpG motif (CpG ODN) can induce production of a wide variety of cytokines and activate B cells, monocytes, dendritic cells, and NK cells. Using the 38C13 B cell lymphoma model, we assessed whether CpG ODN can function as immune adjuvants in tumor antigen immunization. The idiotype served as the tumor antigen. Select CpG ODN were as effective as complete Freund's adjuvant at inducing an antigen-specific antibody response but were associated with less toxicity. These CpG ODN induced a higher titer of antigen-specific IgG2a than did complete Freund's adjuvant, suggesting an enhanced TH1 response. Mice immunized with CpG ODN as an adjuvant were protected from tumor challenge to a degree similar to that seen in mice immunized with complete Freund's adjuvant. We conclude that CpG ODN are effective as immune adjuvants and are attractive as part of a tumor immunization strategy.

  18. Induction of neutralizing antibodies specific for the envelope proteins of the koala retrovirus by immunization with recombinant proteins or with DNA.

    PubMed

    Fiebig, Uwe; Dieckhoff, Britta; Wurzbacher, Christian; Möller, Annekathrin; Kurth, Reinhard; Denner, Joachim

    2015-04-30

    The koala retrovirus (KoRV) is the result of a transspecies transmission of a gammaretrovirus with fatal consequences for the new host. Like many retroviruses, KoRV induces lymphoma, leukemia and an immunodeficiency that is associated with opportunistic infections in the virus-infected animals. We recently reported the induction of neutralizing antibodies by immunization with the recombinant ectodomain of the transmembrane envelope protein p15E of KoRV. Since the neutralization titers of the p15E-specific sera were only moderate, we investigated the use of the surface envelope protein gp70 to induce neutralizing antibodies. We immunized rats and goats with the recombinant gp70 protein of the KoRV, an unglycosylated protein of 52kD (rgp70/p52) or with the corresponding DNA. In parallel we immunized with recombinant rp15E or with a combination of rp15E and rgp70/p52. In all cases binding and neutralizing antibodies were induced. The gp70-specific sera had titers of neutralizing antibodies that were 15-fold higher than the p15E-specific sera. Combining rp15E and rgp70/p52 did not significantly increase neutralizing titers compared to rgp70/p52 alone. High titers of neutralizing antibodies specific for gp70 were also induced by immunization with DNA. Since KoRV and PERV are closely related, we investigated cross-neutralization of the antisera. The antisera against p15E and gp70 of PERV and KoRV inhibited infection by both viruses. The envelope proteins of the KoRV may therefore form the basis of an effective preventive vaccine to protect uninfected koalas from infection and possibly an immunotherapeutic treatment for those already infected.

  19. IFN-λ: A New Inducer of Local Immunity against Cancer and Infections.

    PubMed

    Lasfar, Ahmed; Zloza, Andrew; de la Torre, Andrew; Cohen-Solal, Karine A

    2016-01-01

    IFN-λ is the newly established type III IFN with unique immunomodulatory functions. In contrast to the IFN-α/β family and to some extent IFN-γ, IFN-λ is apparently acting in specific areas of the body to activate resident immune cells and induces a local immunity, instrumental in preventing particular infections and also keeping transformed cells under control. Mucosal areas of lung and gastrointestinal tracts are now under scrutiny to elucidate the immune mechanisms triggered by IFN-λ and leading to viral protection. New evidence also indicates the crucial role of IFN-λ in promoting innate immunity in solid cancer models. Based on its unique biological activities among the IFN system, new immunotherapeutic approaches are now emerging for the treatment of cancer, infection, and autoimmune diseases. In the present review, we highlight the recent advances of IFN-λ immunomodulatory functions. We also discuss the perspectives of IFN-λ as a therapeutic agent.

  20. IFN-λ: A New Inducer of Local Immunity against Cancer and Infections

    PubMed Central

    Lasfar, Ahmed; Zloza, Andrew; de la Torre, Andrew; Cohen-Solal, Karine A.

    2016-01-01

    IFN-λ is the newly established type III IFN with unique immunomodulatory functions. In contrast to the IFN-α/β family and to some extent IFN-γ, IFN-λ is apparently acting in specific areas of the body to activate resident immune cells and induces a local immunity, instrumental in preventing particular infections and also keeping transformed cells under control. Mucosal areas of lung and gastrointestinal tracts are now under scrutiny to elucidate the immune mechanisms triggered by IFN-λ and leading to viral protection. New evidence also indicates the crucial role of IFN-λ in promoting innate immunity in solid cancer models. Based on its unique biological activities among the IFN system, new immunotherapeutic approaches are now emerging for the treatment of cancer, infection, and autoimmune diseases. In the present review, we highlight the recent advances of IFN-λ immunomodulatory functions. We also discuss the perspectives of IFN-λ as a therapeutic agent. PMID:28018361

  1. Induction of innate immune signatures following polyepitope protein-glycoprotein B-TLR4&9 agonist immunization generates multifunctional CMV-specific cellular and humoral immunity

    PubMed Central

    Dasari, Vijayendra; Smith, Corey; Schuessler, Andrea; Zhong, Jie; Khanna, Rajiv

    2014-01-01

    Recent studies have suggested that a successful subunit human cytomegalovirus (CMV) vaccine requires improved formulation to generate broad-based anti-viral immunity following immunization. Here we report the development of a non-live protein-based vaccine strategy for CMV based on a polyepitope protein and CMV glycoprotein B (gB) adjuvanted with TLR4 and/or TLR9 agonists. The polyepitope protein includes contiguous multiple MHC class I-restricted epitopes with an aim to induce CD8+ T cell immunity, while gB is an important target for CD4+ T cell immunity and neutralizing antibodies. Optimal immunogenicity of this bivalent non-live protein vaccine formulation was dependent upon the co-administration of both the TLR4 and TLR9 agonist, which was associated with the activation of innate immune signatures and the influx of different DC subsets including plasmacytoid DCs and migratory CD8-DEC205+CD103-CD326- langerin-negative dermal DCs into the draining lymph nodes. Furthermore these professional antigen presenting cells also expressed IL-6, IL-12p70, TNFα, and IFNα which play a crucial role in the activation of adaptive immunity. In summary, this study provides a novel platform technology in which broad-based anti-CMV immune responses upon vaccination can be maximized by co-delivery of viral antigens and TLR4 and 9 agonists which induce activation of innate immune signatures and promote potent antigen acquisition and cross-presentation by multiple DC subsets. PMID:24463331

  2. Perillyl alcohol suppresses antigen-induced immune responses in the lung

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Imamura, Mitsuru; Sasaki, Oh; Okunishi, Katsuhide

    Highlights: •Perillyl alcohol (POH) is an isoprenoid which inhibits the mevalonate pathway. •We examined whether POH suppresses immune responses with a mouse model of asthma. •POH treatment during sensitization suppressed Ag-induced priming of CD4{sup +} T cells. •POH suppressed airway eosinophila and cytokine production in thoracic lymph nodes. -- Abstract: Perillyl alcohol (POH) is an isoprenoid which inhibits farnesyl transferase and geranylgeranyl transferase, key enzymes that induce conformational and functional changes in small G proteins to conduct signal production for cell proliferation. Thus, it has been tried for the treatment of cancers. However, although it affects the proliferation of immunocytes,more » its influence on immune responses has been examined in only a few studies. Notably, its effect on antigen-induced immune responses has not been studied. In this study, we examined whether POH suppresses Ag-induced immune responses with a mouse model of allergic airway inflammation. POH treatment of sensitized mice suppressed proliferation and cytokine production in Ag-stimulated spleen cells or CD4{sup +} T cells. Further, sensitized mice received aerosolized OVA to induce allergic airway inflammation, and some mice received POH treatment. POH significantly suppressed indicators of allergic airway inflammation such as airway eosinophilia. Cytokine production in thoracic lymph nodes was also significantly suppressed. These results demonstrate that POH suppresses antigen-induced immune responses in the lung. Considering that it exists naturally, POH could be a novel preventive or therapeutic option for immunologic lung disorders such as asthma with minimal side effects.« less

  3. Hypofractionated Irradiation Has Immune Stimulatory Potential and Induces a Timely Restricted Infiltration of Immune Cells in Colon Cancer Tumors

    PubMed Central

    Frey, Benjamin; Rückert, Michael; Weber, Julia; Mayr, Xaver; Derer, Anja; Lotter, Michael; Bert, Christoph; Rödel, Franz; Fietkau, Rainer; Gaipl, Udo S.

    2017-01-01

    In addition to locally controlling the tumor, hypofractionated radiotherapy (RT) particularly aims to activate immune cells in the RT-modified microenvironment. Therefore, we examined whether hypofractionated RT can activate dendritic cells (DCs), induce immune cell infiltration in tumors, and how the chronology of immune cell migration into tumors occurs to gain knowledge for future definition of radiation breaks and inclusion of immunotherapy. Colorectal cancer treatments offer only limited survival benefit, and immunobiological principles for additional therapies need to be explored with preclinical models. The impact of hypofractionated RT on CT26 colon cancer tumor cell death, migration of DCs toward supernatants (SN) of tumor cells, and activation of DCs by SN were analyzed. The subcutaneous tumor of a BALB/c-CT26 mouse model was locally irradiated with 2 × 5 Gy, the tumor volume was monitored, and the infiltration of immune cells in the tumor was determined by flow cytometry daily. Hypofractionated RT induced a mixture of apoptotic and necrotic CT26 cells, which is known to be in particular immunogenic. DCs that migrated toward SN of CT26 cells particularly upregulated the activation markers CD80 and CD86 when in contact with SN of irradiated tumor cells. After hypofractionated RT, the tumor outgrowth was significantly retarded and in the irradiated tumors an increased infiltration of macrophages (CD11bhigh/F4-80+) and DCs (MHC-II+), but only between day 5 and 10 after the first irradiation, takes place. While CD4+ T cells migrated into non-irradiated and irradiated tumors, CD8+ T cells were only found in tumors that had been irradiated and they were highly increased at day 8 after the first irradiation. Myeloid-derived suppressor cells and regulatory T cells show regular turnover in irradiated and non-irradiated tumors. Tumor cell-specific anti-IgM antibodies were enhanced in the serum of animals with irradiated tumors. We conclude that

  4. Antibody response and maternal immunity upon boosting PRRSV-immune sows with experimental farm-specific and commercial PRRSV vaccines.

    PubMed

    Geldhof, Marc F; Van Breedam, Wander; De Jong, Ellen; Lopez Rodriguez, Alfonso; Karniychuk, Uladzimir U; Vanhee, Merijn; Van Doorsselaere, Jan; Maes, Dominiek; Nauwynck, Hans J

    2013-12-27

    The porcine reproductive and respiratory syndrome virus (PRRSV) causes reproductive failure in sows and respiratory disease in pigs of all ages. Despite the frequent use of vaccines to maintain PRRSV immunity in sows, little is known on how the currently used vaccines affect the immunity against currently circulating and genetically divergent PRRSV variants in PRRSV-immune sows, i.e. sows that have a pre-existing PRRSV-specific immunity due to previous infection with or vaccination against the virus. Therefore, this study aimed to assess the capacity of commercially available attenuated/inactivated PRRSV vaccines and autogenous inactivated PRRSV vaccines - prepared according to a previously optimized in-house protocol - to boost the antibody immunity against currently circulating PRRSV variants in PRRSV-immune sows. PRRSV isolates were obtained from 3 different swine herds experiencing PRRSV-related problems, despite regular vaccination of gilts and sows against the virus. In a first part of the study, the PRRSV-specific antibody response upon booster vaccination with commercial PRRSV vaccines and inactivated farm-specific PRRSV vaccines was evaluated in PRRSV-immune, non-pregnant replacement sows from the 3 herds. A boost in virus-neutralizing antibodies against the farm-specific isolate was observed in all sow groups vaccinated with the corresponding farm-specific inactivated vaccines. Use of the commercial attenuated EU type vaccine boosted neutralizing antibodies against the farm-specific isolate in sows derived from 2 farms, while use of the commercial attenuated NA type vaccine did not boost farm-specific virus-neutralizing antibodies in any of the sow groups. Interestingly, the commercial inactivated EU type vaccine boosted farm-specific virus-neutralizing antibodies in sows from 1 farm. In the second part of the study, a field trial was performed at one of the farms to evaluate the booster effect of an inactivated farm-specific vaccine and a commercial

  5. Immunotherapy with an HIV-DNA Vaccine in Children and Adults

    PubMed Central

    Palma, Paolo; Gudmundsdotter, Lindvi; Finocchi, Andrea; Eriksson, Lars E.; Mora, Nadia; Santilli, Veronica; Aquilani, Angela; Manno, Emma C.; Zangari, Paola; Romiti, Maria Luisa; Montesano, Carla; Grifoni, Alba; Brave, Andreas; Ljungberg, Karl; Blomberg, Pontus; Bernardi, Stefania; Sandström, Eric; Hejdeman, Bo; Rossi, Paolo; Wahren, Britta

    2014-01-01

    Therapeutic HIV immunization is intended to induce new HIV-specific cellular immune responses and to reduce viral load, possibly permitting extended periods without antiretroviral drugs. A multigene, multi-subtype A, B, C HIV-DNA vaccine (HIVIS) has been used in clinical trials in both children and adults with the aim of improving and broadening the infected individuals’ immune responses. Despite the different country locations, different regimens and the necessary variations in assays performed, this is, to our knowledge, the first attempt to compare children’s and adults’ responses to a particular HIV vaccine. Ten vertically HIV-infected children aged 4–16 years were immunized during antiretroviral therapy (ART). Another ten children were blindly recruited as controls. Both groups continued their antiretroviral treatment during and after vaccinations. Twelve chronically HIV-infected adults were vaccinated, followed by repeated structured therapy interruptions (STI) of their antiretroviral treatment. The adult group included four controls, receiving placebo vaccinations. The HIV-DNA vaccine was generally well tolerated, and no serious adverse events were registered in any group. In the HIV-infected children, an increased specific immune response to Gag and RT proteins was detected by antigen-specific lymphoproliferation. Moreover, the frequency of HIV-specific CD8+ T-cell lymphocytes releasing perforin was significantly higher in the vaccinees than the controls. In the HIV-infected adults, increased CD8+ T-cell responses to Gag, RT and viral protease peptides were detected. No augmentation of HIV-specific lymphoproliferative responses were detected in adults after vaccination. In conclusion, the HIV-DNA vaccine can elicit new HIV-specific cellular immune responses, particularly to Gag antigens, in both HIV-infected children and adults. Vaccinated children mounted transient new HIV-specific immune responses, including both CD4+ T-cell lymphoproliferation

  6. Anti-tumor immunity induced by an anti-idiotype antibody mimicking human Her-2/neu.

    PubMed

    Mohanty, Kartik; Saha, Asim; Pal, Smarajit; Mallick, Palash; Chatterjee, Sunil K; Foon, Kenneth A; Bhattacharya-Chatterjee, Malaya

    2007-07-01

    Our goal is to apply an anti-idiotype (Id) antibody based vaccine approach for the treatment of Her-2/neu-positive human cancer. Amplification and/or over-expression of Her-2/neu occur in multiple human malignancies and are associated with poor prognosis. Her-2/neu proto-oncogene is a suitable target for cancer immunotherapy. We have developed and characterized a murine monoclonal anti-Id antibody, 6D12 that mimics a specific epitope of Her-2/neu and can be used as a surrogate antigen for Her-2/neu. In this study, the efficacy of 6D12 as a tumor vaccine was evaluated in a murine tumor model. Immunization of immunocompetent C57BL/6 mice with 6D12 conjugated to keyhole limpet hemocyanin and mixed with Freund's adjuvant or 6D12 combined with the adjuvant QS21 induced anti-6D12 as well as anti-Her-2/neu immunity. Her-2/neu-positive human breast carcinoma cells, SK-BR-3 reacted with immunized mice sera as determined by ELISA and flow cytometry. Flow cytometry analysis also demonstrated strong reactivity of immunized mice sera with human Her-2/neu transfected EL4 cells (EL4-Her-2), but no reactivity with nontransfected parental EL4 cells. Antibody dependent cellular cytotoxicity against EL4-Her-2 cells was also observed in presence of immune sera. Mice immunized with 6D12 were protected against a challenge with lethal doses of EL4-Her-2 cells, whereas no protection was observed against parental EL4 cells or when mice were immunized with an unrelated anti-Id antibody and challenged with EL4-Her-2 cells. These data suggest that anti-Id 6D12 vaccine can induce protective Her-2/neu specific antitumor immunity and may serve as a potential network antigen for the treatment of patients with Her-2/neu-positive tumors.

  7. A prime-boost immunization regimen based on a simian adenovirus 36 vectored multi-stage malaria vaccine induces protective immunity in mice.

    PubMed

    Fonseca, Jairo A; McCaffery, Jessica N; Kashentseva, Elena; Singh, Balwan; Dmitriev, Igor P; Curiel, David T; Moreno, Alberto

    2017-05-31

    Malaria remains a considerable burden on public health. In 2015, the WHO estimates there were 212 million malaria cases causing nearly 429,000 deaths globally. A highly effective malaria vaccine is needed to reduce the burden of this disease. We have developed an experimental vaccine candidate (PyCMP) based on pre-erythrocytic (CSP) and erythrocytic (MSP1) stage antigens derived from the rodent malaria parasite P. yoelii. Our protein-based vaccine construct induces protective antibodies and CD4 + T cell responses. Based on evidence that viral vectors increase CD8 + T cell-mediated immunity, we also have tested heterologous prime-boost immunization regimens that included human adenovirus serotype 5 vector (Ad5), obtaining protective CD8 + T cell responses. While Ad5 is commonly used for vaccine studies, the high prevalence of pre-existing immunity to Ad5 severely compromises its utility. Here, we report the use of the novel simian adenovirus 36 (SAd36) as a candidate for a vectored malaria vaccine since this virus is not known to infect humans, and it is not neutralized by anti-Ad5 antibodies. Our study shows that the recombinant SAd36PyCMP can enhance specific CD8 + T cell response and elicit similar antibody titers when compared to an immunization regimen including the recombinant Ad5PyCMP. The robust immune responses induced by SAd36PyCMP are translated into a lower parasite load following P. yoelii infectious challenge when compared to mice immunized with Ad5PyCMP. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Dissection of Antibody Specificities Induced by Yellow Fever Vaccination

    PubMed Central

    Vratskikh, Oksana; Stiasny, Karin; Zlatkovic, Jürgen; Tsouchnikas, Georgios; Jarmer, Johanna; Karrer, Urs; Roggendorf, Michael; Roggendorf, Hedwig; Allwinn, Regina; Heinz, Franz X.

    2013-01-01

    The live attenuated yellow fever (YF) vaccine has an excellent record of efficacy and one dose provides long-lasting immunity, which in many cases may last a lifetime. Vaccination stimulates strong innate and adaptive immune responses, and neutralizing antibodies are considered to be the major effectors that correlate with protection from disease. Similar to other flaviviruses, such antibodies are primarily induced by the viral envelope protein E, which consists of three distinct domains (DI, II, and III) and is presented at the surface of mature flavivirions in an icosahedral arrangement. In general, the dominance and individual variation of antibodies to different domains of viral surface proteins and their impact on neutralizing activity are aspects of humoral immunity that are not well understood. To gain insight into these phenomena, we established a platform of immunoassays using recombinant proteins and protein domains that allowed us to dissect and quantify fine specificities of the polyclonal antibody response after YF vaccination in a panel of 51 vaccinees as well as determine their contribution to virus neutralization by serum depletion analyses. Our data revealed a high degree of individual variation in antibody specificities present in post-vaccination sera and differences in the contribution of different antibody subsets to virus neutralization. Irrespective of individual variation, a substantial proportion of neutralizing activity appeared to be due to antibodies directed to complex quaternary epitopes displayed on the virion surface only but not on monomeric E. On the other hand, DIII-specific antibodies (presumed to have the highest neutralizing activity) as well as broadly flavivirus cross-reactive antibodies were absent or present at very low titers. These data provide new information on the fine specificity as well as variability of antibody responses after YF vaccination that are consistent with a strong influence of individual-specific factors

  9. Dissection of antibody specificities induced by yellow fever vaccination.

    PubMed

    Vratskikh, Oksana; Stiasny, Karin; Zlatkovic, Jürgen; Tsouchnikas, Georgios; Jarmer, Johanna; Karrer, Urs; Roggendorf, Michael; Roggendorf, Hedwig; Allwinn, Regina; Heinz, Franz X

    2013-01-01

    The live attenuated yellow fever (YF) vaccine has an excellent record of efficacy and one dose provides long-lasting immunity, which in many cases may last a lifetime. Vaccination stimulates strong innate and adaptive immune responses, and neutralizing antibodies are considered to be the major effectors that correlate with protection from disease. Similar to other flaviviruses, such antibodies are primarily induced by the viral envelope protein E, which consists of three distinct domains (DI, II, and III) and is presented at the surface of mature flavivirions in an icosahedral arrangement. In general, the dominance and individual variation of antibodies to different domains of viral surface proteins and their impact on neutralizing activity are aspects of humoral immunity that are not well understood. To gain insight into these phenomena, we established a platform of immunoassays using recombinant proteins and protein domains that allowed us to dissect and quantify fine specificities of the polyclonal antibody response after YF vaccination in a panel of 51 vaccinees as well as determine their contribution to virus neutralization by serum depletion analyses. Our data revealed a high degree of individual variation in antibody specificities present in post-vaccination sera and differences in the contribution of different antibody subsets to virus neutralization. Irrespective of individual variation, a substantial proportion of neutralizing activity appeared to be due to antibodies directed to complex quaternary epitopes displayed on the virion surface only but not on monomeric E. On the other hand, DIII-specific antibodies (presumed to have the highest neutralizing activity) as well as broadly flavivirus cross-reactive antibodies were absent or present at very low titers. These data provide new information on the fine specificity as well as variability of antibody responses after YF vaccination that are consistent with a strong influence of individual-specific factors

  10. Role of Gag and lipids during HIV-1 assembly in CD4+ T cells and macrophages

    PubMed Central

    Mariani, Charlotte; Desdouits, Marion; Favard, Cyril; Benaroch, Philippe; Muriaux, Delphine M.

    2014-01-01

    HIV-1 is an RNA enveloped virus that preferentially infects CD4+ T lymphocytes and also macrophages. In CD4+ T cells, HIV-1 mainly buds from the host cell plasma membrane. The viral Gag polyprotein targets the plasma membrane and is the orchestrator of the HIV assembly as its expression is sufficient to promote the formation of virus-like particles carrying a lipidic envelope derived from the host cell membrane. Certain lipids are enriched in the viral membrane and are thought to play a key role in the assembly process and the envelop composition. A large body of work performed on infected CD4+ T cells has provided important knowledge about the assembly process and the membrane virus lipid composition. While HIV assembly and budding in macrophages is thought to follow the same general Gag-driven mechanism as in T-lymphocytes, the HIV cycle in macrophage exhibits specific features. In these cells, new virions bud from the limiting membrane of seemingly intracellular compartments, where they accumulate while remaining infectious. These structures are now often referred to as Virus Containing Compartments (VCCs). Recent studies suggest that VCCs represent intracellularly sequestered regions of the plasma membrane, but their precise nature remains elusive. The proteomic and lipidomic characterization of virions produced by T cells or macrophages has highlighted the similarity between their composition and that of the plasma membrane of producer cells, as well as their enrichment in acidic lipids, some components of raft lipids and in tetraspanin-enriched microdomains. It is likely that Gag promotes the coalescence of these components into an assembly platform from which viral budding takes place. How Gag exactly interacts with membrane lipids and what are the mechanisms involved in the interaction between the different membrane nanodomains within the assembly platform remains unclear. Here we review recent literature regarding the role of Gag and lipids on HIV-1

  11. Induction of specific immune unresponsiveness with purified mixed leukocyte culture-activated T lymphoblasts as autoimmunogen. II. An analysis of the effects measured at the cellular and serological levels

    PubMed Central

    1978-01-01

    T lymphoblasts specific for foreign histocompatibility antigens and purified via mixed leukocyte culture (MLC) and 1 g velocity sedimentation procedures can be used as autoimmunogen to produce specific immunological unresponsiveness in adult animals. This unresponsiveness is positively correlated to the production of autoanti- idiotypic antibodies in the blast immunized animals and no evidence of coexisting alloimmunity was found. We consider this autoanti-idiotypic immunity to be the specific inducing agent of the immune tolerance. The blast immunization procedure will lead to selective reduction in T-cell reactivity against the relevant alloantigens as measured by MLC, cell- mediated lympholysis, or graft-versus-host assays. However, in individual animals, dichtomy in suppression between two T-cell assays could sometimes be observed indicating elimination of only a select group of idiotypic functionally distinct population of T cells in these blast-immunized animals. Attempts to abrogate already immune animals by the autoblast procedure were successful, in part suggesting the use of the present procedure when trying to induce in accelerated reversion of such immunity. PMID:75235

  12. Acid phosphatase activity in liver macrophage aggregates as a marker for pollution-induced immunomodulation of the non-specific immune response in fish

    NASA Astrophysics Data System (ADS)

    Broeg, Katja

    2003-10-01

    The activity of acid phosphatase in liver macrophage aggregates (MA-AP) of different fish species was used as a marker for a pollution-induced modulation of the digestive capacity of phagocytes, since functions of the non-specific immune response play a central role in the maintenance of animals' health. Based upon the investigation of more than 900 individual flounders (Platichthys flesus) and mullets (Liza aurata), natural variations, gender-specific differences and pollution-induced alterations in AP activity are demonstrated in this study. MA-AP activity was dependent on temperature and season but, nevertheless, distinctions between differently polluted areas were visible in all sampling campaigns with lowest MA-AP activity in fish from the polluted areas of the German Bight and the Israeli coast of the Mediterranean Sea. For organochlorine contaminants, as well as for mercury and copper, a significant correlation could be observed between residue concentrations in fish tissues and MA-AP activity. In all cases, except mercury which showed a positive correlation, AP activity was suppressed in animals with a high contaminant burden. MA-AP activity turned out to give reliable and consistent results for a quantification of immunomodulation in both fish species.

  13. Vaccine-specific antibody secreting cells are a robust early marker of LAIV-induced B-cell response in ferrets.

    PubMed

    Cherukuri, Anu; Servat, Esteban; Woo, Jennifer

    2012-01-05

    Currently, a robust set of immune correlates for live attenuated influenza vaccine (LAIV) efficacy in humans has not been fully elucidated. The serum hemagglutination inhibition (HAI) assay has been historically used to measure humoral immune responses to injectable inactivated influenza vaccination. However, serum antibody titers do not reliably reflect the complete mechanism of action of LAIV, which is an intranasally delivered vaccine and is expected to induce local mucosal and cellular immune responses in addition to humoral immune responses. Therefore, we designed a study to evaluate potential immune correlates of LAIV vaccination in the ferret animal model of influenza infection. Ferrets were vaccinated with increasing doses of LAIV and four weeks later challenged with a homologous wild-type (wt) H1N1 strain. Humoral immune responses measured following LAIV vaccination included HAI, serum antibodies and antibody secreting cells (ASC); and the responses were found to correlate with the dose level of LAIV administered in this model. Protection from wt virus challenge was determined by measuring inhibition of wt viral replication in nasal washes and in lung tissue. Results demonstrated that LAIV doses ≥ 5.0 log(10) Plaque Forming Units (PFU) elicited vaccine-specific IgG and IgA ASC frequencies and induced complete protection in the lungs. Further, we developed a novel model utilizing seropositive older ferrets to demonstrate that in the background of previous wt influenza infection LAIV induces a robust vaccine-specific B-cell response even in the absence of serum antibody response, a result that suggests that effector B-cell responses generated by LAIV are not inhibited by prior viral exposure. Finally, we demonstrated that LAIV elicits strain-specific memory B-cell responses that are measurable in a background of wt influenza infections. Taken together, results from these studies identified the antigen-specific ASC frequency as a useful early biomarker of

  14. Enhanced glucocorticoid-induced leucine zipper in dendritic cells induces allergen-specific regulatory CD4(+) T-cells in respiratory allergies.

    PubMed

    Karaki, S; Garcia, G; Tcherakian, C; Capel, F; Tran, T; Pallardy, M; Humbert, M; Emilie, D; Godot, V

    2014-05-01

    Respiratory allergies rely on a defect of IL-10-secreting regulatory CD4(+) T-cells (IL-10-Tregs ) leading to excessive Th2-biased immune responses to allergens. According to clinical data, the restoration of allergen-specific IL-10-Tregs is required to control respiratory allergies and cure patients. The discovery of mechanisms involved in the generation of IL-10-Tregs will thus help to provide effective treatments. We previously demonstrated that dendritic cells (DCs) expressing high levels of the glucocorticoid-induced leucine zipper protein (GILZ) generate antigen-specific IL-10-Tregs . We suspect a defective expression of GILZ in the DCs of respiratory allergic patients and speculate that increasing its expression might restore immune tolerance against allergens through the induction of IL-10-Tregs . We assessed GILZ expression in blood DCs of patients and healthy nonallergic donors by qPCR. We compared the ability of patients' DCs to induce allergen-specific IL-10-Tregs before and after an in vivo up-regulation of GILZ expression by steroid administration, steroids being inducers of GILZ. We report lower levels of GILZ in DCs of respiratory allergic patients that return to normal levels after steroid administration. We show that patients' DCs with increased levels of GILZ generate allergen-specific IL-10-Tregs again. We further confirm unequivocally that GILZ is required in patients' DCs to activate these IL-10-Tregs . This proof of concept study shows that the re-establishment of GILZ expression in patients' DCs to normal levels restores their capacity to activate allergen-specific IL-10-Tregs . We thus highlight the up-regulation of GILZ in DCs as a new interventional approach to restore the immune tolerance to allergens. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  15. An oral vaccine based on U-Omp19 induces protection against B. abortus mucosal challenge by inducing an adaptive IL-17 immune response in mice.

    PubMed

    Pasquevich, Karina A; Ibañez, Andrés E; Coria, Lorena M; García Samartino, Clara; Estein, Silvia M; Zwerdling, Astrid; Barrionuevo, Paula; Oliveira, Fernanda S; Seither, Christine; Warzecha, Heribert; Oliveira, Sergio C; Giambartolomei, Guillermo H; Cassataro, Juliana

    2011-01-14

    As Brucella infections occur mainly through mucosal surfaces, the development of mucosal administered vaccines could be radical for the control of brucellosis. In this work we evaluated the potential of Brucella abortus 19 kDa outer membrane protein (U-Omp19) as an edible subunit vaccine against brucellosis. We investigated the protective immune response elicited against oral B. abortus infection after vaccination of mice with leaves from transgenic plants expressing U-Omp19; or with plant-made or E. coli-made purified U-Omp19. All tested U-Omp19 formulations induced protection against Brucella when orally administered without the need of adjuvants. U-Omp19 also induced protection against a systemic challenge when parenterally administered. This built-in adjuvant ability of U-Omp19 was independent of TLR4 and could be explained at least in part by its capability to activate dendritic cells in vivo. While unadjuvanted U-Omp19 intraperitoneally administered induced a specific Th1 response, following U-Omp19 oral delivery a mixed specific Th1-Th17 response was induced. Depletion of CD4(+) T cells in mice orally vaccinated with U-Omp19 resulted in a loss of the elicited protection, indicating that this cell type mediates immune protection. The role of IL-17 against Brucella infection has never been explored. In this study, we determined that if IL-17A was neutralized in vivo during the challenge period, the mucosal U-Omp19 vaccine did not confer mucosal protection. On the contrary, IL-17A neutralization during the infection did not influence at all the subsistence and growth of this bacterium in PBS-immunized mice. All together, our results indicate that an oral unadjuvanted vaccine based on U-Omp19 induces protection against a mucosal challenge with Brucella abortus by inducing an adaptive IL-17 immune response. They also indicate different and important new aspects i) IL-17 does not contribute to reduce the bacterial burden in non vaccinated mice and ii) IL-17 plays

  16. Respiratory Syncytial Virus (RSV) Pulmonary Infection in Humanized Mice Induces Human Anti-RSV Immune Responses and Pathology

    PubMed Central

    Sharma, Anurag; Wu, Wenzhu; Sung, Biin; Huang, Jing; Tsao, Tiffany; Li, Xiangming; Gomi, Rika; Tsuji, Moriya

    2016-01-01

    ABSTRACT Respiratory syncytial virus (RSV) is a leading cause of lower respiratory tract disease, which causes high rates of morbidity and mortality in infants and the elderly. Models of human RSV pulmonary disease are needed to better understand RSV pathogenesis and to assess the efficacy of RSV vaccines. We assessed the RSV-specific human innate, humoral, and cellular immune responses in humanized mice (mice with a human immune system [HIS mice]) with functional human CD4+ T and B cells. These mice were generated by introduction of HLA class II genes, various human cytokines, and human B cell activation factor into immunodeficient NOD scid gamma (NSG) mice by the use of an adeno-associated virus vector, followed by engraftment of human hematopoietic stem cells. During the first 3 days of infection, HIS mice lost more weight and cleared RSV faster than NSG mice. Human chemokine (C-C motif) ligand 3 (CCL3) and human interleukin-1β (IL-1β) expression was detected in the RSV-infected HIS mice. The pathological features induced by RSV infection in HIS mice included peribronchiolar inflammation, neutrophil predominance in the bronchioalveolar lavage fluid, and enhanced airway mucus production. Human anti-RSV IgG and RSV-neutralizing antibodies were detected in serum and human anti-RSV mucosal IgA was detected in bronchioalveolar lavage fluid for up to 6 weeks. RSV infection induced an RSV-specific human gamma interferon response in HIS mouse splenocytes. These results indicate that human immune cells can induce features of RSV lung disease, including mucus hyperplasia, in murine lungs and that HIS mice can be used to elicit human anti-RSV humoral and cellular immunity. IMPORTANCE Infections with respiratory syncytial virus (RSV) are common and can cause severe lung disease in infants and the elderly. The lack of a suitable animal model with disease features similar to those in humans has hampered efforts to predict the efficacy of novel anti-RSV therapies and

  17. [Study on the specific immunity induced by dendritic cell vaccine loading allogenic microvascular endothelial cell bEnd.3 antigen against U14 cervical cancer cell in mice].

    PubMed

    Zhao, Jun; Lu, Jing; Liu, Ya-qin; Yang, Hong-yan; Huang, You-tian; Zhao, Ji-min; Li, Shan; Zhai, Jing-ming; Zhao, Ming-yao; Zhang, Xi; Dong, Zi-ming

    2011-01-01

    To explore the specific cellular and humoral immunity induced by dendritic cells (DC) vaccine loading allogenic microvascular endothelial cell bEnd.3 antigen against U14 cervical cancer cell of mice. Mouse brain microvascular endothelial cell bEnd.3 was cultured and identified for preparation endothelial cell bEnd.3 antigen. The level of mRNA expression of vascular endothelial growth factor receptor 2 (VEGF-R₂) and integrin αV was detected by reverse transcription (RT)-PCR. The BALB/c mice were immuned with DC loading bEnd.3 antigen 4 times in 4 weeks (bEnd.3-DC group), while the mice only were immuned with DC or injected with phosphate buffer saline (PBS group) as control group. One week after last vaccination, U14 cervical cancer cells were injected subcutaneously into the mice. The tumor size, cytotoxic T lymphocyte (CTL) response of spleen lymphocytes in vitro, the percentage of CD₃+CD₈+ surface markers of spleen lymphocytes, and the titer of serum antibody were detected. The specific immunity was examined by immunocytochemistry and western blot. The expression of VEGF-R₂ and integrin αV gene in bEnd.3 cells were expressed highly. After the vaccine was injected, the tumors of mice in PBS group grew faster than those in other groups, while the tumors in bEnd.3-DC group grew slowly and disappeared after 2 weeks. The volume of tumors in DC group grew slower than those in PBS group [(0.11 ± 0.13) cm³ versus (3.38 ± 0.34) cm³]. The CTL response of spleen lymphocytes in vitro showed that bEnd.3-DC cells could kill bEnd.3 cells, the special lysis rate was more than 60%. The percentage of CD₃+CD₈+ spleen lymphocytes in bEnd.3-DC group [(38.6 ± 0.7)%] was higher than those in other groups (P < 0.05). The titer of serum antibody of bEnd.3-DC group was 1:3200, while it was 1:800 in DC group and there were not any in PBS group. Immunocytochemistry analysis indicated there were specific antigen-antibody reaction to bEnd.3 cell in bEnd.3-DC group. Western

  18. The prototype HIV-1 maturation inhibitor, bevirimat, binds to the CA-SP1 cleavage site in immature Gag particles.

    PubMed

    Nguyen, Albert T; Feasley, Christa L; Jackson, Ken W; Nitz, Theodore J; Salzwedel, Karl; Air, Gillian M; Sakalian, Michael

    2011-12-07

    Bevirimat, the prototype Human Immunodeficiency Virus type 1 (HIV-1) maturation inhibitor, is highly potent in cell culture and efficacious in HIV-1 infected patients. In contrast to inhibitors that target the active site of the viral protease, bevirimat specifically inhibits a single cleavage event, the final processing step for the Gag precursor where p25 (CA-SP1) is cleaved to p24 (CA) and SP1. In this study, photoaffinity analogs of bevirimat and mass spectrometry were employed to map the binding site of bevirimat to Gag within immature virus-like particles. Bevirimat analogs were found to crosslink to sequences overlapping, or proximal to, the CA-SP1 cleavage site, consistent with previous biochemical data on the effect of bevirimat on Gag processing and with genetic data from resistance mutations, in a region predicted by NMR and mutational studies to have α-helical character. Unexpectedly, a second region of interaction was found within the Major Homology Region (MHR). Extensive prior genetic evidence suggests that the MHR is critical for virus assembly. This is the first demonstration of a direct interaction between the maturation inhibitor, bevirimat, and its target, Gag. Information gained from this study sheds light on the mechanisms by which the virus develops resistance to this class of drug and may aid in the design of next-generation maturation inhibitors.

  19. Vaccination with dendritic cells pulsed with hepatitis C pseudo particles induces specific immune responses in mice

    PubMed Central

    Weigand, Kilian; Voigt, Franziska; Encke, Jens; Hoyler, Birgit; Stremmel, Wolfgang; Eisenbach, Christoph

    2012-01-01

    AIM: To explore dendritic cells (DCs) multiple functions in immune modulation. METHODS: We used bone-marrow derived dendritic cells from BALB/c mice pulsed with pseudo particles from the hepatitis C virus to vaccinate naive BALB/c mice. Hepatitis C virus (HCV) pseudo particles consist of the genotype 1b derived envelope proteins E1 and E2, covering a non-HCV core structure. Thus, not a single epitope, but the whole “viral surface” induces immunogenicity. For vaccination, mature and activated DC were injected subcutaneously twice. RESULTS: Humoral and cellular immune responses measured by enzyme-linked immunosorbent assay and interferon-gamma enzyme-linked immunosorbent spot test showed antibody production as well as T-cells directed against HCV. Furthermore, T-cell responses confirmed two highly immunogenic regions in E1 and E2 outside the hypervariable region 1. CONCLUSION: Our results indicate dendritic cells as a promising vaccination model for HCV infection that should be evaluated further. PMID:22371638

  20. Inducible Defenses Stay Up Late: Temporal Patterns of Immune Gene Expression in Tenebrio molitor

    PubMed Central

    Johnston, Paul R; Makarova, Olga; Rolff, Jens

    2014-01-01

    The course of microbial infection in insects is shaped by a two-stage process of immune defense. Constitutive defenses, such as engulfment and melanization, act immediately and are followed by inducible defenses, archetypically the production of antimicrobial peptides, which eliminate or suppress the remaining microbes. By applying RNAseq across a 7-day time course, we sought to characterize the long-lasting immune response to bacterial challenge in the mealworm beetle Tenebrio molitor, a model for the biochemistry of insect immunity and persistent bacterial infection. By annotating a hybrid de novo assembly of RNAseq data, we were able to identify putative orthologs for the majority of components of the conserved insect immune system. Compared with Tribolium castaneum, the most closely related species with a reference genome sequence and a manually curated immune system annotation, the T. molitor immune gene count was lower, with lineage-specific expansions of genes encoding serine proteases and their countervailing inhibitors accounting for the majority of the deficit. Quantitative mapping of RNAseq reads to the reference assembly showed that expression of genes with predicted functions in cellular immunity, wound healing, melanization, and the production of reactive oxygen species was transiently induced immediately after immune challenge. In contrast, expression of genes encoding antimicrobial peptides or components of the Toll signaling pathway and iron sequestration response remained elevated for at least 7 days. Numerous genes involved in metabolism and nutrient storage were repressed, indicating a possible cost of immune induction. Strikingly, the expression of almost all antibacterial peptides followed the same pattern of long-lasting induction, regardless of their spectra of activity, signaling possible interactive roles in vivo. PMID:24318927

  1. Inducible defenses stay up late: temporal patterns of immune gene expression in Tenebrio molitor.

    PubMed

    Johnston, Paul R; Makarova, Olga; Rolff, Jens

    2013-12-06

    The course of microbial infection in insects is shaped by a two-stage process of immune defense. Constitutive defenses, such as engulfment and melanization, act immediately and are followed by inducible defenses, archetypically the production of antimicrobial peptides, which eliminate or suppress the remaining microbes. By applying RNAseq across a 7-day time course, we sought to characterize the long-lasting immune response to bacterial challenge in the mealworm beetle Tenebrio molitor, a model for the biochemistry of insect immunity and persistent bacterial infection. By annotating a hybrid de novo assembly of RNAseq data, we were able to identify putative orthologs for the majority of components of the conserved insect immune system. Compared with Tribolium castaneum, the most closely related species with a reference genome sequence and a manually curated immune system annotation, the T. molitor immune gene count was lower, with lineage-specific expansions of genes encoding serine proteases and their countervailing inhibitors accounting for the majority of the deficit. Quantitative mapping of RNAseq reads to the reference assembly showed that expression of genes with predicted functions in cellular immunity, wound healing, melanization, and the production of reactive oxygen species was transiently induced immediately after immune challenge. In contrast, expression of genes encoding antimicrobial peptides or components of the Toll signaling pathway and iron sequestration response remained elevated for at least 7 days. Numerous genes involved in metabolism and nutrient storage were repressed, indicating a possible cost of immune induction. Strikingly, the expression of almost all antibacterial peptides followed the same pattern of long-lasting induction, regardless of their spectra of activity, signaling possible interactive roles in vivo. Copyright © 2014 Johnston et al.

  2. Gag grouper larvae pathways on the West Florida Shelf

    NASA Astrophysics Data System (ADS)

    Weisberg, Robert H.; Zheng, Lianyuan; Peebles, Ernst

    2014-10-01

    A numerical circulation model, quantitatively assessed against in situ observations, is used to describe the circulation on the West Florida Continental Shelf during spring 2007 when pre-settlement gag (Mycteroperca microlepis) were present in the surf zone near Tampa Bay, Florida. The pre-settlement fish were found to be isotopically distinct from settled juveniles in the area, which is consistent with recent arrival at near shore nursery habitats from offshore spawning grounds. Simulated particle trajectories are employed to test hypotheses relating to either a surface or a near-bottom route of across-shelf transport. The surface-route hypothesis is rejected, whereas the bottom-route hypothesis is found to be consistent with the location of pre-settlement fish and their co-occurrence with macroalgae of offshore, hard-bottom origin. We conclude that gag larvae are transported to the near shore via the bottom Ekman layer and that such transport is facilitated by remote forcing associated with Gulf of Mexico Loop Current interactions with the shelf slope near the Dry Tortugas. Being that such remote forcing occurs inter-annually and not always in phase with the preferred spawning months (late winter through early spring), gag recruitment success should similarly vary with year and location.

  3. Power and politics in international funding for reproductive health: the US Global Gag Rule.

    PubMed

    Crane, Barbara B; Dusenberry, Jennifer

    2004-11-01

    Since 2001, the US government has used its power as a leading donor to family planning programmes to pursue policies in conflict with global agreements on reproductive rights. Prominent among these policies is the Mexico City Policy (or Global Gag Rule), which restricts non-governmental organisations (NGOs) in developing countries that receive USAID family planning funding from engaging in most abortion-related activities, even with their own funds. This paper reviews the history and political origins of the Gag Rule under several Republican party presidents. The Gag Rule has not achieved an overall reduction in abortions; rather, where it has disrupted family planning services, the policy is more likely to have increased the number of abortions. This paper concludes that the Gag Rule is a radical intrusion on the rights and autonomy of recipients of US funding. Regardless of whether or not it is rescinded in the future, the underlying issues in the politics of US reproductive health assistance are likely to persist. NGOs that wish to free themselves from the constraints it imposes must find the means to end their dependence on USAID funding, including turning to other donors. NGOs should also take the lead in opposing policies such as the Gag Rule that violate global agreements.

  4. Vedolizumab treatment for immune checkpoint inhibitor-induced enterocolitis.

    PubMed

    Bergqvist, Viktoria; Hertervig, Erik; Gedeon, Peter; Kopljar, Marija; Griph, Håkan; Kinhult, Sara; Carneiro, Ana; Marsal, Jan

    2017-05-01

    Immune checkpoint inhibitors (ICPI), such as ipilimumab [anti-cytotoxic T-lymphocyte antigen-4 (CTLA-4) antibody] and nivolumab or pembrolizumab [anti-programmed cell death protein-1 (PD-1) antibodies], improve survival in several cancer types. Since inhibition of CTLA-4 or PD-1 leads to non-selective activation of the immune system, immune-related adverse events (irAEs) are frequent. Enterocolitis is a common irAE, currently managed with corticosteroids and, if necessary, anti-tumor necrosis factor-α therapy. Such a regimen carries a risk of serious side-effects including infections, and may potentially imply impaired antitumor effects. Vedolizumab is an anti-integrin α4β7 antibody with gut-specific immunosuppressive effects, approved for Crohn's disease and ulcerative colitis. We report a case series of seven patients with metastatic melanoma or lung cancer, treated with vedolizumab off-label for ipilimumab- or nivolumab-induced enterocolitis, from June 2014 through October 2016. Clinical, laboratory, endoscopic, and histologic data were analyzed. Patients initially received corticosteroids but were steroid-dependent and/or partially refractory. One patient was administered infliximab but was refractory. The median time from onset of enterocolitis to start of vedolizumab therapy was 79 days. Following vedolizumab therapy, all patients but one experienced steroid-free enterocolitis remission, with normalized fecal calprotectin. This was achieved after a median of 56 days from vedolizumab start, without any vedolizumab-related side-effects noted. The patient in whom vedolizumab was not successful, due to active ulcerative colitis, received vedolizumab prophylactically. This is the first case series to suggest that vedolizumab is an effective and well-tolerated therapeutic for steroid-dependent or partially refractory ICPI-induced enterocolitis. A larger prospective study to evaluate vedolizumab in this indication is warranted.

  5. The baculovirus-integrated retrotransposon TED encodes gag and pol proteins that assemble into viruslike particles with reverse transcriptase.

    PubMed Central

    Lerch, R A; Friesen, P D

    1992-01-01

    TED is a lepidopteran retrotransposon found inserted within the DNA genome of the Autographa californica nuclear polyhedrosis virus mutant, FP-D. To examine the proteins and functions encoded by this representative of the gypsy family of retrotransposons, the gag- and pol-like open reading frames (ORFs 1 and 2) were expressed in homologous lepidopteran cells by using recombinant baculovirus vectors. Expression of ORF 1 resulted in synthesis of an abundant TED-specific protein (Pr55gag) that assembled into viruslike particles with a diameter of 55 to 60 nm. Expression of ORF 2, requiring a -1 translational frameshift, resulted in synthesis of a protease that mediated cleavage of Pr55gag to generate p37, the major protein component of the resulting particles. Expression of ORF 2 also produced reverse transcriptase that associated with these particles. Both protease and reverse transcriptase activities mapped to domains within ORF 2 that contain sequence similarities with the corresponding functional domains of the pol gene of the vertebrate retroviruses. These results indicated that TED ORFs 1 and 2 functionally resemble the retrovirus gag and pol genes and demonstrated for the first time that an invertebrate member of the gypsy family of elements encodes active forms of the structural and enzymatic functions necessary for transposition via an RNA intermediate. TED integration within the baculovirus genome thus represents one of the first examples of transposon-mediated transfer of host-derived genes to an eukaryotic virus. Images PMID:1371168

  6. Near infrared photoimmunotherapy rapidly elicits specific host immunity against cancer cells (Conference Presentation)

    NASA Astrophysics Data System (ADS)

    Kobayashi, Hisataka

    2017-02-01

    Near infrared photoimmunotherapy (NIR-PIT) is a new molecularly-targeted cancer photo-therapy based on conjugating a near infrared silica-phthalocyanine dye, IR700, to a monoclonal antibody (mAb) targeting cell-surface molecules. When exposed to NIR light, the conjugate induces a highly-selective necrotic/immunogenic cell death (ICD) only in target-positive, mAb-IR700-bound cancer cells. This cell death occurs as early as 1 minute after exposure to NIR light. Meanwhile, immediately adjacent target-negative cells are unharmed. Dynamic 3D-microscopy of live tumor cells undergoing NIR-PIT showed rapid swelling in treated cells immediately after light exposure, followed by irreversible morphologic changes such as bleb formation, and rupture of vesicles within several minutes. Furthermore, biological markers of ICD including relocation of HSP70/90 and calreticulin, and release of ATP and High Mobility Group Box 1 (HMGB1), were clearly detected immediately after NIR-PIT. When NIR-PIT was performed in a mixture of cancer cells and immature dendritic cells, maturation of immature dendritic cells was strongly induced rapidly after NIR-PIT. Alternatively, NIR-PIT can also target negative regulatory immune cells such as Treg only in the tumor bed. Treg targeting NIR-PIT against CD25 can deplete >80% of Treg in tumor bed within 20 min that induces activation of tumor cell-specific CD8+-T and NK cells within 1.5 hour, and then these activated cells killed cancer cells in local tumor within 1 day and also in distant tumors of the same cell origin within 2 days. In summary, cancer cell-targeting and immuno-suppressor cell-targeting NIR-PITs effectively induce innate and acquired immunity specifically against cancer cells growing in patients, respectively.

  7. CMV-specific immune reconstitution following allogeneic stem cell transplantation

    PubMed Central

    Blyth, Emily; Withers, Barbara; Clancy, Leighton; Gottlieb, David

    2016-01-01

    ABSTRACT Cytomegalovirus (CMV) remains a major contributor to morbidity and mortality following allogeneic haemopoietic stem cell transplant (HSCT) despite widespread use of viraemia monitoring and pre-emptive antiviral therapy. Uncontrolled viral replication occurs primarily in the first 100 d post transplant but this high risk period can extend to many months if immune recovery is delayed. The re-establishment of a functional population of cellular effectors is essential for control of virus replication and depends on recipient and donor serostatus, the stem cell source, degree of HLA matching and post-transplant factors such as CMV antigen exposure, presence of GVHD and ongoing use of immune suppression. A number of immune monitoring assays exist but have not yet become widely accessible for routine clinical use. Vaccination, adoptive transfer of CMV specific T cells and a number of graft engineering processes are being evaluated to enhance of CMV specific immune recovery post HSCT. PMID:27580355

  8. Definition of a high-affinity Gag recognition structure mediating packaging of a retroviral RNA genome

    PubMed Central

    Gherghe, Cristina; Lombo, Tania; Leonard, Christopher W.; Datta, Siddhartha A. K.; Bess, Julian W.; Gorelick, Robert J.; Rein, Alan; Weeks, Kevin M.

    2010-01-01

    All retroviral genomic RNAs contain a cis-acting packaging signal by which dimeric genomes are selectively packaged into nascent virions. However, it is not understood how Gag (the viral structural protein) interacts with these signals to package the genome with high selectivity. We probed the structure of murine leukemia virus RNA inside virus particles using SHAPE, a high-throughput RNA structure analysis technology. These experiments showed that NC (the nucleic acid binding domain derived from Gag) binds within the virus to the sequence UCUG-UR-UCUG. Recombinant Gag and NC proteins bound to this same RNA sequence in dimeric RNA in vitro; in all cases, interactions were strongest with the first U and final G in each UCUG element. The RNA structural context is critical: High-affinity binding requires base-paired regions flanking this motif, and two UCUG-UR-UCUG motifs are specifically exposed in the viral RNA dimer. Mutating the guanosine residues in these two motifs—only four nucleotides per genomic RNA—reduced packaging 100-fold, comparable to the level of nonspecific packaging. These results thus explain the selective packaging of dimeric RNA. This paradigm has implications for RNA recognition in general, illustrating how local context and RNA structure can create information-rich recognition signals from simple single-stranded sequence elements in large RNAs. PMID:20974908

  9. In vitro antigen-induced, antigen-specific antibody production in man. Specific and polyclonal components, kinetics, and cellular requirements

    PubMed Central

    1981-01-01

    A highly specific and reproducible antigen-induced, antigen-specific culture and assay system for antibody production by human peripheral blood B lymphocytes has been developed. The system is clearly T cell and monocyte dependent and is independent of exogenous mitogens. The major factors in our ability to trigger specific antibody production with antigen alone have been the use of extremely low concentrations of antigen in vitro (doses several orders of magnitude below those inducing a peak blastogenic response), careful attention to in vitro cell density and culture vessel geometry, and appreciation of the kinetics of the circulating antigen-inducible B cell repertoire. A dichotomy and overlap between antigen-induced, antigen-specific and antigen-induced, polyclonal responses was observed in the study of doubly immunized individuals. Whereas antibody responses highly specific for the antigen in culture were observed under one set of culture conditions (flat-bottomed vessels, 1.5 x 10(6) cells), switching to another culture system (round-bottomed vessels, 5 x 10(5) cells) resulted in polyclonal responses to antigen. Despite these culture condition-related differences in the induction of antibody synthesis, the suppression of specific antibody production that occurred at high concentrations of antigen was specific only for the antigen in culture. The capability to easily and reproducibly look at truly antigen-induced, antigen specific antibody production should be a major tool in furthering the understanding of human B cell activation and immunoregulation. PMID:6169778

  10. A case of pembrolizumab-induced type-1 diabetes mellitus and discussion of immune checkpoint inhibitor-induced type 1 diabetes.

    PubMed

    Chae, Young Kwang; Chiec, Lauren; Mohindra, Nisha; Gentzler, Ryan; Patel, Jyoti; Giles, Francis

    2017-01-01

    Immune checkpoint inhibitors such as pembrolizumab, ipilimumab, and nivolumab, now FDA-approved for use in treating several types of cancer, have been associated with immune-related adverse effects. Specifically, the antibodies targeting the programmed-cell death-1 immune checkpoint, pembrolizumab and nivolumab, have been rarely reported to induce the development of type 1 diabetes mellitus. Here we describe a case of a patient who developed antibody-positive type 1 diabetes mellitus following treatment with pembrolizumab in combination with systemic chemotherapy for metastatic adenocarcinoma of the lung. We will also provide a brief literature review of other rarely reported cases of type 1 diabetes presenting after treatment with pembrolizumab and nivolumab, as well as discussion regarding potential mechanisms of this adverse effect and its importance as these drugs continue to become even more widespread.

  11. The Foreseeable Harms of Trump's Global Gag Rule.

    PubMed

    Bingenheimer, Jeffrey B; Skuster, Patty

    2017-09-01

    As one of his first acts as President of the United States, Donald Trump signed an executive order reinstating a version of the global gag rule. Under this rule, US grantees are barred from receiving global health funding if they engage in abortion-related work: not only abortion services, but also abortion referrals and counseling or advocacy for the liberalization of abortion laws. Critics of the Trump global gag rule generally raise three classes of objections: (1) that the rule fails to accomplish its presumed objective of reducing the number of abortions; (2) that it negatively affects the health and well-being of individuals and populations in affected countries; and (3) that it interferes with governments' ability to meet their international obligations. In this commentary, we examine the scientific and policy bases for these criticisms. © 2017 The Population Council, Inc.

  12. Immune Responses and Protection of Aotus Monkeys Immunized with Irradiated Plasmodium vivax Sporozoites

    PubMed Central

    Jordán-Villegas, Alejandro; Perdomo, Anilza Bonelo; Epstein, Judith E.; López, Jesús; Castellanos, Alejandro; Manzano, María R.; Hernández, Miguel A.; Soto, Liliana; Méndez, Fabián; Richie, Thomas L.; Hoffman, Stephen L.; Arévalo-Herrera, Myriam; Herrera, Sócrates

    2011-01-01

    A non-human primate model for the induction of protective immunity against the pre-erythrocytic stages of Plasmodium vivax malaria using radiation-attenuated P. vivax sporozoites may help to characterize protective immune mechanisms and identify novel malaria vaccine candidates. Immune responses and protective efficacy induced by vaccination with irradiated P. vivax sporozoites were evaluated in malaria-naive Aotus monkeys. Three groups of six monkeys received two, five, or ten intravenous inoculations, respectively, of 100,000 irradiated P. vivax sporozoites; control groups received either 10 doses of uninfected salivary gland extract or no inoculations. Immunization resulted in the production low levels of antibodies that specifically recognized P. vivax sporozoites and the circumsporozoite protein. Additionally, immunization induced low levels of antigen-specific IFN-γ responses. Intravenous challenge with viable sporozoites resulted in partial protection in a dose-dependent manner. These findings suggest that the Aotus monkey model may be able to play a role in preclinical development of P. vivax pre-erythrocytic stage vaccines. PMID:21292877

  13. Merck Ad5/HIV induces broad innate immune activation that predicts CD8⁺ T-cell responses but is attenuated by preexisting Ad5 immunity.

    PubMed

    Zak, Daniel E; Andersen-Nissen, Erica; Peterson, Eric R; Sato, Alicia; Hamilton, M Kristina; Borgerding, Joleen; Krishnamurty, Akshay T; Chang, Joanne T; Adams, Devin J; Hensley, Tiffany R; Salter, Alexander I; Morgan, Cecilia A; Duerr, Ann C; De Rosa, Stephen C; Aderem, Alan; McElrath, M Juliana

    2012-12-11

    To better understand how innate immune responses to vaccination can lead to lasting protective immunity, we used a systems approach to define immune signatures in humans over 1 wk following MRKAd5/HIV vaccination that predicted subsequent HIV-specific T-cell responses. Within 24 h, striking increases in peripheral blood mononuclear cell gene expression associated with inflammation, IFN response, and myeloid cell trafficking occurred, and lymphocyte-specific transcripts decreased. These alterations were corroborated by marked serum inflammatory cytokine elevations and egress of circulating lymphocytes. Responses of vaccinees with preexisting adenovirus serotype 5 (Ad5) neutralizing antibodies were strongly attenuated, suggesting that enhanced HIV acquisition in Ad5-seropositive subgroups in the Step Study may relate to the lack of appropriate innate activation rather than to increased systemic immune activation. Importantly, patterns of chemoattractant cytokine responses at 24 h and alterations in 209 peripheral blood mononuclear cell transcripts at 72 h were predictive of subsequent induction and magnitude of HIV-specific CD8(+) T-cell responses. This systems approach provides a framework to compare innate responses induced by vectors, as shown here by contrasting the more rapid, robust response to MRKAd5/HIV with that to yellow fever vaccine. When applied iteratively, the findings may permit selection of HIV vaccine candidates eliciting innate immune response profiles more likely to drive HIV protective immunity.

  14. The long terminal repeat-containing retrotransposon Tf1 possesses amino acids in gag that regulate nuclear localization and particle formation.

    PubMed

    Kim, Min-Kyung; Claiborn, Kathryn C; Levin, Henry L

    2005-08-01

    Tf1 is a long terminal repeat-containing retrotransposon of Schizosaccharomyces pombe that is studied to further our understanding of retrovirus propagation. One important application is to examine Tf1 as a model for how human immunodeficiency virus type 1 proteins enter the nucleus. The accumulation of Tf1 Gag in the nucleus requires an N-terminal nuclear localization signal (NLS) and the nuclear pore factor Nup124p. Here, we report that NLS activity is regulated by adjacent residues. Five mutant transposons were made, each with sequential tracts of four amino acids in Gag replaced by alanines. All five versions of Tf1 transposed with frequencies that were significantly lower than that of the wild type. Although all five made normal amounts of Gag, two of the mutations did not make cDNA, indicating that Gag contributed to reverse transcription. The localization of the Gag in the nucleus was significantly reduced by mutations A1, A2, and A3. These results identified residues in Gag that contribute to the function of the NLS. The Gags of A4 and A5 localized within the nucleus but exhibited severe defects in the formation of virus-like particles. Of particular interest was that the mutations in Gag-A4 and Gag-A5 caused their nuclear localization to become independent of Nup124p. These results suggested that Nup124p was only required for import of Tf1 Gag because of its extensive multimerization.

  15. Caveolin-1 interacts with the Gag precursor of murine leukaemia virus and modulates virus production

    PubMed Central

    Yu, Zheng; Beer, Christiane; Koester, Mario; Wirth, Manfred

    2006-01-01

    Background Retroviral Gag determines virus assembly at the plasma membrane and the formation of virus-like particles in intracellular multivesicular bodies. Thereby, retroviruses exploit by interaction with cellular partners the cellular machineries for vesicular transport in various ways. Results The retroviral Gag precursor protein drives assembly of murine leukaemia viruses (MLV) at the plasma membrane (PM) and the formation of virus like particles in multivesicular bodies (MVBs). In our study we show that caveolin-1 (Cav-1), a multifunctional membrane-associated protein, co-localizes with Gag in a punctate pattern at the PM of infected NIH 3T3 cells. We provide evidence that Cav-1 interacts with the matrix protein (MA) of the Gag precursor. This interaction is mediated by a Cav-1 binding domain (CBD) within the N-terminus of MA. Interestingly, the CBD motif identified within MA is highly conserved among most other γ-retroviruses. Furthermore, Cav-1 is incorporated into MLV released from NIH 3T3 cells. Overexpression of a GFP fusion protein containing the putative CBD of the retroviral MA resulted in a considerable decrease in production of infectious retrovirus. Moreover, expression of a dominant-negative Cav-1 mutant affected retroviral titres significantly. Conclusion This study demonstrates that Cav-1 interacts with MLV Gag, co-localizes with Gag at the PM and affects the production of infectious virus. The results strongly suggest a role for Cav-1 in the process of virus assembly. PMID:16956408

  16. Novel vaccine development strategies for inducing mucosal immunity

    PubMed Central

    Fujkuyama, Yoshiko; Tokuhara, Daisuke; Kataoka, Kosuke; Gilbert, Rebekah S; McGhee, Jerry R; Yuki, Yoshikazu; Kiyono, Hiroshi; Fujihashi, Kohtaro

    2012-01-01

    To develop protective immune responses against mucosal pathogens, the delivery route and adjuvants for vaccination are important. The host, however, strives to maintain mucosal homeostasis by responding to mucosal antigens with tolerance, instead of immune activation. Thus, induction of mucosal immunity through vaccination is a rather difficult task, and potent mucosal adjuvants, vectors or other special delivery systems are often used, especially in the elderly. By taking advantage of the common mucosal immune system, the targeting of mucosal dendritic cells and microfold epithelial cells may facilitate the induction of effective mucosal immunity. Thus, novel routes of immunization and antigen delivery systems also show great potential for the development of effective and safe mucosal vaccines against various pathogens. The purpose of this review is to introduce several recent approaches to induce mucosal immunity to vaccines, with an emphasis on mucosal tissue targeting, new immunization routes and delivery systems. Defining the mechanisms of mucosal vaccines is as important as their efficacy and safety, and in this article, examples of recent approaches, which will likely accelerate progress in mucosal vaccine development, are discussed. PMID:22380827

  17. HIV-1 evades innate immune recognition through specific cofactor recruitment

    NASA Astrophysics Data System (ADS)

    Rasaiyaah, Jane; Tan, Choon Ping; Fletcher, Adam J.; Price, Amanda J.; Blondeau, Caroline; Hilditch, Laura; Jacques, David A.; Selwood, David L.; James, Leo C.; Noursadeghi, Mahdad; Towers, Greg J.

    2013-11-01

    Human immunodeficiency virus (HIV)-1 is able to replicate in primary human macrophages without stimulating innate immunity despite reverse transcription of genomic RNA into double-stranded DNA, an activity that might be expected to trigger innate pattern recognition receptors. We reasoned that if correctly orchestrated HIV-1 uncoating and nuclear entry is important for evasion of innate sensors then manipulation of specific interactions between HIV-1 capsid and host factors that putatively regulate these processes should trigger pattern recognition receptors and stimulate type 1 interferon (IFN) secretion. Here we show that HIV-1 capsid mutants N74D and P90A, which are impaired for interaction with cofactors cleavage and polyadenylation specificity factor subunit 6 (CPSF6) and cyclophilins (Nup358 and CypA), respectively, cannot replicate in primary human monocyte-derived macrophages because they trigger innate sensors leading to nuclear translocation of NF-κB and IRF3, the production of soluble type 1 IFN and induction of an antiviral state. Depletion of CPSF6 with short hairpin RNA expression allows wild-type virus to trigger innate sensors and IFN production. In each case, suppressed replication is rescued by IFN-receptor blockade, demonstrating a role for IFN in restriction. IFN production is dependent on viral reverse transcription but not integration, indicating that a viral reverse transcription product comprises the HIV-1 pathogen-associated molecular pattern. Finally, we show that we can pharmacologically induce wild-type HIV-1 infection to stimulate IFN secretion and an antiviral state using a non-immunosuppressive cyclosporine analogue. We conclude that HIV-1 has evolved to use CPSF6 and cyclophilins to cloak its replication, allowing evasion of innate immune sensors and induction of a cell-autonomous innate immune response in primary human macrophages.

  18. Machine-learning algorithms define pathogen-specific local immune fingerprints in peritoneal dialysis patients with bacterial infections.

    PubMed

    Zhang, Jingjing; Friberg, Ida M; Kift-Morgan, Ann; Parekh, Gita; Morgan, Matt P; Liuzzi, Anna Rita; Lin, Chan-Yu; Donovan, Kieron L; Colmont, Chantal S; Morgan, Peter H; Davis, Paul; Weeks, Ian; Fraser, Donald J; Topley, Nicholas; Eberl, Matthias

    2017-07-01

    The immune system has evolved to sense invading pathogens, control infection, and restore tissue integrity. Despite symptomatic variability in patients, unequivocal evidence that an individual's immune system distinguishes between different organisms and mounts an appropriate response is lacking. We here used a systematic approach to characterize responses to microbiologically well-defined infection in a total of 83 peritoneal dialysis patients on the day of presentation with acute peritonitis. A broad range of cellular and soluble parameters was determined in peritoneal effluents, covering the majority of local immune cells, inflammatory and regulatory cytokines and chemokines as well as tissue damage-related factors. Our analyses, utilizing machine-learning algorithms, demonstrate that different groups of bacteria induce qualitatively distinct local immune fingerprints, with specific biomarker signatures associated with Gram-negative and Gram-positive organisms, and with culture-negative episodes of unclear etiology. Even more, within the Gram-positive group, unique immune biomarker combinations identified streptococcal and non-streptococcal species including coagulase-negative Staphylococcus spp. These findings have diagnostic and prognostic implications by informing patient management and treatment choice at the point of care. Thus, our data establish the power of non-linear mathematical models to analyze complex biomedical datasets and highlight key pathways involved in pathogen-specific immune responses. Copyright © 2017 International Society of Nephrology. Published by Elsevier Inc. All rights reserved.

  19. Co-delivery of PSA and PSMA DNA vaccines with electroporation induces potent immune responses.

    PubMed

    Ferraro, Bernadette; Cisper, Neil J; Talbott, Kendra T; Philipson-Weiner, Lindsey; Lucke, Colleen E; Khan, Amir S; Sardesai, Niranjan Y; Weiner, David B

    2011-01-01

    Prostate cancer (PCa) remains a significant public health problem. Current treatment modalities for PCa can be useful, but may be accompanied by deleterious side effects and often do not confer long-term control. Accordingly, additional modalities, such as immunotherapy, may represent an important approach for PCa treatment. The identification of tissue-specific antigens engenders PCa an attractive target for immunotherapeutic approaches. Delivery of DNA vaccines with electroporation has shown promising results for prophylactic and therapeutic targets in a variety of species including humans. Application of this technology for PCa immunotherapy strategies has been limited to single antigen and epitope targets. We sought to test the hypothesis that a broader collection of antigens would improve the breadth and effectiveness of a PCa immune therapy approach. We therefore developed highly optimized DNA vaccines encoding prostate-specific antigen (PSA) and prostate-specific membrane antigen (PSMA) as a dual antigen approach to immune therapy of PCa. PSA-and PSMA-specific cellular immunogenicity was evaluated in a mouse model for co-delivery and single antigen vaccination. Mice received 2 immunizations spaced 2 weeks apart and immunogenicity was evaluated 1 week after the second vaccination. Both the PSA and PSMA vaccines induced robust antigen-specific IFNγ responses by ELISpot. Further characterization of cellular immunogenicity by flow cytometry indicated strong antigen-specific TNFα production by CD4+ T cells and IFNγ and IL-2 secretion by both CD4+ and CD8+ T cells. There was also a strong humoral response as determined by PSA-specific seroconversion. These data support further study of this novel approach to immune therapy of PCa.

  20. Perturbation of gut bacteria induces a coordinated cellular immune response in the purple sea urchin larva.

    PubMed

    Ch Ho, Eric; Buckley, Katherine M; Schrankel, Catherine S; Schuh, Nicholas W; Hibino, Taku; Solek, Cynthia M; Bae, Koeun; Wang, Guizhi; Rast, Jonathan P

    2016-10-01

    The purple sea urchin (Strongylocentrotus purpuratus) genome sequence contains a complex repertoire of genes encoding innate immune recognition proteins and homologs of important vertebrate immune regulatory factors. To characterize how this immune system is deployed within an experimentally tractable, intact animal, we investigate the immune capability of the larval stage. Sea urchin embryos and larvae are morphologically simple and transparent, providing an organism-wide model to view immune response at cellular resolution. Here we present evidence for immune function in five mesenchymal cell types based on morphology, behavior and gene expression. Two cell types are phagocytic; the others interact at sites of microbial detection or injury. We characterize immune-associated gene markers for three cell types, including a perforin-like molecule, a scavenger receptor, a complement-like thioester-containing protein and the echinoderm-specific immune response factor 185/333. We elicit larval immune responses by (1) bacterial injection into the blastocoel and (2) seawater exposure to the marine bacterium Vibrio diazotrophicus to perturb immune state in the gut. Exposure at the epithelium induces a strong response in which pigment cells (one type of immune cell) migrate from the ectoderm to interact with the gut epithelium. Bacteria that accumulate in the gut later invade the blastocoel, where they are cleared by phagocytic and granular immune cells. The complexity of this coordinated, dynamic inflammatory program within the simple larval morphology provides a system in which to characterize processes that direct both aspects of the echinoderm-specific immune response as well as those that are shared with other deuterostomes, including vertebrates.

  1. Preferential Ty1 retromobility in mother cells and nonquiescent stationary phase cells is associated with increased concentrations of total Gag or processed Gag and is inhibited by exposure to a high concentration of calcium.

    PubMed

    Peifer, Andrew C; Maxwell, Patrick H

    2018-03-21

    Retrotransposons are abundant mobile DNA elements in eukaryotic genomes that are more active with age in diverse species. Details of the regulation and consequences of retrotransposon activity during aging remain to be determined. Ty1 retromobility in Saccharomyces cerevisiae is more frequent in mother cells compared to daughter cells, and we found that Ty1 was more mobile in nonquiescent compared to quiescent subpopulations of stationary phase cells. This retromobility asymmetry was absent in mutant strains lacking BRP1 that have reduced expression of the essential Pma1p plasma membrane proton pump, lacking the mRNA decay gene LSM1 , and in cells exposed to a high concentration of calcium. Mother cells had higher levels of Ty1 Gag protein than daughters. The proportion of protease-processed Gag decreased as cells transitioned to stationary phase, processed Gag was the dominant form in nonquiescent cells, but was virtually absent from quiescent cells. Treatment with calcium reduced total Gag levels and the proportion of processed Gag, particularly in mother cells. We also found that Ty1 reduced the fitness of proliferating but not stationary phase cells. These findings may be relevant to understanding regulation and consequences of retrotransposons during aging in other organisms, due to conserved impacts and regulation of retrotransposons.

  2. Preferential Ty1 retromobility in mother cells and nonquiescent stationary phase cells is associated with increased concentrations of total Gag or processed Gag and is inhibited by exposure to a high concentration of calcium

    PubMed Central

    Peifer, Andrew C.

    2018-01-01

    Retrotransposons are abundant mobile DNA elements in eukaryotic genomes that are more active with age in diverse species. Details of the regulation and consequences of retrotransposon activity during aging remain to be determined. Ty1 retromobility in Saccharomyces cerevisiae is more frequent in mother cells compared to daughter cells, and we found that Ty1 was more mobile in nonquiescent compared to quiescent subpopulations of stationary phase cells. This retromobility asymmetry was absent in mutant strains lacking BRP1 that have reduced expression of the essential Pma1p plasma membrane proton pump, lacking the mRNA decay gene LSM1, and in cells exposed to a high concentration of calcium. Mother cells had higher levels of Ty1 Gag protein than daughters. The proportion of protease-processed Gag decreased as cells transitioned to stationary phase, processed Gag was the dominant form in nonquiescent cells, but was virtually absent from quiescent cells. Treatment with calcium reduced total Gag levels and the proportion of processed Gag, particularly in mother cells. We also found that Ty1 reduced the fitness of proliferating but not stationary phase cells. These findings may be relevant to understanding regulation and consequences of retrotransposons during aging in other organisms, due to conserved impacts and regulation of retrotransposons. PMID:29562219

  3. Radiation induces an antitumour immune response to mouse melanoma.

    PubMed

    Perez, Carmen A; Fu, Allie; Onishko, Halina; Hallahan, Dennis E; Geng, Ling

    2009-12-01

    Irradiation of cancer cells can cause immunogenic death. We used mouse models to determine whether irradiation of melanoma can enhance the host antitumour immune response and function as an effective vaccination strategy, and investigated the molecular mechanisms involved in this radiation-induced response. For in vivo studies, C57BL6/J mice and the B16F0 melanoma cell line were used in a lung metastasis model, intratumoural host immune activation assays, and tumour growth delay studies. In vitro studies included a dendritic cell (DC) phagocytosis assay, detection of cell surface exposure of the protein calreticulin (CRT), and small interfering RNA (siRNA)-mediated depletion of CRT cellular levels. Irradiation of cutaneous melanomas prior to their resection resulted in more than 20-fold reduction in lung metastases after systemic challenge with untreated melanoma cells. A syngeneic vaccine derived from irradiated melanoma cells also induced adaptive immune response markers in irradiated melanoma implants. Our data indicate a trend for radiation-induced increase in melanoma cell surface exposure of CRT, which is involved in the enhanced phagocytic activity of DC against irradiated melanoma cells (VIACUC). The present study suggests that neoadjuvant irradiation of cutaneous melanoma tumours prior to surgical resection can stimulate an endogenous anti-melanoma host immune response.

  4. Retinal laser burn (RLB) induced neuropathy leads to substance P dependent loss of ocular immune privilege

    PubMed Central

    Lucas, Kenyatta; Karamichos, Dimitris; Mathew, Rose; Zieske, James D.; Stein-Streilein, Joan

    2012-01-01

    Inflammation in the eye is tightly regulated by multiple mechanisms that together contribute to ocular immune privilege. Many studies have shown that it is very difficult to abrogate the immune privileged mechanism called anterior chamber associated immune deviation (ACAID). Previously, we showed that retinal laser burn (RLB) to one eye abrogated immune privilege (ACAID) bilaterally for an extended period of time. In an effort to explain the inflammation in the non-burned eye, we postulated that neuronal signals initiated inflammation in the contralateral eye. Here, we test the role of substance P, a neuroinflamatory peptide, in RLB-induced loss of ACAID. Histological examination of the retina with and without RLB revealed an increase of the substance P-inducible neurokinin 1 receptor (NK1-R) in the retina of first, the burned eye, and then the contralateral eye. Specific antagonists for NK1-R, given locally with antigen within 24h, but not 3,5, or 7 days post RLB treatment, prevented the bilateral loss of ACAID. Substance P Knockout (KO) mice retained their ability to develop ACAID post RLB. These data support the postulate that substance P transmits early inflammatory signals from the RLB eye to the contralateral eye to induce changes to ocular immune privilege and has a central role in the bilateral loss of ACAID. The possibility is raised that blocking of the substance P pathway with NK1-R antagonists post ocular trauma may prevent unwanted and perhaps extended consequences of trauma-induced inflammation in the eye. PMID:22745377

  5. Immunity in the spleen and blood of mice immunized with irradiated Toxoplasma gondii tachyzoites.

    PubMed

    Zorgi, Nahiara Esteves; Galisteo, Andrés Jimenez; Sato, Maria Notomi; do Nascimento, Nanci; de Andrade, Heitor Franco

    2016-08-01

    Toxoplasma gondii infection induces a strong and long-lasting immune response that is able to prevent most reinfections but allows tissue cysts. Irradiated, sterilized T. gondii tachyzoites are an interesting vaccine, and they induce immunity that is similar to infection, but without cysts. In this study, we evaluated the cellular immune response in the blood and spleen of mice immunized with this preparation by mouth (v.o.) or intraperitoneally (i.p.) and analyzed the protection after challenge with viable parasites. BALB/c mice were immunized with three i.p. or v.o. doses of irradiated T. gondii tachyzoites. Oral challenge with ten cysts of the ME-49 or VEG strain at 90 days after the last dose resulted in high levels of protection with low parasite burden in the immunized animals. There were higher levels of specific IgG, IgA and IgM antibodies in the serum, and the i.p. immunized mice had higher levels of the high-affinity IgG and IgM antibodies than the orally immunized mice, which had more high-affinity IgA antibodies. B cells (CD19(+)), plasma cells (CD138(+)) and the CD4(+) and CD8(+) T cell populations were increased in both the blood and spleen. Cells from the spleen of the i.p. immunized mice also showed antigen-induced production of interleukin-10 (IL-10), interferon gamma (IFN-γ) and interleukin 4 (IL-4). The CD4(+) T cells, B cells and likely CD8(+) T cells from the spleens of the i.p. immunized mice proliferated with a specific antigen. The protection was correlated with the spleen and blood CD8(+) T cell, high-affinity IgG and IgM and antigen-induced IL-10 and IL-4 production. Immunization with irradiated T. gondii tachyzoites induces an immune response that is mediated by B cells and CD4(+) and CD8(+) T cells, with increased humoral and cellular immune responses that are necessary for host protection after infection. The vaccine is similar to natural infection, but free of tissue cysts; this immunity restrains infection at challenge and can be an

  6. Stress-induced enhancement of leukocyte trafficking into sites of surgery or immune activation

    NASA Astrophysics Data System (ADS)

    Viswanathan, Kavitha; Dhabhar, Firdaus S.

    2005-04-01

    Effective immunoprotection requires rapid recruitment of leukocytes into sites of surgery, wounding, infection, or vaccination. In contrast to immunosuppressive chronic stressors, short-term acute stressors have immunoenhancing effects. Here, we quantify leukocyte infiltration within a surgical sponge to elucidate the kinetics, magnitude, subpopulation, and chemoattractant specificity of an acute stress-induced increase in leukocyte trafficking to a site of immune activation. Mice acutely stressed before sponge implantation showed 200-300% higher neutrophil, macrophage, natural killer cell, and T cell infiltration than did nonstressed animals. We also quantified the effects of acute stress on lymphotactin- (LTN; a predominantly lymphocyte-specific chemokine), and TNF-- (a proinflammatory cytokine) stimulated leukocyte infiltration. An additional stress-induced increase in infiltration was observed for neutrophils, in response to TNF-, macrophages, in response to TNF- and LTN, and natural killer cells and T cells in response to LTN. These results show that acute stress initially increases trafficking of all major leukocyte subpopulations to a site of immune activation. Tissue damage-, antigen-, or pathogen-driven chemoattractants subsequently determine which subpopulations are recruited more vigorously. Such stress-induced increases in leukocyte trafficking may enhance immunoprotection during surgery, vaccination, or infection, but may also exacerbate immunopathology during inflammatory (cardiovascular disease or gingivitis) or autoimmune (psoriasis, arthritis, or multiple sclerosis) diseases. chemokine | psychophysiological stress | surgical sponge | wound healing | lymphotactin

  7. Inducible immune proteins in the dampwood termite Zootermopsis angusticollis

    NASA Astrophysics Data System (ADS)

    Rosengaus, Rebeca B.; Cornelisse, Tara; Guschanski, Katerina; Traniello, James F. A.

    2007-01-01

    Dampwood termites, Zootermopsis angusticollis (Isoptera: Termopsidae), mount an immune response to resist microbial infection. Here we report on results of a novel analysis that allowed us to electrophoretically assess changes in hemolymph proteins in the same individual before and after exposure to a pathogen. We demonstrate that contact with a sublethal concentration of the entomopathogenic fungus Metarhizium anisopliae (Deuteromycotina:Hypomycetes) induces the production of protective proteins in nymphs, pseudergates (false workers), and soldiers. Termites exposed to an immunizing dosage of fungal conidia consistently showed an enhancement of constitutive proteins (62-85 kDa) in the hemolymph as well as an induction of novel proteins (28-48 kDa) relative to preimmunization levels. No significant differences in protein banding patterns relative to baseline levels in control and naïve termites were observed. Incubating excised and eluted induced proteins produced by immunized pseudergates or immunized soldiers with conidia significantly reduced the germination of the fungus. The fungistatic effect of eluted proteins differed significantly among five colonies examined. Our results show that the upregulation of protective proteins in the hemolymph underscores the in vivo immune response we previously recorded in Z. angusticollis.

  8. Amplifying IFN-γ Signaling in Dendritic Cells by CD11c-Specific Loss of SOCS1 Increases Innate Immunity to Infection while Decreasing Adaptive Immunity.

    PubMed

    Alice, Alejandro F; Kramer, Gwen; Bambina, Shelly; Baird, Jason R; Bahjat, Keith S; Gough, Michael J; Crittenden, Marka R

    2018-01-01

    Although prophylactic vaccines provide protective humoral immunity against infectious agents, vaccines that elicit potent CD8 T cell responses are valuable tools to shape and drive cellular immunity against cancer and intracellular infection. In particular, IFN-γ-polarized cytotoxic CD8 T cell immunity is considered optimal for protective immunity against intracellular Ags. Suppressor of cytokine signaling (SOCS)1 is a cross-functional negative regulator of TLR and cytokine receptor signaling via degradation of the receptor-signaling complex. We hypothesized that loss of SOCS1 in dendritic cells (DCs) would improve T cell responses by accentuating IFN-γ-directed immune responses. We tested this hypothesis using a recombinant Listeria monocytogenes vaccine platform that targets CD11c + DCs in mice in which SOCS1 is selectively deleted in all CD11c + cells. Unexpectedly, in mice lacking SOCS1 expression in CD11c + cells, we observed a decrease in CD8 + T cell response to the L. monocytogenes vaccine. NK cell responses were also decreased in mice lacking SOCS1 expression in CD11c + cells but did not explain the defect in CD8 + T cell immunity. We found that DCs lacking SOCS1 expression were functional in driving Ag-specific CD8 + T cell expansion in vitro but that this process was defective following infection in vivo. Instead, monocyte-derived innate TNF-α and inducible NO synthase-producing DCs dominated the antibacterial response. Thus, loss of SOCS1 in CD11c + cells skewed the balance of immune response to infection by increasing innate responses while decreasing Ag-specific adaptive responses to infectious Ags. Copyright © 2017 by The American Association of Immunologists, Inc.

  9. Blocking antibodies induced by immunization with a hypoallergenic parvalbumin mutant reduce allergic symptoms in a mouse model of fish allergy

    PubMed Central

    Freidl, Raphaela; Gstoettner, Antonia; Baranyi, Ulrike; Swoboda, Ines; Stolz, Frank; Focke-Tejkl, Margarete; Wekerle, Thomas; van Ree, Ronald; Valenta, Rudolf; Linhart, Birgit

    2017-01-01

    Background Fish is a frequent elicitor of severe IgE-mediated allergic reactions. Beside avoidance, there is currently no allergen-specific therapy available. Hypoallergenic variants of the major fish allergen, parvalbumin, for specific immunotherapy based on mutation of the 2 calcium-binding sites have been developed. Objectives This study sought to establish a mouse model of fish allergy resembling human disease and to investigate whether mouse and rabbit IgG antibodies induced by immunization with a hypoallergenic mutant of the major carp allergen protect against allergic symptoms in sensitized mice. Methods C3H/HeJ mice were sensitized with recombinant wildtype Cyp c 1 or carp extract by intragastric gavage. Antibody, cellular immune responses, and epitope specificity in sensitized mice were investigated by ELISA, rat basophil leukemia assay, T-cell proliferation experiments using recombinant wildtype Cyp c 1, and overlapping peptides spanning the Cyp c 1 sequence. Anti-hypoallergenic Cyp c 1 mutant mouse and rabbit sera were tested for their ability to inhibit IgE recognition of Cyp c 1, Cyp c 1–specific basophil degranulation, and Cyp c 1–induced allergic symptoms in the mouse model. Results A mouse model of fish allergy mimicking human disease regarding IgE epitope recognition and symptoms as close as possible was established. Administration of antisera generated in mice and rabbits by immunization with a hypoallergenic Cyp c 1 mutant inhibited IgE binding to Cyp c 1, Cyp c 1–induced basophil degranulation, and allergic symptoms caused by allergen challenge in sensitized mice. Conclusions Antibodies induced by immunization with a hypoallergenic Cyp c 1 mutant protect against allergic reactions in a murine model of fish allergy. PMID:27876628

  10. Blocking antibodies induced by immunization with a hypoallergenic parvalbumin mutant reduce allergic symptoms in a mouse model of fish allergy.

    PubMed

    Freidl, Raphaela; Gstoettner, Antonia; Baranyi, Ulrike; Swoboda, Ines; Stolz, Frank; Focke-Tejkl, Margarete; Wekerle, Thomas; van Ree, Ronald; Valenta, Rudolf; Linhart, Birgit

    2017-06-01

    Fish is a frequent elicitor of severe IgE-mediated allergic reactions. Beside avoidance, there is currently no allergen-specific therapy available. Hypoallergenic variants of the major fish allergen, parvalbumin, for specific immunotherapy based on mutation of the 2 calcium-binding sites have been developed. This study sought to establish a mouse model of fish allergy resembling human disease and to investigate whether mouse and rabbit IgG antibodies induced by immunization with a hypoallergenic mutant of the major carp allergen protect against allergic symptoms in sensitized mice. C3H/HeJ mice were sensitized with recombinant wildtype Cyp c 1 or carp extract by intragastric gavage. Antibody, cellular immune responses, and epitope specificity in sensitized mice were investigated by ELISA, rat basophil leukemia assay, T-cell proliferation experiments using recombinant wildtype Cyp c 1, and overlapping peptides spanning the Cyp c 1 sequence. Anti-hypoallergenic Cyp c 1 mutant mouse and rabbit sera were tested for their ability to inhibit IgE recognition of Cyp c 1, Cyp c 1-specific basophil degranulation, and Cyp c 1-induced allergic symptoms in the mouse model. A mouse model of fish allergy mimicking human disease regarding IgE epitope recognition and symptoms as close as possible was established. Administration of antisera generated in mice and rabbits by immunization with a hypoallergenic Cyp c 1 mutant inhibited IgE binding to Cyp c 1, Cyp c 1-induced basophil degranulation, and allergic symptoms caused by allergen challenge in sensitized mice. Antibodies induced by immunization with a hypoallergenic Cyp c 1 mutant protect against allergic reactions in a murine model of fish allergy. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  11. Administration of sulfosuccinimidyl-4-[N-maleimidomethyl] cyclohexane-1-carboxylate conjugated GP100{sub 25–33} peptide-coupled spleen cells effectively mounts antigen-specific immune response against mouse melanoma

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chang, Xiaoli; Xia, Chang-Qing, E-mail: cqx65@yahoo.com; Department of Pathology, Immunology and Laboratory Medicine, University of Florida, Gainesville, FL32610

    It remains a top research priority to develop immunotherapeutic approaches to induce potent antigen-specific immune responses against tumors. However, in spite of some promising results, most strategies are ineffective because they generate low numbers of tumor-reactive cytotoxic T lymphocytes (CTLs). Here we designed a strategy to enhance antigen-specific immune response via administering sulfosuccinimidyl-4-[N-maleimidomethyl] cyclohexane-1-carboxylate (sulfo-SMCC)-conjugated melanoma tumor antigen GP100{sub 25–33} peptide-coupled syngeneic spleen cells in a mouse model of melanoma. We found that infusion of GP100{sub 25–33} peptide-coupled spleen cells significantly attenuated the growth of melanoma in prophylactic and therapeutic immunizations. Consistent with these findings, the adoptive transfer of spleenmore » cells from immunized mice to naïve syngeneic mice was able to transfer anti-tumor effect, suggesting that GP100{sub 25–33} peptide-specific immune response was induced. Further studies showed that, CD8+ T cell proliferation and the frequency of interferon (IFN)-γ-producing CD8+ T cells upon ex vivo stimulation by GP100{sub 25–33} were significantly increased compared to control groups. Tumor antigen, GP100{sub 25–23} specific immune response was also confirmed by ELISpot and GP100-tetramer assays. This approach is simple, easy-handled, and efficiently delivering antigens to lymphoid tissues. Our study offers an opportunity for clinically translating this approach into tumor immunotherapy. - Highlights: • Infusion of GP100{sub 25–33}-coupled spleen cells leads to potent anti-melanoma immunity. • GP100{sub 25–33}-coupled spleen cell treatment induces antigen-specific IFN-γ-producing CD8 T cells. • This approach takes advantage of homing nature of immune cells.« less

  12. Pulmonary arterial remodeling induced by a Th2 immune response

    PubMed Central

    Daley, Eleen; Emson, Claire; Guignabert, Christophe; de Waal Malefyt, Rene; Louten, Jennifer; Kurup, Viswanath P.; Hogaboam, Cory; Taraseviciene-Stewart, Laimute; Voelkel, Norbert F.; Rabinovitch, Marlene; Grunig, Ekkehard; Grunig, Gabriele

    2008-01-01

    Pulmonary arterial remodeling characterized by increased vascular smooth muscle density is a common lesion seen in pulmonary arterial hypertension (PAH), a deadly condition. Clinical correlation studies have suggested an immune pathogenesis of pulmonary arterial remodeling, but experimental proof has been lacking. We show that immunization and prolonged intermittent challenge via the airways with either of two different soluble antigens induced severe muscularization in small- to medium-sized pulmonary arteries. Depletion of CD4+ T cells, antigen-specific T helper type 2 (Th2) response, or the pathogenic Th2 cytokine interleukin 13 significantly ameliorated pulmonary arterial muscularization. The severity of pulmonary arterial muscularization was associated with increased numbers of epithelial cells and macrophages that expressed a smooth muscle cell mitogen, resistin-like molecule α, but surprisingly, there was no correlation with pulmonary hypertension. Our data are the first to provide experimental proof that the adaptive immune response to a soluble antigen is sufficient to cause severe pulmonary arterial muscularization, and support the clinical observations in pediatric patients and in companion animals that muscularization represents one of several injurious events to the pulmonary artery that may collectively contribute to PAH. PMID:18227220

  13. The Skin Microbiome: Is It Affected by UV-induced Immune Suppression?

    PubMed Central

    Patra, VijayKumar; Byrne, Scott N.; Wolf, Peter

    2016-01-01

    Human skin apart from functioning as a physical barricade to stop the entry of pathogens, also hosts innumerable commensal organisms. The skin cells and the immune system constantly interact with microbes, to maintain cutaneous homeostasis, despite the challenges offered by various environmental factors. A major environmental factor affecting the skin is ultraviolet radiation (UV-R) from sunlight. UV-R is well known to modulate the immune system, which can be both beneficial and deleterious. By targeting the cells and molecules within skin, UV-R can trigger the production and release of antimicrobial peptides, affect the innate immune system and ultimately suppress the adaptive cellular immune response. This can contribute to skin carcinogenesis and the promotion of infectious agents such as herpes simplex virus and possibly others. On the other hand, a UV-established immunosuppressive environment may protect against the induction of immunologically mediated skin diseases including some of photodermatoses such as polymorphic light eruption. In this article, we share our perspective about the possibility that UV-induced immune suppression may alter the landscape of the skin’s microbiome and its components. Alternatively, or in concert with this, direct UV-induced DNA and membrane damage to the microbiome may result in pathogen associated molecular patterns (PAMPs) that interfere with UV-induced immune suppression. PMID:27559331

  14. Link-N: The missing link towards intervertebral disc repair is species-specific

    PubMed Central

    Bach, Frances C.; Laagland, Lisanne T.; Grant, Michael P.; Creemers, Laura B.; Ito, Keita; Meij, Björn P.; Mwale, Fackson

    2017-01-01

    Introduction Degeneration of the intervertebral disc (IVD) is a frequent cause for back pain in humans and dogs. Link-N stabilizes proteoglycan aggregates in cartilaginous tissues and exerts growth factor-like effects. The human variant of Link-N facilitates IVD regeneration in several species in vitro by inducing Smad1 signaling, but it is not clear whether this is species specific. Dogs with IVD disease could possibly benefit from Link-N treatment, but Link-N has not been tested on canine IVD cells. If Link-N appears to be effective in canines, this would facilitate translation of Link-N into the clinic using the dog as an in vivo large animal model for human IVD degeneration. Materials and methods This study’s objective was to determine the effect of the human and canine variant of Link-N and short (s) Link-N on canine chondrocyte-like cells (CLCs) and compare this to those on already studied species, i.e. human and bovine CLCs. Extracellular matrix (ECM) production was determined by measuring glycosaminoglycan (GAG) content and histological evaluation. Additionally, the micro-aggregates’ DNA content was measured. Phosphorylated (p) Smad1 and -2 levels were determined using ELISA. Results Human (s)Link-N induced GAG deposition in human and bovine CLCs, as expected. In contrast, canine (s)Link-N did not affect ECM production in human CLCs, while it mainly induced collagen type I and II deposition in bovine CLCs. In canine CLCs, both canine and human (s)Link-N induced negligible GAG deposition. Surprisingly, human and canine (s)Link-N did not induce Smad signaling in human and bovine CLCs. Human and canine (s)Link-N only mildly increased pSmad1 and Smad2 levels in canine CLCs. Conclusions Human and canine (s)Link-N exerted species-specific effects on CLCs from early degenerated IVDs. Both variants, however, lacked the potency as canine IVD regeneration agent. While these studies demonstrate the challenges of translational studies in large animal models, (s

  15. Link-N: The missing link towards intervertebral disc repair is species-specific.

    PubMed

    Bach, Frances C; Laagland, Lisanne T; Grant, Michael P; Creemers, Laura B; Ito, Keita; Meij, Björn P; Mwale, Fackson; Tryfonidou, Marianna A

    2017-01-01

    Degeneration of the intervertebral disc (IVD) is a frequent cause for back pain in humans and dogs. Link-N stabilizes proteoglycan aggregates in cartilaginous tissues and exerts growth factor-like effects. The human variant of Link-N facilitates IVD regeneration in several species in vitro by inducing Smad1 signaling, but it is not clear whether this is species specific. Dogs with IVD disease could possibly benefit from Link-N treatment, but Link-N has not been tested on canine IVD cells. If Link-N appears to be effective in canines, this would facilitate translation of Link-N into the clinic using the dog as an in vivo large animal model for human IVD degeneration. This study's objective was to determine the effect of the human and canine variant of Link-N and short (s) Link-N on canine chondrocyte-like cells (CLCs) and compare this to those on already studied species, i.e. human and bovine CLCs. Extracellular matrix (ECM) production was determined by measuring glycosaminoglycan (GAG) content and histological evaluation. Additionally, the micro-aggregates' DNA content was measured. Phosphorylated (p) Smad1 and -2 levels were determined using ELISA. Human (s)Link-N induced GAG deposition in human and bovine CLCs, as expected. In contrast, canine (s)Link-N did not affect ECM production in human CLCs, while it mainly induced collagen type I and II deposition in bovine CLCs. In canine CLCs, both canine and human (s)Link-N induced negligible GAG deposition. Surprisingly, human and canine (s)Link-N did not induce Smad signaling in human and bovine CLCs. Human and canine (s)Link-N only mildly increased pSmad1 and Smad2 levels in canine CLCs. Human and canine (s)Link-N exerted species-specific effects on CLCs from early degenerated IVDs. Both variants, however, lacked the potency as canine IVD regeneration agent. While these studies demonstrate the challenges of translational studies in large animal models, (s)Link-N still holds a regenerative potential for humans.

  16. Acid glycosaminoglycan (aGAG) excretion is increased in children with autism spectrum disorder, and it can be controlled by diet.

    PubMed

    Endreffy, Ildikó; Bjørklund, Geir; Dicső, Ferenc; Urbina, Mauricio A; Endreffy, Emőke

    2016-04-01

    Autism research continues to receive considerable attention as the options for successful management are limited. The understanding of the autism spectrum disorder (ASD) etiology has now progressed to encompass genetic, epigenetic, neurological, hormonal, and environmental factors that affect outcomes for patients with ASD. Glycosaminoglycans (GAGs) are a family of linear, sulfated polysaccharides that are associated with central nervous system (CNS) development, maintenance, and disorders. Proteoglycans (PG) regulate diverse functions in the central nervous system. Heparan sulfate (HS) and chondroitin sulfate (CS) are two major GAGs present in the PGs of the CNS. As neuroscience advances, biochemical treatments to correct brain chemistry become better defined. Nutrient therapy can be very potent and has minimal to no side effects, since no molecules foreign to the body are needed. Given GAGs are involved in several neurological functions, and that its level can be somewhat modulated by the diet, the present study aimed to evaluate the role of GAGs levels in ASD symptoms. Both tGAG and its different fractions were evaluated in the urine of ASD and healthy control childrens. As levels differed between groups, a second trial was conduted evaluating if diet could reduce tGAG levels and if this in turn decrease ASD symptoms. The present study found that tGAG concentration was significantly higher in the urine of children with ASD compared to healthy control children and this was also evident in all GAG fractions. Within groups (controls and ASD), no gender differences in GAG excretion were found. The use of a 90 days elimination diet (casein-free, special carbohydrates, multivitamin/mineral supplement), had major effects in reducing urinary tGAG excretion in children with ASD.

  17. Partial Diversity Generates Effector Immunity Specificity of the Bac41-Like Bacteriocins of Enterococcus faecalis Clinical Strains.

    PubMed

    Kurushima, Jun; Ike, Yasuyoshi; Tomita, Haruyoshi

    2016-09-01

    Bacteriocin 41 (Bac41) is the plasmid-encoded bacteriocin produced by the opportunistic pathogen Enterococcus faecalis Its genetic determinant consists of bacL1 (effector), bacL2 (regulator), bacA (effector), and bacI (immunity). The secreted effectors BacL1 and BacA coordinate to induce the lytic cell death of E. faecalis Meanwhile, the immunity factor BacI provides self-resistance to the Bac41 producer, E. faecalis, against the action of BacL1 and BacA. In this study, we demonstrated that more than half of the 327 clinical strains of E. faecalis screened had functional Bac41 genes. Analysis of the genetic structure of the Bac41 genes in the DNA sequences of the E. faecalis strains revealed that the Bac41-like genes consist of a relatively conserved region and a variable region located downstream from bacA Based on similarities in the variable region, the Bac41-like genes could be classified into type I, type IIa, and type IIb. Interestingly, the distinct Bac41 types had specific immunity factors for self-resistance, BacI1 or BacI2, and did not show cross-immunity to the other type of effector. We also demonstrated experimentally that the specificity of the immunity was determined by the combination of the C-terminal region of BacA and the presence of the unique BacI1 or BacI2 factor. These observations suggested that Bac41-like bacteriocin genes are extensively disseminated among E. faecalis strains in the clinical environment and can be grouped into at least three types. It was also indicated that the partial diversity results in specificity of self-resistance which may offer these strains a competitive advantage. Bacteriocins are antibacterial effectors produced by bacteria. In general, a bacteriocin-coding gene is accompanied by a cognate immunity gene that confers self-resistance on the bacteriocin-producing bacterium itself. We demonstrated that one of the bacteriocins, Bac41, is disseminated among E. faecalis clinical strains and the Bac41 subtypes with

  18. Atomic features of an autoantigen in heparin-induced thrombocytopenia (HIT).

    PubMed

    Cai, Zheng; Zhu, Zhiqiang; Greene, Mark I; Cines, Douglas B

    2016-07-01

    Autoantigen development is poorly understood at the atomic level. Heparin-induced thrombocytopenia (HIT) is an autoimmune thrombotic disorder caused by antibodies to an antigen composed of platelet factor 4 (PF4) and heparin or cellular glycosaminoglycans (GAGs). In solution, PF4 exists as an equilibrium among monomers, dimers and tetramers. Structural studies of these interacting components helped delineate a multi-step process involved in the pathogenesis of HIT. First, heparin binds to the 'closed' end of the PF4 tetramer and stabilizes its conformation; exposing the 'open' end. Second, PF4 arrays along heparin/GAG chains, which approximate tetramers, form large antigenic complexes that enhance antibody avidity. Third, pathogenic HIT antibodies bind to the 'open' end of stabilized PF4 tetramers to form an IgG/PF4/heparin ternary immune complex and also to propagate the formation of 'ultralarge immune complexes' (ULCs) that contain multiple IgG antibodies. Fourth, ULCs signal through FcγRIIA receptors, activating platelets and monocytes directly and generating thrombin, which transactivates hematopoietic and endothelial cells. A non-pathogenic anti-PF4 antibody prevents tetramer formation, binding of pathogenic antibody, platelet activation and thrombosis, providing a new approach to manage HIT. An improved understanding of the pathogenesis of HIT may lead to novel diagnostics and therapeutics for this autoimmune disease. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. [Protective immunity against Mycobacterium tuberculosis].

    PubMed

    Kawamura, Ikuo

    2006-11-01

    Mycobacterium tuberculosis (MTB) is a facultative intracellular pathogen with which over a billion people have been infected and 3 million people die annually. The bacterium induces vigorous immune responses, yet evades host immunity, persisting within phagosomes of the infected macrophages. Thus, it is necessary to delineate that the virulence-related intracellular survival mechanism and the host immune responses to eradicate M. tuberculosis on the molecular basis. In this regard, recent findings clearly indicated that Toll-like receptors (TLRs) play an essential role in the recognition of MTB components by macrophages and dendritic cells, resulting in not only activation of innate immunity but also development of antigen-specific adaptive immunity. It has been also reported that induction of early death of the infected cells may be one of the strategy of host defense against MTB because macrophages go into apoptosis upon infection with MTB, resulting in suppression of the intracellular replication. Furthermore, recent report has shown that autophagy is induced by IFN-gamma and suppress intracellular survival of mycobacteria, suggesting that activation of autophagy pathway is required to overcome phagosome maturation arrest induced by MTB. In addition, it is known that IFN-gamma plays an important role in protection. The cytokine that is produced from NK cells and dendritic cells at the early period of infection strongly induces not only macrophage activation but also development of antigen-specific IFN-gamma-producing CD4+T cells. Since antigen-specific CD8+ T cells and CD1-restricted T cells are also reported to contribute to the protective immunity, cooperation of these T cells is essential for the host resistance. In this paper, I am going to summarize the recent progress of the understanding of protective immunity against MTB.

  20. Virus-like particles displaying H5, H7, H9 hemagglutinins and N1 neuraminidase elicit protective immunity to heterologous avian influenza viruses in chickens

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pushko, Peter, E-mail: ppushko@medigen-usa.com

    Avian influenza (AI) viruses circulating in wild birds pose a serious threat to public health. Human and veterinary vaccines against AI subtypes are needed. Here we prepared triple-subtype VLPs that co-localized H5, H7 and H9 antigens derived from H5N1, H7N3 and H9N2 viruses. VLPs also contained influenza N1 neuraminidase and retroviral gag protein. The H5/H7/H9/N1/gag VLPs were prepared using baculovirus expression. Biochemical, functional and antigenic characteristics were determined including hemagglutination and neuraminidase enzyme activities. VLPs were further evaluated in a chicken AI challenge model for safety, immunogenicity and protective efficacy against heterologous AI viruses including H5N2, H7N3 and H9N2 subtypes.more » All vaccinated birds survived challenges with H5N2 and H7N3 highly pathogenic AI (HPAI) viruses, while all controls died. Immune response was also detectable after challenge with low pathogenicity AI (LPAI) H9N2 virus suggesting that H5/H7/H9/N1/gag VLPs represent a promising approach for the development of broadly protective AI vaccine. - Highlights: •VLPs were prepared that co-localized H5, H7 and H9 subtypes in a VLP envelope. •VLPs were characterized including electron microscopy, HA assay and NA enzyme activity. •Experimental VLP vaccine was evaluated in an avian influenza challenge model. •VLPs induced immune responses against heterologous H5, H7 and H9 virus challenges.« less

  1. Safety and immunogenicity of a live recombinant canarypox virus expressing HIV type 1 gp120 MN MN tm/gag/protease LAI (ALVAC-HIV, vCP205) followed by a p24E-V3 MN synthetic peptide (CLTB-36) administered in healthy volunteers at low risk for HIV infection. AGIS Group and L'Agence Nationale de Recherches sur Le Sida.

    PubMed

    Salmon-Céron, D; Excler, J L; Finkielsztejn, L; Autran, B; Gluckman, J C; Sicard, D; Matthews, T J; Meignier, B; Valentin, C; El Habib, R; Blondeau, C; Raux, M; Moog, C; Tartaglia, J; Chong, P; Klein, M; Milcamps, B; Heshmati, F; Plotkin, S

    1999-05-01

    A live recombinant canarypox vector expressing HIV-1 gpl20 MN tm/gag/protease LAI (ALVAC-HIV, vCP205) alone or boosted by a p24E-V3 MN synthetic peptide (CLTB-36) was tested in healthy volunteers at low risk for HIV infection for their safety and immunogenicity. Both antigens were well tolerated. ALVAC-HIV (vCP205) induced low levels of neutralizing antibodies against HIV-1 MN in 33% of the volunteers. None of them had detectable neutralizing antibodies against a nonsyncytium-inducing HIV-1 clade B primary isolate (Bx08). After the fourth injection of vCP205, CTL activity was detected in 33% of the volunteers and was directed against Env, Gag, and Pol. This activity was mediated by both CD4+ and CD8+ lymphocytes. On the other hand, the CLTB-36 peptide was poorly immunogenic and induced no neutralizing antibodies or CTLs. Although the ALVAC-HIV (vCP205) and CLTB-36 prime-boost regimen was not optimal, further studies with ALVAC-HIV (vCP205) are warranted because of its clear induction of a cellular immune response and utility as a priming agent for other subunit antigens such as envelope glycoproteins, pseudoparticles, or new peptides.

  2. Whole-Killed Blood-Stage Vaccine-Induced Immunity Suppresses the Development of Malaria Parasites in Mosquitoes.

    PubMed

    Zhu, Feng; Liu, Taiping; Zhao, Chenhao; Lu, Xiao; Zhang, Jian; Xu, Wenyue

    2017-01-01

    As a malaria transmission-blocking vaccine alone does not confer a direct benefit to the recipient, it is necessary to develop a vaccine that not only blocks malaria transmission but also protects vaccinated individuals. In this study we observed that a whole-killed blood-stage vaccine (WKV) not only conferred protection against the blood-stage challenge but also markedly inhibited the transmission of different strains of the malaria parasite. Although the parasitemia is much lower in WKV-immunized mice challenged with malaria parasites, the gametocytemia is comparable between control and immunized mice during the early stages of infection. The depletion of CD4 + T cells prior to the adoptive transfer of parasites into WKV-immunized mice has no effect on the development of the malaria parasite in the mosquito, but the adoptive transfer of the serum from the immunized mice into the parasite-inoculated mice remarkably suppresses the development of malaria parasites in mosquitoes. Furthermore, immunized mice challenged with the malaria parasite generate higher levels of parasite-specific Abs and the inflammatory cytokines MCP-1 and IFN-γ. However, the adoptive transfer of parasite-specific IgG or the depletion of MCP-1, but not IFN-γ, to some extent is closely associated with the suppression of malaria parasite development in mosquitoes. These data strongly suggest that WKV-induced immune responses confer protection against the mosquito stage, which is largely dependent on malaria parasite-specific Abs and MCP-1. This finding sheds new light on blocking malaria transmission through the immunization of individuals with the WKV. Copyright © 2016 by The American Association of Immunologists, Inc.

  3. Maturation of the Gag core decreases the stability of retroviral lipid membranes.

    PubMed

    Davidoff, Candice; Payne, Riley J; Willis, Sharon H; Doranz, Benjamin J; Rucker, Joseph B

    2012-11-25

    To better understand how detergents disrupt enveloped viruses, we monitored the biophysical stability of murine leukemia virus (MLV) virus-like particles (VLPs) against a panel of commonly used detergents using real-time biosensor measurements. Although exposure to many detergents, such as Triton X-100 and Empigen, results in lysis of VLP membranes, VLPs appeared resistant to complete membrane lysis by a significant number of detergents, including Tween 20, Tween 80, Lubrol, and Saponin. VLPs maintained their structural integrity after exposure to Tween 20 at concentrations up to 500-fold above its CMC. Remarkably, VLPs containing immature cores composed of unprocessed (uncleaved) Gag polyprotein were significantly more resistant to detergent lysis than VLPs with mature cores. Although the maturity of retroviral Gag is known to influence the stability of the protein core structure itself, our studies suggest that the maturity of the Gag core also influences the stability of the lipid bilayer surrounding the core. Copyright © 2012 Elsevier Inc. All rights reserved.

  4. Maturation of the Gag core decreases the stability of retroviral lipid membranes

    PubMed Central

    Davidoff, Candice; Payne, Riley; Willis, Sharon H.; Doranz, Benjamin J.; Rucker, Joseph B.

    2012-01-01

    To better understand how detergents disrupt enveloped viruses, we monitored the biophysical stability of murine leukemia virus (MLV) virus-like particles (VLPs) against a panel of commonly used detergents using real-time biosensor measurements. Although exposure to many detergents, such as Triton X-100 and Empigen, results in lysis of VLP membranes, VLPs appeared resistant to complete membrane lysis by a significant number of detergents, including Tween 20, Tween 80, Lubrol, and Saponin. VLPs maintained their structural integrity after exposure to Tween 20 at concentrations up to 500-fold above its CMC. Remarkably, VLPs containing immature cores composed of unprocessed (uncleaved) Gag polyprotein were significantly more resistant to detergent lysis than VLPs with mature cores. Although the maturity of retroviral Gag is known to influence the stability of the protein core structure itself, our studies suggest that the maturity of the Gag core also influences the stability of the lipid bilayer surrounding the core. PMID:22995186

  5. Treatment with proteasome inhibitor bortezomib enhances antigen-specific CD8+ T cell-mediated antitumor immunity induced by DNA vaccination

    PubMed Central

    Tseng, Chih Wen; Monie, Archana; Wu, Chao-Yi; Huang, Bruce; Wang, Mei-Cheng; Hung, Chien-Fu; Wu, T.-C.

    2008-01-01

    There is an urgent need to develop new innovative therapies for the control of cancer. Antigen-specific immunotherapy and the employment of proteasome inhibitors have emerged as two potentially plausible approaches for the control of cancer. In the current study, we explored the combination of the DNA vaccine encoding calreticulin (CRT) linked to human papillomavirus type 16 (HPV-16) E7 antigen (CRT/E7) with the proteasome inhibitor; bortezomib for their ability to generate E7-specific immune responses and antitumor effects in vaccinated mice. We found that the combination of treatment with bortezomib and CRT/E7(detox) DNA generated more potent E7-specific CD8+ T cell immune responses and better therapeutic effects against TC-1 tumors in tumor bearing mice compared to monotherapy. Furthermore, we found that treatment with bortezomib led to increased apoptosis of TC-1 tumor cells and could render the TC-1 tumor cells more susceptible to lysis by E7-specific CTLs. Our data has significant implications for future clinical translation. PMID:18542898

  6. Influenza Virus-Like Particles Containing M2 Induce Broadly Cross Protective Immunity

    PubMed Central

    Song, Jae-Min; Wang, Bao-Zhong; Park, Kyoung-Mi; Van Rooijen, Nico; Quan, Fu-Shi; Kim, Min-Chul; Jin, Hyun-Tak; Pekosz, Andrew; Compans, Richard W.; Kang, Sang-Moo

    2011-01-01

    Background Current influenza vaccines based on the hemagglutinin protein are strain specific and do not provide good protection against drifted viruses or emergence of new pandemic strains. An influenza vaccine that can confer cross-protection against antigenically different influenza A strains is highly desirable for improving public health. Methodology/Principal Findings To develop a cross protective vaccine, we generated influenza virus-like particles containing the highly conserved M2 protein in a membrane-anchored form (M2 VLPs), and investigated their immunogenicity and breadth of cross protection. Immunization of mice with M2 VLPs induced anti-M2 antibodies binding to virions of various strains, M2 specific T cell responses, and conferred long-lasting cross protection against heterologous and heterosubtypic influenza viruses. M2 immune sera were found to play an important role in providing cross protection against heterosubtypic virus and an antigenically distinct 2009 pandemic H1N1 virus, and depletion of dendritic and macrophage cells abolished this cross protection, providing new insight into cross-protective immune mechanisms. Conclusions/Significance These results suggest that presenting M2 on VLPs in a membrane-anchored form is a promising approach for developing broadly cross protective influenza vaccines. PMID:21267073

  7. The Impact of Gut Microbiota on Gender-Specific Differences in Immunity

    PubMed Central

    Fransen, Floris; van Beek, Adriaan A.; Borghuis, Theo; Meijer, Ben; Hugenholtz, Floor; van der Gaast-de Jongh, Christa; Savelkoul, Huub F.; de Jonge, Marien I.; Faas, Marijke M.; Boekschoten, Mark V.; Smidt, Hauke; El Aidy, Sahar; de Vos, Paul

    2017-01-01

    Males and females are known to have gender-specific differences in their immune system and gut microbiota composition. Whether these differences in gut microbiota composition are a cause or consequence of differences in the immune system is not known. To investigate this issue, gut microbiota from conventional males or females was transferred to germ-free (GF) animals of the same or opposing gender. We demonstrate that microbiota-independent gender differences in immunity are already present in GF mice. In particular, type I interferon signaling was enhanced in the intestine of GF females. Presumably, due to these immune differences bacterial groups, such as Alistipes, Rikenella, and Porphyromonadaceae, known to expand in the absence of innate immune defense mechanism were overrepresented in the male microbiota. The presence of these bacterial groups was associated with induction of weight loss, inflammation, and DNA damage upon transfer of the male microbiota to female GF recipients. In summary, our data suggest that microbiota-independent gender differences in the immune system select a gender-specific gut microbiota composition, which in turn further contributes to gender differences in the immune system. PMID:28713378

  8. Long-lived tissue resident HIV-1 specific memory CD8+ T cells are generated by skin immunization with live virus vectored microneedle arrays.

    PubMed

    Zaric, Marija; Becker, Pablo Daniel; Hervouet, Catherine; Kalcheva, Petya; Ibarzo Yus, Barbara; Cocita, Clement; O'Neill, Lauren Alexandra; Kwon, Sung-Yun; Klavinskis, Linda Sylvia

    2017-12-28

    The generation of tissue resident memory (T RM ) cells at the body surfaces to provide a front line defence against invading pathogens represents an important goal in vaccine development for a wide variety of pathogens. It has been widely assumed that local vaccine delivery to the mucosae is necessary to achieve that aim. Here we characterise a novel micro-needle array (MA) delivery system fabricated to deliver a live recombinant human adenovirus type 5 vaccine vector (AdHu5) encoding HIV-1 gag. We demonstrate rapid dissolution kinetics of the microneedles in skin. Moreover, a consequence of MA vaccine cargo release was the generation of long-lived antigen-specific CD8 + T cells that accumulate in mucosal tissues, including the female genital and respiratory tract. The memory CD8 + T cell population maintained in the peripheral mucosal tissues was attributable to a MA delivered AdHu5 vaccine instructing CD8 + T cell expression of CXCR3 + , CD103 +, CD49a + , CD69 + , CD127 + homing, retention and survival markers. Furthermore, memory CD8 + T cells generated by MA immunization significantly expanded upon locally administered antigenic challenge and showed a predominant poly-functional profile producing high levels of IFNγ and Granzyme B. These data demonstrate that skin vaccine delivery using microneedle technology induces mobilization of long lived, poly-functional CD8 + T cells to peripheral tissues, phenotypically displaying hallmarks of residency and yields new insights into how to design and deliver effective vaccine candidates with properties to exert local immunosurveillance at the mucosal surfaces. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  9. The sickle-cell trait modifies the intensity and specificity of the immune response against P. falciparum malaria and leads to acquired protective immunity.

    PubMed

    Bayoumi, R A

    1987-03-01

    It is proposed that the in vivo mechanism of protection against falciparum malaria in individuals of the Hb AS genotype is not due solely to the adverse influence of Hb AS erythrocytes on the intraerythrocytic growth and development of P. falciparum. Instead, the simple physiological effect of Hb S on parasite growth appears to trigger an in vivo process of enhancement of the intensity and/or specificity of the host immune response, leading to acquired protective immunity, in a process simulating vaccination. Testing the hypothesis may lead to the identification of plasmodial antigens that induce protective responses in the human host and distinguish them from non-protective, immunosuppressive or decoy antigens that promote parasite survival. This may ultimately help in the selection of candidate antigens for a malaria blood-stage vaccine.

  10. Mechanistic studies of systemic immune responses induced by laser-nanotechnology

    NASA Astrophysics Data System (ADS)

    Chen, Wei R.; Zhou, Feifan; Henderson, Brock; Vasquez, Bailey; Liu, Hong; Hode, Tomas; Nordquist, Robert E.

    2014-02-01

    With the help of the specific absorption spectrum of carbon nanotubes, we achieved selective photothermal tumor cell destruction, particularly using a near-infrared laser to reduce potential damage to untargeted tissues. Combined with immunological stimulation, using a novel adjuvant, we also observed the anti-tumor immune responses when treating animal tumors using the laser-nano treatment. In fact, the local application of laser-nano-immunotherapy appeared to result in a systemic curative effect. In our mechanistic study, we found that the laser-nano-immuno treatment can activate antigen-presenting cells, such as dendritic cells (DCs). More importantly, the uptake and presentation of antigens by these antigen presenting cells were significantly enhanced, as shown by the strong binding of tumor cells and DCs as well as the proliferation of T cells caused by the DCs after the DCs had been incubated with laser-nano-immuno treated tumors. These cellular observations provide evidence that a systemic anti-tumor immune response was induced by the combination of laser and nanotechnology.

  11. Relationship of HIV Reservoir Characteristics with Immune Status and Viral Rebound Kinetics in an HIV Therapeutic Vaccine Study

    PubMed Central

    Li, Jonathan Z.; Heisey, Andrea; Ahmed, Hayat; Wang, Hongying; Zheng, Lu; Carrington, Mary; Wrin, Terri; Schooley, Robert T.; Lederman, Michael M.; Kuritzkes, Daniel R.

    2014-01-01

    Objectives To evaluate the impact of therapeutic HIV vaccination on the HIV reservoir, and assess the relationship of the viral reservoir with HIV-specific immune status and viral rebound kinetics. Design Retrospective analysis of ACTG A5197, a randomized, placebo-controlled trial of a therapeutic rAd5 HIV-1 gag vaccine. Methods Participants received vaccine/placebo at weeks 0, 4, and 26 prior to a 16-week analytic treatment interruption (ATI) at week 38. Cell-associated HIV-1 RNA and DNA (CA-RNA and CA-DNA) and HIV-1 residual viremia (RV) were quantified at weeks 0, 8, and 38. HIV-specific CD4+/CD8+ activity were assessed by an intracellular cytokine staining assay. Results At study entry, CA-RNA and CA-DNA levels were correlated inversely with the numbers of HIV-specific CD4+ interferon-γ-producing cells (CA-RNA: r = −0.23, P=0.03 and CA-DNA: r = −0.28, P<0.01, N=93). Therapeutic HIV vaccination induced HIV-specific CD4+ activity, but did not significantly affect levels of CA-RNA or CA-DNA. Vaccine recipients with undetectable RV at week 8 had higher frequencies of HIV-specific CD4+ and CD8+ interferon-γ-producing cells (undetectable versus detectable RV: 277 versus 161 CD4+ cells/106 lymphocytes, P=0.03 and 1326 versus 669 CD8+ cells/106 lymphocytes, P=0.04). Pre-ATI CA-RNA and CA-DNA were associated with post-ATI plasma HIV set point (CA-RNA: r = 0.51, P<0.01 and CA-DNA: r = 0.47, P<0.01). Conclusions Vaccine-induced T-cell responses were associated with a modest transient effect on RV, but more potent immune responses and/or combination treatment with latency-reversing agents are needed to reduce the HIV reservoir. HIV reservoir measures may act as biomarkers of post-ATI viral rebound kinetics. PMID:25254301

  12. The Effect of Various Concentrations of Nitrous Oxide and Oxygen on the Hypersensitive Gag Reflex.

    PubMed

    De Veaux, Candace K E; Montagnese, Thomas A; Heima, Masahiro; Aminoshariae, Anita; Mickel, Andre

    2016-01-01

    The purpose of this study was to compare the effectiveness of various concentrations of N 2 O/O 2 on obtunding a hypersensitive gag reflex. We hypothesized that the administration of nitrous oxide and oxygen would obtund a hypersensitive gag reflex enough to allow a patient to tolerate the placement and holding of a digital x-ray sensor long enough to obtain a dental radiograph. Volunteers claiming to have a hypersensitive gag reflex were first screened to validate their claim and then tested by placing a size 2 digital x-ray sensor in the position for a periapical radiograph of the right mandibular molar area and holding it in place for 10 seconds. Subjects were first tested using room air only, then 30%, 50%, or 70% nitrous oxide until they were able to tolerate the sensor without gagging or discomfort. A visual analog scale was used for subjective responses, and other statistical tests were used to analyze the results. We found that for some subjects, 30% nitrous oxide was sufficient; for others, 50% was needed; and for the remainder of the subjects, 70% was sufficient to tolerate the test. Using a combination of 70% nitrous oxide and 30% oxygen allowed all patients claiming to have a hypersensitive gag reflex to tolerate the placement and holding of a digital x-ray sensor long enough to take a periapical radiograph.

  13. Comparison of the up-conversion photoluminescence for GAP, GAG and GAM phosphors

    NASA Astrophysics Data System (ADS)

    Deng, Taoli; Jiang, Xianbang

    2018-04-01

    GdAlO3:Er3+/Yb3+, Gd3Al5O12:Er3+/Yb3+ and Gd4Al2O9:Er3+/Yb3+ phosphors were prepared by co-precipitation. The effects for Gd2O3-Al2O3 composite oxides as the host materials with different crystal structures such as GdAlO3, Gd3Al5O12 and Gd4Al2O9 were investigated. It was found that the perovskite structured GdAlO3:Er3+/Yb3+ (GAP phosphor) could be obtained from the precursor when the calcination temperature was 1000 °C, while the garnet structured Gd3Al5O12:Er3+/Yb3+ (GAG phosphor) could be formed when the calcination temperature was 1300 °C, but the monoclinic-structured Gd4Al2O9:Er3+/Yb3+ (GAM phosphor) could be formed only when the calcination temperature was raised up to 1500 °C. The difference of the up-conversion photoluminescence (UCPL) spectra under 980 nm between the GAP, GAG and GAM phosphors was studied. The result showed that the UCPL intensity of the GAP phosphor was close to that of the GAM phosphor with much higher red-to-green intensity ratio than that of GAP phosphor. The UCPL intensity of GAG phosphor was the weakest among them. Finally, the factors which influenced on the UCPL of the GAP, GAG and GAM phosphors were discussed.

  14. Euflammation attenuates peripheral inflammation-induced neuroinflammation and mitigates immune-to-brain signaling.

    PubMed

    Liu, Xiaoyu; Nemeth, Daniel P; Tarr, Andrew J; Belevych, Natalya; Syed, Zunera W; Wang, Yufen; Ismail, Ahmad S; Reed, Nathaniel S; Sheridan, John F; Yajnik, Akul R; Disabato, Damon J; Zhu, Ling; Quan, Ning

    2016-05-01

    Peripheral inflammation can trigger a number of neuroinflammatory events in the CNS, such as activation of microglia and increases of proinflammatory cytokines. We have previously identified an interesting phenomenon, termed "euflammation", which can be induced by repeated subthreshold infectious challenges. Euflammation causes innate immune alterations without overt neuroimmune activation. In the current study, we examined the protective effect of euflammation against peripheral inflammation-induced neuroinflammation and the underlying mechanisms. When Escherichia coli or lipopolysaccharide (LPS) was injected inside or outside the euflammation induction locus (EIL), sickness behavior, global microglial activation, proinflammatory cytokine production in the brain, expression of endothelial cyclooxygenase II and induction of c-fos expression in the paraventricular nucleus of the hypothalamus were all attenuated in the euflammatory mice compared with those in the control unprimed mice. Euflammation also modulated innate immunity outside the EIL by upregulating receptors for pathogen-associated molecular patterns in spleen cells. In addition, euflammation attenuated CNS activation in response to an intra-airpouch (outside the EIL) injection of LPS without suppressing the cytokine expression in the airpouch. Collectively, our study demonstrates that signaling of peripheral inflammation to the CNS is modulated dynamically by peripheral inflammatory kinetics. Specifically, euflammation can offer effective protection against both bacterial infection and endotoxin induced neuroinflammation. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. Immune responses induced by recombinant Bacillus subtilis expressing the spike protein of transmissible gastroenteritis virus in pigs.

    PubMed

    Mou, Chunxiao; Zhu, Liqi; Xing, Xianping; Lin, Jian; Yang, Qian

    2016-07-01

    Transmissible gastroenteritis (TGE) causes severe diarrhea in suckling piglets, results in enormous economic loss in swine-producing areas of the world. To develop an effective, safe, and convenient vaccine for the prevention of TGE, we have constructed a recombinant Bacillus subtilis strain (B. subtilis CotGSG) displaying the transmissible gastroenteritis virus (TGEV) spike (S) protein and discussed its immune function to intestinal submucosal dendritic cells (DCs). Our results showed that the recombinant B. subtilis had the ability to recruit more DCs to sample B. subtilis CotGSG, migrate to MLNs, and induce immune responses. Immunized piglets with B. subtilis CotGSG could significantly elevate the specific SIgA titers in feces, IgG titers and neutralizing antibodies in serum. Collectively, our results suggested that recombinant B. subtilis CotGSG expressing the TGEV S protein could effectively induce immune responses via DCs, and provided a perspective on potential novel strategy and approach that may be applicable to the development of the next generation of TGEV vaccines. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Extracellular self-DNA as a damage-associated molecular pattern (DAMP) that triggers self-specific immunity induction in plants.

    PubMed

    Duran-Flores, Dalia; Heil, Martin

    2017-10-16

    Mammals sense self or non-self extracellular or extranuclear DNA fragments (hereinafter collectively termed eDNA) as indicators of injury or infection and respond with immunity. We hypothesised that eDNA acts as a damage-associated molecular pattern (DAMP) also in plants and that it contributes to self versus non-self discrimination. Treating plants and suspension-cultured cells of common bean (Phaseolus vulgaris) with fragmented self eDNA (obtained from other plants of the same species) induced early, immunity-related signalling responses such as H 2 O 2 generation and MAPK activation, decreased the infection by a bacterial pathogen (Pseudomonas syringae) and increased an indirect defence to herbivores (extrafloral nectar secretion). By contrast, non-self DNA (obtained from lima bean, Phaseolus lunatus, and Acacia farnesiana) had significantly lower or no detectable effects. Only fragments below a size of 700 bp were active, and treating the eDNA preparation DNAse abolished its inducing effects, whereas treatment with RNAse or proteinase had no detectable effect. These findings indicate that DNA fragments, rather than small RNAs, single nucleotides or proteins, accounted for the observed effects. We suggest that eDNA functions a DAMP in plants and that plants discriminate self from non-self at a species-specific level. The immune systems of plants and mammals share multiple central elements, but further work will be required to understand the mechanisms and the selective benefits of an immunity response that is triggered by eDNA in a species-specific manner. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Immunization of Mice with a Live Transconjugant Shigella Hybrid Strain Induced Th1 and Th17 Cell-Mediated Immune Responses and Confirmed Passive Protection Against Heterologous Shigellae.

    PubMed

    Nag, D; Koley, H; Sinha, R; Mukherjee, P; Sarkar, C; Withey, J H; Gachhui, R

    2016-02-01

    An avirulent, live transconjugant Shigella hybrid (LTSHΔstx) strain was constructed in our earlier study by introducing a plasmid vector, pPR1347, into a Shiga toxin gene deleted Shigella dysenteriae 1. Three successive oral administrations of LTSHΔstx to female adult mice produced comprehensive passive heterologous protection in their offspring against challenge with wild-type shigellae. Production of NO and different cytokines such asIL-12p70, IL-1β and IL-23 in peritoneal mice macrophages indicated that LTSHΔstx induced innate and adaptive immunity in mice. Furthermore, production of IFN-γ, IL-10 and IL-17 in LTSH-primed splenic CD4+ T cell suggested that LTSHΔstx may induce Th1 and Th17 cell-mediated immune responses. Exponential increase of the serum IgG and IgA titre against whole shigellae was observed in immunized adult mice during and after the immunization with the highest peak on day 35. Antigen-specific sIgA was also determined from intestinal lavage of immunized mice. The stomach extracts of neonates from immunized mice, mainly containing mother's milk, contained significant levels of anti-LTSHΔstx immunoglobulin. These studies suggest that the LTSHΔstx could be a new live oral vaccine candidate against shigellosis in the near future. © 2015 The Foundation for the Scandinavian Journal of Immunology.

  18. Oncolytic Adenovirus With Temozolomide Induces Autophagy and Antitumor Immune Responses in Cancer Patients

    PubMed Central

    Liikanen, Ilkka; Ahtiainen, Laura; Hirvinen, Mari LM; Bramante, Simona; Cerullo, Vincenzo; Nokisalmi, Petri; Hemminki, Otto; Diaconu, Iulia; Pesonen, Sari; Koski, Anniina; Kangasniemi, Lotta; Pesonen, Saila K; Oksanen, Minna; Laasonen, Leena; Partanen, Kaarina; Joensuu, Timo; Zhao, Fang; Kanerva, Anna; Hemminki, Akseli

    2013-01-01

    Oncolytic adenoviruses and certain chemotherapeutics can induce autophagy and immunogenic cancer cell death. We hypothesized that the combination of oncolytic adenovirus with low-dose temozolomide (TMZ) is safe, effective, and capable of inducing antitumor immune responses. Metronomic low-dose cyclophosphamide (CP) was added to selectively reduce regulatory T-cells. Preclinically, combination therapy inhibited tumor growth, increased autophagy, and triggered immunogenic cell death as indicated by elevated calreticulin, adenosine triphosphate (ATP) release, and nuclear protein high-mobility group box-1 (HMGB1) secretion. A total of 41 combination treatments given to 17 chemotherapy-refractory cancer patients were well tolerated. We observed anti- and proinflammatory cytokine release, evidence of virus replication, and induction of neutralizing antibodies. Tumor cells showed increased autophagy post-treatment. Release of HMGB1 into serum—a possible indicator of immune response—increased in 60% of treatments, and seemed to correlate with tumor-specific T-cell responses, observed in 10/15 cases overall (P = 0.0833). Evidence of antitumor efficacy was seen in 67% of evaluable treatments with a trend for increased survival over matched controls treated with virus only. In summary, the combination of oncolytic adenovirus with low-dose TMZ and metronomic CP increased tumor cell autophagy, elicited antitumor immune responses, and showed promising safety and efficacy. PMID:23546299

  19. Control of SIV infection and subsequent induction of pandemic H1N1 immunity in rhesus macaques using an Ad5 [E1-, E2b-] vector platform.

    PubMed

    Gabitzsch, Elizabeth S; Balint-Junior, Joseph P; Xu, Younong; Balcaitis, Stephanie; Sanders-Beer, Brigitte; Karl, Julie; Weinhold, Kent J; Paessler, Slobodan; Jones, Frank R

    2012-11-26

    Anti-vector immunity mitigates immune responses induced by recombinant adenovirus vector vaccines, limiting their prime-boost capabilities. We have developed a novel gene delivery and expression platform (Ad5 [E1-, E2b-]) that induces immune responses despite pre-existing and/or developed concomitant Ad5 immunity. In the present study, we evaluated if this new Ad5 platform could overcome the adverse condition of pre-existing Ad5 immunity to induce effective immune responses in prime-boost immunization regimens against two different infectious diseases in the same animal. Ad5 immune rhesus macaques (RM) were immunized multiple times with the Ad5 [E1-, E2b-] platform expressing antigens from simian immunodeficiency virus (SIV). Immunized RM developed cell-mediated immunity against SIV antigens Gag, Pol, Nef and Env as well as antibody against Env. Vaccinated and vector control RMs were challenged intra-rectally with homologous SIVmac239. During a 7-week follow-up, there was perturbation of SIV load in some immunized RM. At 7 weeks post-challenge, eight immunized animals (53%) did not have detectable SIV, compared to two RM controls (13%) (P<0.02; log-rank Mantel-Cox test). There was no correlation of protective MHC contributing to infection control. The RM without detectable circulating SIV, now hyper immune to Ad5, were then vaccinated with the same Ad5 [E1-, E2b-] platform expressing H1N1 influenza hemagglutinin (HA). Thirty days post Ad5 [E1-, E2b-]-HA vaccination, significant levels of influenza neutralizing antibody were induced in all animals that increased after an Ad5 [E1-, E2b-]-HA homologous boost. These data demonstrate the versatility of this new vector platform to immunize against two separate disease targets in the same animal despite the presence of immunity against the delivery platform, permitting homologous repeat immunizations with an Ad5 gene delivery platform. Copyright © 2012 Elsevier Ltd. All rights reserved.

  20. Protective antitumor immunity induced by tumor cell lysates conjugated with diphtheria toxin and adjuvant epitope in mouse breast tumor models

    PubMed Central

    Wang, Ze-Yu; Xing, Yun; Liu, Bin; Lu, Lei; Huang, Xiao; Ge, Chi-Yu; Yao, Wen-Jun; Xu, Mao-Lei; Gao, Zhen-Qiu; Cao, Rong-Yue; Wu, Jie; Li, Tai-Ming

    2012-01-01

    Cancer cell vaccine-based immunotherapy has received increasing interest in many clinical trials involving patients with breast cancer. Combining with appropriate adjuvants can enhance the weak immunogenic properties of tumor cell lysates (TCL). In this study, diphtheria toxin (DT) and two tandem repeats of mycobacterial heat shock protein 70 (mHSP70) fragment 407-426 (M2) were conjugated to TCL with glutaraldehyde, and the constructed cancer cell vaccine was named DT-TCL-M2. Subcutaneous injection of DT-TCL-M2 in mice effectively elicited tumor-specific polyclonal immune responses, including humoral and cellular immune responses. High levels of antibodies against TCL were detected in the serum of immunized mice with ELISA and verified with Western blot analyses. The splenocytes from immunized mice showed potent cytotoxicity on Ehrlich ascites carcinoma cells. Moreover, the protective antitumor immunity induced by DT-TCL-M2 inhibited tumor growth in a mouse breast tumor model. DT-TCL-M2 also attenuated tumor-induced angiogenesis and slowed tumor growth in a mouse intradermal tumor model. These findings demonstrate that TCL conjugated with appropriate adjuvants induced effective antitumor immunity in vivo. Improvements in potency could further make cancer cell vaccines a useful and safe method for preventing cancer recurrence after resection. PMID:22464650

  1. Immunization with Recombinantly Expressed LRP4 Induces Experimental Autoimmune Myasthenia Gravis in C57BL/6 Mice.

    PubMed

    Ulusoy, Canan; Çavuş, Filiz; Yılmaz, Vuslat; Tüzün, Erdem

    2017-07-01

    Myasthenia gravis (MG) is an autoimmune disease of the neuromuscular junction (NMJ), characterized with muscle weakness. While MG develops due to acetylcholine receptor (AChR) antibodies in most patients, antibodies to muscle-specific receptor tyrosine kinase (MuSK) or low-density lipoprotein receptor-related protein 4 (LRP4) may also be identified. Experimental autoimmune myasthenia gravis (EAMG) has been previously induced by both LRP4 immunization and passive transfer of LRP4 antibodies. Our aim was to confirm previous results and to test the pathogenic effects of LRP4 immunization in a commonly used mouse strain C57BL/6 (B6) using a recombinantly expressed human LRP4 protein. B6 mice were immunized with human LRP4 in CFA, Torpedo Californica AChR in CFA or only CFA. Clinical and pathogenic aspects of EAMG were compared among groups. LRP4- and AChR-immunized mice showed comparable EAMG clinical severity. LRP4-immunized mice displayed serum antibodies to LRP4 and NMJ IgG and complement factor C3 deposits. IgG2 was the dominant anti-LRP4 isotype. Cultured lymph node cells of LRP4- and AChR-immunized mice gave identical pro-inflammatory cytokine (IL-6, IFN-γ and IL-17) responses to LRP4 and AChR stimulation, respectively. Our results confirm the EAMG-inducing action of LRP4 immunization and identify B6 as a LRP4-EAMG-susceptible mouse strain. Demonstration of complement fixing anti-LRP4 antibodies in sera and complement/IgG deposits at the NMJ of LRP4-immunized mice indicates complement activation as a putative pathogenic mechanism. We have thus developed a practical LRP4-induced EAMG model using a non-conformational protein and a widely available mouse strain for future investigation of LRP4-related MG.

  2. Interactions between nattokinase and heparin/GAGs.

    PubMed

    Zhang, Fuming; Zhang, Jianhua; Linhardt, Robert J

    2015-12-01

    Nattokinase (NK) is a serine protease extracted from a traditional Japanese food called natto. Due to its strong fibrinolytic and thrombolytic activity, NK is regarded as a valuable dietary supplement or nutraceutical for the oral thrombolytic therapy. In addition, NK has been investigated for some other medical applications including treatment of hypertension, Alzheimer's disease, and vitreoretinal disorders. The most widely used clinical anticoagulants are heparin and low molecular weight heparins. The interactions between heparin and proteins modulate diverse patho-physiological processes and heparin modifies the activity of serine proteases. Indeed, heparin plays important roles in almost all of NK's potential therapeutically applications. The current report relies on surface plasmon resonance spectroscopy to examine NK interacting with heparin as well as other glycosaminoglycans (GAGs). These studies showed that NK is a heparin binding protein with an affinity of ~250 nM. Examination with differently sized heparin oligosaccharides indicated that the interaction between NK and heparin is chain-length dependent and the minimum size for heparin binding is a hexasaccharide. Studies using chemically modified heparin showed the 6-O-sulfo as well as the N-sulfo groups but not the 2-O-sulfo groups within heparin, are essential for heparin's interaction with NK. Other GAGs (including HS, DS, and CSE) displayed modest binding affinity to NK. NK also interfered with other heparin-protein interactions, including heparin's interaction with antithrombin and fibroblast growth factors.

  3. Epithelial-to-mesenchymal transition (EMT) induced by inflammatory priming elicits mesenchymal stromal cell-like immune-modulatory properties in cancer cells.

    PubMed

    Ricciardi, M; Zanotto, M; Malpeli, G; Bassi, G; Perbellini, O; Chilosi, M; Bifari, F; Krampera, M

    2015-03-17

    Epithelial-to-mesenchymal transition (EMT) has a central role in cancer progression and metastatic dissemination and may be induced by local inflammation. We asked whether the inflammation-induced acquisition of mesenchymal phenotype by neoplastic epithelial cells is associated with the onset of mesenchymal stromal cell-like immune-regulatory properties that may enhance tumour immune escape. Cell lines of lung adenocarcinoma (A549), breast cancer (MCF7) and hepatocellular carcinoma (HepG2) were co-cultured with T, B and NK cells before and after EMT induction by either the supernatant of mixed-lymphocyte reactions or inflammatory cytokines. EMT occurrence following inflammatory priming elicited multiple immune-regulatory effects in cancer cells resulting in NK and T-cell apoptosis, inhibition of lymphocyte proliferation and stimulation of regulatory T and B cells. Indoleamine 2,3-dioxygenase, but not Fas ligand pathway, was involved at least in part in these effects, as shown by the use of specific inhibitors. EMT induced by inflammatory stimuli confers to cancer cells some mesenchymal stromal cell-like immune-modulatory properties, which could be a cue for cancer progression and metastatic dissemination by favouring immune escape.

  4. The early cellular signatures of protective immunity induced by live viral vaccination.

    PubMed

    Kohler, Siegfried; Bethke, Nicole; Böthe, Matthias; Sommerick, Sophie; Frentsch, Marco; Romagnani, Chiara; Niedrig, Matthias; Thiel, Andreas

    2012-09-01

    Here, we have used primary vaccination of healthy donors with attenuated live yellow fever virus 17D (YFV-17D) as a model to study the generation of protective immunity. In short intervals after vaccination, we analyzed the induction of YFV-17D specific T- and B-cell immunity, bystander activation, dendritic cell subsets, changes in serum cytokine levels, and YFV-17D-specific antibodies. We show activation of innate immunity and a concomitant decline of numbers of peripheral blood T and B cells. An early peak of antigen-specific T cells at day 2, followed by mobilization of innate immune cells, preceded the development of maximal adaptive immunity against YFV-17D at day 14 after vaccination. Interestingly, potent adaptive immunity as measured by high titers of neutralizing YFV-17D-specific antibodies, correlated with early activation and recruitment of YFV-17D-specific CD4(+) T cells and higher levels of sIL-6R. Thus our data might provide new insights into the interplay of innate and adaptive immunity for the induction of protective immunity. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Type 2 Immune Mechanisms in Carbon Nanotube-Induced Lung Fibrosis.

    PubMed

    Dong, Jie; Ma, Qiang

    2018-01-01

    T helper (Th) 2-dependent type 2 immune pathways have been recognized as an important driver for the development of fibrosis. Upon stimulation, activated Th2 immune cells and type 2 cytokines interact with inflammatory and tissue repair functions to stimulate an overzealous reparative response to tissue damage, leading to organ fibrosis and destruction. In this connection, type 2 pathways are activated by a variety of insults and pathological conditions to modulate the response. Carbon nanotubes (CNTs) are nanomaterials with a wide range of applications. However, pulmonary exposure to CNTs causes a number of pathologic outcomes in animal lungs, dominated by inflammation and fibrosis. These findings, alongside the rapidly expanding production and commercialization of CNTs and CNT-containing materials in recent years, have raised concerns on the health risk of CNT exposure in humans. The CNT-induced pulmonary fibrotic lesions resemble those of human fibrotic lung diseases, such as idiopathic pulmonary fibrosis and pneumoconiosis, to a certain extent with regard to disease development and pathological features. In fibrotic scenarios, immune cells are activated including varying immune pathways, ranging from innate immune cell activation to autoimmune disease. These events often precede and/or accompany the occurrence of fibrosis. Upon CNT exposure, significant induction and activation of Th2 cells and type 2 cytokines in the lungs are observed. Moreover, type 2 pathways are shown to play important roles in promoting CNT-induced lung fibrosis by producing type 2 pro-fibrotic factors and inducing the reparative phenotypes of macrophages in response to CNTs. In light of the vastly increased demand for nanosafety and the apparent induction and multiple roles of type 2 immune pathways in lung fibrosis, we review the current literature on CNT-induced lung fibrosis, with a focus on the induction and activation of type 2 responses by CNTs and the stimulating function of type

  6. Glutamic Acid Residues in HIV-1 p6 Regulate Virus Budding and Membrane Association of Gag

    PubMed Central

    Friedrich, Melanie; Setz, Christian; Hahn, Friedrich; Matthaei, Alina; Fraedrich, Kirsten; Rauch, Pia; Henklein, Petra; Traxdorf, Maximilian; Fossen, Torgils; Schubert, Ulrich

    2016-01-01

    The HIV-1 Gag p6 protein regulates the final abscission step of nascent virions from the cell membrane by the action of its two late (l-) domains, which recruit Tsg101 and ALIX, components of the ESCRT system. Even though p6 consists of only 52 amino acids, it is encoded by one of the most polymorphic regions of the HIV-1 gag gene and undergoes various posttranslational modifications including sumoylation, ubiquitination, and phosphorylation. In addition, it mediates the incorporation of the HIV-1 accessory protein Vpr into budding virions. Despite its small size, p6 exhibits an unusually high charge density. In this study, we show that mutation of the conserved glutamic acids within p6 increases the membrane association of Pr55 Gag followed by enhanced polyubiquitination and MHC-I antigen presentation of Gag-derived epitopes, possibly due to prolonged exposure to membrane bound E3 ligases. The replication capacity of the total glutamic acid mutant E0A was almost completely impaired, which was accompanied by defective virus release that could not be rescued by ALIX overexpression. Altogether, our data indicate that the glutamic acids within p6 contribute to the late steps of viral replication and may contribute to the interaction of Gag with the plasma membrane. PMID:27120610

  7. Glutamic Acid Residues in HIV-1 p6 Regulate Virus Budding and Membrane Association of Gag.

    PubMed

    Friedrich, Melanie; Setz, Christian; Hahn, Friedrich; Matthaei, Alina; Fraedrich, Kirsten; Rauch, Pia; Henklein, Petra; Traxdorf, Maximilian; Fossen, Torgils; Schubert, Ulrich

    2016-04-25

    The HIV-1 Gag p6 protein regulates the final abscission step of nascent virions from the cell membrane by the action of its two late (L-) domains, which recruit Tsg101 and ALIX, components of the ESCRT system. Even though p6 consists of only 52 amino acids, it is encoded by one of the most polymorphic regions of the HIV-1 gag gene and undergoes various posttranslational modifications including sumoylation, ubiquitination, and phosphorylation. In addition, it mediates the incorporation of the HIV-1 accessory protein Vpr into budding virions. Despite its small size, p6 exhibits an unusually high charge density. In this study, we show that mutation of the conserved glutamic acids within p6 increases the membrane association of Pr55 Gag followed by enhanced polyubiquitination and MHC-I antigen presentation of Gag-derived epitopes, possibly due to prolonged exposure to membrane bound E3 ligases. The replication capacity of the total glutamic acid mutant E0A was almost completely impaired, which was accompanied by defective virus release that could not be rescued by ALIX overexpression. Altogether, our data indicate that the glutamic acids within p6 contribute to the late steps of viral replication and may contribute to the interaction of Gag with the plasma membrane.

  8. Potent Cell-Intrinsic Immune Responses in Dendritic Cells Facilitate HIV-1-Specific T Cell Immunity in HIV-1 Elite Controllers.

    PubMed

    Martin-Gayo, Enrique; Buzon, Maria Jose; Ouyang, Zhengyu; Hickman, Taylor; Cronin, Jacqueline; Pimenova, Dina; Walker, Bruce D; Lichterfeld, Mathias; Yu, Xu G

    2015-06-01

    The majority of HIV-1 elite controllers (EC) restrict HIV-1 replication through highly functional HIV-1-specific T cell responses, but mechanisms supporting the evolution of effective HIV-1-specific T cell immunity in these patients remain undefined. Cytosolic immune recognition of HIV-1 in conventional dendritic cells (cDC) can facilitate priming and expansion of HIV-1-specific T cells; however, HIV-1 seems to be able to avoid intracellular immune recognition in cDCs in most infected individuals. Here, we show that exposure of cDCs from EC to HIV-1 leads to a rapid and sustained production of type I interferons and upregulation of several interferon-stimulated effector genes. Emergence of these cell-intrinsic immune responses was associated with a reduced induction of SAMHD1 and LEDGF/p75, and an accumulation of viral reverse transcripts, but inhibited by pharmacological blockade of viral reverse transcription or siRNA-mediated silencing of the cytosolic DNA sensor cGAS. Importantly, improved cell-intrinsic immune recognition of HIV-1 in cDCs from elite controllers translated into stronger abilities to stimulate and expand HIV-1-specific CD8 T cell responses. These data suggest an important role of cell-intrinsic type I interferon secretion in dendritic cells for the induction of effective HIV-1-specific CD8 T cells, and may be helpful for eliciting functional T cell immunity against HIV-1 for preventative or therapeutic clinical purposes.

  9. Selection of an HLA-C*03:04-Restricted HIV-1 p24 Gag Sequence Variant Is Associated with Viral Escape from KIR2DL3+ Natural Killer Cells: Data from an Observational Cohort in South Africa.

    PubMed

    Hölzemer, Angelique; Thobakgale, Christina F; Jimenez Cruz, Camilo A; Garcia-Beltran, Wilfredo F; Carlson, Jonathan M; van Teijlingen, Nienke H; Mann, Jaclyn K; Jaggernath, Manjeetha; Kang, Seung-gu; Körner, Christian; Chung, Amy W; Schafer, Jamie L; Evans, David T; Alter, Galit; Walker, Bruce D; Goulder, Philip J; Carrington, Mary; Hartmann, Pia; Pertel, Thomas; Zhou, Ruhong; Ndung'u, Thumbi; Altfeld, Marcus

    2015-11-01

    Viruses can evade immune surveillance, but the underlying mechanisms are insufficiently understood. Here, we sought to understand the mechanisms by which natural killer (NK) cells recognize HIV-1-infected cells and how this virus can evade NK-cell-mediated immune pressure. Two sequence mutations in p24 Gag associated with the presence of specific KIR/HLA combined genotypes were identified in HIV-1 clade C viruses from a large cohort of infected, untreated individuals in South Africa (n = 392), suggesting viral escape from KIR+ NK cells through sequence variations within HLA class I-presented epitopes. One sequence polymorphism at position 303 of p24 Gag (TGag303V), selected for in infected individuals with both KIR2DL3 and HLA-C*03:04, enabled significantly better binding of the inhibitory KIR2DL3 receptor to HLA-C*03:04-expressing cells presenting this variant epitope compared to the wild-type epitope (wild-type mean 18.01 ± 10.45 standard deviation [SD] and variant mean 44.67 ± 14.42 SD, p = 0.002). Furthermore, activation of primary KIR2DL3+ NK cells from healthy donors in response to HLA-C*03:04+ target cells presenting the variant epitope was significantly reduced in comparison to cells presenting the wild-type sequence (wild-type mean 0.78 ± 0.07 standard error of the mean [SEM] and variant mean 0.63 ± 0.07 SEM, p = 0.012). Structural modeling and surface plasmon resonance of KIR/peptide/HLA interactions in the context of the different viral sequence variants studied supported these results. Future studies will be needed to assess processing and antigen presentation of the investigated HIV-1 epitope in natural infection, and the consequences for viral control. These data provide novel insights into how viruses can evade NK cell immunity through the selection of mutations in HLA-presented epitopes that enhance binding to inhibitory NK cell receptors. Better understanding of the mechanisms by which HIV-1 evades NK-cell-mediated immune pressure and the

  10. Systemic and mucosal immunization with Candida albicans hsp90 elicits hsp90-specific humoral response in vaginal mucosa which is further enhanced during experimental vaginal candidiasis.

    PubMed

    Raska, Milan; Belakova, Jana; Horynova, Milada; Krupka, Michal; Novotny, Jiri; Sebestova, Martina; Weigl, Evzen

    2008-08-01

    The Candida albicans heat shock protein 90 kDa (hsp90-CA) is an important target for protective antibodies in disseminated candidiasis of experimental mice and humans. Hsp90-CA is present in the cell wall of Candida pseudohyphae or hyphae--typical pathogenic morphotypes in both mucosal and systemic Candida infections. However, the potential protective effects of hsp90-CA-specific antibodies in vaginal candidiasis has not yet been reported. In the present study we used various vaccine formulations (recombinant hsp90-CA protein and hsp90-CA-encoding DNA vaccine) and routes of administration (intradermal, intranasal, and intravenous) to induce both hsp90-CA-specific systemic and vaginal mucosa immune responses in experimental BALB/c mice. The results showed that intradermal recombinant hsp90-CA protein priming, followed by intranasal or intradermal recombinant hsp90-CA protein boosting induced significant increases in both serum and vaginal hsp90-CA-specific IgG and IgA antibodies compared to the control group, as well as enhanced hsp90-CA-specific splenocyte responses in vitro. In the intradermally boosted group, subsequent experimental vaginal Candida infection induced additional increases in the hsp90-CA specific IgG isotype, suggesting that Candida has the ability to induce a local hsp90-specific antibody (IgG) response during vulvovaginal candidiasis. Further work is required to elucidate the importance of immunity to highly conserved antigens during infection of the human female reproductive tract where a balance between immunity to and tolerance for commonly antigens such as hsp90 is necessary for the maintenance of fertility.

  11. SagE induces highly effective protective immunity against Streptococcus iniae mainly through an immunogenic domain in the extracellular region.

    PubMed

    Sun, Yun; Sun, Li; Xing, Ming-qing; Liu, Chun-sheng; Hu, Yong-hua

    2013-11-12

    Streptococcus iniae is a Gram-positive bacterium and a severe pathogen of a wide range of farmed fish. S. iniae possesses a virulence-associated streptolysin S cluster composed of several components, one of which is SagE. SagE a transmembrane protein with one major extracellular region named ECR. This study aimed to develop a SagE-based DNA candidate vaccine against streptococcosis and examine the immunoprotective mechanism of the vaccine. We constructed a DNA vaccine, pSagE, based on the sagE gene and examined its immunological property in a Japanese flounder (Paralichthys olivaceus) model. The results showed that at 7 days post-vaccination, expression of SagE at transcription and translation levels was detected in the tissues of the vaccinated fish. After challenge with S. iniae at one and two months post-vaccination, pSagE-vaccinated fish exhibited relative percent survival (RPS) of 95% and 88% respectively. Immunological analysis showed that (i) pSagE significantly upregulated the expression of a wide range of immune genes, (ii) pSagE induced the production of specific serum antibodies that bound whole-cell S. iniae, and (iii) treatment of S. iniae with pSagE-induced antibodies blocked bacterial invasion of host cells. To localize the immunoprotective domain of SagE, the ECR-expressing DNA vaccine pSagEECR was constructed. Immunization analysis showed that flounder vaccinated with pSagEECR exhibited a RPS of 68%, and that pSagEECR induced serum antibody production and immune gene expression in a manner similar to, though to lower magnitudes than, those induced by pSagE. We in this study developed a DNA vaccine, pSagE, which induces highly protective immunity against S. iniae. The protective effect of pSagE is probably due to its ability to elicit systemic immune response, in particular that of the humoral branch, which leads to production of specific serum antibodies that impair bacterial infection. These results add insights to the immunoprotective mechanism

  12. Secondary immunization generates clonally related antigen-specific plasma cells and memory B cells.

    PubMed

    Frölich, Daniela; Giesecke, Claudia; Mei, Henrik E; Reiter, Karin; Daridon, Capucine; Lipsky, Peter E; Dörner, Thomas

    2010-09-01

    Rechallenge with T cell-dependent Ags induces memory B cells to re-enter germinal centers (GCs) and undergo further expansion and differentiation into plasma cells (PCs) and secondary memory B cells. It is currently not known whether the expanded population of memory B cells and PCs generated in secondary GCs are clonally related, nor has the extent of proliferation and somatic hypermutation of their precursors been delineated. In this study, after secondary tetanus toxoid (TT) immunization, TT-specific PCs increased 17- to 80-fold on days 6-7, whereas TT-specific memory B cells peaked (delayed) on day 14 with a 2- to 22-fold increase. Molecular analyses of V(H)DJ(H) rearrangements of individual cells revealed no major differences of gene usage and CDR3 length between TT-specific PCs and memory B cells, and both contained extensive evidence of somatic hypermutation with a pattern consistent with GC reactions. This analysis identified clonally related TT-specific memory B cells and PCs. Within clusters of clonally related cells, sequences shared a number of mutations but also could contain additional base pair changes. The data indicate that although following secondary immunization PCs can derive from memory B cells without further somatic hypermutation, in some circumstances, likely within GC reactions, asymmetric mutation can occur. These results suggest that after the fate decision to differentiate into secondary memory B cells or PCs, some committed precursors continue to proliferate and mutate their V(H) genes.

  13. Therapeutic Immunization In HIV Infected Ugandans Receiving Stable Antiretroviral Treatment: A Phase I Safety Study4

    PubMed Central

    Kityo, Cissy; Bousheri, Stephanie; Akao, Juliette; Ssali, Francis; Byaruhanga, Rose; Ssewanyana, Isaac; Muloma, Prossy; Myalo, Sula; Magala, Rose; Lu, Yichen; Mugyenyi, Peter; Cao, Huyen

    2011-01-01

    Therapeutic immunizations in HIV infection may boost immunity during antiretroviral treatment. We report on the first therapeutic vaccine trial in Uganda, Africa. This open label Phase I trial was designed to assess the safety, tolerability and immunogenicity of a therapeutic HIV-1 vaccine candidate. Thirty HIV positive volunteers receiving a stable regimen of antiretroviral therapy with CD4 counts > 400 were recruited for the safety evaluation of LFn-p24C, a detoxified anthrax-derived polypeptide fused to the subtype C HIV gag protein p24. The vaccine was well tolerated and HIV RNA levels remained undetectable following three immunizations. CD4 counts in vaccine recipients were significantly higher compared to the control individuals after 12 months. HIV-specific responses were associated with higher gain in CD4 counts following LFn-p24C immunizations. Volunteers were subsequently asked to undergo a 30-day period of observed treatment interruption. 8/24 (30%) individuals showed no evidence of viral rebound during treatment interruption. All demonstrated prompt suppression of viral load following resumption of ART. Our data demonstrates the safety of LFn-p24C and suggests that adjunct therapeutic immunization may benefit select individuals in further boosting an immune response. PMID:21211581

  14. Old and new facts about hyperthermia-induced modulations of the immune system.

    PubMed

    Frey, Benjamin; Weiss, Eva-Maria; Rubner, Yvonne; Wunderlich, Roland; Ott, Oliver J; Sauer, Rolf; Fietkau, Rainer; Gaipl, Udo S

    2012-01-01

    Hyperthermia (HT) is a potent sensitiser for radiotherapy (RT) and chemotherapy (CT) and has been proven to modulate directly or indirectly cells of the innate and adaptive immune system. We will focus in this article on how anti-tumour immunity can be induced by HT. In contrast to some in vitro assays, in vivo examinations showed that natural killer cells and phagocytes like granulocytes are directly activated against the tumour by HT. Since heat also activates dendritic cells (DCs), HT should be combined with further death stimuli (RT, CT or immune therapy) to allocate tumour antigen, derived from, for example, necrotic tumour cells, for uptake by DCs. We will outline that induction of immunogenic tumour cells and direct tumour cell killing by HT in combination with other therapies contributes to immune activation against the tumour. Studies will be presented showing that non-beneficial effects of HT on immune cells are mostly timely restricted. A special focus is set on immune activation mediated by extracellular present heat shock proteins (HSPs) carrying tumour antigens and further danger signals released by dying tumour cells. Local HT treatment in addition to further stress stimuli exerts abscopal effects and might be considered as in situ tumour vaccination. An increased natural killer (NK) cell activity, lymphocyte infiltration and HSP-mediated induction of immunogenic tumour cells have been observed in patients. Treatments with the addition of HT therefore can be considered as a personalised cancer treatment approach by specifically activating the immune system against the individual unique tumour.

  15. Hantaviruses induce cell type- and viral species-specific host microRNA expression signatures

    PubMed Central

    Shin, Ok Sarah; Kumar, Mukesh; Yanagihara, Richard; Song, Jin-Won

    2014-01-01

    The mechanisms of hantavirus-induced modulation of host cellular immunity remain poorly understood. Recently, microRNAs (miRNAs) have emerged as a class of essential regulators of host immune response genes. To ascertain if differential host miRNA expression toward representative hantavirus species correlated with immune response genes, miRNA expression profiles were analyzed in human endothelial cells, macrophages and epithelial cells infected with pathogenic and nonpathogenic rodent- and shrew-borne hantaviruses. Distinct miRNA expression profiles were observed in a cell type- and viral species-specific pattern. A subset of miRNAs, including miR-151-5p and miR-1973, were differentially expressed between Hantaan virus and Prospect Hill virus. Pathway analyses confirmed that the targets of selected miRNAs were associated with inflammatory responses and innate immune receptor-mediated signaling pathways. Our data suggest that differential immune responses following hantavirus infection may be regulated in part by cellular miRNA through dysregulation of genes critical to the inflammatory process. PMID:24074584

  16. STAT4 Deficiency Fails To Induce Lung Th2 or Th17 Immunity following Primary or Secondary Respiratory Syncytial Virus (RSV) Challenge but Enhances the Lung RSV-Specific CD8+ T Cell Immune Response to Secondary Challenge

    PubMed Central

    Dulek, Daniel E.; Newcomb, Dawn C.; Toki, Shinji; Goliniewska, Kasia; Cephus, Jacqueline; Reiss, Sara; Bates, John T.; Crowe, James E.; Boyd, Kelli L.; Moore, Martin L.; Zhou, Weisong

    2014-01-01

    ABSTRACT Immune-mediated lung injury is a hallmark of lower respiratory tract illness caused by respiratory syncytial virus (RSV). STAT4 plays a critical role in CD4+ Th1 lineage differentiation and gamma interferon (IFN-γ) protein expression by CD4+ T cells. As CD4+ Th1 differentiation is associated with negative regulation of CD4+ Th2 and Th17 differentiation, we hypothesized that RSV infection of STAT4−/− mice would result in enhanced lung Th2 and Th17 inflammation and impaired lung Th1 inflammation compared to wild-type (WT) mice. We performed primary and secondary RSV challenges in WT and STAT4−/− mice and used STAT1−/− mice as a positive control for the development of RSV-specific lung Th2 and Th17 inflammation during primary challenge. Primary RSV challenge of STAT4−/− mice resulted in decreased T-bet and IFN-γ expression levels in CD4+ T cells compared to those of WT mice. Lung Th2 and Th17 inflammation did not develop in primary RSV-challenged STAT4−/− mice. Decreased IFN-γ expression by NK cells, CD4+ T cells, and CD8+ T cells was associated with attenuated weight loss and enhanced viral clearance with primary challenge in STAT4−/− mice compared to WT mice. Following secondary challenge, WT and STAT4−/− mice also did not develop lung Th2 or Th17 inflammation. In contrast to primary challenge, secondary RSV challenge of STAT4−/− mice resulted in enhanced weight loss, an increased lung IFN-γ expression level, and an increased lung RSV-specific CD8+ T cell response compared to those of WT mice. These data demonstrate that STAT4 regulates the RSV-specific CD8+ T cell response to secondary infection but does not independently regulate lung Th2 or Th17 immune responses to RSV challenge. IMPORTANCE STAT4 is a protein critical for both innate and adaptive immune responses to viral infection. Our results show that STAT4 regulates the immune response to primary and secondary challenge with RSV but does not restrain RSV-induced

  17. Immunization with Small Amyloid-β-derived Cyclopeptide Conjugates Diminishes Amyloid-β-Induced Neurodegeneration in Mice.

    PubMed

    Mulder, Cornelis K; Dong, Yun; Brugghe, Humphrey F; Timmermans, Hans A M; Tilstra, Wichard; Westdijk, Janny; van Riet, Elly; van Steeg, Harry; Hoogerhout, Peter; Eisel, Ulrich L M

    2016-01-01

    Soluble oligomeric (misfolded) species of amyloid-β (Aβ) are the main mediators of toxicity in Alzheimer's disease (AD). These oligomers subsequently form aggregates of insoluble fibrils that precipitate as extracellular and perivascular plaques in the brain. Active immunization against Aβ is a promising disease modifying strategy. However, eliciting an immune response against Aβ in general may interfere with its biological function and was shown to cause unwanted side-effects. Therefore, we have developed a novel experimental vaccine based on conformational neo-epitopes that are exposed in the misfolded oligomeric Aβ, inducing a specific antibody response. Here we investigate the protective effects of the experimental vaccine against oligomeric Aβ1-42-induced neuronal fiber loss in vivo. C57BL/6 mice were immunized or mock-immunized. Antibody responses were measured by enzyme-linked immunosorbent assay. Next, mice received a stereotactic injection of oligomeric Aβ1-42 into the nucleus basalis of Meynert (NBM) on one side of the brain (lesion side), and scrambled Aβ1-42 peptide in the contralateral NBM (control side). The densities of choline acetyltransferase-stained cholinergic fibers origination from the NBM were measured in the parietal neocortex postmortem. The percentage of fiber loss in the lesion side was determined relative to the control side of the brain. Immunized responders (79%) showed 23% less cholinergic fiber loss (p = 0.01) relative to mock-immunized mice. Moreover, fiber loss in immunized responders correlated negatively with the measured antibody responses (R2 = 0.29, p = 0.02). These results may provide a lead towards a (prophylactic) vaccine to prevent or at least attenuate (early onset) AD symptoms.

  18. Combination of lentivector immunization and low-dose chemotherapy or PD-1/PD-L1 blocking primes self-reactive T cells and induces anti-tumor immunity.

    PubMed

    Sierro, Sophie R; Donda, Alena; Perret, Rachel; Guillaume, Philippe; Yagita, Hideo; Levy, Frédéric; Romero, Pedro

    2011-08-01

    In the last two decades, anti-cancer vaccines have yielded disappointing clinical results despite the fact that high numbers of self/tumor-specific T cells can be elicited in immunized patients. Understanding the reasons behind this lack of efficacy is critical in order to design better treatment regimes. Recombinant lentivectors (rLVs) have been successfully used to induce antigen-specific T cells to foreign or mutated tumor antigens. Here, we show that rLV expressing a murine nonmutated self/tumor antigen efficiently primes large numbers of self/tumor-specific CD8(+) T cells. In spite of the large number of tumor-specific T cells, however, no anti-tumor activity could be measured in a therapeutic setting, in mice vaccinated with rLV. Accumulating evidence shows that, in the presence of malignancies, inhibition of T-cell activity may predominate overstimulation. Analysis of tumor-infiltrating lymphocytes revealed that specific anti-tumor CD8(+) T cells fail to produce cytokines and express high levels of inhibitory receptors such as programmed death (PD)-1. Association of active immunization with chemotherapy or antibodies that block inhibitory pathways often leads to better anti-tumor effects. We show here that combining rLV vaccination with either cyclophosphamide or PD-1 and PD-L1 blocking antibodies enhances rLV vaccination efficacy and improves anti-tumor immunity. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Palateless custom bar supported overdenture: a treatment modality to treat patient with severe gag reflex.

    PubMed

    Singh, Kunwarjeet; Gupta, Nidhi

    2012-01-01

    To suggest a custom bar supported overdenture treatment modality for prosthodontic management of patients with severe gag reflex. Some patients have a severe gag reflex and cannot tolerate conventional maxillary complete dentures with maximum palatal coverage and extensions of all borders. The condition further gets complicated in patients suffering from respiratory problems along with severe gag reflex. Severe gagging acts as a barrier to treat such patients with accepted clinical procedures and prevent patients from wearing the prosthesis. By saving some of the remaining natural teeth and fabricating, a horse shoe shape palateless simple tooth or bar supported overdenture can be successfully used for treating such patients. The remaining maxillary right and left canines were prepared with the tapered round end diamond bur to receive copings of custom bar after intentional root canal treatment of same teeth. Impression was made with light body and putty of the polyvinyl siloxane elastomer with double step putty wash technique. Impression was poured with die stone. Wax pattern of copings with bar was fabricated with inlay wax which was invested and casted. After retrieving the bar, it was finished and its fit was evaluated. The coping-bar assembly was finally cemented with the glass ionomer cement. Palateless overdenture was fabricated by conventional technique used for the fabrication of complete denture. Palateless custom bar supported overdenture procedure can be successfully used for the management of patients with severe gag reflex with improved denture retention, stability, chewing efficiency and comfort of the patient.

  20. Cetuximab-activated natural killer (NK) and dendritic cells (DC) collaborate to trigger tumor antigen-specific T cell immunity in head and neck cancer patients

    PubMed Central

    Srivastava, Raghvendra M.; Lee, Steve C.; Filho, Pedro A. Andrade; Lord, Christopher A.; Jie, Hyun-bae; Davidson, H. Carter; López-Albaitero, Andrés; Gibson, Sandra P.; Gooding, William E.; Ferrone, Soldano; Ferris, Robert L.

    2013-01-01

    Purpose Tumor antigen (TA)-specific monoclonal antibodies (mAb) block oncogenic signaling and induce Fcγ receptor (FcγR)-mediated cytotoxicity. However, the role of CD8+ cytotoxic T lymphocyte (CTL) and FcγR in initiating innate and adaptive immune responses in mAb-treated human cancer patients is still emerging. Experimental Design FcγRIIIa codon 158 polymorphism was correlated with survival in 107 cetuximab-treated head and neck cancer (HNC) patients. Flow cytometry was performed to quantify EGFR-specific T cells in cetuximab-treated HNC patients. The effect of cetuximab on NK cell, dendritic cell (DC), and T cell activation was measured using IFN-γ release assays and flow cytometry. Results FcγR IIIa polymorphism did not predict clinical outcome in cetuximab-treated HNC patients, however elevated circulating EGFR -specific CD8+ 853-861 T cells were found in cetuximab-treated HNC patients (p<0.005). Cetuximab promoted EGFR-specific cellular immunity through the interaction of EGFR+ tumor cells and FcγRIIIa on NK cells, but not on the polymorphism per se. Cetuximab-activated NK cells induced IFN-γ dependent expression of DC maturation markers, antigen presentation machinery (APM) components such as TAP-1/2, and Th1 chemokines through NKG2D/MICA binding. Cetuximab initiated adaptive immune responses via NK-cell induced DC maturation, which enhanced cross-presentation to CTL specific for EGFR as well as another TA, MAGE-3. Conclusion Cetuximab-activated NK cells promote DC maturation and CD8+ T cell priming, leading to TA spreading and Th1 cytokine release through ‘NK-DC cross-talk.’ FcγRIIIa polymorphism did not predict clinical response to cetuximab, but was necessary for NK-DC interaction and mAb induced cross-presentation. EGFR-specific T cells in cetuximab treated HNC patients may contribute to clinical response. PMID:23444227

  1. Identifying the assembly intermediate in which Gag first associates with unspliced HIV-1 RNA suggests a novel model for HIV-1 RNA packaging.

    PubMed

    Barajas, Brook C; Tanaka, Motoko; Robinson, Bridget A; Phuong, Daryl J; Chutiraka, Kasana; Reed, Jonathan C; Lingappa, Jaisri R

    2018-04-01

    During immature capsid assembly, HIV-1 genome packaging is initiated when Gag first associates with unspliced HIV-1 RNA by a poorly understood process. Previously, we defined a pathway of sequential intracellular HIV-1 capsid assembly intermediates; here we sought to identify the intermediate in which HIV-1 Gag first associates with unspliced HIV-1 RNA. In provirus-expressing cells, unspliced HIV-1 RNA was not found in the soluble fraction of the cytosol, but instead was largely in complexes ≥30S. We did not detect unspliced HIV-1 RNA associated with Gag in the first assembly intermediate, which consists of soluble Gag. Instead, the earliest assembly intermediate in which we detected Gag associated with unspliced HIV-1 RNA was the second assembly intermediate (~80S intermediate), which is derived from a host RNA granule containing two cellular facilitators of assembly, ABCE1 and the RNA granule protein DDX6. At steady-state, this RNA-granule-derived ~80S complex was the smallest assembly intermediate that contained Gag associated with unspliced viral RNA, regardless of whether lysates contained intact or disrupted ribosomes, or expressed WT or assembly-defective Gag. A similar complex was identified in HIV-1-infected T cells. RNA-granule-derived assembly intermediates were detected in situ as sites of Gag colocalization with ABCE1 and DDX6; moreover these granules were far more numerous and smaller than well-studied RNA granules termed P bodies. Finally, we identified two steps that lead to association of assembling Gag with unspliced HIV-1 RNA. Independent of viral-RNA-binding, Gag associates with a broad class of RNA granules that largely lacks unspliced viral RNA (step 1). If a viral-RNA-binding domain is present, Gag further localizes to a subset of these granules that contains unspliced viral RNA (step 2). Thus, our data raise the possibility that HIV-1 packaging is initiated not by soluble Gag, but by Gag targeted to a subset of host RNA granules containing

  2. Identifying the assembly intermediate in which Gag first associates with unspliced HIV-1 RNA suggests a novel model for HIV-1 RNA packaging

    PubMed Central

    Barajas, Brook C.; Tanaka, Motoko; Robinson, Bridget A.; Phuong, Daryl J.; Reed, Jonathan C.

    2018-01-01

    During immature capsid assembly, HIV-1 genome packaging is initiated when Gag first associates with unspliced HIV-1 RNA by a poorly understood process. Previously, we defined a pathway of sequential intracellular HIV-1 capsid assembly intermediates; here we sought to identify the intermediate in which HIV-1 Gag first associates with unspliced HIV-1 RNA. In provirus-expressing cells, unspliced HIV-1 RNA was not found in the soluble fraction of the cytosol, but instead was largely in complexes ≥30S. We did not detect unspliced HIV-1 RNA associated with Gag in the first assembly intermediate, which consists of soluble Gag. Instead, the earliest assembly intermediate in which we detected Gag associated with unspliced HIV-1 RNA was the second assembly intermediate (~80S intermediate), which is derived from a host RNA granule containing two cellular facilitators of assembly, ABCE1 and the RNA granule protein DDX6. At steady-state, this RNA-granule-derived ~80S complex was the smallest assembly intermediate that contained Gag associated with unspliced viral RNA, regardless of whether lysates contained intact or disrupted ribosomes, or expressed WT or assembly-defective Gag. A similar complex was identified in HIV-1-infected T cells. RNA-granule-derived assembly intermediates were detected in situ as sites of Gag colocalization with ABCE1 and DDX6; moreover these granules were far more numerous and smaller than well-studied RNA granules termed P bodies. Finally, we identified two steps that lead to association of assembling Gag with unspliced HIV-1 RNA. Independent of viral-RNA-binding, Gag associates with a broad class of RNA granules that largely lacks unspliced viral RNA (step 1). If a viral-RNA-binding domain is present, Gag further localizes to a subset of these granules that contains unspliced viral RNA (step 2). Thus, our data raise the possibility that HIV-1 packaging is initiated not by soluble Gag, but by Gag targeted to a subset of host RNA granules containing

  3. B cells are critical to T-cell-mediated antitumor immunity induced by a combined immune-stimulatory/conditionally cytotoxic therapy for glioblastoma.

    PubMed

    Candolfi, Marianela; Curtin, James F; Yagiz, Kader; Assi, Hikmat; Wibowo, Mia K; Alzadeh, Gabrielle E; Foulad, David; Muhammad, A K M G; Salehi, Sofia; Keech, Naomi; Puntel, Mariana; Liu, Chunyan; Sanderson, Nicholas R; Kroeger, Kurt M; Dunn, Robert; Martins, Gislaine; Lowenstein, Pedro R; Castro, Maria G

    2011-10-01

    We have demonstrated that modifying the tumor microenvironment through intratumoral administration of adenoviral vectors (Ad) encoding the conditional cytotoxic molecule, i.e., HSV1-TK and the immune-stimulatory cytokine, i.e., fms-like tyrosine kinase 3 ligand (Flt3L) leads to T-cell-dependent tumor regression in rodent models of glioblastoma. We investigated the role of B cells during immune-mediated glioblastoma multiforme regression. Although treatment with Ad-TK+Ad-Flt3L induced tumor regression in 60% of wild-type (WT) mice, it completely failed in B-cell-deficient Igh6(-/-) mice. Tumor-specific T-cell precursors were detected in Ad-TK+Ad-Flt3L-treated WT mice but not in Igh6(-/-) mice. The treatment also failed in WT mice depleted of total B cells or marginal zone B cells. Because we could not detect circulating antibodies against tumor cells and the treatment was equally efficient in WT mice and in mice with B-cell-specific deletion of Prdm 1 (encoding Blimp-1), in which B cells are present but unable to fully differentiate into antibody-secreting plasma cells, tumor regression in this model is not dependent on B cells' production of tumor antigen-specific immunoglobulins. Instead, B cells seem to play a role as antigen-presenting cells (APCs). Treatment with Ad-TK+Ad-Flt3L led to an increase in the number of B cells in the cervical lymph nodes, which stimulated the proliferation of syngeneic T cells and induced clonal expansion of antitumor T cells. Our data show that B cells act as APCs, playing a critical role in clonal expansion of tumor antigen-specific T cells and brain tumor regression.

  4. [Immune system and influenza virus].

    PubMed

    Wierzbicka-Woś, Anna; Tokarz-Deptuła, Beata; Deptuła, Wiesław

    2015-02-15

    Influenza viruses are a significant cause of respiratory infections, causing 3-5 million clinical infections and 250-500 thousand deaths per year. Infections caused by the influenza virus induce a host immune response at the non-specific and specific level (defined as natural and acquired), which leads to limitation of virus replication. Moreover the elements of immunological memory are induced so that they can protect against subsequent infection by the influenza virus. However, there is still no effective way for the total elimination of this virus, and the only effective method to combat this pathogen appears to be vaccination, which through immune system activation greatly limits its spread. The present paper presents the immune reaction at different levels in response to the influenza virus after entering the body and the mechanisms of the influenza virus for avoiding reactions of the immune system, which correspond to its high variability at the molecular level. Moreover, in this paper we describe various methods of stimulating the organism's immune systems with different generations of vaccines and their effectiveness in the fight against this pathogen.

  5. Cytotoxic T lymphocytes to Ebola Zaire virus are induced in mice by immunization with liposomes containing lipid A.

    PubMed

    Rao, M; Matyas, G R; Grieder, F; Anderson, K; Jahrling, P B; Alving, C R

    1999-08-06

    An eight amino acid sequence (TELRTFSI) present in the carboxy terminal end (aa 577-584) of membrane-anchored GP, the major structural protein of Ebola virus, was identified as an H-2k-specific murine cytotoxic T cell epitope. Cytotoxic T lymphocytes (CTLs) to this epitope were induced by immunizing B10.BR mice intravenously with either irradiated Ebola virus or with irradiated Ebola virus encapsulated in liposomes containing lipid A. The CTL response induced by irradiated Ebola virus could not be sustained after the second round of in vitro stimulation of immune splenocytes with the peptide, unless the irradiated virus was encapsulated in liposomes containing lipid A. The identification of an Ebola GP-specific CTL epitope and the requirement of liposomal lipid A for CTL memory recall responses could prove to be a promising approach for developing a vaccine against Ebola virus infection.

  6. In the absence of overt urothelial damage, chondroitinase ABC digestion of the GAG layer increases bladder permeability in ovariectomized female rats

    PubMed Central

    Van Gordon, Samuel; Tyler, Karl; Kropp, Bradley; Towner, Rheal; Lin, HsuehKung; Marentette, John O.; McHowat, Jane; Mohammedi, Ehsan; Greenwood-Van Meerveld, Beverley

    2016-01-01

    Loss of integrity of the protective impermeability barrier in the urothelium has been identified as significant in bladder dysfunction. In this study, we tested the theory that the luminal layer of glycosaminoglycans (GAG) serves as an important component of barrier function. The peptide polycation protamine sulfate (PS), 1 mg/ml, was instilled intravesically for 10 min into rat bladders. Chondroitinase ABC (ChABC), 63 IU/ml, was instilled into an additional six rats for 30 min to digest the GAG layer. Unmanipulated controls and sham-injected controls were also performed. After 24 h, the rats were euthanized, the bladders were removed, and permeability was assessed in the Ussing chamber and by diffusion of FITC-labeled dextran (4 kDa) to measure macromolecular permeability. The status of tight junctions was assessed by immunofluorescence and electron microscopy. In control and sham treated rat bladders, the transepithelial electrical resistance were means of 2.5 ± 1.1 vs. 2.6 ± 1.1 vs 1.2 ± 0.5 and 1.01 ± 0.7 kΩ·cm2 in the PS-treated and ChABC-treated rat bladders (P = 0.0016 and P = 0.0039, respectively). Similar differences were seen in dextran permeability. Histopathology showed a mild inflammation following PS treatment, but the ChABC-treated bladders were indistinguishable from controls. Tight junctions generally remained intact. ChABC digestion alone induced bladder permeability, confirming the importance of the GAG layer to bladder barrier function and supports that loss of the GAG layer seen in bladder biopsies of interstitial cystitis patients could be a significant factor producing symptoms for at least some interstitial cystitis/painful bladder syndrome patients. PMID:26911855

  7. Immunization of mice with LRP4 induces myasthenia similar to MuSK-associated myasthenia gravis.

    PubMed

    Mori, Shuuichi; Motohashi, Norio; Takashima, Rumi; Kishi, Masahiko; Nishimune, Hiroshi; Shigemoto, Kazuhiro

    2017-11-01

    Since the first report of experimental animal models of myasthenia gravis (MG) with autoantibodies against low-density lipoprotein receptor-related protein 4 (LRP4), there have not been any major reports replicating the pathogenicity of anti-LRP4 antibodies (Abs). Recent clinical studies have cast doubt on the specificity and pathogenicity of anti-LRP4 antibodies for MG, highlighting the need for further research. In this study, we purified antigens corresponding to the extracellular region of human LRP4 stably expressed with chaperones in 293 cells and used these antigens to immunize female A/J mice. Immunization with LRP4 protein caused mice to develop myasthenia having similar electrophysiological and histological features as are observed in MG patients with circulating Abs against muscle-specific kinase (MuSK). Our results clearly demonstrate that active immunization of mice with LRP4 proteins causes myasthenia similar to the MG induced by anti-MuSK Abs. Further experimental and clinical studies are required to prove the pathogenicity of anti-LRP4 Abs in MG patients. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  8. Human endogenous retrovirus K(HML-2) Gag and Env specific T-cell responses are not detected in HTLV-I-infected subjects using standard peptide screening methods.

    PubMed

    Jones, R Brad; Leal, Fabio E; Hasenkrug, Aaron M; Segurado, Aluisio C; Nixon, Douglas F; Ostrowski, Mario A; Kallas, Esper G

    2013-01-10

    An estimated 10-20 million individuals are infected with the retrovirus human T-cell leukemia virus type 1 (HTLV-1). While the majority of these individuals remain asymptomatic, 0.3-4% develop a neurodegenerative inflammatory disease, termed HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP). HAM/TSP results in the progressive demyelination of the central nervous system and is a differential diagnosis of multiple sclerosis (MS). The etiology of HAM/TSP is unclear, but evidence points to a role for CNS-inflitrating T-cells in pathogenesis. Recently, the HTLV-1-Tax protein has been shown to induce transcription of the human endogenous retrovirus (HERV) families W, H and K. Intriguingly, numerous studies have implicated these same HERV families in MS, though this association remains controversial. Here, we explore the hypothesis that HTLV-1-infection results in the induction of HERV antigen expression and the elicitation of HERV-specific T-cells responses which, in turn, may be reactive against neurons and other tissues. PBMC from 15 HTLV-1-infected subjects, 5 of whom presented with HAM/TSP, were comprehensively screened for T-cell responses to overlapping peptides spanning HERV-K(HML-2) Gag and Env. In addition, we screened for responses to peptides derived from diverse HERV families, selected based on predicted binding to predicted optimal epitopes. We observed a lack of responses to each of these peptide sets. Thus, although the limited scope of our screening prevents us from conclusively disproving our hypothesis, the current study does not provide data supporting a role for HERV-specific T-cell responses in HTLV-1 associated immunopathology.

  9. Memory and Specificity in the Insect Immune System: Current Perspectives and Future Challenges.

    PubMed

    Cooper, Dustin; Eleftherianos, Ioannis

    2017-01-01

    The immune response of a host to a pathogen is typically described as either innate or adaptive. The innate form of the immune response is conserved across all organisms, including insects. Previous and recent research has focused on the nature of the insect immune system and the results imply that the innate immune response of insects is more robust and specific than previously thought. Priming of the insect innate immune system involves the exposure of insects to dead or a sublethal dose of microbes in order to elicit an initial response. Comparing subsequent infections in primed insects to non-primed individuals indicates that the insect innate immune response may possess some of the qualities of an adaptive immune system. Although some studies demonstrate that the protective effects of priming are due to a "loitering" innate immune response, others have presented more convincing elements of adaptivity. While an immune mechanism capable of producing the same degree of recognition specificity as seen in vertebrates has yet to be discovered in insects, a few interesting cases have been identified and discussed.

  10. Vaccine-induced Human Antibodies Specific for the Third Variable Region of HIV-1 gp120 Impose Immune Pressure on Infecting Viruses

    PubMed Central

    Zolla-Pazner, Susan; Edlefsen, Paul T.; Rolland, Morgane; Kong, Xiang-Peng; deCamp, Allan; Gottardo, Raphael; Williams, Constance; Tovanabutra, Sodsai; Sharpe-Cohen, Sandra; Mullins, James I.; deSouza, Mark S.; Karasavvas, Nicos; Nitayaphan, Sorachai; Rerks-Ngarm, Supachai; Pitisuttihum, Punnee; Kaewkungwal, Jaranit; O'Connell, Robert J.; Robb, Merlin L.; Michael, Nelson L.; Kim, Jerome H.; Gilbert, Peter

    2014-01-01

    To evaluate the role of V3-specific IgG antibodies (Abs) in the RV144 clinical HIV vaccine trial, which reduced HIV-1 infection by 31.2%, the anti-V3 Ab response was assessed. Vaccinees' V3 Abs were highly cross-reactive with cyclic V3 peptides (cV3s) from diverse virus subtypes. Sieve analysis of CRF01_AE breakthrough viruses from 43 vaccine- and 66 placebo-recipients demonstrated an estimated vaccine efficacy of 85% against viruses with amino acids mismatching the vaccine at V3 site 317 (p = 0.004) and 52% against viruses matching the vaccine at V3 site 307 (p = 0.004). This analysis was supported by data showing that vaccinees' plasma Abs were less reactive with I307 when replaced with residues found more often in vaccinees' breakthrough viruses. Simultaneously, viruses with mutations at F317 were less infectious, possibly due to the contribution of F317 to optimal formation of the V3 hydrophobic core. These data suggest that RV144-induced V3-specific Abs imposed immune pressure on infecting viruses and inform efforts to design an HIV vaccine. PMID:25599085

  11. Maternal immune activation causes age- and region-specific changes in brain cytokines in offspring throughout development

    PubMed Central

    Garay, Paula A.; Hsiao, Elaine Y.; Patterson, Paul H.; McAllister, A. Kimberley

    2012-01-01

    Maternal infection is a risk factor for autism spectrum disorder (ASD) and schizophrenia (SZ). Indeed, modeling this risk factor in mice through maternal immune activation (MIA) causes ASD- and SZ-like neuropathologies and behaviors in the offspring. Although MIA upregulates pro-inflammatory cytokines in the fetal brain, whether MIA leads to long-lasting changes in brain cytokines during postnatal development remains unknown. Here, we tested this possibility by measuring protein levels of 23 cytokines in the blood and three brain regions from offspring of poly(I:C)- and saline-injected mice at five postnatal ages using multiplex arrays. Most cytokines examined are present in sera and brains throughout development. MIA induces changes in the levels of many cytokines in the brains and sera of offspring in a region- and age-specific manner. These MIA-induced changes follow a few, unexpected and distinct patterns. In frontal and cingulate cortices, several, mostly pro-inflammatory, cytokines are elevated at birth, followed by decreases during periods of synaptogenesis and plasticity, and increases again in the adult. Cytokines are also altered in postnatal hippocampus, but in a pattern distinct from the other regions. The MIA-induced changes in brain cytokines do not correlate with changes in serum cytokines from the same animals. Finally, these MIA-induced cytokine changes are not accompanied by breaches in the blood-brain barrier, immune cell infiltration or increases in microglial density. Together, these data indicate that MIA leads to long-lasting, region-specific changes in brain cytokines in offspring—similar to those reported for ASD and SZ—that may alter CNS development and behavior. PMID:22841693

  12. Cryo-thermal therapy elicits potent anti-tumor immunity by inducing extracellular Hsp70-dependent MDSC differentiation

    NASA Astrophysics Data System (ADS)

    Zhu, Jun; Zhang, Yan; Zhang, Aili; He, Kun; Liu, Ping; Xu, Lisa X.

    2016-06-01

    Achieving control of metastatic disease is a long-sought goal in cancer therapy. Treatments that encourage a patient’s own immune system are bringing new hopes in reaching such a goal. In clinic, local hyperthermia and cryoablation have been explored to induce anti-tumor immune responses against tumors. We have also developed a novel therapeutic modality of cryo-thermal treatment by alternating liquid nitrogen (LN2) cooling and radio frequency (RF) heating, and better therapeutic effect was achieved in treating metastatic cancer in animal model. In this study, we investigated the mechanism of systemic immune response elicited by cryo-thermal therapy. In the 4T1 murine mammary carcinoma model, we found that local cryo-thermal therapy resulted in a considerable reduction of distant lung metastases, and improved long-term survival. Moreover, results of tumor re-challenge experiments indicated generation of a strong tumor-specific immune memory after the local treatment of primary tumors. Our further study indicated that cryo-thermal therapy caused an elevated extracellular release of Hsp70. Subsequently, Hsp70 induced differentiation of MDSCs into mature DCs, contributing to the relief of MDSCs-mediated immunosuppression and ultimately the activation of strong anti-tumor immune response. Our findings reveal new insight into the mechanism of robust therapeutic effects of cryo-thermal therapy against metastatic cancers.

  13. Engineering HIV-Specific Immunity with Chimeric Antigen Receptors.

    PubMed

    Kitchen, Scott G; Zack, Jerome A

    2016-12-01

    HIV remains a highly important public health and clinical issue despite many recent advances in attempting to develop a cure, which has remained elusive for most people infected with HIV. HIV disease can be controlled with pharmacologic therapies; however, these treatments are expensive, may have severe side effects, and are not curative. Consequently, an improved means to control or eliminate HIV replication is needed. Cytotoxic T lymphocytes (CTLs) play a critical role in controlling viral replication and are an important part in the ability of the immune response to eradicate most viral infections. There are considerable efforts to enhance CTL responses in HIV-infected individuals in hopes of providing the immune response with armaments to more effectively control viral replication. In this review, we discuss some of these efforts and focus on the development of a gene therapy-based approach to engineer hematopoietic stem cells with an HIV-1-specific chimeric antigen receptor, which seeks to provide an inexhaustible source of HIV-1-specific immune cells that are MHC unrestricted and superior to natural antiviral T cell responses. These efforts provide the basis for further development of T cell functional enhancement to target and treat chronic HIV infection in hopes of eradicating the virus from the body.

  14. ERAP1 overexpression in HPV-induced malignancies: A possible novel immune evasion mechanism.

    PubMed

    Steinbach, Alina; Winter, Jan; Reuschenbach, Miriam; Blatnik, Renata; Klevenz, Alexandra; Bertrand, Miriam; Hoppe, Stephanie; von Knebel Doeberitz, Magnus; Grabowska, Agnieszka K; Riemer, Angelika B

    2017-01-01

    Immune evasion of tumors poses a major challenge for immunotherapy. For human papillomavirus (HPV)-induced malignancies, multiple immune evasion mechanisms have been described, including altered expression of antigen processing machinery (APM) components. These changes can directly influence epitope presentation and thus T-cell responses against tumor cells. To date, the APM had not been studied systematically in a large array of HPV + tumor samples. Therefore in this study, systematic expression analysis of the APM was performed on the mRNA and protein level in a comprehensive collection of HPV16 + cell lines. Subsequently, HPV + cervical tissue samples were examined by immunohistochemistry. ERAP1 (endoplasmic reticulum aminopeptidase 1) was the only APM component consistently altered - namely overexpressed - in HPV16 + tumor cell lines. ERAP1 was also found to be overexpressed in cervical intraepithelial neoplasia and cervical cancer samples; expression levels were increasing with disease stage. On the functional level, the influence of ERAP1 expression levels on HPV16 E7-derived epitope presentation was investigated by mass spectrometry and in cytotoxicity assays with HPV16-specific T-cell lines. ERAP1 overexpression did not cause a complete destruction of any of the HPV epitopes analyzed, however, an influence of ERAP1 overexpression on the presentation levels of certain HPV epitopes could be demonstrated by HPV16-specific CD8 + T-cells. These showed enhanced killing toward HPV16 + CaSki cells whose ERAP1 expression had been attenuated to normal levels. ERAP1 overexpression may thus represent a novel immune evasion mechanism in HPV-induced malignancies, in cases when presentation of clinically relevant epitopes is reduced by overactivity of this peptidase.

  15. Antigen-specific helper factors present in the supernatant of concanavalin A-induced spleen cell cultures.

    PubMed

    Kilburn, D G; Anaka, R

    1981-08-01

    The supernatants from cultures of concanavalin A-induced spleen cells contained both antigen-specific and nonspecific (Interleukin 2) helper factors (Hf). The antigen-specific factor could be isolated from the supernatant by adsorption onto and elution from antigen-Sepharose immunoadsorbents. Specific Hf was produced in cultures of either immune or nonimmune spleen cells although in the latter case the quantity of Hf was significantly less. The specific Hf did not manifest the thymocyte stimulatory property of 112.

  16. Immunization with apical membrane antigen 1 confers sterile infection-blocking immunity against Plasmodium sporozoite challenge in a rodent model.

    PubMed

    Schussek, Sophie; Trieu, Angela; Apte, Simon H; Sidney, John; Sette, Alessandro; Doolan, Denise L

    2013-10-01

    Apical membrane antigen 1 (AMA-1) is a leading blood-stage malaria vaccine candidate. Consistent with a key role in erythrocytic invasion, AMA-1-specific antibodies have been implicated in AMA-1-induced protective immunity. AMA-1 is also expressed in sporozoites and in mature liver schizonts where it may be a target of protective cell-mediated immunity. Here, we demonstrate for the first time that immunization with AMA-1 can induce sterile infection-blocking immunity against Plasmodium sporozoite challenge in 80% of immunized mice. Significantly higher levels of gamma interferon (IFN-γ)/interleukin-2 (IL-2)/tumor necrosis factor (TNF) multifunctional T cells were noted in immunized mice than in control mice. We also report the first identification of minimal CD8(+) and CD4(+) T cell epitopes on Plasmodium yoelii AMA-1. These data establish AMA-1 as a target of both preerythrocytic- and erythrocytic-stage protective immune responses and validate vaccine approaches designed to induce both cellular and humoral immunity.

  17. Cell-Specific Imd-NF-κB Responses Enable Simultaneous Antibacterial Immunity and Intestinal Epithelial Cell Shedding upon Bacterial Infection.

    PubMed

    Zhai, Zongzhao; Boquete, Jean-Philippe; Lemaitre, Bruno

    2018-05-03

    Intestinal infection triggers potent immune responses to combat pathogens and concomitantly drives epithelial renewal to maintain barrier integrity. Current models propose that epithelial renewal is primarily driven by damage caused by reactive oxygen species (ROS). Here we found that in Drosophila, the Imd-NF-κB pathway controlled enterocyte (EC) shedding upon infection, via a mechanism independent of ROS-associated apoptosis. Mechanistically, the Imd pathway synergized with JNK signaling to induce epithelial cell shedding specifically in the context of bacterial infection, requiring also the reduced expression of the transcription factor GATAe. Furthermore, cell-specific NF-κB responses enabled simultaneous production of antimicrobial peptides (AMPs) and epithelial shedding in different EC populations. Thus, the Imd-NF-κB pathway is central to the intestinal antibacterial response by mediating both AMP production and the maintenance of barrier integrity. Considering the similarities between Drosophila Imd signaling and mammalian TNFR pathway, our findings suggest the existence of an evolutionarily conserved genetic program in immunity-induced epithelial shedding. Copyright © 2018 Elsevier Inc. All rights reserved.

  18. RNA-sequencing analysis reveals abundant developmental stage-specific and immunity-related genes in the pollen beetle Meligethes aeneus.

    PubMed

    Vogel, H; Badapanda, C; Knorr, E; Vilcinskas, A

    2014-02-01

    The pollen beetle (Meligethes aeneus) is a major pest of oilseed rape (Brassica napus) and other cruciferous crops in Europe. Pesticide-resistant pollen beetle populations are emerging, increasing the economic impact of this species. We isolated total RNA from the larval and adult stages, the latter either naïve or immunized by injection with bacteria and yeast. High-throughput RNA sequencing (RNA-Seq) was carried out to establish a comprehensive transcriptome catalogue and to screen for developmental stage-specific and immunity-related transcripts. We assembled the transcriptome de novo by combining sequence tags from all developmental stages and treatments. Gene expression data based on normalized read counts revealed several functional gene categories that were differentially expressed between larvae and adults, particularly genes associated with digestion and detoxification that were induced in larvae, and genes associated with reproduction and environmental signalling that were induced in adults. We also identified many genes associated with microbe recognition, immunity-related signalling and defence effectors, such as antimicrobial peptides (AMPs) and lysozymes. Digital gene expression analysis revealed significant differences in the profile of AMPs expressed in larvae, naïve adults and immune-challenged adults, providing insight into the steady-state differences between developmental stages and the complex transcriptional remodelling that occurs following the induction of immunity. Our data provide insight into the adaptive mechanisms used by phytophagous insects and could lead to the development of more effective control strategies for insect pests. © 2013 The Royal Entomological Society.

  19. Polysaccharides Isolated from Açaí Fruit Induce Innate Immune Responses

    PubMed Central

    Holderness, Jeff; Schepetkin, Igor A.; Freedman, Brett; Kirpotina, Liliya N.; Quinn, Mark T.; Hedges, Jodi F.; Jutila, Mark A.

    2011-01-01

    The Açaí (Acai) fruit is a popular nutritional supplement that purportedly enhances immune system function. These anecdotal claims are supported by limited studies describing immune responses to the Acai polyphenol fraction. Previously, we characterized γδ T cell responses to both polyphenol and polysaccharide fractions from several plant-derived nutritional supplements. Similar polyphenol and polysaccharide fractions are found in Acai fruit. Thus, we hypothesized that one or both of these fractions could activate γδ T cells. Contrary to previous reports, we did not identify agonist activity in the polyphenol fraction; however, the Acai polysaccharide fraction induced robust γδ T cell stimulatory activity in human, mouse, and bovine PBMC cultures. To characterize the immune response to Acai polysaccharides, we fractionated the crude polysaccharide preparation and tested these fractions for activity in human PBMC cultures. The largest Acai polysaccharides were the most active in vitro as indicated by activation of myeloid and γδ T cells. When delivered in vivo, Acai polysaccharide induced myeloid cell recruitment and IL-12 production. These results define innate immune responses induced by the polysaccharide component of Acai and have implications for the treatment of asthma and infectious disease. PMID:21386979

  20. Microneedle-mediated immunization of an adenovirus-based malaria vaccine enhances antigen-specific antibody immunity and reduces anti-vector responses compared to the intradermal route.

    PubMed

    Carey, John B; Vrdoljak, Anto; O'Mahony, Conor; Hill, Adrian V S; Draper, Simon J; Moore, Anne C

    2014-08-21

    Substantial effort has been placed in developing efficacious recombinant attenuated adenovirus-based vaccines. However induction of immunity to the vector is a significant obstacle to its repeated use. Here we demonstrate that skin-based delivery of an adenovirus-based malaria vaccine, HAdV5-PyMSP1₄₂, to mice using silicon microneedles induces equivalent or enhanced antibody responses to the encoded antigen, however it results in decreased anti-vector responses, compared to intradermal delivery. Microneedle-mediated vaccine priming and resultant induction of low anti-vector antibody titres permitted repeated use of the same adenovirus vaccine vector. This resulted in significantly increased antigen-specific antibody responses in these mice compared to ID-treated mice. Boosting with a heterologous vaccine; MVA-PyMSP1₄₂ also resulted in significantly greater antibody responses in mice primed with HAdV5-PyMSP1₄₂ using MN compared to the ID route. The highest protection against blood-stage malaria challenge was observed when a heterologous route of immunization (MN/ID) was used. Therefore, microneedle-mediated immunization has potential to both overcome some of the logistic obstacles surrounding needle-and-syringe-based immunization as well as to facilitate the repeated use of the same adenovirus vaccine thereby potentially reducing manufacturing costs of multiple vaccines. This could have important benefits in the clinical ease of use of adenovirus-based immunization strategies.

  1. Microneedle-mediated immunization of an adenovirus-based malaria vaccine enhances antigen-specific antibody immunity and reduces anti-vector responses compared to the intradermal route

    PubMed Central

    Carey, John B.; Vrdoljak, Anto; O'Mahony, Conor; Hill, Adrian V. S.; Draper, Simon J.; Moore, Anne C.

    2014-01-01

    Substantial effort has been placed in developing efficacious recombinant attenuated adenovirus-based vaccines. However induction of immunity to the vector is a significant obstacle to its repeated use. Here we demonstrate that skin-based delivery of an adenovirus-based malaria vaccine, HAdV5-PyMSP142, to mice using silicon microneedles induces equivalent or enhanced antibody responses to the encoded antigen, however it results in decreased anti-vector responses, compared to intradermal delivery. Microneedle-mediated vaccine priming and resultant induction of low anti-vector antibody titres permitted repeated use of the same adenovirus vaccine vector. This resulted in significantly increased antigen-specific antibody responses in these mice compared to ID-treated mice. Boosting with a heterologous vaccine; MVA-PyMSP142 also resulted in significantly greater antibody responses in mice primed with HAdV5-PyMSP142 using MN compared to the ID route. The highest protection against blood-stage malaria challenge was observed when a heterologous route of immunization (MN/ID) was used. Therefore, microneedle-mediated immunization has potential to both overcome some of the logistic obstacles surrounding needle-and-syringe-based immunization as well as to facilitate the repeated use of the same adenovirus vaccine thereby potentially reducing manufacturing costs of multiple vaccines. This could have important benefits in the clinical ease of use of adenovirus-based immunization strategies. PMID:25142082

  2. The extent of the uptake of plasmid into the skin determines the immune responses induced by a DNA vaccine applied topically onto the skin

    PubMed Central

    Yu, Zhen; Chung, Woon-Gye; Sloat, Brian R.; Löhr, Christiane V.; Weiss, Richard; Rodriguez, B. Leticia; Li, Xinran; Cui, Zhengrong

    2011-01-01

    Objectives Non-invasive immunization by applying plasmid DNA topically onto the skin is an attractive immunization approach. However, the immune responses induced are generally weak. Previously, we showed that the antibody responses induced by topical DNA vaccine were significantly enhanced when hair follicles in the application area were induced into anagen (growth) stage by hair plucking. In the present study, we further investigated the mechanism of immune enhancement. Methods Three different methods, hair plucking or treatment with retinoic acid (RA) or O- tetradecanoylphorbol-13-acetate (TPA), were used to induce hair follicles into anagen stage before mice were dosed with a β-galactosidase-encoding plasmid, and the specific antibody responses induced were evaluated. Key findings The hair plucking method was more effective at enhancing the resultant antibody responses. Treatment with RA or TPA caused more damages to the skin and induced more severe local inflammations than hair plucking. However, hair plucking was most effective at enhancing the uptake or retention of the DNA in the application area. Conclusions The uptake of plasmid DNA in the application area correlated with the antibody responses induced by a topically applied DNA. PMID:21235583

  3. Global analysis of gene expression reveals mRNA superinduction is required for the inducible immune response to a bacterial pathogen

    PubMed Central

    Barry, Kevin C; Ingolia, Nicholas T; Vance, Russell E

    2017-01-01

    The inducible innate immune response to infection requires a concerted process of gene expression that is regulated at multiple levels. Most global analyses of the innate immune response have focused on transcription induced by defined immunostimulatory ligands, such as lipopolysaccharide. However, the response to pathogens involves additional complexity, as pathogens interfere with virtually every step of gene expression. How cells respond to pathogen-mediated disruption of gene expression to nevertheless initiate protective responses remains unclear. We previously discovered that a pathogen-mediated blockade of host protein synthesis provokes the production of specific pro-inflammatory cytokines. It remains unclear how these cytokines are produced despite the global pathogen-induced block of translation. We addressed this question by using parallel RNAseq and ribosome profiling to characterize the response of macrophages to infection with the intracellular bacterial pathogen Legionella pneumophila. Our results reveal that mRNA superinduction is required for the inducible immune response to a bacterial pathogen. DOI: http://dx.doi.org/10.7554/eLife.22707.001 PMID:28383283

  4. Interactions between nattokinase and heparin/GAGs

    PubMed Central

    Zhang, Fuming

    2015-01-01

    Nattokinase (NK) is a serine protease extracted from a traditional Japanese food called natto. Due to its strong fibrinolytic and thrombolytic activity, NK is regarded as a valuable dietary supplement or nutraceutical for the oral thrombolytic therapy. In addition, NK has been investigated for some other medical applications including treatment of hypertension, Alzheimer’s disease, and vitreoretinal disorders. The most widely used clinical anticoagulants are heparin and low molecular weight heparins. The interactions between heparin and proteins modulate a diverse patho-physiological processes and heparin modifies the activity of serine proteases. Indeed, heparin plays important roles in almost all of NK’s potential therapeutically applications. The current report relies on surface plasmon resonance spectroscopy to examine NK interacting with heparin as well as other glycosaminoglycans (GAGs). These studies showed that NK is a heparin binding protein with an affinity of ~250 nM. Examination with differently sized heparin oligosaccharides indicated that the interaction between NK and heparin is chain-length dependent and the minimum size for heparin binding is a hexasaccharide. Studies using chemically modified heparin showed the 6-O-sulfo as well as the N-sulfo groups but not the 2-O-sulfo groups within heparin, are essential for heparin’s interaction with NK. Other GAGs (including HS, DS, and CSE) displayed modest binding affinity to NK. NK also interfered with other heparin-protein interactions, including heparin’s interaction with antithrombin and fibroblast growth factors. PMID:26412225

  5. Exercise training and immune crosstalk in breast cancer microenvironment: exploring the paradigms of exercise-induced immune modulation and exercise-induced myokines.

    PubMed

    Goh, Jorming; Niksirat, Negin; Campbell, Kristin L

    2014-01-01

    Observational research suggests that exercise may reduce the risk of breast cancer and improve survival. One proposed mechanism for the protective effect of aerobic exercise related to cancer risk and outcomes, but has not been examined definitively, is the immune response to aerobic exercise. Two prevailing paradigms are proposed. The first considers the host immune response as modifiable by aerobic exercise training. This exercise-modulated immune-tumor crosstalk in the mammary microenvironment may alter the balance between tumor initiation and progression versus tumor suppression. The second paradigm considers the beneficial role of exercise-induced, skeletal muscle-derived cytokines, termed "myokines". These myokines exert endocrine-like effects on multiple organs, including the mammary glands. In this systematic review, we i) define the role of macrophages and T-cells in breast cancer initiation and progression; ii) address the two paradigms that support exercise-induced immunomodulation; iii) systematically assessed the literature for exercise intervention that assessed biomarkers relevant to both paradigms in human intervention trials of aerobic exercise training, in healthy women and women with breast cancer; iv) incorporated pre-clinical animal studies and non-RCTs for background discussion of putative mechanisms, through which aerobic exercise training modulates the immunological crosstalk, or the myokine-tumor interaction in the tumor microenvironment; and v) speculated on the potential biomarkers and mechanisms that define an exercise-induced, anti-tumor "signature", with a view toward developing relevant biomarkers for future aerobic exercise intervention trials.

  6. Drug evaluation: bevirimat--HIV Gag protein and viral maturation inhibitor.

    PubMed

    Temesgen, Zelalem; Feinberg, Judith E

    2006-08-01

    Panacos Pharmaceuticals Inc is developing the HIV Gag protein and viral maturation inhibitor bevirimat for the potential oral treatment of HIV infection. Phase II clinical trials are underway and phase III trials expected to commence in 2007.

  7. Nanoparticles, [Gd@C82(OH)22]n, induces dendritic cell maturation and activates Th1 immune responses

    PubMed Central

    Yang, De; Zhao, Yuliang; Guo, Hua; Li, Yana; Tewary, Poonam; Xing, Gengmei; Hou, Wei; Oppenheim, Joost J.; Zhang, Ning

    2010-01-01

    Dendritic cells play a pivotal role in host immune defense, such as elimination of foreign pathogen and inhibition of tumorigenesis. In this paper, we report that [Gd@C82(OH)22]n could induce phenotypic maturation of dendritic cells by stimulating DC production of cytokines including IL-12p70, upregulating DC costimulatory (CD80, CD83, and CD86) and MHC (HLA-A,B,C and HLA-DR) molecules, and switching DCs from a CCL5-responsive to a CCL19-responsive phenotype. We found that [Gd@C82(OH)22]n can induce dendritic cells to become functionally mature as illustrated by their capacity to activate allogeneic T cells. Mice immunized with ovalbumin in the presence of [Gd@C82(OH)22]n exhibit enhanced ovalbumin-specific Th1-polarized immune response as evidenced by the predominantly increased production of IFNγ, IL-1β, and IL-2. The [Gd@C82(OH)22]n nanoparticle is a potent activator of dendritic cells and Th1 immune responses. These new findings also provide a rational understanding of the potent anticancer activities of [Gd@C82(OH)22]n nanoparticles reported previously. PMID:20121217

  8. Sex-biased terminal investment in offspring induced by maternal immune challenge in the house wren (Troglodytes aedon).

    PubMed

    Bowers, E Keith; Smith, Rebecca A; Hodges, Christine J; Zimmerman, Laura M; Thompson, Charles F; Sakaluk, Scott K

    2012-07-22

    The reproductive costs associated with the upregulation of immunity have been well-documented and constitute a fundamental trade-off between reproduction and self-maintenance. However, recent experimental work suggests that parents may increase their reproductive effort following immunostimulation as a form of terminal parental investment as prospects for future reproduction decline. We tested the trade-off and terminal investment hypotheses in a wild population of house wrens (Troglodytes aedon) by challenging the immune system of breeding females with lipopolysaccharide, a potent but non-lethal antigen. Immunized females showed no evidence of reproductive costs; instead, they produced offspring of higher phenotypic quality, but in a sex-specific manner. Relative to control offspring, sons of immunized females had increased body mass and their sisters exhibited higher cutaneous immune responsiveness to phytohaemagglutinin injection, constituting an adaptive strategy of sex-biased allocation by immune-challenged females to enhance the reproductive value of their offspring. Thus, our results are consistent with the terminal investment hypothesis, and suggest that maternal immunization can induce pronounced transgenerational effects on offspring phenotypes.

  9. Modification of the dingman mouth gag for better visibility and access in the management of cleft palate.

    PubMed

    Rao, Latha P; Peter, Sherry

    2015-03-01

    Palatal and pharyngeal surgeries often require wide visibility and access. Various mouth gags and retractors have been devised and many modifications suggested to optimize these surgeries. The Dingman mouth gag, one of the commonly used retractors, offers a lot of advantages in terms of good mouth opening, tongue retraction, self-retaining cheek retractors, and anchorage for sutures, but it has a main limitation in that it allows only limited visibility of the anterior palate and alveolus. Hence, a modification of the Dingman mouth gag is presented for better visibility of and accessibility to the anterior palate.

  10. In vitro analysis of human immunodeficiency virus particle dissociation: gag proteolytic processing influences dissociation kinetics.

    PubMed

    Müller, Barbara; Anders, Maria; Reinstein, Jochen

    2014-01-01

    Human immunodeficiency virus particles undergo a step of proteolytic maturation, in which the main structural polyprotein Gag is cleaved into its mature subunits matrix (MA), capsid (CA), nucleocapsid (NC) and p6. Gag proteolytic processing is accompanied by a dramatic structural rearrangement within the virion, which is necessary for virus infectivity and has been proposed to proceed through a sequence of dissociation and reformation of the capsid lattice. Morphological maturation appears to be tightly regulated, with sequential cleavage events and two small spacer peptides within Gag playing important roles by regulating the disassembly of the immature capsid layer and formation of the mature capsid lattice. In order to measure the influence of individual Gag domains on lattice stability, we established Förster's resonance energy transfer (FRET) reporter virions and employed rapid kinetic FRET and light scatter measurements. This approach allowed us to measure dissociation properties of HIV-1 particles assembled in eukaryotic cells containing Gag proteins in different states of proteolytic processing. While the complex dissociation behavior of the particles prevented an assignment of kinetic rate constants to individual dissociation steps, our analyses revealed characteristic differences in the dissociation properties of the MA layer dependent on the presence of additional domains. The most striking effect observed here was a pronounced stabilization of the MA-CA layer mediated by the presence of the 14 amino acid long spacer peptide SP1 at the CA C-terminus, underlining the crucial role of this peptide for the resolution of the immature particle architecture.

  11. Human endogenous retrovirus expression is inversely related with the up-regulation of interferon-inducible genes in the skin of patients with lichen planus.

    PubMed

    Nogueira, Marcelle Almeida de Sousa; Gavioli, Camila Fátima Biancardi; Pereira, Nátalli Zanete; de Carvalho, Gabriel Costa; Domingues, Rosana; Aoki, Valéria; Sato, Maria Notomi

    2015-04-01

    Lichen planus (LP) is a common inflammatory skin disease of unknown etiology. Reports of a common transactivation of quiescent human endogenous retroviruses (HERVs) support the connection of viruses to the disease. HERVs are ancient retroviral sequences in the human genome and their transcription is often deregulated in cancer and autoimmune diseases. We explored the transcriptional activity of HERV sequences as well as the antiviral restriction factor and interferon-inducible genes in the skin from LP patients and healthy control (HC) donors. The study included 13 skin biopsies from patients with LP and 12 controls. Real-time PCR assay identified significant decrease in the HERV-K gag and env mRNA expression levels in LP subjects, when compared to control group. The expressions of HERV-K18 and HERV-W env were also inhibited in the skin of LP patients. We observed a strong correlation between HERV-K gag with other HERV sequences, regardless the down-modulation of transcripts levels in LP group. In contrast, a significant up-regulation of the cytidine deaminase APOBEC 3G (apolipoprotein B mRNA-editing), and the GTPase MxA (Myxovirus resistance A) mRNA expression level was identified in the LP skin specimens. Other transcript expressions, such as the master regulator of type I interferon-dependent immune responses, STING (stimulator of interferon genes) and IRF-7 (interferon regulatory factor 7), IFN-β and the inflammassome NALP3, had increased levels in LP, when compared to HC group. Our study suggests that interferon-inducible factors, in addition to their role in innate immunity against exogenous pathogens, contribute to the immune control of HERVs. Evaluation of the balance between HERV and interferon-inducible factor expression could possibly contribute to surveillance of inflammatory/malignant status of skin diseases.

  12. Antigen-Conjugated Human IgE Induces Antigen-Specific T Cell Tolerance in a Humanized Mouse Model

    PubMed Central

    Baravalle, Günther; Greer, Alexandra M.; LaFlam, Taylor N.; Shin, Jeoung-Sook

    2015-01-01

    Dendritic cells (DCs) play an important role in immune homeostasis through their ability to present Ags at steady state and mediate T cell tolerance. This characteristic renders DCs an attractive therapeutic target for the induction of tolerance against auto-antigens or allergens. Accordingly, Ag-conjugated DC–specific Abs have been proposed to be an excellent vehicle to deliver Ags to DCs for presentation and tolerance induction. However, this approach requires laborious reagent generation procedures and entails unpredictable side effects resulting from Ab-induced crosslinking of DC surface molecules. In this study, we examined whether IgE, a high-affinity, non–cross-linking natural ligand of FcεRI, could be used to target Ags to DCs and to induce Ag-specific T cell tolerance. We found that Ag-conjugated human IgE Fc domain (Fcε) effectively delivered Ags to DCs and enhanced Ag presentation by 1000- to 2500-fold in human FcεRIα-transgenic mice. Importantly, this presentation resulted in a systemic deletion of Ag-specific T cells and prevented these mice from developing delayed-type hypersensitivity, which is critically dependent on Ag-specific T cell immunity. Thus, targeting FcεRI on DCs via Ag-Fcε fusion protein may serve an alternative method to induce Ag-specific T cell tolerance in humans. PMID:24610015

  13. Coronary Angioplasty Induces Rise in Chlamydia pneumoniae-Specific Antibodies

    PubMed Central

    Tiran, Andreas; Tio, Rene A.; Ossewaarde, Jacobus M.; Tiran, Beate; den Heijer, Peter; The, T. Hauw; Wilders-Truschnig, Martie M.

    1999-01-01

    Chlamydia pneumoniae is frequently found in atherosclerotic lesions, and high titers of specific antibodies are associated with increased risk for acute myocardial infarction. However, a causative relation has not been established yet. We performed a prospective study of 93 patients undergoing percutaneous transluminal coronary angioplasty (PTCA) to investigate whether angioplasty influences Chlamydia-specific antibody titers and whether there is an association with restenosis. Blood samples were obtained before and 1 and 6 months after angioplasty. Antibodies against chlamydial lipopolysaccharide and against purified C. pneumoniae elementary bodies were measured by enzyme-linked immunosorbent assay (ELISA). After angioplasty, the prevalence of antibodies to lipopolysaccharide rose from 20 to 26% for immunoglobulin A (IgA), from 53 to 64% for IgG, and from 2 to 7% for IgM (P = 0.021, 0.004, and 0.046, respectively). There was a rapid increase of mean antibody titers of all antibody classes within 1 month of PTCA. During the following 5 months, antibody titers decreased slightly but were still higher than baseline values. Results of the C. pneumoniae-specific ELISA were essentially the same. The rise of anti-Chlamydia antibodies was not caused by unspecific reactivation of the immune system, as levels of antibodies against cytomegalovirus did not change. Neither seropositivity nor antibody titers were related to restenosis. However, increases in mean IgA and IgM titers were restricted to patients who had suffered from myocardial infarction earlier in their lives. In conclusion, we show that PTCA induces a stimulation of the humoral immune response against C. pneumoniae. These data support the idea that plaque disruption during angioplasty might make hidden chlamydial antigens accessible to the immune system. PMID:10074519

  14. Hantavirus Gc induces long-term immune protection via LAMP-targeting DNA vaccine strategy.

    PubMed

    Jiang, Dong-Bo; Zhang, Jin-Peng; Cheng, Lin-Feng; Zhang, Guan-Wen; Li, Yun; Li, Zi-Chao; Lu, Zhen-Hua; Zhang, Zi-Xin; Lu, Yu-Chen; Zheng, Lian-He; Zhang, Fang-Lin; Yang, Kun

    2018-02-01

    Hemorrhagic fever with renal syndrome (HFRS) occurs widely throughout Eurasia. Unfortunately, there is no effective treatment, and prophylaxis remains the best option against the major pathogenic agent, hantaan virus (HTNV), which is an Old World hantavirus. However, the absence of cellular immune responses and immunological memory hampers acceptance of the current inactivated HFRS vaccine. Previous studies revealed that a lysosome-associated membrane protein 1 (LAMP1)-targeting strategy involving a DNA vaccine based on the HTNV glycoprotein Gn successfully conferred long-term immunity, and indicated that further research on Gc, another HTNV antigen, was warranted. Plasmids encoding Gc and lysosome-targeted Gc, designated pVAX-Gc and pVAX-LAMP/Gc, respectively, were constructed. Proteins of interest were identified by fluorescence microscopy following cell line transfection. Five groups of 20 female BALB/c mice were subjected to the following inoculations: inactivated HTNV vaccine, pVAX-LAMP/Gc, pVAX-Gc, and, as the negative controls, pVAX-LAMP or the blank vector pVAX1. Humoral and cellular immunity were assessed by enzyme-linked immunosorbent assays (ELISAs) and 15-mer peptide enzyme-linked immunospot (ELISpot) epitope mapping assays. Repeated immunization with pVAX-LAMP/Gc enhanced adaptive immune responses, as demonstrated by the specific and neutralizing antibody titers and increased IFN-γ production. The inactivated vaccine induced a comparable humoral reaction, but the negative controls only elicited insignificant responses. Using a mouse model of HTNV challenge, the in vivo protection conferred by the inactivated vaccine and Gc-based constructs (with/without LAMP recombination) was confirmed. Evidence of pan-epitope reactions highlighted the long-term cellular response to the LAMP-targeting strategy, and histological observations indicated the safety of the LAMP-targeting vaccines. The long-term protective immune responses induced by pVAX-LAMP/Gc may be

  15. Does granisetron eliminate the gag reflex? A crossover, double-blind, placebo-controlled pilot study.

    PubMed

    Barenboim, Silvina Friedlander; Dvoyris, Vladislav; Kaufman, Eliezer

    2009-01-01

    Although gagging is a frequent problem that, when severe, can jeopardize the dental procedure, no single protocol is used to alleviate this phenomenon. Selective 5-HT3 antagonists, such as granisetron, may attenuate gagging. In this study, granisetron and placebo were administered intravenously, in a crossover, double-blind manner, to 25 healthy volunteers in 2 different sessions. Gagging levels were recorded before and after administration, as were BP, pulse, and O2 saturation. Recorded results were analyzed with the use of tests for nonparametric values (P = .05). A significant increase in the depth of swab insertion was noted after administration of both placebo and drug. The increase in drug effectiveness correlated with decreased body weight. The true efficacy of granisetron in gagger patients with this treatment protocol has yet to be fully established, although it has been theorized that an increased dosage of granisetron may have a better effect.

  16. Does Granisetron Eliminate the Gag Reflex? A Crossover, Double-Blind, Placebo-Controlled Pilot Study

    PubMed Central

    Friedlander Barenboim, Silvina; Dvoyris, Vladislav; Kaufman, Eliezer

    2009-01-01

    Although gagging is a frequent problem that, when severe, can jeopardize the dental procedure, no single protocol is used to alleviate this phenomenon. Selective 5-HT3 antagonists, such as granisetron, may attenuate gagging. In this study, granisetron and placebo were administered intravenously, in a crossover, double-blind manner, to 25 healthy volunteers in 2 different sessions. Gagging levels were recorded before and after administration, as were BP, pulse, and O2 saturation. Recorded results were analyzed with the use of tests for nonparametric values (P = .05). A significant increase in the depth of swab insertion was noted after administration of both placebo and drug. The increase in drug effectiveness correlated with decreased body weight. The true efficacy of granisetron in gagger patients with this treatment protocol has yet to be fully established, although it has been theorized that an increased dosage of granisetron may have a better effect. PMID:19562886

  17. Polymorphisms in HLA-DPB1 Are Associated With Differences in Rubella Virus–Specific Humoral Immunity After Vaccination

    PubMed Central

    Lambert, Nathaniel D.; Haralambieva, Iana H.; Kennedy, Richard B.; Ovsyannikova, Inna G.; Pankratz, Vernon Shane; Poland, Gregory A.

    2015-01-01

    Vaccination with live attenuated rubella virus induces a strong immune response in most individuals. However, small numbers of subjects never reach or maintain protective antibody levels, and there is a high degree of variability in immune response. We have previously described genetic polymorphisms in HLA and other candidate genes that are associated with interindividual differences in humoral immunity to rubella virus. To expand our previous work, we performed a genome-wide association study (GWAS) to discover single-nucleotide polymorphisms (SNPs) associated with rubella virus–specific neutralizing antibodies. We identified rs2064479 in the HLA-DPB1 genetic region as being significantly associated with humoral immune response variations after rubella vaccination (P = 8.62 × 10−8). All other significant SNPs in this GWAS were located near the HLA-DPB1 gene (P ≤ 1 × 10−7). These findings demonstrate that polymorphisms in HLA-DPB1 are strongly associated with interindividual differences in neutralizing antibody levels to rubella vaccination and represent a validation of our previous HLA work. PMID:25293367

  18. Immune mechanisms induced by an HSV-1 mutant strain: Discrepancy analysis of the immune system gene profile in comparison with a wild-type strain.

    PubMed

    Zhang, Xiaolong; Jiang, Quanlong; Xu, Xingli; Wang, Yongrong; Liu, Lei; Lian, Yaru; Li, Hao; Wang, Lichun; Zhang, Ying; Jiang, Guorun; Zeng, Jieyuan; Zhang, Han; Han, Jing-Dong Jackie; Li, Qihan

    2018-04-25

    Herpes simplex virus is a prevalent pathogen of humans of various age groups. The fact that no prophylactic or therapeutic vaccine is currently available suggests a significant need to further investigate the immune mechanisms induced by the virus and various vaccine candidates. We previously generated an HSV-1 mutant strain, M3, with partial deletions in ul7, ul41 and LAT that produced an attenuated phenotype in mice. In the present study, we performed a comparative analysis to characterize the immune responses induced by M3 versus wild-type HSV-1 in a mouse model. Infection with wild-type HSV-1 triggered an inflammatory-dominated response and adaptive immunity suppression and was accompanied by severe pathological damage. In contrast, infection with M3 induced a systematic immune response involving full activation of both innate and adaptive immunity and was accompanied by no obvious pathological changes. Furthermore, the immune response induced by M3 protected mice from lethal challenge with wild-type strains of HSV-1 and restrained virus proliferation and impaired latency. These data are useful for further HSV-1 vaccine development using a mutant strain construction strategy. Copyright © 2018 Elsevier Ltd. All rights reserved.

  19. Targeting with bovine CD154 enhances humoral immune responses induced by a DNA vaccine in sheep.

    PubMed

    Manoj, Sharmila; Griebel, Philip J; Babiuk, Lorne A; van Drunen Littel-van den Hurk, Sylvia

    2003-01-15

    CD40-CD154 interactions play an important role in regulating humoral and cell-mediated immune responses. Recently, these interactions have been exploited for the development of therapeutic and preventive treatments. The objective of this study was to test the ability of bovine CD154 to target a plasmid-encoded Ag to CD40-expressing APCs. To achieve this, a plasmid coding for bovine CD154 fused to a truncated secreted form of bovine herpesvirus 1 glycoprotein D (tgD), pSLIAtgD-CD154, was constructed. The chimeric tgD-CD154 was expressed in vitro in COS-7 cells and reacted with both glycoprotein D- and CD154-specific Abs. Both tgD and tgD-CD154 were capable of binding to epithelial cells, whereas only tgD-CD154 bound to B cells. Furthermore, dual-labeling of ovine PBMCs revealed that tgD-CD154 was bound by primarily B cells. The functional integrity of the tgD-CD154 chimera was confirmed by the induction of both IL-4-dependent B cell proliferation and tgD-specific lymphoproliferative responses in vitro. Finally, sheep immunized with pSLIAtgD-CD154 developed a more rapid primary tgD-specific Ab response and a significantly stronger tgD-specific secondary response when compared with animals immunized with pSLIAtgD and control animals. Similarly, virus-neutralizing Ab titers were significantly higher after secondary immunization with pSLIAtgD-CD154. These results demonstrate that using CD154 to target plasmid-expressed Ag can significantly enhance immune responses induced by a DNA vaccine.

  20. Gut Immune Maturation Depends on Colonization with a Host-Specific Microbiota

    PubMed Central

    Chung, Hachung; Pamp, Sünje J.; Hill, Jonathan A.; Surana, Neeraj K.; Edelman, Sanna M.; Troy, Erin B.; Reading, Nicola C.; Villablanca, Eduardo J.; Wang, Sen; Mora, Jorge R.; Umesaki, Yoshinori; Mathis, Diane; Benoist, Christophe; Relman, David A.; Kasper, Dennis L.

    2012-01-01

    SUMMARY Gut microbial induction of host immune maturation exemplifies host-microbe mutualism. We colonized germ-free (GF) mice with mouse microbiota (MMb) or human microbiota (HMb) to determine whether small intestinal immune maturation depends on a coevolved host-specific microbiota. Gut bacterial numbers and phylum abundance were similar in MMb and HMb mice, but bacterial species differed, especially the Firmicutes. HMb mouse intestines had low levels of CD4+ and CD8+ T cells, few proliferating T cells, few dendritic cells, and low antimicrobial peptide expression–all characteristics of GF mice. Rat microbiota also failed to fully expand intestinal T cell numbers in mice. Colonizing GF or HMb mice with mouse-segmented filamentous bacteria (SFB) partially restored T cell numbers, suggesting that SFB and other MMb organisms are required for full immune maturation in mice. Importantly, MMb conferred better protection against Salmonella infection than HMb. A host-specific microbiota appears to be critical for a healthy immune system. PMID:22726443

  1. The impact of strain-specific immunity on Lyme disease incidence is spatially heterogeneous.

    PubMed

    Khatchikian, Camilo E; Nadelman, Robert B; Nowakowski, John; Schwartz, Ira; Wormser, Gary P; Brisson, Dustin

    2017-12-01

    Lyme disease, caused by the bacterium Borrelia burgdorferi, is the most common tick-borne infection in the US. Recent studies have demonstrated that the incidence of human Lyme disease would have been even greater were it not for the presence of strain-specific immunity, which protects previously infected patients against subsequent infections by the same B. burgdorferi strain. Here, spatial heterogeneity is incorporated into epidemiological models to accurately estimate the impact of strain-specific immunity on human Lyme disease incidence. The estimated reduction in the number of Lyme disease cases is greater in epidemiologic models that explicitly include the spatial distribution of Lyme disease cases reported at the county level than those that utilize nationwide data. strain-specific immunity has the greatest epidemiologic impact in geographic areas with the highest Lyme disease incidence due to the greater proportion of people that have been previously infected and have developed strain-specific immunity. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Characterization of the immune response to canine parvovirus induced by vaccination with chimaeric plant viruses.

    PubMed

    Nicholas, Benjamin L; Brennan, F R; Martinez-Torrecuadrada, J L; Casal, J I; Hamilton, W D; Wakelin, D

    2002-06-21

    NIH mice were vaccinated subcutaneously or intranasally with chimaeric cow pea mosaic virus (CPMV) constructs expressing a 17-mer peptide sequence from canine parvovirus (CPV) as monomers or dimers on the small or large protein surface subunits. Responses to the chimaeric virus particles (CVPs) were compared with those of mice immunized with the native virus or with parvovirus peptide conjugated to keyhole limpet haemocyanin (KLH). The characteristics of the immune response to vaccination were examined by measuring serum and mucosal antibody responses in ELISA, in vitro antigen-induced spleen cell proliferation and cytokine responses. Mice made strong antibody responses to the native plant virus and peptide-specific responses to two of the four CVP constructs tested which were approximately 10-fold lower than responses to native plant virus. The immune response generated by the CVP constructs showed a marked TH1 bias, as determined by a predominantly IgG(2a) isotype peptide-specific antibody response and the release of IFN-gamma but not IL-4 or IL-5 from lymphocytes exposed to antigen in vitro. In comparison, parvovirus peptide conjugated to KLH generated an IgG(1)-biased (TH2) response. These data indicate that the presentation of peptides on viral particles could be used to bias the immune response in favor of a TH1 response.Anti-viral and anti-peptide IgA were detected in intestinal and bronchial lavage fluid of immunized mice, demonstrating that a mucosal immune response to CPV can be generated by systemic and mucosal immunization with CVP vaccines. Serum antibody from both subcutaneously-vaccinated and intranasally-vaccinated mice showed neutralizing activity against CPV in vitro.

  3. STRESS-INDUCED REDISTRIBUTION OF IMMUNE CELLS - FROM BARRACKS TO BOULEVARDS TO BATTLEFIELDS: A TALE OF THREE HORMONES - CURT RICHTER AWARD WINNER

    PubMed Central

    Dhabhar, Firdaus S.; Malarkey, William B.; Neri, Eric; McEwen, Bruce S.

    2012-01-01

    Background The surveillance and effector functions of the immune system are critically dependent on the appropriate distribution of immune cells in the body. An acute or short-term stress response induces a rapid and significant redistribution of immune cells among different body compartments. Stress-induced leukocyte redistribution may be a fundamental survival response that directs leukocyte subpopulations to specific target organs during stress, and significantly enhances the speed, efficacy and regulation of an immune response. Immune responses are generally enhanced in compartments (e.g., skin) that are enriched with leukocytes, and suppressed in compartments that are depleted of leukocytes during/following stress. The experiments described here were designed to elucidate the: 1) Time-course, trajectory, and subpopulation-specificity of stress-induced mobilization and trafficking of blood leukocytes. 2) Individual and combined actions of the principal stress hormones, norepinephrine (NE), epinephrine (EPI), and corticosterone (CORT), in mediating mobilization or trafficking of specific leukocyte subpopulations. 3) Effects of stress/stress hormones on adhesion molecule, L-selectin (CD62L), expression by each subpopulation to assess its adhesion / functional / maturation status. Methods Male Sprague Dawley rats were stressed (short-term restraint, 2–120 min), or adrenalectomized and injected with vehicle (VEH), NE, EPI, CORT, or their combinations, and blood was collected for measurement of hormones and flow cytometric quantification of leukocyte subpopulations. Results Acute stress induced an early increase/mobilization of neutrophils, lymphocytes, helper T cells (Th), cytolytic T cells (CTL), and B cells into the blood, followed by a decrease/trafficking of all cell types out of the blood, except neutrophil numbers that continued to increase. CD62L expression was increased on neutrophils, decreased on Th, CTL, and natural killer (NK) cells, and showed a

  4. Antigen-specific response of murine immune system toward a yeast beta-glucan preparation, zymosan.

    PubMed

    Miura, T; Ohno, N; Miura, N N; Adachi, Y; Shimada, S; Yadomae, T

    1999-06-01

    Zymosan, a particulate beta-glucan preparation from Saccharomyces cerevisiae, shows various biological activities, including anti-tumor activity. We have previously shown that soluble beta-glucan initiated anti-tumor activity was long-lived and was effective even by prophylactic treatment at 1 month prior to tumor challenge. However, the activity by zymosan was relatively short-lived. Antigen-specific responses of mice to zymosan might be a causative mechanism. In this paper, mice were immunized with zymosan and antibody production and antigen-specific responses of lymphocytes to zymosan were analyzed. Sera of zymosan immune mice contained zymosan-specific IgG assessed by enzyme-linked immunosorbent assay and FACS. Spleen and bone marrow cells of zymosan-immune mice showed higher cytokine production in response to zymosan. Specificity of zymosan-specific responses were also analyzed using various derivatives prepared from zymosan. These facts strongly suggested that mice recognize zymosan as antigen in addition to non-specific immune stimulant.

  5. Deceptive Imprinting and Immune Refocusing in Vaccine Design

    USDA-ARS?s Scientific Manuscript database

    A large number of the world’s most widespread and problematic pathogens evade host immune responses by inducing strain specific immunity to immunodominant epitopes with high mutation rates capable of altering antigenic profiles. The immune system appears to be decoyed into reacting to these immunod...

  6. Modified vaccinia virus Ankara encoding influenza virus hemagglutinin induces heterosubtypic immunity in macaques.

    PubMed

    Florek, Nicholas W; Weinfurter, Jason T; Jegaskanda, Sinthujan; Brewoo, Joseph N; Powell, Tim D; Young, Ginger R; Das, Subash C; Hatta, Masato; Broman, Karl W; Hungnes, Olav; Dudman, Susanne G; Kawaoka, Yoshihiro; Kent, Stephen J; Stinchcomb, Dan T; Osorio, Jorge E; Friedrich, Thomas C

    2014-11-01

    Current influenza virus vaccines primarily aim to induce neutralizing antibodies (NAbs). Modified vaccinia virus Ankara (MVA) is a safe and well-characterized vector for inducing both antibody and cellular immunity. We evaluated the immunogenicity and protective efficacy of MVA encoding influenza virus hemagglutinin (HA) and/or nucleoprotein (NP) in cynomolgus macaques. Animals were given 2 doses of MVA-based vaccines 4 weeks apart and were challenged with a 2009 pandemic H1N1 isolate (H1N1pdm) 8 weeks after the last vaccination. MVA-based vaccines encoding HA induced potent serum antibody responses against homologous H1 or H5 HAs but did not stimulate strong T cell responses prior to challenge. However, animals that received MVA encoding influenza virus HA and/or NP had high frequencies of virus-specific CD4(+) and CD8(+) T cell responses within the first 7 days of H1N1pdm infection, while animals vaccinated with MVA encoding irrelevant antigens did not. We detected little or no H1N1pdm replication in animals that received vaccines encoding H1 (homologous) HA, while a vaccine encoding NP from an H5N1 isolate afforded no protection. Surprisingly, H1N1pdm viral shedding was reduced in animals vaccinated with MVA encoding HA and NP from an H5N1 isolate. This reduced shedding was associated with cross-reactive antibodies capable of mediating antibody-dependent cellular cytotoxicity (ADCC) effector functions. Our results suggest that ADCC plays a role in cross-protective immunity against influenza. Vaccines optimized to stimulate cross-reactive antibodies with ADCC function may provide an important measure of protection against emerging influenza viruses when NAbs are ineffective. Current influenza vaccines are designed to elicit neutralizing antibodies (NAbs). Vaccine-induced NAbs typically are effective but highly specific for particular virus strains. Consequently, current vaccines are poorly suited for preventing the spread of newly emerging pandemic viruses

  7. Modified Vaccinia Virus Ankara Encoding Influenza Virus Hemagglutinin Induces Heterosubtypic Immunity in Macaques

    PubMed Central

    Florek, Nicholas W.; Weinfurter, Jason T.; Jegaskanda, Sinthujan; Brewoo, Joseph N.; Powell, Tim D.; Young, Ginger R.; Das, Subash C.; Hatta, Masato; Broman, Karl W.; Hungnes, Olav; Dudman, Susanne G.; Kawaoka, Yoshihiro; Kent, Stephen J.; Stinchcomb, Dan T.

    2014-01-01

    ABSTRACT Current influenza virus vaccines primarily aim to induce neutralizing antibodies (NAbs). Modified vaccinia virus Ankara (MVA) is a safe and well-characterized vector for inducing both antibody and cellular immunity. We evaluated the immunogenicity and protective efficacy of MVA encoding influenza virus hemagglutinin (HA) and/or nucleoprotein (NP) in cynomolgus macaques. Animals were given 2 doses of MVA-based vaccines 4 weeks apart and were challenged with a 2009 pandemic H1N1 isolate (H1N1pdm) 8 weeks after the last vaccination. MVA-based vaccines encoding HA induced potent serum antibody responses against homologous H1 or H5 HAs but did not stimulate strong T cell responses prior to challenge. However, animals that received MVA encoding influenza virus HA and/or NP had high frequencies of virus-specific CD4+ and CD8+ T cell responses within the first 7 days of H1N1pdm infection, while animals vaccinated with MVA encoding irrelevant antigens did not. We detected little or no H1N1pdm replication in animals that received vaccines encoding H1 (homologous) HA, while a vaccine encoding NP from an H5N1 isolate afforded no protection. Surprisingly, H1N1pdm viral shedding was reduced in animals vaccinated with MVA encoding HA and NP from an H5N1 isolate. This reduced shedding was associated with cross-reactive antibodies capable of mediating antibody-dependent cellular cytotoxicity (ADCC) effector functions. Our results suggest that ADCC plays a role in cross-protective immunity against influenza. Vaccines optimized to stimulate cross-reactive antibodies with ADCC function may provide an important measure of protection against emerging influenza viruses when NAbs are ineffective. IMPORTANCE Current influenza vaccines are designed to elicit neutralizing antibodies (NAbs). Vaccine-induced NAbs typically are effective but highly specific for particular virus strains. Consequently, current vaccines are poorly suited for preventing the spread of newly emerging

  8. Immunizations with chimeric hepatitis B virus-like particles to induce potential anti-hepatitis C virus neutralizing antibodies.

    PubMed

    Vietheer, Patricia T K; Boo, Irene; Drummer, Heidi E; Netter, Hans-Jürgen

    2007-01-01

    Virus-like particles (VLPs) are highly immunogenic and proven to induce protective immunity. The small surface antigen (HBsAg-S) of hepatitis B virus (HBV) self-assembles into VLPs and its use as a vaccine results in protective antiviral immunity against HBV infections. Chimeric HBsAg-S proteins carrying foreign epitopes allow particle formation and have the ability to induce anti-foreign humoral and cellular immune responses. The insertion of the hypervariable region 1 (HVR1) sequence derived from the envelope protein 2 (E2) of hepatitis C virus (HCV) into the major antigenic site of HBsAg-S ('a'-determinant) resulted in the formation of highly immunogenic VLPs that retained the antigenicity of the inserted HVR1 sequence. BALB/c mice were immunized with chimeric VLPs, which resulted in antisera with anti-HCV activity. The antisera were able to immunoprecipitate native HCV envelope complexes (E1E2) containing homologous or heterologous HVR1 sequences. HCV E1E2 pseudotyped HIV-1 particles (HCVpp) were used to measure entry into HuH-7 target cells in the presence or absence of antisera that were raised against chimeric VLPs. Anti-HVR1 VLP sera interfered with entry of entry-competent HCVpps containing either homologous or heterologous HVR1 sequences. Also, immunizations with chimeric VLPs induced antisurface antigen (HBsAg) antibodies, indicating that HBV-specific antigenicity and immunogenicity of the 'a'-determinant region is retained. A multivalent vaccine against different pathogens based on the HBsAg delivery platform should be possible. We hypothesize that custom design of VLPs with an appropriate set of HCV-neutralizing epitopes will induce antibodies that would serve to decrease the viral load at the initial infecting inoculum.

  9. Bacterial Outer Membrane Vesicles Induce Plant Immune Responses.

    PubMed

    Bahar, Ofir; Mordukhovich, Gideon; Luu, Dee Dee; Schwessinger, Benjamin; Daudi, Arsalan; Jehle, Anna Kristina; Felix, Georg; Ronald, Pamela C

    2016-05-01

    Gram-negative bacteria continuously pinch off portions of their outer membrane, releasing membrane vesicles. These outer membrane vesicles (OMVs) are involved in multiple processes including cell-to-cell communication, biofilm formation, stress tolerance, horizontal gene transfer, and virulence. OMVs are also known modulators of the mammalian immune response. Despite the well-documented role of OMVs in mammalian-bacterial communication, their interaction with plants is not well studied. To examine whether OMVs of plant pathogens modulate the plant immune response, we purified OMVs from four different plant pathogens and used them to treat Arabidopsis thaliana. OMVs rapidly induced a reactive oxygen species burst, medium alkalinization, and defense gene expression in A. thaliana leaf discs, cell cultures, and seedlings, respectively. Western blot analysis revealed that EF-Tu is present in OMVs and that it serves as an elicitor of the plant immune response in this form. Our results further show that the immune coreceptors BAK1 and SOBIR1 mediate OMV perception and response. Taken together, our results demonstrate that plants can detect and respond to OMV-associated molecules by activation of their immune system, revealing a new facet of plant-bacterial interactions.

  10. Screening Immunomodulators To Skew the Antigen-Specific Autoimmune Response.

    PubMed

    Northrup, Laura; Sullivan, Bradley P; Hartwell, Brittany L; Garza, Aaron; Berkland, Cory

    2017-01-03

    Current therapies to treat autoimmune diseases often result in side effects such as nonspecific immunosuppression. Therapies that can induce antigen-specific immune tolerance provide an opportunity to reverse autoimmunity and mitigate the risks associated with global immunosuppression. In an effort to induce antigen-specific immune tolerance, co-administration of immunomodulators with autoantigens has been investigated in an effort to reprogram autoimmunity. To date, identifying immunomodulators that may skew the antigen-specific immune response has been ad hoc at best. To address this need, we utilized splenocytes obtained from mice with experimental autoimmune encephalomyelitis (EAE) in order to determine if certain immunomodulators may induce markers of immune tolerance following antigen rechallenge. Of the immunomodulatory compounds investigated, only dexamethasone modified the antigen-specific immune response by skewing the cytokine response and decreasing T-cell populations at a concentration corresponding to a relevant in vivo dose. Thus, antigen-educated EAE splenocytes provide an ex vivo screen for investigating compounds capable of skewing the antigen-specific immune response, and this approach could be extrapolated to antigen-educated cells from other diseases or human tissues.

  11. CARs: Driving T-cell specificity to enhance anti-tumor immunity

    PubMed Central

    Kebriaei, Partow; Kelly, Susan S.; Manuri, Pallavi; Jena, Bipulendu; Jackson, Rineka; Shpall, Elizabeth; Champlin, Richard; Cooper, Laurence J. N.

    2013-01-01

    Adoptive transfer of antigen-specific T cells is a compelling tool to treat cancer. To overcome issues of immune tolerance which limits the endogenous adaptive immune response to tumor-associated antigens, robust systems for the genetic modification and characterization of T cells expressing chimeric antigen receptors (CARs) to redirect specificity have been produced. Refinements with regards to persistence and trafficking of the genetically modified T cells are underway to help improve the potency of genetically modified T cells. Clinical trials utilizing this technology demonstrate feasibility, and increasingly, antitumor activity, paving the way for multi-center trials to establish the efficacy of this novel T-cell therapy. PMID:22202074

  12. Toll-like receptor-5 agonist, entolimod, suppresses metastasis and induces immunity by stimulating an NK-dendritic-CD8+ T-cell axis

    PubMed Central

    Brackett, Craig M.; Kojouharov, Bojidar; Veith, Jean; Greene, Kellee F.; Burdelya, Lyudmila G.; Gollnick, Sandra O.; Abrams, Scott I.; Gudkov, Andrei V.

    2016-01-01

    Activation of an anticancer innate immune response is highly desirable because of its inherent ability to generate an adaptive antitumor T-cell response. However, insufficient safety of innate immune modulators limits clinical use to topical applications. Toll-like receptor 5 (TLR5) agonists are favorably positioned as potential systemic immunotherapeutic agents because of unusual tissue specificity of expression, uniquely safe profile of induced cytokines, and antitumor efficacy demonstrated in a number of animal models. Here, we decipher the molecular and cellular events underlying the metastasis suppressive activity of entolimod, a clinical stage TLR5 agonist that activates NF-κB–, AP-1–, and STAT3–driven immunomodulatory signaling pathways specifically within the liver. Used as a single agent in murine colon and mammary metastatic cancer models, entolimod rapidly induces CXCL9 and -10 that support homing of blood-borne CXCR3-expressing NK cells to the liver predominantly through an IFN-γ signaling independent mechanism. NK cell-dependent activation of dendritic cells is followed by stimulation of a CD8+ T-cell response, which exert both antimetastatic effect of entolimod and establishment of tumor-specific and durable immune memory. These results define systemically administered TLR5 agonists as organ-specific immunoadjuvants, enabling efficient antitumor vaccination that does not depend on identification of tumor-specific antigens. PMID:26831100

  13. Specificity in the immunosuppression induced by avian reticuloendotheliosis virus.

    PubMed Central

    Walker, M H; Rup, B J; Rubin, A S; Bose, H R

    1983-01-01

    Several parameters of the cellular and humoral immune responses of chickens infected with reticuloendotheliosis virus (REV-T), an avian defective acute leukemia virus, or with its helper virus, reticuloendotheliosis-associated virus (REV-A), were evaluated. Spleen cells from chickens infected with REV-T (REV-A) or REV-A exhibited depressed mixed lymphocyte and mitogen responses in vitro. Allograft rejection was delayed by 6 to 14 days in birds infected with REV-A. The specific antitumor cell immune response was also studied by a 51Cr-release cytotoxicity assay. Lymphocytes from chickens infected with low numbers of the REV-T-transformed cells exhibited significant levels of cytolytic reactivity against the 51Cr-labeled REV-T tumor cells in vitro. The mitogen response of lymphocytes from these injected birds was similar to that of uninjected chickens. In contrast, lymphocytes from chickens injected with higher numbers of REV-T-transformed cells exhibited suppressed mitogen reactivity and failed to develop detectable levels of cytotoxic activity directed against the REV-T tumor cells. These results suggest that the general depression of cellular immune competence which occurs during REV-T (REV-A) infection could contribute to the development of this acute leukemia by inhibiting the proliferation of cytotoxic cells directed against the tumor cell antigens. The cytotoxic effect observed after the injection of chickens with non-immunosuppressive levels of REV-T-transformed cells appears to be specific for the REV-T tumor cell antigens since cells transformed by Marek's disease virus or avian erythroblastosis virus were not lysed. In marked contrast, birds whose cellular immune responses were suppressed by infection with REV-A were capable of producing a humoral immune response to viral antigens. Detectable levels of viral antibody, however, did not appear until 12 to 15 days after REV-A infection. Since REV-T (REV-A) induced an acute leukemia resulting in death within 7

  14. Protective Immunity and Reduced Renal Colonization Induced by Vaccines Containing Recombinant Leptospira interrogans Outer Membrane Proteins and Flagellin Adjuvant

    PubMed Central

    Monaris, D.; Sbrogio-Almeida, M. E.; Dib, C. C.; Canhamero, T. A.; Souza, G. O.; Vasconcellos, S. A.; Ferreira, L. C. S.

    2015-01-01

    Leptospirosis is a global zoonotic disease caused by different Leptospira species, such as Leptospira interrogans, that colonize the renal tubules of wild and domestic animals. Thus far, attempts to develop effective leptospirosis vaccines, both for humans and animals, have failed to induce immune responses capable of conferring protection and simultaneously preventing renal colonization. In this study, we evaluated the protective immunity induced by subunit vaccines containing seven different recombinant Leptospira interrogans outer membrane proteins, including the carboxy-terminal portion of the immunoglobulinlike protein A (LigAC) and six novel antigens, combined with aluminum hydroxide (alum) or Salmonella flagellin (FliC) as adjuvants. Hamsters vaccinated with the different formulations elicited high antigen-specific antibody titers. Immunization with LigAC, either with alum or flagellin, conferred protective immunity but did not prevent renal colonization. Similarly, animals immunized with LigAC or LigAC coadministered with six leptospiral proteins with alum adjuvant conferred protection but did not reduce renal colonization. In contrast, immunizing animals with the pool of seven antigens in combination with flagellin conferred protection and significantly reduced renal colonization by the pathogen. The present study emphasizes the relevance of antigen composition and added adjuvant in the efficacy of antileptospirosis subunit vaccines and shows the complex relationship between immune responses and renal colonization by the pathogen. PMID:26108285

  15. Prior Population Immunity Reduces the Expected Impact of CTL-Inducing Vaccines for Pandemic Influenza Control

    PubMed Central

    Bolton, Kirsty J.; McCaw, James M.; Brown, Lorena; Jackson, David; Kedzierska, Katherine; McVernon, Jodie

    2015-01-01

    Vaccines that trigger an influenza-specific cytotoxic T cell (CTL) response may aid pandemic control by limiting the transmission of novel influenza A viruses (IAV). We consider interventions with hypothetical CTL-inducing vaccines in a range of epidemiologically plausible pandemic scenarios. We estimate the achievable reduction in the attack rate, and, by adopting a model linking epidemic progression to the emergence of IAV variants, the opportunity for antigenic drift. We demonstrate that CTL-inducing vaccines have limited utility for modifying population-level outcomes if influenza-specific T cells found widely in adults already suppress transmission and prove difficult to enhance. Administration of CTL-inducing vaccines that are efficacious in "influenza-experienced" and "influenza-naive" hosts can likely slow transmission sufficiently to mitigate a moderate IAV pandemic. However if neutralising cross-reactive antibody to an emerging IAV are common in influenza-experienced hosts, as for the swine-variant H3N2v, boosting CTL immunity may be ineffective at reducing population spread, indicating that CTL-inducing vaccines are best used against novel subtypes such as H7N9. Unless vaccines cannot readily suppress transmission from infected hosts with naive T cell pools, targeting influenza-naive hosts is preferable. Such strategies are of enhanced benefit if naive hosts are typically intensively mixing children and when a subset of experienced hosts have pre-existing neutralising cross-reactive antibody. We show that CTL-inducing vaccination campaigns may have greater power to suppress antigenic drift than previously suggested, and targeting adults may be the optimal strategy to achieve this when the vaccination campaign does not have the power to curtail the attack rate. Our results highlight the need to design interventions based on pre-existing cellular immunity and knowledge of the host determinants of vaccine efficacy, and provide a framework for assessing the

  16. Prior population immunity reduces the expected impact of CTL-inducing vaccines for pandemic influenza control.

    PubMed

    Bolton, Kirsty J; McCaw, James M; Brown, Lorena; Jackson, David; Kedzierska, Katherine; McVernon, Jodie

    2015-01-01

    Vaccines that trigger an influenza-specific cytotoxic T cell (CTL) response may aid pandemic control by limiting the transmission of novel influenza A viruses (IAV). We consider interventions with hypothetical CTL-inducing vaccines in a range of epidemiologically plausible pandemic scenarios. We estimate the achievable reduction in the attack rate, and, by adopting a model linking epidemic progression to the emergence of IAV variants, the opportunity for antigenic drift. We demonstrate that CTL-inducing vaccines have limited utility for modifying population-level outcomes if influenza-specific T cells found widely in adults already suppress transmission and prove difficult to enhance. Administration of CTL-inducing vaccines that are efficacious in "influenza-experienced" and "influenza-naive" hosts can likely slow transmission sufficiently to mitigate a moderate IAV pandemic. However if neutralising cross-reactive antibody to an emerging IAV are common in influenza-experienced hosts, as for the swine-variant H3N2v, boosting CTL immunity may be ineffective at reducing population spread, indicating that CTL-inducing vaccines are best used against novel subtypes such as H7N9. Unless vaccines cannot readily suppress transmission from infected hosts with naive T cell pools, targeting influenza-naive hosts is preferable. Such strategies are of enhanced benefit if naive hosts are typically intensively mixing children and when a subset of experienced hosts have pre-existing neutralising cross-reactive antibody. We show that CTL-inducing vaccination campaigns may have greater power to suppress antigenic drift than previously suggested, and targeting adults may be the optimal strategy to achieve this when the vaccination campaign does not have the power to curtail the attack rate. Our results highlight the need to design interventions based on pre-existing cellular immunity and knowledge of the host determinants of vaccine efficacy, and provide a framework for assessing the

  17. Innate and adaptive immune correlates of vaccine and adjuvant-induced control of mucosal transmission of SIV in macaques.

    PubMed

    Sui, Yongjun; Zhu, Qing; Gagnon, Susan; Dzutsev, Amiran; Terabe, Masaki; Vaccari, Monica; Venzon, David; Klinman, Dennis; Strober, Warren; Kelsall, Brian; Franchini, Genoveffa; Belyakov, Igor M; Berzofsky, Jay A

    2010-05-25

    Adjuvant effects on innate as well as adaptive immunity may be critical for inducing protection against mucosal HIV and simian immunodeficiency virus (SIV) exposure. We therefore studied effects of Toll-like receptor agonists and IL-15 as mucosal adjuvants on both innate and adaptive immunity in a peptide/poxvirus HIV/SIV mucosal vaccine in macaques, and made three critical observations regarding both innate and adaptive correlates of protection: (i) adjuvant-alone without vaccine antigen impacted the intrarectal SIVmac251 challenge outcome, correlating with surprisingly long-lived APOBEC3G (A3G)-mediated innate immunity; in addition, even among animals receiving vaccine with adjuvants, viral load correlated inversely with A3G levels; (ii) a surprising threshold-like effect existed for vaccine-induced adaptive immunity control of viral load, and only antigen-specific polyfunctional CD8(+) T cells correlated with protection, not tetramer(+) T cells, demonstrating the importance of T-cell quality; (iii) synergy was observed between Toll-like receptor agonists and IL-15 for driving adaptive responses through the up-regulation of IL-15Ralpha, which can present IL-15 in trans, as well as for driving the innate A3G response. Thus, strategic use of molecular adjuvants can provide better mucosal protection through induction of both innate and adaptive immunity.

  18. Imperfect vaccine-induced immunity and whooping cough transmission to infants.

    PubMed

    Lavine, Jennie; Broutin, Hélène; Harvill, Eric T; Bjørnstad, Ottar N

    2010-12-10

    Whooping cough, caused by B. pertussis and B. parapertussis, has increased in incidence throughout much of the developed world since the 1980s despite high vaccine coverage, causing an increased risk of infection in infants who have substantial disease-induced mortality. Duration of immunity and epidemically significant routes of transmission across age groups remain unclear and deserve further investigation to inform vaccination strategies to better control pertussis burden. The authors analyze age- and species-specific whooping cough tests and vaccine histories in Massachusetts from 1990 to 2008. On average, the disease-free duration is 10.5 years. However, it has been decreasing over time, possibly due to a rising force of infection through increased circulation. Despite the importance of teenage cases during epidemics, wavelet analyses suggest that they are not the most important source of transmission to infants. In addition, the data indicate that the B. pertussis vaccine is not protective against disease induced by B. parapertussis. Copyright © 2010 Elsevier Ltd. All rights reserved.

  19. Immune complexome analysis reveals the specific and frequent presence of immune complex antigens in lung cancer patients: A pilot study.

    PubMed

    Ohyama, Kaname; Yoshimi, Haruka; Aibara, Nozomi; Nakamura, Yoichi; Miyata, Yasuyoshi; Sakai, Hideki; Fujita, Fumihiko; Imaizumi, Yoshitaka; Chauhan, Anil K; Kishikawa, Naoya; Kuroda, Naotaka

    2017-01-15

    Cancer immunotherapies such as antibodies targeting T cell checkpoints, or adaptive tumor-infiltrating lymphocyte (TIL) transfer, have been developed to boost the endogenous immune response against human malignancies. However, activation of T cells by such antibodies can lead to the risk of autoimmune diseases. Also, the selection of tumor-reactive T cells for TIL relies on information regarding mutated antigens in tumors and does not reflect other factors involved in protein antigenicity. It is therefore essential to engineer therapeutic interventions by which T cell reactivity against tumor cells is selectively enhanced (i.e., "focused cancer immunotherapy") based on tumor antigens that are specifically expressed in the tumor of a certain cancer and in many patients with this cancer. Immune complexes (ICs) are the direct and stable products of immunological recognition by humoral immunity. Here, we searched for tumor-specific IC antigens in each of five cancers (lung (n = 28), colon (n = 20), bladder (n = 20), renal cell (n = 15) and malignant lymphoma (n = 9)), by using immune complexome analysis that comprehensively identifies and profiles the constituent antigens in ICs. This analysis indicated that gelsolin and inter-alpha-trypsin inhibitor heavy chains were specifically and frequently detected (at a frequency higher than 80%), and that phosphoproteins (VENTX, VCIP135) were also specifically present in the ICs of lung cancer patients. Immune complexome analysis successfully identified several tumor-specific IC antigens with high detection frequency in lung cancer patients. These specific antigens are required to validate the clinical benefit by further analysis using a large number of patients. © 2016 UICC.

  20. Trivalent Human Papillomavirus (HPV) VLP vaccine covering HPV type 58 can elicit high level of humoral immunity but also induce immune interference among component types.

    PubMed

    Zhang, Ting; Xu, Yufei; Qiao, Liang; Wang, Youchun; Wu, Xueling; Fan, Dongsheng; Peng, Qinglin; Xu, Xuemei

    2010-04-26

    Both Human Papillomavirus (HPV) type 16/18 bivalent vaccine and type 16/18/6/11 quadrivalent vaccine have been proved to be safe and effective, and licensed for public use. However, these two vaccines do not quite match the distribution of HPV types in China, Southeast Asia and Latin America, where HPV 58 is highly prevalent. Here we produced three types of virus-like particles (VLPs) in baculovirus expression system, formulated a trivalent vaccine containing HPV 16, 18, and 58 L1 VLPs and examined its in vitro neutralizing titers. This vaccine could induce high level and long-term humoral immunity against the component types. But immune interference was observed when comparing type specific neutralizing antibody levels induced by trivalent vaccine to those by corresponding monovalent vaccines. This kind of interference would become more obvious when formulating more types of VLPs into multivalent vaccines, but could be greatly overcome by decreasing the antigen dosage and adding a proper adjuvant. Copyright 2010 Elsevier Ltd. All rights reserved.

  1. Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

    PubMed

    Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

    2015-10-01

    The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

  2. Neonatal mucosal immunization with a non-living, non-genetically modified Lactococcus lactis vaccine carrier induces systemic and local Th1-type immunity and protects against lethal bacterial infection

    PubMed Central

    Ramirez, Karina; Ditamo, Yanina; Rodriguez, Liliana; Picking, Wendy L.; van Roosmalen, Maarten L.; Leenhouts, Kees; Pasetti, Marcela F.

    2010-01-01

    Safe and effective immunization of newborns and infants can significantly reduce childhood mortality, yet conventional vaccines have been largely unsuccessful in stimulating the neonatal immune system. We explored the capacity of a novel mucosal antigen delivery system consisting of non-living, non-genetically modified Lactococcus lactis particles, designated Gram-positive Enhancer Matrix (GEM), to induce immune responses in the neonatal setting. Yersinia pestis LcrV, used as model protective antigen, was displayed on the GEM particles. Newborn mice immunized intranasally with GEM-LcrV developed LcrV-specific antibodies, Th1-type cell-mediated immunity, and were protected against lethal Y. pestis (plague) infection. The GEM particles activated and enhanced the maturation of neonatal dendritic cells both in vivo and in vitro. These dendritic cells showed increased capacities for secretion of pro-inflammatory and Th1-cell polarizing cytokines, antigen presentation and stimulation of CD4+ and CD8+ T cells. These data show that mucosal immunization with L. lactis GEM particles carrying vaccine antigens represents a promising approach to prevent infectious diseases early in life. PMID:19924118

  3. Effects of traditional medical herbs "minor bupleurum decoction" on the non-specific immune responses of white shrimp (Litopenaeus vannamei).

    PubMed

    Wu, Yu-Sheng; Lee, Meng-Chou; Huang, Cheng-Ting; Kung, Tzu-Chi; Huang, Chih-Yang; Nan, Fan-Hua

    2017-05-01

    This study is investigating the effect of minor bupleurum decoction (Xiao-Chai-Hu decoction) on the non-specific immune response of white shrimp (Litopenaeus vannamei). To determine prophenoloxidase activity (proPO), reactive oxygen species production (ROS), superoxide anion production (O 2 - ), nitric oxide production (NO), phagocytic rate (PR), phagocytic index (PI), superoxide dismutase activity (SOD), total haemocyte count (THC) and differential haemocyte count (DHC). In this experiment, treating with different dosages (0, 0.25, 0.5 and, 1%) of minor bupleurum decoction to detect immune parameters on day 0, 1, 2, 4, 7, 14, 21 and 28. Result is shown that 0.25% treatment significantly enhanced the superoxide dismutase (SOD) activity and, 0.25 and 1% treatment significantly increased the ROS production, nitric oxide (NO) production and phagocytic rate (PR) moreover, 0.5 and 1% treatment induced the proPO activity and superoxide anion (O 2 - ) production. Evidence exactly indicated that minor bupleurum decoction is able to enhance the non-specific immunity responses of white shrimp via in vivo examination. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. A leukocyte activation test identifies food items which induce release of DNA by innate immune peripheral blood leucocytes.

    PubMed

    Garcia-Martinez, Irma; Weiss, Theresa R; Yousaf, Muhammad N; Ali, Ather; Mehal, Wajahat Z

    2018-01-01

    Leukocyte activation (LA) testing identifies food items that induce a patient specific cellular response in the immune system, and has recently been shown in a randomized double blinded prospective study to reduce symptoms in patients with irritable bowel syndrome (IBS). We hypothesized that test reactivity to particular food items, and the systemic immune response initiated by these food items, is due to the release of cellular DNA from blood immune cells. We tested this by quantifying total DNA concentration in the cellular supernatant of immune cells exposed to positive and negative foods from 20 healthy volunteers. To establish if the DNA release by positive samples is a specific phenomenon, we quantified myeloperoxidase (MPO) in cellular supernatants. We further assessed if a particular immune cell population (neutrophils, eosinophils, and basophils) was activated by the positive food items by flow cytometry analysis. To identify the signaling pathways that are required for DNA release we tested if specific inhibitors of key signaling pathways could block DNA release. Foods with a positive LA test result gave a higher supernatant DNA content when compared to foods with a negative result. This was specific as MPO levels were not increased by foods with a positive LA test. Protein kinase C (PKC) inhibitors resulted in inhibition of positive food stimulated DNA release. Positive foods resulted in CD63 levels greater than negative foods in eosinophils in 76.5% of tests. LA test identifies food items that result in release of DNA and activation of peripheral blood innate immune cells in a PKC dependent manner, suggesting that this LA test identifies food items that result in release of inflammatory markers and activation of innate immune cells. This may be the basis for the improvement in symptoms in IBS patients who followed an LA test guided diet.

  5. Allele related mutation specific-polymerase chain reaction for rapid diagnosis of Hb New York (beta 113 (G15) Val-->Glu, beta(CD113 GTG-->GAG)).

    PubMed

    Viprakasit, Vip; Tachavanich, Kalaya; Suwantol, Lerlugsn; Pung-Amritt, Parichat; Chinchang, Worawut; Tanphaichitr, Voravarn S

    2002-08-01

    Hemoglobin New York (beta 113 (G15) Val-->Glu), a beta-globin variant, was first reported in a Chinese family living in New York. Subsequently, this abnormal hemoglobin was reported in many Chinese descendants from several groups and it was also known as Hb Kaohsiung. The subtle change in alpha1beta1 contact region apart from the heme group connecting area by Val-->Glu substitution has minor changes in both the electrophoretic mobility and stability making this hemoglobin variant difficult to distinguish from Hb A using routine hemoglobin analysis. The authors described a case of heterozygosity of Hb New York diagnosed by a molecular technique and revealed a mutation in beta(CD113 GTG-->GAG). A novel Allele Related Mutation Specific-Polymerase Chain Reaction (ARMS-PCR) for rapid diagnosis of this mutation has been proposed.

  6. Radiation-induced effects and the immune system in cancer.

    PubMed

    Kaur, Punit; Asea, Alexzander

    2012-01-01

    Chemotherapy and radiation therapy (RT) are standard therapeutic modalities for patients with cancers, and could induce various tumor cell death modalities, releasing tumor-derived antigens as well as danger signals that could either be captured for triggering anti-tumor immune response. Historic studies examining tissue and cellular responses to RT have predominantly focused on damage caused to proliferating malignant cells leading to their death. However, there is increasing evidence that RT also leads to significant alterations in the tumor microenvironment, particularly with respect to effects on immune cells and infiltrating tumors. This review will focus on immunologic consequences of RT and discuss the therapeutic reprogramming of immune responses in tumors and how it regulates efficacy and durability to RT.

  7. DNA and protein co-immunization improves the magnitude and longevity of humoral immune responses in macaques.

    PubMed

    Jalah, Rashmi; Kulkarni, Viraj; Patel, Vainav; Rosati, Margherita; Alicea, Candido; Bear, Jenifer; Yu, Lei; Guan, Yongjun; Shen, Xiaoying; Tomaras, Georgia D; LaBranche, Celia; Montefiori, David C; Prattipati, Rajasekhar; Pinter, Abraham; Bess, Julian; Lifson, Jeffrey D; Reed, Steven G; Sardesai, Niranjan Y; Venzon, David J; Valentin, Antonio; Pavlakis, George N; Felber, Barbara K

    2014-01-01

    We tested the concept of combining DNA with protein to improve anti-HIV Env systemic and mucosal humoral immune responses. Rhesus macaques were vaccinated with DNA, DNA&protein co-immunization or DNA prime followed by protein boost, and the magnitude and mucosal dissemination of the antibody responses were monitored in both plasma and mucosal secretions. We achieved induction of robust humoral responses by optimized DNA vaccination delivered by in vivo electroporation. These responses were greatly increased upon administration of a protein boost. Importantly, a co-immunization regimen of DNA&protein injected in the same muscle at the same time induced the highest systemic binding and neutralizing antibodies to homologous or heterologous Env as well as the highest Env-specific IgG in saliva. Inclusion of protein in the vaccine resulted in more immunized animals with Env-specific IgG in rectal fluids. Inclusion of DNA in the vaccine significantly increased the longevity of systemic humoral immune responses, whereas protein immunization, either as the only vaccine component or as boost after DNA prime, was followed by a great decline of humoral immune responses overtime. We conclude that DNA&protein co-delivery in a simple vaccine regimen combines the strength of each vaccine component, resulting in improved magnitude, extended longevity and increased mucosal dissemination of the induced antibodies in immunized rhesus macaques.

  8. CTA1-DD adjuvant promotes strong immunity against human immunodeficiency virus type 1 envelope glycoproteins following mucosal immunization.

    PubMed

    Sundling, Christopher; Schön, Karin; Mörner, Andreas; Forsell, Mattias N E; Wyatt, Richard T; Thorstensson, Rigmor; Karlsson Hedestam, Gunilla B; Lycke, Nils Y

    2008-12-01

    Strategies to induce potent and broad antibody responses against the human immunodeficiency virus type 1 (HIV-1) envelope glycoproteins (Env) at both systemic and mucosal sites represent a central goal for HIV-1 vaccine development. Here, we show that the non-toxic CTA1-DD adjuvant promoted mucosal and systemic humoral and cell-mediated immune responses following intranasal (i.n.) immunizations with trimeric or monomeric forms of HIV-1 Env in mice and in non-human primates. Env-specific IgG subclasses in the serum of immunized mice reflected a balanced Th1/Th2 type of response. Strikingly, i.n. immunizations with Env and the CTA1-DD adjuvant induced substantial levels of mucosal anti-Env IgA in bronchial alveolar lavage and also detectable levels in vaginal secretions. By contrast, parenteral immunizations of Env formulated in Ribi did not stimulate mucosal IgA responses, while the two adjuvants induced a similar distribution of Env-specific IgG-subclasses in serum. A single parenteral boost with Env in Ribi adjuvant into mice previously primed i.n. with Env and CTA1-DD, augmented the serum anti-Env IgG levels to similar magnitudes as those observed after three intraperitoneal immunizations with Env in Ribi. The augmenting potency of CTA1-DD was similar to that of LTK63 or CpG oligodeoxynucleotides (ODN). However, in contrast to CpG ODN, the effect of CTA1-DD and LTK63 appeared to be independent of MyD88 and toll-like receptor signalling. This is the first demonstration that CTA1-DD augments specific immune responses also in non-human primates, suggesting that this adjuvant could be explored further as a clinically safe mucosal vaccine adjuvant for humoral and cell-mediated immunity against HIV-1 Env.

  9. Can probiotics enhance vaccine-specific immunity in children and adults?

    PubMed

    Kwak, J Y; Lamousé-Smith, E S N

    2017-10-13

    The growing use of probiotics by the general public has heightened the interest in understanding the role of probiotics in promoting health and preventing disease. General practitioners and specialists often receive inquiries from their patients regarding probiotic products and their use to ward off systemic infection or intestinal maladies. Enhanced immune function is among the touted health benefits conferred by probiotics but has not yet been fully established. Results from recent clinical trials in adults suggest a potential role for probiotics in enhancing vaccine-specific immunity. Although almost all vaccinations are given during infancy and childhood, the numbers of and results from studies using probiotics in pediatric subjects are limited. This review evaluates recent clinical trials of probiotics used to enhance vaccine-specific immune responses in adults and infants. We highlight meaningful results and the implications of these findings for designing translational and clinical studies that will evaluate the potential clinical role for probiotics. We conclude that the touted health claims of probiotics for use in children to augment immunity warrant further investigation. In order to achieve this goal, a consensus should be reached on common study designs that apply similar treatment timelines, compare well-characterised probiotic strains and monitor effective responses against different classes of vaccines.

  10. Topical CpG Adjuvantation of a Protein-Based Vaccine Induces Protective Immunity to Listeria monocytogenes

    PubMed Central

    Cheng, Wing Ki; Wee, Kathleen; Kollmann, Tobias R.

    2014-01-01

    Robust CD8+ T cell responses are essential for immune protection against intracellular pathogens. Using parenteral administration of ovalbumin (OVA) protein as a model antigen, the effect of the Toll-like receptor 9 (TLR9) agonist, CpG oligodeoxynucleotide (ODN) 1826, as an adjuvant delivered either topically, subcutaneously, or intramuscularly on antigen-specific CD8+ T cell responses in a mouse model was evaluated. Topical CpG adjuvant increased the frequency of OVA-specific CD8+ T cells in the peripheral blood and in the spleen. The more effective strategy to administer topical CpG adjuvant to enhance CD8+ T cell responses was single-dose administration at the time of antigen injection with a prime-boost regimen. Topical CpG adjuvant conferred both rapid and long-lasting protection against systemic challenge with recombinant Listeria monocytogenes expressing the cytotoxic T lymphocyte (CTL) epitope of OVA257–264 (strain Lm-OVA) in a TLR9-dependent manner. Topical CpG adjuvant induced a higher proportion of CD8+ effector memory T cells than parenteral administration of the adjuvant. Although traditional vaccination strategies involve coformulation of antigen and adjuvant, split administration using topical adjuvant is effective and has advantages of safety and flexibility. Split administration of topical CpG ODN 1826 with parenteral protein antigen is superior to other administration strategies in enhancing both acute and memory protective CD8+ T cell immune responses to subcutaneous protein vaccines. This vaccination strategy induces rapid and persistent protective immune responses against the intracellular organism L. monocytogenes. PMID:24391136

  11. Giardia-specific cellular immune responses in post-giardiasis chronic fatigue syndrome.

    PubMed

    Hanevik, Kurt; Kristoffersen, Einar; Mørch, Kristine; Rye, Kristin Paulsen; Sørnes, Steinar; Svärd, Staffan; Bruserud, Øystein; Langeland, Nina

    2017-01-28

    The role of pathogen specific cellular immune responses against the eliciting pathogen in development of post-infectious chronic fatigue syndrome (PI-CFS) is not known and such studies are difficult to perform. The aim of this study was to evaluate specific anti-Giardia cellular immunity in cases that developed CFS after Giardia infection compared to cases that recovered well. Patients reporting chronic fatigue in a questionnaire study three years after a Giardia outbreak were clinically evaluated five years after the outbreak and grouped according to Fukuda criteria for CFS and idiopathic chronic fatigue. Giardia specific immune responses were evaluated in 39 of these patients by proliferation assay, T cell activation and cytokine release analysis. 20 Giardia exposed non-fatigued individuals and 10 healthy unexposed individuals were recruited as controls. Patients were clinically classified into CFS (n = 15), idiopathic chronic fatigue (n = 5), fatigue from other causes (n = 9) and recovered from fatigue (n = 10). There were statistically significant antigen specific differences between these Giardia exposed groups and unexposed controls. However, we did not find differences between the Giardia exposed fatigue classification groups with regard to CD4 T cell activation, proliferation or cytokine levels in 6 days cultured PBMCs. Interestingly, sCD40L was increased in patients with PI-CFS and other persons with fatigue after Giardia infection compared to the non-fatigued group, and correlated well with fatigue levels at the time of sampling. Our data show antigen specific cellular immune responses in the groups previously exposed to Giardia and increased sCD40L in fatigued patients.

  12. Cluster Intradermal DNA Vaccination Rapidly Induces E7-specific CD8+ T Cell Immune Responses Leading to Therapeutic Antitumor Effects

    PubMed Central

    Peng, Shiwen; Trimble, Cornelia; Alvarez, Ronald D.; Huh, Warner K.; Lin, Zhenhua; Monie, Archana; Hung, Chien-Fu; Wu, T.-C.

    2010-01-01

    Intradermal administration of DNA vaccines via a gene gun represents a feasible strategy to deliver DNA directly into the professional antigen-presenting cells (APCs) in the skin. This helps to facilitate the enhancement of DNA vaccine potency via strategies that modify the properties of APCs. We have previously demonstrated that DNA vaccines encoding human papillomavirus type 16 (HPV-16) E7 antigen linked to calreticulin (CRT) are capable of enhancing the E7-specific CD8+ T cell immune responses and antitumor effects against E7-expressing tumors. It has also been shown that cluster (short-interval) DNA vaccination regimen generates potent immune responses in a minimal timeframe. Thus, in the current study we hypothesize that the cluster intradermal CRT/E7 DNA vaccination will generate significant antigen-specific CD8+ T cell infiltrates in E7-expressing tumors in tumor-bearing mice, leading to an increase in apoptotic tumor cell death. We found that cluster intradermal CRT/E7 DNA vaccination is capable of rapidly generating a significant number of E7-specific CD8+ T cells, resulting in significant therapeutic antitumor effects in vaccinated mice. We also observed that cluster intradermal CRT/E7 DNA vaccination in the presence of tumor generates significantly higher E7-specific CD8+ T cell immune responses in the systemic circulation as well as in the tumors. In addition, this vaccination regimen also led to significantly lower levels of CD4+Foxp3+ T regulatory cells and myeloid suppressor cells compared to vaccination with CRT DNA in peripheral blood and in tumor infiltrating lymphocytes, resulting in an increase in apoptotic tumor cell death. Thus, our study has significant potential for future clinical translation. PMID:18401437

  13. Mast cells mediate the immune suppression induced by dermal exposure to JP-8 jet fuel.

    PubMed

    Limón-Flores, Alberto Y; Chacón-Salinas, Rommel; Ramos, Gerardo; Ullrich, Stephen E

    2009-11-01

    Applying jet propulsion-8 (JP-8) jet fuel to the skin of mice induces immune suppression. Applying JP-8 to the skin of mice suppresses T-cell-mediated immune reactions including, contact hypersensitivity (CHS) delayed-type hypersensitivity and T-cell proliferation. Because dermal mast cells play an important immune regulatory role in vivo, we tested the hypothesis that mast cells mediate jet fuel-induced immune suppression. When we applied JP-8 to the skin of mast cell deficient mice CHS was not suppressed. Reconstituting mast cell deficient mice with wild-type bone marrow derived mast cells (mast cell "knock-in mice") restored JP-8-induced immune suppression. When, however, mast cells from prostaglandin E(2) (PGE(2))-deficient mice were used, the ability of JP-8 to suppress CHS was not restored, indicating that mast cell-derived PGE(2) was activating immune suppression. Examining the density of mast cells in the skin and lymph nodes of JP-8-treated mice indicated that jet fuel treatment caused an initial increase in mast cell density in the skin, followed by increased numbers of mast cells in the subcutaneous space and then in draining lymph nodes. Applying JP-8 to the skin increased mast cell expression of CXCR4, and increased the expression of CXCL12 by draining lymph node cells. Because CXCL12 is a chemoattractant for CXCR4+ mast cells, we treated JP-8-treated mice with AMD3100, a CXCR4 antagonist. AMD3100 blocked the mobilization of mast cells to the draining lymph node and inhibited JP-8-induced immune suppression. Our findings demonstrate the importance of mast cells in mediating jet fuel-induced immune suppression.

  14. Zymosan-induced immune challenge modifies the stress response of hypoxic air-breathing fish (Anabas testudineus Bloch): Evidence for reversed patterns of cortisol and thyroid hormone interaction, differential ion transporter functions and non-specific immune response.

    PubMed

    Simi, S; Peter, Valsa S; Peter, M C Subhash

    2017-09-15

    Fishes have evolved physiological mechanisms to exhibit stress response, where hormonal signals interact with an array of ion transporters and regulate homeostasis. As major ion transport regulators in fish, cortisol and thyroid hormones have been shown to interact and fine-tune the stress response. Likewise, in fishes many interactions have been identified between stress and immune components, but the physiological basis of such interaction has not yet delineated particularly in air-breathing fish. We, therefore, investigated the responses of thyroid hormones and cortisol, ion transporter functions and non-specific immune response of an obligate air-breathing fish Anabas testudineus Bloch to zymosan treatment or hypoxia stress or both, to understand how immune challenge modifies the pattern of stress response in this fish. Induction of experimental peritonitis in these fish by zymosan treatment (200ngg -1 ) for 24h produced rise in respiratory burst and lysozomal activities in head kidney phagocytes. In contrast, hypoxia stress for 30min in immune-challenged fish reversed these non-specific responses of head kidney phagocytes. The decline in plasma cortisol in zymosan-treated fish and its further suppression by hypoxia stress indicate that immune challenge suppresses the cortisol-driven stress response of this fish. Likewise, the decline in plasma T 3 and T 4 after zymosan-treatment and the rise in plasma T 4 after hypoxia stress in immune-challenged fish indicate a critical role for thyroid hormone in immune-stress response due to its differential sensitivity to both immune and stress challenges. Further, analysis of the activity pattern of ion-dependent ATPases viz. Na + /K + -ATPase, H + /K + -ATPase and Na + /NH 4 + -ATPase indicates a functional interaction of ion transport system with the immune response as evident in its differential and spatial modifications after hypoxia stress in immune-challenged fish. The immune-challenge that produced differential

  15. Staphylococcus aureus innate immune evasion is lineage-specific: a bioinfomatics study.

    PubMed

    McCarthy, Alex J; Lindsay, Jodi A

    2013-10-01

    Staphylococcus aureus is a major human pathogen, and is targeted by the host innate immune system. In response, S. aureus genomes encode dozens of secreted proteins that inhibit complement, chemotaxis and neutrophil activation resulting in successful evasion of innate immune responses. These proteins include immune evasion cluster proteins (IEC; Chp, Sak, Scn), staphylococcal superantigen-like proteins (SSLs), phenol soluble modulins (PSMs) and several leukocidins. Biochemical studies have indicated that genetic variants of these proteins can have unique functions. To ascertain the scale of genetic variation in secreted immune evasion proteins, whole genome sequences of 88 S. aureus isolates, representing 25 clonal complex (CC) lineages, in the public domain were analysed across 43 genes encoding 38 secreted innate immune evasion protein complexes. Twenty-three genes were variable, with between 2 and 15 variants, and the variants had lineage-specific distributions. They include genes encoding Eap, Ecb, Efb, Flipr/Flipr-like, Hla, Hld, Hlg, Sbi, Scin-B/C and 13 SSLs. Most of these protein complexes inhibit complement, chemotaxis and neutrophil activation suggesting that isolates from each S. aureus lineage respond to the innate immune system differently. In contrast, protein complexes that lyse neutrophils (LukSF-PVL, LukMF, LukED and PSMs) were highly conserved, but can be carried on mobile genetic elements (MGEs). MGEs also encode proteins with narrow host-specificities arguing that their acquisition has important roles in host/environmental adaptation. In conclusion, this data suggests that each lineage of S. aureus evades host immune responses differently, and that isolates can adapt to new host environments by acquiring MGEs and the immune evasion protein complexes that they encode. Cocktail therapeutics that targets multiple variant proteins may be the most appropriate strategy for controlling S. aureus infections. Copyright © 2013 Elsevier B.V. All rights

  16. Immunity to tumour antigens.

    PubMed

    Li, Geng; Ali, Selman A; McArdle, Stephanie E B; Mian, Shahid; Ahmad, Murrium; Miles, Amanda; Rees, Robert C

    2005-01-01

    During the last decade, a large number of human tumour antigens have been identified. These antigens are classified as tumour-specific shared antigens, tissue-specific differentiation antigens, overexpressed antigens, tumour antigens resulting from mutations, viral antigens and fusion proteins. Antigens recognised by effectors of immune system are potential targets for antigen-specific cancer immunotherapy. However, most tumour antigens are self-proteins and are generally of low immunogenicity and the immune response elicited towards these tumour antigens is not always effective. Strategies to induce and enhance the tumour antigen-specific response are needed. This review will summarise the approaches to discovery of tumour antigens, the current status of tumour antigens, and their potential application to cancer treatment.

  17. [Specific humoral immunity after single immunization with mumps vaccine: data of a 3-year follow-up].

    PubMed

    Otrashevskaia, A V; Bukin, E K; Krasil'nikov, I V; Ignat'ev, G M

    2011-01-01

    The level and spectrum of humoral specific immunity were studied in 60 volunteers immunized with Russian mumps vaccine. Specific IgG levels were measured by enzyme immunoassay (EIA) and neutralization test using the Leningrad-3 (L-3) mumps virus (MV) vaccine strain and 5 heterologous MV strains of various genotypes (A, B, C, D, and H). The maximum functional activity of antibodies was recorded at an average of 18 months postvaccination. Within 3 years after vaccination, starting at 6 months, specific IgG neutralized all 6 MV strains having varying activity in relation to the genotype. Neutralizing titers (NT) against the L-3 strain were 1.3-1.7-fold higher than those against heterologous MV strains throughout the follow-up. Despite a tendency towards lower specific IgG levels, within 3 years postvaccination, EIA IgG titers remained to be 2.5 -log, L-3 strain HT were -log, or more, and the titers against 5 heterologous MV strains were 2 -log2 or more in all the volunteers.

  18. Effect of Phlebodium Decumanum on the Immune Response Induced by Training in Sedentary University Students

    PubMed Central

    Gonzalez-Jurado, Jose A.; Pradas, Francisco; Molina, Edgardo S.; de Teresa, Carlos

    2011-01-01

    Exercise training is considered a good model to provoke different degrees of immune dysfunction affecting physical performance and some physiological responses related to oxidative stress and low grade inflammation. Phlebodium decumanum is a polypodiaceae may induce shown immunomodulating effects, specifically directed to the release of proinflammatory cytokines by macrophages in response to various stimuli, as reported different in vitro studies. The aim of this study was to evaluate the modulating effect of phlebodium decumanum, on the immune response induced by physical exercise. Thirty-one subjects (males only) were randomly divided into two groups: Group PD (n = 18); age: 22.1 ± 1.81, weight 74.21 ± 8.74 kg) that was treated with phlebodium decumanum; Group P (n = 13); age: 22.5 ± 1.63, weight 78 ± 12.5 kg) that was treated with a placebo. Before and after one month training program performed by both groups (three times a week), the following performance parameters and immune response variables were measured: Dynamic Maximum Force; Interval-Training; Tennis test; pro-inflammatory (TNF , IL6) and anti-inflammatory (TNFα-IIrs, IL1-ra) cytokines levels. Data were statistically analyzed with Mann- Whitney U test and Wilcoxon paired test (p < 0.05). Statistically significant differences were recorded within groups before and after the training program. PD group showed a significant improvement in the performance parameters (Strength Muscle Test: dorsal: p < 0.002; deltoids: p < 0.03; and pectorals: p < 0.07; Interval Training: p < 0.06; Tennis Test: p < 0.02). Cytokine levels resulted in a more positive profile in the PD group rather than in the P group, in which higher levels of IL-6 (p < 0.02) and a reduction of TNF-IIrs (p < 0.003) and IL1-ra (p < 0.03) were recorded. In this study the use of phlebodium decumanum demonstrated beneficial effects in the modulation of the immune response during physical performance. Key points Practicing sport or physical

  19. Polymorphisms in HLA-DPB1 are associated with differences in rubella virus-specific humoral immunity after vaccination.

    PubMed

    Lambert, Nathaniel D; Haralambieva, Iana H; Kennedy, Richard B; Ovsyannikova, Inna G; Pankratz, Vernon Shane; Poland, Gregory A

    2015-03-15

    Vaccination with live attenuated rubella virus induces a strong immune response in most individuals. However, small numbers of subjects never reach or maintain protective antibody levels, and there is a high degree of variability in immune response. We have previously described genetic polymorphisms in HLA and other candidate genes that are associated with interindividual differences in humoral immunity to rubella virus. To expand our previous work, we performed a genome-wide association study (GWAS) to discover single-nucleotide polymorphisms (SNPs) associated with rubella virus-specific neutralizing antibodies. We identified rs2064479 in the HLA-DPB1 genetic region as being significantly associated with humoral immune response variations after rubella vaccination (P = 8.62 × 10(-8)). All other significant SNPs in this GWAS were located near the HLA-DPB1 gene (P ≤ 1 × 10(-7)). These findings demonstrate that polymorphisms in HLA-DPB1 are strongly associated with interindividual differences in neutralizing antibody levels to rubella vaccination and represent a validation of our previous HLA work. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  20. The Ocular Conjunctiva as a Mucosal Immunization Route: A Profile of the Immune Response to the Model Antigen Tetanus Toxoid

    PubMed Central

    Belij, Sandra; Marinkovic, Emilija; Stojicevic, Ivana; Montanaro, Jacqueline; Stein, Elisabeth; Bintner, Nora; Stojanovic, Marijana

    2013-01-01

    Background In a quest for a needle-free vaccine administration strategy, we evaluated the ocular conjunctiva as an alternative mucosal immunization route by profiling and comparing the local and systemic immune responses to the subcutaneous or conjunctival administration of tetanus toxoid (TTd), a model antigen. Materials and methods BALB/c and C57BL/6 mice were immunized either subcutaneously with TTd alone or via the conjunctiva with TTd alone, TTd mixed with 2% glycerol or TTd with merthiolate-inactivated whole-cell B. pertussis (wBP) as adjuvants. Mice were immunized on days 0, 7 and 14 via both routes, and an evaluation of the local and systemic immune responses was performed two weeks after the last immunization. Four weeks after the last immunization, the mice were challenged with a lethal dose (2 × LD50) of tetanus toxin. Results The conjunctival application of TTd in BALB/c mice induced TTd-specific secretory IgA production and skewed the TTd-specific immune response toward a Th1/Th17 profile, as determined by the stimulation of IFNγ and IL-17A secretion and/or the concurrent pronounced reduction of IL-4 secretion, irrespective of the adjuvant. In conjunctivaly immunized C57BL/6 mice, only TTd administered with wBP promoted the establishment of a mixed Th1/Th17 TTd-specific immune response, whereas TTd alone or TTd in conjunction with glycerol initiated a dominant Th1 response against TTd. Immunization via the conjunctiva with TTd plus wBP adjuvant resulted in a 33% survival rate of challenged mice compared to a 0% survival rate in non-immunized animals (p<0.05). Conclusion Conjunctival immunization with TTd alone or with various adjuvants induced TTd-specific local and systemic immune responses, predominantly of the Th1 type. The strongest immune responses developed in mice that received TTd together with wBP, which implies that this alternative route might tailor the immune response to fight intracellular bacteria or viruses more effectively. PMID