Sample records for galvanic skin response

  1. 21 CFR 882.1540 - Galvanic skin response measurement device.

    Code of Federal Regulations, 2010 CFR


    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Galvanic skin response measurement device. 882... Galvanic skin response measurement device. (a) Identification. A galvanic skin response measurement device... electrical resistance of the skin and the tissue path between two electrodes applied to the skin....

  2. 21 CFR 882.1540 - Galvanic skin response measurement device.

    Code of Federal Regulations, 2012 CFR


    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Galvanic skin response measurement device. 882... Galvanic skin response measurement device. (a) Identification. A galvanic skin response measurement device... electrical resistance of the skin and the tissue path between two electrodes applied to the skin....

  3. 21 CFR 882.1540 - Galvanic skin response measurement device.

    Code of Federal Regulations, 2014 CFR


    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Galvanic skin response measurement device. 882... Galvanic skin response measurement device. (a) Identification. A galvanic skin response measurement device... electrical resistance of the skin and the tissue path between two electrodes applied to the skin....

  4. 21 CFR 882.1540 - Galvanic skin response measurement device.

    Code of Federal Regulations, 2011 CFR


    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Galvanic skin response measurement device. 882... Galvanic skin response measurement device. (a) Identification. A galvanic skin response measurement device... electrical resistance of the skin and the tissue path between two electrodes applied to the skin....

  5. 21 CFR 882.1540 - Galvanic skin response measurement device.

    Code of Federal Regulations, 2013 CFR


    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Galvanic skin response measurement device. 882... Galvanic skin response measurement device. (a) Identification. A galvanic skin response measurement device... electrical resistance of the skin and the tissue path between two electrodes applied to the skin....

  6. Some relationships between punishment, stuttering, and galvanic skin responses.


    Reed, C G; Lingwall, J B


    The simultaneous effects of response-contingent punishment on stuttering behaviors and the frequency of galvanic skin response (GSR) deflections for 10 subjects were investigated. GSR's and stuttering responses were recorded during base rate, treatment, and extinction conditions. The subjects demonstrated a 50% or greater decrease in stuttering frequency during the treatment condition. Combined data for all subjects indicated that the mean frequency of GSR deflections remained stable or declined across conditions of the study. Analysis of individual data revealed that GSR deflections during treatment as compared with base rate increased for four subjects, remained essentially the same in two subjects, and decreased for four subjects. These results suggest that experimental procedures which result in functional punishment effects on stuttering frequency may not be associated with any predictable pattern on concomitant autonomic arousal.

  7. Galvanic skin response of oral cancer patients during speech.


    Nishigawa, G; Natsuaki, N; Maruo, Y; Okamoto, M; Minagi, S


    Severe speech difficulty is often caused after surgery of an oral cancer. Prosthetic treatment with a removable obturator prosthesis is generally provided for such patients. Although some speech ability is recovered with prosthetic treatment, patients sometimes complain of continued dissatisfaction with their speech. However, it is difficult to evaluate the dissatisfaction. Therefore, a new method for evaluation is desirable. In this study, such a new method using the galvanic skin response as the index for the dissatisfaction of the patient was developed, and its objectivity was investigated. Eleven patients with maxillary bone defects were selected. Prior to the evaluation, improvement of speech with the removable prosthesis was confirmed using the speech intelligibility test and the visual analogue scale. The electrical resistant value at pronunciation was measured with the measuring system composed with the apparatus (galvanic skin response (GSR) measuring apparatus), the personal computer program. The changes for the electrical resistant value after pronunciation were evaluated by calculating the decrease ratio at pronunciation [(the mean electrical resistance before pronunciation - the mean electrical resistance after pronunciation)/the mean electrical resistance before pronunciation]. This decrease ratio at pronunciation was defined as the index of the speech dissatisfaction of the subject. The mean values for the decrease ratio with prosthesis were significantly smaller than the values without prosthesis (P < 0.05). From the results of this study, it is suggested that the measurement of the electrical resistance change of the skin during speech could be a new method for evaluating the speech dissatisfaction of the post-oral-cancer patient.

  8. Media Research with a Galvanic Skin Response Biosensor: Some Kids Work Up a Sweat!

    ERIC Educational Resources Information Center

    Clariana, Roy B.

    This study considers the galvanic skin response (GSR) of sixth-grade students (n=20) using print, video, and microcomputer segments. Subjects received all three media treatments, in randomized order. Data for analysis consisted of standardized test scores and GSR measures; a moderate positive relationship was shown between cumulative GSR and…

  9. Improved electrode paste provides reliable measurement of galvanic skin response

    NASA Technical Reports Server (NTRS)

    Day, J. L.


    High-conductivity electrode paste is used in obtaining accurate skin resistance or skin potential measurements. The paste is isotonic to perspiration, is nonirritating and nonsensitizing, and has an extended shelf life.

  10. Highly wearable galvanic skin response sensor using flexible and conductive polymer foam.


    Kim, Jeehoon; Kwon, Sungjun; Seo, Sangwon; Park, Kwangsuk


    Owing to advancements in daily physiological monitoring technology, diverse healthcare applications have emerged recently. The monitoring of skin conductance responses has extensive feasibility to support healthcare applications such as detecting emotion changes. In this study, we proposed a highly wearable and reliable galvanic skin response (GSR) sensor that measures the signals from the back of the user. To enhance its wearability and usability, we employed flexible conductive foam as the sensing material and designed it to be easily attachable to (and detachable from) a wide variety of clothes. We evaluated the sensing reliability of the proposed sensor by comparing its signal with a reference GSR. The average correlation between the two signals was 0.768; this is sufficiently high to validate the feasibility of the proposed sensor for reliable GSR sensing on the back.

  11. A stress sensor based on Galvanic Skin Response (GSR) controlled by ZigBee.


    Villarejo, María Viqueira; Zapirain, Begoña García; Zorrilla, Amaia Méndez


    Sometimes, one needs to control different emotional situations which can lead the person suffering them to dangerous situations, in both the medium and short term. There are studies which indicate that stress increases the risk of cardiac problems. In this study we have designed and built a stress sensor based on Galvanic Skin Response (GSR), and controlled by ZigBee. In order to check the device's performance, we have used 16 adults (eight women and eight men) who completed different tests requiring a certain degree of effort, such as mathematical operations or breathing deeply. On completion, we appreciated that GSR is able to detect the different states of each user with a success rate of 76.56%. In the future, we plan to create an algorithm which is able to differentiate between each state.

  12. The Efficiacy of Sternocleidomastoid Muscle Flap on Frey's Syndrome via a Novel Test: Galvanic Skin Response.


    Demirci, Ugur; Basut, Oguz; Noyan, Behzat; Demir, Uygar Levent; Afsin Ozmen, O; Kasapoglu, Fikret; Hakan Coskun, H; Onart, Selcuk


    The aim of this study was to evaluate the effects of sternocleidomastoid (SCM) muscle flap on preventing Frey's syndrome by using, Galvanic skin responses (GSR). Fourty-three patients who underwent superficial parotidectomy were randomly divided into two groups and their GSR were recorded. SCM muscle flap was applied over the surgical area only in one group. Six months after the surgery, GSRs were remeasured. In addition, the patients completed a questionnaire regarding their complaints about clinical Frey's syndrome. Four patients had symptoms of clinical Frey's syndrome. Postoperative GSR measurements revealed no significant difference between two sides in flap group (p = 0.426) but higher in without flap group (p = 0.003). The patients with clinical Frey syndrome had significantly higher GSR values than the remaining patients. The SCM muscle flap was an effective method in preventing Frey's syndrome. Moreover, GSR test was highly sensitive and specific for diagnosis.

  13. A Stress Sensor Based on Galvanic Skin Response (GSR) Controlled by ZigBee

    PubMed Central

    Villarejo, María Viqueira; Zapirain, Begoña García; Zorrilla, Amaia Méndez


    Sometimes, one needs to control different emotional situations which can lead the person suffering them to dangerous situations, in both the medium and short term. There are studies which indicate that stress increases the risk of cardiac problems. In this study we have designed and built a stress sensor based on Galvanic Skin Response (GSR), and controlled by ZigBee. In order to check the device's performance, we have used 16 adults (eight women and eight men) who completed different tests requiring a certain degree of effort, such as mathematical operations or breathing deeply. On completion, we appreciated that GSR is able to detect the different states of each user with a success rate of 76.56%. In the future, we plan to create an algorithm which is able to differentiate between each state. PMID:22778631

  14. Evaluating the Efficacy of a Sternocleidomastoid Flap via Galvanic Skin Responses in Superficial Parotidectomy.


    Basut, Oguz; Noyan, Behzat; Demirci, Ugur


    In the present study, we evaluated the efficacy of flaps via measurement of galvanic skin responses (GSR) in patients who had undergone superficial parotidectomy either with or without sternocleidomastoid (SCM) muscle flaps. Retrospective study design was used. The setting included University of Uludag School of Medicine Department of Otorhinolaryngology. Eleven patients who had undergone superficial parotidectomy for benign diseases in our clinic between June 2003 and August 2006 were included in the study. SCM muscle flaps were used in four patients. The GSR of the patients were measured using a MP 30 System. The Mann-Whitney U test was used for the analysis of data. There were complaints that resembled Frey's syndrome in three patients in whom flaps had not been performed. Patients with flaps had no complaints. In patients with flaps, no significant GSR changes were observed between the control and operated sides (P > 0.05). In patients without flaps, the GSR levels were significantly higher on the operated side compared to the control side (P < 0.05). GSR values on the control side did not show any differences between patients with and without a flap. However, there were significantly higher GSR values for the operated side in patients without flaps compared to patients with flaps (P < 0.05). Application of a SCM flap is an efficient method by which to prevent Frey's syndrome, and the GSR test is beneficial both in diagnosiing and determining the severity of the disease as well as evaluating the efficacy of surgical techniques used to prevent Frey's syndrome.

  15. Analysis and Modeling of the Galvanic Skin Response Spontaneous Component in the context of Intelligent Biofeedback Systems Development

    NASA Astrophysics Data System (ADS)

    Unakafov, A.


    The paper presents an approach to galvanic skin response (GSR) spontaneous component analysis and modeling. In the study a classification of biofeedback training methods is given, importance of intelligent methods development is shown. The INTENS method, which is perspective for intellectualization, is presented. An important problem of biofeedback training method intellectualization - estimation of the GSR spontaneous component - is solved in the main part of the work. Its main characteristics are described; results of GSR spontaneous component modeling are shown. Results of small research of an optimum material for GSR probes are presented.

  16. Reduced input from foot sole skin through cooling differentially modulates the short latency and medium latency vestibular reflex responses to galvanic vestibular stimulation.


    Muise, Stephanie B; Lam, Chris K; Bent, Leah R


    Sensory afferent information from the skin of the foot sole and information from the vestibular system converge within the central nervous system; however, their mode of interaction remains unknown. The purpose of this study was to investigate the effect of reduced cutaneous foot sole information on the ability of the vestibular system to evoke short latency (SL) and medium latency (ML) lower limb muscle reflex responses. Galvanic vestibular stimulation (GVS; bipolar; binaural; 25 ms; 2 mA square-wave pulse) was applied to standing human subjects (four women, eight men, average age 21.1 ± 3.0 years) both before and after cooling the foot soles in 1°C ice water (15 min initially, followed by 5 min between blocks of 200 GVS pulses). Changes in soleus reflex amplitude were examined. Following ice water immersion, there was a 35.16% increase in the size of the ML response in the soleus muscle when expressed as a percentage of pre-stimulus electromyographic (EMG) activity (control 26.48 ± 4.91%; ice 36.16 ± 6.52%) with no change in size of the SL response (control 7.42 ± 1.12%; ice 8.72 ± 1.10%). These results support the previously proposed dissociation of the SL and ML responses with respect to their circuitry and functions. The results also suggest a greater role for cutaneous-vestibular interaction in the modulation of the ML than the SL response and at a location prior to the motoneuron pool.

  17. Can galvanic skin conductance be used as an objective indicator of children’s anxiety in the dental setting?

    PubMed Central

    Najafpour, Ebrahim; Asl-Aminabadi, Naser; Nuroloyuni, Sara; Jamali, Zahra


    Background Assessment of procedural distress is essential at assisting children during invasive dental treatments. This study aimed to determine the validity and reliability of galvanic skin response as a measure for assessment of dental anxiety in children. Material and Methods 151 children, aged 5-7 years, participated in this study. Similar dental treatments were rendered to all subjects. At the beginning and end of the session, modified child dental anxiety scale (MCDAS), clinical anxiety rating scale (CARS) and galvanic skin response (GSR) were used to determine children’s anxiety. Results GSR was significantly correlated with both MCDAS (rs=0.62, p=0.02) and CARS (rs=0.44, p=0.032). The correlation between MCDAS and CARS was also significant (rs = 0.9, P<0.001). Anxiety decreased during the session in both GSR (rs=0.52, p=0.001) and MCDAS scales (rs=0.77, p=0.001). CARS also showed a reduction between the initial and second assessment, but it was not statistically significant (rs=0.12, P=0.36). Conclusions The findings suggest that GSR is a reliable and valid measure for assessment of children’s dental anxiety in the clinical context. GSR may help to identify clinically anxious children before dental treatment to provide appropriate interventions. Key words:Dental anxiety, reliability, validity, galvanic skin response. PMID:28298978

  18. The timing of galvanic vestibular stimulation affects responses to platform translation

    NASA Technical Reports Server (NTRS)

    Hlavacka, F.; Shupert, C. L.; Horak, F. B.; Peterson, B. W. (Principal Investigator)


    We compared the effects of galvanic vestibular stimulation applied at 0, 0.5, 1.5 and 2.5 s prior to a backward platform translation on postural responses. The effect of the galvanic stimulation was largest on the final equilibrium position of the center of pressure (CoP). The largest effects occurred for the 0.5 and 0-s pre-period, when the dynamic CoP pressure changes in response to both the galvanic stimulus and the platform translation coincided. The shift in the final equilibrium position was also larger than the sum of the shifts for the galvanic stimulus and the platform translation alone for the 0.5 and 0-s pre-periods. The initial rate of change of the CoP response to the platform translation was not significantly affected in any condition. Changes in the peak CoP position could be accounted for by local interaction of CoP velocity changes induced by the galvanic and translation responses alone, but the changes in final equilibrium position could only be accounted for by a change in global body orientation. These findings suggest that the contribution of vestibulospinal information is greatest during the dynamic phase of the postural response, and that the vestibular system contributes most to the later components of the postural response, particularly to the final equilibrium position. These findings suggest that a nonlinear interaction between the vestibular signal induced by the galvanic current and the sensory stimuli produced by the platform translation occurs when the two stimuli are presented within 1 s, during the dynamic phase of the postural response to the galvanic stimulus. When presented at greater separations in time, the stimuli appear to be treated as independent events, such that no interaction occurs. Copyright 1999 Elsevier Science B.V.

  19. Galvanic Skin Response and Reported Anxiety During Systematic Desensitization

    ERIC Educational Resources Information Center

    Hyman, Edward T.; Gale, Elliot N.


    The purpose of the present study was to investigate the GSR during systematic desensitization. Three groups of females each were preselected for high snake fear. Outcome measures indicated that the desensitization group reduced phobic behavior most, followed by the relaxation group, and then the exposure groups. (Author)

  20. Galvanic Skin Response as a Measure of Soldier Stress

    DTIC Science & Technology


    in the body have been used as an effective measure of stress, including social stress such as performance in front of an audience (Nater, La Marca ...Lake, CA, 1992. Nater, U. M.; La Marca , R.; Florin, L.; Moses, A.; Langhans, W.; Koller, M. M.; Ehlert, U. Stress-Induced Changes in Human

  1. Ambulatory assessment of skin conductivity during first thesis presentation: lower self-confidence predicts prolonged stress response.


    Elfering, Achim; Grebner, Simone


    In this field study self-confidence was tested to predict the course of galvanic electrodermal stress response prior, during and after public speaking. Ten graduate students initially rated their self-confidence and afterwards presented their thesis proposals orally in a 10-min presentation to their supervisor and peers. Galvanic skin response level was measured throughout and analysed for 10 min prior to, during, and 10 min after the presentation. Two major galvanic electrodermal stress response types were observed. Five students showed a 'healthy response', i.e. an anticipatory increase in electrodermal conductance, followed by a decrease after termination of the presentation. The other five students showed a steady increase of skin conductance during and after their presentation ('prolonged response'). In line with the allostatic load model the 'prolonged response' group reported significantly lower self-confidence before presentation than the 'healthy response' group (p < 0.01). Self-confidence is a resource in novices facing an unfamiliar stressor.

  2. Characterization of hydrogen responsive nanoporous palladium films synthesized via a spontaneous galvanic displacement reaction.


    Patton, J F; Lavrik, N V; Joy, D C; Hunter, S R; Datskos, P G; Smith, D B; Sepaniak, M J


    A model is presented regarding the mechanistic properties associated with the interaction of hydrogen with nanoporous palladium (np-Pd) films prepared using a spontaneous galvanic displacement reaction (SGDR), which involves PdCl(2) reduction by atomic Ag. Characterization of these films shows both chemical and morphological factors, which influence the performance characteristics of np-Pd microcantilever (MC) nanomechanical sensing devices. Raman spectroscopy, uniquely complemented with MC response profiles, is used to explore the chemical influence of palladium oxide (PdO). These combined techniques support a reaction mechanism that provides for rapid response to H(2) and recovery in the presence of O(2). Post-SGDR processing via reduction of PdCl(2)(s) in a H(2) environment results in a segregated nanoparticle three-dimensional matrix dispersed in a silver layer. The porous nature of the reduced material is shown by high resolution scanning electron microscopy. Extended grain boundaries, typical of these materials, result in a greater surface area conducive to fast sorption/desorption of hydrogen, encouraged by the presence of PdO. X-ray diffraction and inductively coupled plasma-optical emission spectroscopy are employed to study changes in morphology and chemistry occurring in these nanoporous films under different processing conditions. The unique nature of chemical/morphological effects, as demonstrated by the above characterization methods, provides evidence in support of observed nanomechanical response/recovery profiles offering insight for catalysis, H(2) storage and improved sensing applications.

  3. Sinusoidal galvanic vestibular stimulation (sGVS) induces a vasovagal response in the rat

    PubMed Central

    Martinelli, Giorgio P.; Ogorodnikov, Dmitri; Xiang, Yongqing; Raphan, Theodore; Holstein, Gay R.; Yakushin, Sergei B.


    Blood pressure (BP) and heart rate (HR) were studied in isoflurane-anesthetized Long-Evans rats during sinusoidal galvanic vestibular stimulation (sGVS) and sinusoidal oscillation in pitch to characterize vestibular influences on autonomic control of BP and HR. sGVS was delivered binaurally via Ag/AgCl needle electrodes inserted over the mastoids at stimulus frequencies 0.008–0.4 Hz. Two processes affecting BP and HR were induced by sGVS: 1) a transient drop in BP (≈15–20 mmHg) and HR (≈3 beat*s−1), followed by a slow recovery over 1–6 min; and 2) inhibitory modulations in BP (≈4.5 mmHg/g) and HR (≈0.15 beats*s−1/g) twice in each stimulus cycle. The BP and HR modulations were approximately in-phase with each other and were best evoked by low stimulus frequencies. A wavelet analysis indicated significant energies in BP and HR at scales related to twice and four times the stimulus frequency bands. BP and HR were also modulated by oscillation in pitch at frequencies 0.025–0.5 Hz. Sensitivities at 0.025 Hz were ≈4.5 mmHg/g (BP) and ≈0.17 beat*s−1/g (HR) for pitches of 20–90°. The tilt-induced BP and HR modulations were out-of-phase, but the frequencies at which responses were elicited by tilt and sGVS were the same. The results show that the sGVS-induced responses, which likely originate in the otolith organs, can exert a powerful inhibitory effect on both BP and HR at low frequencies. These responses have a striking resemblance to human vasovagal responses. Thus, sGVS-activated rats can potentially serve as a useful experimental model of the vasovagal response in humans. PMID:21374078

  4. The Effect of Galvanic Vestibular Stimulation on Postural Response of Down Syndrome Individuals on the Seesaw

    ERIC Educational Resources Information Center

    Carvalho, R. L.; Almeida, G. L.


    In order to better understand the role of the vestibular system in postural adjustments on unstable surfaces, we analyzed the effects of galvanic vestibular stimulation (GVS) on the pattern of muscle activity and joint displacements (ankle knee and hip) of eight intellectually normal participants (control group--CG) and eight control group…

  5. Autonomic responses of transsexual and homosexual males to erotic film sequences.


    Barr, R; Blaszczynski, A


    Penile volume and galvanic skin responses to nude female and male film sequences were studied in 10 transsexual patients, 44 patients requesting treatment for homosexual impulses, and 60 heterosexual students. Student controls and homosexuals showed significantly greater galvanic skin responses to the preferred than to the nonpreferred sex. Transsexuals tended to show larger galvanic skin responses to females than did male homosexuals. No strong relationships were found between penile volume and galvanic skin response to the preferred sex. It is concluded that transsexual patients differ significantly from homosexual patients in autonomic responsivity, which may have diagnostic usefulness.


    EPA Science Inventory

    The importance of fish skin is realized when one considers it is the interface between the external and intrnal environment of the animal. As will be pointed out in this chapter, fish skin has a number of vital functions many of which could be life threatening if perturbed beyond...

  7. Modelling event-related skin conductance responses

    PubMed Central

    Bach, Dominik R.; Flandin, Guillaume; Friston, Karl J.; Dolan, Raymond J.


    Analytic tools for psychophysiological signals often make implicit assumptions that are unspecified. In developing a mathematical framework for analysis of skin conductance responses [SCRs], we formalise our assumptions by positing that SCRs can be regarded as the output of a linear time-invariant filter. Here, we provide an empirical test of these assumptions. Our findings indicate that a large component of the variance in SCRs can be explained by one response function per individual. We note that baseline variance (i.e. variance in the absence of evoked responses) is higher than variance that could not be explained by a linear time-invariant model of evoked responses. Furthermore, there was no evidence for nonlinear interactions among evoked responses that depended on their temporal overlap. We develop a canonical response function and show that it can be used for signals from different recording sites. We discuss the implications of these observations for model-based analysis of SCRs. PMID:20093150

  8. Opto-galvanic effect on degenerate magnetic states of sputtered atoms in a glow discharge

    NASA Astrophysics Data System (ADS)

    Zhechev, D.; Steflekova, V.


    The opto-galvanic response of some degenerate states of sputtered atoms to linearly- and circularly polarize light is studied. On the same optical transition both time-resolved- and amplitude opto-galvanic signals are found depending on the polarizations of light absorbed. The latter induces galvanic responses differing in opto-galvanic efficiency, time-evolution and sensitivity to discharge current and laser power. The differences are ascribed to the rate constants of the decay processes, characterizing aligned and oriented atoms.

  9. Characterizing human skin blood flow regulation in response to different local skin temperature perturbations.


    Wu, Y; Nieuwenhoff, M D; Huygen, F J P M; van der Helm, F C T; Niehof, S; Schouten, A C


    Small nerve fibers regulate local skin blood flow in response to local thermal perturbations. Small nerve fiber function is difficult to assess with classical neurophysiological tests. In this study, a vasomotor response model in combination with a heating protocol was developed to quantitatively characterize the control mechanism of small nerve fibers in regulating skin blood flow in response to local thermal perturbation. The skin of healthy subjects' hand dorsum (n=8) was heated to 42°C with an infrared lamp, and then naturally cooled down. The distance between the lamp and the hand was set to three different levels in order to change the irradiation intensity on the skin and implement three different skin temperature rise rates (0.03°C/s, 0.02°C/s and 0.01°C/s). A laser Doppler imager (LDI) and a thermographic video camera recorded the temporal profile of the skin blood flow and the skin temperature, respectively. The relationship between the skin blood flow and the skin temperature was characterized by a vasomotor response model. The model fitted the skin blood flow response well with a variance accounted for (VAF) between 78% and 99%. The model parameters suggested a similar mechanism for the skin blood flow regulation with the thermal perturbations at 0.03°C/s and 0.02°C/s. But there was an accelerated skin vasoconstriction after a slow heating (0.01°C/s) (p-value<0.05). An attenuation of the skin vasodilation was also observed in four out of the seven subjects during the slow heating (0.01°C/s). Our method provides a promising way to quantitatively assess the function of small nerve fibers non-invasively and non-contact.

  10. Autonomic nervous system responses can reveal visual fatigue induced by 3D displays.


    Kim, Chi Jung; Park, Sangin; Won, Myeung Ju; Whang, Mincheol; Lee, Eui Chul


    Previous research has indicated that viewing 3D displays may induce greater visual fatigue than viewing 2D displays. Whether viewing 3D displays can evoke measureable emotional responses, however, is uncertain. In the present study, we examined autonomic nervous system responses in subjects viewing 2D or 3D displays. Autonomic responses were quantified in each subject by heart rate, galvanic skin response, and skin temperature. Viewers of both 2D and 3D displays showed strong positive correlations with heart rate, which indicated little differences between groups. In contrast, galvanic skin response and skin temperature showed weak positive correlations with average difference between viewing 2D and 3D. We suggest that galvanic skin response and skin temperature can be used to measure and compare autonomic nervous responses in subjects viewing 2D and 3D displays.

  11. Behavioral modeling and analysis of galvanic devices

    NASA Astrophysics Data System (ADS)

    Xia, Lei


    A new hybrid modeling approach was developed for galvanic devices including batteries and fuel cells. The new approach reduces the complexity of the First Principles method and adds a physical basis to the empirical methods. The resulting general model includes all the processes that affect the terminal behavior of the galvanic devices. The first step of the new model development was to build a physics-based structure or framework that reflects the important physiochemical processes and mechanisms of a galvanic device. Thermodynamics, electrode kinetics, mass transport and electrode interfacial structure of an electrochemical cell were considered and included in the model. Each process of the cell is represented by a clearly-defined and familiar electrical component, resulting in an equivalent circuit model for the galvanic device. The second step was to develop a parameter identification procedure that correlates the device response data to the parameters of the components in the model. This procedure eliminates the need for hard-to-find data on the electrochemical properties of the cell and specific device design parameters. Thus, the model is chemistry and structure independent. Implementation issues of the new modeling approach were presented. The validity of the new model over a wide range of operating conditions was verified with experimental data from actual devices. The new model was used in studying the characteristics of galvanic devices. Both the steady-state and dynamic behavior of batteries and fuel cells was studied using the impedance analysis techniques. The results were used to explain some experimental results of galvanic devices such as charging and pulsed discharge. The knowledge gained from the device analysis was also used in devising new solutions to application problems such as determining the state of charge of a battery or the maximum power output of a fuel cell. With the new model, a system can be designed that utilizes a galvanic device

  12. DNA repair responses in human skin cells

    SciTech Connect

    Hanawalt, P.C.; Liu, S.C.; Parsons, C.S.


    Sunlight and some environmental chemical agents produce lesions in the DNA of human skin cells that if unrepaired may interfere with normal functioning of these cells. The most serious outcome of such interactions may be malignancy. It is therefore important to develop an understanding of mechanisms by which the lesions may be repaired or tolerated without deleterious consequences. Our models for the molecular processing of damaged DNA have been derived largely from the study of bacterial systems. Some similarities but significant differences are revealed when human cell responses are tested against these models. It is also of importance to learn DNA repair responses of epidermal keratinocytes for comparison with the more extensive studies that have been carried out with dermal fibroblasts. Our experimental results thus far indicate similarities for the excision-repair of ultraviolet-induced pyrimidine dimers in human keratinocytes and fibroblasts. Both the monoadducts and the interstrand crosslinks produced in DNA by photoactivated 8-methoxypsoralen (PUVA) can be repaired in normal human fibroblasts but not in those from xeroderma pigmentosum patients. The monoadducts, like pyrimidine dimers, are probably the more mutagenic/carcinogenic lesions while the crosslinks are less easily repaired and probably result in more effective blocking of DNA function. It is suggested that a split-dose protocol that maximizes the production of crosslinks while minimizing the yield of monoadducts may be more effective and potentially less carcinogenic than the single ultraviolet exposure regimen in PUVA therapy for psoriasis.

  13. Responsive corneosurfametry following in vivo skin preconditioning.


    Uhoda, E; Goffin, V; Pierard, G E


    Skin is subjected to many environmental threats, some of which altering the structure and function of the stratum corneum. Among them, surfactants are recognized factors that may influence irritant contact dermatitis. The present study was conducted to compare the variations in skin capacitance and corneosurfametry (CSM) reactivity before and after skin exposure to repeated subclinical injuries by 2 hand dishwashing liquids. A forearm immersion test was performed on 30 healthy volunteers. 2 daily soak sessions were performed for 5 days. At inclusion and the day following the last soak session, skin capacitance was measured and cyanoacrylate skin-surface strippings were harvested. The latter specimens were used for the ex vivo microwave CSM. Both types of assessments clearly differentiated the 2 hand dishwashing liquids. The forearm immersion test allowed the discriminant sensitivity of CSM to increase. Intact skin capacitance did not predict CSM data. By contrast, a significant correlation was found between the post-test conductance and the corresponding CSM data. In conclusion, a forearm immersion test under realistic conditions can discriminate the irritation potential between surfactant-based products by measuring skin conductance and performing CSM. In vivo skin preconditioning by surfactants increases CSM sensitivity to the same surfactants.

  14. The framing effect and skin conductance responses.


    Ring, Patrick


    Individuals often rely on simple heuristics when they face complex choice situations under uncertainty. Traditionally, it has been proposed that cognitive processes are the main driver to evaluate different choice options and to finally reach a decision. Growing evidence, however, highlights a strong interrelation between judgment and decision-making (JDM) on the one hand, and emotional processes on the other hand. This also seems to apply to judgmental heuristics, i.e., decision processes that are typically considered to be fast and intuitive. In this study, participants are exposed to different probabilities of receiving an unpleasant electric shock. Information about electric shock probabilities is either positively or negatively framed. Integrated skin conductance responses (ISCRs) while waiting for electric shock realization are used as an indicator for participants' emotional arousal. This measure is compared to objective probabilities. I find evidence for a relation between emotional body reactions measured by ISCRs and the framing effect. Under negative frames, participants show significantly higher ISCRs while waiting for an electric shock to be delivered than under positive frames. This result might contribute to a better understanding of the psychological processes underlying JDM. Further studies are necessary to reveal the causality underlying this finding, i.e., whether emotional processes influence JDM or vice versa.

  15. The framing effect and skin conductance responses

    PubMed Central

    Ring, Patrick


    Individuals often rely on simple heuristics when they face complex choice situations under uncertainty. Traditionally, it has been proposed that cognitive processes are the main driver to evaluate different choice options and to finally reach a decision. Growing evidence, however, highlights a strong interrelation between judgment and decision-making (JDM) on the one hand, and emotional processes on the other hand. This also seems to apply to judgmental heuristics, i.e., decision processes that are typically considered to be fast and intuitive. In this study, participants are exposed to different probabilities of receiving an unpleasant electric shock. Information about electric shock probabilities is either positively or negatively framed. Integrated skin conductance responses (ISCRs) while waiting for electric shock realization are used as an indicator for participants' emotional arousal. This measure is compared to objective probabilities. I find evidence for a relation between emotional body reactions measured by ISCRs and the framing effect. Under negative frames, participants show significantly higher ISCRs while waiting for an electric shock to be delivered than under positive frames. This result might contribute to a better understanding of the psychological processes underlying JDM. Further studies are necessary to reveal the causality underlying this finding, i.e., whether emotional processes influence JDM or vice versa. PMID:26300747

  16. Short-term habituation of eye-movement responses induced by galvanic vestibular stimulation (GVS) in the alert guinea pig.


    Kim, Juno


    In a recent study, we showed that primary afferent neurons innervating all vestibular end organs were sensitive to galvanic vestibular stimulation (GVS) in guinea pigs. In order to determine the three-dimensional character of eye movements induced by GVS, changes in eye position were recorded using digital video oculography during delivery of bilateral GVS ranging in intensity between 20 and 80 microA. Pulses were delivered in repetitive trains in order to also ascertain the involvement of vestibular habituation. At low intensities of GVS (up to 40 microA), maintained changes in eye position were induced toward the anode and away from the cathode. These eye movements were predominantly vertical with some horizontal eye movement and very little or no torsion. At higher intensities of GVS (>40 microA), horizontal nystagmus was initially observed, as well as an overall deviation of the beating field toward the anode. Nystagmus was found to habituate rapidly over successive presentations of GVS, whereas the tonic deviation of the eye remained consistent without any detectable habituation. The direction of eye movements induced by GVS was similar to that observed in humans during trans-mastoidal GVS, and the threshold differences between tonic and phasic components for GVS were also similar to previous human GVS studies. The observed habituation appears to be more specific to the phasic VOR component in quadrupedal animals such as guinea pigs, and this may reflect a considerable emphasis placed on otolithic stimulation in these animals during complex locomotor activities.

  17. Recycling galvanized steel: Operating experience and benefits

    SciTech Connect

    Dudek, F.J.; Daniels, E.J.; Morgan, W.A.


    In response to the increase in consumption of galvanized steel for automobiles in the last decade and the problems associated with remelting larger quantities of galvanized steel scrap, a process is being developed to separate and recover the steel and zinc from galvanized ferrous scrap. The zinc is dissolved from the scrap in hot caustic using anodic assistance and is recovered electrolytically as dendritic powder. The dezinced ferrous scrap is rinsed and used directly. The process is effective for zinc, lead, and aluminum removal on loose and baled scrap and on all types of galvanized steel. The process has been pilot tested for batch treatment of 900 tonnes of mostly baled scrap. A pilot plant to continuously treat loose scrap, with a design capacity of 48,000 tonnes annually, has been in operation in East Chicago, Indiana since early in 1993. The first 450 t of scrap degalvanized in the pilot plant have residual zinc below 0.01% and sodium dragout below 0.01%. Use of degalvanized steel scrap decreases raw materials, environmental compliance, and opportunity costs to steel- and iron-makers. Availability of clean degalvanized scrap may enable integrated steel producers to recycle furnace dusts to the sinter plant and EAF shops to produce flat products without use of high quality scrap alternatives such as DRI, pig iron, or iron carbide. Recycling the components of galvanized steel scrap saves primary energy, decreases zinc imports, and adds value to the scrap. The quantities of zinc available by the year 2000 from prompt and obsolete automotive scrap win approach 25% of zinc consumed in the major automotive production centers of the world. Zinc recycling from galvanized steel scrap, either before or after scrap melting, will have to be implemented.

  18. Process for dezincing galvanized steel


    Morgan, W.A.; Dudek, F.J.; Daniels, E.J.


    A process is described for removing zinc from galvanized steel. The galvanized steel is immersed in an electrolyte containing at least about 15% by weight of sodium or potassium hydroxide and having a temperature of at least about 75 C and the zinc is galvanically corroded from the surface of the galvanized steel. The material serving as the cathode is principally a material having a standard electrode potential which is intermediate of the standard electrode potentials of zinc and cadmium in the electrochemical series. The corrosion rate may be accelerated by (1) increasing the number density of corrosion sites in the galvanized steel by mechanically abrading or deforming the galvanized steel, (2) heating the galvanized steel to form an alloy of zinc on the surface of the galvanized steel, (3) mixing the galvanized steel with a material having a standard electrode potential which is intermediate of the standard electrode potentials of zinc and cadmium in the electrochemical series, or (4) moving the galvanized steel relative to itself and to the electrolyte while immersed in the electrolyte. 1 fig.

  19. Process for dezincing galvanized steel


    Morgan, William A.; Dudek, Frederick J.; Daniels, Edward J.


    A process for removing zinc from galvanized steel. The galvanized steel is immersed in an electrolyte containing at least about 15% by weight of sodium or potassium hydroxide and having a temperature of at least about C. and the zinc is galvanically corroded from the surface of the galvanized steel. The material serving as the cathode is principally a material having a standard electrode potential which is intermediate of the standard electrode potentials of zinc and cadmium in the electrochemical series. The corrosion rate may be accelerated by (i) increasing the number density of corrosion sites in the galvanized steel by mechanically abrading or deforming the galvanized steel, (ii) heating the galvanized steel to form an alloy of zinc on the surface of the galvanized steel, (iii) mixing the galvanized steel with a material having a standard electrode potential which is intermediate of the standard electrode potentials of zinc and cadmium in the electrochemical series, or (iv) moving the galvanized steel relative to itself and to the electrolyte while immersed in the electrolyte.

  20. 12-OH-nevirapine sulfate, formed in the skin, is responsible for nevirapine-induced skin rash.


    Sharma, Amy M; Novalen, Maria; Tanino, Tadatoshi; Uetrecht, Jack P


    Nevirapine (NVP) treatment is associated with a significant incidence of skin rash in humans, and it also causes a similar immune-mediated skin rash in Brown Norway (BN) rats. We have shown that the sulfate of a major oxidative metabolite, 12-OH-NVP, covalently binds in the skin. The fact that the sulfate metabolite is responsible for covalent binding in the skin does not prove that it is responsible for the rash. We used various inhibitors of sulfation to test whether this reactive sulfate is responsible for the skin rash. Salicylamide (SA), which depletes 3'-phosphoadenosine-5'-phosphosulfate (PAPS) in the liver, significantly decreased 12-OH-NVP sulfate in the blood, but it did not prevent covalent binding in the skin or the rash. Topical application of 1-phenyl-1-hexanol, a sulfotransferase inhibitor, prevented covalent binding in the skin as well as the rash, but only where it was applied. In vitro incubations of 12-OH-NVP with PAPS and cytosolic fractions from the skin of rats or from human skin also led to covalent binding that was inhibited by 1-phenyl-1-hexanol. Incubation of 12-OH-NVP with PAPS and sulfotransferase 1A1*1, a human isoform that is present in the skin, also led to covalent binding, and this binding was also inhibited by 1-phenyl-1-hexanol. We conclude that salicylamide did not deplete PAPS in the skin and was unable to prevent covalent binding or the rash, while topical 1-phenyl-1-hexanol inhibited sulfation of 12-OH-NVP in the skin and did prevent covalent binding and the rash. These results provide definitive evidence that 12-OH-NVP sulfate formed in skin is responsible for NVP-induced skin rashes. Sulfotransferase is one of the few metabolic enzymes with significant activity in the skin, and it may be responsible for the bioactivation of other drugs that cause skin rashes.

  1. Patterns of Coping, Patterns of Response.

    ERIC Educational Resources Information Center

    Franzen, Michael D.; Heffernan, William

    Both behavioral and cognitive coping strategies are determined by an individual's perception of the stressful stimuli. To investigate the relationship of an individual's usual coping style to differential responses to a behavioral or cognitive stressor in four response systems (heart rate, muscle tension, galvanic skin response, and subjective…

  2. Innate and adaptive immune responses against Staphylococcus aureus skin infections.


    Krishna, Sheila; Miller, Lloyd S


    Staphylococcus aureus is an important human pathogen that is responsible for the vast majority of bacterial skin and soft tissue infections in humans. S. aureus can also become more invasive and cause life-threatening infections such as bacteremia, pneumonia, abscesses of various organs, meningitis, osteomyelitis, endocarditis, and sepsis. These infections represent a major public health threat due to the enormous numbers of these infections and the widespread emergence of methicillin-resistant S. aureus (MRSA) strains. MSRA is endemic in hospitals worldwide and is rapidly spreading throughout the normal human population in the community. The increasing frequency of MRSA infections has complicated treatment as these strains are more virulent and are increasingly becoming resistant to multiple different classes of antibiotics. The important role of the immune response against S. aureus infections cannot be overemphasized as humans with certain genetic and acquired immunodeficiency disorders are at an increased risk for infection. Understanding the cutaneous immune responses against S. aureus is essential as most of these infections occur or originate from a site of infection or colonization of the skin and mucosa. This review will summarize the innate immune responses against S. aureus skin infections, including antimicrobial peptides that have direct antimicrobial activity against S. aureus as well as pattern recognition receptors and proinflammatory cytokines that promote neutrophil abscess formation in the skin, which is required for bacterial clearance. Finally, we will discuss the recent discoveries involving IL-17-mediated responses, which provide a key link between cutaneous innate and adaptive immune responses against S. aureus skin infections.

  3. The skin: its structure and response to ionizing radiation.


    Hopewell, J W


    The response of the skin to ionizing radiation has important implications both for the treatment of malignant disease by radiation and for radiological protection. The structural organization of human skin is described and compared with that of the pig, with which it shows many similarities, in order that the response of the skin to ionizing radiation may be more fully understood. Acute radiation damage to the skin is primarily a consequence of changes in the epidermis; the timing of the peak of the reaction is related to the kinetic organization of this layer. The rate of development of damage is independent of the radiation dose, since this is related to the natural rate of loss of cells from the basal layer of the epidermis. Recovery of the epidermis occurs as a result of the proliferation of surviving clonogenic basal cells from within the irradiated area. The presence of clonogenic cells in the canal of the hair follicle is important, particularly after non-uniform irradiation from intermediate energy beta-emitters. The migration of viable cells from the edges of the irradiated site is also significant when small areas of skin are irradiated. Late damage to the skin is primarily a function of radiation effects on the vasculature; this produces a wave of dermal atrophy after 16-26 weeks. Dermal necrosis develops at this time after high doses. A second phase of dermal thinning is seen to develop after greater than 52 weeks, and this later phase of damage is associated with the appearance of telangiectasia. Highly localized irradiation of the skin, either to a specific layer (as may result from exposure to very low energy beta-emitters) or after exposure to small highly radioactive particles, 'hot particles', produces gross effects that become visibly manifest within 2 weeks of exposure. These changes result from the direct killing of the cells of the skin in interphase after doses greater than 100 Gy. Dose-effect curves have been established for the majority of

  4. Key Role of CRF in the Skin Stress Response System

    PubMed Central

    Zmijewski, Michal A.; Zbytek, Blazej; Tobin, Desmond J.; Theoharides, Theoharis C.; Rivier, Jean


    The discovery of corticotropin-releasing factor (CRF) or CRH defining the upper regulatory arm of the hypothalamic-pituitary-adrenal (HPA) axis, along with the identification of the corresponding receptors (CRFRs 1 and 2), represents a milestone in our understanding of central mechanisms regulating body and local homeostasis. We focused on the CRF-led signaling systems in the skin and offer a model for regulation of peripheral homeostasis based on the interaction of CRF and the structurally related urocortins with corresponding receptors and the resulting direct or indirect phenotypic effects that include regulation of epidermal barrier function, skin immune, pigmentary, adnexal, and dermal functions necessary to maintain local and systemic homeostasis. The regulatory modes of action include the classical CRF-led cutaneous equivalent of the central HPA axis, the expression and function of CRF and related peptides, and the stimulation of pro-opiomelanocortin peptides or cytokines. The key regulatory role is assigned to the CRFR-1α receptor, with other isoforms having modulatory effects. CRF can be released from sensory nerves and immune cells in response to emotional and environmental stressors. The expression sequence of peptides includes urocortin/CRF→pro-opiomelanocortin→ACTH, MSH, and β-endorphin. Expression of these peptides and of CRFR-1α is environmentally regulated, and their dysfunction can lead to skin and systemic diseases. Environmentally stressed skin can activate both the central and local HPA axis through either sensory nerves or humoral factors to turn on homeostatic responses counteracting cutaneous and systemic environmental damage. CRF and CRFR-1 may constitute novel targets through the use of specific agonists or antagonists, especially for therapy of skin diseases that worsen with stress, such as atopic dermatitis and psoriasis. PMID:23939821

  5. Key role of CRF in the skin stress response system.


    Slominski, Andrzej T; Zmijewski, Michal A; Zbytek, Blazej; Tobin, Desmond J; Theoharides, Theoharis C; Rivier, Jean


    The discovery of corticotropin-releasing factor (CRF) or CRH defining the upper regulatory arm of the hypothalamic-pituitary-adrenal (HPA) axis, along with the identification of the corresponding receptors (CRFRs 1 and 2), represents a milestone in our understanding of central mechanisms regulating body and local homeostasis. We focused on the CRF-led signaling systems in the skin and offer a model for regulation of peripheral homeostasis based on the interaction of CRF and the structurally related urocortins with corresponding receptors and the resulting direct or indirect phenotypic effects that include regulation of epidermal barrier function, skin immune, pigmentary, adnexal, and dermal functions necessary to maintain local and systemic homeostasis. The regulatory modes of action include the classical CRF-led cutaneous equivalent of the central HPA axis, the expression and function of CRF and related peptides, and the stimulation of pro-opiomelanocortin peptides or cytokines. The key regulatory role is assigned to the CRFR-1α receptor, with other isoforms having modulatory effects. CRF can be released from sensory nerves and immune cells in response to emotional and environmental stressors. The expression sequence of peptides includes urocortin/CRF→pro-opiomelanocortin→ACTH, MSH, and β-endorphin. Expression of these peptides and of CRFR-1α is environmentally regulated, and their dysfunction can lead to skin and systemic diseases. Environmentally stressed skin can activate both the central and local HPA axis through either sensory nerves or humoral factors to turn on homeostatic responses counteracting cutaneous and systemic environmental damage. CRF and CRFR-1 may constitute novel targets through the use of specific agonists or antagonists, especially for therapy of skin diseases that worsen with stress, such as atopic dermatitis and psoriasis.

  6. Skin vasodilator response to local heating in multiple system atrophy.


    Yamanaka, Yoshitaka; Asahina, Masato; Mathias, Christopher J; Akaogi, Yuichi; Koyama, Yu; Hattori, Takamichi


    Local heating of nonglabrous skin increases skin blood flow (SkBF) in two phases. The initial peak (P1) is mediated by a sensory-axon reflex and the plateau phase (P2) by local production of substances such as nitric oxide. We evaluated the SkBF response to local heating in 15 multiple system atrophy (MSA) patients with autonomic failure and 12 age-matched healthy controls. The mean ratio of SkBF at P1 to that at baseline (SkBF(P1)/SkBF(base) ratio) in MSA was significantly lower than that in controls (P < 0.01). The mean ratio of SkBF at P2 seemed to be slightly reduced in the MSA patients, compared with controls, although there was no significant difference. The P1 phase is thought to be mediated by a sensory-axon reflex modulated by sympathetic nerve activity. These findings are indicative of the skin sympathetic vasomotor dysfunction in MSA.

  7. Comparison of skin stripping, in vitro release, and skin blanching response methods to measure dose response and similarity of triamcinolone acetonide cream strengths from two manufactured sources.


    Pershing, Lynn K; Bakhtian, Shahrzad; Poncelet, Craig E; Corlett, Judy L; Shah, Vinod P


    The collective studies compare in vitro drug release, in vivo skin stripping, and skin blanching response methods for dose responsiveness and bioequivalence assessment of triamcinolone acetonide cream products, as a function of application duration, drug concentration, and manufacturer source. Commercially available triamcinolone acetonide creams (0.025%, 0.1%, and 0.5%) from two manufacturers were evaluated in vitro for rate and extent of drug release across synthetic membranes and in vivo for rate, extent, and variability of drug uptake into human stratum corneum and skin blanching response in human forearm skin. Data demonstrate that increasing triamcinolone acetonide cream concentration applied increased the rate and extent of drug released in vitro as well as the extent of drug uptake and skin blanching response in human skin in vivo. No difference (p < 0.05) between the two sources of 0.1% or 0.5% creams was measured by the skin stripping or skin blanching response methods. Dermatopharmacokinetic analysis of triamcinonide acetonide in vivo is therefore dose responsive to drug concentration applied and application duration and agrees with in vivo skin blanching results. Data support the use of dermatopharmacokinetic methods for bioequivalence and bioavailability assessment of topical drug products.

  8. A study on the frictional response of reptilian shed skin

    NASA Astrophysics Data System (ADS)

    Abdel-Aal, H. A.; Vargiolu, R.; Zahouani, H.; El Mansori, M.


    Deterministic surfaces are constructs of which profile, topography and textures are integral to the function of the system they enclose. They are designed to yield a predetermined tribological response. Developing such entities relies on controlling the structure of the rubbing interface so that, not only the surface is of optimized topography, but also is able to self-adjust its tribological behaviour according to the evolution of sliding conditions. In seeking inspirations for such designs, many engineers are turning toward the biological world to study the construction and behaviour of bio-analogues, and to probe the role surface topography assumes in conditioning of frictional response. That is how a bio-analogue can self-adjust its tribological response to adapt to habitat constraints. From a tribological point of view, Squamate Reptiles, offer diverse examples where surface texturing, submicron and nano-scale features, achieves frictional regulation. In this paper, we study the frictional response of shed skin obtained from a snake (Python regius). The study employed a specially designed tribo-acoustic probe capable of measuring the coefficient of friction and detecting the acoustical behavior of the skin in vivo. The results confirm the anisotropy of the frictional response of snakes. The coefficient of friction depends on the direction of sliding: the value in forward motion is lower than that in the backward direction. Diagonal and side winding motion induces a different value of the friction coefficient. We discuss the origin of such a phenomenon in relation to surface texturing and study the energy constraints, implied by anisotropic friction, on the motion of the reptile.

  9. MicroRNAs in skin response to UV radiation.


    Syed, Deeba N; Khan, Mohammad Imran; Shabbir, Maria; Mukhtar, Hasan


    Solar ultraviolet (UV) radiation, an ubiquitous environmental carcinogen, is classified depending on the wavelength, into three regions; short-wave UVC (200-280 nm), mid-wave UVB (280-320 nm), and long-wave UVA (320- 400 nm). The human skin, constantly exposed to UV radiation, particularly the UVB and UVA components, is vulnerable to its various deleterious effects such as erythema, photoaging, immunosuppression and cancer. To counteract these and for the maintenance of genomic integrity, cells have developed several protective mechanisms including DNA repair, cell cycle arrest and apoptosis. The network of damage sensors, signal transducers, mediators, and various effector proteins is regulated through changes in gene expression. MicroRNAs (miRNAs), a group of small non-coding RNAs, act as posttranscriptional regulators through binding to complementary sequences in the 3´-untranslated region of their target genes, resulting in either translational repression or target degradation. Recent studies show that miRNAs add an additional layer of complexity to the intricately controlled cellular responses to UV radiation. This review summarizes our current knowledge of the role of miRNAs in the regulation of the human skin response upon exposure to UV radiation.

  10. Depressed mitogen responsiveness of lymphocytes at skin temperature.

    PubMed Central

    Lauwasser, M; Shands, J W


    The responsiveness of murine lymphocytes and human peripheral blood lymphocytes to phytohemagglutinin, concanavalin A, pokeweed mitogen, and endotoxin was tested in vitro at 32, 35, and 37 degrees C. The responses at 32 degrees C were delayed and often depressed. Mouse cells responded equally well at 35 and 37 degrees C. Human lymphocytes often responded more rapidly at 37 than at 35 degrees C. Since skin temperature, particularly that of the distal extremities, is usually 32 degrees C or less, a relative deficiency in cell-mediated immunity may exist in these sites. This may be part of the reason for the usual localization of certain infections, such as sporotrichosis, to these coller areas. PMID:457281

  11. Galvanic vestibular stimulation speeds visual memory recall.


    Wilkinson, David; Nicholls, Sophie; Pattenden, Charlotte; Kilduff, Patrick; Milberg, William


    The experiments of Alessandro Volta were amongst the first to indicate that visuo-spatial function can be altered by stimulating the vestibular nerves with galvanic current. Until recently, the beneficial effects of the procedure were masked by the high levels of electrical current applied, which induced nystagmus-related gaze deviation and spatial disorientation. However, several neuropsychological studies have shown that much weaker, imperceptible currents that do not elicit unpleasant side-effects can help overcome visual loss after stroke. Here, we show that visual processing in neurologically healthy individuals can also benefit from galvanic vestibular stimulation. Participants first learnt the names of eight unfamiliar faces and then after a short delay, answered questions from memory about how pairs of these faces differed. Mean correct reaction times were significantly shorter when sub-sensory, noise-enhanced anodal stimulation was administered to the left mastoid, compared to when no stimulation was administered at all. This advantage occurred with no loss in response accuracy, and raises the possibility that the procedure may constitute a more general form of cognitive enhancement.

  12. Issues in recycling galvanized scrap

    SciTech Connect

    Koros, P.J.; Hellickson, D.A.; Dudek, F.J.


    The quality of the steel used for most galvanizing (and tinplate) applications makes scrap derived from their production and use a premier solid charge material for steelmaking. In 1989 the AISI created a Task Force to define the issues and to recommend technologically and economically sound approaches to assure continued, unhindered recyclability of the growing volume of galvanized scrap. The AISI program addressed the treatment of full-sized industrial bales of scrap. The current, on-going MRI (US)--Argonne National Laboratory program is focused on ``loose`` scrap from industrial and post-consumer sources. Results from these programs, issues of scrap management from source to steel melting, the choices for handling zinc in iron and steelmaking and the benefits/costs for removal of zinc (and lead) from scrap prior to melting in BOF and foundry operations are reviewed in this paper.

  13. Novel phenotype in beagle dogs characterized by skin response to compound 48/80 focusing on skin mast cell degranulation.


    Uchida, Mitsuhiro; Ito, Fumi; Tsuchiya, Toshiyuki; Shoji, Yoko; Kurosawa, Toru


    Beagle dogs have long been employed in toxicology studies and as skin disease models. Compared with other experimental animal species, they are known to be susceptible to skin responses, such as rashes, from exposure to various chemical compounds. Here, a unique dog phenotype was identified that showed no skin response to compound 48/80, a mast cell degranulating agent. Although the skin responses to intradermal injection of polyoxyethylene castor oil derivative (HCO-60, a nonionic detergent), histamine dihydrochloride, concanavalin A (IgE receptor-mediated stimuli), or calcium ionophore A23187 were comparable in wild-type (WT) dogs and these nonresponder (NR) dogs, only the response to compound 48/80 was entirely absent from NR dogs. The skin mast cell density and histamine content per mast cell were histologically comparable between WT and NR dogs. By checking for skin responses to compound 48/80, NR dogs were found to exist at the proportion of 17-20% among four animal breeders. From retrospective analysis of in-house breeding histories, the NR phenotype appears to conform to the Mendelian pattern of recessive inheritance. The standard skin response in WT dogs developed at 2-4 months of age. In conclusion, this unique phenotype, typified by insensitivity in the compound 48/80-induced degranulation pathway in mast cells, has been widely retained by recessive inheritance in beagle dogs among general experimental animal breeders. The knowledge concerning this phenotype could lead to better utilization of dogs in studies and aid in model development.

  14. Abnormal lymphocyte response to ultraviolet radiation in multiple skin cancer

    SciTech Connect

    Munch-Petersen, B.; Frentz, G.; Squire, B.; Wallevik, K.; Horn, C.C.; Reymann, F.; Faber, M. )


    The lymphocyte response to ultraviolet radiation (254 nm) was investigated by two different methods in 29 unselected patients with multiple epidermal cancer. The ultraviolet-induced DNA synthesis was determined as the increase in incorporation of (/sup 3/H)thymidine in irradiated cells compared with non-irradiated cells after incubation for 2 h. The ultraviolet tolerance was measured as the ultraviolet dose necessary for 50% reduction in phytohemagglutinin-stimulated lymphocyte proliferation. Patients with both squamous cell differentiated tumours and basal cell carcinomas had very high ultraviolet-induced DNA synthesis values. The ultraviolet tolerance in patient lymphocytes was considerably lower than in control lymphocytes with the lowest values occurring in patients with clinical sun intolerance. These investigations may be of predictive value in skin carcinogenesis.

  15. Organisation of the sympathetic skin response in spinal cord injury

    PubMed Central

    Cariga, P; Catley, M; Mathias, C; Savic, G; Frankel, H; Ellaway, P


    Objectives: The sympathetic skin response (SSR) is a technique to assess the sympathetic cholinergic pathways, and it can be used to study the central sympathetic pathways in spinal cord injury (SCI). This study investigated the capacity of the isolated spinal cord to generate an SSR, and determined the relation between SSR, levels of spinal cord lesion, and supraspinal connections. Methods: Palmar and plantar SSR to peripheral nerve electrical stimulation (median or supraorbital nerve above the lesion, and peroneal nerve below the lesion) were recorded in 29 patients with SCI at various neurological levels and in 10 healthy control subjects. Results: In complete SCI at any neurological level, SSR was absent below the lesion. Palmar SSR to median nerve stimuli was absent in complete SCI with level of lesion above T6. Plantar SSR was absent in all patients with complete SCI at the cervical and thoracic level. In incomplete SCI, the occurrence of SSR was dependent on the preservation of supraspinal connections. For all stimulated nerves, there was no difference between recording from ipsilateral and contralateral limbs. Conclusions: No evidence was found to support the hypothesis that the spinal cord isolated from the brain stem could generate an SSR. The results indicate that supraspinal connections are necessary for the SSR, together with integrity of central sympathetic pathways of the upper thoracic segments for palmar SSR, and possibly all thoracic segments for plantar SSR. PMID:11861696

  16. Determinants of skin sympathetic nerve responses to isometric exercise.


    Wilson, Thad E; Dyckman, Damian J; Ray, Chester A


    Exercise-induced increases in skin sympathetic nerve activity (SSNA) are similar between isometric handgrip (IHG) and leg extension (IKE) performed at 30% of maximal voluntary contraction (MVC). However, the precise effect of exercise intensity and level of fatigue on this relationship is unclear. This study tested the following hypotheses: 1) exercise intensity and fatigue level would not affect the magnitude of exercise-induced increase in SSNA between IHG and IKE, and 2) altering IHG muscle mass would also not affect the magnitude of exercise-induced increase in SSNA. In protocol 1, SSNA (peroneal microneurography) was measured during baseline and during the initial and last 30 s of isometric exercise to volitional fatigue in 12 subjects who randomly performed IHG and IKE bouts at 15, 30, and 45% MVC. In protocol 2, SSNA was measured in eight subjects who performed one-arm IHG at 30% MVC with the addition of IHG of the contralateral arm in 10-s intervals for 1 min. Exercise intensity significantly increased SSNA responses during the first 30 s of IHG (34+/-13, 70+/-11, and 92+/-13% change from baseline) and IKE (30+/-17, 69+/-12, and 76+/-13% change from baseline) for 15, 30, and 45% MVC. During the last 30 s of exercise to volitional fatigue, there were no significant differences in SSNA between exercise intensities or limb. SSNA did not significantly change between one-arm and two-arm IHG. Combined, these data indicate that exercise-induced increases in SSNA are intensity dependent in the initial portion of isometric exercise, but these differences are eliminated with the development of fatigue. Moreover, the magnitude of exercise-induced increase in SSNA responses is not dependent on either muscle mass involved or exercising limb.

  17. Galvanic corrosion of beryllium welds

    SciTech Connect

    Hill, M.A.; Butt, D.P.; Lillard, R.S.


    Beryllium is difficult to weld because it is highly susceptible to cracking. The most commonly used filler metal in beryllium welds is Al-12 wt.% Si. Beryllium has been successfully welded using Al-Si filler metal with more than 30 wt.% Al. This filler creates an aluminum-rich fusion zone with a low melting point that tends to backfill cracks. Drawbacks to adding a filler metal include a reduction in service temperature, a lowering of the tensile strength of the weld, and the possibility for galvanic corrosion to occur at the weld. To evaluate the degree of interaction between Be and Al-Si in an actual weld, sections from a mock beryllium weldment were exposed to 0.1 M Cl{sup {minus}} solution. Results indicate that the galvanic couple between Be and the Al-Si weld material results in the cathodic protection of the weld and of the anodic dissolution of the bulk Be material. While the cathodic protection of Al is generally inefficient, the high anodic dissolution rate of the bulk Be during pitting corrosion combined with the insulating properties of the Be oxide afford some protection of the Al-Si weld material. Although dissolution of the Be precipitate in the weld material does occur, no corrosion of the Al-Si matrix was observed.

  18. Distribution of T Cells in Rainbow Trout (Oncorhynchus mykiss) Skin and Responsiveness to Viral Infection

    PubMed Central

    Leal, Esther; Granja, Aitor G.; Zarza, Carlos; Tafalla, Carolina


    Although the skin constitutes the first line of defense against waterborne pathogens, there is a great lack of information regarding the skin associated lymphoid tissue (SALT) and whether immune components of the skin are homogeneously distributed through the surface of the fish is still unknown. In the current work, we have analyzed the transcription of several immune genes throughout different rainbow trout (Oncorhynchus mykiss) skin areas. We found that immunoglobulin and chemokine gene transcription levels were higher in a skin area close to the gills. Furthermore, this skin area as well as other anterior sections also transcribed significantly higher levels of many different immune genes related to T cell immunity such as T cell receptor α (TCRα), TCRγ, CD3, CD4, CD8, perforin, GATA3, Tbet, FoxP3, interferon γ (IFNγ), CD40L and Eomes in comparison to posterior skin sections. In agreement with these results, immunohistochemical analysis revealed that anterior skin areas had a higher concentration of CD3+ T cells and flow cytometry analysis confirmed that the percentage of CD8+ T lymphocytes was also higher in anterior skin sections. These results demonstrate for the first time that T cells are not homogeneously distributed throughout the teleost skin. Additionally, we studied the transcriptional regulation of these and additional T cell markers in response to a bath infection with viral hemorrhagic septicemia virus (VHSV). We found that VHSV regulated the transcription of several of these T cell markers in both the skin and the spleen; with some differences between anterior and posterior skin sections. Altogether, our results point to skin T cells as major players of teleost skin immunity in response to waterborne viral infections. PMID:26808410

  19. The coordinated Response of the Physical and Antimicrobial Peptide Barriers of the Skin

    PubMed Central

    Borkowski, Andrew W.; Gallo, Richard L.


    Antimicrobial peptides (AMPs) are an essential and multifunctional element for immune defense of the skin during infection and injury. In this issue, Ahrens et al. characterize the response of β-defensins, a class of AMPs, following acute and chronic challenges to the permeability barrier of the skin. Their findings suggest that the antimicrobial and permeability barriers of the skin are closely linked. PMID:21228809

  20. Galvanic etch stop for Si in KOH

    NASA Astrophysics Data System (ADS)

    Connolly, E. J.; French, P. J.; Xia, X. H.; Kelly, J. J.


    Etch stops and etch-stopping techniques are essential 'tools' for 2D and 3D MEMS devices. Until now, use of a galvanic etch stop (ES) for micromachining in alkaline solutions was usually prohibited due to the large Au:Si area needed and/or high oxygen content required to achieve the ES. We report a new galvanic ES which requires a Au:exposed silicon area ratio of only ~1. Thus for the first time a practical galvanic ES for KOH has been achieved. The ES works by adding small amounts of sodium hypochlorite, NaOCl, to KOH solutions. Essentially the NaOCl increases the oxygen content in the KOH etchant. The dependancy of the galvanic ES on KOH concentration and temperature is investigated. Also, we report on the effects of the added NaOCl on etch rates. SEM images are used to examine the galvanically etch-stopped membranes and their surface morphology. For 33% KOH solutions the galvanic etch stop worked well, producing membranes with uniform thickness ~6 µm (i.e. slightly greater than the deposited epilayer). For 20% KOH solutions, the galvanic etch stop still worked, but the resulting membranes were a little thicker (~10 µm).

  1. Staphylococcus pseudintermedius infection associated with nodular skin lesions and systemic inflammatory response syndrome in a dog.


    Min, Sa-Hee; Kang, Min-Hee; Sur, Jung-Hyang; Park, Hee-Myung


    A 10-year-old Pekingese dog with atopic dermatitis was referred due to pyrexia, multiple skin nodules, anorexia, and depression. The dog was diagnosed as having systemic inflammatory response syndrome (SIRS) induced by bacterial dermatitis. This case presents diagnosis and treatment of SIRS with staphylococcal skin infection in a dog that was immunosuppressed due to long-term use of corticosteroid.

  2. Arousal Level in Repressors and Sensitizers as a Function of Response Context

    ERIC Educational Resources Information Center

    Stein, Steven H.


    Repressors and sensitizers were given "noncontextual" and "contextual" tasks, with galvanic skin response as a measure of arousal. Results from the noncontextual task showed that repressors had lower arousal levels than sensitizers during perception and verbal report, but higher during free association. Findings were reversed, however, in the…

  3. Effect of skin wettedness on sweat gland response

    NASA Technical Reports Server (NTRS)

    Nadel, E. R.; Stolwijk, J. A. J.


    Investigation of the effect of skin wettedness upon sweating rate. Several techniques were used to gain a better understanding of the quantitative nature of this effect. The results include the finding that the evaporative power of the environment has a profound effect on the relationship between body temperature and sweating rate.

  4. Ambient temperature affects glabrous skin vasculature and sweating responses to mental task in humans.


    Hayashi, Naoyuki; Someya, Nami; Hirooka, Yoshitaka; Koga, Shunsaku


    We compared responses in heart rate (HR), mean blood pressure (MAP), sweating rate (SR), sweating expulsion (SwE), and skin vascular conductance (VC) to mental task among different ambient temperature (Ta) conditions, i.e., 12, 16, 20, and 24 degrees C. Seven subjects (27+/-5 yrs, 64+/-14 kg) underwent a 2-min color word conflict test (CWT) after 2 mins of baseline data acquisition following a 20-min resting period. All subjects wore long sleeve shirts and long pants. The skin blood flow was measured with a laser Doppler probe on the left index finger pulp to calculate skin VC, and the SR and sweating expulsion (SwE) were measured with a ventilated capsule on the left thenar. CWT significantly increased the HR and MAP, while there was no significant effect of Ta on the magnitudes of these responses. CWT significantly decreased the skin VC when the Ta was 24 degrees C, whereas it significantly increased the skin VC when the Ta was 12 or 16 degrees C. CWT significantly increased SR and SwE in all Ta conditions, and the SwE was greater in warmer conditions. These findings suggest that different ambient temperatures induce different responses in finger skin vasculature to mental task, implying the independent response of cutaneous vasomotor tone and sweat glands in glabrous skin to mental task.

  5. Anterior parietal cortical response to tactile and skin-heating stimuli applied to the same skin site.


    Tommerdahl, M; Delemos, K A; Vierck, C J; Favorov, O V; Whitsel, B L


    1. The response of anterior parietal cortex to skin stimuli was evaluated with optical intrinsic signal imaging and extracellular microelectrode recording methods in anesthetized squirrel monkeys. 2. Nonnoxious mechanical stimulation (vibrotactile or skin tapping) of the contralateral radial interdigital pad was accompanied by a decrease in reflectance (at 833 nm) in sectors of cytoarchitectonic areas 3b and 1. This intrinsic signal was in register with regions shown by previous receptive field mapping studies to receive low-threshold mechanoreceptor input from the radial interdigital pad. 3. A skin-heating stimulus applied to the contralateral radial interdigital pad with a stationary probe/thermode evoked no discernable intrinsic signal in areas 3b and 1, but evoked a signal within a circumscribed part of area 3a. The region of area 3a responsive to skin heating with the stationary probe/thermode was adjacent to the areas 3b and 1 regions that developed an intrinsic signal in response to vibrotactile stimulation of the same skin site. Skin heating with a stationary probe/thermode also evoked intrinsic signal in regions of areas 4 and 2 neighboring the area 3b/1 regions activated by vibrotactile stimulation of the contralateral radial interdigital pad. 4. The intrinsic signal evoked in area 3a by a series of heating stimuli to the contralateral radial interdigital pad (applied with a stationary probe/thermode) increased progressively in magnitude with repeated stimulation (exhibited slow temporal summation) and remained above prestimulus levels for a prolonged period after termination of repetitive stimulation. 5. Brief mechanical stimuli ("taps") applied to the contralateral radial interdigital pad with a probe/thermode maintained either at 37 degrees C or at 52 degrees C were accompanied by the development of an intrinsic signal in both area 3a and areas 3b/1. For the 52 degrees C stimulus, the area 3a intrinsic signal was larger and the intrinsic signal in

  6. Evaluation of laser treatment response of vascular skin disorders in relation to skin properties using multi-spectral imaging

    NASA Astrophysics Data System (ADS)

    de Roode, Rowland; Noordmans, Herke Jan; Rem, Alex; Couwenberg, Sharon; Verdaasdonk, Rudolf


    There can be a large variation in response between laser treatments of vascular malformations like port-wine stains even in one patient. This could be ascribed to variations in the skin properties like tint (melanin) and perfusion (redness) which will influence the effectiveness of the laser dosimetry. To obtain a better understanding of the relation between skin properties just before treatment, laser dosimetry and clinical response, a multi-spectral dermatoscope is applied. A sequence of calibrated images is captured from 400 to 720 nm. Images at the treatment laser wavelength (532 nm) show the absorbing structures during laser exposure. Images of different treatment sessions of one patient were matched with dedicated registration software to quantify the results of the laser treatment (change in blood vessels structure, effect on pigment). For feasibility, images were collected from 5 patients and used to determine the optimal wavelength combination strategies. The image matching software gives an objective impression of the improvement, e.g. the clearing of the port-wine stain over time or pigment reactions, which will facilitate the discussion with the patient about the end point of treatment. The multi-spectral dermatoscope and software developed enables the evaluation of large patient series which will result in objective data to advise the dermatologist on the optimal laser dosimetry in future in relation to the skin properties.

  7. The use of infrared thermography to detect the skin temperature response to physical activity

    NASA Astrophysics Data System (ADS)

    Tanda, G.


    Physical activity has a noticeable effect on skin blood flow and temperature. The thermal regulatory and hemodynamic processes during physical activity are controlled by two conflicting mechanisms: the skin vasoconstriction induced by the blood flow demand to active muscles and the skin vasodilation required by thermoregulation to increase warm blood flow and heat conduction to the skin. The time-evolution of skin temperature during exercise can give useful information about the adaptation of the subject as a function of specific type, intensity and duration of exercise. In this paper, infrared thermography is used to investigate the thermal response of skin temperature during running exercise on treadmill for a group of seven healthy and trained runners. Two different treadmill exercises are considered: a graded load exercise and a constant load exercise; for both exercises the duration was 30 minutes. Within the limits due to the relatively small size of the sample group, results typically indicate a fall in skin temperature during the initial stage of running exercise. As the exercise progresses, the dynamics of the skin temperature response depends on the type of exercise (graded versus constant load) and probably on the level of training of the subject.

  8. Fractionated laser resurfacing corrects the inappropriate UVB response in geriatric skin.


    Spandau, Dan F; Lewis, Davina A; Somani, Ally-Khan; Travers, Jeffrey B


    Non-melanoma skin cancer is a disease primarily afflicting geriatric patients as evidenced by the fact that 80% of all non-melanoma skin cancers are diagnosed in patients over the age of 60 years. As such, geriatric skin responds to cancer-inducing UVB irradiation in a manner that allows the establishment of tumor cells. Currently, the only effective treatment for non-melanoma skin cancer is the removal of the tumors after they appear, indicating the need for a more cost-effective prophylactic therapy. Geriatric volunteers were treated with fractionated laser resurfacing therapy on either sun-protected (upper buttocks) or chronically sun-exposed (dorsal forearm) skin. Fractionated laser resurfacing therapy was shown to decrease the occurrence of senescent fibroblasts in geriatric dermis, increase the dermal expression of IGF-1, and correct the inappropriate UVB response observed in untreated geriatric skin. These responses to fractionated laser resurfacing were equal to the effects seen previously using the more aggressive wounding following dermabrasion. Furthermore, fractionated laser resurfacing was equally effective in both sun-protected and sun-exposed skin. The ability of fractionated laser resurfacing treatment to protect against the occurrence of UVB-damaged proliferating keratinocytes indicates the potential of fractionated laser resurfacing to reduce or prevent aging-associated non-melanoma skin cancer.

  9. Differences in thermal optical response between intact diabetic and nondiabetic human skin

    NASA Astrophysics Data System (ADS)

    Yeh, Shu-Jen; Hanna, Charles F.; Kantor, Stan; Hohs, Ronald; Khalil, Omar S.


    We observed a difference in the thermal response of localized reflectance signal of human skin between type-2 diabetic and non-diabetic volunteers. We investigated the use of this thermo-optical behavior as a basis for a non-invasive method for the determination of the diabetic status of a subject. We used a two-site temperature differential method, which is predicated upon the measurement of localized reflectance from two areas on the surface of the skin, each of these areas is subjected to a different thermal perturbation. The response of skin localized reflectance to temperature was measured and used in a classification algorithm. We used a discriminant function to classify subjects as diabetics or non-diabetics. In a prediction set of 24 non-invasive tests collected from 6 diabetics and 6 non-diabetics, the sensitivity ranged between 73% and 100%, and the specificity ranged between 75% and 100%, depending on the thermal conditions and probe-skin contact time. The difference in thermo-optical response of the skin of the two groups may be explained in terms of difference in response of cutaneous microcirculation to temperature, which is manifested as a difference in the near infrared light absorption and scattering. Another factor is the difference in the temperature response of the scattering coefficient between the two groups, which may be caused by cutaneous structural differences induced by non-enzymatic glycation of skin protein fibers, and/or by the difference in blood cell aggregation.

  10. Skin response to cobalt 60 irradiation and the consequences for matching the color of facial prostheses

    SciTech Connect

    van Oort, R.P.; Vermey, J.; Ten Bosch, J.J.


    A radiotherapy treatment (/sup 60/Co) of cancer in the head and neck region causes side effects in the skin that postpone the facial prosthetic treatment. The increasing and fading erythema and pigmentation of the skin was investigated with the use of a subtractive colorimeter. This method was verified with photographs scored according to the Oxford scoring system. Fourteen patients were investigated during a period of 24 weeks. The mean colorimetric skin response showed a peak 6 weeks after the onset of irradiation. Six to 7 weeks later, there was no significant difference between the skin color before and after irradiation. At this time the dry desquamation of the skin is healed. From this viewpoint, the color matching procedure for a facial prosthesis may start not earlier than 15 weeks from the onset of irradiation. If a nonirradiated control field in the facial region is present, a color match for the facial prosthesis can be started just after the irradiation period.

  11. Biology of human skin transplanted to the nude mouse: I. Response to agents which modify epidermal proliferation.


    Krueger, G G; Shelby, J


    To accept human skin transplanted to the congenitally athymic (nude) mouse as a system to study human skin and its physiologic and pathologic states, it must be demonstrated that skin so maintained retains its function as a biologic unit. We have found that responses of grafted human skin and nude mouse skin to various agents differ. This difference in response has been utilized to assess barrier function and proliferative capacity of human skin grafts. Human skin grafts undergo a proliferative response when 10 ng of the tumor promoter, 12-O-tetradecanoyl phorbol 13-acetate (TPA) is applied. Nudes do not respond to this dose. Increasing the dose to 100 ng of TPA evokes a response in both. However, only in the human skin grafts can this response be blocked with betamethasone valerate (BV). In that human skin grafts do not take on their hosts' responsiveness, and the response of domestic pig skin to these agents before and after grafting is identical, the conclusion is reached that human skin appears to retain its inherent biologic unit function. The data also demonstrate some of the potential of this system to study kinetics of the epidermis of human skin.

  12. The effect of surface wave propagation on neural responses to vibration in primate glabrous skin.


    Manfredi, Louise R; Baker, Andrew T; Elias, Damian O; Dammann, John F; Zielinski, Mark C; Polashock, Vicky S; Bensmaia, Sliman J


    Because tactile perception relies on the response of large populations of receptors distributed across the skin, we seek to characterize how a mechanical deformation of the skin at one location affects the skin at another. To this end, we introduce a novel non-contact method to characterize the surface waves produced in the skin under a variety of stimulation conditions. Specifically, we deliver vibrations to the fingertip using a vibratory actuator and measure, using a laser Doppler vibrometer, the surface waves at different distances from the locus of stimulation. First, we show that a vibration applied to the fingertip travels at least the length of the finger and that the rate at which it decays is dependent on stimulus frequency. Furthermore, the resonant frequency of the skin matches the frequency at which a subpopulation of afferents, namely Pacinian afferents, is most sensitive. We show that this skin resonance can lead to a two-fold increase in the strength of the response of a simulated afferent population. Second, the rate at which vibrations propagate across the skin is dependent on the stimulus frequency and plateaus at 7 m/s. The resulting delay in neural activation across locations does not substantially blur the temporal patterning in simulated populations of afferents for frequencies less than 200 Hz, which has important implications about how vibratory frequency is encoded in the responses of somatosensory neurons. Third, we show that, despite the dependence of decay rate and propagation speed on frequency, the waveform of a complex vibration is well preserved as it travels across the skin. Our results suggest, then, that the propagation of surface waves promotes the encoding of spectrally complex vibrations as the entire neural population is exposed to essentially the same stimulus. We also discuss the implications of our results for biomechanical models of the skin.

  13. The use of reflectance confocal microscopy for monitoring response to therapy of skin malignancies

    PubMed Central

    Ulrich, Martina; Lange-Asschenfeldt, Susanne; Gonzalez, Salvador


    Summary Reflectance confocal microscopy (RCM) is a new non-invasive imaging technique that enables visualizing cells and structures in living skin in real-time with resolution close to that of histological analysis. RCM has been successfully implemented in the assessment of benign and malignant lesions. Most importantly, it also enables monitoring dynamic changes in the skin over time and in response to different therapies, e.g., imiquimod, photodynamic therapy, and others. Given the often traumatic nature of skin cancer that affects both the physiology and the psychology of the patients, it is crucial to have methods that enable monitoring the response to treatment but that minimize the distress and discomfort associated with such process. This article provides a very brief overview of the fundamentals of RCM and then focuses on its recent employment as a monitoring tool in skin cancer and other pathologies that may require frequent follow-up. PMID:23785598

  14. Triclosan Induces Thymic Stromal Lymphopoietin in Skin Promoting Th2 Allergic Responses.


    Marshall, Nikki B; Lukomska, Ewa; Long, Carrie M; Kashon, Michael L; Sharpnack, Douglas D; Nayak, Ajay P; Anderson, Katie L; Jean Meade, B; Anderson, Stacey E


    Triclosan is an antimicrobial chemical incorporated into many personal, medical and household products. Approximately, 75% of the U.S. population has detectable levels of triclosan in their urine, and although it is not typically considered a contact sensitizer, recent studies have begun to link triclosan exposure with augmented allergic disease. We examined the effects of dermal triclosan exposure on the skin and lymph nodes of mice and in a human skin model to identify mechanisms for augmenting allergic responses. Triclosan (0%-3%) was applied topically at 24-h intervals to the ear pinnae of OVA-sensitized BALB/c mice. Skin and draining lymph nodes were evaluated for cellular responses and cytokine expression over time. The effects of triclosan (0%-0.75%) on cytokine expression in a human skin tissue model were also examined. Exposure to triclosan increased the expression of TSLP, IL-1β, and TNF-α in the skin with concomitant decreases in IL-25, IL-33, and IL-1α. Similar changes in TSLP, IL1B, and IL33 expression occurred in human skin. Topical application of triclosan also increased draining lymph node cellularity consisting of activated CD86(+)GL-7(+) B cells, CD80(+)CD86(+) dendritic cells, GATA-3(+)OX-40(+)IL-4(+)IL-13(+) Th2 cells and IL-17 A(+) CD4 T cells. In vivo antibody blockade of TSLP reduced skin irritation, IL-1β expression, lymph node cellularity, and Th2 responses augmented by triclosan. Repeated dermal exposure to triclosan induces TSLP expression in skin tissue as a potential mechanism for augmenting allergic responses.

  15. Investigation of galvanic-coupled intrabody communication using the human body circuit model.


    Kibret, Behailu; Seyedi, MirHojjat; Lai, Daniel T H; Faulkner, Micheal


    Intrabody Communication (IBC) is a technique that uses the human body as a transmission medium for electrical signals to connect wearable electronic sensors and devices. Understanding the human body as the transmission medium in IBC paves way for practical implementation of IBC in body sensor networks. In this study, we propose a model for galvanic coupling-type IBC based on a simplified equivalent circuit representation of the human upper arm. We propose a new way to calculate the electrode-skin contact impedance. Based on the model and human experimental results, we discuss important characteristics of galvanic coupling-type IBC, namely, the effect of tissues, anthropometry of subjects, and electrode configuration on signal propagation. We found that the dielectric properties of the muscle primarily characterize the received signal when receiver electrodes are located close to transmitter electrodes. When receiver and transmitter electrodes are far apart, the skin dielectric property affects the received signal.

  16. Allergic Responses Induced by the Immunomodulatory Effects of Nanomaterials upon Skin Exposure

    PubMed Central

    Yoshioka, Yasuo; Kuroda, Etsushi; Hirai, Toshiro; Tsutsumi, Yasuo; Ishii, Ken J.


    Over the past decade, a vast array of nanomaterials has been created through the development of nanotechnology. With the increasing application of these nanomaterials in various fields, such as foods, cosmetics, and medicines, there has been concern about their safety, that is, nanotoxicity. Therefore, there is an urgent need to collect information about the biological effects of nanomaterials so that we can exploit their potential benefits and design safer nanomaterials, while avoiding nanotoxicity as a result of inhalation or skin exposure. In particular, the immunomodulating effect of nanomaterials is one of most interesting aspects of nanotoxicity. However, the immunomodulating effects of nanomaterials through skin exposure have not been adequately discussed compared with the effects of inhalation exposure, because skin penetration by nanomaterials is thought to be extremely low under normal conditions. On the other hand, the immunomodulatory effects of nanomaterials via skin may cause severe problems for people with impaired skin barrier function, because some nanomaterials could penetrate the deep layers of their allergic or damaged skin. In addition, some studies, including ours, have shown that nanomaterials could exhibit significant immunomodulating effects even if they do not penetrate the skin. In this review, we summarize our current knowledge of the allergic responses induced by nanomaterials upon skin exposure. First, we discuss nanomaterial penetration of the intact or impaired skin barrier. Next, we describe the immunomodulating effects of nanomaterials, focusing on the sensitization potential of nanomaterials and the effects of co-exposure of nanomaterials with substances such as chemical sensitizers or allergens, on the onset of allergy, following skin exposure. Finally, we discuss the potential mechanisms underlying the immunomodulating effects of nanomaterials by describing the involvement of the protein corona in the interaction of

  17. Stuttered and Fluent Speakers' Heart Rate and Skin Conductance in Response to Fluent and Stuttered Speech

    ERIC Educational Resources Information Center

    Zhang, Jianliang; Kalinowski, Joseph; Saltuklaroglu, Tim; Hudock, Daniel


    Background: Previous studies have found simultaneous increases in skin conductance response and decreases in heart rate when normally fluent speakers watched and listened to stuttered speech compared with fluent speech, suggesting that stuttering induces arousal and emotional unpleasantness in listeners. However, physiological responses of persons…

  18. Skin Conductance Responses to Another Person's Gaze in Children with Autism

    ERIC Educational Resources Information Center

    Kylliainen, Anneli; Hietanen, Jari K.


    The effects of another person's gaze on physiological arousal were investigated by measuring skin conductance responses (SCR). Twelve able children with autism and 12 control children were shown face stimuli with straight gaze (eye contact) or averted gaze on a computer monitor. In children with autism, the responses to straight gaze were stronger…

  19. A suction blister model reliably assesses skin barrier restoration and immune response.


    Smith, Tracey J; Wilson, Marques A; Young, Andrew J; Montain, Scott J


    Skin wound healing models can be used to detect changes in immune function in response to interventions. This study used a test-retest format to assess the reliability of a skin suction blister procedure for quantitatively evaluating human immune function in repeated measures type studies. Up to eight suction blisters (~30 mm(2)) were induced via suction on each participant's left and right forearm (randomized order; blister session 1 and 2), separated by approximately one week. Fluid was sampled from each blister, and the top layer of each blister was removed to reveal up to eight skin wounds. Fluid from each wound was collected 4, 7 and 24h after blisters were induced, and proinflammatory cytokines were measured. Transepidermal water loss (TEWL), to assess skin barrier recovery, was measured daily at each wound site until values were within 90% of baseline values (i.e., unbroken skin). Sleep, stress and inflammation (i.e., factors that affect wound healing and immune function), preceding the blister induction, were assessed via activity monitors (Actical, Philips Respironics, Murrysville, Pennsylvania), the Perceived Stress Scale (PSS) and C-reactive protein (CRP), respectively. Area-under-the-curve and TEWL, between blister session 1 and 2, were compared using Pearson correlations and partial correlations (controlling for average nightly sleep, PSS scores and CRP). The suction blister method was considered reliable for assessing immune response and skin barrier recovery if correlation coefficients reached 0.7. Volunteers (n=16; 12 M; 4F) were 23 ± 5 years [mean ± SD]. Time to skin barrier restoration was 4.9 ± 0.8 and 4.8 ± 0.9 days for sessions 1 and 2, respectively. Correlation coefficients for skin barrier restoration, IL-6, IL-8 and MIP-1α were 0.9 (P<0.0001), 0.7 (P=0.008) and 0.9 (P<0.0001), respectively. When average nightly sleep, PSS scores and CRP (i.e., percent difference between sessions 1 and 2) were taken into consideration, correlations in

  20. A galvanic study of different amalgams.


    Wang Chen, C P; Greener, E H


    Due to the difference in open circuit potential (OCP) versus SCE for Aristaloy amalgam (-969 mV) and Dispersalloy amalgam (-549 mV) in Ringer's solution at 25 degrees C, a galvanic cell was created with Dispersalloy amalgam as cathode and Aristaloy amalgam as anode. The galvanic corrosion current was studied as a function of time for the above cell as well as for a cell of type III dental gold (OCP is +0-5 mV) versus Aristaloy amalgam. The initial corrosion current of the latter cell (105 micronA) is about twice that for the cell of Aristaloy amalgam versus Dispersalloy amalgam (54 micronA), however, their passivating behaviour is quite similar. Also, an interrupted galvanic corrosion test simulating the oral 'make and break' situation was performed. A much higher corrosion current than the steady state was found when the two electrodes resumed contact.

  1. Simulation to coating weight control for galvanizing

    NASA Astrophysics Data System (ADS)

    Wang, Junsheng; Yan, Zhang; Wu, Kunkui; Song, Lei


    Zinc coating weight control is one of the most critical issues for continuous galvanizing line. The process has the characteristic of variable-time large time delay, nonlinear, multivariable. It can result in seriously coating weight error and non-uniform coating. We develop a control system, which can automatically control the air knives pressure and its position to give a constant and uniform zinc coating, in accordance with customer-order specification through an auto-adaptive empirical model-based feed forward adaptive controller, and two model-free adaptive feedback controllers . The proposed models with controller were applied to continuous galvanizing line (CGL) at Angang Steel Works. By the production results, the precise and stability of the control model reduces over-coating weight and improves coating uniform. The product for this hot dip galvanizing line does not only satisfy the customers' quality requirement but also save the zinc consumption.

  2. Nicotine increases initial blood flow responses to local heating of human non-glabrous skin.


    Warner, David O; Joyner, Michael J; Charkoudian, Nisha


    Nicotine affects the regulation of skin blood flow (SkBF), but the mechanisms involved are not well understood. We tested the hypothesis that acute exposure to nicotine inhibits both the initial neurally mediated component and the later sustained component of SkBF responses to local heating of non-glabrous skin in humans. SkBF (measured by laser-Doppler) responses to local heating of forearm skin from 32 to 42 degrees C were measured in 11 chronic smokers. Heating occurred at one site over 15 min (RAMP) and over 90 s (STEP) at another site, and was maintained for an additional 30 min. STEP heating was also applied to a site pretreated with bretylium via iontophoresis to inhibit noradrenergic neurotransmission. Responses were measured before and after acute administration of nicotine via cigarettes or nasal spray in two experimental sessions. Nicotine decreased resting skin blood flow (P < 0.05); this response was inhibited by bretylium. During RAMP, nicotine increased the initial SkBF at 42 degrees C (by approximately 12%, P < 0.05). For STEP, nicotine increased the initial peak response (by approximately 25%, P < 0.05), and decreased the sustained plateau value (by approximately 10%, P < 0.05). In skin pretreated with bretylium, the increase caused by nicotine in the initial peak value persisted, but the plateau value was not different from pre-nicotine. These data suggest that in abstinent cigarette smokers, nicotine augments initial responses to both gradual and rapid non-painful heating of non-glabrous skin by sensitizing the sensory nerves that mediate the axon reflex associated with rapid vasodilatation. In contrast, nicotine decreases SkBF responses to prolonged heating by activating noradrenergic nerves.

  3. Immune sensitization to methylene diphenyl diisocyanate (MDI) resulting from skin exposure: albumin as a carrier protein connecting skin exposure to subsequent respiratory responses

    PubMed Central


    Background Methylene diphenyl diisocyanate (MDI), a reactive chemical used for commercial polyurethane production, is a well-recognized cause of occupational asthma. The major focus of disease prevention efforts to date has been respiratory tract exposure; however, skin exposure may also be an important route for inducing immune sensitization, which may promote subsequent airway inflammatory responses. We developed a murine model to investigate pathogenic mechanisms by which MDI skin exposure might promote subsequent immune responses, including respiratory tract inflammation. Methods Mice exposed via the skin to varying doses (0.1-10% w/v) of MDI diluted in acetone/olive oil were subsequently evaluated for MDI immune sensitization. Serum levels of MDI-specific IgG and IgE were measured by enzyme-linked immunosorbant assay (ELISA), while respiratory tract inflammation, induced by intranasal delivery of MDI-mouse albumin conjugates, was evaluated based on bronchoalveolar lavage (BAL). Autologous serum IgG from "skin only" exposed mice was used to detect and guide the purification/identification of skin proteins antigenically modified by MDI exposure in vivo. Results Skin exposure to MDI resulted in specific antibody production and promoted subsequent respiratory tract inflammation in animals challenged intranasally with MDI-mouse albumin conjugates. The degree of (secondary) respiratory tract inflammation and eosinophilia depended upon the (primary) skin exposure dose, and was maximal in mice exposed to 1% MDI, but paradoxically limited in mice receiving 10-fold higher doses (e.g. 10% MDI). The major antigenically-modified protein at the local MDI skin exposure site was identified as albumin, and demonstrated biophysical changes consistent with MDI conjugation. Conclusions MDI skin exposure can induce MDI-specific immune sensitivity and promote subsequent respiratory tract inflammatory responses and thus, may play an important role in MDI asthma pathogenesis. MDI

  4. Molecular Genetic Response to Varied Wavelengths of Light in Xiphophorus maculatus Skin

    PubMed Central

    Chang, Jordan; Lu, Yuan; Boswell, William T.; Boswell, Mikki; Caballero, Kaela L.; Walter, Ronald B.


    Xiphophorus fishes represent a model often utilized to study UVB induced tumorigenesis. Recently, varied genetic responses to UVB exposure has been documented in the skin of female and male Xiphophorus, as have differences in UVB response in the skin of different parental species and for interspecies hybrids produced from crossing them. Additionally, it has been shown that exposure to “cool white” fluorescent light induces a shift in the genetic profiles of Xiphophorus skin that is nearly as robust as the UVB response, but involves a fundamentally different set of genes. Given these results and the use of Xiphophorus interspecies hybrids as an experimental model for UVB inducible melanoma, it is of interest to characterize genes that may be transcriptionally modulated in a wavelength specific manner. The global molecular genetic response of skin upon exposure of the intact animal to specific wavelengths of light has not been investigated. Herein, we report results of RNA-Seq experiments from the skin of male Xiphophorus maculatus Jp 163 B following exposure to varied 50 nm wavelengths of light ranging from 300–600 nm. We identify two specific wavelength regions, 350–400 nm (88 genes) and 500–550 nm (276 genes) that exhibit transcriptional modulation of a significantly greater number of transcripts than any of the other 50 nm regions in the 300–600 nm range. Observed functional sets of genes modulated within these two transcriptionally active light regions suggest different mechanisms of gene modulation. PMID:26460196

  5. Molecular genetic response to varied wavelengths of light in Xiphophorus maculatus skin.


    Chang, Jordan; Lu, Yuan; Boswell, William T; Boswell, Mikki; Caballero, Kaela L; Walter, Ronald B


    Xiphophorus fishes represent a model often utilized to study UVB induced tumorigenesis. Recently, varied genetic responses to UVB exposure have been documented in the skin of female and male Xiphophorus, as have differences in UVB response in the skin of different parental species and for interspecies hybrids produced from crossing them. Additionally, it has been shown that exposure to "cool white" fluorescent light induces a shift in the genetic profiles of Xiphophorus skin that is nearly as robust as the UVB response, but involves a fundamentally different set of genes. Given these results and the use of Xiphophorus interspecies hybrids as an experimental model for UVB inducible melanoma, it is of interest to characterize genes that may be transcriptionally modulated in a wavelength specific manner. The global molecular genetic response of skin upon exposure of the intact animal to specific wavelengths of light has not been investigated. Herein, we report results of RNA-Seq experiments from the skin of male Xiphophorus maculatus Jp 163 B following exposure to varied 50nm wavelengths of light ranging from 300-600nm. We identify two specific wavelength regions, 350-400nm (88 genes) and 500-550nm (276 genes), that exhibit transcriptional modulation of a significantly greater number of transcripts than any of the other 50nm regions in the 300-600nm range. Observed functional sets of genes modulated within these two transcriptionally active light regions suggest different mechanisms of gene modulation.

  6. Acute dissociation predicts rapid habituation of skin conductance responses to aversive auditory probes.


    Giesbrecht, Timo; Merckelbach, Harald; ter Burg, Linda; Cima, Maaike; Simeon, Daphne


    The present study examined how acute dissociation, trait-like dissociative symptoms, and physiological reactivity relate to each other. Sixty-nine undergraduate students were exposed to 14 aversive auditory probes, while their skin conductance responses were measured. A combination of self-reported anxiety and trait-like dissociation was found to predict variability in peritraumatic dissociation levels induced by the aversive probes. Furthermore, high levels of acute dissociation were associated with faster habituation of skin conductance responding, while trait-like dissociation was unrelated to habituation. Interestingly, individuals who reported childhood trauma displayed elevated skin conductance responses. Our findings contribute to the growing body of evidence indicating that subjective feelings of acute dissociation have their objective concomitants, notably fast habituation of physiologic responses.

  7. 77 FR 28404 - Galvanized Steel Wire From China and Mexico

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... COMMISSION Galvanized Steel Wire From China and Mexico Determinations On the basis of the record \\1... retarded, by reason of imports from China of galvanized steel wire, provided for in subheadings 7217.20.30... retarded, by reason of imports from Mexico of galvanized steel wire, provided for in subheadings...

  8. Synchronization of sacral skin blood flow oscillations in response to local heating.


    Jan, Yih-Kuen; Liao, Fuyuan


    Local heating causes an increase in skin blood flow by activating sensory axon reflex and metabolic nitric oxide controls. It has been observed that the remote skin area without temperature changes also shows a slightly increase in blood flow. The responsible mechanism of this indirect vasodilation remains unclear. We hypothesized that the remote skin area will have enhanced synchronization of blood flow oscillations (BFO), thus inducing a vasodilatory response. We studied BFO in two sites separated 10 cm of the sacral skin in 12 healthy people. Ensemble empirical mode decomposition method was used to decompose blood flow signals into a set of intrinsic mode functions (IMFs), and an IMF was selected to quantify each of myogenic, neurogenic, and metabolic modes of BFO. Then the instantaneous phase of the mode was calculated using the Hilbert transform. From the time series of phase difference between a pair of characteristic modes, we detected the epochs of phase synchronization and estimated the level of statistical significance using surrogate time series. The results showed that phase synchronization between neurogenic BFO was significantly higher in the period of the maximal vasodilation. We also observed a weak synchronization between myogenic BFO of the two skin sites. Our results suggested that synchronization of BFO may be associated with the changes in skin blood flow at the non-heated site.

  9. Time and dose-response effects of honokiol on UVB-induced skin cancer development.


    Guillermo, Ruth F; Chilampalli, Chandeshwari; Zhang, Xiaoying; Zeman, David; Fahmy, Hesham; Dwivedi, Chandradhar


    Honokiol has shown chemopreventive effects in chemically-induced and UVB-induced skin cancer in mice. In this investigation, we assessed the time-effects of a topical low dose of honokiol (30 μg), and then the effects of different honokiol doses (30, 45, and 60 μg) on a UVB-induced skin cancer model to find an optimal dose and time for desirable chemopreventive effects. UVB radiation (30 mJ/cm(2), 5 days/week for 25 or 27 weeks) was used to induce skin carcinogenesis in SKH-1 mice. For the time-response experiment 30 μg honokiol in acetone was applied topically to the animals before the UVB exposure (30 min, 1 h, and 2 h) and after the UVB exposure (immediately, 30 min, and 1 h). Control groups were treated with acetone. For the dose-response study, animals were treated topically with acetone or honokiol (30, 45, and 60 μg) one hour before the UVB exposure. In the time-response experiment, honokiol inhibited skin tumor multiplicity by 49-58% while reducing tumor volumes by 70-89%. In the dose-response study, honokiol (30, 45, and 60 μg) significantly decreased skin tumor multiplicity by 36-78% in a dose-dependent manner, while tumor area was reduced by 76-94%. Honokiol (60 μg) significantly reduced tumor incidence by 40% as compared to control group. Honokiol applied in very low doses (30 μg) either before or after UVB radiation shows chemopreventive effects. Honokiol (30, 45, and 60 μg) prevents UVB-induced skin cancer in a dose-dependent manner. Honokiol can be an effective chemopreventive agent against skin cancer.

  10. Claudin tight junction proteins in rainbow trout (Oncorhynchus mykiss) skin: Spatial response to elevated cortisol levels.


    Gauberg, Julia; Kolosov, Dennis; Kelly, Scott P


    This study examined regional distribution and corticosteroid-induced alterations of claudin (cldn) transcript abundance in teleost fish skin. Regional comparison of mRNA encoding 20 Cldns indicated that 12 exhibit differences in abundance along the dorsoventral axis of skin. However, relative abundance of cldns (i.e. most to least abundant) remained similar in different skin regions. Several cldns appear to be present in the epidermis and dermal vasculature whereas others are present only in the epidermis. Increased circulating cortisol levels significantly altered mRNA abundance of 10 cldns in a region specific manner, as well as corticosteroid receptors and 11β-hydroxysteroid dehydrogenase (type 2). Epidermis and epidermal mucous cell morphometrics also altered in response to cortisol, exhibiting changes that appear to enhance skin barrier properties. Taken together, data provide a first look at spatial variation in the molecular physiology of the teleost fish integument TJ complex and region-specific sensitivity to an endocrine factor.

  11. Sympathetic Responses to Noxious Stimulation of Muscle and Skin

    PubMed Central

    Burton, Alexander R.; Fazalbhoy, Azharuddin; Macefield, Vaughan G.


    Acute pain triggers adaptive physiological responses that serve as protective mechanisms that prevent continuing damage to tissues and cause the individual to react to remove or escape the painful stimulus. However, an extension of the pain response beyond signaling tissue damage and healing, such as in chronic pain states, serves no particular biological function; it is maladaptive. The increasing number of chronic pain sufferers is concerning, and the associated disease burden is putting healthcare systems around the world under significant pressure. The incapacitating effects of long-lasting pain are not just psychological – reflexes driven by nociceptors during the establishment of chronic pain may cause serious physiological consequences on regulation of other body systems. The sympathetic nervous system is inherently involved in a host of physiological responses evoked by noxious stimulation. Experimental animal and human models demonstrate a diverse array of heterogeneous reactions to nociception. The purpose of this review is to understand how pain affects the sympathetic nervous system by investigating the reflex cardiovascular and neural responses to acute pain and the long-lasting physiological responses to prolonged (tonic) pain. By observing the sympathetic responses to long-lasting pain, we can begin to understand the physiological consequences of long-term pain on cardiovascular regulation. PMID:27445972

  12. A case study of infant physiologic response to skin-to-skin contact following surgery for complex congenital heart disease

    PubMed Central

    Harrison, Tondi M.; Ludington-Hoe, Susan


    Background Infants with complex congenital heart disease requiring surgical intervention within the first days or weeks of life may be the most seriously ill infants needing intensive nursing and medical care immediately after birth. Skin to skin contact (SSC) is well-accepted and practiced as a positive therapeutic intervention in premature infants, but is not routinely offered to infants in cardiac intensive care units. Physiologic effects of SSC in the congenital heart disease population must be examined before recommending incorporation of SSC into standard care routines. Objective The purpose of this case study was to describe the physiologic response to a single session of SSC in an 18-day-old infant with hypoplastic left heart syndrome. Methods Repeated measures of heart rate, respiratory rate, oxygen saturation, blood pressure, and temperature were recorded 30 minutes prior to SSC, during SSC (including interruptions for bottle and breast feedings), and 10 minutes after SSC was completed. Results All physiologic parameters were clinically acceptable throughout the 135-minute observation. Conclusion This case study provides beginning evidence that SSC is safe in full-term infants following surgery for complex congenital heart disease. Further research with a larger sample is needed to examine effects of SSC on infant physiology before surgery and earlier in the postoperative time period as well as on additional outcomes such as length of stay, maternal-infant interaction, and neurodevelopment. PMID:25325374

  13. Galvanic microparticles increase migration of human dermal fibroblasts in a wound-healing model via reactive oxygen species pathway

    PubMed Central

    Tandon, Nina; Cimetta, Elisa; Villasante, Aranzazu; Kupferstein, Nicolette; Southall, Michael D.; Fassih, Ali; Xie, Junxia; Sun, Ying; Vunjak-Novakovic, Gordana


    Electrical signals have been implied in many biological mechanisms, including wound healing, which has been associated with transient electrical currents not present in intact skin. One method to generate electrical signals similar to those naturally occurring in wounds is by supplementation of galvanic particles dispersed in a cream or gel. We constructed a three-layered model of skin consisting of human dermal fibroblasts in hydrogel (mimic of dermis), a hydrogel barrier layer (mimic of epidermis) and galvanic microparticles in hydrogel (mimic of a cream containing galvanic particles applied to skin). Using this model, we investigated the effects of the properties and amounts of Cu/Zn galvanic particles on adult human dermal fibroblasts in terms of the speed of wound closing and gene expression. The collected data suggest that the effects on wound closing are due to the ROS-mediated enhancement of fibroblast migration, which is in turn mediated by the BMP/SMAD signaling pathway. These results imply that topical low-grade electric currents via microparticles could enhance wound healing. PMID:24113575

  14. Frequency-response-based analysis of respiratory sensor measuring capacitance built across skin

    NASA Astrophysics Data System (ADS)

    Terasawa, Makie; Kumagai, Shinya; Sasaki, Minoru


    A capacitive respiratory sensor is studied by attaching the electrodes to the skin. The signal characteristics related to the electrode position and body motion are examined. The frequency response indicates the nearly pure capacitance characteristics. The sensing mechanism model based on the equivalent skin thickness change generated by the body volume change accompanying respiration is reasonably consistent with the experimental results. The sensing method is examined by measuring the frequency response under some different conditions including the grounding issue. The electrode attached to the concave site tends to show a smaller signal difference between inhalation and exhalation. The convex site stabilizes the measurement. The bellyband combined with the electrode realizes stable sensing with comfortable fit on the skin.

  15. The skin: where malaria infection and the host immune response begin.


    Sinnis, Photini; Zavala, Fidel


    Infection by malaria parasites begins with the inoculation of sporozoites into the skin of the host. The early events following sporozoite deposition in the dermis are critical for both the establishment of malaria infection and for the induction of protective immune responses. The initial sporozoite inoculum is generally low, and only a small percentage of these sporozoites successfully reach the liver and grow to the next life cycle stage, making this a significant bottleneck for the parasite. Recent studies highlight the importance of sporozoite motility and host cell traversal in dermal exit. Importantly, protective immune responses against sporozoites and liver stages of Plasmodium are induced by dendritic cells in the lymph node draining the skin inoculation site. The cellular, molecular, and immunological events that occur in the skin and associated lymph nodes are the topic of this review.

  16. Galvanic Cells: Anodes, Cathodes, Signs and Charges

    ERIC Educational Resources Information Center

    Goodwin, Alan


    Electrochemistry is a difficult subject for students at school and beyond and even for their teachers. This article explores the difficult "truth" that, when a current flows from a galvanic cell, positive ions within the cell electrolyte move towards the electrode labelled positive. This seems to contravene the basic rule that like charges repel…

  17. A theoretical investigation of human skin thermal response to near-infrared laser irradiation

    NASA Astrophysics Data System (ADS)

    Dai, Tianhong; Pikkula, Brian M.; Wang, Lihong V.; Anvari, Bahman


    Near-infrared wavelengths are absorbed less by epidermal melanin mainly located at the basal layer of epidermis (dermo-epidermal junction), and penetrate deeper into human skin dermis and blood than visible wavelengths. Therefore, laser irradiation using near-infrared wavelength may improve the therapeutic outcome of cutaneous hyper-vascular malformations in moderately to heavily pigmented skin patients and those with large-sized blood vessels or blood vessels extending deeply into the skin. A mathematical model composed of a Monte Carlo algorithm to estimate the distribution of absorbed light followed by numerical solution of a bio-heat diffusion equation was utilized to investigate the thermal response of human skin to near-infrared laser irradiation, and compared it with that to visible laser irradiation. Additionally, the effect of skin surface cooling on epidermal protection was theoretically investigated. Simulation results indicated that 940 nm wavelength is superior to 810 and 1064 nm in terms of the ratio of light absorption by targeted blood vessel to the absorption by the basal layer of epidermis, and is more efficient than 595 nm wavelength for the treatment of patients with large-sized blood vessels and moderately to heavily pigmented skin. Dermal blood content has a considerable effect on the laser-induced peak temperature at the basal layer of epidermis, while the effect of blood vessel size is minimum.

  18. Loss of serum response factor in keratinocytes results in hyperproliferative skin disease in mice

    PubMed Central

    Koegel, Heidi; von Tobel, Lukas; Schäfer, Matthias; Alberti, Siegfried; Kremmer, Elisabeth; Mauch, Cornelia; Hohl, Daniel; Wang, Xiao-Jing; Beer, Hans-Dietmar; Bloch, Wilhelm; Nordheim, Alfred; Werner, Sabine


    The transcription factor serum response factor (SRF) plays a crucial role in the development of several organs. However, its role in the skin has not been explored. Here, we show that keratinocytes in normal human and mouse skin expressed high levels of SRF but that SRF expression was strongly downregulated in the hyperproliferative epidermis of wounded and psoriatic skin. Keratinocyte-specific deletion within the mouse SRF locus during embryonic development caused edema and skin blistering, and all animals died in utero. Postnatal loss of mouse SRF in keratinocytes resulted in the development of psoriasis-like skin lesions. These lesions were characterized by inflammation, hyperproliferation, and abnormal differentiation of keratinocytes as well as by disruption of the actin cytoskeleton. Ultrastructural analysis revealed markedly reduced cell-cell and cell-matrix contacts and loss of cell compaction in all epidermal layers. siRNA-mediated knockdown of SRF in primary human keratinocytes revealed that the cytoskeletal abnormalities and adhesion defects were a direct consequence of the loss of SRF. In contrast, the hyperproliferation observed in vivo was an indirect effect that was most likely a consequence of the inflammation. These results reveal that loss of SRF disrupts epidermal homeostasis and strongly suggest its involvement in the pathogenesis of hyperproliferative skin diseases, including psoriasis. PMID:19307725

  19. Factors influencing adverse skin responses in rats receiving repeated subcutaneous injections and potential impact on neurobehavior

    PubMed Central

    Levoe, S. Nikki; Flannery, Brenna M.; Brignolo, Laurie; Imai, Denise M.; Koehne, Amanda; Austin, Adam T.; Bruun, Donald A.; Tancredi, Daniel J.; Lein, Pamela J.


    Repeated subcutaneous (s.c.) injection is a common route of administration in chronic studies of neuroactive compounds. However, in a pilot study we noted a significant incidence of skin abnormalities in adult male Long-Evans rats receiving daily s.c. injections of peanut oil (1.0 ml/kg) in the subscapular region for 21 d. Histopathological analyses of the lesions were consistent with a foreign body reaction. Subsequent studies were conducted to determine factors that influenced the incidence or severity of skin abnormalities, and whether these adverse skin reactions influenced a specific neurobehavioral outcome. Rats injected daily for 21 d with food grade peanut oil had an earlier onset and greater incidence of skin abnormalities relative to rats receiving an equal volume (1.0 ml/kg/d) of reagent grade peanut oil or triglyceride of coconut oil. Skin abnormalities in animals injected daily with peanut oil were increased in animals housed on corncob versus paper bedding. Comparison of animals obtained from different barrier facilities exposed to the same injection paradigm (reagent grade peanut oil, 1.0 ml/kg/d s.c.) revealed significant differences in the severity of skin abnormalities. However, animals from different barrier facilities did not perform differently in a Pavlovian fear conditioning task. Collectively, these data suggest that environmental factors influence the incidence and severity of skin abnormalities following repeated s.c. injections, but that these adverse skin responses do not significantly influence performance in at least one test of learning and memory. PMID:25705100

  20. Continuously varying skin potentials elicited by sinusoidally varying electric shock potentials

    NASA Technical Reports Server (NTRS)

    Senders, J. W.; Senders, V. L.; Tursky, B.


    An investigation was carried out to determine whether a form of quasi-linear systems analysis can be applied to electrodormal responses to yield new insights into the nature of the response mechanisms and their interrelationships. The response investigated was the electrodermal response (galvanic skin potential, GSP) as elicited by an electric shock stimulus applied to the skin. The response subsequent to this stimulation was examined and its characteristics measured. A series of experimental runs on three Ss was accomplished, using sinusoidal modulation envelopes of frequencies. Results showed that it was possible to drive the GSP and to achieve relatively high coherence between the driving frequency and the response itself. The analysis was limited to Fourier analysis of the response in order to determine the relative energies at the driving frequency and at successive harmonics of that driving frequency, and correlational analysis in order to determine the degree of linear relationship between the driving frequency and the driven response.

  1. The nature of the chromophore responsible for naturally occurring fluorescence in mouse skin.


    Weagle, G; Paterson, P E; Kennedy, J; Pottier, R


    Normal mouse skin has a prominent fluorescence peak at 674 nm. Fluorescence emission and fluorescence excitation spectroscopy, carried out both in vitro and in vivo, led to the conclusion that the chromophore(s) responsible for this naturally occurring fluorescence is/are pheophorbide a and/or pheophytin a, degradation products of chlorophyll a that are derived from the mouse food.

  2. Only skin deep: shared genetic response to the deadly chytrid fungus in susceptible frog species.


    Rosenblum, Erica Bree; Poorten, Thomas J; Settles, Matthew; Murdoch, Gordon K


    Amphibian populations around the world are threatened by an emerging infectious pathogen, the chytrid fungus Batrachochytrium dendrobatidis (Bd). How can a fungal skin infection kill such a broad range of amphibian hosts? And do different host species have a similar response to Bd infection? Here, we use a genomics approach to understand the genetic response of multiple susceptible frog species to Bd infection. We characterize the transcriptomes of two closely related endangered frog species (Rana muscosa and Rana sierrae) and analyse whole genome expression profiles from frogs in controlled Bd infection experiments. We integrate the Rana results with a comparable data set from a more distantly related susceptible species (Silurana tropicalis). We demonstrate that Bd-infected frogs show massive disruption of skin function and show no evidence of a robust immune response. The genetic response to infection is shared across the focal susceptible species, suggesting a common effect of Bd on susceptible frogs.

  3. Active skin perfusion and thermoregulatory response in the hand following nerve injury and repair in human upper extremities.


    Deng, Aidong; Liu, Dan; Gu, Chen; Gu, Xiaosong; Gu, Jianhui; Hu, Wen


    Cutaneous vasoconstriction/vasodilatation occurs in response to whole body and local cooling/heating, and the vasomotor activities play a pivotal role in thermal control of the human body. The mechanisms underlying regulation of skin blood flow involve both neurogenic and humeral/local chemical influence, contributing to the initial response to thermal stimuli and the prolonged phase of response, respectively. Previous studies have suggested the impairment of cutaneous thermal regulation after nerve injury. However, the evidence regarding how the skin perfusion and thermoregulatory response evolve after nerve injury and repair remains limited. Here we observed, by utilizing laser-Doppler perfusion imaging, baseline skin perfusion and perfusion change in response to thermal stimuli after median and ulnar nerve injury, and the results showed that baseline perfusion in autonomous skin area profoundly decreased and active rewarming after clod stress dramatically diminished before sensory recovery of the skin became detectable. In addition, baseline cutaneous perfusion was recovered as the skin regained touch sensation, and exhibited positive correlation to touch sensibility of the skin. These data indicate that both active perfusion and thermoregulatory response of the skin are markedly compromised during skin denervation and can be recovered by re-innervation. This suggests the importance of timely repair of injured nerve, especially in the practice of replantation.

  4. Interactive effects between isometric exercise and mental stress on the vascular responses in glabrous and nonglabrous skin.


    Yamazaki, Fumio; Kinoshita, Katsunori; Sone, Ryoko


    Cutaneous vascular responses to mental arithmetic (MA) and handgrip exercise (HG) were studied independently and combined at different local skin temperatures (T (loc)). MA and HG induced (P < 0.05) vasoconstrictor responses in glabrous and nonglabrous skin at a higher level of T (loc), resulting in a nonadditive effect of these two stresses.

  5. Satellite cell proliferation in murine sensory ganglia in response to scarification of the skin.


    Elson, Karen; Simmons, Anthony; Speck, Peter


    Satellite cells (SCs) ensheathe neuronal cell bodies of sensory ganglia and provide mechanical and metabolic support for neurons. In mice, grossly detrimental stimuli such as nerve crush or cut, or explant culture of ganglia induce proliferation of SCs. It is unknown whether SC proliferation occurs in response to the less severe trauma that might commonly occur in a physiological situation. Our aim was to determine the response of SCs to mild trauma, such as scratching the skin. SC proliferation, measured by bromodeoxyuridine (BrdU) uptake, and immune cells, measured by CD45 labelling, were quantified at various times during the 7 days after scarification or abrasion of flank skin. We show that minimal skin trauma, such as scarification or light abrasion, triggers proliferation of SCs. Sections of control mice nervous tissue show <10 BrdU+ cells/ganglionic profile. In contrast, sections of traumatised mice show >50 BrdU+ cells/ganglionic profile, even after simply scratching the skin. The lack of CD45+ cells shows that the proliferating cells are not immune cells. We suggest that SCs in mice are a labile cell population able to proliferate rapidly in response to minimal nerve trauma. This finding has implications for the role of SCs in nervous system repair.

  6. The electromagnetic response of human skin in the millimetre and submillimetre wave range

    NASA Astrophysics Data System (ADS)

    Feldman, Yuri; Puzenko, Alexander; Ben Ishai, Paul; Caduff, Andreas; Davidovich, Issak; Sakran, Fadi; Agranat, Aharon J.


    Recent studies of the minute morphology of the skin by optical coherence tomography revealed that the sweat ducts in human skin are helically shaped tubes, filled with a conductive aqueous solution. This, together with the fact that the dielectric permittivity of the dermis is higher than that of the epidermis, brings forward the supposition that as electromagnetic entities, the sweat ducts could be regarded as low Q helical antennas. The implications of this statement were further investigated by electromagnetic simulation and experiment of the in vivo reflectivity of the skin of subjects under varying physiological conditions (Feldman et al 2008 Phys. Rev. Lett. 100 128102). The simulation and experimental results are in a good agreement and both demonstrate that sweat ducts in the skin could indeed behave as low Q antennas. Thus, the skin spectral response in the sub-Terahertz region is governed by the level of activity of the perspiration system and shows the minimum of reflectivity at some frequencies in the frequency band of 75-110 GHz. It is also correlated to physiological stress as manifested by the pulse rate and the systolic blood pressure. As such, it has the potential to become the underlying principle for remote sensing of the physiological parameters and the mental state of the examined subject.

  7. High-power femtosecond-terahertz pulse induces a wound response in mouse skin

    NASA Astrophysics Data System (ADS)

    Kim, Kyu-Tae; Park, Jaehun; Jo, Sung Jin; Jung, Seonghoon; Kwon, Oh Sang; Gallerano, Gian Piero; Park, Woong-Yang; Park, Gun-Sik


    Terahertz (THz) technology has emerged for biomedical applications such as scanning, molecular spectroscopy, and medical imaging. Although a thorough assessment to predict potential concerns has to precede before practical utilization of THz source, the biological effect of THz radiation is not yet fully understood with scant related investigations. Here, we applied a femtosecond-terahertz (fs-THz) pulse to mouse skin to evaluate non-thermal effects of THz radiation. Analysis of the genome-wide expression profile in fs-THz-irradiated skin indicated that wound responses were predominantly mediated by transforming growth factor-beta (TGF-β) signaling pathways. We validated NFκB1- and Smad3/4-mediated transcriptional activation in fs-THz-irradiated skin by chromatin immunoprecipitation assay. Repeated fs-THz radiation delayed the closure of mouse skin punch wounds due to up-regulation of TGF-β. These findings suggest that fs-THz radiation initiate a wound-like signal in skin with increased expression of TGF-β and activation of its downstream target genes, which perturbs the wound healing process in vivo.

  8. Role of β-TrCP ubiquitin ligase receptor in UVB mediated responses in skin

    PubMed Central

    Bhatia, Neehar; Demmer, Tara A.; Sharma, Alok K.; Elcheva, Irina; Spiegelman, Vladimir S.


    Skin cancers are the most common cancers in the United States. Exposure to UVB radiation is a major risk factor for skin cancer induction. SCFβ-TrCP E3 ubiquitin ligase has been found to be involved in cell cycle, cell proliferation and transformation. Aberrant up-regulation of beta-transducin repeats-containing proteins (β-TrCP) is often found in cancer cell lines and primary tumors. We have previously demonstrated that β-TrCP2 is over-expressed in chemically induced mouse skin tumors [1]. Various cellular stress stimuli, including UVB, induce an increase in β-TrCP1 mRNA and protein levels in human cells [2]. We have previously shown that inhibition of β-TrCP function, by induction of dominant negative β-TrCP2 (β-TrCP2ΔF), in vitro in hTERT immortalized normal keratinocytes, results in increase in UVB induced apoptosis [3]. We have generated transgenic mice with inducible, selective expression of dominant negative β-TrCP2 in epidermis with the Keratin 5 promoter (K5-rTA × TRE-HA-β-TrCPΔF). Here we report that inhibition of β-TrCP function in mouse epidermis results in decrease in UVB-induced edema, hyperplasia, and inflammatory response and increment in UVB-induced apoptosis in skin. Our results suggest that β-TrCP may be an essential player in UVB induced responses in skin and can be a potential therapeutic target for skin cancer. PMID:21187057

  9. Functional role of unmyelinated tactile afferents in human hairy skin: sympathetic response and perceptual localization.


    Olausson, Håkan; Cole, Jonathan; Rylander, Karin; McGlone, Francis; Lamarre, Yves; Wallin, B Gunnar; Krämer, Heidrun; Wessberg, Johan; Elam, Mikael; Bushnell, M Catherine; Vallbo, Ake


    In addition to A-beta fibres the human hairy skin has unmyelinated (C) fibres responsive to light touch. Previous functional magnetic resonance imaging (fMRI) studies in a subject with a neuronopathy who specifically lacks A-beta afferents indicated that tactile C afferents (CT) activate insular cortex, whereas no response was seen in somatosensory areas 1 and 2. Psychophysical tests suggested that CT afferents give rise to an inconsistent perception of weak and pleasant touch. By examining two neuronopathy subjects as well as control subjects we have now demonstrated that CT stimulation can elicit a sympathetic skin response. Further, the neuronopathy subjects' ability to localize stimuli which activate CT afferents was very poor but above chance level. The findings support the interpretation that the CT system is well suited to underpin affective rather than discriminative functions of tactile sensations.

  10. The visceromotor responses to colorectal distension and skin pinch are inhibited by simultaneous jejunal distension.


    Shafton, Anthony D; Furness, John B; Ferens, Dorota; Bogeski, Goce; Koh, Shir Lin; Lean, Nicholas P; Kitchener, Peter D


    Noxious stimuli that are applied to different somatic sites interact; often one stimulus diminishes the sensation elicited from another site. By contrast, inhibitory interactions between visceral stimuli are not well documented. We investigated the interaction between the effects of noxious distension of the colorectum and noxious stimuli applied to the jejunum, in the rat. Colorectal distension elicited a visceromotor reflex, which was quantified using electromyographic (EMG) recordings from the external oblique muscle of the upper abdomen. The same motor units were activated when a strong pinch was applied to the flank skin. Distension of the jejunum did not provoke an EMG response at this site, but when it was applied during colorectal distension it blocked the EMG response. Jejunal distension also inhibited the response to noxious skin pinch. The inhibition of the visceromotor response to colorectal distension was prevented by local application of tetrodotoxin to the jejunum, and was markedly reduced when nicardipine was infused into the local jejunal circulation. Chronic sub-diaphragmatic vagotomy had no effect on the colorectal distension-induced EMG activity or its inhibition by jejunal distension. The nicotinic antagonist hexamethonium suppressed phasic contractile activity in the jejunum, had only a small effect on the inhibition of visceromotor response by jejunal distension. It is concluded that signals that arise from skin pinch and colorectal distension converge in the central nervous system with pathways that are activated by jejunal spinal afferents; the jejunal signals strongly inhibit the abdominal motor activity evoked by noxious stimuli.

  11. Vertical soil profiling using a galvanic contact resistivity scanning approach.


    Pan, Luan; Adamchuk, Viacheslav I; Prasher, Shiv; Gebbers, Robin; Taylor, Richard S; Dabas, Michel


    Proximal sensing of soil electromagnetic properties is widely used to map spatial land heterogeneity. The mapping instruments use galvanic contact, capacitive coupling or electromagnetic induction. Regardless of the type of instrument, the geometrical configuration between signal transmitting and receiving elements typically defines the shape of the depth response function. To assess vertical soil profiles, many modern instruments use multiple transmitter-receiver pairs. Alternatively, vertical electrical sounding can be used to measure changes in apparent soil electrical conductivity with depth at a specific location. This paper examines the possibility for the assessment of soil profiles using a dynamic surface galvanic contact resistivity scanning approach, with transmitting and receiving electrodes configured in an equatorial dipole-dipole array. An automated scanner system was developed and tested in agricultural fields with different soil profiles. While operating in the field, the distance between current injecting and measuring pairs of rolling electrodes was varied continuously from 40 to 190 cm. The preliminary evaluation included a comparison of scan results from 20 locations to shallow (less than 1.2 m deep) soil profiles and to a two-layer soil profile model defined using an electromagnetic induction instrument.

  12. Vertical Soil Profiling Using a Galvanic Contact Resistivity Scanning Approach

    PubMed Central

    Pan, Luan; Adamchuk, Viacheslav I.; Prasher, Shiv; Gebbers, Robin; Taylor, Richard S.; Dabas, Michel


    Proximal sensing of soil electromagnetic properties is widely used to map spatial land heterogeneity. The mapping instruments use galvanic contact, capacitive coupling or electromagnetic induction. Regardless of the type of instrument, the geometrical configuration between signal transmitting and receiving elements typically defines the shape of the depth response function. To assess vertical soil profiles, many modern instruments use multiple transmitter-receiver pairs. Alternatively, vertical electrical sounding can be used to measure changes in apparent soil electrical conductivity with depth at a specific location. This paper examines the possibility for the assessment of soil profiles using a dynamic surface galvanic contact resistivity scanning approach, with transmitting and receiving electrodes configured in an equatorial dipole-dipole array. An automated scanner system was developed and tested in agricultural fields with different soil profiles. While operating in the field, the distance between current injecting and measuring pairs of rolling electrodes was varied continuously from 40 to 190 cm. The preliminary evaluation included a comparison of scan results from 20 locations to shallow (less than 1.2 m deep) soil profiles and to a two-layer soil profile model defined using an electromagnetic induction instrument. PMID:25057135

  13. The effect of change in skin temperature due to evaporative cooling on sweating response during exercise.


    Kondo, N; Nakadome, M; Zhang, K; Shiojiri, T; Shibasaki, M; Hirata, K; Iwata, A


    The purpose of this study was to investigate whether there are any effects of skin temperature changes on sweating response in the first few minutes of mild exercise. Six healthy males performed a bicycle exercise at 100 W (50 rpm) for 30 min under an ambient temperature of 23 degrees C (40% RH). Esophageal temperature (Tes), mean skin temperature (Tsk), local skin temperature at the lower left scapula (Tsl), local sweating rate (Msw) and cutaneous blood flow by laser-Doppler flowmetry (LDF) were measured continuously. Although Tsl decreased markedly just after the onset of sweating, Tsk did not change. Msw did not increase constantly in the early stages of exercise, and there was a temporary interruption in the increase of Msw. This interruption in sweating was affected by the rate of change in Tsl rather than by the absolute value of Tsl, since there was a positive and significant correlation between the time of the interruption in the increase of Msw and the rate of decrease in Tsl (y = 6.47 x +0.04; r = 0.86, P < 0.05). The results suggest that sweating response in the early stages of exercise may be influenced by changes in local skin temperature due to evaporative cooling.

  14. The effect of change in skin temperature due to evaporative cooling on sweating response during exercise

    NASA Astrophysics Data System (ADS)

    Kondo, N.; Nakadome, Manabu; Zhang, Keren; Shiojiri, Tomoyuki; Shibasaki, Manabu; Hirata, Kozo; Iwata, Atsushi

    The purpose of this study was to investigate whether there are any effects of skin temperature changes on sweating response in the first few minutes of mild exercise. Six healthy males performed a bicycle exercise at 100 W (50 rpm) for 30 min under an ambient temperature of 23° C (40% RH). Esophageal temperature (Tes), mean skin temperature (T-sk), local skin temperature at the lower left scapula (Tsl), local sweating rate (M.sw), and cutaneous blood flow by laser-Doppler flowmetry (LDF) were measured continuously. Although Tsl decreased markedly just after the onset of sweating, T-sk did not change. M.sw did not increase constantly in the early stages of exercise, and there was a temporary interruption in the increase of M.sw. This interruption in sweating was affected by the rate of change in Tsl rather than by the absolute value of Tsl, since there was a positive and significant correlation between the time of the interruption in the increase of M.sw and the rate of decrease in Tsl (y=6.47x+0.04; r=0.86, P<0.05). The results suggest that sweating response in the early stages of exercise may be influenced by changes in local skin temperature due to evaporative cooling.

  15. Influence of trichloroacetic acid peeling on the skin stress response system.


    Kimura, Ayako; Kanazawa, Nobuo; Li, Hong-Jin; Yonei, Nozomi; Yamamoto, Yuki; Furukawa, Fukumi


    Although trichloroacetic acid (TCA) peeling is widely applied for cosmetic treatment of photodamaged skin, the entire biological mechanisms have yet to be determined. The skin stress response system (SSRS) involves corticotropin-releasing hormone (CRH) and proopiomelanocortin (POMC) products that are locally-generated in response to locally-provided stressors or pro-inflammatory cytokines. This system would restrict tissue damage and restore local homeostasis. To determine the influence of TCA peeling on the SSRS in vitro and in vivo, expressions of POMC, melanocortin receptor 1 (MC1R), CRH and CRH receptor 1 (CRHR1) mRNA were examined by reverse transcription polymerase chain reaction in Pam212 murine keratinocytes, murine plantar and healthy human abdominal skin specimens after TCA treatment. In addition, their protein expressions as well as those of POMC-derived peptides were examined immunohistochemically. After TCA treatment, transient upregulation of POMC and MC1R mRNA expressions was observed in both murine and human skin, as well as in Pam212. Enhanced POMC protein, recovery of once-impaired MC1R protein, and no enhancement of POMC-derived peptide productions were revealed immunohistochemically in both murine and human epidermis. In contrast, neither expression levels of CRH and CRHR1 mRNA nor epidermal protein were enhanced after TCA application in murine and human skin, except for induction of human CRH mRNA expression. These results suggest that TCA activates the SSRS by inducing POMC and MC1R productions of keratinocytes in the CRH-independent manner, and that the biological effects of POMC itself are responsible for the TCA-induced epidermal SSRS activation.

  16. Different vascular responses in glabrous and nonglabrous skin with increasing core temperature during exercise.


    Yamazaki, Fumio; Sone, Ryoko


    To elucidate the characteristics of vasomotor control in glabrous and nonglabrous skin during dynamic exercise, we compared the vascular responses in both areas to increasing core temperature during the cycle exercise for 30 min at different intensities in the range 20-60% of peak oxygen consumption (VO(2peak)) in a total of 13 male and four female subjects in two experimental protocols. Skin blood flow was monitored using laser Doppler flowmetry. In protocol 1, the slope of the relationship between esophageal temperature (T (es)) and cutaneous vascular conductance (CVC) in the early phase of the exercise decreased (P < 0.05) with increasing exercise intensity at glabrous sites (palm) but not nonglabrous sites (dorsal hand). In protocol 2, to examine whether a difference in vascular responses in the two areas is due to the adrenergic vasoconstrictor system, the release of norepinephrine from adrenergic nerves in forearm and palmar skin was blocked locally by iontophoresis of bretylium tosylate (BT). The administration of BT diminished completely the change of CVC in the palm during the exercise but did not alter the response in the forearm compared with the untreated site. In the two areas, neither the T (es) threshold for vasodilation nor the change in CVC above the threshold in the middle and late phase of the exercise was influenced by the intensity of the exercise. These results suggest that, in the early phase of the exercise, light-to-moderate exercise reduces in an intensity-dependent manner the thermal sensitivity for vasodilation in glabrous skin but not nonglabrous skin via an adrenergic vasoconstrictor pathway.

  17. Effect of skin barrier disruption on immune responses to topically applied cross-reacting material, CRM(197), of diphtheria toxin.


    Godefroy, S; Peyre, M; Garcia, N; Muller, S; Sesardic, D; Partidos, C D


    The high accessibility of the skin and the presence of immunocompetent cells in the epidermis makes this surface an attractive route for needle-free administration of vaccines. However, the lining of the skin by the stratum corneum is a major obstacle to vaccine delivery. In this study we examined the effect of skin barrier disruption on the immune responses to the cross-reacting material CRM(197), a nontoxic mutant of diphtheria toxin (DTx) that is considered as a vaccine candidate. Application of CRM(197), together with cholera toxin (CT), onto the tape-stripped skin of mice elicited antibody responses that had anti-DTx neutralizing activity. Vaccine delivery onto mildly ablated skin or intact skin did not elicit any detectable anti-CRM(197) antibodies. Mice immunized with CRM(197) alone onto the tape-stripped skin mounted a vigorous antigen-specific proliferative response. In contrast, the induction of cellular immunity after CRM(197) deposition onto mildly ablated or intact skin was adjuvant dependent. Furthermore, epidermal cells were activated and underwent apoptosis that was more pronounced when the stratum corneum was removed by tape stripping. Overall, these findings highlight the potential for transcutaneous delivery of CRM(197) and establish a correlation between the degree of barrier disruption and levels of antigen-specific immune responses. Moreover, these results provide the first evidence that the development of a transcutaneous immunization strategy for diphtheria, based on simple and practical methods to disrupt the skin barrier, is feasible.

  18. Nanopatch targeted delivery of both antigen and adjuvant to skin synergistically drives enhanced antibody responses.


    Fernando, Germain J P; Chen, Xianfeng; Primiero, Clare A; Yukiko, Sally R; Fairmaid, Emily J; Corbett, Holly J; Frazer, Ian H; Brown, Lorena E; Kendall, Mark A F


    Many vaccines make use of an adjuvant to achieve stronger immune responses. Alternatively, potent immune responses have also been generated by replacing the standard needle and syringe (which places vaccine into muscle) with devices that deliver vaccine antigen to the skin's abundant immune cell population. However it is not known if the co-delivery of antigen plus adjuvant directly to thousands of skin immune cells generates a synergistic improvement of immune responses. In this paper, we investigate this idea, by testing if Nanopatch delivery of vaccine - both the antigen and the adjuvant - enhances immunogenicity, compared to intramuscular injection. As a test-case, we selected a commercial influenza vaccine as the antigen (Fluvax 2008®) and the saponin Quil-A as the adjuvant. We found, after vaccinating mice, that anti-influenza IgG antibody and haemagglutinin inhibition assay titre response induced by the Nanopatch (with delivered dose of 6.5ng of vaccine and 1.4μg of Quil-A) were equivalent to that of the conventional intramuscular injection using needle and syringe (6000ng of vaccine injected without adjuvant). Furthermore, a similar level of antigen dose sparing (up to 900 fold) - with equivalent haemagglutinin inhibition assay titre responses - was also achieved by delivering both antigen and adjuvant (1.4μg of Quil-A) to skin (using Nanopatches) instead of muscle (intramuscular injection). Collectively, the unprecedented 900 fold antigen dose sparing demonstrates the synergistic improvement to vaccines by co-delivery of both antigen and adjuvant directly to skin immune cells. Successfully extending these findings to humans with a practical delivery device - like the Nanopatch - could have a huge impact on improving vaccines.

  19. Effects of local cooling on sacral skin perfusion response to pressure: implications for pressure ulcer prevention.


    Tzen, Yi-Ting; Brienza, David M; Karg, Patricia; Loughlin, Patrick


    People with spinal cord injuries are at high risk for developing pressure ulcers. Increased skin temperature is one of the extrinsic causative factors for this multi-factorial disease. Previous animal studies revealed that local skin cooling reduced the severity of ulceration, and cooling is widely used in plastic surgery and organ transplants for tissue preservation. The objectives of this pilot study were to develop test protocols and instrumentation and to investigate the effect of local cooling on skin perfusion response to pressure on young healthy human subjects. Reactive hyperemia was quantified in this study to compare the effects of pressure with and without cooling. Reactive hyperemia is a normal physiological response occurring after vessel occlusion. Laser Doppler flowmetry was used to measure skin blood flow. Time-dependent spectral analysis was used to analyze and decompose the blood flow data into frequency ranges associated with specific blood flow control mechanisms. The study used a repeated measures design with two test conditions: 8 kPa of pressure with and without cooling to 25 degrees C. We hypothesized that local cooling would reduce the post-ischemic reactive hyperemic response induced by the rigid indenter. Time series results showed that normalized peak perfusion response was significantly lower with cooling (p=0.019). Time-dependent spectral analysis results suggested that both metabolic and myogenic responses contribute to this protective effect. Findings from our study on humans were consistent with previous animal studies. Additional studies on individuals with spinal cord injury are planned to further evaluate the cooling effect in a high-risk population.

  20. Facial skin blood flow responses to irritant stimuli in the oral cavity.


    Kashima, Hideaki; Hayashi, Naoyuki


    To investigate whether capsaicin and menthol stimuli elicit characteristic responses in facial skin blood flow (SkBF), we observed the facial SkBF response to low and high concentrations of capsaicin and menthol stimuli of 1-ml solution applied to the oral cavity for 20s in 17 healthy subjects. High concentration of capsaicin significantly increased the SkBF in all of the facial areas monitored. High concentration of menthol stimulus significantly decreased SkBF in the nose and increased that in the eyelid, and upper and lower lips. These results demonstrated that capsaicin and menthol stimuli in the oral cavity elicit characteristic responses in facial SkBF.

  1. Increased Expression of Versican in the Inflammatory Response to UVB- and Reactive Oxygen Species-Induced Skin Tumorigenesis

    PubMed Central

    Kunisada, Makoto; Yogianti, Flandiana; Sakumi, Kunihiko; Ono, Ryusuke; Nakabeppu, Yusaku; Nishigori, Chikako


    Excessive exposure to UV radiation is a major risk factor for developing skin cancer. UV-induced reactive oxygen species (ROS) cause accumulation of DNA damage products such as 8-oxoguanine (8-oxoG) in the skin. We have previously shown that mice lacking the repair enzyme 8-oxoguanine glycosylase (Ogg1 knockout mice) are highly susceptible to skin cancer after long-term UVB exposure. To investigate the genes involved, we performed gene profiling of Ogg1 knockout mouse skin after UVB exposure. Among the up-regulated genes in UVB-treated Ogg1 knockout mice, inflammatory response pathway-related genes were most affected. The Vcan gene, which encodes the large extracellular matrix proteoglycan versican, was continuously up-regulated in UVB-treated Ogg1 knockout mice, suggesting that versican is a mediator of skin cancer development. We examined the expression pattern of versican in skin tumors from wild-type mice and UVB-treated Ogg1 knockout mice, and also analyzed 157 sun-related human skin tumors. Versican was strongly expressed in malignant skin tumors in both mice and humans, and especially in Ogg1 knockout mice. Additionally, infiltrating neutrophils strongly colocalized with versican in UVB-treated Ogg1 knockout mouse skin. These data demonstrate that inflammatory responses, particularly neutrophil infiltration and versican up-regulation, are closely involved in UVB/ROS-induced skin tumorigenesis. PMID:22001346

  2. Orbital response indicates nasal pungency: analysis of biomechanical strain on the skin.


    Jalowayski, A A; Johnson, B N; Wise, P M; Schmid-Schönbein, G W; Cain, W S


    Stimulation of the human nasal passage with pungent vapor elicits motor responses in a zone around the eye. This investigation addressed whether quantification of such responses, particularly activity of the orbicularis oculi muscle, could yield a sensitive index of nasal pungency. We placed an array of small, high-contrast targets just beneath the lower eyelid and videotaped their movement to capture deformation of the skin atop the orbicularis oculi during 3 s stimulation with pungent concentrations of ethyl acetate. Eleven subjects participated. Analysis of the movements served to determine mechanical strain, which yielded a single index that we termed 'maximum strain'. This increased with concentration of the vapor and with time during and just after stimulation. Comparison with psychophysical data showed that the strain became evident at concentrations just detectable as pungent. Maximum strain measured on the skin shows promise as an objective index of pungency.

  3. Skin blood flow response to locally applied mechanical and thermal stresses in the diabetic foot.


    Jan, Yih-Kuen; Shen, Sa; Foreman, Robert D; Ennis, William J


    Diabetic foot ulcers are one of the most common complications in diabetics, causing significant disabilities and decreasing the quality of life. Impaired microvascular reactivity contributes to the development of diabetic foot ulcers. However, underlying physiological mechanisms responsible for the impaired microvascular reactivity in response to extrinsic causative factors of foot ulcers such as mechanical and thermal stresses have not been well investigated. A total of 26 participants were recruited into this study, including 18 type 2 diabetics with peripheral neuropathy and 8 healthy controls. Laser Doppler flowmetry was used to measure skin blood flow at the first metatarsal head in response to a mechanical stress at 300mmHg and a fast thermal stress at 42°C. Wavelet analysis of skin blood flow oscillations was used to assess metabolic, neurogenic and myogenic controls. Our results indicated that diabetics have significantly decreased metabolic, neurogenic and myogenic responses to thermal stress, especially in the neurogenic and myogenic controls during the first vasodilatory response and in the metabolic control during the second vasodilatory response. Diabetics have a significantly decreased myogenic response to mechanical stress during reactive hyperemia. Our findings demonstrate that locally applied mechanical and thermal stresses can be used to assess microvascular reactivity and risk of diabetic foot ulcers.

  4. Posterior Superior Temporal Sulcus Responses Predict Perceived Pleasantness of Skin Stroking

    PubMed Central

    Davidovic, Monika; Jönsson, Emma H.; Olausson, Håkan; Björnsdotter, Malin


    Love and affection is expressed through a range of physically intimate gestures, including caresses. Recent studies suggest that posterior temporal lobe areas typically associated with visual processing of social cues also respond to interpersonal touch. Here, we asked whether these areas are selective to caress-like skin stroking. We collected functional magnetic resonance imaging data from 23 healthy participants and compared brain responses to skin stroking and vibration. We did not find any significant differences between stroking and vibration in the posterior temporal lobe; however, right posterior superior temporal sulcus (pSTS) responses predicted healthy participant’s perceived pleasantness of skin stroking, but not vibration. These findings link right pSTS responses to individual variability in perceived pleasantness of caress-like tactile stimuli. We speculate that the right pSTS may play a role in the translation of tactile stimuli into positively valenced, socially relevant interpersonal touch and that this system may be affected in disorders associated with impaired attachment. PMID:27679564

  5. 76 FR 68422 - Galvanized Steel Wire From Mexico: Preliminary Determination of Sales at Less Than Fair Value and...

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... International Trade Administration Galvanized Steel Wire From Mexico: Preliminary Determination of Sales at Less... Department of Commerce (the Department) preliminarily determines that galvanized steel wire (galvanized wire..., 2011, the Department initiated the antidumping duty investigation on galvanized wire from Mexico....

  6. Thermal Response of Human Skin to Microwave Energy: A Critical Review.


    Foster, Kenneth R; Ziskin, Marvin C; Balzano, Quirino


    This is a review/modeling study of heating of tissue by microwave energy in the frequency range from 3 GHz through the millimeter frequency range (30-300 GHz). The literature was reviewed to identify studies that reported RF-induced increases in skin temperature. A simple thermal model, based on a simplified form of Pennes' bioheat equation (BHTE), was developed, using parameter values taken from the literature with no further adjustment. The predictions of the model were in excellent agreement with available data. A parametric analysis of the model shows that there are two heating regimes with different dominant mechanisms of heat transfer. For small irradiated areas (less than about 0.5-1 cm in radius) the temperature increase at the skin surface is chiefly limited by conduction of heat into deeper tissue layers, while for larger irradiated areas, the steady-state temperature increase is limited by convective cooling by blood perfusion. The results support the use of this simple thermal model to aid in the development and evaluation of RF safety limits at frequencies above 3 GHz and for millimeter waves, particularly when the irradiated area of skin is small. However, very limited thermal response data are available, particularly for exposures lasting more than a few minutes to areas of skin larger than 1-2 cm in diameter. The paper concludes with comments about possible uses and limitations of thermal modeling for setting exposure limits in the considered frequency range.

  7. Intestinal Microbiota Promotes Psoriasis-Like Skin Inflammation by Enhancing Th17 Response

    PubMed Central

    Zákostelská, Zuzana; Málková, Jana; Klimešová, Klára; Rossmann, Pavel; Hornová, Michaela; Novosádová, Iva; Stehlíková, Zuzana; Kostovčík, Martin; Hudcovic, Tomáš; Štepánková, Renata; Jůzlová, Kateřina; Hercogová, Jana; Tlaskalová-Hogenová, Helena


    Psoriasis is a chronic inflammatory skin disease in which Th17 cells play a crucial role. Since indigenous gut microbiota influences the development and reactivity of immune cells, we analyzed the link among microbiota, T cells and the formation of psoriatic lesions in the imiquimod-induced murine model of psoriasis. To explore the role of microbiota, we induced skin inflammation in germ-free (GF), broad-spectrum antibiotic (ATB)-treated or conventional (CV) BALB/c and C57BL/6 mice. We found that both mice reared in GF conditions for several generations and CV mice treated with ATB were more resistant to imiquimod-induced skin inflammation than CV mice. The ATB treatment dramatically changed the diversity of gut bacteria, which remained stable after subsequent imiquimod application; ATB treatment resulted in a substantial increase in the order Lactobacillales and a significant decrease in Coriobacteriales and Clostridiales. Moreover, as compared to CV mice, imiquimod induced a lower degree of local and systemic Th17 activation in both GF and ATB-treated mice. These findings suggest that gut microbiota control imiquimod-induced skin inflammation by altering the T cell response. PMID:27434104

  8. Transcriptomic analysis of the temporal host response to skin infestation with the ectoparasitic mite Psoroptes ovis

    PubMed Central


    Background Infestation of ovine skin with the ectoparasitic mite Psoroptes ovis results in a rapid cutaneous immune response, leading to the crusted skin lesions characteristic of sheep scab. Little is known regarding the mechanisms by which such a profound inflammatory response is instigated and to identify novel vaccine and drug targets a better understanding of the host-parasite relationship is essential. The main objective of this study was to perform a combined network and pathway analysis of the in vivo skin response to infestation with P. ovis to gain a clearer understanding of the mechanisms and signalling pathways involved. Results Infestation with P. ovis resulted in differential expression of 1,552 genes over a 24 hour time course. Clustering by peak gene expression enabled classification of genes into temporally related groupings. Network and pathway analysis of clusters identified key signalling pathways involved in the host response to infestation. The analysis implicated a number of genes with roles in allergy and inflammation, including pro-inflammatory cytokines (IL1A, IL1B, IL6, IL8 and TNF) and factors involved in immune cell activation and recruitment (SELE, SELL, SELP, ICAM1, CSF2, CSF3, CCL2 and CXCL2). The analysis also highlighted the influence of the transcription factors NF-kB and AP-1 in the early pro-inflammatory response, and demonstrated a bias towards a Th2 type immune response. Conclusions This study has provided novel insights into the signalling mechanisms leading to the development of a pro-inflammatory response in sheep scab, whilst providing crucial information regarding the nature of mite factors that may trigger this response. It has enabled the elucidation of the temporal patterns by which the immune system is regulated following exposure to P. ovis, providing novel insights into the mechanisms underlying lesion development. This study has improved our existing knowledge of the host response to P. ovis, including the

  9. Electrochemical characteristics of a carbon fibre composite and the associated galvanic effects with aluminium alloys

    NASA Astrophysics Data System (ADS)

    Liu, Z.; Curioni, M.; Jamshidi, P.; Walker, A.; Prengnell, P.; Thompson, G. E.; Skeldon, P.


    The electrochemical behaviour of a carbon fibre reinforced epoxy matrix composite in 3.5% NaCl and 3.5% NaCl + 0.5 M CuSO4 electrolytes was examined by potentiodynamic polarisation, potentiostatic polarisation and scanning electron microscopy. Exposed carbon fibres on two defined regions (“front” and “side”) are a focus of the investigation. The large size of the exposed carbon fibres on the side region is responsible for a higher cathodic current density than the front region in the NaCl electrolyte. The deposition of copper on the front surface of composite confirmed that the significantly higher cathodic current resulted from the exposure of the fibres to the NaCl electrolyte. Galvanic coupling between the composite and individual aluminium alloys (AA7075-T6 and AA1050) was used to measure galvanic potentials and galvanic current densities. The highly alloyed AA7075-T6 alloy and its high population density of cathodic sites compared to the AA1050 acted to reduce the galvanic effect when coupled to the composite front or side regions.

  10. Skin biopsy and quantitative sensory testing do not predict response to lidocaine patch in painful neuropathies.


    Herrmann, David N; Pannoni, Valerie; Barbano, Richard L; Pennella-Vaughan, Janet; Dworkin, Robert H


    Predictors of response to neuropathic pain treatment in patients with painful distal sensory neuropathies are lacking. The 5% lidocaine patch is believed to exert its effects on neuropathic pain via a local stabilizing effect on cutaneous sensory afferents. As such, it provides a model to assess whether the status of epidermal innervation as determined by skin biopsy or quantitative sensory testing (QST) of small- and large-diameter sensory afferents might serve as predictors of response to topical, locally active treatment. In this study we assessed associations between epidermal nerve fiber (ENF) densities, sensory nerve conduction studies (NCS), QST, and response to a 5% lidocaine patch in patients with painful distal sensory neuropathies. We observed no association between distal leg epidermal and subepidermal innervation and response to the lidocaine patch. Several patients with complete loss of distal leg ENF showed a response to the lidocaine patch. Similarly we observed no consistent association between treatment response and QST for vibration, cooling, warm, heat-pain, and cold-pain thresholds, or distal sensory NCS. Thus, distal-leg skin biopsy, QST, and sensory NCS cannot be used to identify patients with painful polyneuropathy likely to respond to a lidocaine patch in clinical practice. Further studies are required to clarify precisely the mechanism and site of action of the lidocaine patch in patients with peripheral neuropathic pain.

  11. Sympathetic nerve activity can be estimated from skin conductance responses - a comment on Henderson et al. (2012).


    Bach, Dominik R


    A recent paper by Henderson et al. (2012) claimed that skin sympathetic nerve activity (SSNA) can not be retrieved from skin conductance responses (SCR). Here, I argue that this claim is not supported by the literature, and comment on contemporary approaches of estimating SSNA from SCR using biophysical models.

  12. Skin vascular response in the hand during sinusoidal exercise in physically trained subjects.


    Yamazaki, Fumio; Sone, Ryoko


    The effect of physical training on the cutaneous vascular response during transient exercise load is unclear. We determined the phase response and amplitude response of cutaneous vascular conductance (CVC) in the hand during sinusoidal exercise in endurance exercise-trained and untrained subjects. Subjects exercised on a cycle ergometer with a sinusoidal load for 32 min. The load variation ranged from 10% [23 (1) W in the trained group, 19 (1) W in the untrained group] to 60% [137 (4) W, 114 (6) W] of peak O(2) uptake, and five different time periods (1, 2, 4, 8, and 16 min) were selected. Skin blood flow in the dorsal hand and palm were monitored by laser-Doppler flowmetry. CVC was evaluated from the ratio of blood flow to mean arterial pressure. During sinusoidal exercise, the amplitude of CVC was smaller in the dorsal hand than palm for shorter periods (1, 2, and 4 min) ( P<0.05). The phase lag of CVC was smaller in the dorsal hand than palm for longer periods (8 and 16 min) ( P<0.05). The amplitude response did not differ significantly between the two groups. The phase lag of CVC in the dorsal hand ( P<0.05) and palm ( P=0.06) was larger in the trained group than untrained group. These findings suggest that glabrous and nonglabrous skin vascular responses in the hand differ during transient exercise load, and physically trained subjects show a slower vascular response in the two skin areas to exercise stimulation than do untrained subjects.

  13. Sympathetic skin response following painful electrical stimulation is increased in major depression.


    Boettger, Michael Karl; Greiner, Wolf; Rachow, Tobias; Brühl, Christiane; Bär, Karl-Jürgen


    Patients with major depressive disorder have repeatedly been described to exhibit increased thresholds upon experimentally applied pain stimuli to the skin as compared to respective controls. Since the sensory-discriminative component of stimulus perception, e.g. for warmth, cold and vibration, appears to be unaltered in depression, higher central nervous centres have been assumed to cause this phenomenon. To date, hardly any attention has been paid to the efferent components of the noxious reflex loop. Here, we aimed to assess the autonomic reaction upon a painful stimulus and to examine whether this is likewise reduced in major depression. For this purpose, sympathetic skin response was obtained from 22 patients with major depression and 20 matched controls. To induce sympathetic skin responses, we applied either noxious electrical stimuli (12 and 18 mA) or innocuous acoustic stimuli (85 dB SPL). Pain intensity was rated using a numeric analogue scale. In contrast to our a priori hypothesis patients showed shorter latencies and higher amplitudes of skin potentials upon noxious stimulation, i.e. a stronger sympathetic response. Intriguingly, the noxious stimuli were still perceived less painful in the patient group. Pain perception weakly correlated with disease severity. From these data, we conclude that despite the diminished pain perception, the autonomic reflex loop following noxious stimulation is not affected in patients with major depressive disorder, and that the increase in sympathetic outflow is not directly related to the perceived pain as in controls, but might rather be attributed to the autonomic dysfunction known for the disease.

  14. Skin inflammation arising from cutaneous Treg deficiency leads to impaired viral immune responses1

    PubMed Central

    Freyschmidt, Eva-Jasmin; Mathias, Clinton B.; Diaz, Natalia; MacArthur, Daniel H.; Laouar, Amale; Manjunath, Narasimhaswamy; Hofer, Matthias D.; Wurbel, Marc-Andre; Campbell, James J.; Chatila, Talal A.; Oettgen, Hans C.


    Individuals with atopic dermatitis (AD) immunized with the small pox vaccine, vaccinia virus (VV), are susceptible to eczema vaccinatum (EV), a potentially-fatal disseminated infection. Dysfunction of FoxP3+ regulatory T cells (Treg) has been implicated in the pathogenesis of AD. To test whether Treg-deficiency predisposes to EV, we percutaneously VV-infected FoxP3-deficient (FoxP3KO) mice, which completely lack FoxP3+ Treg. These animals generated both fewer VV-specific CD8+ effector T cells and interferon-γ producing CD8+ T cells than controls, had higher viral loads and exhibited abnormal Th2 polarized responses to the virus. To focus on the consequences of Treg deficiency confined to the skin, we generated mixed CCR4KO FoxP3KO bone marrow (CCR4/FoxP3) chimeras in which skin, but not other tissues or central lymphoid organs, lack Treg. Like FoxP3KO mice, the chimeras had impaired VV-specific effector T cell responses and higher viral loads. Skin cytokine expression was significantly altered in infected chimeras compared to controls. Levels of the antiviral cytokines, type I and II interferons and IL-12, were reduced whereas expression of the proinflammatory cytokines, IL-6, IL-10, TGF-β and IL-23, was increased. Importantly, infection of CCR4/FoxP3 chimeras by a non-cutaneous route (i.p.) induced immune responses comparable to controls. Our findings implicate allergic skin inflammation resulting from local Treg deficiency in the pathogenesis of EV. PMID:20548030

  15. Skin inflammation arising from cutaneous regulatory T cell deficiency leads to impaired viral immune responses.


    Freyschmidt, Eva-Jasmin; Mathias, Clinton B; Diaz, Natalia; MacArthur, Daniel H; Laouar, Amale; Manjunath, Narasimhaswamy; Hofer, Matthias D; Wurbel, Marc-Andre; Campbell, James J; Chatila, Talal A; Oettgen, Hans C


    Individuals with atopic dermatitis immunized with the small pox vaccine, vaccinia virus (VV), are susceptible to eczema vaccinatum (EV), a potentially fatal disseminated infection. Dysfunction of Forkhead box P3 (FoxP3)-positive regulatory T cells (Treg) has been implicated in the pathogenesis of atopic dermatitis. To test whether Treg deficiency predisposes to EV, we percutaneously VV infected FoxP3-deficient (FoxP3(KO)) mice, which completely lack FoxP3(+) Treg. These animals generated both fewer VV-specific CD8(+) effector T cells and IFN-gamma-producing CD8(+) T cells than controls, had higher viral loads, and exhibited abnormal Th2-polarized responses to the virus. To focus on the consequences of Treg deficiency confined to the skin, we generated mixed CCR4(KO) FoxP3(KO) bone marrow (CCR4/FoxP3) chimeras in which skin, but not other tissues or central lymphoid organs, lack Treg. Like FoxP3(KO) mice, the chimeras had impaired VV-specific effector T cell responses and higher viral loads. Skin cytokine expression was significantly altered in infected chimeras compared with controls. Levels of the antiviral cytokines, type I and II IFNs and IL-12, were reduced, whereas expression of the proinflammatory cytokines, IL-6, IL-10, TGF-beta, and IL-23, was increased. Importantly, infection of CCR4/FoxP3 chimeras by a noncutaneous route (i.p.) induced immune responses comparable to controls. Our findings implicate allergic skin inflammation resulting from local Treg deficiency in the pathogenesis of EV.

  16. The Effects of Low Dose Irradiation on Inflammatory Response Proteins in a 3D Reconstituted Human Skin Tissue Model

    SciTech Connect

    Varnum, Susan M.; Springer, David L.; Chaffee, Mary E.; Lien, Katie A.; Webb-Robertson, Bobbie-Jo M.; Waters, Katrina M.; Sacksteder, Colette A.


    Skin responses to moderate and high doses of ionizing radiation include the induction of DNA repair, apoptosis, and stress response pathways. Additionally, numerous studies indicate that radiation exposure leads to inflammatory responses in skin cells and tissue. However, the inflammatory response of skin tissue to low dose radiation (<10 cGy) is poorly understood. In order to address this, we have utilized a reconstituted human skin tissue model (MatTek EpiDerm FT) and assessed changes in 23 cytokines twenty-four and forty eight hours following treatment of skin with either 3 or 10 cGy low-dose of radiation. Three cytokines, IFN-γ, IL-2, MIP-1α, were significantly altered in response to low dose radiation. In contrast, seven cytokines were significantly altered in response to a high radiation dose of 200 cGy (IL-2, IL-10, IL-13, IFN-γ, MIP-1α, TNF α, and VEGF) or the tumor promoter 12-O-tetradecanoylphorbol 13-acetate (G-CSF, GM-CSF, IL-1α, IL-8, MIP-1α, MIP-1β, RANTES). Additionally, radiation induced inflammation appears to have a distinct cytokine response relative to the non-radiation induced stressor, TPA. Overall, these results indicate that there are subtle changes in the inflammatory protein levels following exposure to low dose radiation and this response is a sub-set of what is seen following a high dose in a human skin tissue model.

  17. Vascular responses in glabrous and nonglabrous skin during acute mental stress in physically trained humans.


    Yano, Hiroki; Sone, Ryoko; Yamazaki, Fumio


    Acute mental stress induces sympathetic activation and influences vasomotor control in various organs. In the present study, to better understand the effect of physical training on peripheral vasomotor control during acute mental stress, we compared the skin vascular responses to mental arithmetic (MA) in physically trained and untrained humans. Eight physically trained (T group) and eight untrained (UT group) healthy volunteers performed 2 min of MA aloud in the supine position under a thermoneutral condition (28 degrees C). Skin blood flow (laser-Doppler flowmetry) and local temperature were monitored at the glabrous (palm, sole) and nonglabrous (forearm, calf) sites. Cutaneous vascular conductance (CVC) was evaluated from the ratio of blood flow to mean arterial pressure (tonometry). Local sweating rate (SR) was measured in the sole and calf by the ventilated capsule method. In the T group, the CVC at glabrous sites consistently decreased (P < 0.05) during MA, while in the UT group, the stress-induced decreases in CVC were transient and gradually recovered during MA. The patterns of changes in CVC at the nonglabrous sites were substantially similar to those at the glabrous sites, but the decreases in CVC at the nonglabrous sites were smaller (P < 0.05) than those at the glabrous sites in both groups. Local temperature at the glabrous sites (especially in the sole) showed higher (P < 0.05) values in the T group compared with the UT group. The SR in the sole and calf were increased (P < 0.05) during MA but did not differ between the two groups. These findings suggest that physical training acts to heighten skin temperature at the glabrous sites but not at the nonglabrous sites. It is also suggested that the change of skin temperature by physical training modifies sympathetic vasomotor control in glabrous and nonglabrous skin during acute mental stress in the peripheral level.

  18. 40 CFR 465.20 - Applicability; description of the galvanized basis material subcategory.

    Code of Federal Regulations, 2010 CFR


    ... PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS COIL COATING POINT SOURCE CATEGORY Galvanized... into publicly owned treatment works from coil coating of galvanized basis material coils....

  19. Resolvin E1 inhibits dendritic cell migration in the skin and attenuates contact hypersensitivity responses.


    Sawada, Yu; Honda, Tetsuya; Hanakawa, Sho; Nakamizo, Satoshi; Murata, Teruasa; Ueharaguchi-Tanada, Yuri; Ono, Sachiko; Amano, Wataru; Nakajima, Saeko; Egawa, Gyohei; Tanizaki, Hideaki; Otsuka, Atsushi; Kitoh, Akihiko; Dainichi, Teruki; Ogawa, Narihito; Kobayashi, Yuichi; Yokomizo, Takehiko; Arita, Makoto; Nakamura, Motonobu; Miyachi, Yoshiki; Kabashima, Kenji


    Resolvin E1 (RvE1) is a lipid mediator derived from ω3 polyunsaturated fatty acids that exerts potent antiinflammatory roles in several murine models. The antiinflammatory mechanism of RvE1 in acquired immune responses has been attributed to attenuation of cytokine production by dendritic cells (DCs). In this study, we newly investigated the effect of RvE1 on DC motility using two-photon microscopy in a contact hypersensitivity (CHS) model and found that RvE1 impaired DC motility in the skin. In addition, RvE1 attenuated T cell priming in the draining lymph nodes and effector T cell activation in the skin, which led to the reduced skin inflammation in CHS. In contrast, leukotriene B4 (LTB4) induced actin filament reorganization in DCs and increased DC motility by activating Cdc42 and Rac1 via BLT1, which was abrogated by RvE1. Collectively, our results suggest that RvE1 attenuates cutaneous acquired immune responses by inhibiting cutaneous DC motility, possibly through LTB4-BLT1 signaling blockade.

  20. Responsiveness of the Spanish Version of the “Skin Cancer Index”

    PubMed Central

    Rivas-Ruiz, F.; Blázquez-Sánchez, N.; Fernández-Canedo, I.; Aguilar-Bernier, M.; Repiso-Jiménez, J. B.; Toribio-Montero, J. C.; Jones-Caballero, M.; Rhee, J.


    Background. Skin Cancer Index (SCI) is a specific questionnaire measuring health related quality of life (HRQL) in patients with cervicofacial non-melanoma skin cancer (CFNMSC). The original scale has recently been adapted and validated into Spanish. Objectives. Evaluate the responsiveness of the Spanish version of SCI. Methods. Patients with CFNMSC candidate for surgical treatment were administered the questionnaire at time of diagnostic (t0), 7 days after surgery (t1), and 5 months after surgery (t2). The scale and subscales scores (C1: social/appearance, C2: emotional) were then evaluated. Differences between t0-t1, t1-t2, and t0-t2 were determined and a gender-and-age segmented analysis was performed. Results. 88 patients, 54.8% male, mean age 62.5 years, completed the study. Differences between t0-t1 and t1-t2 scores were statistically significant (p < 0.05). The lowest values were found at time of diagnosis and postsurgery. Women and patients under 65 years showed the lowest values at the three times. Limitations. Concrete geographic and cultural area. Clinical and histological variables are not analysed. Conclusions. Our results confirm responsiveness of the Spanish version of the SCI. Further development of the instrument in Spanish-speaking countries and populations will make it possible to extend worldwide research and knowledge horizons on skin cancer. PMID:27800183

  1. Effect of skin sympathetic response to local or systemic cold exposure on thermoregulatory functions in humans.


    Sawasaki, N; Iwase, S; Mano, T


    We studied how, sympathetic response to cold exposure determines thermoregulatory function. Three female and seven male volunteers (age, 23.2+/-1.9 years) were exposed to abrupt local cooling and gradual systemic cooling with recording of microneurographic skin sympathetic nerve activity tSSNA), skill temperatures (Ts), tympanic temperature (Tty), skin blood flow measured by laser Doppler flowmetry, and sweating rate measured with a ventilated capsule. Local cooling induced an abrupt vasoconstrictor SSNA increase and Tty rise. There was a significant positive correlation between the increase in the vasoconstrictor SSNA and the change rate of Tty. Systemic cooling at 0.2 degrees C/min enhanced SSNA but gradually decreased Tty, and a significant negative correlation was observed between them. A 10-min delay separated the SSNA rise from the subsequent Tty rise following local cooling. A delay of less than 1 min preceded the SSNA increase after the Tty fall induced by systemic cooling. These findings suggested that subjects with a good SSNA response to cold stress can maintain core temperature, but 10 min is necessary to raise the core temperature by reducing heat loss from the skin surface. In contrast. vasoconstrictor SSNA responds linearly to a fall in core temperature with a delay of less than 1 min.

  2. Mechanisms of DNA Damage Response to Targeted Irradiation in Organotypic 3D Skin Cultures

    PubMed Central

    Acheva, Anna; Ghita, Mihaela; Patel, Gaurang; Prise, Kevin M.; Schettino, Giuseppe


    DNA damage (caused by direct cellular exposure and bystander signaling) and the complex pathways involved in its repair are critical events underpinning cellular and tissue response following radiation exposures. There are limited data addressing the dynamics of DNA damage induction and repair in the skin particularly in areas not directly exposed. Here we investigate the mechanisms regulating DNA damage, repair, intracellular signalling and their impact on premature differentiation and development of inflammatory-like response in the irradiated and surrounding areas of a 3D organotypic skin model. Following localized low-LET irradiation (225 kVp X-rays), low levels of 53BP1 foci were observed in the 3D model (3.8±0.28 foci/Gy/cell) with foci persisting and increasing in size up to 48 h post irradiation. In contrast, in cell monolayers 14.2±0.6 foci/Gy/cell and biphasic repair kinetics with repair completed before 24 h was observed. These differences are linked to differences in cellular status with variable level of p21 driving apoptotic signalling in 2D and accelerated differentiation in both the directly irradiated and bystander areas of the 3D model. The signalling pathways utilized by irradiated keratinocytes to induce DNA damage in non-exposed areas of the skin involved the NF-κB transcription factor and its downstream target COX-2. PMID:24505255

  3. Skin-conductance orienting response in chronic schizophrenics: the role of neuroleptics.


    Spohn, H E; Coyne, L; Wilson, J K; Hayes, K


    The primary aim of this study was to determine whether there is an association between neuroleptic treatment and skin-conductance orienting response (SCOR) nonresponding in chronic schizophrenics. In a design adapted to this purpose, we were unable to demonstrate a relationship between neuroleptics and nonresponding. Although inability to prove the null hypothesis precludes a claim that neuroleptic treatment and SCOR nonresponding are unrelated, internal evidence and prior studies strongly suggest that such a dissociation exists in most chronic schizophrenic nonresponders. We also found stable nonspecific and toxic skin conductance activity differences between SCOR "responders" and "nonresponders" on three occasions of testing. We interpret our results as bearing on state and trait issues in chronic schizophrenics.

  4. Galvanic displacement of metals on semiconductor nanocrystals

    NASA Astrophysics Data System (ADS)

    Johnson, Melanie; Kelly, Joel A.; Henderson, Eric J.; Veinot, Jonathan G. C.


    We report the galvanic displacement (GD) of germanium from germanium nanocrystals (Ge-NCs) with silver. The Ge-NCs are synthesized by reductive thermal processing of germanium suboxide sol-gel prepolymers. Thermal processing yields size-controlled oxide-embedded Ge-NCs, which are liberated by dissolution of the germanium oxide matrix in water. Subsequent exposure of the freestanding Ge-NCs to aqueous solutions of AgNO3 leads to deposition of silver nanostructures by GD. The resulting metal structures were analyzed by XRD, XPS, TEM and EDX, confirming deposition of elemental silver in a variety of shapes and sizes.

  5. 76 FR 19382 - Galvanized Steel Wire From China and Mexico

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... COMMISSION Galvanized Steel Wire From China and Mexico AGENCY: United States International Trade Commission... Mexico of galvanized steel wire, provided for in subheading 7217.20.30 and 7217.20.45 of the Harmonized...., Nashville, TN; National Standard, LLC, Niles, MI; and Oklahoma Steel and Wire Co., Inc., Madill,...

  6. 76 FR 29266 - Galvanized Steel Wire From China and Mexico

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... COMMISSION Galvanized Steel Wire From China and Mexico Determinations On the basis of the record \\1... injured by reason of imports from China and Mexico of galvanized steel wire, provided for in subheading...; National Standard, LLC/DW-National Standard-Niles, LLC, Niles, MI; and Oklahoma Steel & Wire Company,...

  7. Mineralogical Evidence of Galvanic Corrosion in Domestic, Drinking Water Pipes

    EPA Science Inventory

    Drinking water distribution system (DWDS) piping contains numerous examples of galvanically-coupled metals (e.g., soldered copper pipe joints, copper-lead pipes joined during partial replacements of lead service lines). The possible role of galvanic corrosion in the release of l...

  8. Sympathetic Skin Responses from the Neck Area in Patients with Unilateral Migraine

    PubMed Central

    KORKMAZ, Bektaş; YILDIZ, Serpil; YILDIZ, Nebil


    Introduction In this study, in patients with unilateral migraine headache and in normal controls, it was aimed to assess the sympathetic function during attack, post attack, and interval periods and to compare these findings by recording sympathetic skin responses from the neck area, which was not studied before. Methods A total of 37 unilateral patients with migraine (30 women, seven men) who fulfilled the criteria of International Headache Society (2004) were recruited from our outpatient clinic. The control group consisted of 21 healthy individuals (16 women, five men) who are employees or students of our Medical Faculty. Mean latency and maximum amplitude values of sympathetic skin responses obtained from neck areas of the patients during attack, post attack, and interval periods were calculated. We compared the mean latency and the maximum amplitude values of the symptomatic side with the data of the asymptomatic side and with the data of the control group. We also compared the responses of the patients with right-sided headache with the responses of the patients with left-sided headache. All statistical analyses were performed using SPSS. Results On the neck area, we observed sympathetic hypo-function in the attack and interval periods and a relative hyper-function in the post attack period bilaterally, regardless of the symptomatic side. Conclusion These findings suggest that there is ongoing bilateral sympathetic hypo-function in the neck area and there occurs a temporary increase in the function of sympathetic sudomotor activity in the recovery period of headaches.

  9. Early skin toxicity predicts better outcomes, and early tumor shrinkage predicts better response after cetuximab treatment in advanced colorectal cancer.


    Kogawa, T; Doi, A; Shimokawa, M; Fouad, T M; Osuga, T; Tamura, F; Mizushima, T; Kimura, T; Abe, S; Ihara, H; Kukitsu, T; Sumiyoshi, T; Yoshizaki, N; Hirayama, M; Sasaki, T; Kawarada, Y; Kitashiro, S; Okushiba, S; Kondo, H; Tsuji, Y


    Cetuximab-containing treatments for metastatic colorectal cancer have been shown to have higher overall response rates and longer progression-free and overall survival than other systemic therapies. Cetuximab-related manifestations, including severe skin toxicity and early tumor shrinkage, have been shown to be predictors of response to cetuximab. We hypothesized that early skin toxicity is a predictor of response and better outcomes in patients with advanced colorectal carcinoma. We retrospectively evaluated 62 patients with colorectal adenocarcinoma who had unresectable tumors and were treated with cetuximab in our institution. Skin toxicity grade was evaluated on each treatment day. Tumor size was evaluated using computed tomography prior to treatment and 4-8 weeks after the start of treatment with cetuximab.Patients with early tumor shrinkage after starting treatment with cetuximab had a significantly higher overall response rate (P = 0.0001). Patients with early skin toxicity showed significantly longer overall survival (P = 0.0305), and patients with higher skin toxicity grades had longer progression-free survival (P = 0.0168).We have shown that early tumor shrinkage, early onset of skin toxicity, and high skin toxicity grade are predictors of treatment efficacy and/or outcome in patients with advanced colorectal carcinoma treated with cetuximab.

  10. RasGRP1 Transgenic Mice Develop Cutaneous Squamous Cell Carcinomas in Response to Skin Wounding

    PubMed Central

    Diez, Federico R.; Garrido, Ann A.; Sharma, Amrish; Luke, Courtney T.; Stone, James C.; Dower, Nancy A.; Cline, J. Mark; Lorenzo, Patricia S.


    Models of epidermal carcinogenesis have demonstrated that Ras is a critical molecule involved in tumor initiation and progression. Previously, we have shown that RasGRP1 increases the susceptibility of mice to skin tumorigenesis when overexpressed in the epidermis by a transgenic approach, related to its ability to activate Ras. Moreover, RasGRP1 transgenic mice develop spontaneous papillomas and cutaneous squamous cell carcinomas, some of which appear to originate in sites of injury, suggesting that RasGRP1 may be responding to signals generated during the wound-healing process. In this study, we examined the response of the RasGRP1 transgenic animals to full-thickness incision wounding of the skin, and demonstrated that they respond by developing tumors along the wounded site. The tumors did not present mutations in the H-ras gene, but Rasgrp1 transgene dosage correlated with tumor susceptibility and size. Analysis of serum cytokines showed increased levels of granulocyte colony-stimulating factor in transgenic animals after wounding. Furthermore, in vitro experiments with primary keratinocytes showed that granulocyte colony-stimulating factor stimulated Ras activation, although RasGRP1 was dispensable for this effect. Since granulocyte colony-stimulating factor has been recently associated with proliferation of skin cancer cells, our results may help in the elucidation of pathways that activate Ras in the epidermis during tumorigenesis in the absence of oncogenic ras mutations. PMID:19497993

  11. Raman spectroscopy: in vivo quick response code of skin physiological status

    NASA Astrophysics Data System (ADS)

    Vyumvuhore, Raoul; Tfayli, Ali; Piot, Olivier; Le Guillou, Maud; Guichard, Nathalie; Manfait, Michel; Baillet-Guffroy, Arlette


    Dermatologists need to combine different clinically relevant characteristics for a better understanding of skin health. These characteristics are usually measured by different techniques, and some of them are highly time consuming. Therefore, a predicting model based on Raman spectroscopy and partial least square (PLS) regression was developed as a rapid multiparametric method. The Raman spectra collected from the five uppermost micrometers of 11 healthy volunteers were fitted to different skin characteristics measured by independent appropriate methods (transepidermal water loss, hydration, pH, relative amount of ceramides, fatty acids, and cholesterol). For each parameter, the obtained PLS model presented correlation coefficients higher than R2=0.9. This model enables us to obtain all the aforementioned parameters directly from the unique Raman signature. In addition to that, in-depth Raman analyses down to 20 μm showed different balances between partially bound water and unbound water with depth. In parallel, the increase of depth was followed by an unfolding process of the proteins. The combinations of all these information led to a multiparametric investigation, which better characterizes the skin status. Raman signal can thus be used as a quick response code (QR code). This could help dermatologic diagnosis of physiological variations and presents a possible extension to pathological characterization.

  12. Raman spectroscopy: in vivo quick response code of skin physiological status.


    Vyumvuhore, Raoul; Tfayli, Ali; Piot, Olivier; Le Guillou, Maud; Guichard, Nathalie; Manfait, Michel; Baillet-Guffroy, Arlette


    Dermatologists need to combine different clinically relevant characteristics for a better understanding of skin health. These characteristics are usually measured by different techniques, and some of them are highly time consuming. Therefore, a predicting model based on Raman spectroscopy and partial least square (PLS) regression was developed as a rapid multiparametric method. The Raman spectra collected from the five uppermost micrometers of 11 healthy volunteers were fitted to different skin characteristics measured by independent appropriate methods (transepidermal water loss, hydration, pH, relative amount of ceramides, fatty acids, and cholesterol). For each parameter, the obtained PLS model presented correlation coefficients higher than R2=0.9. This model enables us to obtain all the aforementioned parameters directly from the unique Raman signature. In addition to that, in-depth Raman analyses down to 20 μm showed different balances between partially bound water and unbound water with depth. In parallel, the increase of depth was followed by an unfolding process of the proteins. The combinations of all these information led to a multiparametric investigation, which better characterizes the skin status. Raman signal can thus be used as a quick response code (QR code). This could help dermatologic diagnosis of physiological variations and presents a possible extension to pathological characterization.

  13. The responses of glabrous and nonglabrous skin microcirculation to graded dynamic exercise and its recovery.


    Potočnik, N; Lenasi, H


    This study investigated the responses of skin blood flow (SkBF) in glabrous and nonglabrous skin to graded submaximal dynamic exercise and its recovery. We enrolled eight healthy young men with comparable maximal oxygen uptake (VO2max). Laser-Doppler flux (LDF) was assessed on the finger pulp (glabrous site) and the volar forearm (nonglabrous site) simultaneously with skin temperature, heart rate and blood pressure; cutaneous vascular conductance (CVC) was calculated. Subjects were monitored before (baseline), during and 25 minutes after incremental cycling. CVC in the pulp decreased with the onset of exercise (0.53±0.09AUmmHg-1 vs. baseline 1.23±0.25AUmmHg-1, p = 0.006), and persisted low until exercise cessation, whereas CVC in the forearm started to increase at 60% of subjects' VO2max, attaining its maximum at the highest exercise load (0.44±0.11AUmmHg-1 vs. baseline 0.12±0,03AUmmHg-1, p = 0.017). In the recovery, CVC in the pulp attained a higher plateau value compared to baseline (1.51±0.22AUmmHg-1, p = 0.021), interrupted by abrupt transient falls of CVC. On the forearm, CVC subsequently returned to its baseline. SkBF of glabrous and nonglabrous sites adjust in an opposite manner to graded exercise load and also differ during recovery.

  14. Low-dose radiation modifies skin response to acute gamma-rays and protons.


    Mao, Xiao Wen; Pecaut, Michael J; Cao, Jeffrey D; Moldovan, Maria; Gridley, Daila S


    The goal of the present study was to obtain pilot data on the effects of protracted low-dose/low-dose-rate (LDR) γ-rays on the skin, both with and without acute gamma or proton irradiation (IR). Six groups of C57BL/6 mice were examined: a) 0 Gy control, b) LDR, c) Gamma, d) LDR+Gamma, e) Proton, and f) LDR+Proton. LDR radiation was delivered to a total dose of 0.01 Gy (0.03 cGy/h), whereas the Gamma and Proton groups received 2 Gy (0.9 Gy/min and 1.0 Gy/min, respectively). Assays were performed 56 days after exposure. Skin samples from all irradiated groups had activated caspase-3, indicative of apoptosis. The significant (p<0.05) increases in immunoreactivity in the Gamma and Proton groups were not present when LDR pre-exposure was included. However, the terminal deoxynucleotidyl transferase dUTP nick-end labeling assay for DNA fragmentation and histological examination of hematoxylin and eosin-stained sections revealed no significant differences among groups, regardless of radiation regimen. The data demonstrate that caspase-3 activation initially triggered by both forms of acute radiation was greatly elevated in the skin nearly two months after whole-body exposure. In addition, LDR γ-ray priming ameliorated this response.

  15. Host responses in human skin after conventional intradermal injection or microneedle administration of virus-like-particle influenza vaccine.


    Pearton, Marc; Pirri, Daniela; Kang, Sang-Moo; Compans, Richard W; Birchall, James C


    Miniaturized microneedle devices are being developed for painlessly targeting vaccines to the immune cell populations in skin. As skin immunization studies are generally restricted to animal models however, where skin architecture and immunity is greatly different to human, surprisingly little is known about the local human response to intradermal (ID) vaccines. Here surgically excised human skin is used to explore for the first time the complex molecular and cellular host responses to a candidate influenza vaccine comprising nanoparticulate virus-like-particles (VLPs), administered via conventional hypodermic injection or reduced scale microneedles. Responses at the molecular level are determined by microarray analysis (47,296 discrete transcripts) and validated by quantitative PCR (96 genes). Cellular response is probed through monitoring migration of dendritic cells in viable skin tissue. Gene expression mapping, ontological analysis, and qPCR reveal up-regulation of a host of genes responsible for key immunomodulatory processes and host viral response, including cell recruitment, activation, migration, and T cell interaction following both ID and microneedle injection of VLPs; the response from the microneedles being more subtle. Significant morphological and migratory changes to skin dendritic cells are also apparent following microneedle VLP delivery. This is the first study displaying the global, multifaceted immunological events that occur at the site of vaccine deposition in human skin and will subsequently influence the degree and nature of innate and adaptive immune responses. An increased understanding of the detailed similarities and differences in response against antigen administered via different delivery modalities will inform the development of improved vaccines and vaccine delivery systems.

  16. Time-series analysis for rapid event-related skin conductance responses

    PubMed Central

    Bach, Dominik R.; Flandin, Guillaume; Friston, Karl J.; Dolan, Raymond J.


    Event-related skin conductance responses (SCRs) are traditionally analysed by comparing the amplitude of individual peaks against a pre-stimulus baseline. Many experimental manipulations in cognitive neuroscience dictate paradigms with short inter trial intervals, precluding accurate baseline estimation for SCR measurements. Here, we present a novel and general approach to SCR analysis, derived from methods used in neuroimaging that estimate responses using a linear convolution model. In effect, the method obviates peak-scoring and makes use of the full SCR. We demonstrate, across three experiments, that the method has face validity in analysing reactions to a loud white noise and emotional pictures, can be generalised to paradigms where the shape of the response function is unknown and can account for parametric trial-by-trial effects. We suggest our approach provides greater flexibility in analysing SCRs than existing methods. PMID:19686778

  17. Biological and metabolic response in STS-135 space-flown mouse skin.


    Mao, X W; Pecaut, M J; Stodieck, L S; Ferguson, V L; Bateman, T A; Bouxsein, M L; Gridley, D S


    There is evidence that space flight condition-induced biological damage is associated with increased oxidative stress and extracellular matrix (ECM) remodeling. To explore possible mechanisms, changes in gene expression profiles implicated in oxidative stress and in ECM remodeling in mouse skin were examined after space flight. The metabolic effects of space flight in skin tissues were also characterized. Space Shuttle Atlantis (STS-135) was launched at the Kennedy Space Center on a 13-day mission. Female C57BL/6 mice were flown in the STS-135 using animal enclosure modules (AEMs). Within 3-5 h after landing, the mice were euthanized and skin samples were harvested for gene array analysis and metabolic biochemical assays. Many genes responsible for regulating production and metabolism of reactive oxygen species (ROS) were significantly (p < 0.05) altered in the flight group, with fold changes >1.5 compared to AEM control. For ECM profile, several genes encoding matrix and metalloproteinases involved in ECM remodeling were significantly up-/down-regulated following space flight. To characterize the metabolic effects of space flight, global biochemical profiles were evaluated. Of 332 named biochemicals, 19 differed significantly (p < 0.05) between space flight skin samples and AEM ground controls, with 12 up-regulated and 7 down-regulated including altered amino acid, carbohydrate metabolism, cell signaling, and transmethylation pathways. Collectively, the data demonstrated that space flight condition leads to a shift in biological and metabolic homeostasis as the consequence of increased regulation in cellular antioxidants, ROS production, and tissue remodeling. This indicates that astronauts may be at increased risk for pathophysiologic damage or carcinogenesis in cutaneous tissue.

  18. Sex Specific Molecular Genetic Response to UVB Exposure in Xiphophorus maculatus Skin

    PubMed Central

    Boswell, William; Boswell, Mikki; Titus, James; Savage, Markita; Lu, Yuan; Shen, Jianjun; Walter, Ronald B.


    In both Xiphophorus fishes and humans, males are reported to have a higher incidence of melanoma than females. To better understand sex specific differences in the molecular genetic response to UVB, we performed RNA-Seq experiments in skin of female and male Xiphophorus maculatus Jp 163 B following UVB doses of 8 or 16 kJ/m2 exposure. Male X. maculatus differentially express a significantly larger number of transcripts following exposure to 16 kJ/m2 UVB (1,293 genes) compared to 8 kJ/m2 UVB (324 genes). Female skin showed differential gene expression in a larger number of transcripts following 8 kJ/m2 UVB (765) than did males; however, both females and males showed similar numbers of differentially expressed genes at 16 kJ/m2 UVB (1,167 and1,293, respectively). Although most modulated transcripts after UVB exposure represented the same dominant pathways in both females and males (e.g., DNA repair, circadian rhythm, and fatty acid biosynthesis), we identified genes in several pathways that exhibited opposite modulation in female vs. male skin (e.g., synaptic development, cell differentiation, wound healing, and glucose metabolism). The oppositely modulated genes appear related through uncoupling protein 3 (UCP3) that is involved with regulation of fatty acid oxidation and serves to balance glucose and lipid metabolism. Overall, these results identify gender specific differences in UVB induced genetic profiles in the skin of females and males and show female and male X. maculatus respond to UVB differently through pathways involved in reactive oxygen species, wound healing, and energy homeostasis. PMID:26256120

  19. Impact of skin temperature and hydration on plasma volume responses during exercise.


    Kenefick, Robert W; Sollanek, Kurt J; Charkoudian, Nisha; Sawka, Michael N


    Heat stress and hydration may both alter plasma volume (PV) responses during acute exercise; potential interactions have not been fully studied. The purpose of this study was to determine the effect of graded elevations in skin temperature (Tsk) on PV changes during steady-state exercise under conditions of euhydration (EU) and hypohydration (HYPO, -4% of body mass). Thirty-two men (22 ± 4 yr) were divided into four cohorts (n = 8 each) and completed EU and HYPO trials in one environment [ambient temperature (Ta) 10, 20, 30, and 40°C]. Thirty minutes of cycle ergometry (50% V̇o2peak) was performed. Core (Tre) and mean skin (Tsk) temperatures were measured; changes in PV, total circulating protein (TCP), and mean arterial pressure (MAP) were calculated; and skin blood flow (SkBF) was estimated. Hypohydration decreased (P < 0.05) PV by 200 ml (-5.7%) but did not alter TCP. Plasma loss was not different between EU and HYPO during exercise at any Ta. Plasma losses were greater (P < 0.05) with elevated Ta with an average -130, -174, -294, and -445 ml losses during the 10, 20, 30, and 40°C trials, respectively. Significant (P < 0.05) correlations (r = 0.50 to 0.84) were found between ΔTCP and ΔPV during exercise when Tsk was cool/warm (<33°C; Ta 10, 20, and 30°C), but not at 40°C (high Tsk). We conclude that 1) graded skin warming proportionally accentuated plasma loss; 2) plasma loss was associated with plasma protein efflux at lower Tsk and SkBF; 3) at high Tsk, additional plasma loss likely results from increased net filtration at the capillaries; and 4) HYPO did not alter vascular fluid loss during exercise in any environment.

  20. Responses of slowly adapting type II afferent fibres in cat hairy skin to vibrotactile stimuli.

    PubMed Central

    Gynther, B D; Vickery, R M; Rowe, M J


    1. Slowly adapting type II (SAII) afferent fibres that supply the forelimb were isolated from the medial cutaneous nerve of anaesthetized cats and examined for their capacity to signal information about vibrotactile events in the hairy skin. 2. The SAII fibres had a single spot-like receptive field focus where they were highly sensitive to steady indentation and vibration applied with probes normal to the skin surface. However, their sensitivity was affected profoundly by the size of the stimulus probe, its position in relation to the receptive field focus and, to a lesser extent, the magnitude of any pre-indentation on which vibration was superimposed. Small stimulus probes (e.g. 250 microns diameter) were much more effective than larger (> or = 1-2 mm) ones, and small shifts in the position of the perpendicularly applied probe away from the receptive field focus led to a marked decline in responsiveness. 3. With appropriate choice of stimulus parameters for vibratory stimuli applied at the receptive field focus, the SAII fibres could respond at low threshold (< 100 microns), with a tightly phase-locked, regular 1:1 impulse pattern (one impulse per vibration cycle) that accurately signalled the vibration frequency over a bandwidth that extended to 600 Hz. Furthermore, their responses remained phase-locked up to 1000 Hz. Phase-locking in SAII fibres was marginally tighter than that in SAI fibres and comparable to that of Pacinian corpuscle fibres. 4. The sensitivity of forelimb SAII fibres to tangential skin stretch was directionally selective; stretch across the forelimb was much more effective than along its long axis. Vibration associated with tangential skin stretch led to a marked spatial expansion of the field of vibration sensitivity. SAII fibres could therefore signal information about natural stimuli that contain elements of skin stretch and vibration, as may be encountered when the forelimb brushes against textured surfaces. Should the SAII fibres fail to

  1. Immediate skin responses to laser and light treatments: Warning endpoints: How to avoid side effects.


    Wanner, Molly; Sakamoto, Fernanda H; Avram, Mathew M; Anderson, R Rox


    Lasers are versatile, commonly used treatment tools in dermatology. While it is tempting to follow manufacturer's guidelines or other "recipes" for laser treatment, this approach alone can be a recipe for disaster. Specific and immediate skin responses or endpoints exist and are clinically useful because they correlate with underlying mechanisms that are either desirable (ie, therapeutic), undesirable (ie, warning signs of injury or side effects), or incidental. The observation of clinical endpoints is a safe and reliable guide for appropriate treatment. This article presents the warning endpoints during specific dermatologic laser treatments, and the accompanying article presents the therapeutic endpoints, their underlying mechanisms, and the utility of these endpoints.

  2. Histone H3 Phosphorylation in Human Skin Histoculture as a Tool to Evaluate Patient’s Response to Antiproliferative Drugs

    PubMed Central

    Ugarte, Fernando; Porth, Katherine; Sadekova, Svetlana


    Evaluation of patient’s response to chemotherapeutic drugs is often difficult and time consuming. Skin punch biopsies are easily accessible material that can be used for the evaluation of surrogate biomarkers of a patient’s response to a drug. In this study, we hypothesized that assessment of phosphorylated histone H3 in human skin punch biopsies could be used as a pharmacodynamics biomarker of patient’s response to the kinesin spindle protein inhibitor SCH2047069. To test this hypothesis, we used a human skin histoculture technique that allows culturing intact human skin in the presence of the drug. Human melanoma and skin histocultures were treated with SCH2047069, and the effect of the drug was assessed by increasing histone H3 phosphorylation using immunohistochemistry. Our results demonstrate that SCH2047069 has a significant effect on cell proliferation in human melanoma and skin histoculture and justify using human skin punch biopsies for evaluation of the pharmacodynamic changes induced by SCH2047069. ACRONYMS Histone subunit H3 (H3), Kinesin spindle protein (KSP), 5-ethynyl-2′-deoxyuridine (EDU), Dimethyl sulfoxide (DMSO), Formalin-fixed paraffin embedded (FFPE). PMID:26917945

  3. Protein oxidative damage and heme oxygenase in sunlight-exposed human skin: roles of MAPK responses to oxidative stress.


    Akasaka, Emiko; Takekoshi, Susumu; Horikoshi, Yosuke; Toriumi, Kentarou; Ikoma, Norihiro; Mabuchi, Tomotaka; Tamiya, Shiho; Matsuyama, Takashi; Ozawa, Akira


    Oxidative stress derived from ultraviolet (UV) light in sunlight induces different hazardous effects in the skin, including sunburn, photo-aging and DNA mutagenesis. In this study, the protein-bound lipid peroxidation products 4-hydroxy-2-nonenal (HNE) and the oxidative DNA damage marker 8-hydroxy-2'-deoxyguanosine (8OHdG) were investigated in chronically sun-exposed and sun-protected human skins using immunohistochemistry. The levels of antioxidative enzymes, such as heme oxygenase 1 and 2, Cu/Zn-SOD, Mn-SOD and catalase, were also examined. Oxidative stress is also implicated in the activation of signal transduction pathways, such as mitogen-activated protein kinase (MAPK). Therefore, the expression and distribution of phosphorylated p38 MAPK, phosphorylated Jun N-terminal kinase (JNK) and phosphorylated extracellular signal-regulated kinase (ERK) were observed. Skin specimens were obtained from the surgical margins. Chronically sunlight-exposed skin samples were taken from the ante-auricular (n = 10) and sunlight-protected skin samples were taken from the post-auricular (n = 10). HNE was increased in the chronically sunlight-exposed skin but not in the sunlight-protected skin. The expression of heme oxygenase-2 was markedly increased in the sunlight-exposed skin compared with the sun-protected skin. In contrast, the intensity of immunostaining of Cu/Zn-SOD, Mn-SOD and catalase was not different between the two areas. Phosphorylated p38 MAPK and phosphorylated JNK accumulated in the ante-auricular dermis and epidermis, respectively. These data show that particular anti-oxidative enzymes function as protective factors in chronically sunlight-exposed human skin. Taken together, our results suggest (1) antioxidative effects of heme oxygenase-2 in chronically sunlight-exposed human skin, and that (2) activation of p38 MAPK may be responsible for oxidative stress.

  4. Asymmetric response properties of rapidly adapting mechanoreceptive fibers in the rat glabrous skin.


    Devecıoğlu, Ismaıl; Güçlü, Burak


    Previous histological and neurophysiological studies have shown that the innervation density of rapidly adapting (RA) mechanoreceptive fibers increases towards the fingertip. Since the psychophysical detection threshold depends on the contribution of several RA fibers, a high innervation density would imply lower thresholds. However, our previous human study showed that psychophysical detection thresholds for the Non-Pacinian I channel mediated by RA fibers do not improve towards the fingertip. By recording single-unit spike activity from rat RA fibers, here we tested the hypothesis that the responsiveness of RA fibers is asymmetric in the proximo-distal axis which may counterbalance the effects of innervation density. RA fibers (n = 32) innervating the digital glabrous skin of rat hind paw were stimulated with 40-Hz sinusoidal mechanical bursts at five different stimulus locations relative to the receptive field (RF) center (two distal, one RF center, two proximal). Different contactor sizes (area: 0.39, 1.63, 2.96 mm²) were used. Rate-intensity functions were constructed based on average firing rates, and the absolute spike threshold and the entrainment threshold were obtained for each RA fiber. Thresholds for proximal stimulus locations were found to be significantly higher than those for distal stimulus locations, which suggests that the mechanical stimulus is transmitted better towards the proximal direction. The effect of contactor size was not significant. Mechanical impedance of the rat digital glabrous skin was further measured and a lumped-parameter model was proposed to interpret the relationship between the asymmetric response properties of RA fibers and the mechanical properties of the skin.

  5. Postharvest dark skin spots in potato tubers are an oversuberization response to Rhizoctonia solani infection.


    Buskila, Yossi; Tsror Lahkim, Leah; Sharon, Michal; Teper-Bamnolker, Paula; Holczer-Erlich, Orly; Warshavsky, Shimon; Ginzberg, Idit; Burdman, Saul; Eshel, Dani


    Israeli farmers export 250,000 tons of potato tubers annually, ≈40,000 tons of which are harvested early, before skin set. In recent years, there has been an increase in the occurrence of dark skin spots on early-harvested potato tubers ('Nicola') packed in large bags containing peat to retain moisture. The irregular necrotic spots form during storage and overseas transport. Characterization of the conditions required for symptom development indicated that bag temperature after packing is 11 to 13°C and it reaches the target temperature (8°C) only 25 days postharvest. This slow decrease in temperature may promote the establishment of pathogen infection. Isolates from typical lesions were identified as Rhizoctonia spp., and Koch's postulates were completed with 25 isolates by artificial inoculation performed at 13 to 14°C. Phylogenetic analysis, using the internal transcribed spacer sequences (ITS1 and ITS2) of rDNA genes, assigned three isolates to anastomosis group 3 of Rhizoctonia solani. Inoculation of wounded tubers with mycelium of these R. solani isolates resulted in an oversuberization response in the infected area. With isolate Rh17 of R. solani, expression of the suberin biosynthesis-related genes StKCS6 and CYP86A33 increased 6.8- and 3.4-fold, respectively, 24 h postinoculation, followed by a 2.9-fold increase in POP_A, a gene associated with wound-induced suberization, expression 48 h postinoculation, compared with the noninoculated tubers. We suggest that postharvest dark spot disease is an oversuberization response to R. solani of AG-3 infection that occurs prior to tuber skin set.

  6. In Vivo Assessment of Acute UVB Responses in Normal and Xeroderma Pigmentosum (XP-C) Skin-Humanized Mouse Models

    PubMed Central

    García, Marta; Llames, Sara; García, Eva; Meana, Alvaro; Cuadrado, Natividad; Recasens, Mar; Puig, Susana; Nagore, Eduardo; Illera, Nuria; Jorcano, José Luis; Del Rio, Marcela; Larcher, Fernando


    In vivo studies of UVB effects on human skin are precluded by ethical and technical arguments on volunteers and inconceivable in cancer-prone patients such as those affected with Xeroderma Pigmentosum (XP). Establishing reliable models to address mechanistic and therapeutic matters thus remains a challenge. Here we have used the skin-humanized mouse system that circumvents most current model constraints. We assessed the UVB radiation effects including the sequential changes after acute exposure with respect to timing, dosage, and the relationship between dose and degree-sort of epidermal alteration. On Caucasian-derived regenerated skins, UVB irradiation (800 J/m2) induced DNA damage (cyclobutane pyrimidine dimers) and p53 expression in exposed keratinocytes. Epidermal disorganization was observed at higher doses. In contrast, in African descent–derived regenerated skins, physiological hyperpigmentation prevented tissue alterations and DNA photolesions. The acute UVB effects seen in Caucasian-derived engrafted skins were also blocked by a physical sunscreen, demonstrating the suitability of the system for photoprotection studies. We also report the establishment of a photosensitive model through the transplantation of XP-C patient cells as part of a bioengineered skin. The inability of XP-C engrafted skin to remove DNA damaged cells was confirmed in vivo. Both the normal and XP-C versions of the skin-humanized mice proved proficient models to assess UVB-mediated DNA repair responses and provide a strong platform to test novel therapeutic strategies. PMID:20558577

  7. Behavioral triggers of skin conductance responses and their neural correlates in the primate amygdala.


    Laine, Christopher M; Spitler, Kevin M; Mosher, Clayton P; Gothard, Katalin M


    The amygdala plays a crucial role in evaluating the emotional significance of stimuli and in transforming the results of this evaluation into appropriate autonomic responses. Lesion and stimulation studies suggest involvement of the amygdala in the generation of the skin conductance response (SCR), which is an indirect measure of autonomic activity that has been associated with both emotion and attention. It is unclear if this involvement marks an emotional reaction to an external stimulus or sympathetic arousal regardless of its origin. We recorded skin conductance in parallel with single-unit activity from the right amygdala of two rhesus monkeys during a rewarded image viewing task and while the monkeys sat alone in a dimly lit room, drifting in and out of sleep. In both experimental conditions, we found similar SCR-related modulation of activity at the single-unit and neural population level. This suggests that the amygdala contributes to the production or modulation of SCRs regardless of the source of sympathetic arousal.

  8. Laser speckle contrast imaging of skin blood perfusion responses induced by laser coagulation

    NASA Astrophysics Data System (ADS)

    Ogami, M.; Kulkarni, R.; Wang, H.; Reif, R.; Wang, R. K.


    We report application of laser speckle contrast imaging (LSCI), i.e., a fast imaging technique utilising backscattered light to distinguish such moving objects as red blood cells from such stationary objects as surrounding tissue, to localise skin injury. This imaging technique provides detailed information about the acute perfusion response after a blood vessel is occluded. In this study, a mouse ear model is used and pulsed laser coagulation serves as the method of occlusion. We have found that the downstream blood vessels lacked blood flow due to occlusion at the target site immediately after injury. Relative flow changes in nearby collaterals and anastomotic vessels have been approximated based on differences in intensity in the nearby collaterals and anastomoses. We have also estimated the density of the affected downstream vessels. Laser speckle contrast imaging is shown to be used for highresolution and fast-speed imaging for the skin microvasculature. It also allows direct visualisation of the blood perfusion response to injury, which may provide novel insights to the field of cutaneous wound healing.

  9. Laser speckle contrast imaging of skin blood perfusion responses induced by laser coagulation

    SciTech Connect

    Ogami, M; Kulkarni, R; Wang, H; Reif, R; Wang, R K


    We report application of laser speckle contrast imaging (LSCI), i.e., a fast imaging technique utilising backscattered light to distinguish such moving objects as red blood cells from such stationary objects as surrounding tissue, to localise skin injury. This imaging technique provides detailed information about the acute perfusion response after a blood vessel is occluded. In this study, a mouse ear model is used and pulsed laser coagulation serves as the method of occlusion. We have found that the downstream blood vessels lacked blood flow due to occlusion at the target site immediately after injury. Relative flow changes in nearby collaterals and anastomotic vessels have been approximated based on differences in intensity in the nearby collaterals and anastomoses. We have also estimated the density of the affected downstream vessels. Laser speckle contrast imaging is shown to be used for highresolution and fast-speed imaging for the skin microvasculature. It also allows direct visualisation of the blood perfusion response to injury, which may provide novel insights to the field of cutaneous wound healing. (laser biophotonics)

  10. Postocclusive reactive hyperemia and thermal response in the skin microcirculation of subjects with spinal cord injury.


    Schubert, V; Fagrell, B


    The response of skin blood cell flux (SBF) to locally applied pressure was evaluated by laser Doppler fluxmetry over the sacrum and the gluteus maximus muscle in twenty patients with spinal cord injuries (SCI)-ten with tetraplegia, ten with paraplegia-and ten healthy subjects. The SCI patients were further divided into two subgroups, one with sensation and the other without sensation over the sacrum area. The SBF over the sacrum, without applied pressure, showed somewhat higher values among the patients. The ten paraplegic patients (p less than 0.05) and the subgroup of patients without sensation over the sacrum (p less than 0.05) showed the highest values. Occlusion of the SBF was reached at a lower external skin pressure over the sacrum than over the gluteus maximus muscle in the group with spinal cord injuries (p less than 0.01). During the postocclusive reactive hyperemia we found a much shorter time to peak SBF over the gluteus muscle for the patients compared to the healthy subjects (p less than 0.01). In the subgroup of patients without sensation over the sacrum a prolonged time to peak SBF was found (p less than 0.01) over the sacrum compared to patients with sensation and to healthy subjects. The increase of the SBF during postocclusive hyperemia response was lower over both the sacrum and the gluteus maximus muscle areas in the patients with spinal cord injuries (p less than 0.01).(ABSTRACT TRUNCATED AT 250 WORDS)

  11. Optimisation of gelatin extraction from Unicorn leatherjacket (Aluterus monoceros) skin waste: response surface approach.


    Hanjabam, Mandakini Devi; Kannaiyan, Sathish Kumar; Kamei, Gaihiamngam; Jakhar, Jitender Kumar; Chouksey, Mithlesh Kumar; Gudipati, Venkateshwarlu


    Physical properties of gelatin extracted from Unicorn leatherjacket (Aluterus monoceros) skin, which is generated as a waste from fish processing industries, were optimised using Response Surface Methodology (RSM). A Box-Behnken design was used to study the combined effects of three independent variables, namely phosphoric acid (H3PO4) concentration (0.15-0.25 M), extraction temperature (40-50 °C) and extraction time (4-12 h) on different responses like yield, gel strength and melting point of gelatin. The optimum conditions derived by RSM for the yield (10.58%) were 0.2 M H3PO4 for 9.01 h of extraction time and hot water extraction of 45.83 °C. The maximum achieved gel strength and melting point was 138.54 g and 22.61 °C respectively. Extraction time was found to be most influencing variable and had a positive coefficient on yield and negative coefficient on gel strength and melting point. The results indicated that Unicorn leatherjacket skins can be a source of gelatin having mild gel strength and melting point.

  12. Characterization of guinea pig T cell responses elicited after EP-assisted delivery of DNA vaccines to the skin

    PubMed Central

    Schultheis, Katherine; Schaefer, Hubert; Yung, Bryan S.; Oh, Janet; Muthumani, Karuppiah; Humeau, Laurent; Broderick, Kate E.


    The skin is an ideal target tissue for vaccine delivery for a number of reasons. It is highly accessible, and most importantly, enriched in professional antigen presenting cells. Possessing strong similarities to human skin physiology and displaying a defined epidermis, the guinea pig is an appropriate model to study epidermal delivery of vaccine. However, whilst we have characterized the humoral responses in the guinea pig associated with skin vaccine protocols we have yet to investigate the T cell responses. In response to this inadequacy, we developed an IFN-γ ELISpot assay to characterize the cellular immune response in the peripheral blood of guinea pigs. Using a nucleoprotein (NP) influenza pDNA vaccination regimen, we characterized host T cell responses. After delivery of the DNA vaccine to the guinea pig epidermis we detected robust and rapid T cell responses. The levels of IFN-γ spot-forming units averaged approximately 5000 per million cells after two immunizations. These responses were broad in that multiple regions across the NP antigen elicited a T cell response. Interestingly, we identified a number of NP immunodominant T cell epitopes to be conserved across an outbred guinea pig population, a phenomenon which was also observed after immunization with a RSV DNA vaccine. We believe this data enhances our understanding of the cellular immune response elicited to a vaccine in guinea pigs, and globally, will advance the use of this model for vaccine development, especially those targeting skin as a delivery site. PMID:27894716

  13. Characterization of guinea pig T cell responses elicited after EP-assisted delivery of DNA vaccines to the skin.


    Schultheis, Katherine; Schaefer, Hubert; Yung, Bryan S; Oh, Janet; Muthumani, Karuppiah; Humeau, Laurent; Broderick, Kate E; Smith, Trevor R F


    The skin is an ideal target tissue for vaccine delivery for a number of reasons. It is highly accessible, and most importantly, enriched in professional antigen presenting cells. Possessing strong similarities to human skin physiology and displaying a defined epidermis, the guinea pig is an appropriate model to study epidermal delivery of vaccine. However, whilst we have characterized the humoral responses in the guinea pig associated with skin vaccine protocols we have yet to investigate the T cell responses. In response to this inadequacy, we developed an IFN-γ ELISpot assay to characterize the cellular immune response in the peripheral blood of guinea pigs. Using a nucleoprotein (NP) influenza pDNA vaccination regimen, we characterized host T cell responses. After delivery of the DNA vaccine to the guinea pig epidermis we detected robust and rapid T cell responses. The levels of IFN-γ spot-forming units averaged approximately 5000 per million cells after two immunizations. These responses were broad in that multiple regions across the NP antigen elicited a T cell response. Interestingly, we identified a number of NP immunodominant T cell epitopes to be conserved across an outbred guinea pig population, a phenomenon which was also observed after immunization with a RSV DNA vaccine. We believe this data enhances our understanding of the cellular immune response elicited to a vaccine in guinea pigs, and globally, will advance the use of this model for vaccine development, especially those targeting skin as a delivery site.

  14. Galvanic cell for processing of used nuclear fuel


    Garcia-Diaz, Brenda L.; Martinez-Rodriguez, Michael J.; Gray, Joshua R.; Olson, Luke C.


    A galvanic cell and methods of using the galvanic cell is described for the recovery of uranium from used nuclear fuel according to an electrofluorination process. The galvanic cell requires no input energy and can utilize relatively benign gaseous fluorinating agents. Uranium can be recovered from used nuclear fuel in the form of gaseous uranium compound such as uranium hexafluoride, which can then be converted to metallic uranium or UO.sub.2 and processed according to known methodology to form a useful product, e.g., fuel pellets for use in a commercial energy production system.

  15. Laughter counteracts enhancement of plasma neurotrophin levels and allergic skin wheal responses by mobile phone-mediated stress.


    Kimata, Hajime


    Laughter caused by viewing a comic video (Rowan Atkinson's The Best Bits of Mr. Bean) reduced the plasma nerve growth factor, neurotrophin-3 levels, and allergic skin wheal responses in patients with atopic dermatitis, whereas viewing a nonhumorous video (weather information) failed to do so. In contrast, stress induced by writing mail on a mobile phone enhanced the plasma nerve growth factor, neurotrophin-3 levels, and allergic skin wheal responses. However, previewing the comic video counteracted mobile phone-mediated enhancement of plasma neurotrophins or allergic skin wheal responses, whereas previewing the weather information failed to do so. Taken together, these results suggest that, in patients with atopic dermatitis, writing mail on a mobile phone causes stress and enhances allergic responses with a concomitant increase in plasma neurotrophins that are counteracted by laughter. These results may be useful in the study of pathophysiology and treatment of atopic dermatitis.

  16. Personal reflections on a galvanizing trail.


    O'Dell, B L


    This article encompasses my perception of, and experience in, an exciting segment of the trace element era in nutrition research: the role of zinc in the nutrition of animals and humans. Zinc has been a major player on the stage of trace element research, and it has left a trail that galvanized the attention of many researchers, including myself. It is ubiquitous in biological systems, and it plays a multitude of physiologic and biochemical functions. A brief historical overview is followed by a discussion of the contributions the work done in my laboratory has made toward understanding the physiological and biochemical functions of zinc. The effort of 40 years has led to the belief that one of zinc's major roles, and perhaps its first limiting role, is to preserve plasma-membrane function as regards ion channels and signal transduction. Although substantial knowledge has been gained relating to the importance of zinc in nutrition, much remains to be discovered.

  17. Galvanic gold plating for fixed dental prosthesis.


    Ozcelik, Tuncer Burak; Yilmaz, Burak


    Metal ceramic partial fixed dental prostheses have been commonly used for the replacement of missing teeth for many years. Because of an increase in the price of gold, base metal alloys have been the choice of alloy for the fabrication of metal ceramic restorations in many dental clinics. Some major disadvantages of base metals are their corrosion and the dark coloration they may cause at the crown margins. This article describes a galvanic gold-plating technique, which is used to minimize corrosion and improve the esthetics of metal ceramic restorations fabricated with Cr-Co base metal alloys. This technique involves the deposition of a 6 μm to 8 μm 24 K gold layer directly onto the Cr-Co cast prosthesis framework. The technique improves metal surface properties, making them more biocompatible and usable, however, requires additional equipment and experienced laboratory technicians. Clinical studies should be performed to corroborate the long term success of this technique.

  18. Galvanic Liquid Applied Coating System for Protection of Embedded Steel Surfaces from Corrosion

    NASA Technical Reports Server (NTRS)

    Curran, Joseph; MacDowell, Louis; Voska, N. (Technical Monitor)


    The corrosion of reinforcing steel in concrete is an insidious problem for the Kennedy Space Center, government agencies, and the general public. Existing corrosion protection systems on the market are costly, complex, and time-consuming to install, require continuous maintenance and monitoring, and require specialized skills for installation. NASA's galvanic liquid-applied coating offers companies the ability to conveniently protect embedded steel rebar surfaces from corrosion. Liquid-applied inorganic galvanic coating contains one ore more of the following metallic particles: magnesium, zinc, or indium and may contain moisture attracting compounds that facilitate the protection process. The coating is applied to the outer surface of reinforced concrete so that electrical current is established between metallic particles and surfaces of embedded steel rebar; and electric (ionic) current is responsible for providing the necessary cathodic protection for embedded rebar surfaces.

  19. Epidermal Rac1 regulates the DNA damage response and protects from UV-light-induced keratinocyte apoptosis and skin carcinogenesis.


    Deshmukh, Jayesh; Pofahl, Ruth; Haase, Ingo


    Non-melanoma skin cancer (NMSC) is the most common type of cancer. Increased expression and activity of Rac1, a small Rho GTPase, has been shown previously in NMSC and other human cancers; suggesting that Rac1 may function as an oncogene in skin. DMBA/TPA skin carcinogenesis studies in mice have shown that Rac1 is required for chemically induced skin papilloma formation. However, UVB radiation by the sun, which causes DNA damage, is the most relevant cause for NMSC. A potential role of Rac1 in UV-light-induced skin carcinogenesis has not been investigated so far. To investigate this, we irradiated mice with epidermal Rac1 deficiency (Rac1-EKO) and their controls using a well-established protocol for long-term UV-irradiation. Most of the Rac1-EKO mice developed severe skin erosions upon long-term UV-irradiation, unlike their controls. These skin erosions in Rac1-EKO mice healed subsequently. Surprisingly, we observed development of squamous cell carcinomas (SCCs) within the UV-irradiation fields. This shows that the presence of Rac1 in the epidermis protects from UV-light-induced skin carcinogenesis. Short-term UV-irradiation experiments revealed increased UV-light-induced apoptosis of Rac1-deficient epidermal keratinocytes in vitro as well as in vivo. Further investigations using cyclobutane pyrimidine dimer photolyase transgenic mice revealed that the observed increase in UV-light-induced keratinocyte apoptosis in Rac1-EKO mice is DNA damage dependent and correlates with caspase-8 activation. Furthermore, Rac1-deficient keratinocytes showed reduced levels of p53, γ-H2AX and p-Chk1 suggesting an attenuated DNA damage response upon UV-irradiation. Taken together, our data provide direct evidence for a protective role of Rac1 in UV-light-induced skin carcinogenesis and keratinocyte apoptosis probably through regulating mechanisms of the DNA damage response and repair pathways.

  20. Skin-colour changes i the lizard, Anolis carolinensis, in response to localized electrical stimulation and lesions in the diencephalon.


    Hemer, J H; Salas, M A; LaPointe, J L


    A study was made of changes in skin colour in the lizard, Anolis carolinensis, in response to deep electrical stimulation at 0.2 mm intervals throughout the periventricular region of the diencephalon and the anterior brain stem. Double-barrelled glass microelectrodes with tip diameters of 3 microns were used. A 20 microA pulse-train consisting of a 500 Hz signal lasting for 1 s yielded localized responses. Skin darkening occurred only in response to stimulation delivered in the anterior and dorsal region of the diencephalon and skin lightening only in response to stimulation in a small area in the posterior and ventral region of the hypothalamus. Electrical lesions in the latter region resulted in permanent skin darkening. Surgical interruption of the hypothalamo-hypophysial neurosecretory tract did not block skin-colour change in response to dark or light backgrounds. It was concluded that MSH release is under tonic inhibitory control by hypothalamic neurones in Anolis. Both inhibitory and stimulatory neurones can be localized stereotaxically in the diencephalon and neither type corresponds with the neurosecretory neurones of the hypothalamo-hypophysial tract. The functional relationship between the stimulatory neurones and the inhibitory neurones and pars intermedia remains unclear.

  1. Accuracy and response time comparisons of four skin temperature-monitoring devices.


    Krause, B F


    Although technological improvements in skin surface temperature-measurement devices have progressed since they were first used clinically, the question of their accuracy and reliability for skin temperature monitoring still remains. The purpose of this study was to compare the accuracy and response time to temperature change for four temperature-monitoring devices: liquid crystal (Crystaline ST, Sharn, Inc, Tampa, Fla), two different thermistor sensors (RSP, Respiratory Support Products, Inc, Irvine, Calif, and SHER-I-TEMP, Sheridan Catheter Corp, Argyle, NY), and one thermocouple-based temperature sensor (Mon-a-therm, Mallinckrodt, Inc, St. Louis, Mo). A temperature-controlled steel surface plate was used as the reference temperature source for test comparisons. The results showed that Crystaline ST (liquid crystal device) performed better in the accuracy and response time tests than the electronic thermistor and thermocouple temperature-sensor devices tested. Regression analysis of the reference temperature comparisons showed that although all four devices had high correlation coefficients Crystaline ST had the highest correlation (R = 0.99685). Also, the regression equation for Crystaline ST was closest to a perfect fit with reference temperatures, ie, slope = 1.00267 and intercept = 0.20333 (P = .0000). Crystaline ST responded consistently faster than the other devices for each change in temperature setting (5, 10, 15, and 20 degrees F). Crystaline ST responded within 3.5 to 4.4 seconds for every temperature gradient change tested. All three of the other sensor devices had increasingly longer response times as the temperature gradient increased.(ABSTRACT TRUNCATED AT 250 WORDS)

  2. Impaired Leukocyte Trafficking and Skin Inflammatory Responses in Hamsters Lacking a Functional Circadian System

    PubMed Central

    Prendergast, Brian J.; Cable, Erin J.; Patel, Priyesh N.; Pyter, Leah M.; Onishi, Kenneth G.; Stevenson, Tyler J.; Ruby, Norman F.; Bradley, Sean P.


    The immune system is under strong circadian control, and circadian desynchrony is a risk factor for metabolic disorders, inflammatory responses and cancer. Signaling pathways that maintain circadian rhythms (CRs) in immune function in vivo, and the mechanisms by which circadian desynchrony impairs immune function, remain to be fully-identified. These experiments tested the hypothesis that the hypothalamic circadian pacemaker in the suprachiasmatic nucleus (SCN) drives CRs in the immune system, using a non-invasive model of SCN circadian arrhythmia. Robust CRs in blood leukocyte trafficking, with a peak during the early light phase (ZT4) and nadir in the early dark phase (ZT18), were absent in arrhythmic hamsters, as were CRs in spleen clock gene (per1, bmal1) expression, indicating that a functional pacemaker in the SCN is required for the generation of CRs in leukocyte trafficking and for driving peripheral clocks in secondary lymphoid organs. Pinealectomy was without effect on CRs in leukocyte trafficking, but abolished CRs in spleen clock gene expression, indicating that nocturnal melatonin secretion is necessary for communicating circadian time information to the spleen. CRs in trafficking of antigen presenting cells (CD11c+ dendritic cells) in the skin were abolished, and antigen-specific delayed-type hypersensitivity skin inflammatory responses were markedly impaired in arrhythmic hamsters. The SCN drives robust CRs in leukocyte trafficking and lymphoid clock gene expression; the latter of which is not expressed in the absence of melatonin. Robust entrainment of the circadian pacemaker provides a signal critical to diurnal rhythms in immunosurveilliance and optimal memory T-cell dependent immune responses. PMID:23474187

  3. Assessing the sensitivity of human skin hyperspectral responses to increasing anemia severity levels

    NASA Astrophysics Data System (ADS)

    Baranoski, Gladimir V. G.; Dey, Ankita; Chen, Tenn F.


    Anemia is a prevalent medical condition that seriously affects millions of people all over the world. In many regions, not only its initial detection but also its monitoring are hindered by limited access to laboratory facilities. This situation has motivated the development of a wide range of optical devices and procedures to assist physicians in these tasks. Although noticeable progress has been achieved in this area, the search for reliable, low-cost, and risk-free solutions still continues, and the strengthening of the knowledge base about this disorder and its effects is essential for the success of these initiatives. We contribute to these efforts by closely examining the sensitivity of human skin hyperspectral responses (within and outside the visible region of the light spectrum) to reduced hemoglobin concentrations associated with increasing anemia severity levels. This investigation, which involves skin specimens with distinct biophysical and morphological characteristics, is supported by controlled in silico experiments performed using a predictive light transport model and measured data reported in the biomedical literature. We also propose a noninvasive procedure to be employed in the monitoring of this condition at the point-of-care.

  4. Oppositionality and sympathetic skin response in adolescents: specific associations with the headstrong/hurtful dimension.


    Silva, Nanucha Teixeira da; Schestatsky, Pedro; Winckler, Pablo Brea; Salum, Giovanni Abrahão; Petroceli, Alana Wypyszynski; Heldt, Elizeth Paz da Silva


    Oppositionality encompasses distinct dimensions, and few studies have investigated the validity of such distinctions from a pathophysiological perspective. Our aim was to investigate the association between sympathetic skin responses (SSR) and distinct oppositional dimensions in a community sample of adolescents. Forty adolescents aged 13.84±1.46 years participated in this study. Oppositionality was measured by externalizing behavior and bullying scores (dependent variables), while SSR was recorded by electrical changes at the skin level (independent variables). Results showed that increased SSRs were associated with oppositionality; however, these associations were specific to the headstrong/hurtful dimension. Further exploratory analyses demonstrated that increased SSRs were associated with several types of headstrong/hurtful behaviors and underscore the importance of the first aversive stimuli to differentiate groups with low and high headstrong/hurtful behaviors. There were no differences between groups regarding time until habituation. This study provides insights about how dysfunctions in autonomic balance may contribute to the emergence of oppositional behavior among adolescents.

  5. Imaging immune response of skin mast cells in vivo with two-photon microscopy

    NASA Astrophysics Data System (ADS)

    Li, Chunqiang; Pastila, Riikka K.; Lin, Charles P.


    Intravital multiphoton microscopy has provided insightful information of the dynamic process of immune cells in vivo. However, the use of exogenous labeling agents limits its applications. There is no method to perform functional imaging of mast cells, a population of innate tissue-resident immune cells. Mast cells are widely recognized as the effector cells in allergy. Recently their roles as immunoregulatory cells in certain innate and adaptive immune responses are being actively investigated. Here we report in vivo mouse skin mast cells imaging with two-photon microscopy using endogenous tryptophan as the fluorophore. We studied the following processes. 1) Mast cells degranulation, the first step in the mast cell activation process in which the granules are released into peripheral tissue to trigger downstream reactions. 2) Mast cell reconstitution, a procedure commonly used to study mast cells functioning by comparing the data from wild type mice, mast cell-deficient mice, and mast-cell deficient mice reconstituted with bone marrow-derived mast cells (BMMCs). Imaging the BMMCs engraftment in tissue reveals the mast cells development and the efficiency of BMMCs reconstitution. We observed the reconstitution process for 6 weeks in the ear skin of mast cell-deficient Kit wsh/ w-sh mice by two-photon imaging. Our finding is the first instance of imaging mast cells in vivo with endogenous contrast.

  6. Porcine skin thermal response to near-IR lasers using a fast infrared camera

    NASA Astrophysics Data System (ADS)

    Cain, Clarence; Milner, Thomas; Telenkov, Sergey; Schuster, Kurt; Stockton, Kevin; Stolarski, David; Condit, Chris; Rockwell, Benjamin A.; Roach, William P.; Welch, A. J.


    We have measured the Minimum Visible Lesion (MVL) thresholds for porcine skin and determined the ED50 for exposures at 1314 nm and 0.35 ms laser pulses. An in-vivo pigmented animal model, Yucatan mini-pig (Sus scrofa domestica), was used in this study. We also have measured the thermal response using a high-speed Infrared camera for single pulse temperature recordings for Gaussian beams of 1 mm diameter. Several 2-D measurements of temperature as a function of time were made with an IR array detector thermal camera using a sampling rate of 100 frames per second. In Vitro samples of the same pig skin were used for measurements of the optical properties (absorption coefficient, μa, and reduced scattering coefficient μs) as a function of wavelength around 1315 nm wavelength. A measured surface temperature distribution for one IR laser pulse of 0.37J at a spot size of 1.2 mm diameter gave approximately a 43° C rise at a hot spot. Temperature distributions as a function of time and space will be presented and compared with the measured thresholds.

  7. Response of human skin to ultraviolet radiation: dissociation of erythema and metabolic changes following sunscreen protection

    SciTech Connect

    Pearse, A.D.; Marks, R.


    After UV irradiation of human skin there is an increase in epidermal and stratum corneum thickness and an increase in the thymidine autoradiographic labeling index. Previously we have demonstrated that persistent exposure to ultraviolet radiation (UVR) alters the distribution and activities of glucose-6-phosphate dehydrogenase (G-6-PDH) and succinic dehydrogenase (SDH) within the epidermis; G-6-PDH activity is increased over the whole epidermis and SDH activity is diminished in the granular cell area but increased in the basal layer. When skin is protected by an efficient sunscreen and irradiated with UVB, there is almost complete inhibition of the erythema normally seen following UVR exposure. In this study we have investigated the cytochemical, cell kinetic, and histometric changes that take place in the epidermis after UVB irradiation, with and without two different types of sunscreen. Some of the histometric and metabolic changes associated with UVB exposure were still evident despite sunscreen protection and the successful blocking of the erythema response. The implications of these findings are discussed together with the use of sunscreens to prevent development of solar damage.

  8. Event-related skin conductance responses to musical emotions in humans.


    Khalfa, Stéphanie; Isabelle, Peretz; Jean-Pierre, Blondin; Manon, Robert


    While the reasons underlying musical emotions are unclear, music is nevertheless a powerful elicitor of emotion, and as such, may induce autonomic nervous system responses. One typical measure of this neural pathway is the skin conductance response (SCR). This response generally depends upon stimulus arousal, one of the two motivational determinants of emotion. The objective of the present study was to verify whether emotional reactions to music elicit such event-related autonomic responses. To this aim, four musical emotions varying in arousal were employed: fear, happiness, sadness and peacefulness. SCRs were found to be greater with the two more stimulating emotions, fear and happiness, as compared to the two more relaxing emotions, sadness and peacefulness (P<0.05). In addition, subjects' ratings of the emotional clarity for each excerpt did not parallel the corresponding SCRs magnitudes. The results show that SCRs can be evoked and modulated by musical emotional arousal, but are not sensitive to emotional clarity. While several studies have been performed with visual scenes and environmental sounds, the present study brings similar evidence from the musical domain.

  9. Are we afraid of different categories of stimuli in identical ways? Evidence from skin conductance responses.


    Tan, Tengteng; Li, Han; Wang, Yingying; Yang, Jiongjiong


    Studies have shown that emotional pictures attract more attention than neutral pictures, and pictures of living stimuli have similar advantage in driving attention (vs. nonliving). However, factors of emotion, category and picture context are usually mixed so that whether living and nonliving categories elicit different skin conductance (SC) responses, in both conscious and unconscious conditions, remains to be clarified. In this study, participants were presented with negative and neutral pictures denoting different living and nonliving concepts in conscious (Experiments 1 and 2) and unconscious conditions (40ms, Experiment 3) when their SC responses were measured. The picture context was manipulated in Experiments 2 and 3 as half including human-related information. In three experiments, the emotional levels of different categories were matched in different and identical cohorts of participants. The results showed that living pictures in a negative, high-arousing dimension elicited stronger SC responses than nonliving pictures. When nonhuman animals and inanimate objects were compared, the increased SC responses to animals was obtained only for negative pictures without human contexts in the conscious condition, but regardless of human context in the unconscious condition. These results suggested that contextual information and level of conscious awareness are important to modulate the animate advantage in emotional processing.

  10. Iron serves as diffusion barrier in thermally regenerative galvanic cell

    NASA Technical Reports Server (NTRS)

    Crouthamel, C. E.


    Pure iron or iron-coated diaphragm provides a hydrogen diffusion electrode for a thermally regenerative galvanic cell. It allows the gas to diffuse through its interatomic spaces and resists the corrosive action of the cell environment.

  11. 76 FR 21914 - Galvanized Steel Wire From China and Mexico

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... From the Federal Register Online via the Government Publishing Office INTERNATIONAL TRADE COMMISSION Galvanized Steel Wire From China and Mexico AGENCY: United States International Trade Commission. ACTION: Revised schedule for the subject antidumping and countervailing duty investigations....

  12. Technical report on galvanic cells with fused-salt electrolytes

    NASA Technical Reports Server (NTRS)

    Cairns, E. J.; Crouthamel, C. E.; Fischer, A. K.; Foster, M. S.; Hesson, J. C.; Johnson, C. E.; Shimotake, H.; Tevebaugh, A. D.


    Technical report is presented on sodium and lithium cells using fused salt electrolytes. It includes a discussion of the thermally regenerative galvanic cell and the secondary bimetallic cell for storage of electricity.

  13. 1. Elkmont vehicle bridge at Elkmont Campground, galvanized corrugated arch. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1. Elkmont vehicle bridge at Elkmont Campground, galvanized corrugated arch. - Great Smoky Mountains National Park Roads & Bridges, Elkmont Vehicle Bridge, Spanning Little River at Elkmont Campground, Gatlinburg, Sevier County, TN

  14. A rare subset of skin-tropic regulatory T cells expressing Il10/Gzmb inhibits the cutaneous immune response

    PubMed Central

    Ikebuchi, Ryoyo; Teraguchi, Shunsuke; Vandenbon, Alexis; Honda, Tetsuya; Shand, Francis H. W.; Nakanishi, Yasutaka; Watanabe, Takeshi; Tomura, Michio


    Foxp3+ regulatory T cells (Tregs) migrating from the skin to the draining lymph node (dLN) have a strong immunosuppressive effect on the cutaneous immune response. However, the subpopulations responsible for their inhibitory function remain unclear. We investigated single-cell gene expression heterogeneity in Tregs from the dLN of inflamed skin in a contact hypersensitivity model. The immunosuppressive genes Ctla4 and Tgfb1 were expressed in the majority of Tregs. Although Il10-expressing Tregs were rare, unexpectedly, the majority of Il10-expressing Tregs co-expressed Gzmb and displayed Th1-skewing. Single-cell profiling revealed that CD43+ CCR5+ Tregs represented the main subset within the Il10/Gzmb-expressing cell population in the dLN. Moreover, CD43+ CCR5+ CXCR3− Tregs expressed skin-tropic chemokine receptors, were preferentially retained in inflamed skin and downregulated the cutaneous immune response. The identification of a rare Treg subset co-expressing multiple immunosuppressive molecules and having tissue-remaining capacity offers a novel strategy for the control of skin inflammatory responses. PMID:27756896

  15. Histamine response and local cooling in the human skin: involvement of H1- and H2-receptors

    PubMed Central

    Grossmann, M; Jamieson, M J; Kirch, W


    Aims Histamine may contribute locally to cutaneous blood flow control under normal and pathologic conditions. The objective of this study was to observe the influence of skin temperature on histamine vasodilation, and the roles of H1-and H2-receptors using novel noninvasive methods. Methods Eleven healthy subjects received, double-blind, single doses of the H1-receptor antagonist cetirizine (10 mg), cetirizine (10 mg) plus the H2-receptor antagonist cimetidine (400 mg), or placebo on separate occasions. Histamine was dosed cumulatively by iontophoresis to the forearm skin at 34° C and 14° C. Laser-Doppler flux (LDF) was measured at the same sites using customised probeholder/iontophoretic chambers with Peltier cooling elements. Finger mean arterial pressure (MAP) was measured and cutaneous vascular conductance calculated as LDF/MAP. Results Histamine vasodilation was reduced in cold skin. Cetirizine shifted the histamine dose-response at both temperatures: statistically significantly at 14° C only. Combined H1- and H2-receptor antagonism shifted the response significantly at both temperatures. Conclusions H1- and H2-receptors mediate histamine-induced skin vasodilation. The sensitivity of these receptors, particularly the H1- receptor, is attenuated at low skin temperature. Whether the reduced effect in cold skin represents specific receptor or postreceptor desensitization, or nonspecific attenuation of cutaneous vasodilation remains to be elucidated. PMID:10417499

  16. Gua Sha, a press-stroke treatment of the skin, boosts the immune response to intradermal vaccination

    PubMed Central

    Liu, Jinxuan; Zhang, Xiaoying; Huang, Zhen; Zang, Yuhui; Chen, Jiangning; Dong, Lei


    Objective The skin is an important immunological barrier of the body as well as an optimal route for vaccine administration. Gua Sha, which involves press-stroke treatment of the skin, is an effective folk therapy, widely accepted in East Asia, for various symptoms; however, the mechanisms underlying its therapeutic effects have not been clarified. We investigated the influence of Gua Sha on the immunological features of the skin. Methods Gua Sha was performed on BALB/c mice and the effects were evaluated using anatomical, histological, and cytometric methods as well as cytokine determination locally and systemically. The effect on intradermal vaccination was assessed with antigen-specific subtype antibody responses. Results Blood vessel expansion, erythrocyte extravasation, and increased ratios of immune active cells were observed in the skin tissue following the treatment. Pro-inflammatory cytokines were up-regulated, and immunosuppressive cytokines, down-regulated, in the treated and untreated skin and systemic circulation; no obvious variations were detected in case of anti-inflammatory cytokines. Interestingly, intradermal delivery of a model vaccine following Gua Sha induced about three-fold higher IgG titers with a more Th1-biased antibody subtype profile. Conclusion Gua Sha treatment can up-regulate the innate and adaptive immune functions of the skin and boost the response against intradermal antigens. Thus, Gua Sha may serve as a safe, inexpensive, and independent physical adjuvant for intradermal vaccination. PMID:27672506

  17. Polyfibroblast: A Self-Healing and Galvanic Protection Additive

    DTIC Science & Technology


    self-healing and galvanic protection capacity to the primer (Figure 1). Polyfibroblast consists of paint-filled microcapsules and zinc powder. It has...significant added cost. Microcapsule Figure 1. Polyfibroblast contains fresh paint encapsulated in polymer shells plus Zn powder. When scratched, resin...from the broken microcapsules fills the crack to form a polymer scar. Zn powder supplies galvanic protection in the event of incomplete healing

  18. Analysis of skin conductance response during evaluation of preferences for cosmetic products

    PubMed Central

    Ohira, Hideki; Hirao, Naoyasu


    We analyzed skin conductance response (SCR) as a psychophysiological index to evaluate affective aspects of consumer preferences for cosmetic products. To examine the test-retest reliability of association between preferences and SCR, we asked 33 female volunteers to complete two experimental sessions approximately 1 year apart. The participants indicated their preferences in a typical paired comparison task by choosing the better option from a combination of two products among four products. We measured anticipatory SCR prior to expressions of the preferences. We found that the mean amplitude of the SCR elicited by the preferred products was significantly larger than that elicited by the non-preferred products. The participants' preferences and corresponding SCR patterns were well preserved at the second session 1 year later. Our results supported cumulating findings that SCR is a useful index of consumer preferences that has future potential, both in laboratory and marketing settings. PMID:25709593

  19. Analysis of skin conductance response during evaluation of preferences for cosmetic products.


    Ohira, Hideki; Hirao, Naoyasu


    We analyzed skin conductance response (SCR) as a psychophysiological index to evaluate affective aspects of consumer preferences for cosmetic products. To examine the test-retest reliability of association between preferences and SCR, we asked 33 female volunteers to complete two experimental sessions approximately 1 year apart. The participants indicated their preferences in a typical paired comparison task by choosing the better option from a combination of two products among four products. We measured anticipatory SCR prior to expressions of the preferences. We found that the mean amplitude of the SCR elicited by the preferred products was significantly larger than that elicited by the non-preferred products. The participants' preferences and corresponding SCR patterns were well preserved at the second session 1 year later. Our results supported cumulating findings that SCR is a useful index of consumer preferences that has future potential, both in laboratory and marketing settings.

  20. The role of cardiac sympathetic innervation and skin thermoreceptors on cardiac responses during heat stress

    PubMed Central

    Umemoto, Yasunori; Kinoshita, Tokio; Kouda, Ken; Ito, Tomoyuki; Nakamura, Takeshi; Crandall, Craig G.; Tajima, Fumihiro


    The mechanism(s) for the changes in cardiac function during heat stress remain unknown. This study tested two unique hypotheses. First, sympathetic innervation to the heart is required for increases in cardiac systolic function during heat stress. This was accomplished by comparing responses during heat stress between paraplegics versus tetraplegics, with tetraplegics having reduced/absent cardiac sympathetic innervation. Second, stimulation of skin thermoreceptors contributes to cardiovascular adjustments that occur during heat stress in humans. This was accomplished by comparing responses during leg only heating between paraplegic versus able-bodied individuals. Nine healthy able-bodied, nine paraplegics, and eight tetraplegics participated in this study. Lower body (i.e., nonsensed area for para/tetraplegics) was heated until esophageal temperature had increased by ∼1.0°C. Echocardiographic indexes of diastolic and systolic function were performed before and at the end of heat stress. The heat stress increased cardiac output in all groups, but the magnitude of this increase was attenuated in the tetraplegics relative to the able-bodied (1.3 ± 0.4 vs. 2.3 ± 1.0 l/min; P < 0.05). Diastolic function was maintained in all groups. Indexes of left atrial and ventricular systolic function were enhanced in the able-bodied, but did not change in tetraplegics, while these changes in paraplegics were attenuated relative to the able-bodied. These data suggest that the cardiac sympathetic innervation is required to achieve normal increases in cardiac systolic function during heat stress but not required to maintain diastolic function during this exposure. Second, elevated systolic function during heat stress primarily occurs as a result of increases in internal temperature, although stimulation of skin thermoreceptors may contribute. PMID:25795714

  1. Differential cytokine response in interstitial fluid in skin and serum during experimental inflammation in rats

    PubMed Central

    Nedrebø, Torbjørn; Reed, Rolf K; Jonsson, Roland; Berg, Ansgar; Wiig, Helge


    Tumour necrosis factor-α (TNF-α) and interleukin-1β (IL-1β) are important mediators produced during inflammation. We hypothesized that the pro-inflammatory cytokine response in the interstitial fluid (IF) is different from that in serum, and we aimed at quantifying the amount of TNF-α and IL-1β in the IF. By centrifugation of rat skin at < 424 g pure IF is extracted. Using ELISA such fluid was analysed for cytokines in back and/or paw skin of pentobarbital-anaesthetized rats, after either induction of endotoxaemia or ischaemia–reperfusion (I/R) injury. During endotoxaemia, TNF-α increased in the IF from 0 in control to 640 ± 100 pg ml−1 (mean ±s.e.m.) after 90 min, with the serum concentration being 5–10 times higher at all time points. The response pattern of IL-1β after lipopolysaccharide (LPS) challenge differed greatly from that of TNF-α with a large increase in IF from 390 ± 90 to 28 000 ± 1500 pg ml−1 after 210 min, and a significantly smaller increase in serum (600 ± 45 pg ml−1). During reperfusion of the hind paw after 2 h of ischaemia, there was a gradual increase of TNF-α in both IF of the paw skin and serum after 3 min of reperfusion. Both declined after 20 min. The pattern for IL-1β differed, increasing significantly less in serum (25 ± 15 pg ml−1 after 20 min of reperfusion) than in the IF (1100 ± 200 pg ml−1). Immunostaining of the inflamed tissues showed increased expression of the two cytokines in cells of both epidermis and dermis compared to controls. Subdermal injections of TNF-α and IL-1β at the same concentrations found in IF after LPS infusion affected interstitial fluid pressure significantly. Local TNF-α production dominates after I/R injury, whereas in endotoxaemia systemic production predominates. For IL-1β local production dominates in both conditions. Thus, there is a differential pattern of cytokine production and the current method allows the study of the role of cytokines in IF during different

  2. Local Antiglycan Antibody Responses to Skin Stage and Migratory Schistosomula of Schistosoma japonicum

    PubMed Central

    Smit, Cornelis H.; Kies, Christiaan L.; McWilliam, Hamish E. G.; Meeusen, Els N. T.; Hokke, Cornelis H.


    Schistosomiasis is a tropical disease affecting over 230 million people worldwide. Although effective drug treatment is available, reinfections are common, and development of immunity is slow. Most antibodies raised during schistosome infection are directed against glycans, some of which are thought to be protective. Developing schistosomula are considered most vulnerable to immune attack, and better understanding of local antibody responses raised against glycans expressed by this life stage might reveal possible glycan vaccine candidates for future vaccine research. We used antibody-secreting cell (ASC) probes to characterize local antiglycan antibody responses against migrating Schistosoma japonicum schistosomula in different tissues of rats. Analysis by shotgun Schistosoma glycan microarray resulted in the identification of antiglycan antibody response patterns that reflected the migratory pathway of schistosomula. Antibodies raised by skin lymph node (LN) ASC probes mainly targeted N-glycans with terminal mannose residues, Galβ1-4GlcNAc (LacNAc) and Galβ1-4(Fucα1-3)GlcNAc (LeX). Also, responses to antigenic and schistosome-specific glycosphingolipid (GSL) glycans containing highly fucosylated GalNAcβ1-4(GlcNAcβ1)n stretches that are believed to be present at the parasite's surface constitutively upon transformation were found. Antibody targets recognized by lung LN ASC probes were mainly N-glycans presenting GalNAcβ1-4GlcNAc (LDN) and GlcNAc motifs. Surprisingly, antibodies against highly antigenic multifucosylated motifs of GSL glycans were not observed in lung LN ASC probes, indicating that these antigens are not expressed in lung stage schistosomula or are not appropriately exposed to induce immune responses locally. The local antiglycan responses observed in this study highlight the stage- and tissue-specific expression of antigenic parasite glycans and provide insights into glycan targets possibly involved in resistance to S. japonicum infection

  3. Comparison of skin sympathetic nerve responses to isometric arm and leg exercise.


    Ray, Chester A; Wilson, Thad E


    Measurement of skin sympathetic nerve activity (SSNA) during isometric exercise has been previously limited to handgrip. We hypothesized that isometric leg exercise due to the greater muscle mass of the leg would elicit greater SSNA responses than arm exercise because of presumably greater central command and muscle mechanoreceptor activation. To compare the effect of isometric arm and leg exercise on SSNA and cutaneous end-organ responses, 10 subjects performed 2 min of isometric knee extension (IKE) and handgrip (IHG) at 30% of maximal voluntary contraction followed by 2 min of postexercise muscle ischemia (PEMI) in a normothermic environment. SSNA was recorded from the peroneal nerve. Cutaneous vascular conductance (laser-Doppler flux/mean arterial pressure) and electrodermal activity were measured within the field of cutaneous afferent discharge. Heart rate and mean arterial pressure significantly increased by 16 +/- 3 and 23 +/- 3 beats/min and by 22 +/- 2 and 27 +/- 3 mmHg from baseline during IHG and IKE, respectively. Heart rate and mean arterial pressure responses were significantly greater during IKE compared with IHG. SSNA increased significantly and comparably during IHG and IKE (52 +/- 20 and 50 +/- 13%, respectively). During PEMI, SSNA and heart rate returned to baseline, whereas mean arterial pressure remained significantly elevated (Delta12 +/- 2 and Delta13 +/- 2 mmHg from baseline for IHG and IKE, respectively). Neither cutaneous vascular conductance nor electrodermal activity was significantly altered by either exercise or PEMI. These results indicate that, despite cardiovascular differences in response to IHG and IKE, SSNA responses are similar at the same exercise intensity. Therefore, the findings suggest that relative effort and not muscle mass is the main determinant of exercise-induced SSNA responses in humans.

  4. Responses of black and white skin to solar-simulating radiation: differences in DNA photodamage, infiltrating neutrophils, proteolytic enzymes induced, keratinocyte activation, and IL-10 expression.


    Rijken, Feiko; Bruijnzeel, Piet L B; van Weelden, Huib; Kiekens, Rebecca C M


    Black skin is more resistant to the deleterious effects of ultraviolet radiation than white skin. A higher melanin content and a different melanosomal dispersion pattern in the epidermis are thought to be responsible for this. Our purpose was to compare skin responses in black and white skin following exposure to solar-simulating radiation (SSR) to further investigate the photoprotective properties of black skin. Six volunteers of skin phototype I-III (white) were exposed to (doses measured directly with a Waldmann UV detector device) 12,000-18,000 mJ per cm2 (2 MED) of SSR and compared with six volunteers of skin phototype VI (black) exposed to 18,000 mJ per cm2 (<1 MED) of SSR. The presence and distribution of skin pigment, DNA photodamage, infiltrating neutrophils, photoaging associated proteolytic enzymes, keratinocyte activation, and the source of interleukin 10 (IL-10) in skin biopsies taken before and after exposure were studied. In all white skinned subjects, 12,000-18,000 mJ per cm2 of SSR induced DNA damage in epidermal and dermal cells, an influx of neutrophils, active proteolytic enzymes, and diffuse keratinocyte activation. Additionally, in three of the white skinned volunteers IL-10 positive neutrophils were found to infiltrate the epidermis. Except for DNA damage in the supra basal epidermis, none of these changes was found in black skinned subjects. Increased skin pigmentation appears to be primarily responsible for the observed differences in skin responses. Our data could provide an explanation as to why black skin is less susceptible to sunburn, photoaging, and skin carcinogenesis.

  5. The effect of mother-infant skin-to-skin contact on infants' response to the Still Face Task from newborn to three months of age.


    Bigelow, Ann E; Power, Michelle


    The effect of mother-infant skin-to-skin contact on infants' developing social expectations for maternal behavior was investigated longitudinally over infants' first 3 months. Infants with and without skin-to-skin contact engaged with their mothers in the Still Face Task at ages 1 week, 1 month, 2 months, and 3 months. Infants with skin-to-skin contact began responding to changes in their mothers' behavior with their affect at 1 month; infants without skin-to-skin contact did so at 2 months. At 3 months, infants with skin-to-skin contact increased their non-distress vocalizations during the still face phase, suggesting social bidding to their mothers. Skin-to-skin contact accelerated infants' social expectations for their mothers' behavior and enhanced infants' awareness of themselves as active agents in social interactions.

  6. Inclusion of Height and Limb Length when Interpreting Sympathetic Skin Response

    PubMed Central

    Emad, Mohamadreza; Roshanzamir, Sharareh; Dabbaghmanesh, Alireza; Ghasempoor, Mohsen Zafar; Eivazlou, Heidar


    It is more than a decade since scientists are making use of sympathetic skin response (SSR) as a clinical and research method to evaluate sympathetic nervous system. A major portion of the efferent pathway of this response is composed of non-myelinated nerves. Thus, the latency of the response may be significantly different in normal individuals with different height and limb lengths. This study was designed to investigate the effect of these parameters on the SSR results. We measured the height and limb length of 65 normal individuals with different heights (divided into 3 groups of height ≤150 cm, 150-170 cm, and ≥170 cm). The participants had neither peripheral nor central neuropathy. They also had none of the exclusion criteria. Then, they underwent SSR testing of both palms and soles. The correlation between the height and limb length in relation to SSR parameters (latency and amplitude) was analyzed statistically by Pearson’s correlation. No significant correlation was detected between the height and limb length and the SSR amplitude. However, the results showed significant correlation between SSR latency recorded from all four sites (both palms and soles) and the height of participants. Furthermore, there was a significant correlation between SSR latency recorded from any limb and the length of that limb. Regarding the significant effect of the height and limb length on the SSR latency, both the height and limb length should be considered when interpreting the results of SSR. PMID:26722145

  7. Sympathetic skin responses from the scalp evoked by electrical stimulation in seborrheic dermatitis.


    Altunrende, Burcu; Yildiz, Serpil; Kandi, Basak; Yildiz, Nebil


    Although the role of autonomic nervous system in seborrheic dermatitis (SD) is still unclear, seborrhea is sometimes accepted as a sign of autonomic dysfunction in several nervous system diseases. Therefore, we aimed to investigate the sympathetic nervous system (SNS) activity in SD by recording sympathetic skin responses (SSR) from the scalp (S-SSR). Thirty-one control subjects and 22 SD patients were studied by evoking right and left S-SSR with electrical stimulation of the right median nerve at the wrist. Mean latencies and maximum amplitudes were calculated for both sides in each group. In seven out of 31 control subjects and in 13 out of 22 patients, the S-SSR could not be elicited on either side. There were four subjects with unilateral response in the patient group. There were significantly more non-responders among the patients with SD (P < 0.000). This study suggests that in SD, the autonomic nervous system may be involved. The S-SSR is a new site for recording SSR. The responses are relatively symmetrical and can be evoked easily by electrical stimulation, and may be used to evaluate the SNS function in SD patients and also in healthy subjects.

  8. Topical anaesthesia does not affect cutaneous vasomotor or sudomotor responses in human skin.


    Metzler-Wilson, K; Wilson, T E


    (1) The effects of local sensory blockade (topical anaesthesia) on eccrine sweat glands and cutaneous circulation are not well understood. This study aimed to determine whether topical lidocaine/prilocaine alters eccrine sweat gland and cutaneous blood vessel responses. (2) Sweating (capacitance hygrometry) was induced via forearm intradermal microdialysis of five acetylcholine (ACh) doses (1 × 10(-4) to 1 × 10(0) m, 10-fold increments) in control and treated forearm sites in six healthy subjects. Nitric oxide-mediated vasodilatory (sodium nitroprusside) and adrenergic vasoconstrictor (noradrenaline) agonists were iontophoresed in lidocaine/prilocaine-treated and control forearm skin in nine healthy subjects during blood flow assessment (laser Doppler flowmetry, expressed as% from baseline cutaneous vascular conductance; CVC; flux/mean arterial pressure). (3) Non-linear regression curve fitting identified no change in the ED50 of ACh-induced sweating after sensory blockade (-1.42 ± 0.23 logM) compared to control (-1.27 ± 0.23 logM; P > .05) or in Emax (0.43 ± 0.08 with, 0.53 ± 0.16 mg cm(-2) min(-1) without lidocaine/prilocaine; P > .05). Sensory blockade did not alter the vasodilator response to sodium nitroprusside (1280 ± 548% change from baseline CVC with, 1204 ± 247% without lidocaine/prilocaine) or vasoconstrictor response to noradrenaline (-14 ± 4% change from baseline CVC with, -22 ± 14% without lidocaine/prilocaine; P > 0.05). (4) Cutaneous sensory blockade does not appear to alter nitric oxide-mediated vasodilation, adrenergic vasoconstriction, or cholinergic eccrine sweating dose-response sensitivity or responsiveness to maximal dose. Thus, lidocaine/prilocaine treatment should not affect sweat gland function or have blood flow implications for subsequent research protocols or clinical procedures.

  9. Galvanic Corrosion of Coated Al Alloy Panels with More Noble Fasteners

    NASA Astrophysics Data System (ADS)

    Feng, Zhicao

    A test sample incorporating a painted Al alloy panel, uncoated through-hole fasteners, and scribes has been shown to provide accelerated response during atmospheric corrosion testing in the field and in laboratory chambers. Several different aspects of this test sample and the behavior of different coating systems are investigated in this dissertation. The galvanic current between SS316 or Ti-6Al-4V fasteners and painted and scribed AA7075-T6 panels was examined during exposure in a salt fog chamber using a zero-resistance ammeter. The anodic current of the AA7075-T6 panel and the cathodic current of each of the four fasteners were monitored using different connection schemes. The anodic current of the panel depended on the number of fasteners connected. The total cathodic current of fasteners was approximately equal to the anodic current of the AA7075-T6 panel, which validates the accuracy of the current measurement. Furthermore, galvanic interaction between the fasteners was observed such that the cathodic current of other fasteners was decreased when a new fastener was added to the measurement. Scribes on a panel can interact with distant fasteners, not just the closest ones. The amount of corrosion as determined by charge and optical profilometry were close and indicated SS316 fasteners caused more corrosion attack than Ti-6Al-4V fasteners. The galvanic current of an AA7075-T6 panel coupled with mixed SS316 and Ti-6Al-4V fasteners was monitored using a zero-resistance ammeter during 3 weeks exposure in an ASTM B117 chamber or immersed in 5 wt% NaCl solution. SS316 fasteners provided more cathodic current than Ti in both environments and the current in ASTM B117 was higher than in 5 wt% NaCl solution due to greater oxygen availability. The integral of the anodic current with time and optical profilometery (OP) analysis were used to assess the corrosion attack quantitatively for two different coating systems. An acceleration factor was defined to represent the

  10. Performance of Flow and Heat Transfer in a Hot-Dip Round Coreless Galvanizing Bath

    NASA Astrophysics Data System (ADS)

    Yue, Qiang; Zhang, Chengbo; Xu, Yong; Zhou, Li; Kong, Hui; Wang, Jia


    Flow field in a coreless hot-dip galvanizing pot was investigated through a water modeling experiment. The corresponding velocity vector was measured using an acoustic Doppler velocimeter. The flow field of molten zinc in the bath was also analyzed. Steel strip velocities from 1.7 to 2.7 m/s were adopted to determine the effect of steel strip velocity on the molten zinc flow in the bath. A large vortex filled the space at the right side of the sink roll, under linear speed from 1.0 to 2.7 m/s and width from 1.0 to 1.3 m of the steel strip, because of the effects of wall and shear stress. The results of the water modeling experiment were compared with those of numerical simulations. In the simulation, Maxwell equations were solved using finite element method to obtain magnetic flux density, electromagnetic force, and Joule heating. The Joule heating rate reached the maximum and minimum values near the side wall and at the core of the bath, respectively, because of the effect of skin and proximity. In an industrial-sized model, the molten zinc flow and temperature fields driven by electromagnetic force and Joule heating in the inductor of a coreless galvanizing bath were numerically simulated. The results indicated that the direction of electromagnetic force concentrated at the center of the galvanizing pot horizontal planes and exerted a pinch effect on molten zinc. Consequently, molten zinc in the pot was stirred by electromagnetic force. Under molten zinc flow and electromagnetic force stirring, the temperature of the molten zinc became homogeneous throughout the bath. This study provides a basis for optimizing electromagnetic fields in coreless induction pot and fine-tuning the design of steel strip parameters.

  11. Performance of Flow and Heat Transfer in a Hot-Dip Round Coreless Galvanizing Bath

    NASA Astrophysics Data System (ADS)

    Yue, Qiang; Zhang, Chengbo; Xu, Yong; Zhou, Li; Kong, Hui; Wang, Jia


    Flow field in a coreless hot-dip galvanizing pot was investigated through a water modeling experiment. The corresponding velocity vector was measured using an acoustic Doppler velocimeter. The flow field of molten zinc in the bath was also analyzed. Steel strip velocities from 1.7 to 2.7 m/s were adopted to determine the effect of steel strip velocity on the molten zinc flow in the bath. A large vortex filled the space at the right side of the sink roll, under linear speed from 1.0 to 2.7 m/s and width from 1.0 to 1.3 m of the steel strip, because of the effects of wall and shear stress. The results of the water modeling experiment were compared with those of numerical simulations. In the simulation, Maxwell equations were solved using finite element method to obtain magnetic flux density, electromagnetic force, and Joule heating. The Joule heating rate reached the maximum and minimum values near the side wall and at the core of the bath, respectively, because of the effect of skin and proximity. In an industrial-sized model, the molten zinc flow and temperature fields driven by electromagnetic force and Joule heating in the inductor of a coreless galvanizing bath were numerically simulated. The results indicated that the direction of electromagnetic force concentrated at the center of the galvanizing pot horizontal planes and exerted a pinch effect on molten zinc. Consequently, molten zinc in the pot was stirred by electromagnetic force. Under molten zinc flow and electromagnetic force stirring, the temperature of the molten zinc became homogeneous throughout the bath. This study provides a basis for optimizing electromagnetic fields in coreless induction pot and fine-tuning the design of steel strip parameters.

  12. Patterning of colloidal particles in the galvanic microreactor

    NASA Astrophysics Data System (ADS)

    Jan, Linda

    A Cu-Au galvanic microreactor is used to demonstrate the autonomous patterning of two-dimensional colloidal crystals with spatial and orientational order which are adherent to the electrode substrate. The microreactor is comprised of a patterned array of copper and gold microelectrodes in a coplanar arrangement that is immersed in a dilute hydrochloric acid solution in which colloidal polystyrene microspheres are suspended. During the electrochemical dissolution of copper, polystyrene colloids are transported to the copper electrodes. The spatial arrangement of the electrodes determines whether the colloids initiate aggregation at the edges or centers of the copper electrodes. Depending on the microreactor parameters, two-dimensional colloidal crystals can form and adhere to the electrode. This thesis investigates the mechanisms governing the autonomous particle motion, the directed particle trajectory (inner- versus edge-aggregation) as affected by the spatial patterning of the electrodes, and the adherence of the colloidal particles onto the substrate. Using in situ current density measurements, particle velocimetry, and order-of-magnitude arguments, it is shown that particle motion is governed by bulk fluid motion and electrophoresis induced by the electrochemical reactions. Bulk electrolyte flow is most likely driven by electrochemical potential gradients of reaction products formed during the inhomogeneous copper dissolution, particularly due to localized high current density at the electrode junction. Preferential aggregation of the colloidal particles resulting in inner- and edge-aggregation is influenced by changes to the flow pattern in response to difference in current density profiles as affected by the spatial patterning of the electrode. Finally, by determining the onset of particle cementation through particle tracking analysis, and by monitoring the deposition of reaction products through the observation of color changes of the galvanic electrodes in

  13. Passive Resonant Bidirectional Converter with Galvanic Barrier

    NASA Technical Reports Server (NTRS)

    Rosenblad, Nathan S. (Inventor)


    A passive resonant bidirectional converter system that transports energy across a galvanic barrier includes a converter using at least first and second converter sections, each section including a pair of transfer terminals, a center tapped winding; a chopper circuit interconnected between the center tapped winding and one of the transfer terminals; an inductance feed winding interconnected between the other of the transfer terminals and the center tap and a resonant tank circuit including at least the inductance of the center tap winding and the parasitic capacitance of the chopper circuit for operating the converter section at resonance; the center tapped windings of the first and second converter sections being disposed on a first common winding core and the inductance feed windings of the first and second converter sections being disposed on a second common winding core for automatically synchronizing the resonant oscillation of the first and second converter sections and transferring energy between the converter sections until the voltage across the pairs of transfer terminals achieves the turns ratio of the center tapped windings.

  14. Lack of correlation between basal cell survival and gross response in irradiated swine skin

    SciTech Connect

    Shymko, R.M.; Hauser, D.L.; Archambeau, J.O.


    The relationship between basal cell survival and gross response in irradiated swine skin was tested by comparing dose survival curves derived from time-dose isoeffect data with curves obtained directly from basal cell counts in histological sections. Assuming equal effect per exposure and constant cell survival at isoeffect, best-fitting single-hit multi-target and liner-quadratic response curves were determined for time-dose schedules resulting in non-healing of 50% of irradiated fields. Basal cell survivals for single doses of 970, 1649, 2231, and 2619 rad were estimated 1) by counting regenerating islands and 2) by monitoring total basal cell counts through time. The dose survival curve derived from the isoeffect data was steeper than the curve obtained from direct basal cell counts. Furthermore, the direct basal cell survival curve extrapolates to less than 100% at zero dose, indicating the presence of a resistant basal cell subpopulation. The data show that the isoeffect in this case is not strongly coupled to basal cell survival.

  15. Development and validation of an unsupervised scoring system (Autonomate) for skin conductance response analysis

    PubMed Central

    Green, Steven R.; Kragel, Philip A.; Fecteau, Matthew E.; LaBar, Kevin S.


    The skin conductance response (SCR) is increasingly being used as a measure of sympathetic activation concurrent with neuroscience measurements. We present a method of automated analysis of SCR data in the contexts of event-related cognitive tasks and nonspecific responding to complex stimuli. The primary goal of the method is to accurately measure the classical trough-to-peak amplitude of SCR in a fashion closely matching manual scoring. To validate the effectiveness of the method in event-related paradigms, three archived datasets were analyzed by two manual raters, the fully-automated method (Autonomate), and three alternative software packages. Further, the ability of the method to score non-specific responses to complex stimuli was validated against manual scoring. Results indicate high concordance between fully-automated and computer-assisted manual scoring methods. Given that manual scoring is error prone, subject to bias, and time consuming, the automated method may increase efficiency and accuracy of SCR data analysis. PMID:24184342

  16. Body visual discontinuity affects feeling of ownership and skin conductance responses

    PubMed Central

    Tieri, Gaetano; Tidoni, Emmanuele; Pavone, Enea Francesco; Aglioti, Salvatore Maria


    When we look at our hands we are immediately aware that they belong to us and we rarely doubt about the integrity, continuity and sense of ownership of our bodies. Here we explored whether the mere manipulation of the visual appearance of a virtual limb could influence the subjective feeling of ownership and the physiological responses (Skin Conductance Responses, SCRs) associated to a threatening stimulus approaching the virtual hand. Participants observed in first person perspective a virtual body having the right hand-forearm (i) connected by a normal wrist (Full-Limb) or a thin rigid wire connection (Wire) or (ii) disconnected because of a missing wrist (m-Wrist) or a missing wrist plus a plexiglass panel positioned between the hand and the forearm (Plexiglass). While the analysis of subjective ratings revealed that only the observation of natural full connected virtual limb elicited high levels of ownership, high amplitudes of SCRs were found also during observation of the non-natural, rigid wire connection condition. This result suggests that the conscious embodiment of an artificial limb requires a natural looking visual body appearance while implicit reactivity to threat may require physical body continuity, even non-naturally looking, that allows the implementation of protective reactions to threat. PMID:26602036

  17. The Heritability of the Skin Conductance Orienting Response: A Longitudinal Twin Study

    PubMed Central

    Tuvblad, Catherine; Gao, Yu; Isen, Joshua; Botwick, Theodore; Raine, Adrian; Baker, Laura A.


    The orienting response is a widely used experimental paradigm that reflects the association between electrodermal activity and psychological processes. The present study examined the genetic and environmental etiology of skin conductance orienting response (SCOR) magnitude in a sample of twins assessed at ages 9-10, 11-13 and 14-16 years. Structural equation modeling at each visit showed that genetic influences explained 56%, 83%, and 48% of the total variance in SCOR at visit 1, 2, and 3 respectively, with the remaining variance explained by non-shared environmental factors. SCOR was moderately stable across ages, with phenotypic correlations between time points ranging from .35 to .45. A common genetic factor explained 36%, 45% and 49% of the variance in SCOR magnitude across development. Additional age-specific genetic effects were found at ages 9-10 and 11-13 years, explaining 18% and 35% of the variance, respectively. The genetic correlations among the three time points were high, ranging from .55 to .73, indicating a substantial continuity in genetic influences from ages 9 to 16. These findings suggest that genetic factors are important influences in SCOR magnitude during late childhood and adolescence. PMID:21945549

  18. Associations between Language Development and Skin Conductance Responses to Faces and Eye Gaze in Children with Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Stagg, Steven D.; Davis, Robert; Heaton, Pamela


    Attention to social stimuli is associated with language development, and arousal is associated with the increased viewing of stimuli. We investigated whether skin conductance responses (SCRs) are associated with language development in autism spectrum disorder (ASD): a population that shows abnormalities in both attention to others and language…

  19. Adenosine receptor inhibition with theophylline attenuates the skin blood flow response to local heating in humans.


    Fieger, Sarah M; Wong, Brett J


    Mechanisms underlying the robust cutaneous vasodilatation in response to local heating of human skin remain unresolved. Adenosine receptor activation has been shown to induce vasodilatation via nitric oxide, and a substantial portion of the plateau phase to local heating of human skin has been shown to be dependent on nitric oxide. The purpose of this study was to investigate a potential role for adenosine receptor activation in cutaneous thermal hyperaemia in humans. Six subjects were equipped with four microdialysis fibres on the ventral forearm. Sites were randomly assigned to receive one of the following four treatments: (1) lactated Ringer solution to serve as a control; (2) 4 mM theophylline, a competitive, non-selective A(1)/A(2) adenosine receptor antagonist; (3) 10 mM Nomega(-)-nitro-L-arginine methyl ester (L-NAME) to inhibit NO synthase; or (4) combined 4 mm theophylline + 10 mM L-NAME. Following baseline measurements, each site was locally heated from a baseline temperature of 33 degrees C to 42 degrees C at a rate of 1 degrees C (10 s)(-1), and skin blood flow was monitored via laser-Doppler flowmetry (LDF). Cutaneous vascular conductance (CVC) was calculated as LDF divided by mean arterial pressure and normalized to maximal values (CVC(max)) via local heating to 43 degrees C and infusion of 28 mM sodium nitroprusside. The initial peak was significantly reduced in theophylline (68 +/- 2% CVC(max)) and L-NAME sites (54 +/- 5% CVC(max)) compared with control sites (81 +/- 2% CVC(max); P < 0.01 and P < 0.001, respectively). Combined theophylline + L-NAME (52 +/- 5% CVC(max)) reduced the initial peak compared with control and theophylline sites, but was not significantly different compared with L-NAME sites. The secondary plateau was attenuated in theophylline (77 +/- 2% CVC(max)), L-NAME (60 +/- 2% CVC(max)) and theophylline + L-NAME (53 +/- 1% CVC(max)) compared with control sites (94 +/- 2% CVC(max); P < 0.001 for all conditions). The secondary plateau

  20. Positive photocontact responses are not elicited to sunscreen ingredients exposed to UVA prior to application onto the skin.


    Wahie, Shyamal; Lloyd, James J; Farr, Peter M


    Photocontact allergic reactions to sunscreen chemicals are investigated by photopatch testing. It has generally been assumed that for photocontact allergy to be shown, the putative pro-allergen must be in the skin at the time of ultraviolet A (UVA) exposure. However, this assumption has not, to our knowledge, been tested. The objective of this study was to determine whether positive photocontact responses can still be elicited when sunscreen chemicals are exposed to UVA prior to application onto the skin. 3 patients known to have positive photocontact reactions to a total of 6 sunscreen chemicals were studied. For conventional photopatch testing, patch test strips were applied onto the back and removed 1 D later, and the area was irradiated with UVA (5 J/cm(2)). For pre-irradiated testing, patches were exposed to the same dose of UVA immediately before application onto the back and then removed 1 D later. Skin responses were visually assessed by a blinded investigator 1 and 2 D after patch test removal. The same photocontact responses of the same magnitude, as previously documented for each patient, were seen at each of the conventional UVA-exposed patch test sites. However, in no patient was a positive response elicited at any of the sites where pre-irradiated patches had been applied. This study shows that positive photocontact responses to sunscreen chemicals do not occur when the putative pro-allergen is irradiated prior to application onto the skin. This suggests that for a photoallergic reaction to occur, the sunscreen chemical needs to be within the skin when activated by UVA.

  1. The Lancet Weight Determines Wheal Diameter in Response to Skin Prick Testing with Histamine

    PubMed Central

    Andersen, Hjalte H.; Elberling, Jesper; Arendt-Nielsen, Lars


    Background Skin prick test (SPT) is a common test for diagnosing immunoglobulin E-mediated allergies. In clinical routine, technicalities, human errors or patient-related biases, occasionally results in suboptimal diagnosis of sensitization. Objective Although not previously assessed qualitatively, lancet weight is hypothesized to be important when performing SPT to minimize the frequency of false positives, false negatives, and unwanted discomfort. Methods Accurate weight-controlled SPT was performed on the volar forearms and backs of 20 healthy subjects. Four predetermined lancet weights were applied (25 g, 85 g, 135 g and 265 g) using two positive control histamine solutions (1 mg/mL and 10 mg/mL) and one negative control (saline). A total of 400 SPTs were conducted. The outcome parameters were: wheal size, neurogenic inflammation (measured by superficial blood perfusion), frequency of bleeding, and the lancet provoked pain response. Results The mean wheal diameter increased significantly as higher weights were applied to the SPT lancet, e.g. from 3.2 ± 0.28 mm at 25 g to 5.4 ± 1.7 mm at 265 g (p<0.01). Similarly, the frequency of bleeding, the provoked pain, and the neurogenic inflammatory response increased significantly. At 265 g saline evoked two wheal responses (/160 pricks) below 3 mm. Conclusion and clinical relevance The applied weight of the lancet during the SPT-procedure is an important factor. Higher lancet weights precipitate significantly larger wheal reactions with potential diagnostic implications. This warrants additional research of the optimal lancet weight in relation to SPT-guidelines to improve the specificity and sensitivity of the procedure. PMID:27213613


    EPA Science Inventory

    Ultraviolet radiation (UVR) is known to suppress immune responses in human subjects. The purpose of this study was to develop dose responses across a broad range of skin pigmentation in order to facilitate risk assessment. UVR was administered using FS 20 bulbs. Skin pigmentation...

  3. Galvanic sludge metals recovery by pyrometallurgical and hydrometallurgical treatment.


    Rossini, Gustavo; Bernardes, Andréa Moura


    This paper reports a study, on laboratory scale, of sulphating roasting to perform a treatment for a selective recovery of valuable metals from galvanic sludge. The target metals were copper, zinc and nickel and the sulphating agent used was pyrite, from coal wastes. The particularity of this treatment is the use of two hazardous wastes as raw material. They are generated in large quantities at coal extraction sites (coal wastes) and at plating shops (galvanic sludge). The wastes were characterized by X-ray fluorescence (XRF), particle size distribution and water contents. The chemical characterization showed sludges with high copper concentration, with more than 14% (dry base). In the roasting step, the galvanic sludge was mixed with pyritic waste and the parameters evaluated were galvanic sludge/pyrite ratio, roasting temperature and roasting time. After roasting, the product of reaction was leached with water in room temperature for 15 min. Considering that other studies have already demonstrated that the pyrometallurgical step determines the process efficiency, this paper only reports the influence of pyrometallurgical parameters. Hydrometallurgical processes will be better evaluated in further studies. The conditions that best reflect a compromise between the valuable metal recover and the economical viability of the process were achieved for 1:0.4 galvanic sludge/pyrite ratio, 90 min of roasting time and 550 degrees C of roasting temperature. These conditions lead to a recovery of 60% zinc, 43% nickel and 50% copper.


    EPA Science Inventory

    It has previously been observed that chronic exposure to inorganic arsenic and/or its metabolites increase(s) tumor frequency in the skin of K6/ODC transgenic mice. To identify potential biomarkers and modes of action for this skin tumorigenicity, gene expression profiles w...

  5. Botulinum toxin A for palmar hyperhidrosis: assessment with sympathetic skin responses evoked by train of stimuli.


    Al-Hashel, J Y; Youssry, D; Rashaed, H M; Shamov, T; Rousseff, R T


    Objective assessment of the effect of botulinum toxin A (BT) treatment in primary palmar hyperhidrosis (PH) is attempted by different methods. We decided to use for this purpose sympathetic skin responses evoked by train of stimuli (TSSR). Twenty patients with severe PH (five female, median age 24, range 18-36) were examined regularly over 3 months after receiving 50 UI BT in each palm. TSSR were recorded from the palms after sensory stimulation by a train of three supramaximal electric pulses 3 millisecond apart. Results were compared to longitudinally studied TSSR of 20 healthy sex- and age-matched control subjects. All hyperhidrosis patients reported excellent improvement. TSSR amplitudes decreased at week 1 (mean 54% range 48%-67%) and over the following months in a clinically significant trend (slope R=-.82, P<.0001). TSSR in controls changed insignificantly (±13% from the baseline). The difference between patients and controls was highly significant at any time point (P<.001). This study suggests that TSSR may help in assessment of treatments in PH. It confirms objectively the efficacy of BT in PH.

  6. Skin microvascular and metabolic response to pressure relief maneuvers in people with spinal cord injury

    NASA Astrophysics Data System (ADS)

    Ramella-Roman, Jessica C.; Le, Du V. N.; Ghassemi, Pejhman; Nguyen, Thu A.; Lichy, Alison; Groah, Suzanne


    Clinician's recommendations on wheelchair pressure reliefs in the context of the high prevalence of pressure ulcers that occur in people with spinal cord injury is not supported by strong experimental evidence. Some data indicates that altered tissue perfusion and oxygenation occurring under pressure loads, such as during sitting, induce various pathophysiologic changes that may lead to pressure ulcers. Pressure causes a cascade of responses, including initial tissue hypoxia, which leads to ischemia, vascular leakage, tissue acidification, compensatory angiogenesis, thrombosis, and hyperemia, all of which may lead to tissue damage. We have developed an advanced skin sensor that allows measurement of oxygenation in addition to perfusion, and can be safely used during sitting. The sensor consists of a set of fiber optics probes, spectroscopic and Laser Doppler techniques that are used to obtain parameters of interest. The overriding goal of this project is to develop the evidence base for clinical recommendations on pressure reliefs. In this paper we will illustrate the experimental apparatus as well as some preliminary results of a small clinical trial conducted at the National Rehabilitation Hospital.

  7. The sympathetic skin response: normal values, elucidation of afferent components and application limits.


    Uncini, A; Pullman, S L; Lovelace, R E; Gambi, D


    The sympathetic skin response (SSR), recorded at the hand and foot, was elicited using different classes of stimuli in 20 normal controls and 10 patients with peripheral neuropathy. We found that SSR latencies changed significantly with different recording sites, but not with different stimulation sites. Additionally, after ischemic conduction block of the arm in 3 normal controls, the previously obtainable SSR recorded at the hand became unobtainable with median nerve stimulation. Also, in one patient with subacute ganglionitis and 3 patients with demyelinating neuropathies, the SSR could not be elicited by electrical stimulation, but it could with deep inspiration. These results suggest that large diameter myelinated fibers may serve as afferents for the SSR. Furthermore, these findings imply that an unobtainable SSR by electrical stimulation may be due not only to dysfunction of the autonomic efferent nerve fibers, but also to abnormalities of the sensory afferents of the reflex. Therefore, investigations of autonomic dysfunction utilizing the SSR must be interpreted with caution in patients with peripheral neuropathies.

  8. Optical spectroscopy of radiotherapy and photodynamic therapy responses in normal rat skin shows vascular breakdown products

    NASA Astrophysics Data System (ADS)

    Teles de Andrade, Cintia; Nogueira, Marcelo S.; Kanick, Stephen C.; Marra, Kayla; Gunn, Jason; Andreozzi, Jacqueline; Samkoe, Kimberley S.; Kurachi, Cristina; Pogue, Brian W.


    Photodynamic therapy (PDT) and radiotherapy are non-systemic cancer treatment options with different mechanisms of damage. So combining these techniques has been shown to have some synergy, and can mitigate their limitations such as low PDT light penetration or radiotherapy side effects. The present study monitored the induced tissue changes after PDT, radiotherapy, and a combination protocol in normal rat skin, using an optical spectroscopy system to track the observed biophysical changes. The Wistar rats were treated with one of the protocols: PDT followed by radiotherapy, PDT, radiotherapy and radiotherapy followed by PDT. Reflectance spectra were collected in order to observe the effects of these combined therapies, especially targeting vascular response. From the reflectance, information about oxygen saturation, met-hemoglobin and bilirubin concentration, blood volume fraction (BVF) and vessel radius were extracted from model fitting of the spectra. The rats were monitored for 24 hours after treatment. Results showed that there was no significant variation in the vessel size or BVF after the treatments. However, the PDT caused a significant increase in the met-hemoglobin and bilirubin concentrations, indicating an important blood breakdown. These results may provide an important clue on how the damage establishment takes place, helping to understand the effect of the combination of those techniques in order to verify the existence of a known synergistic effect.

  9. R-R interval variation and sympathetic skin response in systemic lupus erythematosus.


    Tekatas, Aslan; Koca, Süleyman Serdar; Tekatas, Demet Deniz; Aksu, Feyza; Dogru, Yüce; Pamuk, Omer Nuri


    The involvement of the autonomic nervous system is less common than that of the central and peripheral nervous system in systemic lupus erythematosus (SLE) patients. However, its involvement can negatively affect the quality of life of the patient and cause life-threatening situations. In this study, autonomic function was evaluated in SLE patients who did not show any sign of autonomic involvement using R-R interval variation (RRIV) and sympathetic skin response (SSR) electrophysiological tests. SSR was used to evaluate the sympathetic nervous system, whereas RRIV was used for the parasympathetic nervous system. We included 23 SLE patients and 21 healthy volunteers in the study. Of the 23 SLE patients, 20 (86.9 %) were female and 3 (13.1 %) were male. The age range of the patients was between 19 and 52 years, with a mean age of 32.5 ± 9.1 years. Routine nerve conduction studies and autonomic tests were performed on patients in the electromyography (EMG) laboratory. Lower extremity SSR latencies were prolonged and a significant loss of amplitude was observed in comparison to the control group. Furthermore, deep-breath RRIV values for the patient group were significantly lower than that of the control group. Both sympathetic and parasympathetic nervous system involvement was seen in our study. In conclusion, EMG can reveal a possible underlying involvement in the absence of signs of autonomic involvement.

  10. Silver nanoparticles mediate differential responses in keratinocytes and fibroblasts during skin wound healing.


    Liu, Xuelai; Lee, Pui-Yan; Ho, Chi-Ming; Lui, Vincent C H; Chen, Yan; Che, Chi-Ming; Tam, Paul K H; Wong, Kenneth K Y


    With advances in nanotechnology, pure silver has been recently engineered into nanometer-sized particles (diameter <100 nm) for use in the treatment of wounds. In conjunction with other studies, we previously demonstrated that the topical application of silver nanoparticles (AgNPs) can promote wound healing through the modulation of cytokines. Nonetheless, the question as to whether AgNPs can affect various skin cell types--keratinocytes and fibroblasts--during the wound-healing process still remains. Therefore, the aim of this study was to focus on the cellular response and events of dermal contraction and epidermal re-epithelialization during wound healing under the influence of AgNPs; for this we used a full-thickness excisional wound model in mice. The wounds were treated with either AgNPs or control with silver sulfadiazine, and the proliferation and biological events of keratinocytes and fibroblasts during healing were studied. Our results confirm that AgNPs can increase the rate of wound closure. On one hand, this was achieved through the promotion of proliferation and migration of keratinocytes. On the other hand, AgNPs can drive the differentiation of fibroblasts into myofibroblasts, thereby promoting wound contraction. These findings further extend our current knowledge of AgNPs in biological and cellular events and also have significant implications for the treatment of wounds in the clinical setting.

  11. Facial skin blood flow responses during exposures to emotionally charged movies.


    Matsukawa, Kanji; Endo, Kana; Ishii, Kei; Ito, Momoka; Liang, Nan


    The changes in regional facial skin blood flow and vascular conductance have been assessed for the first time with noninvasive two-dimensional laser speckle flowmetry during audiovisually elicited emotional challenges for 2 min (comedy, landscape, and horror movie) in 12 subjects. Limb skin blood flow and vascular conductance and systemic cardiovascular variables were simultaneously measured. The extents of pleasantness and consciousness for each emotional stimulus were estimated by the subjective rating from -5 (the most unpleasant; the most unconscious) to +5 (the most pleasant; the most conscious). Facial skin blood flow and vascular conductance, especially in the lips, decreased during viewing of comedy and horror movies, whereas they did not change during viewing of a landscape movie. The decreases in facial skin blood flow and vascular conductance were the greatest with the comedy movie. The changes in lip, cheek, and chin skin blood flow negatively correlated (P < 0.05) with the subjective ratings of pleasantness and consciousness. The changes in lip skin vascular conductance negatively correlated (P < 0.05) with the subjective rating of pleasantness, while the changes in infraorbital, subnasal, and chin skin vascular conductance negatively correlated (P < 0.05) with the subjective rating of consciousness. However, none of the changes in limb skin blood flow and vascular conductance and systemic hemodynamics correlated with the subjective ratings. The mental arithmetic task did not alter facial and limb skin blood flows, although the task influenced systemic cardiovascular variables. These findings suggest that the more emotional status becomes pleasant or conscious, the more neurally mediated vasoconstriction may occur in facial skin blood vessels.

  12. Differential innate immune responses of a living skin equivalent model colonized by Staphylococcus epidermidis or Staphylococcus aureus.


    Holland, Diana B; Bojar, Richard A; Farrar, Mark D; Holland, Keith T


    Staphylococcus epidermidis is a commensal on skin, whereas Staphylococcus aureus is a transient pathogen. The aim was to determine whether the skin's innate defence systems responded differently to these microorganisms. Differential gene expression of a human skin equivalent (SE) model was assessed by microarray technology, in response to colonization by S. epidermidis or S. aureus. Only a small number of transcripts were significantly (P<0.0001) increased (12) or decreased (35) with gene expression changes of >2-fold on SEs colonized with S. epidermidis compared with controls (no colonization). Expression of one innate defence gene, pentraxin 3 (PTX3), was upregulated, while psoriasin, S100A12, S100A15, beta defensin 4, beta defensin 3, lipocalin 2 and peptidoglycan recognition protein 2 were downregulated. In contrast, large numbers of transcripts were significantly increased (480) or decreased (397) with gene expression changes of >2-fold on SEs colonized with S. aureus compared with controls. There was upregulation in gene expression of many skin defence factors including Toll-like receptor 2, beta defensin 4, properdin, PTX3, proinflammatory cytokines tumour necrosis factor-alpha, IL-1 alpha, IL-1 beta, IL-17C, IL-20, IL-23A and chemokines IL-8, CCL4, CCL5, CCL20 and CCL27. These differences may partly explain why S. epidermidis is a normal skin resident and S. aureus is not.

  13. A microfluidic galvanic cell on a single layer of paper

    NASA Astrophysics Data System (ADS)

    Purohit, Krutarth H.; Emrani, Saina; Rodriguez, Sandra; Liaw, Shi-Shen; Pham, Linda; Galvan, Vicente; Domalaon, Kryls; Gomez, Frank A.; Haan, John L.


    Paper microfluidics is used to produce single layer galvanic and hybrid cells to produce energy that could power paper-based analytical sensors. When two aqueous streams are absorbed onto paper to establish co-laminar flow, the streams stay in contact with each other with limited mixing. The interface at which mixing occurs acts as a charge-transfer region, eliminating the need for a salt bridge. We designed a Cusbnd Zn galvanic cell that powers an LED when two are placed in series. We also used more powerful redox couples (formate and silver, formate and permanganate) to produce higher power density (18 and 3.1 mW mg-1 Pd). These power densities are greater than previously reported paper microfluidic fuel cells using formate or methanol. The single layer design is much more simplified than previous reports of multi-layer galvanic cells on paper.

  14. Differences in the Pulsatile Component of the Skin Hemodynamic Response to Verbal Fluency Tasks in the Forehead and the Fingertip

    PubMed Central

    Takahashi, Toshimitsu; Takikawa, Yoriko; Kawagoe, Reiko


    Several studies have claimed that hemodynamic signals measured by near-infrared spectroscopy (NIRS) on the forehead exhibit different patterns during a verbal fluency task (VFT) in various psychiatric disorders, whereas many studies have noted that NIRS signals can reflect task-related changes in skin blood flow. If such a task-related skin hemodynamic response is also observed in the fingertip, a simpler biomarker may be developed. Furthermore, determining the difference in the response pattern may provide physiological insights into the condition. We found that the magnitude of the pulsatile component in skin hemodynamic signals increased on the forehead (p < 0.001 for N = 50, p = 0.073 for N = 8) but decreased on the fingertip (p < 0.001, N = 8) during the VFT, whereas the rate in both areas increased (p < 0.02, N = 8). We also did not find a repetition effect in both the rate and the magnitude on the fingertip, whereas the effect was present in the magnitude (p < 0.02, N = 8) but not in the rate on the forehead. These results suggest that the skin vasomotor system in the forehead could have a different vessel mechanism to psychological tasks compared to the fingertip. PMID:26905432

  15. 76 FR 33242 - Galvanized Steel Wire From the People's Republic of China: Postponement of Preliminary...

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... International Trade Administration Galvanized Steel Wire From the People's Republic of China: Postponement of... of galvanized steel wire from the People's Republic of China. See Galvanized Steel Wire From the... investigation, Davis Wire Corporation, Johnstown Wire Technologies, Inc., Mid-South Wire Company, Inc.,...

  16. 77 FR 17418 - Galvanized Steel Wire From the People's Republic of China: Final Affirmative Countervailing Duty...

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... International Trade Administration Galvanized Steel Wire From the People's Republic of China: Final Affirmative... subsidies are being provided to producers and exporters of galvanized steel wire (galvanized wire) from the... U.S. producers that filed the petition for this investigation are Davis Wire Corporation,...

  17. 76 FR 73589 - Galvanized Steel Wire From the People's Republic of China: Amended Preliminary Determination of...

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... investigation covers galvanized steel wire which is a cold-drawn carbon quality steel product in coils, of solid... International Trade Administration Galvanized Steel Wire From the People's Republic of China: Amended... than fair value in the antidumping investigation of galvanized steel wire from the People's Republic...

  18. Response-surface models for deterministic effects of localized irradiation of the skin by discrete {beta}/{gamma} -emitting sources

    SciTech Connect

    Scott, B.R.


    Individuals who work at nuclear reactor facilities can be at risk for deterministic effects in the skin from exposure to discrete {Beta}- and {gamma}-emitting ({Beta}{gamma}E) sources (e.g., {Beta}{gamma}E hot particles) on the skin or clothing. Deterministic effects are non-cancer effects that have a threshold and increase in severity as dose increases (e.g., ulcer in skin). Hot {Beta}{gamma}E particles are {sup 60}Co- or nuclear fuel-derived particles with diameters > 10 {mu}m and < 3 mm and contain at least 3.7 kBq (0.1 {mu}Ci) of radioactivity. For such {Beta}{gamma}E sources on the skin, it is the beta component of the dose that is most important. To develop exposure limitation systems that adequately control exposure of workers to discrete {Beta}{gamma}E sources, models are needed for systems that adequately control exposure of workers to discrete {Beta}{gamma}E sources, models are needed for evaluating the risk of deterministic effects of localized {Beta} irradiation of the skin. The purpose of this study was to develop dose-rate and irradiated-area dependent, response-surface models for evaluating risks of significant deterministic effects of localized irradiation of the skin by discrete {Beta}{gamma}E sources and to use modeling results to recommend approaches to limiting occupational exposure to such sources. The significance of the research results as follows: (1) response-surface models are now available for evaluating the risk of specific deterministic effects of localized irradiation of the skin; (2) modeling results have been used to recommend approaches to limiting occupational exposure of workers to {Beta} radiation from {Beta}{gamma}E sources on the skin or on clothing; and (3) the generic irradiated-volume, weighting-factor approach to limiting exposure can be applied to other organs including the eye, the ear, and organs of the respiratory or gastrointestinal tract and can be used for both deterministic and stochastic effects.

  19. Different oxidative stress response in keratinocytes and fibroblasts of reconstructed skin exposed to non extreme daily-ultraviolet radiation.


    Marionnet, Claire; Pierrard, Cécile; Lejeune, François; Sok, Juliette; Thomas, Marie; Bernerd, Françoise


    Experiments characterizing the biological effects of sun exposure have usually involved solar simulators. However, they addressed the worst case scenario i.e. zenithal sun, rarely found in common outdoor activities. A non-extreme ultraviolet radiation (UV) spectrum referred as "daily UV radiation" (DUVR) with a higher UVA (320-400 nm) to UVB (280-320 nm) irradiance ratio has therefore been defined. In this study, the biological impact of an acute exposure to low physiological doses of DUVR (corresponding to 10 and 20% of the dose received per day in Paris mid-April) on a 3 dimensional reconstructed skin model, was analysed. In such conditions, epidermal and dermal morphological alterations could only be detected after the highest dose of DUVR. We then focused on oxidative stress response induced by DUVR, by analyzing the modulation of mRNA level of 24 markers in parallel in fibroblasts and keratinocytes. DUVR significantly modulated mRNA levels of these markers in both cell types. A cell type differential response was noticed: it was faster in fibroblasts, with a majority of inductions and high levels of modulation in contrast to keratinocyte response. Our results thus revealed a higher sensitivity in response to oxidative stress of dermal fibroblasts although located deeper in the skin, giving new insights into the skin biological events occurring in everyday UV exposure.

  20. Different Oxidative Stress Response in Keratinocytes and Fibroblasts of Reconstructed Skin Exposed to Non Extreme Daily-Ultraviolet Radiation

    PubMed Central

    Marionnet, Claire; Pierrard, Cécile; Lejeune, François; Sok, Juliette; Thomas, Marie; Bernerd, Françoise


    Experiments characterizing the biological effects of sun exposure have usually involved solar simulators. However, they addressed the worst case scenario i.e. zenithal sun, rarely found in common outdoor activities. A non-extreme ultraviolet radiation (UV) spectrum referred as “daily UV radiation” (DUVR) with a higher UVA (320–400 nm) to UVB (280–320 nm) irradiance ratio has therefore been defined. In this study, the biological impact of an acute exposure to low physiological doses of DUVR (corresponding to 10 and 20% of the dose received per day in Paris mid-April) on a 3 dimensional reconstructed skin model, was analysed. In such conditions, epidermal and dermal morphological alterations could only be detected after the highest dose of DUVR. We then focused on oxidative stress response induced by DUVR, by analyzing the modulation of mRNA level of 24 markers in parallel in fibroblasts and keratinocytes. DUVR significantly modulated mRNA levels of these markers in both cell types. A cell type differential response was noticed: it was faster in fibroblasts, with a majority of inductions and high levels of modulation in contrast to keratinocyte response. Our results thus revealed a higher sensitivity in response to oxidative stress of dermal fibroblasts although located deeper in the skin, giving new insights into the skin biological events occurring in everyday UV exposure. PMID:20706594

  1. Comparison of human skin opto-thermal response to near-infrared and visible laser irradiations: a theoretical investigation

    NASA Astrophysics Data System (ADS)

    Dai, Tianhong; Pikkula, Brian M.; Wang, Lihong V.; Anvari, Bahman


    Near-infrared wavelengths are absorbed less by epidermal melanin, and penetrate deeper into human skin dermis and blood than visible wavelengths. Therefore, laser irradiation using near-infrared wavelengths may improve the therapeutic outcome of cutaneous hyper-vascular malformations in moderately to heavily pigmented skin patients and those with large-sized blood vessels or blood vessels extending deeply into the skin. A mathematical model composed of a Monte Carlo algorithm to estimate the distribution of absorbed light, numerical solution of a bio-heat diffusion equation to calculate the transient temperature distribution, and a damage integral based on an empirical Arrhenius relationship to quantify the tissue damage was utilized to investigate the opto-thermal response of human skin to near-infrared and visible laser irradiations in conjunction with cryogen spray cooling. In addition, the thermal effects of a single continuous laser pulse and micropulse-composed laser pulse profiles were compared. Simulation results indicated that a 940 nm wavelength induces improved therapeutic outcome compared with a 585 and 595 nm wavelengths for the treatment of patients with large-sized blood vessels and moderately to heavily pigmented skin. On the other hand, a 585 nm wavelength shows the best efficacy in treating small-sized blood vessels, as characterized by the largest laser-induced blood vessel damage depth compared with 595 and 940 nm wavelengths. Dermal blood content has a considerable effect on the threshold incident dosage for epidermal damage, while the effect of blood vessel size is minimal. For the same macropulse duration and incident dosage, a micropulse-composed pulse profile results in higher peak temperature at the basal layer of skin epidermis than an ideal single continuous pulse profile.

  2. Visible Light Induces Melanogenesis in Human Skin through a Photoadaptive Response

    PubMed Central

    Randhawa, Manpreet; Seo, InSeok; Liebel, Frank; Southall, Michael D.; Kollias, Nikiforos; Ruvolo, Eduardo


    Visible light (400–700 nm) lies outside of the spectral range of what photobiologists define as deleterious radiation and as a result few studies have studied the effects of visible light range of wavelengths on skin. This oversight is important considering that during outdoors activities skin is exposed to the full solar spectrum, including visible light, and to multiple exposures at different times and doses. Although the contribution of the UV component of sunlight to skin damage has been established, few studies have examined the effects of non-UV solar radiation on skin physiology in terms of inflammation, and limited information is available regarding the role of visible light on pigmentation. The purpose of this study was to determine the effect of visible light on the pro-pigmentation pathways and melanin formation in skin. Exposure to visible light in ex-vivo and clinical studies demonstrated an induction of pigmentation in skin by visible light. Results showed that a single exposure to visible light induced very little pigmentation whereas multiple exposures with visible light resulted in darker and sustained pigmentation. These findings have potential implications on the management of photo-aggravated pigmentary disorders, the proper use of sunscreens, and the treatment of depigmented lesions. PMID:26121474

  3. Visible Light Induces Melanogenesis in Human Skin through a Photoadaptive Response.


    Randhawa, Manpreet; Seo, InSeok; Liebel, Frank; Southall, Michael D; Kollias, Nikiforos; Ruvolo, Eduardo


    Visible light (400-700 nm) lies outside of the spectral range of what photobiologists define as deleterious radiation and as a result few studies have studied the effects of visible light range of wavelengths on skin. This oversight is important considering that during outdoors activities skin is exposed to the full solar spectrum, including visible light, and to multiple exposures at different times and doses. Although the contribution of the UV component of sunlight to skin damage has been established, few studies have examined the effects of non-UV solar radiation on skin physiology in terms of inflammation, and limited information is available regarding the role of visible light on pigmentation. The purpose of this study was to determine the effect of visible light on the pro-pigmentation pathways and melanin formation in skin. Exposure to visible light in ex-vivo and clinical studies demonstrated an induction of pigmentation in skin by visible light. Results showed that a single exposure to visible light induced very little pigmentation whereas multiple exposures with visible light resulted in darker and sustained pigmentation. These findings have potential implications on the management of photo-aggravated pigmentary disorders, the proper use of sunscreens, and the treatment of depigmented lesions.

  4. The impact of paclitaxel or cisplatin-based chemotherapy on sympathetic skin response: a prospective study.


    Argyriou, A A; Koutras, A; Polychronopoulos, P; Papapetropoulos, S; Iconomou, G; Katsoulas, G; Makatsoris, T; Kalofonos, H P; Chroni, E


    The current study aimed to assess the viability of sympathetic sudomotor fibers in cancer patients treated with cisplatin or paclitaxel-based chemotherapy and to ascertain whether this method could contribute to the diagnostic sensitivity of conventional techniques. Sympathetic skin response (SSR) from the hand and sole of 23 cancer patients (nine females and 14 males, mean age 62.4 +/- 10.5 years) was recorded unilaterally before and after chemotherapy with six courses of cumulative cisplatin or paclitaxel containing regimens. Clinical and electrophysiological data were also collected and correlated with the SSR results. Twenty-three healthy subjects served as controls. SSR abnormalities were only present in patients with evidence of peripheral neuropathy assessed by conventional nerve conduction techniques. Three patients had absent SSR in the upper limb whilst six patients had absent SSR both in the upper and lower limbs. In the upper limb, the mean SSR latency was not significantly altered through time (P = 0.086). In the lower limb the mean delay from baseline to follow-up was significantly changed (P = 0.029). In patients, the mean SSR latency was significantly prolonged compared with controls in both upper limb (P = 0.001) and lower limb (P = 0.000). SSR abnormalities were strongly related to sensory conduction abnormalities as detected by conventional techniques (r = 0.39, P = 0.004). Our results showed that SSR does not seem to add to the diagnostic sensitivity of conventional techniques in chemotherapy-induced neuropathy. However, its role in the disclosure of small fibers neuropathy abnormalities is worth considering. Further studies are warranted to address this important issue.

  5. Skin conductance responses are elicited by the airway sensory effects of puffs from cigarettes.


    Naqvi, Nasir H; Bechara, Antoine


    The airway sensations stimulated by smoking are an important source of hedonic impact (pleasure) for dependent smokers. The learning process by which these sensations become pleasurable is not well understood. The classical conditioning model predicts that airway sensory stimulation will elicit sympathetic arousal that is positively correlated with the hedonic impact that is elicited by airway sensory stimulation. To test this prediction, we measured skin conductance responses (SCRs) and subjective hedonic impact elicited by a series of individual puffs from nicotinized, denicotinized and unlit cigarettes. Nicotinized puffs elicited more subjective hedonic impact than denicotinized and unlit puffs partly as a result of the fact that they provided a greater level of airway sensory stimulation. We found that SCRs were not larger for nicotinized puffs than for denicotinized puffs, but that they were larger for both nicotinized and denicotinized puffs than for unlit puffs. We also found that the average SCR of a subject to denicotinized puffs was positively correlated with the average hedonic impact that a subject obtained from denicotinized puffs. Together, this suggests that SCR magnitude does not reflect within-subject variations in hedonic impact that are due to variations in the level of airway sensory stimulation, but that it does reflect individual differences in the amount of hedonic impact that is derived from a given level of airway sensory stimulation. The results of a post hoc correlation analysis suggest that these individual differences may have been due to variations in the prevailing urge to smoke. The implications of these findings for the classical conditioning model, as well as for other learning models, are discussed.

  6. IL-23 induced in keratinocytes by endogenous TLR4 ligands polarizes dendritic cells to drive IL-22 responses to skin immunization

    PubMed Central

    Yoon, Juhan; Oyoshi, Michiko K.; Hoff, Sabine; Chervonsky, Alexander; Oppenheim, Joost J.; Rosenstiel, Philip


    Atopic dermatitis (AD) is a Th2-dominated inflammatory skin disease characterized by epidermal thickening. Serum levels of IL-22, a cytokine known to induce keratinocyte proliferation, are elevated in AD, and Th22 cells infiltrate AD skin lesions. We show that application of antigen to mouse skin subjected to tape stripping, a surrogate for scratching, induces an IL-22 response that drives epidermal hyperplasia and keratinocyte proliferation in a mouse model of skin inflammation that shares many features of AD. DC-derived IL-23 is known to act on CD4+ T cells to induce IL-22 production. However, the mechanisms that drive IL-23 production by skin DCs in response to cutaneous sensitization are not well understood. We demonstrate that IL-23 released by keratinocytes in response to endogenous TLR4 ligands causes skin DCs, which selectively express IL-23R, to up-regulate their endogenous IL-23 production and drive an IL-22 response in naive CD4+ T cells that mediates epidermal thickening. We also show that IL-23 is released in human skin after scratching and polarizes human skin DCs to drive an IL-22 response, supporting the utility of IL-23 and IL-22 blockade in AD. PMID:27551155

  7. Skin Dictionary


    ... your skin, hair, and nails Skin dictionary Camp Discovery Good Skin Knowledge lesson plans and activities Video library Find a ... your skin, hair, and nails Skin dictionary Camp Discovery Good Skin Knowledge lesson plans and activities Video library Find a ...

  8. Skin sensitizers induce antioxidant response element dependent genes: application to the in vitro testing of the sensitization potential of chemicals.


    Natsch, Andreas; Emter, Roger


    Tests for skin sensitization are required prior to the market launch of new cosmetic ingredients and in vitro tests are needed to replace the current animal tests. Protein reactivity is the common feature of skin sensitizers and it is a crucial question whether a cellular in vitro assay can detect protein reactivity of diverse test chemicals. The signaling pathway involving the repressor protein Keap1 and the transcription factor nuclear factor-erythroid 2-related factor 2, which binds to the antioxidant response element (ARE) in the promoter of many phase II detoxification genes, is a potential cellular marker because Keap1 had been shown to be covalently modified by electrophiles which leads to activation of ARE-dependent genes. To evaluate whether this regulatory pathway can be used to develop a predictive cellular in vitro test for sensitization, 96 different chemicals of known skin sensitization potential were added to Hepa1C1C7 cells and the induction of the ARE-regulated quinone reductase (QR) activity was determined. In parallel, 102 chemicals were tested on the reporter cell line AREc32, which contains an eightfold repeat of the ARE sequence upstream of a luciferase gene. Among the strong/extreme skin sensitizers 14 out of 15 and 30 out of 34 moderate sensitizers induced the ARE-dependent luciferase activity and in many cases this response was paralleled by an induction of QR activity in Hepa1C1C7 cells. Sixty percent of the weak sensitizers also induced luciferase activity, and the overall accuracy of the assay was 83 percent. Only four of 30 tested nonsensitizers induced low levels of luciferase activity, indicating a high specificity of the assay. Thus, measurement of the induction of this signaling pathway provides an interesting in vitro test to screen for the skin sensitization potential of novel chemicals.

  9. Quantitative thermal sensory testing and sympathetic skin response in primary Restless legs syndrome - A prospective study on 57 Indian patients.


    Shukla, Garima; Goyal, Vinay; Srivastava, Achal; Behari, Madhuri


    Patients with restless leg syndrome present with sensory symptoms similar to peripheral neuropathy. While there is evidence of abnormalities of dopaminergic pathways, the peripheral nervous system has been studied infrequently. We studied conventional nerve conduction studies, quantitative thermal sensory testing and sympathetic skin response in 57 patients with primary restless leg syndrome. Almost two third patients demonstrated abnormalities in the detailed testing of the peripheral nervous system. Sbtle abnormalities of the peripheral nervous system may be more common than previously believed.

  10. Screening for Staphylococcus epidermidis markers discriminating between skin-flora strains and those responsible for infections of joint prostheses.


    Galdbart, J O; Allignet, J; Tung, H S; Rydèn, C; El Solh, N


    Fifty-four Staphylococcus epidermidis strains responsible for infections of joint prostheses and 23 strains isolated from skin flora were studied for markers of virulence, to discriminate invasive strains from normal flora. They were screened for binding to polystyrene and matrix proteins and for the presence of staphylococcal genes involved in adhesion. The ica operon involved in biofilm formation was the only marker discriminating between these 2 categories of strains.

  11. Force sensor in simulated skin and neural model mimic tactile SAI afferent spiking response to ramp and hold stimuli

    PubMed Central


    Background The next generation of prosthetic limbs will restore sensory feedback to the nervous system by mimicking how skin mechanoreceptors, innervated by afferents, produce trains of action potentials in response to compressive stimuli. Prior work has addressed building sensors within skin substitutes for robotics, modeling skin mechanics and neural dynamics of mechanotransduction, and predicting response timing of action potentials for vibration. The effort here is unique because it accounts for skin elasticity by measuring force within simulated skin, utilizes few free model parameters for parsimony, and separates parameter fitting and model validation. Additionally, the ramp-and-hold, sustained stimuli used in this work capture the essential features of the everyday task of contacting and holding an object. Methods This systems integration effort computationally replicates the neural firing behavior for a slowly adapting type I (SAI) afferent in its temporally varying response to both intensity and rate of indentation force by combining a physical force sensor, housed in a skin-like substrate, with a mathematical model of neuronal spiking, the leaky integrate-and-fire. Comparison experiments were then conducted using ramp-and-hold stimuli on both the spiking-sensor model and mouse SAI afferents. The model parameters were iteratively fit against recorded SAI interspike intervals (ISI) before validating the model to assess its performance. Results Model-predicted spike firing compares favorably with that observed for single SAI afferents. As indentation magnitude increases (1.2, 1.3, to 1.4 mm), mean ISI decreases from 98.81 ± 24.73, 54.52 ± 6.94, to 41.11 ± 6.11 ms. Moreover, as rate of ramp-up increases, ISI during ramp-up decreases from 21.85 ± 5.33, 19.98 ± 3.10, to 15.42 ± 2.41 ms. Considering first spikes, the predicted latencies exhibited a decreasing trend as stimulus rate increased, as is observed in afferent

  12. Noninvasive In Vivo Imaging to Evaluate Immune Responses and Antimicrobial Therapy against Staphylococcus aureus and USA300 MRSA Skin Infections

    PubMed Central

    Cho, John S.; Zussman, Jamie; Donegan, Niles P.; Irene Ramos, Romela; Garcia, Nairy C.; Uslan, Daniel Z.; Iwakura, Yoichiro; Simon, Scott I.; Cheung, Ambrose L.; Modlin, Robert L.; Kim, Jenny; Miller, Lloyd S.


    Staphylococcus aureus skin infections represent a significant public health threat because of the emergence of antibiotic-resistant strains such as methicillin-resistant S. aureus (MRSA). As greater understanding of protective immune responses and more effective antimicrobial therapies are needed, a S. aureus skin wound infection model was developed in which full-thickness scalpel cuts on the backs of mice were infected with a bioluminescent S. aureus (methicillin sensitive) or USA300 community-acquired MRSA strain and in vivo imaging was used to noninvasively monitor the bacterial burden. In addition, the infection-induced inflammatory response was quantified using in vivo fluorescence imaging of LysEGFP mice. Using this model, we found that both IL-1α and IL-1β contributed to host defense during a wound infection, whereas IL-1β was more critical during an intradermal S. aureus infection. Furthermore, treatment of a USA300 MRSA skin infection with retapamulin ointment resulted in up to 85-fold reduction in bacterial burden and a 53% decrease in infection-induced inflammation. In contrast, mupirocin ointment had minimal clinical activity against this USA300 strain, resulting in only a 2-fold reduction in bacterial burden. Taken together, this S. aureus wound infection model provides a valuable preclinical screening method to investigate cutaneous immune responses and the efficacy of topical antimicrobial therapies. PMID:21191403

  13. The effect of heating rate on the cutaneous vasomotion responses of forearm and leg skin in humans.


    Del Pozzi, Andrew T; Miller, James T; Hodges, Gary J


    We examined skin blood flow (SkBF) and vasomotion in the forearm and leg using laser-Doppler fluxmetry (LDF) and spectral analysis to investigate endothelial, sympathetic, and myogenic activities in response to slow (0.1 °C·10 s(-1)) and fast (0.5 °C·10 s(-1)) local heating. At 33 °C (thermoneutral) endothelial activity was higher in the legs than the forearms (P ≤ 0.02). Fast-heating increased SkBF more than slow heating (P=0.037 forearm; P=0.002 leg). At onset of 42 °C, endothelial (P=0.043 forearm; P=0.48 leg) activity increased in both regions during the fast-heating protocol. Following prolonged heating (42 °C) endothelial activity was higher in both the forearm (P=0.002) and leg (P<0.001) following fast-heating. These results confirm regional differences in the response to local heating and suggest that the greater increase in SkBF in response to fast local heating is initially due to increased endothelial and sympathetic activity. Furthermore, with sustained local skin heating, greater vasodilatation was observed with fast heating compared to slow heating. These data indicate that this difference is due to greater endothelial activity following fast heating compared to slow heating, suggesting that the rate of skin heating may alter the mechanisms contributing to cutaneous vasodilatation.

  14. Different responses of the skin temperature to physical exercise: Systematic review.


    Neves, Eduardo B; Vilaca-Alves, Jose; Antunes, Natacha; Felisberto, Ivo M V; Rosa, Claudio; Reis, Victor M


    Studies suggest that skin temperature behavior varies according to the type of exercise, intensity, duration, muscle mass and subcutaneous fat layer. In this sense, the aim of this study was to investigate the skin temperature behavior in the active muscles and other body segments, during and after exercise, according to the type and intensity of the exercise. A systematic literature review was conducted between November 2014 and March 2015 in the Web of Science database, using the terms "thermography" and "exercise" and "muscle" to achieve the objective of this study. During the research were found 55 scientific articles which were subjected to a selection process. Inclusion criteria were: Studies in human beings and original research. The exclusion criterion was the presence of subjects with some kind of disease. The seven papers that make up the present review are dated between 2008 and 2015. From all analyzed studies, it was possible to understand the general behavior of the active muscle skin temperature during the exercise, immediately after and in the 48h after exercise, according to the type and intensity of the exercise performed, which are illustrated in two figures. It can be concluded that the skin temperature over active muscles increases during high intensity anaerobic exercise, decreases slowly after exercise and increases again in the days after the exercise. On the other hand, during low intensity aerobic exercise, skin temperature over active muscles decreases, returning to normal values a few minutes after it and present a small rise in the following days. With regard to the skin temperature over non-active muscles, it can be seen that it decreases during exercise, returning to normal values a few minutes after it and rise similarly to the skin temperature over active muscles in the following days, in all types of exercises studied.

  15. A study of IgE sensitization and skin response to histamine in Asian-Pacific American adults.


    Lee-Wong, Mary; Chou, Vivian; Silverberg, Jonathan I


    Allergic disorders and skin response to histamine have been noted to vary in different ethnicities. We investigated IgE-mediated allergic sensitization and skin response to histamine in Asian Pacific Americans (APAs), black and Hispanic Americans, and white adults. A retrospective questionnaire-based study was performed of 2222 adults presenting at a New York City allergy referral center from 1994 to 2003. Questionnaire data included sex, age, and ethnicity and personal and family history of atopic disorders. Skin-prick test (SPT) data included saline and histamine controls and response to a standardized panel of 10 aeroallergens. APA patients had a lower odds of asthma (adjusted odds ratio [aOR], 0.68; 95% confidence interval [CI], 0.52-0.89; p = 0.005) and/or animal allergies (aOR, 0.64; 95% CI, 0.50-0.82; p = 0.0003). Histamine response was not significantly different in APA (aOR, 0.90; 95% CI, 0.73-1.12; p = 0.36) or Hispanic Americans (aOR, 1.03; 95% CI, 0.85-1.24; p = 0.76), but was higher in black Americans (aOR, 2.32; 95% CI, 1.67-3.21; p < 0.0001). APA had higher odds of a positive SPT to trees (aOR, 1.49; 95% CI, 1.16-1.91; p = 0.002), grasses (aOR, 1.32; 95% CI, 1.05-1.43; p = 0.02), feathers (aOR, 1.65; 95% CI, 1.31-2.09; p < 0.0001), and cockroaches (aOR, 1.37; 95% CI, 1.10-1.62; p = 0.005). Moreover, APA had a higher total number of positive SPTs when compared with white patients (5.5 ± 3.2 versus 4.9 ± 3.3; aOR, 1.34; 95% CI, 1.10-1.62 p = 0.004). APA adults in our patient population had more IgE sensitizations but not an increased skin response to histamine. In contrast, black Americans had increased skin response to histamine.

  16. Adaptation of the dermal collagen structure of human skin and scar tissue in response to stretch: an experimental study.


    Verhaegen, Pauline D; Schouten, Hennie J; Tigchelaar-Gutter, Wikky; van Marle, Jan; van Noorden, Cornelis J; Middelkoop, Esther; van Zuijlen, Paul P


    Surgeons are often faced with large defects that are difficult to close. Stretching adjacent skin can facilitate wound closure. In clinical practice, intraoperative stretching is performed in a cyclical or continuous fashion. However, exact mechanisms of tissue adaptation to stretch remain unclear. Therefore, we investigated collagen and elastin orientation and morphology of stretched and nonstretched healthy skin and scars. Tissue samples were stretched, fixed in stretched-out position, and processed for histology. Objective methods were used to quantify the collagen orientation index (COI), bundle thickness, and bundle spacing. Also sections were analyzed for elastin orientation and quantity. Significantly more parallel aligned collagen bundles were found after cyclical (COI = 0.57) and continuous stretch (COI = 0.57) compared with nonstretched skin (COI = 0.40). Similarly, more parallel aligned elastin was found after stretch. Also, significantly thicker collagen bundles and more bundle spacing were found after stretch. For stretched scars, significantly more parallel aligned collagen was found (COI = 0.61) compared with nonstretched scars (COI = 0.49). In conclusion, both elastin and collagen realign in a parallel fashion in response to stretch. For healthy skin, thicker bundles and more space between the bundles were found. Rapid changes in extension, alignment, and collagen morphology appear to be the underlying mechanisms of adaptation to stretching.

  17. The effect of starting or stopping skin cooling on the thermoregulatory responses during leg exercise in humans.


    Demachi, K; Yoshida, T; Kume, M; Tsuneoka, H


    To assess the effects of starting or stopping leg cooling on the thermoregulatory responses during exercise, 60 min of cycling exercise at 30% of maximal oxygen uptake was performed under 4 conditions using tube trouser perfused with water at 10 °C; no leg cooling (NC), starting of leg cooling after 30 min of exercise (delayed cooling, DC), continuous leg cooling (CC), and stopping of continuous leg cooling after 30 min of exercise (SC) at an environmental temperature of 28.5 °C. During exercise under the DC conditions, an instantaneous increase in the esophageal temperature (Tes), a suppression of the cutaneous vascular conductance at the forearm (%CVC), and a decrease in the mean skin temperature (Tsk) were observed after leg cooling. The total sweat loss (Δm sw,tot) was lower under the DC than the NC condition. In the SC study, however, the Tes remained constant, while the %CVC increased gradually after leg cooling was stopped, and the Δm sw,tot was greater than that under the CC condition. These results suggest that during exercise, rapid skin cooling of the leg may cause an increase in core temperature, while also enhancing thermal stress. However, stopping skin cooling did not significantly affect the core temperature long-term, because the skin blood flow and sweat rate subsequently increased.

  18. An Easy-to-Assemble Three-Part Galvanic Cell

    ERIC Educational Resources Information Center

    Eggen, Per-Odd; Skaugrud, Brit


    The galvanic cell presented in this article is made of only three parts, is easy to assemble, and can light a red light emitting diode (LED). The three cell components consist of a piece of paper with copper sulfate, a piece of paper with sodium sulfate, and a piece of magnesium ribbon. Within less than 1 h, students have time to discuss the…

  19. Common Student Misconceptions in Electrochemistry: Galvanic, Electrolytic, and Concentration Cells.

    ERIC Educational Resources Information Center

    Sanger, Michael J.; Greenbowe, Thomas J.


    Investigates student (N=16) misconceptions concerning electrochemistry related to galvanic, electrolytic, and concentration cells. Findings indicate that most students demonstrating misconceptions were still able to calculate cell potentials correctly. Discusses common misconceptions and possible sources of these. Contains 33 references.…

  20. Galvanic corrosion of nitinol under deaerated and aerated conditions.


    Pound, Bruce G


    Various studies have examined the corrosion rate of nitinol generally under deaerated conditions. Likewise, galvanic corrosion studies have typically involved deaerated solutions. This work addressed the effect of galvanic coupling on the corrosion current of electropolished nitinol in phosphate buffered saline and 0.9% sodium chloride under dearated and aerated conditions for times up to 24 h. Tests were performed on nitinol alone and coupled with MP35N in both the mechanically polished and passivated conditions. Aeration and galvanic coupling were found to have relatively little effect, indicating that the corrosion current is controlled by the anodic reaction. The current can be attributed entirely to Ni(2+) dissolution, which appears to be governed by solid-state mass transport of Ni(2+) through the passive oxide film. Because corrosion of EP nitinol is controlled by the anodic reaction, contact between EP nitinol and MP35N or other biomedical Co-Cr alloys is unlikely to result in significant galvanic effects in vivo. © 2015 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater, 104B: 1322-1327, 2016.

  1. Galvanic Cells and the Determination of Equilibrium Constants

    ERIC Educational Resources Information Center

    Brosmer, Jonathan L.; Peters, Dennis G.


    Readily assembled mini-galvanic cells can be employed to compare their observed voltages with those predicted from the Nernst equation and to determine solubility products for silver halides and overall formation constants for metal-ammonia complexes. Results obtained by students in both an honors-level first-year course in general chemistry and…

  2. Galvanic coupling transmission in intrabody communication: a finite element approach.


    Amparo Callejón, M; Reina-Tosina, Javier; Naranjo-Hernández, David; Roa, Laura M


    Galvanic coupling in intrabody communication (IBC) is a technique that couples low-power and low-frequency voltages and currents into the human body, which acts as a transmission medium, and thus constitutes a promising approach in the design of personal health devices. Despite important advances being made during recent years, the investigation of relevant galvanic IBC parameters, including the influence of human tissues and different electrode configurations, still requires further research efforts. The objective of this work is to disclose knowledge into IBC galvanic coupling transmission mechanisms by using a realistic 3-D finite element model of the human arm. Unlike other computational models for IBC, we have modeled the differential configuration of the galvanic coupling as a four-port network in order to analyze the electric field distribution and current density through different tissues. This has allowed us to provide an insight into signal transmission paths through the human body, showing them to be considerably dependent on variables such as frequency and inter-electrode distance. In addition, other important variables, for example bioimpedance and pathloss, have also been analyzed. Finally, experimental measurements were also carried out for the sake of validation, demonstrating the reliability of the model to emulate in general forms some of the behaviors observed in practice.

  3. 77 FR 17427 - Notice of Final Determination of Sales at Less Than Fair Value: Galvanized Steel Wire From Mexico

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... Steel Wire From Mexico AGENCY: Import Administration, International Trade Administration, Department of... fair value of galvanized steel wire (galvanized wire) from Mexico.\\1\\ \\1\\ See Galvanized Steel Wire... galvanized wire from Mexico is being, or is likely to be, sold in the United States at less than fair...

  4. Clinical Response of Tedizolid versus Linezolid in Acute Bacterial Skin and Skin Structure Infections by Severity Measure Using a Pooled Analysis From Two Phase 3 Double-Blind Trials.


    Sandison, Taylor; De Anda, Carisa; Fang, Edward; Das, Anita F; Prokocimer, Philippe


    Tedizolid phosphate is approved for the treatment of acute bacterial skin and skin structure infections (ABSSSI). In a pooled analysis of 1,333 ABSSSI patients from the ESTABLISH clinical trials, treatment with tedizolid or linezolid demonstrated similar early and posttherapy clinical responses in both non-severe and severe disease, irrespective of the parameters used to measure ABSSSI severity. Shorter 6-day treatment of ABSSSI, including severe infections, with tedizolid phosphate demonstrated comparable efficacy to 10-day treatment with linezolid.

  5. Simulation of the effect of photoprotective titanium dioxide (TiO2) and zinc oxide (ZnO) nanoparticles on the thermal response and optical characteristics of skin

    NASA Astrophysics Data System (ADS)

    Krasnikov, I. V.; Seteikin, A. Yu.; Popov, A. P.


    The thermal response of skin covered with a mixture of titanium dioxide (TiO2) and zinc oxide (ZnO) nanoparticles of optimal sizes and irradiated by sunlight has been calculated. The nanoparticles were rubbed into the skin for maximum protection against the incident radiation. The dependences of the temperature dynamics in different skin layers (corneal layer, epidermis, dermis) have been obtained and analyzed upon skin irradiation with light at a wavelength of 310-800 nm. It has been found that increasing light scattering and absorption due to the nanoparticles introduced into the corneal layer resulted in a decrease in the thermal load and penetration depth of the incident radiation.

  6. Evaluation of Galvanic Vestibular Stimulation System

    NASA Technical Reports Server (NTRS)

    Kofman, I. S.; Warren, E.; DeSoto, R.; Moroney, G.; Chastain, J.; De Dios, Y. E.; Gadd, N.; Taylor, L.; Peters, B. T.; Allen, E.; Reschke, M. F.; Bloomberg, J. J.; Mulavara, A. P.


    Microgravity exposure results in an adaptive central reinterpretation of information from multiple sensory sources to produce a sensorimotor state appropriate for motor actions in this unique environment, but this new adaptive state is no longer appropriate for the 1-g gravitational environment on Earth. During these gravitational transitions, astronauts experience deficits in both perceptual and motor functions including impaired postural control, disruption in spatial orientation, impaired control of locomotion that include alterations in muscle activation variability, modified lower limb kinematics, alterations in head-trunk coordination as well as reduced dynamic visual acuity. Post-flight changes in postural and locomotor control might have adverse consequences if a rapid egress was required following a long-duration mission, where support personnel may not be available to aid crewmembers. The act of emergency egress includes, but is not limited to standing, walking, climbing a ladder, jumping down, monitoring displays, actuating discrete controls, operating auxiliary equipment, and communicating with Mission Control and recovery teams while maintaining spatial orientation, mobility and postural stability in order to escape safely. The average time to recover impaired postural control and functional mobility to preflight levels of performance has been shown to be approximately two weeks after long-duration spaceflight. The postflight alterations are due in part to central reinterpretation of vestibular information caused by exposure to microgravity. In this study we will use a commonly used technique of transcutaneous electrical stimulation applied across the vestibular end organs (galvanic vestibular stimulation, GVS) to disrupt vestibular function as a simulation of post-flight disturbances. The goal of this project is an engineering human-in-the-loop evaluation of a device that can degrade performance of functional tasks (e.g. to maintain upright balance

  7. Antibody responses to 26 skin human papillomavirus types in the Netherlands, Italy and Australia.


    Waterboer, Tim; Neale, Rachel; Michael, Kristina M; Sehr, Peter; de Koning, Maurits N C; Weissenborn, Sönke J; Sampogna, Francesca; Abeni, Damiano; Green, Adele C; Bouwes Bavinck, Jan Nico; Pawlita, Michael


    Solar UV radiation is the main risk factor for cutaneous squamous cell carcinoma (SCC), but infections with skin human papillomavirus (HPV) types have also been linked to the development of SCC. Little is known about the natural history of these infections and whether the seroprevalence of skin HPV types is affected by ambient or individual levels of sun exposure. This study investigated this by analysing sera for antibodies to 26 skin HPV types from five phylogenetic genera obtained from 807 healthy individuals from the Netherlands, Italy and Australia, countries with strong differences in sunlight intensity. Overall HPV seroprevalence was similar across the three countries (50-57 % for beta-HPV types, 40-48 % for gamma-HPV types), and the most frequent beta-HPV and gamma-HPV types were the same in all countries. The highest seroprevalences for 24 of the 26 skin HPV types were observed in Italy (14 types) and Australia (ten types). Seroprevalence among men was generally higher than among women, and the male sex was significantly associated with both beta-HPV [odds ratio (OR) 2.81, 95 % confidence interval (CI) 1.64-4.82] and gamma-HPV (OR 2.42, 95 % CI 1.40-4.18) antibodies in Australia. The only measure of sun sensitivity or UV exposure significantly associated with skin HPV seroprevalence was found for weekend sun exposure in Australia and beta-HPV antibodies. It was concluded that type spectra and HPV seroprevalence are similar in countries with different sunlight intensity, and that levels of UV exposure do not play a strong role in the development of skin HPV antibodies in this study population.

  8. Developmental and Metabolic Plasticity of White-Skinned Grape Berries in Response to Botrytis cinerea during Noble Rot1[OPEN

    PubMed Central

    Collins, Thomas S.; Vicente, Ariel R.; Doyle, Carolyn L.; Ye, Zirou; Allen, Greg; Heymann, Hildegarde


    Noble rot results from exceptional infections of ripe grape (Vitis vinifera) berries by Botrytis cinerea. Unlike bunch rot, noble rot promotes favorable changes in grape berries and the accumulation of secondary metabolites that enhance wine grape composition. Noble rot-infected berries of cv Sémillon, a white-skinned variety, were collected over 3 years from a commercial vineyard at the same time that fruit were harvested for botrytized wine production. Using an integrated transcriptomics and metabolomics approach, we demonstrate that noble rot alters the metabolism of cv Sémillon berries by inducing biotic and abiotic stress responses as well as ripening processes. During noble rot, B. cinerea induced the expression of key regulators of ripening-associated pathways, some of which are distinctive to the normal ripening of red-skinned cultivars. Enhancement of phenylpropanoid metabolism, characterized by a restricted flux in white-skinned berries, was a common outcome of noble rot and red-skinned berry ripening. Transcript and metabolite analyses together with enzymatic assays determined that the biosynthesis of anthocyanins is a consistent hallmark of noble rot in cv Sémillon berries. The biosynthesis of terpenes and fatty acid aroma precursors also increased during noble rot. We finally characterized the impact of noble rot in botrytized wines. Altogether, the results of this work demonstrated that noble rot causes a major reprogramming of berry development and metabolism. This desirable interaction between a fruit and a fungus stimulates pathways otherwise inactive in white-skinned berries, leading to a greater accumulation of compounds involved in the unique flavor and aroma of botrytized wines. PMID:26450706

  9. Developmental and Metabolic Plasticity of White-Skinned Grape Berries in Response to Botrytis cinerea during Noble Rot.


    Blanco-Ulate, Barbara; Amrine, Katherine C H; Collins, Thomas S; Rivero, Rosa M; Vicente, Ariel R; Morales-Cruz, Abraham; Doyle, Carolyn L; Ye, Zirou; Allen, Greg; Heymann, Hildegarde; Ebeler, Susan E; Cantu, Dario


    Noble rot results from exceptional infections of ripe grape (Vitis vinifera) berries by Botrytis cinerea. Unlike bunch rot, noble rot promotes favorable changes in grape berries and the accumulation of secondary metabolites that enhance wine grape composition. Noble rot-infected berries of cv Sémillon, a white-skinned variety, were collected over 3 years from a commercial vineyard at the same time that fruit were harvested for botrytized wine production. Using an integrated transcriptomics and metabolomics approach, we demonstrate that noble rot alters the metabolism of cv Sémillon berries by inducing biotic and abiotic stress responses as well as ripening processes. During noble rot, B. cinerea induced the expression of key regulators of ripening-associated pathways, some of which are distinctive to the normal ripening of red-skinned cultivars. Enhancement of phenylpropanoid metabolism, characterized by a restricted flux in white-skinned berries, was a common outcome of noble rot and red-skinned berry ripening. Transcript and metabolite analyses together with enzymatic assays determined that the biosynthesis of anthocyanins is a consistent hallmark of noble rot in cv Sémillon berries. The biosynthesis of terpenes and fatty acid aroma precursors also increased during noble rot. We finally characterized the impact of noble rot in botrytized wines. Altogether, the results of this work demonstrated that noble rot causes a major reprogramming of berry development and metabolism. This desirable interaction between a fruit and a fungus stimulates pathways otherwise inactive in white-skinned berries, leading to a greater accumulation of compounds involved in the unique flavor and aroma of botrytized wines.

  10. Response of pigmented porcine skin (Sus scrofa domestica) to single 3.8-micron laser radiation pulses

    NASA Astrophysics Data System (ADS)

    Bostick, Anthony C.; Johnson, Thomas E.; Randolph, Donald Q.; Winston, Golda C. H.


    Background and purpose: The purpose of this study is to determine the impact of melanin on skin response to single 3.8 micron, eight microsecond laser pulses and the difference in lesion formation thresholds for input into laser safety standards. Williams et al., performed a study examining laser tissue interaction from 3.8-micron lasers in lightly pigmented Yorkshire pigs (Sus scrofa domestica). However, studies performed by Eggleston et al comparing pigmented and lightly pigmented skin with human skin found that the Yucatan mini-pig is a superior model for laser skin exposures. Methods: Five Yucatan mini-pigs under general anesthesia were exposed to 3.8 micron laser pulses ranging from 0.8 J/cm2 to 93 J/cm2. Gross examinations were done acutely and 24 hours after laser exposure. Skin biopsies were then collected at various times post exposure, and histologic examinations were conducted. Results: The 24 hour ED50 was determined to be 4.5 J/cm2 with fiducial limits of 6.2 and 2.2 J/cm2. As deposited energy was increased, the lesion presentation ranged from whitening of the epidermis (4 J/cm2) to whitening with inflammatory centers (14 J/cm2), and at the highest energy levels inflammatory areas were replaced with an epidermal ulcerated central area (>21 J/cm2). Conclusion: Preliminary findings suggest pigmentation or melanin may play a minor role in the mechanism of laser-tissue damage. The ED50 of Yorkshire pigs was 2.6 J/cm2. The ED50 of the Yucatan mini-pig was found to be 3.6 J/cm2, and although it was higher, it is still within the 95% fiducial limits.

  11. Dose response evaluation of gene expression profiles in the skin of K6/ODC mice exposed to sodium arsenite

    SciTech Connect

    Ahlborn, Gene J.; Nelson, Gail M.; Ward, William O.; Knapp, Geremy; Allen, James W.; Ouyang Ming; Roop, Barbara C.; Chen Yan; O'Brien, Thomas; Kitchin, Kirk T.; Delker, Don A.


    Chronic drinking water exposure to inorganic arsenic and its metabolites increases tumor frequency in the skin of K6/ODC transgenic mice. To identify potential biomarkers and modes of action for this skin tumorigenicity, we characterized gene expression profiles from analysis of K6/ODC mice administered 0, 0.05, 0.25, 1.0 and 10 ppm sodium arsenite in their drinking water for 4 weeks. Following exposure, total RNA was isolated from mouse skin and processed to biotin-labeled cRNA for microarray analyses. Skin gene expression was analyzed with Affymetrix Mouse Genome 430A 2.0 GeneChips (registered) , and pathway analysis was conducted with DAVID (NIH), Ingenuity (registered) Systems and MetaCore's GeneGo. Differential expression of several key genes was verified through qPCR. Only the highest dose (10 ppm) resulted in significantly altered KEGG (Kyoto Encyclopedia of Genes and Genomes) pathways, including MAPK, regulation of actin cytoskeleton, Wnt, Jak-Stat, Tight junction, Toll-like, phosphatidylinositol and insulin signaling pathways. Approximately 20 genes exhibited a dose response, including several genes known to be associated with carcinogenesis or tumor progression including cyclin D1, CLIC4, Ephrin A1, STAT3 and DNA methyltransferase 3a. Although transcription changes in all identified genes have not previously been linked to arsenic carcinogenesis, their association with carcinogenesis in other systems suggests that these genes may play a role in the early stages of arsenic-induced skin carcinogenesis and can be considered potential biomarkers.

  12. Delayed-type hypersensitivity, contact sensitivity, and phytohemagglutinin skin-test responses of heat- and cold-stressed calves.


    Kelley, K W; Greenfield, R E; Evermann, J F; Parish, S M; Perryman, L E


    Three-week-old Holstein bull calves were used to investigate the effect of a 2-week chronic heat (35 C) or cold (-5 C) exposure on delayed-type hypersensitivity (DTH) reactions to purified protein derivative after sensitization with heat-killed Mycobacterium tuberculosis, contact sensitivity (CS) reactions to 1-fluoro-2,4-dinitrobenzene, and phytohemagglutinin (PHA) skin tests. Heat exposure reduced expression of DTH reactions by 42% and CS reactions by 38% at 24 hours after elicitation of the responses. The PHA-induced skin tests were not affected after 1 week of heat exposure, but this reaction was reduced by 20% after 2 weeks of heat exposure. The immune response of calves exposed to cold air temperatures was more complex. Cold exposure suppressed CS reactions by 39% at the end of both the 1st and 2nd weeks. The PHA response was reduced by 39% after 2 weeks of cold exposure. The DTH response depended on duration of cold exposure. The DTH reaction was increased by 42% after 1 week, but was reduced by 14% after 2 weeks. These data are consistent with the hypothesis that environmental stressors alter host resistance by affecting the immune system. Furthermore, these stress-induced changes in immune events depend on the type of immune response, the nature of the environmental stressor, and the length of time that calves are exposed to the stressor.

  13. Optical coherence tomography microangiography for monitoring the response of vascular perfusion to external pressure on human skin tissue

    NASA Astrophysics Data System (ADS)

    Choi, Woo June; Wang, Hequn; Wang, Ruikang K.


    Characterization of the relationship between external pressure and blood flow is important in the examination of pressure-induced disturbance in tissue microcirculation. Optical coherence tomography (OCT)-based microangiography is a promising imaging technique, capable of providing the noninvasive extraction of functional vessels within the skin tissue with capillary-scale resolution. Here, we present a feasibility study of OCT microangiography (OMAG) to evaluate changes in blood perfusion in response to externally applied pressure on human skin tissue in vivo. External force is loaded normal to the tissue surface at the nailfold region of a healthy human volunteer. An incremental force is applied step by step and then followed by an immediate release. Skin perfusion events including baseline are continuously imaged by OMAG, allowing for visualization and quantification of the capillary perfusion in the nailfold tissue. The tissue strain maps are simultaneously evaluated through the available OCT structural images to assess the relationship of the microcirculation response to the applied pressure. The results indicate that the perfusion progressively decreases with the constant increase of pressure. Reactive hyperemia occurs right after the removal of the pressure. The perfusion returns to the baseline level after a few minutes. These findings suggest that OMAG may have great potential for quantitatively assessing tissue microcirculation in the locally pressed tissue in vivo.

  14. Adipose Tissue-Derived Mesenchymal Stem Cells Increase Skin Allograft Survival and Inhibit Th-17 Immune Response

    PubMed Central

    Larocca, Rafael Assumpção; Moraes-Vieira, Pedro Manoel; Bassi, Ênio José; Semedo, Patrícia; de Almeida, Danilo Candido; da Silva, Marina Burgos; Thornley, Thomas; Pacheco-Silva, Alvaro; Câmara, Niels Olsen Saraiva


    Adipose tissue-derived mesenchymal stem cells (ADSC) exhibit immunosuppressive capabilities both in vitro and in vivo. Their use for therapy in the transplant field is attractive as they could render the use of immunosuppressive drugs unnecessary. The aim of this study was to investigate the effect of ADSC therapy on prolonging skin allograft survival. Animals that were treated with a single injection of donor allogeneic ADSC one day after transplantation showed an increase in donor skin graft survival by approximately one week. This improvement was associated with preserved histological morphology, an expansion of CD4+ regulatory T cells (Treg) in draining lymph nodes, as well as heightened IL-10 expression and down-regulated IL-17 expression. In vitro, ADSC inhibit naïve CD4+ T cell proliferation and constrain Th-1 and Th-17 polarization. In summary, infusion of ADSC one day post-transplantation dramatically increases skin allograft survival by inhibiting the Th-17 pathogenic immune response and enhancing the protective Treg immune response. Finally, these data suggest that ADSC therapy will open new opportunities for promoting drug-free allograft survival in clinical transplantation. PMID:24124557

  15. Skin response to a carcinogen involves the xenobiotic receptor pregnane X receptor.


    Elentner, Andreas; Ortner, Daniela; Clausen, Björn; Gonzalez, Frank J; Fernández-Salguero, Pedro M; Schmuth, Matthias; Dubrac, Sandrine


    Skin is in daily contact with potentially harmful molecules from the environment such as cigarette smoke, automobile emissions, industrial soot and groundwater. Pregnane X receptor (PXR) is a transcription factor expressed in liver and intestine that is activated by xenobiotic chemicals including drugs and environmental pollutants. Topical application of the tumor initiator 7,12-dimethylbenz(a)anthracene (DMBA) enhances Pxr, Cyp1a1, Cyp1b1 and Cyp3a11, but not Ahr expression in the skin. Surprisingly, DMBA-induced Pxr upregulation is largely impaired in Langerin(+) cell-depleted skin, suggesting that DMBA mainly triggers Pxr in Langerin(+) cells. Furthermore, PXR deficiency protects from DNA damage in epidermal cells but to a lesser extent than aryl hydrocarbon receptor (AHR) deficiency. Interestingly, skin exposure to low doses of DMBA induces migration of PXR-deficient but not of wild-type and AHR-deficient Langerhans cells (LCs). PXR-humanized mice show a marked increase in DNA damage to epidermal cells after topical application of DMBA, demonstrating relevance of these findings in human tissue. This is the first report suggesting that carcinogens might trigger PXR in epidermal cells, particularly in LCs, thus leading to DNA damage. Further studies are required to better delineate the role of PXR in cutaneous carcinogenesis.

  16. Transcriptomic Analysis of Host Immune Response in the Skin of Chickens Infected with Marek's Disease Virus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Marek’s disease virus, a highly cell-associated oncogenic 'alpha-herpesvirus, is the causative agent of a T cell lymphoma and neuropathic disease called Marek’s disease. The skin is the only anatomical site where infectious enveloped cell-free virions are produced and shed into the environment. Stud...

  17. Surface Lipids as Multifunctional Mediators of Skin Responses to Environmental Stimuli

    PubMed Central

    De Luca, Chiara; Valacchi, Giuseppe


    Skin surface lipid (SSL) film is a mixture of sebum and keratinocyte membrane lipids, protecting skin from environment. Its composition is unique for the high percentage of long chain fatty acids, and of the polyterpenoid squalene, absent in other human tissues, and in non-human Primates sebum. Here, the still incomplete body of information on SSL as mediators of external chemical, physical, and microbial signals and stressors is revised, focusing on the central event of the continuous oxidative modification induced by the metabolic activity of residential and pathological microbial flora, natural or iatrogenic UV irradiation, exposure to chemicals and cosmetics. Once alpha-tocopherol and ubiquinol-10 antioxidant defences of SSL are overcome, oxidation of squalene and cholesterol gives rise to reactive by-products penetrating deeper into skin layers, to mediate local defensive inflammatory, photo-protective, immune reactions or, at higher concentrations, inducing local but also systemic immune depression, ultimately implicating skin cancerogenesis. Qualitative modifications of SSL represent a pathogenetic sign of diagnostic value in dermatological disorders involving altered sebum production, like pytiriasis versicolor, acne, atopic or seborrheic dermatitis, as well as photo-aging. Achievements of nutriceutical interventions aimed at restoring normal SSL composition and homeostasis are discussed, as feasible therapeutic goals and major means of photo-protection. PMID:20981292

  18. Surface lipids as multifunctional mediators of skin responses to environmental stimuli.


    De Luca, Chiara; Valacchi, Giuseppe


    Skin surface lipid (SSL) film is a mixture of sebum and keratinocyte membrane lipids, protecting skin from environment. Its composition is unique for the high percentage of long chain fatty acids, and of the polyterpenoid squalene, absent in other human tissues, and in non-human Primates sebum. Here, the still incomplete body of information on SSL as mediators of external chemical, physical, and microbial signals and stressors is revised, focusing on the central event of the continuous oxidative modification induced by the metabolic activity of residential and pathological microbial flora, natural or iatrogenic UV irradiation, exposure to chemicals and cosmetics. Once alpha-tocopherol and ubiquinol-10 antioxidant defences of SSL are overcome, oxidation of squalene and cholesterol gives rise to reactive by-products penetrating deeper into skin layers, to mediate local defensive inflammatory, photo-protective, immune reactions or, at higher concentrations, inducing local but also systemic immune depression, ultimately implicating skin cancerogenesis. Qualitative modifications of SSL represent a pathogenetic sign of diagnostic value in dermatological disorders involving altered sebum production, like pytiriasis versicolor, acne, atopic or seborrheic dermatitis, as well as photo-aging. Achievements of nutriceutical interventions aimed at restoring normal SSL composition and homeostasis are discussed, as feasible therapeutic goals and major means of photo-protection.

  19. Dextran hydrogel scaffolds enhance angiogenic responses and promote complete skin regeneration during burn wound healing.


    Sun, Guoming; Zhang, Xianjie; Shen, Yu-I; Sebastian, Raul; Dickinson, Laura E; Fox-Talbot, Karen; Reinblatt, Maura; Steenbergen, Charles; Harmon, John W; Gerecht, Sharon


    Neovascularization is a critical determinant of wound-healing outcomes for deep burn injuries. We hypothesize that dextran-based hydrogels can serve as instructive scaffolds to promote neovascularization and skin regeneration in third-degree burn wounds. Dextran hydrogels are soft and pliable, offering opportunities to improve the management of burn wound treatment. We first developed a procedure to treat burn wounds on mice with dextran hydrogels. In this procedure, we followed clinical practice of wound excision to remove full-thickness burned skin, and then covered the wound with the dextran hydrogel and a dressing layer. Our procedure allows the hydrogel to remain intact and securely in place during the entire healing period, thus offering opportunities to simplify the management of burn wound treatment. A 3-week comparative study indicated that dextran hydrogel promoted dermal regeneration with complete skin appendages. The hydrogel scaffold facilitated early inflammatory cell infiltration that led to its rapid degradation, promoting the infiltration of angiogenic cells into the healing wounds. Endothelial cells homed into the hydrogel scaffolds to enable neovascularization by day 7, resulting in an increased blood flow significantly greater than treated and untreated controls. By day 21, burn wounds treated with hydrogel developed a mature epithelial structure with hair follicles and sebaceous glands. After 5 weeks of treatment, the hydrogel scaffolds promoted new hair growth and epidermal morphology and thickness similar to normal mouse skin. Collectively, our evidence shows that customized dextran-based hydrogel alone, with no additional growth factors, cytokines, or cells, promoted remarkable neovascularization and skin regeneration and may lead to novel treatments for dermal wounds.

  20. Skin Diseases: Skin Health and Skin Diseases


    Skip Navigation Bar Home Current Issue Past Issues Skin Diseases Skin Health and Skin Diseases Past Issues / Fall 2008 Table of Contents ... acne to wrinkles Did you know that your skin is the largest organ of your body? It ...

  1. The response of human skin commensal bacteria as a reflection of UV radiation: UV-B decreases porphyrin production.


    Wang, Yanhan; Zhu, Wenhong; Shu, Muya; Jiang, Yong; Gallo, Richard L; Liu, Yu-Tsueng; Huang, Chun-Ming


    Recent global radiation fears reflect the urgent need for a new modality that can simply determine if people are in a radiation risk of developing cancer and other illnesses. Ultraviolet (UV) radiation has been thought to be the major risk factor for most skin cancers. Although various biomarkers derived from the responses of human cells have been revealed, detection of these biomarkers is cumbersome, probably requires taking live human tissues, and varies significantly depending on human immune status. Here we hypothesize that the reaction of Propionibacterium acnes (P. acnes), a human resident skin commensal, to UV radiation can serve as early surrogate markers for radiation risk because the bacteria are immediately responsive to radiation. In addition, the bacteria can be readily accessible and exposed to the same field of radiation as human body. To test our hypothesis, P. acnes was exposed to UV-B radiation. The production of porphyrins in P. acnes was significantly reduced with increasing doses of UV-B. The porphyrin reduction can be detected in both P. acnes and human skin bacterial isolates. Exposure of UV-B to P. acnes- inoculated mice led to a significant decrease in porphyrin production in a single colony of P. acnes and simultaneously induced the formation of cyclobutane pyrimidine dimers (CPD) in the epidermal layers of mouse skin. Mass spectrometric analysis via a linear trap quadrupole (LTQ)-Orbitrap XL showed that five peptides including an internal peptide (THLPTGIVVSCQNER) of a peptide chain release factor 2 (RF2) were oxidized by UV-B. Seven peptides including three internal peptides of 60 kDa chaperonin 1 were de-oxidized by UV-B. When compared to UV-B, gamma radiation also decreased the porphyrin production of P. acnes in a dose-dependent manner, but induced a different signature of protein oxidation/de-oxidation. We highlight that uncovering response of skin microbiome to radiation will facilitate the development of pre-symptomatic diagnosis

  2. The Response of Human Skin Commensal Bacteria as a Reflection of UV Radiation: UV-B Decreases Porphyrin Production

    PubMed Central

    Wang, Yanhan; Zhu, Wenhong; Shu, Muya; Jiang, Yong; Gallo, Richard L.; Liu, Yu-Tsueng; Huang, Chun-Ming


    Recent global radiation fears reflect the urgent need for a new modality that can simply determine if people are in a radiation risk of developing cancer and other illnesses. Ultraviolet (UV) radiation has been thought to be the major risk factor for most skin cancers. Although various biomarkers derived from the responses of human cells have been revealed, detection of these biomarkers is cumbersome, probably requires taking live human tissues, and varies significantly depending on human immune status. Here we hypothesize that the reaction of Propionibacterium acnes (P. acnes), a human resident skin commensal, to UV radiation can serve as early surrogate markers for radiation risk because the bacteria are immediately responsive to radiation. In addition, the bacteria can be readily accessible and exposed to the same field of radiation as human body. To test our hypothesis, P. acnes was exposed to UV-B radiation. The production of porphyrins in P. acnes was significantly reduced with increasing doses of UV-B. The porphyrin reduction can be detected in both P. acnes and human skin bacterial isolates. Exposure of UV-B to P. acnes- inoculated mice led to a significant decrease in porphyrin production in a single colony of P. acnes and simultaneously induced the formation of cyclobutane pyrimidine dimers (CPD) in the epidermal layers of mouse skin. Mass spectrometric analysis via a linear trap quadrupole (LTQ)-Orbitrap XL showed that five peptides including an internal peptide (THLPTGIVVSCQNER) of a peptide chain release factor 2 (RF2) were oxidized by UV-B. Seven peptides including three internal peptides of 60 kDa chaperonin 1 were de-oxidized by UV-B. When compared to UV-B, gamma radiation also decreased the porphyrin production of P. acnes in a dose-dependent manner, but induced a different signature of protein oxidation/de-oxidation. We highlight that uncovering response of skin microbiome to radiation will facilitate the development of pre-symptomatic diagnosis

  3. Galvanic corrosion behaviour of aluminium 3004 and copper in tropical marine atmosphere

    NASA Astrophysics Data System (ADS)

    Subramanian, G.; Palraj, S.; Palanichamy, S.


    The galvanic corrosion behaviour of aluminium 3004 and copper with different area ratios were studied in the tropical marine atmosphere at Tuticorin harbour over a period of 426 days. The area ratios of A Al: A Cu, studied were 1:1, 1:2, 1:4, 1:8, 2:1, 4:1 & 8:1. The galvanic corrosion behaviour of metals was studied in terms of relative increase in the corrosion rate of aluminium due to galvanic coupling with copper, relative decrease in the corrosion rate of copper due to galvanic coupling with aluminium, and the susceptibility of aluminium to pitting owing to galvanic coupling with copper. The galvanic potential and galvanic current of the system were monitored. Pits of different dimensions ranging from mild etchings to perforations were experienced on the borders and the surfaces of the interface of aluminium in contact with copper. The weathering parameters and the environmental pollutants which have a major role in influencing the galvanic corrosion of metals were also monitored. The corrosion products resulting from galvanic corrosion were analysed using XRD and the pitting on aluminium resulting from galvanic corrosion has been highlighted in terms of pit depth, size and density of pit, using a high resolution microscope.

  4. Functional stochastic resonance in human baroreflex induced by 1/f-type noisy galvanic vestibular stimulation

    NASA Astrophysics Data System (ADS)

    Soma, Rika; Kwak, Shin; Yamamoto, Yoshiharu


    We hypothesized that 1/f noise is more beneficial than the conventional white noise in optimizing the brain's response to a weak input signal, and showed that externally added 1/f noise outperforms white noise in sensitizing human baroreflex centers in the brain. We examined the compensatory heart rate response to weak periodic signal introduced at the venous blood pressure receptor, while adding either 1/f or white noise with the same variance to the brain stem by electrically stimulating the bilateral vestibular afferents cutaneously. This stochastic galvanic vestibular stimulation, activating the vestibulo-sympathetic pathway in the brain stem, optimized covariance between weak input signals and the heart rate responses both with 1/f and white noise. Further, the optimal noise level with 1/f noise was significantly lower than that with white noise, suggesting the functional benefit of 1/f noise for the neuronal information transfer in the brain.

  5. Histological assessment of cellular immune response to the phytohemagglutinin skin test in Brazilian free-tailed bats (Tadarida brasiliensis).


    Turmelle, Amy S; Ellison, James A; Mendonça, Mary T; McCracken, Gary F


    Bats are known reservoirs for numerous emerging infectious diseases, occupy unique ecological niches, and occur globally except for Antarctica. Given their impact on human and agricultural health, it is critical to understand the mechanisms underlying immunocompetence in this reservoir host. To date, few studies have examined immune function in the Order Chiroptera, particularly among natural colonies of bats. The phytohemagglutinin (PHA) skin test has been widely used to measure delayed-type cellular immune response in a wide variety of vertebrates, and has been routinely employed in immunoecological studies. Although this test is frequently described as a measure of T cell proliferation, recent studies indicate it may represent a combination of immune responses. In mammals, the immune response is differentially, temporally and spatially regulated, therefore, we characterized the infiltrating leukocyte response to the PHA skin test in bats by examining a time-series of histological sections from PHA and saline injection areas in 41 Brazilian free-tailed bats (Tadarida brasiliensis). Results suggest that bats exhibit diverse leukocyte traffic within 6 h, and up to 24 h following subcutaneous PHA injection. There was a significant presence of lymphocytes and neutrophils, as well as eosinophils, basophils, and macrophages observed in the PHA-injected tissues, compared with saline-injected control tissues. We observed a highly significant negative correlation between the number of lymphocytes and neutrophils in PHA-injected tissue, with peak lymphocyte response at 12 h, and peak neutrophil response at 24 h post-injection. These results indicate substantial variation in the immune response of individuals, and may aid our understanding of disease emergence in natural populations of bats.

  6. Preslaughter diet management in sheep and goats: effects on physiological responses and microbial loads on skin and carcass

    PubMed Central


    Sixteen crossbred buck goats (Kiko x Spanish; BW = 32.8 kg) and wether sheep (Dorset x Suffolk; BW = 39.9 kg) were used to determine the effect of preslaughter diet and feed deprivation time (FDT) on physiological responses and microbial loads on skin and carcasses. Experimental animals were fed either a concentrate (CD) or a hay diet (HD) for 4 d and then deprived of feed for either 12-h or 24-h before slaughter. Blood samples were collected for plasma cortisol and blood metabolite analyses. Longisimus muscle (LM) pH was measured. Skin and carcass swabs were obtained to assess microbial loads. Plasma creatine kinase activity (863.9 and 571.7 ± 95.21 IU) and non-esterified fatty acid concentrations (1,056.1 and 589.8 ± 105.01 mEq/L) were different (P < 0.05) between sheep and goats. Species and diet treatments had significant effects on the ultimate pH of LM. Pre-holding total coliform (TCC) and aerobic plate counts (APC) of skin were significantly different between species. Goats had lower (P < 0.05) TCC (2.1 vs. 3.0 log10 CFU/cm2) and APC (8.2 vs. 8.5 log10 CFU/cm2) counts in the skin compared to sheep. Preslaughter skin E. coli counts and TCC were different (P < 0.05) between species. Goats had lower (P < 0.05) counts of E. coli (2.2 vs. 2.9 log10 CFU/cm2) and TCC (2.3 vs. 3.0 log10 CFU/cm2) in the skin compared with those in sheep. Diet, species, and FDT had no effect (P > 0.05) on E. coli and TCC in carcass swab samples. The APC of carcass swab samples were only affected (P < 0.05) by the FDT. The results indicated that preslaughter dietary management had no significant changes on hormone and blood metabolite concentrations and sheep might be more prone for fecal contamination than goats in the holding pens at abattoir. PMID:25343027

  7. Preslaughter diet management in sheep and goats: effects on physiological responses and microbial loads on skin and carcass.


    Kannan, Govind; Gutta, Venkat R; Lee, Jung Hoon; Kouakou, Brou; Getz, Will R; McCommon, George W


    Sixteen crossbred buck goats (Kiko x Spanish; BW = 32.8 kg) and wether sheep (Dorset x Suffolk; BW = 39.9 kg) were used to determine the effect of preslaughter diet and feed deprivation time (FDT) on physiological responses and microbial loads on skin and carcasses. Experimental animals were fed either a concentrate (CD) or a hay diet (HD) for 4 d and then deprived of feed for either 12-h or 24-h before slaughter. Blood samples were collected for plasma cortisol and blood metabolite analyses. Longisimus muscle (LM) pH was measured. Skin and carcass swabs were obtained to assess microbial loads. Plasma creatine kinase activity (863.9 and 571.7 ± 95.21 IU) and non-esterified fatty acid concentrations (1,056.1 and 589.8 ± 105.01 mEq/L) were different (P < 0.05) between sheep and goats. Species and diet treatments had significant effects on the ultimate pH of LM. Pre-holding total coliform (TCC) and aerobic plate counts (APC) of skin were significantly different between species. Goats had lower (P < 0.05) TCC (2.1 vs. 3.0 log10 CFU/cm(2)) and APC (8.2 vs. 8.5 log10 CFU/cm(2)) counts in the skin compared to sheep. Preslaughter skin E. coli counts and TCC were different (P < 0.05) between species. Goats had lower (P < 0.05) counts of E. coli (2.2 vs. 2.9 log10 CFU/cm(2)) and TCC (2.3 vs. 3.0 log10 CFU/cm(2)) in the skin compared with those in sheep. Diet, species, and FDT had no effect (P > 0.05) on E. coli and TCC in carcass swab samples. The APC of carcass swab samples were only affected (P < 0.05) by the FDT. The results indicated that preslaughter dietary management had no significant changes on hormone and blood metabolite concentrations and sheep might be more prone for fecal contamination than goats in the holding pens at abattoir.

  8. Fluoxetine Ameliorates Atopic Dermatitis-Like Skin Lesions in BALB/c Mice through Reducing Psychological Stress and Inflammatory Response

    PubMed Central

    Li, Yanxi; Chen, Long; Du, Yehong; Huang, Daochao; Han, Huili; Dong, Zhifang


    Atopic dermatitis (AD) is a common chronic inflammatory skin disorder, and patients with AD suffer from severe psychological stress, which markedly increases the prevalence rate of depression and anxiety disorders in later life. Fluoxetine, a selective serotonin reuptake inhibitor, has recently been reported to exert anti-inflammatory and immunosuppressive effects. However, it is unclear whether fluoxetine is effective in the treatment of AD through reducing psychological stress and inflammatory reaction. Here, we reported that a BALB/c mouse model of AD was induced by application of 2,4-dinitrochlorobenzene (DNCB) onto hairless dorsal skin. Chronic fluoxetine treatment (10 mg/kg per day, i.p.) significantly attenuated AD-like symptoms, as reflected by a dramatic decrease in scratching bouts, as well as a decrease in anxiety- and depressive-like behaviors. Furthermore, these behavioral changes were accompanied by a significant decrease in epidermal thickness, the number of mast cells in skin tissue, mRNA levels of interleukin-4 (IL-4) and IL-13 in the spleen, as well as serum immunoglobulin E (IgE) in the DNCB-treated mice by treatment with fluoxetine. Taken together, these results indicate that fluoxetine may suppress psychological stress and inflammatory response during AD development, and subsequently ameliorate AD symptoms, suggesting that fluoxetine may be a potential therapeutic agent against AD in clinic. PMID:27679577

  9. Molecular responses to photogenotoxic stress induced by the antibiotic lomefloxacin in human skin cells: from DNA damage to apoptosis.


    Marrot, Laurent; Belaïdi, Jean Phillipe; Jones, Christophe; Perez, Phillipe; Riou, Lydia; Sarasin, Alain; Meunier, Jean Roch


    Photo-unstable chemicals sometimes behave as phototoxins in skin, inducing untoward clinical side-effects when exposed to sunlight. Some drugs, such as psoralens or fluoroquinolones, can damage genomic DNA, thus increasing the risk of photocarcinogenesis. Here, lomefloxacin, an antibiotic from the fluoroquinolone family known to be involved in skin tumor development in photoexposed mice, was studied using normal human skin cells in culture: fibroblasts, keratinocytes, and Caucasian melanocytes. When treated cells were exposed to simulated solar ultraviolet A (320-400 nm), lomefloxacin induced damage such as strand breaks and pyrimidine dimers in genomic DNA. Lomefloxacin also triggered various stress responses: heme-oxygenase-1 expression in fibroblasts, changes in p53 status as shown by the accumulation of p53 and p21 proteins or the induction of MDM2 and GADD45 genes, and stimulation of melanogenesis by increasing the tyrosinase activity in melanocytes. Lomefloxacin could also lead to apoptosis in keratinocytes exposed to ultraviolet A: caspase-3 was activated and FAS-L gene was induced. Moreover, keratinocytes were shown to be the most sensitive cell type to lomefloxacin phototoxic effects, in spite of the well-established effectiveness of their antioxidant equipment. These data show that the phototoxicity of a given drug can be driven by different mechanisms and that its biologic impact varies according to cell type.

  10. Mucous cell responses in gill and skin of brown trout Salmo trutta fario in acidic, aluminium-containing stream water.


    Ledy, K; Giambérini, L; Pihan, J C


    Morphometric examination was carried out on the gills and skin of wild and caged hatchery brown trout Salmo trutta fario in an acidic (pH 4.9 to 5.4; Al 203 to 250 microg l(-1)) and in a non-acidic (pH 6.7 to 7.0; Al 27 to 67 microg l(-1)) stream in the Vosges Mountains (NE France) to assess the sublethal effects of acidic water on the mucous cell response. The caged fish were randomly collected after 2, 4, 7 and 11 d and the wild fish were obtained by electrofishing. After 2 d, a reduction of both mucous cell (MC) number and size was observed in the gills of fish held in the acidic stream, suggesting a massive mucus discharge. Hyperplasia and hypertrophy of cells immediately followed this mucus secretion. In the same fish population, skin examination showed a slight and delayed decrease of MC number but a significant increase of cell size. The number of mucous cells of gills and skin was similar in both wild trout populations, whereas a significant MC hypertrophy was observed in the wild fish of the acidic stream. The present field experiment indicates that caged fish could be useful as early indicators of acidification. In addition, the examination of wild populations suggested the occurrence of adaptive mechanisms, information that might be of importance in the context of river recovery programs.

  11. Keratin 17 promotes epithelial proliferation and tumor growth by polarizing the immune response in skin

    PubMed Central

    DePianto, Daryle; Kerns, Michelle; Dlugosz, Andrzej A.; Coulombe, Pierre A.


    Basaloid skin tumors, including basal cell carcinoma (BCC) and basaloid follicular hamartoma (BFH), are associated with aberrant Hedgehog (Hh) signaling1 and, in the case of BCC, an expanding set of genetic variants including keratin 5 (K5)2, an intermediate filament-forming protein. We show that genetic ablation of keratin 17 (K17) protein, which is induced in basaloid skin tumors3,4 and co-polymerizes with K5 in vivo5, delays BFH tumor initiation and growth in mice with constitutive Hh signaling in epidermis6,7. The delay is preceded by reduced inflammation and a polarization of inflammatory cytokines from a Th1/Th17- to a Th2-dominated profile. Absence of K17 also attenuates hyperplasia and inflammation in a model of acute dermatitis. Re-expression of K17 in Gli2tg K17−/− keratinocytes induces select Th1 chemokines with established roles in BCC. Our findings establish a novel immunomodulatory role for K17 in Hh-driven basaloid skin tumors that could impact additional tumor settings, psoriasis, and wound repair. PMID:20871598

  12. Dynamics of thermographic skin temperature response during squat exercise at two different speeds.


    Formenti, Damiano; Ludwig, Nicola; Trecroci, Athos; Gargano, Marco; Michielon, Giovanni; Caumo, Andrea; Alberti, Giampietro


    Low intensity resistance training with slow movement and tonic force generation has been shown to create blood flow restriction within muscles that may affect thermoregulation through the skin. We aimed to investigate the influence of two speeds of exercise execution on skin temperature dynamics using infrared thermography. Thirteen active males performed randomly two sessions of squat exercise (normal speed, 1s eccentric/1s concentric phase, 1s; slow speed, 5s eccentric/5s concentric phase, 5s), using ~50% of 1 maximal repetition. Thermal images of ST above muscles quadriceps were recorded at a rate of 0.05Hz before the exercise (to determine basal ST) and for 480s following the initiation of the exercise (to determine the nonsteady-state time course of ST). Results showed that ST changed more slowly during the 5s exercise (p=0.002), whereas the delta (with respect to basal) excursions were similar for the two exercises (p>0.05). In summary, our data provided a detailed nonsteady-state portrait of ST changes following squat exercises executed at two different speeds. These results lay the basis for further investigations entailing the joint use of infrared thermography and Doppler flowmetry to study the events taking place both at the skin and the muscle level during exercises executed at slow speed.

  13. Epidermal growth factor receptor inhibitors trigger a type I interferon response in human skin

    PubMed Central

    Pastore, Saveria


    The Epidermal Growth Factor Receptor (EGFR) is centrally involved in the regulation of key processes of the epithelia, including cell proliferation, survival, differentiation, and also tumorigenesis. Humanized antibodies and small-molecule inhibitors targeting EGFR were developed to disrupt these functions in cancer cells and are currently used in the treatment of diverse metastatic epithelial cancers. By contrast, these drugs possess significant skin-specific toxic effects, comprising the establishment of a persistent inflammatory milieu. So far, the molecular mechanisms underlying these epiphenomena have been investigated rather poorly. Here we showed that keratinocytes respond to anti-EGFR drugs with the development of a type I interferon molecular signature. Upregulation of the transcription factor IRF1 is early implicated in the enhanced expression of interferon-kappa, leading to persistent activation of STAT1 and further amplification of downstream interferon-induced genes, including anti-viral effectors and chemokines. When anti-EGFR drugs are associated to TNF-α, whose expression is enhanced by the drugs themselves, all these molecular events undergo a dramatic enhancement by synergy mechanisms. Finally, high levels of interferon-kappa can be observed in epidermal keratinocytes and also in leukocytes infiltrating the upper dermis of cetuximab-driven skin lesions. Our data suggest that dysregulated activation of type I interferon innate immunity is implicated in the molecular processes triggered by anti-EGFR drugs and leading to persistent skin inflammation. PMID:27322144

  14. Functional response of novel bioprotective poloxamer-structured vesicles on inflamed skin.


    Caddeo, Carla; Manca, Maria Letizia; Matos, Maria; Gutierrez, Gemma; Díez-Sales, Octavio; Peris, José Esteban; Usach, Iris; Fernàndez-Busquets, Xavier; Fadda, Anna Maria; Manconi, Maria


    Resveratrol and gallic acid, a lipophilic and a hydrophilic phenol, were co-loaded in innovative, biocompatible nanovesicles conceived for ensuring the protection of the skin from oxidative- and inflammatory-related affections. The basic vesicles, liposomes and glycerosomes, were produced by a simple, one-step method involving the dispersion of phospholipid and phenols in water or water/glycerol blend, respectively. Liposomes and glycerosomes were modified by the addition of poloxamer, a stabilizer and viscosity enhancer, thus obtaining viscous or semisolid dispersions of structured vesicles. The vesicles were spherical, unilamellar and small in size (~70 nm in diameter). The superior ability of the poloxamer-structured vesicles to promote the accumulation of both phenols in the skin was demonstrated, as well as their low toxicity and great ability to protect fibroblasts from chemically-induced oxidative damage. The in vivo administration of the vesicular phenols on TPA (phorbol ester)-exposed skin led to a significant reduction of oedema and leukocyte infiltration.

  15. Assessment of skin barrier function and biochemical changes of ex vivo human skin in response to physical and chemical barrier disruption.


    Döge, Nadine; Avetisyan, Araks; Hadam, Sabrina; Pfannes, Eva Katharina Barbosa; Rancan, Fiorenza; Blume-Peytavi, Ulrike; Vogt, Annika


    Topical dermatotherapy is intended to be used on diseased skin. Novel drug delivery systems even address differences between intact and diseased skin underlining the need for pre-clinical assessment of different states of barrier disruption. Herein, we studied how short-term incubation in culture media compared to incubation in humidified chambers affects human skin barrier function and viability. On both models we assessed different types and intensities of physical and chemical barrier disruption methods with regard to structural integrity, biophysical parameters and cytokine levels. Tissue degeneration and proliferative activity limited the use of tissue cultures to 48h. Viability is better preserved in cultured tissue. Tape-stripping (50×TS) and 4h sodium lauryl sulfate (SLS) pre-treatment were identified as highly reproducible and effective procedures for barrier disruption. Transepidermal water loss (TEWL) values reproducibly increased with the intensity of disruption while sebum content and skin surface pH were of limited value. Interleukin (IL)-6/8 and various chemokines and proteases were increased in tape-stripped skin which was more pronounced in SLS-treated skin tissue extracts. Thus, albeit limited to 48h, cultured full-thickness skin maintained several barrier characteristics and responded to different intensities of barrier disruption. Potentially, these models can be used to assess pre-clinically the efficacy and penetration of anti-inflammatory compounds.

  16. Protein Kinases and Transcription Factors Activation in Response to UV-Radiation of Skin: Implications for Carcinogenesis

    PubMed Central

    López-Camarillo, César; Ocampo, Elena Aréchaga; Casamichana, Mavil López; Pérez-Plasencia, Carlos; Álvarez-Sánchez, Elizbeth; Marchat, Laurence A.


    Solar ultraviolet (UV) radiation is an important environmental factor that leads to immune suppression, inflammation, photoaging, and skin carcinogenesis. Here, we reviewed the specific signal transduction pathways and transcription factors involved in the cellular response to UV-irradiation. Increasing experimental data supporting a role for p38, MAPK, JNK, ERK1/2, and ATM kinases in the response network to UV exposure is discussed. We also reviewed the participation of NF-κB, AP-1, and NRF2 transcription factors in the control of gene expression after UV-irradiation. In addition, we discussed the promising chemotherapeutic intervention of transcription factors signaling by natural compounds. Finally, we focused on the review of data emerging from the use of DNA microarray technology to determine changes in global gene expression in keratinocytes and melanocytes in response to UV treatment. Efforts to obtain a comprehensive portrait of the transcriptional events regulating photodamage of intact human epidermis after UV exposure reveals the existence of novel factors participating in UV-induced cell death. Progress in understanding the multitude of mechanisms induced by UV-irradiation could lead to the potential use of protein kinases and novel proteins as specific targets for the prevention and control of skin cancer. PMID:22312244

  17. Protein kinases and transcription factors activation in response to UV-radiation of skin: implications for carcinogenesis.


    López-Camarillo, César; Ocampo, Elena Aréchaga; Casamichana, Mavil López; Pérez-Plasencia, Carlos; Alvarez-Sánchez, Elizbeth; Marchat, Laurence A


    Solar ultraviolet (UV) radiation is an important environmental factor that leads to immune suppression, inflammation, photoaging, and skin carcinogenesis. Here, we reviewed the specific signal transduction pathways and transcription factors involved in the cellular response to UV-irradiation. Increasing experimental data supporting a role for p38, MAPK, JNK, ERK1/2, and ATM kinases in the response network to UV exposure is discussed. We also reviewed the participation of NF-κB, AP-1, and NRF2 transcription factors in the control of gene expression after UV-irradiation. In addition, we discussed the promising chemotherapeutic intervention of transcription factors signaling by natural compounds. Finally, we focused on the review of data emerging from the use of DNA microarray technology to determine changes in global gene expression in keratinocytes and melanocytes in response to UV treatment. Efforts to obtain a comprehensive portrait of the transcriptional events regulating photodamage of intact human epidermis after UV exposure reveals the existence of novel factors participating in UV-induced cell death. Progress in understanding the multitude of mechanisms induced by UV-irradiation could lead to the potential use of protein kinases and novel proteins as specific targets for the prevention and control of skin cancer.

  18. Galvanic apparent internal impedance: an intrinsic tissue property.


    Golberg, Alex; Rabinowitch, Haim D; Rubinsky, Boris


    Using basic galvanic cell principles, the ability of tissues to generate electrical current through electrolysis was characterized. Studying Zn/Cu electrolysis in animal organs revealed a fundamental and measurable tissue-specific property - the galvanic apparent internal impedance (GAII), that is most likely related to the salt bridge function of tissues delineated by electrodes. Further to the fundamental knowledge acquired, GAII enables a new diagnostic method to distinguish between tissue types and to determine their health status without a need for expensive calibration, as often required when external power source is used. We demonstrated the GAII sensitivity in detecting tissue ablation with microwave heating or irreversible electroporation. The results open the way for a novel, inexpensive self-powered tissue diagnostic system for a wide range of applications such as minimally invasive tissue health status, ischemia, hydration, real time intra-operative control of minimally invasive surgery, medical imaging, virtual biopsy and many others.

  19. Galvanic Protection Of 2219 Al By Al/Li Powder

    NASA Technical Reports Server (NTRS)

    Daech, Alfred


    Coatings consisting of aluminum/lithium powders incorporated into acrylic resin found to protect panels of 2219 aluminum from corrosion by salt spray better than coating consisting of 2219 aluminum in same acrylic resin. Exact mechanism by which aluminum/lithium coatings protect against corrosion unknown, although galvanic mechanism suspected. These coatings (instead of chromium) applied to fasteners and bars to provide cathodic protection, both with and without impressed electrical current.

  20. Galvanic corrosion testing using electrochemical and immersion techniques

    SciTech Connect

    Roy, Ajit


    This activity plan is prepared in accordance with Lawrence Livermore National Laboratory (LLNL) Yucca Mountain Project procedure 033.YMP-QP 3.0, "Scientific Investigation Control." This plan is written for activity E-20-46, entitled "Galvanic Corrosion Testing," which is a part of the Scientific Investigation Plan (SIP) "Metal Barrier Selection and Testing" (SIP-CM-01, Rev 2, CN SIP-CM-01-2-l).

  1. Corrosion behaviour and biocorrosion of galvanized steel water distribution systems.


    Delaunois, F; Tosar, F; Vitry, V


    Galvanized steel tubes are a popular mean for water distribution systems but suffer from corrosion despite their zinc or zinc alloy coatings. First, the quality of hot-dip galvanized (HDG) coatings was studied. Their microstructure, defects, and common types of corrosion were observed. It was shown that many manufactured tubes do not reach European standard (NBN EN 10240), which is the cause of several corrosion problems. The average thickness of zinc layer was found at 41μm against 55μm prescribed by the European standard. However, lack of quality, together with the usual corrosion types known for HDG steel tubes was not sufficient to explain the high corrosion rate (reaching 20μm per year versus 10μm/y for common corrosion types). Electrochemical tests were also performed to understand the corrosion behaviours occurring in galvanized steel tubes. Results have shown that the limiting step was oxygen diffusion, favouring the growth of anaerobic bacteria in steel tubes. EDS analysis was carried out on corroded coatings and has shown the presence of sulphur inside deposits, suggesting the likely bacterial activity. Therefore biocorrosion effects have been investigated. Actually sulphate reducing bacteria (SRB) can reduce sulphate contained in water to hydrogen sulphide (H2S), causing the formation of metal sulphides. Although microbial corrosion is well-known in sea water, it is less investigated in supply water. Thus, an experimental water main was kept in operation for 6months. SRB were detected by BART tests in the test water main.

  2. Galvanic Manufacturing in the Cities of Russia: Potential Source of Ambient Nanoparticles

    PubMed Central

    Golokhvast, Kirill S.; Shvedova, Anna A.


    Galvanic manufacturing is widely employed and can be found in nearly every average city in Russia. The release and accumulation of different metals (Me), depending on the technology used can be found in the vicinities of galvanic plants. Under the environmental protection act in Russia, the regulations for galvanic manufacturing do not include the regulations and safety standards for ambient ultrafine and nanosized particulate matter (PM). To assess whether Me nanoparticles (NP) are among environmental pollutants caused by galvanic manufacturing, the level of Me NP were tested in urban snow samples collected around galvanic enterprises in two cities. Employing transmission electronic microscopy, energy-dispersive X-ray spectroscopy, and a laser diffraction particle size analyzer, we found that the size distribution of tested Me NP was within 10–120 nm range. This is the first study to report that Me NP of Fe, Cr, Pb, Al, Ni, Cu, and Zn were detected around galvanic shop settings. PMID:25329582

  3. Torsional Eye Movements Evoked by Unilateral Labyrinthine Galvanic Polarizations in the Squirrel Monkey

    NASA Technical Reports Server (NTRS)

    Minor, Lloyd B.; Tomko, David L.; Paige, Gary D.


    Electrical stimulation of vestibular-nerve afferents innervating the semicircular canals has been used to identify the extraocular muscles receiving activation or inhibition by individual ampullary nerves. This technique was originally developed by Szentagothai (1950) and led to the description of three neuron reflex arcs that connect each semicircular canal through an interneuron traversing in the region of the medial longitudinal fasciculus to one ipsilateral and one contralateral eye muscle. Selective ampullary nerve stimulation was subsequently used by Cohen and colleagues (Cohen and Suzuki, 1963; Cohen et al., 1964; Suzuki et al., 1964; Cohen et al., 1966) to study movements of the eyes and activation of individual extraocular muscles in response to stimulation of combinations of ampullary nerves. This work led to a description of the now familiar relationships between activation of a semicircular canal ampullary nerves and the anticipated movement in each eye. Disconjugacy of eye movements induced by individual vertical canal stimulation and dependence of the pulling direction of vertical recti and oblique muscles on eye position were also defined in these experiments. Subsequent studies have defined the mechanisms by which externally applied galvanic currents result in a change in vestibular-nerve afferent discharge. The currents appear to act at the spike trigger site. Perilymphatic cathodal currents depolarize the trigger site and lead to excitation whereas anodal currents hyperpolarize and result in inhibition. Afferents innervating all five vestibular endorgans appear to be affected equally by the currents (Goldberg et al., 1984). Irregularly discharging afferents are about 5-10 times more sensitive than regularly discharging ones because of the steeper slope of the former's faster postspike recovery of excitability in encoder sensitivity (Smith and Goldberg, 1986). Response adaptation similar to that noted during acceleration steps is apparent for

  4. Differential immune response of congenic mice to ultraviolet-treated major histocompatibility complex class II-incompatible skin grafts

    SciTech Connect

    Vermeer, B.J.; Santerse, B.; Van De Kerckhove, B.A.; Schothorst, A.A.; Claas, F.H.


    The influence of ultraviolet (UVB) irradiation on the survival of H-2 class II-disparate skin grafts was studied in congenic mouse strains. Isolated skin was UVB irradiated in vitro at a dose of 40 mJ/cm/sup 2/ from both sides to remove Ia immunogenicity. Immediately after irradiation the skin was transplanted onto the flank of allogeneic mice. When B10.AQR grafts were transplanted onto B10.T(6R) recipients, a significant prolongation of the survival time was observed, while 50% of the UVB-treated grafts were not rejected at all. However, in the opposite direction--i.e., B10.T(6R) grafts onto B10.AQR recipients, no significant prolongation of the survival was observed. To test whether this effect was due to a difference in susceptibility of the donor skin to UVB irradiation or to a different immune response in the recipients, (B10.T(6R) x B10.AQR) grafts were transplanted onto the parent strains. Similar results were obtained, in that UVB-treated grafts did not show a prolonged survival in B10.AQR recipients, whereas a significant prolongation (50% of the grafts survived more than 100 days) was observed in B10.T(6R) recipients. UVB-treated (B10.T(6R) x B10.AQR)F1 grafts were also transplanted onto (B10.T(6R) x C57B1/10)F1, (B10.AQR x C57B1/10)F1, (B10.T(6R) x Balb/c)F1 and (B10.AQR x Balb/c)F1 recipients--but in none of these combinations was a prolonged survival time observed. These data suggest that, in contrast to all in vitro experiments, the abrogation of the immune response by UVB treatment of the stimulator cells is, in vivo, not a general phenomenon. The genetic constitution of the responder mice seems to play an important role in determining whether or not an immune response takes place.

  5. Estrogens and aging skin

    PubMed Central

    Thornton, M. Julie


    Estrogen deficiency following menopause results in atrophic skin changes and acceleration of skin aging. Estrogens significantly modulate skin physiology, targeting keratinocytes, fibroblasts, melanocytes, hair follicles and sebaceous glands, and improve angiogenesis, wound healing and immune responses. Estrogen insufficiency decreases defense against oxidative stress; skin becomes thinner with less collagen, decreased elasticity, increased wrinkling, increased dryness and reduced vascularity. Its protective function becomes compromised and aging is associated with impaired wound healing, hair loss, pigmentary changes and skin cancer.   Skin aging can be significantly delayed by the administration of estrogen. This paper reviews estrogen effects on human skin and the mechanisms by which estrogens can alleviate the changes due to aging. The relevance of estrogen replacement, selective estrogen receptor modulators (SERMs) and phytoestrogens as therapies for diminishing skin aging is highlighted. Understanding estrogen signaling in skin will provide a basis for interventions in aging pathologies. PMID:24194966

  6. Early Clinical Response as a Predictor of Late Treatment Success in Patients With Acute Bacterial Skin and Skin Structure Infections: Retrospective Analysis of 2 Randomized Controlled Trials.


    Nathwani, Dilip; Corey, Ralph; Das, Anita F; Sandison, Taylor; De Anda, Carisa; Prokocimer, Philippe


    In the treatment of acute bacterial skin and skin structure infections, pooled data from 2 clinical trials (N = 1333 patients) showed that programmatic and investigator-assessed early treatment success both had a high positive predictive value (94.3%-100.0%) for late clinical cure, including among hospitalized patients. The negative predictive value of programmatic early success was <20%. These exploratory findings require prospective real-world evaluation.

  7. Skin-Specific Unsaturated Fatty Acids Boost the Staphylococcus aureus Innate Immune Response.


    Nguyen, Minh Thu; Hanzelmann, Dennis; Härtner, Thomas; Peschel, Andreas; Götz, Friedrich


    Antimicrobial fatty acids (AFAs) protect the human epidermis against invasion by pathogenic bacteria. In this study, we questioned whether human skin fatty acids (FAs) can be incorporated into the lipid moiety of lipoproteins and whether such incorporation would have an impact on innate immune stimulation in the model organism Staphylococcus aureus USA300 JE2. This organism synthesized only saturated FAs. However, when feeding USA300 with unsaturated FAs present on human skin (C16:1, C18:1, or C18:2), those were taken up, elongated stepwise by two carbon units, and finally found in the bacterial (phospho)lipid fraction. They were also observed in the lipid moiety of lipoproteins. When USA300 JE2 was fed with the unsaturated FAs, the cells and cell lysates showed an increased innate immune activation with various immune cells and peripheral blood mononuclear cells (PBMCs). Immune activation was highest with linoleic acid (C18:2). There are several pieces of evidence that the enhanced immune stimulating effect was due to the incorporation of unsaturated FAs in lipoproteins. First, the enhanced stimulation was dependent on Toll-like receptor 2 (TLR2). Second, an lgt mutant, unable to carry out lipidation of prolipoproteins, was unable to carry out immune stimulation when fed with unsaturated FAs. Third, the supplied FAs did not significantly affect growth, protein release, or expression of the model lipoprotein Lpl1. Although S. aureus is unable to synthesize unsaturated FAs, it incorporates long-chain unsaturated FAs into its lipoproteins, with the effect that the cells are better recognized by the innate immune system. This is an additional mechanism how our skin controls bacterial colonization and infection.

  8. Regional Skin Temperature Response to Moderate Aerobic Exercise Measured by Infrared Thermography

    PubMed Central

    Fernandes, Alex de Andrade; Amorim, Paulo Roberto dos Santos; Brito, Ciro José; Sillero-Quintana, Manuel; Bouzas Marins, João Carlos


    Background: Infrared thermography (IRT) does not require contact with the skin, and it is a convenient, reliable and non-invasive technique that can be used for monitoring the skin temperature (TSK). Objectives: The aim of this study was to monitor the variations in the regional TSK during exercise on 28 regions of interest (ROIs) (forehead, face, chest, abdomen, back, lumbar, anterior and posterior neck, and posterior and anterior views of the right and left hands, forearms, upper arms, thighs, and legs) with IRT. Patients and Methods: 12 physically active young males were monitored with IRT during the following three phases: a) 30 minutes before exercise b) while performing one hour of moderate intensity exercise on a treadmill at 60% of the VO2max, and c) 60 minutes after exercise. Results: During pre-exercise, all TSK reached a steady-state (P ≤ 0.05), which ensured adequate thermal stabilisation. At the beginning of exercise, there was a significant reduction in the TSK in most ROIs after 10 minutes of activity, except for the lower limbs (legs and thighs). After one hour of recovery, in the anterior view of the hands and thighs and in the posterior view of the legs, there were significant increases in the TSK compared to pre-exercise. Conclusions: There were significant distinctions in the skin temperature distribution during exercise according to the activity of the area under consideration during exercise, which may be important in the development of physiological models and heat flux analyses for different purposes. PMID:27217931

  9. Augmented supraorbital skin sympathetic nerve activity responses to symptom trigger events in rosacea patients

    PubMed Central

    Metzler-Wilson, Kristen; Toma, Kumika; Sammons, Dawn L.; Mann, Sarah; Jurovcik, Andrew J.; Demidova, Olga


    Facial flushing in rosacea is often induced by trigger events. However, trigger causation mechanisms are currently unclear. This study tested the central hypothesis that rosacea causes sympathetic and axon reflex-mediated alterations resulting in trigger-induced symptomatology. Twenty rosacea patients and age/sex-matched controls participated in one or a combination of symptom triggering stressors. In protocol 1, forehead skin sympathetic nerve activity (SSNA; supraorbital microneurography) was measured during sympathoexcitatory mental (2-min serial subtraction of novel numbers) and physical (2-min isometric handgrip) stress. In protocol 2, forehead skin blood flow (laser-Doppler flowmetry) and transepithelial water loss/sweat rate (capacitance hygrometry) were measured during sympathoexcitatory heat stress (whole body heating by perfusing 50°C water through a tube-lined suit). In protocol 3, cheek, forehead, forearm, and palm skin blood flow were measured during nonpainful local heating to induce axon reflex vasodilation. Heart rate (HR) and mean arterial pressure (MAP) were recorded via finger photoplethysmography to calculate cutaneous vascular conductance (CVC; flux·100/MAP). Higher patient transepithelial water loss was observed (rosacea 0.20 ± 0.02 vs. control 0.10 ± 0.01 mg·cm−2·min−1, P < 0.05). HR and MAP changes were not different between groups during sympathoexcitatory stressors or local heating. SSNA during early mental (32 ± 9 and 9 ± 4% increase) and physical (25 ± 4 and 5 ± 1% increase, rosacea and controls, respectively) stress was augmented in rosacea (both P < 0.05). Heat stress induced more rapid sweating and cutaneous vasodilation onset in rosacea compared with controls. No axon reflex vasodilation differences were observed between groups. These data indicate that rosacea affects SSNA and that hyperresponsiveness to trigger events appears to have a sympathetic component. PMID:26133800

  10. Augmented supraorbital skin sympathetic nerve activity responses to symptom trigger events in rosacea patients.


    Metzler-Wilson, Kristen; Toma, Kumika; Sammons, Dawn L; Mann, Sarah; Jurovcik, Andrew J; Demidova, Olga; Wilson, Thad E


    Facial flushing in rosacea is often induced by trigger events. However, trigger causation mechanisms are currently unclear. This study tested the central hypothesis that rosacea causes sympathetic and axon reflex-mediated alterations resulting in trigger-induced symptomatology. Twenty rosacea patients and age/sex-matched controls participated in one or a combination of symptom triggering stressors. In protocol 1, forehead skin sympathetic nerve activity (SSNA; supraorbital microneurography) was measured during sympathoexcitatory mental (2-min serial subtraction of novel numbers) and physical (2-min isometric handgrip) stress. In protocol 2, forehead skin blood flow (laser-Doppler flowmetry) and transepithelial water loss/sweat rate (capacitance hygrometry) were measured during sympathoexcitatory heat stress (whole body heating by perfusing 50°C water through a tube-lined suit). In protocol 3, cheek, forehead, forearm, and palm skin blood flow were measured during nonpainful local heating to induce axon reflex vasodilation. Heart rate (HR) and mean arterial pressure (MAP) were recorded via finger photoplethysmography to calculate cutaneous vascular conductance (CVC; flux·100/MAP). Higher patient transepithelial water loss was observed (rosacea 0.20 ± 0.02 vs. control 0.10 ± 0.01 mg·cm(-2)·min(-1), P < 0.05). HR and MAP changes were not different between groups during sympathoexcitatory stressors or local heating. SSNA during early mental (32 ± 9 and 9 ± 4% increase) and physical (25 ± 4 and 5 ± 1% increase, rosacea and controls, respectively) stress was augmented in rosacea (both P < 0.05). Heat stress induced more rapid sweating and cutaneous vasodilation onset in rosacea compared with controls. No axon reflex vasodilation differences were observed between groups. These data indicate that rosacea affects SSNA and that hyperresponsiveness to trigger events appears to have a sympathetic component.

  11. Behavioral and electrophysiological responses of Aedes albopictus to certain acids and alcohols present in human skin emanations.


    Guha, Lopamudra; Seenivasagan, T; Iqbal, S Thanvir; Agrawal, O P; Parashar, B D


    Human skin emanations attract hungry female mosquitoes toward their host for blood feeding. In this study, we report the flight orientation and electroantennogram response of Aedes albopictus females to certain unsaturated acids and alcohols found in human skin. In the Y-tube olfactometer, odors of lactic acid and 2-methyl-3-pentanol attracted 54-65% of Ae. albopictus females at all doses in a dose-dependent manner. However, at the highest dose (10(-2) g), the acids repelled 40-45% females. Attractancy (ca. 62-68%) at lower doses and repellency (ca. 30-45%) at higher doses were recorded for 3-methyl-3-pentanol and 1-octen-3-ol, while 5-hexen-1-ol, cis-2-hexen-1-ol, and trans 2-hexen-1-ol odor repelled ca. 55-65% of Ae. albopictus females at all doses. Antenna of female Ae. albopictus exhibited a dose-dependent EAG response up to 10(-3) g of L-lactic acid, trans-2-methyl-2-pentenoic acid, 2-octenoic acid, trans-2-hexen-1-ol and 1-octen-3-ol stimulations; however, the highest dose (10(-2) g) caused a little decline in the EAG response. EAG response of 9-10-fold was elicited by lactic acid, 2-octenoic acid, trans-2-hexenoic acid, and 3-methyl-3-pentanol, while cis-2-hexen-1-ol and trans-2-methyl pentenoic acid elicited 1-5-fold responses compared to solvent control. A blend of attractive compounds could be utilized in odor-baited trap for surveillance and repellent molecules with suitable formulation could be used to reduce the biting menace of mosquitoes.

  12. Activation of DNA damage repair pathways in response to nitrogen mustard-induced DNA damage and toxicity in skin keratinocytes.


    Inturi, Swetha; Tewari-Singh, Neera; Agarwal, Chapla; White, Carl W; Agarwal, Rajesh


    Nitrogen mustard (NM), a structural analog of chemical warfare agent sulfur mustard (SM), forms adducts and crosslinks with DNA, RNA and proteins. Here we studied the mechanism of NM-induced skin toxicity in response to double strand breaks (DSBs) resulting in cell cycle arrest to facilitate DNA repair, as a model for developing countermeasures against vesicant-induced skin injuries. NM exposure of mouse epidermal JB6 cells decreased cell growth and caused S-phase arrest. Consistent with these biological outcomes, NM exposure also increased comet tail extent moment and the levels of DNA DSB repair molecules phospho H2A.X Ser139 and p53 Ser15 indicating NM-induced DNA DSBs. Since DNA DSB repair occurs via non homologous end joining pathway (NHEJ) or homologous recombination repair (HRR) pathways, next we studied these two pathways and noted their activation as defined by an increase in phospho- and total DNA-PK levels, and the formation of Rad51 foci, respectively. To further analyze the role of these pathways in the cellular response to NM-induced cytotoxicity, NHEJ and HRR were inhibited by DNA-PK inhibitor NU7026 and Rad51 inhibitor BO2, respectively. Inhibition of NHEJ did not sensitize cells to NM-induced decrease in cell growth and cell cycle arrest. However, inhibition of the HRR pathway caused a significant increase in cell death, and prolonged G2M arrest following NM exposure. Together, our findings, indicating that HRR is the key pathway involved in the repair of NM-induced DNA DSBs, could be useful in developing new therapeutic strategies against vesicant-induced skin injury.

  13. Tephrosia purpurea alleviates phorbol ester-induced tumor promotion response in murine skin.


    Saleem, M; Ahmed Su; Alam, A; Sultana, S


    In recent years, considerable emphasis has been placed on identifying new cancer chemopreventive agents, which could be useful for the human population. Tephrosia purpurea has been shown to possess significant activity against hepatotoxicity, pharmacological and physiological disorders. Earlier we showed that Tephrosia purpurea inhibits benzoyl peroxide-mediated cutaneous oxidative stress and toxicity. In the present study, we therefore assessed the effect of Tephrosia purpurea on 12-O-tetradecanoyl phorbal-13-acetate (TPA; a well-known phorbol ester) induced cutaneous oxidative stress and toxicity in murine skin. The pre-treatment of Swiss albino mice with Tephrosia purpurea prior to application of croton oil (phorbol ester) resulted in a dose-dependent inhibition of cutaneous carcinogenesis. Skin tumor initiation was achieved by a single topical application of 7,12-dimethyl benz(a)anthracene (DMBA) (25 microg per animal per 0.2 ml acetone) to mice. Ten days later tumor promotion was started by twice weekly topical application of croton oil (0.5% per animal per 0.2 ml acetone, v /v). Topical application of Tephrosia purpurea 1 h prior to each application of croton oil (phorbol ester) resulted in a significant protection against cutaneous carcinogenesis in a dose-dependent manner. The animals pre-treated with Tephrosia purpurea showed a decrease in both tumor incidence and tumor yield as compared to the croton oil (phorbol ester)-treated control group. In addition, a significant reduction in TPA-mediated induction in cutaneous ornithine decarboxylase (ODC) activity and [3H]thymidine incorporation was also observed in animals pre-treated with a topical application of Tephrosia purpurea. The effect of topical application of Tephrosia purpurea on TPA-mediated depletion in the level of enzymatic and non-enzymatic molecules in skin was also evaluated and it was observed that topical application of Tephrosia purpurea prior to TPA resulted in the significant recovery of

  14. In vitro assessment of skin irritation potential of surfactant-based formulations by using a 3-D skin reconstructed tissue model and cytokine response.


    Walters, Russel M; Gandolfi, Lisa; Mack, M Catherine; Fevola, Michael; Martin, Katharine; Hamilton, Mathew T; Hilberer, Allison; Barnes, Nicole; Wilt, Nathan; Nash, Jennifer R; Raabe, Hans A; Costin, Gertrude-Emilia


    The personal care industry is focused on developing safe, more efficacious, and increasingly milder products, that are routinely undergoing preclinical and clinical testing before becoming available for consumer use on skin. In vitro systems based on skin reconstructed equivalents are now established for the preclinical assessment of product irritation potential and as alternative testing methods to the classic Draize rabbit skin irritation test. We have used the 3-D EpiDerm™ model system to evaluate tissue viability and primary cytokine interleukin-1α release as a way to evaluate the potential dermal irritation of 224 non-ionic, amphoteric and/or anionic surfactant-containing formulations, or individual raw materials. As part of our testing programme, two representative benchmark materials with known clinical skin irritation potential were qualified through repeated testing, for use as references for the skin irritation evaluation of formulations containing new surfactant ingredients. We have established a correlation between the in vitro screening approach and clinical testing, and are continually expanding our database to enhance this correlation. This testing programme integrates the efforts of global manufacturers of personal care products that focus on the development of increasingly milder formulations to be applied to the skin, without the use of animal testing.

  15. The Galvanic Corrosion of Graphite Epoxy Composite Materials Coupled with Alloys

    DTIC Science & Technology


    Effects . . . . . . ............ 20 12 Polarization Curve Showing Galvanic Current When Steel is Coupled to Titanium or Copper ....... . 21 13...due to the nobility of copper . In this case, use of potential difference would have indicated the small galvanic corrosion. Potential vs Galvanic ...P. Russell. "The Natural Water Corrosion of Steel in Contact with Copper ," Industrial Engineering Chemistry, Vol. 16, 27C (1957). 12. Brown, A.R.G

  16. Differential Responses of Anopheles stephensi (Diptera: Culicidae) to Skin Emanations of a Man, a Cow, and a Guinea Pig in the Olfactometer

    PubMed Central

    Omrani, S -M; Vatandoost, H; Oshaghi, MA; Shokri, F; Yaghoobi-Ershadi, MR; Rassi, Y; Tirgari, S


    Background: Biting habit of mosquitoes plays an important role in the epidemiology of mosquito-borne diseases. Mosquitoes use a set of elaborate sensory modalities to find their preferred hosts by exploiting cues emanating from a nearby host. It has been suggested that the chemical profile of skin can provide further support for anthropophilic mosquito species to find their suitable hosts. This study aimed at revealing the value of skin emanation for a zoophilic species like Anopheles stephensi as a model. Methods: Skin emanations of a man, a cow and a Guinea pig were collected by ethanol soaked cottons. Upwind responses of mosquitoes to 100 and 200 μl of filtered skin materials were non-competitively explored in a dual-choice olfactometer. L-lactic acid and other chemical content of the skin samples were identified by an enzymatic kit and GC-MS, respectively. Results: Unexpectedly, only human skin emanation was resulted in the statistically significant activation and attraction responses of An. stephensi in the wind tunnel. L-lactic acid content of this skin sample was 10 and 29 times more than the cow and the Guinea pig, respectively. The possible role of lactic acid and a few other identified compounds have been discussed here. Conclusion: Anopheles stephensi showed higher and more specific upwind responses to human skin emanation in the olfactometer. Undoubtedly, the thorough explanation of this unexpected finding needs further investigation. But, if new data verify this result, then, it may be necessary to reconsider the role of skin emanation and thence the human blood index and vectorial capacity of this zoophilic mosquito. PMID:22808383

  17. Intense THz pulses cause H2AX phosphorylation and activate DNA damage response in human skin tissue

    PubMed Central

    Titova, Lyubov V.; Ayesheshim, Ayesheshim K.; Golubov, Andrey; Fogen, Dawson; Rodriguez-Juarez, Rocio; Hegmann, Frank A.; Kovalchuk, Olga


    Recent emergence and growing use of terahertz (THz) radiation for medical imaging and public security screening raise questions on reasonable levels of exposure and health consequences of this form of electromagnetic radiation. In particular, picosecond-duration THz pulses have shown promise for novel diagnostic imaging techniques. However, the effects of THz pulses on human cells and tissues thus far remain largely unknown. We report on the investigation of the biological effects of pulsed THz radiation on artificial human skin tissues. We observe that exposure to intense THz pulses for ten minutes leads to a significant induction of H2AX phosphorylation, indicating that THz pulse irradiation may cause DNA damage in exposed skin tissue. At the same time, we find a THz-pulse-induced increase in the levels of several proteins responsible for cell-cycle regulation and tumor suppression, suggesting that DNA damage repair mechanisms are quickly activated. Furthermore, we find that the cellular response to pulsed THz radiation is significantly different from that induced by exposure to UVA (400 nm). PMID:23577291

  18. Alexander von Humboldt: galvanism, animal electricity, and self-experimentation part 1: formative years, naturphilosophie, and galvanism.


    Finger, Stanley; Piccolino, Marco; Stahnisch, Frank W


    During the 1790s, Alexander von Humboldt (1769-1859), who showed an early interest in many facets of natural philosophy and natural history, delved into the controversial subject of galvanism and animal electricity, hoping to shed light on the basic nature of the nerve force. He was motivated by his broad worldview, the experiments of Luigi Galvani, who favored animal electricity in more than a few specialized fishes, and the thinking of Alessandro Volta, who accepted specialized fish electricity but was not willing to generalize to other animals, thinking Galvani's frog experiments flawed by his use of metals. Differing from many German Naturphilosophen, who shunned "violent" experiments, the newest instruments, and detailed measurement, Humboldt conducted thousands of galvanic experiments on animals and animal parts, as well as many on his own body, some of which caused him great pain. He interpreted his results as supporting some but not all of the claims made by both Galvani and Volta. Notably, because of certain negative findings and phenomenological differences, he remained skeptical about the intrinsic animal force being qualitatively identical to true electricity. Hence, he referred to a "galvanic force," not animal electricity, in his letters and publications, a theoretical position he would abandon with Volta's help early in the new century.

  19. NF-E2-related factor 2 regulates the stress response to UVA-1-oxidized phospholipids in skin cells.


    Gruber, Florian; Mayer, Herbert; Lengauer, Barbara; Mlitz, Veronika; Sanders, John M; Kadl, Alexandra; Bilban, Martin; de Martin, Rainer; Wagner, Oswald; Kensler, Thomas W; Yamamoto, Masayuki; Leitinger, Norbert; Tschachler, Erwin


    Long-wavelength ultraviolet (UVA-1) radiation causes oxidative stress that modifies cellular molecules. To defend themselves against noxious oxidation products, skin cells produce detoxifying enzymes and antioxidants. We have recently shown that UVA-1 oxidized the abundant membrane phospholipid 1-palmitoyl-2-arachidonoyl-sn-glycero-3-phosphorylcholine (PAPC), which then induced the stress-response protein heme oxygenase 1 (HO-1) in dermal fibroblasts. Here we examined the effects of UVA-1- and UV-oxidized phospholipids on global gene expression in human dermal fibroblasts and keratinocytes. We identified a cluster of genes that were coinduced by UVA-1-oxidized PAPC and UVA-1 radiation. The cluster included HO-1, glutamate-cysteine ligase modifier subunit, aldo-keto reductases-1-C1 and -C2, and IL-8. These genes are members of the cellular stress response system termed "antioxidant response." Accordingly, the regulatory regions of all of these genes contain binding sites for NF-E2-related factor 2 (NRF2), a major regulator of the antioxidant response. Both UVA-1 irradiation and treatment with oxidized lipids led to increased nuclear accumulation and DNA binding of NRF2. Silencing and deficiency of NRF2 suppressed the antioxidant response. Taken together, our data show that UVA-1-mediated lipid oxidation induces expression of antioxidant response genes, which is dependent on the redox-regulated transcription factor NRF2. Our findings suggest a different view on UV-generated lipid mediators that were commonly regarded as detrimental

  20. Riverine skin temperature response to subsurface processes in low wind speeds

    NASA Astrophysics Data System (ADS)

    Brumer, Sophia E.; Zappa, Christopher J.; Anderson, Steven P.; Dugan, John P.


    Both surface and subsurface processes modulate the surface thermal skin and as such the skin temperature may serve as an indicator for coastal, estuarine, and alluvial processes. Infrared (IR) imagery offers the unique tool to survey such systems, allowing not only to assess temperature variability of the thermal boundary layer, but also to derive surface flow fields through digital particle image velocimetry, optical flow techniques, or spectral methods. In this study, IR time-series imagery taken from a boat moored in the Hudson River estuary is used to determine surface flow, turbulent kinetic energy dissipation rate, and characteristic temperature and velocity length scales. These are linked to subsurface measurements provided by in situ instruments. Under the low wind conditions and weak stratification, surface currents and dissipation rate are found to reflect subsurface mean flow (r2 = 0.89) and turbulence (r2 = 0.75). For relatively low dissipation rates, better correlations are obtained by computing dissipation rates directly from wavenumber spectra rather than when having to assume the validity of the Taylor hypothesis. Furthermore, the subsurface dissipation rate scales with the surface length scales (L) and mean flow (U) using ɛ ∝ U3/L (r2 = 0.9). The surface length scale derived from the thermal fields is found to have a strong linear relationship (r2 = 0.88) to water depth (D) with (D/L) ˜ 13. Such a relation may prove useful for remote bathymetric surveys when no waves are present.

  1. Galvanic interactions of aluminium 3004 and ∝ brass in tropical marine atmosphere

    NASA Astrophysics Data System (ADS)

    Palraj, S.; Subramanian, G.; Palanichamy, S.


    The galvanic corrosion behaviour of aluminium 3004 - ∝ brass with different area ratios was studied in the tropical marine atmosphere at Tuticorin harbour over a period of 426 days. The area ratios, viz. A Aluminium: A ∝ brass, studied were 0.125, 0.25, 0.5, 1, 2, 4 and 8. The galvanic corrosion behaviour of the metals was studied in terms of the relative increase in the corrosion rate of aluminium due to galvanic coupling with ∝ brass, the relative decrease in the corrosion rate of ∝ brass due to galvanic coupling with aluminium, and the susceptibility of aluminium to pitting owing to galvanic coupling with ∝ brass. The galvanic potential and galvanic current of the system were monitored. Pits of different dimensions ranging from mild etchings to perforations were experienced on the borders and the surfaces of the interface of aluminium in contact with ∝ brass. The corrosion products resulting from galvanic corrosion were analysed using XRD and the pitting on aluminium as a result of galvanic corrosion was highlighted in terms of pit depth, size and density of pit, using a high resolution microscope. The most favourable area ratio of aluminium — ∝ brass in marine atmosphere in terms of gravimetric corrosion rate is 8:1 and the most unfavourable area ratio of aluminium — ∝ brass is 1:4.

  2. Skin Cancer


    ... version of this page please turn Javascript on. Skin Cancer What is Skin Cancer? Skin cancer is the most common type ... of approximately 9,480 Americans in 2013. Can Skin Cancer Be Treated? Most basal cell and squamous ...

  3. Use of reflectance near-infrared spectroscopy to investigate the effects of daily moisturizer application on skin optical response and barrier function.


    Qassem, Meha; Kyriacou, Panayiotis


    A number of noninvasive techniques and instruments have emerged over the years allowing much progress toward clarifying the structure and function of human skin and studying the effects of various applied substances. All of this research has provided great insight into the interactions between skin and various products through quantitative and qualitative measurements. Such methods include near-infrared spectroscopy (NIRS), a technique which has gained popularity over the years and has often been employed to accurately determine the moisture levels and water content of skin based on its sensitivity to hydrogen bonding. NIRS has also been applied in many studies to report the efficacy of moisturizing products and assess their benefits to the skin. However, many of these studies have reported an increase in skin water content following moisturizer application while some have challenged the benefits of long-term moisturizer use, particularly on normal skin, and even suggested that it can increase the skin's susceptibility to irritants. This paper reports the results of a pilot in vivo study carried out on the skin of 20 healthy volunteers, categorized into groups depending on their skin type and frequency of moisturizer use, in order to investigate the optical response of human skin after direct short-term contact with water followed by application of a moisturizer. The measurements were obtained using a highly advanced spectrophotometer in the region of 900 to 2100 nm equipped with a customized reflectance fiber optic handheld probe. Scatter graphs of group results and second derivative spectra have shown an interesting pattern between frequent users of moisturizers and individuals who do not use moisturizers, suggesting that long-term daily moisturization may have an effect on skin barrier function. The results also raise some questions regarding the optical characteristics of different skin types, as well as the varying response between different water bands in the

  4. Behavioral and neural responses of toads to salt solutions correlate with basolateral membrane potential of epidermal cells of the skin.


    Hillyard, Stanley D; Baula, Victor; Tuttle, Wendy; Willumsen, Niels J; Larsen, Erik H


    Dehydrated toads initiated water absorption response (WR) behavior and absorbed water from dilute NaCl solutions. With 200-250 mM NaCl, WR behavior and water absorption were both suppressed. With 200-250 mM Na-gluconate, WR initiation was significantly greater than with NaCl but water loss was greater. Neural recordings from spinal nerve #6 showed a greater integrated response to 250 mM NaCl than to 250 mM Na-gluconate, whereas a larger rinse response was seen with Na-gluconate. Studies with isolated epithelium showed a large increase in conductance (G(t)) when 250 mM NaCl replaced NaCl Ringer's as the apical bathing solution that was accompanied by depolarization of the transepithelial potential (V(t)) and basolateral membrane potential (V(b)). Depolarization of V(b) corresponded with the neural response to 250 mM NaCl. When 250 mM Na-gluconate replaced Ringer's as the apical solution G(t) remained low, V(b) transiently hyperpolarized to values near the equilibrium potential for K(+) and corresponded with the reduced neural response. These results support the hypothesis that chemosensory function of the skin is analogous to that of mammalian taste cells but utilizes paracellular ion transport to a greater degree.

  5. Adaptive technique for matching the spectral response in skin lesions' images

    NASA Astrophysics Data System (ADS)

    Pavlova, P.; Borisova, E.; Pavlova, E.; Avramov, L.


    The suggested technique is a subsequent stage for data obtaining from diffuse reflectance spectra and images of diseased tissue with a final aim of skin cancer diagnostics. Our previous work allows us to extract patterns for some types of skin cancer, as a ratio between spectra, obtained from healthy and diseased tissue in the range of 380 - 780 nm region. The authenticity of the patterns depends on the tested point into the area of lesion, and the resulting diagnose could also be fixed with some probability. In this work, two adaptations are implemented to localize pixels of the image lesion, where the reflectance spectrum corresponds to pattern. First adapts the standard to the personal patient and second - translates the spectrum white point basis to the relative white point of the image. Since the reflectance spectra and the image pixels are regarding to different white points, a correction of the compared colours is needed. The latest is done using a standard method for chromatic adaptation. The technique follows the steps below: -Calculation the colorimetric XYZ parameters for the initial white point, fixed by reflectance spectrum from healthy tissue; -Calculation the XYZ parameters for the distant white point on the base of image of nondiseased tissue; -Transformation the XYZ parameters for the test-spectrum by obtained matrix; -Finding the RGB values of the XYZ parameters for the test-spectrum according sRGB; Finally, the pixels of the lesion's image, corresponding to colour from the test-spectrum and particular diagnostic pattern are marked with a specific colour.

  6. The vitamin D3 transcriptomic response in skin cells derived from the Atlantic bottlenose dolphin

    PubMed Central

    Ellis, Blake C.; Gattoni-Celli, Sebastiano; Mancia, Annalaura; Kindy, Mark S.


    The Atlantic bottlenose dolphin has attracted attention due to the evident impact that environmental stressors have taken on its health. In order to better understand the mechanisms linking environmental health with dolphin health, we have established cell cultures from dolphin skin as in vitro tools for molecular evaluations. The vitamin D3 pathway is one mechanism of interest because of its well established chemopreventative and immunomodulatory properties in terrestrial mammals. On the other hand, little is known of the physiological role of this molecule in aquatic animals. 1,25-dihydroxyvitamin D3 (1,25D3), the bioactive and hormonal form of vitamin D3, exerts its biological function by binding to the vitamin D receptor (VDR), a ligand-activated regulator of gene transcription. Therefore, we investigated the transcriptomic changes induced by 1,25D3 administration in dolphin skin cells. Identification of specific genes activated by 1,25D3 has provided clues to the physiological function of the vitamin D3 pathway in the dolphin. We found that exposure of the cells to 1,25D3 upregulated transactivation of a vitamin D-sensitive promoter. cDNA microarray analysis, using a novel dolphin array, identified specific gene targets within this pathway, and real-time PCR (qPCR) confirmed the enhanced expression of select genes of interest. These transcriptional changes correlated with an increase in VDR levels. This is the first report of the presence and activation of the vitamin D3 pathway in a marine mammal, and our experimental results demonstrate a number of similarities to terrestrial animals. Conservation of this pathway in the Atlantic bottlenose dolphin is consistent with the importance of nonclassic functions of vitamin D3, such as its role in innate immunity, similar to what has been demonstrated in other mammals. PMID:19454332

  7. Signal transduction and nuclear responses in Staphylococcus aureus-induced expression of human beta-defensin 3 in skin keratinocytes.


    Menzies, Barbara E; Kenoyer, Aimee


    The human beta-defensin 3 (hBD-3) is an inducible epithelial peptide antibiotic that has potent antistaphylococcal activity. Infection of skin epithelial cells with viable Staphylococcus aureus, a common skin pathogen, induces increased gene expression of hBD-3 and other antimicrobial peptides. The aim of this study was to identify signaling pathways and nuclear responses that contribute to the gene expression of hBD-3 in primary human keratinocytes upon contact with S. aureus. Increased hBD-3 peptide was observed by immunofluorescence microscopy in keratinocytes exposed to S. aureus and to lipoteichoic acid (LTA). Both are ligands for the cell surface Toll-like receptor 2 (TLR2), and thus the contribution of TLR2 signaling in hBD-3 expression was examined. Functional inhibition of TLR2 prior to S. aureus stimulation significantly decreased hBD-3 mRNA levels by 37%, attesting to the involvement of this surface receptor in the initial recognition and downstream signaling for hBD-3 expression. Treatment of keratinocytes with a p38 mitogen-activated protein kinase (MAPK) inhibitor prior to either S. aureus or LTA stimulation was associated with reduced hBD-3 mRNA transcripts and peptide. We also propose a role for the MAPK-regulated transcriptional activating protein 1 in S. aureus-induced hBD-3 gene expression. Combined, these studies indicate a role for TLR2 signaling and MAPK activation in the upregulation of hBD-3 and demonstrate the innate immune capacity of skin keratinocytes under conditions of S. aureus challenge to enhance the local expression of this antistaphylococcal peptide antibiotic.

  8. Apoptosis, inflammatory response and parasite load in skin of Leishmania (Leishmania) chagasi naturally infected dogs: a histomorphometric analysis.


    Verçosa, Bárbara Laurice Araújo; Melo, Maria Norma; Puerto, Helen Lima Del; Mendonça, Ivete Lopes; Vasconcelos, Anilton César


    The skin has an important role in infection by Leishmania chagasi. Apoptosis modulates the inflammatory response acting distinctively either on the progression or regression of the lesions. The parasites interact with multiple regulatory systems inducing apoptosis in host cells, during cell invasion, stabilization and multiplication of pathogens. In this context, the aim of this study was to evaluate cell death within the inflammatory infiltrates, and to correlate these results with parasite load and clinical features of dogs naturally infected with L. chagasi. Fragments of skin pinnas (8 symptomatic+8 asymptomatic+6 negative controls) were used to characterize and measure the inflammatory response, parasite load and apoptosis. Diagnosis of canine leishmaniasis was confirmed by the detection of anti-Leishmania antibodies by IFA and ELISA in serum, direct visualization of the parasite and culture in spleen, liver, pinna, bone marrow and lymph nodes, and PCR (pinna). Histomorphometry was performed with images obtained from 20 representative histological fields in a light microscope. Ultra-thin sections were mounted over a 300 mesh grids, contrasted with 2% uranyl acetate and lead citrate and examined under a Transmission Electronic Microscopy. Amastigotes were only found in the skin of symptomatic animals (31.94 ± 18.81). The number of foci and cellularity of the inflammatory infiltrates in symptomatic dogs were higher than in other groups and in asymptomatics were higher than in controls (p<0.05; Tukey). The average area, perimeter and extreme diameters of the inflammatory infiltrates obtained in symptomatic dogs were higher than in controls (p<0.05; Tukey). The apoptotic index was higher in symptomatic than in other groups and there was no difference between asymptomatics and controls (p<0.05; Tukey). Ultrastructurally, apoptotic cells were shrunken, with condensed nuclear chromatin and cytoplasm. Condensed nuclei were frequently fragmented. Internucleosomal DNA

  9. Effect of nifedipine on depolarization-induced force responses in skinned skeletal muscle fibres of rat and toad.


    Posterino, G S; Lamb, G D


    The effect of the dihydropyridine, nifedipine, on excitation-contraction coupling was compared in toad and rat skeletal muscle, using the mechanically skinned fibre technique, in order to understand better the apparently disparate results of previous studies and to examine recent proposals on the importance of certain intracellular factors in determining the efficacy of dihydropyridines. In twitch fibres from the iliofibularis muscle of the toad, 10 microM nifedipine completely inhibited depolarization-induced force responses within 30 s, without interfering with direct activation of the Ca(2+)-release channels by caffeine application or reduction of myoplasmic [Mg2+]. At low concentrations of nifedipine, inhibition was considerably augmented by repeated depolarizations, with half-maximal inhibition occurring at < 0.1 microM nifedipine. In contrast, in rat extensor digitorum longus (EDL) fibres 1 microM nifedipine had virtually no effect on depolarization-induced force responses, and 10 microM nifedipine caused only approximately 25% reduction in the responses, even upon repeated depolarizations. In rat fibres, 10 microM nifedipine shifted the steady-state force inactivation curve to more negative potentials by < 11 mV, whereas in toad fibres the potent inhibitory effect of nifedipine indicated a much larger shift. The inhibitory effect of nifedipine in rat fibres was little, if at all, increased by the absence of Ca2+ in the transverse tubular (t-) system, provided that the Ca2+ was replaced with sufficient Mg2+. The presence of the reducing agents dithiothreitol (10 mM) or glutathione (10 mM) in the solution bathing a toad skinned fibre did not reduce the inhibitory effect of nifedipine, suggesting that the potency of nifedipine in toad skinned fibres was not due to the washout of intracellular reducing agents. The results are considered in terms of a model that can account for the markedly different effects of nifedipine on the two putative functions of the

  10. Sink or swim: a test of tadpole behavioral responses to predator cues and potential alarm pheromones from skin secretions.


    Maag, Nino; Gehrer, Lukas; Woodhams, Douglas C


    Chemical signaling is a vital mode of communication for most organisms, including larval amphibians. However, few studies have determined the identity or source of chemical compounds signaling amphibian defensive behaviors, in particular, whether alarm pheromones can be actively secreted from tadpoles signaling danger to conspecifics. Here we exposed tadpoles of the common toad Bufo bufo and common frog Rana temporaria to known cues signaling predation risk and to potential alarm pheromones. In both species, an immediate reduction in swimming activity extending over an hour was caused by chemical cues from the predator Aeshna cyanea (dragonfly larvae) that had been feeding on conspecific tadpoles. However, B. bufo tadpoles did not detectably alter their behavior upon exposure to potential alarm pheromones, neither to their own skin secretions, nor to the abundant predator-defense peptide bradykinin. Thus, chemicals signaling active predation had a stronger effect than general alarm secretions of other common toad tadpoles. This species may invest in a defensive strategy alternative to communication by alarm pheromones, given that Bufonidae are toxic to some predators and not known to produce defensive skin peptides. Comparative behavioral physiology of amphibian alarm responses may elucidate functional trade-offs in pheromone production and the evolution of chemical communication.

  11. Clinical utility of clocortolone pivalate for the treatment of corticosteroid-responsive skin disorders: a systematic review

    PubMed Central

    Singh, Sanjay; Mann, Baldeep Kaur


    Clocortolone pivalate 0.1% cream is a class IV mid-strength topical glucocorticoid. After topical application the glucocorticoid achieves higher concentration in inflamed skin compared with normal skin. Furthermore, pharmacologic studies have shown that there is little systemic absorption of clocortolone pivalate and hence no adrenal suppression. Systematic review was performed to evaluate the efficacy and safety of the glucocorticoid. PubMed, the Cochrane Library, and individual websites of the top 20 dermatology journals were searched using a defined strategy. Following the selection criteria, eight clinical trials were selected, of which five were randomized controlled trials. The trials mainly included patients with atopic dermatitis and eczemas. Quality appraisal of randomized controlled trials was done using the Delphi list, which showed that the trials had weaknesses in several items. The results of the systematic review tend to show that clocortolone pivalate cream is generally effective with early onset of action and has a good safety profile in the treatment of these conditions. Further studies comparing this glucocorticoid with other glucocorticoids and treatments in steroid-responsive dermatoses are desirable. PMID:22791998

  12. A Study on the Effects of Sympathetic Skin Response Parameters in Diagnosis of Fibromyalgia Using Artificial Neural Networks.


    Ozkan, Ozhan; Yildiz, Murat; Arslan, Evren; Yildiz, Sedat; Bilgin, Suleyman; Akkus, Selami; Koyuncuoglu, Hasan R; Koklukaya, Etem


    Fibromyalgia syndrome (FMS), usually observed commonly in females over age 30, is a rheumatic disease accompanied by extensive chronic pain. In the diagnosis of the disease non-objective psychological tests and physiological tests and laboratory test results are evaluated and clinical experiences stand out. However, these tests are insufficient in differentiating FMS with similar diseases that demonstrate symptoms of extensive pain. Thus, objective tests that would help the diagnosis are needed. This study analyzes the effect of sympathetic skin response (SSR) parameters on the auxiliary tests used in FMS diagnosis, the laboratory tests and physiological tests. The study was conducted in Suleyman Demirel University, Faculty of Medicine, Physical Medicine and Rehabilitation Clinic in Turkey with 60 patients diagnosed with FMS for the first time and a control group of 30 healthy individuals. In the study all participants underwent laboratory tests (blood tests), certain physiological tests (pulsation, skin temperature, respiration) and SSR measurements. The test data and SSR parameters obtained were classified using artificial neural network (ANN). Finally, in the ANN framework, where only laboratory and physiological test results were used as input, a simulation result of 96.51 % was obtained, which demonstrated diagnostic accuracy. This data, with the addition of SSR parameter values obtained increased to 97.67 %. This result including SSR parameters - meaning a higher diagnostic accuracy - demonstrated that SSR could be a new auxillary diagnostic method that could be used in the diagnosis of FMS.

  13. RNA-Seq Analysis of the Host Response to Staphylococcus aureus Skin and Soft Tissue Infection in a Mouse Model.


    Brady, Rebecca A; Bruno, Vincent M; Burns, Drusilla L


    Staphylococcus aureus is a leading cause of skin and soft tissue infections (SSTI), which are primarily self-limiting. We conducted a comprehensive analysis of the host transcriptome during a S. aureus SSTI to provide insight on the protective mechanisms that thwart these infections. We utilized a murine SSTI model in which one ear is epicutaneously challenged while the other is not. We then harvested these infected and uninfected ears, as well as ears from naïve mice, at one, four, and seven days post-challenge, and performed RNA sequencing (RNA-seq) using the Illumina platform. RNA-seq data demonstrated a robust response at the site of infection. Comparison of gene expression profiles between infected ears and the non-infected ears of challenged mice defined the local response to infection, while comparisons of expression profiles of non-infected ears from challenged mice to ears of naïve mice revealed changes in gene expression levels away from the site indicative of a systemic response. Over 1000 genes exhibited increased expression locally at all tested time points. The local response was more robust than the systemic response. Through evaluation of the RNA-seq data using the Upstream Regulator Analytic as part of the Ingenuity Pathway Analysis software package, we found that changes in the activation and inhibition of regulatory pathways happen first locally, and lag behind systemically. The activated pathways are highly similar at all three time points during SSTI, suggesting a stable global response over time. Transcript increases and pathway activation involve pro- and anti-inflammatory mediators, chemotaxis, cell signaling, keratins, and TH1/TH17 cytokines. Transcript decreases and pathway inhibition demonstrate that metabolic genes and anti-inflammatory pathways are repressed. These data provide insight on the host responses that may aid in resolution of this self-limited S. aureus infection, and may shed light on potential immune correlates of

  14. RNA-Seq Analysis of the Host Response to Staphylococcus aureus Skin and Soft Tissue Infection in a Mouse Model

    PubMed Central

    Brady, Rebecca A.; Bruno, Vincent M.; Burns, Drusilla L.


    Staphylococcus aureus is a leading cause of skin and soft tissue infections (SSTI), which are primarily self-limiting. We conducted a comprehensive analysis of the host transcriptome during a S. aureus SSTI to provide insight on the protective mechanisms that thwart these infections. We utilized a murine SSTI model in which one ear is epicutaneously challenged while the other is not. We then harvested these infected and uninfected ears, as well as ears from naïve mice, at one, four, and seven days post-challenge, and performed RNA sequencing (RNA-seq) using the Illumina platform. RNA-seq data demonstrated a robust response at the site of infection. Comparison of gene expression profiles between infected ears and the non-infected ears of challenged mice defined the local response to infection, while comparisons of expression profiles of non-infected ears from challenged mice to ears of naïve mice revealed changes in gene expression levels away from the site indicative of a systemic response. Over 1000 genes exhibited increased expression locally at all tested time points. The local response was more robust than the systemic response. Through evaluation of the RNA-seq data using the Upstream Regulator Analytic as part of the Ingenuity Pathway Analysis software package, we found that changes in the activation and inhibition of regulatory pathways happen first locally, and lag behind systemically. The activated pathways are highly similar at all three time points during SSTI, suggesting a stable global response over time. Transcript increases and pathway activation involve pro- and anti-inflammatory mediators, chemotaxis, cell signaling, keratins, and TH1/TH17 cytokines. Transcript decreases and pathway inhibition demonstrate that metabolic genes and anti-inflammatory pathways are repressed. These data provide insight on the host responses that may aid in resolution of this self-limited S. aureus infection, and may shed light on potential immune correlates of

  15. Effect of extraction conditions on lycopene extractions from tomato processing waste skin using response surface methodology.


    Kaur, Devinder; Wani, Ali Abas; Oberoi, D P S; Sogi, D S


    Skin, rich in lycopene, is an important component of waste originating from tomato paste manufacturing plants. A central composite design with five independent variables, namely solvent/meal ratio (20:1, 30:1, 40:1, 50:1, and 60:1v/w); number of extractions (1, 2, 3, 4 and 5); temperature (20, 30, 40, 50 and 60°C); particle size (0.05, 0.15, 0.25, 0.35 and 0.43mm); extraction time (4, 8, 12, 16 and 20min) was used to study their effects on lycopene extraction. The experimental values of lycopene ranged between 0.639 and 1.98mg/100g. The second order model obtained for extracted lycopene revealed a coefficient of determination (R(2)) of 0.99 and a standard error of 0.03. Maximum lycopene (1.98mg/100g) was extracted when the solvent/meal ratio, number of extractions, temperature, particle size and extraction time were 30:1v/w, 4, 50°C, 0.15mm and 8min, respectively.

  16. Inverse spin galvanic effect in topological-insulator based heterostructures

    NASA Astrophysics Data System (ADS)

    Rodriguez-Vega, Martin; Schwiete, Georg; Sinova, Jairo; Rossi, Enrico


    We study the inverse spin galvanic effect in heterostructures formed by a layer of a three dimensional strong topological insulator (TI) and a magnetic material. We consider different configurations for the heterostructure and for the contacts. We carefully treat the effect on the TI bands of the proximity of a magnetic material and take into account both intra-band and inter-band contributions to the current-induced spin polarization of the TI surface states. Finally, we discuss the relevance of our results for recent experiments. Work supported by ONR-N00014-13-1-0321, ACS-PRF # 53581-DNI5, and the Jeffress Memorial Trust.

  17. Electrode Architecture in Galvanic and Electrolytic Energy Cells.


    Jeong, Beomgyun; Ocon, Joey D; Lee, Jaeyoung


    Electrodes in galvanic and electrolytic energy cells are complicated structures comprising redox-active materials, ionic/electronic conductors, and porous pathways for mass transfer of reactants. In contrast to breakthroughs in component development, methods of optimizing whole-system architectural design to draw maximum output have not been well explored. In this Minireview, we introduce generalized types of electrode architecture, discuss fabrication strategies, and characterize already built structures. Systematic efforts to discover optimal electrode configurations will resolve long-standing discrepancies that arise between whole systems and the sums of their parts for a number of electrochemical reactions and technologies.

  18. Asymmetric hollow nanorod formation through a partial galvanic replacement reaction.


    Seo, Daeha; Song, Hyunjoon


    An asymmetric single hollow structure was generated from Ag-Au-Ag heterometal nanorods by a partial galvanic replacement reaction for the first time. The C(2)-symmetry breaking took place because of the random generation of a single pit on only one end of the silver domain at an early stage of the reaction. Careful control of the reaction kinetics could also yield a double-hollow structure on both ends of the silver domain. The resulting single- and double-hollow nanorods exhibited characteristic extinctions in the near-IR range.

  19. 76 FR 23564 - Galvanized Steel Wire From the People's Republic of China: Initiation of Countervailing Duty...

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... International Trade Administration Galvanized Steel Wire From the People's Republic of China: Initiation of... concerning imports of galvanized steel wire from the People's Republic of China (PRC) filed in proper form by Davis Wire Corporation, Johnstown Wire Technologies, Inc., Mid-South Wire Company, Inc.,...

  20. Finishes for Metals. Paintability of Galvanized Steel, Corrosion Resistance of Metallized Coatings.

    ERIC Educational Resources Information Center

    Building Research Inst., Inc., Washington, DC.

    Two papers are presented. The first, "Report of the AISI Research Project on the Paintability of Galvanized Steel," was a project aimed at determining optimum procedures for painting bright-spangled galvanized sheet steel products using three classes of trade sales paints--metallic zinc-dust, portland cement-in-oil, and water base emulsion paints.…

  1. 7 CFR 1755.370 - RUS specification for seven wire galvanized steel strand.

    Code of Federal Regulations, 2014 CFR


    ... 7 Agriculture 11 2014-01-01 2014-01-01 false RUS specification for seven wire galvanized steel... steel strand. (a) RUS incorporates by reference ASTM A475-78, Standard Specification for Zinc-Coated Steel Wire Strand, issued May 1978. All seven wire galvanized steel strand purchased after April 1,...

  2. 7 CFR 1755.370 - RUS specification for seven wire galvanized steel strand.

    Code of Federal Regulations, 2013 CFR


    ... 7 Agriculture 11 2013-01-01 2013-01-01 false RUS specification for seven wire galvanized steel... steel strand. (a) RUS incorporates by reference ASTM A475-78, Standard Specification for Zinc-Coated Steel Wire Strand, issued May 1978. All seven wire galvanized steel strand purchased after April 1,...

  3. 7 CFR 1755.370 - RUS specification for seven wire galvanized steel strand.

    Code of Federal Regulations, 2012 CFR


    ... 7 Agriculture 11 2012-01-01 2012-01-01 false RUS specification for seven wire galvanized steel... steel strand. (a) RUS incorporates by reference ASTM A475-78, Standard Specification for Zinc-Coated Steel Wire Strand, issued May 1978. All seven wire galvanized steel strand purchased after April 1,...

  4. 76 FR 55031 - Galvanized Steel Wire From the People's Republic of China: Preliminary Affirmative Countervailing...

    Federal Register 2010, 2011, 2012, 2013, 2014


    ...The Department of Commerce (the Department) preliminarily determines that countervailable subsidies are being provided to producers and exporters of galvanized steel wire (galvanized wire) from the People's Republic of China (PRC). For information on the estimated subsidy rates, see the ``Suspension of Liquidation'' section of this...

  5. EGFR signaling blunts allergen-induced IL-6 production and Th17 responses in the skin and attenuates development and relapse of atopic dermatitis.


    Zhang, Zhonghua; Xiao, Chang; Gibson, Aaron M; Bass, Stacey A; Khurana Hershey, Gurjit K


    Despite the important role for epidermal growth factor (EGF) in epithelial homeostasis and wound healing, it has not been investigated in atopic dermatitis (AD). We used AD animal models to explore the role of EGF in AD. In an acute AD model, skin transepidermal water loss was significantly attenuated in EGF-treated mice. Blockade of EGFR signaling genetically or pharmacologically confirms a protective role for EGFR signaling in AD. In a chronic/relapsing AD model, EGF treatment of mice with established AD resulted in an attenuation of AD exacerbation (skin epithelial thickness, cutaneous inflammation, and total and allergen specific IgE) following cutaneous allergen rechallenge. EGF treatment did not alter expression of skin barrier junction proteins or antimicrobial peptides in the AD model. However, EGF treatment attenuated allergen-induced expression of IL-17A, CXCL1, and CXCL2 and neutrophil accumulation in AD skin following cutaneous allergen exposure. IL-17A production was decreased in the in vitro restimulated skin-draining lymph node cells from the EGF-treated mice. Similarly, IL-17A was increased in waved-2 mice skin following allergen exposure. Whereas IL-6 and IL-1β expression was attenuated in the skin of EGF-treated mice, EGF treatment also suppressed allergen-induced IL-6 production by keratinocytes. Given the central role of IL-6 in priming Th17 differentiation in the skin, this effect of EGF on keratinocytes may contribute to the protective roles for EGFR in AD pathogenesis. In conclusion, our study provides evidence for a previously unrecognized protective role for EGF in AD and a new role for EGF in modulating IL-17 responses in the skin.

  6. Systemic morphine treatment induces changes in firing patterns and responses of nociceptive afferent fibers in mouse glabrous skin.


    Hogan, Dale; Baker, Alyssa L; Morón, Jose A; Carlton, Susan M


    Patients receiving opioids for pain may experience decreased effectiveness of the drug and even abnormal pain sensitivity-hyperalgesia and/or allodynia. We hypothesized that peripheral nociceptor hyperexcitability contributes to opioid-induced hyperalgesia and tested this using an in vitro mouse glabrous skin-nerve preparation. Mice were injected intraperitoneally with escalating doses of morphine (5, 8, 10, 15 mg/kg) or saline every 12 hours for 48 hours and killed approximately 12 hours after the last injection. Receptive fields of nociceptors were tested for mechanical, heat, and cold sensitivity. Activity was also measured during an initial 2-minute period and during 5-minute periods between stimuli. Aberrant activity was common in fibers from morphine-treated mice but rare in saline-treated mice. Resting background activity was elevated in C-fibers from morphine-treated mice. Both C- and Aδ-fibers had afterdischarge in response to mechanical, heat, and/or cold stimulation of the skin as well as spontaneous, unevoked activity. Compared to saline, morphine treatment increased the proportion of fibers displaying polymodal rather than mechanical-only responses. A significant increase in Aδ-mechanoreceptive fibers responding to cold accounted for most of this change. In agreement with this, morphine-treated mice showed increased sensitivity in the cold tail flick test. In morphine-treated mice, aberrant activity and hyperexcitability of nociceptors could contribute to increased pain sensitivity. Importantly, this activity is likely driving central sensitization, a phenomenon contributing to abnormal sensory processing and chronic pain. If similar changes occur in human patients, aberrant nociceptor activity is likely to be interpreted as pain and could contribute to opioid-induced hyperalgesia.

  7. Differential gene expression profiling of mouse skin after sulfur mustard exposure: Extended time response and inhibitor effect

    SciTech Connect

    Gerecke, Donald R. Chen Minjun; Isukapalli, Sastry S.; Gordon, Marion K.; Chang, Y.-C.; Tong Weida; Androulakis, Ioannis P.; Georgopoulos, Panos G.


    Sulfur mustard (HD, SM), is a chemical warfare agent that within hours causes extensive blistering at the dermal-epidermal junction of skin. To better understand the progression of SM-induced blistering, gene expression profiling for mouse skin was performed after a single high dose of SM exposure. Punch biopsies of mouse ears were collected at both early and late time periods following SM exposure (previous studies only considered early time periods). The biopsies were examined for pathological disturbances and the samples further assayed for gene expression profiling using the Affymetrix microarray analysis system. Principal component analysis and hierarchical cluster analysis of the differently expressed genes, performed with ArrayTrack showed clear separation of the various groups. Pathway analysis employing the KEGG library and Ingenuity Pathway Analysis (IPA) indicated that cytokine-cytokine receptor interaction, cell adhesion molecules (CAMs), and hematopoietic cell lineage are common pathways affected at different time points. Gene ontology analysis identified the most significantly altered biological processes as the immune response, inflammatory response, and chemotaxis; these findings are consistent with other reported results for shorter time periods. Selected genes were chosen for RT-PCR verification and showed correlations in the general trends for the microarrays. Interleukin 1 beta was checked for biological analysis to confirm the presence of protein correlated to the corresponding microarray data. The impact of a matrix metalloproteinase inhibitor, MMP-2/MMP-9 inhibitor I, against SM exposure was assessed. These results can help in understanding the molecular mechanism of SM-induced blistering, as well as to test the efficacy of different inhibitors.

  8. Autologous serum skin test response in chronic spontaneous urticaria and respiratory diseases and its relationship with serum interleukin-18 level.


    Kurt, Emel; Aktas, Ayse; Aksu, Kurtulus; Keren, Metin; Dokumacioglu, Ali; Goss, Christopher H; Alatas, Ozkan


    Autologous serum skin test (ASST) is mostly used in chronic spontaneous urticaria (CSU) to show autoreactivity. Interleukin-18 (IL-18) has also been shown to be involved in autoimmune conditions. To investigate the role of autoreactivity assessed by ASST in CSU and respiratory diseases and to investigate whether this autoreactive state is related to IL-18 level or other clinical covariates. Fifty-five patients with CSU (mean age: 40.3 ± 12.3 years), 70 patients with persistent asthma (mean age: 43.7 ± 9.6 years), 21 patients with seasonal allergic rhinitis (SAR) (mean age: 35.5 ± 11.8 years) and 20 normal controls (mean age: 37.7 ± 9.8) were included. All subjects underwent a laboratory examination and skin prick test. ASST was performed and serum IL-18 levels were measured in all subjects. Positive response to ASST and serum IL-18 levels were higher in CSU patients than those with respiratory diseases (asthma and SAR) (P = 0.034 and 0.002, respectively) and normal controls (P = 0.004 and 0.031, respectively). Considering all patients, IL-18 levels were higher in patients with positive ASST (301.8 ± 194.4 vs. 241.8 ± 206.3 pg/ml, P = 0.036) than ASST negative patients. ASST response was associated with disease severity in CSU (P = 0.037) and asthma patients (P = 0.001). Multivariate analysis showed that positive response to ASST was significantly associated with diagnosis of CSU (OR: 3.13, 95% CI: 1.25-7.87) and female gender (OR: 3.98, 95% CI: 1.19-13.38). ASST response could be related with activity of the disease. A positive ASST response found in respiratory diseases patients suggests that it may occur as a result of some inflammatory events during the diseases' process.

  9. Effect of galvanic coupling between overpack materials for high-level nuclear waste containers

    SciTech Connect

    Dunn, D.S.; Cragnolino, G.A.; Sridhar, N.


    The effect of environmental parameters and area ratio on the galvanic protection of Alloy 825 by A516 steel was studied. A simplified model was used to calculate the potential and corrosion current density of the bimetallic couple as a function of the galvanic coupling efficiency. Galvanic corrosion tests were performed to gain confidence in the calculated values. Both the calculations and laboratory testing indicate that, with highly efficient coupling, the potential of the galvanic couple is maintained below the repassivation potential for Alloy 825 in chloride-containing solutions. As a result, the initiation of localized corrosion on Alloy 825 is prevented. The formation of oxides, scales, and corrosion product layers between the barriers is shown to reduce the efficiency of the galvanic couple, which may result in conditions under which the localized corrosion of the inner corrosion resistant barrier can occur.

  10. Galvanic corrosion of aluminum-matrix composites. Technical report No. 2, 1 Mar-31 Dec 90

    SciTech Connect

    Hihara, L.H.; Latanision, R.M.


    Galvanic-corrosion rates of Al-matrix composites were high in aerated chloride-containing solutions. Oxygen reduction was found to be the primary cathodic reaction. Aluminum corroded by pitting. The type of noble constituent (i.e., graphite, SiC, or TiB{sub 2}) also affected galvanic-corrosion rates. For example, results indicated that the galvanic-corrosion rate of Al should be about 30 times greater when coupled to graphite than when coupled to SiC or TiB{sub 2}. In dearated solutions, galvanic corrosion was negligible even if chlorides were present. The galvanic-corrosion rates were determined using the zero-resistance ammeter technique and from potentiodynamic polarization diagrams of ultrapure Al, 6061-T6 Al, graphite fiber, SiC, TiB2, and a commercial graphite fiber/6061-T6 Al metal-matrix composite.

  11. 76 FR 72721 - Galvanized Steel Wire From China and Mexico; Scheduling of the Final Phase of Countervailing Duty...

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... the subject merchandise as galvanized steel wire which is a cold- drawn carbon quality steel product... COMMISSION Galvanized Steel Wire From China and Mexico; Scheduling of the Final Phase of Countervailing Duty... Mexico of galvanized steel wire, provided for in subheading 7217.20 of the Harmonized Tariff Schedule...

  12. Selective CD28 Antagonist Blunts Memory Immune Responses and Promotes Long-Term Control of Skin Inflammation in Nonhuman Primates.


    Poirier, Nicolas; Chevalier, Melanie; Mary, Caroline; Hervouet, Jeremy; Minault, David; Baker, Paul; Ville, Simon; Le Bas-Bernardet, Stephanie; Dilek, Nahzli; Belarif, Lyssia; Cassagnau, Elisabeth; Scobie, Linda; Blancho, Gilles; Vanhove, Bernard


    Novel therapies that specifically target activation and expansion of pathogenic immune cell subsets responsible for autoimmune attacks are needed to confer long-term remission. Pathogenic cells in autoimmunity include memory T lymphocytes that are long-lived and present rapid recall effector functions with reduced activation requirements. Whereas the CD28 costimulation pathway predominantly controls priming of naive T cells and hence generation of adaptive memory cells, the roles of CD28 costimulation on established memory T lymphocytes and the recall of memory responses remain controversial. In contrast to CD80/86 antagonists (CTLA4-Ig), selective CD28 antagonists blunt T cell costimulation while sparing CTLA-4 and PD-L1-dependent coinhibitory signals. Using a new selective CD28 antagonist, we showed that Ag-specific reactivation of human memory T lymphocytes was prevented. Selective CD28 blockade controlled both cellular and humoral memory recall in nonhuman primates and induced long-term Ag-specific unresponsiveness in a memory T cell-mediated inflammatory skin model. No modification of memory T lymphocytes subsets or numbers was observed in the periphery, and importantly no significant reactivation of quiescent viruses was noticed. These findings indicate that pathogenic memory T cell responses are controlled by both CD28 and CTLA-4/PD-L1 cosignals in vivo and that selectively targeting CD28 would help to promote remission of autoimmune diseases and control chronic inflammation.

  13. Longitudinal shift in diabetic wound microbiota correlates with prolonged skin defense response.


    Grice, Elizabeth A; Snitkin, Evan S; Yockey, Laura J; Bermudez, Dustin M; Liechty, Kenneth W; Segre, Julia A


    Diabetics frequently suffer from chronic, nonhealing wounds. Although bacterial colonization and/or infection are generally acknowledged to negatively impact wound healing, the precise relationship between the microbial community and impaired wound healing remains unclear. Because the host cutaneous defense response is proposed to play a key role in modulating microbial colonization, we longitudinally examined the diabetic wound microbiome in tandem with host tissue gene expression. By sequencing 16S ribosomal RNA genes, we show that a longitudinal selective shift in wound microbiota coincides with impaired healing in diabetic mice (Lepr(db/db); db/db). We demonstrate a parallel shift in longitudinal gene expression that occurs in a cluster of genes related to the immune response. Further, we establish a correlation between relative abundance of Staphylococcus spp. and the expression of cutaneous defense response genes. Our data demonstrate that integrating two types of global datasets lends a better understanding to the dynamics governing host-microbe interactions.

  14. Galvanic microcells as control agent of indoor microorganisms

    PubMed Central

    Spisak, Wojciech; Chlebicki, Andrzej; Kaszczyszyn, Mariusz


    Today, fungicides are part of the basic tool kit for indoor surface maintenance. However, fungi develop resistance to fungicides, which consequently accelerates the evolution of virulence. Fungicides also carry the risk of adverse effects in humans. Galvanic microcells are a new tool for fungal control on indoor surfaces. We used two types of electrodes, Zn and Cu, with two potential anti-fungal mechanisms: the oligodynamic action of the metal ions themselves and the electricidal effect of the current between the electrodes. The size of the inhibition zone is related to the distance between the electrodes. We hypothesized that the unique geometric properties of the observed inhibition zone could be modelled using multi foci curve Cassini ovals. Moreover, the size of the inhibition zone possessed two maximum values, while the shape of the observed inhibition zones correlated with the shape of the electric field strength. The control activity of the galvanic microcells correlated with decreasing water content in building materials. Thus, this acute antifungal system works the best in damp building environments where the risk of fungal contamination is highest. PMID:27786247

  15. Setup of Galvanic Sensors for the Monitoring of Gilded Bronzes

    PubMed Central

    Goidanich, Sara; Gulotta, Davide; Brambilla, Laura; Beltrami, Ruben; Fermo, Paola; Toniolo, Lucia


    Traditional electrochemical techniques, such as linear polarization resistance (Rp), and electrochemical impedance spectroscopy (EIS), cannot be applied to gilded bronzes, as it may not be possible to interpret the results obtained due to the bimetallic nature of the studied material. The measurement of the macrocouple current generated by the gold/bronze galvanic couple can be used as an indicator of degradation processes. Nevertheless, this measurement cannot be performed directly on the original artifacts due to the systematic presence of short-circuits between the two metals. In the present work the use of galvanic sensors is proposed as a possible solution for the monitoring of gilded bronze artefacts. The sensors have been designed to simulate real gilded bronze surfaces in terms of composition and stratigraphy and have proved to be a reliable diagnostic tool for the in situ monitoring of the rates of deterioration of gilded bronze surfaces and to test new conservation treatments. Their set-up and application is reported and their performances discussed. PMID:24759110

  16. Temperature Controlled Laser Joining of Aluminum to Galvanized Steel

    NASA Astrophysics Data System (ADS)

    Weller, Daniel; Simon, Jörg; Stritt, Peter; Weber, Rudolf; Graf, Thomas; Bezençon, Cyrille; Bassi, Corrado

    Reliable joining of 6000 series aluminum alloy to galvanized steel is a challenge for current manufacturing technologies. To control and limit the formation of brittle intermetallic phases, mixing of both metals in liquid state has to be avoided. It has been shown that laser weld-brazing is a possible process. Thereby the aluminum and zinc layer of the galvanized steel are molten and the steel remains solid during the process. In addition, to avoid zinc degassing, the aluminum melt bath temperature has to be below zinc boiling temperature of 907°C. To meet these requirements a temperature controlled laser process was developed, allowing to join the two materials without flux and filler material. The thickness of the intermetallic layer shows a dependency on the set temperature used to control the process. At optimum set temperature the thickness of intermetallic phases can be limited to about 5 μm. Tensile strengths of the joints of up to 75% of the aluminum base material were achieved.

  17. Electrochemical properties of suprastructures galvanically coupled to a titanium implant.


    Oh, Keun-Taek; Kim, Kyoung-Nam


    In recent years, dental implants have been widely used for the aesthetic and functional restoration of edentulous patients. Dental implants and restorative alloys are required with high corrosion resistance. Suprastructures and implants of different compositions in electrical contact may develop galvanic or coupled corrosion problems. In addition to galvanic corrosion, crevice and pitting corrosion may occur in the marginal gap between dental implant assemblies. In this study, gold, silver-palladium, cobalt-chromium, and nickel-chromium suprastructures were used to investigate their galvanic and crevice corrosion characteristics in combination with titanium (Ti) implants. Potentiodynamic and potentiostatic testing were performed in artificial saliva at 37 degrees C. Potentiodynamic testing was carried out at the potential scan rate of 1 mV/s in the range of -600-1600 mV (SCE). Potentiostatic testing was performed with an open-circuit potential and current densities at -250, 0, and 250 mV (SCE) in artificial saliva. After electrochemical testing, surface morphologies and cross-sections were examined using micrographs of the samples. Potentiodynamic test results indicated that suprastructure/Ti implant couples produced passive current densities in the range of 0.5-12 microA/cm(2); Ti abutment/Ti implant and gold/Ti implant couples exhibited relatively low passive current densities; Co-Cr/Ti implant couples the highest. Co-Cr and Ni-Cr/Ti implant couples showed breakdown potentials of 700 and 570 mV (SCE), respectively. The open-circuit potentials of silver, Ti abutment, gold, Ni-Cr, and Co-Cr/Ti implant couples were -93.2 +/- 93.9, -123.7 +/- 58.8, -140.0 +/- 80.6, -223.5 +/- 35.1, and -312.7 +/- 29.8 mV (SCE), respectively, and did not change with immersion time. The couples exhibited cathodic current densities at -250 mV (SCE); in particular, gold and silver alloys showed high cathodic current densities of -3.18 and -6.63 microA/cm(2), respectively. At 250 mV (SCE

  18. Enhanced non-peptidergic intraepidermal fiber density and an expanded subset of chloroquine-responsive trigeminal neurons in a mouse model of dry skin itch

    PubMed Central

    Valtcheva, Manouela V.; Samineni, Vijay K.; Golden, Judith P.; Gereau, Robert W.; Davidson, Steve


    Chronic pruritic conditions are often associated with dry skin and loss of epidermal barrier integrity. In this study, repeated application of acetone and ether, followed by water (AEW) to the cheek skin of mice produced persistent scratching behavior with no increase in pain-related forelimb wiping, indicating the generation of itch without pain. Cheek skin immunohistochemistry showed a 64.5% increase in total epidermal innervation in AEW-treated mice compared to water-treated controls. This increase was independent of scratching, because mice prevented from scratching by Elizabethan collars showed similar hyperinnervation. To determine the effects of dry skin treatment on specific subsets of peripheral fibers, we examined Ret-positive, CGRP-positive, and GFRα3-positive intraepidermal fiber density. AEW treatment increased Ret-positive fibers, but not CGRP-positive or GFRα3-positive fibers, suggesting that a specific subset of non-peptidergic fibers could contribute to dry skin itch. To test whether trigeminal ganglion neurons innervating the cheek exhibited altered excitability after AEW treatment, primary cultures of retrogradely labeled neurons were examined using whole-cell patch clamp electrophysiology. AEW treatment produced no differences in measures of excitability compared to water-treated controls. In contrast, a significantly higher proportion of trigeminal ganglion neurons were responsive to the non-histaminergic pruritogen chloroquine after AEW treatment. We conclude that non-peptidergic, Ret-positive fibers and chloroquine-sensitive neurons may contribute to dry skin pruritus. PMID:25640289

  19. No effect of skin temperature on human ventilation response to hypercapnia during light exercise with a normothermic core temperature.


    Greiner, Jesse G; Clegg, Miriam E; Walsh, Michael L; White, Matthew D


    Hyperthermia potentiates the influence of CO(2) on pulmonary ventilation (.V(E)). It remains to be resolved how skin and core temperatures contribute to the elevated exercise ventilation response to CO(2). This study was conducted to assess the influences of mean skin temperature (_T(SK)) and end-tidal PCO(2) (P(ET)CO(2)) on .V(E) during submaximal exercise with a normothermic esophageal temperature (T(ES)). Five males and three females who were 1.76 +/- 0.11 m tall (mean +/- SD), 75.8 +/- 15.6 kg in weight and 22.0 +/- 2.2 years of age performed three 1 h exercise trials in a climatic chamber with the relative humidity (RH) held at 31.5 +/- 9.5% and the ambient temperature (T (AMB)) maintained at one of 25, 30, or 35 degrees C. In each trial, the volunteer breathed eucapnic air for 5 min during a rest period and subsequently cycle ergometer exercised at 50 W until T (ES) stabilized at approximately 37.1 +/- 0.4 degrees C. Once T (ES) stabilized in each trial, the volunteer breathed hypercapnic air twice for approximately 5 min with P(ET)CO(2) elevated by approximately +4 or +7.5 mmHg. The significantly (P < 0.05) different increases of P(ET)CO(2) of +4.20 +/- 0.49 and +7.40 +/- 0.51 mmHg gave proportionately larger increases in .V(E) of 10.9 +/- 3.6 and 15.2 +/- 3.6 L min(-1) (P = 0.001). This hypercapnia-induced hyperventilation was uninfluenced by varying the _T(SK) to three significantly different levels (P < 0.001) of 33.2 +/- 1.2 degrees C, to 34.5 +/- 0.8 degrees C to 36.4 +/- 0.5 degrees C. In conclusion, the results support that skin temperature between approximately 33 and approximately 36 degrees C has neither effect on pulmonary ventilation nor on hypercapnia-induced hyperventilation during a light exercise with a normothermic core temperature.

  20. Response of mouse skin to tattooing: use of SKH-1 mice as a surrogate model for human tattooing

    SciTech Connect

    Gopee, Neera V.; Cui, Yanyan; Olson, Greg; Warbritton, Alan R.; Miller, Barbara J.; Couch, Letha H.; Wamer, Wayne G.; Howard, Paul C. . E-mail:


    Tattooing is a popular cosmetic practice involving more than 45 million US citizens. Since the toxicology of tattoo inks and pigments used to formulate tattoo inks has not been reported, we studied the immunological impact of tattooing and determined recovery time from this trauma. SKH-1 hairless mice were tattooed using commercial tattoo inks or suspensions of titanium dioxide, cadmium sulfide, or iron oxide, and sacrificed at 0.5, 1, 3, 4, 7, or 14 days post-tattooing. Histological evaluation revealed dermal hemorrhage at 0.5 and 1 day. Acute inflammation and epidermal necrosis were initiated at 0.5 day decreasing in incidence by day 14. Dermal necrosis and epidermal hyperplasia were prominent by day 3, reducing in severity by day 14. Chronic active inflammation persisted in all tattooed mice from day 3 to 14 post-tattooing. Inguinal and axillary lymph nodes were pigmented, the inguinal being most reactive as evidenced by lymphoid hyperplasia and polymorphonuclear infiltration. Cutaneous nuclear protein concentrations of nuclear factor-kappa B were elevated between 0.5 and 4 days. Inflammatory and proliferative biomarkers, cyclooxygenase-1, cyclooxygenase-2, and ornithine decarboxylase protein levels were elevated between 0.5 and 4 days in the skin and decreased to control levels by day 14. Interleukin-1 beta and interleukin-10 were elevated in the lymph nodes but suppressed in the tattooed skin, with maximal suppression occurring between days 0.5 and 4. These data demonstrate that mice substantially recover from the tattooing insult by 14 days, leaving behind pigment in the dermis and the regional lymph nodes. The response seen in mice is similar to acute injury seen in humans, suggesting that the murine model might be a suitable surrogate for investigating the toxicological and phototoxicological properties of ingredients used in tattooing.

  1. Effects of Head-Down Bed Rest on the Executive Functions and Emotional Response

    PubMed Central

    Liu, Qing; Zhou, Renlai; Chen, Shanguang; Tan, Cheng


    Prolonged bed rest may cause changes in the autonomic nervous system that are related to cognition and emotion. This study adopted an emotional flanker task to evaluate the effect of 45 days -6° head-down bed rest (HDBR) on executive functioning in 16 healthy young men at each of six time points: the second-to-last day before the bed rest period, the eleventh, twentieth, thirty-second and fortieth day during the bed rest period, and the eighth day after the bed rest period. In addition, self-report inventories (Beck Anxiety Inventory, BAI; Beck Depression Inventory, BDI; Positive Affect and Negative Affect Scale, PANAS) were conducted to record emotional changes, and the participants’ galvanic skin response (GSR), heart rate (HR) and heart rate variability (HRV) were assessed as measures of physiological activity. The results showed that the participants’ reaction time on the flanker task increased significantly relative to their responses on the second-to-last day before the period of bed rest, their galvanic skin response weakened and their degrees of positive affect declined during the bed rest period. Our results provide some evidence for a detrimental effect of prolonged bed rest on executive functioning and positive affect. Whether this stems from a lack of aerobic physical activity and/or the effect of HDBR itself remains to be determined. PMID:23284916

  2. Tension responses to joule temperature jump in skinned rabbit muscle fibres.

    PubMed Central

    Bershitsky, S Y; Tsaturyan, A K


    1. Joule temperature jumps (T-jumps) from 5-9 degrees C up to 40 degrees C were used to study the cross-bridge kinetics and thermodynamics in skinned rabbit muscle fibres. To produce a T-jump, an alternating current pulse was passed through a fibre 5 s after removing the activating solution (pCa congruent to 4.5) from the experimental trough. The pulse frequency was congruent to 30 kHz, amplitude less than or equal to 3 kV, and duration 0.2 ms. The pulse energy liberated in the fibre was calculated using a special analog circuit and then used for estimation of the T-jump amplitude. 2. The T-jump induced a tri-exponential tension transient. Phases 1 and 2 had rate constants k1 = 450-1750 s-1 and k2 = 60-250 s-1 respectively, characterizing the tension rise, whereas phase 3 had a rate constant k3 = 5-10 s-1 representing tension recovery due to the fibre cooling. 3. An increase from 13 to 40 degrees C for the final temperature achieved by the T-jump led to an increase in the amplitudes of phases 1 and 2. After T-jumps to 30-40 degrees C during phase 1, tension increased by 50-80%. During phase 2 an approximately 2-fold tension increase continued. Rate constants k1 and k2 increased with temperature and temperature coefficients (Q10) were 1.6 and 1.7, respectively. 4. To study which processes in the cross-bridges are involved in phases 1 and 2, a series of experiments were made where step length changes of -9 to +3 nm (hs)-1 (nanometres per half-sarcomere length) were applied to the fibre 4 ms before the T-jump. 5. After the step shortening, the rate constant of phase 1 increased, whereas its amplitude decreased compared to those without a length change. This indicates that phase 1 is determined by some force-generating process in the cross-bridges attached to the thin filaments. This process is, most probably, the same as that producing the early tension recovery following the length change. The enthalpy change (delta H) associated with the reaction controlling this

  3. Increased skin conductance responses and neural activity during fear conditioning are associated with a repressive coping style

    PubMed Central

    Klucken, Tim; Kruse, Onno; Schweckendiek, Jan; Stark, Rudolf


    The investigation of individual differences in coping styles in response to fear conditioning is an important issue for a better understanding of the etiology and treatment of psychiatric disorders. It has been assumed that an avoidant (repressive) coping style is characterized by increased emotion regulation efforts in context of fear stimuli as compared to a more vigilant coping style. However, no study so far has investigated the neural correlates of fear conditioning of repressors and sensitizers. In the present fMRI study, 76 participants were classified as repressors or as sensitizers and were exposed to a fear conditioning paradigm, in which the CS+ predicted electrical stimulation, while another neutral stimulus (CS−) did not. In addition, skin conductance responses (SCRs) were measured continuously. As the main findings, we found increased neural activity in repressors as compared to sensitizers in the ventromedial prefrontal cortex and the anterior cingulate cortex (ACC) during fear conditioning. In addition, elevated activity to the CS+ in amygdala, insula, occipital, and orbitofrontal cortex (OFC) as well as elevated conditioned SCRs were found in repressors. The present results demonstrate increased neural activations in structures linked to emotion down-regulation mechanisms like the ventromedial prefrontal cortex, which may reflect the increased coping effort in repressors. At the same time, repressors showed increased activations in arousal and evaluation-associated structures like the amygdala, the occipital cortex (OCC), and the OFC, which was mirrored in increased SCRs. The present results support recent assumptions about a two-process model of repression postulating a fast vigilant response to fear stimuli, and a second process associated with the down-regulation of emotional responses. PMID:26082695

  4. Th17 and regulatory T cells contribute to the in situ immune response in skin lesions of Jorge Lobo's disease.


    Kanashiro-Galo, Luciane; Pagliari, Carla; Barboza, Tania Cristina; de Brito, Arival Cardoso; Xavier, Marilia Brasil; de Oliveira, Clivia Maria Moraes; Unger, Deborah Aben Athar; Sotto, Mirian Nacagami; Quaresma, Juarez Antonio Simões; Duarte, Maria Irma Seixas


    Jorge Lobo's disease (JLD) is a chronic granulomatous mycosis described in various Latin American countries. The main objective of the present study was to investigate the possible role of Th17 and Foxp3+ Treg cells in the pathogenesis of Jorge Lobo's disease. Human skin biopsies were submitted to an immunohistochemistry protocol to detect Foxp3, interleukin (IL)-1beta, CD25, IL-6, IL-17, and IL-23. The epidermis presented acanthosis, hyperkeratosis, and frequent presence of fungi. The dermis presented inflammatory infiltrate comprising macrophages, lymphocytes, epithelioid and multinucleated cells, and an intense number of fungi. Foxp3+ Treg cells and IL-17+ cells were visualized in lymphocytes in the inflammatory infiltrate. IL-1, IL-2R (CD25), IL-6, and IL-23 were visualized in the dermis, intermingled with fungal cells, permeating or participating of the granuloma. Following IL-17, the most prominent cytokine was IL-6. IL-23 and cells expressing CD25 were present in fewer number. The comparative analysis between IL-17 and Foxp3 demonstrated a statistically significant increased number of IL-17+ cells. Th17 cells play a role in the immune response of JLD. IL-1beta and IL-6 added to the previously described increased number of TGF-beta would stimulate such pattern of response. Th17 cells could be present as an effort to modulate the local immune response; however, high levels of a Th17 profile could overcome the role of Treg cells. The unbalance between Treg/Th17 cells seems to corroborate with the less effective immune response against the fungus.

  5. Skin Conditions


    Your skin is your body's largest organ. It covers and protects your body. Your skin Holds body fluids in, preventing dehydration Keeps harmful ... it Anything that irritates, clogs, or inflames your skin can cause symptoms such as redness, swelling, burning, ...

  6. Aging Skin


    ... email address Submit Home > Healthy Aging > Wellness Healthy Aging Aging skin More information on aging skin When it ... treated early. Return to top More information on Aging skin Read more from Varicose Veins ...

  7. Histological Lesions and Cellular Response in the Skin of Alpine Chamois (Rupicapra r. rupicapra) Spontaneously Affected by Sarcoptic Mange

    PubMed Central

    Salvadori, Claudia; Lazzarotti, Camilla; Trogu, Tiziana; Lanfranchi, Paolo


    Population dynamics of chamois (genus Rupicapra, subfamily Caprinae) can be influenced by infectious diseases epizootics, of which sarcoptic mange is probably the most severe in the Alpine chamois (Rupicapra rupicapra rupicapra). In this study, skin lesions and cellular inflammatory infiltrates were characterized in 44 Alpine chamois affected by sarcoptic mange. Dermal cellular responses were evaluated in comparison with chamois affected by trombiculosis and controls. In both sarcoptic mange and trombiculosis, a significantly increase of eosinophils, mast cells, T and B lymphocytes, and macrophages was detected. Moreover, in sarcoptic mange significant higher numbers of T lymphocytes and macrophages compared to trombiculosis were observed. Lesions in sarcoptic mange were classified in three grades, according to crusts thickness, correlated with mite counts. Grade 3 represented the most severe form with crust thickness more than 3.5 mm, high number of mites, and severe parakeratosis with diffuse bacteria. Evidence of immediate and delayed hypersensitivity was detected in all three forms associated with diffuse severe epidermal hyperplasia. In grade 3, a significant increase of B lymphocytes was evident compared to grades 1 and 2, while eosinophil counts were significantly higher than in grade 1, but lower than in grade 2 lesions. An involvement of nonprotective Th2 immune response could in part account for severe lesions of grade 3. PMID:27403422

  8. A psychophysiological inquiry into the nature of the Sokolovian orienting response comparator model: skin conductance and EEG data.


    Barceló, F; Hall, M; Gale, A


    The mechanisms which trigger the orienting response (OR) are still the subject of lively debate. Sokolov (1990) proposes the development of a multidimensional model of the physical parameters of stimulation. Recent OR research has shown that the skin conductance OR (SCOR) is related to task demands and controlled processing, although this is not so clear for central physiological indexes of orienting. Seventy-three subjects performed visual discriminations of stimuli within a warning-stimulus paradigm. The physical complexity of stimuli and their task relevance were manipulated within subjects, while the nonspecific effects of workload were controlled with a group factor. SCORs were measured concurrently with 1-s epochs of EEG alpha and theta power from Fz, Cz, Pz, and Oz. Neither index was reliably affected by the physical complexity of stimulation alone. However, both higher task relevance and higher workload significantly increased the magnitude of EEGORs and SCORs. Task averages of central and autonomic activity showed an overall pattern of covariation, but a second-by-second breakdown of EEG spectra suggests that the SCOR may be an aggregate of the activation of diverse brain mechanisms responsible for physiological orienting. The results are consistent with a model of orienting as a continuous dimension of resource allocation to anticipated and current task demands, rather than with the abrupt dichotomy between voluntary and involuntary orienting. Implications for the classical OR Sokolovian model are discussed.

  9. Curcumin induces stress response and hormetically modulates wound healing ability of human skin fibroblasts undergoing ageing in vitro.


    Demirovic, Dino; Rattan, Suresh I S


    Wound healing becomes impaired in several diseases and during ageing. A commonly used model for the study of wound healing is a scratched monolayer of cells in vitro, which is convenient for the analysis of the cellular and molecular changes occurring during the two phases of wound healing, namely cell migration and cell proliferation. Cell migration, which is the primary event to occur during initial wound healing, is inversely dependent on the number of focal adhesions (FA) that attach cells to the extracellular matrix. Here we report that the number of FA, measured by determining the levels of FA-proteins paxillin and talin, increase with increasing population doubling level of the serially passaged normal adult skin fibroblasts, and that this increase may account for the age-related slowing down of wound healing in vitro. We also report that curcumin, a component of the widely used spice turmeric, modulates wound healing in vitro in a biphasic dose response manner, being stimulatory at low doses (between 1 and 5 μM), and inhibitory at higher doses. Furthermore, our results show that the hormetic effects of low levels of curcumin are achieved by virtue of it being a hormetin in terms of the induction of stress response pathways, including Nrf2 and HO-1 in human cells.

  10. Arsenic transformation predisposes human skin keratinocytes to UV-induced DNA damage yet enhances their survival apparently by diminishing oxidant response

    SciTech Connect

    Sun Yang; Kojima, Chikara; Chignell, Colin; Mason, Ronald; Waalkes, Michael P.


    Inorganic arsenic and UV, both human skin carcinogens, may act together as skin co-carcinogens. We find human skin keratinocytes (HaCaT cells) are malignantly transformed by low-level arsenite (100 nM, 30 weeks; termed As-TM cells) and with transformation concurrently undergo full adaptation to arsenic toxicity involving reduced apoptosis and oxidative stress response to high arsenite concentrations. Oxidative DNA damage (ODD) is a possible mechanism in arsenic carcinogenesis and a hallmark of UV-induced skin cancer. In the current work, inorganic arsenite exposure (100 nM) did not induce ODD during the 30 weeks required for malignant transformation. Although acute UV-treatment (UVA, 25 J/cm{sup 2}) increased ODD in passage-matched control cells, once transformed by arsenic to As-TM cells, acute UV actually further increased ODD (> 50%). Despite enhanced ODD, As-TM cells were resistant to UV-induced apoptosis. The response of apoptotic factors and oxidative stress genes was strongly mitigated in As-TM cells after UV exposure including increased Bcl2/Bax ratio and reduced Caspase-3, Nrf2, and Keap1 expression. Several Nrf2-related genes (HO-1, GCLs, SOD) showed diminished responses in As-TM cells after UV exposure consistent with reduced oxidant stress response. UV-exposed As-TM cells showed increased expression of cyclin D1 (proliferation gene) and decreased p16 (tumor suppressor). UV exposure enhanced the malignant phenotype of As-TM cells. Thus, the co-carcinogenicity between UV and arsenic in skin cancer might involve adaptation to chronic arsenic exposure generally mitigating the oxidative stress response, allowing apoptotic by-pass after UV and enhanced cell survival even in the face of increased UV-induced oxidative stress and increased ODD. - Highlights: > Arsenic transformation adapted to UV-induced apoptosis. > Arsenic transformation diminished oxidant response. > Arsenic transformation enhanced UV-induced DNA damage.

  11. De novo assembly of the sea trout (Salmo trutta m. trutta) skin transcriptome to identify putative genes involved in the immune response and epidermal mucus secretion

    PubMed Central

    Wenne, Roman; Burzynski, Artur


    In fish, the skin is a multifunctional organ and the first barrier against pathogens. Salmonids differ in their susceptibility to microorganisms due to varied skin morphology and gene expression patterns. The brown trout is a salmonid species with important commercial and ecological value in Europe. However, there is a lack of knowledge regarding the genes involved in the immune response and mucus secretion in the skin of this fish. Thus, we characterized the skin transcriptome of anadromous brown trout using next-generation sequencing (NGS). A total of 1,348,306 filtered reads were obtained and assembled into 75,970 contigs. Of these contigs 48.57% were identified using BLAST tool searches against four public databases. KEGG pathway and Gene Ontology analyses revealed that 13.40% and 34.57% of the annotated transcripts, respectively, represent a variety of biological processes and functions. Among the identified KEGG Orthology categories, the best represented were signal transduction (23.28%) and immune system (8.82%), with a variety of genes involved in immune pathways, implying the differentiation of immune responses in the trout skin. We also identified and transcriptionally characterized 8 types of mucin proteins–the main structural components of the mucosal layer. Moreover, 140 genes involved in mucin synthesis were identified, and 1,119 potential simple sequence repeats (SSRs) were detected in 3,134 transcripts. PMID:28212382

  12. Nordihydroguaiaretic Acid from Creosote Bush (Larrea tridentata) Mitigates 12-O-Tetradecanoylphorbol-13-Acetate-Induced Inflammatory and Oxidative Stress Responses of Tumor Promotion Cascade in Mouse Skin

    PubMed Central

    Rahman, Shakilur; Ansari, Rizwan Ahmed; Rehman, Hasibur; Parvez, Suhel; Raisuddin, Sheikh


    Nordihydroguaiaretic acid (NDGA) is a phenolic antioxidant found in the leaves and twigs of the evergreen desert shrub, Larrea tridentata (Sesse and Moc. ex DC) Coville (creosote bush). It has a long history of traditional medicinal use by the Native Americans and Mexicans. The modulatory effects of topically applied NDGA was studied on acute inflammatory and oxidative stress responses in mouse skin induced by stage I tumor promoting agent, 12-O-tetradecanoylphorbol-13-acetate (TPA). Double TPA treatment adversely altered many of the marker responses of stage I skin tumor promotion cascade. Pretreatment of NDGA in TPA-treated mice mitigated cutaneous lipid peroxidation and inhibited production of hydrogen peroxide. NDGA treatment also restored reduced glutathione level and activities of antioxidant enzymes. Elevated activities of myeloperoxidase, xanthine oxidase and skin edema formation in TPA-treated mice were also lowered by NDGA indicating a restrained inflammatory response. Furthermore, results of histological study demonstrated inhibitory effect of NDGA on cellular inflammatory responses. This study provides a direct evidence of antioxidative and anti-inflammatory properties of NDGA against TPA-induced cutaneous inflammation and oxidative stress corroborating its chemopreventive potential against skin cancer. PMID:19861506

  13. Potent response of QS-21 as a vaccine adjuvant in the skin when delivered with the Nanopatch, resulted in adjuvant dose sparing

    PubMed Central

    Ng, Hwee-Ing; Fernando, Germain J. P.; Depelsenaire, Alexandra C. I.; Kendall, Mark A. F.


    Adjuvants play a key role in boosting immunogenicity of vaccines, particularly for subunit protein vaccines. In this study we investigated the induction of antibody response against trivalent influenza subunit protein antigen and a saponin adjuvant, QS-21. Clinical trials of QS-21 have demonstrated the safety but, also a need of high dose for optimal immunity, which could possibly reduce patient acceptability. Here, we proposed the use of a skin delivery technology – the Nanopatch – to reduce both adjuvant and antigen dose but also retain its immune stimulating effects when compared to the conventional needle and syringe intramuscular (IM) delivery. We have demonstrated that Nanopatch delivery to skin requires only 1/100th of the IM antigen dose to induce equivalent humoral response. QS-21 enhanced humoral response in both skin and muscle route. Additionally, Nanopatch has demonstrated 30-fold adjuvant QS-21 dose sparing while retaining immune stimulating effects compared to IM. QS-21 induced localised, controlled cell death in the skin, suggesting that the danger signals released from dead cells contributed to the enhanced immunogenicity. Taken together, these findings demonstrated the suitability of reduced dose of QS-21 and the antigen using the Nanopatch to enhance humoral responses, and the potential to increase patient acceptability of QS-21 adjuvant. PMID:27404789

  14. Potent response of QS-21 as a vaccine adjuvant in the skin when delivered with the Nanopatch, resulted in adjuvant dose sparing.


    Ng, Hwee-Ing; Fernando, Germain J P; Depelsenaire, Alexandra C I; Kendall, Mark A F


    Adjuvants play a key role in boosting immunogenicity of vaccines, particularly for subunit protein vaccines. In this study we investigated the induction of antibody response against trivalent influenza subunit protein antigen and a saponin adjuvant, QS-21. Clinical trials of QS-21 have demonstrated the safety but, also a need of high dose for optimal immunity, which could possibly reduce patient acceptability. Here, we proposed the use of a skin delivery technology - the Nanopatch - to reduce both adjuvant and antigen dose but also retain its immune stimulating effects when compared to the conventional needle and syringe intramuscular (IM) delivery. We have demonstrated that Nanopatch delivery to skin requires only 1/100(th) of the IM antigen dose to induce equivalent humoral response. QS-21 enhanced humoral response in both skin and muscle route. Additionally, Nanopatch has demonstrated 30-fold adjuvant QS-21 dose sparing while retaining immune stimulating effects compared to IM. QS-21 induced localised, controlled cell death in the skin, suggesting that the danger signals released from dead cells contributed to the enhanced immunogenicity. Taken together, these findings demonstrated the suitability of reduced dose of QS-21 and the antigen using the Nanopatch to enhance humoral responses, and the potential to increase patient acceptability of QS-21 adjuvant.

  15. Skin abscess


    Abscess - skin; Cutaneous abscess; Subcutaneous abscess; MRSA - abscess; Staph infection - abscess ... Skin abscesses are common and affect people of all ages. They occur when an infection causes pus ...

  16. Design and fabrication of a sensor integrated MEMS/NANO-skin system for human physiological response measurement

    NASA Astrophysics Data System (ADS)

    Leng, Hongjie; Lin, Yingzi


    Human state in human-machine systems highly affects the system performance, and should be monitored. Physiological cues are more suitable for monitoring the human state in human-machine system. This study was focused on developing a new sensing system, i.e. NANO-Skin, to non-intrusively measure physiological cues from human-machine contact surfaces for human state recognition. The first part was to analyze the relation between human state and physiological cues. Generally, heart rate, skin conductance, skin temperature, operating force, blood alcohol concentration, sweat rate, and electromyography have close relation with human state, and can be measured from human skin. The second part was to compare common sensors, MEMS sensors, and NANO sensors. It was found that MEMS sensors and NANO sensors can offer unique contributions to the development of NANO-Skin. The third part was to discuss the design and manufacture of NANO-Skin. The NANO-Skin involves five components, the flexible substrate, sensors, special integrated circuit, interconnection between sensors and special integrated circuit, and protection layer. Experiments were performed to verify the measurement accuracy of NANO-Skin. It is feasible to use NANO-Skins to non-intrusively measure physiological cues from human-machine contact surfaces for human state recognition.

  17. CANVAS 1 and 2: analysis of clinical response at day 3 in two phase 3 trials of ceftaroline fosamil versus vancomycin plus aztreonam in treatment of acute bacterial skin and skin structure infections.


    Friedland, H David; O'Neal, Tanya; Biek, Donald; Eckburg, Paul B; Rank, Douglas R; Llorens, Lily; Smith, Alex; Witherell, Gary W; Laudano, Joseph B; Thye, Dirk


    Scientific and regulatory interest in assessing clinical endpoints after 48 to 72 h of treatment for acute bacterial skin and skin structure infections (ABSSSI) has increased. Historical, pre-antibiotic-era data suggest that a treatment effect relative to untreated controls can be discerned in this time interval. Ceftaroline fosamil, a broad-spectrum bactericidal cephalosporin with activity against Gram-positive organisms, including methicillin-resistant Staphylococcus aureus (MRSA), and Gram-negative organisms was efficacious in two phase 3 trials of complicated skin infections (CANVAS 1 and 2) using clinical cure rates at the test-of-cure visit. To assess an early clinical response in the CANVAS trials, a retrospective analysis using a day 3 clinical endpoint was conducted. Adults with ABSSSI received intravenous ceftaroline fosamil at 600 mg every 12 h (q12h) or vancomycin at 1 g plus aztreonam at 1 g (V/A) q12h for 5 to 14 days. Clinical response at day 3, defined as cessation of infection spread and absence of fever, was analyzed in patients with a lesion size of ≥ 75 cm(2) and either deep and/or extensive cellulitis, major abscess, or an infected wound. Day 3 integrated CANVAS clinical response rates were 74.0% (296/400) for ceftaroline and 66.2% (263/397) for V/A (difference, 7.8%; 95% confidence interval [CI], 1.3% to 14.0%). In the individual studies, absolute treatment differences of 9.4% (CANVAS 1) and 5.9% (CANVAS 2) favoring ceftaroline were observed. For ABSSSI due to MRSA, response rates were 81.7% and 77.4% in the ceftaroline and V/A groups, respectively. In this retrospective analysis, ceftaroline fosamil monotherapy had a numerically higher clinical response than V/A at day 3 in the treatment of ABSSSI.

  18. Prostaglandin receptor EP2 is responsible for cyclooxygenase-2 induction by prostaglandin E2 in mouse skin.


    Ansari, Kausar M; Sung, You Me; He, Guobin; Fischer, Susan M


    The EP2 prostanoid receptor is one of the four subtypes of receptors for prostaglandin E2 (PGE2). We previously reported that deletion of EP2 led to resistance to chemically induced mouse skin carcinogenesis, whereas overexpression of EP2 resulted in enhanced tumor development. The purpose of this study was to investigate the underlying molecular mechanisms. We found that EP2 knockout mice had reduced cyclooxygenase-2 (COX-2) expression after 12-O-tetradecanoylphorbol-13-acetate (TPA) treatment compared with wild-type (WT) mice. Further, primary keratinocytes from EP2 transgenic mice had increased COX-2 expression after either TPA or PGE2 treatment and COX-2 expression was blocked by 10 microM SQ 22,536, an adenylate cyclase inhibitor. EP2 knockout mice had significantly decreased, whereas EP2 transgenic mice had significantly increased PGE2 production in response to a single treatment of TPA. Cyclic AMP response element-binding protein (CREB) phosphorylation was elevated to a greater extent in keratinocytes from EP2 transgenic mice compared with those of WT mice following PGE2 treatment. A protein kinase A (PKA) inhibitor reduced PGE2-mediated CREB phosphorylation in keratinocytes from EP2 transgenic mice. Furthermore, we found that there was no CREB phosphorylation in EP2 knockout mice following PGE2 treatment. PGE2-induced DNA synthesis (cell proliferation) was significantly decreased in keratinocytes from EP2 knockout mice following pretreatment with 10 microM SQ 22,536. Taken together, EP2 activation of the PKA/CREB-signaling pathway is responsible for keratinocyte proliferation and our findings reveal a positive feedback loop between COX-2 and PGE2 that is mediated by the EP2 receptor.

  19. Characterization of the mechanisms underlying the inflammatory response to Polistes lanio lanio (paper wasp) venom in mouse dorsal skin.


    Yshii, Lídia M; Souza, Gustavo H M F; Camargo, Enilton A; Eberlin, Marcos N; Ribela, Maria Teresa C P; Muscará, Marcelo N; Hyslop, Stephen; Costa, Soraia K P


    Stings by Polistes wasps can cause life-threatening allergic reactions, pain and inflammation. We examined the changes in microvascular permeability and neutrophil influx caused by the venom of Polistes lanio a paper wasp found in southeastern Brazil. The intradermal injection of wasp venom caused long-lasting paw oedema and dose-dependently increased microvascular permeability in mouse dorsal skin. SR140333, an NK(1) receptor antagonist, markedly inhibited the response, but the NK(2) receptor antagonist SR48968 was ineffective. The oedema was reduced in capsaicin-treated rats, indicating a direct activation of sensory fibres. Dialysis of the venom partially reduced the oedema and the remaining response was further inhibited by SR140333. Mass spectrometric analysis of the venom revealed two peptides (QPPTPPEHRFPGLM and ASEPTALGLPRIFPGLM) with sequence similarities to the C-terminal region of tachykinin-like peptides found in Phoneutria nigriventer spider venom and vertebrates. Wasp venom failed to release histamine from mast cells in vitro and spectrofluorometric assay of the venom revealed a negligible content of histamine in the usual dose of P. l. lanio venom (1nmol of histamine/7mug of venom) that was removed by dialysis. The histamine H(1) receptor antagonist pyrilamine, but not bradykinin B(1) or B(2) receptor antagonists, inhibited venom-induced oedema. In conclusion, P. l. lanio venom induces potent oedema and increases vascular permeability in mice, primarily through activation of tachykinin NK(1) receptors by substance P released from sensory C fibres, which in turn releases histamine from dermal mast cells. This is the first description of a neurovascular mechanism for P. l. lanio venom-mediated inflammation. The extent to which the two tachykinin-like peptides identified here contribute to this neurogenic inflammatory response remains to be elucidated.

  20. Epidermal p53 response and repair of thymine dimers in human skin after a single dose of ultraviolet radiation: effects of photoprotection.


    Ling, G; Chadwick, C A; Berne, B; Potten, C S; Pontén, J; Pontén, F


    A cellular p53 response, DNA repair enzymes and melanin pigmentation are important strategies utilized by skin keratinocytes against impairment caused by ultraviolet radiation (UVR). In this study a double-immunofluorescence technique was used to investigate UVR-induced thymine dimers and p53 protein simultaneously. Four healthy volunteers were irradiated on both sides of their buttock skin with a single dose of solar-simulating UVR. One side was pretreated with a topical sunscreen. Biopsies from different time-points were immunostained for visualization of thymine dimers, p53 and proliferation. One single physiological dose of UVR generated widespread formation of thymine dimers throughout the epidermis 4h after irradiation. The level of thymine dimers decreased over time and was followed by a p53 response in the same cells. A late proliferative response was also found. The formation of thymine dimers, the p53 response and the late proliferative response were partially blocked by topical sunscreen. Large inter-individual differences in the kinetics of thymine dimer formation and repair as well as in the p53 response were evident in both sunscreen-protected and unprotected skin.

  1. Charging system with galvanic isolation and multiple operating modes

    SciTech Connect

    Kajouke, Lateef A.; Perisic, Milun; Ransom, Ray M.


    Systems and methods are provided for operating a charging system with galvanic isolation adapted for multiple operating modes. A vehicle charging system comprises a DC interface, an AC interface, a first conversion module coupled to the DC interface, and a second conversion module coupled to the AC interface. An isolation module is coupled between the first conversion module and the second conversion module. The isolation module comprises a transformer and a switching element coupled between the transformer and the second conversion module. The transformer and the switching element are cooperatively configured for a plurality of operating modes, wherein each operating mode of the plurality of operating modes corresponds to a respective turns ratio of the transformer.

  2. Liquid Galvanic Coatings for Protection of Imbedded Metals

    NASA Technical Reports Server (NTRS)

    MacDowell, Louis G. (Inventor); Curran, Joseph J. (Inventor)


    Coating compositions and methods of their use are described herein for the reduction of corrosion in imbedded metal structures. The coatings are applied as liquids to an external surface of a substrate in which the metal structures are imbedded. The coatings are subsequently allowed to dry. The liquid applied coatings provide galvanic protection to the imbedded metal structures. Continued protection can be maintained with periodic reapplication of the coating compositions, as necessary, to maintain electrical continuity. Because the coatings may be applied using methods similar to standard paints, and because the coatings are applied to external surfaces of the substrates in which the metal structures are imbedded, the corresponding corrosion protection may be easily maintained. The coating compositions are particularly useful in the protection of metal-reinforced concrete.

  3. Skin Cancer Protective Behaviors among the Elderly: Explaining Their Response to a Health Education Program Using the Health Belief Model.

    ERIC Educational Resources Information Center

    Carmel, Sara; And Others


    In 4 kibbutzim, 43 adults over 60 completed a questionnaire on sun-exposure protective behaviors before and 2 weeks and 4 months after a skin cancer intervention. Beliefs about skin cancer did not change, but beliefs about the value of health and internal health locus of control changed significantly. (SK)


    EPA Science Inventory

    Abstract - Chronic drinking water exposure to inorganic arsenic and its metabolites increases tumor frequency in the skin of K6/ODC transgenic mice. To identify potential biomarkers and modes of action for this skin tumorigenicity, gene expression profiles were characterized fro...

  5. A toll-like receptor 2-responsive lipid effector pathway protects mammals against skin infections with gram-positive bacteria.


    Georgel, Philippe; Crozat, Karine; Lauth, Xavier; Makrantonaki, Evgenia; Seltmann, Holger; Sovath, Sosathya; Hoebe, Kasper; Du, Xin; Rutschmann, Sophie; Jiang, Zhengfan; Bigby, Timothy; Nizet, Victor; Zouboulis, Christos C; Beutler, Bruce


    flake (flk), an N-ethyl-N-nitrosourea-induced recessive germ line mutation of C57BL/6 mice, impairs the clearance of skin infections by Streptococcus pyogenes and Staphylococcus aureus, gram-positive pathogens that elicit innate immune responses by activating Toll-like receptor 2 (TLR2). Positional cloning and sequencing revealed that flk is a novel allele of the stearoyl coenzyme A desaturase 1 gene (Scd1). flake homozygotes show reduced sebum production and are unable to synthesize the monounsaturated fatty acids (MUFA) palmitoleate (C(16:1)) and oleate (C(18:1)), both of which are bactericidal against gram-positive (but not gram-negative) organisms in vitro. However, intradermal MUFA administration to S. aureus-infected mice partially rescues the flake phenotype, which indicates that an additional component of the sebum may be required to improve bacterial clearance. In normal mice, transcription of Scd1-a gene with numerous NF-kappaB elements in its promoter--is strongly and specifically induced by TLR2 signaling. Similarly, the SCD1 gene is induced by TLR2 signaling in a human sebocyte cell line. These observations reveal the existence of a regulated, lipid-based antimicrobial effector pathway in mammals and suggest new approaches to the treatment or prevention of infections with gram-positive bacteria.

  6. A Toll-Like Receptor 2-Responsive Lipid Effector Pathway Protects Mammals against Skin Infections with Gram-Positive Bacteria

    PubMed Central

    Georgel, Philippe; Crozat, Karine; Lauth, Xavier; Makrantonaki, Evgenia; Seltmann, Holger; Sovath, Sosathya; Hoebe, Kasper; Du, Xin; Rutschmann, Sophie; Jiang, Zhengfan; Bigby, Timothy; Nizet, Victor; Zouboulis, Christos C.; Beutler, Bruce


    flake (flk), an N-ethyl-N-nitrosourea-induced recessive germ line mutation of C57BL/6 mice, impairs the clearance of skin infections by Streptococcus pyogenes and Staphylococcus aureus, gram-positive pathogens that elicit innate immune responses by activating Toll-like receptor 2 (TLR2) (K. Takeda and S. Akira, Cell. Microbiol. 5:143-153, 2003). Positional cloning and sequencing revealed that flk is a novel allele of the stearoyl coenzyme A desaturase 1 gene (Scd1). flake homozygotes show reduced sebum production and are unable to synthesize the monounsaturated fatty acids (MUFA) palmitoleate (C16:1) and oleate (C18:1), both of which are bactericidal against gram-positive (but not gram-negative) organisms in vitro. However, intradermal MUFA administration to S. aureus-infected mice partially rescues the flake phenotype, which indicates that an additional component of the sebum may be required to improve bacterial clearance. In normal mice, transcription of Scd1—a gene with numerous NF-κB elements in its promoter—is strongly and specifically induced by TLR2 signaling. Similarly, the SCD1 gene is induced by TLR2 signaling in a human sebocyte cell line. These observations reveal the existence of a regulated, lipid-based antimicrobial effector pathway in mammals and suggest new approaches to the treatment or prevention of infections with gram-positive bacteria. PMID:16040962

  7. Evaluation of the Sympathetic Skin Response to the Dry Needling Treatment in Female Myofascial Pain Syndrome Patients

    PubMed Central

    Ozden, Ali Veysel; Alptekin, Hasan Kerem; Esmaeilzadeh, Sina; Cihan, Cem; Aki, Semih; Aksoy, Cihan; Oncu, Julide


    Background The aim of this study was to evaluate sympathetic nervous system (SNS) activity following dry needling (DN) treatment, by using the sympathetic skin response (SSR) method in female patients diagnosed with myofascial pain syndrome (MPS). Methods Twenty-nine MPS patients with trapezius muscle pain and 31 healthy subjects were included in this study. During a single treatment session, DN treatment was applied into trigger points, for a duration of 10 minutes. Healthy patients were subjected to SSR in weeks 1 and 4; whereas the patient group was subjected to SSR 1 week prior to their treatment and in the first, second, third and fourth weeks following the completion of their treatment. Results We found diminished latency on both sides. A significantly high algometer measurement (P < 0.05) was observed in the control group. DN treatment was effective in diminishing the visual analog scale (VAS) (P < 0.001), pressure pain threshold (PPT) (P < 0.01), and SSR (P < 0.001). No SSR change was detected in the healthy group after the follow-up period (P > 0.05). Conclusion DN is an effective treatment in MPS and trigger point (TP). This original study is the first to deal with the SSR in MPS and weekly SSR trailing, requiring further investigation to solidy findings. PMID:27298659

  8. Genetic covariance between psychopathic traits and anticipatory skin conductance responses to threat: Evidence for a potential endophenotype

    PubMed Central



    The genetic architecture of the association between psychopathic traits and reduced skin conductance responses (SCRs) is poorly understood. By using 752 twins aged 9–10 years, this study investigated the heritability of two SCR measures (anticipatory SCRs to impending aversive stimuli and unconditioned SCRs to the aversive stimuli themselves) in a countdown task. The study also investigated the genetic and environmental sources of the covariance between these SCR measures and two psychopathic personality traits: impulsive/disinhibited (reflecting impulsive–antisocial tendencies) and manipulative/deceitful (reflecting the affective–interpersonal features). For anticipatory SCRs, 27%, 14%, and 59% of the variation was due to genetic, shared environmental, and nonshared environmental effects, respectively, while the percentages for unconditioned SCRs were 44%, 2%, and 54%. The manipulative/deceitful (not impulsive/disinhibited) traits were negatively associated with both anticipatory SCRs (r = −.14, p < .05) and unconditioned SCRs (r = −.17, p < .05) in males only, with the former association significantly accounted for by genetic influences (rg = −.72). Reduced anticipatory SCRs represent a candidate endophenotype for the affective–interpersonal facets of psychopathic traits in males. PMID:26439076

  9. Skin Biomes.


    Fyhrquist, N; Salava, A; Auvinen, P; Lauerma, A


    The cutaneous microbiome has been investigated broadly in recent years and some traditional perspectives are beginning to change. A diverse microbiome exists on human skin and has a potential to influence pathogenic microbes and modulate the course of skin disorders, e.g. atopic dermatitis. In addition to the known dysfunctions in barrier function of the skin and immunologic disturbances, evidence is rising that frequent skin disorders, e.g. atopic dermatitis, might be connected to a dysbiosis of the microbial community and changes in the skin microbiome. As a future perspective, examining the skin microbiome could be seen as a potential new diagnostic and therapeutic target in inflammatory skin disorders.

  10. A mixture of peptides and sugars derived from plant cell walls increases plant defense responses to stress and attenuates ageing-associated molecular changes in cultured skin cells.


    Apone, Fabio; Tito, Annalisa; Carola, Antonietta; Arciello, Stefania; Tortora, Assunta; Filippini, Lucio; Monoli, Irene; Cucchiara, Mirna; Gibertoni, Simone; Chrispeels, Maarten J; Colucci, Gabriella


    Small peptides and aminoacid derivatives have been extensively studied for their effect of inducing plant defense responses, and thus increasing plant tolerance to a wide range of abiotic stresses. Similarly to plants, these compounds can activate different signaling pathways in mammalian skin cells as well, leading to the up-regulation of anti-aging specific genes. This suggests the existence of analogous defense response mechanisms, well conserved both in plants and animal cells. In this article, we describe the preparation of a new mixture of peptides and sugars derived from the chemical and enzymatic digestion of plant cell wall glycoproteins. We investigate the multiple roles of this product as potential "biostimulator" to protect plants from abiotic stresses, and also as potential cosmeceutical. In particular, the molecular effects of the peptide/sugar mixture of inducing plant defense responsive genes and protecting cultured skin cells from oxidative burst damages were deeply evaluated.

  11. The effect of local corticosteroid injection on F-wave conduction velocity and sympathetic skin response in carpal tunnel syndrome.


    Deniz, Orhan; Aygül, Recep; Kotan, Dilcan; Ozdemir, Gökhan; Odabaş, Faruk Omer; Kaya, M Dursun; Ulvi, Hızır


    The aim of this study was to evaluate the efficacy of steroid injection for the treatment of the carpal tunnel syndrome (CTS), with F-wave parameters and sympathetic skin response (SSR). Seventeen hands of 10 women patients were treated with local steroid injection with 2-month follow-up. All patients underwent single injection into the carpal tunnel. Response to injection was measured nerve conduction studies (NCSs), median nerve F waves, and SSR before and after treatment. To determine the normal values, 42 hands of 21 healthy women were also studied. There was a significant improvement of sensory and motor nerve conduction values when compared to baseline values (P < 0.01). At the end of follow-up period, the median sensory distal latency and the sensory latency differences between the median and the ulnar nerve were improved 35 and 65%, respectively. The maximum, mean F-wave amplitudes and chronodispersion showed a slight improvement with respect to baseline values and controls, but statistical significance was not achieved after treatment. Although no statistically significant improvements were observed in SSR parameters, slightly decreased amplitudes and increased habituation of SSR were noted at the end of the treatment. The present study shows that the local steroid injection results in improvement in NCSs values, but the F-wave parameters were not effectual in short-term outcome of CTS treatment. These findings suggest that the sensory latency differences between the median and the ulnar wrist-to-digit 4 are better parameters in the median nerve recovery after treatment than the median sensory distal latency. Furthermore, the SSR does not seem to be a sensitive method in follow-up of CTS treatment.

  12. Arsenic exposure and human papillomavirus response in non-melanoma skin cancer Mexican patients: a pilot study.


    Rosales-Castillo, J Alberto; Acosta-Saavedra, Leonor C; Torres, Rosantina; Ochoa-Fierro, Jesús; Borja-Aburto, Víctor H; Lopez-Carrillo, Lizbeth; Garcia-Vargas, Gonzalo G; Gurrola, Georgina B; Cebrian, Mariano E; Calderón-Aranda, Emma S


    We assessed the relationships between chronic arsenic (As) exposure, human papilloma virus (HPV) contact and non-melanoma skin cancer (NMSC) by means of a dermatology clinic-based case-control study (42 cases and 48 controls) in Region Lagunera, Mexico, where chronic As poisoning is endemic. Exposure was determined through detailed history of residence in the As-contaminated area and measurement of As levels in drinking water and urine. We used a consensus epitope from the central region of L1 protein of the HPV family to determine antibodies against HPV. A history of As exposure and HPV seropositivity were associated with increased NMSC risks. A history of exposure to high levels of As increased the risk for NMSC (OR = 4.53; P = 0.11) in the group of seronegative HPV patients. A positive response to HPV significantly increased the OR for NMSC to 9.04 (P = 0.01) when history showed exposure to low levels of As. Interestingly, the OR was significantly increased to 16.5 (P = 0.001) when both exposure to high levels of As and HPV seropositivity were present. In addition, the presence of NMSC increased the OR (5.45; P = 0.03) for a positive response to HPV when history showed exposure to low levels of As, but the OR was increased to 8.0 (P = 0.005) in the cases with high exposure levels. Thus, HPV infection could constitute an additional risk factor for NMSC development in humans chronically exposed to As. However, further studies with additional populations are needed to determine the interaction between HPV and As exposure in NMSC.

  13. Oxidative stress response in the skin mucus layer of Goodea gracilis (Hubbs and Turner, 1939) exposed to crude oil: A non-invasive approach.


    Dzul-Caamal, Ricardo; Salazar-Coria, Lucia; Olivares-Rubio, Hugo F; Rocha-Gómez, Maria Alejandra; Girón-Pérez, Manuel Iván; Vega-López, Armando


    The skin of the fish is the foremost target of oxidative stress due to the generation of Reactive Oxygen Species (ROS) originated in the environment and in the skin itself. In this study, a non-destructive assay was developed to evaluate the effects of crude oil (0.0001-0.1mg/L, 96h) on oxidative stress response in the Skin Mucus Layer (SML) of the dusky splitfin goodeid (Goodea gracilis). The response in the SML was compared with recognized target organs through the Integrated Biomarker Response (IBRv2) and a slight addition to the method was proposed. Crude oil was extremely toxic and elicited a clear induction of ROS in the SML, as in the brain, liver and muscle. By the exposure to crude, a significant change in the activities of Superoxide Dismutase (SOD), Catalase (CAT), Glutathione Peroxidase (GPx) as well as on lipid peroxidation (TBARS) and carbonyl protein (RCO) levels was detected. Also, increases in the activity of EROD were found. The general IBRv2 proposed in this study (gIBRv2) showed that oil causes the higher oxidative response in the SML (60.049) under different concentrations of petroleum, which was greater in the brain (56.749), muscle (56.561) and liver (55.775). The results of the study revealed an organ-specific antioxidant defense response that was dependent on the load of petroleum. These results contributed to the understanding of the complexity of oxidative stress response in fish exposed to crude oil using the Skin Mucus Layer as a target for environmental monitoring studies.

  14. Neuroendocrinology of the skin

    PubMed Central

    Zmijewski, Michal A


    The concept on the skin neuro-endocrine has been formulated ten years ago, and recent advances in the field further strengthened this role. Thus, skin forms a bidirectional platform for a signal exchange with other peripheral organs, endocrine and immune systems or brain to enable rapid and selective responses to the environment in order to maintain local and systemic homeostasis. In this context, it is not surprising that the function of the skin is tightly regulated by systemic neuro-endocrine system. Skin cells and skin appendages not only respond to neuropeptides, steroids and other regulatory signals, but also actively synthesis variety of hormones. The stress responses within the skin are tightly regulated by locally synthesized factors and their receptor expression. There is growing evidence for alternative splicing playing an important role in stress signaling. Deregulation of the skin neuro-endocrine signaling can lead or/and be a marker of variety of skin diseases. The major problem in this area relates to their detailed mechanisms of crosstalk between skin and brain and between the local and global endocrine as well as immune systems. PMID:21519402

  15. 7 CFR 1755.370 - RUS specification for seven wire galvanized steel strand.

    Code of Federal Regulations, 2010 CFR


    ... during normal business hours at the National Archives and Records Administration (NARA) and the Rural... stripe, green or orange, respectively, to identify the class of galvanized coating of the strand....

  16. 7 CFR 1755.370 - RUS specification for seven wire galvanized steel strand.

    Code of Federal Regulations, 2011 CFR


    ... during normal business hours at the National Archives and Records Administration (NARA) and the Rural... stripe, green or orange, respectively, to identify the class of galvanized coating of the strand....

  17. Validating a population model of tactile mechanotransduction of slowly adapting type I afferents at levels of skin mechanics, single-unit response and psychophysics.


    Gerling, Gregory J; Rivest, Isabelle I; Lesniak, Daine R; Scanlon, Jacob R; Wan, Lingtian


    Previous models of touch have linked skin mechanics to neural firing rate, neural dynamics to action potential elicitation, and mechanoreceptor populations to psychophysical discrimination. However, no one model spans all levels. The objective of work herein is to build a multi-level, computational model of tactile neurons embedded in cutaneous skin, and then validate its predictions of skin surface deflection, single-afferent firing to indenter shift, and population response for sphere discrimination. The model includes a 3D finite element representation of the distal phalange with hyper- and visco-elastic mechanics. Distributed over its surface, a population of receptor models is comprised of bi-phasic functions to represent Merkel cells' transformation of stress/strain to membrane current and a leaky integrate-and-fire neuronal models to generate the timing of action potentials. After including neuronal noise, the predictions of two population encoding strategies (gradient sum and euclidean distance) are compared to psychophysical discrimination of spheres. Results indicate that predicted skin surface deflection matches Srinivasan's observations for 50 micron and 3.17 mm diameter cylinders and single-afferent responses achieve R(2) = 0.81 when compared to Johnson's recordings. Discrimination results correlate with Goodwin's experiments, whereby 287 and 365 m(-1) spheres are more discriminable than 287 and 296 m(-1).

  18. The Microstructure and Hardness of Hot Dip Galvanized Steel During Wire Drawing

    SciTech Connect

    Klmaku, Snukn; Syla, Nairn; Dilo, Teuta


    The steel wire samples are hot-dip-galvanized. The zinc coating is preformed using the standard method. To recognize the behavior of the zinc coated steel wire during the submission to deformation, the wire samples are drawn on a machine designed for this aim and then investigated. In this research is represented the phase structure of the zinc coated samples. Afterwards the thickness of the layer and the hardness of the hot-dip galvanized steel depending on the drawing is represented.

  19. The Immune Response to Skin Trauma Is Dependent on the Etiology of Injury in a Mouse Model of Burn and Excision.


    Valvis, Samantha M; Waithman, Jason; Wood, Fiona M; Fear, Mark W; Fear, Vanessa S


    Skin trauma has many different causes including incision, blunt force, and burn. All of these traumas trigger an immune response. However, it is currently unclear whether the immune response is specific to the etiology of the injury. This study was established to determine whether the immune response to excision and burn injury of equivalent extent was the same. Using a mouse model of a full-thickness 19 mm diameter excision or 19 mm diameter full-thickness burn injury, we examined the innate immune response at the level of serum cytokine induction, whole-blood lymphocyte populations, dendritic cell function/phenotype, and the ensuing adaptive immune responses of CD4 and CD8 T-cell populations. Strikingly, both the innate and adaptive immune system responses differed between the burn and excision injuries. Acute cytokine induction was faster and different in profile to that of excision injury, leading to changes in systemic monocyte and neutrophil levels. Differences in the immune profile between burn and excision were also noted up to day 84 post injury, suggesting that the etiology of injury leads to sustained changes in the response. This may in part underlie clinical observations of differences in patient morbidity and mortality in response to different skin injury types.

  20. Moment-to-moment flight manoeuvres of the female yellow fever mosquito (Aedes aegypti L.) in response to plumes of carbon dioxide and human skin odour.


    Dekker, Teun; Cardé, Ring T


    Odours are crucial cues enabling female mosquitoes to orient to prospective hosts. However, their in-flight manoeuvres to host odours are virtually unknown. Here we analyzed in 3-D the video records of female Aedes aegypti mosquitoes flying in a wind tunnel in response to host odour plumes that differed in spatial structure and composition. Following a brief (~0.03 s) encounter with CO(2), mosquitoes surged upwind and, in the absence of further encounters, counterturned without displacing upwind. These patterns resemble moth responses to encounter and loss of a filament of pheromone. Moreover, CO(2) encounters induced a highly regular pattern of counterturning across the windline in the horizontal (crosswind) and vertical planes, causing the mosquito to transect repeatedly the area where CO(2) was previously detected. However, despite the rapid changes across all three axes following an encounter with CO(2), the angular velocities remained remarkably constant. This suggests that during these CO(2)-induced surges mosquitoes stabilize flight through sensors, such as the halteres and Johnston organs, sensitive to Coriolis forces. In contrast to the instantaneous responses of the mosquito CO(2), a brief encounter with a filament of human skin odour did not induce a consistent change in mosquito flight. These differential responses were reflected in further experiments with broad plumes. A broad homogeneous plume of skin odour induced rapid upwind flight and source finding, whereas a broad filamentous plume of skin odour lowered activation rates, kinetic responses and source finding compared with homogeneous plumes. Apparently, yellow fever mosquitoes need longer continuous exposure to complex skin-odour blends to induce activation and source finding.

  1. Delayed-type skin hypersensitivity and in vitro lymphocyte immunostimulation responses of swine following inoculation with Mycobacterium avium cell walls and a mycobacterial immunopotentiating glycolipid.


    Renshaw, H W; Gessner, J W; Woodard, L F; Everson, D O


    Miniature swine (n = 5 per group) were inoculated intradermally with mineral oil-in-water emulsions containing either 150 micrograms of mycobacterial immunopotentiating glycolipid P3 (EP3), 150 micrograms of lyophilized Mycobacterium avium (serotype 8) cell walls (E-MaCW), or 150 micrograms P3 and 150 micrograms M. avium cell walls (EP3-MaCW). Swine vaccinated with E-MaCW and EP3-MaCW developed antigen-sensitive lymphocytes detectable with delayed-type hypersensitivity (DTH) skin tests and lymphocyte transformation assays. Swine injected with EP3 were not sensitized. In general EP3-MaCW evoked a more pronounced in vivo DTH tuberculin skin test and in vitro lymphocyte transformation responses than E-MaCW. Time-course studies indicated a more persistent response in swine injected with EP3-MaCW than in those given E-MaCW. Commercial type Yorkshire swine (n = 5) inoculated intradermally with EP3-MaCW developed cell-mediated immune (CMI) responses to avian tuberculin detectable in vivo with delayed-type skin hypersensitivity and in vitro with lymphocyte immunostimulation responses.

  2. Association between skin surface pH, temperature and Staphylococcus pseudintermedius in dogs with immunomodulatory-responsive lymphocytic-plasmacytic pododermatitis.


    Breathnach, Rory M; Quinn, Patrick J; Baker, Kenneth P; McGeady, Thomas; Strobl, Eric; Abbott, Yvonne; Jones, Boyd R


    Secondary bacterial infection is a frequent complication in lesional skin of dogs with immunomodulatory-responsive lymphocytic-plasmacytic pododermatitis (ImR-LPP). However, the influence of skin pH and temperature in determining the composition of the cutaneous microflora at lesional sites has not been investigated. The association between ImR-LPP and pedal skin temperature, pH and Staphylococcus pseudintermedius isolates was thus evaluated. Temperature and pH were measured in 20 dogs with ImR-LPP and in 30 clinically healthy control dogs, and S. pseudintermedius was cultured from interdigital and palmoplantar swabs in both groups and scored semi-quantitatively for bacterial growth. In the ImR-LPP group, mean skin pH was slightly, but significantly, higher at both interdigital and palmoplantar sites. Staphylococcus pseudintermedius was isolated more frequently, and scores for bacterial growth were also significantly higher. However, mean skin temperatures were not significantly different from those in the control group. The isolation of S. pseudintermedius was significantly associated with ImR-LPP, with the single exception of isolates on Columbia blood agar from the palmoplantar region. However, pH and temperature were not significantly associated with the disease, and were not associated with the isolation of S. pseudintermedius at most sites sampled. Staphylococcus pseudintermedius was not isolated from all feet sampled in dogs with ImR-LPP. Taken together, these data would suggest that S. pseudintermedius infection is most likely to be a secondary phenomenon in dogs with ImR-LPP, and that changes in skin pH and temperature are not significant risk factors for this disease.

  3. Effects of stress upon psychophysiological responses and performance following sleep deprivation

    NASA Technical Reports Server (NTRS)

    Roessler, R.; Lester, J. W.


    The usefulness of psychological and physiological variables in predicting performance under stress of 48 hours of sleep deprivation was investigated. Performance tests, with subjects of different ego strength personalities, in concept acquisition, reading comprehension, word association, word memory, and anagrams were conducted, and physiological measurements of (1) the phasic and tonic electrodermal, (2) galvanic skin response, (3) thermal skin resistance, (4) heart rate, (5) respiration, and (6) plethysmographic finger pulse volumn were recorded. It was found that the changes in the pattern of performance were the result of testing subjects at times when they would normally be sleeping, and that sleep deprivation longer than 48 hours must be maintained to produce changes in simple or well learned tasks.

  4. In Vivo Effect of Innate Immune Response Modulating Impurities on the Skin Milieu Using a Macaque Model: Impact on Product Immunogenicity.


    Haile, Lydia A; Puig, Montserrat; Polumuri, Swamy K; Ascher, Jill; Verthelyi, Daniela


    Unwanted immune responses to therapeutic proteins can severely impact their safety and efficacy. Studies show that the presence of trace amounts of host cells and process-related impurities that stimulate pattern recognition receptors (PRR) can cause local inflammation and enhance product immunogenicity. Here we used purified PRR agonists as model impurities to assess the minimal level of individual innate immune response modulating impurities (IIRMIs) that could activate a local immune response. We show that levels of endotoxin as low as 10 pg (0.01 EU), 1 ng for polyinosinic:polycytidylic acid (PolyI:C), 100 ng for synthetic diacylated liopprotein, thiazoloquinolone compound, or muramyl dipeptide, 1 μg for flagellin or β-glucan, or 5 μg for CpG-oligodeoxynucleotide increased expression of genes linked to innate immune activation and inflammatory processes in the skin of rhesus macaques. Furthermore, spiking studies using rasburicase as a model therapeutic showed that the levels of PRR agonists that induced detectable gene upregulation in the skin were associated with increased immunogenicity for rasburicase. This study underscores the need for testing multiple IIRMIs in biologics, strengthening the connection between the local mRNA induction in skin, innate immune activation, and antibody development in primates, and provides an indication of the levels of IIRMI in therapeutic products that could impact product immunogenicity.

  5. Dose-response on the chemopreventive effects of sarcophine-diol on UVB-induced skin tumor development in SKH-1 hairless mice.


    Guillermo, Ruth F; Zhang, Xiaoying; Kaushik, Radhey S; Zeman, David; Ahmed, Safwat A; Khalifa, Sherief; Fahmy, Hesham; Dwivedi, Chandradhar


    Sarcophine-diol (SD) is a lactone ring-opened analogue of sarcophine. It has shown chemopreventive effects on chemically-induced skin tumor development in female CD-1 mice, as well as in a UVB-induced skin tumor development model in hairless SKH-1 mice at a dose of 30 μg SD applied topically and 180 mJ/cm(2) UVB. The objective of this study was to determine the dose-response on the chemopreventive effects of SD on SKH-1 hairless mice when exposed to a UVB radiation dose of 30 mJ/cm(2). This UVB dose better represents chronic human skin exposure to sunlight leading to skin cancer than previous studies applying much higher UVB doses. Carcinogenesis was initiated and promoted by UVB radiation. Female hairless SKH-1 mice were divided into five groups. The control group was topically treated with 200 μL of acetone (vehicle), and the SD treatment groups were topically treated with SD (30 μg, 45 μg, and 60 μg dissolved in 200 μL of acetone) 1 h before UVB radiation (30 mJ/cm(2)). The last group of animals received 60 μg SD/200 μL acetone without UVB exposure. These treatments were continued for 27 weeks. Tumor multiplicity and tumor volumes were recorded on a weekly basis for 27 weeks. Weight gain and any signs of toxicity were also closely monitored. Histological characteristics and the proliferating cell nuclear antigen (PCNA) were evaluated in the mice skin collected at the end of the experiment. The dose-response study proved a modest increase in chemopreventive effects with the increase in SD dose. SD reduced the number of cells positively stained with PCNA proliferation marker in mice skin. The study also showed that SD application without UVB exposure has no effect on the structure of skin. The results from this study suggest that broader range doses of SD are necessary to improve the chemopreventive effects.

  6. Skin Infections


    ... to the touch may have yellow drainage Of cellulitis: a red, inflamed area on the skin that is tender to the touch may occur in an area of a scratch or cut redness often spreads rapidly over the skin's surface ...

  7. Skin Pigment


    ... Diseases Take Big Slice Out of America's Health, Economy (News) Health Tip: Use Caution When Applying Hair Dye Additional ... Skin Diseases Take Big Slice Out of America's Health, Economy THURSDAY, March 2, 2017 (HealthDay News) -- Skin diseases ...

  8. Sagging Skin


    ... Stretch Marks Sun-damaged Skin Unwanted Hair Unwanted Tattoos Varicose Veins Vitiligo Wrinkles Treatments and Procedures Ambulatory ... Stretch Marks Sun-damaged Skin Unwanted Hair Unwanted Tattoos Varicose Veins Vitiligo Wrinkles Treatments and Procedures Ambulatory ...

  9. Human papillomavirus types detected in skin warts and cancer differ in their transforming properties but commonly counteract UVB induced protective responses in human keratinocytes.


    Shterzer, Naama; Heyman, Dariya; Shapiro, Beny; Yaniv, Abraham; Jackman, Anna; Serour, Francis; Chaouat, Malka; Gonen, Pinhas; Tommasino, Massimo; Sherman, Levana


    In the present study, E6E7 and E6 proteins of human papillomaviruses (HPVs) associated with skin warts and cancer were compared for their transforming and carcinogenic abilities in primary human keratinocytes (PHKs). We show that E6E7 of cancer associated beta HPV types, notably 49 and 24, were able to extend the life span and enhance the clonogenic efficiency of PHKs when maintained in serum free/low calcium medium. Activities of the beta HPV E6E7 were lower than those of HPV16 E6E7. In contrast, E6 proteins from HPV types detected in skin warts or cancer, notably 10, 49 and 38, attenuated UVB induced protective responses in PHKs including cell death, proliferation arrest and accumulation of the proapoptotic proteins, p53, bax or bak. Together, this investigation revealed functional differences and commonalities between HPVs associated with skin warts and cancer, and allowed the identification of specific properties of beta HPVs supporting their involvement in skin carcinogenesis.

  10. Human papillomavirus types detected in skin warts and cancer differ in their transforming properties but commonly counteract UVB induced protective responses in human keratinocytes

    SciTech Connect

    Shterzer, Naama; Heyman, Dariya; Shapiro, Beny; Yaniv, Abraham; Jackman, Anna; Serour, Francis; Chaouat, Malka; Gonen, Pinhas; Tommasino, Massimo; Sherman, Levana


    In the present study, E6E7 and E6 proteins of human papillomaviruses (HPVs) associated with skin warts and cancer were compared for their transforming and carcinogenic abilities in primary human keratinocytes (PHKs). We show that E6E7 of cancer associated beta HPV types, notably 49 and 24, were able to extend the life span and enhance the clonogenic efficiency of PHKs when maintained in serum free/low calcium medium. Activities of the beta HPV E6E7 were lower than those of HPV16 E6E7. In contrast, E6 proteins from HPV types detected in skin warts or cancer, notably 10, 49 and 38, attenuated UVB induced protective responses in PHKs including cell death, proliferation arrest and accumulation of the proapoptotic proteins, p53, bax or bak. Together, this investigation revealed functional differences and commonalities between HPVs associated with skin warts and cancer, and allowed the identification of specific properties of beta HPVs supporting their involvement in skin carcinogenesis. - Highlights: • Primary keratinocytes were used to evaluate transforming and carcinogenic abilities of cutaneous HPVs. • E6E7 of cancer associated β HPV types transform primary human keratinocytes. • E6 proteins of cancer and wart associated HPVs inhibit UVB induced cell death. • E6s of cancer and wart associated HPVs attenuate UVB induced proliferation arrest. • E6s of cancer and wart associated HPVs attenuate UVB induced apoptosis signaling.

  11. Nicotinamide for skin cancer chemoprevention.


    Damian, Diona L


    Nicotinamide (vitamin B3 ) has a range of photoprotective effects in vitro and in vivo; it enhances DNA repair, reduces UV radiation-induced suppression of skin immune responses, modulates inflammatory cytokine production and skin barrier function and restores cellular energy levels after UV exposure. Pharmacological doses of nicotinamide have been shown to reduce actinic keratoses and nonmelanoma skin cancer incidence in high-risk individuals, making this a nontoxic and accessible option for skin cancer chemoprevention in this population.

  12. Galvanic corrosion of Mg-Zr fuel cladding and steel immobilized in Portland cement and geopolymer at early ages

    NASA Astrophysics Data System (ADS)

    Rooses, Adrien; Lambertin, David; Chartier, David; Frizon, Fabien


    Galvanic corrosion behaviour of Mg-Zr alloy fuel cladding and steel has been studied in Ordinary Portland cement and Na-geopolymer. Portland cements implied the worse magnesium corrosion performances due to the negative effects of cement hydrates, grinding agents and gypsum on the galvanic corrosion. Galvanic corrosion in Na-geopolymer paste remains very low. Silicates and fluoride from the geopolymer activation solution significantly improve the corrosion resistance of the magnesium alloy while coupling with a cathode.

  13. The UV response of the skin: a review of the MAPK, NFkappaB and TNFalpha signal transduction pathways.


    Muthusamy, Visalini; Piva, Terrence J


    The sun emits different types of ultraviolet (UV) light. Our skin is a natural target of UV radiation which is involved in vitamin D3 production in our body. UV radiation at high doses is an environmental carcinogen which can elicit skin damage as well as inducing skin cancer. It can mediate inflammatory and immunological reactions through activation of receptors, DNA/RNA damage and production of reactive oxygen species. It is also involved in the release of pro-inflammatory cytokines, of which TNFalpha has been implicated in tumorigenic activities. In order to mediate its effects, UV radiation is known to activate multiple signalling cascades such as the p38 MAPK, Jun N-terminal kinase, extracellular signal-regulated kinase 1/2 and NFkappaB pathways in skin cells. The role each of these pathways plays in mediating the release of cytokines such as TNFalpha remains to be fully characterized. Once the function of these pathways is known, this information may provide for the formulation of therapy which will prevent the release of immunosuppressive cytokines resulting in a reduction in skin cancer formation.

  14. Skin Aging


    Your skin changes as you age. You might notice wrinkles, age spots and dryness. Your skin also becomes thinner and loses fat, making it ... heal, too. Sunlight is a major cause of skin aging. You can protect yourself by staying out ...

  15. Galvanic corrosion behavior of titanium implants coupled to dental alloys.


    Cortada, M; Giner, L; Costa, S; Gil, F J; Rodríguez, D; Planell, J A


    The corrosion of five materials for implant suprastructures (cast-titanium, machined-titanium, gold alloy, silver-palladium alloy and chromium-nickel alloy), was investigated in vitro, the materials being galvanically coupled to a titanium implant. Various electrochemical parameters E(CORR), i(CORR) Evans diagrams, polarization resistance and Tafel slopes) were analyzed. The microstructure of the different dental materials was observed before and after corrosion processes by optical and electron microscopy. Besides, the metallic ions released in the saliva environment were quantified during the corrosion process by means of inductively coupled plasma-mass spectrometry technique (ICP-MS). The cast and machined titanium had the most passive current density at a given potential and chromium-nickel alloy had the most active critical current density values. The high gold content alloys have excellent resistance corrosion, although this decreases when the gold content is lower in the alloy. The palladium alloy had a low critical current density due to the presence of gallium in this composition but a selective dissolution of copper-rich phases was observed through energy dispersive X-ray analysis.

  16. Broadband architecture for galvanically accessible superconducting microwave resonators

    NASA Astrophysics Data System (ADS)

    Bosman, Sal J.; Singh, Vibhor; Bruno, Alessandro; Steele, Gary A.


    In many hybrid quantum systems, a superconducting circuit is required, which combines DC-control with a coplanar waveguide (CPW) microwave resonator. The strategy thus far for applying a DC voltage or current bias to microwave resonators has been to apply the bias through a symmetry point in such a way that it appears as an open circuit for certain frequencies. Here, we introduce a microwave coupler for superconducting CPW cavities in the form of a large shunt capacitance to ground. Such a coupler acts as a broadband mirror for microwaves while providing galvanic connection to the center conductor of the resonator. We demonstrate this approach with a two-port λ/4-transmission resonator with linewidths in the MHz regime ( Q ˜103 ) that shows no spurious resonances and apply a voltage bias up to 80 V without affecting the quality factor of the resonator. This resonator coupling architecture, which is simple to engineer, fabricate, and analyse, could have many potential applications in experiments involving superconducting hybrid circuits.

  17. Galvanic Cell Type Sensor for Soil Moisture Analysis.


    Gaikwad, Pramod; Devendrachari, Mruthyunjayachari Chattanahalli; Thimmappa, Ravikumar; Paswan, Bhuneshwar; Raja Kottaichamy, Alagar; Makri Nimbegondi Kotresh, Harish; Thotiyl, Musthafa Ottakam


    Here we report the first potentiometric sensor for soil moisture analysis by bringing in the concept of Galvanic cells wherein the redox energies of Al and conducting polyaniline are exploited to design a battery type sensor. The sensor consists of only simple architectural components, and as such they are inexpensive and lightweight, making it suitable for on-site analysis. The sensing mechanism is proved to be identical to a battery type discharge reaction wherein polyaniline redox energy changes from the conducting to the nonconducting state with a resulting voltage shift in the presence of soil moisture. Unlike the state of the art soil moisture sensors, a signal derived from the proposed moisture sensor is probe size independent, as it is potentiometric in nature and, hence, can be fabricated in any shape or size and can provide a consistent output signal under the strong aberration conditions often encountered in soil moisture analysis. The sensor is regenerable by treating with 1 M HCl and can be used for multiple analysis with little read out hysteresis. Further, a portable sensor is fabricated which can provide warning signals to the end user when the moisture levels in the soil go below critically low levels, thereby functioning as a smart device. As the sensor is inexpensive, portable, and potentiometric, it opens up avenues for developing effective and energy efficient irrigation strategies, understanding the heat and water transfer at the atmosphere-land interface, understanding soil mechanics, forecasting the risk of natural calamities, and so on.

  18. Counteracting Muscle Atrophy using Galvanic Stimulation of the Vestibular System

    NASA Technical Reports Server (NTRS)

    Fox, Robert A.; Polyakov, Igor


    The unloading of weight bearing from antigravity muscles during space flight produces significant muscle atrophy and is one of the most serious health problems facing the space program. Various exercise regimens have been developed and used either alone or in combination with pharmacological techniques to ameliorate this atrophy, but no effective countermeasure exists for this problem. The research in this project was conducted to evaluate the potential use of vestibular galvanic stimulation (VGS) to prevent muscle atrophy resulting from unloading of weight bearing from antigravity muscles. This approach was developed based on two concepts related to the process of maintaining the status of the anti-gravity neuromuscular system. These two premises are: (1) The "tone," or bias on spinal motorneurons is affected by vestibular projections that contribute importantly to maintaining muscle health and status. (2) VGS can be used to modify the excitability, or 'tone' of motorneuron of antigravity muscles. Thus, the strategy is to use VGS to modify the gain of vestibular projections to antigravity muscles and thereby change the general status of these muscles.

  19. The galvanic corrosion behavior of depleted uranium in synthetic seawater coupled to aluminum, magnesium, and mild steel

    SciTech Connect

    McIntyre, J.F.; LeFeave, E.P.; Musselman, K.A.


    The galvanic corrosion behavior of a depleted uranium-titanium alloy (Du-.75Ti) coupled to MgZk60A-T5, AA-7075-T6, bare steel-4340, and coated steel-4340 exposed to ASTM seawater was investigated by monitoring the galvanic current with time. Gravimetric measurements, polarization resistance measurements, and concepts of ''mixed-potential'' theory were used to calculate corrosion rates. It was demonstrated that galvanic currents must be monitored over extended periods of time to detect changes in the galvanic corrosion behavior. Good agreement was obtained for corrosion rates calculated using the concepts of ''mixed-potential'' theory and those obtained from gravimetric measurements.

  20. A galvanic sensor for monitoring the corrosion condition of the concrete reinforcing steel: relationship between the galvanic and the corrosion currents.


    Pereira, Elsa Vaz; Figueira, Rita Bacelar; Salta, Maria Manuela Lemos; da Fonseca, Inês Teodora Elias


    This work reports a study carried out on the design and performance of galvanic and polarization resistance sensors to be embedded in concrete systems for permanent monitoring of the corrosion condition of reinforcing steel, aiming to establish a correlation between the galvanic currents, I(gal), and the corrosion currents, I(corr), estimated from the polarization resistance, R(p). Sensors have been tested in saturated Ca(OH)(2) aqueous solutions, under a variety of conditions, simulating the most important parameters that can accelerate the corrosion of concrete reinforcing steel, such as carbonation, ingress of chloride ions, presence or absence of O(2). For all the conditions, the influence of temperature (20 to 55 °C) has also been considered. From this study, it could be concluded that the galvanic currents are sensitive to the various parameters following a trend similar to that of the R(p) values. A relationship between the galvanic and the corrosion current densities was obtained and the limiting values of the I(gal), indicative of the state condition of the reinforcing steel for the designed sensor, were established.

  1. A Galvanic Sensor for Monitoring the Corrosion Condition of the Concrete Reinforcing Steel: Relationship Between the Galvanic and the Corrosion Currents

    PubMed Central

    Pereira, Elsa Vaz; Figueira, Rita Bacelar; Salta, Maria Manuela Lemos; da Fonseca, Inês Teodora Elias


    This work reports a study carried out on the design and performance of galvanic and polarization resistance sensors to be embedded in concrete systems for permanent monitoring of the corrosion condition of reinforcing steel, aiming to establish a correlation between the galvanic currents, Igal, and the corrosion currents, Icorr, estimated from the polarization resistance, Rp. Sensors have been tested in saturated Ca(OH)2 aqueous solutions, under a variety of conditions, simulating the most important parameters that can accelerate the corrosion of concrete reinforcing steel, such as carbonation, ingress of chloride ions, presence or absence of O2. For all the conditions, the influence of temperature (20 to 55 °C) has also been considered. From this study, it could be concluded that the galvanic currents are sensitive to the various parameters following a trend similar to that of the Rp values. A relationship between the galvanic and the corrosion current densities was obtained and the limiting values of the Igal, indicative of the state condition of the reinforcing steel for the designed sensor, were established. PMID:22291514

  2. DFT study on the galvanic interaction between pyrite (100) and galena (100) surfaces

    NASA Astrophysics Data System (ADS)

    Ke, Baolin; Li, Yuqiong; Chen, Jianhua; Zhao, Cuihua; Chen, Ye


    The galvanic interaction between pyrite and galena surface has been investigated using density functional theory (DFT) method. The calculated results show that galvanic interactions between pyrite and galena surface are decreased with the increase of contact distance. The galvanic interactions still occurs even the distance larger than the sum of two atoms radius (≈2.8 Å), and the limit distance of galvanic interaction between galena and pyrite surface is about 10 Å, which is consistent with the quantum tunneling effect. Through Mulliken charge population calculation, it is found that electrons transfer from galena to pyrite. For galena surface, Pb 6s and 6p states lose electrons and S 3p state loses a small amount of electrons, which causes the electron loss of galena. For pyrite surface, Fe 4p state obtains large numbers of electrons, resulting in the decrease of positive charge of Fe atom. However, the 3p state of S atom loses a small numbers of electrons. The reactivity of mineral surface has also been studied by calculating the frontier orbitals of minerals. Results suggest that the highest occupied molecular orbital (HOMO) coefficients of galena are increased whereas those of pyrite are decreased with the enhancing galvanic interaction, indicating that the oxidation of galena surface would be enhanced due to the galvanic interaction. The Fukui indices and dual descriptor values of surface atoms suggest that the nucleophilicity of the galena surface increases, meanwhile, the electrophilicity of pyrite surface increases with the decrease of the contact distance. In addition, the density of states (DOS) of atoms results show that the activity of electrons in Pb 6s and 6p orbitals enhances while the activity of electrons in Fe 3d orbitals weaken due to the galvanic contact between minerals.

  3. Ring discharge on the backsurface of a composite skin with ohmic anisotropy in response to frontal high current injection

    NASA Astrophysics Data System (ADS)

    Lee, T. S.; Robb, J. D.

    The ring discharge hazard to a carbon-reinforced-composites fuel tank skin under lightning strike conditions is investigated. A model of anisotropy in electric conductivity is adopted whereby longitudinal conductivity and transverse conductivity are considered separately. It is concluded that the current flow pattern contains a stagnation-dominated near-field region and a geometry-dominated far-field decaying region. While this pattern is unaltered by anisotropy in conductivity, the accompanying nonliner electrical field pattern is greatly distorted. It is noted that conclusions applicable to the ignition hazard which were derived from the model of a uniform scalar conductivity for the skin still remain intact.

  4. Can Postural Instability Respond to Galvanic Vestibular Stimulation in Patients with Parkinson’s Disease?

    PubMed Central

    Kataoka, Hiroshi; Okada, Yohei; Kiriyama, Takao; Kita, Yorihiro; Nakamura, Junji; Morioka, Shu; Shomoto, Koji; Ueno, Satoshi


    Objective Galvanic vestibular stimulation (GVS) activates the vestibular afferents, and these changes in vestibular input exert a strong influence on the subject’s posture or standing balance. In patients with Parkinson’s disease (PD), vestibular dysfunction might contribute to postural instability and gait disorders. Methods Current intensity was increased to 0.7 mA, and the current was applied to the patients for 20 minutes. To perform a sham stimulation, the current intensity was increased as described and then decreased to 0 mA over the course of 10 seconds. The patient’s status was recorded continuously for 20 minutes with the patient in the supine position. Results Three out of 5 patients diagnosed with PD with postural instability and/or abnormal axial posture showed a reduction in postural instability after GVS. The score for item 12 of the revised Unified Parkinson’s Disease Rating Scale part 3 was decreased in these patients. Conclusions The mechanism of postural instability is complex and not completely understood. In 2 out of the 5 patients, postural instability was not changed in response to GVS. Nonetheless, the GVS-induced change in postural instability for 3 patients in our study suggests that GVS might be a therapeutic option for postural instability. PMID:26648182

  5. Postmenopausal skin and estrogen.


    Archer, David F


    The aging global population continues to drive increasing demand for cosmaceuticals and cosmetic surgery among older men and women. Since the discovery in the 1990s that estrogen receptors are present in skin cells and decline in number from the onset of menopause in women, researchers have explored a number of ways in which estrogen can improve skin condition. Skin is estrogen responsive, and several studies now exist to support the antiaging properties of estrogen replacement therapies in postmenopausal women. Both systemic and topical estrogens appear to have positive effects on hormonal aging, increasing skin collagen content, thickness, elasticity and hydration. Estrogen therapies may also improve wound healing and reduce the incidence of wound complications. This review explores the potential for targeted estrogen replacement as a therapeutic option for long-term skin management in postmenopausal women.

  6. [Skin and sun exposure].


    Cannavò, Serafinella Patrizia; Borgia, Francesco; Trifirò, Caterina; Aragona, Emanuela


    Fisherman commonly experience a significant number of cutaneous problems, related to the exposure to environmental factors due to their working conditions. Among these factors, sun exposure is able to determine both acute and chronic skin damage, mostly linked to the effects of the ultraviolet (UV) radiation on epidermal and dermal structures. In particular, UV-A appears to play a major role in the deterioration of dermal structure leading to the photoaged appearance of the skin, while UV-B is mainly responsible for skin cancers. Peculiar clinical features of skin damage in fishermen include dryness, irregular pigmentation, wrinkling, stellate pseudoscars, elastosis, inelasticity, telangiectasia, comedones and sebaceous hyperplasia. Furtheremore, the high incidence of non-melanoma skin cancers, on sun-exposed areas, confirms the need for occupational health policies focusing on issues such as photoprotection.

  7. Long-term IgG response to porcine Neu5Gc-antigens without transmission of PERV in burn patients treated with porcine skin xenografts

    PubMed Central

    Scobie, Linda; Padler-Karavani, Vered; Le Bas-Bernardet, Stephanie; Crossan, Claire; Blaha, Josef; Matouskova, Magda; Hector, Ralph D; Cozzi, Emanuele; Vanhove, Bernard; Charreau, Beatrice; Blancho, Gilles; Bourdais, Ludovic; Tallacchini, Mariachiara; Ribes, Juan M; Yu, Hai; Chen, Xi; Kracikova, Jitka; Broz, Ludomir; Hejnar, Jiri; Vesely, Pavel; Takeuchi, Yasuhiro; Varki, Ajit; Soulillou, Jean-Paul


    Acellular materials of xenogenic origin are used worldwide as xenografts and Phase I trials of viable pig pancreatic islets are currently being performed. However, limited information is available on transmission of porcine endogenous retrovirus (PERV) after xenotransplantation and on the long-term immune response of recipients to xenoantigens. We analyzed the blood of burn patients who had received living pig skin dressings for up to 8 weeks for the presence of PERV as well as for the level and nature of their long term (maximum 34 years) immune response against pig antigens. Whilst no evidence of PERV genomic material or anti PERV antibody response was found, we observed a moderate increase in anti αGal antibodies and a high and sustained anti non-αGal IgG response in those patients. Antibodies against the non-human sialic acid Neu5Gc constituted the anti non-αGal response with the recognition pattern on a sialogly can array differing from that of burn patients treated without pig skin. These data suggest that anti-Neu5Gc antibodies may represent a barrier for long-term acceptance of porcine xenografts. As anti-Neu5Gc antibodies can promote chronic inflammation, the long-term safety of living and acellular pig tissue implants in recipients warrants further evaluation. PMID:23945141

  8. Long-term IgG response to porcine Neu5Gc antigens without transmission of PERV in burn patients treated with porcine skin xenografts.


    Scobie, Linda; Padler-Karavani, Vered; Le Bas-Bernardet, Stephanie; Crossan, Claire; Blaha, Josef; Matouskova, Magda; Hector, Ralph D; Cozzi, Emanuele; Vanhove, Bernard; Charreau, Beatrice; Blancho, Gilles; Bourdais, Ludovic; Tallacchini, Mariachiara; Ribes, Juan M; Yu, Hai; Chen, Xi; Kracikova, Jitka; Broz, Ludomir; Hejnar, Jiri; Vesely, Pavel; Takeuchi, Yasuhiro; Varki, Ajit; Soulillou, Jean-Paul


    Acellular materials of xenogenic origin are used worldwide as xenografts, and phase I trials of viable pig pancreatic islets are currently being performed. However, limited information is available on transmission of porcine endogenous retrovirus (PERV) after xenotransplantation and on the long-term immune response of recipients to xenoantigens. We analyzed the blood of burn patients who had received living pig-skin dressings for up to 8 wk for the presence of PERV as well as for the level and nature of their long term (maximum, 34 y) immune response against pig Ags. Although no evidence of PERV genomic material or anti-PERV Ab response was found, we observed a moderate increase in anti-αGal Abs and a high and sustained anti-non-αGal IgG response in those patients. Abs against the nonhuman sialic acid Neu5Gc constituted the anti-non-αGal response with the recognition pattern on a sialoglycan array differing from that of burn patients treated without pig skin. These data suggest that anti-Neu5Gc Abs represent a barrier for long-term acceptance of porcine xenografts. Because anti-Neu5Gc Abs can promote chronic inflammation, the long-term safety of living and acellular pig tissue implants in recipients warrants further evaluation.

  9. Sensitive skin.


    Misery, L; Loser, K; Ständer, S


    Sensitive skin is a clinical condition defined by the self-reported facial presence of different sensory perceptions, including tightness, stinging, burning, tingling, pain and pruritus. Sensitive skin may occur in individuals with normal skin, with skin barrier disturbance, or as a part of the symptoms associated with facial dermatoses such as rosacea, atopic dermatitis and psoriasis. Although experimental studies are still pending, the symptoms of sensitive skin suggest the involvement of cutaneous nerve fibres and neuronal, as well as epidermal, thermochannels. Many individuals with sensitive skin report worsening symptoms due to environmental factors. It is thought that this might be attributed to the thermochannel TRPV1, as it typically responds to exogenous, endogenous, physical and chemical stimuli. Barrier disruptions and immune mechanisms may also be involved. This review summarizes current knowledge on the epidemiology, potential mechanisms, clinics and therapy of sensitive skin.

  10. Anti-inflammation activities of mycosporine-like amino acids (MAAs) in response to UV radiation suggest potential anti-skin aging activity.


    Suh, Sung-Suk; Hwang, Jinik; Park, Mirye; Seo, Hyo Hyun; Kim, Hyoung-Shik; Lee, Jeong Hun; Moh, Sang Hyun; Lee, Taek-Kyun


    Certain photosynthetic marine organisms have evolved mechanisms to counteract UV-radiation by synthesizing UV-absorbing compounds, such as mycosporine-like amino acids (MAAs). In this study, MAAs were separated from the extracts of marine green alga Chlamydomonas hedleyi using HPLC and were identified as porphyra-334, shinorine, and mycosporine-glycine (mycosporine-Gly), based on their retention times and maximum absorption wavelengths. Furthermore, their structures were confirmed by triple quadrupole MS/MS. Their roles as UV-absorbing compounds were investigated in the human fibroblast cell line HaCaT by analyzing the expression levels of genes associated with antioxidant activity, inflammation, and skin aging in response to UV irradiation. The mycosporine-Gly extract, but not the other MAAs, had strong antioxidant activity in the 2,2-diphenyl-1-picryhydrazyl (DPPH) assay. Furthermore, treatment with mycosporine-Gly resulted in a significant decrease in COX-2 mRNA levels, which are typically increased in response to inflammation in the skin, in a concentration-dependent manner. Additionally, in the presence of MAAs, the UV-suppressed genes, procollagen C proteinase enhancer (PCOLCE) and elastin, which are related to skin aging, had increased expression levels equal to those in UV-mock treated cells. Interestingly, the increased expression of involucrin after UV exposure was suppressed by treatment with the MAAs mycosporine-Gly and shinorine, but not porphyra-334. This is the first report investigating the biological activities of microalgae-derived MAAs in human cells.

  11. The impact of methylmercury on 1,25-dihydroxyvitamin D3-induced transcriptomic responses in dolphin skin cells.


    Ellis, Blake C; Gattoni-Celli, Sebastiano; Kindy, Mark S


    The Atlantic bottlenose dolphin has been the focus of much attention owing to the considerable impact of environmental stress on its health and the associated implications for human health. Here, we used skin cells from the dolphin to investigate the protective role of the vitamin D pathway against environmental stressors. We previously reported that dolphin skin cells respond to 1,25-dihydroxyvitamin D3 (1,25D3), the bioactive metabolite of vitamin D3, by upregulation of the vitamin D receptor (VDR) and expression of several genes. Methylmercury is a highly bioaccumulative environmental stressor of relevance to the dolphin. We currently report that in dolphin cells sublethal concentrations of methylmercury compromise the ability of 1,25D3 to upregulate VDR, to transactivate a vitamin D-sensitive promoter, and to express specific target genes. These results help elucidate the effects of vitamin D and methylmercury on innate immunity in dolphin skin and potentially in human skin as well, considering similarities in the vitamin D pathway between the two species.

  12. The topical antimicrobial zinc pyrithione is a heat shock response inducer that causes DNA damage and PARP-dependent energy crisis in human skin cells.


    Lamore, Sarah D; Cabello, Christopher M; Wondrak, Georg T


    The differentiated epidermis of human skin serves as an essential barrier against environmental insults from physical, chemical, and biological sources. Zinc pyrithione (ZnPT) is an FDA-approved microbicidal agent used worldwide in clinical antiseptic products, over-the-counter topical antimicrobials, and cosmetic consumer products including antidandruff shampoos. Here we demonstrate for the first time that cultured primary human skin keratinocytes and melanocytes display an exquisite vulnerability to nanomolar concentrations of ZnPT resulting in pronounced induction of heat shock response gene expression and impaired genomic integrity. In keratinocytes treated with nanomolar concentrations of ZnPT, expression array analysis revealed massive upregulation of genes encoding heat shock proteins (HSPA6, HSPA1A, HSPB5, HMOX1, HSPA1L, and DNAJA1) further confirmed by immunodetection. Moreover, ZnPT treatment induced rapid depletion of cellular ATP levels and formation of poly(ADP-ribose) polymers. Consistent with an involvement of poly(ADP-ribose) polymerase (PARP) in ZnPT-induced energy crisis, ATP depletion could be antagonized by pharmacological inhibition of PARP. This result was independently confirmed using PARP-1 knockout mouse embryonic fibroblasts that were resistant to ATP depletion and cytotoxicity resulting from ZnPT exposure. In keratinocytes and melanocytes, single-cell gel electrophoresis and flow cytometric detection of gamma-H2A.X revealed rapid induction of DNA damage in response to ZnPT detectable before general loss of cell viability occurred through caspase-independent pathways. Combined with earlier experimental evidence that documents penetration of ZnPT through mammalian skin, our findings raise the possibility that this topical antimicrobial may target and compromise keratinocytes and melanocytes in intact human skin.

  13. The topical antimicrobial zinc pyrithione is a heat shock response inducer that causes DNA damage and PARP-dependent energy crisis in human skin cells

    PubMed Central

    Lamore, Sarah D.; Cabello, Christopher M.


    The differentiated epidermis of human skin serves as an essential barrier against environmental insults from physical, chemical, and biological sources. Zinc pyrithione (ZnPT) is an FDA-approved microbicidal agent used worldwide in clinical antiseptic products, over-the-counter topical antimicrobials, and cosmetic consumer products including antidandruff shampoos. Here we demonstrate for the first time that cultured primary human skin keratinocytes and melanocytes display an exquisite vulnerability to nanomolar concentrations of ZnPT resulting in pronounced induction of heat shock response gene expression and impaired genomic integrity. In keratinocytes treated with nanomolar concentrations of ZnPT, expression array analysis revealed massive upregulation of genes encoding heat shock proteins (HSPA6, HSPA1A, HSPB5, HMOX1, HSPA1L, and DNAJA1) further confirmed by immunodetection. Moreover, ZnPT treatment induced rapid depletion of cellular ATP levels and formation of poly(ADP-ribose) polymers. Consistent with an involvement of poly(ADP-ribose) polymerase (PARP) in ZnPT-induced energy crisis, ATP depletion could be antagonized by pharmacological inhibition of PARP. This result was independently confirmed using PARP-1 knockout mouse embryonic fibroblasts that were resistant to ATP depletion and cytotoxicity resulting from ZnPT exposure. In keratinocytes and melanocytes, single-cell gel electrophoresis and flow cytometric detection of γ-H2A.X revealed rapid induction of DNA damage in response to ZnPT detectable before general loss of cell viability occurred through caspase-independent pathways. Combined with earlier experimental evidence that documents penetration of ZnPT through mammalian skin, our findings raise the possibility that this topical antimicrobial may target and compromise keratinocytes and melanocytes in intact human skin. PMID:19809895

  14. Biothermomechanics of skin tissues

    NASA Astrophysics Data System (ADS)

    Xu, F.; Lu, T. J.; Seffen, K. A.

    Biothermomechanics of skin is highly interdisciplinary involving bioheat transfer, burn damage, biomechanics and neurophysiology. During heating, thermally induced mechanical stress arises due to the thermal denaturation of collagen, resulting in macroscale shrinkage. Thus, the strain, stress, temperature and thermal pain/damage are highly correlated; in other words, the problem is fully coupled. The aim of this study is to develop a computational approach to examine the heat transfer process and the heat-induced mechanical response, so that the differences among the clinically applied heating modalities can be quantified. Exact solutions for temperature, thermal damage and thermal stress for a single-layer skin model were first derived for different boundary conditions. For multilayer models, numerical simulations using the finite difference method (FDM) and finite element method (FEM) were used to analyze the temperature, burn damage and thermal stress distributions in the skin tissue. The results showed that the thermomechanical behavior of skin tissue is very complex: blood perfusion has little effect on thermal damage but large influence on skin temperature distribution, which, in turn, influences significantly the resulting thermal stress field; the stratum corneum layer, although very thin, has a large effect on the thermomechanical behavior of skin, suggesting that it should be properly accounted for in the modeling of skin thermal stresses; the stress caused by non-uniform temperature distribution in the skin may also contribute to the thermal pain sensation.

  15. Environment and the skin

    PubMed Central

    Suskind, Raymond R.


    The skin is an important interface between man and his environment; it is an important portal of entry for hazardous agents and a vulnerable target tissue as well. It is a uniquely accessible model system for detecting hazards and for studying mechanisms of a wide variety of biologic funcitons. Environmental causes of skin reactions comprise a vast array of physical, chemical and biological agents. To appreciate the role of the skin as an interface with man's environment, it is necessary to understand the multiple adaptive mechanisms, and the defenses of the skin against the environmental stresses. The skin is endowed with a versatile group of defenses against penetration, fluid loss from the body, thermal stress, solar radiation, physical trauma and microbial agents. Patterns of adverse response range in quality and intensity from uncomplicated itching to metastatic neoplasia. Environmental problems comprise a large segment of disabling skin disease. Although critical epidemiologic data is limited, cutaneous illnesses comprise a significant segment of occupational disease. This represents a significant loss in productivity and a major cause of disability. The most serious research needs include the development of surveillance systems for identifying skin hazards and determining frequency of environmental skin disease; the development of new models for studying cutaneous penetration; the elucidation of the mechanisms of nonallergic inflammatory reactions (primary irritation) and of the accommodation phenomenon; the development of more sensitive models for predicting adverse responses to marginal irritants; the utilization of modern skills of immunobiology and immunochemistry to elucidate mechanisms of allergic responses; the launching of epidemiologic studies to determine the long term effects of PCBs and associated compounds such as dioxins; and the expansion of research in the mechanisms of skin cancer in relation to susceptibility, genetic and metabolic

  16. Suppressive Effect of Dietary Fucoidan on Proinflammatory Immune Response and MMP-1 Expression in UVB-Irradiated Mouse Skin.


    Maruyama, Hiroko; Tamauchi, Hidekazu; Kawakami, Fumitaka; Yoshinaga, Keiko; Nakano, Takahisa


    It is well known that ultraviolet B irradiation leads to dermal inflammation. In this study, we found that Mekabu fucoidan suppressed edema, decreased the thickness of the prickle cell layer, and decreased matrix metalloproteinase 1 in the skin of mice irradiated with ultraviolet B. Moreover, we found that the mean level of interferon gamma of Mekabu fucoidan-treated, ultraviolet B-irradiated mice (approximately 2.2 ng/mL) was not significantly different from that in normal mice (approximately 2.5 ng/mL). In contrast, a significant decrease in the mean level of interferon gamma (approximately 1.3 ng/mL) in ultraviolet B-irradiated control mice was observed compared with that in Mekabu fucoidan-treated, ultraviolet B-irradiated mice. The mean thickness of the prickle cell layer in the skin of Mekabu fucoidan-treated, ultraviolet B-irradiated mice was less than that in the ultraviolet B-irradiated control mice. Metalloproteinase 1 activity was significantly higher in the skin of ultraviolet B-irradiated mice than in the skin of untreated, nonirradiated normal mice. Metalloproteinase 1 in the skin of ultraviolet B-irradiated, Mekabu fucoidan- or L(+)-ascorbic acid (vitamin C)-treated mice was significantly lower than that in the ultraviolet B-irradiated control mice. Mitigation of the morphological changes in Mekabu fucoidan-treated mice was correlated with a decrease in metalloproteinase 1 levels. These data indicate that Mekabu fucoidan is an effective suppressor of inflammation in an ultraviolet B-irradiated mouse model.

  17. Looking, Feeling, and Doing: Are There Age Differences in Attention, Mood and Behavioral Responses to Skin Cancer Information?

    PubMed Central

    Isaacowitz, Derek M.; Choi, YoonSun


    Overview Previous studies on aging and attention to emotional information found that older adults may look away from negative stimuli to regulate their moods. However, it is an open question whether older adults’ tendency to look less at negative material comes at the expense of learning when negative information is also health-relevant. This study investigated how age-related changes in attention to negative but relevant information about skin cancer risk reduction influenced both subsequent health behavior and mood regulation. Methods Younger (18-25, n = 78) and older (60-92, n = 77) adults’ fixations toward videos containing negatively-valenced content and risk-reduction information about skin cancer were recorded with eye-tracking. Self-reported mood ratings were measured throughout. Behavioral outcome measures (e.g., answering knowledge questions about skin cancer, choosing a sunscreen, completing a skin self-exam) assessed participants’ learning of key health-relevant information, their interest in seeking additional information, and their engagement in protective behaviors. Results Older adults generally looked less at the negative video content, more rapidly regulated their moods, and learned fewer facts about skin cancer; yet, they engaged in a greater number of protective behaviors than did younger adults. Conclusions Older adults may demonstrate an efficient looking strategy that extracts important information without disrupting their moods, and they may compensate for less learning by engaging in a greater number of protective behaviors. Younger adults may be distracted by disruptions to their mood, constraining their engagement in protective behaviors. PMID:22149125

  18. Influence of stripping and cooling atmospheres on surface properties and corrosion of zinc galvanizing coatings

    NASA Astrophysics Data System (ADS)

    Yasakau, K. A.; Giner, I.; Vree, C.; Ozcan, O.; Grothe, R.; Oliveira, A.; Grundmeier, G.; Ferreira, M. G. S.; Zheludkevich, M. L.


    In this work the influence of stripping/cooling atmospheres used after withdrawal of steel sheet from Zn or Zn-alloy melt on surface properties of Zn (Z) and Zn-Al-Mg (ZM) hot-dip galvanizing coatings has been studied. The aim was to understand how the atmosphere (composed by nitrogen (N2) or air) affects adhesion strength to model adhesive and corrosive behaviour of the galvanized substrates. It was shown that the surface chemical composition and Volta potential of the galvanizing coatings prepared under the air or nitrogen atmosphere are strongly influenced by the atmosphere. The surface chemistry Z and ZM surfaces prepared under N2 contained a higher content of metal atoms and a richer hydroxide density than the specimens prepared under air atmosphere as assessed by X-ray photoelectron spectroscopy (XPS). The induced differences on the microstructure of the galvanized coatings played a key role on the local corrosion induced defects as observed by means of in situ Atomic force microscopy (AFM). Peel force tests performed on the substrates coated by model adhesive films indicate a higher adhesive strength to the surfaces prepared under nitrogen atmosphere. The obtained results have been discussed in terms of the microstructure and surface chemical composition of the galvanizing coatings.

  19. Experimental Study on Rebar Corrosion Using the Galvanic Sensor Combined with the Electronic Resistance Technique

    PubMed Central

    Xu, Yunze; Li, Kaiqiang; Liu, Liang; Yang, Lujia; Wang, Xiaona; Huang, Yi


    In this paper, a new kind of carbon steel (CS) and stainless steel (SS) galvanic sensor system was developed for the study of rebar corrosion in different pore solution conditions. Through the special design of the CS and SS electronic coupons, the electronic resistance (ER) method and zero resistance ammeter (ZRA) technique were used simultaneously for the measurement of both the galvanic current and the corrosion depth. The corrosion processes in different solution conditions were also studied by linear polarization resistance (LPR) and the measurements of polarization curves. The test result shows that the galvanic current noise can provide detailed information of the corrosion processes. When localized corrosion occurs, the corrosion rate measured by the ER method is lower than the real corrosion rate. However, the value measured by the LPR method is higher than the real corrosion rate. The galvanic current and the corrosion current measured by the LPR method shows linear correlation in chloride-containing saturated Ca(OH)2 solution. The relationship between the corrosion current differences measured by the CS electronic coupons and the galvanic current between the CS and SS electronic coupons can also be used to evaluate the localized corrosion in reinforced concrete. PMID:27618054

  20. Experimental Study on Rebar Corrosion Using the Galvanic Sensor Combined with the Electronic Resistance Technique.


    Xu, Yunze; Li, Kaiqiang; Liu, Liang; Yang, Lujia; Wang, Xiaona; Huang, Yi


    In this paper, a new kind of carbon steel (CS) and stainless steel (SS) galvanic sensor system was developed for the study of rebar corrosion in different pore solution conditions. Through the special design of the CS and SS electronic coupons, the electronic resistance (ER) method and zero resistance ammeter (ZRA) technique were used simultaneously for the measurement of both the galvanic current and the corrosion depth. The corrosion processes in different solution conditions were also studied by linear polarization resistance (LPR) and the measurements of polarization curves. The test result shows that the galvanic current noise can provide detailed information of the corrosion processes. When localized corrosion occurs, the corrosion rate measured by the ER method is lower than the real corrosion rate. However, the value measured by the LPR method is higher than the real corrosion rate. The galvanic current and the corrosion current measured by the LPR method shows linear correlation in chloride-containing saturated Ca(OH)₂ solution. The relationship between the corrosion current differences measured by the CS electronic coupons and the galvanic current between the CS and SS electronic coupons can also be used to evaluate the localized corrosion in reinforced concrete.

  1. Calcium-activated force responses in fast- and slow-twitch skinned muscle fibres of the rat at different temperatures.

    PubMed Central

    Stephenson, D G; Williams, D A


    1. Force responses from mechanically skinned fibres of rat skeletal muscles (extensor digitorum longus and soleus) were measured at different temperatures in the range 3-35 degrees C following sudden changes in Ca2+ concentration in the preparations. 2. At all temperatures there were characteristic differences between the slow- and fast-twitch muscle fibres with respect to the relative steady-state force-[Ca2+] relation: such as a lower [Ca2+] threshold for activation and a less steep force-pCa curve in slow-twitch muscle fibres. 3. At 3-5 degrees C the force changes in both types of muscle fibres lagged considerably behind the estimated changes in [Ca2+] within the preparations and this enabled us to perform a comparative analysis of the Ca2+ kinetics in the process of force development in both muscle fibre types. This analysis suggest that two and six Ca2+ ions are involved in the regulatory unit for contraction of slow- and fast-twitch muscle fibres respectively. 4. The rate of relaxation following a sudden decrease in [Ca2+] was much lower in the slow-twitch than in the fast-twitch muscle at 5 degrees C, suggesting that properties of the contractile apparatus could play an essential role in determining the rate of relaxation in vivo. 5. There was substantial variation in Ca2+ sensitivity between muscle fibres of the same type from different animals at each temperature. However the steepness of the force-[Ca2+] relation was essentially the same for all fibres of the same type. 6. A change in temperature from 5 to 25 degrees C had a statistically significant effect on the sensitivity of the fast-twitch muscle fibres, rendering them less sensitive to Ca2+ by a factor of 2. However a further increase in temperature from 25 to 35 degrees C did not have any statistically significant effect on the force-[Ca2+] relation in fast-twitch muscle fibres. 7. The effect of temperature on the Ca2+ sensitivity of slow-twitch muscle fibres was not statistically significant

  2. Skin aging and dry skin.


    Hashizume, Hideo


    Skin aging appears to be the result of both scheduled and continuous "wear and tear" processes that damage cellular DNA and proteins. Two types of aging, chronological skin aging and photoaging, have distinct clinical and histological features. Chronological skin aging is a universal and inevitable process characterized primarily by physiologic alterations in skin function. In this case, keratinocytes are unable to properly terminally differentiate to form a functional stratum corneum, and the rate of formation of neutral lipids that contribute to the barrier function slows, causing dry, pale skin with fine wrinkles. In contrast, photoaging results from the UVR of sunlight and the damage thus becomes apparent in sun-exposed skin. Characteristics of this aging type are dry and sallow skin displaying fine wrinkles as well as deep furrows, resulting from the disorganization of epidermal and dermal components associated with elastosis and heliodermatitis. Understanding of the functions of the skin and the basic principles of moisturizer use and application is important for the prevention of skin aging. Successful treatment of dry skin with appropriate skin care products gives the impression of eternal youth.

  3. Eicosanoids in skin inflammation.


    Nicolaou, Anna


    Eicosanoids play an integral part in homeostatic mechanisms related to skin health and structural integrity. They also mediate inflammatory events developed in response to environmental factors, such as exposure to ultraviolet radiation, and inflammatory and allergic disorders, including psoriasis and atopic dermatitis. This review article discusses biochemical aspects related to cutaneous eicosanoid metabolism, the contribution of these potent autacoids to skin inflammation and related conditions, and considers the importance of nutritional supplementation with bioactives such as omega-3 and omega-6 polyunsaturated fatty acids and plant-derived antioxidants as means of addressing skin health issues.

  4. Human Papillomavirus E7 oncoprotein transgenic skin develops an enhanced inflammatory response to 2,4-Dinitrochlorobenzene by an arginase-1 dependent mechanism

    PubMed Central

    Tran, L.S.; Bergot, A-S.; Mattarollo, S.R.


    We have shown that expression of Human Papillomavirus type 16 E7 (HPV16.E7) protein within epithelial cells, as occurs in HPV associated-premalignancy and cancers, results in local immune suppression, and a weak and ineffective immune response to E7 protein. However, a robust acute inflammatory stimulus can overcome this to enable immune elimination of HPV16.E7 transformed epithelial cells. 2,4-Dinitrochlorobenzene (DNCB) can elicit acute inflammation and has been shown to initiate the regression of HPV-associated genital warts. Although clinical use of DNCB is discouraged due to its mutagenic potential, understanding how DNCB induced acute inflammation alters local HPV16.E7 mediated-immune suppression might lead to better treatments. Here, we show that topical DNCB application to skin expressing HPV16.E7 as a transgene induces a hyperinflammatory response, not seen in non-transgenic control animals. The E7 associated-inflammatory response is characterized by enhanced expression of Th2 cytokines and increased infiltration of CD11b+Gr1intF4/80+Ly6ChiLy6Glow myeloid cells, producing arginase-1. Inhibition of arginase with an arginase specific inhibitor, N(omega)-hydroxy-nor-L-arginine, ameliorates the DNCB-induced inflammatory response. Our results demonstrate that HPV16.E7 protein enhances DNCB associated-production of arginase-1 by myeloid cells and consequent inflammatory cellular infiltration of skin. PMID:24732401

  5. IgE–mediated mast cell responses are inhibited by thymol-mediated, activation-induced cell death in skin inflammation

    PubMed Central

    Wechsler, Joshua B.; Hsu, Chia-Lin; Bryce, Paul J.


    Background Mast cells play a critical role in inflammatory skin diseases through releasing pro-inflammatory mediators; however, few therapies directly target these cells. In 1878, the use of topical Thymol, a now recognized potent agonist for Transient Receptor Potential (TRP) channels, was first described to treat eczema and psoriasis. Objective We sought to determine the mechanisms through which thymol may alter skin inflammation. Methods We examined the effect of topical thymol on IgE-dependent responses using a mast cell–dependent passive cutaneous anaphylaxis (PCA) model as well as in vitro cultured mast cells. Results Thymol dose-dependently inhibited PCA when administered topically 24 hours prior to antigen challenge but provoked an ear swelling response directly on application. This direct effect was associated with local mast cell degranulation and was absent in histamine-deficient mice. However, unlike with PCA responses, there was no late phase swelling. In vitro, thymol directly trigged calcium flux in mast cells via TRP-channel activation, along with degranulation and cytokine transcription. However, no cytokine protein was produced. Instead, thymol induced a significant increase in apoptotic cell death that was seen both in vitro and in vivo. Conclusions We propose that the efficacy of thymol in reducing IgE-dependent responses is through promotion of activation-induced apoptotic cell death of mast cells and that this likely explains the clinical benefits observed in early clinical reports. PMID:24486068

  6. Subdominant H60 antigen-specific CD8 T-cell response precedes dominant H4 antigen-specific response during the initial phase of allogenic skin graft rejection

    PubMed Central

    Yoo, Kang Il; Jeon, Ji Yeong; Ryu, Su Jeong; Nam, Giri; Youn, Hyewon; Choi, Eun Young


    In allogeneic transplantation, including the B6 anti-BALB.B settings, H60 and H4 are two representative dominant minor histocompatibility antigens that induce strong CD8 T-cell responses. With different distribution patterns, H60 expression is restricted to hematopoietic cells, whereas H4 is ubiquitously expressed. H60-specific CD8 T-cell response has been known to be dominant in most cases of B6 anti-BALB.B allo-responses, except in the case of skin transplantation. To understand the mechanism underlying the subdominance of H60 during allogeneic skin transplantation, we investigated the dynamics of the H60-specific CD8 T cells in B6 mice transplanted with allogeneic BALB.B tail skin. Unexpectedly, longitudinal bioluminescence imaging and flow cytometric analyses revealed that H60-specific CD8 T cells were not always subdominant to H4-specific cells but instead showed a brief dominance before the H4 response became predominant. H60-specific CD8 T cells could expand in the draining lymph node and migrate to the BALB.B allografts, indicating their active participation in the anti-BALB.B allo-response. Enhancing the frequencies of H60-reactive CD8 T cells prior to skin transplantation reversed the immune hierarchy between H60 and H4. Additionally, H60 became predominant when antigen presentation was limited to the direct pathway. However, when antigen presentation was restricted to the indirect pathway, the expansion of H60-specific CD8 T cells was limited, whereas H4-specific CD8 T cells expanded significantly, suggesting that the temporary immunodominance and eventual subdominance of H60 could be due to their reliance on the direct antigen presentation pathway. These results enhance our understanding of the immunodominance phenomenon following allogeneic tissue transplantation. PMID:25676063

  7. Effects of locus coeruleus stimulation on the responses of SI neurons of the rat to controlled natural and electrical stimulation of the skin.


    Snow, P J; Andre, P; Pompeiano, O


    1. The effects of microstimulation of the locus coeruleus (LC) region on the spontaneous discharge and the response of SI neurons to natural and electrical stimulation of the skin have been investigated in 26 urethane anesthetized Sprague-Dawley rats. In particular, one or two air puffs, 5-10 msec in duration, 1-2 psi, usually separated by an interval of 40 msec, were applied on the hairy skin of the wrist or the forepaw at the presentation rate of 1/sec. For units unresponsive to air puffs, similar presentation of low intensity electrical stimuli (0.2-5.0 V, 0.2-0.4 msec pulses) were applied through two needles inserted on the most effective area of the skin. Both natural and electrical stimulations of the skin were applied under control conditions, as well as 50 msec after a 250 msec train of 0.3 msec pulses at 40 Hz. 20-30 microA applied stereotaxically to the LC complex through a tungsten microelectrode. 2. Not all cortical units exhibited spontaneous discharge. Most of the units, however, which were spontaneously active, were inhibited by electrical stimulation of the LC complex, while the remaining ones were excited. The sites of stimulation, which included either the LC proper or the locus subcoeruleus, were identified following both anatomical and physiological criteria. 3. SI neurons recorded at sites between 400 and 950 microns below the surface of the cortex, thus being most likely granule cells of layers III and IV, responded to cutaneous stimuli with spikes which occurred with a latency of 20-30 msec in response to single air puffs and a latency of 15-20 msec in response to single electrical pulses to the skin. In both instances the response to the second stimulus applied at the interstimulus interval of 40 msec was markedly reduced or abolished due to postexcitatory inhibition following the response to the first stimulus (in-field inhibition). In contrast, units particularly located at or below 1000 microns from the cortical surface, which were of

  8. Electrochemistry and speciation of Au(+) in a deep eutectic solvent: growth and morphology of galvanic immersion coatings.


    Ballantyne, Andrew D; Forrest, Gregory C H; Frisch, Gero; Hartley, Jennifer M; Ryder, Karl S


    In this study we compare the electrochemical and structural properties of three gold salts AuCl, AuCN and KAu(CN)2 in a Deep Eutectic Solvent (DES) electrolyte (Ethaline 200) in order to elucidate factors affecting the galvanic deposition of gold coatings on nickel substrates. A chemically reversible diffusion limited response was observed for AuCl, whereas AuCN and KAu(CN)2 showed much more complicated, kinetically limited responses. Galvanic exchange reactions were performed on nickel substrates from DES solutions of the three gold salts; the AuCN gave a bright gold coating, the KAu(CN)2 solution give a visibly thin coating, whilst the coating from AuCl was dull, friable and poorly adhesive. This behaviour was rationalised by the differing speciation for each of these compounds, as evidenced by EXAFS methods. Analysis of EXAFS data shows that AuCl forms the chlorido-complex [AuCl2](-), AuCN forms a mixed [AuCl(CN)](-) species, whereas KAu(CN)2 maintains its [Au(CN)2](-) structure. The more labile Cl(-) enables easier reduction of Au when compared to the tightly bound cyanide species, hence leading to slower kinetics of deposition and differing electrochemical behaviour. We conclude that metal speciation in DESs is a function of the initial metal salt and that this has a strong influence on the mechanism and rate of growth, as well as on the morphology of the metal deposit obtained. In addition, these coatings are also extremely promising from a technological perspective as Electroless Nickel Immersion Gold (ENIG) finishes in the printed circuit board (PCB) industry, where the elimination of acid in gold plating formulation could potentially lead to more reliable coatings. Consequently, these results are both significant and timely.

  9. Skin optics

    SciTech Connect

    van Gemert, M.J.; Jacques, S.L.; Sterenborg, H.J.; Star, W.M.


    Quantitative dosimetry in the treatment of skin disorders with (laser) light requires information on propagation of light in the skin related to the optical properties of the individual skin layers. This involves the solution of the integro-differential equation of radiative transfer in a model representing skin geometry, as well as experimental methods to determine the optical properties of each skin layer. These activities are unified under the name skin optics. This paper first reviews the current status of tissue optics, distinguishing between the cases of: dominant absorption, dominant scattering, and scattering about equal to absorption. Then, previously published data as well as some current unpublished data on (human) stratum corneum, epidermis and dermis, have been collected and/or (re)analyzed in terms of absorption coefficient, scattering coefficient, and anisotropy factor of scattering. The results are that the individual skin layers show strongly forward scattering (anisotropy factors between 0.7 and 0.9). The absorption and scattering data show that for all wavelengths considered scattering is much more important than absorption. Under such circumstances, solutions to the transport equation for a multilayer skin model and finite beam laser irradiation are currently not yet available. Hence, any quantitative dosimetry for skin treated with (laser) light is currently lacking.

  10. SERS activity studies of Ag/Au bimetallic films prepared by galvanic replacement.


    Wang, Chaonan; Fang, Jinghuai; Jin, Yonglong


    Ag films on Si substrates were fabricated by immersion plating, which served as sacrificial materials for preparation of Ag/Au bimetallic films by galvanic replacement method. SEM images displayed that the sacrificial Ag films presenting island morphology experienced interesting structural evolution process during galvanic replacement reaction, and nano-scaled holes were formed in the resultant bimetallic films. SERS measurements using crystal violet as an analyte showed that SERS intensities of bimetallic films were enhanced significantly compared with that of pure Ag films and related mechanisms were discussed. Immersion plating experiment carried out on Ag films on PEN substrates fabricated by photoinduced reduction method further confirmed that galvanic replacement is an easy method to fabricate Ag/Au bimetallic and a potential approach to improve the SERS performance of Ag films.

  11. Thunderbolt in biogeochemistry: galvanic effects of lightning as another source for metal remobilization

    PubMed Central

    Schaller, Jörg; Weiske, Arndt; Berger, Frank


    Iron and manganese are relevant constituents of the earth's crust and both show increasing mobility when reduced by free electrons. This reduction is known to be controlled by microbial dissimilation processes. Alternative sources of free electrons in nature are cloud-to-ground lightning events with thermal and galvanic effects. Where thermal effects of lightning events are well described, less is known about the impact of galvanic lightning effects on metal mobilization. Here we show that a significant mobilization of manganese occurs due to galvanic effects of both positive and negative lightning, where iron seems to be unaffected with manganese being abundant in oxic forms in soils/sediments. A mean of 0.025 mmol manganese (negative lightning) or 0.08 mmol manganese (positive lightning) mobilization may occur. We suggest that lightning possibly influences biogeochemical cycles of redox sensitive elements in continental parts of the tropics/subtropics on a regional/local scale. PMID:24184989

  12. Photo-galvanic effect in Bi2Se3 thin films with ionic liquid gating

    NASA Astrophysics Data System (ADS)

    Pan, Yu; Richardella, Anthony; Lee, Joon Sue; Flanagan, Thomas; Samarth, Nitin


    A key challenge in three dimensional (3D) topological insulators (TIs) is to reveal the helical spin-polarized surface states via electrical transport measurements. A recent study [Nature Nanotech. 7, 96 (2012)] showed that circularly polarized light can be used to generate and control photocurrents in the 3D TI Bi2Se3, even at photon energies that are well above the bulk band gap. Symmetry considerations suggest that this ``photo-galvanic effect'' arises purely from photo-currents induced in the surface Dirac states. To gain insights into this phenomenon, we have carried out systematic measurements of the photo-galvanic effect in electrically gated MBE-grown Bi2Se3 thin films of varying thickness. By using an ionic liquid as an optically transparent gate, we map out the behavior of the photo-galvanic effect as a function of Fermi energy over a temperature range 5 K <= T <= 300 K. Supported by ONR and NSF.

  13. Galvanic Exchange in Colloidal Metal/Metal-Oxide Core/Shell Nanocrystals

    PubMed Central


    While galvanic exchange is commonly applied to metallic nanoparticles, recently its applicability was expanded to metal-oxides. Here the galvanic exchange is studied in metal/metal-oxide core/shell nanocrystals. In particular Sn/SnO2 is treated by Ag+, Pt2+, Pt4+, and Pd2+. The conversion dynamics is monitored by in situ synchrotron X-ray diffraction. The Ag+ treatment converts the Sn cores to the intermetallic AgxSn (x ∼ 4) phase, by changing the core’s crystal structure. For the analogous treatment by Pt2+, Pt4+, and Pd2+, such a galvanic exchange is not observed. This different behavior is caused by the semipermeability of the naturally formed SnO2 shell, which allows diffusion of Ag+ but protects the nanocrystal cores from oxidation by Pt and Pd ions. PMID:27635186

  14. Thunderbolt in biogeochemistry: galvanic effects of lightning as another source for metal remobilization.


    Schaller, Jörg; Weiske, Arndt; Berger, Frank


    Iron and manganese are relevant constituents of the earth's crust and both show increasing mobility when reduced by free electrons. This reduction is known to be controlled by microbial dissimilation processes. Alternative sources of free electrons in nature are cloud-to-ground lightning events with thermal and galvanic effects. Where thermal effects of lightning events are well described, less is known about the impact of galvanic lightning effects on metal mobilization. Here we show that a significant mobilization of manganese occurs due to galvanic effects of both positive and negative lightning, where iron seems to be unaffected with manganese being abundant in oxic forms in soils/sediments. A mean of 0.025 mmol manganese (negative lightning) or 0.08 mmol manganese (positive lightning) mobilization may occur. We suggest that lightning possibly influences biogeochemical cycles of redox sensitive elements in continental parts of the tropics/subtropics on a regional/local scale.

  15. Two-Step Tuberculin Skin Testing in School-Going Adolescents with Initial 0-4 Millimeter Responses in a High Tuberculosis Prevalence Setting in South India

    PubMed Central

    Murthy, Maitreyi; Selvam, Sumithra; Jesuraj, Nelson; Bennett, Sean; Doherty, Mark; Grewal, Harleen M. S.; Vaz, Mario


    Background The utility of two-step tuberculin skin testing among adolescents in high tuberculosis prevalence settings is not well established. Objectives To determine the proportion and determinants of a 0-4 mm response to an initial standard tuberculin skin test (TST) and evaluating 'boosting' with repeat testing. Methods Adolescents between 11 and 18 years attending schools/colleges underwent a TST; those with a response of between 0–4 mm had a repeat TST 1-4 weeks later. Results Initial TST was done for 6608/6643 participants; 1257 (19%) developed a 0-4 mm response to the initial TST. Younger age and under-nutrition were more likely to be associated with a 0-4 mm response, while the presence of BCG (Bacillus Calmette Guerin) scar and higher socio-economic class were less likely to be associated with a 0-4 mm response. On repeat testing boosting was seen in 13.2% (145/1098; ≥ 6 mm over the initial test) while 4.3% showed boosting using a more conservative cutoff of a repeat TST ≥ 10 mm with an increment of at least 6 mm (47/1098). History of exposure to a tuberculosis (TB) case was associated with enhanced response. Conclusion The proportion of adolescents who demonstrated boosting on two-step TST testing in our study was relatively low. As a result repeat testing did not greatly alter the prevalence of TST positivity. However, the two-step TST helps identify individuals who can potentially boost their immune response to a second test, and thus, prevents them from being misclassified as those with newly acquired infection, or tuberculin converters. While two-step tuberculin skin testing may have a limited role in population- level TST surveys, it may be useful where serial tuberculin testing needs to be performed to distinguish those who show an enhanced response or boosters from those who indeed have a new infection, or converters. PMID:24039716

  16. 76 FR 23548 - Galvanized Steel Wire From the People's Republic of China and Mexico: Initiation of Antidumping...

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... (``Sterling'') on the record. The Department placed the statement of Indian producer Visakha Wire Ropes... International Trade Administration Galvanized Steel Wire From the People's Republic of China and Mexico... Department of Commerce (the ``Department'') received petitions concerning imports of galvanized steel...

  17. 76 FR 47150 - Galvanized Steel Wire From the People's Republic of China and Mexico: Postponement of Preliminary...

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... International Trade Administration Galvanized Steel Wire From the People's Republic of China and Mexico... duty investigations of galvanized steel wire from the People's Republic of China (PRC) and Mexico. The... Steel Wire From the People's Republic of China and Mexico: Initiation of Antidumping Duty...

  18. An anti-galvanic replacement reaction of DNA templated silver nanoclusters monitored by the light-scattering technique.


    Liu, Guoliang; Feng, Da-Qian; Zheng, Wenjie; Chen, Tianfeng; Li, Dan


    An anti-galvanic replacement reaction (AGRR) of copper(II) ions reduced by ultra-small ssDNA-templated silver nanoclusters forming Ag-Cu alloy nanoparticles was observed. The reaction is against the classic galvanic theory and was monitored sensitively by the light-scattering technique.

  19. Geochemical investigation of the galvanic effects during oxidation of pyrite and base-metals sulfides.


    Chopard, Aurélie; Plante, Benoît; Benzaazoua, Mostafa; Bouzahzah, Hassan; Marion, Philippe


    Predicting the water quality at mine sites is of significant importance for developing mines with respect for the environment. Acid mine drainage (AMD) occurs when sulfides are in contact with oxygen and water, and several parameters and mechanisms influence final drainage quality. Galvanic interactions influence the reactivity of sulfide minerals, which act as semi-conductors. These galvanic interactions have been insufficiently studied in the context of AMD generation. In this study, the influence of pyrite on the reactivity of sphalerite and chalcopyrite was investigated. Five blends, comprised of free grains of quartz/pyrite, quartz/chalcopyrite, quartz/sphalerite, quartz/pyrite/chalcopyrite, and quartz/pyrite/sphalerite, were subjected to geochemical testing. Five weathering cells were monitored over a 200-day period during which they were leached twice weekly. Leachates were analyzed for pH, Eh, electrical conductivity, and sulfate and metal concentrations. The results of these analyses showed that galvanic interactions occurred between free sulfide grains. Pyrite was galvanically protected over the full testing period in the quartz/pyrite/chalcopyrite blend, and partially protected in the quartz/pyrite/sphalerite blend. Moreover, the release of Cu from chalcopyrite and Zn, Mn, and Cd from sphalerite was accelerated in the presence of pyrite. This work provides a better understanding of the influence of pyrite on chalcopyrite and sphalerite reactivity by highlighting the galvanic effects. In the future, to improve the reliability of AMD prediction tests, galvanic interactions should be considered in both the prediction of the acid generation potential and the estimation of metal and metalloid release rates.

  20. The differential response of the skin in young and old rats to a combination of X-rays and 'wet' or 'dry' hyperthermia.


    Hamlet, R; Hopewell, J W


    The left hind feet of groups of female rats aged 7, 14 and 52 weeks were irradiated at three dose levels of X-rays (20, 25 or 30 Gy). Hyperthermia (42.5 degrees C for 1 h) was carried out immediately following irradiation using either 'wet' or 'dry' heat, achieved by immersion in either water or fluorocarbon liquid. The results demonstrated that 'wet' heat produced a consistently greater enhancement of the irradiation damage than 'dry' heat. The thermal enhancement ratio for irradiation plus 'wet' heat was approximately 1.5 and for irradiation plus 'dry' heat it was in the range 1.17 to 1.39. Immersion of the feet in fluorocarbon liquid at 37 degrees C did not significantly modify the irradiation response of the skin. The lower thermal enhancement ratios obtained using immersion in fluorocarbon liquid at 42.5 degrees C are close to those obtained in large animal studies and also similar to the limited amount of data from clinical studies where microwave or ultrasound heating techniques were used. It has been demonstrated that there are large age-related differences in the response of the rat foot skin to irradiation alone. It has also been shown in the present study, using rats of the same age, that the response to irradiation plus hyperthermia was less age dependent. This finding may reflect the differing methods by which damage occurs in tissue after irradiation or hyperthermia.

  1. Analysis of skin and secretions of Dybowski's frogs (Rana dybowskii) exposed to Staphylococcus aureus or Escherichia coli identifies immune response proteins.


    Xiao, Xiang-Hong; Miao, Hui-Min; Xu, Yi-Gang; Zhang, Jing-Yu; Chai, Long-Hui; Xu, Jia-Jia


    The aim of the present study was to investigate responses in Dybowski's frogs (Rana dybowskii) exposed to bacteria, using proteomic and transcriptomic approaches. Staphylococcus aureus and Escherichia coli were used as representative Gram-positive and Gram-negative bacteria, respectively, in an infectious challenge model. Frog skin and skin secretions were collected and protein expression in infected frogs compared to control frogs by two-dimensional gel electrophoresis, silver staining, and image analysis. Proteins that demonstrated differential expression were analysed by mass spectrometry and identified by searching protein databases. More than 180 protein spots demonstrated differential expression in E. coli- or S. aureus-challenged groups and, of these, more than 55 spots were up- or down-regulated at least sixfold, post-infection. Proteins with a potential function in the immune response were identified, such as stathmin 1a, annexin A1, superoxide dismutase A, C-type lectin, lysozyme, antimicrobial peptides, cofilin-1-B, mannose receptor, histone H4, prohormone convertase 1, carbonyl reductase 1 and some components of the Toll-like receptor (TLR) signalling pathway. These molecules are potential candidates for further investigation of immune mechanisms in R. dybowskii; in particular, TLR-mediated responses, which might be activated in frogs exposed to pathogenic bacteria as part of innate immune defence, but which might also impact on adaptive immunity to infection.

  2. Asymmetries in sensory pathways from skin to motoneurons on each side of the body determine the direction of an avoidance response in hatchling Xenopus tadpoles.


    Zhao, F Y; Burton, B G; Wolf, E; Roberts, A


    1. When swimming is initiated by tail stimulation in hatchling Xenopus tadpoles, the first trunk contraction is usually on the opposite side and directs the animal away from the stimulus. We have investigated how asymmetries in the skin sensory pathways mediate this response. 2. In alpha-bungarotoxin-immobilized tadpoles, intracellular recordings were made of responses to ipsilateral (ISS) and contralateral skin stimulation (CSS) in thirty-two presumed motoneurons. ISS evokes an inhibitory postsynaptic potential (IPSP) followed by an excitatory postsynaptic potential (EPSP) whereas CSS only evokes an EPSP. Blocking the short latency IPSP evoked by ISS with strychnine reduced the difference in spike latency on the two sides but spikes still occurred first to CSS. 3. Motoneuron EPSPs evoked by ISS and CSS were therefore recorded during microperfusion of strychnine to block the short latency IPSP. We found: (a) the CSS-EPSPs have lower threshold, larger amplitude at a given intensity of stimulus, faster rising phase, and shorter latencies than those of ISS-EPSPs; (b) the ISS-EPSP onset latencies were longer than CSS-EPSPs and became shorter as the stimulus intensity increased while those of CSS-EPSPs remained little changed. At high stimulus intensities, EPSPs caused by CSS and ISS became similar; and (c) onset latencies of ISS-EPSPs had higher variance than those of CSS-EPSPs. However, this difference was reduced as the stimulus intensity was increased. 4. Since motoneuron EPSP onset latencies varied with stimulus intensity, we proposed that the pathway from the opposite side had stronger synapses from afferents to sensory interneurons. To test this proposal we built a neuronal population model of the spinal pathway from skin afferents, via sensory interneurons to ipsilateral and contralateral motoneurons incorporating this asymmetry. Inhibition was omitted from the model. 5. Simulated motoneuron EPSPs in response to skin stimulation on each side of the body showed

  3. 5-HT1A/1B Receptors as Targets for Optimizing Pigmentary Responses in C57BL/6 Mouse Skin to Stress

    PubMed Central

    Wu, Hua-Li; Pang, Si-Lin; Liu, Qiong-Zhen; Wang, Qian; Cai, Min-Xuan; Shang, Jing


    Stress has been reported to induce alterations of skin pigmentary response. Acute stress is associated with increased turnover of serotonin (5-hydroxytryptamine; 5-HT) whereas chronic stress causes a decrease. 5-HT receptors have been detected in pigment cells, indicating their role in skin pigmentation. To ascertain the precise role of 5-HT in stress-induced pigmentary responses, C57BL/6 mice were subjected to chronic restraint stress and chronic unpredictable mild stress (CRS and CUMS, two models of chronic stress) for 21 days, finally resulting in abnormal pigmentary responses. Subsequently, stressed mice were characterized by the absence of a black pigment in dorsal coat. The down-regulation of tyrosinase (TYR) and tyrosinase-related proteins (TRP1 and TRP2) expression in stressed skin was accompanied by reduced levels of 5-HT and decreased expression of 5-HT receptor (5-HTR) system. In both murine B16F10 melanoma cells and normal human melanocytes (NHMCs), 5-HT had a stimulatory effect on melanin production, dendricity and migration. When treated with 5-HT in cultured hair follicles (HFs), the increased expression of melanogenesis-related genes and the activation of 5-HT1A, 1B and 7 receptors also occurred. The serum obtained from stressed mice showed significantly decreased tyrosinase activity in NHMCs compared to that from nonstressed mice. The decrease in tyrosinase activity was further augmented in the presence of 5-HTR1A, 1B and 7 antagonists, WAY100635, SB216641 and SB269970. In vivo, stressed mice received 5-HT precursor 5-hydroxy-l-tryptophan (5-HTP), a member of the class of selective serotonin reuptake inhibitors (fluoxetine; FX) and 5-HTR1A/1B agonists (8-OH-DPAT/CP94253), finally contributing to the normalization of pigmentary responses. Taken together, these data strongly suggest that the serotoninergic system plays an important role in the regulation of stress-induced depigmentation, which can be mediated by 5-HT1A/1B receptors. 5-HT and 5-HTR1A

  4. Wear resistance of WC/Co HVOF-coatings and galvanic Cr coatings modified by diamond nanoparticles

    NASA Astrophysics Data System (ADS)

    Kandeva, M.; Grozdanova, T.; Karastoyanov, D.; Assenova, E.


    The efforts in the recent 20 years are related to search of ecological solutions in the tribotechnologies for the replacement of galvanic Cr coatings in the contact systems operating under extreme conditions: abrasion, erosion, cavitation, corrosion, shock and vibration loads. One of the solutions is in the composite coatings deposited by high velocity gas-flame process (HVOF). The present paper presents comparative study results for mechanical and tribological characteristics of galvanic Cr coatings without nanoparticles, galvanic Cr coatings modified by diamond nanoparticles NDDS of various concentration 0.6; 10; 15 и 20% obtained under three technological regimes, and composite WC-12Co coating. Comparative results about hardness, wear, wear resistance and friction coefficient are obtained for galvanic Cr-NDDS and WC-12Co coatings operating at equal friction conditions of dry friction on abrasive surface. The WC-12Co coating shows 5.4 to 7 times higher wear resistance compared to the galvanic Cr-NDDS coatings.

  5. Skin findings in newborns


    Newborn skin characteristics; Infant skin characteristics; Neonatal care - skin ... the first few weeks of the baby's life. Newborn skin will vary, depending on the length of the pregnancy. Premature infants have thin, transparent skin. The skin of a ...

  6. Sensitive skin: an overview.


    Berardesca, E; Farage, M; Maibach, H


    Sensitive skin is a condition of subjective cutaneous hyper-reactivity to environmental factors. Subjects experiencing this condition report exaggerated reactions when their skin is in contact with cosmetics, soaps and sun screens, and they often report worsening after exposure to dry and cold climate. Although no sign of irritation is commonly detected, itching, burning, stinging and a tight sensation are constantly present. Generally substances that are not commonly considered irritants are involved in this abnormal response.Sensitive skin and subjective irritation are widespread but still far from being completely defined and understood. A correlation between sensitive skin and constitutional anomalies and/or other triggering factors such as occupational skin diseases or chronic exposure to irritants has been hypothesized. Recent findings suggest that higher sensitivity can be due to different mechanisms. Hyper-reactors may have a thinner stratum corneum with a reduced corneocyte area causing a higher transcutaneous penetration of water-soluble chemicals. Alterations in vanilloid receptors and changes in neuronal transmission have been described. Monitoring skin parameters such as barrier function, proclivity to irritation, corneocyte size and sensorial transmission can also be useful to identify regional differences in skin sensitivity.

  7. Skin Infections


    ... it can get infected by them. Some common types of skin infections are Bacterial: Cellulitis and impetigo. Staphylococcal infections can also affect the skin. Viral: Shingles, warts, and herpes simplex Fungal: Athlete's foot and yeast infections Parasitic: Body lice, head lice, and scabies ...

  8. An elastic second skin

    NASA Astrophysics Data System (ADS)

    Yu, Betty; Kang, Soo-Young; Akthakul, Ariya; Ramadurai, Nithin; Pilkenton, Morgan; Patel, Alpesh; Nashat, Amir; Anderson, Daniel G.; Sakamoto, Fernanda H.; Gilchrest, Barbara A.; Anderson, R. Rox; Langer, Robert


    We report the synthesis and application of an elastic, wearable crosslinked polymer layer (XPL) that mimics the properties of normal, youthful skin. XPL is made of a tunable polysiloxane-based material that can be engineered with specific elasticity, contractility, adhesion, tensile strength and occlusivity. XPL can be topically applied, rapidly curing at the skin interface without the need for heat- or light-mediated activation. In a pilot human study, we examined the performance of a prototype XPL that has a tensile modulus matching normal skin responses at low strain (<40%), and that withstands elongations exceeding 250%, elastically recoiling with minimal strain-energy loss on repeated deformation. The application of XPL to the herniated lower eyelid fat pads of 12 subjects resulted in an average 2-grade decrease in herniation appearance in a 5-point severity scale. The XPL platform may offer advanced solutions to compromised skin barrier function, pharmaceutical delivery and wound dressings.

  9. Chromophores in human skin

    NASA Astrophysics Data System (ADS)

    Young, Antony R.


    Human skin, especially the epidermis, contains several major solar ultraviolet-radiation- (UVR-) absorbing endogenous chromophores including DNA, urocanic acid, amino acids, melanins and their precursors and metabolites. The lack of solubility of melanins prevents their absorption spectra being defined by routine techniques. Indirect spectroscopic methods show that their spectral properties depend on the stimulus for melanogenesis. The photochemical consequences of UVR absorption by some epidermal chromophores are relatively well understood whereas we lack a detailed understanding of the consequent photobiological and clinical responses. Skin action spectroscopy is not a reliable way of relating a photobiological outcome to a specific chromophore but is important for UVR hazard assessment. Exogenous chromophores may be administered to the skin in combination with UVR exposure for therapeutic benefit, or as sunscreens for the prevention of sunburn and possibly skin cancer.

  10. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    PubMed Central

    Dang, N.N.; Pang, S.G.; Song, H.Y.; An, L.G.; Ma, X.L.


    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response. PMID:25493381

  11. The loss of ATP2C1 impairs the DNA damage response and induces altered skin homeostasis: Consequences for epidermal biology in Hailey-Hailey disease

    PubMed Central

    Cialfi, Samantha; Le Pera, Loredana; De Blasio, Carlo; Mariano, Germano; Palermo, Rocco; Zonfrilli, Azzurra; Uccelletti, Daniela; Palleschi, Claudio; Biolcati, Gianfranco; Barbieri, Luca; Screpanti, Isabella; Talora, Claudio


    Mutation of the Golgi Ca2+-ATPase ATP2C1 is associated with deregulated calcium homeostasis and altered skin function. ATP2C1 mutations have been identified as having a causative role in Hailey-Hailey disease, an autosomal-dominant skin disorder. Here, we identified ATP2C1 as a crucial regulator of epidermal homeostasis through the regulation of oxidative stress. Upon ATP2C1 inactivation, oxidative stress and Notch1 activation were increased in cultured human keratinocytes. Using RNA-seq experiments, we found that the DNA damage response (DDR) was consistently down-regulated in keratinocytes derived from the lesions of patients with Hailey-Hailey disease. Although oxidative stress activates the DDR, ATP2C1 inactivation down-regulates DDR gene expression. We showed that the DDR response was a major target of oxidative stress-induced Notch1 activation. Here, we show that this activation is functionally important because early Notch1 activation in keratinocytes induces keratinocyte differentiation and represses the DDR. These results indicate that an ATP2C1/NOTCH1 axis might be critical for keratinocyte function and cutaneous homeostasis, suggesting a plausible model for the pathological features of Hailey-Hailey disease. PMID:27528123

  12. Mutations in an amino acid transporter gene are responsible for sex-linked translucent larval skin of the silkworm, Bombyx mori.


    Kiuchi, Takashi; Banno, Yutaka; Katsuma, Susumu; Shimada, Toru


    The sex-linked translucent (os) mutation in the silkworm, Bombyx mori, confers slightly translucent larval skin resulting from a decrease in the incorporation of uric acid into epidermal cells. By positional cloning, we narrowed a region linked to the os phenotype to approximately 157 kb located on scaffold Bm_scaf72 on the Z chromosome (chromosome 1). The region contained four gene models. Sequencing analysis revealed that one of the candidate genes had a 7-bp deletion in the coding region. We also found a 111-bp deletion or single-nucleotide substitution in the same gene using independent os mutant strains. Because all the mutations caused the generation of abnormal transcripts followed by translation of a truncated protein, we conclude that the mutation of this candidate gene is responsible for the translucent larval skin of the os mutant. Sequence analysis indicated that the gene responsible for the os mutation had homology to amino acid transporters of the solute carrier family of proteins. Our results suggest that solute carrier proteins are involved in uric acid transport in insects and other invertebrates.

  13. Excluded and behaving unethically: social exclusion, physiological responses, and unethical behavior.


    Kouchaki, Maryam; Wareham, Justin


    Across 2 studies, we investigated the ethical consequences of physiological responses to social exclusion. In Study 1, participants who were socially excluded were more likely to engage in unethical behavior to make money and the level of physiological arousal experienced during exclusion--measured using galvanic skin response--mediated the effects of exclusion on unethical behavior. Likewise, in Study 2, results from a sample of supervisor-subordinate dyads revealed a positive relationship between experience of workplace ostracism and unethical behaviors as rated by the immediate supervisors. This relationship was mediated by employees' reports of experienced physiological arousal. Together, the results of these studies demonstrate that physiological arousal accompanies social exclusion and provides an explanatory mechanism for the increased unethical behavior in both samples. Theoretical implications of these findings for research on ethical behavior and social exclusion in the workplace are discussed.

  14. Cancer promotion in a mouse-skin model by a 60-Hz magnetic field: II. Tumor development and immune response.


    McLean, J R; Stuchly, M A; Mitchel, R E; Wilkinson, D; Yang, H; Goddard, M; Lecuyer, D W; Schunk, M; Callary, E; Morrison, D


    This paper describes preliminary findings on the influence of 60-Hz (2-mT) magnetic fields on tumor promotion and co-promotion in the skins of mice. The effect of magnetic fields on natural killer (NK) cell activity in spleen and blood was also examined. Groups of 32 juvenile female mice were exposed to the magnetic field as described in part I. The dorsal skin of all animals was treated with a subthreshold dose of the carcinogen 7,12-dimethyl-benz(a)anthracene (DMBA). One week after the treatment, two groups were sham exposed (group A) or field exposed at 2 mT (group B) 6 h/day for 21 weeks, to test whether the field would act as a tumor promoter. No tumors developed in these two groups of mice. To test whether the magnetic field would modify tumor development by directly affecting tumor growth or by suppressing immune surveillance, two additional groups of mice were treated weekly with the tumor promoter 12-0-tetradecanoylphorbol-13-acetate (TPA) and then either sham exposed (group C) or field exposed (group D). The time to appearance of tumors was shorter (but not statistically so) in the group exposed to magnetic fields and TPA. Some differences in NK cell activity and spleen size were observed between the sham- and field-exposed groups.

  15. Synthetic antimicrobial and LPS-neutralising peptides suppress inflammatory and immune responses in skin cells and promote keratinocyte migration

    PubMed Central

    Pfalzgraff, Anja; Heinbockel, Lena; Su, Qi; Gutsmann, Thomas; Brandenburg, Klaus; Weindl, Günther


    The stagnation in the development of new antibiotics and the concomitant high increase of resistant bacteria emphasize the urgent need for new therapeutic options. Antimicrobial peptides are promising agents for the treatment of bacterial infections and recent studies indicate that Pep19-2.5, a synthetic anti-lipopolysaccharide (LPS) peptide (SALP), efficiently neutralises pathogenicity factors of Gram-negative (LPS) and Gram-positive (lipoprotein/-peptide, LP) bacteria and protects against sepsis. Here, we investigated the potential of Pep19-2.5 and the structurally related compound Pep19-4LF for their therapeutic application in bacterial skin infections. SALPs inhibited LP-induced phosphorylation of NF-κB p65 and p38 MAPK and reduced cytokine release and gene expression in primary human keratinocytes and dermal fibroblasts. In LPS-stimulated human monocyte-derived dendritic cells and Langerhans-like cells, the peptides blocked IL-6 secretion, downregulated expression of maturation markers and inhibited dendritic cell migration. Both SALPs showed a low cytotoxicity in all investigated cell types. Furthermore, SALPs markedly promoted cell migration via EGFR transactivation and ERK1/2 phosphorylation and accelerated artificial wound closure in keratinocytes. Peptide-induced keratinocyte migration was mediated by purinergic receptors and metalloproteases. In contrast, SALPs did not affect proliferation of keratinocytes. Conclusively, our data suggest a novel therapeutic target for the treatment of patients with acute and chronic skin infections. PMID:27509895

  16. Polyfibroblast: A Self-Healing and Galvanic Protection Additive

    DTIC Science & Technology


    of premature microcapsule rupture, and have shown that the microcapsules are resilient to solvent soaking. 2 Project Goals and Objectives This month...capability of Polyfibroblast microcapsules , we designed the following test. We short-circuited a A1008 steel specimen to a strip of polyurethane...pH New experiments have revealed that alkaline plating baths etch the polymer skin layer. Fresh microcapsules placed in plating baths with a pH of

  17. Biologic activities of molecular chaperones and pharmacologic chaperone imidazole-containing dipeptide-based compounds: natural skin care help and the ultimate challenge: implication for adaptive responses in the skin.


    Babizhayev, Mark A; Nikolayev, Gennady M; Nikolayeva, Juliana G; Yegorov, Yegor E


    Accumulation of molecular damage and increased molecular heterogeneity are hallmarks of photoaged skin and pathogenesis of human cutaneous disease. Growing evidence demonstrates the ability of molecular chaperone proteins and of pharmacologic chaperones to decrease the environmental stress and ameliorate the oxidation stress-related and glycation disease phenotypes, suggesting that the field of chaperone therapy might hold novel treatments for skin diseases and aging. In this review, we examine the evidence suggesting a role for molecular chaperone proteins in the skin and their inducer and protecting agents: pharmacologic chaperone imidazole dipeptide-based agents (carcinine and related compounds) in cosmetics and dermatology. Furthermore, we discuss the use of chaperone therapy for the treatment of skin photoaging diseases and other skin pathologies that have a component of increased glycation and/or free radical-induced oxidation in their genesis. We examine biologic activities of molecular and pharmacologic chaperones, including strategies for identifying potential chaperone compounds and for experimentally demonstrating chaperone activity in in vitro and in vivo models of human skin disease. This allows the protein to function and traffic to the appropriate location in the skin, thereby increasing protein activity and cellular function and reducing stress on skin cells. The benefits of imidazole dipeptide antioxidants with transglycating activity (such as carcinine) in skin care are that they help protect and repair cell membrane damage and help retain youthful, younger-looking skin. All skin types will benefit from daily, topical application of pharmacologic chaperone antioxidants, anti-irritants, in combination with water-binding protein agents that work to mimic the structure and function of healthy skin. General strategies are presented addressing ground techniques to improve absorption of usually active chaperone proteins and dipeptide compounds, include

  18. Tactile cues significantly modulate the perception of sweat-induced skin wetness independently of the level of physical skin wetness

    PubMed Central

    Fournet, Damien; Hodder, Simon; Havenith, George


    Humans sense the wetness of a wet surface through the somatosensory integration of thermal and tactile inputs generated by the interaction between skin and moisture. However, little is known on how wetness is sensed when moisture is produced via sweating. We tested the hypothesis that, in the absence of skin cooling, intermittent tactile cues, as coded by low-threshold skin mechanoreceptors, modulate the perception of sweat-induced skin wetness, independently of the level of physical wetness. Ten males (22 yr old) performed an incremental exercise protocol during two trials designed to induce the same physical skin wetness but to induce lower (TIGHT-FIT) and higher (LOOSE-FIT) wetness perception. In the TIGHT-FIT, a tight-fitting clothing ensemble limited intermittent skin-sweat-clothing tactile interactions. In the LOOSE-FIT, a loose-fitting ensemble allowed free skin-sweat-clothing interactions. Heart rate, core and skin temperature, galvanic skin conductance (GSC), and physical (wbody) and perceived skin wetness were recorded. Exercise-induced sweat production and physical wetness increased significantly [GSC: 3.1 μS, SD 0.3 to 18.8 μS, SD 1.3, P < 0.01; wbody: 0.26 no-dimension units (nd), SD 0.02, to 0.92 nd, SD 0.01, P < 0.01], with no differences between TIGHT-FIT