Thyroid epithelial cell hyperplasia in IFN-gamma deficient NOD.H-2h4 mice.

PubMed

Yu, Shiguang; Sharp, Gordon C; Braley-Mullen, Helen

2006-01-01

The role of inflammatory cells in thyroid epithelial cell (thyrocyte) hyperplasia is unknown. Here, we demonstrate that thyrocyte hyperplasia in IFN-gamma-/- NOD.H-2h4 mice has an autoimmune basis. After chronic exposure to increased dietary iodine, 60% of IFN-gamma-/- mice had severe thyrocyte hyperplasia with minimal or moderate lymphocyte infiltration, and thyroid dysfunction with reduced serum T4. All mice produced anti-thyroglobulin autoantibody. Some wild-type NOD.H-2h4 mice had isolated areas of thyrocyte hyperplasia with predominantly lymphocytic infiltration, whereas IL-4-/- and 50% of wild-type NOD.H-2h4 mice developed lymphocytic thyroiditis but no thyrocyte hyperplasia. Both thyroid infiltrating inflammatory cells and environmental factors (iodine) were required to induce thyrocyte hyperplasia. Splenocytes from IFN-gamma-/- mice with thyrocyte hyperplasia, but not splenocytes from naïve IFN-gamma-/- mice, induced hyperplasia in IFN-gamma-/- NOD.H-2h4.SCID mice. These results may provide clues for understanding the mechanisms underlying development of epithelial cell hyperplasia not only in thyroids but also in other tissues and organs.

Compartmentalized bronchoalveolar IFN-gamma and IL-12 response in human pulmonary tuberculosis.

PubMed

Herrera, Maria Teresa; Torres, Martha; Nevels, Denarra; Perez-Redondo, Carlos Núñez; Ellner, Jerrold J; Sada, Eduardo; Schwander, Stephan K

2009-01-01

Human tuberculosis (TB) principally involves the lungs, where local immunity impacts on the load of Mycobacterium tuberculosis (M.tb). Because concomitants of local Th1 immunity are still under-explored in humans, we characterized immune responses in bronchoalveolar cells (BACs) and systemically in peripheral blood mononuclear cells (PBMCs) in persons with active pulmonary TB and in healthy community controls. PPD- and live M.tb-induced IFN-gamma-production were observed in CD4(+), CD8(+), gammadeltaTCR(+), and CD56(+) alveolar T cell subpopulations and NK cells (CD3(-)CD56(+)). IFN-gamma-producing CD4(+) T cells (mostly CD45RO(+)) were more abundant (p<0.05). M.tb-induced IL-12p70, but interestingly also IL-4, was increased (p<0.05) in BACs from TB patients. Constitutive expression of IL-12Rbeta1 and IL-12Rbeta2 mRNA in BACs and PBMCs and IFN-gammaR1 in BACs was similar in both study groups. Data were normalized to account for differences in proportions of alveolar T cells and macrophages in the study groups. IFN-gamma-production and its induction by IL-12R engagement occur virtually unimpaired in the bronchoalveolar spaces of patients with pulmonary TB. The reasons for the apparent failure to control M. tuberculosis growth during active pulmonary TB disease is unknown but could be the expression of locally acting immunosuppressive mechanisms that subvert the antimycobacterial effects of IFN-gamma.

IFN-gamma induction by SCG, 1,3-beta-D-glucan from Sparassis crispa, in DBA/2 mice in vitro.

PubMed

Harada, Toshie; Miura, Noriko N; Adachi, Yoshiyuki; Nakajima, Mitsuhiro; Yadomae, Toshiro; Ohno, Naohito

2002-12-01

Sparassis crispa Fr. in an edible mushroom recently cultivable in Japan. A branched beta-glucan from S. crispa (SCG) is a major 6-branched 1,3-beta-D-glucan showing antitumor activity. In this study, we examined interferon-gamma (IFN-gamma) induction by SCG from splenocytes in DBA/2 mice in vitro. In the splenocytes derived from almost all inbred strains of mice except for DBA/1 and DBA/2 mice, IFN-gamma production was not induced by SCG. The breeder and genders of DBA/2 mice showed no influence on IFN-gamma induction by SCG. On the other hand, the magnitude of IFN-gamma induction was lower in young mice than in their older counterparts. IFN-gamma was induced by SCG in adherent splenocytes, but IFN-gamma production was most significantly increased by SCG in instances involving coexistence of adherent and nonadherent splenocytes. In fact, inhibition of cell-cell contact reduced IFN-gamma induction by SCG. In addition, interleukin-12 p70 (IL-12p70) was induced by SCG in DBA/2 mice. It was suggested that soluble factors and cell-cell contact mediate synergistic effects on SCG-induced IFN-gamma production.

Distinct regulatory functions of SLP-76 and MIST in NK cell cytotoxicity and IFN-gamma production.

PubMed

Hidano, Shinya; Sasanuma, Hiroki; Ohshima, Keiko; Seino, Ken-ichiro; Kumar, Lalit; Hayashi, Katsuhiko; Hikida, Masaki; Kurosaki, Tomohiro; Taniguchi, Masaru; Geha, Raif S; Kitamura, Daisuke; Goitsuka, Ryo

2008-03-01

Activation of NK cells is triggered by multiple receptors. We demonstrate here that SLP-76 is required for CD16- and NKG2D-mediated NK cell cytotoxicity, while MIST negatively regulates these responses in an SLP-76-dependent manner. Exceptionally, MIST acts as a positive regulator of cytotoxicity against YAC-1 cells, although SLP-76 plays a more key role. SLP-76 acts as a dominant positive regulator for both NKG2D-mediated and YAC-1 cell-triggered IFN-gamma production. Although NKG2D-mediated IFN-gamma production depends on phospholipase C (PLC) gamma 2, YAC-1 cell-triggered IFN-gamma production is PLC gamma 2- and Syk/ZAP-70 independent and nuclear factor-kappa B mediated. SLP-76 is required for this process in the presence of MIST but is dispensable in the absence of MIST. Thus, YAC-1 cell-triggered NKG2D-independent IFN-gamma production appears to be regulated by SLP-76-dependent and -independent pathways, in which the latter is negatively regulated by MIST. Taken together, these results suggest that SLP-76 and MIST distinctly but interactively regulate NK cell cytotoxicity and IFN-gamma production.

Reversion and conversion of Mycobacterium tuberculosis IFN-gamma ELISpot results during anti-tuberculous treatment in HIV-infected children.

PubMed

Connell, Tom G; Davies, Mary-Ann; Johannisen, Christine; Wood, Kathryn; Pienaar, Sandy; Wilkinson, Katalin A; Wilkinson, Robert J; Zar, Heather J; Beatty, David; Nicol, Mark P; Curtis, Nigel; Eley, Brian

2010-05-27

Recent interest has focused on the potential use of serial interferon gamma (IFN-gamma) release assay (IGRA) measurements to assess the response to anti-tuberculous (TB) treatment. The kinetics of IFN-gamma responses to Mycobacterium tuberculosis (MTB) antigens in HIV-infected children during treatment have not however been previously investigated. IFN-gamma responses to the MTB antigens, ESAT-6, CFP-10 and PPD were measured by an enzyme-linked immunospot assay (IFN-gamma ELISpot) at presentation and at one, two and six months after starting anti-tuberculous treatment in HIV-infected children with definite or probable TB. Responses at different time points were compared using a Mann-Whitney U test with paired data analysed using the Wilcoxon signed rank test. A Fisher's exact or Chi-squared test was used to compare proportions when test results were analysed as dichotomous outcomes. Of 102 children with suspected TB, 22 (21%) had definite TB and 24 (23%) probable TB. At least one follow up IFN-gamma ELISpot assay result was available for 31 (67%) of the 46 children. In children with definite or probable TB in whom the IFN-gamma ELISpot assay result was positive at presentation, anti-tuberculous treatment was accompanied by a significant decrease in both the magnitude of the IFN-gamma response to individual or combined MTB-specific antigens (ESAT-6 median 110 SFCs/106 PBMC (IQR 65-305) at presentation vs. 15 (10-115) at six months, p = 0.04; CFP-10 177 (48-508) vs. 20 (5-165), p = 0.004, ESAT-6 or CFP-10 median 250 SFCs/106 PBMC (IQR 94-508) vs. 25 (10-165), p = 0.004) and in the proportion of children with a positive IFN-gamma ELISpot assay (Fisher's exact test: ESAT-6 15/0 vs 5/11, p = 0.0002, CFP-10 22/0 vs 8/17, p = 0.0001, ESAT-6 or CFP-10 22/0 vs. 9/17, p= 0.002). However almost half of the children had a positive IFN-gamma ELISpot assay after six months of anti-tuberculous treatment. In addition, there was conversion of the IFN-gamma ELISpot assay result

IL-4 inhibits the synthesis of IFN-gamma and induces the synthesis of IgE in human mixed lymphocyte cultures.

PubMed

Vercelli, D; Jabara, H H; Lauener, R P; Geha, R S

1990-01-15

The T cell-derived lymphokine IL-4 is essential for the induction of IgE synthesis by human lymphocytes. The IgE-inducing effect of IL-4 is antagonized by IFN-gamma. The secretion of IFN-gamma is vigorously triggered in MLC. Thus, IL-4-stimulated MLC represent a suitable model to characterize the functional antagonism between IL-4 and IFN-gamma. In this report, we show that rIL-4 consistently induced IgE synthesis when added to human primary MLC. IL-4-dependent IgE production required cognate T/B cell recognition, because it was inhibited by antibodies to CD3 and MHC class II (HlA-DR) Ag. A neutralizing anti-IFN-gamma mAb dramatically enhanced IL-4-dependent IgE synthesis by MLC, indicating that endogenous IFN-gamma is a major inhibitor of IgE production. More importantly, addition of rIL-4 markedly inhibited the release of IFN-gamma in supernatants of MLC and Con A-activated PBMC. The decrease in IFN-gamma protein was accompanied by a decreased expression of IFN-gamma mRNA transcripts. The downregulation of IFN-gamma by IL-4 is likely to play an important role in the IL-4-dependent induction of IgE synthesis.

Chlamydia muridarum evades growth restriction by the IFN-gamma-inducible host resistance factor Irgb10.

PubMed

Coers, Jörn; Bernstein-Hanley, Isaac; Grotsky, David; Parvanova, Iana; Howard, Jonathan C; Taylor, Gregory A; Dietrich, William F; Starnbach, Michael N

2008-05-01

Chlamydiae are obligate intracellular bacterial pathogens that exhibit a broad range of host tropism. Differences in host tropism between Chlamydia species have been linked to host variations in IFN-gamma-mediated immune responses. In mouse cells, IFN-gamma can effectively restrict growth of the human pathogen Chlamydia trachomatis but fails to control growth of the closely related mouse pathogen Chlamydia muridarum. The ability of mouse cells to resist C. trachomatis replication is largely dependent on the induction of a family of IFN-gamma-inducible GTPases called immunity-related GTPases or IRGs. In this study we demonstrate that C. muridarum can specifically evade IRG-mediated host resistance. It has previously been suggested that C. muridarum inactivates the IRG protein Irga6 (Iigp1) to dampen the murine immune response. However, we show that Irga6 is dispensable for the control of C. trachomatis replication. Instead, an effective IFN-gamma response to C. trachomatis requires the IRG proteins Irgm1 (Lrg47), Irgm3 (Igtp), and Irgb10. Ectopic expression of Irgb10 in the absence of IFN-gamma is sufficient to reduce intracellular growth of C. trachomatis but fails to restrict growth of C. muridarum, indicating that C. muridarum can specifically evade Irgb10-driven host responses. Importantly, we find that Irgb10 protein intimately associates with inclusions harboring C. trachomatis but is absent from inclusions formed by C. muridarum. These data suggest that C. muridarum has evolved a mechanism to escape the murine IFN-gamma response by restricting access of Irgb10 and possibly other IRG proteins to the inclusion.

Pregnancy IFN-gamma responses to foetal alloantigens are altered by maternal allergy and gravidity status.

PubMed

Breckler, L A; Hale, J; Taylor, A; Dunstan, J A; Thornton, C A; Prescott, S L

2008-11-01

During pregnancy, variations in maternal-foetal cellular interactions may influence immune programming. This study was carried out to determine if maternal responses to foetal alloantigens are altered by maternal allergic disease and/or previous pregnancies. For this cohort study, peripheral blood was collected from allergic (n = 69) and nonallergic (n = 63) pregnant women at 20, 30, 36-week gestation and 6-week postpartum (pp). Cord blood was collected at delivery. Mixed lymphocyte reactions were used to measure maternal cytokine responses [interleukin-6 (IL-6), IL-10, IL-13 and (interferon-gamma) IFN-gamma] at each time point towards foetal mononuclear cells. Maternal cytokine responses during pregnancy (20, 30 and 36 weeks) were suppressed compared to the responses at 6-week pp. The ratio of maternal IFN-gamma/IL-13 and IFN-gamma/IL-10 responses were lower during pregnancy. Allergic mothers had lower IFN-gamma responses at each time-point during pregnancy with the greatest difference in responses observed at 36-week gestation. When allergic and nonallergic women were further stratified by gravidity group, IFN-gamma responses of allergic multigravid mothers were significantly lower than nonallergic multigravid mothers during pregnancy. During normal pregnancy, peripheral T-cell cytokine responses to foetal alloantigens may be altered by both allergic status of the mother and previous pregnancies. These factors could influence the cytokine milieu experienced by the foetus and will be further explored in the development of allergic disease during early life.

Plant protein hydrolysates support CHO-320 cells proliferation and recombinant IFN-gamma production in suspension and inside microcarriers in protein-free media.

PubMed

Ballez, J S; Mols, J; Burteau, C; Agathos, S N; Schneider, Y J

2004-03-01

We have recently developed a protein-free medium (PFS) able to support the growth of Chinese hamster ovary (CHO) cells in suspension. Upon further supplementation with some plant protein hydrolysates, medium performances reached what could be observed in serum-containing media [Burteau et al. In Vitro Cell. Dev. Biol.-Anim. 39 (2003) 291]. Now, we describe the use of rice and wheat protein hydrolysates, as non-nutritional additives to the culture medium to support productivity and cell growth in suspension or in microcarriers. When CHO-320 cells secreting recombinant interferon-gamma (IFN-gamma) were cultivated in suspension in a bioreactor with our PFS supplemented with wheat hydrolysates, the maximum cell density increased by 25% and the IFN-gamma secretion by 60% compared to the control PFS. A small-scale perfusion system consisting of CHO-320 cells growing on and inside fibrous microcarriers under discontinuous operation was first developed. Under these conditions, rice protein hydrolysates stimulated recombinant IFN-gamma secretion by 30% compared to the control PFS. At the bioreactorscale, similar results were obtained but when compared to shake-flasks studies, nutrients, oxygen or toxic by-products gradients inside the microcarriers seemed to be the main limitation of the system. An increase of the perfusion rate to maintain glucose concentration over 5.5 mM and dissolved oxygen (DO) at 60% was able to stimulate the production of IFN-gamma to a level of 6.6 mug h(-1) g(-1) of microcarriers after 160 h when a cellular density of about 4 x 10(8) cell g(-1) of carriers was reached.

Continuous in vivo infusion of interferon-gamma (IFN-gamma) enhances engraftment of syngeneic wild-type cells in Fanca-/- and Fancg-/- mice.

PubMed

Si, Yue; Ciccone, Samantha; Yang, Feng-Chun; Yuan, Jin; Zeng, Daisy; Chen, Shi; van de Vrugt, Henri J; Critser, John; Arwert, Fre; Haneline, Laura S; Clapp, D Wade

2006-12-15

Fanconi anemia (FA) is a heterogeneous genetic disorder characterized by bone marrow (BM) failure and cancer susceptibility. Identification of the cDNAs of FA complementation types allows the potential of using gene transfer technology to introduce functional cDNAs as transgenes into autologous stem cells and provide a cure for the BM failure in FA patients. However, strategies to enhance the mobilization, transduction, and engraftment of exogenous stem cells are required to optimize efficacy prior to widespread clinical use. Hypersensitivity of Fancc-/- cells to interferon-gamma (IFN-gamma), a nongenotoxic immune-regulatory cytokine, enhances engraftment of syngeneic wild-type (WT) cells in Fancc-/- mice. However, whether this phenotype is of broad relevance in other FA complementation groups is unresolved. Here we show that primitive and mature myeloid progenitors in Fanca-/- and Fancg-/- mice are hypersensitive to IFN-gamma and that in vivo infusion of IFN-gamma at clinically relevant concentrations was sufficient to allow consistent long-term engraftment of isogenic WT repopulating stem cells. Given that FANCA, FANCC, and FANCG complementation groups account for more than 90% of all FA patients, these data provide evidence that IFN-gamma conditioning may be a useful nongenotoxic strategy for myelopreparation in FA patients.

Increased IFN-gamma production by NK and CD3+/CD56+ cells in sexually HIV-1-exposed but uninfected individuals.

PubMed

Montoya, Carlos Julio; Velilla, Paula Andrea; Chougnet, Claire; Landay, Alan L; Rugeles, Maria Teresa

2006-08-01

The mechanisms involved in controlling the establishment of HIV-1 infection are not fully understood. In particular, the role of innate immunity in natural resistance exhibited by individuals who are continuously exposed to HIV-1 but remain seronegative (ESN) has not been thoroughly evaluated. We determined the frequency and function of peripheral blood innate immune cells (plasmacytoid and myeloid dendritic cells, monocytes, NK cells, CD3+/CD56+ cells and invariant NKT cells) in ESN, chronically HIV-1-infected and low-risk HIV-1 seronegative individuals. ESN demonstrated a similar frequency of innate immune cells in comparison to controls and a higher frequency of dendritic cells, NK and invariant NKT cells compared to HIV-1-infected subjects. Incubation of mononuclear cells with stimulatory CpG ODN induced CD86 and CD69 up-regulation to a similar degree on innate cells from the three study groups. CpG ODN-stimulated secretion of cytokines was also similar between ESN and controls, while secretion of IFN-alpha was significantly decreased in HIV-1+ individuals. Importantly, expression of IFN-gamma by PMA/Ionomycin-activated CD56(bright) NK cells and CD3+/CD56+ cells was significantly higher in ESN when compared with controls. The anti-viral effects of IFN-gamma are well established, and so our results suggest that IFN-gamma production by innate immune cells might be one of the multiple factors involved in controlling the establishment of sexually transmitted HIV-1 infection.

Alternative mechanism by which IFN-gamma enhances tumor recognition: active release of heat shock protein 72.

PubMed

Bausero, Maria A; Gastpar, Robert; Multhoff, Gabriele; Asea, Alexzander

2005-09-01

IFN-gamma exhibits differential effects depending on the target and can induce cellular activation and enhance survival or mediate cell death via activation of apoptotic pathways. In this study, we demonstrate an alternative mechanism by which IFN-gamma enhances tumor recognition, mediated by the active release of Hsp72. We demonstrate that stimulation of 4T1 breast adenocarcinoma cells and K562 erythroleukemic cells with IFN-gamma triggers the cellular stress response, which results in the enhanced expression of total Hsp72 expression without a significant increase in cell death. Intracellular expression of Hsp72 was abrogated in cells stably transfected with a mutant hsf-1 gene. IFN-gamma-induced Hsp72 expression correlated with enhanced surface expression and consequent release of Hsp72 into the culture medium. Pretreatment of tumors with compounds known to the block the classical protein transport pathway, including monensin, brefeldin A, tunicamycin, and thapsigargin, did not significantly block Hsp72 release. However, pretreatment with intracellular calcium chelator BAPTA-AM or disruption of lipid rafts using methyl beta-cyclodextrin completely abrogated IFN-gamma-induced Hsp72 release. Biochemical characterization revealed that Hsp72 is released within exosomes and has the ability to up-regulate CD83 expression and stimulate IL-12 release by naive dendritic cells. Pretreatment with neutralizing mAb or depletion of Hsp72 completely abrogated its chaperokine function. Taken together, these findings are indicative of an additional previously unknown mechanism by which IFN-gamma promotes tumor surveillance and furthers our understanding of the central role of extracellular Hsp72 as an endogenous adjuvant and danger signal.

Requirement for IFN-gamma in IL-12 production induced by collaboration between v(alpha)14(+) NKT cells and antigen-presenting cells.

PubMed

Yang, Y F; Tomura, M; Ono, S; Hamaoka, T; Fujiwara, H

2000-12-01

Two cytokines IL-4 and IL-12 are known to determine the balance between T(h)1 and T(h)2 development. In addition to IL-4 production of V(alpha)14(+) NKT cells, they have recently been demonstrated to have the capacity to stimulate IL-12 production by antigen-presenting cells (APC). This study demonstrates that IFN-gamma is absolutely required for the NKT cell-stimulated IL-12 production. Culture of B cell-depleted spleen cells from C57BL/6 mice with alpha-galactosylceramide (alpha-GalCer) capable of selectively stimulating V(alpha)14/J(alpha)281(+) NKT cells resulted in the production of IL-12 together with IL-4. Whereas IL-4 production occurred in culture of IFN-gamma(-/-) C57BL/6 splenocytes, the same culture failed to generate IL-12 production. While IL-12 production induced during culture of V(alpha)14(+) NKT cells and APC depended on the interaction between CD40 ligand on NKT cells and CD40 on APC, the expression levels of these key molecules were comparable in cells from wild-type and IFN-gamma(-/-) mice. Addition of rIFN-gamma to alpha-GalCer stimulated IFN-gamma(-/-) splenocyte culture, and administration of rIFN-gamma to alpha-GalCer-injected IFN-gamma(-/-) mice resulted in the restoration of IL-12 production in vitro and in vivo. These results illustrate a mandatory role for IFN-gamma in V(alpha)14(+) NKT cell-stimulated IL-12 production by APC.

IFN-gamma synergizes with LPS to induce nitric oxide biosynthesis through glycogen synthase kinase-3-inhibited IL-10.

PubMed

Lin, Chiou-Feng; Tsai, Cheng-Chieh; Huang, Wei-Ching; Wang, Chi-Yun; Tseng, Hsiang-Chi; Wang, Yi; Kai, Jui-In; Wang, Szu-Wen; Cheng, Yi-Lin

2008-10-15

Interferon-gamma (IFN-gamma) plays a crucial role in innate immunity and inflammation. It causes the synergistic effect on endotoxin lipopolysaccharide (LPS)-stimulated inducible nitric oxide synthase (iNOS)/NO biosynthesis; however, the mechanism remains unclear. In the present study, we investigated the effects of glycogen synthase kinase-3 (GSK-3)-mediated inhibition of anti-inflammatory interleukin-10 (IL-10). We found, in LPS-stimulated macrophages, that IFN-gamma increased iNOS expression and NO production in a time-dependent manner. In addition, ELISA analysis showed the upregulation of tumor necrosis factor-alpha and regulated on activation, normal T expressed and secreted, and the downregulation of IL-10. RT-PCR further showed changes in the IL-10 mRNA level as well. Treating cells with recombinant IL-10 showed a decrease in IFN-gamma/LPS-induced iNOS/NO biosynthesis, whereas anti-IL-10 neutralizing antibodies enhanced this effect, suggesting that IL-10 acts in an anti-inflammatory role. GSK-3-inhibitor treatment blocked IFN-gamma/LPS-induced iNOS/NO biosynthesis but upregulated IL-10 production. Inhibiting GSK-3 using short-interference RNA showed similar results. Additionally, treating cells with anti-IL-10 neutralizing antibodies blocked these effects. We further showed that inhibiting GSK-3 increased phosphorylation of transcription factor cyclic AMP response element binding protein. Inhibiting protein tyrosine kinase Pyk2, an upstream regulator of GSK-3beta, caused inhibition on IFN-gamma/LPS-induced GSK-3beta phosphorylation at tyrosine 216 and iNOS/NO biosynthesis. Taken together, these findings reveal the involvement of GSK-3-inhibited IL-10 on the induction of iNOS/NO biosynthesis by IFN-gamma synergized with LPS. (c) 2008 Wiley-Liss, Inc.

Inter-operator variation in ELISPOT analysis of measles virus-specific IFN-gamma-secreting T cells.

PubMed

Ryan, J E; Ovsyannikova, I G; Dhiman, N; Pinsky, N A; Vierkant, R A; Jacobson, R M; Poland, G A

2005-01-01

The ELISPOT assay is a highly sensitive technique used for the detection of individual cytokine releasing cells. We have developed an IFN-gamma ELISPOT assay utilizing unfractionated frozen peripheral blood mononuclear cells (PBMC) to quantify the frequency of measles virus (MV)-specific IFN-gamma-secreting T cells in 117 healthy children who had been previously immunized with two doses of the measles-mumps-rubella vaccine. We have also estimated the variability associated with the quantification of ELISPOT plates and compared the number of MV-specific IFN-gamma-secreting T cells for each subject as determined by two different operators of an ELISPOT reader. The median frequency of MV-specific IFN-gamma-producing memory T cells detected by this assay was 0.005 % and 0.01 % as determined by an in-house and commercial operator, respectively. Although we found a significant correlation (r = 0.83, p<0.0001) between the number of spots counted by the commercial and in-house operators of an ELISPOT reader, the median number of spots counted by the commercial operator was twice the number of spots counted by an in-house operator (p<0.001). This demonstrates the importance of using a common ELISPOT reader and operator, among other parameters, to quantify the number of spots when a large volume of plates are being scanned and analyzed.

LPS induces direct death of IFN-gamma primed murine embryonic hepatocyte, BNL CL2 cells in a TNF-alpha independent manner.

PubMed

So, H S; Jung, B H; Yeum, S S; Park, J S; Kim, M S; Lee, J H; Chung, S Y; Choi, S; Chae, H J; Kim, H R; Ko, C B; Chung, H T; Park, R

2000-11-01

Although it has been well known that the role of LPS on liver damage is mediated through TNF-alpha, the mechanism by which LPS modulates the cytotoxicity of IFN-gamma on hepatocytes has not yet been clearly demonstrated. Here, we demonstrate that IFN-gamma mediated apoptosis in murine embryonic hepatocyte BNL CL2 cells is potentiated by the addition of LPS (0.5 microg/ml). Consistently, LPS markedly increases the catalytic activity of caspase 3-like protease but not caspase 1-like protease in IFN-gamma treated cells. In addition, TNF-alpha alone does not affect cell viability but rather it potentiates the cytotoxic effect of IFN-gamma on BNL CL2 cells. However, the cell viability of IFN-gamma/LPS treated cells is affected by the addition of polymyxin B but not by TNF binding protein I (TNF-BPI). These data suggest that the lipid moiety of LPS may mediate direct cytotoxicity of BNL CL2 cells in a TNF-alpha independent manner.

Alopecia of IFN-gamma knockout mouse as a model for disturbance of the hair cycle: a unique arrest of the hair cycle at the anagen phase accompanied by mitosis.

PubMed

Hirota, Ryuichiro; Tajima, Sadao; Yoneda, Yukio; Tamayama, Takumi; Watanabe, Masahito; Ueda, Kouichi; Kubota, Takahiro; Yoshida, Ryotaro

2002-09-01

Interferon-gamma(-/-) (IFN-gamma(-/-)) and IFN-gamma(+/+) C57BL/6 mice (3 weeks of age) completed the production of morphogenesis-derived hair. Around 6 weeks of age, however, most of the IFN-gamma(-/-) but none of the IFN-gamma(+/+) mice began to lose hairs in the dorsal and occipital areas in the absence of inflammatory reactions, and the alopecia was sustained for at least several 10-week periods of observation. A single subcutaneous injection of IFN-gamma to IFN-gamma(-/-) mice at 3, but not 4, 5, or 8 weeks of age could protect all the mice from alopecia, revealing that the lack of IFN-gamma around 3 weeks of age is directly responsible for the alopecia. Histologic features showed that the hair follicles of the IFN-gamma(+/+) mice passed through the anagen (4-5 weeks of age) and catagen/telogen ( approximately 6 weeks of age) phases, whereas those of IFN-gamma(-/-) mice (5 weeks of age or older) stayed in the anagen phase. TUNEL and bromodeoxyuridine experiments suggested that an arrest with unlimited DNA synthesis of the hair cycle in the anagen phase by the lack of IFN-gamma-dependent apoptosis in the midfollicle region and diffuse shedding of previously formed hair induced alopecia in IFN-gamma(-/-) mice.

Antitumor effect of interleukin (IL)-12 in the absence of endogenous IFN-gamma: a role for intrinsic tumor immunogenicity and IL-15.

PubMed

Gri, Giorgia; Chiodoni, Claudia; Gallo, Elena; Stoppacciaro, Antonella; Liew, Foo Y; Colombo, Mario P

2002-08-01

IFN-gamma knockout mice (GKO) rejected C26 colon carcinoma cells transduced to secrete interleukin(IL)-12 but do not reject similarly transduced TSA mammary adenocarcinoma (C26/12 and TSA/12 cells, respectively). To determine whether such difference could be because of a different tumor response to IFN-gamma, we injected BALB/c mice with TSA, C26, and their IL-12-transduced counterparts rendered unresponsive to IFN-gamma by stable transduction of a dominant negative (DN), truncated IFN-gamma receptor alpha chain. TSA/DN and C26/DN showed the same in vivo growth kinetics as parental cells, whereas coexpression of IL-12 induced rejection independent of tumor-cell responsiveness to IFN-gamma. This suggests that the role of IFN-gamma is primarily in activating the host immune response, which appears to depend on the intrinsic immunogenicity of the target tumor. C26 and TSA share a common tumor-associated antigen, yet C26 cells are more immunogenic than TSA. C26/12 expressed 10-fold higher levels of class I MHC molecules and induced higher CTL activity compared with TSA/12 cells in GKO mice. Moreover, whereas in GKO mice the TSA/12 tumor was associated with a greater number of infiltrating T cells, only those infiltrating C26/12 tumor expressed the activation marker OX40. The search for cytokine(s) that might contribute in determining the different T-cell response to these IL-12-transduced tumors in GKO mice revealed a role of IL-15. In situ hybridization showed IL-15 expression in C26/12 but not in TSA/12 tumors. In addition, injection of GKO mice with soluble IL-15 receptor-alpha to block IL-15 expression prevented rejection of C26/12 cells. Together, the results suggest that in the absence of IFN-gamma, IL-12 can exert antitumor activity through alternative mechanisms, depending on the tumor cell type and the availability of cytokines that can replace IFN-gamma in sustaining T-cell functions.

CCR6 and NK1.1 distinguish between IL-17A and IFN-gamma-producing gammadelta effector T cells.

PubMed

Haas, Jan D; González, Frano H Malinarich; Schmitz, Susanne; Chennupati, Vijaykumar; Föhse, Lisa; Kremmer, Elisabeth; Förster, Reinhold; Prinz, Immo

2009-12-01

Gammadelta T cells are a potent source of innate IL-17A and IFN-gamma, and they acquire the capacity to produce these cytokines within the thymus. However, the precise stages and required signals that guide this differentiation are unclear. Here we show that the CD24(low) CD44(high) effector gammadelta T cells of the adult thymus are segregated into two lineages by the mutually exclusive expression of CCR6 and NK1.1. Only CCR6+ gammadelta T cells produced IL-17A, while NK1.1+ gammadelta T cells were efficient producers of IFN-gamma but not of IL-17A. Their effector phenotype correlated with loss of CCR9 expression, particularly among the NK1.1+ gammadelta T cells. Accordingly, both gammadelta T-cell subsets were rare in gut-associated lymphoid tissues, but abundant in peripheral lymphoid tissues. There, they provided IL-17A and IFN-gamma in response to TCR-specific and TCR-independent stimuli. IL-12 and IL-18 induced IFN-gamma and IL-23 induced IL-17A production by NK1.1+ or CCR6+ gammadelta T cells, respectively. Importantly, we show that CCR6+ gammadelta T cells are more responsive to TCR stimulation than their NK1.1+ counterparts. In conclusion, our findings support the hypothesis that CCR6+ IL-17A-producing gammadelta T cells derive from less TCR-dependent selection events than IFN-gamma-producing NK1.1+ gammadelta T cells.

CpG-B Oligodeoxynucleotides Inhibit TLR-Dependent and -Independent Induction of Type I IFN in Dendritic Cells

PubMed Central

Liu, Yi C.; Gray, Reginald C.; Hardy, Gareth A. D.; Kuchtey, John; Abbott, Derek W.; Emancipator, Steven N.; Harding, Clifford V.

2010-01-01

CpG oligodeoxynucleotides (ODNs) signal through TLR9 to induce type I IFN (IFN-αβ) in dendritic cells (DCs). CpG-A ODNs are more efficacious than CpG-B ODNs for induction of IFN-αβ. Because IFN-αβ may contribute to autoimmunity, it is important to identify mechanisms to inhibit induction of IFN-αβ. In our studies, CpG-B ODN inhibited induction of IFN-αβ by CpG-A ODN, whereas induction of TNF-α and IL-12p40 by CpG-A ODN was not affected. CpG-B inhibition of IFN-αβ was observed in FLT3 ligand-induced murine DCs, purified murine myeloid DCs, plasmacytoid DCs, and human PBMCs. CpG-B ODN inhibited induction of IFN-αβ by agonists of multiple receptors, including MyD88-dependent TLRs (CpG-AODN signaling via TLR9, or R837 or Sendai virus signaling via TLR7) and MyD88-independent receptors (polyinosinic:polycytidylic acid signaling via TLR3 or ds break-DNA signaling via a cytosolic pathway). CpG-B ODN did not inhibit the IFN-αβ positive feedback loop second-wave IFN-αβ, because IFN-αβ–induced expression of IFN-αβ was unaffected, and CpG-B inhibition of IFN-αβ was manifested in IFN-αβR−/− DCs, which lack the positive feedback mechanism. Rather, CpG-B ODN inhibited early TLR-induced first wave IFN-α4 and IFN-β. Chromatin immunoprecipitation revealed that association of IFN regulatory factor 1 with the IFN-α4 and IFN-β promoters was induced by CpG-A ODN but not CpG-B ODN. Moreover, CpG-A–induced association of IFN regulatory factor 1 with these promoters was inhibited by CpG-B ODN. Our studies demonstrate a novel mechanism of transcriptional regulation of first-wave IFN-αβ that selectively inhibits induction of IFN-αβ downstream of multiple receptors and may provide targets for future therapeutic inhibition of IFN-αβ expression in vivo. PMID:20181884

Murine J774 Macrophages Recognize LPS/IFN-g, Non-CpG DNA or Two-CpG DNA-containing Sequences as Immunologically Distinct

PubMed Central

Crosby, Lynn; Casey, Warren; Morgan, Kevin; Ni, Hong; Yoon, Lawrence; Easton, Marilyn; Misukonis, Mary; Burleson, Gary; Ghosh, Dipak K.

2010-01-01

Specific bacterial lipopolysaccharides (LPS), IFN-γ, and unmethylated cytosine or guanosine-phosphorothioate containing DNAs (CpG) activate host immunity, influencing infectious responses. Macrophages detect, inactivate and destroy infectious particles, and synthetic CpG sequences invoke similar responses of the innate immune system. Previously, murine macrophage J774 cells treated with CpG induced the expression of nitric oxide synthase 2 (NOS2) and cyclo-oxygenase 2 (COX2) mRNA and protein. In this study murine J774 macrophages were exposed to vehicle, interferon γ + lipopolysaccharide (IFN-g/LPS), non-CpG (SAK1), or two-CpG sequence-containing DNA (SAK2) for 0–18 hr and gene expression changes measured. A large number of immunostimulatory and inflammatory changes were observed. SAK2 was a stronger activator of TNFα- and chemokine expression-related changes than LPS/IFN-g. Up regulation included tumor necrosis factor receptor superfamily genes (TNFRSF’s), IL-1 receptor signaling via stress-activated protein kinase (SAPK), NF-κB activation, hemopoietic maturation factors and sonic hedgehog/wingless integration site (SHH/Wnt) pathway genes. Genes of the TGF-β pathway were down regulated. In contrast, LPS/IFN-g -treated cells showed increased levels for TGF-β signaling genes, which may be linked to the observed up regulation of numerous collagens and down regulation of Wnt pathway genes. SAK1 produced distinct changes from LPS/IFN-g or SAK2. Therefore, J774 macrophages recognize LPS/IFN-g, non-CpG DNA or two-CpG DNA-containing sequences as immunologically distinct. PMID:20097302

Evidence for a gamma-interferon receptor that regulates macrophage tumoricidal activity

PubMed Central

1984-01-01

Gamma-interferon (IFN-gamma) is the macrophage-activating factor (MAF) produced by normal murine splenic cells and the murine T cell hybridoma 24/G1 that induces nonspecific tumoricidal activity in macrophages. Incubation of 24/G1 supernatants diluted to 8.3 IRU IFN-gamma/ml with 6 X 10(6) elicited peritoneal macrophages or bone marrow-derived macrophages for 4 h at 37 degrees C, resulted in removal of 80% of the MAF activity from the lymphokine preparation. Loss of activity appeared to result from absorption and not consumption because (a) 40% of the activity was removed after exposure to macrophage for 30 min at 4 degrees C, (b) no reduction of MAF activity was detected when the 24/G1 supernatant was incubated with macrophage culture supernatants, and (c) macrophage-treated supernatants showed a selective loss of MAF activity but not interleukin 2 (IL-2) activity. Absorption was dependent on the input of either IFN-gamma or macrophages and was time dependent at 37 degrees C but not at 4 degrees C. With four rodent species tested, absorption of murine IFN-gamma displayed species specificity. However, cultured human peripheral blood monocytes and the human histiocytic lymphoma cell line U937 were able to absorb the murine lymphokine. Although the majority of murine cell lines tested absorbed 24/G1 MAF activity, two murine macrophage cell lines, P388D1 and J774, were identified which absorbed significantly reduced amounts of natural IFN- gamma. Purified murine recombinant IFN-gamma was absorbed by elicited macrophages but not by P388D1. Normal macrophages but not P388D1 bound fluoresceinated microspheres coated with recombinant IFN-gamma and binding was inhibited by pretreatment of the normal cells with 24/G1 supernatants. Scatchard plot analysis showed that 12,000 molecules of soluble 125I-recombinant IFN-gamma bound per bone marrow macrophage with a Ka of 0.9 X 10(8) M-1. Binding was quantitatively inhibitable by natural IFN-gamma but not by murine IFN alpha. IFN

Renal ischemia-reperfusion injury and adenosine 2A receptor-mediated tissue protection: the role of CD4+ T cells and IFN-gamma.

PubMed

Day, Yuan-Ji; Huang, Liping; Ye, Hong; Li, Li; Linden, Joel; Okusa, Mark D

2006-03-01

A(2A) adenosine receptor (A(2A)R)-expressing bone marrow (BM)-derived cells contribute to the renal protective effect of A(2A) agonists in renal ischemia-reperfusion injury (IRI). We performed IRI in mice lacking T and B cells to determine whether A(2A)R expressed in CD4+ cells mediate protection from IRI. Rag-1 knockout (KO) mice were protected in comparison to wild-type (WT) mice when subjected to IRI. ATL146e, a selective A(2A) agonist, did not confer additional protection. IFN-gamma is an important early signal in IRI and is thought to contribute to reperfusion injury. Because IFN-gamma is produced by kidney cells and T cells we performed IRI in BM chimeras in which the BM of WT mice was reconstituted with BM from IFN-gamma KO mice (IFN-gamma KO-->WT chimera). We observed marked reduction in IRI in comparison to WT-->WT chimeras providing additional indirect support for the role of T cells. To confirm the role of CD4+ A(2A)R in mediating protection from IRI, Rag-1 KO mice were subjected to ischemia-reperfusion. The protection observed in Rag-1 KO mice was reversed in Rag-1 KO mice that were adoptively transferred WT CD4+ cells (WT CD4+-->Rag-1 KO) or A(2A) KO CD4+ cells (A(2A) KO CD4+-->Rag-1 KO). ATL146e reduced injury in WT CD4+-->Rag-1 KO mice but not in A(2A) KO CD4+-->Rag-1 KO mice. Rag-1 KO mice reconstituted with CD4+ cells derived from IFN-gamma KO mice (IFN-gamma CD4+-->Rag-1 KO) were protected from IRI; ATL146e conferred no additional protection. These studies demonstrate that CD4+ IFN-gamma contributes to IRI and that A(2A) agonists mediate protection from IRI through action on CD4+ cells.

Differential effects of LPS, IFN-gamma and TNF alpha on the secretion of lysozyme by individual human mononuclear phagocytes: relationship to cell maturity.

PubMed Central

Lewis, C E; McCarthy, S P; Lorenzen, J; McGee, J O

1990-01-01

Human mononuclear phagocytes can be activated to perform a variety of complex functions by exposure to the immunomodulators, lipopolysaccharide (LPS), interferon-gamma (IFN-gamma) and tumour necrosis factor alpha (TNF alpha). Although such activation often involves the release of various cytokines by monocytes and macrophages, little is known of the effects of such signals on their secretion of lysozyme (LZM). In this study, a reverse haemolytic plaque assay for LZM secretion is coupled with immunocytochemistry for the pan macrophage (CD68) marker, EBM/11. This enabled the direct effects of LPS, IFN-gamma and TNF alpha on the secretion of LZM by individual, immunoidentified human mononuclear phagocytes to be investigated. The overall secretion of this peptide by populations of freshly isolated or 3-day cultured monocytes was augmented by exposure for 6 hr to bacterial LPS, recombinant human IFN-gamma or recombinant human TNF alpha. Extension of the culture period for monocytes from 3 to 7 days prior to use in the assay resulted in higher levels of LZM secretion, which could be further increased by TNF alpha but not by LPS or IFN-gamma. Individual peritoneal macrophages activated by inflammation in vivo were uniform in their augmented LZM responses to TNF alpha, but a small subpopulation of human peritoneal macrophages, which may represent younger 'inflammatory' exudate macrophages, was seen to be preferentially responsive to the LZM-stimulating effects of LPS and IFN-gamma. These studies suggest that (i) secretion of LZM by human mononuclear phagocytes can be regulated by LPS and IFN-gamma, although the effects of these agents may be dependent upon the state of maturation and/or differentiation of the cells, and (ii) TNF alpha is a potent stimulant of LZM secretion by monocytes and macrophages irrespective of cell maturity. Images Figure 1 Figure 1 PMID:2107146

The level of PPD-specific IFN-gamma-producing CD4+ T cells in the blood predicts the in vivo response to PPD.

PubMed

Martins, Marcia Valéria B S; Lima, Mônica Cristina B S; Duppre, Nadia C; Matos, Haroldo J; Spencer, John S; Brennan, Patrick J; Sarno, Euzenir N; Fonseca, Leila; Pereira, Geraldo M B; Pessolani, Maria Cristina V

2007-05-01

There are no reliable means for detecting subclinical mycobacterial infections. The recent sequencing of several mycobacterial genomes has now afforded new opportunities for the development of pathogen-specific diagnostic tests, critical in the context of leprosy and tuberculosis control. In the present study, we applied a multi-parametric flow cytometric analysis that allowed the investigation of T-cell functions in order to define immunological markers that measure previous exposure to mycobacteria. We compared the in vivo response to PPD, the gold standard skin test reagent for measuring previous exposure to Mycobacterium tuberculosis, with in vitro parameters of leukocyte activation in five PPD positive and five PPD negative healthy volunteers. PPD-stimulated peripheral leukocytes expressing CD4, CD69, cutaneous lymphocyte-associated antigen (CLA) and intracellular IFN-gamma were enumerated in whole blood and compared with the size of in vivo PPD-induced induration and IFN-gamma production levels as measured by ELISA in supernatants of PPD-stimulated peripheral blood mononuclear cells. The reactivity to the tuberculin skin test (TST) was associated with markedly increased frequencies of PPD-responsive activated (CD69+) and IFN-gamma-producing CD4+T cells. Detection of PPD-specific IFN-gamma producing leukocytes was restricted to CD4+T cells and a subset of these cells was shown to express the skin homing molecule CLA. Multiple linear regression modeling of responses to PPD showed the highest association between skin test indurations and frequencies of PPD-responsive IFN-gamma-producing CD4+CD69+ T cells. Our data show that the in vitro enumeration of antigen-specific IFN-gamma-producing CD4+ T cells can provide an alternative to the in vivo tuberculin test for the detection of latent Mycobacterium tuberculosis infection. Moreover, the measurement of these immunological parameters can be useful for the screening of new specific antigens defined by the genome

Detection of Mycobacterium bovis infection in African buffaloes (Syncerus caffer) using QuantiFERON®-TB Gold (QFT) tubes and the Qiagen cattletype® IFN-gamma ELISA.

PubMed

Bernitz, Netanya; Clarke, Charlene; Roos, Eduard O; Goosen, Wynand J; Cooper, David; van Helden, Paul D; Parsons, Sven D C; Miller, Michele A

2018-02-01

African buffaloes (Syncerus caffer) are wildlife maintenance hosts of Mycobacterium bovis, the cause of bovine tuberculosis. Consequently, M. bovis infected buffaloes pose a transmission risk for cattle and other wildlife species. Previously, a modification to the Qiagen QuantiFERON ® -TB Gold (QFT) system, using QFT tubes and an in-house bovine interferon-gamma (IFN-γ) ELISA, was evaluated for the detection of M. bovis infection in buffaloes. Subsequently, Qiagen has developed a commercially available cattletype ® IFN-gamma ELISA for the detection of antigen-specific IFN-γ release in ruminants. The aim of this study was to investigate the use of QFT tubes and the cattletype ® IFN-gamma ELISA, in a cattletype IFN-γ release assay (IGRA), to detect M. bovis infection in African buffaloes. The test agreements between the cattletype IGRA, single comparative intradermal skin test (SCITT) and Bovigam ® 1G IGRA in two M. bovis-exposed buffalo populations (n = 134 and n = 92) were calculated and κ coefficients ranged from 0.65 (95% CI 0.48-0.82) to 0.86 (95% CI 0.72-0.99). Increasing the QFT incubation time in one M. bovis-exposed buffalo cohort (n = 92), from 20 to 40 h, had no effect on the cattletype IGRA test results. Inter-assay and intra-assay reproducibility determination for the cattletype IGRA produced coefficient of variations (CV) <9.1% and <1.7%, respectively. A total of 21/21 known M. bovis-unexposed buffaloes tested negative in the cattletype IGRA. Moreover, the cattletype IGRA test result values were significantly greater for 13 M. bovis culture-positive buffaloes compared with 14 M. bovis-exposed culture-negative (P < .01) and 21 M. bovis-unexposed (P < .001) buffaloes, respectively. These findings suggest that the combination of QFT tubes and the cattletype ® IFN-gamma ELISA is a promising new diagnostic assay for the detection of M. bovis infection in African buffaloes. However, further research is needed to evaluate the

Despite Increased Type 1 IFN, Autoimmune Nonobese Diabetic Mice Display Impaired Dendritic Cell Response to CpG and Decreased Nuclear Localization of IFN-Activated STAT1.

PubMed

Rahman, M Jubayer; Rahir, Gwendoline; Dong, Matthew B; Zhao, Yongge; Rodrigues, Kameron B; Hotta-Iwamura, Chie; Chen, Ye; Guerrero, Alan; Tarbell, Kristin V

2016-03-01

Innate immune signals help break self-tolerance to initiate autoimmune diseases such as type 1 diabetes, but innate contributions to subsequent regulation of disease progression are less clear. Most studies have measured in vitro innate responses of GM-CSF dendritic cells (DCs) that are functionally distinct from conventional DCs (cDCs) and do not reflect in vivo DC subsets. To determine whether autoimmune NOD mice have alterations in type 1 IFN innate responsiveness, we compared cDCs from prediabetic NOD and control C57BL/6 (B6) mice stimulated in vivo with the TLR9 ligand CpG, a strong type 1 IFN inducer. In response to CpG, NOD mice produce more type 1 IFN and express higher levels of CD40, and NOD monocyte DCs make more TNF. However, the overall CpG-induced transcriptional response is muted in NOD cDCs. Of relevance the costimulatory proteins CD80/CD86, signals needed for regulatory T cell homeostasis, are upregulated less on NOD cDCs. Interestingly, NOD Rag1(-/-) mice also display a defect in CpG-induced CD86 upregulation compared with B6 Rag1(-/-), indicating this particular innate alteration precedes adaptive autoimmunity. The impaired response in NOD DCs is likely downstream of the IFN-α/β receptor because DCs from NOD and B6 mice show similar CpG-induced CD86 levels when anti-IFN-α/β receptor Ab is added. IFN-α-induced nuclear localization of activated STAT1 is markedly reduced in NOD CD11c(+) cells, consistent with lower type 1 IFN responsiveness. In conclusion, NOD DCs display altered innate responses characterized by enhanced type 1 IFN and activation of monocyte-derived DCs but diminished cDC type 1 IFN response.

Factors affecting induction of peripheral IFN-gamma recall response to influenza A virus vaccination in pigs

USDA-ARS?s Scientific Manuscript database

While T cell contribution to IAV immunity is appreciated, data comparing methods to evaluate IFN-gamma production by IAV-specific T cells elicited following vaccination is limited. To understand the differential immunogenicity between live-attenuated influenza virus (LAIV) and whole-inactivated viru...

Reproducibility of Interferon Gamma (IFN-γ) Release Assays. A Systematic Review

PubMed Central

Tagmouti, Saloua; Slater, Madeline; Benedetti, Andrea; Kik, Sandra V.; Banaei, Niaz; Cattamanchi, Adithya; Metcalfe, John; Dowdy, David; van Zyl Smit, Richard; Dendukuri, Nandini

2014-01-01

Rationale: Interferon gamma (IFN-γ) release assays for latent tuberculosis infection result in a larger-than-expected number of conversions and reversions in occupational screening programs, and reproducibility of test results is a concern. Objectives: Knowledge of the relative contribution and extent of the individual sources of variability (immunological, preanalytical, or analytical) could help optimize testing protocols. Methods: We performed a systematic review of studies published by October 2013 on all potential sources of variability of commercial IFN-γ release assays (QuantiFERON-TB Gold In-Tube and T-SPOT.TB). The included studies assessed test variability under identical conditions and under different conditions (the latter both overall and stratified by individual sources of variability). Linear mixed effects models were used to estimate within-subject SD. Measurements and Main Results: We identified a total of 26 articles, including 7 studies analyzing variability under the same conditions, 10 studies analyzing variability with repeat testing over time under different conditions, and 19 studies reporting individual sources of variability. Most data were on QuantiFERON (only three studies on T-SPOT.TB). A considerable number of conversions and reversions were seen around the manufacturer-recommended cut-point. The estimated range of variability of IFN-γ response in QuantiFERON under identical conditions was ±0.47 IU/ml (coefficient of variation, 13%) and ±0.26 IU/ml (30%) for individuals with an initial IFN-γ response in the borderline range (0.25–0.80 IU/ml). The estimated range of variability in noncontrolled settings was substantially larger (±1.4 IU/ml; 60%). Blood volume inoculated into QuantiFERON tubes and preanalytic delay were identified as key sources of variability. Conclusions: This systematic review shows substantial variability with repeat IFN-γ release assays testing even under identical conditions, suggesting that reversions

SIR2-deficient Leishmania infantum induces a defined IFN-gamma/IL-10 pattern that correlates with protection.

PubMed

Silvestre, Ricardo; Cordeiro-Da-Silva, Anabela; Santarém, Nuno; Vergnes, Baptiste; Sereno, Denis; Ouaissi, Ali

2007-09-01

The ability to manipulate the Leishmania genome to create genetically modified parasites by introducing or eliminating genes is considered a powerful alternative for developing a new generation vaccine against leishmaniasis. Previously, we showed that the deletion of one allele of the Leishmania infantum silent information regulatory 2 (LiSIR2) locus was sufficient to dramatically affect amastigote axenic proliferation. Furthermore, LiSIR2 single knockout (LiSIR2(+/-)) amastigotes were unable to replicate in vitro inside macrophages. Because this L. infantum mutant persisted in BALB/c mice for up to 6 wk but failed to establish an infection, we tested its ability to provide protection toward a virulent L. infantum challenge. Strikingly, vaccination with a single i.p. injection of LiSIR2(+/-) single knockout elicits complete protection. Thus, vaccinated BALB/c mice showed a reversal of T cell anergy with specific anti-Leishmania cytotoxic activity and high levels of NO production. Moreover, vaccinated mice simultaneously generated specific anti-Leishmania IgG Ab subclasses suggestive of both type 1 and type 2 responses. A strong correlation was found between the elimination of the parasites and an increased Leishmania-specific IFN-gamma/IL-10 ratio. Therefore, we propose that the polarization to a high IFN-gamma/low IL-10 ratio after challenge is a clear indicator of vaccine success. Furthermore these mutants, which presented attenuated virulence, represent a good model to understand the correlatives of protection in visceral leishmaniasis.

The immunomodulatory effects of interferon-gamma on mature B-lymphocyte responses.

PubMed

Jurado, A; Carballido, J; Griffel, H; Hochkeppel, H K; Wetzel, G D

1989-06-15

Interferon-gamma (IFN-gamma) exerts a broad spectrum of activities which affect the responses of mature B-cells. It strongly inhibits B-cell activation, acts as a B-cell growth factor (BCGF), and also induces final differentiation to immunoglobulin (Ig) production. IFN-gamma is deeply involved in the differential control of isotype expression, as it enhances IgG2a production and suppresses both IgG1 and IgE production. Although it is now possible to draw a general scheme of the effects of IFN-gamma on B-cells, a number of paradoxical results still exist in the field. In this manuscript, different experimental systems are analyzed in an attempt to explain these apparent paradoxes.

Decreased release of histamine and sulfidoleukotrienes by human peripheral blood leukocytes after wasp venom immunotherapy is partially due to induction of IL-10 and IFN-gamma production of T cells.

PubMed

Pierkes, M; Bellinghausen, I; Hultsch, T; Metz, G; Knop, J; Saloga, J

1999-02-01

Recent studies provide evidence that venom immunotherapy (VIT) alters the pattern of cytokine production by inducing an allergen-specific T-cell shift in cytokine expression from TH2 (IL-4, IL-5) to TH1 (IFN-gamma) cytokines and also inducing the production of IL-10. This study was carried out to analyze whether these changes in cytokine production of T cells already observed 1 week after the initiation of VIT in subjects with wasp venom allergy also influence the reactivity of effector cells, such as mast cells and basophils. All subjects included in this study had a history of severe systemic allergic reactions to wasp stings and positive skin test responses with venom and venom-specific IgE in the sera. Peripheral blood leukocytes were isolated before and after the initiation of VIT (rush therapy reaching a maintenance dose of 100 microg venom injected subcutaneously within 1 week) and preincubated with or without addition of IL-10, IFN-gamma, IL-10 + IFN-gamma, anti-IL-10, or anti-IFN-gamma. After stimulation with wasp venom, histamine and sulfidoleukotriene release were assessed by ELISA and compared with spontaneous release and total histamine content. After the induction of VIT, venom-induced absolute and relative histamine and sulfidoleukotriene release were reduced. This was at least partially due to the induction of IFN-gamma and IL-10 production, because (1) neutralization of IL-10 and IFN-gamma by mAbs partially restored the release after the initiation of VIT and (2) the addition of exogenous IFN-gamma and IL-10 caused a statistically significant diminution of the venom-induced histamine and sulfidoleukotriene release before VIT. Depletion of CD2(+) T cells also restored the releasability after VIT. These data indicate that T cells (producing IL-10 and IFN-gamma after VIT) play a key role for the inhibition of histamine and sulfidoleukotriene release of effector cells.

Interleukin-4 but not gamma interferon production correlates with the severity of murine cutaneous leishmaniasis.

PubMed Central

Morris, L; Troutt, A B; McLeod, K S; Kelso, A; Handman, E; Aebischer, T

1993-01-01

For murine cutaneous leishmaniasis, data to date suggest a correlation between the presence of gamma interferon (IFN-gamma) and resistance in C57BL/6 mice and the presence of interleukin-4 (IL-4) and disease in BALB/c mice. In this study, 13 inbred strains of mice covering the range of susceptibility to disease were infected with Leishmania major to determine whether the subsequent expression of IFN-gamma or IL-4 is a reliable indicator of cure or progressive disease. The presence of IL-4 and IFN-gamma mRNAs in the draining lymph nodes was examined 9 weeks after infection, when differences in disease severity became obvious. There were large differences in the levels of IL-4 mRNA among the different strains, whereas IFN-gamma mRNA was detected at similar levels in all strains. The levels of IL-4 mRNA correlated with lesion score, with susceptible and intermediate strains containing up to 100-fold more than any of the resistant strains. Differences in the levels of IFN-gamma mRNA were within only a fourfold range, with significant overlap among susceptible, intermediate, and resistant strains. Similarly, the levels of IFN-gamma secreted in vitro by lymph node cells from infected mice in response to L. major antigens were within a 10-fold range for most strains, and there was no correlation with lesion score. Analysis of Leishmania-specific antibody levels revealed a correlation between immunoglobulin G1 (IgG1) titers and lesion score, consistent with the role of IL-4 as a switch factor for IgG1. In contrast, there was no correlation between IgG2a titers and lesion score, supporting the notion that IFN-gamma synthesis (which promotes IgG2a production) is not correlated with disease state. These data suggest that along the spectrum of murine cutaneous leishmaniasis, IL-4 is a reliable indicator of disease, but IFN-gamma is not prognostic for resistance. Images PMID:8335376

Interferon-gamma alone triggers the production of nitric oxide from serum-starved BNL CL.2, murine embryonic liver cells.

PubMed

Pae, H O; Yoo, J C; Choi, B M; Paik, S G; Kim, Y H; Jin, H S; Chung, H T

1999-01-01

A previous study has demonstrated that both interferon-gamma (IFN-gamma) and lipopolysaccharide (LPS) were needed to induce the production of nitric oxide (NO) in BNL CL.2 cells, murine embryonic liver cells. We here demonstrate that when BNL CL.2 cells were cultured with serum-free medium, they were induced to produce NO by the stimulation of IFN-gamma alone. BNL CL.2 cells were cultured with serum-free or serum-containing medium for 1-3 days and then stimulated to synthesize NO by IFN-gamma. Surprisingly, only serum-starved cells showed significant amount of nitrite accumulation and iNOS protein expression in response to IFN-gamma in dose- and time-dependent manners, but serum-supplied cells did not. When the cells were stimulated with IFN-gamma, tumor necrosis factor-alpha (TNF-alpha), or LPS in combinations, only the combination of IFN-gamma and LPS produced more NO than that produced by IFN-gamma alone. The production of NO by the cells stimulated with IFN-gamma or IFN-gamma plus LPS was blocked by the addition of N(G)-monomethyl-L-arginine (N(G)MMA), a NO synthesis inhibitor. To address the intracellular signal pathway responsible for the production of NO by the cells stimulated with IFN-gamma aloneor IFN-gamma plus LPS, we examined the effects of several protein kinase inhibitors on the production of NO from the cells. The production of NO was significantly inhibited by protein tyrosine kinase (PTK) inhibitors, genistein and herbimycin A, but not by protein kinase A or C inhibitors. These results suggest that the deprivation of serum from BNL CL.2 cell culture medium might prime the cells to induce NO synthesis when the cells are triggered by IFN-gamma and the involvement of PTK signal transduction pathway in the expression of inducible NO synthase gene in murine hepatoma cells.

Experimental reinfection of BALB/c mice with different recombinant type I/III strains of Toxoplasma gondii: involvement of IFN-gamma and IL-10.

PubMed

Brandão, Geane Peroni; Melo, Maria Norma; Gazzinelli, Ricardo Tostes; Caetano, Braulia Costa; Ferreira, Adriana Melo; Silva, Letícia Azevedo; Vitor, Ricardo Wagner Almeida

2009-03-01

To assess reinfection of BALB/c mice with different Toxoplasma gondii strains, the animals were prime infected with the non-virulent D8 strain and challenged with virulent recombinant strains. Thirty days after challenge, brain cysts were obtained from surviving BALB/c mice and inoculated in Swiss mice to obtain tachyzoites for DNA extraction and PCR-RFLP analysis to distinguish the different T. gondii strains present in possible co-infections. Anti-Toxoplasma immune responses were evaluated in D8-primed BALB/c mice by detecting IFN-gamma and IL-10 produced by T cells and measuring immunoglobulin levels in serum samples. PCR-RFLP demonstrated that BALB/c mice were reinfected with the EGS strain at 45 days post prime infection (dpi) and with the EGS and CH3 strains at 180 dpi. High levels of IFN-gamma were detected after D8 infection, with no significant difference between 45 and 180-day intervals. However, higher IL-10 levels and higher plasmatic IgG1 and IgA were detected from samples obtained 180 days after infection. BALB/c mice were susceptible to reinfection with different recombinant T. gondii strains and this susceptibility correlated with enhancement of IL-10 production.

[Proliferation and IFN-gamma secretion of autologous T lymphocytes stimulated by myeloid leukemia cells induced with rhGM-CSF and rhIL-4].

PubMed

Xie, Yan-Hui; Chen, Qin-Fen; Xie, Yi; Xie, Hong

2002-12-01

To observe the proliferation of T lymphocytes stimulated by CML and AML cells which were induced by rhGM-CSF and rhIL-4, and the secretion of IFN-gamma from proliferated T lymphocytes, the expression of CD80, CD86 and HLA-DR on CML and AML cells induced by GM-CSF and IL-4 was assayed by flow cytometry in vitro. Then one-way mixed lymphocyte reaction was carried out, with induced leukemia cells as stimulating cells and auto-T lymphocytes as reactive cells. The secretion of IFN-gamma from T lymphocytes was determined by double antibody sandwich ELISA. The results showed that GM-CSF and IL-4 significantly upregulated the expression of CD80, CD86 and HLA-DR on CML cells and CD80 and CD86 on AML cells, which could stimulate the T lymphocyte proliferation and high secretion of IFN-gamma (in CML group) of autologous T lymphocytes. It is concluded that the CML and AML cells induced by GM-CSF and IL-4 have the ability to present tumor specific antigen to auto-T lymphocyte.

Association of TNF-alpha (-308 A/G) and IFN-gamma (+874 A/T) gene polymorphisms in response to spontaneous and treatment induced viral clearance in HCV infected multitransfused thalassemic patients.

PubMed

Biswas, Aritra; Gupta, Nabyendu; Gupta, Debanjali; Datta, Abira; Firdaus, Rushna; Chowdhury, Prosanto; Bhattacharyya, Maitreyee; Sadhukhan, Provash C

2018-06-01

Multitransfused thalassemic individuals are at high risk of developing transfusion transmitted Hepatitis C virus (HCV) infection. The aim of the study was to correlate the effects of host cytokine single nucleotide polymorphisms of TNF-α (-308 A/G) and IFN-γ (+874 A/T) in spontaneous or IFN induced treatment response in the HCV infected thalassemic individuals. A total of 427 HCV sero-reactive thalassemic individuals were processed for HCV viral genomic diversity and host gene polymorphisms analysis of TNF-α (-308 A/G) and IFN-γ (+874 A/T). Out of 427 HCV sero-reactive individuals, 69.09% were found to be HCV RNA positive with genotype 3 as the predominant infecting strain (94.29%). Study highlighted that, A allele was significantly associated with (p < .05) spontaneous clearance of HCV infection and G allele was correlated with viral persistence at TNF-α (-308) gene polymorphism. Whereas in case of IFN-γ (+874) SNPs, A allele was significantly responsible (p < .05) for spontaneous clearance than T allele. Our study also indicated that in relapsed cases, IFN-γ (+874) T allele is more responsible than A allele. Though no significant correlation was found at both TNF-α (-308) and IFN-γ (+874) gene polymorphism among SVR and relapsed thalassemic patients. A allele at both TNF-α (-308) and IFN-γ (+874) were strongly associated with spontaneous clearance among this population. But in case of SVR and relapsed cases no significant association was found. This cytokine gene polymorphisms pattern will help clinicians to take an informed decision about therapeutic management of HCV infected thalassemic individuals. Copyright © 2017 Elsevier Ltd. All rights reserved.

Increase in neutrophil Fc gamma receptor I expression following interferon gamma treatment in rheumatoid arthritis.

PubMed Central

Goulding, N J; Knight, S M; Godolphin, J L; Guyre, P M

1992-01-01

The therapeutic potential of interferon gamma (IFN gamma) in a number of disease states is still being explored, but progress is hampered by the lack of a suitable measure of in vivo biological activity. To assess the in vivo biological effects of recombinant human IFN gamma (rhIFN gamma), 14 patients were studied in a randomised, prospective, double blind, placebo controlled trial of this cytokine for the treatment of rheumatoid arthritis. The levels of Fc gamma receptors on peripheral blood neutrophils were measured at baseline and after 21 days of once daily, subcutaneous injections of rhIFN gamma or placebo. An induction of neutrophil Fc gamma receptor type I (Fc gamma RI) was seen in the group of patients receiving recombinant human rhIFN gamma but not in those receiving placebo. No change in the expression of Fc gamma RII or Fc gamma RIII was detected. The amount of induction of Fc gamma RI detected on the neutrophils of patients receiving rhIFN gamma did not correlate with clinical measures of response at either 21 days or at the end of the study (24 weeks). No significant clinical responses were observed in the rhIFN gamma group at these times. These data confirm that the reported in vitro effect of IFN gamma on human neutrophil Fc receptor expression can be reproduced in vivo. PMID:1534001

Increase in neutrophil Fc gamma receptor I expression following interferon gamma treatment in rheumatoid arthritis.

PubMed

Goulding, N J; Knight, S M; Godolphin, J L; Guyre, P M

1992-04-01

The therapeutic potential of interferon gamma (IFN gamma) in a number of disease states is still being explored, but progress is hampered by the lack of a suitable measure of in vivo biological activity. To assess the in vivo biological effects of recombinant human IFN gamma (rhIFN gamma), 14 patients were studied in a randomised, prospective, double blind, placebo controlled trial of this cytokine for the treatment of rheumatoid arthritis. The levels of Fc gamma receptors on peripheral blood neutrophils were measured at baseline and after 21 days of once daily, subcutaneous injections of rhIFN gamma or placebo. An induction of neutrophil Fc gamma receptor type I (Fc gamma RI) was seen in the group of patients receiving recombinant human rhIFN gamma but not in those receiving placebo. No change in the expression of Fc gamma RII or Fc gamma RIII was detected. The amount of induction of Fc gamma RI detected on the neutrophils of patients receiving rhIFN gamma did not correlate with clinical measures of response at either 21 days or at the end of the study (24 weeks). No significant clinical responses were observed in the rhIFN gamma group at these times. These data confirm that the reported in vitro effect of IFN gamma on human neutrophil Fc receptor expression can be reproduced in vivo.

HIV-1 Gag p17 presented as virus-like particles on the E2 scaffold from Geobacillus stearothermophilus induces sustained humoral and cellular immune responses in the absence of IFN{gamma} production by CD4+ T cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Caivano, Antonella; Doria-Rose, Nicole A.; Dept. of Molecular and Cell Biology, University of Washington, Seattle, WA 98124-6108

2010-11-25

We have constructed stable virus-like particles displaying the HIV-1 Gag(p17) protein as an N-terminal fusion with an engineered protein domain from the Geobacillus stearothermophilus pyruvate dehydrogenase subunit E2. Mice immunized with the Gag(p17)-E2 60-mer scaffold particles mounted a strong and sustained antibody response. Antibodies directed to Gag(p17) were boosted significantly with additional immunizations, while anti-E2 responses reached a plateau. The isotype of the induced antibodies was biased towards IgG1, and the E2-primed CD4+ T cells did not secrete IFN{gamma}. Using transgenic mouse model systems, we demonstrated that CD8+ T cells primed with E2 particles were able to exert lytic activitymore » and produce IFN{gamma}. These results show that the E2 scaffold represents a powerful vaccine delivery system for whole antigenic proteins or polyepitope engineered proteins, evoking antibody production and antigen specific CTL activity even in the absence of IFN{gamma}-producing CD4+ T cells.« less

The IFN-gamma +874T/A gene polymorphism is associated with retinochoroiditis toxoplasmosis susceptibility.

PubMed

Albuquerque, Maíra Cavalcanti de; Aleixo, Ana Luisa Quintella do Couto; Benchimol, Eliezer Israel; Leandro, Ana Cristina Câmara S; das Neves, Leandro Batista; Vicente, Regiane Trigueiro; Bonecini-Almeida, Maria da Glória; Amendoeira, Maria Regina Reis

2009-05-01

Toxoplasmosis is a worldwide zoonosis that generally produces an asymptomatic infection. In some cases, however, toxoplasmosis infection can lead to ocular damage. The immune system has a crucial role in both the course of the infection and in the evolution of toxoplasmosis disease. In particular, IFN-gamma plays an important role in resistance to toxoplasmosis. Polymorphisms in genes encoding cytokines have been shown to have an association with susceptibility to parasitic diseases. The aim of this work was to analyse the occurrence of polymorphisms in the gene encoding IFN-gamma (+874T/A) among Toxoplasma gondii seropositive individuals, including those with ocular lesions caused by the parasite, from a rural population of Santa Rita de Cássia, Barra Mansa, state of Rio de Janeiro, Brazil. Further, we verified which of these polymorphisms could be related to susceptibility to the development of ocular toxoplasmosis. This study included 34 individuals with ocular toxoplasmosis (ocular group) and 134 without ocular lesions (control group). The differences between A and T allele distributions were not statistically significant between the two groups. However, we observed that a higher frequency of individuals from the ocular group possessed the A/A genotype, when compared with the control group, suggesting that homozygocity for the A allele could enhance susceptibility to ocular toxoplasmosis in T. gondii infection.

Interferon-gamma +874 T/A and interleukin-10 -1082 A/G single nucleotide polymorphism in Egyptian children with tuberculosis.

PubMed

Mosaad, Y M; Soliman, O E; Tawhid, Z E; Sherif, D M

2010-10-01

The aim was to investigate the association of interferon-gamma (IFN-γ) +874 T/A and interleukin-10 (IL-10)-1082 A/G single nucleotide polymorphisms with tuberculous infection and post-BCG lymphadenitis in Egyptian children. IFN-γ +874 T/A and IL-10 -1082 A/G polymorphism detection by amplification refractory mutation system technique was carried out for 110 patients with TB, 40 patients with post-BCG lymphadenitis and 118 healthy controls. IFN-γ +874 A allele was higher in TB and post-BCG patients than those in healthy controls (Pc=0.006 and 0.002, respectively). IFN-γ +874 genotype AA was significantly higher in patients with TB than that in control (Pc=0.015), in extrapulmonary than patients with pulmonary TB (PTB) (Pc=0.009), and young children with TB below 5 years (Pc=0.024). No statistically significant differences were observed between patients with TB and controls for the frequency of IL-10(-1082) alleles or genotypes (P>0.05); however, a statistically significant difference in the frequency of IL-10 (-1082) GG genotype was found between patients with pulmonary and extrapulmonary TB (Pc=0.003). Low producer IFN-γ +874 A/A genotype is associated with post-BCG lymphadenitis and TB disease especially in younger children below 5 years. IL-10-1082 G/G genotype did not exhibit significant association except for increased GG frequency in PTB. Both cytokine polymorphisms have no relation to tuberculin reaction in patients with TB. © 2010 The Authors. Scandinavian Journal of Immunology © 2010 Blackwell Publishing Ltd.

A CpG oligonucleotide can protect mice from a low aerosol challenge dose of Burkholderia mallei.

PubMed

Waag, David M; McCluskie, Michael J; Zhang, Ningli; Krieg, Arthur M

2006-03-01

Treatment with an oligodeoxynucleotide (ODN) containing CPG motifs (CpG ODN 7909) was found to protect BALB/c mice from lung infection or death after aerosol challenge with Burkholderia mallei. Protection was associated with enhanced levels of gamma interferon (IFN-gamma)-inducible protein 10, interleukin-12 (IL-12), IFN-gamma, and IL-6. Preexposure therapy with CpG ODNs may protect victims of a biological attack from glanders.

Inhibiting HLA-G restores IFN-γ and TNF-α producing T cell in pleural Tuberculosis.

PubMed

Saurabh, Abhinav; Chakraborty, Sushmita; Kumar, Prabin; Mohan, Anant; Bhatnagar, Anuj K; Rishi, Narayan; Mitra, Dipendra Kumar

2018-03-01

Human Leukocyte Antigen-G (HLA-G), a non-classical, class Ib molecule, has been shown to mediate immunoregulatory functions by inducing apoptosis, inhibits cytotoxicity and differentiation by modulating cytokine secretion. Due to its immune-suppressive function, it facilitates tolerance in feto-maternal interface and transplantation. In contrary, it favours immune evasion of microbes and tumors by inhibiting immune and inflammatory responses. In Tuberculosis (TB), we previously reported differential expression of HLA-G and its receptor Ig-like transcript -2 (ILT-2) in disseminated vs. localized Tuberculosis. The present study explores the impact of HLA-G inhibition on the function of T cells and monocytes, in TB Pleural Effusion (PE), a localized form of TB. Blocking of HLA-G resulted in significant increase in IFN-γ and TNF-α production by CD3 + T cells. Additionally, we observed that HLA-G influences the apoptosis and cytotoxic effect of T cells from TB- PE patients. Next, we checked the impact of interaction between HLA-G and ILT-4 receptor in monocytes derived from TB-PE patients upon blocking and observed significant increase in IFN-γ production. The present study reveals for the first time HLA-G mediated suppression of Th1 cytokines, especially, IFN-γ and TNF-α in TB-PE patients. Copyright © 2018 Elsevier Ltd. All rights reserved.

Oral administration of Uncariae rhynchophylla inhibits the development of DNFB-induced atopic dermatitis-like skin lesions via IFN-gamma down-regulation in NC/Nga mice.

PubMed

Kim, Dong-Young; Jung, Jung-A; Kim, Tae-Ho; Seo, Sang-Wan; Jung, Sung-Ki; Park, Cheung-Seog

2009-04-21

Uncariae rhynchophylla (UR) is an herb which has blood pressure lowering and anti-inflammatory effects and has been prescribed traditionally to treat stroke and vascular dementia. In the present study, we examined whether UR suppress Atopic dermatitis (AD)-like skin lesions in NC/Nga mice treated with 2, 4-dinitrofluorobenzene (DNFB) under SPF conditions. The effect of UR in DNFB- treated NC/Nga mice was determined by measuring the skin symptom severity, levels of serum IgE, and of the amounts of IL-4 and IFN-gamma secreted by activated T cells in draining lymph nodes. Oral administration of UR to DNFB-treated NC/Nga mice was found to inhibit ear thickness increases and the skin lesions induced by DNFB. IFN-gamma production by CD4+ T cells from the lymph nodes of DNFB-treated NC/Nga mice was significantly inhibited by UR treatment, although levels of IL-4 and total IgE in serum were not. UR may suppress the development of AD-like dermatitis in DNFB-treated NC/Nga mice by reducing IFN-gamma production.

Induction of indolamine 2,3-dioxygenase and kynurenine 3-monooxygenase in rat brain following a systemic inflammatory challenge: a role for IFN-gamma?

PubMed

Connor, Thomas J; Starr, Neasa; O'Sullivan, Joan B; Harkin, Andrew

2008-08-15

Inflammation-mediated dysregulation of the kynurenine pathway has been implicated as a contributor to a number of major brain disorders. Consequently, we examined the impact of a systemic inflammatory challenge on kynurenine pathway enzyme expression in rat brain. Indoleamine 2,3-dioxygenase (IDO) expression was induced in cortex and hippocampus following systemic lipopolysaccharide (LPS) administration. Whilst IDO expression was paralleled by increased circulating interferon (IFN)-gamma concentrations, IFN-gamma expression in the brain was only modestly altered following LPS administration. In contrast, induction of IDO was associated with increased central tumour necrosis factor (TNF)-alpha and interleukin (IL)-6 expression. Similarly, in cultured glial cells LPS-induced IDO expression was accompanied by increased TNF-alpha and IL-6 expression, whereas IFN-gamma was not detectable. These findings indicate that IFN-gamma is not required for LPS-induced IDO expression in brain. A robust increase in kynurenine-3-monooxygenase (KMO) expression was observed in rat brain 24h post LPS, without any change in kynurenine aminotransferase II (KAT II) expression. In addition, we report that constitutive expression of KAT II is approximately 8-fold higher than KMO in cortex and 20-fold higher in hippocampus. Similarly, in glial cells constitutive expression of KAT II was approximately 16-fold higher than KMO, and expression of KMO but not KAT II was induced by LPS. These data are the first to demonstrate that a systemic inflammatory challenge stimulates KMO expression in brain; a situation that is likely to favour kynurenine metabolism in a neurotoxic direction. However, our observation that expression of KAT II is much higher than KMO in rat brain is likely to counteract potential neurotoxicity that could arise from KMO induction following an acute inflammation.

HLA-E upregulation on IFN-gamma-activated AML blasts impairs CD94/NKG2A-dependent NK cytolysis after haplo-mismatched hematopoietic SCT.

PubMed

Nguyen, S; Beziat, V; Dhedin, N; Kuentz, M; Vernant, J P; Debre, P; Vieillard, V

2009-05-01

Natural killer (NK) cells generated after haploidentical hematopoietic SCT in patients with AML are characterized by specific phenotypic features and impaired functioning that may affect transplantation outcome. We show that IFN-gamma produced by immature CD56(bright) NK cells upregulates cell surface expression of HLA-E on AML blasts and that this upregulation protects leukemic cells from NK-mediated cell lysis through the mediation of CD94/NKG2A, an inhibitory receptor overexpressed on NK cells after haploidentical SCT. Two years after transplantation, however, maturing NK cells were functionally active, as evidenced by high cytotoxicity and poor IFN-gamma production. This implies that maturation of NK cells is the key to improved immune responses and transplantation outcome.

Requirement for distinct Janus kinases and STAT proteins in T cell proliferation versus IFN-gamma production following IL-12 stimulation.

PubMed

Ahn, H J; Tomura, M; Yu, W G; Iwasaki, M; Park, W R; Hamaoka, T; Fujiwara, H

1998-12-01

While IL-12 is known to activate JAK2 and TYK2 and induce the phosphorylation of STAT4 and STAT3, little is known regarding how the activation of these signaling molecules is related to the biologic effects of IL-12. Using an IL-12-responsive T cell clone (2D6), we investigated their requirements for proliferation and IFN-gamma production of 2D6 cells. 2D6 cells could be maintained with either IL-12 or IL-2. 2D6 lines maintained with IL-12 (2D6(IL-12)) or IL-2 (2D6(IL-2)) exhibited comparable levels of proliferation, but produced large or only small amounts of IFN-gamma, respectively, when restimulated with IL-12 after starvation of either cytokine. 2D6(IL-12) induced TYK2 and STAT4 phosphorylation. In contrast, their phosphorylation was marginally induced in 2D6(IL-2). The reduced STAT4 phosphorylation was due to a progressive decrease in the amount of STAT4 protein along with the passages in IL-2-containing medium. 2D6(IL-12) and 2D6(IL-2) similarly proliferating in response to IL-12 induced comparable levels of JAK2 activation and STAT5 phosphorylation. JAK2 was associated with STAT5, and IL-12-induced STAT5 phosphorylation was elicited in the absence of JAK3 activation. These results indicate that IL-12 has the capacity to induce/maintain STAT4 and STAT5 proteins, and that TYK2 and JAK2 activation correlate with STAT4 phosphorylation/IFN-gamma induction and STAT5 phosphorylation/cellular proliferation, respectively.

[Knockdown of STAT3 inhibits proliferation and migration of HepG2 hepatoma cells induced by IFN1].

PubMed

Li, Xiaofang; Wang, Yuqi; Yan, Ben; Fang, Peipei; Ma, Chao; Xu, Ning; Fu, Xiaoyan; Liang, Shujuan

2018-02-01

Objective To prepare lentiviruses expressing shRNA sequences targeting human signal transducer and activator of transcription 3 (STAT3) and detect the effect of STAT3 knockdown on type I interferon (IFN1)-induced proliferation and migration in HepG2 cells. Methods Four STAT3-targeting shRNA sequences (shRNA1-shRNA4) and one control sequence (Ctrl shRNA) were selected and cloned respectively into pLKO.1-sp6-pgk-GFP to construct shRNA-expressing vectors. Along with backbone psPAX2 and pMD2.G vectors, they were separately transfected into HEK293T cells to prepare lentiviruses. HepG2 cells were infected with the lentiviruses. Cytoplastic STAT3 level was detected by Western blotting to screen effective shRNA sequence(s) targeting STAT3. Proliferation and migration of HepG2 cells were analyzed by CCK-8 assay and Transwell TM migration and scratching assay, respectively. To detect the effect of IFN1 on cell proliferation and migration of HepG2 cells, the cells were treated with 2000 U/mL IFNα2b for indicated time and the activation of IFN-triggered STAT1 signal transduction was assayed by Western blotting. Results Two most effective STAT3-targeting shRNA sequences shRNA1 and shRNA2 were selected, and the expression of both STAT3 shRNA significantly decreased proliferation and migration of HepG2 cells. When treated with IFNα2b, 2000 U/mL of IFN1 showed more competent in attenuating growth and migration of HepG2 cells. Our data further proved that knockdown of STAT3 increased the phosphorylation of STAT1, and IFNα2b further enhanced the activation of STAT1 signaling in HepG2 cells. Conclusion Knockdown of STAT3 inhibits cell migration and growth, and rescues IFN response through up-regulating STAT1 signal transduction in HepG2 hepatoma cells.

Monocytes Play an IL-12-Dependent Crucial Role in Driving Cord Blood NK Cells to Produce IFN-g in Response to Trypanosoma cruzi

PubMed Central

Guilmot, Aline; Bosse, Julie; Carlier, Yves; Truyens, Carine

2013-01-01

We previously reported that foetuses congenitally infected with Trypanosoma cruzi, the agent of Chagas disease, mount an adult-like parasite-specific CD8+ T-cell response, producing IFN-g, and present an altered NK cell phenotype, possibly reflecting a post-activation state supported by the ability of the parasite to trigger IFN-g synthesis by NK cells in vitro. We here extended our knowledge on NK cell activation by the parasite. We compared the ability of T. cruzi to activate cord blood and adult NK cells from healthy individuals. Twenty-four hours co-culture of cord blood mononuclear cells with T. cruzi trypomastigotes and IL-15 induced high accumulation of IFN-g transcripts and IFN-g release. TNF-a, but not IL-10, was also produced. This was associated with up-regulation of CD69 and CD54, and down-regulation of CD62L on NK cells. The CD56bright NK cell subset was the major IFN-g responding subset (up to 70% IFN-g-positive cells), while CD56dim NK cells produced IFN-g to a lesser extent. The response points to a synergy between parasites and IL-15. The neonatal response, observed in all newborns, remained however slightly inferior to that of adults. Activation of IL-15-sensitized cord blood NK cells by the parasite required contacts with live/intact parasites. In addition, it depended on the engagement of TLR-2 and 4 and involved IL-12 and cross-talk with monocytes but not with myeloid dendritic cells, as shown by the use of neutralizing antibodies and cell depletion. This work highlights the ability of T. cruzi to trigger a robust IFN-g response by IL-15-sensitized human neonatal NK cells and the important role of monocytes in it, which might perhaps partially compensate for the neonatal defects of DCs. It suggests that monocyte- and IL-12- dependent IFN-g release by NK cells is a potentially important innate immune response pathway allowing T. cruzi to favour a type 1 immune response in neonates. PMID:23819002

[Adenovirus-mediated canine interferon-gamma expression and its antiviral activity against canine parvovirus].

PubMed

Zhang, Kao; Jin, Huijun; Zhong, Fei; Li, Xiujin; Neng, Changai; Chen, Huihui; Li, Wenyan; Wen, Jiexia

2012-11-04

To construct recombinant adenovirus containing canine interferon-gamma (cIFN-gamma) gene and to investigate its antiviral activity against canine parvovirus in Madin-Darby canine kidney cells (MDCK). [Methods] The cIFN-gamma gene was inserted into adenovirus shuttle plasmid to construct pShuttle3-cIFN-gamma expression vector, from which the cIFN-gamma expression cassette was transferred into the adenovirus genomic plasmid pAdeno-X by specific restriction sites to generate recombinant adenovirus genomic plasmid pAd-cIFN-gamma. The pAd-cIFN-gamma plasmid was linearized by digestion and transfected into human embryonic kidney (HEK) 293T cells to generate the replication-defective cIFN-gamma recombinant adenovirus (Ad-cIFN-gamma). To analyze its anti-canine parvovirus activity, the MDCK cells were pre-infected by Ad-cIFN-gamma recombinant adenovirus, and then infected by canine parvovirus. The antiviral activity of the Ad-cIFN-gamma recombinant adenovirus against parvovirus was analyzed. The recombinant adenovirus containing cIFN-gamma gene was constructed by the ligation method. The recombinant adenovirus could mediates recombinant cIFN-gamma secretory expression in MDCK cells. The Ad-cIFN-gamma recombinant adenovirus could significantly inhibit canine parvovirus replication in MDCK cells pre-infected with the recombinant adenovirus. These results indicate that the Ad-cIFN-gamma recombinant adenovirus has the potent antiviral activity against canine parvovirus. The Ad-cIFN-gamma recombinant adenovirus was successfully constructed by the ligation method and possessed a powerful antiviral activity against canine parvovirus.

Modulation of the allergen-induced human IgE response in Hu-SCID mice: inhibitory effect of human recombinant IFN-gamma and allergen-derived lipopeptide.

PubMed

Duez, C; Gras-Masse, H; Hammad, H; Akoum, H; Didierlaurent, A; André, C; Tonnel, A B; Pestel, J

2001-01-01

We have previously established a model to study the in vivo human IgE response using humanized SCID mice. Allergic SCID mice were obtained following intraperitoneal injection with mononuclear cells from Dermatophagoides pteronyssinus (Dpt)-sensitive patients, and sensitization by Dpt allergen intraperitoneal injection (immunization) or Dpt aerosol (inhalation). Human serum IgE was measured in allergic SCID mice after administration of human recombinant IFN-gamma or the lipopeptide LP 52-71 (derived from peptide p52-71 from Der p 1, Dpt major allergen, coupled to a lipophilic moiety), during the immunization or the inhalation phase. IFN-gamma inhibited human IgE production when given at the time of immunization, but not during inhalation. This effect was long-lasting as Dpt aerosol, given one month after immunization and IFN-gamma administration, failed to increase IgE levels. Unlike Dpt or p52-71, LP 52-71 failed to induce human IgE production at day 14 and 21 after its injection, but did inhibit the development of the IgE response after a secondary Dpt-challenge. Moreover, LP 52-71 administration 14 days after Dpt inhalation decreased IgE levels, in contrast to peptide 52-71, which increased IgE levels. Thus, taken together these results indicate that the development of the human IgE response in allergic SCID mice can be modulated by modified allergen and a Th1 cytokine.

Allergen-specific Th1 cells counteract efferent Th2 cell-dependent bronchial hyperresponsiveness and eosinophilic inflammation partly via IFN-gamma.

PubMed

Huang, T J; MacAry, P A; Eynott, P; Moussavi, A; Daniel, K C; Askenase, P W; Kemeny, D M; Chung, K F

2001-01-01

Th2 T cell immune-driven inflammation plays an important role in allergic asthma. We studied the effect of counterbalancing Th1 T cells in an asthma model in Brown Norway rats that favors Th2 responses. Rats received i.v. transfers of syngeneic allergen-specific Th1 or Th2 cells, 24 h before aerosol exposure to allergen, and were studied 18-24 h later. Adoptive transfer of OVA-specific Th2 cells, but not Th1 cells, and OVA, but not BSA exposure, induced bronchial hyperresponsiveness (BHR) to acetylcholine and eosinophilia in a cell number-dependent manner. Importantly, cotransfer of OVA-specific Th1 cells dose-dependently reversed BHR and bronchoalveolar lavage (BAL) eosinophilia, but not mucosal eosinophilia. OVA-specific Th1 cells transferred alone induced mucosal eosinophilia, but neither BHR nor BAL eosinophilia. Th1 suppression of BHR and BAL eosinophilia was allergen specific, since cotransfer of BSA-specific Th1 cells with the OVA-specific Th2 cells was not inhibitory when OVA aerosol alone was used, but was suppressive with OVA and BSA challenge. Furthermore, recipients of Th1 cells alone had increased gene expression for IFN-gamma in the lungs, while those receiving Th2 cells alone showed increased IL-4 mRNA. Importantly, induction of these Th2 cytokines was inhibited in recipients of combined Th1 and Th2 cells. Anti-IFN-gamma treatment attenuated the down-regulatory effect of Th1 cells. Allergen-specific Th1 cells down-regulate efferent Th2 cytokine-dependent BHR and BAL eosinophilia in an asthma model via mechanisms that depend on IFN-gamma. Therapy designed to control the efferent phase of established asthma by augmenting down-regulatory Th1 counterbalancing mechanisms should be effective.

Anti-interferon-gamma antibodies in the treatment of autoimmune diseases.

PubMed

Skurkovich, Boris; Skurkovich, Simon

2003-02-01

Interferon (IFN)-gamma is an important immune regulator in normal immunity. When IFN gamma production is disturbed, various autoimmune diseases (ADs) can develop, in which we suggest that anti-IFN gamma could have a beneficial effect. Depending on the cell type in which IFN gamma synthesis is disturbed, different clinical manifestations may result. We have also proposed to remove tumor necrosis factor (TNF)-alpha, together with certain types of IFNs, to treat various ADs and AIDS, also an autoimmune condition. Anti-IFN gamma has been tested in several T-helper cell (Th1) ADs, including rheumatoid arthritis (RA), multiple sclerosis (MS), corneal transplant rejection, uveitis, Type I diabetes, schizophrenia (anti-IFN gamma and anti-TNF alpha), and various autoimmune skin diseases (alopecia areata, psoriasis vulgaris, vitiligo, pemphigus vulgaris and epidermolysis bullosa). A strong, sometimes striking, therapeutic response followed administration of anti-IFN gamma, indicating that it may be a promising therapy for Th1 ADs.

PM-17INTRACEREBRAL IFN-γ DOES NOT ENHANCE THE RESPONSE TO VACCINE IMMUNOTHERAPY FOR CANINE GLIOMA

PubMed Central

Pluhar, Liz; Olin, Michael; Goulart, Michelle; Andersen, Brian; Hunt, Matt; Ohlfest, John

2014-01-01

Due to the complexity of human tumor environment and host immune interactions, the majority of successful brain cancer therapies in rodent models fail to show the same efficacy when translated to human patients. Pet dogs with spontaneous glioma recapitulate important features of human disease and we have used this more representative model to assess the response to vaccine immunotherapy with and without interferon gamma (IFN-γ) gene therapy after surgery. Dogs with newly diagnosed glioma underwent surgical tumor debulking and were randomized to receive 1) autologous tumor lysate vaccines with CpG ODN as an adjuvant (n = 12) or 2) Ad-mediated interferon gamma (IFN-γ) gene therapy injected around the resection cavity followed by vaccine immunotherapy (n = 12). A grade IV IFN-γ dose-related toxicity (severe encephalitis and lymphocytic perivascular cuffing) resulted in death of one dog. No further adverse events were seen at a lower IFN-γ dose supporting the safety of the treatment. This immunotherapy activated a humoral response with specific tumor-reactive IgG antibodies detected after vaccination in all dogs. Addition of IFN-γ gene therapy did not affect the median overall survival time of 204 days versus 211 days with vaccine alone. As expected, there were significant differences (P = 0.036) in survival between dogs with low-grade (369 days) versus high-grade (204 days) tumors. During postmortem analysis, no dog with a low-grade tumor had recurrence, whereas all dogs with grade III/IV tumors died from progression. We hoped that forced IFN-γ expression would sensitize residual tumor cells to CTL recognition and recruit NK cells to kill MHC Ilow/- cells, thereby enhancing the effects of vaccine immunotherapy. Our data failed to support this theory, however the lack of difference could be due to the small number of dogs in each group (type II error) or to insufficient in situ expression of IFN-γ to elicit the desired effect.

Mucosal tolerance to experimental autoimmune myasthenia gravis is associated with down-regulation of AChR-specific IFN-gamma-expressing Th1-like cells and up-regulation of TGF-beta mRNA in mononuclear cells.

PubMed

Ma, C G; Zhang, G X; Xiao, B G; Wang, Z Y; Link, J; Olsson, T; Link, H

1996-02-13

Oral and nasal administration of nicotinic acetylcholine receptor (AChR) to Lewis rats prior to myasthenogenic immunization with AChR and complete Freund's adjuvant (CFA) resulted in prevention or marked decrease of the severity of experimental autoimmune myasthenia gravis (EAMG) and suppression of AChR-specific B-cell responses and of AChR-reactive T-cell function. To examine the involvement of immunoregulatory cytokines and the underlying mechanisms involved in tolerance induction, in situ hybridization with radiolabeled cDNA oligonucleotide proves was adopted to enumerate mononuclear cells (MNC) expressing mRNA for the proinflammatory cytokine interferon-gamma (IFN-gamma), the B cell-stimulating interleukin-4 (IL-4), and the immunosuppressive transforming growth factor-beta (TGF-beta). Popliteal and inguinal lymph nodes from EAMG rats contained elevated numbers of AChR-reactive IFN-gamma, IL-4, and TGF-beta mRNA-expressing cells, compared to control rats receiving PBS orally or nasally and injected with CFA only. Oral and nasal tolerance was accompanied by decreased numbers of AChR-reactive IFN-gamma and IL-4 mRNA-expressing cells and strong up-regulation of TGF-beta mRNA-positive cells in lymphoid organs when compared to nontolerized EAMG control rats. The results suggest that IFN-gamma and IL-4 are central effector molecules in the development of EAMG and that TGF-beta plays an important role in tolerance induction to EAMG.

T cell-intrinsic requirement for NF-kappa B induction in postdifferentiation IFN-gamma production and clonal expansion in a Th1 response.

PubMed

Corn, Radiah A; Aronica, Mark A; Zhang, Fuping; Tong, Yingkai; Stanley, Sarah A; Kim, Se Ryoung Agnes; Stephenson, Linda; Enerson, Ben; McCarthy, Susan; Mora, Ana; Boothby, Mark

2003-08-15

NF-kappaB/Rel transcription factors are linked to innate immune responses and APC activation. Whether and how the induction of NF-kappaB signaling in normal CD4(+) T cells regulates effector function are not well-understood. The liberation of NF-kappaB dimers from inhibitors of kappaB (IkappaBs) constitutes a central checkpoint for physiologic regulation of most forms of NF-kappaB. To investigate the role of NF-kappaB induction in effector T cell responses, we targeted inhibition of the NF-kappaB/Rel pathway specifically to T cells. The Th1 response in vivo is dramatically weakened when T cells defective in their NF-kappaB induction (referred to as IkappaBalpha(DeltaN) transgenic cells) are activated by a normal APC population. Analyses in vivo, and IL-12-supplemented T cell cultures in vitro, reveal that the mechanism underlying this T cell-intrinsic requirement for NF-kappaB involves activation of the IFN-gamma gene in addition to clonal expansion efficiency. The role of NF-kappaB in IFN-gamma gene expression includes a modest decrease in Stat4 activation, T box expressed in T cell levels, and differentiation efficiency along with a more prominent postdifferentiation step. Further, induced expression of Bcl-3, a trans-activating IkappaB-like protein, is decreased in T cells as a consequence of NF-kappaB inhibition. Together, these findings indicate that NF-kappaB induction in T cells regulates efficient clonal expansion, Th1 differentiation, and IFN-gamma production by Th1 lymphocytes at a control point downstream from differentiation.

Malarial pigment haemozoin, IFN-gamma, TNF-alpha, IL-1beta and LPS do not stimulate expression of inducible nitric oxide synthase and production of nitric oxide in immuno-purified human monocytes

PubMed Central

Skorokhod, Oleksii A; Schwarzer, Evelin; Ceretto, Monica; Arese, Paolo

2007-01-01

Background Enhanced production of nitric oxide (NO) following upmodulation of the inducible isoform of NO synthase (iNOS) by haemozoin (HZ), inflammatory cytokines and LPS may provide protection against Plasmodium falciparum malaria by killing hepatic and blood forms of parasites and inhibiting the cytoadherence of parasitized erythrocytes (RBC) to endothelial cells. Monocytes and macrophages are considered to contribute importantly to protective upregulation of iNOS and production of NO. Data obtained with murine phagocytes fed with human HZ and synthetic HZ (sHZ) indicate that supplemental treatment of those cells with IFN-gamma elicited significant increases in protein and mRNA expression of iNOS and NO production, providing a potential mechanism linking HZ phagocytosis and increased production of NO. Purpose of this study was to analyse the effect of P. falciparum HZ and sHZ supplemental to treatment with IFN-gamma and/or a stimulatory cytokine-LPS mix on iNOS protein and mRNA expression in immuno-purified human monocytes. Methods Adherent immunopurified human monocytes (purity >85%), and murine phagocytic cell lines RAW 264.7, N11 and ANA1 were fed or not with P. falciparum HZ or sHZ and treated or not with IFN-gamma or a stimulatory cytokine-LPS mix. Production of NO was quantified in supernatants, iNOS protein and mRNA expression were measured after immunoprecipitation and Western blotting and quantitative RT-PCT, respectively. Results Phagocytosis of HZ/sHZ by human monocytes did not increase iNOS protein and mRNA expression and NO production either after stimulation by IFN-gamma or the cytokine-LPS mix. By contrast, in HZ/sHZ-laden murine macrophages, identical treatment with IFN-gamma and the cytokine-LPS mix elicited significant increases in protein and mRNA expression of iNOS and NOS metabolites production, in agreement with literature data. Conclusion Results indicate that human monocytes fed or not with HZ/sHZ were constantly unable to express i

Polyclonal and allergen-induced cytokine responses in adults with asthma: resolution of asthma is associated with normalization of IFN-gamma responses.

PubMed

Smart, Joanne M; Horak, Elisabeth; Kemp, Andrew S; Robertson, Colin F; Tang, Mimi L K

2002-09-01

Atopic disease is associated with skewing of immune responses away from a T(H)1 toward a T(H)2 profile. Previous studies have implicated this cytokine imbalance in the development of disease. However, it is not known whether normalization of this imbalance is conversely associated with disease resolution. To further delineate the role of reduced T(H)1 and increased T(H)2 cytokine production in the pathogenesis of atopic disease and to determine whether disease resolution is associated with alteration of cytokine profiles, we investigated cytokine responses in a cohort of adult patients with asthma followed from childhood. A cohort of wheezy children and control subjects aged 7 to 10 years were recruited from 1964 to 1967. Subjects were reevaluated every 7 years to monitor the outcome of childhood asthma. At the 42-year follow-up, 89 subjects from this cohort were evaluated for mitogen and house dust mite (HDM)-induced T(H)1 (IFN-gamma) and T(H)2 (IL-4, IL-5, and IL-13) cytokine responses. Cytokine responses were compared in patients with ongoing asthma, patients with resolved asthma, and control subjects. Patients with severe ongoing asthma had significantly reduced HDM-induced IFN-gamma production compared with that of control subjects and patients with resolved asthma. In contrast, HDM-induced IFN-gamma production in patients with resolved asthma was equivalent to that seen in control subjects. Patients with ongoing and resolved asthma produced significantly higher levels of IL-5 in response to HDM compared with that seen in control subjects, with levels being equivalent in patients with active and resolved asthma. HDM-induced IL-13 production was significantly increased in the patients with resolved asthma when compared with that seen in the control subjects. PHA-induced cytokine responses did not parallel HDM-induced responses. Patients with persistent and severe atopic asthma have a reduced HDM-induced T(H)1 response, whereas those with resolved asthma do not

Production and characterization of guinea pig recombinant gamma interferon and its effect on macrophage activation.

PubMed

Jeevan, A; McFarland, C T; Yoshimura, T; Skwor, T; Cho, H; Lasco, T; McMurray, D N

2006-01-01

Gamma interferon (IFN-gamma) plays a critical role in the protective immune responses against mycobacteria. We previously cloned a cDNA coding for guinea pig IFN-gamma (gpIFN-gamma) and reported that BCG vaccination induced a significant increase in the IFN-gamma mRNA expression in guinea pig cells in response to living mycobacteria and that the virulent H37Rv strain of Mycobacterium tuberculosis stimulated less IFN-gamma mRNA than did the attenuated H37Ra strain. In this study, we successfully expressed and characterized recombinant gpIFN-gamma with a histidine tag at the N terminus (His-tagged rgpIFN-gamma) in Escherichia coli. rgpIFN-gamma was identified as an 18-kDa band in the insoluble fraction; therefore, the protein was purified under denaturing conditions and renatured. N-terminal amino acid sequencing of the recombinant protein yielded the sequence corresponding to the N terminus of His-tagged gpIFN-gamma. The recombinant protein upregulated major histocompatibility complex class II expression in peritoneal macrophages. The antiviral activity of rgpIFN-gamma was demonstrated with a guinea pig fibroblast cell line (104C1) infected with encephalomyocarditis virus. Interestingly, peritoneal macrophages treated with rgpIFN-gamma did not produce any nitric oxide but did produce hydrogen peroxide and suppressed the intracellular growth of mycobacteria. Furthermore, rgpIFN-gamma induced morphological alterations in cultured macrophages. Thus, biologically active rgpIFN-gamma has been successfully produced and characterized in our laboratory. The study of rgpIFN-gamma will further increase our understanding of the cellular and molecular responses induced by BCG vaccination in the guinea pig model of pulmonary tuberculosis.

Suppression of human anti-inflammatory plasma cytokines IL-10 and IL-1RA with elevation of proinflammatory cytokine IFN-gamma during the isolation of the Antarctic winter

NASA Technical Reports Server (NTRS)

Shearer, William T.; Lee, Bang-Ning; Cron, Stanley G.; Rosenblatt, Howard M.; Smith, E. O'Brian; Lugg, Desmond J.; Nickolls, Peter M.; Sharp, Robert M.; Rollings, Karl; Reuben, James M.

2002-01-01

Cellular immune function has been shown to be decreased and latent virus shedding to be increased in human beings isolated during the Antarctic winter, a model used for assessing some effects of space flight. However, the balance of proinflammatory (IFN-gamma) and anti-inflammatory (IL-10 and IL-1RA) cytokines has not previously been evaluated. We therefore sought to determine whether isolation during the Antarctic winter would alter the proinflammatory and anti-inflammatory cytokine balance. Cytokine levels were measured with ELISA in monthly plasma samples from January through September 1999 in 21 study subjects in the Antarctic and 7 control subjects on Macquarie Island. There was a significant time-dependent increase in plasma IFN-gamma (P =.039) as well as decreases in IL-10 (P =.042) and IL-1RA (P =.053) in the study subjects compared with the control subjects. The study subjects also had significantly increased plasma IFN-gamma levels (P < or =.045) but decreased IL-10 and IL-1RA levels (P < or =.036) at individual time points of isolation. Isolation of human beings in the Antarctic appears to shift the plasma cytokine balance toward a proinflammatory profile. These observations are consistent with T-cell activation that might be due to activation of latent viruses, and they could hold importance for determining the risks of space flight.

Effect of gamma interferon on resolution of murine chlamydial genital infection.

PubMed Central

Rank, R G; Ramsey, K H; Pack, E A; Williams, D M

1992-01-01

Mice infected in the genital tract with the Chlamydia trachomatis agent of mouse pneumonitis were treated with monoclonal rat anti-gamma interferon (anti-IFN-gamma) antibody to determine whether IFN-gamma participated in the resolution of the infection. In two experiments, anti-IFN-gamma antibody treatment resulted in significantly prolonged infections. In support of these data, passive administration of recombinant IFN-gamma to chronically infected nu/nu mice was able to bring about resolution of the infection in some animals. PMID:1398955

Essential Cell-Autonomous Role for Interferon (IFN) Regulatory Factor 1 in IFN-γ-Mediated Inhibition of Norovirus Replication in Macrophages

PubMed Central

Maloney, Nicole S.; Thackray, Larissa B.; Goel, Gautam; Hwang, Seungmin; Duan, Erning; Vachharajani, Punit; Xavier, Ramnik

2012-01-01

Noroviruses (NVs) cause the majority of cases of epidemic nonbacterial gastroenteritis worldwide and contribute to endemic enteric disease. However, the molecular mechanisms responsible for immune control of their replication are not completely understood. Here we report that the transcription factor interferon regulatory factor 1 (IRF-1) is required for control of murine NV (MNV) replication and pathogenesis in vivo. This led us to studies documenting a cell-autonomous role for IRF-1 in gamma interferon (IFN-γ)-mediated inhibition of MNV replication in primary macrophages. This role of IRF-1 in the inhibition of MNV replication by IFN-γ is independent of IFN-αβ signaling. While the signal transducer and activator of transcription STAT-1 was also required for IFN-γ-mediated inhibition of MNV replication in vitro, class II transactivator (CIITA), interferon regulatory factor 3 (IRF-3), and interferon regulatory factor 7 (IRF-7) were not required. We therefore hypothesized that there must be a subset of IFN-stimulated genes (ISGs) regulated by IFN-γ in a manner dependent only on STAT-1 and IRF-1. Analysis of transcriptional profiles of macrophages lacking various transcription factors confirmed this hypothesis. These studies identify a key role for IRF-1 in IFN-γ-dependent control of norovirus infection in mice and macrophages. PMID:22973039

Interferon-alpha and interferon-gamma sensitize human tenon fibroblasts to mitomycin-C.

PubMed

Wang, Xiao Yang; Crowston, Jonathan G; Zoellner, Hans; Healey, Paul R

2007-08-01

To investigate the effect of interferon (IFN)-alpha and IFN-gamma pretreatment on mitomycin C (MMC)-induced cell death in human Tenon fibroblasts (HTFs) and the mechanisms by which IFN-alpha and IFN-gamma modulate the susceptibility of HTFs to MMC. HTFs were pretreated with IFN-alpha and IFN-gamma for 48 hours before 5-minute application of 0.4 mg/mL MMC. Cell death after 48 hours was determined by Annexin V/propidium iodide (PI) staining and lactate dehydrogenase (LDH) release assay. Fas, Fas-ligand, and Bcl-2 expression were determined by flow cytometry. Fas associated death domain (FADD), Bax, cytochrome c, and caspase expression were determined by Western blot analysis and immunofluorescence staining. MMC treatment increased cell death and upregulated Fas and FADD expression, but had no effect on Fas-Ligand, Bax, Bcl-2, or cytochrome c. Neither IFN-alpha nor IFN-gamma alone induced HTF death, but each increased cell death 2 days after MMC treatment in a dose-dependent fashion. Combination IFN-alpha and IFN-gamma had a synergistic effect. IFN-alpha and IFN-gamma pretreatment increased Fas expression. Fas upregulation was associated with increased sensitivity to MMC. IFN pretreatment increased procaspase-8, procaspase-9, and procaspase-3 expression, and caspase-3 activation. Caspase-8, caspase-3, and broad caspase inhibitors, but not caspase-9 inhibitor, inhibited MMC-induced cell death in nonpretreated and IFN-pretreated cells. IFN-alpha and IFN-gamma enhance the susceptibility of HTFs to MMC-induced cell death through a Fas-mediated and a caspase-3-dependent pathway. Pretreatment with IFN primed HTFs to MMC, providing a potential means for initially slowing the healing response with IFN and subsequently terminating fibroblast activity through MMC-induced cell death.

Golgi targeting of human guanylate-binding protein-1 requires nucleotide binding, isoprenylation, and an IFN-gamma-inducible cofactor.

PubMed

Modiano, Nir; Lu, Yanping E; Cresswell, Peter

2005-06-14

Human guanylate-binding protein-1 (hGBP-1) is a large GTPase, similar in structure to the dynamins. Like many smaller GTPases of the Ras/Rab family, it is farnesylated, suggesting it may dock into membranes and perhaps play a role in intracellular trafficking. To date, however, hGBP-1 has never been associated with a specific intracellular compartment. Here we present evidence that hGBP-1 can associate with the Golgi apparatus. Redistribution from the cytosol to the Golgi was observed by immunofluorescence and subcellular fractionation after aluminum fluoride treatment, suggesting that it occurs when hGBP-1 is in its GTP-bound state. Relocalization was blocked by a farnesyl transferase inhibitor. The C589S mutant of hGBP-1, which cannot be farnesylated, and the previously uncharacterized R48P mutant, which cannot bind GTP, both failed to localize to the Golgi. These two mutants had a dominant-negative effect, preventing endogenous wild-type hGBP-1 from efficiently redistributing after aluminum fluoride treatment. Furthermore, hGBP-1 requires another IFN-gamma-induced factor to be targeted to the Golgi, because constitutively expressed hGBP-1 remained cytosolic in cells treated with aluminum fluoride unless the cells were preincubated with IFN-gamma. Finally, two nonhydrolyzing mutants of hGBP-1, corresponding to active mutants of Ras family proteins, failed to constitutively associate with the Golgi; we propose three possible explanations for this surprising result.

Interferon-gamma promotes the survival and Fc epsilon RI-mediated histamine release in cultured human mast cells.

PubMed Central

Yanagida, M; Fukamachi, H; Takei, M; Hagiwara, T; Uzumaki, H; Tokiwa, T; Saito, H; Iikura, Y; Nakahata, T

1996-01-01

We examined the effects of interferon-gamma (IFN-gamma) on 100% pure human mast cells generated in suspension cultures of umbilical cord blood mononuclear cells in the presence of stem cell factor (SCF) and interleukin-6 (IL-6). When mast cells were suspended in serum-free medium without any cytokine after the withdrawal of SCF and IL-6, they died over a period of 5 days because of apoptosis. IFN-gamma in the cultures suppressed apoptosis and prolonged their survival in a dose-dependent manner. This survival-promoting effect of IFN-gamma was blocked by neutralizing antibodies to IFN-gamma or to IFN-gamma receptor (IFN-gamma R). When mast cells were incubated with IFN-gamma in serum-free medium for more than 4 hr during sensitization, immunoglobulin E (IgE)/anti-IgE antibody-induced histamine release was effectively enhanced. Polymerase chain reaction (PCR) amplification of the alpha-chain of IFN-gamma R (IFN-gamma R alpha) yielded products of the correct size predicted from the sequence of the receptor. In addition, flow cytometry using anti-IFN-gamma R monoclonal antibodies (mAbs) indicated that these mast cells bear IFN-gamma R on their surface. These findings suggested that IFN-gamma activates human mast cells via specific receptors in certain aspects of inflammatory reactions. Images Figure 2 Figure 4 PMID:9014819

IFN-gamma-mediated inhibition of human IgE synthesis by IL-21 is associated with a polymorphism in the IL-21R gene.

PubMed

Pène, Jérôme; Guglielmi, Laurence; Gauchat, Jean-François; Harrer, Nathalie; Woisetschläger, Maximilian; Boulay, Vera; Fabre, Jean-Michel; Demoly, Pascal; Yssel, Hans

2006-10-15

IL-21 is a cytokine produced by CD4+ T cells that has been reported to regulate human, as well as, mouse T and NK cell function and to inhibit Ag-induced IgE production by mouse B cells. In the present study, we show that human rIL-21 strongly enhances IgE production by both CD19+ CD27- naive, and CD19+ CD27+ memory B cells, stimulated with anti-CD40 mAb and rIL-4 and that it promotes the proliferative responses of these cells. However, rIL-21 does not significantly affect anti-CD40 mAb and rIL-4-induced Cepsilon promoter activation in a gene reporter assay, nor germline Cepsilon mRNA expression in purified human spleen or peripheral blood B cells. In contrast, rIL-21 inhibits rIL-4-induced IgE production in cultures of PBMC or total splenocytes by an IFN-gamma-dependent mechanism. The presence of a polymorphism (T-83C), in donors heterozygous for this mutation was found to be associated not only with lower rIL-21-induced IFN-gamma production levels, but also with a lower sensitivity to the inhibitory effects of IL-21 on the production of IgE, compared with those in donors expressing the wild-type IL-21R. Taken together, these results show that IL-21 differentially regulates IL-4-induced human IgE production, via its growth- and differentiation-promoting capacities on isotype-, including IgE-, committed B cells, as well as via its ability to induce IFN-gamma production, most likely by T and NK cells, whereas the outcome of these IL-21-mediated effects is dependent on the presence of a polymorphism in the IL-21R.

Role of gamma interferon in a neonatal mouse model of group B streptococcal disease.

PubMed Central

Cusumano, V; Mancuso, G; Genovese, F; Delfino, D; Beninati, C; Losi, E; Teti, G

1996-01-01

The aim of this study was to assess the role of gamma interferon (IFN-gamma) in a neonatal mouse model of group B streptococcal (GBS) sepsis. IFN-gamma was produced by spleen cells at 24, 48, and 72 h after GBS challenge. Treatment with anti-IFN-gamma at 6 h before challenge totally abrogated the IFN-gamma response but did not affect survival. Subcutaneous administration of recombinant IFN-gamma (2,500 IU per pup) at 18 h after challenge resulted in increased survival time and reduced blood colony counts at 48 and 72 h. In vitro preincubation of neonatal whole blood with IFN-gamma before the addition of GBS resulted in significant restriction of bacterial growth. These data indicate that administration of recombinant IFN-gamma can partially restore impaired host defenses against GBS in neonatal mice. This cytokine may be useful for the treatment of neonatal infections. PMID:8757817

The effect of centaurein on interferon-{gamma} expression and Listeria infection in mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chang, S.-L.; Department of Biological Science and Technology, National Chiao Tung University, 1001, Ta Hsueh Road, Hsinchu 300, Taiwan; Yeh, H.-H.

2007-02-15

We previously found that centaurein enhanced IFN-{gamma} transcription in T cells. Here, we demonstrate that centaurein increased the IFN-{gamma} expression in T and NK cells and the serum IFN-{gamma} level in mice. Centaurein elevated the transcription of T-bet but not GATA-3, which is consistent with its effect on that of IFN-{gamma} but not IL-4. Additionally, centaurein effectively protected mice against Listeria infection. Moreover, centaurein per se or in combination with antibiotics could treat Listeria infection. Our mechanistic studies suggest that centaurein augments IFN-{gamma} expression via a transcriptional up-regulation of T-bet and that centaurein protects against or treats Listeria infection viamore » a modulation of IFN-{gamma} expression.« less

Tomatine adjuvantation of protective immunity to a major pre-erythrocytic vaccine candidate of malaria is mediated via CD8+ T cell release of IFN-gamma.

PubMed

Heal, Karen G; Taylor-Robinson, Andrew W

2010-01-01

The glycoalkaloid tomatine, derived from the wild tomato, can act as a powerful adjuvant to elicit an antigen-specific cell-mediated immune response to the circumsporozoite (CS) protein, a major pre-erythrocytic stage malaria vaccine candidate antigen. Using a defined MHC-class-I-restricted CS epitope in a Plasmodium berghei rodent model, antigen-specific cytotoxic T lymphocyte activity and IFN-gamma secretion ex vivo were both significantly enhanced compared to responses detected from similarly stimulated splenocytes from naive and tomatine-saline-immunized mice. Further, through lymphocyte depletion it is demonstrated that antigen-specific IFN-gamma is produced exclusively by the CD8(+) T cell subset. We conclude that the processing of the P. berghei CS peptide as an exogenous antigen and its presentation via MHC class I molecules to CD8(+) T cells leads to an immune response that is an in vitro correlate of protection against pre-erythrocytic malaria. Further characterization of tomatine as an adjuvant in malaria vaccine development is indicated.

IFN-{gamma} sensitizes MIN6N8 insulinoma cells to TNF-{alpha}-induced apoptosis by inhibiting NF-{kappa}B-mediated XIAP upregulation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Hun Sik; Kim, Sunshin; Lee, Myung-Shik

2005-10-28

Although X-linked inhibitor of apoptosis protein (XIAP) is an important intracellular suppressor of apoptosis in a variety of cell types, its role in cytokine-induced pancreatic {beta}-cell apoptosis remains unclear. Here, we found that: (i) XIAP level was inversely correlated with tumor necrosis factor (TNF)-{alpha}-induced apoptosis in MIN6N8 insulinoma cells; (ii) adenoviral XIAP overexpression abrogated the TNF-{alpha}-induced apoptosis through inhibition of caspase activity; (iii) downregulation of XIAP by antisense oligonucleotide or Smac peptide sensitized MIN6N8 cells to TNF-{alpha}-induced apoptosis; (iv) XIAP expression was induced by TNF-{alpha} through a nuclear factor-{kappa}B (NF-{kappa}B)-dependent pathway, and interferon (IFN)-{gamma} prevented such an induction in amore » manner independent of NF-{kappa}B, which presents a potential mechanism underlying cytotoxic IFN-{gamma}/TNF-{alpha} synergism. Taken together, our results suggest that XIAP is an important modulator of TNF-{alpha}-induced apoptosis of MIN6N8 cells, and XIAP regulation in pancreatic {beta}-cells might play an important role in pancreatic {beta}-cell apoptosis and in the pathogenesis of type 1 diabetes.« less

Equine interferon gamma synthesis in lymphocytes after in vivo infection and in vitro stimulation with EHV-1.

PubMed

Paillot, R; Daly, J M; Juillard, V; Minke, J M; Hannant, D; Kydd, J H

2005-08-22

Equine cytotoxic T lymphocyte (CTL) responses to equine herpesvirus-1 (EHV-1) are well characterised but little is known about the cytokine response after infection or vaccination. EHV-1 is common in horses and infects lymphocytes in vivo. This virus was used as a model to measure the synthesis of interferon gamma (IFN-gamma) by equine peripheral blood mononuclear cells (PBMC) after in vivo infection and/or in vitro stimulation with EHV-1. Both flow cytometry and ELISPOT assays were used to quantify equine IFN-gamma using a mouse anti-bovine IFN-gamma monoclonal antibody (clone CC302; shown to cross-react with recombinant equine IFN-gamma) and a rabbit anti-canine IFN-gamma polyclonal antibody. The percentage of PBMC synthesising IFN-gamma after in vitro stimulation with EHV-1 increased with age. In yearlings infected experimentally with EHV-1, PBMC showed two peaks of IFN-gamma synthesis, 11 and 56 days after infection. The IFN-gamma synthesis was principally associated with CD8(+) cells. The patterns of IFN-gamma synthesis detected by intracellular IFN-gamma staining or ELISPOT were compared with CTL data and shown to be similar. These methods were also applied successfully to frozen samples of PBMC. Measurement of equine IFN-gamma using these simple techniques can now be applied to future studies on protective cellular immune responses following virus infection and/or vaccination of horses.

Graft-versus-host disease causes failure of donor hematopoiesis and lymphopoiesis in interferon-gamma receptor-deficient hosts.

PubMed

Delisle, Jean-Sébastien; Gaboury, Louis; Bélanger, Marie-Pier; Tassé, Eliane; Yagita, Hideo; Perreault, Claude

2008-09-01

The immunopathologic condition known as graft-versus-host disease (GVHD) results from a type I T-cell process. However, a prototypical type I cytokine, interferon-gamma (IFN-gamma), can protect against several manifestations of GVHD in recipients of major histocompatibility complex (MHC)-mismatched hematopoietic cells. We transplanted hematopoietic cells from C3H.SW donors in wild-type (wt) and IFN-gamma-receptor-deficient (IFN-gammaRKO) MHC-matched C57BL/6 recipients. In IFN-gammaRKO recipients, host cells were unresponsive to IFN-gamma, whereas wt donor cells were exposed to exceptionally high levels of IFN-gamma. From an IFN-gamma perspective, we could therefore evaluate the impact of a loss-of-function on host cells and gain-of-function on donor cells. We found that lack of IFN-gammaR prevented up-regulation of MHC proteins on host cells but did not mitigate damage to most target organs. Two salient phenotypes in IFN-gammaRKO recipients involved donor cells: lymphoid hypoplasia and hematopoietic failure. Lymphopenia was due to FasL-induced apoptosis and decreased cell proliferation. Bone marrow aplasia resulted from a decreased proliferation of hematopoietic stem/progenitor cells that was associated with down-regulation of 2 genes negatively regulated by IFN-gamma: Ccnd1 and Myc. We conclude that IFN-gamma produced by alloreactive T cells may entail a severe graft-versus-graft reaction and could be responsible for cytopenias that are frequently observed in subjects with GVHD.

Differential effects of human interferon alpha and interferon gamma on xenografted human thyroid tissue in severe combined immunodeficient mice and nude mice.

PubMed

Kawai, K; Enomoto, T; Fornasier, V; Resetkova, E; Volpé, R

1997-03-01

We have studied the in vivo effects of human interferon alpha (IFN-alpha) and interferon gamma (IFN-gamma) administration on human thyroid tissue xenografted into two mouse strains: severe combined immunodeficient (SCID) mice and nude mice. Human lymphocytes survive in SCID mice but are lysed in nude mice. Thyroid tissues from Graves' disease or Hashimoto's thyroiditis, or paranodular [normal, (N)] tissue was xenografted into SCID mice (0.8 g/mouse) pretreated with anti-asialo GM-1 antiserum and radiation and also into nude mice. One week after xenografting, SCID and nude mice were divided into three groups. Group A was treated with IFN-alpha intraperitoneally (2,000 units/mouse) three times weekly; group B was treated with IFN-gamma similarly; group C was treated with phosphate buffered saline (PBS) only (control). Autologous human peripheral blood mononuclear cells (PBMCs) were added to mice receiving N xenografts. Blood was taken every 2 weeks for levels of IgG and thyroid antibodies (TAb). After 6 weeks of treatment, mice were sacrificed, and xenograft thyrocyte histocompatibility leukocyte antigen (HLA-DR) and intercellular adhesion molecule (ICAM-1) expression were measured. In addition, thyrocyte cultures were stimulated in vitro with 200 units/ml of either IFN-alpha or IFN-gamma or PBS (control). SCID mice xenografted with autoimmune thyroid disease (AITD) in group A showed a significantly higher TAb production than group C, whereas in group B, TAb production was not statistically increased compared to control (group C). SCID mice xenografted with N did not produce TAb in any group, nor did nude mice xenografted with AITD. Thyrocyte HLA-DR expression was markedly increased in group A and B in SCID mice xenografted with Graves' disease, Hashimoto's thyroiditis, and N tissue compared to group C. In contrast, only group B (IFN-gamma) showed an increase in thyrocyte HLA-DR in nude mice. In the in vitro studies, only IFN-gamma (not IFN-alpha) stimulated

Interferon-gamma receptor-deficiency renders mice highly susceptible to toxoplasmosis by decreased macrophage activation.

PubMed

Deckert-Schlüter, M; Rang, A; Weiner, D; Huang, S; Wiestler, O D; Hof, H; Schlüter, D

1996-12-01

Toxoplasma gondii may cause severe infections in immunocompromised patients including fetuses and those with AIDS. Among the factors mediating protection against T. gondii, IFN-gamma has gained special attention. To analyze the role of IFN-gamma in the early phase of toxoplasmosis, IFN-gamma receptor-deficient (IFN-gamma R0/0) mice were orally infected with low-virulent toxoplasms. IFN-gamma R0/0 mice died of the disease up to day 10 postinfection, whereas immunocompetent wild-type (WT) mice developed a chronic toxoplasmosis. Histopathology revealed that in IFN-gamma R0/0 mice, the parasite multiplied unrestrictedly in the small intestine, the intestinal lymphatic tissue, the liver, and the spleen. Ultimately, animals died of a necrotizing hepatitis. In WT mice, the same organs were effected, but multiplication of the parasite was effectively limited. Compared with WT mice, immunohistochemistry and flow cytometry demonstrated that in IFN-gamma R0/0 mice, macrophages were only marginally activated in response to the infection, as evidenced by a reduced expression of major histocompatability complex class II antigens. In addition, immunohistochemistry and RT-PCR showed a reduced production of the macrophage-derived cytokines tumor necrosis factor-alpha, inducible nitric oxide synthase, and IL-1 beta in the liver of IFN-gamma R0/0 mice. In contrast, activation of T cells, recruitment of immune cells to inflammatory foci, and anti-T. gondii IgM antibody production were unaffected by the mutation of the IFN-gamma R. Moreover, induction of IL-2, IL-4, and IL-10 mRNA transcripts in the liver was normal in IFN-gamma R0/0 mice. Adoptive transfer experiments revealed that the immune T cells of WT animals did not protect IFN-gamma R0/0 mice from lethal infection with highly virulent toxoplasms, whereas WT mice were significantly protected by the adoptive transfer. Based on these studies, we conclude that IFN-gamma is absolutely required for an efficient activation of

Continuous in vivo infusion of interferon-gamma (IFN-γ) enhances engraftment of syngeneic wild-type cells in Fanca–/– and Fancg–/– mice

PubMed Central

Si, Yue; Ciccone, Samantha; Yang, Feng-Chun; Yuan, Jin; Zeng, Daisy; Chen, Shi; van de Vrugt, Henri J.; Critser, John; Arwert, Fre; Haneline, Laura S.; Clapp, D. Wade

2006-01-01

Fanconi anemia (FA) is a heterogeneous genetic disorder characterized by bone marrow (BM) failure and cancer susceptibility. Identification of the cDNAs of FA complementation types allows the potential of using gene transfer technology to introduce functional cDNAs as transgenes into autologous stem cells and provide a cure for the BM failure in FA patients. However, strategies to enhance the mobilization, transduction, and engraftment of exogenous stem cells are required to optimize efficacy prior to widespread clinical use. Hypersensitivity of Fancc–/– cells to interferon-gamma (IFN-γ), a nongenotoxic immune-regulatory cytokine, enhances engraftment of syngeneic wild-type (WT) cells in Fancc–/– mice. However, whether this phenotype is of broad relevance in other FA complementation groups is unresolved. Here we show that primitive and mature myeloid progenitors in Fanca–/– and Fancg–/– mice are hypersensitive to IFN-γ and that in vivo infusion of IFN-γ at clinically relevant concentrations was sufficient to allow consistent long-term engraftment of isogenic WT repopulating stem cells. Given that FANCA, FANCC, and FANCG complementation groups account for more than 90% of all FA patients, these data provide evidence that IFN-γ conditioning may be a useful nongenotoxic strategy for myelopreparation in FA patients. PMID:16946306

Interferon-gamma of the giant panda (Ailuropoda melanoleuca): complementary DNA cloning, expression, and phylogenetic analysis.

PubMed

Tao, Yaqiong; Zeng, Bo; Xu, Liu; Yue, Bisong; Yang, Dong; Zou, Fangdong

2010-01-01

Interferon-gamma (IFN-gamma) is the only member of type II IFN and is vital in the regulation of immune and inflammatory responses. Herein we report the cloning, expression, and sequence analysis of IFN-gamma from the giant panda (Ailuropoda melanoleuca). The open reading frame of this gene is 501 base pair in length and encodes a polypeptide consisting of 166 amino acids. All conserved N-linked glycosylation sites and cysteine residues among carnivores were found in the predicted amino acid sequence of the giant panda. Recombinant giant panda IFN-gamma with a V5 epitope and polyhistidine tag was expressed in HEK293 host cells and confirmed by Western blotting. Phylogenetic analysis of mammalian IFN-gamma-coding sequences indicated that the giant panda IFN-gamma was closest to that of carnivores, then to ungulates and dolphin, and shared a distant relationship with mouse and human. These results represent a first step into the study of IFN-gamma in giant panda.

Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice

PubMed Central

Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.

2001-01-01

Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339

Histaminergic regulation of interferon-gamma (IFN-γ) production by human natural killer (NK) cells

PubMed Central

ASEA, A; HANSSON, M; CZERKINSKY, C; HOUZE, T; HERMODSSON, S; STRANNEGÅRD, Ö; HELLSTRAND, K

1996-01-01

Monocytes, recovered from human peripheral blood by counter-current centrifugal elutriation, effectively inhibit the production of IFN-γ by CD3−/56+ NK cells in response to IL-2. This study aimed at defining the nature of the inhibitory signal, particularly the importance of monocyte-derived reactive metabolites of oxygen. It was found that monocytes recovered from patients with chronic granulomatous disease (CGD), a condition characterized by deficient NADPH-oxidase activity of phagocytes, did not inhibit IFN-γ production by NK cells. Further, catalase, a scavenger of hydrogen peroxide, completely reversed the inhibitory signal, whereas scavengers of the superoxide anion, hypohalous acids, the hydroxyl radical, or nitric oxide synthesis inhibitors such as L-NMMA were ineffective. Inhibition of IFN-γ production was operating on a pre-translational level, as indicated by the inability of enriched NK cells to accumulate IFN-γ mRNA in the presence of elutriated monocytes. Hydrogen peroxide, at micromolar concentrations, reconstituted the inhibition of IFN-γ production when added to enriched NK cells. Histamine, a biogenic amine which inhibits the generation of reactive oxygen metabolites in monocytes, abrogated the inhibition of IFN-γ production in NK cells; by this mechanism, histamine strongly synergized with IL-2 to induce IFN-γ in mixtures of NK cells and monocytes. The synergizing effect of histamine was specifically mediated by H2-type histamine receptors. We conclude that: (i) the induction of IFN-γ mRNA in NK cells is effectively down-regulated by products of the oxidative metabolism of monocytes; and (ii) histamine effectively enhances IFN-γ production by preventing monocyte-induced oxidative damage to NK cells. PMID:8706348

Is secretion of IFN-gamma in response to Mycobacterium tuberculosis antigens in youngest children sufficient to play a role in TB diagnostics?

PubMed

Bielecka, Teresa; Komorowska-Piotrowska, Anna; Krenke, Katarzyna; Feleszko, Wojciech; Kulus, Marek

2018-02-01

To assess whether children ≤5 years of age, produce sufficient amounts of interferon gamma (IFN-ɣ) in response to phytohaemagglutinin (mitogen), and Mycobacterium tuberculosis antigens (TB antigens) in the QuantiFERON-TB Gold in-Tube test (QFT-GIT), (Cellestis Ltd., Australia). Is TB-antigen-induced IFN-ɣ response in children ≤5 years sufficient to consider QFT-GIT a possible tool for TB diagnostics? Study design, patient-subject selection, and methods: We recruited children 0-17 years old suspected of TB infection to this cross-sectional study, in whom QFT-GIT and TST were performed. We analyzed the median IFN-ɣ levels in mitogen and TB antigen tubes in children ≤5 years and >5 years, and the correlation between IFN-ɣ level in both tubes and age. A total of 153 children were enrolled, age median was 7.8 (IQR:8), 45 (29.4%) aged ≤5 years (median 3.4, IQR:1.7), 108 > 5 years (median 10.55, IQR:5.93). In the mitogen tubes, the median IFN-ɣ level was higher in children >5 years (median 17.87, IQR:2.1 vs 16.77, IQR:7.6), but surprisingly in the TB antigen tubes it was higher in the younger group (median 0.12, IQR:0.21vs 0.06, IQR:0.09, P = 0.04). We proved a positive correlation between IFN-ɣ level and age in mitogen tubes (r = 0.18, P = 0.03) and a negative correlation in TB antigen tubes (r = -0.17, P = 0.04). In latent tuberculosis infection patients, the latter correlation was found to be even stronger (r = -0.39, P = 0.01). The youngest children release sufficient amount of IFN-ɣ in response to TB antigens thus QFT-GIT might be a useful tool for TB diagnostics in this age group. © 2017 Wiley Periodicals, Inc.

A CpG Oligonucleotide Can Protect Mice from a Low Aerosol Challenge Dose of Burkholderia mallei

PubMed Central

Waag, David M.; McCluskie, Michael J.; Zhang, Ningli; Krieg, Arthur M.

2006-01-01

Treatment with an oligodeoxynucleotide (ODN) containing CPG motifs (CpG ODN 7909) was found to protect BALB/c mice from lung infection or death after aerosol challenge with Burkholderia mallei. Protection was associated with enhanced levels of gamma interferon (IFN-γ)-inducible protein 10, interleukin-12 (IL-12), IFN-γ, and IL-6. Preexposure therapy with CpG ODNs may protect victims of a biological attack from glanders. PMID:16495571

A Promising IFN-Deficient System to Manufacture IFN-Sensitive Influenza Vaccine Virus.

PubMed

Chen, Can; Fan, Wenhui; Li, Jing; Zheng, Weinan; Zhang, Shuang; Yang, Limin; Liu, Di; Liu, Wenjun; Sun, Lei

2018-01-01

Interferon (IFN)-sensitive and replication-incompetent influenza viruses are likely to be the alternatives to inactivated and attenuated virus vaccines. Some IFN-sensitive influenza vaccine candidates with modified non-structural protein 1 (NS1) are highly attenuated in IFN-competent hosts but induce robust antiviral immune responses. However, little research has been done on the manufacturability of these IFN-sensitive vaccine viruses. Here, RIG-I-knockout 293T cells were used to package the IFN-sensitive influenza A/WSN/33 (H1N1) virus expressing the mutant NS1 R38A/K41A. We found that the packaging efficiency of the NS1 R38A/K41A virus in RIG-I-knockout 293T cells was much higher than that in 293T cells. Moreover, the NS1 R38A/K41A virus almost lost its IFN antagonist activity and could no longer replicate in A549, MDCK, and Vero cells after 3-6 passages. This indicated that the replication of NS1 R38A/K41A virus is limited in conventional cells. Therefore, we further established a stable Vero cell line expressing the wild-type (WT) NS1 of the WSN virus, based on the Tet-On 3G system. The NS1 R38A/K41A virus was able to steadily propagate in this IFN-deficient cell line for at least 20 passages. In a mouse model, the NS1 R38A/K41A virus showed more than a 4-log reduction in lung virus titers compared to the WT virus at 3 and 5 days post infection. Furthermore, we observed that the NS1 R38A/K41A virus triggered high-level of IFN-α/β production in lung tissues and was eliminated from the host in a relatively short period of time. Additionally, this virus induced high-titer neutralizing antibodies against the WT WSN, A/Puerto Rico/8/1934 (PR8), or A/California/04/2009 (CA04) viruses and provided 100% protection against the WT WSN virus. Thus, we found that the replication of the NS1 R38A/K41A virus was limited in IFN-competent cells and mice. We also presented a promising IFN-deficient system, involving a RIG-I-knockout 293T cell line to package the IFN

Effect of interferon-gamma on complement gene expression in different cell types.

PubMed

Lappin, D F; Guc, D; Hill, A; McShane, T; Whaley, K

1992-01-15

We have studied the expression of the complement components C2, C3, factor B, C1 inhibitor (C1-inh), C4-binding protein (C4-bp) and factor H in human peripheral blood monocytes, skin fibroblasts, umbilical vein endothelial cells (HUVEC) and the human hepatoma cell line G2 (Hep G2) in the absence and the presence of interferon-gamma (IFN-gamma). E.l.i.s.a. performed on culture fluids, run-on transcription assays, Northern blot and double-dilution dot-blot techniques confirmed that monocytes expressed all six components, whereas fibroblasts, HUVEC and HepG2 each expressed five of the six components. Fibroblasts and HUVEC did not synthesize C4-bp, and Hep G2 did not produce factor H. In addition to these differences, the synthesis rates of C3, C1-inh and factor H were not the same in all cell types. However, the synthesis rates of C2 and factor B were similar in all four cell types. The half-lives of the mRNAs were shorter in monocytes than in other cell types. Monocyte factor H mRNA had a half-life of 12 min in monocytes, compared with over 3 h in fibroblasts and HUVEC. The instability of factor H mRNA in monocytes may contribute to their low factor H secretion rate. IFN-gamma produced dose-dependent stimulation of C2, factor B, C1-inh, C4-bp and factor H synthesis by all cell types expressing these proteins, but decreased C3 synthesis in all four cell types. Cell-specific differences in the response to IFN-gamma were observed. The increased rates of transcription of the C1-inh and factor H genes in HUVEC were greater than in other cell types, while the increased rate of transcription of the C2, factor B and C1-inh genes in Hep G2 cells was less than in other cell types. IFN-gamma did not affect the stability of C3, factor H or C4 bp mRNAs, but increased the stability of factor B and C1-inh mRNAs and decreased the stability of C2 mRNA. Although these changes occurred in all four cell types studied, the half-life of C1-inh mRNA in monocytes was increased almost 4-fold

Interferon-gamma: biologic functions and HCV therapy (type I/II) (1 of 2 parts).

PubMed

Gattoni, A; Parlato, A; Vangieri, B; Bresciani, M; Derna, R

2006-01-01

This review is aimed at exhaustively presenting and discussing the interferon-gamma (IFN-gamma), a cytokine that plays an important role in inducing and modulating an array of immune responses. A review of the most significant and recent clinical trials was performed. Although IFN-gamma has some antiviral activity, it is much less active in this regard than type I IFNs. IFN-gamma is involved in the regulation of nearly all phases of the immune and inflammatory responses, including the activation and differentiation of T cells, B cells, NK cells, macrophages, and others. It is therefore best regarded as a distint immunoregulatory cytokine. IFN-gamma secretion is a hallmark of Th1 lymphocytes. It is also secreted by nearly all CD8 T cells, by some Th0 cells, and by NK cells. Each of these cell types secretes IFN-gamma only when activated, usually as part of immune response and especially in response to IL-2 and IL-12. IFN-gamma production is inhibited by IL-4, IL-10, TGFbeta, glucocorticoids, cyclosporin A and FK506. Nearly all cell types express the heterodimeric receptor for IFN-beta and respond to this cytokine by increasing the surface expression of class I MHC proteins. As a result, virtually any cell in the vicinity of an IFN-beta-secreting cell becomes more efficient at presenting endogenous antigens and hence a better target for cytotoxic killing if it harbors an intracellular pathogen. Unlike the type I IFNs, IFN-gamma also increases the expression of class II MHC proteins on professional APCs, and so promotes antigen presentation to helper T cells as well. It also induces de novo expression of class II MHC proteins on venular endothelial cells and on some other epithelial and connective tissue cells that do not otherwise express them, thus enabling these cell types to function as temporary APCs at sites of intense immune reactions. The effector functions of NK cells are to lyse virus-infected cells and to secrete IFN-gamma, which activates macrofages to

Evaluating pleural ADA, ADA2, IFN-γ and IGRA for diagnosing tuberculous pleurisy.

PubMed

Keng, Li-Ta; Shu, Chin-Chung; Chen, Jason Yao-Ping; Liang, Sheng-Kai; Lin, Ching-Kai; Chang, Lih-Yu; Chang, Chia-Hao; Wang, Jann-Yuan; Yu, Chong-Jen; Lee, Li-Na

2013-10-01

Conventional methods for diagnosing tuberculous pleurisy (TB pleurisy) are either invasive or have a long turn-around-time. Performances of pleural adenosine deaminase (ADA), ADA2, interferon-gamma (IFN-γ), and interferon-gamma release assays (IGRA) as diagnostic tools for TB pleurisy were evaluated. Eighty-eight patients with lymphocyte-predominant pleural exudates between June 2010 and March 2011, including 31 with clinically diagnosed TB pleurisy, were prospectively studied. Pleural ADA and ADA2 activity were measured by colorimetric method, IFN-γ levels by enzyme-linked immuno-sorbent assay, and IGRA by enzyme-linked immuno-spot (T-SPOT.TB) assay. Pleural ADA, ADA2, and IFN-γ levels, but not the proportion of positive T-SPOT.TB assay, were significantly higher in patients with TB pleurisy than in those without TB pleurisy. The area under the receiver-operating-characteristic (ROC) curve was 0.920, 0.893, 0.875, and 0.544 for IFN-γ, ADA2, ADA, and T-SPOT.TB assay, respectively. The combination of ADA ≥ 40 IU/L and IFN-γ ≥ 75 pg/mL yielded a specificity of 100%. Pleural ADA, ADA2 and IFN-γ, but not T-SPOT.TB assay, are all sensitive and specific for TB pleurisy. In patients with lymphocyte-predominant pleural exudates, ADA ≥ 40 IU/L and IFN-γ ≥ 75 pg/mL in pleural effusion imply a very high probability of TB pleurisy. Copyright © 2013 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

TNF-alpha, but not IFN-gamma, regulates CCN2 (CTGF), collagen type I, and proliferation in mesangial cells: possible roles in the progression of renal fibrosis.

PubMed

Cooker, Laurinda A; Peterson, Darryl; Rambow, Joann; Riser, Melisa L; Riser, Rebecca E; Najmabadi, Feridoon; Brigstock, David; Riser, Bruce L

2007-07-01

Connective tissue growth factor (CCN2) is a profibrotic factor acting downstream and independently of TGF-beta to mediate renal fibrosis. Although inflammation is often involved in the initiation and/or progression of fibrosis, the role of inflammatory cytokines in regulation of glomerular CCN2 expression, cellular proliferation, and extracellular matrix accumulation is unknown. We studied two such cytokines, TNF-alpha and IFN-gamma, for their effects on cultured mesangial cells in the presence or absence of TGF-beta, as a model for progressive renal fibrosis. Short-term treatment with TNF-alpha, like TGF-beta, significantly increased secreted CCN2 per cell, but unlike TGF-beta inhibited cellular replication. TNF-alpha combined with TGF-beta further increased CCN2 secretion and mRNA levels and reduced proliferation. Surprisingly, however, TNF-alpha treatment decreased baseline collagen type I protein and mRNA levels and largely blocked their stimulation by TGF-beta. Long-term treatment with TGF-beta or TNF-alpha alone no longer increased CCN2 protein levels. However, the combination synergistically increased CCN2. IFN-gamma had no effect on either CCN2 or collagen activity and produced a mild inhibition of TGF-beta-induced collagen only at a high concentration (500 U/ml). In summary, we report a strong positive regulatory role for TNF-alpha, but not IFN-gamma, in CCN2 production and secretion, including that driven by TGF-beta. The stimulation of CCN2 release by TNF-alpha, unlike TGF-beta, is independent of cellular proliferation and not linked to increased collagen type I accumulation. This suggests that the paradigm of TGF-beta-driven CCN2 with subsequent collagen production may be overridden by an as yet undefined inhibitory mechanism acting either directly or indirectly on matrix metabolism.

High frequencies of circulating IFN-gamma-secreting CD8 cytotoxic T cells specific for a novel MHC class I-restricted Mycobacterium tuberculosis epitope in M. tuberculosis-infected subjects without disease.

PubMed

Pathan, A A; Wilkinson, K A; Wilkinson, R J; Latif, M; McShane, H; Pasvol, G; Hill, A V; Lalvani, A

2000-09-01

MHC class I-restricted CD8 cytotoxic T lymphocytes (CTL) are essential for protective immunity to Mycobacterium tuberculosis in animal models but their role in humans remains unclear. We therefore studied subjects who had successfully contained M. tuberculosis infection in vivo, i.e. exposed healthy household contacts and individuals with inactive self-healed pulmonary tuberculosis. Using the ELISPOT assay for IFN-gamma, we screened peptides from ESAT-6, a secreted antigen that is highly specific for M. tuberculosis. We identified a novel nonamer epitope: unstimulated peripheral blood-derived CD8 T cells displayed peptide-specific IFN-gamma release ex vivo while CD8 T cell lines and clones exhibited HLA-A68.02-restricted cytolytic activity and recognized endogenously processed antigen. The frequency of CD8 CTL specific for this single M. tuberculosis epitope, 1/2500 peripheral blood lymphocytes, was equivalent to the combined frequency of all IFN-gamma-secreting purified protein derivative-reactive T cells ex vivo. This highly focused CTL response was maintained in an asymptomatic contact over 2 years and is the most potent antigen-specific antimycobacterial CD8 CTL response hitherto described. Thus, human M. tuberculosis-specific CD8 CTL are not necessarily associated with active disease per se. Rather, our results are consistent with a protective role for these ESAT-6-specific CD8 T cells in the long-term control of M. tuberculosis in vivo in humans.

[Aerosolized recombinant interferon-gamma prevent antigen-induced eosinophil recruitment in guinea pig trachea].

PubMed

Gao, Y; Chenping; Lin, X P

1997-10-01

In order to determine whether interferon-gamma (IFN-gamma) inhibits eosinphil infiltration in the trachea of asthmatic guinea pigs induced by Rhizopus nigricans. We had administered aerosolized rIFN-gamma in the tracheas of 30 sensitized guinea pigs which had been divided into six groups, then teated animal inhaled rIFN-gamma of 5 x 10(4), 20 x 10(4), and 40 x 10(4) concentration, BDP and normal saline respectively at 24 h, 12 h, 2 h before being challenged. (1) Provocation positive rates decreased in 40 x 10(4) rIFN-gamma and BDP group compared with that in normal saline group and before intervention (P < 0.05), airway resistence decreased (P < 0.01). (2) The administration of aerosolized rIFN-gamma (40 x 10(4)) and BDP also decreased fungus-induced eosnophils but not other cells infiltration in the trachea. (3) In BALF, Eos count and ECP level were obviously lower than those in other groups. However, eosinophil numbers did not show significant change in the peripheral blood. Local administration of rIFN-gamma (40 x 10(4)) may reduce airway inflammation and intervene asthmatic attack by inhibition of Eos, ECP infiltration in airways.

[Regulating human interferon-gamma gene expression in marrow stromal cells in mice by Tet-off system].

PubMed

Qin, Xin-Tian; Lu, Yue; Tan, Yin-Duo; Chen, Xiao-Qin; Gen, Qi-Rong

2008-01-01

We have constructed plasmid "pTre-IFN-gamma" and proved that the Tet-off system could regulate the expression of human interferon-gamma (IFN-gamma) gene in murine marrow stromal cells in vitro. This study was to investigate the regulatory reversibility of Tet-off system and its effect on the expression of human IFN-gamma gene in murine marrow stromal cells in mice. Plasmids pTet-off and pTre-IFN-gamma were co-transfected into murine marrow stromal cells. The expression of IFN-gamma in marrow stromal cells was detected with ELISA. The marrow stromal cells were transfused into BABL/c naked mice after co-transfection. The expression of IFN-gamma mRNA in the spleen was detected by real-time fluorescent quantitative reverse transcription-polymerase chain reaction (RT-PCR). IFN-gamma protein was detected in the culture solution of marrow stromal cells after co-transfection. The secretion peak appeared within the first 72 h. The protein level of IFN-gamma was significantly lower in 300 ng/ml tetracycline hydrochloride-treated marrow stroma cells than in untreated cells [(67.11+/-22.14) pg/1 x 10(7) cells vs. (319.96+/-29.04) pg/1 x 10(7) cells, P<0.001]; its expression was increased when removed tetracycline hydrochloride (P=0.032). The expression of human IFN-gamma mRNA was detected in the spleen. The mRNA level of IFN-gamma was significantly higher in untreated group than in continuous tetracycline hydrochloride-treated group [(1.5+/-0.7)x10(5) copies . (100 mg)(-1) vs. (6.9+/-5.3)x10(2) copies . (100 mg)(-1), P<0.001]; its expression in the mice received tetracycline hydrochloride for one single time lay between the above two groups with significant difference. In mice, Tet-off system could rapidly, efficiently and reversibly regulate the expression of human IFN-gamma gene in marrow stromal cells in vitro and in vivo.

High resolution mapping of the binding site on human IgG1 for Fc gamma RI, Fc gamma RII, Fc gamma RIII, and FcRn and design of IgG1 variants with improved binding to the Fc gamma R.

PubMed

Shields, R L; Namenuk, A K; Hong, K; Meng, Y G; Rae, J; Briggs, J; Xie, D; Lai, J; Stadlen, A; Li, B; Fox, J A; Presta, L G

2001-03-02

Immunoglobulin G (IgG) Fc receptors play a critical role in linking IgG antibody-mediated immune responses with cellular effector functions. A high resolution map of the binding site on human IgG1 for human Fc gamma RI, Fc gamma RIIA, Fc gamma RIIB, Fc gamma RIIIA, and FcRn receptors has been determined. A common set of IgG1 residues is involved in binding to all Fc gamma R; Fc gamma RII and Fc gamma RIII also utilize residues outside this common set. In addition to residues which, when altered, abrogated binding to one or more of the receptors, several residues were found that improved binding only to specific receptors or simultaneously improved binding to one type of receptor and reduced binding to another type. Select IgG1 variants with improved binding to Fc gamma RIIIA exhibited up to 100% enhancement in antibody-dependent cell cytotoxicity using human effector cells; these variants included changes at residues not found at the binding interface in the IgG/Fc gamma RIIIA co-crystal structure (Sondermann, P., Huber, R., Oosthuizen, V., and Jacob, U. (2000) Nature 406, 267-273). These engineered antibodies may have important implications for improving antibody therapeutic efficacy.

Development of an aptamer beacon for detection of interferon-gamma.

PubMed

Tuleuova, Nazgul; Jones, Caroline N; Yan, Jun; Ramanculov, Erlan; Yokobayashi, Yohei; Revzin, Alexander

2010-03-01

Traditional antibody-based affinity sensing strategies employ multiple reagents and washing steps and are unsuitable for real-time detection of analyte binding. Aptamers, on the other hand, may be designed to monitor binding events directly, in real-time, without the need for secondary labels. The goal of the present study was to design an aptamer beacon for fluorescence resonance energy transfer (FRET)-based detection of interferon-gamma (IFN-gamma)--an important inflammatory cytokine. Variants of DNA aptamer modified with biotin moieties and spacers were immobilized on avidin-coated surfaces and characterized by surface plasmon resonance (SPR). The SPR studies showed that immobilization of aptamer via the 3' end resulted in the best binding IFN-gamma (K(d) = 3.44 nM). This optimal aptamer variant was then used to construct a beacon by hybridizing fluorophore-labeled aptamer with an antisense oligonucleotide strand carrying a quencher. SPR studies revealed that IFN-gamma binding with an aptamer beacon occurred within 15 min of analyte introduction--suggesting dynamic replacement of the quencher-complementary strand by IFN-gamma molecules. To further highlight biosensing applications, aptamer beacon molecules were immobilized inside microfluidic channels and challenged with varying concentration of analyte. Fluorescence microscopy revealed low fluorescence in the absence of analyte and high fluorescence after introduction of IFN-gamma. Importantly, unlike traditional antibody-based immunoassays, the signal was observed directly upon binding of analyte without the need for multiple washing steps. The surface immobilized aptamer beacon had a linear range from 5 to 100 nM and a lower limit of detection of 5 nM IFN-gamma. In conclusion, we designed a FRET-based aptamer beacon for monitoring of an inflammatory cytokine-IFN-gamma. In the future, this biosensing strategy will be employed to monitor dynamics of cytokine production by the immune cells.

Blood concentrations of the cytokines IL-1beta, IL-6, IL-10, TNF-alpha and IFN-gamma during experimentally induced swine dysentery.

PubMed

Kruse, Robert; Essén-Gustavsson, Birgitta; Fossum, Caroline; Jensen-Waern, Marianne

2008-08-12

Knowledge of the cytokine response at infection with Brachyspira hyodysenteriae can help understanding disease mechanism involved during swine dysentery. Since this knowledge is still limited the aim of the present study was to induce dysentery experimentally in pigs and to monitor the development of important immunoregulatory cytokines in blood collected at various stages of the disease. Ten conventional pigs (~23 kg) were orally inoculated with Brachyspira hyodysenteriae B204T. Eight animals developed muco-haemorrhagic diarrhoea with impaired general body condition. Blood was sampled before inoculation and repeatedly during acute dysentery and recovery periods and cytokine levels of IL-1beta, IL-6, Il-10, TNF-alpha and IFN-gamma were measured by ELISA. IL-1beta was increased at the beginning of the dysentery period and coincided with the appearance of Serum amyloid A and clinical signs of disease. TNF-alpha increased in all animals after inoculation, with a peak during dysentery, and IL-6 was found in 3 animals during dysentery and in the 2 animals that did not develop clinical signs of disease. IL-10 was found in all sick animals during the recovery period. IFN-gamma was not detected on any occasion. B. hyodysenteriae inoculation induced production of systemic levels of IL-1beta during the dysentery period and increased levels of IL-10 coincided with recovery from dysentery.

Differential co-promoting activities of alpha, beta and gamma interferons in the murine skin two-stage carcinogenesis model.

PubMed

Reiners, J J; Cantu, A; Thai, G; Pavone, A

1993-03-01

SENCAR mice develop more papillomas in two-stage skin carcinogenesis protocols if gamma interferon (IFN-gamma) is co-administered with 12-O-tetradecanoylphorbol-13-acetate (TPA) during the promotion phase. In the current study preparations of murine alpha, beta and gamma IFNs were surveyed for their abilities to modulate TPA-dependent promotion and induction of epidermal hyperplasia, inflammation and ornithine decarboxylase activity (ODC). Single or multiple i.p. administrations of IFN-alpha, -beta or -gamma (< or = 2500 units) did not induce epidermal hyperplasia, inflammation or ODC activity. Single or multiple i.p. administrations of IFN-alpha, -beta or -gamma (2500 units) to mice being topically promoted with 0.1 or 1 microgram of TPA did not alter the epidermal hyperplasia induced by the phorbol ester. The vascular permeability of the skin, as evaluated by the extravasation of Evans blue dye, was increased in a dose-dependent fashion by TPA over the range of 0.1-1 microgram. Treatment of mice promoted with 0.1 microgram of TPA with IFN-gamma (> or = 2500 units) significantly increased the skin's vascular permeability. Comparable effects were not obtained with IFN-beta (IFN-alpha not tested). Treatment of TPA-promoted mice with IFN-gamma, and to a lesser extent IFN-beta, weakly potentiated the TPA-dependent induction of epidermal ODC activity. Under conditions in which IFN-gamma had co-promoting activities in an initiation-promotion protocol, co-treatment of initiated mice with 1 microgram of TPA and IFN-alpha or -beta (100-5000 units) did not reproducibly alter tumor latency., or papilloma and carcinoma multiplicities. These findings suggest that the co-promoting activities of IFNs are restricted to the gamma class, and are not uniformly reflected by parameters commonly employed as short-term markers of tumor promotion.

CD8+ gamma-delta TCR+ and CD4+ T cells produce IFN-γ at 5-7 days after yellow fever vaccination in Indian rhesus macaques, before the induction of classical antigen-specific T cell responses.

PubMed

Neves, Patrícia C C; Rudersdorf, Richard A; Galler, Ricardo; Bonaldo, Myrna C; de Santana, Marlon Gilsepp Veloso; Mudd, Philip A; Martins, Maurício A; Rakasz, Eva G; Wilson, Nancy A; Watkins, David I

2010-11-29

The yellow fever 17D (YF-17D) vaccine is one of the most efficacious vaccines developed to date. Interestingly, vaccination with YF-17D induces IFN-γ production early after vaccination (days 5-7) before the development of classical antigen-specific CD8(+) and CD4(+) T cell responses. Here we investigated the cellular source of this early IFN-γ production. At days 5 and 7 post-vaccination activated CD8(+) gamma-delta TCR T cells produced IFN-γ and TNF-α. Activated CD4(+) T cells produced IFN-γ and TNF-α at day 7 post-vaccination. This early IFN-γ production was also induced after vaccination with recombinant YF-17D (rYF-17D), but was not observed after recombinant Adenovirus type 5 (rAd5) vaccination. Early IFN-γ production, therefore, might be an important aspect of yellow fever vaccination. Copyright © 2010 Elsevier Ltd. All rights reserved.

Gammadelta T lymphocytes from cystic fibrosis patients and healthy donors are high TNF-alpha and IFN-gamma-producers in response to Pseudomonas aeruginosa.

PubMed

Raga, Salvador; Julià, M Rosa; Crespí, Catalina; Figuerola, Joan; Martínez, Natalia; Milà, Joan; Matamoros, Núria

2003-01-01

Gammadelta T cells have an important immunoregulatory and effector function through cytokine release. They are involved in the responses to Gram-negative bacterium and in protection of lung epithelium integrity. On the other hand, they have been implicated in airway inflammation. The aim of the present work was to study intracytoplasmic IL-2, IL-4, IFN-gamma and TNF-alpha production by gammadelta and alphabeta T lymphocytes from cystic fibrosis patients and healthy donors in response to Pseudomonas aeruginosa (PA). Flow cytometric detection was performed after peripheral blood mononuclear cells (PBMC) culture with a cytosolic extract from PA and restimulation with phorbol ester plus ionomycine. Proliferative responses, activation markers and receptor usage of gammadelta T cells were also evaluated. The highest production of cytokine was of TNF-alpha and IFN-gamma, gammadelta being better producers than alphabeta. No differences were found between patients and controls. The Vgamma9delta2 subset of gammadelta T cells was preferentially expanded. CD25 and CD45RO expression by the alphabeta T subset and PBMC proliferative response to PA were defective in cystic fibrosis lymphocytes. Our results support the hypothesis that gammadelta T lymphocytes play an important role in the immune response to PA and in the chronic inflammatory lung reaction in cystic fibrosis patients. They do not confirm the involvement of a supressed Th1 cytokine response in the pathogenesis of this disease.

Wild type measles virus attenuation independent of type I IFN.

PubMed

Druelle, Johan; Sellin, Caroline I; Waku-Kouomou, Diane; Horvat, Branka; Wild, Fabian T

2008-02-03

Measles virus attenuation has been historically performed by adaptation to cell culture. The current dogma is that attenuated virus strains induce more type I IFN and are more resistant to IFN-induced protection than wild type (wt). The adaptation of a measles virus isolate (G954-PBL) by 13 passages in Vero cells induced a strong attenuation of this strain in vivo. The adapted virus (G954-V13) differs from its parental strain by only 5 amino acids (4 in P/V/C and 1 in the M gene). While a vaccine strain, Edmonston Zagreb, could replicate equally well in various primate cells, both G954 strains exhibited restriction to the specific cell type used initially for their propagation. Surprisingly, we observed that both G954 strains induced type I IFN, the wt strain inducing even more than the attenuated ones, particularly in human plasmacytoid Dendritic Cells. Type I IFN-induced protection from the infection of both G954 strains depended on the cell type analyzed, being less efficient in the cells used to grow the viral strain. Thus, mutations in M and P/V/C proteins can critically affect MV pathogenicity, cellular tropism and lead to virus attenuation without interfering with the alpha/beta IFN system.

Wild type measles virus attenuation independent of type I IFN

PubMed Central

Druelle, Johan; Sellin, Caroline I; Waku-Kouomou, Diane; Horvat, Branka; Wild, Fabian T

2008-01-01

Background Measles virus attenuation has been historically performed by adaptation to cell culture. The current dogma is that attenuated virus strains induce more type I IFN and are more resistant to IFN-induced protection than wild type (wt). Results The adaptation of a measles virus isolate (G954-PBL) by 13 passages in Vero cells induced a strong attenuation of this strain in vivo. The adapted virus (G954-V13) differs from its parental strain by only 5 amino acids (4 in P/V/C and 1 in the M gene). While a vaccine strain, Edmonston Zagreb, could replicate equally well in various primate cells, both G954 strains exhibited restriction to the specific cell type used initially for their propagation. Surprisingly, we observed that both G954 strains induced type I IFN, the wt strain inducing even more than the attenuated ones, particularly in human plasmacytoid Dendritic Cells. Type I IFN-induced protection from the infection of both G954 strains depended on the cell type analyzed, being less efficient in the cells used to grow the viral strain. Conclusion Thus, mutations in M and P/V/C proteins can critically affect MV pathogenicity, cellular tropism and lead to virus attenuation without interfering with the α/β IFN system. PMID:18241351

β-Glucan from Saccharomyces cerevisiae Induces IFN-γ Production In Vivo in BALB/c Mice.

PubMed

Javmen, Artur; Nemeikaitė-Čėnienė, Aušra; Bratchikov, Maksim; Grigiškis, Saulius; Grigas, Fortūnatas; Jonauskienė, Irena; Zabulytė, Danguolė; Mauricas, Mykolas

2015-01-01

β-Glucan is one of the most abundant polymers in nature and has been established as an immunomodulator. This compound has notable physiological effects on mammalian immune systems, including anti-tumor and anti-infective activities and can activate the immune response. It is considered that the immune-stimulating activities of β-glucan can depend on physicochemical parameters, such as molecular size. Saccharomyces cerevisiae, also known as baker's yeast, is a frequently used source of β-glucan. The aim of the experiments was to investigate how different Saccharomyces cerevisiae β-glucan preparations with different molecular size affect interferon-gamma (IFN-γ) production in BALB/c mice. In vivo and in vitro BALB/c mouse models were used for the investigations. Different β-glucan preparations were orally administrated in the in vivo experiments. IFN-γ production in BALB/c mice was analyzed by enzyme-linked immunosorbent assay and measuring interferon-γ RNA concentration. The results showed that orally-administered β-glucan from S. cerevisiae enhanced IFN-γ production in BALB/c mice in the in vivo model, but not by mouse leukocytes in vitro. Moreover, water-soluble β-glucan enhanced IFN-γ production more effectively than did particulate β-glucan. IFN-γ plays an important role in immunity against viral and bacterial infections. Our experiments have shown that β-glucan preparations enhance IFN-γ production in BALB/c mice and can be potentially used for immune system stimulation in mammals. Current results may be used to develop soluble β-glucan nutritional supplements. Copyright © 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

Induced expression of mRNA for IL-5, IL-6, TNF-alpha, MIP-2 and IFN-gamma in immunologically activated rat peritoneal mast cells: inhibition by dexamethasone and cyclosporin A.

PubMed

Williams, C M; Coleman, J W

1995-10-01

We examined the capacity of purified rat peritoneal connective tissue-type mast cells (PMC) to express mRNA for several cytokines. Stimulation of PMC with anti-IgE for 4 hr induced the expression of mRNA encoding interleukin-5 (IL-5), IL-6, tumour necrosis factor-alpha (TNF-alpha), macrophage inflammatory protein-2 (MIP-2) and interferon-gamma (IFN-gamma). Unstimulated PMC expressed detectable mRNA for TNF-alpha but not for the other four cytokines. Incubation of PMC with cyclosporin A (CsA) or dexamethasone (DEX), each at 10(-6) M for 24 hr, significantly inhibited the induced expression of mRNA for each of the five cytokines, and also inhibited release of biologically active TNF-alpha. Throughout these experiments mRNA levels of the housekeeping gene G3PDH were not altered by stimulation with anti-IgE or incubation with CsA or DEX. We conclude that immunological activation of rat PMC induces gene expression of several cytokines and that expression of these genes can be inhibited by immunosuppressive drugs.

Induced expression of mRNA for IL-5, IL-6, TNF-alpha, MIP-2 and IFN-gamma in immunologically activated rat peritoneal mast cells: inhibition by dexamethasone and cyclosporin A.

PubMed Central

Williams, C M; Coleman, J W

1995-01-01

We examined the capacity of purified rat peritoneal connective tissue-type mast cells (PMC) to express mRNA for several cytokines. Stimulation of PMC with anti-IgE for 4 hr induced the expression of mRNA encoding interleukin-5 (IL-5), IL-6, tumour necrosis factor-alpha (TNF-alpha), macrophage inflammatory protein-2 (MIP-2) and interferon-gamma (IFN-gamma). Unstimulated PMC expressed detectable mRNA for TNF-alpha but not for the other four cytokines. Incubation of PMC with cyclosporin A (CsA) or dexamethasone (DEX), each at 10(-6) M for 24 hr, significantly inhibited the induced expression of mRNA for each of the five cytokines, and also inhibited release of biologically active TNF-alpha. Throughout these experiments mRNA levels of the housekeeping gene G3PDH were not altered by stimulation with anti-IgE or incubation with CsA or DEX. We conclude that immunological activation of rat PMC induces gene expression of several cytokines and that expression of these genes can be inhibited by immunosuppressive drugs. Images Figure 1 Figure 2 Figure 3 PMID:7490125

Interferon (IFN)-λ Takes the Helm: Immunomodulatory Roles of Type III IFNs

PubMed Central

Zanoni, Ivan; Granucci, Francesca; Broggi, Achille

2017-01-01

Type III interferons (IFNs) (or IFN-λ) are the latest addition to the IFN family. Even though they share little protein homology with type I IFN, both exhibit remarkable functional similarities: each can be induced in response to viral infections, and both lead to Janus kinases (JAK) and signal transducer and activator of transcription (STAT) activation. The JAK/STAT pathway induces antiviral responses and IFN-stimulated gene transcription. However, despite the similarities in their effector functions with type I IFNs, IFN-λ also has a non-redundant role in protecting barrier organs: epithelial cells preferentially produce IFN-λ rather than type I IFNs; and interferon lambda receptor 1 (IFNLR1), the specific receptor for IFN-λ, is highly expressed on cells of epithelial lineage. Thus far, IFN-λ has been considered mainly as an epithelial cytokine, which restricts viral replication in epithelial cells and constitutes an added layer of protection at mucosal sites. However, it is now increasingly recognized that IFNLR1 is expressed broadly, and that immune cells such as neutrophils and dendritic cells also respond to IFN-λ. Moreover, in many in vivo models, IFN-λ modulates immune cell functions and thereby configures itself less as a cytokine that is only specific to the epithelium, and more as a cytokine that directly controls the inflammatory response at mucosal sites. Here, we critically review the recent literature on immune modulatory roles for IFN-λ, and distinguish between the direct and indirect effects of this IFN on immune cell functions in different inflammatory settings. PMID:29234323

Interferon (IFN)-λ Takes the Helm: Immunomodulatory Roles of Type III IFNs.

PubMed

Zanoni, Ivan; Granucci, Francesca; Broggi, Achille

2017-01-01

Type III interferons (IFNs) (or IFN-λ) are the latest addition to the IFN family. Even though they share little protein homology with type I IFN, both exhibit remarkable functional similarities: each can be induced in response to viral infections, and both lead to Janus kinases (JAK) and signal transducer and activator of transcription (STAT) activation. The JAK/STAT pathway induces antiviral responses and IFN-stimulated gene transcription. However, despite the similarities in their effector functions with type I IFNs, IFN-λ also has a non-redundant role in protecting barrier organs: epithelial cells preferentially produce IFN-λ rather than type I IFNs; and interferon lambda receptor 1 (IFNLR1), the specific receptor for IFN-λ, is highly expressed on cells of epithelial lineage. Thus far, IFN-λ has been considered mainly as an epithelial cytokine, which restricts viral replication in epithelial cells and constitutes an added layer of protection at mucosal sites. However, it is now increasingly recognized that IFNLR1 is expressed broadly, and that immune cells such as neutrophils and dendritic cells also respond to IFN-λ. Moreover, in many in vivo models, IFN-λ modulates immune cell functions and thereby configures itself less as a cytokine that is only specific to the epithelium, and more as a cytokine that directly controls the inflammatory response at mucosal sites. Here, we critically review the recent literature on immune modulatory roles for IFN-λ, and distinguish between the direct and indirect effects of this IFN on immune cell functions in different inflammatory settings.

Role of CD28/B7 costimulation in the dexamethasone-induced suppression of IFN-gamma.

PubMed

Agarwal, S K; Marshall, G D

2000-11-01

In vitro exposure of peripheral blood mononuclear cells (PBMC) to glucocorticoids (GC), at concentrations observed during psychologic stress, induces a shift in the human type 1/type 2 cytokine balance toward a type 2 cytokine response. The mechanisms involved in these cytokine alterations are unknown but likely include modulation of regulatory cytokines or the interaction between the antigen-presenting cell (APC) and T lymphocyte or both. The CD28/B7 costimulation pathway has been reported to modulate the type 1/type 2 cytokine balance and may contribute to the GC-associated cytokine alterations. Therefore, we sought to determine the effect of dexamethasone (Dex) on the expression and function of the human CD28/B7 costimulatory pathway and whether these alterations contribute to the Dex-induced type 1/type 2 cytokine alterations. Dex inhibited the expression of both CD80 and CD86 on THP-1 cells, a human acute monocytic leukemia cell line, as determined by flow cytometry. Dex also inhibited the expression of CD28 and CTLA-4 on phytohemagglutinin (PHA)-stimulated CD3+ T lymphocytes, which was attenuated by the addition of interleukin-12 (IL-12). Lastly, activation of CD28 with anti-CD28 antibody attenuated the Dex-induced decrease in interferon-gamma (IFN-gamma) production by anti-CD3 antibody-stimulated PBMC. These data suggest that Dex induces a modulation of the CD28/B7 costimulatory pathway that contributes to the shift in the type 1/type 2 cytokine balance toward a predominant type 2 cytokine response.

Biosynthesis and N-glycosylation of human interferon-gamma. Asn25 and Asn97 differ markedly in how efficiently they are glycosylated and in their oligosaccharide composition.

PubMed

Sareneva, T; Mørtz, E; Tölö, H; Roepstorff, P; Julkunen, I

1996-12-01

Interferon-gamma (IFN-gamma) is a secretory glycoprotein produced by T cells in response to antigenic or mitogenic stimuli. We studied the kinetics of the synthesis, N-glycosylation, and secretion of IFN-gamma in human CD8+ T lymphocytes stimulated via T-cell receptor. Highly elevated IFN-gamma mRNA levels were found as early as 1 h after stimulation. Maximal IFN-gamma protein synthesis was observed 2-4 h after induction and appeared to correlate to steady-state IFN-gamma mRNA levels. As analyzed by pulse/chase experiments, the secretion of IFN-gamma from T cells was very rapid, the secretion half-time being approximately 20-25 min. Inhibition of N-glycosylation by tunicamycin dramatically reduced the expression of IFN-gamma, but did not block its secretion. Natural IFN-gamma is heterogeneously glycosylated and doubly, singly, and unglycosylated forms exist. Experiments performed in a cell-free translation/glycosylation system with mutated IFN-gamma constructs lacking either one of the potential glycosylation sites suggested that Asn25 is more efficiently glycosylated than Asn97. Site-specific oligosaccharide analysis of natural IFN-gamma by glycosidase treatment followed by matrix-assisted-laser-desorption-ionization mass spectrometry revealed considerable variation in the carbohydrate structures, with more than 30 different forms. The glycans at Asn25 consisted of fucosylated, mainly complex-type oligosaccharides, whereas the glycans at Asn97 were more heterogeneous, with hybrid and high-mannose structures. Our results emphasize the essential role of N-linked glycans in the biology of IFN-gamma and show that there is a considerable heterogeneity in the individual sugar chains of this important human cytokine.

Development of a lion-specific interferon-gamma assay.

PubMed

Maas, M; van Kooten, P J S; Schreuder, J; Morar, D; Tijhaar, E; Michel, A L; Rutten, V P M G

2012-10-15

The ongoing spread of bovine tuberculosis (BTB) in African free-ranging lion populations, for example in the Kruger National Park, raises the need for diagnostic assays for BTB in lions. These, in addition, would be highly relevant for zoological gardens worldwide that want to determine the BTB status of their lions, e.g. for translocations. The present study concerns the development of a lion-specific IFN-γ assay, following the production and characterization of monoclonal antibodies specific for lion interferon-gamma (IFN-γ). Recombinant lion IFN-γ (rLIFN-γ) was produced in mammalian cells and used to immunize mice to establish hybridoma cell lines producing monoclonal antibodies. These were used to develop a sensitive, lion IFN-γ-specific capture ELISA, able to detect rLIFN-γ to the level of 160 pg/ml. Recognition of native lion IFN-γ was shown in an initial assessment of supernatants of mitogen stimulated whole blood cultures of 11 known BTB-negative lions. In conclusion, the capture ELISA shows potential as a diagnostic assay for bovine tuberculosis in lions. Preliminary results also indicate the possible use of the test for other (feline) species. Copyright © 2012 Elsevier B.V. All rights reserved.

Double-blind trial of recombinant gamma-interferon versus placebo in the treatment of rheumatoid arthritis. 1989.

PubMed

Cannon, Grant W; Pincus, Seth H; Emkey, Ronald D; Denes, Alex; Cohen, Selwyn A; Wolfe, Frederick; Saway, P Anthony; Jaffer, Adrian M; Weaver, Arthur L; Cogen, Lewis; Schindler, John D

2008-02-01

One hundred five patients were enrolled in a 12-week, randomized, prospective, double-blind, placebo-controlled trial of recombinant human gamma-interferon (rHu gamma-IFN) for the treatment of rheumatoid arthritis. Fifty-four patients received rHu gamma-IFN and 51 received placebo. Forty-two patients in each group completed the 12-week trial. Some clinical improvement occurred in both groups of patients. Although the improvement with rHu gamma-IFN was greater than that with placebo, the differences were generally not statistically significant.

Should they stay, or should they go? Relative future risk of bovine tuberculosis for interferon-gamma test-positive cattle left on farms.

PubMed

Lahuerta-Marin, Angela; Gallagher, Martin; McBride, Stewart; Skuce, Robin; Menzies, Fraser; McNair, Jim; McDowell, Stanley W J; Byrne, Andrew W

2015-09-04

Bovine tuberculosis (bTB), caused by Mycobacterium bovis, is a serious infectious disease that remains an ongoing concern for cattle farming worldwide. Tuberculin skin-tests are often used to identify infected animals (reactors) during test-and-cull programs, however, due to relatively poor sensitivity, additional tests can be implemented in parallel. For example, in Northern Ireland interferon-gamma (IFN-g) testing is used in high-risk herds. However, skin-test negative animals which are positive to the IFN-g test are not required by law to be slaughtered - therefore the final choice for these animals' fate is left with the owner. During this study we investigated whether these animals represented a greater risk of becoming a skin reactor, relative to IFN-g test negative animals from the same herds. Our study population included 1107 IFN-g positive animals from 239 herds. A Cox-proportional hazard model indicated that animals which tested IFN-g positive were 2.31 times (95% CI: 1.92-2.79; P < 0.001) more likely to become a reactor compared with IFN-g negative animals. Animals from dairy herds, and from herds in the south-east, were of higher risk than animals from beef herds and other regions, respectively. Our findings suggest that IFN-g positive animals represent a higher risk of failing a skin-test in the future, indicating the value of IFN-g testing for identifying early-stage infected animals. These IFN-g positive animals are not under any disease restriction, and may move freely (trade), which may put recipient herds at increased risk. Our findings provide important evidence for stakeholders engaged in bTB eradication programs.

Development and testing of species-specific ELISA assays to measure IFN-γ and TNF-α in bottlenose dolphins (Tursiops truncatus)

PubMed Central

Eberle, Kirsten C.; Venn-Watson, Stephanie K.; Jensen, Eric D.; LaBresh, Joanna; Sullivan, Yvonne; Kakach, Laura

2018-01-01

Monitoring the immune status of cetaceans is important for a variety of health conditions. Assays to quantify cytokines, especially pro-inflammatory cytokines, could be employed, in addition to currently available diagnostic assays, to screen for alterations in the health status of an animal. Though a number of immunological assays are readily available for humans and mice, specific assays for many veterinary species, including cetaceans such as bottlenose dolphins (Tursiops truncatus), are more limited. Herein, we describe the development of IFN-gamma (IFN-γ) and TNF-alpha (TNF-α) enzyme-linked immunosorbent assays (ELISAs) specific to bottlenose dolphins. Utilizing these assays, we monitored the immune status of bottlenose dolphins from a managed population over a period of eleven months. The ELISA assays developed for bottlenose dolphins were used to measure IFN-γ and TNF-α in serum or in culture supernatants from peripheral blood mononuclear cells (PBMCs) stimulated with varying concentrations of mitogens concanavalin A (ConA) or phytohemagglutinin (PHA). Induction of TNF-α in PBMC cultures was consistently highest with 1 μg/mL ConA, while 1 μg/mL PHA induced the highest secretion of IFN-γ. Serum levels of TNF-α and IFN-γ remained relatively constant for each animal over the time period examined. CBC and plasma chemistry variables measured concurrently in the bottlenose dolphins were then examined as independent predictors of cytokine levels. We found these clinical variables were more likely to predict linear changes in serum IFN-γ and TNF-α levels compared to concentrations of these cytokines in mitogen-stimulated PBMC culture supernatants. Cytokine assays developed will be of substantial benefit in monitoring bottlenose dolphin health as an adjunct to currently available diagnostic tests. PMID:29304133

Nontuberculous mycobacterial infection with concurrent IgG4-related lymphadenopathy.

PubMed

Liu, Ting-Ting; Weng, Shao-Wen; Wang, Ming-Chung; Huang, Wan-Ting

2016-03-01

Disseminated nontuberculous mycobacteria (NTM) infection with concurrent IgG4-related lymphadenopathy has not been reported. We described a patient with neutralizing autoantibodies to interferon-gamma (IFN-γ) and elevated levels of serum IgG4 presenting with generalized lymphadenopathy and reactive dermatosis. Histologically, lymph nodes (LNs) showed effaced nodal architecture with polymorphic infiltrates, mimicking angioimmunoblastic T-cell lymphoma. Both the absolute number and the ratio of IgG4+ plasma cells to IgG+ plasma cells were increased. Mycobacterium abscessus was isolated from cultures of LNs, and demonstrated by polymerase chain reaction-restriction fragment length polymorphism. The skin biopsy showed neutrophilic dermatosis, consistent with Sweet syndrome. The patient met the criteria of both adult-onset immunodeficiency syndrome and IgG4-related lymphadenopathy. This case provides evidence of disseminated NTM infection with concurrent type III IgG4-related lymphadenopathy in the patient with anti-IFN-γ autoantibodies. © 2015 APMIS. Published by John Wiley & Sons Ltd.

Interferon-gamma induces apoptosis and augments the expression of Fas and Fas ligand by microglia in vitro.

PubMed

Badie, B; Schartner, J; Vorpahl, J; Preston, K

2000-04-01

Activation of microglia by interferon-gamma (IFN-gamma) has been implicated in a number of central nervous system (CNS) inflammatory disease processes. Because IFN-gamma has also been shown to play a role in programmed cell death, we investigated its cytotoxicity and its effect on the Fas apoptotic pathway in microglia. Flow cytometry was used to quantify the IFN-gamma-mediated apoptotic response and Fas and Fas ligand (FasL) expression in two well-characterized murine microglia cell lines (BV-2 and N9). Nuclear fragmentation, suggestive of apoptosis, was noted within 24 h of incubation of microglia with IFN-gamma (10 U/ml). After a 72-h incubation, almost every BV-2 and N9 microglia, but not GL261 glioma cells, underwent cell death and detached from the culture plates. This cytotoxicity occurred even at low IFN-gamma concentrations (1 U/ml) and was inhibited by BAF, a pan-caspase inhibitor. Incubation of BV-2 and N9 microglia, but not GL261 glioma cells, with IFN-gamma also potentiated the expression of Fas and FasL in a similar dose-response and time-course manner, as seen for the apoptotic response. Whereas Fas expression increased by 100% in both microglia cells, FasL upregulation was more pronounced and increased by as much as 200% in the N9 cells. These findings suggest that in addition to its role as a microglia activator, IFN-gamma may also induce apoptosis of microglia, possibly through simultaneous upregulation of Fas and FasL. Interferon-gamma modulation of the Fas pathway and apoptosis in microglia may be important in the pathogenesis of inflammatory CNS disease processes. Copyright 2000 Academic Press.

Interferon Gamma potentiates the injury caused by MPP(+) on SH-SY5Y cells, which is attenuated by the nitric oxide synthases inhibition.

PubMed

Titze-de-Almeida, Simoneide S; Lustosa, Cátia Faria; Horst, Camila Hillesheim; Bel, Elaine Del; Titze-de-Almeida, Ricardo

2014-12-01

This study examined whether the cytokine interferon (IFN) gamma plays a role in the injury of SH-SY5Y cells caused by MPP(+) (1-methyl-4-phenylpyridinium). First of all, IFN-gamma sensitized cells to the neurotoxin MPP(+), as determined by MTT (3-(4,5-dimethylthiazol-2-y1)-2,5-diphenyltetrazolium bromide) assay. MPP(+)-injured cells showed higher reactive oxygen species (ROS) levels, which was reinforced by IFN-gamma. The injury triggered a marked expression of the neuronal NOS (nNOS) enzyme. L-NAME [N(ω)-nitro-L-arginine methyl ester, a non-specific NOS inhibitor] reestablished the cell viability after IFN-gamma challenging, and recovered cells from MPP(+) injury (95.0 vs. 84.7 %; P < 0.05). Seven-NI (7-nitroindazole, a nNOS inhibitor) protected cells against the injury by MPP(+) co-administered with IFN-gamma. Both inhibitors restrained the apoptosis of SH-SY5Y cells caused by MPP(+)/IFN-gamma. Regarding oxidative stress, L-NAME and 7-NI attenuated the increase in ROS levels caused by MPP(+) (45.3 or 48.4 vs. 87.9 %, P < 0.05). Indeed, L-NAME was more effective than 7-NI for reducing oxidative stress caused by MPP(+) under IFN-gamma exposition. The nNOS gene silencing by small-interfering RNAs recovered cells challenged by IFN-gamma (24 h), or MPP(+) (8 h). In conclusion, IFN-gamma sensitizes cells to MPP(+)-induced injury, also causing an increase in ROS levels. Pretreating cells with L-NAME or 7-NI reverts both the oxidative stress and apoptosis triggered by the neurotoxin MPP(+). Taking together, our data reinforce that IFN-gamma and NOS enzymes play a role in oxidative stress and dopaminergic cell death triggered by MPP(+).

Sphingosine kinase inhibitor suppresses IL-18-induced interferon-gamma production through inhibition of p38 MAPK activation in human NK cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cheon, Soyoung; Song, Seok Bean; Jung, Minkyung

2008-09-12

Natural killer (NK) cells play an important role in the innate immune response. Interleukin-18 (IL-18) is a well-known interferon-gamma (IFN-{gamma} inducing factor, which stimulates immune response in NK and T cells. Sphingosine kinase (SPHK) catalyzes the formation of sphingosine 1-phosphate (S1P), which acts as a second messenger to function as an anti-apoptotic factor and proliferation stimulator of immune cells. In this study, to elucidate whether SPHK is involved in IL-18-induced IFN-{gamma} production, we measured IL-18-induced IFN-{gamma} production after pre-treatment with SPHK inhibitor (SKI) in NK-92MI cells. We found that IL-18-induced IFN-{gamma} expression was blocked by SKI pre-treatment in both mRNAmore » and protein levels. In addition, the increased IFN-{gamma} production by stimulation with IL-18 is mediated through both SPHK and p38 MAPK. To determine the upstream signals of SKI and p38 MAPK in IL-18-induced IFN-{gamma} production, phosphorylation levels of p38 MAPK was measured after SKI pre-treatment. As a result, inhibition of SPHK by SKI blocked phosphorylation of p38 MAPK, showing that SPHK activation by IL-18 is an upstream signal of p38 MAPK activation. Inhibition of SPHK by SKI also inhibited IL-18-induced IFN-{gamma} production in human primary NK cells. In conclusion, SPHK activation is an essential factor for IL-18-induced IFN-{gamma} production via p38 MAPK.« less

Type I IFN augments IL-27-dependent TRIM25 expression to inhibit HBV replication.

PubMed

Tan, Guangyun; Xiao, Qingfei; Song, Hongxiao; Ma, Feng; Xu, Fengchao; Peng, Di; Li, Na; Wang, Xiaosong; Niu, Junqi; Gao, Pujun; Qin, F Xiao-Feng; Cheng, Genhong

2018-03-01

Hepatitis B virus (HBV) can cause chronic hepatitis B, which may lead to cirrhosis and liver cancer. Type I interferon (IFN) is an approved drug for the treatment of chronic hepatitis B. However, the fundamental mechanisms of antiviral action by type I IFN and the downstream signaling pathway are unclear. TRIM25 is an IFN-stimulated gene (ISG) that has an important role in RIG-I ubiquitination and activation. Whether TRIM25 is induced in liver cells by type I IFN to mediate anti-HBV function remains unclear. Here we report that interleukin-27 (IL-27) has a critical role in IFN-induced TRIM25 upregulation. TRIM25 induction requires both STAT1 and STAT3. In TRIM25 knockout HepG2 cells, type I IFN production was consistently attenuated and HBV replication was increased, whereas overexpression of TRIM25 in HepG2 cells resulted in elevated IFN production and reduced HBV replication. More interestingly, we found that TRIM25 expression was downregulated in HBV patients and the addition of serum samples from HBV patients could inhibit TRIM25 expression in HepG2 cells, suggesting that HBV might have involved a mechanism to inhibit antiviral ISG expression and induce IFN resistance. Collectively, our results demonstrate that type I IFN -induced TRIM25 is an important factor in inhibiting HBV replication, and the IFN-IL-27-TRIM25 axis may represent a new target for treating HBV infection.

Production of interferon-gamma by in vivo tumor-sensitized T cells: Association with active antitumor immunity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bursuker, I.; Pearce, M.T.

1990-02-01

The state of active immunity to Meth A fibrosarcoma in mice immunized with an admixture of Meth A cells and Propionibacterium acnes is associated with possession by the host of spleen cells capable of producing interferon-gamma (IFN-gamma) upon in vitro restimulation with irradiated tumor cells. The ability of spleen cells from immunized mice to produce IFN-gamma in response to irradiated Meth A cells decays as active antitumor immunity is replaced by a state of immunological memory. The IFN-producing cells are L3T4+Ly2+, cyclophosphamide-sensitive and radiosensitive T cells, as determined by their sensitivity to corresponding monoclonal antibodies and complement. The induction ofmore » IFN-gamma production by in vivo tumor-sensitized T cells is tumor specific, in that spleen cells from mice immunized against Meth A fibrosarcoma can produce IFN in response to irradiated Meth A cells but not in response to another syngeneic tumor M109 lung carcinoma.« less

Systemic production of IFN-alpha by garlic (Allium sativum) in humans.

PubMed

Bhattacharyya, Mau; Girish, G V; Karmohapatra, Soumendra K; Samad, S A; Sinha, Asru K

2007-05-01

The effect of foods on the production of interferon-alpha (IFN-alpha) is currently unknown. Garlic (Allium sativum) used as a folk medicine is reported to stimulate nitric oxide (NO) production. We investigated the systemic increase of NO due to the ingestion of garlic on the plasma IFN-alpha level in normal volunteers. Normal volunteers (10 groups, 10 in each group) ate 2 g fresh garlic, and plasma NO and IFN-alpha levels were determined after 2 and 4 h. The participants were also asked to eat garlic for various periods of time, and plasma NO and IFN-alpha were similarly assayed. Ingestion of 2 g fresh, but not boiled, garlic was found to increase the basal plasma level of NO from 2.7 +/- 0.1 microM to 8.76 +/- 0.21 microM at 2 and 4 h, respectively. The basal plasma IFN-alpha level increased from 9.51 +/- 0.26 nM to 46.3 +/- 1.2 nM in normal volunteers (n = 10) at the same time. The chronic eating of garlic was found to maintain IFN-alpha at high levels for at least 7 days. The exposure of neutrophils to garlic in vivo or in vitro, which also stimulated synthesis of NO in these cells, was found to stimulate IFN-alpha synthesis as measured by the stimulation of IFN-alpha mRNA synthesis. Thus, consumption of garlic resulted in stimulated synthesis of NO and, in turn, IFN-alpha in humans, which could be beneficial in viral or proliferative diseases.

Interleukin-12- and interferon-gamma-mediated natural killer cell activation by Agaricus blazei Murill.

PubMed

Yuminamochi, Eri; Koike, Taisuke; Takeda, Kazuyoshi; Horiuchi, Isao; Okumura, Ko

2007-06-01

Dried fruiting bodies of Agaricus blazei Murill (A. blazei) and its extracts have generally used as complementary and alternative medicines (CAMs). Here, we report that the oral administration of A. blazei augmented cytotoxicity of natural killer (NK) cells in wild-type (WT) C57BL/6, C3H/HeJ, and BALB/c mice. Augmented cytotoxicity was demonstrated by purified NK cells from treated wild-type (WT) and RAG-2-deficient mice, but not from interferon-gamma (IFN-gamma) deficient mice. NK cell activation and IFN-gamma production was also observed in vitro when dendritic cell (DC)-rich splenocytes of WT mice were coincubation with an extract of A. blazei. Both parameters were largely inhibited by neutralizing anti-interleukin-12 (IL-12) monoclonal antibody (mAb) and completely inhibited when anti-IL-12 mAb and anti-IL-18 mAb were used in combination. An aqueous extract of the hemicellulase-digested compound of A. blazei particle; (ABPC) induced IFN-gamma production more effectively, and this was completely inhibited by anti-IL-12 mAb alone. NK cell cytotoxicty was augmented with the same extracts, again in an IL-12 and IFN-gamma-dependent manner. These results clearly demonstrated that A. blazei and ABPC augmented NK cell activation through IL-12-mediated IFN-gamma production.

[Plasma levels of interferon gamma and interleukin 10 in patients with lymphonodular toxoplasmosis].

PubMed

Bielec, D; Patorska-Mach, E; Semczuk, G; Toruń, E

1997-01-01

The concentrations of IFN gamma and IL 10 in plasma of sixteen patients with toxoplasmic lymphadenopathy were measured. These examinations were carried out two times in the interval of a month. We found increased level of IFN gamma and normal concentrations of IL 10 in both of these terms.

Fish oil feeding delays influenza virus clearance and impairs production of interferon-gamma and virus-specific immunoglobulin A in the lungs of mice.

PubMed

Byleveld, P M; Pang, G T; Clancy, R L; Roberts, D C

1999-02-01

Ingestion of fish oil can suppress the inflammatory response to injury and may impair host resistance to infection. To investigate the effect of a diet containing fish oil on immunity to viral infection, 148 BALB/c mice were fed diets containing 3 g/100 g of sunflower oil with either 17 g/100 g of fish oil or beef tallow for 14 d before intranasal challenge with live influenza virus. At d 1 and d 5 after infection, the mice fed fish oil had higher lung viral load and lower body weight (P < 0.05). In addition to the greater viral load and weight loss at d 5 after infection, the fish oil group consumed less food (P < 0.05) while the beef tallow group was clearing the virus, had regained their preinfection weights and was returning to their preinfection food consumption. The fish oil group had impaired production of lung interferon-gamma (IFN-gamma), serum immunoglobulin (Ig) G and lung IgA-specific antibodies (all P < 0. 05) although lung IFN-alpha/beta and the relative proportions of bronchial lymph node CD4+ and CD8+ T lymphocytes did not differ between groups after infection. The present study demonstrates a delay in virus clearance in mice fed fish oil associated with reduced IFN-gamma and antibody production and a greater weight loss and suppression of appetite following influenza virus infection. However, differences observed during the course of infection did not affect the ultimate outcome as both groups cleared the virus and returned to preinfection food consumption and body weight by d 7.

Interferon-gamma interferes with transforming growth factor-beta signaling through direct interaction of YB-1 with Smad3.

PubMed

Higashi, Kiyoshi; Inagaki, Yutaka; Fujimori, Ko; Nakao, Atsuhito; Kaneko, Hideo; Nakatsuka, Iwao

2003-10-31

Transforming growth factor-beta (TGF-beta) and interferon-gamma (IFN-gamma) exert antagonistic effects on collagen synthesis in human dermal fibroblasts. We have recently shown that Y box-binding protein YB-1 mediates the inhibitory effects of IFN-gamma on alpha2(I) procollagen gene (COL1A2) transcription through the IFN-gamma response element located between -161 and -150. Here we report that YB-1 counter-represses TGF-beta-stimulated COL1A2 transcription by interfering with Smad3 bound to the upstream sequence around -265 and subsequently by interrupting the Smad3-p300 interaction. Western blot and immunofluorescence analyses using inhibitors for Janus kinases or casein kinase II suggested that the casein kinase II-dependent signaling pathway mediates IFN-gamma-induced nuclear translocation of YB-1. Down-regulation of endogenous YB-1 expression by double-stranded YB-1-specific RNA abrogated the transcriptional repression of COL1A2 by IFN-gamma in the absence and presence of TGF-beta. In transient transfection assays, overexpression of YB-1 in human dermal fibroblasts exhibited antagonistic actions against TGF-beta and Smad3. Physical interaction between Smad3 and YB-1 was demonstrated by immunoprecipitation-Western blot analyses, and electrophoretic mobility shift assays using the recombinant Smad3 and YB-1 proteins indicated that YB-1 forms a complex with Smad3 bound to the Smad-binding element. Glutathione S-transferase pull-down assays showed that YB-1 binds to the MH1 domain of Smad3, whereas the central and carboxyl-terminal regions of YB-1 were required for its interaction with Smad3. YB-1 also interferes with the Smad3-p300 interaction by its preferential binding to p300. Altogether, the results provide a novel insight into the mechanism by which IFN-gamma/YB-1 counteracts TGF-beta/Smad3. They also indicate that IFN-gamma/YB-1 inhibits COL1A2 transcription by dual actions: via the IFN-gamma response element and through a cross-talk with the TGF

Mycobacterium tuberculosis infection in health care workers in rural India: comparison of a whole-blood interferon gamma assay with tuberculin skin testing.

PubMed

Pai, Madhukar; Gokhale, Kaustubh; Joshi, Rajnish; Dogra, Sandeep; Kalantri, Shriprakash; Mendiratta, Deepak K; Narang, Pratibha; Daley, Charles L; Granich, Reuben M; Mazurek, Gerald H; Reingold, Arthur L; Riley, Lee W; Colford, John M

2005-06-08

Mycobacterium tuberculosis infection in health care workers has not been adequately studied in developing countries using newer diagnostic tests. To estimate latent tuberculosis infection prevalence in health care workers using the tuberculin skin test (TST) and a whole-blood interferon gamma (IFN-gamma) assay; to determine agreement between the tests; and to compare their correlation with risk factors. A cross-sectional comparison study of 726 health care workers aged 18 to 61 years (median age, 22 years) with no history of active tuberculosis conducted from January to May 2004, at a rural medical school in India. A total of 493 (68%) of the health care workers had direct contact with patients with tuberculosis and 514 (71%) had BCG vaccine scars. Tuberculin skin testing was performed using 1-TU dose of purified protein derivative RT23, and the IFN-gamma assay was performed by measuring IFN-gamma response to early secreted antigenic target 6, culture filtrate protein 10, and a portion of tuberculosis antigen TB7.7. Agreement between TST and the IFN-gamma assay, and comparison of the tests with respect to their association with risk factors. A large proportion of the health care workers were latently infected; 360 (50%) were positive by either TST or IFN-gamma assay, and 226 (31%) were positive by both tests. The prevalence estimates of TST and IFN-gamma assay positivity were comparable (41%; 95% confidence interval [CI], 38%-45% and 40%; 95% CI, 37%-43%, respectively). Agreement between the tests was high (81.4%; kappa = 0.61; 95% CI, 0.56-0.67). Increasing age and years in the health profession were significant risk factors for both IFN-gamma assay and TST positivity. BCG vaccination had little impact on TST and IFN-gamma assay results. Our study showed high latent tuberculosis infection prevalence in Indian health care workers, high agreement between TST and IFN-gamma assay, and similar association between positive test results and risk factors. Although TST and

Cryptococcus neoformans inhibits nitric oxide synthesis caused by CpG-oligodeoxynucleotide-stimulated macrophages in a fashion independent of capsular polysaccharides.

PubMed

Xiao, Gang; Miyazato, Akiko; Inden, Ken; Nakamura, Kiwamu; Shiratori, Kohei; Nakagawa, Kiyotaka; Miyazawa, Teruo; Suzuki, Kazuo; Kaku, Mitsuo; Kawakami, Kazuyoshi

2008-03-01

Cryptococcus neoformans is eradicated by macrophages via production of NO. Unmethylated CpG-ODN protect mice from infection with this fungal pathogen by inducing IFN-gamma. The present study was designed to elucidate the effect of C. neoformans on the synthesis of NO by alveolar macrophages. For this purpose, MH-S, an alveolar macrophage cell line, was stimulated with CpG-ODN in the presence of IFN-gamma. A highly virulent strain of C. neoformans with thick capsule suppressed the production of NO. Capsular polysaccharides were not essential for this suppression, because there was no difference between acapsular mutant (Cap67) and its parent strain. Physical or close interaction of Cap67 with MH-S was necessary, as shown by the loss of such effect when direct contact was interfered by nitrocellulose membrane. Similar effects were observed by disrupted as well as intact Cap67. Whereas the inhibitory effect of intact Cap67 was completely abrogated by heat treatment, disrupted Cap67 did not receive such influence. Finally, disrupted Cap67 did not show any inhibitory effect on the TLR9-mediated activation of NF-kappaB in a luciferase reporter assay with HEK293T cells, although the TLR4-mediated activation was suppressed. These results revealed that C. neoformans suppressed the synthesis of NO by CpG-ODN and IFN-gamma-stimulated macrophages in a fashion independent of capsular polysaccharides, although the precise mechanism remains to be elucidated.

[IFN-gamma enzyme-linked immunospot assay versus PPD tuberculin skin test in the diagnosis of tuberculous epididymitis].

PubMed

Huang, Hao; Yang, Xi-Fei; Deng, Qun-Yi; Li, Bing; Liu, Guo-Hui; Zhang, Jie-Yun; Yang, Da-Fei

2012-06-01

To explore the potential application of IFN-gamma enzyme-linked immunospot (ELISPOT) assay in the diagnosis of tuberculous epididymitis (TE) by comparing ELISPOT assay with the traditional purified protein derivative (PPD) tuberculin skin test. We examined 13 TE patients using an in-house ELISPOT kit, another 11 TE patients by PPD skin testing, and 57 healthy male volunteers by parallel test with both the methods. Twelve (92.3%) of the 13 TE cases were positive on ELISPOT assay, and 10 (90.9%) of the 11 TE cases positive on PPD skin test, with no statistically significant differences between the two groups (P > 0.05). Among the 57 healthy male volunteers, 8 (14.0%) were positive on ELISPOT, and 28 (49.1%) positive on PPD test, the latter significantly higher than the former (P < 0.001). In terms of sensitivity, ELISPOT assay is similar to PPD test in the examination of tuberculous epididymitis. As for specificity, ELISPOT assay seems better than PPD test in differentiating tuberculous epididymitis patients from healthy males.

Reduced TNF-alpha and IFN-gamma responses to Central Asian strain 1 and Beijing isolates of Mycobacterium tuberculosis in comparison with H37Rv strain.

PubMed

Tanveer, Mahnaz; Hasan, Zahra; Kanji, Akbar; Hussain, Rabia; Hasan, Rumina

2009-06-01

Pakistan ranks eighth in terms of tuberculosis burden worldwide, with an incidence of 181/100000. The predominant genotypes of Mycobacterium tuberculosis are reported to be the Central Asian strain 1 (CAS1) and Beijing families.Mycobacteriumtuberculosis down-regulates host pro-inflammatory cytokines, which are essential for protection against infection. There is currently little information regarding the interaction of the CAS1 genotype with host cells. We studied the growth rates of CAS1 and Beijing clinical isolates, and their ability to induce cytokines compared with the laboratory reference strain H37Rv. Host responses were studied using a THP-1 monocytic cell line model and an ex vivo whole blood assay. Growth rates of CAS1 and Beijing isolates were significantly lower (P=0.011) compared with H37Rv. All clinical isolates induced significantly lower levels of TNF-alpha secretion (P=0.003) than H37Rv in THP-1 cells and in the whole blood assay of healthy donors (n=8). They also induced lower IFN-gamma secretion in the whole blood assay (P<0.001). A positive correlation was observed between the growth indices (GI) of H37Rv, Beijing and CAS1 strains and the TNF-alpha responses they induced [Pearson's correlation coefficient (R(2)): 0.936, 0.775 and 0.55, respectively], and also between GI and IFN-gamma production (R(2): 0.422, 0.946, 0.674). These findings suggest that reduced growth rate, together with down-modulation of pro-inflammatory cytokines, is a contributory mechanism for the predominance of the CAS genotype.

Concerted action of IFN-α and IFN-λ induces local NK cell immunity and halts cancer growth.

PubMed

Lasfar, Ahmed; de laTorre, Andrew; Abushahba, Walid; Cohen-Solal, Karine A; Castaneda, Ismael; Yuan, Yao; Reuhl, Kenneth; Zloza, Andrew; Raveche, Elizabeth; Laskin, Debra L; Kotenko, Sergei V

2016-08-02

Hepatocellular carcinoma (HCC) is the most prevalent type of liver cancer. No significant improvement has been reported with currently available systemic therapies. IFN-α has been tested in both clinic and animal models and only moderate benefits have been observed. In animal models, similar modest antitumor efficacy has also been reported for IFN-λ, a new type of IFN that acts through its own receptor complex. In the present study, the antitumor efficacy of the combination of IFN-α and IFN-λ was tested in the BNL mouse hepatoma model. This study was accomplished by using either engineered tumor cells (IFN-α/IFN-λ gene therapy) or by directly injecting tumor-bearing mice with IFN-α/IFN-λ. Both approaches demonstrated that IFN-α/IFN-λ combination therapy was more efficacious than IFN monotherapy based on either IFN-α or IFN-λ. In complement to tumor surgery, IFN-α/IFN-λ combination induced complete tumor remission. Highest antitumor efficacy has been obtained following local administration of IFN-α/IFN-λ combination at the tumor site that was associated with strong NK cells tumor infiltration. This supports the use of IFN-α/IFN-λ combination as a new cancer immunotherapy for stimulating antitumor response after cancer surgery.

Concerted action of IFN-α and IFN-λ induces local NK cell immunity and halts cancer growth

PubMed Central

Lasfar, Ahmed; de la Torre, Andrew; Abushahba, Walid; Cohen-Solal, Karine A; Castaneda, Ismael; Yuan, Yao; Reuhl, Kenneth; Zloza, Andrew; Raveche, Elizabeth; Laskin, Debra L; Kotenko, Sergei V

2016-01-01

Hepatocellular carcinoma (HCC) is the most prevalent type of liver cancer. No significant improvement has been reported with currently available systemic therapies. IFN-α has been tested in both clinic and animal models and only moderate benefits have been observed. In animal models, similar modest antitumor efficacy has also been reported for IFN-λ, a new type of IFN that acts through its own receptor complex. In the present study, the antitumor efficacy of the combination of IFN-α and IFN-λ was tested in the BNL mouse hepatoma model. This study was accomplished by using either engineered tumor cells (IFN-α/IFN-λ gene therapy) or by directly injecting tumor-bearing mice with IFN-α/IFN-λ. Both approaches demonstrated that IFN-α/IFN-λ combination therapy was more efficacious than IFN monotherapy based on either IFN-α or IFN-λ. In complement to tumor surgery, IFN-α/IFN-λ combination induced complete tumor remission. Highest antitumor efficacy has been obtained following local administration of IFN-α/IFN-λ combination at the tumor site that was associated with strong NK cells tumor infiltration. This supports the use of IFN-α/IFN-λ combination as a new cancer immunotherapy for stimulating antitumor response after cancer surgery. PMID:27363032

Interferon-gamma regulates nucleoside transport systems in macrophages through signal transduction and activator of transduction factor 1 (STAT1)-dependent and -independent signalling pathways.

PubMed Central

Soler, Concepció; Felipe, Antonio; García-Manteiga, José; Serra, Maria; Guillén-Gómez, Elena; Casado, F Javier; MacLeod, Carol; Modolell, Manuel; Pastor-Anglada, Marçal; Celada, Antonio

2003-01-01

The expressions of CNT and ENT (concentrative and equilibrative nucleoside transporters) in macrophages are differentially regulated by IFN-gamma (interferon-gamma). This cytokine controls gene expression through STAT1-dependent and/or -independent pathways (where STAT1 stands for signal transduction and activator of transcription 1). In the present study, the role of STAT1 in the response of nucleoside transporters to IFN-gamma was studied using macrophages from STAT1 knockout mice. IFN-gamma triggered an inhibition of ENT1-related nucleoside transport activity through STAT1-dependent mechanisms. Such inhibition of macrophage growth and ENT1 activity by IFN-gamma is required for DNA synthesis. Interestingly, IFN-gamma led to an induction of the CNT1- and CNT2-related nucleoside transport activities independent of STAT1, thus ensuring the supply of extracellular nucleosides for the STAT1-independent RNA synthesis. IFN-gamma up-regulated CNT2 mRNA and CNT1 protein levels and down-regulated ENT1 mRNA in both wild-type and STAT1 knockout macrophages. This is consistent with a STAT1-independent, long-term-mediated, probably transcription-dependent, regulation of nucleoside transporter genes. Moreover, STAT1-dependent post-transcriptional mechanisms are implicated in the regulation of ENT1 activity. Although nitric oxide is involved in the regulation of ENT1 activity in B-cells at a post-transcriptional level, our results show that STAT1-dependent induction of nitric oxide by IFN-gamma is not implicated in the regulation of ENT1 activity in macrophages. Our results indicate that both STAT1-dependent and -independent pathways are involved in the regulation of nucleoside transporters by IFN-gamma in macrophages. PMID:12868960

[Effects of interferon-gamma on cytotoxicity of murine activated macrophages against murine glioma cells].

PubMed

Ohyama, K; Kikuchi, H; Oda, Y; Moritake, K; Yamasaki, T

1993-06-01

We studied the effects of mouse IFN-gamma on the cytotoxic activity of murine activated macrophages (M phi) against mouse VM-Glioma cells (H-2b). Activated M phi were obtained from peritoneal exudate cells of mice from four strains, C57BL/6 (H-2b), C3H/He(H-2k), DBA/2 (H-2d), and BALB/c (H-2d), following intraperitoneal injection of (1) LPS 200 micrograms, (2) BCG 200 micrograms, (3) C. parvum 200 micrograms, or (4) MDP 350 micrograms 7 days prior to 20-hr 51Cr release-assay. Of the various combination of mouse strains and activating agents tested, that of activated M phi of the C3H/He mouse with induction by LPS had the most tumoricidal effect against the glioma cells, which was not MHC restricted. Although LPS-activated M phi underwent marked loss of cytotoxicity following initiation of in vitro culture, this 24 hr pretreatment with IFN-gamma inhibited this reduction in tumoricidal effects in a dose-dependent fashion. On the other hand, 24 hr pretreatment of target cells with IFN-gamma did not increase their susceptibility to lysis by activated M phi. These findings suggest that IFN-gamma augments the in vitro tumoricidal activation of M phi; This effect appears to be unrelated to any influence of IFN-gamma on target sensitivity to lysis by macrophages.

Association study of interferon gamma (IFN-γ) +874T/A gene polymorphism in patients with paranoid schizophrenia.

PubMed

Paul-Samojedny, Monika; Owczarek, Aleksander; Suchanek, Renata; Kowalczyk, Malgorzata; Fila-Danilow, Anna; Borkowska, Paulina; Kucia, Krzysztof; Kowalski, Jan

2011-03-01

Schizophrenia is a multifactorial disease with changes affecting the immune system. Dysregulation of the cytokine network in schizophrenia has been well documented. Such changes may occur due to disturbances in cytokine levels that are linked to polymorphisms of cytokine genes. However, research in the role of cytokine gene polymorphisms in schizophrenia has been surprisingly scanty. The aim of this study was to identify, in a case control study, whether polymorphism of IFN-γ gene is a risk factor for the development of paranoid schizophrenia. To the best of our knowledge, this is the first study that examines the association between the IFN-γ gene polymorphism and psychopathological symptoms in patients with paranoid schizophrenia. Polymorphism of IFN-γ (+874T/A, rs 62559044) in schizophrenic patients (n=179), as well as healthy individuals (n=196), both Polish residents, was genotyped using AS-PCR method. Of note, when analyzing the results, we took into consideration the gender of studied individuals. Surprisingly, a single-nucleotide polymorphism in the first intron of the IFN-γ gene was found to be associated with paranoid schizophrenia in males, but not in females. The presence of allele A at position +874 in the IFN-γ gene correlates with 1.66-fold higher risk of paranoid schizophrenia development in males. Differences in the genotypes may have an important role in determining the level of I gene transcription. Because other polymorphisms have been demonstrated to influence IFN-γ transcription, further analysis is necessary to clarify the role of this gene in the pathogenesis of paranoid schizophrenia.

Repeated irradiations with gamma-rays at a Dose of 0.5 Gy may exacerbate asthma.

PubMed

Fang, Su-ping; Tago, Fumitoshi; Tanaka, Takashi; Simura, Noriko; Muto, Yasuko; Goto, Resuke; Kojima, Shuji

2005-06-01

We previously showed that 0.5 Gy whole-body gamma-ray irradiation with a single or small number of repeated exposures inhibits tumor growth in mice, via elevation of the IFN-gamma/IL-4 ratio concomitantly with a decrease in the percentage of B cells. Here we examined whether repeated 0.5 Gy gamma-rays irradiation can improve asthma in an OVA-induced asthmatic mouse model. We found that repeated irradiation (10 times) with 0.5 Gy of gamma-rays significantly increased total IgE in comparison with the disease-control group. The levels of IL-4 and IL-5 were also significantly higher in the gamma-ray-irradiated group, while that of IFN-gamma was significantly lower, resulting in a further decrease of the IFN-gamma/IL-4 ratio from the normal value. These results indicate that the repeated irradiation with gamma-rays may exacerbate asthma, and may have opposite effects on different immune reactions unlike the irradiation with a single or small number of repeated exposures.

Effect of treatment with interferon-gamma and concanavalin A on the course of infection of mice with Salmonella typhimurium strain LT-2

NASA Technical Reports Server (NTRS)

Gould, Cheryl L.; Sonnenfeld, Gerald

1987-01-01

The effect of pretreatment of mice with 34 units/day, for five days, of interferon-gamma (IFN-gamma) on the course of infection with LD50 of Salmonella typhimurium strain LT-2 was assessed, using two IFN preparations: (1) a hybridoma supernatant fluid containing concanavalin-A-induced IFN-gamma activity and (2) pure murine IFN-gamma produced by recombinant DNA technology. The hybridoma supernatant-treated Salmonella-infected mice were found to die faster than mice treated only with Salmonella. Pure murine IFN-gamma was found to protect infected mice significantly, with 95 percent of mice surviving LD50 infection. In contrast, the Salmonella-infected mice treated with hybridoma supernatant were found to die faster than the Salmonella-infected untreated controls. Mice treated with concanavalin A alone prior to infection with S. typhimurium died more quickly than the untreated infected controls, suggesting that contamination with concanavalin A had a detrimental effect on mice survival.

OK-432 synergizes with IFN-γ to confer dendritic cells with enhanced antitumor immunity.

PubMed

Pan, Ke; Lv, Lin; Zheng, Hai-xia; Zhao, Jing-jing; Pan, Qiu-zhong; Li, Jian-jun; Weng, De-sheng; Wang, Dan-dan; Jiang, Shan-shan; Chang, Alfred E; Li, Qiao; Xia, Jian-chuan

2014-03-01

Generation of functional dendritic cells (DCs) with boosted immunity after the withdrawal of initial activation/maturation conditions remains a significant challenge. In this study, we investigated the impact of a newly developed maturation cocktail consisting of OK-432 and interferon-gamma (IFN-γ) on the function of human monocyte-derived DCs (MoDCs). We found that OK-432 plus IFN-γ stimulation could induce significantly stronger expression of surface molecules, production of cytokines, as well as migration of DCs compared with OK-432 stimulation alone. Most importantly, DCs matured with OK-432 plus IFN-γ-induced maintained secretion of interleukin-12 (IL-12)p70 in secondary culture after stimulus withdrawal. Functionally, OK-432 plus IFN-γ-conditioned DCs induce remarkable Th1 and Tc1 responses more effectively than OK-432 alone, even more than the use of α-type-1 cytokine cocktail. As a result, DCs matured with OK-432 plus IFN-γ can prime stronger cytotoxic lymphocyte (CTL) and natural killer (NK) cell response against tumor cells in vitro. Peripheral blood mononuclear cells activated by DCs matured with OK-432 plus IFN-γ also showed greater tumor growth inhibition in vivo in null mice. Molecular mechanistic analysis showed that DC maturation using IFN-γ in concert with OK-432 involves the activation of p38 and nuclear factor-kappa B (NF-κB) pathways. This study provided a novel strategy to generate more potent immune segments in DC vaccine.

Targeting IFN-λ: therapeutic implications.

PubMed

Eslam, Mohammed; George, Jacob

2016-12-01

Type-III interferons (IFN-λ), the most recently discovered family of IFNs, shares common features with other family members, but also has many distinctive activities. IFN-λ uniquely has a different receptor complex, and a more focused pattern of tissue expression and signaling effects, from other classes of IFNs. Multiple genome-wide association studies (GWAS) and subsequent validation reports suggest a pivotal role for polymorphisms near the IFNL3 gene in hepatitis C clearance and control, as also for several other epithelial cell tropic viruses. Apart from its antiviral activity, IFN-λ possesses anti-tumor, immune-inflammatory and homeostatic functions. The overlapping effects of IFN-λ with type I IFN, with a restricted tissue expression pattern renders IFN-λ an attractive therapeutic target for viral infection, cancer and autoimmune diseases, with limited side effects. Areas covered: This review will summarize the current and future therapeutic opportunities offered by this most recently discovered family of interferons. Expert opinion: Our knowledge on IFN-λ is rapidly expanding. Though there are many remaining questions and challenges that require elucidation, the unique characteristics of IFN-λ increases enthusiasm that multiple therapeutic options will emerge.

In vivo induction of interferon gamma expression in grey horses with metastatic melanoma resulting from direct injection of plasmid DNA coding for equine interleukin 12.

PubMed

Müller, J-M V; Wissemann, J; Meli, M L; Dasen, G; Lutz, H; Heinzerling, L; Feige, K

2011-11-01

Whole blood pharmacokinetics of intratumourally injected naked plasmid DNA coding for equine Interleukin 12 (IL-12) was assessed as a means of in vivo gene transfer in the treatment of melanoma in grey horses. The expression of induced interferon gamma (IFN-g) was evaluated in order to determine the pharmacodynamic properties of in vivo gene transduction. Seven grey horses bearing melanoma were injected intratumourally with 250 µg naked plasmid DNA coding for IL-12. Peripheral blood and biopsies from the injection site were taken at 13 time points until day 14 post injection (p.i.). Samples were analysed using quantitative real-time PCR. Plasmid DNA was quantified in blood samples and mRNA expression for IFN-g in tissue samples. Plasmid DNA showed fast elimination kinetics with more than 99 % of the plasmid disappearing within 36 hours. IFN-g expression increased quickly after IL-12 plasmid injection, but varied between individual horses. Intratumoural injection of plasmid DNA is a feasible method for inducing transgene expression in vivo. Biological activity of the transgene IL-12 was confirmed by measuring expression of IFN-g.

SU-G-BRB-16: Vulnerabilities in the Gamma Metric

DOE Office of Scientific and Technical Information (OSTI.GOV)

Neal, B; Siebers, J

Purpose: To explore vulnerabilities in the gamma index metric that undermine its wide use as a radiation therapy quality assurance tool. Methods: 2D test field pairs (images) are created specifically to achieve high gamma passing rates, but to also include gross errors by exploiting the distance-to-agreement and percent-passing components of the metric. The first set has no requirement of clinical practicality, but is intended to expose vulnerabilities. The second set exposes clinically realistic vulnerabilities. To circumvent limitations inherent to user-specific tuning of prediction algorithms to match measurements, digital test cases are manually constructed, thereby mimicking high-quality image prediction. Results: Withmore » a 3 mm distance-to-agreement metric, changing field size by ±6 mm results in a gamma passing rate over 99%. For a uniform field, a lattice of passing points spaced 5 mm apart results in a passing rate of 100%. Exploiting the percent-passing component, a 10×10 cm{sup 2} field can have a 95% passing rate when an 8 cm{sup 2}=2.8×2.8 cm{sup 2} highly out-of-tolerance (e.g. zero dose) square is missing from the comparison image. For clinically realistic vulnerabilities, an arc plan for which a 2D image is created can have a >95% passing rate solely due to agreement in the lateral spillage, with the failing 5% in the critical target region. A field with an integrated boost (e.g whole brain plus small metastases) could neglect the metastases entirely, yet still pass with a 95% threshold. All the failure modes described would be visually apparent on a gamma-map image. Conclusion: The %gamma<1 metric has significant vulnerabilities. High passing rates can obscure critical faults in hypothetical and delivered radiation doses. Great caution should be used with gamma as a QA metric; users should inspect the gamma-map. Visual analysis of gamma-maps may be impractical for cine acquisition.« less

IFN-γ regulates human dental pulp stem cells behavior via NF-κB and MAPK signaling

PubMed Central

He, Xinyao; Jiang, Wenkai; Luo, Zhirong; Qu, Tiejun; Wang, Zhihua; Liu, Ningning; Zhang, Yaqing; Cooper, Paul R.; He, Wenxi

2017-01-01

During caries, dental pulp expresses a range of pro-inflammatory cytokines in response to the infectious challenge. Interferon gamma (IFN-γ) is a dimerized soluble cytokine, which is critical for immune responses. Previous study has demonstrated that IFN-γ at relative high concentration (100 ng/mL) treatment improved the impaired dentinogenic and immunosuppressive regulatory functions of disease-derived dental pulp stem cells (DPSCs). However, little is known about the regulatory effects of IFN-γ at relative low concentration on healthy DPSC behavior (including proliferation, migration, and multiple-potential differentiation). Here we demonstrate that IFN-γ at relatively low concentrations (0.5 ng/mL) promoted the proliferation and migration of DPSCs, but abrogated odonto/osteogenic differentiation. Additionally, we identified that NF-κB and MAPK signaling pathways are both involved in the process of IFN-γ-regulated odonto/osteogenic differentiation of DPSCs. DPSCs treated with IFN-γ and supplemented with pyrrolidine dithiocarbamate (PDTC, an NF-κB inhibitor) or SB203580 (a MAPK inhibitor) showed significantly improved potential for odonto/osteogenic differentiation of DPSCs both in vivo and in vitro. These data provide important insight into the regulatory effects of IFN-γ on the biological behavior of DPSCs and indicate a promising therapeutic strategy for dentin/pulp tissue engineering in future endodontic treatment. PMID:28098169

Effects of interferon-gamma and tumor necrosis factor-alpha on macrophage enzyme levels

NASA Technical Reports Server (NTRS)

Pierangeli, Silvia S.; Sonnenfeld, Gerald

1989-01-01

Murine peritoneal macrophages were treated with interferon-gamma (IFN-gamma) or tumor necrosis factor-alpha (TNF). Measurements of changes in acid phosphatase and beta-glucuronidase levels were made as an indication of activation by cytokine treatment. IFN-gamma or TNF-gamma treatment resulted in a significant increase in the activities of both enzymes measured in the cell lysates. This increase was observable after 6 h of incubation, but reached its maximum level after 24 h of incubation. The effect of the treatment of the cell with both cytokines together was additive. No synergistic effect of addition of both cytokines on the enzyme levels was observed.

Mitochondria-dependent and -independent mechanisms in tumour necrosis factor-related apoptosis-inducing ligand (TRAIL)-induced apoptosis are both regulated by interferon-gamma in human breast tumour cells.

PubMed Central

Ruiz-Ruiz, Carmen; López-Rivas, Abelardo

2002-01-01

Tumour necrosis factor-related apoptosis-inducing ligand (TRAIL/APO-2L) induces apoptosis in a variety of tumour cells upon binding to death receptors TRAIL-R1 and TRAIL-R2. Here we describe the sensitization by interferon (IFN)-gamma to TRAIL-induced apoptosis in the breast tumour cell lines MCF-7 and MDA-MB231. IFN-gamma promoted TRAIL-mediated activation of caspase-8, Bcl-2 interacting domain death agonist (Bid) degradation, Bcl-2-associated X protein (Bax) translocation to mitochondria, cytochrome c release to the cytosol and activation of caspase-9 in these cell lines. No changes in the expression of TRAIL receptors were observed upon IFN-gamma treatment. Overexpression of Bcl-2 in MCF-7 cells completely inhibited IFN-gamma-induced sensitization to TRAIL-mediated cell death. Interestingly, TRAIL-induced apoptosis was also clearly enhanced by IFN-gamma in caspase-3-overexpressing MCF-7 cells, in the absence of Bax translocation to mitochondria and cytochrome c release to the cytosol. In summary, our results suggest that IFN-gamma facilitates TRAIL-induced activation of mitochondria-regulated as well as mitochondria-independent apoptotic pathways in breast tumour cells. PMID:11936954

Coexposure of mice to trovafloxacin and lipopolysaccharide, a model of idiosyncratic hepatotoxicity, results in a unique gene expression profile and interferon gamma-dependent liver injury.

PubMed

Shaw, Patrick J; Ditewig, Amy C; Waring, Jeffrey F; Liguori, Michael J; Blomme, Eric A; Ganey, Patricia E; Roth, Robert A

2009-01-01

The antibiotic trovafloxacin (TVX) has caused severe idiosyncratic hepatotoxicity in people, whereas levofloxacin (LVX) has not. Mice cotreated with TVX and lipopolysaccharide (LPS), but not with LVX and LPS, develop severe hepatocellular necrosis. Mice were treated with TVX and/or LPS, and hepatic gene expression changes were measured before liver injury using gene array. Hepatic gene expression profiles from mice treated with TVX/LPS clustered differently from those treated with LPS or TVX alone. Several of the probe sets expressed differently in TVX/LPS-treated mice were involved in interferon (IFN) signaling and the janus kinase/signal transducers and activators of transcription (JAK/STAT) pathway. A time course of plasma concentrations of IFN-gamma and interleukin (IL)-18, which directly induces IFN-gamma production, revealed that both cytokines were selectively increased in TVX/LPS-treated mice. Both IL-18(-/-) and IFN-gamma(-/-) mice were significantly protected from TVX/LPS-induced liver injury. In addition, IFN-gamma(-/-) mice had decreased plasma concentrations of tumor necrosis factor-alpha, IL-18, and IL-1beta when compared to wild-type mice. In conclusion, the altered expression of genes involved in IFN signaling in TVX/LPS-treated mice led to the finding that IL-18 and IFN-gamma play a critical role in TVX/LPS-induced liver injury.

Interferon-α (IFN-α) suppresses HTLV-1 gene expression and cell cycling, while IFN-α combined with zidovudin induces p53 signaling and apoptosis in HTLV-1-infected cells

PubMed Central

2013-01-01

Background Human T-cell leukemia virus type-1 (HTLV-1) is the causative retrovirus of adult T-cell leukemia/lymphoma (ATL) and HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP). HTLV-1 gene expression is maintained at low levels in vivo by unknown mechanisms. A combination therapy of interferon-α (IFN-α) and zidovudin (AZT) shows therapeutic effects in ATL patients, although its mechanism is also obscure. We previously found that viral gene expression in IL-2-dependent HTLV-1-infected T-cells (ILTs) derived from ATL patients was markedly suppressed by stromal cells through a type I IFN response. Here, we investigated the effects of IFN-α with or without AZT on viral gene expression and cell growth in ILTs. Results ILTs expressed variable but lower amounts of HTLV-1 Tax protein than HTLV-1-transformed HUT102 cells. Following the addition of IFN-α, the amounts of HTLV-1 p19 in the supernatants of these cells decreased in three days, while HTLV-1 gene expression decreased only in ILTs but not HUT102 cells. IFN-α also suppressed the spontaneous HTLV-1 induction in primary ATL cells cultured for 24 h. A time course study using ILTs revealed that the levels of intracellular Tax proteins decreased in the first 24 h after addition of IFN-α, before the reduction in HTLV-1 mRNA levels. The initial decreases of Tax protein following IFN-α treatment were observed in 6 of 7 ILT lines tested, although the reduction rates varied among ILT lines. An RNA-dependent protein kinase (PKR)-inhibitor reversed IFN-mediated suppression of Tax in ILTs. IFN-α also induced cell cycle arrest at the G0/G1 phase and suppressed NF-κB activities in these cells. AZT alone did not affect HTLV-1 gene expression, cell viability or NF-κB activities. AZT combined with IFN-α markedly induced cell apoptosis associated with phosphorylation of p53 and induction of p53-responsive genes in ILTs. Conclusions IFN-α suppressed HTLV-1 gene expression at least through a PKR

Inhibition of interferon-gamma expression by osmotic shrinkage of peripheral blood lymphocytes.

PubMed

Lang, K S; Weigert, C; Braedel, S; Fillon, S; Palmada, M; Schleicher, E; Rammensee, H-G; Lang, F

2003-01-01

A hypertonic environment, as it prevails in renal medulla or in hyperosmolar states such as hyperglycemia of diabetes mellitus, has been shown to impair the immune response, thus facilitating the development of infection. The present experiments were performed to test whether hypertonicity influences activation of T lymphocytes. To this end, peripheral blood lymphocytes (PBL) of cytomegalovirus (CMV)-positive donors were stimulated by human leukocyte antigen (HLA)-A2-restricted CMV epitope NLVPMVATV to produce interferon (IFN)-gamma at varying extracellular osmolarity. As a result, increasing extracellular osmolarity during exposure to the CMV antigen indeed decreased IFN-gamma formation. Addition of NaCl was more effective than urea. A 50% inhibition was observed at 350 mosM by addition of NaCl. The combined application of the Ca(2+) ionophore ionomycin (1 microg/ml) and the phorbol ester phorbol 12-myristate 13-acetate (PMA; 5 microg/ml) stimulated IFN-gamma production, an effect again reversed by hyperosmolarity. Moreover, hyperosmolarity abrogated the stimulating effect of ionomycin (1 microg/ml) and PMA (5 microg/ml) on the transcription factors activator protein (AP)-1, nuclear factor of activated T cells (NFAT), and NF-kappaB but not Sp1. In conclusion, osmotic cell shrinkage blunts the stimulatory action of antigen exposure on IFN-gamma production, an effect explained at least partially by suppression of transcription factor activation.

Gamma-interferon causes a selective induction of the lysosomal proteases, cathepsins B and L, in macrophages

NASA Technical Reports Server (NTRS)

Lah, T. T.; Hawley, M.; Rock, K. L.; Goldberg, A. L.

1995-01-01

Previous studies have indicated that acid-optimal cysteine proteinase(s) in the endosomal-lysosomal compartments, cathepsins, play a critical role in the proteolytic processing of endocytosed proteins to generate the antigenic peptides presented to the immune system on major histocompatibility complex (MHC) class II molecules. The presentation of these peptides and the expression of MHC class II molecules by macrophages and lymphocytes are stimulated by gamma-interferon (gamma-IFN). We found that treatment of human U-937 monocytes with gamma-IFN increased the activities and the content of the two major lysosomal cysteine proteinases, cathepsins B and L. Assays of protease activity, enzyme-linked immunosorbant assays (ELISA) and immunoblotting showed that this cytokine increased the amount of cathepsin B 5-fold and cathepsin L 3-fold in the lysosomal fraction. By contrast, the aspartic proteinase, cathepsin D, in this fraction was not significantly altered by gamma-IFN treatment. An induction of cathepsins B and L was also observed in mouse macrophages, but not in HeLa cells. These results suggest coordinate regulation in monocytes of the expression of cathepsins B and L and MHC class II molecules. Presumably, this induction of cysteine proteases contributes to the enhancement of antigen presentation by gamma-IFN.

STING-Dependent Interferon-λ1 Induction in HT29 Cells, a Human Colorectal Cancer Cell Line, After Gamma-Radiation.

PubMed

Chen, Jianzhou; Markelc, Bostjan; Kaeppler, Jakob; Ogundipe, Vivian M L; Cao, Yunhong; McKenna, W Gillies; Muschel, Ruth J

2018-05-01

To investigate the induction of type III interferons (IFNs) in human cancer cells by gamma-rays. Type III IFN expression in human cancer cell lines after gamma-ray irradiation in vitro was assessed by reverse transcription-quantitative polymerase chain reaction and enzyme-linked immunosorbent assay. Signaling pathways mediating type III IFN induction were examined by a variety of means, including immunoblotting, flow cytometry, confocal imaging, and reverse transcription-quantitative polymerase chain reaction. Key mediators in these pathways were further explored and validated using gene CRISPR knockout or short hairpin RNA knockdown. Exposure to gamma-rays directly induced type III IFNs (mainly IFNL1) in human cancer cell lines in dose- and time-dependent fashions. The induction of IFNL1 was primarily mediated by the cytosolic DNA sensors-STING-TBK1-IRF1 signaling axis, with a lesser contribution from the nuclear factor kappa b signaling in HT29 cells. In addition, type III IFN signaling through its receptors serves as a positive feedback loop, further enhancing IFN expression via up-regulation of the kinases in the STING-TBK1 signaling axis. Our results suggest that IFNL1 can be up-regulated in human cancer cell lines after gamma-ray treatment. In HT29 cells this induction occurs via the STING pathway, adding another layer of complexity to the understanding of radiation-induced antitumor immunity, and may provide novel insights into IFN-based cancer treatment. Copyright © 2018 Elsevier Inc. All rights reserved.

Effects of chicken interferon Gamma on Newcastle disease virus vaccine immunogenicity

USDA-ARS?s Scientific Manuscript database

More effective vaccines are needed to control avian diseases. The use of chicken interferon gamma (chIFN') during vaccination is a potentially important but controversial approach that may improve the immune response to antigens. In the present study, three different systems to co-deliver chIFN' wit...

A cyclometalated iridium(III) complex used as a conductor for the electrochemical sensing of IFN-γ

NASA Astrophysics Data System (ADS)

Miao, Xiangmin; Ko, Chung-Nga; Vellaisamy, Kasipandi; Li, Zongbing; Yang, Guanjun; Leung, Chung-Hang; Ma, Dik-Lung

2017-02-01

A novel iridium(III) complex was prepared and used as a conductor for sensitive and enzyme-free electrochemical detection of interferon gamma (IFN-γ). This assay is based on a dual signal amplification mechanism involving positively charged gold nanoparticles ((+)AuNPs) and hybridization chain reaction (HCR). To construct the sensor, nafion (Nf) and (+)AuNPs composite membrane was first immobilized onto the electrode surface. Subsequently, a loop-stem structured capture probe (CP) containing a special IFN-γ interact strand was modified onto the (+)AuNP surface via the formation of Au-S bonds. Upon addition of IFN-γ, the loop-stem structure of CP was opened, and the newly exposed “sticky” region of CP then hybridized with DNA hairpin-1 (H1), which in turn opened its hairpin structure for hybridizing with DNA hairpin-2 (H2). Happen of HCR between H1 and H2 thus generated a polymeric duplex DNA (dsDNA) chain. Meanwhile, the iridium(III) complex could interact with the grooves of the dsDNA polymer, producing a strong current signal that was proportional to IFN-γ concentration. Thus, sensitive detection of IFN-γ could be realized with a detection limit down to 16.3 fM. Moreover, satisfied results were achieved by using this method for the detection of IFN-γ in human serum samples.

Lectin of Bacillus subtilis sp. as overinducer of gamma-interferonogenesis.

PubMed

Kishko, Ia H; Vasylenko, M I; Pidhors'kyĭ, V S; Kovalenko, E O

1997-01-01

It has been demonstrated experimentally that lectin of Bacillus subtilis sp. in comparison with generally accepted Con A, PHA and lectin of "gold rain" grass--Laburnum anagyroides M e d i k in trials on white mice of CBA line gave in 4 hours of induction maximal titers of gamma-IFN in blood serum of animals--153.6 +/- 17.0 IU/ml. Practically identical titers had been obtained after induction by lectin "gold rain", some lower--after Con A and PHA. At swine gamma-IFN synthesis optimal density of cell suspension must contain 2.5 + 10(7) immunocytes in 1 ml, owing to which it is possible to obtain the titer equal 1 : 2150. Materials with using of bacterial lectins at various degree of purification had shown that maximal titers in blood serum of mongrel white mice were registered at administration to animals of non-purified lectin, 4 times lower--at using of half-purified and purified lectins. Data of these trials in vivo were confirmed by materials of gamma-IFN induction by immunocytes of swine, cattle and even man.

Delayed growth of EL4 lymphoma in SR-A-deficient mice is due to upregulation of nitric oxide and interferon-gamma production by tumor-associated macrophages.

PubMed

Komohara, Yoshihiro; Takemura, Kenichi; Lei, Xiao Feng; Sakashita, Naomi; Harada, Mamoru; Suzuki, Hiroshi; Kodama, Tatsuhiko; Takeya, Motohiro

2009-11-01

Class A scavenger receptors (SR-A, CD204) are highly expressed in tumor-associated macrophages (TAM). To investigate the function of SR-A in TAM, wild-type and SR-A-deficient (SR-A(-/-)) mice were injected with EL4 cells. Although these groups of mice did not differ in the numbers of infiltrating macrophages and lymphocytes and in neovascularization, SR-A(-/-) mice had delayed growth of EL4 tumors. Expression of inducible nitric oxide (NO) synthase and interferon (IFN)-gamma mRNA increased significantly in tumor tissues from SR-A(-/-) mice. Engulfment of necrotic EL4 cells induced upregulation of NO and IFN-gamma production by cultured macrophages, and production of NO and IFN-gamma increased in SR-A(-/-) macrophages in vitro. IFN-beta production by cultured macrophages was also elevated in SR-A(-/-) macrophages in vitro. These results suggested that the antitumor activity of macrophages increased in SR-A(-/-) mice because of upregulation of NO and IFN-gamma production. These data indicate an important role of SR-A in regulating TAM function by inhibiting toll-like receptor (TLR)4-IFN-beta signaling.

TNF-alpha -308G>A polymorphism is associated with suicide attempts in major depressive disorder.

PubMed

Kim, Yong-Ku; Hong, Jin-Pyo; Hwang, Jung-A; Lee, Heon-Jeong; Yoon, Ho-Kyoung; Lee, Bun-Hee; Jung, Han-Yong; Hahn, Sang-Woo; Na, Kyoung-Sae

2013-09-05

Despite the substantial role of the cytokine network in depression and suicide, few studies have investigated the role of genetic polymorphisms of pro- and anti-inflammatory cytokines in suicide in major depressive disorder (MDD). The aim of this study was to investigate whether tumor necrosis factor-alpha (TNF-alpha) -308G>A, interferon-gamma (IFN-gamma) +874A>T, and interleukin-10 (IL-10) -1082A>G are associated with increased risk for suicide attempts in MDD. Among patients with MDD, 204 patients who had attempted suicide and 97 control patients who had not attempted suicide were recruited. A chi-square test was used to identify a possible risk genotype or allele type for suicide. A subsequent multivariate logistic regression analysis was conducted to investigate the influence of a risk genotype or allele type adjusted for other environmental factors. The lethality of the suicide attempt was also tested between genotype and allele types among suicidal patients with MDD. The GG genotype of the TNF-alpha -308G>A polymorphism was found to significantly increase risk for suicide attempt (adjusted OR=2.630, 95% CI=1.206 to 5.734). IFN-gamma +874A>T and IL-10 -1082A>G were not associated with risk for suicide. Lethality of the suicide attempt was not associated with any of the three cytokine genotypes or allele types. Limitations include a relatively small sample size and a cross-sectional design. TNF-alpha -308G>A polymorphism is an independent risk factor for suicide attempts in MDD. Future studies should clarify the neural mechanisms by which the GG genotype of TNF-alpha -308G>A influences suicide in MDD. Copyright © 2013 Elsevier B.V. All rights reserved.

Interferon lambda (IFN-λ) efficiently blocks norovirus transmission in a mouse model.

PubMed

Rocha-Pereira, Joana; Jacobs, Sophie; Noppen, Sam; Verbeken, Eric; Michiels, Thomas; Neyts, Johan

2018-01-01

Human noroviruses are highly efficient in person to person transmission thus associated with explosive outbreaks of acute gastroenteritis. Outbreak control is limited to disinfection and isolation measures. Strategies to control the spread of noroviruses should be developed and models to study norovirus transmission will greatly facilitate this. Here, a mouse-to-mouse transmission model, in which mice develop acute murine norovirus (MNV)-induced diarrhea, was used to explore the role of interferon lambda (IFN-λ) in the control of a norovirus infection. Sentinel AG129 mice [deficient in IFN-α/β and IFN-γ receptors] that were co-housed with MNV-infected mice shedding high amounts of virus in their stool, developed a MNV-infection with associated diarrhea. Inoculation of such sentinel mice with an IFN-λ expression plasmid resulted in the production of circulating IFN-λ and upregulation of the expression of IFN-stimulated genes (ISGs) of the gut. Injection of the IFN-λ-expressing plasmid to sentinels prevents MNV-induced disease upon exposure to MNV-infected mice, as well as MNV replication in the small intestine, the associated signs of inflammation and the mounting of a specific IgG-based immune response. This demonstrates that IFN-λ can alone mediate protection against transmission of norovirus. The development of a simple delivery method for IFN-λ could be explored as a strategy to control norovirus outbreaks and protect vulnerable populations such as the elderly and immunocompromised. Copyright © 2017. Published by Elsevier B.V.

Interferon Gamma in African Trypanosome Infections: Friends or Foes?

PubMed

Wu, Hui; Liu, Gongguan; Shi, Meiqing

2017-01-01

African trypanosomes cause fatal infections in both humans and livestock. Interferon gamma (IFN-γ) plays an essential role in resistance to African trypanosomes. However, increasing evidence suggests that IFN-γ, when excessively synthesized, also induces immunopathology, enhancing susceptibility to the infection. Thus, production of IFN-γ must be tightly regulated during infections with African trypanosomes to ensure that a robust immune response is elicited without tissue destruction. Early studies have shown that secretion of IFN-γ is downregulated by interleukin 10 (IL-10). More recently, IL-27 has been identified as a negative regulator of IFN-γ production during African trypanosome infections. In this review, we discuss the current state of our understanding of the role of IFN-γ in African trypanosome infections. We have focused on the cellular source of IFN-γ, its beneficial and detrimental effects, and mechanisms involved in regulation of its production, highlighting some recent advances and offering some perspectives on future directions.

Interferon-gamma inhibits intestinal restitution by preventing gap junction communication between enterocytes.

PubMed

Leaphart, Cynthia L; Qureshi, Faisal; Cetin, Selma; Li, Jun; Dubowski, Theresa; Baty, Catherine; Batey, Catherine; Beer-Stolz, Donna; Guo, Fengli; Murray, Sandra A; Hackam, David J

2007-06-01

Necrotizing enterocolitis (NEC) is characterized by interferon-gamma (IFN-gamma) release and inadequate intestinal restitution. Because enterocytes migrate together, mucosal healing may require interenterocyte communication via connexin 43-mediated gap junctions. We hypothesize that enterocyte migration requires interenterocyte communication, that IFN impairs migration by impairing connexin 43, and that impaired healing during NEC is associated with reduced gap junctions. NEC was induced in Swiss-Webster or IFN(-/-) mice, and restitution was determined in the presence of the gap junction inhibitor oleamide, or via time-lapse microscopy of IEC-6 cells. Connexin 43 expression, trafficking, and localization were detected in cultured or primary enterocytes or mouse or human intestine by confocal microscopy and (35)S-labeling, and gap junction communication was assessed using live microscopy with oleamide or connexin 43 siRNA. Enterocytes expressed connexin 43 in vitro and in vivo, and exchanged fluorescent dye via gap junctions. Gap junction inhibition significantly reduced enterocyte migration in vitro and in vivo. NEC was associated with IFN release and loss of enterocyte connexin 43 expression. IFN inhibited enterocyte migration by reducing gap junction communication through the dephosphorylation and internalization of connexin 43. Gap junction inhibition significantly increased NEC severity, whereas reversal of the inhibitory effects of IFN on gap junction communication restored enterocyte migration after IFN exposure. Strikingly, IFN(-/-) mice were protected from the development of NEC, and showed restored connexin 43 expression and intestinal restitution. IFN inhibits enterocyte migration by preventing interenterocyte gap junction communication. Connexin 43 loss may provide insights into the development of NEC, in which restitution is impaired.

MPT-51/CpG DNA vaccine protects mice against Mycobacterium tuberculosis.

PubMed

Silva, Bruna Daniella de Souza; da Silva, Ediane Batista; do Nascimento, Ivan Pereira; Dos Reis, Michelle Cristina Guerreiro; Kipnis, André; Junqueira-Kipnis, Ana Paula

2009-07-16

Tuberculosis (TB) is a severe infectious disease that kills approximately two million people worldwide every year. Because BCG protection is variable and does not protects adults, there is a great need for a new vaccine against TB that does not represent a risk for immunocompromised patients and that is also capable of protecting adult individuals. MPT-51 is a protein found in the genome of mycobacteria and binds to the fibronectin of the extracellular matrix, which may have a role in host tissue attachment and virulence. In order to test the usefulness of MPT-51 as a subunit vaccine, BALB/c were vaccinated and challenged with Mycobacterium tuberculosis. The infection of BALB/c with M. tuberculosis increased the number of IFN-gamma(+) T lymphocytes specific to MPT-51 in the spleen and lungs. Inoculation with rMPT-51/FIA and with rMPT-51/CpG DNA in non-infected BALB/c increased the amounts of IFN-gamma(+) T lymphocytes. Inoculation with rMPT-51/FIA also induced a humoral response specific to MPT-51. CFU counts of lung tissues done 60 days after infection showed a reduction of about 2 log in the bacteria load in the group of animals inoculated with rMPT-51/CpG DNA. These results make MPT-51 a valuable component to be further evaluated in the development of other subunit vaccines.

Knockdown of hTERT and concurrent treatment with interferon-gamma inhibited proliferation and invasion of human glioblastoma cell lines

PubMed Central

George, Joseph; Banik, Naren L.; Ray, Swapan K.

2011-01-01

Human telomerase reverse transcriptase (hTERT) is the catalytic component of telomerase that facilitates tumor cell invasion and proliferation. Telomerase and hTERT are remarkably upregulated in majority of cancers including glioblastoma. Interferon-gamma (IFN-γ) modulates several cellular activities including cell cycle and multiplication through transcriptional regulation. The present investigation was designed to unravel the molecular mechanisms of the inhibition of cell proliferation, migration, and invasion of human glioblastoma SNB-19 and LN-18 cell lines after knockdown of hTERT using a plasmid vector based siRNA and concurrent treatment with IFN-γ. We observed more than 80% inhibition of cell proliferation, migration, and invasion of both cell lines after the treatment with combination of hTERT siRNA and IFN-γ. Our studies also showed accumulation of apoptotic cells in subG1 phase and an increase in cell population in G0/G1 with a reduction in G2/M phase indicating cell cycle arrest in G0/G1 phase for apoptosis. Semiquantitative and real-time RT-PCR analyses demonstrated significant downregulation of c- Myc and upregulation of p21 Waf1 and p27 Kip1. Western blotting confirmed the downregulation of the molecules involved in cell proliferation, migration, and invasion and also showed upregulation of cell cycle inhibitors. In conclusion, our study demonstrated that knockdown of hTERT siRNA and concurrent treatment with IFN-γ effectively inhibited cell proliferation, migration, and invasion in glioblastoma cells through downregulation of the molecules involved in these processes and cell cycle inhibition. Therefore, the combination of hTERT siRNA and IFN-γ offers a potential therapeutic strategy for controlling growth of human glioblastoma cells. PMID:20394835

Establishment and evaluation of a bead-based luminex assay allowing simultaneous quantification of equine IL-12 and IFN-γ.

PubMed

Duran, Maria Carolina; Willenbrock, Saskia; Müller, Jessika-M V; Nolte, Ingo; Feige, Karsten; Murua Escobar, Hugo

2013-04-01

Interleukin-12 (IL-12) and interferon gamma (IFN-γ) are key cytokines in immunemediated equine melanoma therapy. Currently, a method for accurate simultaneous quantification of these equine cytokines is lacking. Therefore, we sought to establish an assay that allows for accurate and simultaneous quantification of equine IL-12 (eIL-12) and IFN-γ (eIFN-γ). Several antibodies were evaluated for cross-reactivity to eIL-12 and eIFN-γ and were used to establish a bead-based Luminex assay, which was subsequently applied to quantify cytokine concentrations in biological samples. Cytokine detection ranged from 31.5-5,000 pg/ml and 15-10,000 pg/ml for eIL-12 and eIFN-γ, respectively. eIL-12 was detected in supernatants of stimulated peripheral blood mononuclear cells (PBMCs) and supernatants/cell lysates of eIL-12 expression plasmid-transfected cells. Low or undetectable cytokine concentrations were measured in negative controls. In equine serum samples, the mean measured eIL-12 concentration was 1,374 ± 8 pg/ml. The bead-based assay and ELISA for eIFN-γ used to measure eIFN-γ concentrations, showed similar concentrations. Results demonstrate, to our knowledge for the first time, that cross-reactive antibody pairs to eIL-12 and eIFN-γ and Luminex bead-based technology allow for accurate, simultaneous and multiplexed quantification of these key cytokines in biological samples.

Immunity to Trichinella spiralis infection in vitamin A-deficient mice

PubMed Central

1992-01-01

Vitamin A-deficient (A-) mice make strikingly poor IgG responses when they are immunized with purified protein antigens. Previously, we showed that A- T cells overproduce interferon gamma (IFN-gamma), which then could inhibit interleukin 4 (IL-4)-stimulated B cell IgG responses. To determine if the altered IFN-gamma regulation pattern and its immunological consequences would extend to a natural infection, we studied mice infected with the parasitic helminth Trichinella spiralis. The course of the infection was similar in A- and A-sufficient (A+) mice. These mice did not differ with respect to newborn larvae/female/hour produced in the intestine, or muscle larvae burden 5 wk postinfection. They also did not differ in the intestinal worm expulsion rate until day 15, when A- mice still harbored parasites, whereas A+ mice had cleared intestinal worms. Vitamin A deficiency reduced both the frequency of B lymphocytes secreting IgG1 antibodies to parasite antigens, and the bone marrow eosinophilia associated with helminth infection. The cytokine secretion patterns in infected mice were consistent with these observations and with previous studies. Mesenteric lymph node cells from infected A- mice secreted significantly more IFN-gamma, and significantly less IL-2, IL-4, and IL- 5 than infected A+ controls. A- splenocytes secreted significantly more IFN-gamma, and equivalent amounts of IL-2, IL-4, and IL-5 compared with A+ controls. Interestingly, CD4-CD8- cells secreted the majority of the IL-4 produced in the spleen. The IL-2, IL-4, and IL-5 steady-state transcript levels correlated with secreted protein levels, but IFN- gamma transcripts did not. Although they secreted more protein, A- cells contained fewer IFN-gamma transcripts than A+ cells. These results suggest two vitamin A-mediated regulation steps in IFN-gamma gene expression: positive regulation of IFN-gamma transcript levels, and negative regulation posttranscriptionally. The essentially unaltered outcome of T

IFN-ε protects primary macrophages against HIV infection.

PubMed

Tasker, Carley; Subbian, Selvakumar; Gao, Pan; Couret, Jennifer; Levine, Carly; Ghanny, Saleena; Soteropoulos, Patricia; Zhao, Xilin; Landau, Nathaniel; Lu, Wuyuan; Chang, Theresa L

2016-12-08

IFN-ε is a unique type I IFN that is not induced by pattern recognition response elements. IFN-ε is constitutively expressed in mucosal tissues, including the female genital mucosa. Although the direct antiviral activity of IFN-ε was thought to be weak compared with IFN-α, IFN-ε controls Chlamydia muridarum and herpes simplex virus 2 in mice, possibly through modulation of immune response. We show here that IFN-ε induces an antiviral state in human macrophages that blocks HIV-1 replication. IFN-ε had little or no protective effect in activated CD4 + T cells or transformed cell lines unless activated CD4 + T cells were infected with replication-competent HIV-1 at a low MOI. The block to HIV infection of macrophages was maximal after 24 hours of treatment and was reversible. IFN-ε acted on early stages of the HIV life cycle, including viral entry, reverse transcription, and nuclear import. The protection did not appear to operate through known type I IFN-induced HIV host restriction factors, such as APOBEC3A and SAMHD1. IFN-ε-stimulated immune mediators and pathways had the signature of type I IFNs but were distinct from IFN-α in macrophages. IFN-ε induced significant phagocytosis and ROS, which contributed to the block to HIV replication. These findings indicate that IFN-ε induces an antiviral state in macrophages that is mediated by different factors than those induced by IFN-α. Understanding the mechanism of IFN-ε-mediated HIV inhibition through immune modulation has implications for prevention.

IFN-ε protects primary macrophages against HIV infection

PubMed Central

Tasker, Carley; Subbian, Selvakumar; Gao, Pan; Couret, Jennifer; Levine, Carly; Ghanny, Saleena; Soteropoulos, Patricia; Zhao, Xilin; Landau, Nathaniel; Lu, Wuyuan

2016-01-01

IFN-ε is a unique type I IFN that is not induced by pattern recognition response elements. IFN-ε is constitutively expressed in mucosal tissues, including the female genital mucosa. Although the direct antiviral activity of IFN-ε was thought to be weak compared with IFN-α, IFN-ε controls Chlamydia muridarum and herpes simplex virus 2 in mice, possibly through modulation of immune response. We show here that IFN-ε induces an antiviral state in human macrophages that blocks HIV-1 replication. IFN-ε had little or no protective effect in activated CD4+ T cells or transformed cell lines unless activated CD4+ T cells were infected with replication-competent HIV-1 at a low MOI. The block to HIV infection of macrophages was maximal after 24 hours of treatment and was reversible. IFN-ε acted on early stages of the HIV life cycle, including viral entry, reverse transcription, and nuclear import. The protection did not appear to operate through known type I IFN-induced HIV host restriction factors, such as APOBEC3A and SAMHD1. IFN-ε–stimulated immune mediators and pathways had the signature of type I IFNs but were distinct from IFN-α in macrophages. IFN-ε induced significant phagocytosis and ROS, which contributed to the block to HIV replication. These findings indicate that IFN-ε induces an antiviral state in macrophages that is mediated by different factors than those induced by IFN-α. Understanding the mechanism of IFN-ε–mediated HIV inhibition through immune modulation has implications for prevention. PMID:27942584

Towards molecular modeling of the impact of heparin-derived oligosaccharides on hIFN-γ binding

NASA Astrophysics Data System (ADS)

Lilkova, E.; Petkov, P.; Ilieva, N.; Litov, L.

2015-10-01

Human interferon gamma (hIFN-γ) is an important signalling molecule, which plays a key role in the formation and modulation of immune response. The role of the cytokine C-termini in the formation of a complex with the extracellular receptor is still controversial due to the lack of structural information about this domain. Moreover, the C-termini are also responsible for the high affinity interaction of hIFN-γ with the glycosaminoglicans heparan sulfate and heparin. This interaction can drastically change the properties and behaviour of the protein. We performed molecular dynamics simulations in order to model the structure of the hIFN-γ C-terminal part and the interaction of the cytokine with heparin-derived oligosaccharides. For this purpose we reconstructed the missing C-terminal amino acid residues and performed folding simulations to determine their conformation. In order to simulate the interaction with heparin-like fragments, we developed CHARMM 36 compatible force field for the sulfamate anion group that is present in the glucosamine sugar to complete the heparin and heparan sulfate force field. The new topology and parameters reproduce the available experimental structural properties of heparin-like fragments. The simulations show that the oligosaccharides quickly bind the IFN-γ C-termini and reduce their solvent accessible surface area.

SEARCHING FOR OVERIONIZED PLASMA IN THE GAMMA-RAY-EMITTING SUPERNOVA REMNANT G349.7+0.2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ergin, T.; Sezer, A.; Saha, L.

2015-05-10

G349.7+0.2 is a supernova remnant (SNR) expanding in a dense medium of molecular clouds and interacting with clumps of molecular material emitting gamma-rays. We analyzed the gamma-ray data of the Large Area Telescope on board the Fermi Gamma-Ray Space Telescope and detected G349.7+0.2 in the energy range of 0.2–300 GeV with a significance of ∼13σ, showing no extended morphology. Modeling of the gamma-ray spectrum revealed that the GeV gamma-ray emission dominantly originates from the decay of neutral pions, where the protons follow a broken power-law distribution with a spectral break at ∼12 GeV. To search for features of radiative recombinationmore » continua in the eastern and western regions of the remnant, we analyzed the Suzaku data of G349.7+0.2 and found no evidence for overionized plasma. In this paper, we discuss possible scenarios to explain the hadronic gamma-ray emission in G349.7+0.2 and the mixed morphology nature of this SNR.« less

Essential role of mitochondrial antiviral signaling, IFN regulatory factor (IRF)3, and IRF7 in Chlamydophila pneumoniae-mediated IFN-beta response and control of bacterial replication in human endothelial cells.

PubMed

Buss, Claudia; Opitz, Bastian; Hocke, Andreas C; Lippmann, Juliane; van Laak, Vincent; Hippenstiel, Stefan; Krüll, Matthias; Suttorp, Norbert; Eitel, Julia

2010-03-15

Chlamydophila pneumoniae infection of the vascular wall as well as activation of the transcription factor IFN regulatory factor (IRF)3 have been linked to development of chronic vascular lesions and atherosclerosis. The innate immune system detects invading pathogens by use of pattern recognition receptors, some of which are able to stimulate IRF3/7 activation and subsequent type I IFN production (e. g., IFN-beta). In this study, we show that infection of human endothelial cells with C. pneumoniae-induced production of IFN-beta, a cytokine that so far has been mainly associated with antiviral immunity. Moreover, C. pneumoniae infection led to IRF3 and IRF7 nuclear translocation in HUVECs and RNA interference experiments showed that IRF3 and IRF7 as well as the mitochondrial antiviral signaling (MAVS) were essential for IFN-beta induction. Finally, C. pneumoniae replication was enhanced in endothelial cells in which IRF3, IRF7, or MAVS expression was inhibited by small interfering RNA and attenuated by IFN-beta treatment. In conclusion, C. pneumoniae infection of endothelial cells activates an MAVS-, IRF3-, and IRF7-dependent signaling, which controls bacterial growth and might modulate development of vascular lesions.

[Interleukin 8 and interferon gamma in ocular toxoplasmosis].

PubMed

Czepiel, Jacek; Biesiada, Grazyna; Sobczyk-Krupiarz, Iwona; Miklasszewska, Grazyna; Fedak, Danuta; Solnica, Bogdan; Mach, Tomasz; Garlicki, Aleksander

2011-01-01

Toxoplasmosis is one of the most common parasitic infections in the world, it is caused by Toxoplasma gondii. The infection is typically asymptomatic or the symptoms are very mild. Approximately 10% patients have limphadenopathy, involvement of the others organs, like eyes, nervous system, liver, heart, are observed more rarely. The aim of our study was to assess the level of selected cytokines in blood among patients with ocular toxoplasmosis. We have enrolled in the study 30 patients, 19-42 years old, treated for ocular toxoplasmosis, and 20 healthy volunteers, 20-48 years old, to the control group. Tests for blood morphology, C-reactive protein, the level of IL-8 and IFN-gamma were performed in all patients. The blood parameters in toxoplasmosis group were performed before antiparasitic treatment was given. The level of IFN-gamma in blood was lower among patients with ocular toxoplasmosis comparing with control group (1.52 vs. 4.18 pg/ml; p = 0.002). The level of IL-8 in blood was lower among patients with ocular toxoplasmosis comparing with control group (22.96 vs. 94.3 pg/ml; p = 0,007). There were no correlations between analyzed cytokines and blood morphology or CRP. The low level of IFN-gamma and IL-8 in blood is important factor leading to reactivation of the ocular toxoplasmosis.

The development of a modified human IFN-alpha2b linked to the Fc portion of human IgG1 as a novel potential therapeutic for the treatment of hepatitis C virus infection.

PubMed

Jones, Tim D; Hanlon, Marian; Smith, Beverley J; Heise, Charles T; Nayee, Prakash D; Sanders, Deborah A; Hamilton, Anita; Sweet, Clive; Unitt, Esther; Alexander, Graeme; Lo, Kin-Ming; Gillies, Stephen D; Carr, Frank J; Baker, Matthew P

2004-09-01

Interferon-alpha (IFN-alpha), in conjunction with ribavirin, is the current standard for the treatment of chronic hepatitis C virus (HCV) infection. This treatment requires frequent dosing, with a significant risk of the development of anti-IFN-alpha neutralizing antibodies that correlates with lack of efficacy or relapse. We have developed an IFN-alpha linked to the Fc region of human IgG1 for improved half-life and less frequent dosing. We have also identified, using a human T cell proliferation assay, three regions of IFN-alpha2b that are potentially immunogenic, and a variant containing a total of six mutations within these regions was made. This variant was made as a fusion to Fc either with or without a flexible linker between the fusion partners. Both configurations of the variant were less active than native IFN-alpha alone, although the variant containing the flexible linker had in vitro antiviral activity within the range of other modified IFN-alphas currently in clinical use. Peptides spanning the modified regions were tested in T cell proliferation assays and found to be less immunogenic than native controls when using peripheral blood mononuclear cells (PBMCs) from both healthy individuals and HCV-infected patients who had been treated previously with IFN-alpha2b. Copyright Mary Ann Liebert, Inc.

The IFN Response in Bats Displays Distinctive IFN-Stimulated Gene Expression Kinetics with Atypical RNASEL Induction.

PubMed

De La Cruz-Rivera, Pamela C; Kanchwala, Mohammed; Liang, Hanquan; Kumar, Ashwani; Wang, Lin-Fa; Xing, Chao; Schoggins, John W

2018-01-01

Bats host a large number of zoonotic viruses, including several viruses that are highly pathogenic to other mammals. The mechanisms underlying this rich viral diversity are unknown, but they may be linked to unique immunological features that allow bats to act as asymptomatic viral reservoirs. Vertebrates respond to viral infection by inducing IFNs, which trigger antiviral defenses through IFN-stimulated gene (ISG) expression. Although the IFN system of several bats is characterized at the genomic level, less is known about bat IFN-mediated transcriptional responses. In this article, we show that IFN signaling in bat cells from the black flying fox ( Pteropus alecto ) consists of conserved and unique ISG expression profiles. In IFN-stimulated cells, bat ISGs comprise two unique temporal subclusters with similar early induction kinetics but distinct late-phase declines. In contrast, human ISGs lack this decline phase and remained elevated for longer periods. Notably, in unstimulated cells, bat ISGs were expressed more highly than their human counterparts. We also found that the antiviral effector 2-5A-dependent endoribonuclease, which is not an ISG in humans, is highly IFN inducible in black flying fox cells and contributes to cell-intrinsic control of viral infection. These studies reveal distinctive innate immune features that may underlie a unique virus-host relationship in bats. Copyright © 2017 by The American Association of Immunologists, Inc.

Immune stimulation by a CpG-containing oligodeoxynucleotide is enhanced when encapsulated and delivered in lipid particles.

PubMed

Mui, B; Raney, S G; Semple, S C; Hope, M J

2001-09-01

The therapeutic benefit from phosphorothioate oligodeoxynucleotides (PS ODN) containing immune stimulatory sequences (ISS) has been demonstrated in animal models of cancer and infection. In particular, when CpG-containing PS ODN are administered to mice, activation of macrophages and dendritic, NK, T, and B cells occurs, resulting in the release of an array of cytokines, including interleukin-12 (IL-12), interferon-gamma (IFN-gamma), and tumor necrosis factor-alpha (TNF-alpha). We have previously described stabilized antisense-lipid particles (SALP) for the i.v. administration of antisense ODN [Biochim Biophys Acta (2001) 1510:152--166]. Given the propensity for SALP to target macrophages in vivo it was of interest to determine whether they could enhance the potency of CpG ODN to induce an immune response. In this report we show that when CpG-containing SALP are administered intravenously to ICR mice the plasma concentrations of IL-12, IFN-gamma, IL-6, monocyte chemoattractant protein-1, and TNF-alpha are greatly increased compared with the same dose of free ODN. The pattern of cytokine induction indicates that the immune response is T helper cell type 1-biased, similar to that observed for PS CpG ODN ISS in general. Furthermore, when phosphodiester (PO) ODN is substituted for PS ODN in the SALP formulation cytokine induction is even greater at the early time points, in marked contrast to free PO ODN, which is inactive. These results demonstrate that the immunogenicity of ISS is not only enhanced by encapsulation in lipid particles, which more closely mimic the way ISS DNA would normally be presented to antigen presenting cells by pathogens in vivo, but also SALP enable unmodified PO CpG ODN to be used as immune stimulants.

Early Experience With CliniMACS Prodigy CCS (IFN-gamma) System in Selection of Virus-specific T Cells From Third-party Donors for Pediatric Patients With Severe Viral Infections After Hematopoietic Stem Cell Transplantation.

PubMed

Kállay, Krisztián; Kassa, Csaba; Réti, Marienn; Karászi, Éva; Sinkó, János; Goda, Vera; Stréhn, Anita; Csordás, Katalin; Horváth, Orsolya; Szederjesi, Attila; Tasnády, Szabolcs; Hardi, Apor; Kriván, Gergely

2018-04-01

Viral reactivation is a frequent complication of allogeneic hematopoietic stem cell transplantation especially in children. For refractory cases, rapid virus-specific T-cell therapy would be ideally implemented within a few days. Over the course of a year in our pediatric cohort of 43 allogeneic transplantation, 9 patients fulfilled criteria for virus-specific T-cell therapy. Viral infections were due to cytomegalovirus (CMV) in 3, Epstein-Barr virus (EBV) in 2, and adenovirus (AdV) in 1 case, whereas >1 virus was detected in 3 cases. Viral diseases necessitating a T-cell therapy were CMV pneumonitis and colitis, AdV enteritis and cystitis, and EBV-induced posttransplantation lymphoproliferative disease. Cells were produced by the CliniMACS Prodigy CCS (IFN-gamma) System within 24 hours after mononuclear leukapheresis. Eight patients became completely asymptomatic, whereas 7 also cleared the virus. Six patients are alive without viral illness or sequelae demonstrating viral DNA clearance in peripheral blood with a median follow-up of 535 (350-786) days. One patient with CMV pneumonitis died of respiratory insufficiency. In 2 cases the viral illness improved or cleared, however, the patients died of invasive aspergillosis. No cases of graft-versus-host disease, rejection, organ toxicity, or recurrent infection were noticed. Virus-specific T-cell therapy implemented by the CliniMACS Prodigy CCS (IFN-gamma) System is an automated, fast, safe, and probably effective way to control resistant viral diseases after pediatric hematopoietic stem cell transplantation.

Effects of type I/type II interferons and transforming growth factor-beta on B-cell differentiation and proliferation. Definition of costimulation and cytokine requirements for immunoglobulin synthesis and expression.

PubMed

Estes, D M; Tuo, W; Brown, W C; Goin, J

1998-12-01

In this report, we sought to determine the role of selected type I interferons [interferon-alpha (IFN-alpha) and interferon-tau (IFN-tau)], IFN-gamma and transforming growth factor-beta (TGF-beta) in the regulation of bovine antibody responses. B cells were stimulated via CD40 in the presence or absence of B-cell receptor (BCR) cross-linking. IFN-alpha enhanced IgM, IgG2 and IgA responses but did not enhance IgG1 responses. BCR signalling alone was more effective at inducing IgG2 responses with IFN-alpha than dual cross-linking with CD40. Recombinant ovine IFN-tau was less effective at inducing IgG2 responses when compared with IFN-alpha, though IgA responses were similar in magnitude following BCR cross-linking. At higher concentrations, IFN-tau enhanced IgA responses greater than twofold over the levels observed with IFN-alpha. Previous studies have shown that addition of IFN-gamma to BCR or pokeweed mitogen-activated bovine B cells stimulates IgG2 production. However, following CD40 stimulation alone, IFN-gamma was relatively ineffective at stimulating high-rate synthesis of any non-IgM isotype. Dual cross-linking via CD40 and the BCR resulted in decreased synthesis of IgM with a concomitant increase in IgA and similar levels of IgG2 production to those obtained via the BCR alone. We also assessed the effects of endogenous and exogenous TGF-beta on immunoglobulin synthesis by bovine B cells. Exogenous TGF-beta stimulates both IgG2 and IgA production following CD40 and BCR cross-linking in the presence of IL-2. Blocking endogenous TGF-beta did not inhibit the up-regulation of IgG2 or IgA by interferons.

Effect of recombinant human gamma interferon on intracellular activities of antibiotics against Listeria monocytogenes in the human macrophage cell line THP-1.

PubMed Central

Scorneaux, B; Ouadrhiri, Y; Anzalone, G; Tulkens, P M

1996-01-01

Listeria monocytogenes is a facultative intracellular pathogen which enters cells by endocytosis and reaches phagolysosomes from where it escapes and multiplies in the cytosol of untreated cells. Exposure of macrophages to gamma interferon (IFN-gamma) restricts L. monocytogenes to phagosomes and prevents its intracellular multiplication. We have tested whether IFN-gamma also modulates the susceptibility of L. monocytogenes to antibiotics. We selected drugs from three different classes displaying marked properties concerning their cellular accumulation and subcellular distribution, namely, ampicillin (not accumulated by cells but present in cytosol), azithromycin (largely accumulated by cells but mostly restricted to lysosomes), and sparfloxacin (accumulated to a fair extent but detected only in cytosol). We used a continuous line of myelomonocytic cells (THP-1 macrophages), which display specific surface receptors for IFN-gamma, and examined the activity of these antibiotics against L. monocytogenes Hly+ (virulent variant) and L. monocytogenes Hly- (a nonvirulent variant defective in hemolysin production). Untreated THP-1 and phorbol myristate acetate-differentiated THP-1 were permissive for infection and multiplication of intracellular L. monocytogenes Hly+ (virulent variant). All three antibiotics tested were bactericidal against this Listeria strain when added to an extracellular concentration of 10x their MIC. After preexposure of THP-1 to IFN-gamma, L. monocytogenes Hly+ was still phagocytosed but no longer grew intracellularly. The activity of ampicillin became almost undetectable (antagonistic effect), and that of azithromycin was unchanged (additive effect with that of IFN-gamma), whereas that of sparfloxacin was markedly enhanced (synergy). A similar behavior (lack of bacterial growth, associated with a loss of activity of ampicillin, an enhanced activity of sparfloxacin, and unchanged activity of azithromycin) was observed in cells infected with L

Exogenous IFN-beta regulates the RANKL-c-Fos-IFN-beta signaling pathway in the collagen antibody-induced arthritis model.

PubMed

Zhao, Rong; Chen, Ni-Nan; Zhou, Xiao-Wei; Miao, Ping; Hu, Chao-Ying; Qian, Liu; Yu, Qi-Wen; Zhang, Ji-Ying; Nie, Hong; Chen, Xue-hua; Li, Pu; Xu, Rong; Xiao, Lian-Bo; Zhang, Xin; Liu, Jian-Ren; Zhang, Dong-Qing

2014-12-10

Although a variety of drugs have been used to treat the symptoms of rheumatoid arthritis (RA), none of them are able to cure the disease. Interferon β (IFN-β) has pleiotropic effects on RA, but whether it can be used to treat RA remains globally controversial. Thus, in this study we tested the effects of IFN-β on RA patients and on collagen antibody-induced arthritis (CAIA) model mice. The cytokine and auto-antibody expression profiles in the serum and synovial fluid (SF) from RA patients were assessed using enzyme-linked immunosorbent assay (ELISA) and compared with the results from osteoarthritis (OA) patients. Exogenous IFN-β was administered to RA patients and CAIA model mice, and the therapeutic effects were evaluated. Endogenous IFN-β expression in the joint bones of CAIA model mice was evaluated by quantitative real-time PCR (qRT-PCR). The effects of exogenous IFN-β on CAIA model mice were assessed using a clinical scoring system, hematoxylin eosin and safranin-O with fast green counterstain histology, molybdenum target X-ray, and tartrate-resistant acid phosphatase (TRAP) staining. The RANKL-RANK signaling pathway was analyzed using qRT-PCR. The RAW 264.7 cell line was differentiated into osteoclasts with RANKL stimulation and then treated with exogenous IFN-β. The expression of inflammatory cytokines (IFN-γ, IL-17, MMP-3, and RANKL) and auto-antibodies (CII antibodies, RF-IgM, and anti-CCP/GPI) were significantly higher in RA compared with OA patients. After IFN-β intervention, some clinical symptoms in RA patients were partially alleviated, and the expression of IFN-γ, IL-17, MMP-3, and OPG) returned to normal levels. In the CAIA model, the expression of endogenous IFN-β in the joint bones was decreased. After IFN-β administration, the arthritis scores were decreased; synovial inflammation, cartilage, and bone destruction were clearly attenuated; and the expression of c-Fos and NFATc1 were reduced, while RANKL and TRAF6 expression was

Naive helper T cells from BCG-vaccinated volunteers produce IFN-gamma and IL-5 to mycobacterial antigen-pulsed dendritic cells.

PubMed

Kowalewicz-Kulbat, Magdalena; Kaźmierczak, Dominik; Donevski, Stefan; Biet, Franck; Pestel, Joël; Rudnicka, Wiesława

2008-01-01

Mycobacterium bovis bacillus Calmette-Guérin (BCG) is a live vaccine that has been used in routine vaccination against tuberculosis for nearly 80 years. However, its efficacy is controversial. The failure of BCG vaccination may be at least partially explained by the induction of poor or inappropriate host responses. Dendritic cells (DCs) are likely to play a key role in the induction of immune response to mycobacteria by polarizing the reactivity of T lymphocytes toward a Th1 profile, contributing to the generation of protective cellular immunity against mycobacteria. In this study we aimed to investigate the production of Th1 and Th2 cytokines by naive CD4+ T cells to mycobacterial antigen-pulsed DCs in the group of young, healthy BCG vaccinated volunteers. The response of naive helper T cells was compared with the response of total blood lymphocytes. Our present results clearly showed that circulating naive CD45RA+CD4+ lymphocytes from BCG-vaccinated subjects can become effector helper cells producing IFN-gamma and IL-5 under the stimulation by autologous dendritic cells presenting mycobacterial protein antigen-PPD or infected with live M. bovis BCG bacilli.

Heterogeneity within populations of recombinant Chinese hamster ovary cells expressing human interferon-gamma.

PubMed

Coppen, S R; Newsam, R; Bull, A T; Baines, A J

1995-04-20

The Chinese hamster ovary (CHO) cell line has great commercial importance in the production of recombinant human proteins, especially those for therapeutic use. Much attention has been paid to CHO cell population physiology in order to define factors affecting product fidelity and yield. Such studies have revealed that recombinant proteins, including human interferon-gamma (IFN-gamma), can be heterogeneous both in glycosylation and in proteolytic processing. The type of heterogeneity observed depends on the growth physiology of the cell population, although the relationship between them is complex. In this article we report results of a cytological study of the CHO320 line which expresses recombinant human IFN-gamma. When grown in suspension culture, this cell line exhibited three types of heterogeneity: (1) heterogeneity of the production of IFN-gamma within the cell population, (2) heterogeneity of the number of nuclei and mitotic spindles in dividing cells, and (3) heterogeneity of cellular environment. The last of these arises from cell aggregates which form in suspension culture: Some cells are exposed to the culture medium; others are fully enclosed within the mass with little or no direct access to the medium. Thus, live cells producing IFN-gamma are heterogeneous in their environment, with variable access to O(2) and nutrients. Within the aggregates, it appears that live cells proliferate on a dead cell mass. The layer of live cells can be several cells deep. Specific cell-cell attachments are observed between the living cells in these aggregates. Two proteins, known to be required for the formation of certain types of intercellular junctions, spectrin and vinculin, have been localized to the regions of cell-cell contact. The aggregation of the cells appears to be an active process requiring protein synthesis. (c) 1995 John Wiley & Sons, Inc.

Hepatitis D virus replication is sensed by MDA5 and induces IFN-β/λ responses in hepatocytes.

PubMed

Zhang, Zhenfeng; Filzmayer, Christina; Ni, Yi; Sültmann, Holger; Mutz, Pascal; Hiet, Marie-Sophie; Vondran, Florian W R; Bartenschlager, Ralf; Urban, Stephan

2018-07-01

Hepatitis B virus (HBV) and D virus (HDV) co-infections cause the most severe form of viral hepatitis. HDV induces an innate immune response, but it is unknown how the host cell senses HDV and if this defense affects HDV replication. We aim to characterize interferon (IFN) activation by HDV, identify the responsible sensor and evaluate the effect of IFN on HDV replication. HDV and HBV susceptible hepatoma cell lines and primary human hepatocytes (PHH) were used for infection studies. Viral markers and cellular gene expression were analyzed at different time points after infection. Pattern recognition receptors (PRRs) required for HDV-mediated IFN activation and the impact on HDV replication were studied using stable knock-down or overexpression of the PRRs. Microarray analysis revealed that HDV but not HBV infection activated a broad range of interferon stimulated genes (ISGs) in HepG2 NTCP cells. HDV strongly activated IFN-β and IFN-λ in cell lines and PHH. HDV induced IFN levels remained unaltered upon RIG-I (DDX58) or TLR3 knock-down, but were almost completely abolished upon MDA5 (IFIH1) depletion. Conversely, overexpression of MDA5 but not RIG-I and TLR3 in HuH7.5 NTCP cells partially restored ISG induction. During long-term infection, IFN levels gradually diminished in both HepG2 NTCP and HepaRG NTCP cell lines. MDA5 depletion had little effect on HDV replication despite dampening HDV-induced IFN response. Moreover, treatment with type I or type III IFNs did not abolish HDV replication. Active replication of HDV induces an IFN-β/λ response, which is predominantly mediated by MDA5. This IFN response and exogenous IFN treatment have only a moderate effect on HDV replication in vitro indicating the adaption of HDV replication to an IFN-activated state. In contrast to hepatitis B virus, infection with hepatitis D virus induces a strong IFN-β/λ response in innate immune competent cell lines. MDA5 is the key sensor for the recognition of hepatitis D virus

Complementation of a mutant cell line: central role of the 91 kDa polypeptide of ISGF3 in the interferon-alpha and -gamma signal transduction pathways.

PubMed Central

Müller, M; Laxton, C; Briscoe, J; Schindler, C; Improta, T; Darnell, J E; Stark, G R; Kerr, I M

1993-01-01

Mutants in complementation group U3, completely defective in the response of all genes tested to interferons (IFNs) alpha and gamma, do not express the 91 and 84 kDa polypeptide components of interferon-stimulated gene factor 3 (ISGF3), a transcription factor known to play a primary role in the IFN-alpha response pathway. The 91 and 84 kDa polypeptides are products of a single gene. They result from differential splicing and differ only in a 38 amino acid extension at the C-terminus of the 91 kDa polypeptide. Complementation of U3 mutants with cDNA constructs expressing the 91 kDa product at levels comparable to those observed in induced wild-type cells completely restored the response to both IFN-alpha and -gamma and the ability to form ISGF3. Complementation with the 84 kDa component similarly restored the ability to form ISGF3 and, albeit to a lower level, the IFN-alpha response of all genes tested so far. It failed, however, to restore the IFN-gamma response of any gene analysed. The precise nature of the DNA motifs and combination of factors required for the transcriptional response of all genes inducible by IFN-alpha and -gamma remains to be established. The results presented here, however, emphasize the apparent general requirement of the 91 kDa polypeptide in the primary transcriptional response to both types of IFN. Images PMID:7693454

Screening of a ScFv Antibody With High Affinity for Application in Human IFN-γ Immunoassay

PubMed Central

Yang, Hang; Zhong, Yanfang; Wang, Juncheng; Zhang, Qinghong; Li, Xiulan; Ling, Sumei; Wang, Shihua; Wang, Rongzhi

2018-01-01

Interferon gamma (IFN-γ), a signal proinflammatory cytokine secreted by immune cell, and plays a critical role in the pathogenesis and progression of many diseases. It has been regarded as an important marker for determination of disease-specific immune responses. Therefore, it is urgent to develop a feasible and accurate method to detect IFN-γ in clinic real blood samples. Until now, the immunoassay based on singe chain variable fragment (scFv) antibody for human IFN-γ is still not reported. In the present study, an scFv antibody named scFv-A8 with high specificity was obtained by phage display and biopanning, with the affinity 2.6 × 109 L/mol. Maltose binding protein (MBP) was used to improve the solubility of scFv by inserting an linker DNA between scFv and MBP tag, and the resulted fusion protein (MBP-LK-scFv) has high solubility and antigen biding activity. The expressed and purified MBP-LK-scFv antibody was used to develop the indirect competitive enzyme-linked immunosorbent assay (ELISA) (ic-ELISA) for detection of human IFN-γ, and the result indicated that the linear range to detect IFN-γ was 6–60 pg/mL with IC50 of 25 pg/mL. The limit of detection was 2 pg/mL (1.3 fm), and the average recovery was 85.05%, further demonstrating that the detection method based on scFv has higher recovery and accuracy. Hence, the developed ic-ELISA can be used to detect IFN-γ in real samples, and it may be further provided a scientific basis for disease diagnosis. PMID:29563896

Inhibition of alpha interferon (IFN-α)-induced microRNA-122 negatively affects the anti-hepatitis B virus efficiency of IFN-α.

PubMed

Hao, Junli; Jin, Wensong; Li, Xinghui; Wang, Saifeng; Zhang, Xiaojun; Fan, Hongxia; Li, Changfei; Chen, Lizhao; Gao, Bin; Liu, Guangze; Meng, Songdong

2013-01-01

Alpha interferon (IFN-α)-based therapy can effectively treat chronic hepatitis B virus (HBV) infection, which causes life-threatening complications. Responses to IFN-α therapy vary greatly in chronic hepatitis B (CHB) patients, but underlying mechanisms are almost unknown. In this study, we found that IFN-α treatment induced a marked decrease of microRNA-122 (miR-122) expression in hepatocytes. We next showed that IFN-α-induced miR-122 downregulation was only partly due to transcriptional suppression. One IFN-stimulated gene (ISG), NT5C3, which was identified as a miR-122 target, efficiently inhibited miR-122 by binding and sequestering miR-122 with its mRNA 3'-untranslated region (3'-UTR), indicating that this ISG is involved in IFN-α-mediated miR-122 suppression. Notably, the inhibitory effect of IFN-α on miR-122 was completely abolished by blocking IFN-α-induced upregulation of NT5C3 mRNA expression by RNA interference (RNAi). Meanwhile, we observed that miR-122 dramatically inhibited HBV expression and replication. Finally, we showed that IFN-α-mediated HBV-inhibitory effects could be enhanced significantly by blocking IFN-α-induced downregulation of miR-122. We therefore concluded that IFN-α-induced inhibition of miR-122 may negatively affect the anti-HBV function of IFN-α. These data provide valuable insights for a better understanding of the antiviral mechanism of IFN-α and raise further potential interest in enhancing its anti-HBV efficacy.

Inhibition of Alpha Interferon (IFN-α)-Induced MicroRNA-122 Negatively Affects the Anti-Hepatitis B Virus Efficiency of IFN-α

PubMed Central

Hao, Junli; Jin, Wensong; Li, Xinghui; Wang, Saifeng; Zhang, Xiaojun; Fan, Hongxia; Li, Changfei; Chen, Lizhao; Gao, Bin

2013-01-01

Alpha interferon (IFN-α)-based therapy can effectively treat chronic hepatitis B virus (HBV) infection, which causes life-threatening complications. Responses to IFN-α therapy vary greatly in chronic hepatitis B (CHB) patients, but underlying mechanisms are almost unknown. In this study, we found that IFN-α treatment induced a marked decrease of microRNA-122 (miR-122) expression in hepatocytes. We next showed that IFN-α-induced miR-122 downregulation was only partly due to transcriptional suppression. One IFN-stimulated gene (ISG), NT5C3, which was identified as a miR-122 target, efficiently inhibited miR-122 by binding and sequestering miR-122 with its mRNA 3′-untranslated region (3′-UTR), indicating that this ISG is involved in IFN-α-mediated miR-122 suppression. Notably, the inhibitory effect of IFN-α on miR-122 was completely abolished by blocking IFN-α-induced upregulation of NT5C3 mRNA expression by RNA interference (RNAi). Meanwhile, we observed that miR-122 dramatically inhibited HBV expression and replication. Finally, we showed that IFN-α-mediated HBV-inhibitory effects could be enhanced significantly by blocking IFN-α-induced downregulation of miR-122. We therefore concluded that IFN-α-induced inhibition of miR-122 may negatively affect the anti-HBV function of IFN-α. These data provide valuable insights for a better understanding of the antiviral mechanism of IFN-α and raise further potential interest in enhancing its anti-HBV efficacy. PMID:23055569

IFN-λ cancer immunotherapy: new kid on the block

PubMed Central

Lasfar, Ahmed; Gogas, Helen; Zloza, Andrew; Kaufman, Howard L; Kirkwood, John M

2016-01-01

Interferon-lambda (IFN-λ) is a new IFN type, related to IFN-α, that is commonly used in the clinic. However, significant side effects accompanying IFN-α treatment limit enthusiasm for IFN-α. In this review, we discuss the current landscape of IFN-α use in oncology and describe the biologic characteristics of IFN-λ. IFN-λ offers unique advantages, including a more tumor cell selective targeting, lower off-target binding and an ability to generate both innate and adaptive immune responses. IFN-λ has also demonstrated therapeutic benefit in murine cancer models. IFN-λ may be used in clinic as a single agent or in combination with other immunotherapy agents, such as immune checkpoint inhibitors. Further clinical trials will be needed to fully elucidate the potential of this novel agent in oncology. PMID:27381684

IFN-λ cancer immunotherapy: new kid on the block.

PubMed

Lasfar, Ahmed; Gogas, Helen; Zloza, Andrew; Kaufman, Howard L; Kirkwood, John M

2016-07-01

Interferon-lambda (IFN-λ) is a new IFN type, related to IFN-α, that is commonly used in the clinic. However, significant side effects accompanying IFN-α treatment limit enthusiasm for IFN-α. In this review, we discuss the current landscape of IFN-α use in oncology and describe the biologic characteristics of IFN-λ. IFN-λ offers unique advantages, including a more tumor cell selective targeting, lower off-target binding and an ability to generate both innate and adaptive immune responses. IFN-λ has also demonstrated therapeutic benefit in murine cancer models. IFN-λ may be used in clinic as a single agent or in combination with other immunotherapy agents, such as immune checkpoint inhibitors. Further clinical trials will be needed to fully elucidate the potential of this novel agent in oncology.

Effect of IFN-gamma on the killing of S. aureus in human whole blood. Assessment of bacterial viability by CFU determination and by a new method using alamarBlue.

PubMed

DeForge, L E; Billeci, K L; Kramer, S M

2000-11-01

Given the increasing incidence of methicillin resistant Staphylococcus aureus (MRSA) and the recent emergence of MRSA with a reduced susceptibility to vancomycin, alternative approaches to the treatment of infection are of increasing relevance. The purpose of these studies was to evaluate the effect of IFN-gamma on the ability of white blood cells to kill S. aureus and to develop a simpler, higher throughput bacterial killing assay. Using a methicillin sensitive clinical isolate of S. aureus, a clinical isolate of MRSA, and a commercially available strain of MRSA, studies were conducted using a killing assay in which the bacteria were added directly into whole blood. The viability of the bacteria in samples harvested at various time points was then evaluated both by the classic CFU assay and by a new assay using alamarBlue. In the latter method, serially diluted samples and a standard curve containing known concentrations of bacteria were placed on 96-well plates, and alamarBlue was added. Fluorescence readings were taken, and the viability of the bacteria in the samples was calculated using the standard curve. The results of these studies demonstrated that the CFU and alamarBlue methods yielded equivalent detection of bacteria diluted in buffer. For samples incubated in whole blood, however, the alamarBlue method tended to yield lower viabilities than the CFU method due to the emergence of a slower growing subpopulation of S. aureus upon incubation in the blood matrix. A significant increase in bacterial killing was observed upon pretreatment of whole blood for 24 h with 5 or 25 ng/ml IFN-gamma. This increase in killing was detected equivalently by the CFU and alamarBlue methods. In summary, these studies describe a method that allows for the higher throughput analysis of the effects of immunomodulators on bacterial killing.

Intra-tumoral gene delivery of feIL-2, feIFN-gamma and feGM-CSF using magnetofection as a neoadjuvant treatment option for feline fibrosarcomas: a phase-I study.

PubMed

Jahnke, A; Hirschberger, J; Fischer, C; Brill, T; Köstlin, R; Plank, C; Küchenhoff, H; Krieger, S; Kamenica, K; Schillinger, U

2007-12-01

Despite aggressive pre- or postoperative treatment, feline fibrosarcomas have a high relapse rate. In this study, a new treatment option based on immune stimulation by intra-tumoral delivery of three feline cytokine genes was performed. The objective of this phase-I dose-escalation study was to determine a safe dose for further evaluation in a subsequent phase-II trial. Twenty-five client-owned cats with clinical diagnosis of fibrosarcoma - primary tumours as well as recurrences - entered the study. Four increasing doses of plasmids coding for feIL-2, feIFN-gamma or feGM-CSF, respectively, were previously defined. In groups I, II, III and IV these doses were 15, 50, 150 and 450 microg per plasmid and a corresponding amount of magnetic nanoparticles. Two preoperative intra-tumoral injections of the magnetic DNA solution were followed by magnetofection. A group of four control cats received only surgical treatment. Side effects were registered and graded according to the VCOG-CTCAE scale and correlated to treatment. Statistical analyses included one-way anova, post hoc and Kruskal-Wallis tests. ELISA tests detecting plasma feIFN-gamma and plasma feGM-CSF were performed. One cat out of group IV (450 microg per plasmid) showed adverse events probably related to gene delivery. As these side effects were self-limiting and occurred only in one of eight cats in group IV, this dose was determined to be well tolerable. Altogether six cats developed local recurrences during a 1-year observation period. Four of these cats had been treated with dose IV. Regarding these observations, a subsequent phase-II trial including a representative amount of cats should be tested for the efficacy of dose IV as well as dose III.

Electrochemical impedance spectroscopy based-on interferon-gamma detection

NASA Astrophysics Data System (ADS)

Li, Guan-Wei; Kuo, Yi-Ching; Tsai, Pei-I.; Lee, Chih-Kung

2014-03-01

Tuberculosis (TB) is an ancient disease constituted a long-term menace to public health. According to World Health Organization (WHO), mycobacterium tuberculosis (MTB) infected nearly a third of people of the world. There is about one new TB occurrence every second. Interferon-gamma (IFN-γ) is associated with susceptibility to TB, and interferongamma release assays (IGRA) is considered to be the best alternative of tuberculin skin test (TST) for diagnosis of latent tuberculosis infection (LTBI). Although significant progress has been made with regard to the design of enzyme immunoassays for IFN-γ, adopting this assay is still labor-intensive and time-consuming. To alleviate these drawbacks, we used IFN-γ antibody to facilitate the detection of IFN-γ. An experimental verification on the performance of IGRA was done in this research. We developed two biosensor configurations, both of which possess high sensitivity, specificity, and rapid IFN-γ diagnoses. The first is the electrochemical method. The second is a circular polarization interferometry configuration, which incorporates two light beams with p-polarization and s-polarization states individually along a common path, a four photo-detector quadrature configuration to arrive at a phase modulated ellipsometer. With these two methods, interaction between IFN-γ antibody and IFN-γ were explored and presented in detail.

Extracellular Vesicles from Neural Stem Cells Transfer IFN-γ via Ifngr1 to Activate Stat1 Signaling in Target Cells

PubMed Central

Cossetti, Chiara; Iraci, Nunzio; Mercer, Tim R.; Leonardi, Tommaso; Alpi, Emanuele; Drago, Denise; Alfaro-Cervello, Clara; Saini, Harpreet K.; Davis, Matthew P.; Schaeffer, Julia; Vega, Beatriz; Stefanini, Matilde; Zhao, CongJian; Muller, Werner; Garcia-Verdugo, Jose Manuel; Mathivanan, Suresh; Bachi, Angela; Enright, Anton J.; Mattick, John S.; Pluchino, Stefano

2015-01-01

SUMMARY The idea that stem cell therapies work only via cell replacement is challenged by the observation of consistent intercellular molecule exchange between the graft and the host. Here we defined a mechanism of cellular signaling by which neural stem/precursor cells (NPCs) communicate with the microenvironment via extracellular vesicles (EVs), and we elucidated its molecular signature and function. We observed cytokine-regulated pathways that sort proteins and mRNAs into EVs. We described induction of interferon gamma (IFN-γ) pathway in NPCs exposed to proinflammatory cytokines that is mirrored in EVs. We showed that IFN-γ bound to EVs through Ifngr1 activates Stat1 in target cells. Finally, we demonstrated that endogenous Stat1 and Ifngr1 in target cells are indispensable to sustain the activation of Stat1 signaling by EV-associated IFN-γ/Ifngr1 complexes. Our study identifies a mechanism of cellular signaling regulated by EV-associated IFN-γ/Ifngr1 complexes, which grafted stem cells may use to communicate with the host immune system. PMID:25242146

The effect of co-administration of DNA carrying chicken interferon-gamma gene on protection of chickens against infectious bursal disease by DNA-mediated vaccination.

PubMed

Hsieh, Ming Kun; Wu, Ching Ching; Lin, Tsang Long

2006-11-17

The purpose of the present study was to determine whether DNA vaccination by co-administration of DNA coding for chicken interferon-gamma (IFN-gamma) gene and DNA encoding for the VP243 gene of IBDV could enhance immune response and protection efficacy of chickens against challenge by IBDV. Plasmids carrying VP243 gene of IBDV strain variant E (VE) (P/VP243/E) and chicken IFN-gamma gene (P/cIFN-gamma) were constructed, respectively. One-day-old chickens were intramuscularly injected with P/VP243/E, or P/cIFN-gamma, or both once, twice, or three times into the thigh muscle of one leg or the thigh muscles of two separate legs at weekly intervals. Chickens were orally challenged with IBDV strain VE at 3 weeks of age and observed for 10 days. Chickens receiving two plasmids in the same site two times had significantly higher (P<0.05) bursal lesion scores and significantly lower (P<0.05) bursa weight/body weight ratios than those that only received P/VP243/E two or three times. Chickens inoculated with two plasmids separately in the thigh muscles of different legs or P/VP243/E two times had 33-50% protection and those receiving two plasmids in the same sites did not have any protection against IBD. The enzyme-linked immunosorbent assay (ELISA) and virus neutralization (VN) titers to IBDV of chickens in the groups with three doses of P/VP243/E were significantly higher (P<0.05) than those in groups receiving two doses of P/VP243/E or P/VP243/E and P/cIFN-gamma. Chickens protected by DNA vaccination did not have detectable IBDV antigen in the bursae as determined by immunofluorescent antibody assay (IFA). The results indicated that co-administration of plasmid encoding chicken IFN-gamma gene with plasmid encoding a large segment gene of the IBDV did not enhance immune response and protection against challenge by IBDV.

Pleiotrophin (PTN) is expressed in vascularized human atherosclerotic plaques: IFN-γ/JAK/STAT1 signaling is critical for the expression of PTN in macrophages

PubMed Central

Li, Fuqiang; Tian, Fang; Wang, Lai; Williamson, Ian K.; Sharifi, Behrooz G.; Shah, Prediman K.

2010-01-01

Neovascularization is critical to destabilization of atheroma. We previously reported that the angiogenic growth factor pleiotrophin (PTN) coaxes monocytes to assume the phenotype of functional endothelial cells in vitro and in vivo. In this study we show that PTN expression is colocalized with capillaries of human atherosclerotic plaques. Among the various reagents that are critical to the pathogenesis of atherosclerosis, interferon (IFN)-γ was found to markedly induce PTN mRNA expression in a dose-dependent manner in macrophages. Mechanistic studies revealed that the Janus kinase inhibitors, WHI-P154 and ATA, efficiently blocked STAT1 phosphorylation in a concentration- and time-dependent manner. Notably, the level of phosphorylated STAT1 was found to correlate directly with the PTN mRNA levels. In addition, STAT1/STAT3/p44/42 signaling molecules were found to be phosphorylated by IFN-γ in macrophages, and they were translocated into the nucleus. Further, PTN promoter analysis showed that a gamma-activated sequence (GAS) located at −2086 to −2078 bp is essential for IFN-γ-regulated promoter activity. Moreover, electrophoretic mobility shift, supershift, and chromatin immunoprecipitation analyses revealed that both STAT1 and STAT3 bind to the GAS at the chromatin level in the IFN-γ stimulated cells. Finally, to test whether the combined effect of STAT1/STAT3/p44/42 signaling is required for the expression of PTN in macrophages, gene knockdowns of these transcription factors were performed using siRNA. Cells lacking STAT1, but not STAT3 or p42, have markedly reduced PTN mRNA levels. These data suggest that PTN expression in the human plaques may be in part regulated by IFN-γ and that PTN is involved in the adaptive immunity.—Li, F., Tian, F., Wang, L., Williamson, I. K., Sharifi, B. G., Shah, P. K. Pleiotrophin (PTN) is expressed in vascularized human atherosclerotic plaques: IFN-γ/JAK/STAT1 signaling is critical for the expression of PTN in macrophages

Regulation by interferon alpha of immunoglobulin isotype selection and lymphokine production in mice

PubMed Central

1991-01-01

Antigens and infectious agents that stimulate interferon alpha(IFN- alpha) production in mice induce antibody responses that are predominantly of the immunoglobulin (Ig)G2a isotype and contain little or no IgE. This suggested the possibility that IFN-alpha might have a role in directing Ig isotype selection. Consistent with this possibility, we have found that injection of mice with recombinant mouse IFN-alpha suppresses IgE secretion, enhances IgG2a secretion, and has no independent effect on IgG1 secretion in mice stimulated with a foreign anti-IgD antibody. Injection of mice with polyinosinic acid.polycytidylic acid (poly I.C), an inducer of macrophage IFN-alpha production, also suppresses the anti-IgD antibody-induced IgE response and stimulates the IgG2a response; these effects are blocked by a sheep antibody that neutralizes mouse IFN-alpha/beta. Both recombinant IFN- alpha and poly I.C have maximum IgE suppressive and IgG2a stimulatory effects when injected early in the anti-IgD antibody-induced immune response. Addition of IFN-alpha to mouse B cells cultured with lipopolysaccharide (LPS) + interleukin 4 (IL-4) suppresses both IgG1 and IgE production, but much less potently than IFN-gamma. IFN-alpha suppresses anti-IgD antibody-induced increases in the level of splenic IL-4 mRNA, but enhances the anti-IgD antibody-induced increase in the splenic level of IFN-gamma mRNA. These results are consistent with the effect of IFN-alpha on Ig isotype expression in mice, as IL-4 stimulates IgE and suppresses IgG2a secretion while IFN-gamma exerts opposite effects. These observations suggest that antigen presenting cells, by secreting IFN-alpha early in the course of an immune response, can influence the nature of that response both through direct effects on B cells and by influencing the differentiation of T cells. PMID:1940796

Association of the IFN-γ (+874A/T) Genetic Polymorphism with Paranoid Schizophrenia in Tunisian Population.

PubMed

Jemli, Achraf; Eshili, Awatef; Trifa, Fatma; Mechri, Anouar; Zaafrane, Ferid; Gaha, Lotfi; Juckel, George; Tensaout, Besma Bel Hadj Jrad

2017-02-01

Since growing evidence suggests a significant role of chronic low-grade inflammation in the physiopathology of schizophrenia, we have hypothesized that functional genetic variant of the IFN gamma (IFN-γ; +874A/T; rs2430561) gene may be involved in the predisposition to schizophrenia. This research is based on a case-control study which aims to identify whether polymorphism of the IFN-γ gene is a risk factor for the development of schizophrenia. The RFLP-PCR genotyping of the IFN-γ gene was conducted on a Tunisian population composed of 218 patients and 162 controls. The IFN-γ (+874A/T) polymorphism analysis showed higher frequencies of minor homozygous genotype (TT) and allele (T) in all patients compared with controls (11.5 vs. 4.9%; p = 0.03, OR = 2.64 and 30.7 vs. 24.1%, p = 0.04, OR = 1.4, respectively). This correlation was confirmed for male but not for female patients. Also, the T allele was significantly more common among patients with paranoid schizophrenia when compared with controls (25.8 vs. 4.9%, p = 0.0001; OR = 6.7). Using the binary regression analysis to eliminate confounding factors as age and sex, only this last association remained significant (p = 0.03; OR = 1.76, CI = 1.05-2.93). In conclusion, our results showed a significant association between +874A/T polymorphism of IFN-γ and paranoid schizophrenia, suggesting that this single nucleotide polymorphism (SNP) or another at proximity could predispose to paranoid schizophrenia. Since the minor allele of this polymorphism was correlated with an increased expression of their product, our study validates the hypothesis of excessive pro-inflammatory cytokine in the physiopathology of paranoid schizophrenia.

Induction of multispecific Th-1 type immune response against HCV in mice by protein immunization using CpG and Montanide ISA 720 as adjuvants.

PubMed

Qiu, Qi; Wang, Richard Yuan-Hu; Jiao, Xuanmao; Jin, Bo; Sugauchi, Fuminaka; Grandinetti, Teresa; Alter, Harvey J; Shih, J Wai-Kuo

2008-10-09

Recent studies demonstrate that Th1-type immune responses against a broad spectrum of hepatitis C virus (HCV) gene products are crucial to the resolution of acute HCV infection. We investigated new vaccine approaches to augment the strength of HCV-specific Th1-type immune responses. ELISPOT assay revealed that single or multiple protein immunization using both CpG ODN and Montanide ISA 720 as adjuvants induced much stronger IFN-gamma-producing Th1 responses against core, NS3 and NS5b targets than did the formulation without these adjuvants. Protein vaccination using CpG ODN and Montanide ISA 720 as adjuvants also greatly enhanced humoral responses to HCV core, E1/E2 and NS3. When specific IgG isotypes were assayed, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants produced higher titers of IgG2a dominant antibodies than did protein immunization alone, indicating a more Th1-biased pathway. This increase in IgG2a is consistent with the induction of Th1 cells secreting IFN-gamma demonstrated by ELISPOT assay. In conclusion, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants greatly enhanced cellular (Th1 type) as well as humoral immune responses against HCV in Balb/c mice. The use of adjuvants appears critical to the induction of Th1 immune responses during HCV vaccination with recombinant proteins.

[Construction and expression of HSV-2gD-Hsp70 fusion protein gene].

PubMed

Fan, Jian-Yong; Yang, Hui-Lan; Wang, Ying; Guan, Lei

2006-11-01

To construct and express Hsp70-HSV2gD fusion protein. Genes of Hsp70 and HSV-2gD were subcloned into vectors pGEX-4T-1 respectively. After confirmed by DNA sequence analysis, the recombinant plasmids pGEX-4T-HSP-gD was transformed into E. coli DH5alpha and induced to express with IPTG. The expressed protein was characterized by SDS-PAGE and Western blot after purified. BALB/c mice were immunized with fusion proteins respectively via intra-m uscular injection. The proliferation of spleen lymphocytes, the level of y-IFN in culture and anti-HSV-2gD IgG antibody in serum was detected was detected. The expressed protein was analyzed by SDS-PAGE after induced with IPTG, which showed a new band with an apparent molecular mass corresponding to the predicted size (118 kD). Western Blotting analysis demonstrates that the purified Hsp70-HSV2gD fusion protein had specific binding activity. The stimulation indexes of spleen lymphocytes, the level of gamma-IFN in culture and anti-HSV-2gD IgG antibody in serum of GST-Hsp70-gD group was obviously higher than that of other groups (P < 0.05 respectively). The successful expression of the Hsp70-HSV2gD fusion protein, which can induce immune responses, laid a solid foundation for its further research.

Antigen presentation by small intestinal epithelial cells uniquely enhances IFN-γ secretion from CD4{sup +} intestinal intraepithelial lymphocytes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hatano, Ryo; Yamada, Kiyoshi; Iwamoto, Taku

2013-06-14

Highlights: •Small intestinal epithelial cells (sIECs). •sIECs are able to induce antigen specific proliferation of CD4{sup +} IELs. •sIECs induce markedly enhanced IFN-γ secretion by CD4{sup +} IELs. •Induction of enhanced IFN-γ secretion by sIECs is uniquely observed in CD4{sup +} IELs. -- Abstract: Small intestinal epithelial cells (sIECs) express major histocompatibility complex class II molecules even in a normal condition, and are known to function as antigen presenting cells (APCs) at least in vitro. These findings raised the possibility that sIECs play an important role in inducing immune responses against luminal antigens, especially those of intestinal intraepithelial lymphocytes (IELs)more » and lamina propria lymphocytes (LPLs). We herein showed that antigenic stimulation with sIECs induced markedly greater secretion of interferon-gamma (IFN-γ) by CD4{sup +} IELs, but not interleukin (IL)-4, IL-10 and IL-17 although the proliferative response was prominently lower than that with T cell-depleted splenic APCs. In contrast, no enhanced IFN-γ secretion by CD4{sup +} LPLs and primed splenic CD4{sup +} T cells was observed when stimulated with sIECs. Taken together, these results suggest that sIECs uniquely activate CD4{sup +} IELs and induce remarkable IFN-γ secretion upon antigenic stimulation in vivo.« less

Associations of cord blood fatty acids with lymphocyte proliferation, IL-13, and IFN-γ

PubMed Central

Gold, Diane R.; Willwerth, Ben M.; Tantisira, Kelan G.; Finn, Patricia W.; Schaub, Bianca; Perkins, David L.; Tzianabos, Arthur; Ly, Ngoc P.; Schroeter, Christian; Gibbons, Fiona; Campos, Hannia; Oken, Emily; Gillman, Matthew W.; Palmer, Lyle J.; Ryan, Louise M.; Weiss, Scott T.

2006-01-01

Background. N-3 and n-6 polyunsaturated fatty acids (PUFAs) have been hypothesized to have opposing influences on neonatal immune responses that might influence the risk of allergy or asthma. However, both n-3 eicosapentaenoic acid (EPA) and n-6 arachidonic acid (AA) are required for normal fetal development. Objective. We evaluated whether cord blood fatty acid levels were related to neonatal immune responses and whether n-3 and n-6 PUFA responses differed. Methods. We examined the relation of cord blood plasma n-3 and n-6 PUFAs (n = 192) to antigen- and mitogen-stimulated cord blood lymphocyte proliferation (n = 191) and cytokine (IL-13 and IFN-γ; n = 167) secretion in a US birth cohort. Results. Higher levels of n-6 linoleic acid were correlated with higher IL-13 levels in response to Bla g 2 (cockroach, P = .009) and Der f 1 (dust mite, P = .02). Higher n-3 EPA and n-6 AA levels were each correlated with reduced lymphocyte proliferation and IFN-γ levels in response to Bla g 2 and Der f 1 stimulation. Controlling for potential confounders, EPA and AA had similar independent effects on reduced allergen-stimulated IFN-γ levels. If neonates had either EPA or AA levels in the highest quartile, their Der f 1 IFN-γ levels were 90% lower (P = .0001) than those with both EPA and AA levels in the lowest 3 quartiles. Reduced AA/EPA ratio was associated with reduced allergen-stimulated IFN-γ level. Conclusion. Increased levels of fetal n-3 EPA and n-6 AA might have similar effects on attenuation of cord blood lymphocyte proliferation and IFN-γ secretion. Clinical implications. The implications of these findings for PMID:16630954

Interferon-lambda (IFN-λ) induces signal transduction and gene expression in human hepatocytes, but not in lymphocytes or monocytes

PubMed Central

Dickensheets, Harold; Sheikh, Faruk; Park, Ogyi; Gao, Bin; Donnelly, Raymond P.

2013-01-01

This study compared the ability of IFN-α and IFN-λ to induce signal transduction and gene expression in primary human hepatocytes, PBLs, and monocytes. IFN-α drug products are widely used to treat chronic HCV infection; however, IFN-α therapy often induces hematologic toxicities as a result of the broad expression of IFNARs on many cell types, including most leukocytes. rIFN-λ1 is currently being tested as a potential alternative to IFN-α for treating chronic HCV. Although IFN-λ has been shown to be active on hepatoma cell lines, such as HepG2 and Huh-7, its ability to induce responses in primary human hepatocytes or leukocytes has not been examined. We found that IFN-λ induces activation of Jak/STAT signaling in mouse and human hepatocytes, and the ability of IFN-λ to induce STAT activation correlates with induction of numerous ISGs. Although the magnitude of ISG expression induced by IFN-λ in hepatocytes was generally lower than that induced by IFN-α, the repertoire of regulated genes was quite similar. Our findings demonstrate that although IFN-α and IFN-λ signal through distinct receptors, they induce expression of a common set of ISGs in hepatocytes. However, unlike IFN-α, IFN-λ did not induce STAT activation or ISG expression by purified lymphocytes or monocytes. This important functional difference may provide a clinical advantage for IFN-λ as a treatment for chronic HCV infection, as it is less likely to induce the leukopenias that are often associated with IFN-α therapy. PMID:23258595

Detection of IFN-γ Secretion by T Cells Collected Before and After Successful Treatment of Early Lyme Disease.

PubMed

Callister, Steven M; Jobe, Dean A; Stuparic-Stancic, Aleksandra; Miyamasu, Misato; Boyle, Jeff; Dattwyler, Raymond J; Arnaboldi, Paul M

2016-05-15

Current serodiagnostics for Lyme disease lack sensitivity during early disease, and cannot determine treatment response. We evaluated an assay based on QuantiFERON technology utilizing peptide antigens derived from Borrelia burgdorferi to stimulate interferon-gamma (IFN-γ) release as an alternative to serodiagnosis for the laboratory detection of Lyme disease. Blood was obtained from patients with erythema migrans before (n = 29) and 2 months after (n = 27) antibiotic therapy. IFN-γ release was measured by enzyme-linked immunosorbent assay (ELISA) following overnight stimulation of whole blood with the peptide antigens, and compared to the results of standard serological assays (C6, ELISA, and Western blot). IFN-γ release was observed in pretreatment blood of 20 of 29 (69%) patients with Lyme disease. Following antibiotic treatment, IFN-γ was significantly reduced (P = .0002), and was detectable in only 4 of 20 (20%) initially positive patients. By contrast, anti-C6 antibodies were detected in pretreatment sera from 17 of 29 (59%) subjects, whereas only 5 of 29 (17%) patients had positive Western blot seroreactivity. Antibody responses persisted and expanded following treatment. Our findings suggest that measurement of IFN-γ after incubating blood with Borrelia antigens could be useful in the laboratory diagnosis of early Lyme disease. Also, after antibiotic treatment, this response appears to be short lived. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

[Effects of recombinant human alpha-2b and gamma interferons on bone marrow megakaryocyte progenitors (CFU-Meg) from patients with chronic myelocytic leukemia].

PubMed

Tanabe, Y; Dan, K; Kuriya, S; Nomura, T

1989-10-01

The effects of recombinant human interferon (IFN) alpha-2b and gamma on the bone marrow megakaryocyte progenitors (CFU-Meg) were compared between eight patients in the chronic phase of Ph1-positive chronic myelocytic leukemia (CML) and five hematologically normal patients. CFU-Meg was assayed in plasma clot culture added with phytohemagglutinin-stimulated leukocyte-conditioned medium as a source of colony stimulating activity. The average count of CFU-Meg colonies formed from the bone marrow of CML patients was 5.5 times that of normal controls. Spontaneous CFU-Meg colonies were grown in seven of eight CML patients, but in none of five controls. Colony formation by CFU-Meg in CML as well as normal bone marrow was suppressed by the two preparations of IFN in a dose dependent fashion. Their suppressive influence on colonies from CFU-Meg was comparable between CML and normal bone marrow at lower concentrations, but was less marked for CML than normal bone marrow at higher concentrations. The formation of CFU-Meg colonies from CML bone marrow was more severely suppressed by IFN-gamma than IFN-alpha-2b. Depletion of either T lymphocytes or adherent cells from the CML bone marrow cells diminished the suppressive effects of IFN-gamma, but had no influence on the effects of IFN-alpha-2b.

Mycobacterium avium Complex Empyema in a Patient with Interferon Gamma Autoantibodies

PubMed Central

Chung, Heath H; Opal, Steven M; Dworkin, Jonathan D

2014-01-01

Interferon gamma (IFN-γ) autoantibodies are a relatively recently discovered clinical entity, which have been shown to be associated with disseminated non-tuberculous mycobacterial (NTM) infections and other opportunistic infections. Interestingly, isolated NTM infections (without disseminated NTM infection) have not been shown to be a good predictor of the presence of IFN-γ autoantibodies. This case describes an isolated NTM empyema in a patient with IFN-γ autoantibodies and makes the argument that the development of an NTM empyema in a patient with no known immunodeficiency should prompt consideration for IFN-γ testing. Additionally, this case underscores the importance for clinicians to recognize that an unusual infection without the typical cause of impairment in immunity should prompt a more thorough investigation of the patient's immune system. PMID:25285250

Adenovirus expressing IFN-λ (Ad/hIFN-λ) produced anti-tumor effects through inducing apoptosis in human tongue squamous cell carcinoma cell.

PubMed

Song, Bing; Yang, Yong; Wang, Yan-Li; Fan, Xiao-Hui; Huang, Yu-Mei; Ci, Hao-Su; Zuo, Jin-Hua

2015-01-01

To investigate the potential therapeutic effects of adenovirus expressing IFN-λ1 and IFN-λ2 (Ad/hIFN-λ) in treating squamous cell carcinoma of the oral tongue (SCCOT) and to explore the underlying mechanisms. Two SCCOT cell lines HSC-3 and Tca8113 were adopted as study objects. Cell Counting Kit-8 (CCK-8) cell proliferation and viability assay was performed to evaluate the antiproliferative effects of Ad/hIFN-λ and IFN-λ treatments at different dosages. Flow cytometry (FCM) was performed to investigate the apoptosis rate induced by Ad/hIFN-λ. In vivo study was performed through evaluating tumorigenicity and tumor volume on BALB/c nu/nu mice inoculated with HSC-3 cells with or without infection of Ad/hIFN-λ. qPCR was used to screen important apoptosis related genes expression and western blot (WB) was performed to verify the results. WB was also used to test the phosphorylation of STATs protein in the JAK/STAT signaling pathways. Our results indicated an obvious antiproliferative effect of Ad/hIFN-λ in vitro on infected HSC-3 and Tca8113 cells. The antiproliferative effects started to appear at 48 h (day 2) after infection. IFN-λs alone treating HSC-3 and Tca8113 cells also showed a dose-dependent inhibitory manner. Though the antiproliferative effects did not show on 24 h (day 1), early apoptosis rate already increased significantly in cells infected with Ad/hIFN-λ (P<0.05) detected by FCM. The underlying mechanisms of antiproliferative activity rely on the IFN-λ signaling by phosphorylation of STATs protein. Expression of Bax, Bcl-2 and Caspase-3 were promoted by Ad/hIFN-λ leading to higher apoptosis rate. Upper stream of p21 and Rb dephosphorylation explained the Caspase-3 activation. Animal study showed that HSC-3 cells infected with Ad/hIFN-λ significantly promoted the survival rate and decreased mean tumor volume comparing to HSC-3 cells group. Ad/hIFN-λ injection had obvious antiproliferative effects on HSC-3 and Tca8113 cells. Ad/hIFN

The Pseudorabies Virus Glycoprotein gE/gI Complex Suppresses Type I Interferon Production by Plasmacytoid Dendritic Cells

PubMed Central

Lamote, Jochen A. S.; Kestens, Manon; Van Waesberghe, Cliff; Delva, Jonas; De Pelsmaeker, Steffi; Devriendt, Bert

2017-01-01

ABSTRACT Plasmacytoid dendritic cells (pDC) play a central role in the antiviral immune response, both in the innate response and in shaping the adaptive response, mainly because of their ability to produce massive amounts of type I interferon (TI-IFN). Here, we report that cells infected with the live attenuated Bartha vaccine strain of porcine alphaherpesvirus pseudorabies virus (PRV) trigger a dramatically increased TI-IFN response by porcine primary pDC compared to cells infected with wild-type PRV strains (Becker and Kaplan). Since Bartha is one of the relatively few examples of a highly successful alphaherpesvirus vaccine, identification of factors that may contribute to its efficacy may provide insights for the rational design of other alphaherpesvirus vaccines. The Bartha vaccine genome displays several mutations compared to the genome of wild-type PRV strains, including a large deletion in the unique short (US) region, encompassing the glycoprotein E (gE), gI, US9, and US2 genes. Using recombinant PRV Becker strains harboring the entire Bartha US deletion or single mutations in the four affected US genes, we demonstrate that the absence of the viral gE/gI complex contributes to the observed increased IFN-α response. Furthermore, we show that the absence of gE leads to an enhanced extracellular signal-regulated kinase 1/2 (ERK1/2) phosphorylation in pDC, which correlates with a higher TI-IFN production by pDC. In conclusion, the PRV Bartha vaccine strain triggers strongly increased TI-IFN production by porcine pDC. Our data further indicate that the gE/gI glycoprotein complex suppresses TI-IFN production by pDC, which represents the first alphaherpesvirus factor that suppresses pDC activity. IMPORTANCE Several alphaherpesviruses, including herpes simpex virus, still lack effective vaccines. However, the highly successful Bartha vaccine has contributed substantially to eradication of the porcine alphaherpesvirus pseudorabies virus (PRV) in several countries

The Pseudorabies Virus Glycoprotein gE/gI Complex Suppresses Type I Interferon Production by Plasmacytoid Dendritic Cells.

PubMed

Lamote, Jochen A S; Kestens, Manon; Van Waesberghe, Cliff; Delva, Jonas; De Pelsmaeker, Steffi; Devriendt, Bert; Favoreel, Herman W

2017-04-01

Plasmacytoid dendritic cells (pDC) play a central role in the antiviral immune response, both in the innate response and in shaping the adaptive response, mainly because of their ability to produce massive amounts of type I interferon (TI-IFN). Here, we report that cells infected with the live attenuated Bartha vaccine strain of porcine alphaherpesvirus pseudorabies virus (PRV) trigger a dramatically increased TI-IFN response by porcine primary pDC compared to cells infected with wild-type PRV strains (Becker and Kaplan). Since Bartha is one of the relatively few examples of a highly successful alphaherpesvirus vaccine, identification of factors that may contribute to its efficacy may provide insights for the rational design of other alphaherpesvirus vaccines. The Bartha vaccine genome displays several mutations compared to the genome of wild-type PRV strains, including a large deletion in the unique short (US) region, encompassing the glycoprotein E (gE), gI, US9, and US2 genes. Using recombinant PRV Becker strains harboring the entire Bartha US deletion or single mutations in the four affected US genes, we demonstrate that the absence of the viral gE/gI complex contributes to the observed increased IFN-α response. Furthermore, we show that the absence of gE leads to an enhanced extracellular signal-regulated kinase 1/2 (ERK1/2) phosphorylation in pDC, which correlates with a higher TI-IFN production by pDC. In conclusion, the PRV Bartha vaccine strain triggers strongly increased TI-IFN production by porcine pDC. Our data further indicate that the gE/gI glycoprotein complex suppresses TI-IFN production by pDC, which represents the first alphaherpesvirus factor that suppresses pDC activity. IMPORTANCE Several alphaherpesviruses, including herpes simpex virus, still lack effective vaccines. However, the highly successful Bartha vaccine has contributed substantially to eradication of the porcine alphaherpesvirus pseudorabies virus (PRV) in several countries. The

Gamma Interferon-Induced T-Cell Loss in Virulent Mycobacterium avium Infection

PubMed Central

Flórido, Manuela; Pearl, John E.; Solache, Alejandra; Borges, Margarida; Haynes, Laura; Cooper, Andrea M.; Appelberg, Rui

2005-01-01

Infection by virulent Mycobacterium avium caused progressive severe lymphopenia in C57BL/6 mice due to increased apoptosis rates. T-cell depletion did not occur in gamma interferon (IFN-γ)-deficient mice which showed increased T-cell numbers and proliferation; in contrast, deficiency in nitric oxide synthase 2 did not prevent T-cell loss. Although T-cell loss was IFN-γ dependent, expression of the IFN-γ receptor on T cells was not required for depletion. Similarly, while T-cell loss was optimal if the T cells expressed IFN-γ, CD8+ T-cell depletion could occur in the absence of T-cell-derived IFN-γ. Depletion did not require that the T cells be specific for mycobacterial antigen and was not affected by deficiencies in the tumor necrosis factor receptors p55 or p75, the Fas receptor (CD95), or the respiratory burst enzymes or by forced expression of bcl-2 in hematopoietic cells. PMID:15908387

COULD INTERFERON-GAMMA BE A THERAPEUTIC TARGET FOR TREATING HEART FAILURE?

PubMed Central

Levick, Scott P.; Goldspink, Paul H.

2013-01-01

The cytokine interferon-gamma (IFN-γ), is the only known member of the type II family of interferons, and as such, binds to its own distinct receptor. It is important in host defense against infection, as well as adaptive immune responses. Whilst a wide array of cytokines are known to be involved in adverse remodeling of the heart and the progression to heart failure, the role of IFN-γ is unclear. Recent evidence from clinical studies, animal models of myocarditis and hypertension, as well as isolated cell studies, provide conflicting data as to whether IFN-γ is pathological or protective in the heart. Thus, it is important to highlight these discrepant findings so that areas of future investigation can be identified to more clearly determine the precise role of IFN-γ in the heart. Accordingly, this review will: 1) discuss the source of IFN-γ in the diseased heart; 2) summarize the data from animal studies; 3) discuss the effects of IFN-γ on isolated cardiac fibroblasts and cardiomyocytes; 4) identify signaling mechanisms that may be invoked by IFN-γ in the heart; and 5) present the clinical evidence supporting a role for IFN-γ in heart failure. PMID:23589353

TLR9 Polymorphisms Are Associated with Altered IFN-γ Levels in Children with Cerebral Malaria

PubMed Central

Sam-Agudu, Nadia A.; Greene, Jennifer A.; Opoka, Robert O.; Kazura, James W.; Boivin, Michael J.; Zimmerman, Peter A.; Riedesel, Melissa A.; Bergemann, Tracy L.; Schimmenti, Lisa A.; John, Chandy C.

2010-01-01

Toll-like receptor (TLR) polymorphisms have been associated with disease severity in malaria infection, but mechanisms for this association have not been characterized. The TLR2, 4, and 9 single nucleotide polymorphism (SNP) frequencies and serum interferon-γ (IFN-γ) and tumor necrosis factor-α (TNF-α) levels were assessed in Ugandan children with cerebral malaria (CM, N = 65) and uncomplicated malaria (UM, N = 52). The TLR9 C allele at −1237 and G allele at 1174 were strongly linked, and among children with CM, those with the C allele at −1237 or the G allele at 1174 had higher levels of IFN-γ than those without these alleles (P = 0.03 and 0.008, respectively). The TLR9 SNPs were not associated with altered IFN-γ levels in children with UM or altered TNF-α levels in either group. We present the first human data that TLR SNPs are associated with altered cytokine production in parasitic infection. PMID:20348497

Hemagglutinin of Influenza A Virus Antagonizes Type I Interferon (IFN) Responses by Inducing Degradation of Type I IFN Receptor 1.

PubMed

Xia, Chuan; Vijayan, Madhuvanthi; Pritzl, Curtis J; Fuchs, Serge Y; McDermott, Adrian B; Hahm, Bumsuk

2015-12-16

Influenza A virus (IAV) employs diverse strategies to circumvent type I interferon (IFN) responses, particularly by inhibiting the synthesis of type I IFNs. However, it is poorly understood if and how IAV regulates the type I IFN receptor (IFNAR)-mediated signaling mode. In this study, we demonstrate that IAV induces the degradation of IFNAR subunit 1 (IFNAR1) to attenuate the type I IFN-induced antiviral signaling pathway. Following infection, the level of IFNAR1 protein, but not mRNA, decreased. Indeed, IFNAR1 was phosphorylated and ubiquitinated by IAV infection, which resulted in IFNAR1 elimination. The transiently overexpressed IFNAR1 displayed antiviral activity by inhibiting virus replication. Importantly, the hemagglutinin (HA) protein of IAV was proved to trigger the ubiquitination of IFNAR1, diminishing the levels of IFNAR1. Further, influenza A viral HA1 subunit, but not HA2 subunit, downregulated IFNAR1. However, viral HA-mediated degradation of IFNAR1 was not caused by the endoplasmic reticulum (ER) stress response. IAV HA robustly reduced cellular sensitivity to type I IFNs, suppressing the activation of STAT1/STAT2 and induction of IFN-stimulated antiviral proteins. Taken together, our findings suggest that IAV HA causes IFNAR1 degradation, which in turn helps the virus escape the powerful innate immune system. Thus, the research elucidated an influenza viral mechanism for eluding the IFNAR signaling pathway, which could provide new insights into the interplay between influenza virus and host innate immunity. Influenza A virus (IAV) infection causes significant morbidity and mortality worldwide and remains a major health concern. When triggered by influenza viral infection, host cells produce type I interferon (IFN) to block viral replication. Although IAV was shown to have diverse strategies to evade this powerful, IFN-mediated antiviral response, it is not well-defined if IAV manipulates the IFN receptor-mediated signaling pathway. Here, we

Cytokines affecting CD4+T regulatory cells in transplant tolerance. II. Interferon gamma (IFN-γ) promotes survival of alloantigen-specific CD4+T regulatory cells.

PubMed

Nomura, Masaru; Hodgkinson, Suzanne J; Tran, Giang T; Verma, Nirupama D; Robinson, Catherine; Plain, Karren M; Boyd, Rochelle; Hall, Bruce M

2017-06-01

CD4 + T cells that transfer alloantigen-specific transplant tolerance are short lived in culture unless stimulated with specific-donor alloantigen and lymphocyte derived cytokines. Here, we examined if IFN-γ maintained survival of tolerance transferring CD4 + T cells. Alloantigen-specific transplant tolerance was induced in DA rats with heterotopic adult PVG heart allografts by a short course of immunosuppression and these grafts functioned for >100days with no further immunosuppression. In previous studies, we found the CD4 + T cells from tolerant rats that transfer tolerance to an irradiated DA host grafted with a PVG heart, lose their tolerance transferring ability after 3days of culture, either with or without donor alloantigen, and effect rejection of specific-donor grafts. If cultures with specific-donor alloantigen are supplemented by supernatant from ConA activated lymphocytes the tolerance transferring cells survive, suggesting these cells depend on cytokines for their survival. In this study, we found addition of rIFN-γ to MLC with specific-donor alloantigen maintained the capacity of tolerant CD4 + T cells to transfer alloantigen-specific tolerance and their ability to suppress PVG allograft rejection mediated by co-administered naïve CD4 + T cells. IFN-γ suppressed the in vitro proliferation of tolerant CD4 + T cells. Tolerant CD4 + CD25 + T cells did not proliferate in MLC to PVG stimulator cells with no cytokine added, but did when IFN-γ was present. IFN-γ did not alter proliferation of tolerant CD4 + CD25 + T cells to third-party Lewis. Tolerant CD4 + CD25 + T cells' expression of IFN-γ receptor (IFNGR) was maintained in culture when IFN-γ was present. This study suggested that IFN-γ maintained tolerance mediating alloantigen-specific CD4 + CD25 + T cells. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.

Neutralizing Antibodies against IFN-[Beta] in Multiple Sclerosis: Antagonization of IFN-[Beta] Mediated Suppression of MMPs

ERIC Educational Resources Information Center

Gilli, Francesca; Bertolotto, Antonio; Sala, Arianna; Hoffmann, Francine; Capobianco, Marco; Malucchi, Simona; Glass, Tracy; Kappos, Ludwig; Lindberg, Raija L. P.; Leppert, David

2004-01-01

Neutralizing antibodies (NAb) against interferon-[Beta] (IFN-Beta) develop in about a third of treated multiple sclerosis patients and are believed to reduce therapeutic efficacy of IFN-[Beta] on clinical and MRI measures. The expression of the interferon acute-response protein, myxovirus resistance protein A (MxA) is a sensitive measure of the…

Partial interferon-gamma receptor 1 deficiency in a child with tuberculoid bacillus Calmette-Guérin infection and a sibling with clinical tuberculosis.

PubMed Central

Jouanguy, E; Lamhamedi-Cherradi, S; Altare, F; Fondanèche, M C; Tuerlinckx, D; Blanche, S; Emile, J F; Gaillard, J L; Schreiber, R; Levin, M; Fischer, A; Hivroz, C; Casanova, J L

1997-01-01

Complete interferon-gamma receptor 1 (IFNgammaR1) deficiency has been identified previously as a cause of fatal bacillus Calmette-Guérin (BCG) infection with lepromatoid granulomas, and of disseminated nontuberculous mycobacterial (NTM) infection in children who had not been inoculated with BCG. We report here a kindred with partial IFNgammaR1 deficiency: one child afflicted by disseminated BCG infection with tuberculoid granulomas, and a sibling, who had not been inoculated previously with BCG, with clinical tuberculosis. Both responded to antimicrobials and are currently well without prophylactic therapy. Impaired response to IFN-gamma was documented in B cells by signal transducer and activator of transcription 1 nuclear translocation, in fibroblasts by cell surface HLA class II induction, and in monocytes by cell surface CD64 induction and TNF-alpha secretion. Whereas cells from healthy children responded to even low IFN-gamma concentrations (10 IU/ml), and cells from a child with complete IFNgammaR1 deficiency did not respond to even high IFN-gamma concentrations (10,000 IU/ml), cells from the two siblings did not respond to low or intermediate concentrations, yet responded to high IFN-gamma concentrations. A homozygous missense IFNgR1 mutation was identified, and its pathogenic role was ascertained by molecular complementation. Thus, whereas complete IFNgammaR1 deficiency in previously identified kindreds caused fatal lepromatoid BCG infection and disseminated NTM infection, partial IFNgammaR1 deficiency in this kindred caused curable tuberculoid BCG infection and clinical tuberculosis. PMID:9389728

Clinical and diagnostic developments of a gamma interferon release assay for use in bovine tuberculosis control programs

USDA-ARS?s Scientific Manuscript database

Currently the Bovigam assay is used as an official supplemental test within the bovine tuberculosis eradication program. This assay measures interferon-gamma (IFN-gamma) produced by lymphocytes in response to specific antigens. The objectives of the present study were to evaluate two Mycobacterium ...

Perforin and gamma interferon expression are required for CD4+ and CD8+ T-cell-dependent protective immunity against a human parasite, Trypanosoma cruzi, elicited by heterologous plasmid DNA prime-recombinant adenovirus 5 boost vaccination.

PubMed

de Alencar, Bruna C G; Persechini, Pedro M; Haolla, Filipe A; de Oliveira, Gabriel; Silverio, Jaline C; Lannes-Vieira, Joseli; Machado, Alexandre V; Gazzinelli, Ricardo T; Bruna-Romero, Oscar; Rodrigues, Mauricio M

2009-10-01

A heterologous prime-boost strategy using plasmid DNA, followed by replication-defective recombinant adenovirus 5, is being proposed as a powerful way to elicit CD4(+) and CD8(+) T-cell-mediated protective immunity against intracellular pathogens. We confirmed this concept and furthered existing research by providing evidence that the heterologous prime-boost regimen using the gene encoding amastigote surface protein 2 elicited CD4(+) and CD8(+) T-cell-mediated protective immunity (reduction of acute parasitemia and prolonged survival) against experimental infection with Trypanosoma cruzi. Protective immunity correlated with the presence of in vivo antigen-specific cytotoxic activity prior to challenge. Based on this, our second goal was to determine the outcome of infection after heterologous prime-boost immunization of perforin-deficient mice. These mice were highly susceptible to infection. A detailed analysis of the cell-mediated immune responses in immunized perforin-deficient mice showed an impaired gamma interferon (IFN-gamma) secretion by immune spleen cells upon restimulation in vitro with soluble recombinant antigen. In spite of a normal numeric expansion, specific CD8(+) T cells presented several functional defects detected in vivo (cytotoxicity) and in vitro (simultaneous expression of CD107a/IFN-gamma or IFN-gamma/tumor necrosis factor alpha) paralleled by a decreased expression of CD44 and KLRG-1. Our final goal was to determine the importance of IFN-gamma in the presence of highly cytotoxic T cells. Vaccinated IFN-gamma-deficient mice developed highly cytotoxic cells but failed to develop any protective immunity. Our study thus demonstrated a role for perforin and IFN-gamma in a number of T-cell-mediated effector functions and in the antiparasitic immunity generated by a heterologous plasmid DNA prime-adenovirus boost vaccination strategy.

PPAR{gamma} activates ABCA1 gene transcription but reduces the level of ABCA1 protein in HepG2 cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mogilenko, Denis A., E-mail: denis@iem.sp.ru; Department of Embryology, St. Petersburg State University, 199034 St. Petersburg; Shavva, Vladimir S.

Research highlights: {yields} PPAR{gamma} activates ABCA1 gene expression but decreases ABCA1 protein content in human hepatoma cell line HepG2. {yields} Treatment of HepG2 cells with PPAR{gamma} agonist GW1929 leads to dissociation of LXR{beta} from ABCA1-LXR{beta} complex. {yields} Inhibition of protein kinases MEK1/2 abolishes PPAR{gamma}-mediated dissociation of LXR{beta} from ABCA1/LXR{beta} complex. {yields} Activation of PPAR{gamma} leads to increasing of the level of LXR{beta} associated with LXRE within ABCA1 gene promoter. -- Abstract: Synthesis of ABCA1 protein in liver is necessary for high-density lipoproteins (HDL) formation in mammals. Nuclear receptor PPAR{gamma} is known as activator of ABCA1 expression, but details of PPAR{gamma}-mediatedmore » regulation of ABCA1 at both transcriptional and post-transcriptional levels in hepatocytes have not still been well elucidated. In this study we have shown, that PPAR{gamma} activates ABCA1 gene transcription in human hepatoma cells HepG2 through increasing of LXR{beta} binding with promoter region of ABCA1 gene. Treatment of HepG2 cells with PPAR{gamma} agonist GW1929 leads to dissociation of LXR{beta} from ABCA1/LXR{beta} complex and to nuclear translocation of this nuclear receptor resulting in reduction of ABCA1 protein level 24 h after treatment. Inhibition of protein kinases MEK1/2 abolishes PPAR{gamma}-mediated dissociation of LXR{beta} from ABCA1/LXR{beta} complex, but does not block PPAR{gamma}-dependent down-regulation of ABCA1 protein in HepG2 cells. These data suggest that PPAR{gamma} may be important for regulation of the level of hepatic ABCA1 protein and indicate the new interplays between PPAR{gamma}, LXR{beta} and MEK1/2 in regulation of ABCA1 mRNA and protein expression.« less

Type I IFN Inhibits Alternative Macrophage Activation during Mycobacterium tuberculosis Infection and Leads to Enhanced Protection in the Absence of IFN-γ Signaling

PubMed Central

Sousa, Jeremy; McNab, Finlay W.; Torrado, Egídio; Cardoso, Filipa; Machado, Henrique; Castro, Flávia; Cardoso, Vânia; Gaifem, Joana; Wu, Xuemei; Appelberg, Rui; Castro, António Gil; O’Garra, Anne; Saraiva, Margarida

2016-01-01

Tuberculosis causes ∼1.5 million deaths every year, thus remaining a leading cause of death from infectious diseases in the world. A growing body of evidence demonstrates that type I IFN plays a detrimental role in tuberculosis pathogenesis, likely by interfering with IFN-γ–dependent immunity. In this article, we reveal a novel mechanism by which type I IFN may confer protection against Mycobacterium tuberculosis infection in the absence of IFN-γ signaling. We show that production of type I IFN by M. tuberculosis–infected macrophages induced NO synthase 2 and inhibited arginase 1 gene expression. In vivo, absence of both type I and type II IFN receptors led to strikingly increased levels of arginase 1 gene expression and protein activity in infected lungs, characteristic of alternatively activated macrophages. This correlated with increased lung bacterial burden and pathology and decreased survival compared with mice deficient in either receptor. Increased expression of other genes associated with alternatively activated macrophages, as well as increased expression of Th2-associated cytokines and decreased TNF expression, were also observed. Thus, in the absence of IFN-γ signaling, type I IFN suppressed the switching of macrophages from a more protective classically activated phenotype to a more permissive alternatively activated phenotype. Together, our data support a model in which suppression of alternative macrophage activation by type I IFN during M. tuberculosis infection, in the absence of IFN-γ signaling, contributes to host protection. PMID:27849167

Designing of interferon-gamma inducing MHC class-II binders

PubMed Central

2013-01-01

Background The generation of interferon-gamma (IFN-γ) by MHC class II activated CD4+ T helper cells play a substantial contribution in the control of infections such as caused by Mycobacterium tuberculosis. In the past, numerous methods have been developed for predicting MHC class II binders that can activate T-helper cells. Best of author’s knowledge, no method has been developed so far that can predict the type of cytokine will be secreted by these MHC Class II binders or T-helper epitopes. In this study, an attempt has been made to predict the IFN-γ inducing peptides. The main dataset used in this study contains 3705 IFN-γ inducing and 6728 non-IFN-γ inducing MHC class II binders. Another dataset called IFNgOnly contains 4483 IFN-γ inducing epitopes and 2160 epitopes that induce other cytokine except IFN-γ. In addition we have alternate dataset that contains IFN-γ inducing and equal number of random peptides. Results It was observed that the peptide length, positional conservation of residues and amino acid composition affects IFN-γ inducing capabilities of these peptides. We identified the motifs in IFN-γ inducing binders/peptides using MERCI software. Our analysis indicates that IFN-γ inducing and non-inducing peptides can be discriminated using above features. We developed models for predicting IFN-γ inducing peptides using various approaches like machine learning technique, motifs-based search, and hybrid approach. Our best model based on the hybrid approach achieved maximum prediction accuracy of 82.10% with MCC of 0.62 on main dataset. We also developed hybrid model on IFNgOnly dataset and achieved maximum accuracy of 81.39% with 0.57 MCC. Conclusion Based on this study, we have developed a webserver for predicting i) IFN-γ inducing peptides, ii) virtual screening of peptide libraries and iii) identification of IFN-γ inducing regions in antigen (http://crdd.osdd.net/raghava/ifnepitope/). Reviewers This article was reviewed by Prof Kurt

Respiratory Francisella tularensis live vaccine strain infection induces Th17 cells and prostaglandin E2, which inhibits generation of gamma interferon-positive T cells.

PubMed

Woolard, Matthew D; Hensley, Lucinda L; Kawula, Thomas H; Frelinger, Jeffrey A

2008-06-01

Two key routes of Francisella tularensis infection are through the skin and airway. We wished to understand how the route of inoculation influenced the primary acute adaptive immune response. We show that an intranasal inoculation of the F. tularensis live vaccine strain (LVS) with a 1,000-fold-smaller dose than an intradermal dose results in similar growth kinetics and peak bacterial burdens. In spite of similar bacterial burdens, we demonstrate a difference in the quality, magnitude, and kinetics of the primary acute T-cell response depending on the route of inoculation. Further, we show that prostaglandin E(2) secretion in the lung is responsible for the difference in the gamma interferon (IFN-gamma) response. Intradermal inoculation led to a large number of IFN-gamma(+) T cells 7 days after infection in both the spleen and the lung. In contrast, intranasal inoculation induced a lower number of IFN-gamma(+) T cells in the spleen and lung but an increased number of Th17 cells in the lung. Intranasal infection also led to a significant increase of prostaglandin E(2) (PGE(2)) in the bronchoalveolar lavage fluid. Inhibition of PGE(2) production with indomethacin treatment resulted in increased numbers of IFN-gamma(+) T cells and decreased bacteremia in the lungs of intranasally inoculated mice. This research illuminates critical differences in acute adaptive immune responses between inhalational and dermal infection with F. tularensis LVS mediated by the innate immune system and PGE(2).

Immunological role of CD4+CD28null T lymphocytes, natural killer cells, and interferon-gamma in pediatric patients with sickle cell disease: relation to disease severity and response to therapy.

PubMed

ElAlfy, Mohsen Saleh; Adly, Amira Abdel Moneam; Ebeid, Fatma Soliman ElSayed; Eissa, Deena Samir; Ismail, Eman Abdel Rahman; Mohammed, Yasser Hassan; Ahmed, Manar Elsayed; Saad, Aya Sayed

2018-06-20

Sickle cell disease (SCD) is associated with alterations in immune phenotypes. CD4 + CD28 null T lymphocytes have pro-inflammatory functions and are linked to vascular diseases. To assess the percentage of CD4 + CD28 null T lymphocytes, natural killer cells (NK), and IFN-gamma levels, we compared 40 children and adolescents with SCD with 40 healthy controls and evaluated their relation to disease severity and response to therapy. Patients with SCD steady state were studied, focusing on history of frequent vaso-occlusive crisis, hydroxyurea therapy, and IFN-gamma levels. Analysis of CD4 + CD28 null T lymphocytes and NK cells was done by flow cytometry. Liver and cardiac iron overload were assessed. CD4 + CD28 null T lymphocytes, NK cells, and IFN-gamma levels were significantly higher in patients than controls. Patients with history of frequent vaso-occlusive crisis and those with vascular complications had higher percentage of CD4 + CD28 null T lymphocytes and IFN-gamma while levels were significantly lower among hydroxyurea-treated patients. CD4 + CD28 null T lymphocytes were positively correlated to transfusional iron input while these cells and IFN-gamma were negatively correlated to cardiac T2* and duration of hydroxyurea therapy. NK cells were correlated to HbS and indirect bilirubin. Increased expression of CD4 + CD28 null T lymphocytes highlights their role in immune dysfunction and pathophysiology of SCD complications.

Molecular cloning and characterization of a novel bovine IFN-ε.

PubMed

Guo, Yongli; Gao, Mingchun; Bao, Jun; Luo, Xiuxin; Liu, Ying; An, Dong; Zhang, Haili; Ma, Bo; Wang, Junwei

2015-03-01

A bovine IFN-ε (BoIFN-ε) gene was amplified from bovine liver genomic DNA consisting of a 463bp partial 5'UTR, 582bp complete ORF and 171bp partial 3'UTR, which encodes a protein of 193 amino acids with a 21-amino acid signal peptide and shares 61 to 87% identity with other species IFN-ε. Then BoIFN-ε gene was characterized, and it can be transcribed in EBK cells at a high level after being infected by VSV. Recombinant proteins were expressed in Escherichia coli and the antiviral activity was determined in vitro, which revealed that bovine IFN-ε has less antiviral activity than bovine IFN-α. In addition, an immunofluorescence assay indicated that BoIFN-ε expressed in MDBK cells could be detected by polyclonal antibody against BoIFN-ε. Furthermore, the BoIFN-ε gene can be constitutively expressed in the liver, thymus, kidney, small intestine and testis, but not in the heart. This study revealed that BoIFN-ε has the typical characteristics of type I interferon and can be expressed constitutively in certain tissue, which not only can be a likely candidate for a novel, effective therapeutic agent, but also facilitate further research on the role of bovine IFN system. Copyright © 2014 Elsevier B.V. All rights reserved.

Systemic Activation of the IFN System by Exposure of Natural Epithelia to Physiologic (Low Dose) Levels of IFN

DTIC Science & Technology

1990-06-20

infecting organisms. The potential efficacy of using low concentrations of IFN for therapeutic treatment of feline leukemia virus and human... immunodeficiency virus infections in humans has been reported (15). Oral administration of IFN to neonatal mice in higher concentrations prior to infection with

Tumor necrosis factor alpha mediates resistance to Trypanosoma cruzi infection in mice by inducing nitric oxide production in infected gamma interferon-activated macrophages.

PubMed Central

Silva, J S; Vespa, G N; Cardoso, M A; Aliberti, J C; Cunha, F Q

1995-01-01

Cell invasion by Trypanosoma cruzi and its intracellular replication are essential for continuation of the parasite life cycle and for production of Chagas' disease. T. cruzi is able to replicate in nucleated cells and can be killed by activated macrophages. Gamma interferon (IFN-gamma) is one of the major stimuli for the activation of macrophages and has been shown to be a key activation factor for the killing of intracellular parasites through a mechanism dependent upon nitric oxide (NO) biosynthesis. We show that although the addition of exogenous tumor necrosis factor alpha (TNF-alpha) does not potentiate the trypanocidal activity of IFN-gamma in vitro, treatment of resistant C57BI/6 mice with an anti-TNF-alpha monoclonal antibody increased parasitemia and mortality. In addition, the anti-TNF-alpha-treated animals had decreased NO production, both in vivo and in vitro, suggesting an important role for TNF-alpha in controlling infection. In order to better understand the role of TNF-alpha in the macrophage-mediating killing of parasites, cultures of T. cruzi-infected macrophages were treated with an anti-TNF-alpha monoclonal antibody. IFN-gamma-activated macrophages failed to kill intracellular parasites following treatment with 100 micrograms of anti-TNF-alpha. In these cultures, the number of parasites released at various time points after infection was significantly increased while NO production was significantly reduced. We conclude that IFN-gamma-activated macrophages produce TNF-alpha after infection by T. cruzi and suggest that this cytokine plays a role in amplifying NO production and parasite killing. PMID:7591147

Application of genetically engineered Salmonella typhimurium for interferon-gamma-induced therapy against melanoma.

PubMed

Yoon, Wonsuck; Park, Yoo Chang; Kim, Jinseok; Chae, Yang Seok; Byeon, Jung Hye; Min, Sang-Hyun; Park, Sungha; Yoo, Young; Park, Yong Keun; Kim, Byeong Mo

2017-01-01

Salmonella have been experimentally used as anti-cancer agents, because they show selective growth in tumours. In this study, we genetically modified attenuated Salmonella typhimurium to express and secrete interferon-gamma (IFN-γ) as a tumouricidal agent to enhance the therapeutic efficacy of Salmonella. IFN-γ was fused to the N-terminal region (residues 1-160) of SipB (SipB160) for secretion from bacterial cells. Attenuated S. typhimurium expressing recombinant IFN-γ (S. typhimurium (IFN-γ)) invaded the melanoma cells and induced cytotoxicity. Subcutaneous administration of S. typhimurium (IFN-γ) also efficiently inhibited tumour growth and prolonged the survival of C57BL/6 mice bearing B16F10 melanoma compared with administration of phosphate-buffered saline (PBS), unmodified S. typhimurium or S. typhimurium expressing empty vector (S. typhimurium [Vec]) in a natural killer (NK) cell-dependent manner. Moreover, genetically modified Salmonella, including S. typhimurium (IFN-γ), showed little toxicity to normal tissues with no observable adverse effects. However, S. typhimurium (IFN-γ)-mediated tumour suppression was attributed to direct killing of tumour cells rather than to stable anti-tumour immunity. Collectively, these results suggest that tumour-targeted therapy using S. typhimurium (IFN-γ) has potential for melanoma treatment. Copyright © 2016 Elsevier Ltd. All rights reserved.

IFN-λ Inhibits MiR-122 Transcription through a Stat3-HNF4α Inflammatory Feedback Loop in an IFN-α Resistant HCV Cell Culture System

PubMed Central

Aboulnasr, Fatma; Hazari, Sidhartha; Nayak, Satyam; Chandra, Partha K.; Panigrahi, Rajesh; Ferraris, Pauline; Chava, Srinivas; Kurt, Ramazan; Song, Kyongsub; Dash, Asha; Balart, Luis A.; Garry, Robert F.; Wu, Tong; Dash, Srikanta

2015-01-01

Background HCV replication in persistently infected cell culture remains resistant to IFN-α/RBV combination treatment, whereas IFN-λ1 induces viral clearance. The antiviral mechanisms by which IFN-λ1 induces sustained HCV clearance have not been determined. Aim To investigate the mechanisms by which IFN-λ clears HCV replication in an HCV cell culture model. Methods IFN-α sensitive (S3-GFP) and resistant (R4-GFP) cells were treated with equivalent concentrations of either IFN-α or IFN-λ. The relative antiviral effects of IFN-α and IFN-λ1 were compared by measuring the HCV replication, quantification of HCV-GFP expression by flow cytometry, and viral RNA levels by real time RT-PCR. Activation of Jak-Stat signaling, interferon stimulated gene (ISG) expression, and miRNA-122 transcription in S3-GFP and R4-GFP cells were examined. Results We have shown that IFN-λ1 induces HCV clearance in IFN-α resistant and sensitive replicon cell lines in a dose dependent manner through Jak-Stat signaling, and induces STAT 1 and STAT 2 activation, ISRE-luciferase promoter activation and ISG expression. Stat 3 activation is also involved in IFN-λ1 induced antiviral activity in HCV cell culture. IFN-λ1 induced Stat 3 phosphorylation reduces the expression of hepatocyte nuclear factor 4 alpha (HNF4α) through miR-24 in R4-GFP cells. Reduced expression of HNF4α is associated with decreased expression of miR-122 resulting in an anti-HCV effect. Northern blot analysis confirms that IFN-λ1 reduces miR-122 levels in R4-GFP cells. Our results indicate that IFN-λ1 activates the Stat 3-HNF4α feedback inflammatory loop to inhibit miR-122 transcription in HCV cell culture. Conclusions In addition to the classical Jak–Stat antiviral signaling pathway, IFN-λ1 inhibits HCV replication through the suppression of miRNA-122 transcription via an inflammatory Stat 3–HNF4α feedback loop. Inflammatory feedback circuits activated by IFNs during chronic inflammation expose non

IFNL4 ss469415590 Variant Is Associated with Treatment Response in Japanese HCV Genotype 1 Infected Individuals Treated with IFN-Including Regimens

PubMed Central

Miyamura, Tatsuo; Kanda, Tatsuo; Nakamoto, Shingo; Arai, Makoto; Nakamura, Masato; Wu, Shuang; Jiang, Xia; Sasaki, Reina; Yasui, Shin; Ooka, Yoshihiko; Imazeki, Fumio; Mikami, Shigeru; Yokosuka, Osamu

2014-01-01

Aim. Eradication of hepatitis C virus (HCV) is still challenging even if interferon- (IFN-) free regimens with direct-acting antiviral agents (DAAs) for HCV-infected individuals are available in clinical practice. IFNL4 is a newly described protein, associated with human antiviral defenses. We investigated whether IFNL4 ss469415590 variant has an effect on the prediction of treatment response in HCV-infected patients treated with IFN-including regimens. Patients and Methods. In all, 185 patients infected with HCV genotype 1 treated with peg-IFN plus ribavirin, with or without telaprevir, were genotyped for IFNL4 ss469415590. We retrospectively investigated whether the role of IFNL4 ss469415590 variant and other factors could predict sustained virological response (SVR) in Japanese patients infected with HCV genotype 1. Results. There were 65.7%, 31.5%, and 2.8% patients in the IFNL4 ss469415590 TT/TT, TT/-G, and -G/-G groups, respectively. SVR rates were 82.1% or 49.3% in patients treated with peg-IFN plus ribavirin with or without telaprevir, respectively. IFNL4 ss469415590 variant and HCV viral loads or IFNL4 ss469415590 variant and early virological response were better predictors of SVR in patients treated with peg-IFN plus ribavirin with or without telaprevir, respectively. Conclusion. In the era of DAAs, measurement of IFNL4 ss469415590 variant could help the prediction of SVR in Japanese HCV genotype 1 infected individuals treated with IFN-including regimens. PMID:25548683

Chronic Fibro-Inflammatory Responses in Autoimmune Pancreatitis Depend on IFN-α and IL-33 Produced by Plasmacytoid Dendritic Cells.

PubMed

Watanabe, Tomohiro; Yamashita, Kouhei; Arai, Yasuyuki; Minaga, Kosuke; Kamata, Ken; Nagai, Tomoyuki; Komeda, Yoriaki; Takenaka, Mamoru; Hagiwara, Satoru; Ida, Hiroshi; Sakurai, Toshiharu; Nishida, Naoshi; Strober, Warren; Kudo, Masatoshi

2017-05-15

In previous studies, we found that human IgG4-related autoimmune pancreatitis (AIP) and murine AIP are driven by activation of plasmacytoid dendritic cells (pDCs) producing IFN-α. In the present studies we examined additional roles of pDC-related mechanisms in AIP pathogenesis, particularly those responsible for induction of fibrosis. We found that in murine AIP (MRL/Mp mice treated with polyinosinic-polycytidylic acid) not only the pancreatic infiltration of immune cells but also the development of fibrosis were markedly reduced by the depletion of pDCs or blockade of type I IFN signaling; moreover, such treatment was accompanied by a marked reduction of pancreatic expression of IL-33. Conversely, polyinosinic-polycytidylic acid-induced inflamed pancreatic tissue in murine AIP exhibited increased expression of type I IFNs and IL-33 (and downstream IL-33 cytokines such as IL-13 and TGF-β1). pDCs stimulated by type I IFN were the source of the IL-33 because purified populations of these cells isolated from the inflamed pancreas produced a large amount of IL-33 upon activation by TLR9 ligands, and such production was abrogated by the neutralization of type I IFN. The role of IL-33 in murine AIP pathogenesis was surprisingly important because blockade of IL-33 signaling by anti-ST2 Ab attenuated both pancreatic inflammation and accompanying fibrosis. Finally, whereas patients with both conventional pancreatitis and IgG4-related AIP exhibited increased numbers of acinar cells expressing IL-33, only the latter also exhibited pDCs producing this cytokine. These data thus suggest that pDCs producing IFN-α and IL-33 play a pivotal role in the chronic fibro-inflammatory responses underlying murine AIP and human IgG4-related AIP. Copyright © 2017 by The American Association of Immunologists, Inc.

Potential mechanisms of cytosolic calcium modulation in interferon-gamma treated U937 cells

NASA Technical Reports Server (NTRS)

Klein, Jon B.; Mcleish, Kenneth R.; Sonnenfeld, Gerald; Dean, William L.

1987-01-01

The ability of interferon-gamma (IFN-gamma) to alter cytoplasmic Ca(2+) content in the monocytelike cell line U937 was investigated, using a slow Ca-channel blocker, diltiazem. In addition, the Ca-ATPase and the Ca-uptake activities were measured in isolated U937 membranes, together with the effect of inositol trisphosphate (IP3) upon the Ca(2+) release from Ca-loaded membranes. The addition of 50 U/ml INF-gamma to U937 cultures was found to increase internal Ca(2+) by about 100 percent within 3 min. The increase was significantly reduced by incubation in Ca-free buffer or by the addition of diltiazem. A crude membrane preparation from U937 cells was found to contain significant amounts of Ca-ATPase activity and to sequester Ca(2+) to a level of 8 nmol/mg in 30 sec; the addition of IP3 induced release of a portion of the sequestered Ca(2+) which was then resequestered. The results suggest that IFN-gamma causes an increase of cytoplasmic Ca(2+), in part, by the IP3-induced release from the internal storage sites and, in part, from the entry of extracellular Ca through slow channels.

Interleukin-17A-Deficient Mice Are Highly Susceptible to Toxoplasma gondii Infection Due to Excessively Induced T. gondii HSP70 and Interferon Gamma Production.

PubMed

Moroda, Masataka; Takamoto, Masaya; Iwakura, Yoichiro; Nakayama, Jun; Aosai, Fumie

2017-12-01

Interleukin17A (IL-17A) is known to be involved in the host defense against pathogens and the pathogenesis of autoimmune diseases. Previously, we showed that excessive amounts of interferon gamma (IFN-γ) play an important role in the pathogenesis of the lethal effects of Toxoplasma gondii by inducing anaphylactic responses. In the study described in this report, we examined the effects of IL-17A deficiency on murine host defense against oral T. gondii infection. IL-17A-deficient C57BL/6 (B6) mice exhibited higher rates of mortality than wild-type (WT) mice during the acute phase of T. gondii infection. CD4 + T cells in the mesenteric lymph nodes (mLNs) and ileum of T. gondii -infected IL-17A-deficient mice produced higher levels of IFN-γ than did those of WT mice. In addition, the level of T. gondii HSP70 ( T.g HSP70) expression was also significantly increased in the ileum, mLNs, liver, and spleen of infected IL-17A-deficient mice compared with that in WT mice. These elevated levels of expression of T.g HSP70 and IFN-γ in infected IL-17A-deficient mice were presumably linked to the IL-17A defect since they decreased to WT levels after treatment with recombinant IL-17A. Furthermore, IL-17A-deficient mice were highly susceptible to the anaphylactic effect of T.g HSP70, and the survival of IL-17A-deficient mice during the acute phase was improved by treatment with an anti- T.g HSP70 monoclonal antibody. These results suggest that IL-17A plays an important role in host survival against T. gondii infection by protecting the host from an anaphylactic reaction via the downregulation of T.g HSP70 and IFN-γ production. Copyright © 2017 American Society for Microbiology.

Cadmium-sulfide crystallites in Cd-(. gamma. EC) sub n G peptide complexes from tomato. [Lycopersicon esculentum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Reese, R.N.; White, C.A.; Winge, D.R.

Hydroponically grown tomato plants (Lycopersicon esculentum P. Mill cv Golden Boy) exposed to 100 micromolar cadmium sulfate produced metal-({gamma}EC){sub n}G peptide complexes containing acid-labile sulfur. The properties of the complexes resemble those of the cadmium-({gamma}EC){sub n}G peptide complexes from Schizo-saccharomyces pombe and Candida glabrata known to contain a cadmium sulfide crystallite core. The crystallite is stabilized by a sheath of peptides of general structure ({gamma}Glu-Cys){sub n}-Gly. The cadmium-peptide complexes of tomato contained predominantly peptides of n{sub 3}, n{sub 4}, and n{sub 5}. Spectroscopic analyses indicated that the tomato cadmium-sulfide-peptide complex contained CdS crystallite core particles smaller than 2.0 nanometers inmore » diameter.« less

Gamma Interferon Loaded onto Albumin Nanoparticles: In Vitro and In Vivo Activities against Brucella abortus▿

PubMed Central

Segura, S.; Gamazo, C.; Irache, J. M.; Espuelas, S.

2007-01-01

The aim of this study was to evaluate the activity of gamma interferon (IFN-γ) when it was either adsorbed onto or loaded into albumin nanoparticles. Brucella abortus-infected macrophages and infected BALB/c mice were selected as the models for testing of the therapeutic potentials of these cytokine delivery systems, in view of the well-established role of IFN-γ-activated macrophages for the control of Brucella sp. infections. Whereas the encapsulation of IFN-γ inside the matrix of nanoparticles completely abrogated its activity, adsorbed IFN-γ increased by 0.75 log unit the bactericidal effect induced by RAW macrophages activated with free IFN-γ, along with a higher level of production of nitric oxide. In infected BALB/c-mice, IFN-γ adsorbed onto nanoparticles was also more active than free cytokine in reducing the number of bacteria in the spleens, and the effect was mediated by an increased ratio of IFN-γ-secreting (Th1) to interleukin-4-secreting (Th2) cells. Overall, albumin nanoparticles would be suitable as carriers that target IFN-γ to macrophages and, thus, potentiate their therapeutic activity. PMID:17220401

Interferon Gamma as a Biomarker of Exposure to Enteric Viruses

EPA Science Inventory

Interferon gamma (IFN-γ) was selected as a biomarker for viral exposure. Twelve-week-old BALB/c mice were intraperitoneally injected with Coxsackievirus B3 or B4 diluted in phosphate-buffered saline (PBS). Control mice were injected with PBS only. Four months after viral infectio...

Bovine immune response to inoculation with Neospora caninum surface antigen SRS2 lipopeptides mimics immune response to infection with live parasites.

PubMed

Baszler, Timothy V; Shkap, Varda; Mwangi, Waithaka; Davies, Christopher J; Mathison, Bruce A; Mazuz, Monica; Resnikov, Dror; Fish, Lea; Leibovitch, Benjamin; Staska, Lauren M; Savitsky, Igor

2008-04-01

Infection of cattle with Neospora caninum protozoa, the causative agent of bovine protozoal abortion, results in robust cellular and humoral immune responses, particularly CD4(+) T-lymphocyte activation and gamma interferon (IFN-gamma) secretion. In the present study, N. caninum SRS2 (NcSRS2) T-lymphocyte-epitope-bearing subunits were incorporated into DNA and peptide preparations to assess CD4(+) cell proliferation and IFN-gamma T-lymphocyte-secretion immune responses in cattle with predetermined major histocompatibility complex (MHC) genotypes. In order to optimize dendritic-cell processing, NcSRS2 DNA vaccine was delivered with granulocyte macrophage-colony-stimulating factor and Flt3 ligand adjuvant. The synthesized NcSRS2 peptides were coupled with a palmitic acid molecule (lipopeptide) and delivered with Freund's adjuvant. Cattle vaccinated with NcSRS2 DNA vaccine alone did not induce T-lymphocyte activation or IFN-gamma secretion, whereas subsequent booster inoculation with NcSRS2-lipopeptides induced robust NcSRS2-specific immune responses. Compared to the response in control animals, NcSRS2-lipopeptide-immunized cattle had significantly increased NcSRS2-specific T-lymphocyte proliferation, numbers of IFN-gamma-secreting peripheral blood mononuclear cells, and immunoglobulin G1 (IgG1) and IgG2a antibody levels. The findings show that N. caninum NcSRS2 subunits bearing T-lymphocyte epitopes induced cell-mediated immune responses similar to the protective immune responses previously described against live parasite infection, namely T-lymphocyte activation and IFN-gamma secretion. The findings support the investigation of NcSRS2 immunogens for protection against N. caninum-induced fetal infection and abortion in cattle.

Type III IFNs are produced by and stimulate human plasmacytoid dendritic cells1

PubMed Central

Yin, Zhiwei; Dai, Jihong; Deng, Jing; Sheikh, Faruk; Natalia, Mahwish; Shih, Tiffany; Lewis-Antes, Anita; Amrute, Sheela B.; Garrigues, Ursula; Doyle, Sean; Donnelly, Raymond P; Kotenko, Sergei V; Fitzgerald-Bocarsly, Patricia

2012-01-01

Plasmacytoid dendritic cells (pDC) are rare cells found in peripheral blood and lymphoid tissues. pDC are considered to be “professional” type I interferon (IFN) producing cells and produce 10–100-fold more IFN-α than other cell types in response to enveloped viruses or synthetic TLR-7 and -9 agonists. In this study, purified pDC were found to express high levels of IFN-λ receptor mRNA as well as cell-surface IFN-λ receptor. We have developed intracellular flow cytometry assays using antibodies to IFN-λ1/3 or -λ2 to assess the expression of IFN-λ proteins by pDC. We observed that a subset of human pDC expresses only intracellular IFN-α while another subset produces both IFN-α and IFN-λ after stimulation with virus or the TLR9 agonist, CpGA; the cells that co-expressed IFN-α and IFN-λ were the cells with the highest levels of IFN-α expression. Antibody cross-linking of CD4 or BDCA-2 molecules on pDC inhibited both HSV-induced IFN-λ and IFN-α production. Like the production of IFN-α, the HSV-induced IFN-λ production in pDC was mediated through TLR9 and independent of virus replication. Exogenous IFN-λ treatment of pDC resulted in increased virus-induced expression of both IFN-α and IFN-λ. In addition, both exogenous IFN-λ and –α inhibited dexamethasone-induced apoptosis of pDC. We conclude that pDC are major producers of IFN-λ1 and –λ2 in response to viral stimulation and also express functional receptors for this cytokine. Thus, IFN-λ can serve as an autocrine signal to strengthen the antiviral response of pDC by increasing IFN-α and IFN-λ production, resulting in prolonged pDC survival. PMID:22891284

Impaired plasmacytoid dendritic cell (PDC)-NK cell activity in viremic human immunodeficiency virus infection attributable to impairments in both PDC and NK cell function.

PubMed

Conry, Sara J; Milkovich, Kimberly A; Yonkers, Nicole L; Rodriguez, Benigno; Bernstein, Helene B; Asaad, Robert; Heinzel, Frederick P; Tary-Lehmann, Magdalena; Lederman, Michael M; Anthony, Donald D

2009-11-01

Human immunodeficiency virus (HIV) and hepatitis C virus (HCV) infections impair plasmacytoid dendritic cell (PDC) and natural killer (NK) cell subset numbers and functions, though little is known about PDC-NK cell interactions during these infections. We evaluated PDC-dependent NK cell killing and gamma interferon (IFN-gamma) and granzyme B production, using peripheral blood mononuclear cell (PBMC)-based and purified cell assays of samples from HCV- and HIV-infected subjects. CpG-enhanced PBMC killing and IFN-gamma and granzyme B activity (dependent on PDC and NK cells) were impaired in viremic HIV infection. In purified PDC-NK cell culture experiments, CpG-enhanced, PDC-dependent NK cell activity was cell contact and IFN-alpha dependent, and this activity was impaired in viremic HIV infection but not in HCV infection. In heterologous PDC-NK cell assays, impaired PDC-NK cell killing activity was largely attributable to an NK cell defect, while impaired PDC-NK cell IFN-gamma-producing activity was attributable to both PDC and NK cell defects. Additionally, the response of NK cells to direct IFN-alpha stimulation was defective in viremic HIV infection, and this defect was not attributable to diminished IFN-alpha receptor expression, though IFN-alpha receptor and NKP30 expression was closely associated with killer activity in viremic HIV infection but not in healthy controls. These data indicate that during uncontrolled HIV infection, PDC-dependent NK cell function is impaired, which is in large part attributable to defective IFN-alpha-induced NK cell activity and not to altered IFN-alpha receptor, NKP30, NKP44, NKP46, or NKG2D expression.

MOLECULAR CLONING, SEQUENCING, EXPRESSION AND BIOLOGICAL ACTIVITY OF GIANT PANDA (AILUROPODA MELANOLEUCA) INTERFERON-GAMMA.

PubMed

Zhu, Hui; Wang, Wen-Xiu; Wang, Bao-Qin; Zhu, Xiao-Fu; Wu, Xu-Jin; Ma, Qing-Yi; Chen, De-Kun

2012-06-29

The giant panda (Ailuropoda melanoleuca) is an endangered species and indigenous to China. Interferon-gamma (IFN-γ) is the only member of type □ IFN and is vital for the regulation of host adapted immunity and inflammatory response. Little is known aboutthe FN-γ gene and its roles in giant panda.In this study, IFN-γ gene of Qinling giant panda was amplified from total blood RNA by RT-CPR, cloned, sequenced and analysed. The open reading frame (ORF) of Qinling giant panda IFN-γ encodes 152 amino acidsand is highly similar to Sichuan giant panda with an identity of 99.3% in cDNA sequence. The IFN-γ cDNA sequence was ligated to the pET32a vector and transformed into E. coli BL21 competent cells. Expression of recombinant IFN-γ protein of Qinling giant panda in E. coli was confirmed by SDS-PAGE and Western blot analysis. Biological activity assay indicated that the recombinant IFN-γ protein at the concentration of 4-10 µg/ml activated the giant panda peripheral blood lymphocytes,while at 12 µg/mlinhibited. the activation of the lymphocytes.These findings provide insights into the evolution of giant panda IFN-γ and information regarding amino acid residues essential for their biological activity.

[The clinical application of quantiferon TB-2G: its usefulness and limitations].

PubMed

Sato, Shigeki; Nagai, Hideaki

2011-02-01

compromised hosts is essential for TB control, but T cell assay might be influenced by the degree of cell-mediated immunosuppression. The relationship between immunocompetence and specific interferon (IFN)-gamma response in whole blood QuantiFERON-TB Gold (QFT) is uncertain. Immune-related clinical indicators associated with the degree of antigen-specific IFN-gamma production were analysed using a large immunologically-unselected population with obvious TB infection. The absolute number of blood lymphocyte in TB patients was significantly associated with specific IFN-gamma production in a linear regression model. Sensitivity of 2 IFN-gamma Release Assays, QFT and ELISPOT, partly depends on peripheral lymphocyte counts. At low lymphocyte count conditions, ELISPOT assay is superior to whole blood QFT for detecting tuberculosis infection. (4) QuantiFERON TB-2G among staffs in the hospitals of Nationao Hospital Organization: Susumu OGURI, Chihiro NISHIO, Kensuke SUMI, Masayoshi MINAGUCHI, Tomomasa TSUBOI, Atuo SATOU, Osamu TOKUNAGA, Takeshi MIYAMOMAE, Takuya KURASAWA (National Hospital Organization Minami-Kyoto National Hospital) To investigate the infection rate of tuberculosis among staffs working in the hospitals of NHO. Questionnaires were sent to the hospitals and the responses were analyzed. Among the staffs working in the hospitals with tuberculosis wards, positive rate of QuantiFERON TB-2G was 6.9%, probable positive rate was 5.6%. On the other hand, among the staffs working in the hospitals without tuberculosis wards, positive rate was 4.4%, probable positive rate was 3.9%. It is necessary to monitor the infection rate among hospital staffs.

Decreased interferon-α production in response to CpG DNA dysregulates cytokine responses in patients with multiple sclerosis.

PubMed

Hirotani, Makoto; Niino, Masaaki; Fukazawa, Toshiyuki; Yaguchi, Hiroaki; Nakamura, Masakazu; Kikuchi, Seiji; Sasaki, Hidenao

2012-05-01

Type I interferons (IFNs), represented by IFN-α and β, activate immune effector cells belonging to the innate and adaptive immune systems. Plasmacytoid dendritic cells (pDCs) produce IFN-α in response to CpG DNA. We aimed to examine the impact of pDC-produced IFN-α on the adaptive immune system in Multiple Sclerosis (MS). Our results demonstrated that CpG DNA-induced IFN-α production was significantly decreased in PBMCs from MS patients. Decreased levels of IL-12 p70, IFN-γ, and IL-17 and increased level of IL-10 were found in CpG DNA-treated PBMCs of healthy subjects unlike in those from MS patients. In samples pre-treated with IFN-α and IFN-β, decreased levels of IL-12 p70, IFN-γ, and IL-17 and increased level of IL-10 were detected in PBMCs from MS patients. These results suggest that CpG DNA-induced decreased IFN-α production causes pro-inflammatory cytokine secretion, and either IFN-α or IFN-β induces anti-inflammatory cytokine secretion in the adaptive immune system in MS. Copyright © 2012 Elsevier Inc. All rights reserved.

Cerebral and ocular toxoplasmosis related with IFN-γ, TNF-α, and IL-10 levels

PubMed Central

Meira, Cristina S.; Pereira-Chioccola, Vera L.; Vidal, José E.; de Mattos, Cinara C. Brandão; Motoie, Gabriela; Costa-Silva, Thais A.; Gava, Ricardo; Frederico, Fábio B.; de Mattos, Luiz C.

2014-01-01

This study analyzed the synthesis of Interferon gamma (IFN-γ), Tumor Necrosis Factor alpha (TNF-α), and Interleukin 10 (IL-10) in chronically infected patients which developed the symptomatic disease as cerebral or ocular toxoplasmosis. Blood from 61 individuals were divided into four groups: Cerebral toxoplasmosis/AIDS patients (CT/AIDS group) (n = 15), ocular toxoplasmosis patients (OT group) (n = 23), chronic toxoplasmosis individuals (CHR group) (n = 13) and healthy individuals (HI group) (n = 10). OT, CHR, and HI groups were human immunodeficiency virus (HIV) seronegative. The diagnosis was made by laboratorial (PCR and ELISA) and clinical subjects. For cytokine determination, peripheral blood mononuclear cells (PBMC) of each patient were isolated and stimulated in vitro with T. gondii antigen. IFN-γ, TNF-α, and IL-10 activities were determined by ELISA. Patients from CT/AIDS and OT groups had low levels of IFN-γ when were compared with those from CHR group. These data suggest the low resistance to develop ocular lesions by the low ability to produce IFN-γ against the parasite. The same patients, which developed ocular or cerebral toxoplasmosis had higher TNF-α levels than CHR individuals. High TNF-α synthesis contribute to the inflammatory response and damage of the choroid and retina in OT patients and in AIDS patients caused a high inflammatory response as the TNF-α synthesis is not affected since monocytes are the major source this cytokine in response to soluble T. gondii antigens. IL-10 levels were almost similar in CT/AIDS and OT patients but low when compared with CHR individuals. The deviation to Th2 immune response including the production of anti-inflammatory cytokines, such as IL-10 may promote the parasite's survival causing the tissue immune destruction. IL-10 production in T. gondii-infected brains may support the persistence of parasites as down-regulating the intracerebral immune response. All these indicate that OT and CT

Cerebral and ocular toxoplasmosis related with IFN-γ, TNF-α, and IL-10 levels.

PubMed

Meira, Cristina S; Pereira-Chioccola, Vera L; Vidal, José E; de Mattos, Cinara C Brandão; Motoie, Gabriela; Costa-Silva, Thais A; Gava, Ricardo; Frederico, Fábio B; de Mattos, Luiz C

2014-01-01

This study analyzed the synthesis of Interferon gamma (IFN-γ), Tumor Necrosis Factor alpha (TNF-α), and Interleukin 10 (IL-10) in chronically infected patients which developed the symptomatic disease as cerebral or ocular toxoplasmosis. Blood from 61 individuals were divided into four groups: Cerebral toxoplasmosis/AIDS patients (CT/AIDS group) (n = 15), ocular toxoplasmosis patients (OT group) (n = 23), chronic toxoplasmosis individuals (CHR group) (n = 13) and healthy individuals (HI group) (n = 10). OT, CHR, and HI groups were human immunodeficiency virus (HIV) seronegative. The diagnosis was made by laboratorial (PCR and ELISA) and clinical subjects. For cytokine determination, peripheral blood mononuclear cells (PBMC) of each patient were isolated and stimulated in vitro with T. gondii antigen. IFN-γ, TNF-α, and IL-10 activities were determined by ELISA. Patients from CT/AIDS and OT groups had low levels of IFN-γ when were compared with those from CHR group. These data suggest the low resistance to develop ocular lesions by the low ability to produce IFN-γ against the parasite. The same patients, which developed ocular or cerebral toxoplasmosis had higher TNF-α levels than CHR individuals. High TNF-α synthesis contribute to the inflammatory response and damage of the choroid and retina in OT patients and in AIDS patients caused a high inflammatory response as the TNF-α synthesis is not affected since monocytes are the major source this cytokine in response to soluble T. gondii antigens. IL-10 levels were almost similar in CT/AIDS and OT patients but low when compared with CHR individuals. The deviation to Th2 immune response including the production of anti-inflammatory cytokines, such as IL-10 may promote the parasite's survival causing the tissue immune destruction. IL-10 production in T. gondii-infected brains may support the persistence of parasites as down-regulating the intracerebral immune response. All these indicate that OT and CT

BID is a critical factor controlling cell viability regulated by IFN-α.

PubMed

Tsuno, Takaya; Mejido, Josef; Zhao, Tongmao; Phillips, Terry; Myers, Timothy G; Bekisz, Joseph; Zoon, Kathryn C

2012-01-01

Clinical applications of human interferon (IFN)-α have met with varying degrees of success. Nevertheless, key molecules in cell viability regulated by IFN-α have not been clearly identified. Our previous study indicated that IFN (α, β, and ω) receptor (IFNAR) 1/2- and IFN regulatory factor 9-RNA interference (RNAi) completely restored cell viability after IFN-α treatment in human ovarian adenocarcinoma OVCAR3 cells sensitive to IFN-α. In this study, IFNAR1/2- and IFN regulatory factor 9-RNAi inhibited the gene expression of tumor necrosis factor-related apoptosis-inducing ligand (TRAIL), but not of Fas ligand, after IFN-α treatment. In fact, TRAIL but not Fas ligand inhibited the viability of OVCAR3 cells. IFN-α notably upregulated the levels of TRAIL protein in the supernatant and on the membrane of OVCAR3 cells. After TRAIL signaling, caspase 8 inhibitor and BH3 interacting domain death agonist (BID)-RNAi significantly restored cell viability in response to IFN-α and TRAIL in OVCAR3 cells. Furthermore, BID-RNAi prevented both IFN-α and TRAIL from collapsing the mitochondrial membrane potential (ΔΨm). Finally, we provided important evidence that BID overexpression led to significant inhibition of cell viability after IFN-α or TRAIL treatments in human lung carcinoma A549 cells resistant to IFN-α. Thus, this study suggests that BID is crucial for cell viability regulated by IFN-α which can induce mitochondria-mediated apoptosis, indicating a notable potential to be a targeted therapy for IFN-α resistant tumors.

Enhanced immune response to gastric cancer specific antigen Peptide by coencapsulation with CpG oligodeoxynucleotides in nanoemulsion.

PubMed

Shi, Rui; Hong, Liu; Wu, Daocheng; Ning, Xiaoxuan; Chen, Yu; Lin, Tao; Fan, Daiming; Wu, Kaichun

2005-02-01

CpG oligodeoxynucleotides (CpG ODN) have been shown to have potent adjuvant activity for a wide range of antigens. Of particular interest is their improved activity when closely associated with the antigen. The purpose of this study is to construct a nanovaccine coencapsulated with a gastric cancer specific antigen MG7 mimotope peptide and adjuvant CpG ODN 1645 using new nanotechnology as nanoemulsion and evaluate its immunocompetence. Nanoemulsion vaccine was prepared using magnetic ultrasound methods. BALB/c mice were immunized and the in vivo effectiveness was evaluated using tumor challenge assay. It was shown that the tumor masses formed in the mice immunized with coencapsulated nanovaccine (0.0825 g) markedly smaller (P < 0.01) than those formed in the mice immunized with nanovaccine encapsulated with antigen peptide alone (0.4465 g). A tumor inhibiting rate as high as 82.5% of the coencapsulated nanovaccine was obtained, while nanovaccine encapsulated with peptide only could not achieve the same effect (28.5%) (P < 0.01). Enzyme-linked immunospot assay (ELISPOT) showed that immunization using MG7 mimotope peptide coencapsulated with CpG ODN within the same nanoemulsion enhanced the frequency of splenocytes secreting IFN-gamma significantly (P < 0.01) when compared with immunization using MG7 peptide encapsulated in nanoemulsion alone (197spots/1 x 10(6) vs. 73 spots/1 x 10(6)). Cellular ELISA indicated that serum titer of antibody against MG7-Ag was significantly higher (P < 0.01) in mice immunized with coencapsulation form nanovaccine (0.7884) than that in the group immunized with nanovaccine encapsulated with MG7 peptide alone (0.3616). Using intracellular flow cytometric analysis, it was found that the IFN-gamma response was contributed by CD4+ T-cells. Our experiments suggest that a vaccinal approach using nano-delivery system carrying in tumoral epitope and CpG ODN as adjuvant may have important implications for cancer therapy.

Protective effects of granulocyte colony-stimulating factor on endotoxin shock in mice with retrovirus-induced immunodeficiency syndrome.

PubMed

Toki, S; Hiromatsu, K; Aoki, Y; Makino, M; Yoshikai, Y

1997-10-01

Mice with retrovirus-induced murine acquired immunodeficiency syndrome (MAIDS) were hypersensitive to lipopolysaccharide (LPS)-induced lethal shock accompanied by marked elevations of systematic interleukin 1beta (IL-beta) and interferon gamma (IFN-gamma) after LPS challenge. Pretreatment with 10 microg of recombinant human granulocyte colony-stimulating factor (rhG-CSF) protected MAIDS mice from hypersensitivity to LPS-induced lethal shock and this protection was concomitant with suppression of IFN-gamma production. Copyright 1997 Academic Press Limited.

IFN regulatory factor 1 restricts hepatitis E virus replication by activating STAT1 to induce antiviral IFN-stimulated genes.

PubMed

Xu, Lei; Zhou, Xinying; Wang, Wenshi; Wang, Yijin; Yin, Yuebang; Laan, Luc J W van der; Sprengers, Dave; Metselaar, Herold J; Peppelenbosch, Maikel P; Pan, Qiuwei

2016-10-01

IFN regulatory factor 1 (IRF1) is one of the most important IFN-stimulated genes (ISGs) in cellular antiviral immunity. Although hepatitis E virus (HEV) is a leading cause of acute hepatitis worldwide, how ISGs counteract HEV infection is largely unknown. This study was conducted to investigate the effect of IRF1 on HEV replication. Multiple cell lines were used in 2 models that harbor HEV. In different HEV cell culture systems, IRF1 effectively inhibited HEV replication. IRF1 did not trigger IFN production, and chromatin immunoprecipitation sequencing data analysis revealed that IRF1 bound to the promoter region of signal transducers and activators of transcription 1 (STAT1). Functional assay confirmed that IRF1 could drive the transcription of STAT1, resulting in elevation of total and phosphorylated STAT1 proteins and further activating the transcription of a panel of downstream antiviral ISGs. By pharmacological inhibitors and RNAi-mediated gene-silencing approaches, we revealed that antiviral function of IRF1 is dependent on the JAK-STAT cascade. Furthermore, induction of ISGs and the anti-HEV effect of IRF1 overlapped that of IFNα, but was potentiated by ribavirin. We demonstrated that IRF1 effectively inhibits HEV replication through the activation of the JAK-STAT pathway, and the subsequent transcription of antiviral ISGs, but independent of IFN production.-Xu, L., Zhou, X., Wang, W., Wang, Y., Yin, Y., van der Laan, L. J. W., Sprengers, D., Metselaar, H. J., Peppelenbosch, M. P., Pan, Q. IFN regulatory factor 1 restricts hepatitis E virus replication by activating STAT1 to induce antiviral IFN-stimulated genes. © FASEB.

IFN-λ: A New Inducer of Local Immunity against Cancer and Infections.

PubMed

Lasfar, Ahmed; Zloza, Andrew; de la Torre, Andrew; Cohen-Solal, Karine A

2016-01-01

IFN-λ is the newly established type III IFN with unique immunomodulatory functions. In contrast to the IFN-α/β family and to some extent IFN-γ, IFN-λ is apparently acting in specific areas of the body to activate resident immune cells and induces a local immunity, instrumental in preventing particular infections and also keeping transformed cells under control. Mucosal areas of lung and gastrointestinal tracts are now under scrutiny to elucidate the immune mechanisms triggered by IFN-λ and leading to viral protection. New evidence also indicates the crucial role of IFN-λ in promoting innate immunity in solid cancer models. Based on its unique biological activities among the IFN system, new immunotherapeutic approaches are now emerging for the treatment of cancer, infection, and autoimmune diseases. In the present review, we highlight the recent advances of IFN-λ immunomodulatory functions. We also discuss the perspectives of IFN-λ as a therapeutic agent.

IFN-λ: A New Inducer of Local Immunity against Cancer and Infections

PubMed Central

Lasfar, Ahmed; Zloza, Andrew; de la Torre, Andrew; Cohen-Solal, Karine A.

2016-01-01

IFN-λ is the newly established type III IFN with unique immunomodulatory functions. In contrast to the IFN-α/β family and to some extent IFN-γ, IFN-λ is apparently acting in specific areas of the body to activate resident immune cells and induces a local immunity, instrumental in preventing particular infections and also keeping transformed cells under control. Mucosal areas of lung and gastrointestinal tracts are now under scrutiny to elucidate the immune mechanisms triggered by IFN-λ and leading to viral protection. New evidence also indicates the crucial role of IFN-λ in promoting innate immunity in solid cancer models. Based on its unique biological activities among the IFN system, new immunotherapeutic approaches are now emerging for the treatment of cancer, infection, and autoimmune diseases. In the present review, we highlight the recent advances of IFN-λ immunomodulatory functions. We also discuss the perspectives of IFN-λ as a therapeutic agent. PMID:28018361

Investigating the Role of TNF-α and IFN-γ Activation on the Dynamics of iNOS Gene Expression in LPS Stimulated Macrophages.

PubMed

Salim, Taha; Sershen, Cheryl L; May, Elebeoba E

2016-01-01

Macrophage produced inducible nitric oxide synthase (iNOS) is known to play a critical role in the proinflammatory response against intracellular pathogens by promoting the generation of bactericidal reactive nitrogen species. Robust and timely production of nitric oxide (NO) by iNOS and analogous production of reactive oxygen species are critical components of an effective immune response. In addition to pathogen associated lipopolysaccharides (LPS), iNOS gene expression is dependent on numerous proinflammatory cytokines in the cellular microenvironment of the macrophage, two of which include interferon gamma (IFN-γ) and tumor necrosis factor alpha (TNF-α). To understand the synergistic effect of IFN-γ and TNF-α activation, and LPS stimulation on iNOS expression dynamics and NO production, we developed a systems biology based mathematical model. Using our model, we investigated the impact of pre-infection cytokine exposure, or priming, on the system. We explored the essentiality of IFN-γ priming to the robustness of initial proinflammatory response with respect to the ability of macrophages to produce reactive species needed for pathogen clearance. Results from our theoretical studies indicated that IFN-γ and subsequent activation of IRF1 are essential in consequential production of iNOS upon LPS stimulation. We showed that IFN-γ priming at low concentrations greatly increases the effector response of macrophages against intracellular pathogens. Ultimately the model demonstrated that although TNF-α contributed towards a more rapid response time, measured as time to reach maximum iNOS production, IFN-γ stimulation was significantly more significant in terms of the maximum expression of iNOS and the concentration of NO produced.

sup 60 Co. gamma. -rays induce predominantly C/G to G/C transversions in double-stranded M13 DNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hoebee, B.; Loman, H.; Brouwer, J.

Upon irradiation with gamma rays of an oxygenated aqueous solution of double-stranded M13 DNA, a very specific mutation spectrum was found with respect to both the type and the positions in the DNA sequence. Of the 23 mutations, which were sequenced, 16 represent a C/G to G/C transversion. A C/G to T/A transition was found once and a G/C to T/A transversion twice. The remaining 4 mutations are frameshifts, 2 are identical and formed by the insertion of a G/C basepair; the other 2 mutations are due to a duplication of 10 basepairs situated at different positions but with amore » remarkable homology in base sequence. Fourteen mutations, including the 2 duplications are found in the neighborhood of a TGCT/ACGA sequence.« less

Type I IFN gene delivery suppresses regulatory T cells within tumors.

PubMed

Hashimoto, H; Ueda, R; Narumi, K; Heike, Y; Yoshida, T; Aoki, K

2014-12-01

Type I interferon (IFN) is a pleiotropic cytokine regulating the cancer cell death and immune response. IFN-α can, as we have also reported, effectively induce an antitumor immunity by the activation of tumor-specific T cells and maturation of dendritic cells in various animal models. Unknown, however, is how the type I IFN alters the immunotolerant microenvironment in the tumors. Here, we found that intratumoral IFN-α gene transfer significantly decreased the frequency of regulatory T cells (Tregs) per CD4(+) T cells in tumors. The concentration of a Treg-inhibitory cytokine, interleukin (IL)-6, was correlated with the IFN-α expression level in tumors, and intratumoral CD11c(+) cells produced IL-6 in response to IFN-α stimulation. To confirm the role of IL-6 in the suppression of Tregs in tumors, an anti-IL-6 receptor antibody was administered in IFN-α-treated mice. The antibody increased the frequency of Tregs in the tumors, and attenuated systemic tumor-specific immunity induced by IFN-α. Furthermore, the IFN-α-mediated IL-6 production increased the frequency of Th17 cells in the tumors, which may be one of the mechanisms for the reduction of Tregs. The study demonstrated that IFN-α gene delivery creates an environment strongly supporting the enhancement of antitumor immunity through the suppression of Tregs.

Protective Role of Gamma Interferon during the Recall Response to Influenza Virus

PubMed Central

Bot, Adrian; Bot, Simona; Bona, Constantin A.

1998-01-01

During secondary immune responses to influenza virus, virus-specific T memory cells are a major source of gamma interferon (IFN-γ). We assessed the contribution of IFN-γ to heterologous protection against the A/WSN/33 (H1N1) virus of wild-type and IFN-γ−/− mice previously immunized with the A/HK/68 (H3N2) virus. The IFN-γ−/− mice displayed significantly reduced survival rates subsequent to a challenge with various doses of the A/WSN/33 virus. This was associated with an impaired ability of the IFN-γ−/− mice to completely clear the pulmonary virus by day 7 after the challenge, although significant reduction of the virus titers was noted. However, the IFN-γ−/− mice developed type A influenza virus cross-reactive cytotoxic T lymphocytes (CTLs) similar to the wild-type mice, as demonstrated by both cytotoxicity and a limiting-dilution assay for the estimation of CTL precursor frequency. The pulmonary recruitment of T cells in IFN-γ−/− mice was not dramatically affected, and the percentage of CD4+ and CD8+ T cells was similar to that of wild-type mice. The T cells from IFN-γ−/− mice did not display a significant switch toward a Th2 profile. Furthermore, the IFN-γ−/− mice retained the ability to mount significant titers of WSN and HK virus-specific hemagglutination-inhibiting antibodies. Together, these results are consistent with a protective role of IFN-γ during the heterologous response against influenza virus independently of the generation and local recruitment of cross-reactive CTLs. PMID:9658110

Methylation of CIITA promoter IV causes loss of HLA-II inducibility by IFN-γ in promyelocytic cells

PubMed Central

De Ambrosis, Alessandro; Banelli, Barbara; Pira, Giuseppina Li; Aresu, Ottavia; Romani, Massimo; Ferrini, Silvano; Accolla, Roberto S.

2008-01-01

The human promyelocytic cell line THP-1 expresses high level of HLA class II (HLA-II) molecules after IFN-γ treatment. Here, we report a variant of THP-1 that does not express HLA-II after IFN-γ. The variant's HLA-II phenotype is constant over time in culture and it is not related to a defective IFN-γ-signalling pathway. Transfection of CIITA, the HLA-II transcriptional activator, under the control of a cytomegalovirus promoter rescues high level of HLA-DR surface expression in the variant indicating that the biosynthetic block resides in the expression of CIITA and not in the CIITA-dependent transactivation of the HLA-II promoters. Treatment of the variant with 5-azacytidine (5-aza), which inhibits CpG methylation, restores inducibility of HLA-II by IFN-γ both at transcriptional and phenotypic level and antigen presenting and processing function of the variant. DNA studies demonstrate that the molecular defect of the THP-1 variant originates from the methylation of the CIITA promoter IV. Furthermore, treatment with 5-aza produces a substantial demethylation of CIITA promoter IV and a significant increase of IFN-γ-dependent HLA-II expression in another myelomonocytic cell line, U937. Therefore hyper-methylation of CIITA promoter IV may be a relevant mechanism of epigenetic control preventing HLA-II IFN-γ inducibility in the myelomonocytic cell lineage. PMID:18829986

Double-Stranded RNA Induces Biphasic STAT1 Phosphorylation by both Type I Interferon (IFN)-Dependent and Type I IFN-Independent Pathways

PubMed Central

Dempoya, Junichi; Imaizumi, Tadaatsu; Hayakari, Ryo; Xing, Fei; Yoshida, Hidemi; Okumura, Ken; Satoh, Kei

2012-01-01

Upon viral infection, pattern recognition receptors sense viral nucleic acids, leading to the production of type I interferons (IFNs), which initiate antiviral activities. Type I IFNs bind to their cognate receptor, IFNAR, resulting in the activation of signal-transducing activators of transcription 1 (STAT1). Thus, it has long been thought that double-stranded RNA (dsRNA)-induced STAT1 phosphorylation is mediated by the transactivation of type I IFN signaling. Foreign RNA, such as viral RNA, in cells is sensed by the cytoplasmic sensors retinoic acid-inducible gene I (RIG-I) and melanoma differentiation-associated gene 5 (MDA-5). In this study, we explored the molecular mechanism responsible for STAT1 phosphorylation in response to the sensing of dsRNA by cytosolic RNA sensors. Polyinosinic-poly(C) [poly(I:C)], a synthetic dsRNA that is sensed by both RIG-I and MDA-5, induces STAT1 phosphorylation. We found that the poly(I:C)-induced initial phosphorylation of STAT1 is dependent on the RIG-I pathway and that MDA-5 is not involved in STAT1 phosphorylation. Furthermore, pretreatment of the cells with neutralizing antibody targeting the IFN receptor suppressed the initial STAT1 phosphorylation in response to poly(I:C), suggesting that this initial phosphorylation event is predominantly type I IFN dependent. In contrast, neither the known RIG-I pathway nor type I IFN is involved in the late phosphorylation of STAT1. In addition, poly(I:C) stimulated STAT1 phosphorylation in type I IFN receptor-deficient U5A cells with delayed kinetics. Collectively, our study provides evidence of a comprehensive regulatory mechanism in which dsRNA induces STAT1 phosphorylation, indicating the importance of STAT1 in maintaining very tight regulation of the innate immune system. PMID:22973045

Pre-immune state induced by chicken interferon gamma inhibits the replication of H1N1 human and H9N2 avian influenza viruses in chicken embryo fibroblasts.

PubMed

Yuk, Seong-Su; Lee, Dong-Hun; Park, Jae-Keun; Tseren-Ochir, Erdene-Ochir; Kwon, Jung-Hoon; Noh, Jin-Yong; Lee, Joong-Bok; Park, Seung-Yong; Choi, In-Soo; Song, Chang-Seon

2016-04-27

Interferon gamma (IFN-γ), an immunoregulatory cytokine, is known to control many microbial infections. In a previous study, chicken interferon gamma (chIFN-γ) was found to be up-regulated following avian influenza virus (AIV) infection in specific pathogen-free chickens. We aimed to investigate whether the pre-immune state induced by chIFN-γ could generate an antiviral response against influenza virus. We generated a chIFN-γ-expressing plasmid and transfected it into chicken embryo fibroblasts (CEFs) and then infected the cells with human origin H1N1 or avian origin H9N2 influenza viruses. Viral titers of culture medium were evaluated in MDCK cell and the viral RNA and IFN-stimulated genes (ISGs) were then quantified by real-time reverse transcriptase polymerase. To further evaluate the role of the antiviral effect of chIFN-γ by using a backward approach, synthetic small interfering RNAs (siRNA) targeting chIFN-γ were used to suppress chIFN-γ. The chIFN-γ-stimulated CEFs inhibited the replication of viral RNA (vRNA) and showed a mild decrease in the infectious virus load released in the culture medium. Compared to the mock-transfected control, the messenger RNA (mRNA) levels of type I IFNs and IFN-stimulated genes were up-regulated in the cells expressing chIFN-γ. After treatment with the siRNA, we detected a higher expression of viral genes than that observed in the mock-transfected control. Our results suggest that apart from the important role played by chIFN-γ in the antiviral state generated against influenza virus infection, the pre-immune state induced by chIFN-γ can be helpful in mitigating the propagation of influenza virus.

IFN-λ suppresses intestinal inflammation by non-translational regulation of neutrophil function.

PubMed

Broggi, Achille; Tan, Yunhao; Granucci, Francesca; Zanoni, Ivan

2017-10-01

Interferon-λ (IFN-λ) is a central regulator of mucosal immunity; however, its signaling specificity relative to that of type I interferons is poorly defined. IFN-λ can induce antiviral interferon-stimulated genes (ISGs) in epithelia, while the effect of IFN-λ in non-epithelial cells remains unclear. Here we report that neutrophils responded to IFN-λ. We found that in addition to inducing ISG transcription, IFN-λ (but not IFN-β) specifically activated a translation-independent signaling pathway that diminished the production of reactive oxygen species and degranulation in neutrophils. In mice, IFN-λ was elicited by enteric viruses and acted on neutrophils to decrease oxidative stress and intestinal damage. Thus, IFN-λ acted as a unique immunomodulatory agent by modifying transcriptional and non-translational neutrophil responses, which might permit a controlled development of the inflammatory process.

Immune Cell Profiling of IFN-λ Response Shows pDCs Express Highest Level of IFN-λR1 and Are Directly Responsive via the JAK-STAT Pathway.

PubMed

Kelly, Aoife; Robinson, Mark W; Roche, Gerard; Biron, Christine A; O'Farrelly, Cliona; Ryan, Elizabeth J

2016-12-01

The interferon lambda (IFN-λ) cytokines have well-known antiviral properties, yet their contribution to immune regulation is not well understood. Epithelial cells represent the major target cell of IFN-λ; peripheral blood mononuclear cells are generally considered nonresponsive, with the exception of plasmacytoid dendritic cells (pDCs). In this study we aimed to define the potential for discrete subpopulations of cells to directly respond to IFN-λ. Analysis of peripheral blood leukocytes reveals that, while pDCs uniformly express the highest levels of IFN-λ receptor, a small proportion of B cells and monocytes also express the receptor. Nevertheless, B cells and monocytes respond poorly to IFN-λ stimulation in vitro, with minimal STAT phosphorylation and interferon-stimulated gene (ISG) induction observed. We confirm that pDCs respond to IFN-λ in vitro, upregulating their expression of pSTAT1, pSTAT3, and pSTAT5. However, we found that pDCs do not upregulate pSTAT6 in response to IFN-λ treatment. Our results highlight unique aspects of the response to IFN-λ and confirm that while the IFN-λ receptor is expressed by a small proportion of several different circulating immune cell lineages, under normal conditions only pDCs respond to IFN-λ stimulation with robust STAT phosphorylation and ISG induction. The difference in STAT6 responsiveness of pDCs to type I and type III interferons may help explain the divergence in their biological activities.

Modulation of the humoral and cellular immune response in Abeta immunotherapy by the adjuvants monophosphoryl lipid A (MPL), cholera toxin B subunit (CTB) and E. coli enterotoxin LT(R192G).

PubMed

Maier, Marcel; Seabrook, Timothy J; Lemere, Cynthia A

2005-10-25

Abeta vaccination or passive transfer of human-specific anti-Abeta antibodies are approaches under investigation to prevent and/or treat Alzheimer's disease (AD). Successful active Abeta vaccination requires a strong and safe adjuvant to induce anti-Abeta antibody formation. We compared the adjuvants monophosphoryl lipid A (MPL)/trehalose dicorynomycolate (TDM), cholera toxin B subunit (CTB) and Escherichia coli heat-labile enterotoxin LT(R192G) for their ability to induce a humoral and cellular immune reaction, using fibrillar Abeta1-40/42 as a common immunogen in wildtype B6D2F1 mice. Subcutaneous (s.c.) administration with MPL/TDM resulted in anti-Abeta antibodies levels up to four times higher compared to s.c. LT(R192G). Using MPL/TDM, the anti-Abeta antibodies induced were mainly IgG2b, IgG1 and lower levels of IgG2a and IgM, with a moderate splenocyte proliferation and IFN-gamma production in vitro upon stimulation with Abeta1-40/42. LT(R192G), previously shown by us to induce robust titers of anti-Abeta antibodies, generated predominantly IgG2b and IgG1 anti-Abeta antibodies with very low splenocyte proliferation and IFN-gamma production. Weekly intranasal (i.n.) administration over 11 weeks of Abeta40/42 with CTB induced only moderate levels of antibodies. All immunogens generated antibodies that recognized mainly the Abeta1-7 epitope and specifically detected amyloid plaques on AD brain sections. In conclusion, MPL/TDM, in addition to LT(R192G), is an effective adjuvant when combined with Abeta40/42 and may aid in the design of Abeta immunotherapy.

A phase II trial on alpha-interferon (alpha IFN) effect in patients with monoclonal IgM gammopathy.

PubMed

Rotoli, B; De Renzo, A; Frigeri, F; Buffardi, S; Marcenò, R; Cavallaro, A M; Ruggeri, P; Liso, V; Musto, P; Andriani, A

1994-05-01

Waldenström's macroglobulinemia (WM) is an incurable disorder of B cells. Following occasional reports of response to alpha interferon (IFN) and in view of its effectiveness in hairy cell leukemia, we tested this agent in a relatively large group (n = 88) of patients who had an IgM monoclonal component (MC) greater than 10 g/l. Thirty eight patients had a MC > 30 g/l and were classified as Waldenström's macroglobulinemia (WM), while fifty had either WM in an early stage or an IgM monoclonal gammopathy of undeterminated significance (all of them operationally classified as IgM-MGUS). All patients received IFN 3 MU/day for one month and then 3 times/week. Response to treatment was mainly based on MC reduction in two consecutive determinations (> 50%: major response; 25-50%: minor response). Of 36 evaluable WM patients, 12 had a major and 6 a minor response; of 41 evaluable IgM-MGUS patients, 2 had a major and 6 a minor response. In WM patients with a major response, MC reduction was associated with disappearance of hyperviscosity symptoms, raised Hb level and reduced bone marrow lymphoplasmacytosis. At the dose used, tolerance was excellent in the majority of patients; only 15% withdrew from the study due to side effects. Although single cases and very small series have already been reported, no large study collecting quantitative data on the effects of alpha IFN in WM has been published so far. Our results suggest that IFN treatment is not indicated for patients with a low monoclonal component, while it is of clinical benefit in about 50% of patients with IgM > 30 g/l.

Pharmacokinetic and pharmacodynamic characterization of a new formulation containing synergistic proportions of interferons alpha-2b and gamma (HeberPAG®) in patients with mycosis fungoides: an open-label trial

PubMed Central

2012-01-01

Background The synergistic combination of interferon (IFN) alpha-2b and IFN gamma results in more potent in vitro biological effects mediated by both IFNs. The aim of this investigation was to evaluate by first time the pharmacokinetics and pharmacodynamics of this combination in patients with mycosis fungoides. Methods An exploratory, prospective, open-label clinical trial was conducted. Twelve patients, both genders, 18 to 75 years-old, with mycosis fungoides at stages IB to III, were eligible for the study. All of them received intramuscularly a single high dose (23 × 106 IU) of a novel synergistic IFN mixture (HeberPAG®) for pharmacokinetic and pharmacodynamic studies. Serum IFN alpha-2b and IFN gamma concentrations were measured during 96 hours by commercial enzyme immunoassays (EIA) specific for each IFN. Other blood IFN-inducible markers and laboratory variables were used as pharmacodynamics and safety criteria. Results The pharmacokinetic evaluation by EIA yielded a similar pattern for both IFNs that are also in agreement with the well-known described profiles for these molecules when these are administered separately. The average values for main parameters were: Cmax: 263 and 9.3 pg/mL; Tmax: 9.5 and 6.9 h; AUC: 4483 and 87.5 pg.h/mL, half-life (t1/2): 4.9 and 13.4 h; mean residence time (MRT): 13.9 and 13.5 h, for serum IFN alpha-2b and IFN gamma, respectively. The pharmacodynamic variables were strongly stimulated by simultaneous administration of both IFNs: serum neopterin and beta-2 microglobulin levels (β2M), and stimulation of 2’-5’ oligoadenylate synthetase (OAS1) mRNA expression. The most encouraging data was the high increment of serum neopterin, 8.0 ng/mL at 48 h, not been described before for any unmodified or pegylated IFN. Additionally, β2M concentration doubled the pre-dose value at 24–48 hours. For both variables the values remained clearly upper baseline levels at 96 hours. Conclusions HeberPAG®possesses improved

Delayed translational silencing of ceruloplasmin transcript in gamma interferon-activated U937 monocytic cells: role of the 3' untranslated region

NASA Technical Reports Server (NTRS)

Mazumder, B.; Fox, P. L.

1999-01-01

Ceruloplasmin (Cp) is an acute-phase protein with ferroxidase, amine oxidase, and pro- and antioxidant activities. The primary site of Cp synthesis in human adults is the liver, but it is also synthesized by cells of monocytic origin. We have shown that gamma interferon (IFN-gamma) induces the synthesis of Cp mRNA and protein in monocytic cells. We now report that the induced synthesis of Cp is terminated by a mechanism involving transcript-specific translational repression. Cp protein synthesis in U937 cells ceased after 16 h even in the presence of abundant Cp mRNA. RNA isolated from cells treated with IFN-gamma for 24 h exhibited a high in vitro translation rate, suggesting that the transcript was not defective. Ribosomal association of Cp mRNA was examined by sucrose centrifugation. When Cp synthesis was high, i.e., after 8 h of IFN-gamma treatment, Cp mRNA was primarily associated with polyribosomes. However, after 24 h, when Cp synthesis was low, Cp mRNA was primarily in the nonpolyribosomal fraction. Cytosolic extracts from cells treated with IFN-gamma for 24 h, but not for 8 h, contained a factor which blocked in vitro Cp translation. Inhibitor expression was cell type specific and present in extracts of human cells of myeloid origin, but not in several nonmyeloid cells. The inhibitory factor bound to the 3' untranslated region (3'-UTR) of Cp mRNA, as shown by restoration of in vitro translation by synthetic 3'-UTR added as a "decoy" and detection of a binding complex by RNA gel shift analysis. Deletion mapping of the Cp 3'-UTR indicated an internal 100-nucleotide region of the Cp 3'-UTR that was required for complex formation as well as for silencing of translation. Although transcript-specific translational control is common during development and differentiation and global translational control occurs during responses to cytokines and stress, to our knowledge, this is the first report of translational silencing of a specific transcript following cytokine

New Identification of the Mixed-Morphology Supernova Remnant G298.6-0.0 with Possible Gamma-Ray Association

NASA Technical Reports Server (NTRS)

Bamba, Aya; Sawada, Makoto; Nakano, Yuto; Terada, Yukikatsu; Hewitt, John; Petre, Robert; Angelini, Lorella

2015-01-01

We present an X-ray analysis on the Galactic supernova remnant (SNR) G298.6-0.0 observed with Suzaku. The X-ray image shows a center-filled structure inside a radio shell, implying that this SNR can be categorized as a mixed-morphology (MM) SNR. The spectrum is well reproduced by a single-temperature plasma model in ionization equilibrium, with a temperature of 0.78 (0.70-0.87) keV. The total plasma mass of 30M indicates that the plasma has an interstellar medium origin. The association with a GeV gamma-ray source, 3FGL J1214.0-6236, on the shell of the SNR is discussed, in comparison with other MMSNRs with GeV gamma-ray associations. It is found that the flux ratio between absorption-corrected thermal X-rays and GeV gamma-rays decreases as the physical size of MMSNRs becomes larger. The absorption-corrected thermal X-ray flux of G298.6-0.0 and the GeV gamma-ray flux of 3FGL J1214.0-6236 closely follow this trend, implying that 3FGL J1214.0-6236 is likely to be a GeV counterpart of G298.6-0.0.

Reduction of cell viability induced by IFN-alpha generates impaired data on antiviral assay using Hep-2C cells.

PubMed

de Oliveira, Edson R A; Lima, Bruna M M P; de Moura, Wlamir C; Nogueira, Ana Cristina M de A

2013-12-31

Type I interferons (IFNs) exert an array of important biological functions on the innate immune response and has become a useful tool in the treatment of various diseases. An increasing demand in the usage of recombinant IFNs, mainly due to the treatment of chronic hepatitis C infection, augmented the need of quality control for this biopharmaceutical. A traditional bioassay for IFN potency assessment is the cytopathic effect reduction antiviral assay where a given cell line is preserved by IFN from a lytic virus activity using the cell viability as a frequent measure of end point. However, type I IFNs induce other biological effects such as cell-cycle arrest and apoptosis that can influence directly on viability of many cell lines. Here, we standardized a cytopathic effect reduction antiviral assay using Hep-2C cell/mengovirus combination and studied a possible impact of cell viability variations caused by IFN-alpha 2b on responses generated on the antiviral assay. Using the four-parameter logistic model, we observed less correlation and less linearity on antiviral assay when responses from IFN-alpha 2b 1000 IU/ml were considered in the analysis. Cell viability tests with MTT revealed a clear cell growth inhibition of Hep-2C cells under stimulation with IFN-alpha 2b. Flow cytometric cell-cycle analysis and apoptosis assessment showed an increase of S+G2 phase and higher levels of apoptotic cells after treatment with IFN-alpha 2b 1000 IU/ml under our standardized antiviral assay procedure. Considering our studied dose range, we also observed strong STAT1 activation on Hep-2C cells after stimulation with the higher doses of IFN-alpha 2b. Our findings showed that the reduction of cell viability driven by IFN-alpha can cause a negative impact on antiviral assays. We assume that the cell death induction and the cell growth inhibition effect of IFNs should also be considered while employing antiviral assay protocols in a quality control routine and emphasizes the

Quantitative differences in the immunomodulatory effects of Rebif and Avonex in IFN-β 1a treated multiple sclerosis patients

PubMed Central

Christophi, George P.; Christophi, Jennifer A.; Gruber, Ross C.; Mihai, Cornelia; Mejico, Luis J.; Massa, Paul T.; Jubelt, Burk

2012-01-01

Interferon-β (IFN-β) is a current effective treatment for multiple sclerosis (MS) and exerts its therapeutic effects by down-modulating the systemic immune response and cytokine signaling. In clinical practice there are several formulations of interferon including a low dose of IFN-β 1a formulation of 30μg IM once weekly (Avonex) and a high dose formulation of 44 μg SC three times weekly (Rebif). Recent studies suggest that Rebif is more efficacious compared to Avonex in preventing relapses and decreasing MRI activity in relapsing remitting MS (RRMS) patients. This study examines whether there are quantitative gene expression changes in interferon-treated RRMS patients that can explain the difference in efficacy and side effects between Rebif and Avonex. Herein, RRMS patients were treated for three months with IFN-β 1a and the levels of plasma cytokines and gene expression in peripheral blood mononuclear cells were examined. Thirty-two normal subjects were compared to thirty-two RRMS patients, of which ten were treated with Rebif and ten with Avonex. Rebif and Avonex both significantly and equally suppressed plasma TNF-α and IL-6 levels. Rebif suppressed IL-13 significantly more than Avonex. Rebif also significantly suppressed the levels of the chemokines CCL17 and RANTES, the protease ADAM8, and COX-2 at a higher degree compared to Avonex. The STAT1-inducible genes IP-10 and caspase 1 were significantly increased with Rebif compared to Avonex. In conclusion, the higher dosed, more frequently administered IFN-β 1a Rebif when compared to IFN β-1a Avonex has more potent immunomodulatory effects. These quantitative results might relate to efficacy and side-effect profile of the two IFN-β 1a formulations and provide prospective practical clinical tools to monitor treatment and adjust dosage. PMID:21658727

Effects of positive results for Mycobacterium avium subsp paratuberculosis as determined by microbial culture of feces or antibody ELISA on results of caudal fold tuberculin test and interferon-gamma assay for tuberculosis in cattle.

PubMed

Dunn, John R; Kaneene, John B; Grooms, Daniel L; Bolin, Steven R; Bolin, Carole A; Bruning-Fann, Colleen S

2005-02-01

To determine whether cattle testing positive for Mycobacterium avium subsp paratuberculosis as determined by microbial culture of feces or antibody ELISA were more likely to have false-positive responses on the caudal fold tuberculin (CFT) test or interferon-gamma (IFN-gamma) assay for Mycobacterium bovis than cattle testing negative for M paratuberculosis. 1043 cattle from 10 herds in Michigan. Feces and blood samples for plasma were collected from cattle > or =24 months old on the day the CFT test was read. Fecal samples were submitted for microbial culture for M paratuberculosis. Plasma samples were tested for antibody against M paratuberculosis, and IFN-gamma after stimulation with purified protein derivative tuberculin from M bovis or M avium. Of 1043 cattle, 180 (17.3%) had positive CFT test results (suspects) and 8 (0.8%) had positive IFN-gamma assay results after stimulation with purified protein derivative tuberculin from M bovis. Forty-five (4.3%) and 115 (11.0%) cattle tested positive for M paratuberculosis as determined by microbial culture of feces and antibody ELISA, respectively. Cattle with positive responses for M paratuberculosis appeared to have an increased likelihood of false-positive results on the CFT test, although this association was not significant. No significant association was detected among cattle testing positive for M paratuberculosis as determined by microbial culture of feces and antibody ELISA and positive CFT test and IFN-gamma assay results for M bovis.

Asymptomatic Borrelia-seropositive individuals display the same incidence of Borrelia-specific interferon-gamma (IFN-γ)-secreting cells in blood as patients with clinical Borrelia infection

PubMed Central

Ekerfelt, C; Forsberg, P; Svenvik, M; Roberg, M; Bergström, S; Ernerudh, J

1999-01-01

Lyme disease is a complex disorder that sometimes becomes chronic. There are contradictory reports of experimental Borrelia infections regarding which type of T cell cytokine responses, i.e. Th1 or Th2, are needed to eradicate the Borrelia spirochaetes. In human borreliosis a predominance of Borrelia-specific Th1-like responses has been shown. In this study, spontaneous, as well as Borrelia-specific, secretion of IFN-γ (Th1) and IL-4 (Th2) in Borrelia-seropositive healthy asymptomatic individuals (n = 17) was investigated in peripheral blood by a sensitive ELISPOT assay, and compared with previously reported responses in patients with clinical Borrelia infection (n = 25). The seropositive asymptomatic individuals displayed the same predominance of Borrelia-specific IFN-γ-secreting cells as the patients with clinical Borrelia infection. Interestingly, the proportion of spontaneously IL-4-secreting cells, reflecting the unstimulated in vivo secretion, was lower in the seropositive asymptomatic individuals compared with patients with chronic Borrelia infections (n = 13, P = 0.02), whereas no such difference was found compared with subacute Borrelia infections (n = 12). These findings indicate that IFN-γ secretion alone is not sufficient to eliminate Borrelia spirochaetes in humans, although IFN-γ may still have a beneficial role in borreliosis acting in concert with other mechanisms. PMID:10193424

Different modulation by histamine of IL-4 and interferon-gamma (IFN-γ) release according to the phenotype of human Th0, Th1 and Th2 clones

PubMed Central

LAGIER, B; LEBEL, B; BOUSQUET, J; PÈNE, J

1997-01-01

Histamine, an important inflammatory mediator in allergic diseases and asthma, has been reported to have modulator effects on T cells, suggesting that the bronchial microenvironment may regulate the function of resident T cells. We examined the effect of histamine on the release of the Th2-associated cytokines IL-4 and IL-5 and the Th1-associated cytokine IFN-γ by 30 CD4+ T cell clones from peripheral blood or bronchial biopsy of one atopic subject. Based on the IL-4/IFN-γ ratio, the clones were ascribed to the Th2 (ratio >1), Th0 (ratio ⩾ 0.1 and ⩽1) or Th1 (ratio <0.1) phenotype. Histamine inhibited IFN-γ production by Th1-like cells (P<0.02, Kruskall–Wallis), especially from bronchial biopsy, but had no effect on IL-4 release. Regarding Th0 clones, histamine inhibited IL-4 production (P<0.02) in a dose-dependent manner and slightly inhibited IFN-γ production, but had no effect on Th2-like cells. Histamine had a heterogeneous and insignificant effect on IL-5 production. The H2-receptor antagonist ranitidine completely reversed the inhibition of IL-4 and IFN-γ production, whereas the agonist dimaprit mimicked this effect. In contrast, H1- and H3-receptor agonists and antagonists had no significant effect. These data demonstrate that histamine has different effects on IL-4 and IFN-γ release by T helper cells according to their phenotype via H2-receptors. This study extends the immunomodulatory effects of histamine which may contribute to the perpetuation of airway inflammation in asthma. PMID:9182905

Autophagy Facilitates IFN-γ-induced Jak2-STAT1 Activation and Cellular Inflammation*

PubMed Central

Chang, Yu-Ping; Tsai, Cheng-Chieh; Huang, Wei-Ching; Wang, Chi-Yun; Chen, Chia-Ling; Lin, Yee-Shin; Kai, Jui-In; Hsieh, Chia-Yuan; Cheng, Yi-Lin; Choi, Pui-Ching; Chen, Shun-Hua; Chang, Shih-Ping; Liu, Hsiao-Sheng; Lin, Chiou-Feng

2010-01-01

Autophagy is regulated for IFN-γ-mediated antimicrobial efficacy; however, its molecular effects for IFN-γ signaling are largely unknown. Here, we show that autophagy facilitates IFN-γ-activated Jak2-STAT1. IFN-γ induces autophagy in wild-type but not in autophagy protein 5 (Atg5−/−)-deficient mouse embryonic fibroblasts (MEFs), and, autophagy-dependently, IFN-γ induces IFN regulatory factor 1 and cellular inflammatory responses. Pharmacologically inhibiting autophagy using 3-methyladenine, a known inhibitor of class III phosphatidylinositol 3-kinase, confirms these effects. Either Atg5−/− or Atg7−/− MEFs are, independent of changes in IFN-γ receptor expression, resistant to IFN-γ-activated Jak2-STAT1, which suggests that autophagy is important for IFN-γ signal transduction. Lentivirus-based short hairpin RNA for Atg5 knockdown confirmed the importance of autophagy for IFN-γ-activated STAT1. Without autophagy, reactive oxygen species increase and cause SHP2 (Src homology-2 domain-containing phosphatase 2)-regulated STAT1 inactivation. Inhibiting SHP2 reversed both cellular inflammation and the IFN-γ-induced activation of STAT1 in Atg5−/− MEFs. Our study provides evidence that there is a link between autophagy and both IFN-γ signaling and cellular inflammation and that autophagy, because it inhibits the expression of reactive oxygen species and SHP2, is pivotal for Jak2-STAT1 activation. PMID:20592027

SOCS1 and SOCS3 Are Targeted by Hepatitis C Virus Core/gC1qR Ligation To Inhibit T-Cell Function

PubMed Central

Yao, Zhi Qiang; Waggoner, Stephen N.; Cruise, Michael W.; Hall, Caroline; Xie, Xuefang; Oldach, David W.; Hahn, Young S.

2005-01-01

T cells play an important role in the control of hepatitis C virus (HCV) infection. We have previously demonstrated that the HCV core inhibits T-cell responses through interaction with gC1qR. We show here that core proteins from chronic and resolved HCV patients differ in sequence, gC1qR-binding ability, and T-cell inhibition. Specifically, chronic core isolates bind to gC1qR more efficiently and inhibit T-cell proliferation as well as gamma interferon (IFN-γ) production more profoundly than resolved core isolates. This inhibition is mediated by the disruption of STAT phosphorylation through the induction of SOCS molecules. Silencing either SOCS1 or SOCS3 by small interfering RNA dramatically augments the production of IFN-γ in T cells, thereby abrogating the inhibitory effect of core. Additionally, the ability of core proteins from patients with chronic infections to induce SOCS proteins and suppress STAT activation greatly exceeds that of core proteins from patients with resolved infections. These results suggest that the HCV core/gC1qR-induced T-cell dysfunction involves the induction of SOCS, a powerful inhibitor of cytokine signaling, which represents a novel mechanism by which a virus usurps the host machinery for persistence. PMID:16306613

Unique nonstructural proteins of Pneumonia Virus of Mice (PVM) promote degradation of interferon (IFN) pathway components and IFN-stimulated gene proteins.

PubMed

Dhar, Jayeeta; Barik, Sailen

2016-12-01

Pneumonia Virus of Mice (PVM) is the only virus that shares the Pneumovirus genus of the Paramyxoviridae family with Respiratory Syncytial Virus (RSV). A deadly mouse pathogen, PVM has the potential to serve as a robust animal model of RSV infection, since human RSV does not fully replicate the human pathology in mice. Like RSV, PVM also encodes two nonstructural proteins that have been implicated to suppress the IFN pathway, but surprisingly, they exhibit no sequence similarity with their RSV equivalents. The molecular mechanism of PVM NS function, therefore, remains unknown. Here, we show that recombinant PVM NS proteins degrade the mouse counterparts of the IFN pathway components. Proteasomal degradation appears to be mediated by ubiquitination promoted by PVM NS proteins. Interestingly, NS proteins of PVM lowered the levels of several ISG (IFN-stimulated gene) proteins as well. These results provide a molecular foundation for the mechanisms by which PVM efficiently subverts the IFN response of the murine cell. They also reveal that in spite of their high sequence dissimilarity, the two pneumoviral NS proteins are functionally and mechanistically similar.

The antihypertension drug doxazosin suppresses JAK/STATs phosphorylation and enhances the effects of IFN-α/γ-induced apoptosis.

PubMed

Park, Mi Sun; Kim, Boh-Ram; Kang, Sokbom; Kim, Dae-Yong; Rho, Seung Bae

2014-11-01

Doxazosin, a commonly prescribed treatment for patients with benign prostatic hyperplasia, serves as an α1-blocker of the adrenergic receptors. In this study, we calculated its effect on the ovarian carcinoma cells. Doxazosin induces dose-dependent growth suppression and is additively activated through IFN-α or IFN-γ stimulation. They both enhanced G1 phase arrest, as well as the activity of caspase-3, and the reduction of cyclin D1 and CDK4 protein levels. Doxazosin growth suppression was abolished either by the Janus family of tyrosine kinase (JAK) or the signal transducer and activator of transcription (STAT) inhibitor treatment. The activity of JAK/STAT was dependent on the level of doxazosin, suggesting a requirement of doxazosin for the activation of JAK/STAT. Furthermore, doxazosin plus IFN-α or doxazosin plus IFN-γ additively suppressed the activation of the JAK/STAT signals through phosphorylation of JAK and STAT, thus affecting the activation of subsequent downstream signaling components PI3K, mTOR, 70S6K, and PKCδ. In vivo study demonstrated that doxazosin significantly suppressed tumor growth in an ovarian cancer cell xenograft mouse model, inducing apoptotic cell death by up-regulating the expression of p53, whereas c-Myc expression was markedly reduced. Our data indicate that doxazosin can modulate the apoptotic effects of IFN-α- and IFN-γ through the JAK/STAT signaling pathways. Collectively, we indicate that this action may be a potent chemotherapeutic property against ovarian carcinoma.

Inhibition of IFN-γ-dependent antiviral airway epithelial defense by cigarette smoke

PubMed Central

2010-01-01

Background Although individuals exposed to cigarette smoke are more susceptible to respiratory infection, the effects of cigarette smoke on lung defense are incompletely understood. Because airway epithelial cell responses to type II interferon (IFN) are critical in regulation of defense against many respiratory viral infections, we hypothesized that cigarette smoke has inhibitory effects on IFN-γ-dependent antiviral mechanisms in epithelial cells in the airway. Methods Primary human tracheobronchial epithelial cells were first treated with cigarette smoke extract (CSE) followed by exposure to both CSE and IFN-γ. Epithelial cell cytotoxicity and IFN-γ-induced signaling, gene expression, and antiviral effects against respiratory syncytial virus (RSV) were tested without and with CSE exposure. Results CSE inhibited IFN-γ-dependent gene expression in airway epithelial cells, and these effects were not due to cell loss or cytotoxicity. CSE markedly inhibited IFN-γ-induced Stat1 phosphorylation, indicating that CSE altered type II interferon signal transduction and providing a mechanism for CSE effects. A period of CSE exposure combined with an interval of epithelial cell exposure to both CSE and IFN-γ was required to inhibit IFN-γ-induced cell signaling. CSE also decreased the inhibitory effect of IFN-γ on RSV mRNA and protein expression, confirming effects on viral infection. CSE effects on IFN-γ-induced Stat1 activation, antiviral protein expression, and inhibition of RSV infection were decreased by glutathione augmentation of epithelial cells using N-acetylcysteine or glutathione monoethyl ester, providing one strategy to alter cigarette smoke effects. Conclusions The results indicate that CSE inhibits the antiviral effects of IFN-γ, thereby presenting one explanation for increased susceptibility to respiratory viral infection in individuals exposed to cigarette smoke. PMID:20504369

Interferon-gamma response to the treatment of active pulmonary and extra-pulmonary tuberculosis.

PubMed

Liang, L; Shi, R; Liu, X; Yuan, X; Zheng, S; Zhang, G; Wang, W; Wang, J; England, K; Via, L E; Cai, Y; Goldfeder, L C; Dodd, L E; Barry, C E; Chen, R Y

2017-10-01

Interferon-gamma (IFN-γ) release assays (IGRAs) are used to diagnose tuberculosis (TB) but not to measure treatment response. To measure IFN-γ response to active anti-tuberculosis treatment. Patients from the Henan Provincial Chest Hospital, Henan, China, with TB symptoms and/or signs were enrolled into this prospective, observational cohort study and followed for 6 months of treatment, with blood and sputum samples collected at 0, 2, 4, 6, 8, 16 and 24 weeks. The QuantiFERON® TB-Gold assay was run on collected blood samples. Participants received a follow-up telephone call at 24 months to determine relapse status. Of the 152 TB patients enrolled, 135 were eligible for this analysis: 118 pulmonary (PTB) and 17 extra-pulmonary TB (EPTB) patients. IFN-γ levels declined significantly over time among all patients (P = 0.002), with this decline driven by PTB patients (P = 0.001), largely during the initial 8 weeks of treatment (P = 0.019). IFN-γ levels did not change among EPTB patients over time or against baseline culture or drug resistance status. After 6 months of effective anti-tuberculosis treatment, IFN-γ levels decreased significantly in PTB patients, largely over the initial 8 weeks of treatment. IFN-γ concentrations may offer some value for monitoring anti-tuberculosis treatment response among PTB patients.

MODELING THE MULTIWAVELENGTH EMISSION FROM G73.9+0.9: GAMMA RAYS FROM AN SNR–MC INTERACTION

DOE Office of Scientific and Technical Information (OSTI.GOV)

Araya, Miguel, E-mail: miguel.araya@ucr.ac.cr

G73.9+0.9 has been classified as a probable shell-type supernova remnant, though it has also been suggested that it could have a pulsar wind nebula (PWN). Here, a broadband model of the non-thermal emission of G73.9+0.9 from radio to gamma rays is presented. The model includes a new gamma-ray observation obtained by the analysis of seven years of data from the Fermi/LAT telescope. Above 200 MeV, the source is detected with a significance of 13σ and the spectrum of the radiation is best described by a power law with an index of ∼2.5. The leptonic mechanisms are hard to reconcile withmore » the measured radio and gamma-ray spectral energy distribution. A PWN origin for the high-energy emission is also not very likely, due to the lack of detection of pulsars and of X-ray emission in the region, as well as from the shape of the gamma-ray spectrum. Given the possibility that the object is interacting with molecular clouds, a hadronic origin of the high-energy emission is more likely, and the spectral properties of the cosmic rays responsible for this radiation are derived.« less

Performance and Value of IFN-Lambda3 and IFN-Lambda4 Genotyping in Patients with Chronic Hepatitis C (CHC) Genotype 2/3 in a Real World Setting

PubMed Central

Susser, Simone; Rogalska-Taranta, Magdalena; Petersen, Jörg; Böker, Klaus H. W.; Grigorian, Natalia; Link, Ralph; Naumann, Uwe; John, Christine; Lueth, Stefan; Malfertheiner, Peter; Manns, Michael P.; Wedemeyer, Heiner; Sarrazin, Christoph; Cornberg, Markus

2015-01-01

Background SNPs near the interferon lambda (IFNL) 3 gene are predictors for sustained virological response (SVR) in patients with chronic hepatitis C genotype (GT) 1. In addition, a dinucleotide frame shift in ss469415590 was described, which generates IFNL4. In this study, we compared the role of IFNL4 variants with IFNL3-(rs12979860) and IFNL3-(rs8099917) on response to pegylated (PEG)-IFN and Ribavirin (RBV) in patients with chronic hepatitis C GT2/3. Methods We recruited 1006 patients with chronic hepatitis C and GT2/3 in a large German registry. A treatment with PEG-IFN and Ribavirin was started by 959 patients. We performed genotyping of IFNL3 (rs12979860, n = 726; rs8099917, n = 687) and of IFNL4 (ss469415590; n = 631). Results Both preferable IFNL3 genotypes were associated with RVR (both p<0.0001) rather than with SVR (rs12979860: p = 0.251; rs8099917: p = 0.447). Only RVR was linked to SVR in univariate and multivariate analyzes (both p<0.001). Concordance of genotyping in patients with available serum samples and EDTA blood samples (n = 259) was more than 96% for both IFNL3 SNPs. IFNL3-(rs12979860) correlated with IFNL4: 99.2% of patients with IFNL3-(rs12979860)-CC were IFNL4-(ss469415590)-TT/TT. IFNL3-(rs12979860)-CT was linked with IFNL4-(ss469415590)-TT/ΔG (98.0%) and IFNL3-(rs12979860)-TT was associated with IFNL4-(ss469415590)-ΔG/ΔG (97.6%). Conclusion IFNL3 genotyping from serum was highly efficient and can be used as an alternative if EDTA whole blood is not available. In Caucasian GT2/3 patients genotyping for INFL4-(ss469415590) does not lead to additional information for the decision-making process. Importantly, IFNL3 SNPs were not associated with SVR but with RVR. Even in the era of new direct acting antiviral (DAA) therapies, IFNL3 testing may therefore still be considered for naïve GT2/3 patients to decide if dual Peg-IFN/RBV therapy is an option in resource limited regions. PMID:26699619

Performance and Value of IFN-Lambda3 and IFN-Lambda4 Genotyping in Patients with Chronic Hepatitis C (CHC) Genotype 2/3 in a Real World Setting.

PubMed

Wiegand, Steffen B; Heidrich, Benjamin; Susser, Simone; Rogalska-Taranta, Magdalena; Petersen, Jörg; Böker, Klaus H W; Grigorian, Natalia; Link, Ralph; Naumann, Uwe; John, Christine; Lueth, Stefan; Malfertheiner, Peter; Manns, Michael P; Wedemeyer, Heiner; Sarrazin, Christoph; Cornberg, Markus

2015-01-01

SNPs near the interferon lambda (IFNL) 3 gene are predictors for sustained virological response (SVR) in patients with chronic hepatitis C genotype (GT) 1. In addition, a dinucleotide frame shift in ss469415590 was described, which generates IFNL4. In this study, we compared the role of IFNL4 variants with IFNL3-(rs12979860) and IFNL3-(rs8099917) on response to pegylated (PEG)-IFN and Ribavirin (RBV) in patients with chronic hepatitis C GT2/3. We recruited 1006 patients with chronic hepatitis C and GT2/3 in a large German registry. A treatment with PEG-IFN and Ribavirin was started by 959 patients. We performed genotyping of IFNL3 (rs12979860, n = 726; rs8099917, n = 687) and of IFNL4 (ss469415590; n = 631). Both preferable IFNL3 genotypes were associated with RVR (both p<0.0001) rather than with SVR (rs12979860: p = 0.251; rs8099917: p = 0.447). Only RVR was linked to SVR in univariate and multivariate analyzes (both p<0.001). Concordance of genotyping in patients with available serum samples and EDTA blood samples (n = 259) was more than 96% for both IFNL3 SNPs. IFNL3-(rs12979860) correlated with IFNL4: 99.2% of patients with IFNL3-(rs12979860)-CC were IFNL4-(ss469415590)-TT/TT. IFNL3-(rs12979860)-CT was linked with IFNL4-(ss469415590)-TT/ΔG (98.0%) and IFNL3-(rs12979860)-TT was associated with IFNL4-(ss469415590)-ΔG/ΔG (97.6%). IFNL3 genotyping from serum was highly efficient and can be used as an alternative if EDTA whole blood is not available. In Caucasian GT2/3 patients genotyping for INFL4-(ss469415590) does not lead to additional information for the decision-making process. Importantly, IFNL3 SNPs were not associated with SVR but with RVR. Even in the era of new direct acting antiviral (DAA) therapies, IFNL3 testing may therefore still be considered for naïve GT2/3 patients to decide if dual Peg-IFN/RBV therapy is an option in resource limited regions.

Allergen-induced cytokine production, atopic disease, IgE, and wheeze in children.

PubMed

Contreras, J Paola; Ly, Ngoc P; Gold, Diane R; He, Hongzhen; Wand, Mathew; Weiss, Scott T; Perkins, David L; Platts-Mills, Thomas A E; Finn, Patricia W

2003-12-01

The early childhood allergen-induced immune responses associated with atopic disease and IgE production in early life are not well understood. We assessed the relationship of allergen-induced cytokine production by PBMCs to both atopic disease and to IgE increase in a cohort of children with a parental history of allergy or asthma (n = 112) at a median of 2 years of age. We examined cockroach (Bla g 1)-induced, house dust mite (Der f 1)-induced, and cat (Fel d 1)-induced cytokine secretion, including secretion of IFN-gamma, IL-13, IL-10, and TNF-alpha. We investigated whether distinct cytokine patterns associated with atopic disease can be detected in immune responses of children. PBMCs were isolated, and allergen-induced cytokine secretion was analyzed by means of ELISA. Atopic disease was defined as physician- or nurse-diagnosed eczema or hay fever. Increased IgE was defined as an IgE level of greater than 35 U/mL to dust mite, cockroach, cat, and egg white or a total IgE level of 60 U/mL or greater. Compared with children without atopic disease, children with atopic disease had lower Der f 1 (P =.005) and Bla g 2 (P =.03) allergen-induced IFN-gamma levels. Compared with children without increased IgE (n = 95), those with increased IgE (n = 16) had higher Der f 1-induced (P =.006) and Fel d 1-induced (P =.005) IL-13 levels and lower Bla g 2-induced (P =.03) IFN-gamma levels. Compared with children with neither atopic disease nor repeated wheeze, children with both atopic disease and repeated wheeze had lower levels of allergen-induced IFN-gamma (P =.01 for Der f 1 and P =.02 for Bla g 2) cytokine secretion. In young children at risk for asthma or allergy, decreased allergen-induced IFN-gamma secretion is associated with atopic disease and, in some cases, with increased IgE levels. Increased allergen-induced IL-13 secretion is most strongly associated with early life increase of IgE.

Mycobacterium bovis Bacille Calmette-Guérin Infection in the CNS Suppresses Experimental Autoimmune Encephalomyelitis and Th17 Responses in an IFN-gamma-independent Manner1

PubMed Central

Lee, JangEun; Reinke, Emily K.; Zozulya, Alla L.; Sandor, Matyas; Fabry, Zsuzsanna

2009-01-01

Multiple sclerosis (MS) and an animal model resembling MS, experimental autoimmune encephalomyelitis (EAE), are inflammatory demyelinating diseases of the central nervous system (CNS) that are suppressed by systemic mycobacterial infection in mice and BCG vaccination in humans. Host defense responses against Mycobacterium in mice are influenced by T lymphocytes and their cytokine products, particularly IFN-γ, which plays a protective regulatory role in EAE. To analyze the counter-regulatory role of mycobacterial infection-induced IFN-γ in the CNS on the function of the pathological Th17 cells and the clinical outcome of EAE, we induced EAE in mice that were intracerebrally infected with Mycobacterium bovis bacille Calmette-Guerin (BCG). Here we demonstrate that intracerebral (i.c.) BCG infection prevented inflammatory cell recruitment to the spinal cord and suppressed the development of EAE. Concomitantly, there was a significant decrease in the frequency of MOG-specific IFN-γ-producing CD4+ T cells in the CNS. IL-17+CD4+ T cell responses were significantly suppressed in i.c. BCG-infected mice following EAE induction regardless of T cell specificity. The frequency of Foxp3+CD4+ T cells in these mice was equivalent to that of control mice. The i.c. BCG infection-induced protection of EAE and suppression of MOG-specific IL-17+CD4+ T cell responses were similar in both wild type (WT) and IFN-γ deficient mice. These data show that live BCG infection in the brain suppresses CNS autoimmunity. These findings also reveal that the regulation of Th17-mediated autoimmunity in the CNS can be independent of IFN-γ-mediated mechanisms. PMID:18941210

Interferon-gamma and interleukin-10 profile of children with tuberculosis in North Sumatera, Indonesia

NASA Astrophysics Data System (ADS)

Daulay, R. S.; Daulay, R. M.

2018-03-01

Cellular immunity was mediated the host immune response against Mycobacterium tuberculosis, in which cytokine and T-helper (Th) 1 cells play an important role. Interferon-gamma (IFN-γ) is a leading cytokine involved in the immune response of tuberculosis (TB).The primary function of IFN-γ is to activate macrophages in opposition Mycobacterium tuberculosis. Contrast from IFN-γ, interleukin-10 (IL-10) is considered inhibitory cytokine, important to an adequate balance between inflammatory responses. To analyze cytokine profile, particularly IFN-γ and IL-10 of the children with TB in Indonesia, a cross-sectional study was conducted at two general hospitals and seven primary health care located in Medan and Batubara, North Sumatera, Indonesia. Among 51 children with TB disease and 51 healthy children, found that IFN-γ and IL-10 levels were lower in TB patients compared to healthy children. Statistically significant decreased production of the IFN-γ levels (p=0.042) were found in TB patients 9.41 (1.10-28.06) pg/ml contrast to healthy children 6.30 (1.30-89.76) pg/ml. Homologue finding of the IL-10 levels were also found in TB patients 4.93 (0.22-48.01) pg/ml and 4.93 (0.07-81.60) pg/ml in healthy children, but not statistically significant (p=0.784). High levels of IL-10 were not proven to suppress the levels production of IFN-γ in TB patients.

Household food insecurity is associated with low interferon-gamma levels in pregnant Indian women.

PubMed

Vaidya, A; Bhosale, R; Sambarey, P; Suryavanshi, N; Young, S; Mave, V; Kanade, S; Kulkarni, V; Deshpande, P; Balasubramanian, U; Elf, J; Gupte, N; Gupta, A; Mathad, J S

2017-07-01

Over 20% of tuberculosis (TB) cases during pregnancy occur in India. To determine the association between household food insecurity and interferon-gamma (IFN-γ) levels in pregnancy. Pregnant women in India were administered the Household Food Insecurity Access Scale (HFIAS) questionnaire and underwent an IFN-γ release assay. Logistic regression was used to identify factors associated with food insecurity. Of 538 women, 60 (11%) had household food insecurity, 47 (78%) of which were moderate or severe food insecure. After mitogen stimulation, moderate or severe food insecure women had a median IFN-γ concentration of 4.2 IU/ml (IQR 2.2-9.8) vs. 8.4 IU/ml (IQR 3.0-10) in women with no or mild food insecurity (P = 0.03). In multivariate analysis, higher IFN-γ concentrations were associated with human immunodeficiency virus infection (OR 1.3, 95%CI 0.51-2.1, P = 0.001), and inversely associated with moderate or severe food insecurity (OR -1.6, 95%CI -2.9 to -0.27, P = 0.02) and the number of adults in the household (OR -0.08, 95%CI -0.16 to -0.01, P = 0.03). There was no association between food insecurity and IFN-γ response to Mycobacterium tuberculosis antigen. Food insecurity in pregnancy is associated with low IFN-γ levels. There was no association between food insecurity and IFN-γ response to M. tuberculosis antigen, but our study was underpowered to detect this outcome.

Nickel, palladium and rhodium induced IFN-gamma and IL-10 production as assessed by in vitro ELISpot-analysis in contact dermatitis patients

PubMed Central

Bordignon, Valentina; Palamara, Francesca; Cordiali-Fei, Paola; Vento, Antonella; Aiello, Arianna; Picardo, Mauro; Ensoli, Fabrizio; Cristaudo, Antonio

2008-01-01

Background Recent attempts to diminish nickel use in most industrial products have led to an increasing utilization of alternative metal compounds for destinations such as the alloys used in orthopaedics, jewellery and dentistry. The present study was undertaken with the aim to evaluate the potential for an allergic response to nickel, palladium and rhodium on the basis of antigen-specific induction of inflammatory/regulatory cytokines, and to characterize, according to the cytokine profiles, the nature of simultaneous positive patch tests elicited in vivo. Peripheral blood mononuclear cells (PBMC) from 40 patients with different patch test results were kept in short term cultures in the presence of optimized concentrations of NiSO4 × 6H2O, PdCl2 and Rh(CH3COO)2. The production of IFN-γ and IL-10 elicited by metal compounds were analyzed by the ELISpot assay. Results We found a specific IFN-γ response by PBMC upon in vitro stimulation with nickel or palladium in well recognized allergic individuals. All controls with a negative patch test to a metal salt showed an in vitro IL-10 response and not IFN-γ production when challenged with the same compound. Interestingly, all subjects with positive patch test to both nickel and palladium (group 3) showed an in vitro response characterized by the release of IFN-γ after nickel stimulation and production of IL-10 in response to palladium. Conclusion These results strongly suggest that the different cytokine profiles elicited in vitro reflect different immune responses which may lead to the control of the allergic responses or to symptomatic allergic contact dermatitis. The development of sensitive and specific in vitro assays based on the determination of the cytokine profiles in response to contact allergens may have important diagnostic and prognostic implications and may prove extremely useful in complementing the diagnostic limits of traditional patch testing. PMID:18482439

Transplantation of polarized type 2 donor T cells reduces mortality caused by experimental graft-versus-host disease.

PubMed

Krenger, W; Cooke, K R; Crawford, J M; Sonis, S T; Simmons, R; Pan, L; Delmonte, J; Karandikar, M; Ferrara, J L

1996-11-15

Acute graft-versus-host disease (GVHD) is thought to be initiated by alloreactive type 1 T cells that secrete gamma-interferon (IFN-gamma). IFN-gamma induces the production of inflammatory cytokines, e.g., tumor necrosis factor-alpha and interleukin (IL)-1, which are the distal mediators of GVHD. We demonstrate that the transplantation of polarized type 2 murine T cells (i.e., cells secreting IL-4 but not IFN-gamma) together with T-cell-depleted bone marrow results in a significant increase in survival (P<0.001) after bone marrow transplantation across minor histocompatibility barriers (B10.BR-->CBA/J). Further analysis demonstrated that increased survival in recipients of polarized type 2 T cells correlated with diminished production of both IFN-gamma and tumor necrosis factor-alpha but with increases in IL-4 2 weeks after transplantation. Despite improved survival, histologic changes of GVHD were evident in oral mucosal and hepatic tissues at 7 weeks after bone marrow transplantation. These data provide further evidence that inflammatory cytokines in the immediate posttransplant period are pivotal to the development of mortality but that they do not correlate with individual target organ damage.

Identification and Characterization of Neospora caninum Cyclophilin That Elicits Gamma Interferon Production

PubMed Central

Tuo, Wenbin; Fetterer, Raymond; Jenkins, Mark; Dubey, J. P.

2005-01-01

Gamma interferon (IFN-γ) response is essential to the development of a host protective immunity in response to infections by intracellular parasites. Neosporosis, an infection caused by the intracellular protozoan parasite Neospora caninum, is fatal when there is a complete lack of IFN-γ in the infected host. However, the mechanism by which IFN-γ is elicited by the invading parasite is unclear. This study has identified a microbial protein in the N. caninum tachyzoite N. caninum cyclophilin (NcCyP) as a major component of the parasite responsible for the induction of IFN-γ production by bovine peripheral blood mononuclear cells (PBMC) and antigen-specific CD4+ T cells. NcCyP has high sequence homology (86%) with Toxoplasma gondii 18-kDa CyP with a calculated molecular mass of 19.4 kDa. NcCyP is a secretory protein with a predicted signal peptide of 17 amino acids. Abundant NcCyP was detected in whole-cell N. caninum tachyzoite lysate antigen (NcAg) and N. caninum tachyzoite culture supernatant. In N. caninum tachyzoite culture supernatant, three NcCyP bands of 19, 22, and 24 kDa were identified. NcAg stimulated high levels of IFN-γ production by PBMC and CD4+ T cells. The IFN-γ-inducing effect of NcAg was blocked by cyclosporine, a specific ligand for CyP, in a dose-dependent manner. Furthermore, cyclosporine abolished IFN-γ production by PBMC from naïve cows as well as PBMC and CD4+ T cells from infected/immunized cows. These results indicate that the N. caninum tachyzoite naturally produces a potent IFN-γ-inducing protein, NcCyP, which may be important for parasite survival as well as host protection. PMID:16041025

Evaluation of Gamma Interferon and Antibody Tuberculosis Tests in Alpacas

PubMed Central

Holder, Tom; Clifford, Derek; Dexter, Ian; Brewer, Jacky; Smith, Noel; Waring, Laura; Crawshaw, Tim; Gillgan, Steve; Lyashchenko, Konstantin; Lawrence, John; Clarke, John; de la Rua-Domenech, Ricardo; Vordermeier, Martin

2012-01-01

We describe the performance of cell-based and antibody blood tests for the antemortem diagnosis of tuberculosis (TB) in South American camelids (SAC). The sensitivity and specificity of the gamma interferon (IFN-γ) release assay, two lateral flow rapid antibody tests (Stat-Pak and Dual Path Platform [DPP]), and two enzyme-linked immunosorbent assay (ELISA)-based antibody tests (Idexx and Enferplex) were determined using diseased alpacas from Mycobacterium bovis culture-confirmed breakdown herds and TB-free alpacas from geographical areas with no history of bovine TB, respectively. Our results show that while the sensitivities of the IFN-γ and antibody tests were similar (range of 57.7% to 66.7%), the specificity of the IFN-γ test (89.1%) was lower than those of any of the antibody tests (range of 96.4% to 97.4%). This lower specificity of the IFN-γ test was at least in part due to undisclosed Mycobacterium microti infection in the TB-free cohort, which stimulates a positive purified protein derivative (PPD) response. The sensitivity of infection detection could be increased by combining two antibody tests, but even the use of all four antibody tests failed to detect all diseased alpacas. These antibody-negative alpacas were IFN-γ positive. We found that the maximum sensitivity could be achieved only by the combination of the IFN-γ test with two antibody tests in a “test package,” although this resulted in decreased specificity. The data from this evaluation of tests with defined sensitivity and specificity provide potential options for antemortem screening of SAC for TB in herd breakdown situations and could also find application in movement testing and tracing investigations. PMID:22914362

Evaluation of gamma interferon and antibody tuberculosis tests in alpacas.

PubMed

Rhodes, Shelley; Holder, Tom; Clifford, Derek; Dexter, Ian; Brewer, Jacky; Smith, Noel; Waring, Laura; Crawshaw, Tim; Gillgan, Steve; Lyashchenko, Konstantin; Lawrence, John; Clarke, John; de la Rua-Domenech, Ricardo; Vordermeier, Martin

2012-10-01

We describe the performance of cell-based and antibody blood tests for the antemortem diagnosis of tuberculosis (TB) in South American camelids (SAC). The sensitivity and specificity of the gamma interferon (IFN-γ) release assay, two lateral flow rapid antibody tests (Stat-Pak and Dual Path Platform [DPP]), and two enzyme-linked immunosorbent assay (ELISA)-based antibody tests (Idexx and Enferplex) were determined using diseased alpacas from Mycobacterium bovis culture-confirmed breakdown herds and TB-free alpacas from geographical areas with no history of bovine TB, respectively. Our results show that while the sensitivities of the IFN-γ and antibody tests were similar (range of 57.7% to 66.7%), the specificity of the IFN-γ test (89.1%) was lower than those of any of the antibody tests (range of 96.4% to 97.4%). This lower specificity of the IFN-γ test was at least in part due to undisclosed Mycobacterium microti infection in the TB-free cohort, which stimulates a positive purified protein derivative (PPD) response. The sensitivity of infection detection could be increased by combining two antibody tests, but even the use of all four antibody tests failed to detect all diseased alpacas. These antibody-negative alpacas were IFN-γ positive. We found that the maximum sensitivity could be achieved only by the combination of the IFN-γ test with two antibody tests in a "test package," although this resulted in decreased specificity. The data from this evaluation of tests with defined sensitivity and specificity provide potential options for antemortem screening of SAC for TB in herd breakdown situations and could also find application in movement testing and tracing investigations.

Borrelia-primed and -infected mice deficient of interleukin-17 develop arthritis after neutralization of gamma-interferon.

PubMed

Kuo, Joseph; Warner, Thomas F; Schell, Ronald F

2017-03-01

The immune mechanisms responsible for development of Lyme arthritis are partially understood with interleukin-17 (IL-17) and gamma-interferon (IFN-γ) playing a generally accepted role. Elevated levels of IL-17 and/or IFN-γ have been reported in samples from human Lyme arthritis patients and experimental mice. In addition, IL-17 and IFN-γ have been implicated in the onset of arthritis in Borrelia-primed and -infected C57BL/6 mice. Recently, we showed that IL-17-deficient mice developed swelling and histopathological changes consistent with arthritis in the presence of high levels of IFN-γ. We hypothesized that neutralization of IFN-γ in IL-17-deficient mice would inhibit Borrelia-induced arthritis. Our results, however, showed that swelling of the hind paws and histopathological changes of arthritis did not differ between Borrelia-primed and -infected IL-17-deficient and wild-type mice with or without neutralization of IFN-γ. We also found higher levels of tumor necrosis factor alpha (TNF-α) and IL-6 in the popliteal lymph node cells of Borrelia-primed and -infected IL-17-deficient mice after neutralization of IFN-γ. These results suggest that multiple cytokines interact in the development of Borrelia-induced arthritis. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

A randomized, double-blind, phase I/II trial of tumor necrosis factor and interferon-gamma for treatment of AIDS-related complex (Protocol 025 from the AIDS Clinical Trials Group).

PubMed

Agosti, J M; Coombs, R W; Collier, A C; Paradise, M A; Benedetti, J K; Jaffe, H S; Corey, L

1992-05-01

To determine safety and efficacy of tumor necrosis factor (TNF) and interferon-gamma (IFN gamma) in the treatment of patients with acquired immunodeficiency syndrome (AIDS)-related complex, a randomized, double-blind study was conducted. Twenty-five patients with AIDS-related complex and CD4 lymphocytes less than or equal to 500 x 10(6)/L attended an AIDS Clinical Trials Unit of a tertiary referral center. Patients were administered tumor necrosis factor (TNF) (10 micrograms/m2) or IFN gamma (10 micrograms/m2), or both intramuscularly three times weekly for 16 weeks. Side effects from all three preparations included fever, constitutional symptoms, and local reactions. No significant hematologic, hepatic, renal, or coagulation abnormalities were observed. CD4 lymphocyte counts, beta 2-microglobulin, p24 antigen levels, and anti-p24 antibody did not change significantly during therapy. Similarly, no significant change was noted in rates of HIV isolation from peripheral blood mononuclear cells or plasma. TNF and IFN gamma were tolerable after premedication with acetaminophen; however, no significant change in markers of human immunodeficiency virus infection was demonstrated. These cytokines alone do not appear to be of benefit, nor do they appear to hasten the progression of HIV infection.

Stat1-independent regulation of gene expression in response to IFN-γ

PubMed Central

Ramana, Chilakamarti V.; Gil, M. Pilar; Han, Yulong; Ransohoff, Richard M.; Schreiber, Robert D.; Stark, George R.

2001-01-01

Although Stat1 is essential for cells to respond fully to IFN-γ, there is substantial evidence that, in the absence of Stat1, IFN-γ can still regulate the expression of some genes, induce an antiviral state and affect cell growth. We have now identified many genes that are regulated by IFN-γ in serum-starved Stat1-null mouse fibroblasts. The proteins induced by IFN-γ in Stat1-null cells can account for the substantial biological responses that remain. Some genes are induced in both wild-type and Stat1-null cells and thus are truly Stat1-independent. Others are subject to more complex regulation in response to IFN-γ, repressed by Stat1 in wild-type cells and activated in Stat1-null cells. Many genes induced by IFN-γ in Stat1-null fibroblasts also are induced by platelet-derived growth factor in wild-type cells and thus are likely to be involved in cell proliferation. In mouse cells expressing the docking site mutant Y440F of human IFN-γ receptor subunit 1, the mouse Stat1 is not phosphorylated in response to human IFN-γ, but c-myc and c-jun are still induced, showing that the Stat1 docking site is not required for Stat1-independent signaling. PMID:11390994

Using Deep Learning for Gamma Ray Source Detection at the First G-APD Cherenkov Telescope (FACT)

NASA Astrophysics Data System (ADS)

Bieker, Jacob

2018-06-01

Finding gamma-ray sources is of paramount importance for Imaging Air Cherenkov Telescopes (IACT). This study looks at using deep neural networks on data from the First G-APD Cherenkov Telescope (FACT) as a proof-of-concept of finding gamma-ray sources with deep learning for the upcoming Cherenkov Telescope Array (CTA). In this study, FACT’s individual photon level observation data from the last 5 years was used with convolutional neural networks to determine if one or more sources were present. The neural networks used various architectures to determine which architectures were most successful in finding sources. Neural networks offer a promising method for finding faint and extended gamma-ray sources for IACTs. With further improvement and modifications, they offer a compelling method for source detection for the next generation of IACTs.

IFN-γ signaling maintains skin pigmentation homeostasis through regulation of melanosome maturation

PubMed Central

Natarajan, Vivek T.; Ganju, Parul; Singh, Archana; Vijayan, Vinaya; Kirty, Kritika; Yadav, Shalini; Puntambekar, Shraddha; Bajaj, Sonali; Dani, Prachi P.; Kar, Hemanta K.; Gadgil, Chetan J.; Natarajan, Krishnamurthy; Rani, Rajni; Gokhale, Rajesh S.

2014-01-01

Cellular homeostasis is an outcome of complex interacting processes with nonlinear feedbacks that can span distinct spatial and temporal dimensions. Skin tanning is one such dynamic response that maintains genome integrity of epidermal cells. Although pathways underlying hyperpigmentation cascade are recognized, negative feedback regulatory loops that can dampen the activated melanogenesis process are not completely understood. In this study, we delineate a regulatory role of IFN-γ in skin pigmentation biology. We show that IFN-γ signaling impedes maturation of the key organelle melanosome by concerted regulation of several pigmentation genes. Withdrawal of IFN-γ signal spontaneously restores normal cellular programming. This effect in melanocytes is mediated by IFN regulatory factor-1 and is not dependent on the central regulator microphthalmia-associated transcription factor. Chronic IFN-γ signaling shows a clear hypopigmentation phenotype in both mouse and human skin. Interestingly, IFN-γ KO mice display a delayed recovery response to restore basal state of epidermal pigmentation after UV-induced tanning. Together, our studies delineate a new spatiotemporal role of the IFN-γ signaling network in skin pigmentation homeostasis, which could have implications in various cutaneous depigmentary and malignant disorders. PMID:24474804

Akt interaction with PLC(gamma) regulates the G(2)/M transition triggered by FGF receptors from MDA-MB-231 breast cancer cells.

PubMed

Browaeys-Poly, Edith; Perdereau, Dominique; Lescuyer, Arlette; Burnol, Anne-Françoise; Cailliau, Katia

2009-12-01

Estrogen-independent breast cancer cell growth is under the control of fibroblast growth factors receptors (FGFRs), but the role of phospholipase C gamma (PLC(gamma)) and Akt, the downstream effectors activated by FGFRs, in cell proliferation is still unresolved. FGFRs from highly invasive MDA-MB-231 cells were expressed in Xenopus oocyte, a powerful model system to assess the G(2)/M checkpoint regulation. Under FGF1 stimulation, an analysis of the progression in the M-phase of the cell cycle and of the Akt signaling cascades were performed using the phosphatidylinositol-3-kinase inhibitor, LY294002, and a mimetic peptide of the SH3 domain of PLC(gamma). Activated Akt binds and phosphorylates PLC(gamma) before Akt targets the tumor suppressor Chfr. Disruption of the Akt-PLC(gamma) interaction directs Akt binding to Chfr and accelerates the alleviation of the G(2)/M checkpoint. The PLC(gamma)-Akt interaction, triggered by FGF receptors from estrogen-independent breast cancer cells MDA-MB-231, regulates progression in the M-phase of the cell cycle.

HCV-specific immune responses induced by CIGB-230 in combination with IFN-α plus ribavirin

PubMed Central

Amador-Cañizares, Yalena; Martínez-Donato, Gillian; Álvarez-Lajonchere, Liz; Vasallo, Claudia; Dausá, Mariacarla; Aguilar-Noriega, Daylen; Valenzuela, Carmen; Raíces, Ivette; Dubuisson, Jean; Wychowski, Czeslaw; Cinza-Estévez, Zurina; Castellanos, Marlén; Núñez, Magdalys; Armas, Anny; González, Yaimé; Revé, Ismariley; Guerra, Ivis; Pérez Aguiar, Ángel; Dueñas-Carrera, Santiago

2014-01-01

AIM: To analyze hepatitis C virus (HCV)-specific immune responses in chronically infected patients under triple therapy with interferon-α (IFN-α) plus ribavirin and CIGB-230. METHODS: CIGB-230 was administered in different schedules with respect to IFN-α plus ribavirin therapy. Paired serum and peripheral blood mononuclear cells (PBMC) samples from baseline and end of treatment were analyzed. The HCV-specific humoral response was tested by enzyme-linked immunosorbent assay, neutralizing antibodies were evaluated by cell culture HCV neutralization assays, PBMC proliferation was assayed by carboxyfluorescein succinimidyl ester staining and IFN-γ secretion was assessed by enzyme-linked immunospot. Data on virological and histological response and their association with immune variables are also provided. RESULTS: From week 12 to week 48, all groups of patients showed a significant reduction in mean leukocyte counts. Statistically significant reductions in antibody titers were frequent, but only individuals immunized with CIGB-230 as early add-on treatment sustained the core-IgG response, and the neutralizing antibody response was enhanced only in patients receiving CIGB-230. Cell-mediated immune responses also tended to decline, but significant reductions in IFN-γ secretion and total absence of core-specific lymphoproliferation were exclusive of the control group. Only CIGB-230-immunized individuals showed de novo induced lymphoproliferative responses against the structural antigens. Importantly, it was demonstrated that the quality of the CIGB-230-induced immune response depended on the number of doses and timing of administration in relation to the antiviral therapy. Specifically, the administration of 6 doses of CIGB-230 as late add-on to therapy increased the neutralizing antibody activity and the de novo core-specific IFN-γ secretion, both of which were associated with the sustained virological response. CONCLUSION: CIGB-230, combined with IFN

Critical role of type 1 cytokines in controlling initial infection with Burkholderia mallei.

PubMed

Rowland, Caroline A; Lertmemongkolchai, Ganjana; Bancroft, Alison; Haque, Ashraful; Lever, M Stephen; Griffin, Kate F; Jackson, Matthew C; Nelson, Michelle; O'Garra, Anne; Grencis, Richard; Bancroft, Gregory J; Lukaszewski, Roman A

2006-09-01

Burkholderia mallei is a gram-negative bacterium which causes the potentially fatal disease glanders in humans; however, there is little information concerning cell-mediated immunity to this pathogen. The role of gamma interferon (IFN-gamma) during B. mallei infection was investigated using a disease model in which infected BALB/c mice normally die between 40 and 60 days postinfection. IFN-gamma knockout mice infected with B. mallei died within 2 to 3 days after infection, and there was uncontrolled bacterial replication in several organs, demonstrating the essential role of IFN-gamma in the innate immune response to this pathogen. Increased levels of IFN-gamma, interleukin-6 (IL-6), and monocyte chemoattractant protein 1 were detected in the sera of immunocompetent mice in response to infection, and splenic mRNA expression of IFN-gamma, IL-6, IL-12p35, and IL-27 was elevated 24 h postinfection. The effects of IL-18, IL-27, and IL-12 on stimulation of the rapid IFN-gamma production were investigated in vitro by analyzing IFN-gamma production in the presence of heat-killed B. mallei. IL-12 was essential for IFN-gamma production in vitro; IL-18 was also involved in induction of IFN-gamma, but IL-27 was not required for IFN-gamma production in response to heat-killed B. mallei. The main cellular sources of IFN-gamma were identified in vitro as NK cells, CD8+ T cells, and TCRgammadelta T cells. Our data show that B. mallei is susceptible to cell-mediated immune responses which promote expression of type 1 cytokines. This suggests that development of effective vaccines against glanders should target the production of IFN-gamma.

Immune responses to mumps vaccine in adults who were vaccinated in childhood.

PubMed

Hanna-Wakim, Rima; Yasukawa, Linda L; Sung, Phillip; Arvin, Ann M; Gans, Hayley A

2008-06-15

In a mumps outbreak in the United States, many infected individuals were adults who had received 2 doses of mumps vaccine. The persistence of cellular immunity to mumps vaccine has not been defined. This was an observational, nonrandomized cohort study evaluating cell-mediated and humoral immunity to mumps in 10 vaccinated and 10 naturally immune adults. Mumps-specific T cell activation and interferon (IFN)-gamma production were measured using lymphoproliferative and flow cytometry assays, and mumps immunoglobulin (Ig) G was measured using enzyme-linked immunosorbent assay. T cell immunity to mumps was high in both groups; 70% of vaccinated and 80% of naturally immune individuals had a positive (> or =3) stimulation index (SI) (P = 1.0). The mean percentages of mumps-specific CD4+ T cells that expressed CD69 and produced IFN-gamma were equivalent in the 2 groups: 0.06% and 0.12%, respectively (P = .11). The mean SIs in the groups were also equivalent, although IFN-gamma concentrations from cultures stimulated with mumps antigen were higher in naturally immune adults than in vaccinated adults (P < or = .01). All adults were positive for mumps IgG. T and B cell immunity to mumps was detected in adults at least 10 years after immunization. Except for IFN-gamma release, responses in vaccinated adults paralleled those observed in naturally immune individuals.

Use of IFN-γ and IP-10 detection in the diagnosis of latent tuberculosis infection in patients with inflammatory rheumatic diseases.

PubMed

Villar-Hernández, Raquel; Latorre, Irene; Mínguez, Sonia; Díaz, Jéssica; García-García, Esther; Muriel-Moreno, Beatriz; Lacoma, Alicia; Prat, Cristina; Olivé, Alex; Ruhwald, Morten; Mateo, Lourdes; Domínguez, José

2017-10-01

Biologic agents are used against rheumatic diseases, however, they increase the risk of developing severe infections and diseases such as tuberculosis. We aimed to determine the benefits of IP-10 detection to diagnose latent tuberculosis infection (LTBI) in patients with inflammatory rheumatic diseases on different immunosuppressive drug regimens, and compare these results with IFN-γ detection. We included 64 patients with inflammatory rheumatic diseases. We used QuantiFERON Gold In-Tube (QFN-G-IT) and T-SPOT.TB to detect IFN-γ production, and an in-house ELISA for IP-10 detection from the previous QFN-G-IT stimulated samples. We assessed the combined use of IFN-γ release assays (IGRAs) and IP-10 test, and analyzed the influence of immunotherapy on the tests performance. We obtained 34.9% positive results by T-SPOT.TB, 25.0% by QFN-G-IT and 31.3% by IP-10 test. The combined use of IGRAs and IP-10 detection increased significantly the amount of positive results (p < 0.0001). Treatment intake had no significant effect on in vitro tests (p > 0.05). IP-10 and IFN-γ detection is comparable and their combined use could increase the number of positive results in the diagnosis of LTBI in rheumatic patients. The tested assays were not influenced by rheumatoid immunosuppressive therapy. Thus, IP-10 could be of use in the development of new and improved LTBI diagnostic tools. Copyright © 2017 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

A randomized phase II trial comparing two different sequence combinations of autologous vaccine and human recombinant interferon gamma and human recombinant interferon alpha2B therapy in patients with metastatic renal cell carcinoma: clinical outcome and analysis of immunological parameters.

PubMed

Schwaab, T; Heaney, J A; Schned, A R; Harris, R D; Cole, B F; Noelle, R J; Phillips, D M; Stempkowski, L; Ernstoff, M S

2000-04-01

The clinical observation of spontaneous regression in patients with renal cell carcinoma (RCC) and the response to various immunotherapeutic therapies strongly suggest a role for the host immune system in this disease. Prior studies showed that sequential administration of interferon (IFN) gamma and IFN alpha to RCC patients was safe. Clinical responses as well as immune changes in the peripheral blood mononuclear cell compartment were observed. Autologous tumor cell vaccines (AV) have also demonstrated activity in renal cell carcinoma. We hypothesize that the addition of AV to sequential IFN gamma and a therapy might improve the tumor-specific immune response by providing an appropriate source of antigen in the appropriate cytokine environment. To our knowledge, this is the first trial using AV combined with IFN alpha and IFN gamma. The purpose of this study was to evaluate the feasibility of manufacturing and administering (AV) from resected tumor samples, and administration of AV with combination IFN gamma and IFN alpha therapy. Finally, the impact on immunological parameters of these treatment options was assessed. Patients with metastatic RCC were randomly assigned to receive AV plus bCG along with a sequential administration of IFN gamma and a either together or after initiation of vaccine. Toxicity and clinical responses were evaluated. Modulations of the immune system were investigated by analyzing phenotype, cytokine mRNA expression, T cell proliferation and cytotoxicity in the peripheral blood mononuclear cell compartment. Fourteen patients with metastatic renal cell carcinoma were enrolled in this study; 9 were available for response evaluation. In a 70 day period, 3 (33%) showed mixed responses, 5 (56%) stable disease and 1 (11%) progression of disease. Toxicities were consistent with previous clinical reports. In the flow-cytometry phenotype analysis, stimulation of distinct subsets of circulating T-lymphocytes and a decrease of CD8+ T cell subsets was

Memory T cell proliferative responses and IFN-γ productivity sustain long-lasting efficacy of a Cap-based PCV2 vaccine upon PCV2 natural infection and associated disease.

PubMed

Ferrari, Luca; Borghetti, Paolo; De Angelis, Elena; Martelli, Paolo

2014-04-16

Porcine circovirus type 2 (PCV2) vaccination represents an important measure to cope with PCV2 infection; however, data regarding the modulation of the immune cell compartment are still limited, especially under field conditions. This study is aimed at investigating the features of the cellular immune response in conventional piglets induced by vaccination using a capsid (Cap) protein-based PCV2 vaccine compared to unvaccinated animals when exposed to PCV2 natural infection. Immune reactivity was evaluated by quantifying peripheral cell subsets involved in the anti-viral response and characterizing the interferon-gamma (IFN-γ) secreting cell (SC) responsiveness both in vivo and upon in vitro whole PCV2 recall. The vaccination triggered an early and intense IFN-γ secreting cell response and induced the activation of peripheral lymphocytes. The early increase of IFN-γ SC frequencies resulted in a remarkable and transient tendency to increased IFN-γ productivity in vaccinated pigs. In vaccinated animals, soon before the onset of infection occurred 15-16 weeks post-vaccination, the recalled PCV2-specific immune response was characterized by moderate PCV2-specific IFN-γ secreting cell frequencies and augmented productivity together with reactive CD4+CD8+ memory T cells. Conversely, upon infection, unvaccinated animals showed very high frequencies of IFN-γ secreting cells and a tendency to lower productivity, which paralleled with effector CD4-CD8+ cytotoxic cell responsiveness. The study shows that PCV2 vaccination induces a long-lasting immunity sustained by memory T cells and IFN-γ secreting cells that potentially played a role in preventing the onset of infection; the extent and duration of this reactivity can be an important feature for evaluating the protective immunity induced by vaccination.

Memory T cell proliferative responses and IFN-γ productivity sustain long-lasting efficacy of a Cap-based PCV2 vaccine upon PCV2 natural infection and associated disease

PubMed Central

2014-01-01

Porcine circovirus type 2 (PCV2) vaccination represents an important measure to cope with PCV2 infection; however, data regarding the modulation of the immune cell compartment are still limited, especially under field conditions. This study is aimed at investigating the features of the cellular immune response in conventional piglets induced by vaccination using a capsid (Cap) protein-based PCV2 vaccine compared to unvaccinated animals when exposed to PCV2 natural infection. Immune reactivity was evaluated by quantifying peripheral cell subsets involved in the anti-viral response and characterizing the interferon-gamma (IFN-γ) secreting cell (SC) responsiveness both in vivo and upon in vitro whole PCV2 recall. The vaccination triggered an early and intense IFN-γ secreting cell response and induced the activation of peripheral lymphocytes. The early increase of IFN-γ SC frequencies resulted in a remarkable and transient tendency to increased IFN-γ productivity in vaccinated pigs. In vaccinated animals, soon before the onset of infection occurred 15-16 weeks post-vaccination, the recalled PCV2-specific immune response was characterized by moderate PCV2-specific IFN-γ secreting cell frequencies and augmented productivity together with reactive CD4+CD8+ memory T cells. Conversely, upon infection, unvaccinated animals showed very high frequencies of IFN-γ secreting cells and a tendency to lower productivity, which paralleled with effector CD4–CD8+ cytotoxic cell responsiveness. The study shows that PCV2 vaccination induces a long-lasting immunity sustained by memory T cells and IFN-γ secreting cells that potentially played a role in preventing the onset of infection; the extent and duration of this reactivity can be an important feature for evaluating the protective immunity induced by vaccination. PMID:24735253

Role of Gamma Interferon in the Pathogenesis of Severe Schistosomiasis in Interleukin-4-Deficient Mice

PubMed Central

La Flamme, Anne Camille; Patton, Elisabeth A.; Pearce, Edward J.

2001-01-01

In the absence of interleukin-4 (IL-4), infection with Schistosoma mansoni leads to a severe fatal disease rather than the chronic survivable condition that occurs in wild-type (WT) mice. Because the sustained production of NO most closely correlates to weight loss and fatality in infected IL-4−/− mice and because gamma interferon (IFN-γ) is an important inducer of inducible NO synthase, infected IL-4−/− mice were treated with anti-IFN-γ antibodies to determine the role of IFN-γ during schistosomiasis in WT and IL-4−/− animals. When IFN-γ was neutralized, Th2 responses were enhanced and NO production was reduced in both WT and IL-4−/− mice. The decreased NO production correlated with a rescue of proliferation in splenocytes from infected IL-4−/− mice. Furthermore, the neutralization of IFN-γ in vivo improved the gross appearance of the liver and led to a reduction in granuloma size in infected IL-4−/− but not WT mice. However, the neutralization of IFN-γ in vivo did not affect the development of severe disease in infected IL-4−/− mice. These results suggest that while the increased production of IFN-γ does lead to some of the pathology observed in infected IL-4−/− mice, it is not ultimately responsible for cachexia and death. PMID:11705919

Correlations between endotoxin, interferon-gamma, biopterin and serum phospholipase A2-activities during lethal gram negative sepsis in rats.

PubMed

Hunsicker, A; Kullich, W; Weissenhofer, W; Lorenz, D; Petermann, J; Rokos, H; Schwesinger, G

1997-05-01

To establish a standardised reproducible animal model of intraperitoneal sepsis, and to investigate early immunoserological responses to find a mediator-based system for evaluation and grading of diffuse peritonitis in patients Prospective experimental study 4 Teaching hospitals, Germany and Austria 42 LEW. 1W rats, 12 of which acted as controls Gram negative sepsis was induced by intraperitoneal injection of 6 ml of a mixture of Escherichia coli (K1:H+) 10(10) organisms/ml, autogenous haemoglobin 2.9 ml (haemoglobin concentration 3%), 0.9% sodium chloride 3 ml, and suspension 0.1 ml. Control rats were given physiological saline 6 ml alone. Concentrations of endotoxin, interferon gamma (IFN-gamma), and biopterin, and serum phospholipase A2 (PLA2) activity. There were significant differences between the septic and control rats in concentrations of endotoxin (EU/ml) (median (interquartile range) 21.85 (2.02-159.5) compared with 0, p < 0.0001; IFN-gamma (pg/ml) 1263.0 (271.0-7575.0) compared with 101.0 (89.0-141.0), p < 0.0001; biopterin (nmol/L) 111.0 (66.4-156.3) compared with 53.7 (38.3-67.6), p < 0.001; and PLA2 (U/L) 163.0 (125.8-209.0) compared with 112.5 (88.5-126.5) p < 0.01. Measurements of concentrations of endotoxin, IFN-gamma, pteridines, and PLA2 activity may well be adequate markers for early recognition of sepsis, and perhaps for grading it during the first 6 hours after induction. The allow a clear distinction to be made between septic and non-septic disorders in 87% of cases.

We Can Still Be Friends: IFN-γ Breaks Up Macrophage Enhancers.

PubMed

Novakovic, Boris; Wang, Cheng; Logie, Colin

2017-08-15

Interferon (IFN)-γ can prime macrophages for inflammatory responses by several mechanisms, including enhancer establishment and gene activation. In this issue of Immunity, Kang et al. (2017) provide insight into the mechanisms of IFN-γ-mediated gene repression as they show that IFN-γ promotes the disassembly of select active enhancers by interfering with enhancer-binding transcription factor MAF. Copyright © 2017 Elsevier Inc. All rights reserved.

Successive Intramuscular Boosting with IFN-Alpha Protects Mycobacterium bovis BCG-Vaccinated Mice against M. lepraemurium Infection

PubMed Central

Guerrero, G. G.; Rangel-Moreno, J.; Islas-Trujillo, S.; Rojas-Espinosa, Ó.

2015-01-01

Leprosy caused by Mycobacterium leprae primarily affects the skin and peripheral nerves. As a human infectious disease, it is still a significant health and economic burden on developing countries. Although multidrug therapy is reducing the number of active cases to approximately 0.5 million, the number of cases per year is not declining. Therefore, alternative host-directed strategies should be addressed to improve treatment efficacy and outcome. In this work, using murine leprosy as a model, a very similar granulomatous skin lesion to human leprosy, we have found that successive IFN-alpha boosting protects BCG-vaccinated mice against M. lepraemurium infection. No difference in the seric isotype and all IgG subclasses measured, neither in the TH1 nor in the TH2 type cytokine production, was seen. However, an enhanced iNOS/NO production in BCG-vaccinated/i.m. IFN-alpha boosted mice was observed. The data provided in this study suggest a promising use for IFN-alpha boosting as a new prophylactic alternative to be explored in human leprosy by targeting host innate cell response. PMID:26484351

Parasite distribution and associated immune response during the acute phase of Toxoplasma gondii infection in sheep.

PubMed

Verhelst, Delfien; De Craeye, Stéphane; Entrican, Gary; Dorny, Pierre; Cox, Eric

2014-12-16

In many countries, Toxoplasma gondii (T. gondii) is a major cause of reproductive disorders and abortions in the sheep industry, and therefore responsible for important financial and economic losses. In addition, undercooked infected lamb is an important risk factor for human toxoplasmosis. In the present study, the initial phase of the infection was investigated: the parasite's entry site, the subsequent distribution of the parasite and the host-immune response. Parasite DNA was already detected in the cranial small intestinal mucosa the first days after oral infection with T. gondii tissue cysts. Simultaneously, high IFN-gamma and IL-12 responses were induced mainly in the mesenteric lymph nodes. The emergence of IgG1 (at 8dpi), and IgG2 (at 11 dpi) was accompanied by a decrease or even disappearance of the IFN-gamma and IL-12 response in the Peyers' patches (PP), PBMC's and popliteal LN's. Meanwhile the parasite DNA could be recovered from most mucosal and systemic tissues to become undetectable in the small intestine, popliteal LN, PBMC and spleen 3 weeks pi. Our results indicate that parasites enter the cranial small intestine the first days after infection and that after an increase the first two weeks after infection, the parasite DNA levels in the intestine drop below the detection limit three weeks after infection. This coincides with an increase in parastic-specific serum IgG1 and IgG2 and a decrease of the antigen-specific IFN-gamma response in PP, PBMC and popliteal LN. We suggest a role for IFN-gamma and IL-12 in controlling the infection.

MO-F-CAMPUS-I-02: Accuracy in Converting the Average Breast Dose Into the Mean Glandular Dose (MGD) Using the F-Factor in Cone Beam Breast CT- a Monte Carlo Study Using Homogeneous and Quasi-Homogeneous Phantoms

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lai, C; Zhong, Y; Wang, T

2015-06-15

Purpose: To investigate the accuracy in estimating the mean glandular dose (MGD) for homogeneous breast phantoms by converting from the average breast dose using the F-factor in cone beam breast CT. Methods: EGSnrc-based Monte Carlo codes were used to estimate the MGDs. 13-cm in diameter, 10-cm high hemi-ellipsoids were used to simulate pendant-geometry breasts. Two different types of hemi-ellipsoidal models were employed: voxels in quasi-homogeneous phantoms were designed as either adipose or glandular tissue while voxels in homogeneous phantoms were designed as the mixture of adipose and glandular tissues. Breast compositions of 25% and 50% volume glandular fractions (VGFs), definedmore » as the ratio of glandular tissue voxels to entire breast voxels in the quasi-homogeneous phantoms, were studied. These VGFs were converted into glandular fractions by weight and used to construct the corresponding homogeneous phantoms. 80 kVp x-rays with a mean energy of 47 keV was used in the simulation. A total of 109 photons were used to image the phantoms and the energies deposited in the phantom voxels were tallied. Breast doses in homogeneous phantoms were averaged over all voxels and then used to calculate the MGDs using the F-factors evaluated at the mean energy of the x-rays. The MGDs for quasi-homogeneous phantoms were computed directly by averaging the doses over all glandular tissue voxels. The MGDs estimated for the two types of phantoms were normalized to the free-in-air dose at the iso-center and compared. Results: The normalized MGDs were 0.756 and 0.732 mGy/mGy for the 25% and 50% VGF homogeneous breasts and 0.761 and 0.733 mGy/mGy for the corresponding quasi-homogeneous breasts, respectively. The MGDs estimated for the two types of phantoms were similar within 1% in this study. Conclusion: MGDs for homogeneous breast models may be adequately estimated by converting from the average breast dose using the F-factor.« less

Control of HIV infection by IFN-α: implications for latency and a cure.

PubMed

Bourke, Nollaig M; Napoletano, Silvia; Bannan, Ciaran; Ahmed, Suaad; Bergin, Colm; McKnight, Áine; Stevenson, Nigel J

2018-03-01

Viral infections, including HIV, trigger the production of type I interferons (IFNs), which in turn, activate a signalling cascade that ultimately culminates with the expression of anti-viral proteins. Mounting evidence suggests that type I IFNs, in particular IFN-α, play a pivotal role in limiting acute HIV infection. Highly active anti-retroviral treatment reduces viral load and increases life expectancy in HIV positive patients; however, it fails to fully eliminate latent HIV reservoirs. To revisit HIV as a curable disease, this article reviews a body of literature that highlights type I IFNs as mediators in the control of HIV infection, with particular focus on the anti-HIV restriction factors induced and/or activated by IFN-α. In addition, we discuss the relevance of type I IFN treatment in the context of HIV latency reversal, novel therapeutic intervention strategies and the potential for full HIV clearance.

In vitro stimulatory effect of N-acetyl tryptophan-glucopyranoside against gamma radiation induced immunosuppression.

PubMed

Malhotra, Poonam; Singh, Darshana; Kumar, Raj

2018-03-01

Radiation-induced manifestations like free radical burst, oxidative damage and apoptosis leading to cell death. In present study, N-acetyl tryptophan glucopyranoside (NATG) was assessed for its immune-radioprotective activities using J774A.1 cells. Clonogenic cell survival, cell cycle progression and cytokines i.e. IFN-γ, TNF-α, IL-2, IL-10, IL-12, IL-13 and IL-17A expression were evaluated in irradiated and NATG pretreated cells using clonogenic formation ability, flow cytometry and ELISA assay. Results indicated that 0.25μg/ml NATG exhibited maximum radioprotection against gamma-radiation (2Gy) without intervening in cell cycle progression. NATG pretreated (-2 h) plus irradiated cells showed significant elevation in IFN-γ (∼38.2%), IL-17A (∼53.7%) and IL-12 (∼58.8%) expression as compared to only irradiated cells. Conversely, significant decrease in TNF-α (∼21.6%), IL-10 (∼31.2%), IL-2 (∼23.7%) and IL-13 expression (∼17.8%) were observed in NATG pretreated plus irradiated cells as compared to irradiated cells. Conclusively, NATG pretreatment to irradiated J774A.1 cells, stimulate Th 1 while diminish Th 2 cytokines that contributes to radioprotection. © 2017 Wiley Periodicals, Inc.

Bioinformatics analysis of organizational and expressional characterizations of the IFNs, IRFs and CRFBs in grass carp Ctenopharyngodon idella.

PubMed

Liao, Zhiwei; Wan, Quanyuan; Su, Jianguo

2016-08-01

Interferons (IFNs) play crucial roles in the immune response of defense against viral infection and bacteria invasion. In the present study, we systematically identified and characterized the IFNs, their regulatory factors (Interferon Regulatory Factors, IRFs) and receptors (Cytokine Receptor Family B, CRFBs) in grass carp (Ctenopharyngodon idella). Grass carp IFNs can be classified into type I IFN (IFN-I) and type II IFN (IFN-II) like other teleosts. IFN-I consist of two groups with two (group I) or four (group II) cysteines in the mature peptide and can be further divided into three subgroups (IFN-a, -c and -d), containing four members: IFN1, IFN2, IFN3, IFN4 in grass carp. IFN-II contain two members, IFNγ2 with the similarity to mammalian IFNγ and a cyprinid specific IFNγ1 (IFNγ-rel) molecule. mRNA expression analyses of IFNs discovered that IFN1 and IFN-II were sustainably expressed in many tissues, while other IFN members were transiently expressed in specific tissues and time points. In the immune response, IFN transcriptions are primarily regulated through multiple IRFs after grass carp reovirus (GCRV) challenge. IRF family possess thirteen members in grass carp, which can be further divided into four subfamilies (IRF-1, -3, -4 and -5 subfamily), each of them plays different roles in the innate and adaptive immunity via various signaling pathways to interact with IFNs (mainly IFN-I). IFNs have to bind receptors (CRFBs) to perform their functions. CRFBs as IFN receptors contain six members in grass carp. The structure and expression characterizations of IFNs, IRFs and CRFBs were analyzed using bioinformatics tools. These results might provide basic data for the further functional research of IFN system, and deeply understand fish immune mechanisms against virus infection. Copyright © 2016 Elsevier Ltd. All rights reserved.

Cellular sources and targets of IFN-γ-mediated protection against viral demyelination and neurological deficits

PubMed Central

Murray, Paul D.; McGavern, Dorian B.; Pease, Larry R.; Rodriguez, Moses

2017-01-01

IFN-γ is an anti-viral and immunomodulatory cytokine critical for resistance to multiple pathogens. Using mice with targeted disruption of the gene for IFN-γ, we previously demonstrated that this cytokine is critical for resistance to viral persistence and demyelination in the Theiler’s virus model of multiple sclerosis. During viral infections, IFN-γ is produced by natural killer (NK) cells, CD4+ and CD8+ T cells; however, the proportions of lymphocyte subsets responding to virus infection influences the contributions to IFN-γ-mediated protection. To determine the lymphocyte subsets that produce IFN-γ to maintain resistance, we used adoptive transfer strategies to generate mice with lymphocyte-specific deficiencies in IFN-γ-production. We demonstrate that IFN-γ production by both CD4+ and CD8+ T cell subsets is critical for resistance to Theiler’s murine encephalomyelitis virus (TMEV)-induced demyelination and neurological disease, and that CD4+ T cells make a greater contribution to IFN-γ-mediated protection. To determine the cellular targets of IFN-γ-mediated responses, we used adoptive transfer studies and bone marrow chimerism to generate mice in which either hematopoietic or somatic cells lacked the ability to express IFN-γ receptor. We demonstrate that IFN-γ receptor must be present on central nervous system glia, but not bone marrow-derived lymphocytes, in order to maintain resistance to TMEV-induced demyelination. PMID:11857334

Biologic consequences of Stat1-independent IFN signaling

PubMed Central

Gil, M. Pilar; Bohn, Erwin; O'Guin, Andrew K.; Ramana, Chilakamarti V.; Levine, Beth; Stark, George R.; Virgin, Herbert W.; Schreiber, Robert D.

2001-01-01

Although Stat1 is required for many IFN-dependent responses, recent work has shown that IFNγ functions independently of Stat1 to affect the growth of tumor cells or immortalized fibroblasts. We now demonstrate that both IFNγ and IFNα/β regulate proliferative responses in cells of the mononuclear phagocyte lineage derived from Stat1-null mice. Using both representational difference analysis and gene arrays, we show that IFNγ exerts its Stat1-independent actions on mononuclear phagocytes by regulating the expression of many genes. This result was confirmed by monitoring changes in expression and function of the corresponding gene products. Regulation of the expression of these genes requires the IFNγ receptor and Jak1. The physiologic relevance of IFN-dependent, Stat1-independent signaling was demonstrated by monitoring antiviral responses in Stat1-null mice. Thus, the IFN receptors engage alternative Stat1-independent signaling pathways that have important physiological consequences. PMID:11390995

Siglec-1 inhibits RSV-induced interferon gamma production by adult T cells in contrast to newborn T cells.

PubMed

Jans, Jop; Unger, Wendy W J; Vissers, Marloes; Ahout, Inge M L; Schreurs, Inge; Wickenhagen, Arthur; de Groot, Ronald; de Jonge, Marien I; Ferwerda, Gerben

2018-04-01

Interferon gamma (IFN-γ) plays an important role in the antiviral immune response during respiratory syncytial virus (RSV) infections. Monocytes and T cells are recruited to the site of RSV infection, but it is unclear whether cell-cell interactions between monocytes and T cells regulate IFN-γ production. In this study, micro-array data identified the upregulation of sialic acid-binding immunoglobulin-type lectin 1 (Siglec-1) in human RSV-infected infants. In vitro, RSV increased expression of Siglec-1 on healthy newborn and adult monocytes. RSV-induced Siglec-1 on monocytes inhibited IFN-γ production by adult CD4 + T cells. In contrast, IFN-γ production by RSV in newborns was not affected by Siglec-1. The ligand for Siglec-1, CD43, is highly expressed on adult CD4 + T cells compared to newborns. Our data show that Siglec-1 reduces IFN-γ release by adult T cells possibly by binding to the highly expressed CD43. The Siglec-1-dependent inhibition of IFN-γ in adults and the low expression of CD43 on newborn T cells provides a better understanding of the immune response against RSV in early life and adulthood. © 2017 The Authors. European Journal of Immunology published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Combined therapy with danazol, pegilated interferon, and ribavirin improves thrombocytopenia and liver injury in rats with fibrosis.

PubMed

Alvarez, Guillermo Cabrera; Madrid-Marina, Vicente; Jimenez-Mendez, Ricardo; Buitimea, Angel Leon; Román, Margarita Bahena; Cortez-Gomez, Rudyard; Esparza, Jorge Reyes; Rodríguez-Fragoso, Lourdes

2007-01-01

The aim of this study was to investigate the effects of combinations of pegilated-interferon (PEG-IFN), ribavirin, and danazol on thrombocytopenia and liver injury in rats with fibrosis. Male adult Wistar rats were treated with either mineral oil, danazol (0.83 mg/kg per day), PEG-interferon alpha-2a (PEG-IFN, 0.3 microg/ week) + ribavirin (12 mg/kg per day), PEG-IFN + ribavirin + danazol, CCl(4) (4 g/kg for eight weeks), CCl(4) + PEG-IFN + ribavirin, or CCl(4) + PEG-IFN + ribavirin+ danazol. The following assays were conducted: hematology, clinical chemistry, liver function, liver fibrosis, lymphocyte cytokine mRNA expression, and bone-marrow DNA content. Platelet counts were low in sham-treated animals and animals treated with PEG- IFN + ribavirin (30% and 25% respectively; P < 0.05). PEG-IFN + ribavirin + danazol reduced platelet counts of fibrotic animals by only 9% (P < 0.05). PEG- IFN + ribavirin reduced hepatic collagen content by 50%, whereas danazol + PEG-IFN + ribavirin reduced hepatic collagen content by 60% (P < 0.05). PEG-IFN + ribavirin reduced the total bilirubin concentration by 27%, alanine amino transferase (ALT) activity by 75% and gamma-glutamyl transpeptidase (gamma-GTP) activity by 74% (P < 0.05). In contrast, danazol + PEG-IFN + ribavirin reduced total bilirubin levels by 61%, alkaline phosphatase activity by 45%, ALT activity by 76%, and gamma-GTP activity by 74% (P < 0.05). The only treatment that increased interleukin 10 (IL-10) mRNA in fibrotic rats was PEG-IFN + ribavirin. However, danazol + PEG-IFN + ribavirin reduced the expression of IL-6, IL-10, tumor necrosis factor alpha and transforming growth factor ss. Bone-marrow DNA content was not altered by any treatment. In conclusion, PEG-IFN + ribavirin + danazol could be a new therapeutic option for patients with liver injury, fibrosis, and thrombocytopenia.

Pegylated IFN-α suppresses hepatitis C virus by promoting the DAPK-mTOR pathway.

PubMed

Liu, Wei-Liang; Yang, Hung-Chih; Hsu, Ching-Sheng; Wang, Chih-Chiang; Wang, Tzu-San; Kao, Jia-Horng; Chen, Ding-Shinn

2016-12-20

Death-associated protein kinase (DAPK) has been found to be induced by IFN, but its antiviral activity remains elusive. Therefore, we investigated whether DAPK plays a role in the pegylated IFN-α (peg-IFN-α)-induced antiviral activity against hepatitis C virus (HCV) replication. Primary human hepatocytes, Huh-7, and infectious HCV cell culture were used to study the relationship between peg-IFN-α and the DAPK-mammalian target of rapamycin (mTOR) pathways. The activation of DAPK and signaling pathways were determined using immunoblotting. By silencing DAPK and mTOR, we further assessed the role of DAPK and mTOR in the peg-IFN-α-induced suppression of HCV replication. Peg-IFN-α up-regulated the expression of DAPK and mTOR, which was associated with the suppression of HCV replication. Overexpression of DAPK enhanced mTOR expression and then inhibited HCV replication. In addition, knockdown of DAPK reduced the expression of mTOR in peg-IFN-α-treated cells, whereas silencing of mTOR had no effect on DAPK expression, suggesting mTOR may be a downstream effector of DAPK. More importantly, knockdown of DAPK or mTOR significantly mitigated the inhibitory effects of peg-IFN-α on HCV replication. In conclusion, our data suggest that the DAPK-mTOR pathway is critical for anti-HCV effects of peg-IFN-α.

Loss of PTEN causes SHP2 activation, making lung cancer cells unresponsive to IFN-γ

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Chia-Ling; Chiang, Tzu-Hui; Tseng, Po-Chun

Src homology-2 domain-containing phosphatase (SHP) 2, an oncogenic phosphatase, inhibits type II immune interferon (IFN)-γ signaling by subverting signal transducers and activators of transcription 1 tyrosine phosphorylation and activation. For cancer immunoediting, this study aimed to investigate the decrease of phosphatase and tensin homolog deleted on chromosome 10 (PTEN), a tumor suppressor protein, leading to cellular impairment of IFN-γ signaling. In comparison with human lung adenocarcinoma A549 cells, the natural PTEN loss in another human lung adenocarcinoma line, PC14PE6/AS2 cells, presents reduced responsiveness in IFN-γ-induced IFN regulatory factor 1 activation and CD54 expression. Artificially silencing PTEN expression in A549 cellsmore » also caused cells to be unresponsive to IFN-γ without affecting IFN-γ receptor expression. IFN-γ-induced inhibition of cell proliferation and cytotoxicity were demonstrated in A549 cells but were defective in PC14PE6/AS2 cells and in PTEN-deficient A549 cells. Aberrant activation of SHP2 by ROS was specifically shown in PC14PE6/AS2 cells and PTEN-deficient A549 cells. Inhibiting ROS and SHP2 rescued cellular responses to IFN-γ-induced cytotoxicity and inhibition of cell proliferation in PC14PE6/AS2 cells. These results demonstrate that a decrease in PTEN facilitates ROS/SHP2 signaling, causing lung cancer cells to become unresponsive to IFN-γ. - Highlights: • This study demonstrates that PTEN decrease causes cellular unresponsive to IFN-γ. • Lung cancer cells with PTEN deficiency show unresponsive to IFN-γ signaling. • PTEN decrease inhibits IFN-γ-induced CD54, cell proliferation inhibition, and cytotoxicity. • ROS-mediated SHP2 activation makes PTEN-deficient cells unresponsive to IFN-γ.« less

Gamma-hydroxybutyric acid in male and female cynomolgus monkeys trained to discriminate 1.0 or 2.0 g/kg ethanol.

PubMed

Helms, Christa M; Rogers, Laura S M; Grant, Kathleen A

2008-07-01

Gamma-hydroxybutyric acid has been proposed as a pharmacotherapy for alcoholism in part based on similar discriminative stimulus effects as ethanol. To date, drug discrimination studies with gamma-hydroxybutyric acid and ethanol have exclusively used rodents or pigeons as subjects. To evaluate possible differences between species, sex, and route of administration, this study investigated the substitution of gamma-hydroxybutyric acid (intragastrically or intramuscularly) for ethanol 30 or 60 min after administration in male (n=6) and female (n=7) cynomolgus monkeys trained to discriminate 1.0 and 2.0 g/kg ethanol. At least one dose of gamma-hydroxybutyric acid completely or partially substituted for ethanol in three of the 13 monkeys tested, with each case occurring in female monkeys. Ethanol-appropriate responding did not increase with gamma-hydroxybutyric acid dose. Monkeys were more sensitive to the response rate decreasing effects of gamma-hydroxybutyric acid administered intramuscularly compared with intragastrically. The lack of gamma-hydroxybutyric acid substitution for ethanol suggests that these drugs have different receptor bases for discrimination. Furthermore, the data do not strongly support shared discriminative stimulus effects as the rationale for gamma-hydroxybutyric acid pharmacotherapy for alcoholism.

IFN-β: A Contentious Player in Host–Pathogen Interaction in Tuberculosis

PubMed Central

Sabir, Naveed; Hussain, Tariq; Shah, Syed Zahid Ali; Zhao, Deming; Zhou, Xiangmei

2017-01-01

Tuberculosis (TB) is a major health threat to the human population worldwide. The etiology of the disease is Mycobacterium tuberculosis (Mtb), a highly successful intracellular pathogen. It has the ability to manipulate the host immune response and to make the intracellular environment suitable for its survival. Many studies have addressed the interactions between the bacteria and the host immune cells as involving many immune mediators and other cellular players. Interferon-β (IFN-β) signaling is crucial for inducing the host innate immune response and it is an important determinant in the fate of mycobacterial infection. The role of IFN-β in protection against viral infections is well established and has been studied for decades, but its role in mycobacterial infections remains much more complicated and debatable. The involvement of IFN-β in immune evasion mechanisms adopted by Mtb has been an important area of investigation in recent years. These advances have widened our understanding of the pro-bacterial role of IFN-β in host–pathogen interactions. This pro-bacterial activity of IFN-β appears to be correlated with its anti-inflammatory characteristics, primarily by antagonizing the production and function of interleukin 1β (IL-1β) and interleukin 18 (IL-18) through increased interleukin 10 (IL-10) production and by inhibiting the nucleotide-binding domain and leucine-rich repeat protein-3 (NLRP3) inflammasome. Furthermore, it also fails to provoke a proper T helper 1 (Th1) response and reduces the expression of major histocompatibility complex II (MHC-II) and interferon-γ receptors (IFNGRs). Here we will review some studies to provide a paradigm for the induction, regulation, and role of IFN-β in mycobacterial infection. Indeed, recent studies suggest that IFN-β plays a role in Mtb survival in host cells and its downregulation may be a useful therapeutic strategy to control Mtb infection. PMID:29258190

IFN-β: A Contentious Player in Host-Pathogen Interaction in Tuberculosis.

PubMed

Sabir, Naveed; Hussain, Tariq; Shah, Syed Zahid Ali; Zhao, Deming; Zhou, Xiangmei

2017-12-16

Tuberculosis (TB) is a major health threat to the human population worldwide. The etiology of the disease is Mycobacterium tuberculosis (Mtb), a highly successful intracellular pathogen. It has the ability to manipulate the host immune response and to make the intracellular environment suitable for its survival. Many studies have addressed the interactions between the bacteria and the host immune cells as involving many immune mediators and other cellular players. Interferon-β (IFN-β) signaling is crucial for inducing the host innate immune response and it is an important determinant in the fate of mycobacterial infection. The role of IFN-β in protection against viral infections is well established and has been studied for decades, but its role in mycobacterial infections remains much more complicated and debatable. The involvement of IFN-β in immune evasion mechanisms adopted by Mtb has been an important area of investigation in recent years. These advances have widened our understanding of the pro-bacterial role of IFN-β in host-pathogen interactions. This pro-bacterial activity of IFN-β appears to be correlated with its anti-inflammatory characteristics, primarily by antagonizing the production and function of interleukin 1β (IL-1β) and interleukin 18 (IL-18) through increased interleukin 10 (IL-10) production and by inhibiting the nucleotide-binding domain and leucine-rich repeat protein-3 (NLRP3) inflammasome. Furthermore, it also fails to provoke a proper T helper 1 (Th1) response and reduces the expression of major histocompatibility complex II (MHC-II) and interferon-γ receptors (IFNGRs). Here we will review some studies to provide a paradigm for the induction, regulation, and role of IFN-β in mycobacterial infection. Indeed, recent studies suggest that IFN-β plays a role in Mtb survival in host cells and its downregulation may be a useful therapeutic strategy to control Mtb infection.

VISA is an adapter protein required for virus-triggered IFN-beta signaling.

PubMed

Xu, Liang-Guo; Wang, Yan-Yi; Han, Ke-Jun; Li, Lian-Yun; Zhai, Zhonghe; Shu, Hong-Bing

2005-09-16

Viral infection or stimulation of TLR3 triggers signaling cascades, leading to activation of the transcription factors IRF-3 and NF-kappaB, which collaborate to induce transcription of type I interferon (IFN) genes. In this study, we identified a protein termed VISA (for virus-induced signaling adaptor) as a critical component in the IFN-beta signaling pathways. VISA recruits IRF-3 to the cytoplasmic viral dsRNA sensor RIG-I. Depletion of VISA inhibits virus-triggered and RIG-I-mediated activation of IRF-3, NF-kappaB, and the IFN-beta promoter, suggesting that VISA plays a central role in virus-triggered TLR3-independent IFN-beta signaling. Our data also indicate that VISA interacts with TRIF and TRAF6 and mediates bifurcation of the TLR3-triggered NF-kappaB and IRF-3 activation pathways. These findings suggest that VISA is critically involved in both virus-triggered TLR3-independent and TLR3-mediated antiviral IFN signaling.

Effects of IFN-β1a and IFN-β1b treatment on the expression of cytokines, inducible NOS (NOS type II), and myelin proteins in animal model of multiple sclerosis.

PubMed

Lubina-Dąbrowska, Natalia; Stepień, Adam; Sulkowski, Grzegorz; Dąbrowska-Bouta, Beata; Langfort, Józef; Chalimoniuk, Małgorzata

2017-08-01

The aim of this study was to investigate the effects of interferon (IFN)-β1a and IFN-β1b treatment on inflammatory factors and myelin protein levels in the brain cortex of the Lewis rat experimental autoimmune encephalomyelitis (EAE), animal model of multiple sclerosis. To induce EAE, rat were immunized with inoculums containing spinal cord guinea pig homogenized in phosphate-buffered saline and emulsified in Freund's complete adjuvant containing 110 µg of the appropriate antigen in 100 µl of an emulsion and additionally 4-mg/ml Mycobacterium tuberculosis (H37Ra). The rats were treated three times per week with subcutaneous applications of 300,000 units IFN-β1a or IFN-β1b. The treatments were started 8 days prior to immunization and continued until day 14 after immunization. The rats were killed on the 14th day of the experiment. EAE induced dramatic increase in interleukin (IL)-1β, IL-6, and tumor necrosis factor (TNF)-concentrations and inducible nitric oxide synthase (iNOS) expression in the brain, which closely corresponded to the course of neurological symptoms and the loss of weight. Both IFN-β1b and IFN-β1a treatments inhibited the pro-inflammatory cytokines (IL-6, IL-1β, TNF-α and IFN-γ), decreased the activation of astrocytes, increased the myelin protein level in the brain cortex, and improved the neurological status of EAE rats by different mechanisms; IFN-β1a reduced iNOS expression, at least in part, by the enhancement of IL-10, while IFN-β1b diminished IL-10 concentration and did not decrease EAE-induced iNOS expression.

The G-protein coupled receptor, GPR84 regulates IL-4 production by T lymphocytes in response to CD3 crosslinking.

PubMed

Venkataraman, Chandrasekar; Kuo, Frederick

2005-11-15

The orphan G-protein coupled receptor, GPR84 is highly expressed in the bone marrow, and in splenic T cells and B cells. In this study, GPR84-deficient mice were generated to understand the biological function of this orphan receptor. The proliferation of T and B cells in response to various mitogens was normal in GPR84-deficient mice. Interestingly, primary stimulation of T cells with anti-CD3 resulted in increased IL-4 but not IL-2 or IFN-gamma production in GPR84(-/-) mice compared to wild-type mice. Augmented IL-4 production in GPR84-deficient T cells was not related to increased frequency of IL-4-secreting cells in response to anti-CD3 stimulation. In fact, stimulation with anti-CD3 and anti-CD28 resulted in increased levels of IL-4 but not IFN-gamma steady-state mRNA in GPR84(-/-) T cells. In addition, Th2 effector cells generated in vitro from GPR84(-/-) mice produced higher levels of IL-4, IL-5 and IL-13 compared to wild-type mice. However, there was no detectable difference in the extent of IL-4 and IL-5 production between the two groups of mice in response to antigen stimulation of spleen cells, isolated from mice previously immunized with OVA in alum. These studies reveal a novel role for GPR84 in regulating early IL-4 gene expression in activated T cells.

[Study the rudimentary immunoregulatory mechanisms of Ganoderma Spore oil on immunocompromized mice].

PubMed

Yi, Youjin; Hu, Shun; Xiong, Xingyao; Liu, Dongbo; Zhong, Yingli

2012-09-01

To study the rudimentary immunoregulatory mechanisms of Ganoderma spore oil on immunocompromized mice model. Thrity KM mice were randomly selected and assigned into three groups (ten animals per group): the model control group, Ganoderma Lucidum spores oil group and the normal control group. The model control group and Ganoderma Lucidum spores oil group were injected intraperitoneally with cyclophosphamide at 40 mg x kg(-1) d to generate a immunocompromized mice model. The normal control group were administered with 0.9% NaCl solution 0.1 ml/10 g BW as placebo. All agents were given orally once a day, given for consecutive 30 days, Ganoderma Lucidum spores oil group 150 mg/kg, the others given maize 0.1 ml/10 g BW. The serum TNF-alpha , IFN-gamma content of the mice through ELISA kit and the expression levels of IL-2, IL-10, IL-12, IL-4, IFN-gamma, TNF-alpha mRNA in mouse spleen and thymus were examined by RT-PCR to rudimentary study its immunoregulatory mechanisms. Ganoderma spore oil can significantly increased the content of TNF-alpha and IFN-gamma in the serum and the expression levels of IL-2, IL-10, IL-12, IL-4, IFN-gamma, TNF-alpha mRNA in spleen and thymus, with obvious difference from the model control (P < or = 0.05). Ganoderma spore oil can be able to improve the above cytokine ion expression to immunoregulate the immunocompromized mice.

T-Cell Mineralocorticoid Receptor Controls Blood Pressure by Regulating Interferon-Gamma.

PubMed

Sun, Xue-Nan; Li, Chao; Liu, Yuan; Du, Lin-Juan; Zeng, Meng-Ru; Zheng, Xiao-Jun; Zhang, Wu-Chang; Liu, Yan; Zhu, Mingjiang; Kong, Deping; Zhou, Li; Lu, Limin; Shen, Zhu-Xia; Yi, Yi; Du, Lili; Qin, Mu; Liu, Xu; Hua, Zichun; Sun, Shuyang; Yin, Huiyong; Zhou, Bin; Yu, Ying; Zhang, Zhiyuan; Duan, Sheng-Zhong

2017-05-12

Hypertension remains to be a global public health burden and demands novel intervention strategies such as targeting T cells and T-cell-derived cytokines. Mineralocorticoid receptor (MR) antagonists have been clinically used to treat hypertension. However, the function of T-cell MR in blood pressure (BP) regulation has not been elucidated. We aim to determine the role of T-cell MR in BP regulation and to explore the mechanism. Using T-cell MR knockout mouse in combination with angiotensin II-induced hypertensive mouse model, we demonstrated that MR deficiency in T cells strikingly decreased both systolic and diastolic BP and attenuated renal and vascular damage. Flow cytometric analysis showed that T-cell MR knockout mitigated angiotensin II-induced accumulation of interferon-gamma (IFN-γ)-producing T cells, particularly CD8 + population, in both kidneys and aortas. Similarly, eplerenone attenuated angiotensin II-induced elevation of BP and accumulation of IFN-γ-producing T cells in wild-type mice. In cultured CD8 + T cells, T-cell MR knockout suppressed IFN-γ expression whereas T-cell MR overexpression and aldosterone both enhanced IFN-γ expression. At the molecular level, MR interacted with NFAT1 (nuclear factor of activated T-cells 1) and activator protein-1 in T cells. Finally, T-cell MR overexpressing mice manifested more elevated BP compared with control mice after angiotensin II infusion and such difference was abolished by IFN-γ-neutralizing antibodies. MR may interact with NFAT1 and activator protein-1 to control IFN-γ in T cells and to regulate target organ damage and ultimately BP. Targeting MR in T cells specifically may be an effective novel approach for hypertension treatment. © 2017 American Heart Association, Inc.

N-acetyl-cysteine prevents toxic oxidative effects induced by IFN-α in human neurons.

PubMed

Alboni, Silvia; Gibellini, Lara; Montanari, Claudia; Benatti, Cristina; Benatti, Stefania; Tascedda, Fabio; Brunello, Nicoletta; Cossarizza, Andrea; Pariante, Carmine M

2013-09-01

Currently IFN-α is widely used for effective treatment of viral infections and several malignancies. However, IFN-α can cause neuropsychiatric disturbances and mental impairments, including fatigue, insomnia, depression, irritability and cognitive deficits. Molecular and cellular mechanisms leading to such side-effects are still poorly understood. Neurons seem to be an important target in mediating cellular effects induced by exposure to this cytokine, but so far little is known about IFN-α-induced effects on these cells. We have investigated the ability of IFN-α (2-100 ng/ml) to induce damage and toxicity to the human neuroblastoma SH-SY5Y cell line, commonly used for studying such phenomena, and the mechanisms underlying these effects. After 24 h treatment, IFN-α increased mitochondrial activity, whereas cell density was reduced in a dose- and time-dependent manner. This effect did not depend on reduced cell proliferation, but rather the activation of apoptosis, as revealed by an increased Bax:Bcl-2 mRNA ratio after 72-h IFN-α exposure. At this time-point, IFN-α also reduced the expression of the brain-derived neurotrophic factor gene, and induced an increase in reactive oxygen species (ROS). A co-treatment with N-acetyl-cysteine (NAC; 5 mm), a potent antioxidant and mitochondrial modulator, was able to counteract all of these IFN-α-induced effects. These findings demonstrated that IFN-α induces neurotoxicity and apoptosis that is, in part, very likely due to mitochondrial damages and production of ROS. We suggest that NAC, already tested for the treatment of psychiatric disorders, may be useful to prevent IFN-α-induced central side-effects in a safe and effective way.

CD3+ICOS+ T cells show differences in the synthesis of nitric oxide, IFN-γ, and IL-10 in patients with pulmonary tuberculosis or in healthy household contacts.

PubMed

Lara-Rodríguez, Carmen; Alvarado-Vásquez, Noé; Bernal, Demetrio; Gorocica, Patricia; Zenteno, Edgar; Lascuraín, Ricardo

2016-11-01

Evidence indicates that more than 90 % of infected individuals never develop active tuberculosis. This fact highlights the relevance of the immune response in tuberculosis control. The inducible co-stimulator (ICOS) is a regulator of the function, differentiation, proliferation, and activation of T cells. Moreover, T cells synthesise nitric oxide (NO), interferon gamma (IFN-γ), and interleukin (IL)-10, which help regulate the immune response to tuberculosis. Therefore, we assessed the synthesis of NO, IFN-γ, and IL-10 in CD3 + ICOS + T cells from healthy individuals, household contacts (HHC), and patients with active pulmonary tuberculosis (PTB), previously stimulated with the antigen H37Rv. Our results indicated a significant increase in both the percentage of ICOS + cells and CD3 + ICOS + T cells producing NO, IFN-γ, and IL-10 in cells obtained from patients with PTB (p < 0.01). In addition, a high mitochondrial membrane potential (ΔΨ m ) in CD3 + ICOS + T cells was observed in the cells from HHC and from PTB patients, and is associated with the activation of T cells. In conclusion, results show that the CD3 + ICOS + T cells obtained from PTB patients are the main producers of NO, IFN-γ, and IL-10. In addition, our results imply that NO is a modulator of ICOS expression of T cells from PTB patients.

Effects of interferon-gamma and lipopolysaccharide on macrophage iron metabolism are mediated by nitric oxide-induced degradation of iron regulatory protein 2.

PubMed

Kim, S; Ponka, P

2000-03-03

Iron regulatory proteins (IRP-1 and IRP-2) control the synthesis of transferrin receptors (TfR) and ferritin by binding to iron-responsive elements, which are located in the 3'-untranslated region and the 5'-untranslated region of their respective mRNAs. Cellular iron levels affect binding of IRPs to iron-responsive elements and consequently expression of TfR and ferritin. Moreover, NO(*), a redox species of nitric oxide that interacts primarily with iron, can activate IRP-1 RNA binding activity resulting in an increase in TfR mRNA levels. Recently we found that treatment of RAW 264.7 cells (a murine macrophage cell line) with NO(+) (nitrosonium ion, which causes S-nitrosylation of thiol groups) resulted in a rapid decrease in RNA binding of IRP-2 followed by IRP-2 degradation, and these changes were associated with a decrease in TfR mRNA levels (Kim, S., and Ponka, P. (1999) J. Biol. Chem. 274, 33035-33042). In this study, we demonstrated that stimulation of RAW 264.7 cells with lipopolysaccharide (LPS) and interferon-gamma (IFN-gamma) increased IRP-1 binding activity, whereas RNA binding of IRP-2 decreased and was followed by a degradation of this protein. Moreover, the decrease of IRP-2 binding/protein levels was associated with a decrease in TfR mRNA levels in LPS/IFN-gamma-treated cells, and these changes were prevented by inhibitors of inducible nitric oxide synthase. Furthermore, LPS/IFN-gamma-stimulated RAW 264.7 cells showed increased rates of ferritin synthesis. These results suggest that NO(+)-mediated degradation of IRP-2 plays a major role in iron metabolism during inflammation.

The elephant interferon gamma assay: a contribution to diagnosis of tuberculosis in elephants.

PubMed

Angkawanish, T; Morar, D; van Kooten, P; Bontekoning, I; Schreuder, J; Maas, M; Wajjwalku, W; Sirimalaisuwan, A; Michel, A; Tijhaar, E; Rutten, V

2013-11-01

Mycobacterium tuberculosis (M. tb) has been shown to be the main causative agent of tuberculosis in elephants worldwide. M. tb may be transmitted from infected humans to other species including elephants and vice versa, in case of prolonged intensive contact. An accurate diagnostic approach covering all phases of the infection in elephants is required. As M. tb is an intracellular pathogen and cell-mediated immune (CMI) responses are elicited early after infection, the skin test is the CMI assay of choice in humans and cattle. However, this test is not applicable in elephants. The interferon gamma (IFN-γ) assay is considered a good alternative for the skin test in general, validated for use in cattle and humans. This study was aimed at development of an IFN-γ assay applicable for diagnosis of tuberculosis in elephants. Recombinant elephant IFN-γ (rEpIFN-γ) produced in eukaryotic cells was used to immunize mice and generate the monoclonal antibodies. Hybridomas were screened for IFN-γ-specific monoclonal antibody production and subcloned, and antibodies were isotyped and affinity purified. Western blot confirmed recognition of the rEpIFN-γ. The optimal combination of capture and detection antibodies selected was able to detect rEpIFN-γ in concentrations as low as 1 pg/ml. The assay was shown to be able to detect the native elephant IFN-γ, elicited in positive-control cultures (pokeweed mitogen (PWM), phorbol myristate acetate plus ionomycin (PMA/I)) of both Asian and African elephant whole-blood cultures (WBC). Preliminary data were generated using WBC from non-infected elephants, a M. tb infection-suspected elephant and a culture-confirmed M. tb-infected elephant. The latter showed measurable production of IFN-γ after stimulation with ESAT6/CFP10 PPDB and PPDA in concentration ranges as elicited in WBC by Mycobacterium tuberculosis complex (MTBC)-specific antigens in other species. Hence, the IFN-γ assay presented potential as a diagnostic tool for the

Limitations of Using IL-17A and IFN-γ-Induced Protein 10 to Detect Bovine Tuberculosis

PubMed Central

Xin, Ting; Gao, Xintao; Yang, Hongjun; Li, Pingjun; Liang, Qianqian; Hou, Shaohua; Sui, Xiukun; Guo, Xiaoyu; Yuan, Weifeng; Zhu, Hongfei; Ding, Jiabo; Jia, Hong

2018-01-01

Bovine tuberculosis (bTB) is primarily caused by infection with Mycobacterium bovis, which belongs to the Mycobacterium tuberculosis complex. The airborne route is considered the most common for transmission of M. bovis, and more than 15% of cattle with bTB shed the Mycobacterium, which can be detect by nested PCR to amplify mycobacterial mpb70 from a nasal swab from a cow. To screen for cytokines fostering early and accurate detection of bTB, peripheral blood mononuclear cells were isolated from naturally M. bovis-infected, experimentally M. bovis 68002-infected, and uninfected cattle, then these cells were stimulated by PPD-B, CFP-10-ESAT-6 (CE), or phosphate-buffered saline (PBS) for 6 h. The levels of interferon gamma (IFN-γ), IFN-γ-induced protein 10 (IP-10), IL-6, IL-12, IL-17A, and tumor necrosis factor alpha mRNA were measured using real-time PCR. To explore the cytokines associated with different periods of M. bovis infection, cattle were divided into three groups: PCR-positive, PCR-negative, and uninfected using the tuberculin skin test, CFP-10/ESAT-6/TB10.4 protein cocktail-based skin test, IFN-γ release assay (IGRA), CFP-10/ESAT-6 (CE)-based IGRA, and nested PCR. The expression of IP-10, IL-17A, and IFN-γ proteins induced by PPD-B, CE, or PBS was detected by ELISA. The results showed that levels of PPD-B-stimulated IL-17A and IP-10 (mRNA and protein), and CE-induced IP-10 (mRNA and protein) were significantly higher in cattle naturally or experimentally infected with M. bovis than in those that were uninfected. The levels of PPD-B- or CE-induced IL-17A and IP-10 (protein) could be used to differentiate M. bovis-infected calves from uninfected ones for 6 to 30 weeks post-infection, whereas PPD-B- and CE-induced IP-10 and IL-17A mRNA expression could be used to differentiate M. bovis-infected calves from uninfected ones between 6 and 58 weeks post-infection. However, CE-induced IL-17A (protein) was not a reliable indicator of M. bovis infection

Immunostimulatory effects of natural human interferon-alpha (huIFN-alpha) on carps Cyprinus carpio L.

PubMed

Watanuki, Hironobu; Chakraborty, Gunimala; Korenaga, Hiroki; Kono, Tomoya; Shivappa, R B; Sakai, Masahiro

2009-10-15

Human interferon-alpha (huIFN-alpha) is an important immunomodulatory substance used in the treatment and prevention of numerous infectious and immune-related diseases in animals. However, the immunostimulatory effects of huIFN-alpha in fish remain to be investigated. In the current study, the immune responses of the carp species Cyprinus carpio L. to treatment with huIFN-alpha were analyzed via measurement of superoxide anion production, phagocytic activity and the expression of cytokine genes including interleukin-1beta, tumor necrosis factor-alpha and interleukin 10. Low doses of huIFN-alpha were administered orally once a day for 3 days, and sampling was carried out at 1, 3 and 5 days post-treatment. Our results indicate that a low dose of huIFN-alpha significantly increased phagocytic activity and superoxide anion production in the carp kidney. The huIFN-alpha-treated fish also displayed a significant upregulation in cytokine gene expression. The current study demonstrates the stimulatory effects of huIFN-alpha on the carp immune system and highlights the immunomodulatory role of huIFN-alpha in fish.

Mycobacterium tuberculosis ESAT6 induces IFN-β gene expression in Macrophages via TLRs-mediated signaling.

PubMed

Jang, Ah-Ra; Choi, Joo-Hee; Shin, Sung Jae; Park, Jong-Hwan

2018-04-01

Mycobacterium tuberculosis is a highly virulent bacterium that causes tuberculosis. It infects about one third of the world's population. Type I interferons (IFNs) play a detrimental role in host defense against M. tuberculosis infection. Proteins secreted by M. tuberculosis through ESX-1 secretion system contribute to type I IFNs production. However, the precise mechanism by which 6-kDa early secretory antigen target (ESAT6), one of ESX-1-mediated secretory proteins, induces type I IFNs production in host cells is currently unclear. Therefore, the objective of the present study was to determine the underlying molecular mechanism regulating ESAT6-mediated gene expression of IFN-β in macrophages. Recombinant ESAT6 produced from E. coli expression system induced IFN-β gene expression in various types of macrophages such as mouse bone marrow-derived macrophages (BMDMs), peritoneal macrophages, and MH-S cells (murine alveolar macrophage cell line). Deficiency of TLR4 and TRIF absolutely abrogated ESAT6-induced IFN-β gene expression. TLR2 and MyD88 were partially involved in IFN-β gene expression in response to low dose of ESAT6. Another recombinant ESAT6 produced from baculovirus system also upregulated IFN-β gene expression via TLR4-dependent pathway. Polymyxin B (PMB) treatment impaired LPS-induced IFN-β expression. However, IFN-β expression induced by ESAT6 was not influenced by PMB. This suggests that ESAT6-mediated IFN-β expression is not due to LPS contamination. Treatment with ESAT6 resulted in activation of TBK1 and IRF3 in macrophages. Such activation was abolished in TLR4- and TRIF-deficient cells. Moreover, inhibition of IRF3 and TBK1 suppressed IFN-β gene expression in response to ESAT6. Our results suggest that ESAT6 might contribute to virulence of M. tuberculosis by regulating type I IFNs production through TLR4-TRIF signaling pathway. Copyright © 2017 Elsevier Ltd. All rights reserved.

Kinetics of IFN-gamma and TNF-alpha gene expression and their relationship with disease progression after infection with Mycobacterium tuberculosis in guinea pigs.

PubMed

Roh, In Soon; Cho, Sungae; Eum, Seok-Yong; Cho, Sang-Nae

2013-05-01

Guinea pig is one of the most suitable animal models for Mycobacterium tuberculosis (M. tb) infection since it shows similarities to pulmonary infection in humans. Although guinea pig shows hematogenous spread of M. tb infection into the whole body, immunological studies have mainly focused on granulomatous tissues in lungs and spleens. In order to investigate the time-course of disease pathogenesis and immunological profiles in each infected organ, we performed the following approaches with guinea pigs experimentally infected with M. tb over a 22-week post-infection period. We examined body weight changes, M. tb growth curve, cytokine gene expression (IFN-γ and TNF-α), and histopathology in liver, spleen, lungs and lymph nodes of infected guinea pigs. The body weights of infected guinea pigs did not increase as much as uninfected ones and the number of M. tb bacilli in their organs increased except bronchotracheal lymph node during the experimental period. The gene expression of IFN-γ and TNF-α was induced between 3 and 6 weeks of infection; however, kinetic profiles of cytokine gene expression showed heterogeneity among organs over the study period. Histophathologically granulomatous lesions were developed in all four organs of infected guinea pigs. Although IFN-γ and TNF-α gene expression profiles showed heterogeneity, the granuloma formation was clearly observed in every organ regardless of whether the number of bacilli increased or decreased. However, this protective immunity was accompanied with severe tissue damage in all four organs, which may lead to the death of guinea pigs.

The Superiority of IFN-λ as a Therapeutic Candidate to Control Acute Influenza Viral Lung Infection.

PubMed

Kim, Sujin; Kim, Min-Ji; Kim, Chang-Hoon; Kang, Ju Wan; Shin, Ha Kyung; Kim, Dong-Young; Won, Tae-Bin; Han, Doo Hee; Rhee, Chae Seo; Yoon, Joo-Heon; Kim, Hyun Jik

2017-02-01

Here, we studied the IFN-regulated innate immune response against influenza A virus (IAV) infection in the mouse lung and the therapeutic effect of IFN-λ2/3 in acute IAV lung infection. For viral infections, IAV (WS/33, H1N1, PR8 H1N1, H5N1) were inoculated into wild-type mice by intranasal delivery, and IAV mRNA level and viral titer were measured. To compare the antiviral effect of IFNs in vivo in the lung, neutralizing antibodies and recombinant IFNs were used. After intranasal inoculation of IAV into mice, viral infection peaked at 7 days postinfection, and the IAV titer also reached its peak at this time. We found that IFN-β and IFN-λ2/3 were preferentially induced after IAV infection and the IFN-λ2/3-mediated innate immune response was specifically required for the induction of IFN-stimulated genes (ISGs) transcription in the mouse respiratory tract. Neutralization of secreted IFN-λ2/3 aggravated acute IAV lung infection in mice with intact IFN-β induction; consistent with this finding, the transcription of ISGs was significantly reduced. Intranasal administration of IFN-λ2/3 significantly suppressed various strains of IAV infection, including WS/33 (H1N1), PR (H1N1), and H5N1 in the mouse lung, and was accompanied by greater up-regulation of ISGs. Taken together, our data indicate that the IFN-λ2/3-mediated innate immune response is necessary to protect the lungs from IAV infection, and intranasally delivered IFN-λ2/3 has the potential to be a useful therapeutic strategy for treating acute IAV lung infection.

Annexin V Incorporated into Influenza Virus Particles Inhibits Gamma Interferon Signaling and Promotes Viral Replication

PubMed Central

Berri, Fatma; Haffar, Ghina; Lê, Vuong Ba; Sadewasser, Anne; Paki, Katharina; Lina, Bruno; Wolff, Thorsten

2014-01-01

ABSTRACT During the budding process, influenza A viruses (IAVs) incorporate multiple host cell membrane proteins. However, for most of them, their significance in viral morphogenesis and infectivity remains unknown. We demonstrate here that the expression of annexin V (A5) is upregulated at the cell surface upon IAV infection and that a substantial proportion of the protein is present in lipid rafts, the site of virus budding. Western blotting and immunogold analysis of highly purified IAV particles showed the presence of A5 in the virion. Significantly, gamma interferon (IFN-γ)-induced Stat phosphorylation and IFN-γ-induced 10-kDa protein (IP-10) production in macrophage-derived THP-1 cells was inhibited by purified IAV particles. Disruption of the IFN-γ signaling pathway was A5 dependent since downregulation of its expression or its blockage reversed the inhibition and resulted in decreased viral replication in vitro. The functional significance of these results was also observed in vivo. Thus, IAVs can subvert the IFN-γ antiviral immune response by incorporating A5 into their envelope during the budding process. IMPORTANCE Many enveloped viruses, including influenza A viruses, bud from the plasma membrane of their host cells and incorporate cellular surface proteins into viral particles. However, for the vast majority of these proteins, only the observation of their incorporation has been reported. We demonstrate here that the host protein annexin V is specifically incorporated into influenza virus particles during the budding process. Importantly, we showed that packaged annexin V counteracted the antiviral activity of gamma interferon in vitro and in vivo. Thus, these results showed that annexin V incorporated in the viral envelope of influenza viruses allow viral escape from immune surveillance. Understanding the role of host incorporated protein into virions may reveal how enveloped RNA viruses hijack the host cell machinery for their own purposes. PMID

High IFN-gamma and TNF production by peripheral NK cells of Colombian patients with different clinical presentation of Plasmodium falciparum

PubMed Central

2012-01-01

Background In Colombia, Plasmodium falciparum infection rarely results in severe disease or mortality compared to infections in African populations. During natural infection NK cells exhibit a cytolytic effect and regulate dendritic cells, macrophages, neutrophils as well as affect antigen specific T and B cell responses. To characterize the NK cells in P. falciparum infected patients of a highly endemic region of Colombia, the degree of NK proliferation and production of IFN gamma and TNF production in these cells were explored. Methods Seventeen patients with acute and three with severe P. falciparum malaria patients from the Northwest region of the country were recruited in the study. In addition, 20 healthy controls were included: 10 from Medellin (no-transmission area) and 10 from the Uraba region (a malaria endemic area). Immunophenotypic analysis of peripheral mononuclear cells was performed by FACS to detect total number of NK cells, subtypes and intracellular IFNγ and TNF production by NK cells in the different patient groups. Results The total mean CD56+/CD3- NK cell proportions in acute and severe malaria subjects were 9.14% (7.15%CD56dim, 2.01%CD56bright) and 19.62% (16.05%CD56dim, 3.58%CD56bright), respectively, in contrast to healthy controls from endemic (total mean CD56+/CD3-1.2%) and non-endemic area (total mean CD56+/CD3- 0.67%). Analysis of basal IFNγ and TNF levels confirmed the CD56bright NK population as the main cytokine producer (p < 0.0001) in the groups affected with malaria, with the CD56dim NK cell exhibiting the highest potential of TNF production after stimulus in the acute malaria group. Conclusions The results confirm the important role of not only CD56bright but also of CD56dim NK cell populations as producers of the two cytokines in malaria patients in Colombia. PMID:22316273

Patients with inflammatory bowel disease (IBD) reveal increased induction capacity of intracellular interferon-gamma (IFN-γ) in peripheral CD8+ lymphocytes co-cultured with intestinal epithelial cells

PubMed Central

Bisping, G; Lügering, N; Lütke-Brintrup, S; Pauels, H -G; Schürmann, G; Domschke, W; Kucharzik, T

2001-01-01

Intestinal epithelial cells seem to play a key role during IBD. The network of cellular interactions between epithelial cells and lamina propria mononuclear cells is still incompletely understood. In the following co-culture model we investigated the influence of intestinal epithelial cells on cytokine expression of T cytotoxic and T helper cells from patients with IBD and healthy controls. Peripheral blood mononuclear cells (PBMC) were purified by a Ficoll–Hypaque gradient followed by co-incubation with epithelial cells in multiwell cell culture insert plates in direct contact as well as separated by transwell filters. We used Caco-2 cells as well as freshly isolated colonic epithelia obtained from surgical specimens. Three-colour immunofluorescence flow cytometry was performed after collection, stimulation and staining of PBMC with anti-CD4, anti-CD8, anti-IFN-γ and anti-IL-4. Patients with IBD (Crohn's disease (CD), n = 12; ulcerative colitis (UC), n = 16) and healthy controls (n = 10) were included in the study. After 24 h of co-incubation with Caco-2 cells we found a significant increase of IFN-γ-producing CD8+ lymphocytes in patients with IBD. In contrast, healthy controls did not respond to the epithelial stimulus. No significant differences could be found between CD and UC or active and inactive disease. A significant increase of IFN-γ+/CD8+ lymphocytes in patients with UC was also seen after direct co-incubation with primary cultures of colonic crypt cells. The observed epithelial–lymphocyte interaction seems to be MHC I-restricted. No significant epithelial cell-mediated effects on cytokine expression were detected in the PBMC CD4+ subsets. Patients with IBD—even in an inactive state of disease—exert an increased capacity for IFN-γ induction in CD8+ lymphocytes mediated by intestinal epithelial cells. This mechanism may be important during chronic intestinal inflammation, as in the case of altered mucosal barrier function epithelial cells may

Cytokine-induced depression during IFN-α treatment: the role of IL-6 and sleep quality

PubMed Central

Prather, Aric A.; Rabinovitz, Mordechai; Pollock, Bruce G.; Lotrich, Francis E.

2009-01-01

Depressive symptoms, poor sleep quality, and systemic markers of inflammation (e.g. interleukin (IL)-6) are frequently associated. Interferon-alpha (IFN-α) therapy results in major depressive disorder (MDD) in some people, offering the possibility to elucidate the relationship of MDD to sleep and inflammation during treatment. In particular, delineating the temporal relations among these factors could help inform their causal relationships. To this end, a cohort of 95 non-depressed hepatitis C patients was followed prospectively for four consecutive months during IFN-α therapy. We found that higher pre-treatment levels of circulating IL-6 predicted incidence of MDD (X2(1)=7.7; p<0.05). Time-lagged mixed-effect analyses supported uni-directional associations in which IL-6 predicted next month’s PSQI scores (F(47, 11.6) = 78.4; p<0.0005), and PSQI scores predicted next month’s depressive Beck Depression Inventory-II (BDI) scores (F(16,22.6) = 3.4; p<0.005). In addition, on any given month of treatment, IL-6 levels predicted BDI symptoms the following month (F(16,97.5) = 7.3; p<0.0005), and conversely BDI predicted next month’s IL-6 (F(14,7.4) = 5.2; p<0.05) – providing evidence for a positive feedback relationship between depressive symptoms and systemic inflammation. These data provide further evidence that high levels of inflammation and poor sleep quality may be risk factors for IFN-α induced depression. Furthermore, these findings highlight the complex temporal relationships that exist among sleep, depression, and inflammation, and support the need for further prospective investigations to elucidate the dynamics that underlie depression during IFN-α treatment. PMID:19615438

IFN-gamma Impairs Release of IL-8 by IL-1beta-stimulated A549 Lung Carcinoma Cells

PubMed Central

Boost, Kim A; Sadik, Christian D; Bachmann, Malte; Zwissler, Bernhard; Pfeilschifter, Josef; Mühl, Heiko

2008-01-01

Background Production of interferon (IFN)-γ is key to efficient anti-tumor immunity. The present study was set out to investigate effects of IFNγ on the release of the potent pro-angiogenic mediator IL-8 by human A549 lung carcinoma cells. Methods A549 cells were cultured and stimulated with interleukin (IL)-1β alone or in combination with IFNγ. IL-8 production by these cells was analyzed with enzyme linked immuno sorbent assay (ELISA). mRNA-expression was analyzed by real-time PCR and RNase protection assay (RPA), respectively. Expression of inhibitor-κ Bα, cellular IL-8, and cyclooxygenase-2 was analyzed by Western blot analysis. Results Here we demonstrate that IFNγ efficiently reduced IL-8 secretion under the influence of IL-1β. Surprisingly, real-time PCR analysis and RPA revealed that the inhibitory effect of IFNγ on IL-8 was not associated with significant changes in mRNA levels. These observations concurred with lack of a modulatory activity of IFNγ on IL-1β-induced NF-κB activation as assessed by cellular IκB levels. Moreover, analysis of intracellular IL-8 suggests that IFNγ modulated IL-8 secretion by action on the posttranslational level. In contrast to IL-8, IL-1β-induced cyclooxygenase-2 expression and release of IL-6 were not affected by IFNγ indicating that modulation of IL-1β action by this cytokine displays specificity. Conclusion Data presented herein agree with an angiostatic role of IFNγ as seen in rodent models of solid tumors and suggest that increasing T helper type 1 (Th1)-like functions in lung cancer patients e.g. by local delivery of IFNγ may mediate therapeutic benefit via mechanisms that potentially include modulation of pro-angiogenic IL-8. PMID:18801189

Functional Haplotypes of Fc gamma (Fcγ) receptor (FcγRIIA and FcγRIIIB) predict risk to repeated episodes of severe malarial anemia and mortality in Kenyan children

PubMed Central

Ouma, Collins; Davenport, Gregory C.; Garcia, Steven; Kempaiah, Prakasha; Chaudhary, Ateefa; Were, Tom; Anyona, Samuel B.; Raballah, Evans; Konah, Stephen N.; Hittner, James B.; Vulule, John M.; Ong’echa, John M.; Perkins, Douglas J.

2011-01-01

Development of protective immunity against Plasmodium falciparum is partially mediated through binding of malaria-specific IgG to Fc gamma (γ) receptors. Variation in human FcγRIIA-H/R-131 and FcγRIIIB-NA1/NA2 affect differential binding of IgG sub-classes. Since variability in FcγR may play an important role in severe malarial anemia (SMA) pathogenesis by mediating phagocytosis of red blood cells and triggering cytokine production, the relationship between FcγRIIA-H/R131 and FcγRIIIB-NA1/NA2 haplotypes and susceptibility to SMA (Hb<6.0g/dL) was investigated in Kenyan children (n=528) with acute malaria residing in a holoendemic P. falciparum transmission region. In addition, the association between carriage of the haplotypes and repeated episodes of SMA and all-cause mortality were investigated over a three-year follow-up period. Since variability in FcγR can alter interferon (IFN)-γ production, a mediator of innate and adaptive immune responses, functional associations between the haplotypes and IFN-γ were also explored. During acute malaria, children with SMA had elevated peripheral IFN-γ levels (P=0.006). Although multivariate logistic regression analyses (controlling for covariates) revealed no associations between the FcγR haplotypes and susceptibility to SMA during acute infection, the FcγRIIA-131H/FcγRIIIB-NA1 haplotype was associated with decreased peripheral IFN-γ (P=0.046). Longitudinal analyses showed that carriage of the FcγRIIA-131H/FcγRIIIB-NA1 haplotype was associated with reduced risk of SMA (RR; 0.65, 95%CI, 0.46-0.90; P=0.012) and all-cause mortality (P=0.002). In contrast, carriers of the FcγRIIA-131H/FcγRIIIB-NA2 haplotype had increased susceptibility to SMA (RR; 1.47, 95%CI, 1.06-2.04; P=0.020). Results here demonstrate that variation in the FcγR gene alters susceptibility to repeated episodes of SMA and mortality, as well as functional changes in IFN-γ production. PMID:21818580

In vitro effects of CpG oligodeoxynucleotides delivered by gelatin nanoparticles on canine peripheral blood mononuclear cells of atopic and healthy dogs - a pilot study.

PubMed

Prélaud, Ana Rostaher; Fuchs, Sebastian; Weber, Karin; Winter, Gerhard; Coester, Conrad; Mueller, Ralf S

2013-10-01

Cytosine-phosphate-guanine (CpG) oligodeoxynucleotides offer a novel promising immunotherapeutic approach for atopic dermatitis (AD) both in humans and animals. Gelatin nanoparticles (GNP) enhance and prolong CpG-associated immunomodulatory effects and minimize adverse effects both in vitro and in vivo. Information about the effects of this combination in dogs is lacking. The aim of this study was to evaluate immunological effects of CpG coupled to GNP on canine peripheral blood mononuclear cells (PBMCs) in vitro. Eight dogs with AD, diagnosed by standard criteria and with a concurrent immediate hypersensitivity to house dust mites were included. Control samples were taken from eight healthy, age-matched control dogs without history or evidence of cutaneous or systemic illness. Peripheral blood mononuclear cells of healthy and allergic dogs were incubated with CpG-GNP and the uptake of CpG-GNP was demonstrated using confocal laser scanning microscopy. Cell culture supernatant concentrations of interferon gamma (IFN-γ), interleukin (IL)-4, IL-6 and IL-10 were measured by Canine Cytokine Milliplex. No significant changes in IFN-γ and IL-4 were found when comparing PBMCs incubated with CpG and CpG-GNP with the negative controls in atopic and healthy dogs. Interleukin-6 was not detected in any of the groups. However, a statistically significant increase in IL-10 concentration was found after 24 h stimulation with CpG-GNP compared with CpG alone both in atopic and healthy dogs. As IL-10 is considered an immunosuppressive cytokine playing a key role in peripheral tolerance; the reported CpG-GNP formulation could be a new approach in allergy treatment. © 2013 ESVD and ACVD.

Type I IFN-related NETosis in ataxia telangiectasia and Artemis deficiency.

PubMed

Gul, Ersin; Sayar, Esra Hazar; Gungor, Bilgi; Eroglu, Fehime Kara; Surucu, Naz; Keles, Sevgi; Guner, Sukru Nail; Findik, Siddika; Alpdundar, Esin; Ayanoglu, Ihsan Cihan; Kayaoglu, Basak; Geckin, Busra Nur; Sanli, Hatice Asena; Kahraman, Tamer; Yakicier, Cengiz; Muftuoglu, Meltem; Oguz, Berna; Cagdas Ayvaz, Deniz Nazire; Gursel, Ihsan; Ozen, Seza; Reisli, Ismail; Gursel, Mayda

2017-11-16

Pathological inflammatory syndromes of unknown etiology are commonly observed in ataxia telangiectasia (AT) and Artemis deficiency. Similar inflammatory manifestations also exist in patients with STING-associated vasculopathy in infancy (SAVI). We sought to test the hypothesis that the inflammation-associated manifestations observed in patients with AT and Artemis deficiency stem from increased type I IFN signature leading to neutrophil-mediated pathological damage. Cytokine/protein signatures were determined by ELISA, cytometric bead array, or quantitative PCR. Stat1 phosphorylation levels were determined by flow cytometry. DNA species accumulating in the cytosol of patients' cells were quantified microscopically and flow cytometrically. Propensity of isolated polymorhonuclear granulocytes to form neutrophil extracellular traps (NETs) was determined using fluorescence microscopy and picogreen assay. Neutrophil reactive oxygen species levels and mitochondrial stress were assayed using fluorogenic probes, microscopy, and flow cytometry. Type I and III IFN signatures were elevated in plasma and peripheral blood cells of patients with AT, Artemis deficiency, and SAVI. Chronic IFN production stemmed from the accumulation of DNA in the cytoplasm of AT and Artemis-deficient cells. Neutrophils isolated from patients spontaneously produced NETs and displayed indicators of oxidative and mitochondrial stress, supportive of their NETotic tendencies. A similar phenomenon was also observed in neutrophils from healthy controls exposed to patient plasma samples or exogeneous IFN-α. Type I IFN-mediated neutrophil activation and NET formation may contribute to inflammatory manifestations observed in patients with AT, Artemis deficiency, and SAVI. Thus, neutrophils represent a promising target to manage inflammatory syndromes in diseases with active type I IFN signature. Copyright © 2017 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights

Comprehensive Antiretroviral Restriction Factor Profiling Reveals the Evolutionary Imprint of the ex Vivo and in Vivo IFN-β Response in HTLV-1-Associated Neuroinflammation.

PubMed

Leal, Fabio E; Menezes, Soraya Maria; Costa, Emanuela A S; Brailey, Phillip M; Gama, Lucio; Segurado, Aluisio C; Kallas, Esper G; Nixon, Douglas F; Dierckx, Tim; Khouri, Ricardo; Vercauteren, Jurgen; Galvão-Castro, Bernardo; Saraiva Raposo, Rui Andre; Van Weyenbergh, Johan

2018-01-01

HTLV-1-Associated Myelopathy (HAM/TSP) is a progressive neuroinflammatory disorder for which no disease-modifying treatment exists. Modest clinical benefit from type I interferons (IFN-α/β) in HAM/TSP contrasts with its recently identified IFN-inducible gene signature. In addition, IFN-α treatment in vivo decreases proviral load and immune activation in HAM/TSP, whereas IFN-β therapy decreases tax mRNA and lymphoproliferation. We hypothesize this "IFN paradox" in HAM/TSP might be explained by both cell type- and gene-specific effects of type I IFN in HTLV-1-associated pathogenesis. Therefore, we analyzed ex vivo transcriptomes of CD4 + T cells, PBMCs and whole blood in healthy controls, HTLV-1-infected individuals, and HAM/TSP patients. First, we used a targeted approach, simultaneously quantifying HTLV-1 mRNA (HBZ, Tax), proviral load and 42 host genes with known antiretroviral (anti-HIV) activity in purified CD4 + T cells. This revealed two major clusters ("antiviral/protective" vs. "proviral/deleterious"), as evidenced by significant negative (TRIM5/TRIM22/BST2) vs. positive correlation (ISG15/PAF1/CDKN1A) with HTLV-1 viral markers and clinical status. Surprisingly, we found a significant inversion of antiretroviral activity of host restriction factors, as evidenced by opposite correlation to in vivo HIV-1 vs. HTLV-1 RNA levels. The anti-HTLV-1 effect of antiviral cluster genes was significantly correlated to their adaptive chimp/human evolution score, for both Tax mRNA and PVL. Six genes of the proposed antiviral cluster underwent lentivirus-driven purifying selection during primate evolution (TRIM5/TRIM22/BST2/APOBEC3F-G-H), underscoring the cross-retroviral evolutionary imprint. Secondly, we examined the genome-wide type I IFN response in HAM/TSP patients, following short-term ex vivo culture of PBMCs with either IFN-α or IFN-β. Microarray analysis evidenced 12 antiretroviral genes (including TRIM5α/TRIM22/BST2) were significantly up-regulated by IFN

Recent considerations in the use of recombinant interferon gamma for biological therapy of atopic dermatitis.

PubMed

Brar, Kanwaljit; Leung, Donald Y M

2016-01-01

Atopic dermatitis (AD) is the most common inflammatory skin disease in the general population. There are different endophenotypes of AD that likely have a unique immune and molecular basis, such as those who are predisposed to eczema herpeticum, or Staphylococcus aureus infections. In this review, we highlight the endophenotypes of AD where reduced interferon gamma expression may be playing a role. Additionally, we review the potential role of recombinant interferon gamma therapy in the treatment of atopic dermatitis and the particular phenotypes that may benefit from this treatment. Recombinant interferon gamma treatment will likely benefit the pediatric population with AD, as well as those with susceptibilities for skin infections. Future studies are needed to elucidate whether IFN-γ may reduce the prevalence of skin infection in AD.

G-protein gamma subunit 1 is required for sugar reception in Drosophila

PubMed Central

Ishimoto, Hiroshi; Takahashi, Kuniaki; Ueda, Ryu; Tanimura, Teiichi

2005-01-01

Though G-proteins have been implicated in the primary step of taste signal transduction, no direct demonstration has been done in insects. We show here that a G-protein gamma subunit, Gγ1, is required for the signal transduction of sugar taste reception in Drosophila. The Gγ1 gene is expressed mainly in one of the gustatory receptor neurons. Behavioral responses of the flies to sucrose were reduced by the targeted suppression of neural functions of Gγ1-expressing cells using neural modulator genes such as the modified Shaker K+ channel (EKO), the tetanus toxin light chain or the shibire (shits1) gene. RNA interference targeting to the Gγ1 gene reduced the amount of Gγ1 mRNA and suppressed electrophysiological response of the sugar receptor neuron. We also demonstrated that responses to sugars were lowered in Gγ1 null mutant, Gγ1N159. These results are consistent with the hypothesis that Gγ1 participates in the signal transduction of sugar taste reception. PMID:16121192

Immune-enhancing activities of low molecular weight β-glucan depolymerized by gamma irradiation

NASA Astrophysics Data System (ADS)

Sung, Nak-Yun; Byun, Eui-Hong; Kwon, Sun-Kyu; Song, Beom-Seok; Choi, Jong-il; Kim, Jae-Hun; Byun, Myung-Woo; Yoo, Young-Choon; Kim, Mee-Ree; Lee, Ju-Woon

2009-07-01

β-glucans are structural cell wall polymers of many microorganisms and cereals which possess immunomodulatory properties and have been used in the food, cosmetic and medical industry. In our previous study, β-glucan was depolymerized by gamma irradiation and leads to improve the solubility and viscosity. This study was carried out to evaluate the functional properties, mainly immune-enhancing activities of low molecular weight β-glucan fragmented by gamma irradiation. The results showed that RAW 264.7 macrophage cell stimulation activities of irradiated β-glucan were higher than that of non-irradiated β-glucan. In addition, the oral administration of gamma-irradiated β-glucan significantly increased the proliferation and cytokine (IFN-γ and IL-2) release of spleen and Peyer's patch cells compared with non-irradiated β-glucan. In conclusion, gamma irradiation could be used as an effective method for the production of depolymerized β-glucan improved functional property such as immunomodulatory activity.

Reactive Oxygen Species Induce Antiviral Innate Immune Response through IFN-λ Regulation in Human Nasal Epithelial Cells

PubMed Central

Kim, Hyun Jik; Kim, Chang-Hoon; Ryu, Ji-Hwan; Kim, Min-Ji; Park, Chong Yoon; Lee, Jae Myun; Holtzman, Michael J.

2013-01-01

This study sought to explore the role of the IFN-related innate immune responses (IFN-β and IFN-λ) and of reactive oxygen species (ROS) after influenza A virus (IAV) infection for antiviral innate immune activity in normal human nasal epithelial (NHNE) cells that are highly exposed to IAV. Passage-2 NHNE cells were inoculated with the IAV WSN/33 for 1, 2, and 3 days to assess the capacity of IFN and the relationship between ROS generation and IFN-λ secretion for controlling IAV infection. Viral titers and IAV mRNA levels increased after infection. In concert with viral titers, we found that the generation of IFNs, such as IFN-β, IFN-λ1, and IFN-λ2/3, was induced after IAV infection until 3 days after infection. The induction of IFN-λ gene expression and protein secretion may be predominant after IAV infection. Similarly, we observed that intracellular ROS generation increased 60 minutes after IAV infection. Viral titers and mRNA levels of IAV were significantly higher in cases with scavenging ROS, in cases with an induced IFN-λ mRNA level, or where the secreted protein concentration of IFN-λ was attenuated after the suppression of ROS generation. Both mitochondrial and dual oxidase (Doux)2-generated ROS were correlated with IAV mRNA and viral titers. The inhibition of mitochondrial ROS generation and the knockdown of Duox2 gene expression highly increased IAV viral titers and decreased IFN-λ secretion. Our findings suggest that the production of ROS may be responsible for IFN-λ secretion to control IAV infection. Both mitochondria and Duox2 are possible sources of ROS generation, which is required to initiate an innate immune response in NHNE cells. PMID:23786562

S-NPP VIIRS thermal emissive band gain correction during the blackbody warm-up-cool-down cycle

NASA Astrophysics Data System (ADS)

Choi, Taeyoung J.; Cao, Changyong; Weng, Fuzhong

2016-09-01

The Suomi National Polar orbiting Partnership (S-NPP) Visible Infrared Imaging Radiometer Suite (VIIRS) has onboard calibrators called blackbody (BB) and Space View (SV) for Thermal Emissive Band (TEB) radiometric calibration. In normal operation, the BB temperature is set to 292.5 K providing one radiance level. From the NOAA's Integrated Calibration and Validation System (ICVS) monitoring system, the TEB calibration factors (F-factors) have been trended and show very stable responses, however the BB Warm-Up-Cool-Down (WUCD) cycles provide detectors' gain and temperature dependent sensitivity measurements. Since the launch of S-NPP, the NOAA Sea Surface Temperature (SST) group noticed unexpected global SST anomalies during the WUCD cycles. In this study, the TEB Ffactors are calculated during the WUCD cycle on June 17th 2015. The TEB F-factors are analyzed by identifying the VIIRS On-Board Calibrator Intermediate Product (OBCIP) files to be Warm-Up or Cool-Down granules. To correct the SST anomaly, an F-factor correction parameter is calculated by the modified C1 (or b1) values which are derived from the linear portion of C1 coefficient during the WUCD. The F-factor correction factors are applied back to the original VIIRS SST bands showing significantly reducing the F-factor changes. Obvious improvements are observed in M12, M14 and M16, but corrections effects are hardly seen in M16. Further investigation is needed to find out the source of the F-factor oscillations during the WUCD.

Apoptotic-cell-derived membrane microparticles and IFN-α induce an inflammatory immune response.

PubMed

Niessen, Anna; Heyder, Petra; Krienke, Stefan; Blank, Norbert; Tykocinski, Lars-Oliver; Lorenz, Hanns-Martin; Schiller, Martin

2015-07-15

A dysregulation in the clearance of apoptotic material is considered a major pathogenetic factor for the emergence of autoimmune diseases. Apoptotic-cell-derived membrane microparticles (AdMPs), which are released from the cell surface during apoptosis, have been implicated in the pathogenesis of autoimmunity. Also of importance are cytokines, such as interferon-α (IFN-α), which is known to be a major player in patients with systemic lupus erythematosus (SLE). This study investigates the combined effect of AdMPs and IFN-α on professional phagocytes. In the presence of IFN-α, phagocytosis of AdMPs by human monocytes was significantly increased in a dose-dependent manner. The combination of AdMPs and raised IFN-α concentrations resulted in an increase in the secretion of pro-inflammatory cytokines and an upregulation of surface molecule expression involved in antigen uptake. In addition, macrophage polarisation was shifted towards a more inflammatory type of cell. The synergism between IFN-α and AdMPs seemed to be mediated by an upregulation of phosphorylated STAT1. Our results indicate that IFN-α, together with AdMPs, amplify the initiation and maintenance of inflammation. This mechanism might especially play a crucial role in disorders with a defective clearance of apoptotic material. © 2015. Published by The Company of Biologists Ltd.

Activation-specific metabolic requirements for NK cell IFN-γ production1

PubMed Central

Keppel, Molly P.; Topcagic, Nermina; Mah, Annelise Y.; Vogel, Tiphanie P.; Cooper, Megan A.

2014-01-01

There has been increasing recognition of the importance of cellular metabolism and metabolic substrates for the function and differentiation of immune cells. Here, for the first time, we investigate the metabolic requirements for production of IFN-γ by freshly isolated NK cells. Primary murine NK cells mainly utilize mitochondrial oxidative phosphorylation at rest and with short-term activation. Remarkably, we discovered significant differences in the metabolic requirements of murine NK cell IFN-γ production depending upon the activation signal. Stimulation of NK cell IFN-γ production was independent of glycolysis or mitochondrial oxidative phosphorylation when cells were activated with IL-12+IL-18. By contrast, stimulation via activating NK receptors required glucose-driven oxidative phosphorylation. Prolonged treatment with high-dose, but not low dose, IL-15 eliminated the metabolic requirement for receptor stimulation. In summary, this study demonstrates that metabolism provides an essential second signal for induction of IFN-γ production by activating NK cell receptors that can be reversed with prolonged high-dose IL-15 treatment. PMID:25595780

Dynamic control of type I IFN signalling by an integrated network of negative regulators.

PubMed

Porritt, Rebecca A; Hertzog, Paul J

2015-03-01

Whereas type I interferons (IFNs) have critical roles in protection from pathogens, excessive IFN responses contribute to pathology in both acute and chronic settings, pointing to the importance of balancing activating signals with regulatory mechanisms that appropriately tune the response. Here we review evidence for an integrated network of negative regulators of IFN production and action, which function at all levels of the activating and effector signalling pathways. We propose that the aim of this extensive network is to limit tissue damage while enabling an IFN response that is temporally appropriate and of sufficient magnitude. Understanding the architecture and dynamics of this network, and how it differs in distinct tissues, will provide new insights into IFN biology and aid the design of more effective therapeutics. Crown Copyright © 2015. Published by Elsevier Ltd. All rights reserved.

[Role of IFN-γ + 874 genetic polymorphisms in allogeneic hematopoietic stem cell transplantation].

PubMed

Cai, Xiao-jin; Song, A-xia; Wang, Hua; Zhang, Ping; Zhang, Gui-xin; Yang, Fan; Wei, Jia-lin; Ma, Qiao-ling; Yan, Zhang-song; Jiang, Er-lie; Huang, Yong; Wang, Mei; He, Yi; Feng, Si-zhou; Han, Ming-zhe

2012-12-01

To explore the impact of IFN-γ + 874 polymorphisms on the outcome in HLA matched sibling HSCT. We used PCR-sequence-specific primer analysis (PCR-SSP) to analyze the polymorphisms of IFN-γ + 874 T/A in 80 recipient and donor pairs from October 2005 to March 2008. Recipients having donors who possessed IFN-γ + 874 A/A genotype had significantly earlier neutrophil recovery compared with those having donors with non-A/A genotype (15 (11 - 27) days vs 18 (12 - 30) days, P = 0.029). And IFN-γ + 874 A/A in both recipients and donors further facilitated neutrophil recovery compared with others (13 (11 - 25) days and 19 (12 - 31) days, P = 0.019). Besides, IFN-γ + 874 A/A in recipients increased the probability of grade II-IV acute graft versus disease (aGVHD) and cytomegalovirus viraemia compared with IFN-γ + 874 T/A or T/T genotype (20% vs 4% P = 0.041, 43.6% vs 16.0% P = 0.032), which lead to increased 5-year transplant-related mortality (TRM) (33.7% ± 6.8% vs 12.0% ± 6.5%, P = 0.050) and decreased 5-year event free survival (EFS) \\[(58.2 ± 6.7)% vs (84.0 ± 7.3)%, P = 0.032\\] compared with the latter. IFN-γ + 874 A/A in both recipients and donors also significantly increased the probability of grade II-IV aGVHD and cytomegalovirus viraemia compared with the other (21.7% vs 5.9%, P = 0.050; 45.7% vs 20.6%, P = 0.020), which caused increased 5-year TRM \\[(31.6 ± 7.5)% vs (13.6 ± 6.5)%, P = 0.048\\] and decreased 5-year EFS \\[(56.8 ± 7.3)% vs (79.4 ± 6.9)%, P = 0.037\\] compared with the other. In HLA-matched sibling HSCT setting, the presence of IFN-γ + 874 T allele in recipients or in both recipients and donors significantly decreased the risk of grade II-IV aGVHD and CMV infection and increased EFS. While IFN-γ + 874 A/A in donors or in both recipients and donors was associated with shorter duration to neutrophil recovery.

Comprehensive Antiretroviral Restriction Factor Profiling Reveals the Evolutionary Imprint of the ex Vivo and in Vivo IFN-β Response in HTLV-1-Associated Neuroinflammation

PubMed Central

Leal, Fabio E.; Menezes, Soraya Maria; Costa, Emanuela A. S.; Brailey, Phillip M.; Gama, Lucio; Segurado, Aluisio C.; Kallas, Esper G.; Nixon, Douglas F.; Dierckx, Tim; Khouri, Ricardo; Vercauteren, Jurgen; Galvão-Castro, Bernardo; Saraiva Raposo, Rui Andre; Van Weyenbergh, Johan

2018-01-01

HTLV-1-Associated Myelopathy (HAM/TSP) is a progressive neuroinflammatory disorder for which no disease-modifying treatment exists. Modest clinical benefit from type I interferons (IFN-α/β) in HAM/TSP contrasts with its recently identified IFN-inducible gene signature. In addition, IFN-α treatment in vivo decreases proviral load and immune activation in HAM/TSP, whereas IFN-β therapy decreases tax mRNA and lymphoproliferation. We hypothesize this “IFN paradox” in HAM/TSP might be explained by both cell type- and gene-specific effects of type I IFN in HTLV-1-associated pathogenesis. Therefore, we analyzed ex vivo transcriptomes of CD4+ T cells, PBMCs and whole blood in healthy controls, HTLV-1-infected individuals, and HAM/TSP patients. First, we used a targeted approach, simultaneously quantifying HTLV-1 mRNA (HBZ, Tax), proviral load and 42 host genes with known antiretroviral (anti-HIV) activity in purified CD4+ T cells. This revealed two major clusters (“antiviral/protective” vs. “proviral/deleterious”), as evidenced by significant negative (TRIM5/TRIM22/BST2) vs. positive correlation (ISG15/PAF1/CDKN1A) with HTLV-1 viral markers and clinical status. Surprisingly, we found a significant inversion of antiretroviral activity of host restriction factors, as evidenced by opposite correlation to in vivo HIV-1 vs. HTLV-1 RNA levels. The anti-HTLV-1 effect of antiviral cluster genes was significantly correlated to their adaptive chimp/human evolution score, for both Tax mRNA and PVL. Six genes of the proposed antiviral cluster underwent lentivirus-driven purifying selection during primate evolution (TRIM5/TRIM22/BST2/APOBEC3F-G-H), underscoring the cross-retroviral evolutionary imprint. Secondly, we examined the genome-wide type I IFN response in HAM/TSP patients, following short-term ex vivo culture of PBMCs with either IFN-α or IFN-β. Microarray analysis evidenced 12 antiretroviral genes (including TRIM5α/TRIM22/BST2) were significantly up

Monocyte NOTCH2 expression predicts IFN-β immunogenicity in multiple sclerosis patients.

PubMed

Adriani, Marsilio; Nytrova, Petra; Mbogning, Cyprien; Hässler, Signe; Medek, Karel; Jensen, Poul Erik H; Creeke, Paul; Warnke, Clemens; Ingenhoven, Kathleen; Hemmer, Bernhard; Sievers, Claudia; Lindberg Gasser, Raija Lp; Fissolo, Nicolas; Deisenhammer, Florian; Bocskei, Zsolt; Mikol, Vincent; Fogdell-Hahn, Anna; Kubala Havrdova, Eva; Broët, Philippe; Dönnes, Pierre; Mauri, Claudia; Jury, Elizabeth C

2018-06-07

Multiple sclerosis (MS) is an autoimmune disease characterized by CNS inflammation leading to demyelination and axonal damage. IFN-β is an established treatment for MS; however, up to 30% of IFN-β-treated MS patients develop neutralizing antidrug antibodies (nADA), leading to reduced drug bioactivity and efficacy. Mechanisms driving antidrug immunogenicity remain uncertain, and reliable biomarkers to predict immunogenicity development are lacking. Using high-throughput flow cytometry, NOTCH2 expression on CD14+ monocytes and increased frequency of proinflammatory monocyte subsets were identified as baseline predictors of nADA development in MS patients treated with IFN-β. The association of this monocyte profile with nADA development was validated in 2 independent cross-sectional MS patient cohorts and a prospective cohort followed before and after IFN-β administration. Reduced monocyte NOTCH2 expression in nADA+ MS patients was associated with NOTCH2 activation measured by increased expression of Notch-responsive genes, polarization of monocytes toward a nonclassical phenotype, and increased proinflammatory IL-6 production. NOTCH2 activation was T cell dependent and was only triggered in the presence of serum from nADA+ patients. Thus, nADA development was driven by a proinflammatory environment that triggered activation of the NOTCH2 signaling pathway prior to first IFN-β administration.

IFN-γ Stimulates Autophagy-Mediated Clearance of Burkholderia cenocepacia in Human Cystic Fibrosis Macrophages

PubMed Central

Assani, Kaivon; Tazi, Mia F.; Amer, Amal O.; Kopp, Benjamin T.

2014-01-01

Burkholderia cenocepacia is a virulent pathogen that causes significant morbidity and mortality in patients with cystic fibrosis (CF), survives intracellularly in macrophages, and uniquely causes systemic infections in CF. Autophagy is a physiologic process that involves engulfing non-functional organelles and proteins and delivering them for lysosomal degradation, but also plays a role in eliminating intracellular pathogens, including B. cenocepacia. Autophagy is defective in CF but can be stimulated in murine CF models leading to increased clearance of B. cenocepacia, but little is known about autophagy stimulation in human CF macrophages. IFN-γ activates macrophages and increases antigen presentation while also inducing autophagy in macrophages. We therefore, hypothesized that treatment with IFN-γ would increase autophagy and macrophage activation in patients with CF. Peripheral blood monocyte derived macrophages (MDMs) were obtained from CF and non-CF donors and subsequently infected with B. cenocepacia. Basal serum levels of IFN-γ were similar between CF and non-CF patients, however after B. cenocepacia infection there is deficient IFN-γ production in CF MDMs. IFN-γ treated CF MDMs demonstrate increased co-localization with the autophagy molecule p62, increased autophagosome formation, and increased trafficking to lysosomes compared to untreated CF MDMs. Electron microscopy confirmed IFN-γ promotes double membrane vacuole formation around bacteria in CF MDMs, while only single membrane vacuoles form in untreated CF cells. Bacterial burden is significantly reduced in autophagy stimulated CF MDMs, comparable to non-CF levels. IL-1β production is decreased in CF MDMs after IFN-γ treatment. Together, these results demonstrate that IFN-γ promotes autophagy-mediated clearance of B. cenocepacia in human CF macrophages. PMID:24798083

Evolution of IFN-λ in tetrapod vertebrates and its functional characterization in green anole lizard (Anolis carolinensis).

PubMed

Chen, Shan Nan; Zhang, Xiao Wen; Li, Li; Ruan, Bai Ye; Huang, Bei; Huang, Wen Shu; Zou, Peng Fei; Fu, Jian Ping; Zhao, Li Juan; Li, Nan; Nie, Pin

2016-08-01

IFN-λ (IFNL), i.e. type III IFN genes were found in a conserved gene locus in tetrapod vertebrates. But, a unique locus containing IFNL was found in avian. In turtle and crocodile, IFNL genes were distributed in these two separate loci. As revealed in phylogenetic trees, IFN-λs in these two different loci and other amniotes were grouped into two different clades. The conservation in gene presence and gene locus was also observed for the receptors of IFN-λ, IFN-λR1 and IL-10RB in tetrapods. It is further revealed that in North American green anole lizard Anolis carolinensis, a single IFNL gene was situated collinearly in the conserved locus as in other tetrapods, together with its receptors IFN-λR1 and IL-10RB also identified in this study. The IFN-λ and its receptors were expressed in all examined organs/tissues, and their expression was stimulated following the injection of polyI:polyC. The ISREs in promoter of IFN-λ in lizard were responsible to IRF3 as demonstrated using luciferase report system, and IFN-λ in lizard functioned through the receptors, IFN-λR1 and IL-10RB, as the up-regulation of ISGs was observed in ligand-receptor transfected, and also in recombinant IFN-λ stimulated, cell lines. Taken together, it is concluded that the mechanisms involved in type III IFN ligand-receptor system, and in its signalling pathway and its down-stream genes may be conserved in green anole lizard, and may even be so in tetrapods from xenopus to human. Copyright © 2016. Published by Elsevier Ltd.

Zinc is a potent and specific inhibitor of IFN-λ3 signalling

PubMed Central

Read, Scott A.; O'Connor, Kate S.; Suppiah, Vijay; Ahlenstiel, Chantelle L. E.; Obeid, Stephanie; Cook, Kristina M.; Cunningham, Anthony; Douglas, Mark W.; Hogg, Philip J.; Booth, David; George, Jacob; Ahlenstiel, Golo

2017-01-01

Lambda interferons (IFNL, IFN-λ) are pro-inflammatory cytokines important in acute and chronic viral infection. Single-nucleotide polymorphisms rs12979860 and rs8099917 within the IFNL gene locus predict hepatitis C virus (HCV) clearance, as well as inflammation and fibrosis progression in viral and non-viral liver disease. The underlying mechanism, however, is not defined. Here we show that the rs12979860 CC genotype correlates with increased hepatic metallothionein expression through increased systemic zinc levels. Zinc interferes with IFN-λ3 binding to IFNL receptor 1 (IFNLR1), resulting in decreased antiviral activity and increased viral replication (HCV, influenza) in vitro. HCV patients with high zinc levels have low hepatocyte antiviral and inflammatory gene expression and high viral loads, confirming the inhibitory role of zinc in vivo. We provide the first evidence that zinc can act as a potent and specific inhibitor of IFN-λ3 signalling and highlight its potential as a target of therapeutic intervention for IFN-λ3-mediated chronic disease. PMID:28513591

Neutrophil mediated IFN activation in the bone marrow alters B cell development in human and murine SLE1

PubMed Central

Palanichamy, Arumugam; Bauer, Jason W; Yalavarthi, Srilakshmi; Meednu, Nida; Barnard, Jennifer; Owen, Teresa; Cistrone, Christopher; Bird, Anna; Rabinovich, Alfred; Nevarez, Sarah; Knight, Jason S.; Dedrick, Russell; Rosenberg, Alexander; Wei, Chungwen; Rangel-Moreno, Javier; Liesveld, Jane; Sanz, Inaki; Baechler, Emily; Kaplan, Mariana J.; Anolik, Jennifer H

2014-01-01

Inappropriate activation of type I interferon (IFN) plays a key role in the pathogenesis of autoimmune disease, including systemic lupus erythematosus (SLE). Here we report the presence of IFN activation in SLE bone marrow (BM), as measured by an IFN gene signature, increased IFN regulated chemokines, and direct production of IFN by BM resident cells, associated with profound changes in B cell development. The majority of SLE patients had an IFN signature in the BM that was more pronounced than the paired peripheral blood (PB) and correlated with both higher autoantibodies and disease activity. Pronounced alterations in B cell development were noted in SLE in the presence of an IFN signature with a reduction in the fraction of pro/pre B cells suggesting an inhibition in early B cell development and an expansion of B cells at the transitional (T2) stage. These B cell changes strongly correlated with an increase in BAFF and APRIL expression in the IFN high BM. Furthermore, we found that BM neutrophils in SLE were prime producers of IFN-α and B cell factors. In NZM lupus-prone mice similar changes in B cell development were observed and mediated by IFN, given abrogation in NZM mice lacking type I IFN receptor. BM neutrophils were abundant, responsive to and producers of IFN, in close proximity to B cells. These results indicate that the BM is an important but previously unrecognized target organ in SLE with neutrophil mediated IFN activation and alterations in B cell ontogeny and selection. PMID:24379124

Liposomal gD ectodomain (gD1-306) vaccine protects against HSV2 genital or rectal infection of female and male mice.

PubMed

Olson, K; Macias, P; Hutton, S; Ernst, W A; Fujii, G; Adler-Moore, J P

2009-12-11

Herpes simplex virus type 2 (HSV2) is the most common causative agent of genital herpes, with infection rates as high as 1 in 6 adults. The present studies were done to evaluate the efficacy of a liposomal HSV2 gD(1-306) vaccine (L-gD(1-306)-HD) in an acute murine HSV2 infection model of intravaginal (female) or intrarectal (male or female) challenge. Two doses of L-gD(1-306)-HD containing 60 microg gD(1-306)-HD and 15 microg monophosphoryl lipid A (MPL) per dose provided protection against HSV2 intravaginal challenge (86-100% survival, P< or =0.0003 vs. control liposomes; P=0.06 vs. L-gD(1-306)-HD without MPL). Both male and female mice (BALB/c and C57BL/6) immunized with L-gD(1-306)-HD/MPL were significantly protected against HSV2 intrarectal challenge, with higher survival rates compared to controls (71-100%, P< or =0.007). L-gD(1-306)-HD/MPL also provided increased survival when compared to a liposomal peptide vaccine, L-gD(264-285)-HD/MPL (male BALB/c, PgD(1-306)-HD/MPL also had minimal disease signs, reduced viral burden in their spinal cords and elevated neutralizing antibody titers in the females. The vaccine also stimulated gD(1-306)-HD specific splenocytes of both male and female mice with significantly elevated levels of IFN-gamma compared to IL-4 (P< or =0.01) indicating that there was an enhanced Th1 response. These results provide the first evidence that the L-gD(1-306)-HD vaccine can protect both male and female mice against intrarectal HSV2 challenge.

Ursolic acid isolated from Uncaria rhynchophylla activates human dendritic cells via TLR2 and/or TLR4 and induces the production of IFN-gamma by CD4+ naïve T cells.

PubMed

Jung, Tae-Young; Pham, Thanh Nhan Nguyen; Umeyama, Akemi; Shoji, Noboru; Hashimoto, Toshihiro; Lee, Je-Jung; Takei, Masao

2010-09-25

Ursolic acid is triterpene isolated from Uncaria rhynchophylla and is a pharmacologically active substance. The induction of dendritic cell maturation is critical for the induction of Ag-specific T-lymphocyte response and may be essential for the development of human vaccine relying on T cell immunity. In this study, we investigated that the effect of Ursolic acid on the phenotypic and functional maturation of human monocyte-derived dendritic cells in vitro. Dendritic cells harvested on day 8 were examined using functional assay. The expression levels of CD1a, CD80, CD83, CD86, HLA-DR and CCR7 on Ursolic acid-primed dendritic cells was slightly enhanced. Ursolic acid dose-dependently enhanced the T cell stimulatory capacity in an allogeneic mixed lymphocyte reaction, as measured by T cell proliferation. The production of IL-12p70 induced by Ursolic acid-primed dendritic cells was inhibited by the anti-Toll-like receptor-2 (TLR2) mAb and anti-TLR4 mAb. Moreover, Ursolic acid-primed dendritic cells expressed levels of mRNA coding for both TLR2 and TLR4. The majority of cells produced considerable interferon-gamma (IFN-gamma), but also small amounts of interleukin (IL-4)-4. Ursolic acid-primed dendritic cells have an intermediate migratory capacity towards CCL19 and CCL21. These results suggest that Ursolic acid modulates human dendritic cells function in a fashion that favors Th1 polarization via the activation of IL-12p70 dependent on TLR2 and/or TLR4, and may be used on dendritic cells-based vaccines for cancer immunotherapy. 2010 Elsevier B.V. All rights reserved.

IFN-ε Is Constitutively Expressed by Cells of the Reproductive Tract and Is Inefficiently Secreted by Fibroblasts and Cell Lines

PubMed Central

Hermant, Pascale; Francius, Cédric; Clotman, Frédéric; Michiels, Thomas

2013-01-01

Type-I interferons (IFNs) form a large family of cytokines that primarily act to control the early development of viral infections. Typical type-I IFN genes, such as those encoding IFN-α or IFN-β are upregulated by viral infection in many cell types. In contrast, the gene encoding IFN-ε was reported to be constitutively expressed by cells of the female reproductive tract and to contribute to the protection against vaginal infections with herpes simplex virus 2 and Chlamydia muridarum. Our data confirm the lack of induction of IFN-ε expression after viral infection and the constitutive expression of IFN-ε by cells of the female but also of the male reproductive organs. Interestingly, when expressed from transfected expression plasmids in 293T, HeLa or Neuro2A cells, the mouse and human IFN-ε precursors were inefficiently processed and secretion of IFN-ε was minimal. Analysis of chimeric constructs produced between IFN-ε and limitin (IFN-ζ) showed that both the signal peptide and the mature moiety of IFN-ε contribute to poor processing of the precursor. Immunofluorescent detection of FLAG-tagged IFN-ε in transfected cells suggested that IFN-ε and chimeric proteins were defective for progression through the secretory pathway. IFN-ε did not, however, act intracellularly and impart an antiviral state to producing cells. Given the constitutive expression of IFN-ε in specialized cells and the poor processing of IFN-ε precursor in fibroblasts and cell lines, we hypothesize that IFN-ε secretion may require a co-factor specifically expressed in cells of the reproductive organs, that might secure the system against aberrant release of this IFN. PMID:23951133

Local Delivery of the Toll-Like Receptor 9 Ligand CpG Downregulates Host Immune and Inflammatory Responses, Ameliorating Established Leishmania (Viannia) panamensis Chronic Infection

PubMed Central

Fernández, Olga L.; Rodriguez-Pinto, Daniel; Castilho, Tiago M.; Corral Caridad, Maria J.; Goldsmith-Pestana, Karen; Saravia, Nancy Gore; McMahon-Pratt, Diane

2017-01-01

ABSTRACT Infection by Leishmania (Viannia) panamensis, the predominant etiologic agent for cutaneous leishmaniasis in Colombia, is characterized by a chronic mixed inflammatory response. Current treatment options are plagued by toxicity, lengthy treatment regimens, and growing evidence of drug resistance. Immunotherapy, modulating the immune system to mount a protective response, may provide an alternate therapeutic approach. We investigated the ability of the Toll-like receptor 9 (TLR9) ligand CpG to modulate established disease in the L. (V.) panamensis mouse model. Treatment of established infection with a high dose (50 μg) of CpG ameliorated disease and lowered parasite burden. Interestingly, immediately after treatment there was a significant increase in transforming growth factor β (TGF-β) and concomitantly an increase in T regulatory cell (Treg) function. Although a general reduction in cell-mediated immune cytokine and chemokine (gamma interferon [IFN-γ], interleukin 10 [IL-10], IL-13, IL-6, granulocyte-macrophage colony-stimulating factor [GM-CSF], IL-4, and MIP-1α) responses of the treated mice was observed, certain chemokines (RANTES, monocyte chemoattractant protein 1[MCP-1], and IP-10) were increased. Further, in peripheral blood mononuclear cells (PBMCs) from patients with cutaneous leishmaniasis, CpG treatment similarly exhibited a dose-response effect on the production of IFN-γ, IL-17, IL-10, and IL-13, with reductions observed at higher doses. To further understand the underlying mechanisms and cell populations driving the CpG mediated response, we examined the ex vivo dose effects mediated by the TLR9+ cell populations (dendritic cells, macrophages, and B cells) found to accumulate labeled CpG in vivo. Notably, B cells altered the production of IL-17, IL-13, and IFN-γ, supporting a role for B cells functioning as antigen-presenting cells (APCs) and/or regulatory cells during infection. Interestingly, B cells have been previously

Impaired capacity for upregulation of MHC class II in tumor-associated microglia.

PubMed

Schartner, Jill M; Hagar, Aaron R; Van Handel, Michelle; Zhang, Leying; Nadkarni, Nivedita; Badie, Behnam

2005-09-01

Immunotherapy for malignant gliomas is being studied as a possible adjunctive therapy for this highly fatal disease. Thus far, inadequate understanding of brain tumor immunology has hindered the design of such therapies. For instance, the role of microglia and macrophages, which comprise a significant proportion of tumor-infiltrating inflammatory cells, in the regulation of the local anti-tumor immune response is poorly understood. To study the response of microglia and macrophages to known activators in brain tumors, we injected CpG oligodeoxynucleotide (ODN), interferon-gamma (IFN-gamma), and IFN-gamma/LPS into normal and intracranial RG2 glioma-bearing rodents. Microglia/macrophage infiltration and their surface expression of MHC class II B7.1 and B7.2 was examined by flow cytometry. Each agent evaluated yielded a distinct microglia/macrophage response: CpG ODN was the most potent inducer of microglia/macrophage infiltration and B7.1 expression, while IFN-gamma resulted in the highest MHC-II expression in both normal and tumors. Regardless of the agent injected, however, MHC-II induction was significantly muted in tumor microglia/macrophage as compared with normal brain. These data suggest that microglia/macrophage responsiveness to activators can vary in brain tumors when compared with normal brain. Understanding the mechanism of these differences may be critical in the development of novel immunotherapies for malignant glioma. (c) 2005 Wiley-Liss, Inc.

Lateral switch to IFN beta-1a 44 mcg may be effective as escalation switch to fingolimod in selected persons with relapsing remitting multiple sclerosis: a real-world setting experience.

PubMed

D'Amico, E; Patti, F; Zanghì, A; Lo Fermo, S; Chisari, C G; Zappia, M

2018-05-01

The efficacy of lateral and escalation switch is a challenge in MS. We compared in a real-world setting the efficacy of switching to IFN beta-1a 44 mcg or to fingolimod in persons with relapsing remitting MS (pwRRMS) who failed with others injectable IFNs or glatiramer acetate. retrospective analysis of 24 months prospectively-collected data at the MS center of the University of Catania, Italy was performed. Patients who were switched to IFN-beta 1a 44 mcg or fingolimod were analyzed using propensity-score covariate adjustment model within demographic (e.g. age and gender) and disease (e.g. timing of pre-switch relapse) characteristics. Switching-time was considered the starting-time of the observation. 43 pwRRMS on IFN beta-1a 44 mcg and 49 pwRRMS on fingolimod were included. Baseline characteristics differed for EDSS score and number of T2 lesions (higher in group on fingolimod). At 24 months of follow up, both groups showed no differences in the survival curves of reaching a first new relapse, new T2 and Gd+ MRI brain lesions, even corrected for the propensity score covariate adjustment. lateral switch to IFN beta-1a 44 mcg and escalation switch to fingolimod showed same ability in influencing RRMS disease activity at 24 months.

Dynamic Changes in Pro- and Anti-Inflammatory Cytokine Profiles and Gamma Interferon Receptor Signaling Integrity Correlate with Tuberculosis Disease Activity and Response to Curative Treatment▿

PubMed Central

Sahiratmadja, Edhyana; Alisjahbana, Bachti; de Boer, Tjitske; Adnan, Iskandar; Maya, Anugrah; Danusantoso, Halim; Nelwan, Ronald H. H.; Marzuki, Sangkot; van der Meer, Jos W. M.; van Crevel, Reinout; van de Vosse, Esther; Ottenhoff, Tom H. M.

2007-01-01

Pro- and anti-inflammatory cytokines and their signaling pathways play key roles in protection from and pathogenesis of mycobacterial infection, and their balance and dynamic changes may control or predict clinical outcome. Peripheral blood cells' capacity to produce proinflammatory (tumor necrosis factor alpha [TNF-α], interleukin-12/23p40 [IL-12/23p40], and gamma interferon [IFN-γ]) and anti-inflammatory (IL-10) cytokines in response to Mycobacterium tuberculosis or unrelated stimuli (lipopolysaccharide, phytohemagglutinin) was studied in 93 pulmonary tuberculosis (TB) patients and 127 healthy controls from Indonesia. Their cells' ability to respond to IFN-γ was examined to investigate whether M. tuberculosis infection can also inhibit IFN-γ receptor (IFN-γR) signaling. Although there was interindividual variability in the observed responses, the overall results revealed that M. tuberculosis-induced TNF-α and IFN-γ levels showed opposite trends. Whereas TNF-α production was higher in active-TB patients than in controls, IFN-γ production was strongly depressed during active TB, correlated inversely with TB disease severity, and increased during therapy. By contrast, mitogen-induced IFN-γ production, although lower in patients than in controls, did not change during treatment, suggesting an M. tuberculosis-specific and reversible component in the depression of IFN-γ. Depressed IFN-γ production was not due to decreased IL-12/IL-23 production. Importantly, IFN-γ-inducible responses were also significantly depressed during active TB and normalized during treatment, revealing disease activity-related and reversible impairment in IFN-γR signaling in TB. Finally, IFN-γ/IL-10 ratios significantly correlated with TB cure. Taken together, these results show that M. tuberculosis-specific stimulation of IFN-γ (but not TNF-α) production and IFN-γR signaling are significantly depressed in active TB, correlate with TB disease severity and activity, and

Decrease of PECAM-1-gene-expression induced by proinflammatory cytokines IFN-γ and IFN-α is reversed by TGF-β in sinusoidal endothelial cells and hepatic mononuclear phagocytes

PubMed Central

Neubauer, Katrin; Lindhorst, Alexander; Tron, Kyrylo; Ramadori, Giuliano; Saile, Bernhard

2008-01-01

Background and aim The mechanisms of transmigration of inflammatory cells through the sinusoids are still poorly understood. This study aims to identify in vitro conditions (cytokine treatment) which may allow a better understanding of the changes in PECAM (platelet endothelial cell adhesion molecule)-1-gene-expression observed in vivo. Methods and results In this study we show by immunohistochemistry, that there is an accumulation of ICAM-1 (intercellular cell adhesion molecule-1) and ED1 positive cells in necrotic areas of livers of CCl4-treated rats, whereas there are few PECAM-1 positive cells observable. After the administration of CCl4, we could detect an early rise of levels of IFN-γ followed by an enhanced TGF-β protein level. As shown by Northern blot analysis and surface protein expression analysed by flow cytometry, IFN-γ-treatment decreased PECAM-1-gene-expression in isolated SECs (sinusoidal endothelial cells) and mononuclear phagocytes (MNPs) in parallel with an increase in ICAM-1-gene-expression in a dose and time dependent manner. In contrast, TGF-β-treatment increased PECAM-1-expression. Additional administration of IFN-γ to CCl4-treated rats and observations in IFN-γ-/- mice confirmed the effect of IFN-γ on PECAM-1 and ICAM-1-expression observed in vitro and increased the number of ED1-expressing cells 12 h after administration of the toxin. Conclusion The early decrease of PECAM-1-expression and the parallel increase of ICAM-1-expression following CCl4-treatment is induced by elevated levels of IFN-γ in livers and may facilitate adhesion and transmigration of inflammatory cells. The up-regulation of PECAM-1-expression in SECs and MNPs after TGF-β-treatment suggests the involvement of PECAM-1 during the recovery after liver damage. PMID:18466611

Association between level of interferon gamma and acid-fast bacillipositivity in pulmonary tuberculosis

NASA Astrophysics Data System (ADS)

Priwahyuningtyas, N. B.; Sinaga, B. Y. M.; Pandia, P.; Eyanoer, P. C.

2018-03-01

Tuberculosis is an infectious disease which caused by Mycobacterium tuberculosis (M. tuberculosis) that infected numerous organ especially the lung. A person’s immunity is very affecting for a person exposed to pulmonary tuberculosis. T-helper-1 cell (Th1) is very influential in the immune system especially in interfering intracellular bacterial infection. One of the cytokines known produced by Th1 cell is interferon gamma (IFN-γ) which is in eliminating M. tuberculosis. The study aims to identify the association between level of IFN-γ and AFB positivity in pulmonary tuberculosis patients in Medan. It is a case-control study. The subjects of the study were 60 new cases of pulmonary tuberculosis with AFB sputum smear- positive that never received ATT consisting 20 cases AFB (+1), 20 cases AFB (+2) and 20 cases AFB (+3).Samples were plasma collected from the venous blood of pulmonary tuberculosis patients. The plasma then underwent laboratory assay with ELISA techniques. Independent t-test was p<0.05 considered significant. Level of IFN-γ in TB AFB (+1) is higher than TB AFB (+2) and (+3), with thesignificant statistical result (p=0.001).

IFN-γ Induces Mimic Extracellular Trap Cell Death in Lung Epithelial Cells Through Autophagy-Regulated DNA Damage.

PubMed

Lin, Chiou-Feng; Chien, Shun-Yi; Chen, Chia-Ling; Hsieh, Chia-Yuan; Tseng, Po-Chun; Wang, Yu-Chih

2016-02-01

Treatment of interferon-γ (IFN-γ) causes cell growth inhibition and cytotoxicity in lung epithelial malignancies. Regarding the induction of autophagy related to IFN-γ signaling, this study investigated the link between autophagy and IFN-γ cytotoxicity. In A549 human lung cancer cells, IFN-γ treatment induced concurrent apoptotic and nonapoptotic events. Unexpectedly, the nonapoptotic cells present mimic extracellular trap cell death (ETosis), which was regulated by caspase-3 and by autophagy induction through immunity-related GTPase family M protein 1 and activating transcription factor 6. Furthermore, IFN-γ signaling controlled mimic ETosis through a mechanism involving an autophagy- and Fas-associated protein with death domain-controlled caspase-8/-3 activation. Following caspase-mediated lamin degradation, IFN-γ caused DNA damage-associated ataxia telangiectasia and Rad3-related protein (ATR)/ataxia telangiectasia mutated (ATM)-regulated mimic ETosis. Upon ATR/ATM signaling, peptidyl arginine deiminase 4 (PAD4)-mediated histone 3 citrullination promoted mimic ETosis. Such IFN-γ-induced effects were defective in PC14PE6/AS2 human lung cancer cells, which were unsusceptible to IFN-γ-induced autophagy. Due to autophagy-based caspase cascade activation, IFN-γ triggers unconventional caspase-mediated DNA damage, followed by ATR/ATM-regulated PAD4-mediated histone citrullination during mimic ETosis in lung epithelial malignancy.

Distinct expression pattern of IFN-alpha and TNF-alpha in juvenile idiopathic arthritis synovial tissue.

PubMed

Gattorno, M; Chicha, L; Gregorio, A; Ferlito, F; Rossi, F; Jarrossay, D; Lanzavecchia, A; Martini, A; Manz, M G

2007-04-01

Recent laboratory and clinical data suggest that two prototype autoimmune diseases, systemic lupus erythematosus and rheumatoid arthritis are mainly driven by distinct cytokines, interferon (IFN)-alpha and tumour necrosis factor (TNF)-alpha, respectively. We here investigated the presence and characteristics of natural type I IFN-producing cells (IPCs), as well as IFN-alpha and TNF-alpha expression at sites of inflammation in juvenile idiopathic arthritis (JIA). Peripheral blood (PB) and synovial fluid (SF) mononuclear cells (MNCs) (n = 25 each) from JIA patients with active disease were studied. IPCs were identified as BCDA-2(+)CD123(+)HLA-DR(+)CD45RA(+) cells, and dendritic cells (DCs) as CD11c(+)CD14(-/low)lin(-) cells by flow cytometry. IPCs and DCs were analysed for Toll-like receptor-7 and -9 mRNA expression by real-time polymerase chain reaction. IFN-alpha was measured by enzyme-linked immunosorbent assay in serum, SF and in supernatants of influenza virus-infected, cultured IPCs. Synovial tissues of n = 6 additional JIA patients were analysed by immunohistochemistry using mAbs against CD123, IFN-alpha, TNF-alpha, CD3, CD19 and CD138. IPCs were enriched in SF MNCs compared with PB MNCs in all JIA patients. Influenza-induced, but no spontaneous IFN-alpha release was detected from SF IPCs, and serum and SF IFN-alpha levels were not elevated. Nonetheless, in synovial tissue IFN-alpha producing cells accumulated at inflammatory lymph-follicular-like structures, while TNF-alpha producing cells were mostly found at the lining and sublining layers. These data suggest that besides TNF-alpha-expressing cells, IFN-alpha-producing IPCs are involved in initiation, maintenance or regulation of the inflammatory response in JIA.

Gamma Interferon-Induced Guanylate Binding Protein 1 Is a Novel Actin Cytoskeleton Remodeling Factor

PubMed Central

Ostler, Nicole; Britzen-Laurent, Nathalie; Liebl, Andrea; Naschberger, Elisabeth; Lochnit, Günter; Ostler, Markus; Forster, Florian; Kunzelmann, Peter; Ince, Semra; Supper, Verena; Praefcke, Gerrit J. K.; Schubert, Dirk W.; Stockinger, Hannes; Herrmann, Christian

2014-01-01

Gamma interferon (IFN-γ) regulates immune defenses against viruses, intracellular pathogens, and tumors by modulating cell proliferation, migration, invasion, and vesicle trafficking processes. The large GTPase guanylate binding protein 1 (GBP-1) is among the cellular proteins that is the most abundantly induced by IFN-γ and mediates its cell biologic effects. As yet, the molecular mechanisms of action of GBP-1 remain unknown. Applying an interaction proteomics approach, we identified actin as a strong and specific binding partner of GBP-1. Furthermore, GBP-1 colocalized with actin at the subcellular level and was both necessary and sufficient for the extensive remodeling of the fibrous actin structure observed in IFN-γ-exposed cells. These effects were dependent on the oligomerization and the GTPase activity of GBP-1. Purified GBP-1 and actin bound to each other, and this interaction was sufficient to impair the formation of actin filaments in vitro, as demonstrated by atomic force microscopy, dynamic light scattering, and fluorescence-monitored polymerization. Cosedimentation and band shift analyses demonstrated that GBP-1 binds robustly to globular actin and slightly to filamentous actin. This indicated that GBP-1 may induce actin remodeling via globular actin sequestering and/or filament capping. These results establish GBP-1 as a novel member within the family of actin-remodeling proteins specifically mediating IFN-γ-dependent defense strategies. PMID:24190970

Gamma interferon-induced guanylate binding protein 1 is a novel actin cytoskeleton remodeling factor.

PubMed

Ostler, Nicole; Britzen-Laurent, Nathalie; Liebl, Andrea; Naschberger, Elisabeth; Lochnit, Günter; Ostler, Markus; Forster, Florian; Kunzelmann, Peter; Ince, Semra; Supper, Verena; Praefcke, Gerrit J K; Schubert, Dirk W; Stockinger, Hannes; Herrmann, Christian; Stürzl, Michael

2014-01-01

Gamma interferon (IFN-γ) regulates immune defenses against viruses, intracellular pathogens, and tumors by modulating cell proliferation, migration, invasion, and vesicle trafficking processes. The large GTPase guanylate binding protein 1 (GBP-1) is among the cellular proteins that is the most abundantly induced by IFN-γ and mediates its cell biologic effects. As yet, the molecular mechanisms of action of GBP-1 remain unknown. Applying an interaction proteomics approach, we identified actin as a strong and specific binding partner of GBP-1. Furthermore, GBP-1 colocalized with actin at the subcellular level and was both necessary and sufficient for the extensive remodeling of the fibrous actin structure observed in IFN-γ-exposed cells. These effects were dependent on the oligomerization and the GTPase activity of GBP-1. Purified GBP-1 and actin bound to each other, and this interaction was sufficient to impair the formation of actin filaments in vitro, as demonstrated by atomic force microscopy, dynamic light scattering, and fluorescence-monitored polymerization. Cosedimentation and band shift analyses demonstrated that GBP-1 binds robustly to globular actin and slightly to filamentous actin. This indicated that GBP-1 may induce actin remodeling via globular actin sequestering and/or filament capping. These results establish GBP-1 as a novel member within the family of actin-remodeling proteins specifically mediating IFN-γ-dependent defense strategies.

Enhancement of antiproliferative activity of interferons by RNA interference-mediated silencing of SOCS gene expression in tumor cells.

PubMed

Takahashi, Yuki; Kaneda, Haruka; Takasuka, Nana; Hattori, Kayoko; Nishikawa, Makiya; Watanabe, Yoshihiko; Takakura, Yoshinobu

2008-08-01

The suppressor of cytokine signaling (SOCS) proteins, negative regulators of interferon (IFN)-induced signaling pathways, is involved in IFN resistance of tumor cells. To improve the growth inhibitory effect of IFN-beta and IFN-gamma on a murine melanoma cell line, B16-BL6, and a murine colon carcinoma cell line, Colon26 cells, SOCS-1 and SOCS-3 gene expression in tumor cells was downregulated by transfection of plasmid DNA expressing short hairpin RNA targeting one of these genes (pshSOCS-1 and pshSOCS-3, respectively). Transfection of pshSOCS-1 significantly increased the antiproliferative effect of IFN-gamma on B16-BL6 cells. However, any other combinations of plasmids and IFN had little effect on the growth of B16-BL6 cells. In addition, transfection of pshSOCS-1 and pshSOCS-3 produced little improvement in the effect of IFN on Colon26 cells. To understand the mechanism underlining these findings, the level of SOCS gene expression was measured by real time polymerase chain reaction. Addition of IFN-gamma greatly increased the SOCS-1 mRNA expression in B16-BL6 cells. Taking into account the synergistic effect of pshSOCS-1 and IFN-gamma on the growth of B16-BL6 cells, these findings suggest that IFN-gamma-induced high SOCS-1 gene expression in B16-BL6 cells significantly interferes with the antiproliferative effect of IFN-gamma. These results indicate that silencing SOCS gene expression can be an effective strategy to enhance the antitumor effect of IFN under conditions in which the SOCS gene expression is upregulated by IFN.

TH1/TH2 cytokines and soluble CD30 levels in kidney allograft patients with donor bone marrow cell infusion.

PubMed

Solgi, G; Amirzagar, A A; Pourmand, G; Mehrsai, A R; Taherimahmoudi, M; Baradaran, N; Nicknam, M H; Ebrahimi Rad, M R; Saraji, A; Asadpoor, A A; Moheiydin, M; Nikbin, B

2009-09-01

We investigated the relevance of donor bone marrow cell infusion (DBMI) and serum levels of interferon-gamma (IFN-gamma), interleukin-10 (IL-10), and soluble CD30 (sCD30) in kidney recipients. We analyzed the allograft outcomes correlated with sCD30, IFN-gamma, and IL-10 levels using pre- and posttransplantation sera from 40 live donor renal transplants (20 patients with DBMI [2.1 x 10(9) +/- 1.3 x 10(9) mononuclear cells/body] and 20 controls). Patients with acute rejection episodes (ARE)-3/20 DBMI and 6/20 controls-showed increased sCD30 and IFN-gamma as well as decreased IL-10 posttransplantation compared with nonrejectors. Significant differences were observed for sCD30 and IFN-gamma levels: 59.54 vs 30.92 ng/mL (P = .02) and 11.91 vs 3.01 pg/mL (P = .01), respectively. Comparison of pre- and posttransplant levels of IFN-gamma, IL-10, and sCD30 in ARE patients showed higher levels in posttransplant sera except for IFN-gamma in controls (6.37 vs 11.93; P = .01). Increased IFN-gamma and IL-10 were correlated with rejection (r = .93; P = .008). sCD30 correlated with serum creatinine among ARE patients in control and DBMI groups (r = .89; P = .019; and r = 1.00; P < .0001, respectively). Higher levels of sCD30, IFN-gamma, and IL-10 posttransplantation in rejecting patients provided evidence for coexistence of cellular and humoral responses in ARE. There appeared to be a down-regulatory effect of infusion on alloresponses.

Lineage-specific expansion of IFIT gene family: an insight into coevolution with IFN gene family.

PubMed

Liu, Ying; Zhang, Yi-Bing; Liu, Ting-Kai; Gui, Jian-Fang

2013-01-01

In mammals, IFIT (Interferon [IFN]-induced proteins with Tetratricopeptide Repeat [TPR] motifs) family genes are involved in many cellular and viral processes, which are tightly related to mammalian IFN response. However, little is known about non-mammalian IFIT genes. In the present study, IFIT genes are identified in the genome databases from the jawed vertebrates including the cartilaginous elephant shark but not from non-vertebrates such as lancelet, sea squirt and acorn worm, suggesting that IFIT gene family originates from a vertebrate ancestor about 450 million years ago. IFIT family genes show conserved gene structure and gene arrangements. Phylogenetic analyses reveal that this gene family has expanded through lineage-specific and species-specific gene duplication. Interestingly, IFN gene family seem to share a common ancestor and a similar evolutionary mechanism; the function link of IFIT genes to IFN response is present early since the origin of both gene families, as evidenced by the finding that zebrafish IFIT genes are upregulated by fish IFNs, poly(I:C) and two transcription factors IRF3/IRF7, likely via the IFN-stimulated response elements (ISRE) within the promoters of vertebrate IFIT family genes. These coevolution features creates functional association of both family genes to fulfill a common biological process, which is likely selected by viral infection during evolution of vertebrates. Our results are helpful for understanding of evolution of vertebrate IFN system.

High gamma power in ECoG reflects cortical electrical stimulation effects on unit activity in layers V/VI

NASA Astrophysics Data System (ADS)

Yazdan-Shahmorad, Azadeh; Kipke, Daryl R.; Lehmkuhle, Mark J.

2013-12-01

Objective. Cortical electrical stimulation (CES) has been used extensively in experimental neuroscience to modulate neuronal or behavioral activity, which has led this technique to be considered in neurorehabilitation. Because the cortex and the surrounding anatomy have irregular geometries as well as inhomogeneous and anisotropic electrical properties, the mechanism by which CES has therapeutic effects is poorly understood. Therapeutic effects of CES can be improved by optimizing the stimulation parameters based on the effects of various stimulation parameters on target brain regions. Approach. In this study we have compared the effects of CES pulse polarity, frequency, and amplitude on unit activity recorded from rat primary motor cortex with the effects on the corresponding local field potentials (LFP), and electrocorticograms (ECoG). CES was applied at the surface of the cortex and the unit activity and LFPs were recorded using a penetrating electrode array, which was implanted below the stimulation site. ECoGs were recorded from the vicinity of the stimulation site. Main results. Time-frequency analysis of LFPs following CES showed correlation of gamma frequencies with unit activity response in all layers. More importantly, high gamma power of ECoG signals only correlated with the unit activity in lower layers (V-VI) following CES. Time-frequency correlations, which were found between LFPs, ECoGs and unit activity, were frequency- and amplitude-dependent. Significance. The signature of the neural activity observed in LFP and ECoG signals provides a better understanding of the effects of stimulation on network activity, representative of large numbers of neurons responding to stimulation. These results demonstrate that the neurorehabilitation and neuroprosthetic applications of CES targeting layered cortex can be further improved by using field potential recordings as surrogates to unit activity aimed at optimizing stimulation efficacy. Likewise, the signatures

Sequential determination of serum viral titers, virus-specific IgG antibodies, and TNF-α, IL-6, IL-10, and IFN-γ levels in patients with Crimean-Congo hemorrhagic fever.

PubMed

Kaya, Safak; Elaldi, Nazif; Kubar, Ayhan; Gursoy, Nevcihan; Yilmaz, Meral; Karakus, Gulderen; Gunes, Turabi; Polat, Zubeyde; Gozel, Mustafa Gokhan; Engin, Aynur; Dokmetas, Ilyas; Bakir, Mehmet; Yilmaz, Neziha; Sencan, Mehmet

2014-07-28

Although there have been a number of studies on the pathogenesis of Crimean-Congo hemorrhagic fever (CCHF) recently, knowledge on this topic is still insufficient. This study aims to reveal the kinetics of serum CCHF virus (CCHFV) titers, serum levels of anti-CCHFV immunoglobulin (Ig)G, tumor necrosis factor (TNF)-α, interleukin (IL)-6, IL-10, and interferon (IFN)-γ in CCHF patients. In total, 31 CCHF cases (11 fatal) were studied. Serum samples were obtained daily from all patients from the time of admission and continued for a 7-day hospitalization period for serologic (ELISA), virologic (real-time PCR), and cytokine (ELISA) analysis. The mean serum CCHFV titer at admission was 5.5E + 09 copies/mL in fatal cases and 5.7E + 08 copies/mL in survivors (p < 0.001). Compared to survivors, both the mean serum levels of IL-6 and TNF-α at admission were found to be significantly increased in fatal cases. The serum levels of IL-6, TNF-α and serum CCHFV titer at admission were significantly and positively correlated with disseminated intravascular coagulation (DIC) scores (r = 0.626, p = 0.0002; r = 0.461, p = 0.009; and r = 0.625, p = 0.003, respectively). When the data obtained from the sequential determination of CCHFV titer and levels of anti-CCHFV IgG, IL-6, TNF-α, IL-10 and IFN-γ were grouped according to the days of illness, the initial serum CCHFV titer of a fatal patient was 5.5E + 09 (copies/mL) and it was 6.1E + 09 (copies/mL) in a survivor on the 2 day of illness. While significant alterations were observed in all cytokines during the monitoring period, IL-6 levels remained consistently higher in fatal cases and TNF-α levels increased in both in fatal and non-fatal CCHF cases. The increased CCHFV load and higher concentrations of IL-6 and TNF-α, the presence of DIC, and the absence of CCHFV specific immunity are strongly associated with death in CCHF.

Analysis of Intrinsic Peptide Detectability via Integrated Label-Free and SRM-Based Absolute Quantitative Proteomics.

PubMed

Jarnuczak, Andrew F; Lee, Dave C H; Lawless, Craig; Holman, Stephen W; Eyers, Claire E; Hubbard, Simon J

2016-09-02

Quantitative mass spectrometry-based proteomics of complex biological samples remains challenging in part due to the variability and charge competition arising during electrospray ionization (ESI) of peptides and the subsequent transfer and detection of ions. These issues preclude direct quantification from signal intensity alone in the absence of a standard. A deeper understanding of the governing principles of peptide ionization and exploitation of the inherent ionization and detection parameters of individual peptides is thus of great value. Here, using the yeast proteome as a model system, we establish the concept of peptide F-factor as a measure of detectability, closely related to ionization efficiency. F-factor is calculated by normalizing peptide precursor ion intensity by absolute abundance of the parent protein. We investigated F-factor characteristics in different shotgun proteomics experiments, including across multiple ESI-based LC-MS platforms. We show that F-factors mirror previously observed physicochemical predictors as peptide detectability but demonstrate a nonlinear relationship between hydrophobicity and peptide detectability. Similarly, we use F-factors to show how peptide ion coelution adversely affects detectability and ionization. We suggest that F-factors have great utility for understanding peptide detectability and gas-phase ion chemistry in complex peptide mixtures, selection of surrogate peptides in targeted MS studies, and for calibration of peptide ion signal in label-free workflows. Data are available via ProteomeXchange with identifier PXD003472.

Prenatal Dexamethasone and Postnatal High-Fat Diet Decrease Interferon Gamma Production through an Age-Dependent Histone Modification in Male Sprague-Dawley Rats

PubMed Central

Yu, Hong-Ren; Tain, You-Lin; Sheen, Jiunn-Ming; Tiao, Mao-Meng; Chen, Chih-Cheng; Kuo, Ho-Chang; Hung, Pi-Lien; Hsieh, Kai-Sheng; Huang, Li-Tung

2016-01-01

Overexposure to prenatal glucocorticoid (GC) disturbs hypothalamic-pituitary-adrenocortical axis-associated neuroendocrine metabolism and susceptibility to metabolic syndrome. A high-fat (HF) diet is a major environmental factor that can cause metabolic syndrome. We aimed to investigate whether prenatal GC plus a postnatal HF diet could alter immune programming in rat offspring. Pregnant Sprague-Dawley rats were given intraperitoneal injections of dexamethasone or saline at 14–21 days of gestation. Male offspring were then divided into four groups: vehicle, prenatal dexamethasone exposure, postnatal HF diet (VHF), and prenatal dexamethasone exposure plus a postnatal HF diet (DHF). The rats were sacrificed and adaptive immune function was evaluated. Compared to the vehicle, the DHF group had lower interferon gamma (IFN-γ) production by splenocytes at postnatal day 120. Decreases in H3K9 acetylation and H3K36me3 levels at the IFN-γ promoter correlated with decreased IFN-γ production. The impaired IFN-γ production and aberrant site-specific histone modification at the IFN-γ promoter by prenatal dexamethasone treatment plus a postnatal HF diet resulted in resilience at postnatal day 180. Prenatal dexamethasone and a postnatal HF diet decreased IFN-γ production through a site-specific and an age-dependent histone modification. These findings suggest a mechanism by which prenatal exposure to GC and a postnatal environment exert effects on fetal immunity programming. PMID:27669212

Adenovirus-specific T-cell Subsets in Human Peripheral Blood and After IFN-γ Immunomagnetic Selection.

PubMed

Qian, Chongsheng; Wang, Yingying; Cai, Huili; Laroye, Caroline; De Carvalho Bittencourt, Marcelo; Clement, Laurence; Stoltz, Jean-François; Decot, Véronique; Reppel, Loïc; Bensoussan, Danièle

2016-01-01

Adoptive antiviral cellular immunotherapy by infusion of virus-specific T cells (VSTs) is becoming an alternative treatment for viral infection after hematopoietic stem cell transplantation. The T memory stem cell (TSCM) subset was recently described as exhibiting self-renewal and multipotency properties which are required for sustained efficacy in vivo. We wondered if such a crucial subset for immunotherapy was present in VSTs. We identified, by flow cytometry, TSCM in adenovirus (ADV)-specific interferon (IFN)-γ+ T cells before and after IFN-γ-based immunomagnetic selection, and analyzed the distribution of the main T-cell subsets in VSTs: naive T cells (TN), TSCM, T central memory cells (TCM), T effector memory cell (TEM), and effector T cells (TEFF). In this study all of the different T-cell subsets were observed in the blood sample from healthy donor ADV-VSTs, both before and after IFN-γ-based immunomagnetic selection. As the IFN-γ-based immunomagnetic selection system sorts mainly the most differentiated T-cell subsets, we observed that TEM was always the major T-cell subset of ADV-specific T cells after immunomagnetic isolation and especially after expansion in vitro. Comparing T-cell subpopulation profiles before and after in vitro expansion, we observed that in vitro cell culture with interleukin-2 resulted in a significant expansion of TN-like, TCM, TEM, and TEFF subsets in CD4IFN-γ T cells and of TCM and TEM subsets only in CD8IFN-γ T cells. We demonstrated the presence of all T-cell subsets in IFN-γ VSTs including the TSCM subpopulation, although this was weakly selected by the IFN-γ-based immunomagnetic selection system.

IFN-γ protects from apoptotic neutrophil-mediated tissue injury during acute Listeria monocytogenes infection.

PubMed

Wang, Guan; Lin, Ang; Han, Qiuju; Zhao, Huajun; Tian, Zhigang; Zhang, Jian

2018-06-23

Listeria monocytogenes (LM) is a foodborne Gram-positive intracellular pathogen that can cause listeriosis in humans and animals. Although phagocytes are known to be involved in the response to this infection, the role of neutrophils is not entirely clear. Here, we have demonstrated that soon after LM infection, a large number of IFN-γ-producing neutrophils quickly accumulated in the spleen, blood, and peritoneal cavity. Both in vivo and in vitro experiments demonstrated that neutrophils were an important source of IFN-γ. IFN-γ played a critical protective role against acute LM infection, as demonstrated by the poor survival of Ifng -/- mice. Moreover, IFN-γ promoted bacterial clearance by the neutrophils, thereby inhibiting LM-induced neutrophil apoptosis and spleen damage. In addition to this, IFN-γ could effectively drive macrophage-mediated phagocytosis of apoptotic neutrophils, which was accompanied with TGF-β secretion and was involved in protection against tissue injury. Importantly, by phagocytizing apoptotic neutrophils, macrophages obtained myeloperoxidase, an important bactericidal molecule only produced by neutrophils, which further promoted the antibacterial activity of macrophages. These findings demonstrate that neutrophils are an important source of IFN-γ at the early stage of LM infection, which is characterized by both LM elimination and tissue-protective effects. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Induction and disappearance of G2 chromatid breaks in lymphocytes after low doses of low-LET gamma-rays and high-LET fast neutrons.

PubMed

Vral, A; Thierens, H; Baeyens, A; De Ridder, L

2002-04-01

To determine by means of the G2 assay the number of chromatid breaks induced by low-LET gamma-rays and high-LET neutrons, and to compare the kinetics of chromatid break rejoining for radiations of different quality. The G2 assay was performed on blood samples of four healthy donors who were irradiated with low-LET gamma-rays and high-LET neutrons. In a first set of experiments a dose-response curve for the formation of chromatid breaks was carried out for gamma-rays and neutrons with doses ranging between 0.1 and 0.5 Gy. In a second set of experiments, the kinetics of chromatid break formation and disappearance were investigated after a dose of 0.5 Gy using post-irradiation times ranging between 0.5 and 3.5 h. For the highest dose of 0.5 Gy, the number of isochromatid breaks was also scored. No significant differences in the number of chromatid breaks were observed between low-LET gamma-rays and high-LET neutrons for the four donors at any of the doses given. The dose-response curves for the formation of chromatid breaks are linear for both radiation qualities and RBEs = 1 were obtained. Scoring of isochromatid breaks at the highest dose of 0.5 Gy revealed that high-LET neutrons were, however, more effective at inducing isochromatid breaks (RBE = 6.2). The rejoining experiments further showed that the kinetics of disappearance of chromatid breaks following irradiation with low-LET gamma-rays or high-LET neutrons were not significantly different. Half-times of 0.92 h for gamma-rays and 0.84 h for neutrons were obtained. Applying the G2 assay, the results demonstrate that at low doses of irradiation, the induction as well as the disappearance of chromatid breaks is independent of the LET of the radiation qualities used (0.24 keV x microm(-1) 60Co gamma-rays and 20 keV x microm(-1) fast neutrons). As these radiation qualities produce the same initial number of double-strand breaks, the results support the signal model that proposes that chromatid breaks are the result

Interferon-gamma inhibits HIV-induced invasiveness of monocytes.

PubMed

Dhawan, S; Wahl, L M; Heredia, A; Zhang, Y; Epstein, J S; Meltzer, M S; Hewlett, I K

1995-12-01

HIV-infected monocytes form highly invasive network on basement membrane matrix and secrete high levels of 92-kd metalloproteinase (MMP-9), an enzyme that degrades basement membrane proteins. In the present study, using matrigel as a model basement membrane system, we demonstrate that treatment of human immunodeficiency virus (HIV)-infected monocytes with interferon-gamma at 50 U/ml inhibited the ability of infected monocytes to form an invasive network on matrigel and their invasion through the matrigel matrix. These effects were associated with a significant reduction in the levels of MMP-9 produced by HIV-infected monocytes treated with interferon-gamma 1 day prior to infection with HIV as compared with that of untreated HIV-infected monocytes. Monocytes treated with interferon-gamma 1 day after HIV infection showed the presence of integrated HIV sequences; however, the levels of MMP-9 were substantially lower than those produced by monocytes inoculated with live HIV, heat-inactivated HIV, or even the control uninfected monocytes. Exposure of monocytes to heat-inactivated HIV did not result in increased invasiveness or high MMP-9 production, suggesting that regulation of metalloproteinase by monocytes was independent of CD4-gp120 interactions and required active virus infection. Furthermore, addition of interferon-gamma to monocytes on day 10 after infection inhibited MMP-9 production by more than threefold with no significant reduction of virus replication. These results indicate that the mechanism of interferon-gamma-induced down-regulation of MMP-9 levels and reduced monocyte invasiveness may be mediated by a mechanism independent of antiviral activity of IFN-gamma in monocytes. Down-regulation of MMP-9 in HIV-infected monocytes by interferon-gamma may play an important role in the control of HIV pathogenesis.

miR-370 regulates ISG15 expression and influences IFN-α sensitivity in hepatocellular carcinoma cells.

PubMed

Liu, Zhuo; Ma, Min; Yan, Lei; Chen, Shilin; Li, Sha; Yang, Darong; Wang, Xiaohong; Xiao, Hua; Deng, Hongyu; Zhu, Haizhen; Zuo, Chaohui; Xia, Man

2018-05-05

Interferon-α (IFN-α) is an adjuvant to chemotherapy and radiotherapy for hepatocellular carcinoma (HCC), but some HCC patients do not respond to treatment with IFN-α. We performed loss-of-function and gain-of-function experiments to examine the role of ISG15 in the IFN-α sensitivity of LH86, HLCZ01, SMMC7721, and Huh7 cell lines and tumor samples. The overexpression of ISG15 reduced apoptosis in Huh7 and LH86 cells in the presence of IFN-α, whereas the shRNA-mediated knock down of ISG15 expression increased apoptosis in both Huh7 and LH86 cells. We identified a putative miR-370 target site in the 3'-UTR in the ISG15 mRNA, and the level of miR-370 expression in HCC cell lines reflected the level of IFN-α-induced apoptosis exhibited by each. Both HCC cell lines and tumor samples had significantly lower levels of miR-370 than the control cells and tissues (P< 0.05). The overexpression of miR-370 in IFN-α-treated LH86 and Huh7 cells increased apoptosis and reduced the volume of LH86- and Huh7-derived xenograft tumors in mice treated with IFN-α compared with the control tumors. Our findings suggest that miR-370 functions as an HCC tumor suppressor and regulator of IFN-α sensitivity and that miR-370 might be a useful prognostic marker for HCC patients.

Cell death is induced by ciglitazone, a peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) agonist, independently of PPAR{gamma} in human glioma cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Myoung Woo; Kim, Dae Seong; Kim, Hye Ryung

Highlights: Black-Right-Pointing-Pointer Greater than 30 {mu}M ciglitazone induces cell death in glioma cells. Black-Right-Pointing-Pointer Cell death by ciglitazone is independent of PPAR{gamma} in glioma cells. Black-Right-Pointing-Pointer CGZ induces cell death by the loss of MMP via decreased Akt. -- Abstract: Peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) regulates multiple signaling pathways, and its agonists induce apoptosis in various cancer cells. However, their role in cell death is unclear. In this study, the relationship between ciglitazone (CGZ) and PPAR{gamma} in CGZ-induced cell death was examined. At concentrations of greater than 30 {mu}M, CGZ, a synthetic PPAR{gamma} agonist, activated caspase-3 and induced apoptosis inmore » T98G cells. Treatment of T98G cells with less than 30 {mu}M CGZ effectively induced cell death after pretreatment with 30 {mu}M of the PPAR{gamma} antagonist GW9662, although GW9662 alone did not induce cell death. This cell death was also observed when cells were co-treated with CGZ and GW9662, but was not observed when cells were treated with CGZ prior to GW9662. In cells in which PPAR{gamma} was down-regulated cells by siRNA, lower concentrations of CGZ (<30 {mu}M) were sufficient to induce cell death, although higher concentrations of CGZ ( Greater-Than-Or-Slanted-Equal-To 30 {mu}M) were required to induce cell death in control T98G cells, indicating that CGZ effectively induces cell death in T98G cells independently of PPAR{gamma}. Treatment with GW9662 followed by CGZ resulted in a down-regulation of Akt activity and the loss of mitochondrial membrane potential (MMP), which was accompanied by a decrease in Bcl-2 expression and an increase in Bid cleavage. These data suggest that CGZ is capable of inducing apoptotic cell death independently of PPAR{gamma} in glioma cells, by down-regulating Akt activity and inducing MMP collapse.« less

IFN-λ prevents influenza virus spread from the upper airways to the lungs and limits virus transmission

PubMed Central

Ye, Liang; Schwaderlapp, Marilena; Gad, Hans Henrik; Hartmann, Rune; Garcin, Dominique; Mahlakõiv, Tanel

2018-01-01

Host factors restricting the transmission of respiratory viruses are poorly characterized. We analyzed the contribution of type I and type III interferon (IFN) using a mouse model in which the virus is selectively administered to the upper airways, mimicking a natural respiratory virus infection. Mice lacking functional IFN-λ receptors (Ifnlr1−/−) no longer restricted virus dissemination from the upper airways to the lungs. Ifnlr1−/− mice shed significantly more infectious virus particles via the nostrils and transmitted the virus much more efficiently to naïve contacts compared with wild-type mice or mice lacking functional type I IFN receptors. Prophylactic treatment with IFN-α or IFN-λ inhibited initial virus replication in all parts of the respiratory tract, but only IFN-λ conferred long-lasting antiviral protection in the upper airways and blocked virus transmission. Thus, IFN-λ has a decisive and non-redundant function in the upper airways that greatly limits transmission of respiratory viruses to naïve contacts. PMID:29651984

A Novel Immunoregulatory Function for IL-23: Inhibition of IL-12 Dependent IFN-γ Production

PubMed Central

Sieve, Amy N.; Meeks, Karen D.; Lee, Suheung; Berg, Rance E.

2011-01-01

Summary Most studies investigating the function of IL-23 have concluded that it promotes IL-17 secreting T cells. While some reports have also characterized IL-23 as having redundant pro-inflammatory effects with IL-12, we have instead found that IL-23 antagonizes IL-12 induced secretion of IFN-γ. When splenocytes or purified populations of T cells are cultured with IL-23, IFN-γ secretion in response to IL-12 is dramatically reduced. The impact of IL-23 is most prominent in CD8 T cells, but is also observed in NK and CD4 T cells. Mechanistically, the IL-23 receptor is not required for this phenomenon, and IL-23 inhibits signaling through the IL-12 receptor by reducing IL-12 induced signal transducer and activator of transcription 4 (STAT4) phosphorylation. IL-23 is also able to reduce IFN-γ secretion by antagonizing endogenously produced IL-12 from Listeria monocytogenes (LM) infected macrophages. In vivo, LM infection induces higher serum IFN-γ levels and a greater percentage of IFN-γ+CD8+ T cells in IL-23p19 deficient mice as compared to wild-type mice. This increase in IFN-γ production coincides with increased LM clearance at days 2–3 post-infection. Our data suggest that IL-23 may be a key factor in determining the responsiveness of lymphocytes to IL-12 and their subsequent secretion of IFN-γ. PMID:20458705

Newly identified CpG ODNs, M5-30 and M6-395, stimulate mouse immune cells to secrete TNF-alpha and enhance Th1-mediated immunity.

PubMed

Choi, Sun-Shim; Chung, Eunkyung; Jung, Yu-Jin

2010-08-01

Bacterial CpG motifs are known to induce both innate and adaptive immunity in infected hosts via toll-like receptor 9 (TLR9). Because small oligonucleotides (ODNs) mimicking bacterial CpG motifs are easily synthesized, they have found use as immunomodulatory agents in a number of disease models. We have developed a novel bioinformatics approach to identify effective CpG ODN sequences and evaluate their function as TLR9 ligands in a murine system. Among the CpG ODNs we identified, M5-30 and M6-395 showed significant ability to stimulate TNF-alpha and IFN-gamma production in a mouse macrophage cell line and mouse splenocytes, respectively. We also found that these CpG ODNs activated cells through the canonical NF-kappa B signaling pathway. Moreover, both CpG ODNs were able to induce Th1-mediated immunity in Mycobacterium tuberculosis (Mtb)-infected mice. Our results demonstrate that M5-30 and M6-395 function as TLR9-specific ligands, making them useful in the study of TLR9 functionality and signaling in mice.

IFN-γ stimulates osteoclast formation and bone loss in vivo via antigen-driven T cell activation

PubMed Central

Gao, Yuhao; Grassi, Francesco; Ryan, Michaela Robbie; Terauchi, Masakazu; Page, Karen; Yang, Xiaoying; Weitzmann, M. Neale; Pacifici, Roberto

2006-01-01

T cell–produced cytokines play a pivotal role in the bone loss caused by inflammation, infection, and estrogen deficiency. IFN-γ is a major product of activated T helper cells that can function as a pro- or antiresorptive cytokine, but the reason why IFN-γ has variable effects in bone is unknown. Here we show that IFN-γ blunts osteoclast formation through direct targeting of osteoclast precursors but indirectly stimulates osteoclast formation and promotes bone resorption by stimulating antigen-dependent T cell activation and T cell secretion of the osteoclastogenic factors RANKL and TNF-α. Analysis of the in vivo effects of IFN-γ in 3 mouse models of bone loss — ovariectomy, LPS injection, and inflammation via silencing of TGF-β signaling in T cells — reveals that the net effect of IFN-γ in these conditions is that of stimulating bone resorption and bone loss. In summary, IFN-γ has both direct anti-osteoclastogenic and indirect pro-osteoclastogenic properties in vivo. Under conditions of estrogen deficiency, infection, and inflammation, the net balance of these 2 opposing forces is biased toward bone resorption. Inhibition of IFN-γ signaling may thus represent a novel strategy to simultaneously reduce inflammation and bone loss in common forms of osteoporosis. PMID:17173138

[Immune diagnostics of disorders in the IFN-alpha/NK-cell system in patients with frequently recurrent herpes simplex].

PubMed

Karsonova, A V; Shulzhenko, A E; Karaulov, A V

2014-01-01

Study of features of NK-cell response to the effect of recombinant IFN-alpha in complex with evaluation of the ability to synthesize inherent IFN-alpha in patients with frequently recurrent herpes simplex (FRHS). 48 patients with genital (n = 31), labial (n = 10) and mixed localization (n = 7) FRHS diagnosis were observed. 31 healthy donors composed the control group. MC were cultivated in the presence of a recombinant human IFN-alpha2b at the concentration of 10, 100 and 1000 U/ml for 24 hours. NK-cell response to the effect of IFN-alpha was evaluated after 24 hours using flow cytometry by degranulation reaction and in the NK-activity test. IFN-alpha synthesis was evaluated in HSV-1, HSV-2 and Newcastle disease virus stimulated cell supernatants by EIA method. Patients with FRHS were established to be a heterogeneous group by parameters in the IFN-alpha/NK-cell cytotoxicity system. 2 types of NK-cell response to the stimulation by recombinant IFN-alpha were identified. Type A is characterized by a decrease of NK-cell response to IFN-alpha in the remission phase and does not have this defect in the exacerbation phase. Synthesis of inherent IFN-alpha in response to viral inductors for type A was comparable with the response in healthy donors in both phases. On the contrary type B having normal sensitivity of NK-cells to IFN-alpha in the remission phase is characterized by a decrease of this parameter in the exacerbation phase for more than 3 times. Synthesis of inherent IFN-alpha in response to viral inductors during type B is increased in the remission phase and decreased in the exacerbation phase. During immune-correcting therapy of FRHS a personalized approach taking into account features of NK-cell response to IFN-alpha is necessary, because types A and B have principal differences by cytotoxicity parameters of NK-cells and their change under the effect of IFN-alpha, as well as by parameters of IFN-alpha synthesis in response to viral inductors at various phases

Effect of leukocyte therapy on tumor necrosis factor-alpha and interferon-gamma production in patients with recurrent spontaneous abortion.

PubMed