Sample records for gamma ifn-g ffactor

  1. Evidence for a gamma-interferon receptor that regulates macrophage tumoricidal activity

    PubMed Central

    1984-01-01

    Gamma-interferon (IFN-gamma) is the macrophage-activating factor (MAF) produced by normal murine splenic cells and the murine T cell hybridoma 24/G1 that induces nonspecific tumoricidal activity in macrophages. Incubation of 24/G1 supernatants diluted to 8.3 IRU IFN-gamma/ml with 6 X 10(6) elicited peritoneal macrophages or bone marrow-derived macrophages for 4 h at 37 degrees C, resulted in removal of 80% of the MAF activity from the lymphokine preparation. Loss of activity appeared to result from absorption and not consumption because (a) 40% of the activity was removed after exposure to macrophage for 30 min at 4 degrees C, (b) no reduction of MAF activity was detected when the 24/G1 supernatant was incubated with macrophage culture supernatants, and (c) macrophage-treated supernatants showed a selective loss of MAF activity but not interleukin 2 (IL-2) activity. Absorption was dependent on the input of either IFN-gamma or macrophages and was time dependent at 37 degrees C but not at 4 degrees C. With four rodent species tested, absorption of murine IFN-gamma displayed species specificity. However, cultured human peripheral blood monocytes and the human histiocytic lymphoma cell line U937 were able to absorb the murine lymphokine. Although the majority of murine cell lines tested absorbed 24/G1 MAF activity, two murine macrophage cell lines, P388D1 and J774, were identified which absorbed significantly reduced amounts of natural IFN- gamma. Purified murine recombinant IFN-gamma was absorbed by elicited macrophages but not by P388D1. Normal macrophages but not P388D1 bound fluoresceinated microspheres coated with recombinant IFN-gamma and binding was inhibited by pretreatment of the normal cells with 24/G1 supernatants. Scatchard plot analysis showed that 12,000 molecules of soluble 125I-recombinant IFN-gamma bound per bone marrow macrophage with a Ka of 0.9 X 10(8) M-1. Binding was quantitatively inhibitable by natural IFN-gamma but not by murine IFN alpha. IFN-beta competed only weakly. Monoclonal antibodies against IFN-gamma either inhibited or enhanced MAF activity by blocking or increasing IFN-gamma binding to macrophages, respectively. These results indicate that IFN-gamma reacts with a receptor on macrophage in a specific and saturable manner and this interaction initiates macrophage activation. PMID:6330272

  2. Bacterial DNA-induced NK cell IFN-gamma production is dependent on macrophage secretion of IL-12.

    PubMed

    Chace, J H; Hooker, N A; Mildenstein, K L; Krieg, A M; Cowdery, J S

    1997-08-01

    Bacterial DNA (bDNA) activates B cells and macrophages and can augment inflammatory responses by inducing release of proinflammatory cytokines. We found that bDNA stimulation of mouse spleen cells induced NK cell IFN-gamma production that was dependent upon the presence of unmethylated CpG motifs, and oligonucleotides with internal CpG motifs could also induce splenocytes to secrete IFN-gamma. The bDNA-induced IFN-gamma response was strictly macrophages dependent. While splenocytes from SCID mice secreted IFN-gamma in response to bDNA, depletion of macrophages eliminated this response. Additionally, purified NK cells did not respond to bDNA; however, addition of macrophages restored the NK cell IFN-gamma response. Coculture of NK cells with preactivated macrophages further increased bDNA-induced NK cell IFN-gamma production. Anti-IL-12 or IL-10 inhibited bDNA-induced IFN-gamma response. Treatment of purified macrophages with bDNA resulted in IL-12 secretion accompanied by an increase in IL-12 p40 mRNA level. Although isolated NK cells did not make IFN-gamma in response to bDNA, NK cells costimulated with IL-12 gained the ability to respond to bDNA. These experiments show that bDNA induces macrophage IL-12 production which, in turn, stimulates NK cell IFN-gamma production. Macrophage-derived IL-12 renders NK cells responsive to bDNA permitting an even greater IFN-gamma response to bDNA.

  3. Interferon-gamma alone triggers the production of nitric oxide from serum-starved BNL CL.2, murine embryonic liver cells.

    PubMed

    Pae, H O; Yoo, J C; Choi, B M; Paik, S G; Kim, Y H; Jin, H S; Chung, H T

    1999-01-01

    A previous study has demonstrated that both interferon-gamma (IFN-gamma) and lipopolysaccharide (LPS) were needed to induce the production of nitric oxide (NO) in BNL CL.2 cells, murine embryonic liver cells. We here demonstrate that when BNL CL.2 cells were cultured with serum-free medium, they were induced to produce NO by the stimulation of IFN-gamma alone. BNL CL.2 cells were cultured with serum-free or serum-containing medium for 1-3 days and then stimulated to synthesize NO by IFN-gamma. Surprisingly, only serum-starved cells showed significant amount of nitrite accumulation and iNOS protein expression in response to IFN-gamma in dose- and time-dependent manners, but serum-supplied cells did not. When the cells were stimulated with IFN-gamma, tumor necrosis factor-alpha (TNF-alpha), or LPS in combinations, only the combination of IFN-gamma and LPS produced more NO than that produced by IFN-gamma alone. The production of NO by the cells stimulated with IFN-gamma or IFN-gamma plus LPS was blocked by the addition of N(G)-monomethyl-L-arginine (N(G)MMA), a NO synthesis inhibitor. To address the intracellular signal pathway responsible for the production of NO by the cells stimulated with IFN-gamma aloneor IFN-gamma plus LPS, we examined the effects of several protein kinase inhibitors on the production of NO from the cells. The production of NO was significantly inhibited by protein tyrosine kinase (PTK) inhibitors, genistein and herbimycin A, but not by protein kinase A or C inhibitors. These results suggest that the deprivation of serum from BNL CL.2 cell culture medium might prime the cells to induce NO synthesis when the cells are triggered by IFN-gamma and the involvement of PTK signal transduction pathway in the expression of inducible NO synthase gene in murine hepatoma cells.

  4. Sustained exogenous expression of therapeutic levels of IFN-gamma ameliorates atopic dermatitis in NC/Nga mice via Th1 polarization.

    PubMed

    Hattori, Kayoko; Nishikawa, Makiya; Watcharanurak, Kanitta; Ikoma, Akihiko; Kabashima, Kenji; Toyota, Hiroyasu; Takahashi, Yuki; Takahashi, Rei; Watanabe, Yoshihiko; Takakura, Yoshinobu

    2010-03-01

    The short in vivo half-life of IFN-gamma can prevent the cytokine from inducing immunological changes that are favorable for the treatment of Th2-dominant diseases, such as atopic dermatitis. To examine whether a sustained supply of IFN-gamma is effective in regulating the balance of Th lymphocyte subpopulations, plasmid vector encoding mouse IFN-gamma, pCpG-Mugamma, or pCMV-Mugamma was injected into the tail vein of NC/Nga mice, a model for human atopic dermatitis. A single hydrodynamic injection of a CpG motif reduced pCpG-Mugamma at a dose of 0.14 microg/mouse resulted in a sustained concentration of IFN-gamma in the serum, and the concentration was maintained at >300 pg/ml over 80 d. The pCpG-Mugamma-mediated IFN-gamma gene transfer was associated with an increase in the serum concentration of IL-12, reduced production of IgE, and inhibition of mRNA expression of IL-4, -5, -10, -13, and -17 and thymus and activation-regulated chemokine in the spleen. These immunological changes were not clearly observed in mice receiving two injections of 20 microg pCMV-Mugamma, a CpG-replete plasmid DNA, because of the transient nature of the expression from the vector. The mice receiving pCpG-Mugamma showed a significant reduction in the severity of skin lesions and in the intensity of their scratching behavior. Furthermore, high transepidermal water loss, epidermal thickening, and infiltration of lymphocytes and eosinophils, all of which were obvious in the untreated mice, were significantly inhibited. These results indicate that an extraordinary sustained IFN-gamma expression induces favorable immunological changes, leading to a Th1-dominant state in the atopic dermatitis model.

  5. Interleukin-4 but not gamma interferon production correlates with the severity of murine cutaneous leishmaniasis.

    PubMed Central

    Morris, L; Troutt, A B; McLeod, K S; Kelso, A; Handman, E; Aebischer, T

    1993-01-01

    For murine cutaneous leishmaniasis, data to date suggest a correlation between the presence of gamma interferon (IFN-gamma) and resistance in C57BL/6 mice and the presence of interleukin-4 (IL-4) and disease in BALB/c mice. In this study, 13 inbred strains of mice covering the range of susceptibility to disease were infected with Leishmania major to determine whether the subsequent expression of IFN-gamma or IL-4 is a reliable indicator of cure or progressive disease. The presence of IL-4 and IFN-gamma mRNAs in the draining lymph nodes was examined 9 weeks after infection, when differences in disease severity became obvious. There were large differences in the levels of IL-4 mRNA among the different strains, whereas IFN-gamma mRNA was detected at similar levels in all strains. The levels of IL-4 mRNA correlated with lesion score, with susceptible and intermediate strains containing up to 100-fold more than any of the resistant strains. Differences in the levels of IFN-gamma mRNA were within only a fourfold range, with significant overlap among susceptible, intermediate, and resistant strains. Similarly, the levels of IFN-gamma secreted in vitro by lymph node cells from infected mice in response to L. major antigens were within a 10-fold range for most strains, and there was no correlation with lesion score. Analysis of Leishmania-specific antibody levels revealed a correlation between immunoglobulin G1 (IgG1) titers and lesion score, consistent with the role of IL-4 as a switch factor for IgG1. In contrast, there was no correlation between IgG2a titers and lesion score, supporting the notion that IFN-gamma synthesis (which promotes IgG2a production) is not correlated with disease state. These data suggest that along the spectrum of murine cutaneous leishmaniasis, IL-4 is a reliable indicator of disease, but IFN-gamma is not prognostic for resistance. Images PMID:8335376

  6. Role of IL-10 -1082, IFN-gamma +874, and TNF-alpha -308 genes polymorphisms in suicidal behavior.

    PubMed

    Omrani, Mir Davood; Bushehri, Behzad; Bagheri, Morteza; Salari-Lak, Shaker; Alipour, Azize; Anoshae, Mohamad-Reza; Massomi, Reza

    2009-01-01

    In this study, it was determined whether the IL-10 -1082, IFN-gamma +874, and TNF-alpha -308 polymorphisms were associated with suicidal behavior. One hundred forty five patients with suicidal behavior and 160 normal individuals were genotyped for IL-10 -1082, IFN-gamma +874, and TNF-alpha -308 polymorphisms using ASO-PCR method. TNF-alpha -308 G/G genotype has been increased in males with completed suicide behavior versus control group (p value = 0.017). IL-10 -1082 A/A genotype is higher in both male and female suicide completed groups (p value = 0.017). IFN-gamma (+874) A/A genotype was significantly higher in males with completed suicide behavior versus normal male control (p value = 0.027). It can be concluded that IL-10, IFN-gamma, and TNF-alpha polymorphisms may play a role in suicidal behavior.

  7. Immunity to Trichinella spiralis infection in vitamin A-deficient mice

    PubMed Central

    1992-01-01

    Vitamin A-deficient (A-) mice make strikingly poor IgG responses when they are immunized with purified protein antigens. Previously, we showed that A- T cells overproduce interferon gamma (IFN-gamma), which then could inhibit interleukin 4 (IL-4)-stimulated B cell IgG responses. To determine if the altered IFN-gamma regulation pattern and its immunological consequences would extend to a natural infection, we studied mice infected with the parasitic helminth Trichinella spiralis. The course of the infection was similar in A- and A-sufficient (A+) mice. These mice did not differ with respect to newborn larvae/female/hour produced in the intestine, or muscle larvae burden 5 wk postinfection. They also did not differ in the intestinal worm expulsion rate until day 15, when A- mice still harbored parasites, whereas A+ mice had cleared intestinal worms. Vitamin A deficiency reduced both the frequency of B lymphocytes secreting IgG1 antibodies to parasite antigens, and the bone marrow eosinophilia associated with helminth infection. The cytokine secretion patterns in infected mice were consistent with these observations and with previous studies. Mesenteric lymph node cells from infected A- mice secreted significantly more IFN-gamma, and significantly less IL-2, IL-4, and IL- 5 than infected A+ controls. A- splenocytes secreted significantly more IFN-gamma, and equivalent amounts of IL-2, IL-4, and IL-5 compared with A+ controls. Interestingly, CD4-CD8- cells secreted the majority of the IL-4 produced in the spleen. The IL-2, IL-4, and IL-5 steady-state transcript levels correlated with secreted protein levels, but IFN- gamma transcripts did not. Although they secreted more protein, A- cells contained fewer IFN-gamma transcripts than A+ cells. These results suggest two vitamin A-mediated regulation steps in IFN-gamma gene expression: positive regulation of IFN-gamma transcript levels, and negative regulation posttranscriptionally. The essentially unaltered outcome of T. spiralis infection in vitamin A-deficient mice probably reflects a balance between cellular and humoral responses. The IFN-gamma overproduction might have a positive effect on the gut inflammatory response, but the decrease eosinophilia, cytokine production in mesenteric lymph node, and IgG1-secreting cell frequency might have a negative effect on T. spiralis immunity. PMID:1730911

  8. The immunomodulatory effects of interferon-gamma on mature B-lymphocyte responses.

    PubMed

    Jurado, A; Carballido, J; Griffel, H; Hochkeppel, H K; Wetzel, G D

    1989-06-15

    Interferon-gamma (IFN-gamma) exerts a broad spectrum of activities which affect the responses of mature B-cells. It strongly inhibits B-cell activation, acts as a B-cell growth factor (BCGF), and also induces final differentiation to immunoglobulin (Ig) production. IFN-gamma is deeply involved in the differential control of isotype expression, as it enhances IgG2a production and suppresses both IgG1 and IgE production. Although it is now possible to draw a general scheme of the effects of IFN-gamma on B-cells, a number of paradoxical results still exist in the field. In this manuscript, different experimental systems are analyzed in an attempt to explain these apparent paradoxes.

  9. Regulation of the steady state level of Fc gamma RI mRNA by IFN-gamma and dexamethasone in human monocytes, neutrophils, and U-937 cells.

    PubMed

    Pan, L Y; Mendel, D B; Zurlo, J; Guyre, P M

    1990-07-01

    The high affinity IgG FcR Fc gamma RI, CD64, plays important roles in the immune response. Fc gamma RI is predominantly expressed on monocytes and macrophages, and barely detectable on neutrophils. rIFN-gamma markedly increases the expression of Fc gamma RI on neutrophils, monocytes, macrophages and myeloid cell lines such as U-937, HL-60, and THP-1. Glucocorticoids inhibit the augmentation of Fc gamma RI expression by rIFN-gamma on neutrophils and myeloid cell lines, but enhance the augmentation of Fc gamma RI expression by rIFN-gamma on monocytes. In this study, we examined the effect of rIFN-gamma and dexamethasone (Dex) on the steady state level of Fc gamma RI mRNA in U-937 cells, neutrophils, and monocytes by hybridizing total RNA with the Fc gamma RI cDNA probe, p135. We found that the amount of Fc gamma RI mRNA increased within 1 h of treatment with rIFN-gamma in all three cell types. This initial induction of Fc gamma RI mRNA by rIFN-gamma was completely blocked by an inhibitor of RNA synthesis, actinomycin D, suggesting that the rIFN-gamma-mediated induction of Fc gamma RI mRNA is dependent on gene transcription. Dex, used in combination with rIFN-gamma, partially blocked the induction of Fc gamma RI mRNA by rIFN-gamma in U-937 cells and neutrophils, but caused a synergistic increase in Fc gamma RI mRNA levels in monocytes. The inhibitory effect of Dex on the steady state level of Fc gamma RI mRNA in U-937 cells was blocked by an inhibitor of protein synthesis, cycloheximide, suggesting that Dex-induced proteins were involved in the regulation of Fc gamma RI expression. This study indicates that the regulation of Fc gamma RI expression on U-937 cells, neutrophils, and monocytes by rIFN-gamma and Dex occurs, at least in part, at the mRNA level. rIFN-gamma increases the steady state level of Fc gamma RI mRNA through a common pathway among U-937 cells, neutrophils, and monocytes, whereas the effect of Dex on rIFN-gamma-induced Fc gamma RI mRNA is cell-type specific.

  10. A CpG oligonucleotide can protect mice from a low aerosol challenge dose of Burkholderia mallei.

    PubMed

    Waag, David M; McCluskie, Michael J; Zhang, Ningli; Krieg, Arthur M

    2006-03-01

    Treatment with an oligodeoxynucleotide (ODN) containing CPG motifs (CpG ODN 7909) was found to protect BALB/c mice from lung infection or death after aerosol challenge with Burkholderia mallei. Protection was associated with enhanced levels of gamma interferon (IFN-gamma)-inducible protein 10, interleukin-12 (IL-12), IFN-gamma, and IL-6. Preexposure therapy with CpG ODNs may protect victims of a biological attack from glanders.

  11. Regulation by interferon alpha of immunoglobulin isotype selection and lymphokine production in mice

    PubMed Central

    1991-01-01

    Antigens and infectious agents that stimulate interferon alpha(IFN- alpha) production in mice induce antibody responses that are predominantly of the immunoglobulin (Ig)G2a isotype and contain little or no IgE. This suggested the possibility that IFN-alpha might have a role in directing Ig isotype selection. Consistent with this possibility, we have found that injection of mice with recombinant mouse IFN-alpha suppresses IgE secretion, enhances IgG2a secretion, and has no independent effect on IgG1 secretion in mice stimulated with a foreign anti-IgD antibody. Injection of mice with polyinosinic acid.polycytidylic acid (poly I.C), an inducer of macrophage IFN-alpha production, also suppresses the anti-IgD antibody-induced IgE response and stimulates the IgG2a response; these effects are blocked by a sheep antibody that neutralizes mouse IFN-alpha/beta. Both recombinant IFN- alpha and poly I.C have maximum IgE suppressive and IgG2a stimulatory effects when injected early in the anti-IgD antibody-induced immune response. Addition of IFN-alpha to mouse B cells cultured with lipopolysaccharide (LPS) + interleukin 4 (IL-4) suppresses both IgG1 and IgE production, but much less potently than IFN-gamma. IFN-alpha suppresses anti-IgD antibody-induced increases in the level of splenic IL-4 mRNA, but enhances the anti-IgD antibody-induced increase in the splenic level of IFN-gamma mRNA. These results are consistent with the effect of IFN-alpha on Ig isotype expression in mice, as IL-4 stimulates IgE and suppresses IgG2a secretion while IFN-gamma exerts opposite effects. These observations suggest that antigen presenting cells, by secreting IFN-alpha early in the course of an immune response, can influence the nature of that response both through direct effects on B cells and by influencing the differentiation of T cells. PMID:1940796

  12. Effects of type I/type II interferons and transforming growth factor-beta on B-cell differentiation and proliferation. Definition of costimulation and cytokine requirements for immunoglobulin synthesis and expression.

    PubMed

    Estes, D M; Tuo, W; Brown, W C; Goin, J

    1998-12-01

    In this report, we sought to determine the role of selected type I interferons [interferon-alpha (IFN-alpha) and interferon-tau (IFN-tau)], IFN-gamma and transforming growth factor-beta (TGF-beta) in the regulation of bovine antibody responses. B cells were stimulated via CD40 in the presence or absence of B-cell receptor (BCR) cross-linking. IFN-alpha enhanced IgM, IgG2 and IgA responses but did not enhance IgG1 responses. BCR signalling alone was more effective at inducing IgG2 responses with IFN-alpha than dual cross-linking with CD40. Recombinant ovine IFN-tau was less effective at inducing IgG2 responses when compared with IFN-alpha, though IgA responses were similar in magnitude following BCR cross-linking. At higher concentrations, IFN-tau enhanced IgA responses greater than twofold over the levels observed with IFN-alpha. Previous studies have shown that addition of IFN-gamma to BCR or pokeweed mitogen-activated bovine B cells stimulates IgG2 production. However, following CD40 stimulation alone, IFN-gamma was relatively ineffective at stimulating high-rate synthesis of any non-IgM isotype. Dual cross-linking via CD40 and the BCR resulted in decreased synthesis of IgM with a concomitant increase in IgA and similar levels of IgG2 production to those obtained via the BCR alone. We also assessed the effects of endogenous and exogenous TGF-beta on immunoglobulin synthesis by bovine B cells. Exogenous TGF-beta stimulates both IgG2 and IgA production following CD40 and BCR cross-linking in the presence of IL-2. Blocking endogenous TGF-beta did not inhibit the up-regulation of IgG2 or IgA by interferons.

  13. Induction of ceruloplasmin synthesis by IFN-gamma in human monocytic cells

    NASA Technical Reports Server (NTRS)

    Mazumder, B.; Mukhopadhyay, C. K.; Prok, A.; Cathcart, M. K.; Fox, P. L.

    1997-01-01

    Ceruloplasmin is a 132-kDa glycoprotein abundant in human plasma. It has multiple in vitro activities, including copper transport, lipid pro- and antioxidant activity, and oxidation of ferrous ion and aromatic amines; however, its physiologic role is uncertain. Although ceruloplasmin is synthesized primarily by the liver in adult humans, production by cells of monocytic origin has been reported. We here show that IFN-gamma is a potent inducer of ceruloplasmin synthesis by monocytic cells. Activation of human monoblastic leukemia U937 cells with IFN-gamma increased the production of ceruloplasmin by at least 20-fold. The identity of the protein was confirmed by plasmin fingerprinting. IFN-gamma also increased ceruloplasmin mRNA. Induction followed a 2- to 4-h lag and was partially blocked by cycloheximide, indicating a requirement for newly synthesized factors. Ceruloplasmin induction in monocytic cells was agonist specific, as IL-1, IL-4, IL-6, IFN-alpha, IFN-beta, TNF-alpha, and LPS were completely ineffective. The induction was also cell type specific, as IFN-gamma did not induce ceruloplasmin synthesis in endothelial or smooth muscle cells. In contrast, IFN-gamma was stimulatory in other monocytic cells, including THP-1 cells and human peripheral blood monocytes, and also in HepG2 cells. Ceruloplasmin secreted by IFN-gamma-stimulated U937 cells had ferroxidase activity and was, in fact, the only secreted protein with this activity. Monocytic cell-derived ceruloplasmin may contribute to defense responses via its ferroxidase activity, which may drive iron homeostasis in a direction unfavorable to invasive organisms.

  14. Differential effects of human interferon alpha and interferon gamma on xenografted human thyroid tissue in severe combined immunodeficient mice and nude mice.

    PubMed

    Kawai, K; Enomoto, T; Fornasier, V; Resetkova, E; Volpé, R

    1997-03-01

    We have studied the in vivo effects of human interferon alpha (IFN-alpha) and interferon gamma (IFN-gamma) administration on human thyroid tissue xenografted into two mouse strains: severe combined immunodeficient (SCID) mice and nude mice. Human lymphocytes survive in SCID mice but are lysed in nude mice. Thyroid tissues from Graves' disease or Hashimoto's thyroiditis, or paranodular [normal, (N)] tissue was xenografted into SCID mice (0.8 g/mouse) pretreated with anti-asialo GM-1 antiserum and radiation and also into nude mice. One week after xenografting, SCID and nude mice were divided into three groups. Group A was treated with IFN-alpha intraperitoneally (2,000 units/mouse) three times weekly; group B was treated with IFN-gamma similarly; group C was treated with phosphate buffered saline (PBS) only (control). Autologous human peripheral blood mononuclear cells (PBMCs) were added to mice receiving N xenografts. Blood was taken every 2 weeks for levels of IgG and thyroid antibodies (TAb). After 6 weeks of treatment, mice were sacrificed, and xenograft thyrocyte histocompatibility leukocyte antigen (HLA-DR) and intercellular adhesion molecule (ICAM-1) expression were measured. In addition, thyrocyte cultures were stimulated in vitro with 200 units/ml of either IFN-alpha or IFN-gamma or PBS (control). SCID mice xenografted with autoimmune thyroid disease (AITD) in group A showed a significantly higher TAb production than group C, whereas in group B, TAb production was not statistically increased compared to control (group C). SCID mice xenografted with N did not produce TAb in any group, nor did nude mice xenografted with AITD. Thyrocyte HLA-DR expression was markedly increased in group A and B in SCID mice xenografted with Graves' disease, Hashimoto's thyroiditis, and N tissue compared to group C. In contrast, only group B (IFN-gamma) showed an increase in thyrocyte HLA-DR in nude mice. In the in vitro studies, only IFN-gamma (not IFN-alpha) stimulated thyrocyte HLA-DR and ICAM-1 expression in Graves' disease, Hashimoto's thyroiditis, and N tissues. We concluded that in SCID mice, IFN-alpha causes TAB production in AITD xenografts but not in N xenografts, while increasing thyrocyte HLA-DR expression in both. Also, IFN-gamma does not cause a statistically increased TAb in AITD xenografts in SCID mice, despite a sharp rise in thyrocyte HLA-DR expression. In addition, because IFN-alpha has no effect in nude mice or in vitro on thyrocyte HLA-DR expression, its effects in SCID mice must be mediated via local infiltrating lymphocytes. Finally, IFN-gamma has a direct effect on thyrocytes to increase HLA-DR expression (and, in vitro, ICAM-1 expression) but may not stimulate TAb production.

  15. Bovine immune response to inoculation with Neospora caninum surface antigen SRS2 lipopeptides mimics immune response to infection with live parasites.

    PubMed

    Baszler, Timothy V; Shkap, Varda; Mwangi, Waithaka; Davies, Christopher J; Mathison, Bruce A; Mazuz, Monica; Resnikov, Dror; Fish, Lea; Leibovitch, Benjamin; Staska, Lauren M; Savitsky, Igor

    2008-04-01

    Infection of cattle with Neospora caninum protozoa, the causative agent of bovine protozoal abortion, results in robust cellular and humoral immune responses, particularly CD4(+) T-lymphocyte activation and gamma interferon (IFN-gamma) secretion. In the present study, N. caninum SRS2 (NcSRS2) T-lymphocyte-epitope-bearing subunits were incorporated into DNA and peptide preparations to assess CD4(+) cell proliferation and IFN-gamma T-lymphocyte-secretion immune responses in cattle with predetermined major histocompatibility complex (MHC) genotypes. In order to optimize dendritic-cell processing, NcSRS2 DNA vaccine was delivered with granulocyte macrophage-colony-stimulating factor and Flt3 ligand adjuvant. The synthesized NcSRS2 peptides were coupled with a palmitic acid molecule (lipopeptide) and delivered with Freund's adjuvant. Cattle vaccinated with NcSRS2 DNA vaccine alone did not induce T-lymphocyte activation or IFN-gamma secretion, whereas subsequent booster inoculation with NcSRS2-lipopeptides induced robust NcSRS2-specific immune responses. Compared to the response in control animals, NcSRS2-lipopeptide-immunized cattle had significantly increased NcSRS2-specific T-lymphocyte proliferation, numbers of IFN-gamma-secreting peripheral blood mononuclear cells, and immunoglobulin G1 (IgG1) and IgG2a antibody levels. The findings show that N. caninum NcSRS2 subunits bearing T-lymphocyte epitopes induced cell-mediated immune responses similar to the protective immune responses previously described against live parasite infection, namely T-lymphocyte activation and IFN-gamma secretion. The findings support the investigation of NcSRS2 immunogens for protection against N. caninum-induced fetal infection and abortion in cattle.

  16. Should they stay, or should they go? Relative future risk of bovine tuberculosis for interferon-gamma test-positive cattle left on farms.

    PubMed

    Lahuerta-Marin, Angela; Gallagher, Martin; McBride, Stewart; Skuce, Robin; Menzies, Fraser; McNair, Jim; McDowell, Stanley W J; Byrne, Andrew W

    2015-09-04

    Bovine tuberculosis (bTB), caused by Mycobacterium bovis, is a serious infectious disease that remains an ongoing concern for cattle farming worldwide. Tuberculin skin-tests are often used to identify infected animals (reactors) during test-and-cull programs, however, due to relatively poor sensitivity, additional tests can be implemented in parallel. For example, in Northern Ireland interferon-gamma (IFN-g) testing is used in high-risk herds. However, skin-test negative animals which are positive to the IFN-g test are not required by law to be slaughtered - therefore the final choice for these animals' fate is left with the owner. During this study we investigated whether these animals represented a greater risk of becoming a skin reactor, relative to IFN-g test negative animals from the same herds. Our study population included 1107 IFN-g positive animals from 239 herds. A Cox-proportional hazard model indicated that animals which tested IFN-g positive were 2.31 times (95% CI: 1.92-2.79; P < 0.001) more likely to become a reactor compared with IFN-g negative animals. Animals from dairy herds, and from herds in the south-east, were of higher risk than animals from beef herds and other regions, respectively. Our findings suggest that IFN-g positive animals represent a higher risk of failing a skin-test in the future, indicating the value of IFN-g testing for identifying early-stage infected animals. These IFN-g positive animals are not under any disease restriction, and may move freely (trade), which may put recipient herds at increased risk. Our findings provide important evidence for stakeholders engaged in bTB eradication programs.

  17. Impaired plasmacytoid dendritic cell (PDC)-NK cell activity in viremic human immunodeficiency virus infection attributable to impairments in both PDC and NK cell function.

    PubMed

    Conry, Sara J; Milkovich, Kimberly A; Yonkers, Nicole L; Rodriguez, Benigno; Bernstein, Helene B; Asaad, Robert; Heinzel, Frederick P; Tary-Lehmann, Magdalena; Lederman, Michael M; Anthony, Donald D

    2009-11-01

    Human immunodeficiency virus (HIV) and hepatitis C virus (HCV) infections impair plasmacytoid dendritic cell (PDC) and natural killer (NK) cell subset numbers and functions, though little is known about PDC-NK cell interactions during these infections. We evaluated PDC-dependent NK cell killing and gamma interferon (IFN-gamma) and granzyme B production, using peripheral blood mononuclear cell (PBMC)-based and purified cell assays of samples from HCV- and HIV-infected subjects. CpG-enhanced PBMC killing and IFN-gamma and granzyme B activity (dependent on PDC and NK cells) were impaired in viremic HIV infection. In purified PDC-NK cell culture experiments, CpG-enhanced, PDC-dependent NK cell activity was cell contact and IFN-alpha dependent, and this activity was impaired in viremic HIV infection but not in HCV infection. In heterologous PDC-NK cell assays, impaired PDC-NK cell killing activity was largely attributable to an NK cell defect, while impaired PDC-NK cell IFN-gamma-producing activity was attributable to both PDC and NK cell defects. Additionally, the response of NK cells to direct IFN-alpha stimulation was defective in viremic HIV infection, and this defect was not attributable to diminished IFN-alpha receptor expression, though IFN-alpha receptor and NKP30 expression was closely associated with killer activity in viremic HIV infection but not in healthy controls. These data indicate that during uncontrolled HIV infection, PDC-dependent NK cell function is impaired, which is in large part attributable to defective IFN-alpha-induced NK cell activity and not to altered IFN-alpha receptor, NKP30, NKP44, NKP46, or NKG2D expression.

  18. [Experimental study of IFN-alpha and IFN-gamma on reversing ATRA-resistance in MR2 cell line].

    PubMed

    He, Peng-Cheng; Zhang, Mei; Li, Jing; Cao, Yun-Xin; Cai, Rui-Bo; Liu, Ya-Lin

    2007-03-01

    To explore the possibility and the possible mechanism of reversing ATRA-resistance in MR2 cells by using IFN-alpha and IFN-gamma in combination with all-trans retinoic acid (ATRA). After MR2 cells(ATRA-resistance cell line) were treated with IFN-alpha, IFN-gamma and ATRA alone or IFN-alpha and IFN-gamma in combination with ATRA respectively, the cell proliferation was tested by MTT colorimetry, the cell differentiation was tested through light microscope, by NBT test and flow cytometry (FCM). The expression of promyelocytic leukemia (PML) protein was observed by indirect immunofluorescence staining. Both IFN-alpha and IFN-gamma could inhibit the proliferation of MR2 cells. The effects were more obviously in both IFN-alpha+ATRA group and IFN-gamma+ATRA group. But there were no significant difference between either IFN-alpha group and IFN-gamma group or IFN-alpha+ATRA group and IFN-gamma+ATRA group (P>0.05). Both IFN could also induce the differentiation of MR2 cells. The effects of IFN-alpha+ATRA group and IFN-gamma+ATRA group were more obvious. However, the differentiation of MR2 cells induced by IFN-gamma+ATRA group was more higher than that by IFN-alpha+ATRA group (P<0.05). Both IFN could induce the expression of PML protein. The reversing effcet of IFN-gamma+ATRA group on ATRA-resistence in MR2 cells are more powerful than that of IFN-alpha+ATRA group, which may be related to the different signal transduction pathway of IFN-alpha and IFN-gamma.

  19. Influences of MxA gene -88 G/T and IFN-gamma +874 A/T on the natural history of hepatitis B virus infection in an endemic area.

    PubMed

    Peng, X M; Lei, R X; Gu, L; Ma, H H; Xie, Q F; Gao, Z L

    2007-10-01

    The influence of human genetics on the natural history of hepatitis B virus (HBV) infection may be diminished in endemic areas because infection at a young age predisposes to chronic HBV infection. The present study aimed to address this issue through the determination of the influences of single nucleotide polymorphisms (SNPs) of myxovirus resistence-1 (MxA) -88 G/T and interferon (IFN)-gamma +874 A/T on the natural history of HBV infection in endemic regions. One hundred adult patients with self-limiting HBV infection (positive for both anti-HBs and anti-HBc) and 340 adult patients with persistent HBV infection were recruited from southern China, an endemic area with an HBsAg carrier rate of 17.8%. SNPs of MxA -88 G/T and interferon (IFN)-gamma +874 A/T were typed using a protocol based on competitively differentiated polymerase chain reaction. A highly significant difference in the distribution of MxA -88 G/T was observed between those with persistent and self-limiting HBV infections. The latter displayed a lower frequency of the GG genotype (41.0% vs. 52.9%, P = 0.036) and a higher frequency of the TT genotype (16.0% vs. 2.4%, P = 0.000), compared to patients with persistent infection. These differences were not gender- or age-specific. However, a significant distribution difference of IFN-gamma +874 A/T was not observed. Between two groups of patients, respectively, the distribution frequencies of the AA genotype (65.0% vs. 72.8%, P = 0.139) and the TT genotype (2.0% vs. 1.2%, P = 0.894) were found. These results suggest that MxA gene -88 G/T and IFN-gamma +874 A/T behave differently in endemic HBV infections. Further study is necessary to clarify the influences of human genetics on endemic HBV infections.

  20. [Adenovirus-mediated canine interferon-gamma expression and its antiviral activity against canine parvovirus].

    PubMed

    Zhang, Kao; Jin, Huijun; Zhong, Fei; Li, Xiujin; Neng, Changai; Chen, Huihui; Li, Wenyan; Wen, Jiexia

    2012-11-04

    To construct recombinant adenovirus containing canine interferon-gamma (cIFN-gamma) gene and to investigate its antiviral activity against canine parvovirus in Madin-Darby canine kidney cells (MDCK). [Methods] The cIFN-gamma gene was inserted into adenovirus shuttle plasmid to construct pShuttle3-cIFN-gamma expression vector, from which the cIFN-gamma expression cassette was transferred into the adenovirus genomic plasmid pAdeno-X by specific restriction sites to generate recombinant adenovirus genomic plasmid pAd-cIFN-gamma. The pAd-cIFN-gamma plasmid was linearized by digestion and transfected into human embryonic kidney (HEK) 293T cells to generate the replication-defective cIFN-gamma recombinant adenovirus (Ad-cIFN-gamma). To analyze its anti-canine parvovirus activity, the MDCK cells were pre-infected by Ad-cIFN-gamma recombinant adenovirus, and then infected by canine parvovirus. The antiviral activity of the Ad-cIFN-gamma recombinant adenovirus against parvovirus was analyzed. The recombinant adenovirus containing cIFN-gamma gene was constructed by the ligation method. The recombinant adenovirus could mediates recombinant cIFN-gamma secretory expression in MDCK cells. The Ad-cIFN-gamma recombinant adenovirus could significantly inhibit canine parvovirus replication in MDCK cells pre-infected with the recombinant adenovirus. These results indicate that the Ad-cIFN-gamma recombinant adenovirus has the potent antiviral activity against canine parvovirus. The Ad-cIFN-gamma recombinant adenovirus was successfully constructed by the ligation method and possessed a powerful antiviral activity against canine parvovirus.

  1. Protective effects of granulocyte colony-stimulating factor on endotoxin shock in mice with retrovirus-induced immunodeficiency syndrome.

    PubMed

    Toki, S; Hiromatsu, K; Aoki, Y; Makino, M; Yoshikai, Y

    1997-10-01

    Mice with retrovirus-induced murine acquired immunodeficiency syndrome (MAIDS) were hypersensitive to lipopolysaccharide (LPS)-induced lethal shock accompanied by marked elevations of systematic interleukin 1beta (IL-beta) and interferon gamma (IFN-gamma) after LPS challenge. Pretreatment with 10 microg of recombinant human granulocyte colony-stimulating factor (rhG-CSF) protected MAIDS mice from hypersensitivity to LPS-induced lethal shock and this protection was concomitant with suppression of IFN-gamma production. Copyright 1997 Academic Press Limited.

  2. [Polymorphism of TNF-alpha (308 A/G), IL-10 (1082 A/G, 819 C/T 592 A/C), IL-6 (174 G/C), and IFN-gamma (874 A/T); genetically conditioned cytokine synthesis level in children with diabetes type 1].

    PubMed

    Siekiera, Urszula; Jarosz-Chobot, P; Janusz, J; Koehler, Brygida

    2002-01-01

    Type 1 diabetes is a genetically conditioned autoimmune disease. Genes that account for strong clustering of the disease susceptibility are located within the HLA region. There is also considerable individual variation in the immune response and role of cytokine genes in the disease predisposition. The aim of our research was identification of the genetically controlled TNF-alpha, IL-10, IL-6, IFN-gamma secretion profile in children with diabetes type 1. We have examined 36 children with diabetes type 1 and 36 healthy individuals. DNA was extracted from mononuclear peripheral blood cells. For identification of the cytokine polymorphism PCR-SSP method was used. Patients with diabetes type 1 differ from the group of healthy persons in the cytokine synthesis level and in the cytokine genotypes distribution. Genotype TNF-alpha (A/G) as well as IL-10 (ATA/ATA) was found only in group of children with diabetes but not in the control group. Genotypes IL-10 (GCC/GCC), IL-6 (C/C), IFN-gamma (T/T) were observed with decreased frequency in children with diabetes type 1. No differences between patients and control group in the frequency of IL-10 (GCC/ACC) (GCC/ATA), (ACC/ACC) (ACC/ATA) IL-6 (G/G), (G/C) and IFN-gamma (T/A), (A/A) genotypes were observed. Children with diabetes type 1 were more frequent "high producers" of TNF-alpha and IL-6. It is possible to us molecular method to estimate the genetically controlled immune reactivity. It is a very important immunogenetic factor of the disease predisposition.

  3. Interferon-gamma promotes the survival and Fc epsilon RI-mediated histamine release in cultured human mast cells.

    PubMed Central

    Yanagida, M; Fukamachi, H; Takei, M; Hagiwara, T; Uzumaki, H; Tokiwa, T; Saito, H; Iikura, Y; Nakahata, T

    1996-01-01

    We examined the effects of interferon-gamma (IFN-gamma) on 100% pure human mast cells generated in suspension cultures of umbilical cord blood mononuclear cells in the presence of stem cell factor (SCF) and interleukin-6 (IL-6). When mast cells were suspended in serum-free medium without any cytokine after the withdrawal of SCF and IL-6, they died over a period of 5 days because of apoptosis. IFN-gamma in the cultures suppressed apoptosis and prolonged their survival in a dose-dependent manner. This survival-promoting effect of IFN-gamma was blocked by neutralizing antibodies to IFN-gamma or to IFN-gamma receptor (IFN-gamma R). When mast cells were incubated with IFN-gamma in serum-free medium for more than 4 hr during sensitization, immunoglobulin E (IgE)/anti-IgE antibody-induced histamine release was effectively enhanced. Polymerase chain reaction (PCR) amplification of the alpha-chain of IFN-gamma R (IFN-gamma R alpha) yielded products of the correct size predicted from the sequence of the receptor. In addition, flow cytometry using anti-IFN-gamma R monoclonal antibodies (mAbs) indicated that these mast cells bear IFN-gamma R on their surface. These findings suggested that IFN-gamma activates human mast cells via specific receptors in certain aspects of inflammatory reactions. Images Figure 2 Figure 4 PMID:9014819

  4. Production and characterization of guinea pig recombinant gamma interferon and its effect on macrophage activation.

    PubMed

    Jeevan, A; McFarland, C T; Yoshimura, T; Skwor, T; Cho, H; Lasco, T; McMurray, D N

    2006-01-01

    Gamma interferon (IFN-gamma) plays a critical role in the protective immune responses against mycobacteria. We previously cloned a cDNA coding for guinea pig IFN-gamma (gpIFN-gamma) and reported that BCG vaccination induced a significant increase in the IFN-gamma mRNA expression in guinea pig cells in response to living mycobacteria and that the virulent H37Rv strain of Mycobacterium tuberculosis stimulated less IFN-gamma mRNA than did the attenuated H37Ra strain. In this study, we successfully expressed and characterized recombinant gpIFN-gamma with a histidine tag at the N terminus (His-tagged rgpIFN-gamma) in Escherichia coli. rgpIFN-gamma was identified as an 18-kDa band in the insoluble fraction; therefore, the protein was purified under denaturing conditions and renatured. N-terminal amino acid sequencing of the recombinant protein yielded the sequence corresponding to the N terminus of His-tagged gpIFN-gamma. The recombinant protein upregulated major histocompatibility complex class II expression in peritoneal macrophages. The antiviral activity of rgpIFN-gamma was demonstrated with a guinea pig fibroblast cell line (104C1) infected with encephalomyocarditis virus. Interestingly, peritoneal macrophages treated with rgpIFN-gamma did not produce any nitric oxide but did produce hydrogen peroxide and suppressed the intracellular growth of mycobacteria. Furthermore, rgpIFN-gamma induced morphological alterations in cultured macrophages. Thus, biologically active rgpIFN-gamma has been successfully produced and characterized in our laboratory. The study of rgpIFN-gamma will further increase our understanding of the cellular and molecular responses induced by BCG vaccination in the guinea pig model of pulmonary tuberculosis.

  5. Plant protein hydrolysates support CHO-320 cells proliferation and recombinant IFN-gamma production in suspension and inside microcarriers in protein-free media.

    PubMed

    Ballez, J S; Mols, J; Burteau, C; Agathos, S N; Schneider, Y J

    2004-03-01

    We have recently developed a protein-free medium (PFS) able to support the growth of Chinese hamster ovary (CHO) cells in suspension. Upon further supplementation with some plant protein hydrolysates, medium performances reached what could be observed in serum-containing media [Burteau et al. In Vitro Cell. Dev. Biol.-Anim. 39 (2003) 291]. Now, we describe the use of rice and wheat protein hydrolysates, as non-nutritional additives to the culture medium to support productivity and cell growth in suspension or in microcarriers. When CHO-320 cells secreting recombinant interferon-gamma (IFN-gamma) were cultivated in suspension in a bioreactor with our PFS supplemented with wheat hydrolysates, the maximum cell density increased by 25% and the IFN-gamma secretion by 60% compared to the control PFS. A small-scale perfusion system consisting of CHO-320 cells growing on and inside fibrous microcarriers under discontinuous operation was first developed. Under these conditions, rice protein hydrolysates stimulated recombinant IFN-gamma secretion by 30% compared to the control PFS. At the bioreactorscale, similar results were obtained but when compared to shake-flasks studies, nutrients, oxygen or toxic by-products gradients inside the microcarriers seemed to be the main limitation of the system. An increase of the perfusion rate to maintain glucose concentration over 5.5 mM and dissolved oxygen (DO) at 60% was able to stimulate the production of IFN-gamma to a level of 6.6 mug h(-1) g(-1) of microcarriers after 160 h when a cellular density of about 4 x 10(8) cell g(-1) of carriers was reached.

  6. Alopecia of IFN-gamma knockout mouse as a model for disturbance of the hair cycle: a unique arrest of the hair cycle at the anagen phase accompanied by mitosis.

    PubMed

    Hirota, Ryuichiro; Tajima, Sadao; Yoneda, Yukio; Tamayama, Takumi; Watanabe, Masahito; Ueda, Kouichi; Kubota, Takahiro; Yoshida, Ryotaro

    2002-09-01

    Interferon-gamma(-/-) (IFN-gamma(-/-)) and IFN-gamma(+/+) C57BL/6 mice (3 weeks of age) completed the production of morphogenesis-derived hair. Around 6 weeks of age, however, most of the IFN-gamma(-/-) but none of the IFN-gamma(+/+) mice began to lose hairs in the dorsal and occipital areas in the absence of inflammatory reactions, and the alopecia was sustained for at least several 10-week periods of observation. A single subcutaneous injection of IFN-gamma to IFN-gamma(-/-) mice at 3, but not 4, 5, or 8 weeks of age could protect all the mice from alopecia, revealing that the lack of IFN-gamma around 3 weeks of age is directly responsible for the alopecia. Histologic features showed that the hair follicles of the IFN-gamma(+/+) mice passed through the anagen (4-5 weeks of age) and catagen/telogen ( approximately 6 weeks of age) phases, whereas those of IFN-gamma(-/-) mice (5 weeks of age or older) stayed in the anagen phase. TUNEL and bromodeoxyuridine experiments suggested that an arrest with unlimited DNA synthesis of the hair cycle in the anagen phase by the lack of IFN-gamma-dependent apoptosis in the midfollicle region and diffuse shedding of previously formed hair induced alopecia in IFN-gamma(-/-) mice.

  7. Cellular sources and targets of IFN-gamma-mediated protection against viral demyelination and neurological deficits.

    PubMed

    Murray, Paul D; McGavern, Dorian B; Pease, Larry R; Rodriguez, Moses

    2002-03-01

    IFN-gamma is an anti-viral and immunomodulatory cytokine critical for resistance to multiple pathogens. Using mice with targeted disruption of the gene for IFN-gamma, we previously demonstrated that this cytokine is critical for resistance to viral persistence and demyelination in the Theiler's virus model of multiple sclerosis. During viral infections, IFN-gamma is produced by natural killer (NK) cells, CD4(+) and CD8(+) T cells; however, the proportions of lymphocyte subsets responding to virus infection influences the contributions to IFN-gamma-mediated protection. To determine the lymphocyte subsets that produce IFN-gamma to maintain resistance, we used adoptive transfer strategies to generate mice with lymphocyte-specific deficiencies in IFN-gamma-production. We demonstrate that IFN-gamma production by both CD4(+) and CD8(+) T cell subsets is critical for resistance to Theiler's murine encephalomyelitis virus (TMEV)-induced demyelination and neurological disease, and that CD4(+) T cells make a greater contribution to IFN-gamma-mediated protection. To determine the cellular targets of IFN-gamma-mediated responses, we used adoptive transfer studies and bone marrow chimerism to generate mice in which either hematopoietic or somatic cells lacked the ability to express IFN-gamma receptor. We demonstrate that IFN-gamma receptor must be present on central nervous system glia, but not bone marrow-derived lymphocytes, in order to maintain resistance to TMEV-induced demyelination.

  8. Equine interferon gamma synthesis in lymphocytes after in vivo infection and in vitro stimulation with EHV-1.

    PubMed

    Paillot, R; Daly, J M; Juillard, V; Minke, J M; Hannant, D; Kydd, J H

    2005-08-22

    Equine cytotoxic T lymphocyte (CTL) responses to equine herpesvirus-1 (EHV-1) are well characterised but little is known about the cytokine response after infection or vaccination. EHV-1 is common in horses and infects lymphocytes in vivo. This virus was used as a model to measure the synthesis of interferon gamma (IFN-gamma) by equine peripheral blood mononuclear cells (PBMC) after in vivo infection and/or in vitro stimulation with EHV-1. Both flow cytometry and ELISPOT assays were used to quantify equine IFN-gamma using a mouse anti-bovine IFN-gamma monoclonal antibody (clone CC302; shown to cross-react with recombinant equine IFN-gamma) and a rabbit anti-canine IFN-gamma polyclonal antibody. The percentage of PBMC synthesising IFN-gamma after in vitro stimulation with EHV-1 increased with age. In yearlings infected experimentally with EHV-1, PBMC showed two peaks of IFN-gamma synthesis, 11 and 56 days after infection. The IFN-gamma synthesis was principally associated with CD8(+) cells. The patterns of IFN-gamma synthesis detected by intracellular IFN-gamma staining or ELISPOT were compared with CTL data and shown to be similar. These methods were also applied successfully to frozen samples of PBMC. Measurement of equine IFN-gamma using these simple techniques can now be applied to future studies on protective cellular immune responses following virus infection and/or vaccination of horses.

  9. Increased IFN-gamma production by NK and CD3+/CD56+ cells in sexually HIV-1-exposed but uninfected individuals.

    PubMed

    Montoya, Carlos Julio; Velilla, Paula Andrea; Chougnet, Claire; Landay, Alan L; Rugeles, Maria Teresa

    2006-08-01

    The mechanisms involved in controlling the establishment of HIV-1 infection are not fully understood. In particular, the role of innate immunity in natural resistance exhibited by individuals who are continuously exposed to HIV-1 but remain seronegative (ESN) has not been thoroughly evaluated. We determined the frequency and function of peripheral blood innate immune cells (plasmacytoid and myeloid dendritic cells, monocytes, NK cells, CD3+/CD56+ cells and invariant NKT cells) in ESN, chronically HIV-1-infected and low-risk HIV-1 seronegative individuals. ESN demonstrated a similar frequency of innate immune cells in comparison to controls and a higher frequency of dendritic cells, NK and invariant NKT cells compared to HIV-1-infected subjects. Incubation of mononuclear cells with stimulatory CpG ODN induced CD86 and CD69 up-regulation to a similar degree on innate cells from the three study groups. CpG ODN-stimulated secretion of cytokines was also similar between ESN and controls, while secretion of IFN-alpha was significantly decreased in HIV-1+ individuals. Importantly, expression of IFN-gamma by PMA/Ionomycin-activated CD56(bright) NK cells and CD3+/CD56+ cells was significantly higher in ESN when compared with controls. The anti-viral effects of IFN-gamma are well established, and so our results suggest that IFN-gamma production by innate immune cells might be one of the multiple factors involved in controlling the establishment of sexually transmitted HIV-1 infection.

  10. IFN-gamma priming up-regulates IFN-stimulated gene factor 3 (ISGF3) components, augmenting responsiveness of IFN-resistant melanoma cells to type I IFNs.

    PubMed

    Wong, L H; Hatzinisiriou, I; Devenish, R J; Ralph, S J

    1998-06-01

    IFN-stimulated gene factor 3 (ISGF3) mediates transcriptional activation of IFN-sensitive genes (ISGs). The component subunits of ISGF3, STAT1alphabeta, STAT2, and p48-ISGF3gamma, are tyrosine phosphorylated before their assembly into a complex. Subsequently, the ISGF3 complex is translocated to the nucleus. We have recently established that the responsiveness of human melanoma cell lines to type I IFNs correlates directly with their intracellular levels of ISGF3 components, particularly STAT1. In the present study, we show that pretreating IFN-resistant melanoma cell lines with IFN-gamma (IFN-gamma priming) before stimulation with type I IFN also results in increased levels of ISGF3 components and enhanced DNA-binding activation of ISGF3. In addition, IFN-gamma priming of IFN-resistant melanoma cell lines increased expression of type I IFN-induced ISG products, including ISG54, 2'-5'-oligoadenylate synthase, HLA class I, B7-1, and ICAM-1 Ags. Furthermore, IFN-gamma priming enhanced the antiviral effect of IFN-beta on the IFN-resistant melanoma cell line, MM96. These results support a role for IFN-gamma priming in up-regulating ISGF3, thereby augmenting the responsiveness of IFN-resistant melanoma cell lines to type I IFN and providing a molecular basis and justification for using sequential IFN therapy, as proposed by others, to enhance the use of IFNs in the treatment of melanoma.

  11. Graft-versus-host disease causes failure of donor hematopoiesis and lymphopoiesis in interferon-gamma receptor-deficient hosts.

    PubMed

    Delisle, Jean-Sébastien; Gaboury, Louis; Bélanger, Marie-Pier; Tassé, Eliane; Yagita, Hideo; Perreault, Claude

    2008-09-01

    The immunopathologic condition known as graft-versus-host disease (GVHD) results from a type I T-cell process. However, a prototypical type I cytokine, interferon-gamma (IFN-gamma), can protect against several manifestations of GVHD in recipients of major histocompatibility complex (MHC)-mismatched hematopoietic cells. We transplanted hematopoietic cells from C3H.SW donors in wild-type (wt) and IFN-gamma-receptor-deficient (IFN-gammaRKO) MHC-matched C57BL/6 recipients. In IFN-gammaRKO recipients, host cells were unresponsive to IFN-gamma, whereas wt donor cells were exposed to exceptionally high levels of IFN-gamma. From an IFN-gamma perspective, we could therefore evaluate the impact of a loss-of-function on host cells and gain-of-function on donor cells. We found that lack of IFN-gammaR prevented up-regulation of MHC proteins on host cells but did not mitigate damage to most target organs. Two salient phenotypes in IFN-gammaRKO recipients involved donor cells: lymphoid hypoplasia and hematopoietic failure. Lymphopenia was due to FasL-induced apoptosis and decreased cell proliferation. Bone marrow aplasia resulted from a decreased proliferation of hematopoietic stem/progenitor cells that was associated with down-regulation of 2 genes negatively regulated by IFN-gamma: Ccnd1 and Myc. We conclude that IFN-gamma produced by alloreactive T cells may entail a severe graft-versus-graft reaction and could be responsible for cytopenias that are frequently observed in subjects with GVHD.

  12. Anti-interferon-gamma antibodies in the treatment of autoimmune diseases.

    PubMed

    Skurkovich, Boris; Skurkovich, Simon

    2003-02-01

    Interferon (IFN)-gamma is an important immune regulator in normal immunity. When IFN gamma production is disturbed, various autoimmune diseases (ADs) can develop, in which we suggest that anti-IFN gamma could have a beneficial effect. Depending on the cell type in which IFN gamma synthesis is disturbed, different clinical manifestations may result. We have also proposed to remove tumor necrosis factor (TNF)-alpha, together with certain types of IFNs, to treat various ADs and AIDS, also an autoimmune condition. Anti-IFN gamma has been tested in several T-helper cell (Th1) ADs, including rheumatoid arthritis (RA), multiple sclerosis (MS), corneal transplant rejection, uveitis, Type I diabetes, schizophrenia (anti-IFN gamma and anti-TNF alpha), and various autoimmune skin diseases (alopecia areata, psoriasis vulgaris, vitiligo, pemphigus vulgaris and epidermolysis bullosa). A strong, sometimes striking, therapeutic response followed administration of anti-IFN gamma, indicating that it may be a promising therapy for Th1 ADs.

  13. Transplantation of polarized type 2 donor T cells reduces mortality caused by experimental graft-versus-host disease.

    PubMed

    Krenger, W; Cooke, K R; Crawford, J M; Sonis, S T; Simmons, R; Pan, L; Delmonte, J; Karandikar, M; Ferrara, J L

    1996-11-15

    Acute graft-versus-host disease (GVHD) is thought to be initiated by alloreactive type 1 T cells that secrete gamma-interferon (IFN-gamma). IFN-gamma induces the production of inflammatory cytokines, e.g., tumor necrosis factor-alpha and interleukin (IL)-1, which are the distal mediators of GVHD. We demonstrate that the transplantation of polarized type 2 murine T cells (i.e., cells secreting IL-4 but not IFN-gamma) together with T-cell-depleted bone marrow results in a significant increase in survival (P<0.001) after bone marrow transplantation across minor histocompatibility barriers (B10.BR-->CBA/J). Further analysis demonstrated that increased survival in recipients of polarized type 2 T cells correlated with diminished production of both IFN-gamma and tumor necrosis factor-alpha but with increases in IL-4 2 weeks after transplantation. Despite improved survival, histologic changes of GVHD were evident in oral mucosal and hepatic tissues at 7 weeks after bone marrow transplantation. These data provide further evidence that inflammatory cytokines in the immediate posttransplant period are pivotal to the development of mortality but that they do not correlate with individual target organ damage.

  14. Critical role of type 1 cytokines in controlling initial infection with Burkholderia mallei.

    PubMed

    Rowland, Caroline A; Lertmemongkolchai, Ganjana; Bancroft, Alison; Haque, Ashraful; Lever, M Stephen; Griffin, Kate F; Jackson, Matthew C; Nelson, Michelle; O'Garra, Anne; Grencis, Richard; Bancroft, Gregory J; Lukaszewski, Roman A

    2006-09-01

    Burkholderia mallei is a gram-negative bacterium which causes the potentially fatal disease glanders in humans; however, there is little information concerning cell-mediated immunity to this pathogen. The role of gamma interferon (IFN-gamma) during B. mallei infection was investigated using a disease model in which infected BALB/c mice normally die between 40 and 60 days postinfection. IFN-gamma knockout mice infected with B. mallei died within 2 to 3 days after infection, and there was uncontrolled bacterial replication in several organs, demonstrating the essential role of IFN-gamma in the innate immune response to this pathogen. Increased levels of IFN-gamma, interleukin-6 (IL-6), and monocyte chemoattractant protein 1 were detected in the sera of immunocompetent mice in response to infection, and splenic mRNA expression of IFN-gamma, IL-6, IL-12p35, and IL-27 was elevated 24 h postinfection. The effects of IL-18, IL-27, and IL-12 on stimulation of the rapid IFN-gamma production were investigated in vitro by analyzing IFN-gamma production in the presence of heat-killed B. mallei. IL-12 was essential for IFN-gamma production in vitro; IL-18 was also involved in induction of IFN-gamma, but IL-27 was not required for IFN-gamma production in response to heat-killed B. mallei. The main cellular sources of IFN-gamma were identified in vitro as NK cells, CD8+ T cells, and TCRgammadelta T cells. Our data show that B. mallei is susceptible to cell-mediated immune responses which promote expression of type 1 cytokines. This suggests that development of effective vaccines against glanders should target the production of IFN-gamma.

  15. Cloning, sequencing and expression of white rhinoceros (Ceratotherium simum) interferon-gamma (IFN-gamma) and the production of rhinoceros IFN-gamma specific antibodies.

    PubMed

    Morar, D; Tijhaar, E; Negrea, A; Hendriks, J; van Haarlem, D; Godfroid, J; Michel, A L; Rutten, V P M G

    2007-01-15

    Bovine tuberculosis (BTB) is endemic in African buffalo (Syncerus caffer) in the Kruger National Park (KNP). In addition to buffalo, Mycobacterium bovis has been found in at least 14 other mammalian species in South Africa, including kudu (Tragelaphus strepsiceros), Chacma baboon (Papio ursinus) and lion (Panthera leo). This has raised concern about the spillover into other potentially susceptible species like rhinoceros, thus jeopardising breeding and relocation projects aiming at the conservation of biodiversity. Hence, procedures to screen for and diagnose BTB in black rhinoceros (Diceros bicornis) and white rhinoceros (Ceratotherium simum) need to be in place. The Interferon-gamma (IFN-gamma) assay is used as a routine diagnostic tool to determine infection of cattle and recently African buffalo, with M. bovis and other mycobacteria. The aim of the present work was to develop reagents to set up a rhinoceros IFN-gamma (RhIFN-gamma) assay. The white rhinoceros IFN-gamma gene was cloned, sequenced and expressed as a mature protein. Amino acid (aa) sequence analysis revealed that RhIFN-gamma shares a homology of 90% with equine IFN-gamma. Monoclonal antibodies, as well as polyclonal chicken antibodies (Yolk Immunoglobulin-IgY) with specificity for recombinant RhIFN-gamma were produced. Using the monoclonals as capture antibodies and the polyclonal IgY for detection, it was shown that recombinant as well as native white rhinoceros IFN-gamma was recognised. This preliminary IFN-gamma enzyme-linked immunosorbent assay (ELISA), has the potential to be developed into a diagnostic assay for M. bovis infection in rhinoceros.

  16. Role of gamma interferon in a neonatal mouse model of group B streptococcal disease.

    PubMed Central

    Cusumano, V; Mancuso, G; Genovese, F; Delfino, D; Beninati, C; Losi, E; Teti, G

    1996-01-01

    The aim of this study was to assess the role of gamma interferon (IFN-gamma) in a neonatal mouse model of group B streptococcal (GBS) sepsis. IFN-gamma was produced by spleen cells at 24, 48, and 72 h after GBS challenge. Treatment with anti-IFN-gamma at 6 h before challenge totally abrogated the IFN-gamma response but did not affect survival. Subcutaneous administration of recombinant IFN-gamma (2,500 IU per pup) at 18 h after challenge resulted in increased survival time and reduced blood colony counts at 48 and 72 h. In vitro preincubation of neonatal whole blood with IFN-gamma before the addition of GBS resulted in significant restriction of bacterial growth. These data indicate that administration of recombinant IFN-gamma can partially restore impaired host defenses against GBS in neonatal mice. This cytokine may be useful for the treatment of neonatal infections. PMID:8757817

  17. Allergen-induced cytokine production, atopic disease, IgE, and wheeze in children.

    PubMed

    Contreras, J Paola; Ly, Ngoc P; Gold, Diane R; He, Hongzhen; Wand, Mathew; Weiss, Scott T; Perkins, David L; Platts-Mills, Thomas A E; Finn, Patricia W

    2003-12-01

    The early childhood allergen-induced immune responses associated with atopic disease and IgE production in early life are not well understood. We assessed the relationship of allergen-induced cytokine production by PBMCs to both atopic disease and to IgE increase in a cohort of children with a parental history of allergy or asthma (n = 112) at a median of 2 years of age. We examined cockroach (Bla g 1)-induced, house dust mite (Der f 1)-induced, and cat (Fel d 1)-induced cytokine secretion, including secretion of IFN-gamma, IL-13, IL-10, and TNF-alpha. We investigated whether distinct cytokine patterns associated with atopic disease can be detected in immune responses of children. PBMCs were isolated, and allergen-induced cytokine secretion was analyzed by means of ELISA. Atopic disease was defined as physician- or nurse-diagnosed eczema or hay fever. Increased IgE was defined as an IgE level of greater than 35 U/mL to dust mite, cockroach, cat, and egg white or a total IgE level of 60 U/mL or greater. Compared with children without atopic disease, children with atopic disease had lower Der f 1 (P =.005) and Bla g 2 (P =.03) allergen-induced IFN-gamma levels. Compared with children without increased IgE (n = 95), those with increased IgE (n = 16) had higher Der f 1-induced (P =.006) and Fel d 1-induced (P =.005) IL-13 levels and lower Bla g 2-induced (P =.03) IFN-gamma levels. Compared with children with neither atopic disease nor repeated wheeze, children with both atopic disease and repeated wheeze had lower levels of allergen-induced IFN-gamma (P =.01 for Der f 1 and P =.02 for Bla g 2) cytokine secretion. In young children at risk for asthma or allergy, decreased allergen-induced IFN-gamma secretion is associated with atopic disease and, in some cases, with increased IgE levels. Increased allergen-induced IL-13 secretion is most strongly associated with early life increase of IgE.

  18. IL-4 inhibits the synthesis of IFN-gamma and induces the synthesis of IgE in human mixed lymphocyte cultures.

    PubMed

    Vercelli, D; Jabara, H H; Lauener, R P; Geha, R S

    1990-01-15

    The T cell-derived lymphokine IL-4 is essential for the induction of IgE synthesis by human lymphocytes. The IgE-inducing effect of IL-4 is antagonized by IFN-gamma. The secretion of IFN-gamma is vigorously triggered in MLC. Thus, IL-4-stimulated MLC represent a suitable model to characterize the functional antagonism between IL-4 and IFN-gamma. In this report, we show that rIL-4 consistently induced IgE synthesis when added to human primary MLC. IL-4-dependent IgE production required cognate T/B cell recognition, because it was inhibited by antibodies to CD3 and MHC class II (HlA-DR) Ag. A neutralizing anti-IFN-gamma mAb dramatically enhanced IL-4-dependent IgE synthesis by MLC, indicating that endogenous IFN-gamma is a major inhibitor of IgE production. More importantly, addition of rIL-4 markedly inhibited the release of IFN-gamma in supernatants of MLC and Con A-activated PBMC. The decrease in IFN-gamma protein was accompanied by a decreased expression of IFN-gamma mRNA transcripts. The downregulation of IFN-gamma by IL-4 is likely to play an important role in the IL-4-dependent induction of IgE synthesis.

  19. IFN-gamma induction by SCG, 1,3-beta-D-glucan from Sparassis crispa, in DBA/2 mice in vitro.

    PubMed

    Harada, Toshie; Miura, Noriko N; Adachi, Yoshiyuki; Nakajima, Mitsuhiro; Yadomae, Toshiro; Ohno, Naohito

    2002-12-01

    Sparassis crispa Fr. in an edible mushroom recently cultivable in Japan. A branched beta-glucan from S. crispa (SCG) is a major 6-branched 1,3-beta-D-glucan showing antitumor activity. In this study, we examined interferon-gamma (IFN-gamma) induction by SCG from splenocytes in DBA/2 mice in vitro. In the splenocytes derived from almost all inbred strains of mice except for DBA/1 and DBA/2 mice, IFN-gamma production was not induced by SCG. The breeder and genders of DBA/2 mice showed no influence on IFN-gamma induction by SCG. On the other hand, the magnitude of IFN-gamma induction was lower in young mice than in their older counterparts. IFN-gamma was induced by SCG in adherent splenocytes, but IFN-gamma production was most significantly increased by SCG in instances involving coexistence of adherent and nonadherent splenocytes. In fact, inhibition of cell-cell contact reduced IFN-gamma induction by SCG. In addition, interleukin-12 p70 (IL-12p70) was induced by SCG in DBA/2 mice. It was suggested that soluble factors and cell-cell contact mediate synergistic effects on SCG-induced IFN-gamma production.

  20. In vivo induction of interferon gamma expression in grey horses with metastatic melanoma resulting from direct injection of plasmid DNA coding for equine interleukin 12.

    PubMed

    Müller, J-M V; Wissemann, J; Meli, M L; Dasen, G; Lutz, H; Heinzerling, L; Feige, K

    2011-11-01

    Whole blood pharmacokinetics of intratumourally injected naked plasmid DNA coding for equine Interleukin 12 (IL-12) was assessed as a means of in vivo gene transfer in the treatment of melanoma in grey horses. The expression of induced interferon gamma (IFN-g) was evaluated in order to determine the pharmacodynamic properties of in vivo gene transduction. Seven grey horses bearing melanoma were injected intratumourally with 250 µg naked plasmid DNA coding for IL-12. Peripheral blood and biopsies from the injection site were taken at 13 time points until day 14 post injection (p.i.). Samples were analysed using quantitative real-time PCR. Plasmid DNA was quantified in blood samples and mRNA expression for IFN-g in tissue samples. Plasmid DNA showed fast elimination kinetics with more than 99 % of the plasmid disappearing within 36 hours. IFN-g expression increased quickly after IL-12 plasmid injection, but varied between individual horses. Intratumoural injection of plasmid DNA is a feasible method for inducing transgene expression in vivo. Biological activity of the transgene IL-12 was confirmed by measuring expression of IFN-g.

  1. Increase in neutrophil Fc gamma receptor I expression following interferon gamma treatment in rheumatoid arthritis.

    PubMed Central

    Goulding, N J; Knight, S M; Godolphin, J L; Guyre, P M

    1992-01-01

    The therapeutic potential of interferon gamma (IFN gamma) in a number of disease states is still being explored, but progress is hampered by the lack of a suitable measure of in vivo biological activity. To assess the in vivo biological effects of recombinant human IFN gamma (rhIFN gamma), 14 patients were studied in a randomised, prospective, double blind, placebo controlled trial of this cytokine for the treatment of rheumatoid arthritis. The levels of Fc gamma receptors on peripheral blood neutrophils were measured at baseline and after 21 days of once daily, subcutaneous injections of rhIFN gamma or placebo. An induction of neutrophil Fc gamma receptor type I (Fc gamma RI) was seen in the group of patients receiving recombinant human rhIFN gamma but not in those receiving placebo. No change in the expression of Fc gamma RII or Fc gamma RIII was detected. The amount of induction of Fc gamma RI detected on the neutrophils of patients receiving rhIFN gamma did not correlate with clinical measures of response at either 21 days or at the end of the study (24 weeks). No significant clinical responses were observed in the rhIFN gamma group at these times. These data confirm that the reported in vitro effect of IFN gamma on human neutrophil Fc receptor expression can be reproduced in vivo. PMID:1534001

  2. Increase in neutrophil Fc gamma receptor I expression following interferon gamma treatment in rheumatoid arthritis.

    PubMed

    Goulding, N J; Knight, S M; Godolphin, J L; Guyre, P M

    1992-04-01

    The therapeutic potential of interferon gamma (IFN gamma) in a number of disease states is still being explored, but progress is hampered by the lack of a suitable measure of in vivo biological activity. To assess the in vivo biological effects of recombinant human IFN gamma (rhIFN gamma), 14 patients were studied in a randomised, prospective, double blind, placebo controlled trial of this cytokine for the treatment of rheumatoid arthritis. The levels of Fc gamma receptors on peripheral blood neutrophils were measured at baseline and after 21 days of once daily, subcutaneous injections of rhIFN gamma or placebo. An induction of neutrophil Fc gamma receptor type I (Fc gamma RI) was seen in the group of patients receiving recombinant human rhIFN gamma but not in those receiving placebo. No change in the expression of Fc gamma RII or Fc gamma RIII was detected. The amount of induction of Fc gamma RI detected on the neutrophils of patients receiving rhIFN gamma did not correlate with clinical measures of response at either 21 days or at the end of the study (24 weeks). No significant clinical responses were observed in the rhIFN gamma group at these times. These data confirm that the reported in vitro effect of IFN gamma on human neutrophil Fc receptor expression can be reproduced in vivo.

  3. Immune responses to mumps vaccine in adults who were vaccinated in childhood.

    PubMed

    Hanna-Wakim, Rima; Yasukawa, Linda L; Sung, Phillip; Arvin, Ann M; Gans, Hayley A

    2008-06-15

    In a mumps outbreak in the United States, many infected individuals were adults who had received 2 doses of mumps vaccine. The persistence of cellular immunity to mumps vaccine has not been defined. This was an observational, nonrandomized cohort study evaluating cell-mediated and humoral immunity to mumps in 10 vaccinated and 10 naturally immune adults. Mumps-specific T cell activation and interferon (IFN)-gamma production were measured using lymphoproliferative and flow cytometry assays, and mumps immunoglobulin (Ig) G was measured using enzyme-linked immunosorbent assay. T cell immunity to mumps was high in both groups; 70% of vaccinated and 80% of naturally immune individuals had a positive (> or =3) stimulation index (SI) (P = 1.0). The mean percentages of mumps-specific CD4+ T cells that expressed CD69 and produced IFN-gamma were equivalent in the 2 groups: 0.06% and 0.12%, respectively (P = .11). The mean SIs in the groups were also equivalent, although IFN-gamma concentrations from cultures stimulated with mumps antigen were higher in naturally immune adults than in vaccinated adults (P < or = .01). All adults were positive for mumps IgG. T and B cell immunity to mumps was detected in adults at least 10 years after immunization. Except for IFN-gamma release, responses in vaccinated adults paralleled those observed in naturally immune individuals.

  4. Parasite distribution and associated immune response during the acute phase of Toxoplasma gondii infection in sheep.

    PubMed

    Verhelst, Delfien; De Craeye, Stéphane; Entrican, Gary; Dorny, Pierre; Cox, Eric

    2014-12-16

    In many countries, Toxoplasma gondii (T. gondii) is a major cause of reproductive disorders and abortions in the sheep industry, and therefore responsible for important financial and economic losses. In addition, undercooked infected lamb is an important risk factor for human toxoplasmosis. In the present study, the initial phase of the infection was investigated: the parasite's entry site, the subsequent distribution of the parasite and the host-immune response. Parasite DNA was already detected in the cranial small intestinal mucosa the first days after oral infection with T. gondii tissue cysts. Simultaneously, high IFN-gamma and IL-12 responses were induced mainly in the mesenteric lymph nodes. The emergence of IgG1 (at 8dpi), and IgG2 (at 11 dpi) was accompanied by a decrease or even disappearance of the IFN-gamma and IL-12 response in the Peyers' patches (PP), PBMC's and popliteal LN's. Meanwhile the parasite DNA could be recovered from most mucosal and systemic tissues to become undetectable in the small intestine, popliteal LN, PBMC and spleen 3 weeks pi. Our results indicate that parasites enter the cranial small intestine the first days after infection and that after an increase the first two weeks after infection, the parasite DNA levels in the intestine drop below the detection limit three weeks after infection. This coincides with an increase in parastic-specific serum IgG1 and IgG2 and a decrease of the antigen-specific IFN-gamma response in PP, PBMC and popliteal LN. We suggest a role for IFN-gamma and IL-12 in controlling the infection.

  5. Interferon-alpha and interferon-gamma sensitize human tenon fibroblasts to mitomycin-C.

    PubMed

    Wang, Xiao Yang; Crowston, Jonathan G; Zoellner, Hans; Healey, Paul R

    2007-08-01

    To investigate the effect of interferon (IFN)-alpha and IFN-gamma pretreatment on mitomycin C (MMC)-induced cell death in human Tenon fibroblasts (HTFs) and the mechanisms by which IFN-alpha and IFN-gamma modulate the susceptibility of HTFs to MMC. HTFs were pretreated with IFN-alpha and IFN-gamma for 48 hours before 5-minute application of 0.4 mg/mL MMC. Cell death after 48 hours was determined by Annexin V/propidium iodide (PI) staining and lactate dehydrogenase (LDH) release assay. Fas, Fas-ligand, and Bcl-2 expression were determined by flow cytometry. Fas associated death domain (FADD), Bax, cytochrome c, and caspase expression were determined by Western blot analysis and immunofluorescence staining. MMC treatment increased cell death and upregulated Fas and FADD expression, but had no effect on Fas-Ligand, Bax, Bcl-2, or cytochrome c. Neither IFN-alpha nor IFN-gamma alone induced HTF death, but each increased cell death 2 days after MMC treatment in a dose-dependent fashion. Combination IFN-alpha and IFN-gamma had a synergistic effect. IFN-alpha and IFN-gamma pretreatment increased Fas expression. Fas upregulation was associated with increased sensitivity to MMC. IFN pretreatment increased procaspase-8, procaspase-9, and procaspase-3 expression, and caspase-3 activation. Caspase-8, caspase-3, and broad caspase inhibitors, but not caspase-9 inhibitor, inhibited MMC-induced cell death in nonpretreated and IFN-pretreated cells. IFN-alpha and IFN-gamma enhance the susceptibility of HTFs to MMC-induced cell death through a Fas-mediated and a caspase-3-dependent pathway. Pretreatment with IFN primed HTFs to MMC, providing a potential means for initially slowing the healing response with IFN and subsequently terminating fibroblast activity through MMC-induced cell death.

  6. Ionizing radiation potentiates the induction of nitric oxide synthase by interferon-gamma (Ifn-gamma) or Ifn-gamma and lipopolysaccharide in bnl cl.2 murine embryonic liver cells: role of hydrogen peroxide.

    PubMed

    Yoo, J C; Pae, H O; Choi, B M; Kim, W I; Kim, J D; Kim, Y M; Chung, H T

    2000-02-01

    The effects of ionizing irradiation on the nitric oxide (NO) production in murine embryonic liver cell line, BNL CL.2 cells, were investigated. Various doses (5-40 Gy) of radiation made BNL CL.2 cells responsive to interferon-gamma alone for the production of NO in a dose-dependent manner. Small amounts of lipopolysaccharide (LPS) or tumor necrosis factor-alpha (TNF-alpha) synergized with IFN-gamma in the production of NO from irradiated BNL CL.2 cells, even though LPS or TNF-alpha alone did not induce NO production from the same cells. Immunoblots showed parallel induction of inducible nitric oxide synthase (iNOS). NO production in irradiated BNL CL.2 cells by IFN-gamma or IFN-gamma plus LPS was decreased by the addition of catalase, suggesting that H(2)O(2) produced by ionizing irradiation primed the cells to trigger NO production in response to IFN-gamma or IFN-gamma plus LPS. Furthermore, the treatment of nongamma-irradiated BNL CL.2 cells with H(2)O(2) made the cells responsive to IFN-gamma or IFN-gamma plus LPS for the production of NO. This study shows that ionizing irradiation has the ability to induce iNOS gene expression in responsive to IFN-gamma via the formation of H(2)O(2) in BNL CL.2 murine embryonic liver cells.

  7. Evaluation of gamma interferon (IFN-gamma)-induced protein 10 (IP-10) responses for detection of cattle infected with Mycobacterium bovis: comparisons to IFN-gamma responses

    USDA-ARS?s Scientific Manuscript database

    Gamma interferon (IFN-gamma)-induced protein 10 (IP-10) has recently shown promise as a diagnostic biomarker of Mycobacterium tuberculosis infection of humans. The aim of the current study was to compare IP-10 and IFN-gamma responses upon Mycobacterium bovis infection in cattle using archived sample...

  8. Biosynthesis and N-glycosylation of human interferon-gamma. Asn25 and Asn97 differ markedly in how efficiently they are glycosylated and in their oligosaccharide composition.

    PubMed

    Sareneva, T; Mørtz, E; Tölö, H; Roepstorff, P; Julkunen, I

    1996-12-01

    Interferon-gamma (IFN-gamma) is a secretory glycoprotein produced by T cells in response to antigenic or mitogenic stimuli. We studied the kinetics of the synthesis, N-glycosylation, and secretion of IFN-gamma in human CD8+ T lymphocytes stimulated via T-cell receptor. Highly elevated IFN-gamma mRNA levels were found as early as 1 h after stimulation. Maximal IFN-gamma protein synthesis was observed 2-4 h after induction and appeared to correlate to steady-state IFN-gamma mRNA levels. As analyzed by pulse/chase experiments, the secretion of IFN-gamma from T cells was very rapid, the secretion half-time being approximately 20-25 min. Inhibition of N-glycosylation by tunicamycin dramatically reduced the expression of IFN-gamma, but did not block its secretion. Natural IFN-gamma is heterogeneously glycosylated and doubly, singly, and unglycosylated forms exist. Experiments performed in a cell-free translation/glycosylation system with mutated IFN-gamma constructs lacking either one of the potential glycosylation sites suggested that Asn25 is more efficiently glycosylated than Asn97. Site-specific oligosaccharide analysis of natural IFN-gamma by glycosidase treatment followed by matrix-assisted-laser-desorption-ionization mass spectrometry revealed considerable variation in the carbohydrate structures, with more than 30 different forms. The glycans at Asn25 consisted of fucosylated, mainly complex-type oligosaccharides, whereas the glycans at Asn97 were more heterogeneous, with hybrid and high-mannose structures. Our results emphasize the essential role of N-linked glycans in the biology of IFN-gamma and show that there is a considerable heterogeneity in the individual sugar chains of this important human cytokine.

  9. The effect of centaurein on interferon-{gamma} expression and Listeria infection in mice

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chang, S.-L.; Department of Biological Science and Technology, National Chiao Tung University, 1001, Ta Hsueh Road, Hsinchu 300, Taiwan; Yeh, H.-H.

    2007-02-15

    We previously found that centaurein enhanced IFN-{gamma} transcription in T cells. Here, we demonstrate that centaurein increased the IFN-{gamma} expression in T and NK cells and the serum IFN-{gamma} level in mice. Centaurein elevated the transcription of T-bet but not GATA-3, which is consistent with its effect on that of IFN-{gamma} but not IL-4. Additionally, centaurein effectively protected mice against Listeria infection. Moreover, centaurein per se or in combination with antibiotics could treat Listeria infection. Our mechanistic studies suggest that centaurein augments IFN-{gamma} expression via a transcriptional up-regulation of T-bet and that centaurein protects against or treats Listeria infection viamore » a modulation of IFN-{gamma} expression.« less

  10. Nuclear receptor ERR alpha and coactivator PGC-1 beta are effectors of IFN-gamma-induced host defense.

    PubMed

    Sonoda, Junichiro; Laganière, Josée; Mehl, Isaac R; Barish, Grant D; Chong, Ling-Wa; Li, Xiangli; Scheffler, Immo E; Mock, Dennis C; Bataille, Alain R; Robert, Francois; Lee, Chih-Hao; Giguère, Vincent; Evans, Ronald M

    2007-08-01

    Macrophage activation by the proinflammatory cytokine interferon-gamma (IFN-gamma) is a critical component of the host innate response to bacterial pathogenesis. However, the precise nature of the IFN-gamma-induced activation pathway is not known. Here we show using genome-wide expression and chromatin-binding profiling that IFN-gamma induces the expression of many nuclear genes encoding mitochondrial respiratory chain machinery via activation of the nuclear receptor ERR alpha (estrogen-related receptor alpha, NR3B1). Studies with macrophages lacking ERR alpha demonstrate that it is required for induction of mitochondrial reactive oxygen species (ROS) production and efficient clearance of Listeria monocytogenes (LM) in response to IFN-gamma. As a result, mice lacking ERR alpha are susceptible to LM infection, a phenotype that is localized to bone marrow-derived cells. Furthermore, we found that IFN-gamma-induced activation of ERR alpha depends on coactivator PGC-1 beta (peroxisome proliferator-activated receptor gamma coactivator-1 beta), which appears to be a direct target for the IFN-gamma/STAT-1 signaling cascade. Thus, ERR alpha and PGC-1 beta act together as a key effector of IFN-gamma-induced mitochondrial ROS production and host defense.

  11. Differential co-promoting activities of alpha, beta and gamma interferons in the murine skin two-stage carcinogenesis model.

    PubMed

    Reiners, J J; Cantu, A; Thai, G; Pavone, A

    1993-03-01

    SENCAR mice develop more papillomas in two-stage skin carcinogenesis protocols if gamma interferon (IFN-gamma) is co-administered with 12-O-tetradecanoylphorbol-13-acetate (TPA) during the promotion phase. In the current study preparations of murine alpha, beta and gamma IFNs were surveyed for their abilities to modulate TPA-dependent promotion and induction of epidermal hyperplasia, inflammation and ornithine decarboxylase activity (ODC). Single or multiple i.p. administrations of IFN-alpha, -beta or -gamma (< or = 2500 units) did not induce epidermal hyperplasia, inflammation or ODC activity. Single or multiple i.p. administrations of IFN-alpha, -beta or -gamma (2500 units) to mice being topically promoted with 0.1 or 1 microgram of TPA did not alter the epidermal hyperplasia induced by the phorbol ester. The vascular permeability of the skin, as evaluated by the extravasation of Evans blue dye, was increased in a dose-dependent fashion by TPA over the range of 0.1-1 microgram. Treatment of mice promoted with 0.1 microgram of TPA with IFN-gamma (> or = 2500 units) significantly increased the skin's vascular permeability. Comparable effects were not obtained with IFN-beta (IFN-alpha not tested). Treatment of TPA-promoted mice with IFN-gamma, and to a lesser extent IFN-beta, weakly potentiated the TPA-dependent induction of epidermal ODC activity. Under conditions in which IFN-gamma had co-promoting activities in an initiation-promotion protocol, co-treatment of initiated mice with 1 microgram of TPA and IFN-alpha or -beta (100-5000 units) did not reproducibly alter tumor latency., or papilloma and carcinoma multiplicities. These findings suggest that the co-promoting activities of IFNs are restricted to the gamma class, and are not uniformly reflected by parameters commonly employed as short-term markers of tumor promotion.

  12. Differential IFN-gamma stimulation of HLA-A gene expression through CRM-1-dependent nuclear RNA export.

    PubMed

    Browne, Sarah K; Roesser, James R; Zhu, Sheng Zu; Ginder, Gordon D

    2006-12-15

    IFNs regulate most MHC class I genes by stimulating transcription initiation. As shown previously, IFN-gamma controls HLA-A expression primarily at the posttranscriptional level. We have defined two 8-base sequences in a 39-nucleotide region in the 3'-transcribed region of the HLA-A gene that are required for the posttranscriptional response to IFN-gamma. Stimulation of HLA-A expression by IFN-gamma requires nuclear export of HLA-A mRNA by chromosome maintenance region 1 (CRM-1). Treatment of cells with leptomycin B, a specific inhibitor of CRM-1, completely inhibited IFN-gamma induction of HLA-A. Expression of a truncated, dominant-negative form of the nucleoporin NUP214/CAN, DeltaCAN, that specifically interacts with CRM-1, also prevented IFN-gamma stimulation of HLA-A, providing confirmation of the role of CRM-1. Increased expression of HLA-A induced by IFN-gamma also requires protein methylation, as shown by the fact that treatment of SK-N-MC cells or HeLa cells with the PRMT1 inhibitor 5'-methyl-5'-thioadenosine abolished the cellular response to IFN-gamma. In contrast with HLA-A, IFN-gamma-induced expression of the HLA class Ib gene, HLA-E, was not affected by either 5'-methyl-5'-thioadenosine or leptomycin B. These results provide proof of principle that it is possible to differentially modulate the IFN-gamma-induced expression of the HLA-E and HLA-A genes, whose products often mediate opposing effects on cellular immunity to tumor cells, pathogens, and autoantigens.

  13. IFN-gamma receptor-deficient mice generate antiviral Th1-characteristic cytokine profiles but altered antibody responses.

    PubMed

    Schijns, V E; Haagmans, B L; Rijke, E O; Huang, S; Aguet, M; Horzinek, M C

    1994-09-01

    The lymphokine IFN-gamma is a pleiotropic immunomodulator and possesses intrinsic antiviral activity. We studied its significance in the development of antiviral immune responses by using IFN-gamma receptor-deficient (IFN-gamma R-/-) mice. After inoculation with live attenuated pseudorabies virus (PRV), the mutant mice showed no infectivity titers in various tissues, and transient viral Ag expression only in the spleen, similar as in wild-type mice. However, the absence of the IFN-gamma R resulted in increased proliferative splenocyte responses. The PRV-immune animals showed a normal IFN-gamma and IL-2 production, without detectable IL-4, and with decreased IL-10 secretion in response to viral Ag or Con A. Immunohistochemically, an increased ratio of IFN-gamma:IL-4-producing spleen cells was found. After immunization with either live attenuated or inactivated PRV, IFN-gamma R-/- mice produced significantly less antiviral Ab, and more succumbed to challenge infection than the intact control animals. The reduction in Ab titers in the mutant mice correlated with lower protection by their sera in transfer experiments. Our data demonstrate that ablation of the IFN-gamma receptor surprisingly does not inhibit the generation of antiviral Th1-type and increase Th2-type cytokine responses. However, it profoundly impairs the generation of protective antiviral Ab.

  14. Critical role of IFN-gamma in CFA-mediated protection of NOD mice from diabetes development.

    PubMed

    Mori, Yoshiko; Kodaka, Tetsuro; Kato, Takako; Kanagawa, Edith M; Kanagawa, Osami

    2009-11-01

    IFN-gamma signaling-deficient non-obese diabetic (NOD) mice develop diabetes with similar kinetics to those of wild-type NOD mice. However, the immunization of IFN-gamma signaling-deficient NOD mice with CFA failed to induce long-term protection, whereas wild-type NOD mice receiving CFA remained diabetes-free. CFA also failed to protect IFN-gamma receptor-deficient (IFN-gammaR(-/-)) NOD mice from the autoimmune rejection of transplanted islets, as it does in diabetic NOD mice, and from disease transfer by spleen cells from diabetic NOD mice. These data clearly show that the pro-inflammatory cytokine IFN-gamma is necessary for the CFA-mediated protection of NOD mice from diabetes. There is no difference in the T(h)1/T(h)17 balance between IFN-gammaR(-/-) NOD and wild-type NOD mice. There is also no difference in the total numbers and percentages of regulatory T (Treg) cells in the lymph node CD4(+) T-cell populations between IFN-gammaR(-/-) NOD and wild-type NOD mice. However, pathogenic T cells lacking IFN-gammaR are resistant to the suppressive effect of Treg cells, both in vivo and in vitro. Therefore, it is likely that CFA-mediated protection against diabetes development depends on a change in the balance between Treg cells and pathogenic T cells, and IFN-gamma signaling seems to control the susceptibility of pathogenic T cells to the inhibitory activity of Treg cells.

  15. Interferon-gamma of the giant panda (Ailuropoda melanoleuca): complementary DNA cloning, expression, and phylogenetic analysis.

    PubMed

    Tao, Yaqiong; Zeng, Bo; Xu, Liu; Yue, Bisong; Yang, Dong; Zou, Fangdong

    2010-01-01

    Interferon-gamma (IFN-gamma) is the only member of type II IFN and is vital in the regulation of immune and inflammatory responses. Herein we report the cloning, expression, and sequence analysis of IFN-gamma from the giant panda (Ailuropoda melanoleuca). The open reading frame of this gene is 501 base pair in length and encodes a polypeptide consisting of 166 amino acids. All conserved N-linked glycosylation sites and cysteine residues among carnivores were found in the predicted amino acid sequence of the giant panda. Recombinant giant panda IFN-gamma with a V5 epitope and polyhistidine tag was expressed in HEK293 host cells and confirmed by Western blotting. Phylogenetic analysis of mammalian IFN-gamma-coding sequences indicated that the giant panda IFN-gamma was closest to that of carnivores, then to ungulates and dolphin, and shared a distant relationship with mouse and human. These results represent a first step into the study of IFN-gamma in giant panda.

  16. A CpG Oligonucleotide Can Protect Mice from a Low Aerosol Challenge Dose of Burkholderia mallei

    PubMed Central

    Waag, David M.; McCluskie, Michael J.; Zhang, Ningli; Krieg, Arthur M.

    2006-01-01

    Treatment with an oligodeoxynucleotide (ODN) containing CPG motifs (CpG ODN 7909) was found to protect BALB/c mice from lung infection or death after aerosol challenge with Burkholderia mallei. Protection was associated with enhanced levels of gamma interferon (IFN-γ)-inducible protein 10, interleukin-12 (IL-12), IFN-γ, and IL-6. Preexposure therapy with CpG ODNs may protect victims of a biological attack from glanders. PMID:16495571

  17. HIV-1 Gag p17 presented as virus-like particles on the E2 scaffold from Geobacillus stearothermophilus induces sustained humoral and cellular immune responses in the absence of IFN{gamma} production by CD4+ T cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Caivano, Antonella; Doria-Rose, Nicole A.; Dept. of Molecular and Cell Biology, University of Washington, Seattle, WA 98124-6108

    2010-11-25

    We have constructed stable virus-like particles displaying the HIV-1 Gag(p17) protein as an N-terminal fusion with an engineered protein domain from the Geobacillus stearothermophilus pyruvate dehydrogenase subunit E2. Mice immunized with the Gag(p17)-E2 60-mer scaffold particles mounted a strong and sustained antibody response. Antibodies directed to Gag(p17) were boosted significantly with additional immunizations, while anti-E2 responses reached a plateau. The isotype of the induced antibodies was biased towards IgG1, and the E2-primed CD4+ T cells did not secrete IFN{gamma}. Using transgenic mouse model systems, we demonstrated that CD8+ T cells primed with E2 particles were able to exert lytic activitymore » and produce IFN{gamma}. These results show that the E2 scaffold represents a powerful vaccine delivery system for whole antigenic proteins or polyepitope engineered proteins, evoking antibody production and antigen specific CTL activity even in the absence of IFN{gamma}-producing CD4+ T cells.« less

  18. [Regulating human interferon-gamma gene expression in marrow stromal cells in mice by Tet-off system].

    PubMed

    Qin, Xin-Tian; Lu, Yue; Tan, Yin-Duo; Chen, Xiao-Qin; Gen, Qi-Rong

    2008-01-01

    We have constructed plasmid "pTre-IFN-gamma" and proved that the Tet-off system could regulate the expression of human interferon-gamma (IFN-gamma) gene in murine marrow stromal cells in vitro. This study was to investigate the regulatory reversibility of Tet-off system and its effect on the expression of human IFN-gamma gene in murine marrow stromal cells in mice. Plasmids pTet-off and pTre-IFN-gamma were co-transfected into murine marrow stromal cells. The expression of IFN-gamma in marrow stromal cells was detected with ELISA. The marrow stromal cells were transfused into BABL/c naked mice after co-transfection. The expression of IFN-gamma mRNA in the spleen was detected by real-time fluorescent quantitative reverse transcription-polymerase chain reaction (RT-PCR). IFN-gamma protein was detected in the culture solution of marrow stromal cells after co-transfection. The secretion peak appeared within the first 72 h. The protein level of IFN-gamma was significantly lower in 300 ng/ml tetracycline hydrochloride-treated marrow stroma cells than in untreated cells [(67.11+/-22.14) pg/1 x 10(7) cells vs. (319.96+/-29.04) pg/1 x 10(7) cells, P<0.001]; its expression was increased when removed tetracycline hydrochloride (P=0.032). The expression of human IFN-gamma mRNA was detected in the spleen. The mRNA level of IFN-gamma was significantly higher in untreated group than in continuous tetracycline hydrochloride-treated group [(1.5+/-0.7)x10(5) copies . (100 mg)(-1) vs. (6.9+/-5.3)x10(2) copies . (100 mg)(-1), P<0.001]; its expression in the mice received tetracycline hydrochloride for one single time lay between the above two groups with significant difference. In mice, Tet-off system could rapidly, efficiently and reversibly regulate the expression of human IFN-gamma gene in marrow stromal cells in vitro and in vivo.

  19. [Study the rudimentary immunoregulatory mechanisms of Ganoderma Spore oil on immunocompromized mice].

    PubMed

    Yi, Youjin; Hu, Shun; Xiong, Xingyao; Liu, Dongbo; Zhong, Yingli

    2012-09-01

    To study the rudimentary immunoregulatory mechanisms of Ganoderma spore oil on immunocompromized mice model. Thrity KM mice were randomly selected and assigned into three groups (ten animals per group): the model control group, Ganoderma Lucidum spores oil group and the normal control group. The model control group and Ganoderma Lucidum spores oil group were injected intraperitoneally with cyclophosphamide at 40 mg x kg(-1) d to generate a immunocompromized mice model. The normal control group were administered with 0.9% NaCl solution 0.1 ml/10 g BW as placebo. All agents were given orally once a day, given for consecutive 30 days, Ganoderma Lucidum spores oil group 150 mg/kg, the others given maize 0.1 ml/10 g BW. The serum TNF-alpha , IFN-gamma content of the mice through ELISA kit and the expression levels of IL-2, IL-10, IL-12, IL-4, IFN-gamma, TNF-alpha mRNA in mouse spleen and thymus were examined by RT-PCR to rudimentary study its immunoregulatory mechanisms. Ganoderma spore oil can significantly increased the content of TNF-alpha and IFN-gamma in the serum and the expression levels of IL-2, IL-10, IL-12, IL-4, IFN-gamma, TNF-alpha mRNA in spleen and thymus, with obvious difference from the model control (P < or = 0.05). Ganoderma spore oil can be able to improve the above cytokine ion expression to immunoregulate the immunocompromized mice.

  20. Effect of gamma interferon on resolution of murine chlamydial genital infection.

    PubMed Central

    Rank, R G; Ramsey, K H; Pack, E A; Williams, D M

    1992-01-01

    Mice infected in the genital tract with the Chlamydia trachomatis agent of mouse pneumonitis were treated with monoclonal rat anti-gamma interferon (anti-IFN-gamma) antibody to determine whether IFN-gamma participated in the resolution of the infection. In two experiments, anti-IFN-gamma antibody treatment resulted in significantly prolonged infections. In support of these data, passive administration of recombinant IFN-gamma to chronically infected nu/nu mice was able to bring about resolution of the infection in some animals. PMID:1398955

  1. S-NPP VIIRS thermal emissive band gain correction during the blackbody warm-up-cool-down cycle

    NASA Astrophysics Data System (ADS)

    Choi, Taeyoung J.; Cao, Changyong; Weng, Fuzhong

    2016-09-01

    The Suomi National Polar orbiting Partnership (S-NPP) Visible Infrared Imaging Radiometer Suite (VIIRS) has onboard calibrators called blackbody (BB) and Space View (SV) for Thermal Emissive Band (TEB) radiometric calibration. In normal operation, the BB temperature is set to 292.5 K providing one radiance level. From the NOAA's Integrated Calibration and Validation System (ICVS) monitoring system, the TEB calibration factors (F-factors) have been trended and show very stable responses, however the BB Warm-Up-Cool-Down (WUCD) cycles provide detectors' gain and temperature dependent sensitivity measurements. Since the launch of S-NPP, the NOAA Sea Surface Temperature (SST) group noticed unexpected global SST anomalies during the WUCD cycles. In this study, the TEB Ffactors are calculated during the WUCD cycle on June 17th 2015. The TEB F-factors are analyzed by identifying the VIIRS On-Board Calibrator Intermediate Product (OBCIP) files to be Warm-Up or Cool-Down granules. To correct the SST anomaly, an F-factor correction parameter is calculated by the modified C1 (or b1) values which are derived from the linear portion of C1 coefficient during the WUCD. The F-factor correction factors are applied back to the original VIIRS SST bands showing significantly reducing the F-factor changes. Obvious improvements are observed in M12, M14 and M16, but corrections effects are hardly seen in M16. Further investigation is needed to find out the source of the F-factor oscillations during the WUCD.

  2. Interferon-gamma receptor-deficiency renders mice highly susceptible to toxoplasmosis by decreased macrophage activation.

    PubMed

    Deckert-Schlüter, M; Rang, A; Weiner, D; Huang, S; Wiestler, O D; Hof, H; Schlüter, D

    1996-12-01

    Toxoplasma gondii may cause severe infections in immunocompromised patients including fetuses and those with AIDS. Among the factors mediating protection against T. gondii, IFN-gamma has gained special attention. To analyze the role of IFN-gamma in the early phase of toxoplasmosis, IFN-gamma receptor-deficient (IFN-gamma R0/0) mice were orally infected with low-virulent toxoplasms. IFN-gamma R0/0 mice died of the disease up to day 10 postinfection, whereas immunocompetent wild-type (WT) mice developed a chronic toxoplasmosis. Histopathology revealed that in IFN-gamma R0/0 mice, the parasite multiplied unrestrictedly in the small intestine, the intestinal lymphatic tissue, the liver, and the spleen. Ultimately, animals died of a necrotizing hepatitis. In WT mice, the same organs were effected, but multiplication of the parasite was effectively limited. Compared with WT mice, immunohistochemistry and flow cytometry demonstrated that in IFN-gamma R0/0 mice, macrophages were only marginally activated in response to the infection, as evidenced by a reduced expression of major histocompatability complex class II antigens. In addition, immunohistochemistry and RT-PCR showed a reduced production of the macrophage-derived cytokines tumor necrosis factor-alpha, inducible nitric oxide synthase, and IL-1 beta in the liver of IFN-gamma R0/0 mice. In contrast, activation of T cells, recruitment of immune cells to inflammatory foci, and anti-T. gondii IgM antibody production were unaffected by the mutation of the IFN-gamma R. Moreover, induction of IL-2, IL-4, and IL-10 mRNA transcripts in the liver was normal in IFN-gamma R0/0 mice. Adoptive transfer experiments revealed that the immune T cells of WT animals did not protect IFN-gamma R0/0 mice from lethal infection with highly virulent toxoplasms, whereas WT mice were significantly protected by the adoptive transfer. Based on these studies, we conclude that IFN-gamma is absolutely required for an efficient activation of macrophages. Macrophages are of critical importance in toxoplasmosis, and insufficient macrophage activation cannot be compensated by other immune mechanisms.

  3. Histaminergic regulation of interferon-gamma (IFN-gamma) production by human natural killer (NK) cells.

    PubMed

    Asea, A; Hansson, M; Czerkinsky, C; Houze, T; Hermodsson, S; Strannegård, O; Hellstrand, K

    1996-08-01

    Monocytes, recovered from human peripheral blood by counter-current centrifugal elutriation, effectively inhibit the production of IFN-gamma by CD3-/56+ NK cells in response to IL-2. This study aimed at defining the nature of the inhibitory signal, particularly the importance of monocyte-derived reactive metabolites of oxygen. It was found that monocytes recovered from patients with chronic granulomatous disease (CGD), a condition characterized by deficient NADPH-oxidase activity of phagocytes, did not inhibit IFN-gamma production by NK cells. Further, catalase, a scavenger of hydrogen peroxide, completely reversed the inhibitory signal whereas scavengers of the superoxide anion, hypohalous acids, the hydroxyl radical, or nitric oxide synthesis inhibitors such as L-NMMA were ineffective. Inhibition of IFN-gamma production was operating on a pretranslational level, as indicated by the inability of enriched NK cells to accumulate IFN-gamma mRNA in the presence of elutriated monocytes. Hydrogen peroxide, at micromolar concentrations, reconstituted the inhibition of IFN-gamma production when added to enriched NK cells. Histamine, a biogenic amine which inhibits the generation of reactive oxygen metabolites in monocytes, abrogated the inhibition of IFN-gamma production in NK cells; by this mechanism, histamine strongly synergized with IL-2 to induce IFN-gamma in mixtures of NK cells and monocytes. The synergizing effect of histamine was specifically mediated by H2-type histamine receptors. We conclude that: (i) the induction of IFN-gamma mRNA in NK cells is effectively down-regulated by products of the oxidative metabolism of monocytes; and (ii) histamine effectively enhances IFN-gamma production by preventing monocyte-induced oxidative damage to NK cells.

  4. Combined therapy with danazol, pegilated interferon, and ribavirin improves thrombocytopenia and liver injury in rats with fibrosis.

    PubMed

    Alvarez, Guillermo Cabrera; Madrid-Marina, Vicente; Jimenez-Mendez, Ricardo; Buitimea, Angel Leon; Román, Margarita Bahena; Cortez-Gomez, Rudyard; Esparza, Jorge Reyes; Rodríguez-Fragoso, Lourdes

    2007-01-01

    The aim of this study was to investigate the effects of combinations of pegilated-interferon (PEG-IFN), ribavirin, and danazol on thrombocytopenia and liver injury in rats with fibrosis. Male adult Wistar rats were treated with either mineral oil, danazol (0.83 mg/kg per day), PEG-interferon alpha-2a (PEG-IFN, 0.3 microg/ week) + ribavirin (12 mg/kg per day), PEG-IFN + ribavirin + danazol, CCl(4) (4 g/kg for eight weeks), CCl(4) + PEG-IFN + ribavirin, or CCl(4) + PEG-IFN + ribavirin+ danazol. The following assays were conducted: hematology, clinical chemistry, liver function, liver fibrosis, lymphocyte cytokine mRNA expression, and bone-marrow DNA content. Platelet counts were low in sham-treated animals and animals treated with PEG- IFN + ribavirin (30% and 25% respectively; P < 0.05). PEG-IFN + ribavirin + danazol reduced platelet counts of fibrotic animals by only 9% (P < 0.05). PEG- IFN + ribavirin reduced hepatic collagen content by 50%, whereas danazol + PEG-IFN + ribavirin reduced hepatic collagen content by 60% (P < 0.05). PEG-IFN + ribavirin reduced the total bilirubin concentration by 27%, alanine amino transferase (ALT) activity by 75% and gamma-glutamyl transpeptidase (gamma-GTP) activity by 74% (P < 0.05). In contrast, danazol + PEG-IFN + ribavirin reduced total bilirubin levels by 61%, alkaline phosphatase activity by 45%, ALT activity by 76%, and gamma-GTP activity by 74% (P < 0.05). The only treatment that increased interleukin 10 (IL-10) mRNA in fibrotic rats was PEG-IFN + ribavirin. However, danazol + PEG-IFN + ribavirin reduced the expression of IL-6, IL-10, tumor necrosis factor alpha and transforming growth factor ss. Bone-marrow DNA content was not altered by any treatment. In conclusion, PEG-IFN + ribavirin + danazol could be a new therapeutic option for patients with liver injury, fibrosis, and thrombocytopenia.

  5. Interferon-gamma: biologic functions and HCV therapy (type I/II) (1 of 2 parts).

    PubMed

    Gattoni, A; Parlato, A; Vangieri, B; Bresciani, M; Derna, R

    2006-01-01

    This review is aimed at exhaustively presenting and discussing the interferon-gamma (IFN-gamma), a cytokine that plays an important role in inducing and modulating an array of immune responses. A review of the most significant and recent clinical trials was performed. Although IFN-gamma has some antiviral activity, it is much less active in this regard than type I IFNs. IFN-gamma is involved in the regulation of nearly all phases of the immune and inflammatory responses, including the activation and differentiation of T cells, B cells, NK cells, macrophages, and others. It is therefore best regarded as a distint immunoregulatory cytokine. IFN-gamma secretion is a hallmark of Th1 lymphocytes. It is also secreted by nearly all CD8 T cells, by some Th0 cells, and by NK cells. Each of these cell types secretes IFN-gamma only when activated, usually as part of immune response and especially in response to IL-2 and IL-12. IFN-gamma production is inhibited by IL-4, IL-10, TGFbeta, glucocorticoids, cyclosporin A and FK506. Nearly all cell types express the heterodimeric receptor for IFN-beta and respond to this cytokine by increasing the surface expression of class I MHC proteins. As a result, virtually any cell in the vicinity of an IFN-beta-secreting cell becomes more efficient at presenting endogenous antigens and hence a better target for cytotoxic killing if it harbors an intracellular pathogen. Unlike the type I IFNs, IFN-gamma also increases the expression of class II MHC proteins on professional APCs, and so promotes antigen presentation to helper T cells as well. It also induces de novo expression of class II MHC proteins on venular endothelial cells and on some other epithelial and connective tissue cells that do not otherwise express them, thus enabling these cell types to function as temporary APCs at sites of intense immune reactions. The effector functions of NK cells are to lyse virus-infected cells and to secrete IFN-gamma, which activates macrofages to destroy phagocytosed microbes. The mechanism of NK cell-mediates cytolysis is essentially the same as that of cytolysis by CTLS. NK cells lyse virally infected cells before antigen specific CTLS came become fully active, that is, during the first few days after viral infection. NK cells are expanded and activated by cytokines of innate immunity, such as IL-12 and IL-15, and they kill infected cells, especially those that display reduced levels of class I molecoles. Some tumors, especially those of hematopoietic origin, are targets of NK cells, perlevels or types of class I MHC molecules. Therefore, IFN-gamma serves critical functions in innate immunity and in specific cell-mediated immunity (in addition, IFN activates neutrophilis and stimulates the cytolitic activity of NK cells). Many IFNs-gamma induced effects result in heigtened immune surveillance. IFN-gamma is a remarkable cytokine that orchestrates many distinct cellular programs through transcriptional control over large numbers of genes. Many IFNs-gamma-induced effects resulting in heightend immune surveillance and immune system function during infection have been discussed in this review. As the pathogens (microorganism with the potential to cause tissue injury or disease) augment local IFN-gamma production, and IFN-gamma augments the immune system response, an important function of IFN-gamma during in vivo infection is suggested. IFN-gamma is primarily secreted by activated T cells and natural killer cells, and can promote macrophage activation, mediate antiviral e antibacterial immunity, enhance antigen presentation, orchestrate activation of the innate immune system, coordinate lymphocyte-endothelium interaction, regulate Th1/Th2 balance, and control cellular proliferation and apoptosis.

  6. Interferon-gamma +874 T/A and interleukin-10 -1082 A/G single nucleotide polymorphism in Egyptian children with tuberculosis.

    PubMed

    Mosaad, Y M; Soliman, O E; Tawhid, Z E; Sherif, D M

    2010-10-01

    The aim was to investigate the association of interferon-gamma (IFN-γ) +874 T/A and interleukin-10 (IL-10)-1082 A/G single nucleotide polymorphisms with tuberculous infection and post-BCG lymphadenitis in Egyptian children. IFN-γ +874 T/A and IL-10 -1082 A/G polymorphism detection by amplification refractory mutation system technique was carried out for 110 patients with TB, 40 patients with post-BCG lymphadenitis and 118 healthy controls. IFN-γ +874 A allele was higher in TB and post-BCG patients than those in healthy controls (Pc=0.006 and 0.002, respectively). IFN-γ +874 genotype AA was significantly higher in patients with TB than that in control (Pc=0.015), in extrapulmonary than patients with pulmonary TB (PTB) (Pc=0.009), and young children with TB below 5 years (Pc=0.024). No statistically significant differences were observed between patients with TB and controls for the frequency of IL-10(-1082) alleles or genotypes (P>0.05); however, a statistically significant difference in the frequency of IL-10 (-1082) GG genotype was found between patients with pulmonary and extrapulmonary TB (Pc=0.003). Low producer IFN-γ +874 A/A genotype is associated with post-BCG lymphadenitis and TB disease especially in younger children below 5 years. IL-10-1082 G/G genotype did not exhibit significant association except for increased GG frequency in PTB. Both cytokine polymorphisms have no relation to tuberculin reaction in patients with TB. © 2010 The Authors. Scandinavian Journal of Immunology © 2010 Blackwell Publishing Ltd.

  7. Reversion and conversion of Mycobacterium tuberculosis IFN-gamma ELISpot results during anti-tuberculous treatment in HIV-infected children.

    PubMed

    Connell, Tom G; Davies, Mary-Ann; Johannisen, Christine; Wood, Kathryn; Pienaar, Sandy; Wilkinson, Katalin A; Wilkinson, Robert J; Zar, Heather J; Beatty, David; Nicol, Mark P; Curtis, Nigel; Eley, Brian

    2010-05-27

    Recent interest has focused on the potential use of serial interferon gamma (IFN-gamma) release assay (IGRA) measurements to assess the response to anti-tuberculous (TB) treatment. The kinetics of IFN-gamma responses to Mycobacterium tuberculosis (MTB) antigens in HIV-infected children during treatment have not however been previously investigated. IFN-gamma responses to the MTB antigens, ESAT-6, CFP-10 and PPD were measured by an enzyme-linked immunospot assay (IFN-gamma ELISpot) at presentation and at one, two and six months after starting anti-tuberculous treatment in HIV-infected children with definite or probable TB. Responses at different time points were compared using a Mann-Whitney U test with paired data analysed using the Wilcoxon signed rank test. A Fisher's exact or Chi-squared test was used to compare proportions when test results were analysed as dichotomous outcomes. Of 102 children with suspected TB, 22 (21%) had definite TB and 24 (23%) probable TB. At least one follow up IFN-gamma ELISpot assay result was available for 31 (67%) of the 46 children. In children with definite or probable TB in whom the IFN-gamma ELISpot assay result was positive at presentation, anti-tuberculous treatment was accompanied by a significant decrease in both the magnitude of the IFN-gamma response to individual or combined MTB-specific antigens (ESAT-6 median 110 SFCs/106 PBMC (IQR 65-305) at presentation vs. 15 (10-115) at six months, p = 0.04; CFP-10 177 (48-508) vs. 20 (5-165), p = 0.004, ESAT-6 or CFP-10 median 250 SFCs/106 PBMC (IQR 94-508) vs. 25 (10-165), p = 0.004) and in the proportion of children with a positive IFN-gamma ELISpot assay (Fisher's exact test: ESAT-6 15/0 vs 5/11, p = 0.0002, CFP-10 22/0 vs 8/17, p = 0.0001, ESAT-6 or CFP-10 22/0 vs. 9/17, p= 0.002). However almost half of the children had a positive IFN-gamma ELISpot assay after six months of anti-tuberculous treatment. In addition, there was conversion of the IFN-gamma ELISpot assay result during anti-tuberculous therapy in six of 12 children in whom the initial IFN-gamma ELISpot assay was negative. In HIV-infected children with definite or probable TB, anti-tuberculosis treatment is accompanied by a reduction in the magnitude of the IFN-gamma ELISpot response to MTB-antigens. However, serial IFN-gamma ELISpot measurements appear to have limited clinical utility in assessing a successful response to anti-tuberculous treatment in HIV infected children.

  8. Knockdown of hTERT and concurrent treatment with interferon-gamma inhibited proliferation and invasion of human glioblastoma cell lines

    PubMed Central

    George, Joseph; Banik, Naren L.; Ray, Swapan K.

    2011-01-01

    Human telomerase reverse transcriptase (hTERT) is the catalytic component of telomerase that facilitates tumor cell invasion and proliferation. Telomerase and hTERT are remarkably upregulated in majority of cancers including glioblastoma. Interferon-gamma (IFN-γ) modulates several cellular activities including cell cycle and multiplication through transcriptional regulation. The present investigation was designed to unravel the molecular mechanisms of the inhibition of cell proliferation, migration, and invasion of human glioblastoma SNB-19 and LN-18 cell lines after knockdown of hTERT using a plasmid vector based siRNA and concurrent treatment with IFN-γ. We observed more than 80% inhibition of cell proliferation, migration, and invasion of both cell lines after the treatment with combination of hTERT siRNA and IFN-γ. Our studies also showed accumulation of apoptotic cells in subG1 phase and an increase in cell population in G0/G1 with a reduction in G2/M phase indicating cell cycle arrest in G0/G1 phase for apoptosis. Semiquantitative and real-time RT-PCR analyses demonstrated significant downregulation of c- Myc and upregulation of p21 Waf1 and p27 Kip1. Western blotting confirmed the downregulation of the molecules involved in cell proliferation, migration, and invasion and also showed upregulation of cell cycle inhibitors. In conclusion, our study demonstrated that knockdown of hTERT siRNA and concurrent treatment with IFN-γ effectively inhibited cell proliferation, migration, and invasion in glioblastoma cells through downregulation of the molecules involved in these processes and cell cycle inhibition. Therefore, the combination of hTERT siRNA and IFN-γ offers a potential therapeutic strategy for controlling growth of human glioblastoma cells. PMID:20394835

  9. Fish oil feeding delays influenza virus clearance and impairs production of interferon-gamma and virus-specific immunoglobulin A in the lungs of mice.

    PubMed

    Byleveld, P M; Pang, G T; Clancy, R L; Roberts, D C

    1999-02-01

    Ingestion of fish oil can suppress the inflammatory response to injury and may impair host resistance to infection. To investigate the effect of a diet containing fish oil on immunity to viral infection, 148 BALB/c mice were fed diets containing 3 g/100 g of sunflower oil with either 17 g/100 g of fish oil or beef tallow for 14 d before intranasal challenge with live influenza virus. At d 1 and d 5 after infection, the mice fed fish oil had higher lung viral load and lower body weight (P < 0.05). In addition to the greater viral load and weight loss at d 5 after infection, the fish oil group consumed less food (P < 0.05) while the beef tallow group was clearing the virus, had regained their preinfection weights and was returning to their preinfection food consumption. The fish oil group had impaired production of lung interferon-gamma (IFN-gamma), serum immunoglobulin (Ig) G and lung IgA-specific antibodies (all P < 0. 05) although lung IFN-alpha/beta and the relative proportions of bronchial lymph node CD4+ and CD8+ T lymphocytes did not differ between groups after infection. The present study demonstrates a delay in virus clearance in mice fed fish oil associated with reduced IFN-gamma and antibody production and a greater weight loss and suppression of appetite following influenza virus infection. However, differences observed during the course of infection did not affect the ultimate outcome as both groups cleared the virus and returned to preinfection food consumption and body weight by d 7.

  10. Interferon Gamma potentiates the injury caused by MPP(+) on SH-SY5Y cells, which is attenuated by the nitric oxide synthases inhibition.

    PubMed

    Titze-de-Almeida, Simoneide S; Lustosa, Cátia Faria; Horst, Camila Hillesheim; Bel, Elaine Del; Titze-de-Almeida, Ricardo

    2014-12-01

    This study examined whether the cytokine interferon (IFN) gamma plays a role in the injury of SH-SY5Y cells caused by MPP(+) (1-methyl-4-phenylpyridinium). First of all, IFN-gamma sensitized cells to the neurotoxin MPP(+), as determined by MTT (3-(4,5-dimethylthiazol-2-y1)-2,5-diphenyltetrazolium bromide) assay. MPP(+)-injured cells showed higher reactive oxygen species (ROS) levels, which was reinforced by IFN-gamma. The injury triggered a marked expression of the neuronal NOS (nNOS) enzyme. L-NAME [N(ω)-nitro-L-arginine methyl ester, a non-specific NOS inhibitor] reestablished the cell viability after IFN-gamma challenging, and recovered cells from MPP(+) injury (95.0 vs. 84.7 %; P < 0.05). Seven-NI (7-nitroindazole, a nNOS inhibitor) protected cells against the injury by MPP(+) co-administered with IFN-gamma. Both inhibitors restrained the apoptosis of SH-SY5Y cells caused by MPP(+)/IFN-gamma. Regarding oxidative stress, L-NAME and 7-NI attenuated the increase in ROS levels caused by MPP(+) (45.3 or 48.4 vs. 87.9 %, P < 0.05). Indeed, L-NAME was more effective than 7-NI for reducing oxidative stress caused by MPP(+) under IFN-gamma exposition. The nNOS gene silencing by small-interfering RNAs recovered cells challenged by IFN-gamma (24 h), or MPP(+) (8 h). In conclusion, IFN-gamma sensitizes cells to MPP(+)-induced injury, also causing an increase in ROS levels. Pretreating cells with L-NAME or 7-NI reverts both the oxidative stress and apoptosis triggered by the neurotoxin MPP(+). Taking together, our data reinforce that IFN-gamma and NOS enzymes play a role in oxidative stress and dopaminergic cell death triggered by MPP(+).

  11. Requirement for IFN-gamma in IL-12 production induced by collaboration between v(alpha)14(+) NKT cells and antigen-presenting cells.

    PubMed

    Yang, Y F; Tomura, M; Ono, S; Hamaoka, T; Fujiwara, H

    2000-12-01

    Two cytokines IL-4 and IL-12 are known to determine the balance between T(h)1 and T(h)2 development. In addition to IL-4 production of V(alpha)14(+) NKT cells, they have recently been demonstrated to have the capacity to stimulate IL-12 production by antigen-presenting cells (APC). This study demonstrates that IFN-gamma is absolutely required for the NKT cell-stimulated IL-12 production. Culture of B cell-depleted spleen cells from C57BL/6 mice with alpha-galactosylceramide (alpha-GalCer) capable of selectively stimulating V(alpha)14/J(alpha)281(+) NKT cells resulted in the production of IL-12 together with IL-4. Whereas IL-4 production occurred in culture of IFN-gamma(-/-) C57BL/6 splenocytes, the same culture failed to generate IL-12 production. While IL-12 production induced during culture of V(alpha)14(+) NKT cells and APC depended on the interaction between CD40 ligand on NKT cells and CD40 on APC, the expression levels of these key molecules were comparable in cells from wild-type and IFN-gamma(-/-) mice. Addition of rIFN-gamma to alpha-GalCer stimulated IFN-gamma(-/-) splenocyte culture, and administration of rIFN-gamma to alpha-GalCer-injected IFN-gamma(-/-) mice resulted in the restoration of IL-12 production in vitro and in vivo. These results illustrate a mandatory role for IFN-gamma in V(alpha)14(+) NKT cell-stimulated IL-12 production by APC.

  12. Effect of interferon-gamma on complement gene expression in different cell types.

    PubMed

    Lappin, D F; Guc, D; Hill, A; McShane, T; Whaley, K

    1992-01-15

    We have studied the expression of the complement components C2, C3, factor B, C1 inhibitor (C1-inh), C4-binding protein (C4-bp) and factor H in human peripheral blood monocytes, skin fibroblasts, umbilical vein endothelial cells (HUVEC) and the human hepatoma cell line G2 (Hep G2) in the absence and the presence of interferon-gamma (IFN-gamma). E.l.i.s.a. performed on culture fluids, run-on transcription assays, Northern blot and double-dilution dot-blot techniques confirmed that monocytes expressed all six components, whereas fibroblasts, HUVEC and HepG2 each expressed five of the six components. Fibroblasts and HUVEC did not synthesize C4-bp, and Hep G2 did not produce factor H. In addition to these differences, the synthesis rates of C3, C1-inh and factor H were not the same in all cell types. However, the synthesis rates of C2 and factor B were similar in all four cell types. The half-lives of the mRNAs were shorter in monocytes than in other cell types. Monocyte factor H mRNA had a half-life of 12 min in monocytes, compared with over 3 h in fibroblasts and HUVEC. The instability of factor H mRNA in monocytes may contribute to their low factor H secretion rate. IFN-gamma produced dose-dependent stimulation of C2, factor B, C1-inh, C4-bp and factor H synthesis by all cell types expressing these proteins, but decreased C3 synthesis in all four cell types. Cell-specific differences in the response to IFN-gamma were observed. The increased rates of transcription of the C1-inh and factor H genes in HUVEC were greater than in other cell types, while the increased rate of transcription of the C2, factor B and C1-inh genes in Hep G2 cells was less than in other cell types. IFN-gamma did not affect the stability of C3, factor H or C4 bp mRNAs, but increased the stability of factor B and C1-inh mRNAs and decreased the stability of C2 mRNA. Although these changes occurred in all four cell types studied, the half-life of C1-inh mRNA in monocytes was increased almost 4-fold, whereas the increases in the other cell types were less than 30%. These data show that the constitutive synthesis rates of complement components may vary in the different cell types. They also show that the degree of change in synthesis rates in response to IFN-gamma in each of the cell types often varies due to differences in transcriptional response, sometimes in association with changes in mRNA stability.

  13. Controlling nuclear JAKs and STATs for specific gene activation by IFN{gamma}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Noon-Song, Ezra N.; Ahmed, Chulbul M.; Dabelic, Rea

    2011-07-08

    Highlights: {yields} Gamma interferon (IFN{gamma}) and its receptor subunit, IFNGR1, interact with the promoter region of IFN{gamma}-associated genes along with transcription factor STAT1{alpha}. {yields} We show that activated Janus kinases pJAK2 and pJAK1 also associate with IFNGR1 in the nucleus. {yields} The activated Janus kinases are responsible for phosphorylation of tyrosine 41 on histone H3, an important epigenetic event for specific gene activation. -- Abstract: We previously showed that gamma interferon (IFN{gamma}) and its receptor subunit, IFNGR1, interacted with the promoter region of IFN{gamma}-activated genes along with transcription factor STAT1{alpha}. Recent studies have suggested that activated Janus kinases pJAK2 andmore » pJAK1 also played a role in gene activation by phosphorylation of histone H3 on tyrosine 41. This study addresses the question of the role of activated JAKs in specific gene activation by IFN{gamma}. We carried out chromatin immunoprecipitation (ChIP) followed by PCR in IFN{gamma} treated WISH cells and showed association of pJAK1, pJAK2, IFNGR1, and STAT1 on the same DNA sequence of the IRF-1 gene promoter. The {beta}-actin gene, which is not activated by IFN{gamma}, did not show this association. The movement of activated JAK to the nucleus and the IRF-1 promoter was confirmed by the combination of nuclear fractionation, confocal microscopy and DNA precipitation analysis using the biotinylated GAS promoter. Activated JAKs in the nucleus was associated with phosphorylated tyrosine 41 on histone H3 in the region of the GAS promoter. Unphosphorylated JAK2 was found to be constitutively present in the nucleus and was capable of undergoing activation in IFN{gamma} treated cells, most likely via nuclear IFNGR1. Association of pJAK2 and IFNGR1 with histone H3 in IFN{gamma} treated cells was demonstrated by histone H3 immunoprecipitation. Unphosphorylated STAT1 protein was associated with histone H3 of untreated cells. IFN{gamma} treatment resulted in its disassociation and then re-association as pSTAT1. The results suggest a novel role for activated JAKs in epigenetic events for specific gene activation.« less

  14. Analysis of Intrinsic Peptide Detectability via Integrated Label-Free and SRM-Based Absolute Quantitative Proteomics.

    PubMed

    Jarnuczak, Andrew F; Lee, Dave C H; Lawless, Craig; Holman, Stephen W; Eyers, Claire E; Hubbard, Simon J

    2016-09-02

    Quantitative mass spectrometry-based proteomics of complex biological samples remains challenging in part due to the variability and charge competition arising during electrospray ionization (ESI) of peptides and the subsequent transfer and detection of ions. These issues preclude direct quantification from signal intensity alone in the absence of a standard. A deeper understanding of the governing principles of peptide ionization and exploitation of the inherent ionization and detection parameters of individual peptides is thus of great value. Here, using the yeast proteome as a model system, we establish the concept of peptide F-factor as a measure of detectability, closely related to ionization efficiency. F-factor is calculated by normalizing peptide precursor ion intensity by absolute abundance of the parent protein. We investigated F-factor characteristics in different shotgun proteomics experiments, including across multiple ESI-based LC-MS platforms. We show that F-factors mirror previously observed physicochemical predictors as peptide detectability but demonstrate a nonlinear relationship between hydrophobicity and peptide detectability. Similarly, we use F-factors to show how peptide ion coelution adversely affects detectability and ionization. We suggest that F-factors have great utility for understanding peptide detectability and gas-phase ion chemistry in complex peptide mixtures, selection of surrogate peptides in targeted MS studies, and for calibration of peptide ion signal in label-free workflows. Data are available via ProteomeXchange with identifier PXD003472.

  15. Sphingosine kinase inhibitor suppresses IL-18-induced interferon-gamma production through inhibition of p38 MAPK activation in human NK cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cheon, Soyoung; Song, Seok Bean; Jung, Minkyung

    2008-09-12

    Natural killer (NK) cells play an important role in the innate immune response. Interleukin-18 (IL-18) is a well-known interferon-gamma (IFN-{gamma} inducing factor, which stimulates immune response in NK and T cells. Sphingosine kinase (SPHK) catalyzes the formation of sphingosine 1-phosphate (S1P), which acts as a second messenger to function as an anti-apoptotic factor and proliferation stimulator of immune cells. In this study, to elucidate whether SPHK is involved in IL-18-induced IFN-{gamma} production, we measured IL-18-induced IFN-{gamma} production after pre-treatment with SPHK inhibitor (SKI) in NK-92MI cells. We found that IL-18-induced IFN-{gamma} expression was blocked by SKI pre-treatment in both mRNAmore » and protein levels. In addition, the increased IFN-{gamma} production by stimulation with IL-18 is mediated through both SPHK and p38 MAPK. To determine the upstream signals of SKI and p38 MAPK in IL-18-induced IFN-{gamma} production, phosphorylation levels of p38 MAPK was measured after SKI pre-treatment. As a result, inhibition of SPHK by SKI blocked phosphorylation of p38 MAPK, showing that SPHK activation by IL-18 is an upstream signal of p38 MAPK activation. Inhibition of SPHK by SKI also inhibited IL-18-induced IFN-{gamma} production in human primary NK cells. In conclusion, SPHK activation is an essential factor for IL-18-induced IFN-{gamma} production via p38 MAPK.« less

  16. Impaired capacity for upregulation of MHC class II in tumor-associated microglia.

    PubMed

    Schartner, Jill M; Hagar, Aaron R; Van Handel, Michelle; Zhang, Leying; Nadkarni, Nivedita; Badie, Behnam

    2005-09-01

    Immunotherapy for malignant gliomas is being studied as a possible adjunctive therapy for this highly fatal disease. Thus far, inadequate understanding of brain tumor immunology has hindered the design of such therapies. For instance, the role of microglia and macrophages, which comprise a significant proportion of tumor-infiltrating inflammatory cells, in the regulation of the local anti-tumor immune response is poorly understood. To study the response of microglia and macrophages to known activators in brain tumors, we injected CpG oligodeoxynucleotide (ODN), interferon-gamma (IFN-gamma), and IFN-gamma/LPS into normal and intracranial RG2 glioma-bearing rodents. Microglia/macrophage infiltration and their surface expression of MHC class II B7.1 and B7.2 was examined by flow cytometry. Each agent evaluated yielded a distinct microglia/macrophage response: CpG ODN was the most potent inducer of microglia/macrophage infiltration and B7.1 expression, while IFN-gamma resulted in the highest MHC-II expression in both normal and tumors. Regardless of the agent injected, however, MHC-II induction was significantly muted in tumor microglia/macrophage as compared with normal brain. These data suggest that microglia/macrophage responsiveness to activators can vary in brain tumors when compared with normal brain. Understanding the mechanism of these differences may be critical in the development of novel immunotherapies for malignant glioma. (c) 2005 Wiley-Liss, Inc.

  17. Cryptococcus neoformans inhibits nitric oxide synthesis caused by CpG-oligodeoxynucleotide-stimulated macrophages in a fashion independent of capsular polysaccharides.

    PubMed

    Xiao, Gang; Miyazato, Akiko; Inden, Ken; Nakamura, Kiwamu; Shiratori, Kohei; Nakagawa, Kiyotaka; Miyazawa, Teruo; Suzuki, Kazuo; Kaku, Mitsuo; Kawakami, Kazuyoshi

    2008-03-01

    Cryptococcus neoformans is eradicated by macrophages via production of NO. Unmethylated CpG-ODN protect mice from infection with this fungal pathogen by inducing IFN-gamma. The present study was designed to elucidate the effect of C. neoformans on the synthesis of NO by alveolar macrophages. For this purpose, MH-S, an alveolar macrophage cell line, was stimulated with CpG-ODN in the presence of IFN-gamma. A highly virulent strain of C. neoformans with thick capsule suppressed the production of NO. Capsular polysaccharides were not essential for this suppression, because there was no difference between acapsular mutant (Cap67) and its parent strain. Physical or close interaction of Cap67 with MH-S was necessary, as shown by the loss of such effect when direct contact was interfered by nitrocellulose membrane. Similar effects were observed by disrupted as well as intact Cap67. Whereas the inhibitory effect of intact Cap67 was completely abrogated by heat treatment, disrupted Cap67 did not receive such influence. Finally, disrupted Cap67 did not show any inhibitory effect on the TLR9-mediated activation of NF-kappaB in a luciferase reporter assay with HEK293T cells, although the TLR4-mediated activation was suppressed. These results revealed that C. neoformans suppressed the synthesis of NO by CpG-ODN and IFN-gamma-stimulated macrophages in a fashion independent of capsular polysaccharides, although the precise mechanism remains to be elucidated.

  18. Enhancement of antiproliferative activity of interferons by RNA interference-mediated silencing of SOCS gene expression in tumor cells.

    PubMed

    Takahashi, Yuki; Kaneda, Haruka; Takasuka, Nana; Hattori, Kayoko; Nishikawa, Makiya; Watanabe, Yoshihiko; Takakura, Yoshinobu

    2008-08-01

    The suppressor of cytokine signaling (SOCS) proteins, negative regulators of interferon (IFN)-induced signaling pathways, is involved in IFN resistance of tumor cells. To improve the growth inhibitory effect of IFN-beta and IFN-gamma on a murine melanoma cell line, B16-BL6, and a murine colon carcinoma cell line, Colon26 cells, SOCS-1 and SOCS-3 gene expression in tumor cells was downregulated by transfection of plasmid DNA expressing short hairpin RNA targeting one of these genes (pshSOCS-1 and pshSOCS-3, respectively). Transfection of pshSOCS-1 significantly increased the antiproliferative effect of IFN-gamma on B16-BL6 cells. However, any other combinations of plasmids and IFN had little effect on the growth of B16-BL6 cells. In addition, transfection of pshSOCS-1 and pshSOCS-3 produced little improvement in the effect of IFN on Colon26 cells. To understand the mechanism underlining these findings, the level of SOCS gene expression was measured by real time polymerase chain reaction. Addition of IFN-gamma greatly increased the SOCS-1 mRNA expression in B16-BL6 cells. Taking into account the synergistic effect of pshSOCS-1 and IFN-gamma on the growth of B16-BL6 cells, these findings suggest that IFN-gamma-induced high SOCS-1 gene expression in B16-BL6 cells significantly interferes with the antiproliferative effect of IFN-gamma. These results indicate that silencing SOCS gene expression can be an effective strategy to enhance the antitumor effect of IFN under conditions in which the SOCS gene expression is upregulated by IFN.

  19. [Aerosolized recombinant interferon-gamma prevent antigen-induced eosinophil recruitment in guinea pig trachea].

    PubMed

    Gao, Y; Chenping; Lin, X P

    1997-10-01

    In order to determine whether interferon-gamma (IFN-gamma) inhibits eosinphil infiltration in the trachea of asthmatic guinea pigs induced by Rhizopus nigricans. We had administered aerosolized rIFN-gamma in the tracheas of 30 sensitized guinea pigs which had been divided into six groups, then teated animal inhaled rIFN-gamma of 5 x 10(4), 20 x 10(4), and 40 x 10(4) concentration, BDP and normal saline respectively at 24 h, 12 h, 2 h before being challenged. (1) Provocation positive rates decreased in 40 x 10(4) rIFN-gamma and BDP group compared with that in normal saline group and before intervention (P < 0.05), airway resistence decreased (P < 0.01). (2) The administration of aerosolized rIFN-gamma (40 x 10(4)) and BDP also decreased fungus-induced eosnophils but not other cells infiltration in the trachea. (3) In BALF, Eos count and ECP level were obviously lower than those in other groups. However, eosinophil numbers did not show significant change in the peripheral blood. Local administration of rIFN-gamma (40 x 10(4)) may reduce airway inflammation and intervene asthmatic attack by inhibition of Eos, ECP infiltration in airways.

  20. Distinct regulatory functions of SLP-76 and MIST in NK cell cytotoxicity and IFN-gamma production.

    PubMed

    Hidano, Shinya; Sasanuma, Hiroki; Ohshima, Keiko; Seino, Ken-ichiro; Kumar, Lalit; Hayashi, Katsuhiko; Hikida, Masaki; Kurosaki, Tomohiro; Taniguchi, Masaru; Geha, Raif S; Kitamura, Daisuke; Goitsuka, Ryo

    2008-03-01

    Activation of NK cells is triggered by multiple receptors. We demonstrate here that SLP-76 is required for CD16- and NKG2D-mediated NK cell cytotoxicity, while MIST negatively regulates these responses in an SLP-76-dependent manner. Exceptionally, MIST acts as a positive regulator of cytotoxicity against YAC-1 cells, although SLP-76 plays a more key role. SLP-76 acts as a dominant positive regulator for both NKG2D-mediated and YAC-1 cell-triggered IFN-gamma production. Although NKG2D-mediated IFN-gamma production depends on phospholipase C (PLC) gamma 2, YAC-1 cell-triggered IFN-gamma production is PLC gamma 2- and Syk/ZAP-70 independent and nuclear factor-kappa B mediated. SLP-76 is required for this process in the presence of MIST but is dispensable in the absence of MIST. Thus, YAC-1 cell-triggered NKG2D-independent IFN-gamma production appears to be regulated by SLP-76-dependent and -independent pathways, in which the latter is negatively regulated by MIST. Taken together, these results suggest that SLP-76 and MIST distinctly but interactively regulate NK cell cytotoxicity and IFN-gamma production.

  1. Interferon-gamma regulates nucleoside transport systems in macrophages through signal transduction and activator of transduction factor 1 (STAT1)-dependent and -independent signalling pathways.

    PubMed Central

    Soler, Concepció; Felipe, Antonio; García-Manteiga, José; Serra, Maria; Guillén-Gómez, Elena; Casado, F Javier; MacLeod, Carol; Modolell, Manuel; Pastor-Anglada, Marçal; Celada, Antonio

    2003-01-01

    The expressions of CNT and ENT (concentrative and equilibrative nucleoside transporters) in macrophages are differentially regulated by IFN-gamma (interferon-gamma). This cytokine controls gene expression through STAT1-dependent and/or -independent pathways (where STAT1 stands for signal transduction and activator of transcription 1). In the present study, the role of STAT1 in the response of nucleoside transporters to IFN-gamma was studied using macrophages from STAT1 knockout mice. IFN-gamma triggered an inhibition of ENT1-related nucleoside transport activity through STAT1-dependent mechanisms. Such inhibition of macrophage growth and ENT1 activity by IFN-gamma is required for DNA synthesis. Interestingly, IFN-gamma led to an induction of the CNT1- and CNT2-related nucleoside transport activities independent of STAT1, thus ensuring the supply of extracellular nucleosides for the STAT1-independent RNA synthesis. IFN-gamma up-regulated CNT2 mRNA and CNT1 protein levels and down-regulated ENT1 mRNA in both wild-type and STAT1 knockout macrophages. This is consistent with a STAT1-independent, long-term-mediated, probably transcription-dependent, regulation of nucleoside transporter genes. Moreover, STAT1-dependent post-transcriptional mechanisms are implicated in the regulation of ENT1 activity. Although nitric oxide is involved in the regulation of ENT1 activity in B-cells at a post-transcriptional level, our results show that STAT1-dependent induction of nitric oxide by IFN-gamma is not implicated in the regulation of ENT1 activity in macrophages. Our results indicate that both STAT1-dependent and -independent pathways are involved in the regulation of nucleoside transporters by IFN-gamma in macrophages. PMID:12868960

  2. Dichotomy of protective cellular immune responses to human visceral leishmaniasis.

    PubMed

    Khalil, E A G; Ayed, N B; Musa, A M; Ibrahim, M E; Mukhtar, M M; Zijlstra, E E; Elhassan, I M; Smith, P G; Kieny, P M; Ghalib, H W; Zicker, F; Modabber, F; Elhassan, A M

    2005-05-01

    Healing/protective responses in human visceral leishmaniasis (VL) are associated with stimulation/production of Th1 cytokines, such as interferon IFN-gamma, and conversion in the leishmanin skin test (LST). Such responses were studied for 90 days in 44 adult healthy volunteers from VL non-endemic areas, with no past history of VL/cutaneous leishmaniasis (CL) and LST non-reactivity following injection with one of four doses of Alum-precipitated autoclaved Leishmania major (Alum/ALM) +/- bacille Calmette-Guerin (BCG), a VL candidate vaccine. The vaccine was well tolerated with minimal localized side-effects and without an increase in antileishmanial antibodies or interleukin (IL)-5. Five volunteers (5/44; 11.4%) had significant IFN-gamma production by peripheral blood mononuclear cells (PBMCs) in response to Leishmania antigens in their prevaccination samples (P = 0.001) but were LST non-reactive. On day 45, more than half the volunteers (26/44; 59.0%) had significantly high LST indurations (mean 9.2 +/- 2.7 mm) and high IFN-gamma levels (mean 1008 +/- 395; median 1247 pg/ml). Five volunteers had significant L. donovani antigen-induced IFN-gamma production (mean 873 +/- 290; median 902; P = 0.001), but were non-reactive in LST. An additional five volunteers (5/44; 11.4%) had low IFN-gamma levels (mean 110 +/- 124 pg/ml; median 80) and were non-reactive in LST (induration = 00 mm). The remaining eight volunteers had low IFN-gamma levels, but significant LST induration (mean 10 +/- 2.9 mm; median 11). By day 90 the majority of volunteers (27/44; 61.4%) had significant LST induration (mean 10.8 +/- 9.9 mm; P < 0.001), but low levels of L. donovani antigen-induced IFN-gamma (mean 66.0 +/- 62 pg/ml; P > 0.05). Eleven volunteers (11/44; 25%) had significantly high levels of IFN-gamma and LST induration, while five volunteers had low levels of IFN-gamma (<100 pg/ml) and no LST reactivity (00 mm). One volunteer was lost to follow-up. In conclusion, it is hypothesized that cellular immune responses to human VL are dichotomatous, and that IFN-gamma production and the LST response are not in a causal relationship. Following vaccination and probably cure of VL infection, the IFN-gamma response declines with time while the LST response persists. LST is a simple test that can be used to assess candidate vaccine efficacy.

  3. Mycobacterium tuberculosis infection in health care workers in rural India: comparison of a whole-blood interferon gamma assay with tuberculin skin testing.

    PubMed

    Pai, Madhukar; Gokhale, Kaustubh; Joshi, Rajnish; Dogra, Sandeep; Kalantri, Shriprakash; Mendiratta, Deepak K; Narang, Pratibha; Daley, Charles L; Granich, Reuben M; Mazurek, Gerald H; Reingold, Arthur L; Riley, Lee W; Colford, John M

    2005-06-08

    Mycobacterium tuberculosis infection in health care workers has not been adequately studied in developing countries using newer diagnostic tests. To estimate latent tuberculosis infection prevalence in health care workers using the tuberculin skin test (TST) and a whole-blood interferon gamma (IFN-gamma) assay; to determine agreement between the tests; and to compare their correlation with risk factors. A cross-sectional comparison study of 726 health care workers aged 18 to 61 years (median age, 22 years) with no history of active tuberculosis conducted from January to May 2004, at a rural medical school in India. A total of 493 (68%) of the health care workers had direct contact with patients with tuberculosis and 514 (71%) had BCG vaccine scars. Tuberculin skin testing was performed using 1-TU dose of purified protein derivative RT23, and the IFN-gamma assay was performed by measuring IFN-gamma response to early secreted antigenic target 6, culture filtrate protein 10, and a portion of tuberculosis antigen TB7.7. Agreement between TST and the IFN-gamma assay, and comparison of the tests with respect to their association with risk factors. A large proportion of the health care workers were latently infected; 360 (50%) were positive by either TST or IFN-gamma assay, and 226 (31%) were positive by both tests. The prevalence estimates of TST and IFN-gamma assay positivity were comparable (41%; 95% confidence interval [CI], 38%-45% and 40%; 95% CI, 37%-43%, respectively). Agreement between the tests was high (81.4%; kappa = 0.61; 95% CI, 0.56-0.67). Increasing age and years in the health profession were significant risk factors for both IFN-gamma assay and TST positivity. BCG vaccination had little impact on TST and IFN-gamma assay results. Our study showed high latent tuberculosis infection prevalence in Indian health care workers, high agreement between TST and IFN-gamma assay, and similar association between positive test results and risk factors. Although TST and IFN-gamma assay appear comparable in this population, they have different performance and operational characteristics; therefore, the decision to select one test over the other will depend on the population, purpose of testing, and resource availability.

  4. TH1/TH2 cytokines and soluble CD30 levels in kidney allograft patients with donor bone marrow cell infusion.

    PubMed

    Solgi, G; Amirzagar, A A; Pourmand, G; Mehrsai, A R; Taherimahmoudi, M; Baradaran, N; Nicknam, M H; Ebrahimi Rad, M R; Saraji, A; Asadpoor, A A; Moheiydin, M; Nikbin, B

    2009-09-01

    We investigated the relevance of donor bone marrow cell infusion (DBMI) and serum levels of interferon-gamma (IFN-gamma), interleukin-10 (IL-10), and soluble CD30 (sCD30) in kidney recipients. We analyzed the allograft outcomes correlated with sCD30, IFN-gamma, and IL-10 levels using pre- and posttransplantation sera from 40 live donor renal transplants (20 patients with DBMI [2.1 x 10(9) +/- 1.3 x 10(9) mononuclear cells/body] and 20 controls). Patients with acute rejection episodes (ARE)-3/20 DBMI and 6/20 controls-showed increased sCD30 and IFN-gamma as well as decreased IL-10 posttransplantation compared with nonrejectors. Significant differences were observed for sCD30 and IFN-gamma levels: 59.54 vs 30.92 ng/mL (P = .02) and 11.91 vs 3.01 pg/mL (P = .01), respectively. Comparison of pre- and posttransplant levels of IFN-gamma, IL-10, and sCD30 in ARE patients showed higher levels in posttransplant sera except for IFN-gamma in controls (6.37 vs 11.93; P = .01). Increased IFN-gamma and IL-10 were correlated with rejection (r = .93; P = .008). sCD30 correlated with serum creatinine among ARE patients in control and DBMI groups (r = .89; P = .019; and r = 1.00; P < .0001, respectively). Higher levels of sCD30, IFN-gamma, and IL-10 posttransplantation in rejecting patients provided evidence for coexistence of cellular and humoral responses in ARE. There appeared to be a down-regulatory effect of infusion on alloresponses.

  5. Thyroid epithelial cell hyperplasia in IFN-gamma deficient NOD.H-2h4 mice.

    PubMed

    Yu, Shiguang; Sharp, Gordon C; Braley-Mullen, Helen

    2006-01-01

    The role of inflammatory cells in thyroid epithelial cell (thyrocyte) hyperplasia is unknown. Here, we demonstrate that thyrocyte hyperplasia in IFN-gamma-/- NOD.H-2h4 mice has an autoimmune basis. After chronic exposure to increased dietary iodine, 60% of IFN-gamma-/- mice had severe thyrocyte hyperplasia with minimal or moderate lymphocyte infiltration, and thyroid dysfunction with reduced serum T4. All mice produced anti-thyroglobulin autoantibody. Some wild-type NOD.H-2h4 mice had isolated areas of thyrocyte hyperplasia with predominantly lymphocytic infiltration, whereas IL-4-/- and 50% of wild-type NOD.H-2h4 mice developed lymphocytic thyroiditis but no thyrocyte hyperplasia. Both thyroid infiltrating inflammatory cells and environmental factors (iodine) were required to induce thyrocyte hyperplasia. Splenocytes from IFN-gamma-/- mice with thyrocyte hyperplasia, but not splenocytes from naïve IFN-gamma-/- mice, induced hyperplasia in IFN-gamma-/- NOD.H-2h4.SCID mice. These results may provide clues for understanding the mechanisms underlying development of epithelial cell hyperplasia not only in thyroids but also in other tissues and organs.

  6. LPS induces direct death of IFN-gamma primed murine embryonic hepatocyte, BNL CL2 cells in a TNF-alpha independent manner.

    PubMed

    So, H S; Jung, B H; Yeum, S S; Park, J S; Kim, M S; Lee, J H; Chung, S Y; Choi, S; Chae, H J; Kim, H R; Ko, C B; Chung, H T; Park, R

    2000-11-01

    Although it has been well known that the role of LPS on liver damage is mediated through TNF-alpha, the mechanism by which LPS modulates the cytotoxicity of IFN-gamma on hepatocytes has not yet been clearly demonstrated. Here, we demonstrate that IFN-gamma mediated apoptosis in murine embryonic hepatocyte BNL CL2 cells is potentiated by the addition of LPS (0.5 microg/ml). Consistently, LPS markedly increases the catalytic activity of caspase 3-like protease but not caspase 1-like protease in IFN-gamma treated cells. In addition, TNF-alpha alone does not affect cell viability but rather it potentiates the cytotoxic effect of IFN-gamma on BNL CL2 cells. However, the cell viability of IFN-gamma/LPS treated cells is affected by the addition of polymyxin B but not by TNF binding protein I (TNF-BPI). These data suggest that the lipid moiety of LPS may mediate direct cytotoxicity of BNL CL2 cells in a TNF-alpha independent manner.

  7. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sakaeda, Yoshiichi; Hiroi, Miki; Shimojima, Takahiro

    Sulindac, a non-steroidal anti-inflammatory drug, has been shown to exert an anti-tumor effect on several types of cancer. To determine the effect of sulindac on intracellular signaling pathways in host immune cells such as macrophages, we investigated the effect of the drug on interferon gamma (IFN{gamma})-induced expression of signal transducer and activator of transcription 1 (STAT1) and other genes in mouse macrophage-like cell line RAW264.7 cells. Sulindac, but not aspirin or sodium salicylate, inhibited IFN{gamma}-induced expression of the CXC ligand 9 (CXCL9) mRNA, a chemokine for activated T cells, whereas the interferon-induced expression of CXCL10 or IFN regulatory factor-1 wasmore » not affected by sulindac. Luciferase reporter assay demonstrated that sulindac inhibited IFN{gamma}-induced promoter activity of the CXCL9 gene. Surprisingly, sulindac had no inhibitory effect on IFN{gamma}-induced STAT1 activation; however, constitutive nuclear factor {kappa}B activity was suppressed by the drug. These results indicate that sulindac selectively inhibited IFN{gamma}-inducible gene expression without inhibiting STAT1 activation.« less

  8. Decreased release of histamine and sulfidoleukotrienes by human peripheral blood leukocytes after wasp venom immunotherapy is partially due to induction of IL-10 and IFN-gamma production of T cells.

    PubMed

    Pierkes, M; Bellinghausen, I; Hultsch, T; Metz, G; Knop, J; Saloga, J

    1999-02-01

    Recent studies provide evidence that venom immunotherapy (VIT) alters the pattern of cytokine production by inducing an allergen-specific T-cell shift in cytokine expression from TH2 (IL-4, IL-5) to TH1 (IFN-gamma) cytokines and also inducing the production of IL-10. This study was carried out to analyze whether these changes in cytokine production of T cells already observed 1 week after the initiation of VIT in subjects with wasp venom allergy also influence the reactivity of effector cells, such as mast cells and basophils. All subjects included in this study had a history of severe systemic allergic reactions to wasp stings and positive skin test responses with venom and venom-specific IgE in the sera. Peripheral blood leukocytes were isolated before and after the initiation of VIT (rush therapy reaching a maintenance dose of 100 microg venom injected subcutaneously within 1 week) and preincubated with or without addition of IL-10, IFN-gamma, IL-10 + IFN-gamma, anti-IL-10, or anti-IFN-gamma. After stimulation with wasp venom, histamine and sulfidoleukotriene release were assessed by ELISA and compared with spontaneous release and total histamine content. After the induction of VIT, venom-induced absolute and relative histamine and sulfidoleukotriene release were reduced. This was at least partially due to the induction of IFN-gamma and IL-10 production, because (1) neutralization of IL-10 and IFN-gamma by mAbs partially restored the release after the initiation of VIT and (2) the addition of exogenous IFN-gamma and IL-10 caused a statistically significant diminution of the venom-induced histamine and sulfidoleukotriene release before VIT. Depletion of CD2(+) T cells also restored the releasability after VIT. These data indicate that T cells (producing IL-10 and IFN-gamma after VIT) play a key role for the inhibition of histamine and sulfidoleukotriene release of effector cells.

  9. Interferon-gamma induces apoptosis and augments the expression of Fas and Fas ligand by microglia in vitro.

    PubMed

    Badie, B; Schartner, J; Vorpahl, J; Preston, K

    2000-04-01

    Activation of microglia by interferon-gamma (IFN-gamma) has been implicated in a number of central nervous system (CNS) inflammatory disease processes. Because IFN-gamma has also been shown to play a role in programmed cell death, we investigated its cytotoxicity and its effect on the Fas apoptotic pathway in microglia. Flow cytometry was used to quantify the IFN-gamma-mediated apoptotic response and Fas and Fas ligand (FasL) expression in two well-characterized murine microglia cell lines (BV-2 and N9). Nuclear fragmentation, suggestive of apoptosis, was noted within 24 h of incubation of microglia with IFN-gamma (10 U/ml). After a 72-h incubation, almost every BV-2 and N9 microglia, but not GL261 glioma cells, underwent cell death and detached from the culture plates. This cytotoxicity occurred even at low IFN-gamma concentrations (1 U/ml) and was inhibited by BAF, a pan-caspase inhibitor. Incubation of BV-2 and N9 microglia, but not GL261 glioma cells, with IFN-gamma also potentiated the expression of Fas and FasL in a similar dose-response and time-course manner, as seen for the apoptotic response. Whereas Fas expression increased by 100% in both microglia cells, FasL upregulation was more pronounced and increased by as much as 200% in the N9 cells. These findings suggest that in addition to its role as a microglia activator, IFN-gamma may also induce apoptosis of microglia, possibly through simultaneous upregulation of Fas and FasL. Interferon-gamma modulation of the Fas pathway and apoptosis in microglia may be important in the pathogenesis of inflammatory CNS disease processes. Copyright 2000 Academic Press.

  10. Critical roles of myeloid differentiation factor 88-dependent proinflammatory cytokine release in early phase clearance of Listeria monocytogenes in mice.

    PubMed

    Seki, Ekihiro; Tsutsui, Hiroko; Tsuji, Noriko M; Hayashi, Nobuki; Adachi, Keishi; Nakano, Hiroki; Futatsugi-Yumikura, Shizue; Takeuchi, Osamu; Hoshino, Katsuaki; Akira, Shizuo; Fujimoto, Jiro; Nakanishi, Kenji

    2002-10-01

    Listeria monocytogenes (LM), a facultative intracellular Gram-positive bacterium, often causes lethal infection of the host. In this study we investigated the molecular mechanism underlying LM eradication in the early phase of infection. Upon infection with LM, both IL-12 and IL-18 were produced, and then they synergistically induced IFN-gamma production, leading to normal LM clearance in the host. IFN-gamma knockout (KO) mice were highly susceptible to LM infection. IL-12/IL-18 double knockout mice were also highly susceptible. Their susceptibility was less than that of IFN-gamma KO mice, but more than that of single IL-12 or IL-18 KO mice. Mice deficient in myeloid differentiation factor 88 (MyD88), an essential adaptor molecule used by signal transduction pathways of all members of the Toll-like receptor (TLR) family, showed an inability to produce IL-12 and IFN-gamma following LM infection and were most susceptible to LM. Furthermore, MyD88-deficient, but not IFN-gamma-deficient, Kupffer cells could not produce TNF-alpha in response to LM in vitro, indicating the importance of MyD88-dependent TNF-alpha production for host defense. As TLR2 KO, but not TLR4 KO, mice showed partial impairment in their capacity to produce IL-12, IFN-gamma, and TNF-alpha, TLR2 activation partly contributed to the induction of IL-12-mediated IFN-gamma production. These results indicated a critical role for TLRs/MyD88-dependent IL-12/TNF-alpha production and for IL-12- and IL-18-mediated IFN-gamma production in early phase clearance of LM.

  11. Effect of treatment with interferon-gamma and concanavalin A on the course of infection of mice with Salmonella typhimurium strain LT-2

    NASA Technical Reports Server (NTRS)

    Gould, Cheryl L.; Sonnenfeld, Gerald

    1987-01-01

    The effect of pretreatment of mice with 34 units/day, for five days, of interferon-gamma (IFN-gamma) on the course of infection with LD50 of Salmonella typhimurium strain LT-2 was assessed, using two IFN preparations: (1) a hybridoma supernatant fluid containing concanavalin-A-induced IFN-gamma activity and (2) pure murine IFN-gamma produced by recombinant DNA technology. The hybridoma supernatant-treated Salmonella-infected mice were found to die faster than mice treated only with Salmonella. Pure murine IFN-gamma was found to protect infected mice significantly, with 95 percent of mice surviving LD50 infection. In contrast, the Salmonella-infected mice treated with hybridoma supernatant were found to die faster than the Salmonella-infected untreated controls. Mice treated with concanavalin A alone prior to infection with S. typhimurium died more quickly than the untreated infected controls, suggesting that contamination with concanavalin A had a detrimental effect on mice survival.

  12. Investigation of genes coding for inflammatory components in Parkinson's disease.

    PubMed

    Håkansson, Anna; Westberg, Lars; Nilsson, Staffan; Buervenich, Silvia; Carmine, Andrea; Holmberg, Björn; Sydow, Olof; Olson, Lars; Johnels, Bo; Eriksson, Elias; Nissbrandt, Hans

    2005-05-01

    Several findings obtained recently indicate that inflammation may contribute to the pathogenesis in Parkinson's disease (PD). Genetic variants of genes coding for components involved in immune reactions in the brain might therefore influence the risk of developing PD or the age of disease onset. Five single nucleotide polymorphisms (SNPs) in the genes coding for interferon-gamma (IFN-gamma; T874A in intron 1), interferon-gamma receptor 2 (IFN-gamma R2; Gln64Arg), interleukin-10 (IL-10; G1082A in the promoter region), platelet-activating factor acetylhydrolase (PAF-AH; Val379Ala), and intercellular adhesion molecule 1 (ICAM-1; Lys469Glu) were genotyped, using pyrosequencing, in 265 patients with PD and 308 controls. None of the investigated SNPs was found to be associated with PD; however, the G1082A polymorphism in the IL-10 gene promoter was found to be related to the age of disease onset. Linear regression showed a significantly earlier onset with more A-alleles (P = 0.0095; after Bonferroni correction, P = 0.048), resulting in a 5-year delayed age of onset of the disease for individuals having two G-alleles compared with individuals having two A-alleles. The results indicate that the IL-10 G1082A SNP could possibly be related to the age of onset of PD. Copyright 2005 Movement Disorder Society.

  13. Mitochondria-dependent and -independent mechanisms in tumour necrosis factor-related apoptosis-inducing ligand (TRAIL)-induced apoptosis are both regulated by interferon-gamma in human breast tumour cells.

    PubMed Central

    Ruiz-Ruiz, Carmen; López-Rivas, Abelardo

    2002-01-01

    Tumour necrosis factor-related apoptosis-inducing ligand (TRAIL/APO-2L) induces apoptosis in a variety of tumour cells upon binding to death receptors TRAIL-R1 and TRAIL-R2. Here we describe the sensitization by interferon (IFN)-gamma to TRAIL-induced apoptosis in the breast tumour cell lines MCF-7 and MDA-MB231. IFN-gamma promoted TRAIL-mediated activation of caspase-8, Bcl-2 interacting domain death agonist (Bid) degradation, Bcl-2-associated X protein (Bax) translocation to mitochondria, cytochrome c release to the cytosol and activation of caspase-9 in these cell lines. No changes in the expression of TRAIL receptors were observed upon IFN-gamma treatment. Overexpression of Bcl-2 in MCF-7 cells completely inhibited IFN-gamma-induced sensitization to TRAIL-mediated cell death. Interestingly, TRAIL-induced apoptosis was also clearly enhanced by IFN-gamma in caspase-3-overexpressing MCF-7 cells, in the absence of Bax translocation to mitochondria and cytochrome c release to the cytosol. In summary, our results suggest that IFN-gamma facilitates TRAIL-induced activation of mitochondria-regulated as well as mitochondria-independent apoptotic pathways in breast tumour cells. PMID:11936954

  14. Double-blind trial of recombinant gamma-interferon versus placebo in the treatment of rheumatoid arthritis. 1989.

    PubMed

    Cannon, Grant W; Pincus, Seth H; Emkey, Ronald D; Denes, Alex; Cohen, Selwyn A; Wolfe, Frederick; Saway, P Anthony; Jaffer, Adrian M; Weaver, Arthur L; Cogen, Lewis; Schindler, John D

    2008-02-01

    One hundred five patients were enrolled in a 12-week, randomized, prospective, double-blind, placebo-controlled trial of recombinant human gamma-interferon (rHu gamma-IFN) for the treatment of rheumatoid arthritis. Fifty-four patients received rHu gamma-IFN and 51 received placebo. Forty-two patients in each group completed the 12-week trial. Some clinical improvement occurred in both groups of patients. Although the improvement with rHu gamma-IFN was greater than that with placebo, the differences were generally not statistically significant.

  15. Development of a lion-specific interferon-gamma assay.

    PubMed

    Maas, M; van Kooten, P J S; Schreuder, J; Morar, D; Tijhaar, E; Michel, A L; Rutten, V P M G

    2012-10-15

    The ongoing spread of bovine tuberculosis (BTB) in African free-ranging lion populations, for example in the Kruger National Park, raises the need for diagnostic assays for BTB in lions. These, in addition, would be highly relevant for zoological gardens worldwide that want to determine the BTB status of their lions, e.g. for translocations. The present study concerns the development of a lion-specific IFN-γ assay, following the production and characterization of monoclonal antibodies specific for lion interferon-gamma (IFN-γ). Recombinant lion IFN-γ (rLIFN-γ) was produced in mammalian cells and used to immunize mice to establish hybridoma cell lines producing monoclonal antibodies. These were used to develop a sensitive, lion IFN-γ-specific capture ELISA, able to detect rLIFN-γ to the level of 160 pg/ml. Recognition of native lion IFN-γ was shown in an initial assessment of supernatants of mitogen stimulated whole blood cultures of 11 known BTB-negative lions. In conclusion, the capture ELISA shows potential as a diagnostic assay for bovine tuberculosis in lions. Preliminary results also indicate the possible use of the test for other (feline) species. Copyright © 2012 Elsevier B.V. All rights reserved.

  16. Development of an aptamer beacon for detection of interferon-gamma.

    PubMed

    Tuleuova, Nazgul; Jones, Caroline N; Yan, Jun; Ramanculov, Erlan; Yokobayashi, Yohei; Revzin, Alexander

    2010-03-01

    Traditional antibody-based affinity sensing strategies employ multiple reagents and washing steps and are unsuitable for real-time detection of analyte binding. Aptamers, on the other hand, may be designed to monitor binding events directly, in real-time, without the need for secondary labels. The goal of the present study was to design an aptamer beacon for fluorescence resonance energy transfer (FRET)-based detection of interferon-gamma (IFN-gamma)--an important inflammatory cytokine. Variants of DNA aptamer modified with biotin moieties and spacers were immobilized on avidin-coated surfaces and characterized by surface plasmon resonance (SPR). The SPR studies showed that immobilization of aptamer via the 3' end resulted in the best binding IFN-gamma (K(d) = 3.44 nM). This optimal aptamer variant was then used to construct a beacon by hybridizing fluorophore-labeled aptamer with an antisense oligonucleotide strand carrying a quencher. SPR studies revealed that IFN-gamma binding with an aptamer beacon occurred within 15 min of analyte introduction--suggesting dynamic replacement of the quencher-complementary strand by IFN-gamma molecules. To further highlight biosensing applications, aptamer beacon molecules were immobilized inside microfluidic channels and challenged with varying concentration of analyte. Fluorescence microscopy revealed low fluorescence in the absence of analyte and high fluorescence after introduction of IFN-gamma. Importantly, unlike traditional antibody-based immunoassays, the signal was observed directly upon binding of analyte without the need for multiple washing steps. The surface immobilized aptamer beacon had a linear range from 5 to 100 nM and a lower limit of detection of 5 nM IFN-gamma. In conclusion, we designed a FRET-based aptamer beacon for monitoring of an inflammatory cytokine-IFN-gamma. In the future, this biosensing strategy will be employed to monitor dynamics of cytokine production by the immune cells.

  17. T cell epitope-specific defects in the immune response to cat allergen in patients with atopic dermatitis.

    PubMed

    Carneiro, Raquel; Reefer, Amanda; Wilson, Barbara; Hammer, Juergen; Platts-Mills, Thomas; Custis, Natalie; Woodfolk, Judith

    2004-04-01

    Atopic dermatitis (AD) is often associated with high titer IgE antibodies (ab) to allergens, and IL-10-mediated regulation of IFN-gamma has been proposed to contribute to this IgE ab production. However, the relevance of IL-10 and IFN-gamma to IgE associated with AD has not been examined in the context of an allergen-specific system. Analysis of PBMC responses in vitro showed deficient T cell proliferation to overlapping IL-10- (peptide (P) 2:1) and IFN-gamma- (P2:2) inducing chain 2 major epitopes of cat allergen (Fel d 1) in cultures from sensitized AD patients (mean IgE to cat=20.9 IU/ml). Diminished IFN-gamma induction by Fel d 1 and P2:2, along with elevated peptide-induced IL-10 (except for P2:1) was observed in PBMC cultures from AD subjects compared with non-AD (sensitized and non-sensitized) subjects. Neither T cell proliferation nor IFN-gamma production to chain 2 epitopes could be restored by anti-IL-10 mAb in cultures from sensitized AD subjects. Moreover, allergen avoidance was associated with a paradoxical decrease in both IL-10 and IFN-gamma in peptide-stimulated PBMC from these subjects. Control of IFN-gamma production to chain 2 epitopes by IL-10 may be relevant to sensitization status. Development of high titer IgE ab in AD could reflect a failure of this mechanism.

  18. Coexposure of mice to trovafloxacin and lipopolysaccharide, a model of idiosyncratic hepatotoxicity, results in a unique gene expression profile and interferon gamma-dependent liver injury.

    PubMed

    Shaw, Patrick J; Ditewig, Amy C; Waring, Jeffrey F; Liguori, Michael J; Blomme, Eric A; Ganey, Patricia E; Roth, Robert A

    2009-01-01

    The antibiotic trovafloxacin (TVX) has caused severe idiosyncratic hepatotoxicity in people, whereas levofloxacin (LVX) has not. Mice cotreated with TVX and lipopolysaccharide (LPS), but not with LVX and LPS, develop severe hepatocellular necrosis. Mice were treated with TVX and/or LPS, and hepatic gene expression changes were measured before liver injury using gene array. Hepatic gene expression profiles from mice treated with TVX/LPS clustered differently from those treated with LPS or TVX alone. Several of the probe sets expressed differently in TVX/LPS-treated mice were involved in interferon (IFN) signaling and the janus kinase/signal transducers and activators of transcription (JAK/STAT) pathway. A time course of plasma concentrations of IFN-gamma and interleukin (IL)-18, which directly induces IFN-gamma production, revealed that both cytokines were selectively increased in TVX/LPS-treated mice. Both IL-18(-/-) and IFN-gamma(-/-) mice were significantly protected from TVX/LPS-induced liver injury. In addition, IFN-gamma(-/-) mice had decreased plasma concentrations of tumor necrosis factor-alpha, IL-18, and IL-1beta when compared to wild-type mice. In conclusion, the altered expression of genes involved in IFN signaling in TVX/LPS-treated mice led to the finding that IL-18 and IFN-gamma play a critical role in TVX/LPS-induced liver injury.

  19. Antitumor effect of interleukin (IL)-12 in the absence of endogenous IFN-gamma: a role for intrinsic tumor immunogenicity and IL-15.

    PubMed

    Gri, Giorgia; Chiodoni, Claudia; Gallo, Elena; Stoppacciaro, Antonella; Liew, Foo Y; Colombo, Mario P

    2002-08-01

    IFN-gamma knockout mice (GKO) rejected C26 colon carcinoma cells transduced to secrete interleukin(IL)-12 but do not reject similarly transduced TSA mammary adenocarcinoma (C26/12 and TSA/12 cells, respectively). To determine whether such difference could be because of a different tumor response to IFN-gamma, we injected BALB/c mice with TSA, C26, and their IL-12-transduced counterparts rendered unresponsive to IFN-gamma by stable transduction of a dominant negative (DN), truncated IFN-gamma receptor alpha chain. TSA/DN and C26/DN showed the same in vivo growth kinetics as parental cells, whereas coexpression of IL-12 induced rejection independent of tumor-cell responsiveness to IFN-gamma. This suggests that the role of IFN-gamma is primarily in activating the host immune response, which appears to depend on the intrinsic immunogenicity of the target tumor. C26 and TSA share a common tumor-associated antigen, yet C26 cells are more immunogenic than TSA. C26/12 expressed 10-fold higher levels of class I MHC molecules and induced higher CTL activity compared with TSA/12 cells in GKO mice. Moreover, whereas in GKO mice the TSA/12 tumor was associated with a greater number of infiltrating T cells, only those infiltrating C26/12 tumor expressed the activation marker OX40. The search for cytokine(s) that might contribute in determining the different T-cell response to these IL-12-transduced tumors in GKO mice revealed a role of IL-15. In situ hybridization showed IL-15 expression in C26/12 but not in TSA/12 tumors. In addition, injection of GKO mice with soluble IL-15 receptor-alpha to block IL-15 expression prevented rejection of C26/12 cells. Together, the results suggest that in the absence of IFN-gamma, IL-12 can exert antitumor activity through alternative mechanisms, depending on the tumor cell type and the availability of cytokines that can replace IFN-gamma in sustaining T-cell functions.

  20. Major histocompatibility complex class II molecule expression on muscle cells is regulated by differentiation: implications for the immunopathogenesis of muscle autoimmune diseases.

    PubMed

    Mantegazza, R; Gebbia, M; Mora, M; Barresi, R; Bernasconi, P; Baggi, F; Cornelio, F

    1996-08-01

    Major histocompatibility complex (MHC) class II molecules are expressed on myoblasts after interferon-gamma (IFN-gamma) treatment, suggesting a muscle cell involvement in antigen presentation in inflammatory myopathies. However, they were not observed on normal or pathological myofibers. This discrepancy might be related to different responsiveness of developmentally differentiated muscle cells to IFN-gamma. Myoblasts expressed class II transcripts and proteins after IFN-gamma, while myotubes and innervated contracting muscle cells did not show staining for class II molecules. At all cell stages no loss of IFN-gamma receptor was detected indicating that myofiber maturation blocks their capacity to express MHC class II molecules. This suggests that completely differentiated myofibers cannot participate in class II restricted immunological reactions.

  1. PM-17INTRACEREBRAL IFN-γ DOES NOT ENHANCE THE RESPONSE TO VACCINE IMMUNOTHERAPY FOR CANINE GLIOMA

    PubMed Central

    Pluhar, Liz; Olin, Michael; Goulart, Michelle; Andersen, Brian; Hunt, Matt; Ohlfest, John

    2014-01-01

    Due to the complexity of human tumor environment and host immune interactions, the majority of successful brain cancer therapies in rodent models fail to show the same efficacy when translated to human patients. Pet dogs with spontaneous glioma recapitulate important features of human disease and we have used this more representative model to assess the response to vaccine immunotherapy with and without interferon gamma (IFN-γ) gene therapy after surgery. Dogs with newly diagnosed glioma underwent surgical tumor debulking and were randomized to receive 1) autologous tumor lysate vaccines with CpG ODN as an adjuvant (n = 12) or 2) Ad-mediated interferon gamma (IFN-γ) gene therapy injected around the resection cavity followed by vaccine immunotherapy (n = 12). A grade IV IFN-γ dose-related toxicity (severe encephalitis and lymphocytic perivascular cuffing) resulted in death of one dog. No further adverse events were seen at a lower IFN-γ dose supporting the safety of the treatment. This immunotherapy activated a humoral response with specific tumor-reactive IgG antibodies detected after vaccination in all dogs. Addition of IFN-γ gene therapy did not affect the median overall survival time of 204 days versus 211 days with vaccine alone. As expected, there were significant differences (P = 0.036) in survival between dogs with low-grade (369 days) versus high-grade (204 days) tumors. During postmortem analysis, no dog with a low-grade tumor had recurrence, whereas all dogs with grade III/IV tumors died from progression. We hoped that forced IFN-γ expression would sensitize residual tumor cells to CTL recognition and recruit NK cells to kill MHC Ilow/- cells, thereby enhancing the effects of vaccine immunotherapy. Our data failed to support this theory, however the lack of difference could be due to the small number of dogs in each group (type II error) or to insufficient in situ expression of IFN-γ to elicit the desired effect.

  2. Detection of Mycobacterium bovis infection in African buffaloes (Syncerus caffer) using QuantiFERON®-TB Gold (QFT) tubes and the Qiagen cattletype® IFN-gamma ELISA.

    PubMed

    Bernitz, Netanya; Clarke, Charlene; Roos, Eduard O; Goosen, Wynand J; Cooper, David; van Helden, Paul D; Parsons, Sven D C; Miller, Michele A

    2018-02-01

    African buffaloes (Syncerus caffer) are wildlife maintenance hosts of Mycobacterium bovis, the cause of bovine tuberculosis. Consequently, M. bovis infected buffaloes pose a transmission risk for cattle and other wildlife species. Previously, a modification to the Qiagen QuantiFERON ® -TB Gold (QFT) system, using QFT tubes and an in-house bovine interferon-gamma (IFN-γ) ELISA, was evaluated for the detection of M. bovis infection in buffaloes. Subsequently, Qiagen has developed a commercially available cattletype ® IFN-gamma ELISA for the detection of antigen-specific IFN-γ release in ruminants. The aim of this study was to investigate the use of QFT tubes and the cattletype ® IFN-gamma ELISA, in a cattletype IFN-γ release assay (IGRA), to detect M. bovis infection in African buffaloes. The test agreements between the cattletype IGRA, single comparative intradermal skin test (SCITT) and Bovigam ® 1G IGRA in two M. bovis-exposed buffalo populations (n = 134 and n = 92) were calculated and κ coefficients ranged from 0.65 (95% CI 0.48-0.82) to 0.86 (95% CI 0.72-0.99). Increasing the QFT incubation time in one M. bovis-exposed buffalo cohort (n = 92), from 20 to 40 h, had no effect on the cattletype IGRA test results. Inter-assay and intra-assay reproducibility determination for the cattletype IGRA produced coefficient of variations (CV) <9.1% and <1.7%, respectively. A total of 21/21 known M. bovis-unexposed buffaloes tested negative in the cattletype IGRA. Moreover, the cattletype IGRA test result values were significantly greater for 13 M. bovis culture-positive buffaloes compared with 14 M. bovis-exposed culture-negative (P < .01) and 21 M. bovis-unexposed (P < .001) buffaloes, respectively. These findings suggest that the combination of QFT tubes and the cattletype ® IFN-gamma ELISA is a promising new diagnostic assay for the detection of M. bovis infection in African buffaloes. However, further research is needed to evaluate the sensitivity and specificity of the assay in larger African buffalo populations. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Rhodiola sachalinesis induces the expression of inducible nitric oxide synthase gene by murine fetal hepatocytes (BNL CL.2).

    PubMed

    Pae, H O; Seo, W G; Oh, G S; Kim, N Y; Kim, Y M; Kwon, T O; Shin, M K; Chai, K Y; Chung, H T

    2001-02-01

    We have examined the effect of the aqueous extract of Rhodiola sachalinensis root (RSE), a traditional herbal medicine, on nitric oxide (NO) synthesis in murine fetal hepatocytes (BNL CL.2) by measuring the stable end-product nitrite and the mRNA of inducible NO synthase (iNOS). Interferon-gamma (IFN-gamma) by itself failed to induce NO synthesis in BNL CL.2 cells. RSE also did not elicit NO synthesis at concentrations up to 1,000 microg/ml, but dose- and time-dependently induced NO synthesis in the presence of IFN-gamma in BNL CL.2 cells. Whereas RSE or IFN-gamma failed to induce detectable levels of iNOS mRNA, a combination of RSE and IFN-gamma markedly induced iNOS mRNA in BNL CL.2 cells. Thus, we found that RSE triggered IFN-gamma-primed BNL CL.2 cells to synthesize NO by inducing iNOS gene expression. The capability of RSE to induce NO synthesis might be related to the therapeutic efficacy of RSE on the liver diseases.

  4. Amelioration of skewed Th1/Th2 balance in tumor-bearing and asthma-induced mice by oral administration of Agaricus blazei extracts.

    PubMed

    Takimoto, Hiroaki; Kato, Hanano; Kaneko, Masahiro; Kumazawa, Yoshio

    2008-01-01

    We showed in a previous study that hot-water extracts of Agaricus blazei (Agaricus extracts) had anti-tumor activity to Meth A fibrosarcoma, but it remains unclear whether the Agaricus extracts ameliorate the skewed balance of type-1 T helper (Th1) and type-2 T helper (Th2) cells. We examined whether Agaricus extracts effect the skewed Th1/Th2 balance in tumor-bearing and asthma-induced mice. When Meth A-bearing mice were given orally either Agaricus extracts or water once a day starting 5 days after tumor implantation, spleen T cells, prepared from tumor-bearing mice treated with Agaricus extracts, in response to anti-CD3 monoclonal antibody produced significantly higher levels of interferon gamma (IFN-gamma) than that of controls. The mRNA expression of IFN-gamma-inducing protein 10 and the frequency of CD69(+) or CD49d(+) cells, among activated T cells infiltrated into tumors, significantly increased in Agaricus-treated mice, compared with those of tumor-controls. In asthma-induced mice, treatment with the Agaricus extracts caused significant downregulation of OVA-specific antibody responses of IgG1 and IgE but not of IgG2a, and significantly decreased total cell numbers, levels of interleukin 5, and eosinophil numbers in bronchial alveolar lavage fluids. IFN-gamma production by anti-CD3-stimulated spleen cells, obtained from Agaricus-treated mice, significantly increased. Our results strongly suggest that oral administration of Agaricus extracts ameliorates the Th1/Th2 balance from the Th2-skewed conditions.

  5. Production of interferon-gamma by in vivo tumor-sensitized T cells: Association with active antitumor immunity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bursuker, I.; Pearce, M.T.

    1990-02-01

    The state of active immunity to Meth A fibrosarcoma in mice immunized with an admixture of Meth A cells and Propionibacterium acnes is associated with possession by the host of spleen cells capable of producing interferon-gamma (IFN-gamma) upon in vitro restimulation with irradiated tumor cells. The ability of spleen cells from immunized mice to produce IFN-gamma in response to irradiated Meth A cells decays as active antitumor immunity is replaced by a state of immunological memory. The IFN-producing cells are L3T4+Ly2+, cyclophosphamide-sensitive and radiosensitive T cells, as determined by their sensitivity to corresponding monoclonal antibodies and complement. The induction ofmore » IFN-gamma production by in vivo tumor-sensitized T cells is tumor specific, in that spleen cells from mice immunized against Meth A fibrosarcoma can produce IFN in response to irradiated Meth A cells but not in response to another syngeneic tumor M109 lung carcinoma.« less

  6. IFN-gamma synergizes with LPS to induce nitric oxide biosynthesis through glycogen synthase kinase-3-inhibited IL-10.

    PubMed

    Lin, Chiou-Feng; Tsai, Cheng-Chieh; Huang, Wei-Ching; Wang, Chi-Yun; Tseng, Hsiang-Chi; Wang, Yi; Kai, Jui-In; Wang, Szu-Wen; Cheng, Yi-Lin

    2008-10-15

    Interferon-gamma (IFN-gamma) plays a crucial role in innate immunity and inflammation. It causes the synergistic effect on endotoxin lipopolysaccharide (LPS)-stimulated inducible nitric oxide synthase (iNOS)/NO biosynthesis; however, the mechanism remains unclear. In the present study, we investigated the effects of glycogen synthase kinase-3 (GSK-3)-mediated inhibition of anti-inflammatory interleukin-10 (IL-10). We found, in LPS-stimulated macrophages, that IFN-gamma increased iNOS expression and NO production in a time-dependent manner. In addition, ELISA analysis showed the upregulation of tumor necrosis factor-alpha and regulated on activation, normal T expressed and secreted, and the downregulation of IL-10. RT-PCR further showed changes in the IL-10 mRNA level as well. Treating cells with recombinant IL-10 showed a decrease in IFN-gamma/LPS-induced iNOS/NO biosynthesis, whereas anti-IL-10 neutralizing antibodies enhanced this effect, suggesting that IL-10 acts in an anti-inflammatory role. GSK-3-inhibitor treatment blocked IFN-gamma/LPS-induced iNOS/NO biosynthesis but upregulated IL-10 production. Inhibiting GSK-3 using short-interference RNA showed similar results. Additionally, treating cells with anti-IL-10 neutralizing antibodies blocked these effects. We further showed that inhibiting GSK-3 increased phosphorylation of transcription factor cyclic AMP response element binding protein. Inhibiting protein tyrosine kinase Pyk2, an upstream regulator of GSK-3beta, caused inhibition on IFN-gamma/LPS-induced GSK-3beta phosphorylation at tyrosine 216 and iNOS/NO biosynthesis. Taken together, these findings reveal the involvement of GSK-3-inhibited IL-10 on the induction of iNOS/NO biosynthesis by IFN-gamma synergized with LPS. (c) 2008 Wiley-Liss, Inc.

  7. Effect of pro-inflammatory mediators on membrane-associated mucins expressed by human ocular surface epithelial cells.

    PubMed

    Albertsmeyer, Ann-Christin; Kakkassery, Vinodh; Spurr-Michaud, Sandra; Beeks, Olivia; Gipson, Ilene K

    2010-03-01

    Membrane-associated mucins are altered on the ocular surface in non-Sjögren's dry eye. This study sought to determine if inflammatory mediators, present in tears of dry eye patients, regulate membrane-associated mucins MUC1 and -16 at the level of gene expression, protein biosynthesis and/or ectodomain release. A human corneal limbal epithelial cell line (HCLE), which produces membrane-associated mucins, was used. Cells were treated with interleukin (IL)-6, -8, or -17, tumor necrosis factor-alpha (TNF-alpha), and Interferon-gamma (IFN-gamma), or a combination of TNF-alpha and IFN-gamma, or IFN-gamma and IL-17, for 1, 6, 24, or 48 h. Presence of receptors for these mediators was verified by RT-PCR. Effects of the cytokines on expression levels of MUC1 and -16 were determined by real-time PCR, and on mucin protein biosynthesis and ectodomain release in cell lysates and culture media, respectively, by immunoblot analysis. TNF-alpha and IFN-gamma each significantly induced MUC1 expression, cellular protein content and ectodomain release over time. Combined treatment with the two cytokines was not additive. By comparison, one of the inflammatory mediators, IFN-gamma, affected all three parameters-gene expression, cellular protein, and ectodomain release-for MUC16. Combined treatment with TNF-alpha and IFN-gamma showed effects similar to IFN-gamma alone, except that ectodomain release followed that of TNF-alpha, which induced MUC16 ectodomain release. In conclusion, inflammatory mediators present in tears of dry eye patients can affect MUC1 and -16 on corneal epithelial cells and may be responsible for alterations of surface mucins in dry eye.

  8. Interferon-gamma interferes with transforming growth factor-beta signaling through direct interaction of YB-1 with Smad3.

    PubMed

    Higashi, Kiyoshi; Inagaki, Yutaka; Fujimori, Ko; Nakao, Atsuhito; Kaneko, Hideo; Nakatsuka, Iwao

    2003-10-31

    Transforming growth factor-beta (TGF-beta) and interferon-gamma (IFN-gamma) exert antagonistic effects on collagen synthesis in human dermal fibroblasts. We have recently shown that Y box-binding protein YB-1 mediates the inhibitory effects of IFN-gamma on alpha2(I) procollagen gene (COL1A2) transcription through the IFN-gamma response element located between -161 and -150. Here we report that YB-1 counter-represses TGF-beta-stimulated COL1A2 transcription by interfering with Smad3 bound to the upstream sequence around -265 and subsequently by interrupting the Smad3-p300 interaction. Western blot and immunofluorescence analyses using inhibitors for Janus kinases or casein kinase II suggested that the casein kinase II-dependent signaling pathway mediates IFN-gamma-induced nuclear translocation of YB-1. Down-regulation of endogenous YB-1 expression by double-stranded YB-1-specific RNA abrogated the transcriptional repression of COL1A2 by IFN-gamma in the absence and presence of TGF-beta. In transient transfection assays, overexpression of YB-1 in human dermal fibroblasts exhibited antagonistic actions against TGF-beta and Smad3. Physical interaction between Smad3 and YB-1 was demonstrated by immunoprecipitation-Western blot analyses, and electrophoretic mobility shift assays using the recombinant Smad3 and YB-1 proteins indicated that YB-1 forms a complex with Smad3 bound to the Smad-binding element. Glutathione S-transferase pull-down assays showed that YB-1 binds to the MH1 domain of Smad3, whereas the central and carboxyl-terminal regions of YB-1 were required for its interaction with Smad3. YB-1 also interferes with the Smad3-p300 interaction by its preferential binding to p300. Altogether, the results provide a novel insight into the mechanism by which IFN-gamma/YB-1 counteracts TGF-beta/Smad3. They also indicate that IFN-gamma/YB-1 inhibits COL1A2 transcription by dual actions: via the IFN-gamma response element and through a cross-talk with the TGF-beta/Smad signaling pathway.

  9. Peptide Inhibitors for Viral Infections and as Anti-inflammatory Agents | NCI Technology Transfer Center | TTC

    Cancer.gov

    IFN-gamma and IL-10 are cytokine signaling molecules that play fundamental roles in inflammation, cancer growth and autoimmune diseases.  Unfortunately, there are no specific inhibitors of IFN-gamma or IL-10 on the market to date. The National Cancer Institute seeks parties interested in licensing or collaborative research to co-develop selective IL-10 and IFN-gamma peptide inhibitors.

  10. Chlamydia muridarum evades growth restriction by the IFN-gamma-inducible host resistance factor Irgb10.

    PubMed

    Coers, Jörn; Bernstein-Hanley, Isaac; Grotsky, David; Parvanova, Iana; Howard, Jonathan C; Taylor, Gregory A; Dietrich, William F; Starnbach, Michael N

    2008-05-01

    Chlamydiae are obligate intracellular bacterial pathogens that exhibit a broad range of host tropism. Differences in host tropism between Chlamydia species have been linked to host variations in IFN-gamma-mediated immune responses. In mouse cells, IFN-gamma can effectively restrict growth of the human pathogen Chlamydia trachomatis but fails to control growth of the closely related mouse pathogen Chlamydia muridarum. The ability of mouse cells to resist C. trachomatis replication is largely dependent on the induction of a family of IFN-gamma-inducible GTPases called immunity-related GTPases or IRGs. In this study we demonstrate that C. muridarum can specifically evade IRG-mediated host resistance. It has previously been suggested that C. muridarum inactivates the IRG protein Irga6 (Iigp1) to dampen the murine immune response. However, we show that Irga6 is dispensable for the control of C. trachomatis replication. Instead, an effective IFN-gamma response to C. trachomatis requires the IRG proteins Irgm1 (Lrg47), Irgm3 (Igtp), and Irgb10. Ectopic expression of Irgb10 in the absence of IFN-gamma is sufficient to reduce intracellular growth of C. trachomatis but fails to restrict growth of C. muridarum, indicating that C. muridarum can specifically evade Irgb10-driven host responses. Importantly, we find that Irgb10 protein intimately associates with inclusions harboring C. trachomatis but is absent from inclusions formed by C. muridarum. These data suggest that C. muridarum has evolved a mechanism to escape the murine IFN-gamma response by restricting access of Irgb10 and possibly other IRG proteins to the inclusion.

  11. Immunologic response and memory T cells in subjects cured of tegumentary leishmaniasis.

    PubMed

    Carvalho, Augusto M; Magalhães, Andréa; Carvalho, Lucas P; Bacellar, Olívia; Scott, Phillip; Carvalho, Edgar M

    2013-11-09

    The main clinical forms of tegumentary leishmaniasis are cutaneous leishmaniasis (CL) and mucosal leishmaniasis (ML). L.braziliensis infection is characterized by an exaggerated production of IFN-gamma and TNF-alpha, cytokines involved in parasite destruction, but also in the pathology. Maintenance of an antigen-specific immune response may be important for resistance to re-infection and will contribute for vaccine development. In the present work we investigated the immune response in CL and ML cured individuals. Participants in the present study included 20 CL and 20 ML patients, who were evaluated prior to, as well as 2 to 15 years after therapy. IFN-gamma, IL-2 and TNF-alpha production were determined by ELISA in supernatants of mononuclear cells stimulated with soluble L.braziliensis antigen (SLA). The frequency of memory CD4+ T cell populations was determined by FACS. Here we show that the majority of CL and ML patients did not produce in vitro IFN-gamma in response to SLA after cure. In the cured individuals who responded to SLA, effector memory (CD45RA-CCR7-) CD4+ T cells were the ones producing IFN-gamma. Because a large percent of CL and ML cured patients lost SLA-induced IFN-gamma production in peripheral blood, we performed Leishmania skin test (LST). A positive LST was found in 87.5% and 100% of CL and ML cured individuals, respectively, who did not produce IFN-gamma or IL-2 in vitro. This study shows that in spite of losing in vitro antigen-specific response to Leishmania, cured CL and ML subjects retain the ability to respond to SLA in vivo. These findings indicate that LST, rather than IFN-gamma production, may be a better assessment of lasting immunity to leishmaniasis in human studies, and thus a better tool for assessing immunization after vaccine. Furthermore, in cured individuals which maintains Leishmania-specific IFN-gamma production, effector memory CD4+ T cells were the main source of this cytokine.

  12. Lion (Panthera leo) and cheetah (Acinonyx jubatus) IFN-gamma sequences.

    PubMed

    Maas, Miriam; Van Rhijn, Ildiko; Allsopp, Maria T E P; Rutten, Victor P M G

    2010-04-15

    Cloning and sequencing of the full length lion and cheetah interferon-gamma (IFN-gamma) transcript will enable the expression of the recombinant cytokine, to be used for production of monoclonal antibodies and to set up lion and cheetah-specific IFN-gamma ELISAs. These are relevant in blood-based diagnosis of bovine tuberculosis, an important threat to lions in the Kruger National Park. Alignment of nucleotide and amino acid sequences of lion and cheetah and that of domestic cats showed homologies of 97-100%. Copyright 2009 Elsevier B.V. All rights reserved.

  13. Delayed growth of EL4 lymphoma in SR-A-deficient mice is due to upregulation of nitric oxide and interferon-gamma production by tumor-associated macrophages.

    PubMed

    Komohara, Yoshihiro; Takemura, Kenichi; Lei, Xiao Feng; Sakashita, Naomi; Harada, Mamoru; Suzuki, Hiroshi; Kodama, Tatsuhiko; Takeya, Motohiro

    2009-11-01

    Class A scavenger receptors (SR-A, CD204) are highly expressed in tumor-associated macrophages (TAM). To investigate the function of SR-A in TAM, wild-type and SR-A-deficient (SR-A(-/-)) mice were injected with EL4 cells. Although these groups of mice did not differ in the numbers of infiltrating macrophages and lymphocytes and in neovascularization, SR-A(-/-) mice had delayed growth of EL4 tumors. Expression of inducible nitric oxide (NO) synthase and interferon (IFN)-gamma mRNA increased significantly in tumor tissues from SR-A(-/-) mice. Engulfment of necrotic EL4 cells induced upregulation of NO and IFN-gamma production by cultured macrophages, and production of NO and IFN-gamma increased in SR-A(-/-) macrophages in vitro. IFN-beta production by cultured macrophages was also elevated in SR-A(-/-) macrophages in vitro. These results suggested that the antitumor activity of macrophages increased in SR-A(-/-) mice because of upregulation of NO and IFN-gamma production. These data indicate an important role of SR-A in regulating TAM function by inhibiting toll-like receptor (TLR)4-IFN-beta signaling.

  14. Lipopolysaccharide-induced dopaminergic cell death in rat midbrain slice cultures: role of inducible nitric oxide synthase and protection by indomethacin.

    PubMed

    Shibata, Haruki; Katsuki, Hiroshi; Nishiwaki, Mayumi; Kume, Toshiaki; Kaneko, Shuji; Akaike, Akinori

    2003-09-01

    Glial cell activation associated with inflammatory reaction may contribute to pathogenic processes of neurodegenerative disorders, through production of several cytotoxic molecules. We investigated the consequences of glial activation by interferon-gamma (IFN-gamma)/lipopolysaccharide (LPS) in rat midbrain slice cultures. Application of IFN-gamma followed by LPS caused dopaminergic cell death and accompanying increases in nitrite production and lactate dehydrogenase release. Aminoguanidine, an inhibitor of inducible nitric oxide synthase (iNOS), or SB203580, an inhibitor of p38 mitogen-activated protein kinase, prevented dopaminergic cell loss as well as nitrite production. SB203580 also suppressed expression of iNOS and cyclooxygenase-2 (COX-2) induced by IFN-gamma/LPS. A COX inhibitor indomethacin protected dopaminergic neurons from IFN-gamma/LPS-induced injury, whereas selective COX-2 inhibitors such as NS-398 and nimesulide did not. Notably, indomethacin was able to attenuate neurotoxicity of a nitric oxide (NO) donor. Neutralizing antibodies against tumour necrosis factor-alpha and interleukin-1beta did not inhibit dopaminergic cell death caused by IFN-gamma/LPS, although combined application of these antibodies blocked lactate dehydrogenase release and decrease in the number of non-dopaminergic neurons. These results indicate that iNOS-derived NO plays a crucial role in IFN-gamma/LPS-induced dopaminergic cell death, and that indomethacin exerts protective effect by mechanisms probably related to NO neurotoxicity rather than through COX inhibition.

  15. Pregnancy IFN-gamma responses to foetal alloantigens are altered by maternal allergy and gravidity status.

    PubMed

    Breckler, L A; Hale, J; Taylor, A; Dunstan, J A; Thornton, C A; Prescott, S L

    2008-11-01

    During pregnancy, variations in maternal-foetal cellular interactions may influence immune programming. This study was carried out to determine if maternal responses to foetal alloantigens are altered by maternal allergic disease and/or previous pregnancies. For this cohort study, peripheral blood was collected from allergic (n = 69) and nonallergic (n = 63) pregnant women at 20, 30, 36-week gestation and 6-week postpartum (pp). Cord blood was collected at delivery. Mixed lymphocyte reactions were used to measure maternal cytokine responses [interleukin-6 (IL-6), IL-10, IL-13 and (interferon-gamma) IFN-gamma] at each time point towards foetal mononuclear cells. Maternal cytokine responses during pregnancy (20, 30 and 36 weeks) were suppressed compared to the responses at 6-week pp. The ratio of maternal IFN-gamma/IL-13 and IFN-gamma/IL-10 responses were lower during pregnancy. Allergic mothers had lower IFN-gamma responses at each time-point during pregnancy with the greatest difference in responses observed at 36-week gestation. When allergic and nonallergic women were further stratified by gravidity group, IFN-gamma responses of allergic multigravid mothers were significantly lower than nonallergic multigravid mothers during pregnancy. During normal pregnancy, peripheral T-cell cytokine responses to foetal alloantigens may be altered by both allergic status of the mother and previous pregnancies. These factors could influence the cytokine milieu experienced by the foetus and will be further explored in the development of allergic disease during early life.

  16. Continuous in vivo infusion of interferon-gamma (IFN-gamma) enhances engraftment of syngeneic wild-type cells in Fanca-/- and Fancg-/- mice.

    PubMed

    Si, Yue; Ciccone, Samantha; Yang, Feng-Chun; Yuan, Jin; Zeng, Daisy; Chen, Shi; van de Vrugt, Henri J; Critser, John; Arwert, Fre; Haneline, Laura S; Clapp, D Wade

    2006-12-15

    Fanconi anemia (FA) is a heterogeneous genetic disorder characterized by bone marrow (BM) failure and cancer susceptibility. Identification of the cDNAs of FA complementation types allows the potential of using gene transfer technology to introduce functional cDNAs as transgenes into autologous stem cells and provide a cure for the BM failure in FA patients. However, strategies to enhance the mobilization, transduction, and engraftment of exogenous stem cells are required to optimize efficacy prior to widespread clinical use. Hypersensitivity of Fancc-/- cells to interferon-gamma (IFN-gamma), a nongenotoxic immune-regulatory cytokine, enhances engraftment of syngeneic wild-type (WT) cells in Fancc-/- mice. However, whether this phenotype is of broad relevance in other FA complementation groups is unresolved. Here we show that primitive and mature myeloid progenitors in Fanca-/- and Fancg-/- mice are hypersensitive to IFN-gamma and that in vivo infusion of IFN-gamma at clinically relevant concentrations was sufficient to allow consistent long-term engraftment of isogenic WT repopulating stem cells. Given that FANCA, FANCC, and FANCG complementation groups account for more than 90% of all FA patients, these data provide evidence that IFN-gamma conditioning may be a useful nongenotoxic strategy for myelopreparation in FA patients.

  17. Interleukin-12- and interferon-gamma-mediated natural killer cell activation by Agaricus blazei Murill.

    PubMed

    Yuminamochi, Eri; Koike, Taisuke; Takeda, Kazuyoshi; Horiuchi, Isao; Okumura, Ko

    2007-06-01

    Dried fruiting bodies of Agaricus blazei Murill (A. blazei) and its extracts have generally used as complementary and alternative medicines (CAMs). Here, we report that the oral administration of A. blazei augmented cytotoxicity of natural killer (NK) cells in wild-type (WT) C57BL/6, C3H/HeJ, and BALB/c mice. Augmented cytotoxicity was demonstrated by purified NK cells from treated wild-type (WT) and RAG-2-deficient mice, but not from interferon-gamma (IFN-gamma) deficient mice. NK cell activation and IFN-gamma production was also observed in vitro when dendritic cell (DC)-rich splenocytes of WT mice were coincubation with an extract of A. blazei. Both parameters were largely inhibited by neutralizing anti-interleukin-12 (IL-12) monoclonal antibody (mAb) and completely inhibited when anti-IL-12 mAb and anti-IL-18 mAb were used in combination. An aqueous extract of the hemicellulase-digested compound of A. blazei particle; (ABPC) induced IFN-gamma production more effectively, and this was completely inhibited by anti-IL-12 mAb alone. NK cell cytotoxicty was augmented with the same extracts, again in an IL-12 and IFN-gamma-dependent manner. These results clearly demonstrated that A. blazei and ABPC augmented NK cell activation through IL-12-mediated IFN-gamma production.

  18. Alternative mechanism by which IFN-gamma enhances tumor recognition: active release of heat shock protein 72.

    PubMed

    Bausero, Maria A; Gastpar, Robert; Multhoff, Gabriele; Asea, Alexzander

    2005-09-01

    IFN-gamma exhibits differential effects depending on the target and can induce cellular activation and enhance survival or mediate cell death via activation of apoptotic pathways. In this study, we demonstrate an alternative mechanism by which IFN-gamma enhances tumor recognition, mediated by the active release of Hsp72. We demonstrate that stimulation of 4T1 breast adenocarcinoma cells and K562 erythroleukemic cells with IFN-gamma triggers the cellular stress response, which results in the enhanced expression of total Hsp72 expression without a significant increase in cell death. Intracellular expression of Hsp72 was abrogated in cells stably transfected with a mutant hsf-1 gene. IFN-gamma-induced Hsp72 expression correlated with enhanced surface expression and consequent release of Hsp72 into the culture medium. Pretreatment of tumors with compounds known to the block the classical protein transport pathway, including monensin, brefeldin A, tunicamycin, and thapsigargin, did not significantly block Hsp72 release. However, pretreatment with intracellular calcium chelator BAPTA-AM or disruption of lipid rafts using methyl beta-cyclodextrin completely abrogated IFN-gamma-induced Hsp72 release. Biochemical characterization revealed that Hsp72 is released within exosomes and has the ability to up-regulate CD83 expression and stimulate IL-12 release by naive dendritic cells. Pretreatment with neutralizing mAb or depletion of Hsp72 completely abrogated its chaperokine function. Taken together, these findings are indicative of an additional previously unknown mechanism by which IFN-gamma promotes tumor surveillance and furthers our understanding of the central role of extracellular Hsp72 as an endogenous adjuvant and danger signal.

  19. Extended follow-up of anti-HBe-positive patients with chronic hepatitis B retreated with ribavirin and interferon-alpha.

    PubMed

    Carreño, V; Rico, M A; Pardo, M; Quiroga, J A

    2001-11-01

    In a pilot study of combination therapy with ribavirin and IFN alpha conducted in anti-HBe-positive individuals with chronic hepatitis B, 21% of patients achieved a sustained ALT normalization and clearance of hepatitis B virus (HBV) DNA as measured by PCR. The present work has assessed whether these sustained responses are lasting long-term. In addition, IFN gamma levels were tested serially in serum as a measure of the immune system activation during treatment. By extending the post-treatment follow-up period 2 years the occurrence of delayed HBV DNA relapses was observed. A low serum level of IFN gamma was detected during and after treatment. IFN gamma demonstrated a multiphasic time-course: the amount of IFN gamma increased in parallel with reductions in HBV DNA but also with ALT flare-ups. In conclusion, the extended follow-up study of anti-HBe-positive patients after combined treatment with ribavirin and IFN alpha has shown that sustained responses are lasting in 17% patients but also that a late onset HBV DNA relapse may occur.

  20. Association of TNF-alpha (-308 A/G) and IFN-gamma (+874 A/T) gene polymorphisms in response to spontaneous and treatment induced viral clearance in HCV infected multitransfused thalassemic patients.

    PubMed

    Biswas, Aritra; Gupta, Nabyendu; Gupta, Debanjali; Datta, Abira; Firdaus, Rushna; Chowdhury, Prosanto; Bhattacharyya, Maitreyee; Sadhukhan, Provash C

    2018-06-01

    Multitransfused thalassemic individuals are at high risk of developing transfusion transmitted Hepatitis C virus (HCV) infection. The aim of the study was to correlate the effects of host cytokine single nucleotide polymorphisms of TNF-α (-308 A/G) and IFN-γ (+874 A/T) in spontaneous or IFN induced treatment response in the HCV infected thalassemic individuals. A total of 427 HCV sero-reactive thalassemic individuals were processed for HCV viral genomic diversity and host gene polymorphisms analysis of TNF-α (-308 A/G) and IFN-γ (+874 A/T). Out of 427 HCV sero-reactive individuals, 69.09% were found to be HCV RNA positive with genotype 3 as the predominant infecting strain (94.29%). Study highlighted that, A allele was significantly associated with (p < .05) spontaneous clearance of HCV infection and G allele was correlated with viral persistence at TNF-α (-308) gene polymorphism. Whereas in case of IFN-γ (+874) SNPs, A allele was significantly responsible (p < .05) for spontaneous clearance than T allele. Our study also indicated that in relapsed cases, IFN-γ (+874) T allele is more responsible than A allele. Though no significant correlation was found at both TNF-α (-308) and IFN-γ (+874) gene polymorphism among SVR and relapsed thalassemic patients. A allele at both TNF-α (-308) and IFN-γ (+874) were strongly associated with spontaneous clearance among this population. But in case of SVR and relapsed cases no significant association was found. This cytokine gene polymorphisms pattern will help clinicians to take an informed decision about therapeutic management of HCV infected thalassemic individuals. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Differential effects of LPS, IFN-gamma and TNF alpha on the secretion of lysozyme by individual human mononuclear phagocytes: relationship to cell maturity.

    PubMed Central

    Lewis, C E; McCarthy, S P; Lorenzen, J; McGee, J O

    1990-01-01

    Human mononuclear phagocytes can be activated to perform a variety of complex functions by exposure to the immunomodulators, lipopolysaccharide (LPS), interferon-gamma (IFN-gamma) and tumour necrosis factor alpha (TNF alpha). Although such activation often involves the release of various cytokines by monocytes and macrophages, little is known of the effects of such signals on their secretion of lysozyme (LZM). In this study, a reverse haemolytic plaque assay for LZM secretion is coupled with immunocytochemistry for the pan macrophage (CD68) marker, EBM/11. This enabled the direct effects of LPS, IFN-gamma and TNF alpha on the secretion of LZM by individual, immunoidentified human mononuclear phagocytes to be investigated. The overall secretion of this peptide by populations of freshly isolated or 3-day cultured monocytes was augmented by exposure for 6 hr to bacterial LPS, recombinant human IFN-gamma or recombinant human TNF alpha. Extension of the culture period for monocytes from 3 to 7 days prior to use in the assay resulted in higher levels of LZM secretion, which could be further increased by TNF alpha but not by LPS or IFN-gamma. Individual peritoneal macrophages activated by inflammation in vivo were uniform in their augmented LZM responses to TNF alpha, but a small subpopulation of human peritoneal macrophages, which may represent younger 'inflammatory' exudate macrophages, was seen to be preferentially responsive to the LZM-stimulating effects of LPS and IFN-gamma. These studies suggest that (i) secretion of LZM by human mononuclear phagocytes can be regulated by LPS and IFN-gamma, although the effects of these agents may be dependent upon the state of maturation and/or differentiation of the cells, and (ii) TNF alpha is a potent stimulant of LZM secretion by monocytes and macrophages irrespective of cell maturity. Images Figure 1 Figure 1 PMID:2107146

  2. Renal ischemia-reperfusion injury and adenosine 2A receptor-mediated tissue protection: the role of CD4+ T cells and IFN-gamma.

    PubMed

    Day, Yuan-Ji; Huang, Liping; Ye, Hong; Li, Li; Linden, Joel; Okusa, Mark D

    2006-03-01

    A(2A) adenosine receptor (A(2A)R)-expressing bone marrow (BM)-derived cells contribute to the renal protective effect of A(2A) agonists in renal ischemia-reperfusion injury (IRI). We performed IRI in mice lacking T and B cells to determine whether A(2A)R expressed in CD4+ cells mediate protection from IRI. Rag-1 knockout (KO) mice were protected in comparison to wild-type (WT) mice when subjected to IRI. ATL146e, a selective A(2A) agonist, did not confer additional protection. IFN-gamma is an important early signal in IRI and is thought to contribute to reperfusion injury. Because IFN-gamma is produced by kidney cells and T cells we performed IRI in BM chimeras in which the BM of WT mice was reconstituted with BM from IFN-gamma KO mice (IFN-gamma KO-->WT chimera). We observed marked reduction in IRI in comparison to WT-->WT chimeras providing additional indirect support for the role of T cells. To confirm the role of CD4+ A(2A)R in mediating protection from IRI, Rag-1 KO mice were subjected to ischemia-reperfusion. The protection observed in Rag-1 KO mice was reversed in Rag-1 KO mice that were adoptively transferred WT CD4+ cells (WT CD4+-->Rag-1 KO) or A(2A) KO CD4+ cells (A(2A) KO CD4+-->Rag-1 KO). ATL146e reduced injury in WT CD4+-->Rag-1 KO mice but not in A(2A) KO CD4+-->Rag-1 KO mice. Rag-1 KO mice reconstituted with CD4+ cells derived from IFN-gamma KO mice (IFN-gamma CD4+-->Rag-1 KO) were protected from IRI; ATL146e conferred no additional protection. These studies demonstrate that CD4+ IFN-gamma contributes to IRI and that A(2A) agonists mediate protection from IRI through action on CD4+ cells.

  3. Individual and combined tumoricidal effects of dexamethasone and interferons on human leukocyte cell lines.

    PubMed

    Pan, L Y; Guyre, P M

    1988-02-01

    We investigated the influence of glucocorticoids on two effects of interferons (IFNs) which are thought to relate to their antitumor actions: cytotoxic activity and induction of HLA antigen expression. We treated human myeloid cell lines (U-937, HL-60, THP-1, K-562, and KG-1a), and T-(MOLT-4) and B- (Daudi) lymphoblastic cell lines with concentrations of IFN-alpha, IFN-gamma, and dexamethasone (Dex) which are commonly achieved in the circulation following therapeutic administration. The results show that for every cell line except Daudi, the greatest inhibition of cell growth occurred when IFN-gamma and Dex treatments were combined. The advantage of combined IFN-gamma and Dex treatment over treatment with either agent alone was most dramatic for the three cell lines (U-937, HL-60, and THP-1) which have monocytoid characteristics. There was also more growth inhibition by the combination of IFN-alpha and Dex than by either agent alone for all seven cell lines tested. The induction of HLA antigen expression by IFN-alpha and IFN-gamma, an effect which could increase recognition of the tumor cells by the immune system, was as great or greater in the presence of Dex as in its absence. These results demonstrate that glucocorticoids do not inhibit, and in some cases enhance, two effects of IFNs that appear to be related to their antitumor actions: inhibition of tumor cell proliferation and enhancement of HLA antigen expression.

  4. Effect of priming/booster immunisation protocols on immune response to canine parvovirus peptide induced by vaccination with a chimaeric plant virus construct.

    PubMed

    Nicholas, B L; Brennan, F R; Hamilton, W D O; Wakelin, D

    2003-06-02

    Expression of a 17-mer peptide sequence from canine parvovirus expressed on cowpea mosaic virus (CPMV) to form chimaeric virus particles (CVPs) creates vaccine antigens that elicit strong anti-peptide immune responses in mice. Systemic (subcutaneous, s.c.) immunisation and boosting with such CVP constructs produces IgG(2a) serum antibody responses, while mucosal (intranasal, i.n.) immunisation and boosting elicits intestinal IgA responses. Combinations of systemic and mucosal routes for priming and boosting immunisations were used to examine their influence on the level, type and location of immune response generated to one of these constructs (CVP-1). In all cases, s.c. administration, whether for immunisation or boosting, generated a Th1-biased response, reflected in a predominantly IgG(2a) serum antibody isotype and secretion of IFN-gamma from in vitro-stimulated lymphocytes. Serum antibody responses were greatest in animals primed and boosted subcutaneously, and least in mucosally vaccinated mice. The i.n. exposure also led to IFN-gamma release from in vitro-stimulated cells, but serum IgG(2a) was significantly elevated only in mice primed intranasally and boosted subcutaneously. Peptide- and wild-type CPMV-specific IgA responses in gut lavage fluid were greatest in animals exposed mucosally and least in those primed and boosted subcutaneously or primed subcutaneously and boosted orally. Lymphocytes from immunised mice proliferated in response to in vitro stimulation with CPMV but not with peptide. The predominant secretion of IFN-gamma from all immunising/boosting combinations indicates that the route of vaccination and challenge does not alter the Th1 bias of the response to CVP constructs. However, optimal serum and intestinal antibody responses were achieved by combining s.c. and i.n. administration.

  5. Complementation of a mutant cell line: central role of the 91 kDa polypeptide of ISGF3 in the interferon-alpha and -gamma signal transduction pathways.

    PubMed Central

    Müller, M; Laxton, C; Briscoe, J; Schindler, C; Improta, T; Darnell, J E; Stark, G R; Kerr, I M

    1993-01-01

    Mutants in complementation group U3, completely defective in the response of all genes tested to interferons (IFNs) alpha and gamma, do not express the 91 and 84 kDa polypeptide components of interferon-stimulated gene factor 3 (ISGF3), a transcription factor known to play a primary role in the IFN-alpha response pathway. The 91 and 84 kDa polypeptides are products of a single gene. They result from differential splicing and differ only in a 38 amino acid extension at the C-terminus of the 91 kDa polypeptide. Complementation of U3 mutants with cDNA constructs expressing the 91 kDa product at levels comparable to those observed in induced wild-type cells completely restored the response to both IFN-alpha and -gamma and the ability to form ISGF3. Complementation with the 84 kDa component similarly restored the ability to form ISGF3 and, albeit to a lower level, the IFN-alpha response of all genes tested so far. It failed, however, to restore the IFN-gamma response of any gene analysed. The precise nature of the DNA motifs and combination of factors required for the transcriptional response of all genes inducible by IFN-alpha and -gamma remains to be established. The results presented here, however, emphasize the apparent general requirement of the 91 kDa polypeptide in the primary transcriptional response to both types of IFN. Images PMID:7693454

  6. CCR6 and NK1.1 distinguish between IL-17A and IFN-gamma-producing gammadelta effector T cells.

    PubMed

    Haas, Jan D; González, Frano H Malinarich; Schmitz, Susanne; Chennupati, Vijaykumar; Föhse, Lisa; Kremmer, Elisabeth; Förster, Reinhold; Prinz, Immo

    2009-12-01

    Gammadelta T cells are a potent source of innate IL-17A and IFN-gamma, and they acquire the capacity to produce these cytokines within the thymus. However, the precise stages and required signals that guide this differentiation are unclear. Here we show that the CD24(low) CD44(high) effector gammadelta T cells of the adult thymus are segregated into two lineages by the mutually exclusive expression of CCR6 and NK1.1. Only CCR6+ gammadelta T cells produced IL-17A, while NK1.1+ gammadelta T cells were efficient producers of IFN-gamma but not of IL-17A. Their effector phenotype correlated with loss of CCR9 expression, particularly among the NK1.1+ gammadelta T cells. Accordingly, both gammadelta T-cell subsets were rare in gut-associated lymphoid tissues, but abundant in peripheral lymphoid tissues. There, they provided IL-17A and IFN-gamma in response to TCR-specific and TCR-independent stimuli. IL-12 and IL-18 induced IFN-gamma and IL-23 induced IL-17A production by NK1.1+ or CCR6+ gammadelta T cells, respectively. Importantly, we show that CCR6+ gammadelta T cells are more responsive to TCR stimulation than their NK1.1+ counterparts. In conclusion, our findings support the hypothesis that CCR6+ IL-17A-producing gammadelta T cells derive from less TCR-dependent selection events than IFN-gamma-producing NK1.1+ gammadelta T cells.

  7. Compartmentalized bronchoalveolar IFN-gamma and IL-12 response in human pulmonary tuberculosis.

    PubMed

    Herrera, Maria Teresa; Torres, Martha; Nevels, Denarra; Perez-Redondo, Carlos Núñez; Ellner, Jerrold J; Sada, Eduardo; Schwander, Stephan K

    2009-01-01

    Human tuberculosis (TB) principally involves the lungs, where local immunity impacts on the load of Mycobacterium tuberculosis (M.tb). Because concomitants of local Th1 immunity are still under-explored in humans, we characterized immune responses in bronchoalveolar cells (BACs) and systemically in peripheral blood mononuclear cells (PBMCs) in persons with active pulmonary TB and in healthy community controls. PPD- and live M.tb-induced IFN-gamma-production were observed in CD4(+), CD8(+), gammadeltaTCR(+), and CD56(+) alveolar T cell subpopulations and NK cells (CD3(-)CD56(+)). IFN-gamma-producing CD4(+) T cells (mostly CD45RO(+)) were more abundant (p<0.05). M.tb-induced IL-12p70, but interestingly also IL-4, was increased (p<0.05) in BACs from TB patients. Constitutive expression of IL-12Rbeta1 and IL-12Rbeta2 mRNA in BACs and PBMCs and IFN-gammaR1 in BACs was similar in both study groups. Data were normalized to account for differences in proportions of alveolar T cells and macrophages in the study groups. IFN-gamma-production and its induction by IL-12R engagement occur virtually unimpaired in the bronchoalveolar spaces of patients with pulmonary TB. The reasons for the apparent failure to control M. tuberculosis growth during active pulmonary TB disease is unknown but could be the expression of locally acting immunosuppressive mechanisms that subvert the antimycobacterial effects of IFN-gamma.

  8. Effects of Inteferons on Human B-cell Differentiation in vitro

    PubMed Central

    Kim, Samyong; Stoetter, Hans; Heimpel, Herrman

    1987-01-01

    The effects of interferons (IFN) on in vitro differentiation of B-lymphocytes were studied. Peripheral lymphocytes from normal subjects were cultivated under polyclonal activator pokeweed mitogen (PWN) or Epstein-Barr virus (EBV) stimulation. The secreted Ig in the culture supernatants were measured for IgM by ELISA method. To determine the cellular level of IFN action T-cell enriched fraction (Te) or B-cell enriched fraction (Be) were preincubated with IFN prior to recombination culture. IFN had modulatory activities on Ig production; at low to moderately high doses (10–1000 U/ml of IFN-alpha or 12–120 U/ml of IFN-gamma) stimulating when IFN was added until 48 hr after the start of the culture, while after 72 hr from culture start IFN suppressed Ig production. Preincubation of Be-cells with moderately high doses of IFN (120 U/ml of IFN-gamma or 1000 U/ml of IFN-alpha) prior to PWM-stimulation suppressed Ig production. Likewise, in EBV-stimulated culture, high dose IFN suppressed Ig production. But low dose of IFN enhanced ig production in EBV-stimulated culture. Preincubation of Te-cells with IFN prior to PWM-stimulation with Be-cells enhanced the Ig production. The T-cell subset analysis at the end of these culture showed enhanced ratio of T-helper cell relative to T-suppressor cells, suggesting increased T-helper cell proliferation after incubation with IFN. Thus, it is concluded that IFNs have modulatory activities on B-cell differentiation. The mechanism seems to be direct effects on B-cells (in PWM and EBV system) as well as through T-helper cell mediation (PWM system). The IFN-gamma showed more potent (2-to 6-fold) stimulatory activities than IFN-alpha. PMID:2484953

  9. KIR2DL4 differentially signals downstream functions in human NK cells through distinct structural modules.

    PubMed

    Miah, S M Shahjahan; Hughes, Tracey L; Campbell, Kerry S

    2008-03-01

    KIR2DL4 (2DL4) is a member of the killer cell Ig-like receptor (KIR) family in human NK cells. It can stimulate potent cytokine production and weak cytolytic activity in resting NK cells, but the mechanism for 2DL4-mediated signaling remains unclear. In this study we characterized the signaling pathways stimulated by 2DL4 engagement. In a human NK-like cell line, KHYG-1, cross-linking of 2DL4 activated MAPKs including JNK, ERK, and p38. Furthermore, 2DL4 cross-linking resulted in phosphorylation of IkappaB kinase beta (IKKbeta) and the phosphorylation and degradation of IkappaBalpha, which indicate activation of the classical NF-kappaB pathway. Engagement of 2DL4 was also shown to activate the transcription and translation of a variety of cytokine genes, including TNF-alpha, IFN-gamma, MIP1alpha, MIP1beta, and IL-8. Pharmacological inhibitors of JNK, MEK1/2 and p38, blocked IFN-gamma, IL-8, and MIP1alpha production, suggesting that MAPKs are regulating 2DL4-mediated cytokine production in a nonredundant manner. Activation of both p38 and ERK appear to be upstream of the stimulation of NF-kappaB. Mutation of a transmembrane arginine in 2DL4 to glycine (R/G mutant) abrogated FcepsilonRI-gamma association, as well as receptor-mediated cytolytic activity and calcium responses. Surprisingly, the R/G mutant still activated MAPKs and the NF-kappaB pathway and selectively stimulated the production of MIP1alpha, but not that of IFN-gamma or IL-8. In conclusion, we provide evidence that the activating functions of 2DL4 can be compartmentalized into two distinct structural modules: 1) through transmembrane association with FcepsilonRI-gamma; and 2) through another receptor domain independent of the transmembrane arginine.

  10. An IFNG SNP with an estrogen-like response element selectively enhances promoter expression in peripheral but not lamina propria T cells.

    PubMed

    Gonsky, R; Deem, R L; Bream, J H; Young, H A; Targan, S R

    2006-07-01

    This study examines mucosa-specific regulatory pathways involved in modulation of interferon-gamma (IFN-gamma) in lamina propria T cells. Previous studies identified mucosa-specific CD2 cis-elements within the -204 to -108 bp IFNG promoter. Within this region, a single-site nucleotide polymorphism, -179G/T, imparts tumor necrosis factor-alpha stimulation of IFNG in peripheral blood lymphocytes, and is linked with accelerated AIDS progression. We discovered a putative estrogen response element (ERE) introduced by the -179T, which displays selective activation in peripheral blood mononuclear cells (PBMC) vs lamina propria mononuclear cells (LPMC). Transfection of PBMC with constructs containing the -179G or -179T site revealed CD2-mediated enhancement of the -179T compared to -179G allele, although, in LPMC, a similar level of expression was detected. Electrophoretic mobility shift assay (EMSA) analysis demonstrated CD2-mediated nucleoprotein binding to the -179T but not the -179G in PBMC. In LPMC, binding is constitutive to both -179G and -179T regions. Sequence and EMSA analysis suggests that the -179T allele creates an ERE-like binding site capable of binding recombinant estrogen receptor. Estrogen response element transactivation is enhanced by CD2 signaling, but inhibited by estrogen in PBMC but not in LPMC, although expression of estrogen receptor was similar. This is the first report to describe a potential molecular mechanism responsible for selectively controlling IFN-gamma production in LPMC.

  11. [Plasma levels of interferon gamma and interleukin 10 in patients with lymphonodular toxoplasmosis].

    PubMed

    Bielec, D; Patorska-Mach, E; Semczuk, G; Toruń, E

    1997-01-01

    The concentrations of IFN gamma and IL 10 in plasma of sixteen patients with toxoplasmic lymphadenopathy were measured. These examinations were carried out two times in the interval of a month. We found increased level of IFN gamma and normal concentrations of IL 10 in both of these terms.

  12. Increased Interleukin-4 production by CD8 and gammadelta T cells in health-care workers is associated with the subsequent development of active tuberculosis.

    PubMed

    Ordway, Diane J; Costa, Leonor; Martins, Marta; Silveira, Henrique; Amaral, Leonard; Arroz, Maria J; Ventura, Fernando A; Dockrell, Hazel M

    2004-08-15

    We evaluated immune responses to Mycobacterium tuberculosis in 10 health-care workers (HCWs) and 10 non-HCWs and correlated their immune status with the development of active tuberculosis (TB). Twenty individuals were randomly recruited, tested, and monitored longitudinally for TB presentation. Peripheral blood mononuclear cells (PBMCs) from donors were stimulated with M. tuberculosis and tested for cell proliferation and the production of interferon (IFN)- gamma, interleukin (IL)-5, and IL-4, by use of enzyme-linked immunosorbent or flow-cytometric assays. HCWs had higher levels of cell proliferation (24,258 cpm) and IFN- gamma (6373 pg/mL) to M. tuberculosis than did non-HCWs (cell proliferation, 11,462 cpm; IFN- gamma, 3228 pg/mL). Six of 10 HCWs showed increased median percentages of CD8+IL-4+ (4.7%) and gammadelta +IL-4+ (2.3%) T cells and progressed to active TB. HCWs who remained healthy showed increased median percentages of CD8+IFN- gamma+ (25.0%) and gammadelta +IFN- gamma+ (8.0%) and lower percentages of CD8+IL-4+ (0.05%) and gammadelta +IL-4+ (0.03%) T cells.

  13. Repeated irradiations with gamma-rays at a Dose of 0.5 Gy may exacerbate asthma.

    PubMed

    Fang, Su-ping; Tago, Fumitoshi; Tanaka, Takashi; Simura, Noriko; Muto, Yasuko; Goto, Resuke; Kojima, Shuji

    2005-06-01

    We previously showed that 0.5 Gy whole-body gamma-ray irradiation with a single or small number of repeated exposures inhibits tumor growth in mice, via elevation of the IFN-gamma/IL-4 ratio concomitantly with a decrease in the percentage of B cells. Here we examined whether repeated 0.5 Gy gamma-rays irradiation can improve asthma in an OVA-induced asthmatic mouse model. We found that repeated irradiation (10 times) with 0.5 Gy of gamma-rays significantly increased total IgE in comparison with the disease-control group. The levels of IL-4 and IL-5 were also significantly higher in the gamma-ray-irradiated group, while that of IFN-gamma was significantly lower, resulting in a further decrease of the IFN-gamma/IL-4 ratio from the normal value. These results indicate that the repeated irradiation with gamma-rays may exacerbate asthma, and may have opposite effects on different immune reactions unlike the irradiation with a single or small number of repeated exposures.

  14. Interleukin-17A-Deficient Mice Are Highly Susceptible to Toxoplasma gondii Infection Due to Excessively Induced T. gondii HSP70 and Interferon Gamma Production.

    PubMed

    Moroda, Masataka; Takamoto, Masaya; Iwakura, Yoichiro; Nakayama, Jun; Aosai, Fumie

    2017-12-01

    Interleukin17A (IL-17A) is known to be involved in the host defense against pathogens and the pathogenesis of autoimmune diseases. Previously, we showed that excessive amounts of interferon gamma (IFN-γ) play an important role in the pathogenesis of the lethal effects of Toxoplasma gondii by inducing anaphylactic responses. In the study described in this report, we examined the effects of IL-17A deficiency on murine host defense against oral T. gondii infection. IL-17A-deficient C57BL/6 (B6) mice exhibited higher rates of mortality than wild-type (WT) mice during the acute phase of T. gondii infection. CD4 + T cells in the mesenteric lymph nodes (mLNs) and ileum of T. gondii -infected IL-17A-deficient mice produced higher levels of IFN-γ than did those of WT mice. In addition, the level of T. gondii HSP70 ( T.g HSP70) expression was also significantly increased in the ileum, mLNs, liver, and spleen of infected IL-17A-deficient mice compared with that in WT mice. These elevated levels of expression of T.g HSP70 and IFN-γ in infected IL-17A-deficient mice were presumably linked to the IL-17A defect since they decreased to WT levels after treatment with recombinant IL-17A. Furthermore, IL-17A-deficient mice were highly susceptible to the anaphylactic effect of T.g HSP70, and the survival of IL-17A-deficient mice during the acute phase was improved by treatment with an anti- T.g HSP70 monoclonal antibody. These results suggest that IL-17A plays an important role in host survival against T. gondii infection by protecting the host from an anaphylactic reaction via the downregulation of T.g HSP70 and IFN-γ production. Copyright © 2017 American Society for Microbiology.

  15. Anti-cytokine autoantibodies in autoimmunity: preponderance of neutralizing autoantibodies against interferon-alpha, interferon-omega and interleukin-12 in patients with thymoma and/or myasthenia gravis.

    PubMed

    Meager, A; Wadhwa, M; Dilger, P; Bird, C; Thorpe, R; Newsom-Davis, J; Willcox, N

    2003-04-01

    We have screened for spontaneous anticytokine autoantibodies in patients with infections, neoplasms and autoimmune diseases, because of their increasingly reported co-occurrence. We tested for both binding and neutralizing autoantibodies to a range of human cytokines, including interleukin-1alpha (IL-1alpha), IL-1beta, IL-2, IL-4, IL-6, IL-8, IL-10, IL-12, IL-18, interferon-alpha2 (IFN-alpha2), IFN-omega, IFN-beta, IFN-gamma, tumour necrosis factor alpha (TNF-alpha), transforming growth factor beta-1 (TGF-beta1) and granulocyte-macrophage colony stimulating factor (GM-CSF), in plasmas or sera. With two notable exceptions described below, we found only occasional, mostly low-titre, non-neutralizing antibodies, mainly to GM-CSF; also to IL-10 in pemphigoid. Strikingly, however, high-titre, mainly IgG, autoantibodies to IFN-alpha2, IFN-omega and IL-12 were common at diagnosis in patients with late-onset myasthenia gravis (LOMG+), thymoma (T) but no MG (TMG-) and especially with both thymoma and MG together (TMG+). The antibodies recognized other closely related type I IFN-alpha subtypes, but rarely the distantly related type I IFN-beta, and never (detectably) the unrelated type II IFN-gamma. Antibodies to IL-12 showed a similar distribution to those against IFN-alpha2, although prevalences were slightly lower; correlations between individual titres against each were so modest that they appear to be entirely different specificities. Neither showed any obvious correlations with clinical parameters including thymoma histology and HLA type, but they did increase sharply if the tumours recurred. These antibodies neutralized their respective cytokine in bioassays in vitro; although they persisted for years severe infections were surprisingly uncommon, despite the immunosuppressive therapy also used in most cases. These findings must hold valuable clues to autoimmunizing mechanisms in paraneoplastic autoimmunity.

  16. Experimental reinfection of BALB/c mice with different recombinant type I/III strains of Toxoplasma gondii: involvement of IFN-gamma and IL-10.

    PubMed

    Brandão, Geane Peroni; Melo, Maria Norma; Gazzinelli, Ricardo Tostes; Caetano, Braulia Costa; Ferreira, Adriana Melo; Silva, Letícia Azevedo; Vitor, Ricardo Wagner Almeida

    2009-03-01

    To assess reinfection of BALB/c mice with different Toxoplasma gondii strains, the animals were prime infected with the non-virulent D8 strain and challenged with virulent recombinant strains. Thirty days after challenge, brain cysts were obtained from surviving BALB/c mice and inoculated in Swiss mice to obtain tachyzoites for DNA extraction and PCR-RFLP analysis to distinguish the different T. gondii strains present in possible co-infections. Anti-Toxoplasma immune responses were evaluated in D8-primed BALB/c mice by detecting IFN-gamma and IL-10 produced by T cells and measuring immunoglobulin levels in serum samples. PCR-RFLP demonstrated that BALB/c mice were reinfected with the EGS strain at 45 days post prime infection (dpi) and with the EGS and CH3 strains at 180 dpi. High levels of IFN-gamma were detected after D8 infection, with no significant difference between 45 and 180-day intervals. However, higher IL-10 levels and higher plasmatic IgG1 and IgA were detected from samples obtained 180 days after infection. BALB/c mice were susceptible to reinfection with different recombinant T. gondii strains and this susceptibility correlated with enhancement of IL-10 production.

  17. STING-Dependent Interferon-λ1 Induction in HT29 Cells, a Human Colorectal Cancer Cell Line, After Gamma-Radiation.

    PubMed

    Chen, Jianzhou; Markelc, Bostjan; Kaeppler, Jakob; Ogundipe, Vivian M L; Cao, Yunhong; McKenna, W Gillies; Muschel, Ruth J

    2018-05-01

    To investigate the induction of type III interferons (IFNs) in human cancer cells by gamma-rays. Type III IFN expression in human cancer cell lines after gamma-ray irradiation in vitro was assessed by reverse transcription-quantitative polymerase chain reaction and enzyme-linked immunosorbent assay. Signaling pathways mediating type III IFN induction were examined by a variety of means, including immunoblotting, flow cytometry, confocal imaging, and reverse transcription-quantitative polymerase chain reaction. Key mediators in these pathways were further explored and validated using gene CRISPR knockout or short hairpin RNA knockdown. Exposure to gamma-rays directly induced type III IFNs (mainly IFNL1) in human cancer cell lines in dose- and time-dependent fashions. The induction of IFNL1 was primarily mediated by the cytosolic DNA sensors-STING-TBK1-IRF1 signaling axis, with a lesser contribution from the nuclear factor kappa b signaling in HT29 cells. In addition, type III IFN signaling through its receptors serves as a positive feedback loop, further enhancing IFN expression via up-regulation of the kinases in the STING-TBK1 signaling axis. Our results suggest that IFNL1 can be up-regulated in human cancer cell lines after gamma-ray treatment. In HT29 cells this induction occurs via the STING pathway, adding another layer of complexity to the understanding of radiation-induced antitumor immunity, and may provide novel insights into IFN-based cancer treatment. Copyright © 2018 Elsevier Inc. All rights reserved.

  18. [Effects of interferon-gamma on cytotoxicity of murine activated macrophages against murine glioma cells].

    PubMed

    Ohyama, K; Kikuchi, H; Oda, Y; Moritake, K; Yamasaki, T

    1993-06-01

    We studied the effects of mouse IFN-gamma on the cytotoxic activity of murine activated macrophages (M phi) against mouse VM-Glioma cells (H-2b). Activated M phi were obtained from peritoneal exudate cells of mice from four strains, C57BL/6 (H-2b), C3H/He(H-2k), DBA/2 (H-2d), and BALB/c (H-2d), following intraperitoneal injection of (1) LPS 200 micrograms, (2) BCG 200 micrograms, (3) C. parvum 200 micrograms, or (4) MDP 350 micrograms 7 days prior to 20-hr 51Cr release-assay. Of the various combination of mouse strains and activating agents tested, that of activated M phi of the C3H/He mouse with induction by LPS had the most tumoricidal effect against the glioma cells, which was not MHC restricted. Although LPS-activated M phi underwent marked loss of cytotoxicity following initiation of in vitro culture, this 24 hr pretreatment with IFN-gamma inhibited this reduction in tumoricidal effects in a dose-dependent fashion. On the other hand, 24 hr pretreatment of target cells with IFN-gamma did not increase their susceptibility to lysis by activated M phi. These findings suggest that IFN-gamma augments the in vitro tumoricidal activation of M phi; This effect appears to be unrelated to any influence of IFN-gamma on target sensitivity to lysis by macrophages.

  19. Distinct Th1, Th2 and Treg cytokines balance in chronic periapical granulomas and radicular cysts.

    PubMed

    Teixeira-Salum, Tatiana Beber; Rodrigues, Denise Bertulucci Rocha; Gervásio, Aurélia M; Souza, Cássio J A; Rodrigues, Virmondes; Loyola, Adriano Motta

    2010-03-01

    Periapical lesions are a host response that involves immune reaction to prevent dissemination of bacteria from an infected root canal. The purpose of this study was to evaluate the levels of nitric oxide (NO), IL-4, TGF-beta, tumor necrosis factor-alpha (TNF-alpha), and interferon-gamma (IFN-gamma) in chronic periapical lesions and to determine their possible association with clinical and radiographic parameters. Seventeen human radicular cysts and 30 periapical granulomas were used in this study. Cytokines and NO were assessed by enzyme-linked immunosorbent assay and by the Griess reaction respectively confirmed by immunohistochemical. TNF-alpha and IFN-gamma were detected in 10% of granulomas and in 41.2% and 70% of radicular cysts. IL-4 was reactive in 24% of cysts, and TGF-beta was positive in all samples. Patients with tenderness showed significantly higher levels of IFN-gamma and IL-4 (P < 0.05). Swelling was associated with high levels of TNF-alpha, IFN-gamma, and IL-4 (P < 0.05). Lesions presenting bone resorption were associated with high levels of NO (P < 0.05). Periapical granulomas display a regulatory environment characterized by high TGF-beta and low inflammatory cytokine levels, while radicular cysts has mist Th1 and Th2 inflammatory reaction with the presence of IFN-gamma, TNF-alpha, and IL-4.

  20. Activation of mouse liver natural killer cells and NK1.1(+) T cells by bacterial superantigen-primed Kupffer cells.

    PubMed

    Dobashi, H; Seki, S; Habu, Y; Ohkawa, T; Takeshita, S; Hiraide, H; Sekine, I

    1999-08-01

    Although bacterial superantigens have been well characterized as potent stimulators of T cells, their role in natural killer (NK)-type cells remains largely unknown. In the present study, we examined the effect of bacterial superantigens on mouse liver NK cells and NK1.1 Ag(+) (NK1(+)) T cells. C57BL/6 mice were intravenously injected with staphylococcal enterotoxin B (SEB) or streptococcal pyrogenic exotoxin A (SPE-A), and mononuclear cells (MNC) of various organs were obtained from mice 4 hours after being injected with superantigen. MNC were cultured for 48 hours, and interferon gamma (IFN-gamma) levels of supernatants were measured. The antitumor cytotoxicities of the liver and spleen MNC were also evaluated 24 hours after the mice were injected with superantigen. Liver MNC produced more IFN-gamma than did splenocytes, and peripheral blood and lung MNC did not produce any detectable IFN-gamma. In addition, liver MNC acquired a potent antitumor cytotoxicity by the SEB injection, and both NK cells and NK1(+)T cells but not cluster of differentiation (CD)8(+) T cells were responsible for the cytotoxicity as demonstrated by either in vivo or in vitro cell depletion experiments, and the NK-type cells were partly responsible for the increased serum IFN-gamma. Activation of liver NK-type cells was also supported by the fact that liver NK cells proportionally increased and NK1(+) T cells augmented their CD11a expressions after SEB injection. The pretreatment of mice with anti-IFN-gamma Ab and/or with anti-interleukin-12 (IL-12) Ab diminished the SEB-induced cytotoxicity of liver MNC. Furthermore, the in vivo depletion of Kupffer cells decreased the SEB-induced cytotoxicity of liver MNC. Consistent with these results, liver MNC stimulated with superantigens in the presence of Kupffer cells in vitro produced a greater amount of IFN-gamma than did the liver MNC without Kupffer cells or splenocytes. Our results suggest that bacterial superantigen-primed Kupffer cells produce IL-12 and other monokines, while also nonspecifically activating both NK cells and NK1(+) T cells to produce IFN-gamma.

  1. [Therapeutic effect of double fill nine tastes soup in treating recurrent respiratory infection (RRI) and change of immune function in children].

    PubMed

    Wang, Youcheng; Zhang, Lijuan; Hu, Guohua; Wang, Menghe; Tang, Xiaoyuan; Guo, Hui; Shi, Yimei; Chen, Shufang; Shi, Changchun

    2012-04-01

    To investigate the therapeutic effect of double fill nine tastes soup in treating children recurrent respiratory infection (RRTI) and the change of immune function. 77 RRTI patients were randomly selected into observation and control groups. The observation group was treated with Chinese medicine- double fill nine tastes soup,water frying points 2 times oral. The control was treated with transfer factor oral liquid,every 10 mL,2 times daily oral. Treatment periods were both two months. IgA, IgG, IgM and IL-12, TNF-alpha, INF-gamma were detected before and after treatment to assess the clinical effects and the changes of immune factors, meanwhile, a health group was established. Before treatment, compared with the health group, the serum IgA, IgG, IgM, IgE, IL-12, TNF-alpha, IFN-gamma in both groups were significantly different (P < 0.01). After treatment, the ratio of IgA, IgG, Ig M, IL-12, TNF-alpha, IFN-gamma in two groups were significantly different (P < 0.01). Compared with the recurrence rate and clinical effects, the observation group was better than control, and the differences were significant (P < 0.01). Double fill nine tastes soup has significant effects in treating recurrent respiratory infection (RRI) and enhance the immune function in children.

  2. Perforin and gamma interferon expression are required for CD4+ and CD8+ T-cell-dependent protective immunity against a human parasite, Trypanosoma cruzi, elicited by heterologous plasmid DNA prime-recombinant adenovirus 5 boost vaccination.

    PubMed

    de Alencar, Bruna C G; Persechini, Pedro M; Haolla, Filipe A; de Oliveira, Gabriel; Silverio, Jaline C; Lannes-Vieira, Joseli; Machado, Alexandre V; Gazzinelli, Ricardo T; Bruna-Romero, Oscar; Rodrigues, Mauricio M

    2009-10-01

    A heterologous prime-boost strategy using plasmid DNA, followed by replication-defective recombinant adenovirus 5, is being proposed as a powerful way to elicit CD4(+) and CD8(+) T-cell-mediated protective immunity against intracellular pathogens. We confirmed this concept and furthered existing research by providing evidence that the heterologous prime-boost regimen using the gene encoding amastigote surface protein 2 elicited CD4(+) and CD8(+) T-cell-mediated protective immunity (reduction of acute parasitemia and prolonged survival) against experimental infection with Trypanosoma cruzi. Protective immunity correlated with the presence of in vivo antigen-specific cytotoxic activity prior to challenge. Based on this, our second goal was to determine the outcome of infection after heterologous prime-boost immunization of perforin-deficient mice. These mice were highly susceptible to infection. A detailed analysis of the cell-mediated immune responses in immunized perforin-deficient mice showed an impaired gamma interferon (IFN-gamma) secretion by immune spleen cells upon restimulation in vitro with soluble recombinant antigen. In spite of a normal numeric expansion, specific CD8(+) T cells presented several functional defects detected in vivo (cytotoxicity) and in vitro (simultaneous expression of CD107a/IFN-gamma or IFN-gamma/tumor necrosis factor alpha) paralleled by a decreased expression of CD44 and KLRG-1. Our final goal was to determine the importance of IFN-gamma in the presence of highly cytotoxic T cells. Vaccinated IFN-gamma-deficient mice developed highly cytotoxic cells but failed to develop any protective immunity. Our study thus demonstrated a role for perforin and IFN-gamma in a number of T-cell-mediated effector functions and in the antiparasitic immunity generated by a heterologous plasmid DNA prime-adenovirus boost vaccination strategy.

  3. TNF-alpha -308G>A polymorphism is associated with suicide attempts in major depressive disorder.

    PubMed

    Kim, Yong-Ku; Hong, Jin-Pyo; Hwang, Jung-A; Lee, Heon-Jeong; Yoon, Ho-Kyoung; Lee, Bun-Hee; Jung, Han-Yong; Hahn, Sang-Woo; Na, Kyoung-Sae

    2013-09-05

    Despite the substantial role of the cytokine network in depression and suicide, few studies have investigated the role of genetic polymorphisms of pro- and anti-inflammatory cytokines in suicide in major depressive disorder (MDD). The aim of this study was to investigate whether tumor necrosis factor-alpha (TNF-alpha) -308G>A, interferon-gamma (IFN-gamma) +874A>T, and interleukin-10 (IL-10) -1082A>G are associated with increased risk for suicide attempts in MDD. Among patients with MDD, 204 patients who had attempted suicide and 97 control patients who had not attempted suicide were recruited. A chi-square test was used to identify a possible risk genotype or allele type for suicide. A subsequent multivariate logistic regression analysis was conducted to investigate the influence of a risk genotype or allele type adjusted for other environmental factors. The lethality of the suicide attempt was also tested between genotype and allele types among suicidal patients with MDD. The GG genotype of the TNF-alpha -308G>A polymorphism was found to significantly increase risk for suicide attempt (adjusted OR=2.630, 95% CI=1.206 to 5.734). IFN-gamma +874A>T and IL-10 -1082A>G were not associated with risk for suicide. Lethality of the suicide attempt was not associated with any of the three cytokine genotypes or allele types. Limitations include a relatively small sample size and a cross-sectional design. TNF-alpha -308G>A polymorphism is an independent risk factor for suicide attempts in MDD. Future studies should clarify the neural mechanisms by which the GG genotype of TNF-alpha -308G>A influences suicide in MDD. Copyright © 2013 Elsevier B.V. All rights reserved.

  4. Peroxisome proliferator-activated receptor {alpha} agonists modulate Th1 and Th2 chemokine secretion in normal thyrocytes and Graves' disease

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Antonelli, Alessandro, E-mail: a.antonelli@med.unipi.it; Ferrari, Silvia Martina, E-mail: sm.ferrari@int.med.unipi.it; Frascerra, Silvia, E-mail: lafrasce@gmail.com

    2011-07-01

    Until now, no data are present about the effect of peroxisome proliferator-activated receptor (PPAR){alpha} activation on the prototype Th1 [chemokine (C-X-C motif) ligand (CXCL)10] (CXCL10) and Th2 [chemokine (C-C motif) ligand 2] (CCL2) chemokines secretion in thyroid cells. The role of PPAR{alpha} and PPAR{gamma} activation on CXCL10 and CCL2 secretion was tested in Graves' disease (GD) and control primary thyrocytes stimulated with interferon (IFN){gamma} and tumor necrosis factor (TNF){alpha}. IFN{gamma} stimulated both CXCL10 and CCL2 secretion in primary GD and control thyrocytes. TNF{alpha} alone stimulated CCL2 secretion, while had no effect on CXCL10. The combination of IFN{gamma} and TNF{alpha} hadmore » a synergistic effect both on CXCL10 and CCL2 chemokines in GD thyrocytes at levels comparable to those of controls. PPAR{alpha} activators inhibited the secretion of both chemokines (stimulated with IFN{gamma} and TNF{alpha}) at a level higher (for CXCL10, about 60-72%) than PPAR{gamma} agonists (about 25-35%), which were confirmed to inhibit CXCL10, but not CCL2. Our data show that CCL2 is modulated by IFN{gamma} and TNF{alpha} in GD and normal thyrocytes. Furthermore we first show that PPAR{alpha} activators inhibit the secretion of CXCL10 and CCL2 in thyrocytes, suggesting that PPAR{alpha} may be involved in the modulation of the immune response in the thyroid.« less

  5. Cytokine responses in young and old rhesus monkeys: effect of caloric restriction.

    PubMed

    Mascarucci, Paolo; Taub, Dennis; Saccani, Simona; Paloma, Marjorie A; Dawson, Harry; Roth, George S; Lane, Mark A; Ingram, Donald K

    2002-05-01

    Caloric restriction (CR) is the only known intervention demonstrated to retard a great variety of aging processes, extend median and maximum life-span, and decrease the incidence of age-associated diseases in mammals. Paralleling findings from rodent studies, studies in rhesus monkeys (Macaca mulatta) suggest that CR may retard many age-sensitive parameters in primates. A recent study in rhesus monkeys showed age-related dysregulation of cytokine levels. Specifically, age-related increases in interleukin-10 (IL-10) and IL-6 proteins were observed in supernatants from lipopolysaccharide (LPS)-stimulated peripheral blood mononuclear cells (PBMCs), and interferon-gamma (IFN-gamma) protein exhibited an age-related decrease in phytohemagglutinin (PHA)-stimulated PBMCs. To investigate effects of CR on age-related changes in cytokine production, we obtained PBMCs from control and CR rhesus monkeys aged 6-7 and 22-25 years. We evaluated IL-10 and IL-6 protein and gene expression after exposure to LPS and IFN-gamma protein and gene expression after PHA stimulation. The results revealed significantly higher levels of IFN-gamma protein and gene expression in aged monkeys on CR for 2 years compared with controls. No significant CR effects were observed on IL-10 and IL-6 protein levels. IFN-gamma plays an important role in the initial defense mechanism against viral and microbial disease and cancer. Altered regulation of IFN-gamma in old CR rhesus monkeys may be a key factor in reducing cancer incidence and other age-associated diseases.

  6. Interferon effects on protozoan infections

    NASA Technical Reports Server (NTRS)

    Sonnenfeld, G.; Wirth, J.; Kierszenbaum, F.; Degee, A. L. W.; Mansfield, J. M.

    1985-01-01

    The effects of interferon (IFN) on mice infected with two different parasitic protozoans, Trypanosoma cruzi and Trypanosoma brucei rhodesiense, are investigated experimentally. The preparation of the cell cultures, IFN and assays, antibody, and the experimental procedures are described. It is observed that in cells treated with IFN-gamma there is an increased association of T. cruzi with murine macrophages and an increase in the killing of T. cruzi by IFN-gamma-treated murine macrophages. For spleen cells infected with T.b. rhodesiense in vitro, it is detected that live trypanosomes cannot induce IFN in cells from normal mice, but can in cells from immunized mice; and that trypanosome-lysates induce IFN in vitro in cells from normal mice. The data suggest that there is a two-step mechanism for mice against T. cruzi and T.b. rhodesiense.

  7. The level of PPD-specific IFN-gamma-producing CD4+ T cells in the blood predicts the in vivo response to PPD.

    PubMed

    Martins, Marcia Valéria B S; Lima, Mônica Cristina B S; Duppre, Nadia C; Matos, Haroldo J; Spencer, John S; Brennan, Patrick J; Sarno, Euzenir N; Fonseca, Leila; Pereira, Geraldo M B; Pessolani, Maria Cristina V

    2007-05-01

    There are no reliable means for detecting subclinical mycobacterial infections. The recent sequencing of several mycobacterial genomes has now afforded new opportunities for the development of pathogen-specific diagnostic tests, critical in the context of leprosy and tuberculosis control. In the present study, we applied a multi-parametric flow cytometric analysis that allowed the investigation of T-cell functions in order to define immunological markers that measure previous exposure to mycobacteria. We compared the in vivo response to PPD, the gold standard skin test reagent for measuring previous exposure to Mycobacterium tuberculosis, with in vitro parameters of leukocyte activation in five PPD positive and five PPD negative healthy volunteers. PPD-stimulated peripheral leukocytes expressing CD4, CD69, cutaneous lymphocyte-associated antigen (CLA) and intracellular IFN-gamma were enumerated in whole blood and compared with the size of in vivo PPD-induced induration and IFN-gamma production levels as measured by ELISA in supernatants of PPD-stimulated peripheral blood mononuclear cells. The reactivity to the tuberculin skin test (TST) was associated with markedly increased frequencies of PPD-responsive activated (CD69+) and IFN-gamma-producing CD4+T cells. Detection of PPD-specific IFN-gamma producing leukocytes was restricted to CD4+T cells and a subset of these cells was shown to express the skin homing molecule CLA. Multiple linear regression modeling of responses to PPD showed the highest association between skin test indurations and frequencies of PPD-responsive IFN-gamma-producing CD4+CD69+ T cells. Our data show that the in vitro enumeration of antigen-specific IFN-gamma-producing CD4+ T cells can provide an alternative to the in vivo tuberculin test for the detection of latent Mycobacterium tuberculosis infection. Moreover, the measurement of these immunological parameters can be useful for the screening of new specific antigens defined by the genome sequence allowing selection of the best candidates for new diagnostics (including new skin tests), and vaccines for leprosy and tuberculosis.

  8. Interferon Gamma in African Trypanosome Infections: Friends or Foes?

    PubMed

    Wu, Hui; Liu, Gongguan; Shi, Meiqing

    2017-01-01

    African trypanosomes cause fatal infections in both humans and livestock. Interferon gamma (IFN-γ) plays an essential role in resistance to African trypanosomes. However, increasing evidence suggests that IFN-γ, when excessively synthesized, also induces immunopathology, enhancing susceptibility to the infection. Thus, production of IFN-γ must be tightly regulated during infections with African trypanosomes to ensure that a robust immune response is elicited without tissue destruction. Early studies have shown that secretion of IFN-γ is downregulated by interleukin 10 (IL-10). More recently, IL-27 has been identified as a negative regulator of IFN-γ production during African trypanosome infections. In this review, we discuss the current state of our understanding of the role of IFN-γ in African trypanosome infections. We have focused on the cellular source of IFN-γ, its beneficial and detrimental effects, and mechanisms involved in regulation of its production, highlighting some recent advances and offering some perspectives on future directions.

  9. Comparison of interferon and bovine herpesvirus-1-specific IgA levels in nasal secretions of dairy cattle administered an intranasal modified live viral vaccine prior to calving or on the day of calving.

    PubMed

    Cortese, Victor S; Woolums, Amelia; Hurley, David J; Berghaus, Roy; Bernard, John K; Short, Thomas H

    2017-05-01

    Thirty-two Holstein cows were allocated to receive intranasal vaccination with modified live bovine herpesvirus-1 (BHV-1), bovine respiratory syncytial virus (BRSV) and parainfluenza type 3 virus (PI3V) vaccine either two weeks prior to their projected calving date, or within 24h after calving. Nasal secretions were collected twice at a 12-h interval on the day prior to vaccination (day 0) and at 2, 4, 7, 10 and 14days post vaccination to measure interferon (IFN) alpha, IFN-beta, IFN-gamma, and BHV-1-specific IgA by ELISA. Serum neutralizing antibody titers to BHV-1 and BRSV were measured on days 0, 7, and 14. There was a significant treatment effect (p<0.0004) and interaction (p<0.05) on nasal BHV-1 IgA levels, with higher IgA levels in cows vaccinated within 24h after calving. There was a significant treatment effect on nasal IFN-gamma concentration (p<0.05) and on nasal total IFN concentration (p<0.05), with higher IFN-gamma and total IFN concentrations seen in cows vaccinated within 24h after calving. There was no significant treatment or interaction effect on nasal IFN-alpha or IFN-beta concentrations, or on serum neutralizing titers to BRSV. In spite of prior viral vaccination during the previous lactation, cows vaccinated on the day of calving responded to an intranasal viral vaccination with increased concentrations of IFN-gamma and increased titers of IgA following vaccination which was significantly higher than cows vaccinated precalving. This study is the first to examine respiratory mucosal responses in immunologically mature dairy cattle vaccinated intranasally before and after calving. Copyright © 2017. Published by Elsevier B.V.

  10. Release of nitric oxide during the T cell-independent pathway of macrophage activation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Beckerman, K.P.; Rogers, H.W.; Corbett, J.A.

    1993-02-01

    Immunodeficient mice are remarkably resistant to Listeria monocytogenes (LM) infection. The authors examined the role that nitric oxide (NO) plays in the CB-17/lcr SCID (SCID) response to LM. SCID spleen cells produced large quantities of NO (as measured by nitrite formation) when incubated in the presence of heat-killed LM. NO produced large quantities of nitrite in response to LM, but only in the presence of IFN-[gamma]. The production of NO induced by LM was not affected by neutralizing antibodies to TNF or IL-1. The production of NO was inhibited by addition of either of two inhibitors of NO synthase, N[supmore » G]-monomethyl arginine, or aminoguanidine. In a different situation, NK cells that were stimulated by TNF and Listeria products to release IFN-[gamma] did not produce NO. Macrophages cultured with IFN-[gamma] killed live LM. This increased killing of LM was significantly inhibited by amino-guanidine. In vivo, administration of aminoguanidine resulted in a marked increase in the mortality and spleen bacterial loads of LM-infected SCID or immunocompetent control mice. It is concluded that NO is a critical effector molecule of T cell-independent natural resistence of LM as studied in the SCID mouse, and that the NO-mediated response is essential for both SCID and immunocompetent host to survive after LM infection. 37 refs., 7 figs.« less

  11. Presymptomatic differences in Toll-like receptor function in infants who have allergy.

    PubMed

    Prescott, Susan L; Noakes, Paul; Chow, Bonita W Y; Breckler, Liza; Thornton, Catherine A; Hollams, Elysia M; Ali, May; van den Biggelaar, Anita H J; Tulic, Meri K

    2008-08-01

    Microbial exposure might play a key role in allergy development, but little is known about the role of Toll-like receptors (TLRs). This study explored the association between neonatal TLR microbial recognition/function, allergy risk (maternal allergy), and prospective allergy development. Cord blood mononuclear cells (n = 111) were cultured either alone or with optimal concentrations of TLR ligands: lipoteichoic acid (TLR2), polyinosinicpolycytidylic acid (TLR3), LPS with IFN-gamma (TLR4), flagellin (TLR5), imiquimod R837 (TLR7), or CpG (TLR9). Cytokine responses were assessed in relation to allergy risk (maternal allergy) and allergy outcomes (sensitization, food allergy, and atopic dermatitis) at 12 months of age. Maternal allergy (n = 59) was associated with significantly higher neonatal IL-12 and IFN-gamma responses to TLR2, TLR3, and TLR4 activation, whereas TNF-alpha and IL-6 responses to TLR2, TLR4, and TLR5 activation were significantly higher in newborns who subsequently had allergic disease (n = 32). Notably, consistent with previous reports, newborns who had disease had lower T(H)1 IFN-gamma response to mitogens (PHA). Allergic disease was associated with increased (rather than decreased) perinatal TLR responses. Further studies are needed to determine how these responses track in the postnatal period and whether this relative hyperresponsiveness is a product of intrauterine influences, including maternal atopy, functional genetic polymorphisms, or both.

  12. Initial On-Orbit Radiometric Calibration of the Suomi NPP VIIRS Reflective Solar Bands

    NASA Technical Reports Server (NTRS)

    Lei, Ning; Wang, Zhipeng; Fulbright, Jon; Lee, Shihyan; McIntire, Jeff; Chiang, Vincent; Xiong, Jack

    2012-01-01

    The on-orbit radiometric response calibration of the VISible/Near InfraRed (VISNIR) and the Short-Wave InfraRed (SWIR) bands of the Visible/Infrared Imager/Radiometer Suite (VIIRS) aboard the Suomi National Polar-orbiting Partnership (NPP) satellite is carried out through a Solar Diffuser (SD). The transmittance of the SD screen and the SD's Bidirectional Reflectance Distribution Function (BRDF) are measured before launch and tabulated, allowing the VIIRS sensor aperture spectral radiance to be accurately determined. The radiometric response of a detector is described by a quadratic polynomial of the detector?s digital number (dn). The coefficients were determined before launch. Once on orbit, the coefficients are assumed to change by a common factor: the F-factor. The radiance scattered from the SD allows the determination of the F-factor. In this Proceeding, we describe the methodology and the associated algorithms in the determination of the F-factors and discuss the results.

  13. Cross reactive immune responses in cattle arising from exposure to Mycobacterium bovis and non-tuberculous mycobacteria.

    PubMed

    Jenkins, A O; Gormley, E; Gcebe, N; Fosgate, G T; Conan, A; Aagaard, C; Michel, A L; Rutten, V P M G

    2018-04-01

    Accurate diagnosis of tuberculosis in cattle may be compromised in areas where there are high rates of exposure to environmental/non-tuberculous mycobacteria (NTM). This cross reaction of immune responses to Mycobacterium bovis antigens shared with NTMs can result in reduced specificity of commonly used diagnostic tests including tuberculin skin tests and the interferon gamma assay (IFN-ɣ). In this study we assessed the cross-reactive immune responses of M. bovis (infected) and NTM exposed animals to M. bovis and M. avium tuberculin, the ESAT6/CFP10 cocktail antigen, tuberculin derived from cultures of selected NTMs, and a panel of recombinant mycobacterium tuberculosis complex (MTBC) antigens sharing homology with orthologues in NTM. Gamma interferon (IFN-ɣ) responses were measured in whole blood cultures using the IFN-ɣ assay and the IFN-ɣ elispot assay on purified peripheral blood mononuclear cells (PBMC). We observed the expected strong IFN-ɣ response to PPD-B in the M. bovis infected animals that distinguished this group from non-infected NTM exposed cattle. The IFN-ɣ responses to PPD-N (M. nonchromogenicum), were relatively high in both infected and non-infected NTM exposed cattle, but were not significantly different to classify the true infection status of each group. The results indicated that the cross-reactive responses to PPD-B and/or PPD-A with PPD-N, likely arose from prior exposure to environmental non-tuberculous mycobacteria. The IFN-ɣ immune responses to the 10 R-Mag measured by the IFN-ɣ elispot assay revealed that three of the selected antigens, Rv3615 (ESpC), Rv0287 (esxG) and the ESAT6/CFP10, were immunogenic in the infected cattle, and distinguished the infected cattle from the non-infected NTM exposed animals. The combined data of PPDs and R-Mags derived from NTM mycobacteria may prove useful in future development of novel bTB diagnostic tests. Copyright © 2018 Elsevier B.V. All rights reserved.

  14. Inter-operator variation in ELISPOT analysis of measles virus-specific IFN-gamma-secreting T cells.

    PubMed

    Ryan, J E; Ovsyannikova, I G; Dhiman, N; Pinsky, N A; Vierkant, R A; Jacobson, R M; Poland, G A

    2005-01-01

    The ELISPOT assay is a highly sensitive technique used for the detection of individual cytokine releasing cells. We have developed an IFN-gamma ELISPOT assay utilizing unfractionated frozen peripheral blood mononuclear cells (PBMC) to quantify the frequency of measles virus (MV)-specific IFN-gamma-secreting T cells in 117 healthy children who had been previously immunized with two doses of the measles-mumps-rubella vaccine. We have also estimated the variability associated with the quantification of ELISPOT plates and compared the number of MV-specific IFN-gamma-secreting T cells for each subject as determined by two different operators of an ELISPOT reader. The median frequency of MV-specific IFN-gamma-producing memory T cells detected by this assay was 0.005 % and 0.01 % as determined by an in-house and commercial operator, respectively. Although we found a significant correlation (r = 0.83, p<0.0001) between the number of spots counted by the commercial and in-house operators of an ELISPOT reader, the median number of spots counted by the commercial operator was twice the number of spots counted by an in-house operator (p<0.001). This demonstrates the importance of using a common ELISPOT reader and operator, among other parameters, to quantify the number of spots when a large volume of plates are being scanned and analyzed.

  15. Mice deficient in LRG-47 display enhanced susceptibility to Trypanosoma cruzi infection associated with defective hemopoiesis and intracellular control of parasite growth.

    PubMed

    Santiago, Helton C; Feng, Carl G; Bafica, Andre; Roffe, Ester; Arantes, Rosa M; Cheever, Allen; Taylor, Gregory; Vieira, Leda Q; Vierira, Leda Q; Aliberti, Julio; Gazzinelli, Ricardo T; Sher, Alan

    2005-12-15

    IFN-gamma is known to be required for host control of intracellular Trypanosoma cruzi infection in mice, although the basis of its protective function is poorly understood. LRG-47 is an IFN-inducible p47GTPase that has been shown to regulate host resistance to intracellular pathogens. To investigate the possible role of LRG-47 in IFN-gamma-dependent control of T. cruzi infection, LRG-47 knockout (KO) and wild-type (WT) mice were infected with the Y strain of this parasite, and host responses were analyzed. When assayed on day 12 after parasite inoculation, LRG-47 KO mice, in contrast to IFN-gamma KO mice, controlled early parasitemia almost as effectively as WT animals. However, the infected LRG-47 KO mice displayed a rebound in parasite growth on day 15, and all succumbed to the infection by day 19. Additional analysis indicated that LRG-47-deficient mice exhibit unimpaired proinflammatory responses throughout the infection. Instead, reactivated disease in the KO animals was associated with severe splenic and thymic atrophy, anemia, and thrombocytopenia not observed in their WT counterparts. In addition, in vitro studies revealed that IFN-gamma-stimulated LRG-47 KO macrophages display defective intracellular killing of amastigotes despite normal expression of TNF and NO synthetase type 2 and that both NO synthetase type 2 and LRG-47 are required for optimum IFN-gamma-dependent restriction of parasite growth. Together, these data establish that LRG-47 can influence pathogen control by simultaneously regulating macrophage-microbicidal activity and hemopoietic function.

  16. Immune stimulation by a CpG-containing oligodeoxynucleotide is enhanced when encapsulated and delivered in lipid particles.

    PubMed

    Mui, B; Raney, S G; Semple, S C; Hope, M J

    2001-09-01

    The therapeutic benefit from phosphorothioate oligodeoxynucleotides (PS ODN) containing immune stimulatory sequences (ISS) has been demonstrated in animal models of cancer and infection. In particular, when CpG-containing PS ODN are administered to mice, activation of macrophages and dendritic, NK, T, and B cells occurs, resulting in the release of an array of cytokines, including interleukin-12 (IL-12), interferon-gamma (IFN-gamma), and tumor necrosis factor-alpha (TNF-alpha). We have previously described stabilized antisense-lipid particles (SALP) for the i.v. administration of antisense ODN [Biochim Biophys Acta (2001) 1510:152--166]. Given the propensity for SALP to target macrophages in vivo it was of interest to determine whether they could enhance the potency of CpG ODN to induce an immune response. In this report we show that when CpG-containing SALP are administered intravenously to ICR mice the plasma concentrations of IL-12, IFN-gamma, IL-6, monocyte chemoattractant protein-1, and TNF-alpha are greatly increased compared with the same dose of free ODN. The pattern of cytokine induction indicates that the immune response is T helper cell type 1-biased, similar to that observed for PS CpG ODN ISS in general. Furthermore, when phosphodiester (PO) ODN is substituted for PS ODN in the SALP formulation cytokine induction is even greater at the early time points, in marked contrast to free PO ODN, which is inactive. These results demonstrate that the immunogenicity of ISS is not only enhanced by encapsulation in lipid particles, which more closely mimic the way ISS DNA would normally be presented to antigen presenting cells by pathogens in vivo, but also SALP enable unmodified PO CpG ODN to be used as immune stimulants.

  17. [Effects of recombinant human alpha-2b and gamma interferons on bone marrow megakaryocyte progenitors (CFU-Meg) from patients with chronic myelocytic leukemia].

    PubMed

    Tanabe, Y; Dan, K; Kuriya, S; Nomura, T

    1989-10-01

    The effects of recombinant human interferon (IFN) alpha-2b and gamma on the bone marrow megakaryocyte progenitors (CFU-Meg) were compared between eight patients in the chronic phase of Ph1-positive chronic myelocytic leukemia (CML) and five hematologically normal patients. CFU-Meg was assayed in plasma clot culture added with phytohemagglutinin-stimulated leukocyte-conditioned medium as a source of colony stimulating activity. The average count of CFU-Meg colonies formed from the bone marrow of CML patients was 5.5 times that of normal controls. Spontaneous CFU-Meg colonies were grown in seven of eight CML patients, but in none of five controls. Colony formation by CFU-Meg in CML as well as normal bone marrow was suppressed by the two preparations of IFN in a dose dependent fashion. Their suppressive influence on colonies from CFU-Meg was comparable between CML and normal bone marrow at lower concentrations, but was less marked for CML than normal bone marrow at higher concentrations. The formation of CFU-Meg colonies from CML bone marrow was more severely suppressed by IFN-gamma than IFN-alpha-2b. Depletion of either T lymphocytes or adherent cells from the CML bone marrow cells diminished the suppressive effects of IFN-gamma, but had no influence on the effects of IFN-alpha-2b.

  18. Recombinant Mycobacterium bovis BCG producing IL-18 reduces IL-5 production and bronchoalveolar eosinophilia induced by an allergic reaction.

    PubMed

    Biet, F; Duez, C; Kremer, L; Marquillies, P; Amniai, L; Tonnel, A-B; Locht, C; Pestel, J

    2005-08-01

    Allergic reactions occur through the exacerbated induction of a Th2 cell type expression profile and can be prevented by agents favoring a Th1 profile. Bacillus Calmette-Guérin (BCG) is able to induce high IFN-gamma levels and has been shown to decrease experimentally induced allergy. The induction of IFN-gamma is mediated by interleukin (IL)-12 known to be secreted upon mycobacterial infections and can be enhanced by IL-18 acting in synergy with IL-12. We evaluated the ability of a recombinant BCG strain producing IL-18 (rBCG) to modify the Th2 type responses in a murine model of ovalbumin (OVA)-dependent allergic reaction. Mice were injected intraperitoneally or intranasally with OVA at days 0 and 15 and exposed to an OVA aerosol challenge at days 29, 30, 31 and 34. At days 0 and 15, two additional groups of mice received OVA together with 5 x 10(6) colony forming units of either rBCG or nonrecombinant BCG. A time-course analysis of OVA-specific immunoglobulin (Ig)E, IgG1 and IgG2a levels indicated no significant difference between the three groups of mice. However, following in vitro stimulation with OVA, lymph node cells from rBCG-treated mice produced less IL-5 and more IFN-gamma than those of mice injected with nonrecombinant BCG. In addition, 48 h after the last OVA challenge, a strong reduction of bronchoalveolar eosinophilia was found in the rBCG-injected mice compared to the nontreated or nonrecombinant BCG-treated groups. These results indicate that the production of IL-18 by rBCG may enhance the immunomodulatory properties of BCG that suppress pulmonary Th2 responses and, in particular, decrease airway eosinophilia.

  19. Nontuberculous mycobacterial infection with concurrent IgG4-related lymphadenopathy.

    PubMed

    Liu, Ting-Ting; Weng, Shao-Wen; Wang, Ming-Chung; Huang, Wan-Ting

    2016-03-01

    Disseminated nontuberculous mycobacteria (NTM) infection with concurrent IgG4-related lymphadenopathy has not been reported. We described a patient with neutralizing autoantibodies to interferon-gamma (IFN-γ) and elevated levels of serum IgG4 presenting with generalized lymphadenopathy and reactive dermatosis. Histologically, lymph nodes (LNs) showed effaced nodal architecture with polymorphic infiltrates, mimicking angioimmunoblastic T-cell lymphoma. Both the absolute number and the ratio of IgG4+ plasma cells to IgG+ plasma cells were increased. Mycobacterium abscessus was isolated from cultures of LNs, and demonstrated by polymerase chain reaction-restriction fragment length polymorphism. The skin biopsy showed neutrophilic dermatosis, consistent with Sweet syndrome. The patient met the criteria of both adult-onset immunodeficiency syndrome and IgG4-related lymphadenopathy. This case provides evidence of disseminated NTM infection with concurrent type III IgG4-related lymphadenopathy in the patient with anti-IFN-γ autoantibodies. © 2015 APMIS. Published by John Wiley & Sons Ltd.

  20. Gamma-interferon causes a selective induction of the lysosomal proteases, cathepsins B and L, in macrophages

    NASA Technical Reports Server (NTRS)

    Lah, T. T.; Hawley, M.; Rock, K. L.; Goldberg, A. L.

    1995-01-01

    Previous studies have indicated that acid-optimal cysteine proteinase(s) in the endosomal-lysosomal compartments, cathepsins, play a critical role in the proteolytic processing of endocytosed proteins to generate the antigenic peptides presented to the immune system on major histocompatibility complex (MHC) class II molecules. The presentation of these peptides and the expression of MHC class II molecules by macrophages and lymphocytes are stimulated by gamma-interferon (gamma-IFN). We found that treatment of human U-937 monocytes with gamma-IFN increased the activities and the content of the two major lysosomal cysteine proteinases, cathepsins B and L. Assays of protease activity, enzyme-linked immunosorbant assays (ELISA) and immunoblotting showed that this cytokine increased the amount of cathepsin B 5-fold and cathepsin L 3-fold in the lysosomal fraction. By contrast, the aspartic proteinase, cathepsin D, in this fraction was not significantly altered by gamma-IFN treatment. An induction of cathepsins B and L was also observed in mouse macrophages, but not in HeLa cells. These results suggest coordinate regulation in monocytes of the expression of cathepsins B and L and MHC class II molecules. Presumably, this induction of cysteine proteases contributes to the enhancement of antigen presentation by gamma-IFN.

  1. Assessment of humoral and cellular-mediated immune response in chickens treated with tilmicosin, florfenicol, or enrofloxacin at the time of Newcastle disease vaccination.

    PubMed

    Khalifeh, M S; Amawi, M M; Abu-Basha, E A; Yonis, I Bani

    2009-10-01

    The effect of tilmicosin, florfenicol, or enrofloxacin on humoral and cell-mediated immune response induced by Newcastle disease (ND) vaccination was evaluated in 20-wk-old specific-pathogen-free layer chickens. Humoral immunity was measured by detection of ND virus (NDV) antibody titer and anti-NDV IgG response using the hemagglutination inhibition (HI) test and ELISA, respectively, whereas cell-mediated immunity was evaluated by measurement of chicken interferon gamma (ChIFN-gamma) produced in splenocytes cell culture stimulated with concanavalin A, inactivated NDV antigen, or live attenuated La Sota strain using ELISA. Florfenicol hampered the ND antibody production measured by both HI and ELISA. Tilmicosin and enrofloxacin reduced the production of ND antibody in the first 3 wk after the last ND vaccination measured by HI test, which suggests that these antibiotics exert their effect mainly on the IgM isotype. The ND-vaccinated, but not treated group, showed an increase in ChIFN-gamma production after NDV antigen-specific stimulation above the nonstimulated cell culture, whereas this effect was masked in all the antibiotic-treated groups due to the stronger ChIFN-gamma production background value reported in the nonstimulated cell culture. In conclusion, our results showed, for the first time, that tilmicosin, florfenicol, or enrofloxacin reduced the humoral immune response and had beneficial effects on the cell-mediated immune response. In addition, we demonstrated that the combination of both inactivated and attenuated ND vaccine gave a strong immune response at both the humoral and cellular level.

  2. Factors affecting induction of peripheral IFN-gamma recall response to influenza A virus vaccination in pigs

    USDA-ARS?s Scientific Manuscript database

    While T cell contribution to IAV immunity is appreciated, data comparing methods to evaluate IFN-gamma production by IAV-specific T cells elicited following vaccination is limited. To understand the differential immunogenicity between live-attenuated influenza virus (LAIV) and whole-inactivated viru...

  3. Effects of chicken interferon Gamma on Newcastle disease virus vaccine immunogenicity

    USDA-ARS?s Scientific Manuscript database

    More effective vaccines are needed to control avian diseases. The use of chicken interferon gamma (chIFN') during vaccination is a potentially important but controversial approach that may improve the immune response to antigens. In the present study, three different systems to co-deliver chIFN' wit...

  4. Effector and memory T cell subsets in the response to bovine tuberculosis

    USDA-ARS?s Scientific Manuscript database

    Long-term (i.e., 14 days) cultured IFN-gamma ELISPOT assays of peripheral blood mononuclear cells (PBMC) are used to access T cell central memory (Tcm) responses in both cattle and humans. With bovine tuberculosis, vaccine-elicited long-term IFN-gamma ELISPOT response correlates with protection; how...

  5. Human epidermal langerhans cells express the immunoregulatory enzyme indoleamine 2,3-dioxygenase.

    PubMed

    von Bubnoff, Dagmar; Bausinger, Huguette; Matz, Heike; Koch, Susanne; Häcker, Georg; Takikawa, Osamu; Bieber, Thomas; Hanau, Daniel; de la Salle, Henri

    2004-08-01

    Langerhans cells (LC) are a special subset of dendritic cells integrating cutaneous immunity. The study of LC function is of major interest not only for efforts of vaccine design and immunotherapy but also for gaining an insight into the pathogenesis of immune-mediated cutaneous diseases and neoplasias. Recently, defined antigen-presenting cells were described that express indoleamine 2,3-dioxygenase (IDO) and inhibit T cell proliferation in vitro and in vivo. Here, we show that stimulation with interferon-gamma (IFN-gamma) induces the expression of functionally active IDO in highly purified human epidermal LC. The induction of IDO after stimulation of LC with IFN-gamma seems to follow a defined kinetic with rapid upregulation followed by a downregulation after about 24 h of culture. Accordingly, proliferation of T cells induced by anti-CD3 antibodies was modulated by supernatants of IFN-gamma-activated human epidermal LC. Importantly, downregulation of T cell proliferation by supernatants of 24 h IFN-gamma-activated LC was prevented by inhibition of IDO. These results indicate that LC not only have the capacity to stimulate but also to inhibit T cells, and suggest that LC possess an immunoregulatory function in promoting T cell tolerance by production of IDO.

  6. Granulocyte-macrophage colony-stimulating factor (GM-CSF) regulates cytokine induction by 1,3-beta-D-glucan SCG in DBA/2 mice in vitro.

    PubMed

    Harada, Toshie; Miura, Noriko N; Adachi, Yoshiyuki; Nakajima, Mitsuhiro; Yadomae, Toshiro; Ohno, Naohito

    2004-08-01

    Sparassis crispa Fr. is an edible/medicinal mushroom that recently became cultivable in Japan. SCG is a major 6-branched 1,3-beta-D-glucan in S. crispa showing antitumor activity. We recently found that the splenocytes from naive DBA/1 and DBA/2 mice strongly react with SCG to produce interferon-gamma (IFN-gamma). In this study, cytokines induced by SCG were screened and found to be IFN-gamma, tumor necrosis factor-alpha (TNF-alpha), granulocyte-macrophage colony-stimulating factor (GM-CSF), and interleukin-12 (IL-12p70). The addition of recombinant murine GM-CSF (rMuGM-CSF) to spleen cell cultures from various strains of mice synergistically enhanced IFN-gamma, TNF-alpha and IL-12p70 in the presence of SCG. In contrast, neutralizing GM-CSF using anti-GM-CSF monoclonal antibody (mAb) significantly inhibited IFN-gamma, TNF-alpha, and IL-12p70 elicited by SCG. We conclude that GM-CSF is a key molecule for cytokine induction by beta-glucan, and GM-CSF induction by SCG is the specific step in DBA/2 mice in vitro.

  7. Effect of recombinant human gamma interferon on intracellular activities of antibiotics against Listeria monocytogenes in the human macrophage cell line THP-1.

    PubMed Central

    Scorneaux, B; Ouadrhiri, Y; Anzalone, G; Tulkens, P M

    1996-01-01

    Listeria monocytogenes is a facultative intracellular pathogen which enters cells by endocytosis and reaches phagolysosomes from where it escapes and multiplies in the cytosol of untreated cells. Exposure of macrophages to gamma interferon (IFN-gamma) restricts L. monocytogenes to phagosomes and prevents its intracellular multiplication. We have tested whether IFN-gamma also modulates the susceptibility of L. monocytogenes to antibiotics. We selected drugs from three different classes displaying marked properties concerning their cellular accumulation and subcellular distribution, namely, ampicillin (not accumulated by cells but present in cytosol), azithromycin (largely accumulated by cells but mostly restricted to lysosomes), and sparfloxacin (accumulated to a fair extent but detected only in cytosol). We used a continuous line of myelomonocytic cells (THP-1 macrophages), which display specific surface receptors for IFN-gamma, and examined the activity of these antibiotics against L. monocytogenes Hly+ (virulent variant) and L. monocytogenes Hly- (a nonvirulent variant defective in hemolysin production). Untreated THP-1 and phorbol myristate acetate-differentiated THP-1 were permissive for infection and multiplication of intracellular L. monocytogenes Hly+ (virulent variant). All three antibiotics tested were bactericidal against this Listeria strain when added to an extracellular concentration of 10x their MIC. After preexposure of THP-1 to IFN-gamma, L. monocytogenes Hly+ was still phagocytosed but no longer grew intracellularly. The activity of ampicillin became almost undetectable (antagonistic effect), and that of azithromycin was unchanged (additive effect with that of IFN-gamma), whereas that of sparfloxacin was markedly enhanced (synergy). A similar behavior (lack of bacterial growth, associated with a loss of activity of ampicillin, an enhanced activity of sparfloxacin, and unchanged activity of azithromycin) was observed in cells infected with L. monocytogenes Hly-. This modulation of antibiotic activity, which we ascribe to the change of subcellular localization of L. monocytogenes caused by IFN-gamma or by the lack of virulence factor, could result from a change in bacterial responsiveness to antibiotics, a modification of the drug activity, or differences in drug bioavailabilities between cytosol and phagosomes. PMID:8723471

  8. The effect of co-administration of DNA carrying chicken interferon-gamma gene on protection of chickens against infectious bursal disease by DNA-mediated vaccination.

    PubMed

    Hsieh, Ming Kun; Wu, Ching Ching; Lin, Tsang Long

    2006-11-17

    The purpose of the present study was to determine whether DNA vaccination by co-administration of DNA coding for chicken interferon-gamma (IFN-gamma) gene and DNA encoding for the VP243 gene of IBDV could enhance immune response and protection efficacy of chickens against challenge by IBDV. Plasmids carrying VP243 gene of IBDV strain variant E (VE) (P/VP243/E) and chicken IFN-gamma gene (P/cIFN-gamma) were constructed, respectively. One-day-old chickens were intramuscularly injected with P/VP243/E, or P/cIFN-gamma, or both once, twice, or three times into the thigh muscle of one leg or the thigh muscles of two separate legs at weekly intervals. Chickens were orally challenged with IBDV strain VE at 3 weeks of age and observed for 10 days. Chickens receiving two plasmids in the same site two times had significantly higher (P<0.05) bursal lesion scores and significantly lower (P<0.05) bursa weight/body weight ratios than those that only received P/VP243/E two or three times. Chickens inoculated with two plasmids separately in the thigh muscles of different legs or P/VP243/E two times had 33-50% protection and those receiving two plasmids in the same sites did not have any protection against IBD. The enzyme-linked immunosorbent assay (ELISA) and virus neutralization (VN) titers to IBDV of chickens in the groups with three doses of P/VP243/E were significantly higher (P<0.05) than those in groups receiving two doses of P/VP243/E or P/VP243/E and P/cIFN-gamma. Chickens protected by DNA vaccination did not have detectable IBDV antigen in the bursae as determined by immunofluorescent antibody assay (IFA). The results indicated that co-administration of plasmid encoding chicken IFN-gamma gene with plasmid encoding a large segment gene of the IBDV did not enhance immune response and protection against challenge by IBDV.

  9. Induction of multispecific Th-1 type immune response against HCV in mice by protein immunization using CpG and Montanide ISA 720 as adjuvants.

    PubMed

    Qiu, Qi; Wang, Richard Yuan-Hu; Jiao, Xuanmao; Jin, Bo; Sugauchi, Fuminaka; Grandinetti, Teresa; Alter, Harvey J; Shih, J Wai-Kuo

    2008-10-09

    Recent studies demonstrate that Th1-type immune responses against a broad spectrum of hepatitis C virus (HCV) gene products are crucial to the resolution of acute HCV infection. We investigated new vaccine approaches to augment the strength of HCV-specific Th1-type immune responses. ELISPOT assay revealed that single or multiple protein immunization using both CpG ODN and Montanide ISA 720 as adjuvants induced much stronger IFN-gamma-producing Th1 responses against core, NS3 and NS5b targets than did the formulation without these adjuvants. Protein vaccination using CpG ODN and Montanide ISA 720 as adjuvants also greatly enhanced humoral responses to HCV core, E1/E2 and NS3. When specific IgG isotypes were assayed, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants produced higher titers of IgG2a dominant antibodies than did protein immunization alone, indicating a more Th1-biased pathway. This increase in IgG2a is consistent with the induction of Th1 cells secreting IFN-gamma demonstrated by ELISPOT assay. In conclusion, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants greatly enhanced cellular (Th1 type) as well as humoral immune responses against HCV in Balb/c mice. The use of adjuvants appears critical to the induction of Th1 immune responses during HCV vaccination with recombinant proteins.

  10. Apical effect of diosmectite on damage to the intestinal barrier induced by basal tumour necrosis factor-alpha.

    PubMed Central

    Mahraoui, L; Heyman, M; Plique, O; Droy-Lefaix, M T; Desjeux, J F

    1997-01-01

    BACKGROUND: In many digestive diseases the intestinal barrier is weakened by the release of proinflammatory cytokines, including tumour necrosis factor-alpha (TNF alpha). AIM: To investigate the protective effect of apical diosmectite on the intestinal dysfunction induced by the proinflammatory cytokine TNF alpha. METHODS: Filter grown monolayers of the intestinal cell line HT29-19A were incubated for 48 hours in basal medium containing 10 ng/ml TNF alpha and 5 U/ml interferon-gamma (IFN gamma). Next, 1, 10, or 100 mg/ml diosmectite was placed in the apical medium for one hour. Intestinal function was then assessed in Ussing chambers by measuring ionic conductance (G) and apicobasal fluxes of 14C-mannitol (Jman), and intact horseradish peroxidase. In control intestinal monolayers, diosmectite did not significantly modify G, Jman, or intact horseradish peroxidase. RESULTS: After incubation with TNF alpha and IFN gamma, intestinal function altered, as shown by the increases compared with control values for G (22.8 (3.7) v (9.6 (0.5) mS/cm2), Jman (33.8 (7.5) v 7.56 (0.67) micrograms/h x cm2), and intact horseradish peroxidase (1.95 (1.12) v 0.14 (0.04) micrograms/h x cm2). G and Jman were closely correlated, suggesting that the increase in permeability was paracellular. Treatment with diosmectite restored al the variables to control values. CONCLUSIONS: Basal TNF alpha disrupts the intestinal barrier through the tight junctions, and apical diosmectite counteracts this disruption. PMID:9135522

  11. Pre-immune state induced by chicken interferon gamma inhibits the replication of H1N1 human and H9N2 avian influenza viruses in chicken embryo fibroblasts.

    PubMed

    Yuk, Seong-Su; Lee, Dong-Hun; Park, Jae-Keun; Tseren-Ochir, Erdene-Ochir; Kwon, Jung-Hoon; Noh, Jin-Yong; Lee, Joong-Bok; Park, Seung-Yong; Choi, In-Soo; Song, Chang-Seon

    2016-04-27

    Interferon gamma (IFN-γ), an immunoregulatory cytokine, is known to control many microbial infections. In a previous study, chicken interferon gamma (chIFN-γ) was found to be up-regulated following avian influenza virus (AIV) infection in specific pathogen-free chickens. We aimed to investigate whether the pre-immune state induced by chIFN-γ could generate an antiviral response against influenza virus. We generated a chIFN-γ-expressing plasmid and transfected it into chicken embryo fibroblasts (CEFs) and then infected the cells with human origin H1N1 or avian origin H9N2 influenza viruses. Viral titers of culture medium were evaluated in MDCK cell and the viral RNA and IFN-stimulated genes (ISGs) were then quantified by real-time reverse transcriptase polymerase. To further evaluate the role of the antiviral effect of chIFN-γ by using a backward approach, synthetic small interfering RNAs (siRNA) targeting chIFN-γ were used to suppress chIFN-γ. The chIFN-γ-stimulated CEFs inhibited the replication of viral RNA (vRNA) and showed a mild decrease in the infectious virus load released in the culture medium. Compared to the mock-transfected control, the messenger RNA (mRNA) levels of type I IFNs and IFN-stimulated genes were up-regulated in the cells expressing chIFN-γ. After treatment with the siRNA, we detected a higher expression of viral genes than that observed in the mock-transfected control. Our results suggest that apart from the important role played by chIFN-γ in the antiviral state generated against influenza virus infection, the pre-immune state induced by chIFN-γ can be helpful in mitigating the propagation of influenza virus.

  12. [Theories on the mode of action of desensitization].

    PubMed

    Klimek, L; Reske-Kunz, A B; Saloga, J

    1999-01-01

    Specific immunotherapy (SIT) has been practised successfully for about 80 years. In classic immunotherapy, an allergen-extract is repeatedly injected subcutaneously in increasing doses. A large number of clinically controlled studies have proved the efficacy of this kind of immunotherapy, while its mode of action is not precisely known yet. A successful SIT leads to an impairment of allergic symptoms (symptom score), and a concordant decrease in drug use. Furthermore, a reduced reactivity in specific dermal, nasal and bronchial provocation tests is induced as well as a diminished unspecific reagibility in the affected tissues. Several studies showed reduced values for allergen-specific IgE (serum) that followed an initial increase. A reduced immigration of eosinophils was found, both after provocation with allergen and during the pollen season, as well as diminished values of markers for the activity of eosinophils, e.g. eosinophil cationic protein (ECP). Also, a reduced allergen-induced histamine-liberation from mast cells and basophils has been reported. The underlying mechanism for these effects of SIT might be a reorientation of the allergen-induced lymphokine-production to a dominant TH1-cytokine-profile. Because the relation between the quantity of IL-4 and its regulator IFN-gamma controls the extent of IgE-synthesis by B-cells, the reorientation leads to a diminished production of IgE. IFN-gamma inhibits the differentiation of TH2-cells; by this less TH2-cells are present to help B-cells to produce IgE-antibodies, and to induce the differentiation of mast cells and basophils as well as immigration, differentiation and activation of eosinophils. Thus, the positive effects of SIT can be explained by the reorientation T-cell lymphokine profile. The mechanism under discussion for explaining this reorientation include: 1) an increased differentiation of allergen-specific CD4+ precursor-cells or a reorientation of established TH2-cells to the production of IFN-gamma, 2) the differentiation of IFN-gamma-producing CD8+ T-cells and of T-cells with receptors for T-cell-antigenes of the gamma, delta-type; and 3) the induction of an energy in TH2-cells.

  13. Immunological role of CD4+CD28null T lymphocytes, natural killer cells, and interferon-gamma in pediatric patients with sickle cell disease: relation to disease severity and response to therapy.

    PubMed

    ElAlfy, Mohsen Saleh; Adly, Amira Abdel Moneam; Ebeid, Fatma Soliman ElSayed; Eissa, Deena Samir; Ismail, Eman Abdel Rahman; Mohammed, Yasser Hassan; Ahmed, Manar Elsayed; Saad, Aya Sayed

    2018-06-20

    Sickle cell disease (SCD) is associated with alterations in immune phenotypes. CD4 + CD28 null T lymphocytes have pro-inflammatory functions and are linked to vascular diseases. To assess the percentage of CD4 + CD28 null T lymphocytes, natural killer cells (NK), and IFN-gamma levels, we compared 40 children and adolescents with SCD with 40 healthy controls and evaluated their relation to disease severity and response to therapy. Patients with SCD steady state were studied, focusing on history of frequent vaso-occlusive crisis, hydroxyurea therapy, and IFN-gamma levels. Analysis of CD4 + CD28 null T lymphocytes and NK cells was done by flow cytometry. Liver and cardiac iron overload were assessed. CD4 + CD28 null T lymphocytes, NK cells, and IFN-gamma levels were significantly higher in patients than controls. Patients with history of frequent vaso-occlusive crisis and those with vascular complications had higher percentage of CD4 + CD28 null T lymphocytes and IFN-gamma while levels were significantly lower among hydroxyurea-treated patients. CD4 + CD28 null T lymphocytes were positively correlated to transfusional iron input while these cells and IFN-gamma were negatively correlated to cardiac T2* and duration of hydroxyurea therapy. NK cells were correlated to HbS and indirect bilirubin. Increased expression of CD4 + CD28 null T lymphocytes highlights their role in immune dysfunction and pathophysiology of SCD complications.

  14. Mucosal tolerance to experimental autoimmune myasthenia gravis is associated with down-regulation of AChR-specific IFN-gamma-expressing Th1-like cells and up-regulation of TGF-beta mRNA in mononuclear cells.

    PubMed

    Ma, C G; Zhang, G X; Xiao, B G; Wang, Z Y; Link, J; Olsson, T; Link, H

    1996-02-13

    Oral and nasal administration of nicotinic acetylcholine receptor (AChR) to Lewis rats prior to myasthenogenic immunization with AChR and complete Freund's adjuvant (CFA) resulted in prevention or marked decrease of the severity of experimental autoimmune myasthenia gravis (EAMG) and suppression of AChR-specific B-cell responses and of AChR-reactive T-cell function. To examine the involvement of immunoregulatory cytokines and the underlying mechanisms involved in tolerance induction, in situ hybridization with radiolabeled cDNA oligonucleotide proves was adopted to enumerate mononuclear cells (MNC) expressing mRNA for the proinflammatory cytokine interferon-gamma (IFN-gamma), the B cell-stimulating interleukin-4 (IL-4), and the immunosuppressive transforming growth factor-beta (TGF-beta). Popliteal and inguinal lymph nodes from EAMG rats contained elevated numbers of AChR-reactive IFN-gamma, IL-4, and TGF-beta mRNA-expressing cells, compared to control rats receiving PBS orally or nasally and injected with CFA only. Oral and nasal tolerance was accompanied by decreased numbers of AChR-reactive IFN-gamma and IL-4 mRNA-expressing cells and strong up-regulation of TGF-beta mRNA-positive cells in lymphoid organs when compared to nontolerized EAMG control rats. The results suggest that IFN-gamma and IL-4 are central effector molecules in the development of EAMG and that TGF-beta plays an important role in tolerance induction to EAMG.

  15. Cytokine appearance and effects of anti-tumor necrosis factor alpha antibodies in a neonatal rat model of group B streptococcal infection.

    PubMed Central

    Teti, G; Mancuso, G; Tomasello, F

    1993-01-01

    Cytokines are suspected of playing an important role in the pathophysiology of septic shock. This study was undertaken to determine whether tumor necrosis factor alpha (TNF-alpha) induces the production of other cytokines and mediates mortality in a neonatal rat model of sepsis caused by group B streptococci (GBS). We have measured TNF-alpha, interleukin-1 alpha (IL-1 alpha), interleukin-6 (IL-6), and gamma interferon (IFN-gamma) levels in neonatal rats infected with different strains (H738, 259, and 90) and doses (1 50% lethal dose [LD50] and 5 90% lethal doses [LD90]) of type III GBS. TNF-alpha and IL-6 were detected by the L929 cytotoxicity and the B9 proliferation assays, respectively, in serial plasma samples. IL-1 alpha and IFN-gamma were measured in spleen homogenates by enzyme-linked immunosorbent assay kits by using antibodies raised against the corresponding mouse cytokines. Plasma TNF-alpha levels significantly rose above baseline values within 12 h after intraperitoneal challenge with 5 LD90 of GBS strain H738, corresponding to 3 x 10(3) CFU. A mean peak TNF-alpha concentration of 232 +/- 124 U/ml was reached at 20 h. Peak IL-1 alpha and IL-6 levels of 766 +/- 404 U/g and 1,033 +/- 520 U/ml, respectively, were reached at 24 h after bacterial challenge. Maximal spleen concentrations of IFN-gamma (449 +/- 283 U/g) were measured at 36 h. Concentrations of TNF-alpha, but not other cytokines, remained significantly elevated at 72 h, a time when mortality approached 100%. Significant correlations were found between concentrations of each of the cytokines tested and the logs of CFU concentrations in the blood. In order to ascertain whether TNF-alpha influenced the production of other cytokines, rat pups received two injections of anti-murine TNF-alpha or normal rabbit serum at 2 h before and at 26 h after challenge with live GBS. Plasma TNF-alpha bioactivity was undetectable in anti-TNF-alpha-treated animals, while IL-6 and IFN-gamma, but not IL-1 alpha, levels were significantly reduced, compared with normal serum controls. Rat pups pretreated with anti-TNF-alpha serum and infected with 1 and 5 LD90 of strains H738 and 259 showed enhanced early (48 to 72 h) survival. However, by 96 h this protection was no longer apparent. PMID:8418044

  16. Inflammation activates the interferon signaling pathways in taste bud cells.

    PubMed

    Wang, Hong; Zhou, Minliang; Brand, Joseph; Huang, Liquan

    2007-10-03

    Patients with viral and bacterial infections or other inflammatory illnesses often experience taste dysfunctions. The agents responsible for these taste disorders are thought to be related to infection-induced inflammation, but the mechanisms are not known. As a first step in characterizing the possible role of inflammation in taste disorders, we report here evidence for the presence of interferon (IFN)-mediated signaling pathways in taste bud cells. IFN receptors, particularly the IFN-gamma receptor IFNGR1, are coexpressed with the taste cell-type markers neuronal cell adhesion molecule and alpha-gustducin, suggesting that both the taste receptor cells and synapse-forming cells in the taste bud can be stimulated by IFN. Incubation of taste bud-containing lingual epithelia with recombinant IFN-alpha and IFN-gamma triggered the IFN-mediated signaling cascades, resulting in the phosphorylation of the downstream STAT1 (signal transducer and activator of transcription protein 1) transcription factor. Intraperitoneal injection of lipopolysaccharide or polyinosinic:polycytidylic acid into mice, mimicking bacterial and viral infections, respectively, altered gene expression patterns in taste bud cells. Furthermore, the systemic administration of either IFN-alpha or IFN-gamma significantly increased the number of taste bud cells undergoing programmed cell death. These findings suggest that bacterial and viral infection-induced IFNs can act directly on taste bud cells, affecting their cellular function in taste transduction, and that IFN-induced apoptosis in taste buds may cause abnormal cell turnover and skew the representation of different taste bud cell types, leading to the development of taste disorders. To our knowledge, this is the first study providing direct evidence that inflammation can affect taste buds through cytokine signaling pathways.

  17. Bovine central memory T cells are highly proliferative in response to bovine tuberculosis infection

    USDA-ARS?s Scientific Manuscript database

    Long-term (i.e., 14 days) cultured IFN-gamma responses of peripheral blood mononuclear cells are used as a correlate of T cell central memory (Tcm) responses in both humans and cattle. With bovine tuberculosis, vaccine-elicited long-term IFN-gamma ELISPOT assays are a correlate of protection. Recent...

  18. Bovine central memory T cells are highly proliferative in response to bovine tuberculosis infection

    USDA-ARS?s Scientific Manuscript database

    Long-term (i.e., 14 days) cultured IFN-gamma ELISPOT assays measure central memory T cell (Tcm) responses in both humans and cattle. With bovine tuberculosis, vaccine-elicited long-term IFN-gamma ELISPOT responses correlate with protection. In other species, Tcm’s pose low activation threshold and a...

  19. Characterization of effector and memory T cell subsets in the immune response to bovine tuberculosis in cattle

    USDA-ARS?s Scientific Manuscript database

    Vaccine-elicited long-term cultured IFN-gamma ELISPOT responses correlate with protection against bovine tuberculosis in cattle. With humans, cultured IFN-gamma ELISPOT assays are primarily a measure of central memory T cell (Tcm) responses; however, this important subset of lymphocytes is poorly ch...

  20. THE EFFICACY OF THREE MEDICINAL PLANTS: GARLIC, GINGER AND MIRAZID AND A CHEMICAL DRUG METRONIDAZOLE AGAINST CRYPTOSPORIDIUM PARVUM. I-IMMUNOLOGICAL RESPONSE.

    PubMed

    Abouel-Nour, Mohamed F; EL-Shewehy, Dina Magdy M; Hamada, Shadia F; Morsy, Tosson A

    2015-12-01

    Cryptosporidisis parvum is a zoonotic protozoan parasite infects intestinal epithelial cells causing a major health problem for man and animals. Experimentally the immunologic mediated elimination of C. parvum requires CD4+ T cells and IFN-gamma. But, the innate immune responses also have a significant protective role in both man and animals. the mucosal immune response to C. parvum in C57BL/6 neonatal and GKO mice shows a concomitant Thl and Th2 cytokine mRNA expression, with a crucial role for IFN-gamma in the resolution of the infection. NK cells and IFN-gamma have been shown to be important components in immunity in T and B cell-deficient mice, but IFN-gamma-dependent resistance is demonstrated in alymphocytic mice. Epithelial cells may play a vital role in immunity as once infected these cells have increased expression of inflammatory chemokines and cytokines and demonstrate anti-infection killing mechanisms. C. parvum immunological response was used to evaluate the efficacy of anti-cryptosporidisis agents of Garlic, Ginger, Mirazid and Metronidazole in experimentally infected mice.

  1. Breast milk cytokine and IgA composition differ in Estonian and Swedish mothers-relationship to microbial pressure and infant allergy.

    PubMed

    Tomicić, Sara; Johansson, Git; Voor, Tiia; Björkstén, Bengt; Böttcher, Malin Fagerås; Jenmalm, Maria C

    2010-10-01

    The immune system of the neonate is influenced by maternal immunity during pregnancy and lactation. An altered microbial exposure, possibly underlying the increase of allergic diseases in affluent societies, may affect maternal breast milk immune composition. Secretory IgA (SIgA), IL-4, IL-10, IL-13, IFN-[gamma], TGF-[beta]1, and TGF-[beta]2 were analyzed with ELISA in colostrum and 1-mo mature milk from mothers from Estonia (n = 39) and Sweden (n = 60), the two geographically adjacent countries with different living conditions and allergy incidence. The IL-10 and IFN-[gamma] levels were higher in colostrum from Estonian than Swedish mothers, whereas the opposite was true for TGF-[beta]2. In mature milk, higher SIgA and IFN-[gamma] levels but lower TGF-[beta]1 and TGF-[beta]2 levels were observed in Estonian than Swedish mothers. Interestingly, in Sweden but not Estonia, the TGF-[beta]1 and TGF-[beta]2 levels correlated inversely with environmental endotoxin concentrations, whereas positive correlations to microbial load were observed for IL-4, IL-10, and IFN-[gamma]. High colostral IL-13 levels were associated with allergic sensitization during infancy in Sweden. In conclusion, Estonian mothers have lower breast milk levels of TGF-[beta], particularly TGF-[beta]2, but higher levels of SIgA, IL-10, and IFN-[gamma] than Swedish mothers, possibly because of differences in microbial load.

  2. Treatment of trypanosome-infected mice with exogenous interferon, interferon inducers, or antibody to interferon

    NASA Technical Reports Server (NTRS)

    Degee, Antonie L. W.; Mansfield, John M.; Sonnenfeld, Gerald

    1986-01-01

    Earlier studies have demonstrated that mice resistant to Trypanosoma brucei rhodesiense (the B10.BR/SgSnJ strain) produces, upon infection by this parasite, two peaks of serum interferon (IFN), while the susceptible mice (C3HeB/FeJ) produces no IFN. In the present study, survival times were compared for B10.BR/SgSnJ, C3HeB/FeJ, and CBA/J (an intermediately resistant strain) mice that were injected, prior to infection with the parasite, with either of the following three preparations (1) IFN-gamma, (2) an antibody to IFN-gamma and (3) polyriboinosinic-polyribocytidylic acid (to induce IFN-alpha/beta). No effect on the survival times of mice by any of these preparations could be demonstrated, contrary to some previous reports.

  3. Infiltration of Th1 and Th17 cells and activation of microglia in the CNS during the course of experimental autoimmune encephalomyelitis.

    PubMed

    Murphy, Aine C; Lalor, Stephen J; Lynch, Marina A; Mills, Kingston H G

    2010-05-01

    Experimental autoimmune encephalomyelitis (EAE) is a mouse model for multiple sclerosis, where disease is mediated by autoantigen-specific T cells. Although there is evidence linking CD4(+) T cells that secrete IL-17, termed Th17 cells, and IFN-gamma-secreting Th1 cells with the pathogenesis of EAE, the precise contribution of these T cell subtypes or their associated cytokines is still unclear. We have investigated the infiltration of CD4(+) T cells that secrete IFN-gamma, IL-17 or both cytokines into CNS during development of EAE and have examined the role of T cells in microglial activation. Our findings demonstrate that Th17 cells and CD4(+) T cells that produce both IFN-gamma and IL-17, which we have called Th1/Th17 cells, infiltrate the brain prior to the development of clinical symptoms of EAE and that this coincides with activation of CD11b(+) microglia and local production of IL-1beta, TNF-alpha and IL-6 in the CNS. In contrast, significant infiltration of Th1 cells was only detected after the development of clinical disease. Co-culture experiments, using mixed glia and MOG-specific T cells, revealed that T cells that secreted IFN-gamma and IL-17 were potent activators of pro-inflammatory cytokines but T cells that secrete IFN-gamma, but not IL-17, were less effective. In contrast both Th1 and Th1/Th17 cells enhanced MHC-class II and co-stimulatory molecule expression on microglia. Our findings suggest that T cells which secrete IL-17 or IL-17 and IFN-gamma infiltrate the CNS prior to the onset of clinical symptoms of EAE, where they may mediate CNS inflammation, in part, through microglial activation. Copyright 2010 Elsevier Inc. All rights reserved.

  4. Interaction of rotavirus with human peripheral blood mononuclear cells: plasmacytoid dendritic cells play a role in stimulating memory rotavirus specific T cells in vitro.

    PubMed

    Mesa, Martha C; Rodríguez, Luz-Stella; Franco, Manuel A; Angel, Juana

    2007-09-15

    We studied the interaction of RV with human peripheral blood mononuclear cells (PBMC) from adult volunteers. After exposure of PBMC to rhesus RV (RRV), T and B lymphocytes, NK cells, monocytes, and myeloid and plasmacytoid dendritic cells expressed RV non-structural proteins, at variable levels. Expression of these RV proteins was abolished if infection was done in the presence of anti-VP7 neutralizing antibodies or 10% autologous serum. Supernatants of RRV exposed PBMC contained TNF-alpha, IL-6, IFN-alpha, IFN-gamma, IL-2 and IL-10. Plasmacytoid DC were found to be the main source of IFN-alpha production, and in their absence the production of IFN-gamma and the frequency of RV specific T cells that secrete IFN-gamma diminished. Finally, we could not detect RV-antigen associated with the PBMC or expression of RV non-structural proteins in PBMC of acutely RV-infected children. Thus, although PBMC are susceptible to the initial steps of RV infection, most PBMC of children with RV-gastroenteritis are not infected.

  5. Effects of interferon-gamma and tumor necrosis factor-alpha on macrophage enzyme levels

    NASA Technical Reports Server (NTRS)

    Pierangeli, Silvia S.; Sonnenfeld, Gerald

    1989-01-01

    Murine peritoneal macrophages were treated with interferon-gamma (IFN-gamma) or tumor necrosis factor-alpha (TNF). Measurements of changes in acid phosphatase and beta-glucuronidase levels were made as an indication of activation by cytokine treatment. IFN-gamma or TNF-gamma treatment resulted in a significant increase in the activities of both enzymes measured in the cell lysates. This increase was observable after 6 h of incubation, but reached its maximum level after 24 h of incubation. The effect of the treatment of the cell with both cytokines together was additive. No synergistic effect of addition of both cytokines on the enzyme levels was observed.

  6. Growth Arrest of Epithelial Cells during Measles Virus Infection Is Caused by Upregulation of Interferon Regulatory Factor 1

    PubMed Central

    Yokota, Shin-ichi; Okabayashi, Tamaki; Yokosawa, Noriko; Fujii, Nobuhiro

    2004-01-01

    Natural infection with measles virus (MeV) is initiated when the virus reaches epithelial cells in the respiratory tract, oropharynx, or conjunctivae. Human epithelial cells infected with MeV frequently show growth suppression. In this study, we investigated the possible mechanisms for this suppression. The bronchiolar epithelial cell A549 showed growth arrest in G0/G1 following MeV infection or treatment with gamma interferon (IFN-γ). IFN regulatory factor-1 (IRF-1) was upregulated during MeV infection, although A549 did not produce IFN-γ. Cells of the cervical squamous cell line SiHa persistently infected with various strains of MeV displayed slower growth than uninfected SiHa cells, although the growth rates varied depending on the MeV strain. Transfection of antisense-oriented IRF-1 cDNA released the MeV-infected SiHa cells from growth suppression. Although these infected cells did not produce IFN-γ and suppressed IFN-α/β-induced Jak1 phosphorylation, Jak1 was constitutively phosphorylated. The growth rates negatively correlated with levels of both IRF-1 expression and constitutively phosphorylated Jak1. These results indicate that MeV upregulates IRF-1 in a manner that is independent of IFN but dependent on the JAK/STAT pathway. This induction of IRF-1 appears to suppress cell growth, although the extent seems to vary among MeV strains. PMID:15078941

  7. Interferon-gamma inhibits intestinal restitution by preventing gap junction communication between enterocytes.

    PubMed

    Leaphart, Cynthia L; Qureshi, Faisal; Cetin, Selma; Li, Jun; Dubowski, Theresa; Baty, Catherine; Batey, Catherine; Beer-Stolz, Donna; Guo, Fengli; Murray, Sandra A; Hackam, David J

    2007-06-01

    Necrotizing enterocolitis (NEC) is characterized by interferon-gamma (IFN-gamma) release and inadequate intestinal restitution. Because enterocytes migrate together, mucosal healing may require interenterocyte communication via connexin 43-mediated gap junctions. We hypothesize that enterocyte migration requires interenterocyte communication, that IFN impairs migration by impairing connexin 43, and that impaired healing during NEC is associated with reduced gap junctions. NEC was induced in Swiss-Webster or IFN(-/-) mice, and restitution was determined in the presence of the gap junction inhibitor oleamide, or via time-lapse microscopy of IEC-6 cells. Connexin 43 expression, trafficking, and localization were detected in cultured or primary enterocytes or mouse or human intestine by confocal microscopy and (35)S-labeling, and gap junction communication was assessed using live microscopy with oleamide or connexin 43 siRNA. Enterocytes expressed connexin 43 in vitro and in vivo, and exchanged fluorescent dye via gap junctions. Gap junction inhibition significantly reduced enterocyte migration in vitro and in vivo. NEC was associated with IFN release and loss of enterocyte connexin 43 expression. IFN inhibited enterocyte migration by reducing gap junction communication through the dephosphorylation and internalization of connexin 43. Gap junction inhibition significantly increased NEC severity, whereas reversal of the inhibitory effects of IFN on gap junction communication restored enterocyte migration after IFN exposure. Strikingly, IFN(-/-) mice were protected from the development of NEC, and showed restored connexin 43 expression and intestinal restitution. IFN inhibits enterocyte migration by preventing interenterocyte gap junction communication. Connexin 43 loss may provide insights into the development of NEC, in which restitution is impaired.

  8. Polarization of T-helper lymphocytes toward the Th2 phenotype in uremic patients.

    PubMed

    Libetta, C; Rampino, T; Dal Canton, A

    2001-08-01

    T-helper (Th) lymphocytes consist of Th1 and Th2 subsets. Th1 cells are effectors of cell-mediated immunity and secrete interferon-gamma (IFN-gamma), which recruits new Th1 cells in cooperation with interleukin-12 (IL-12; produced by monocytes) and inhibits Th2 differentiation. Th2 cells produce IL-4 and IL-10, which inhibit IFN-gamma secretion and cell immunity. We investigated whether the impaired immune response in uremia is associated with an altered balance of Th1/Th2. Peripheral-blood mononuclear cells (PBMCs) were collected from patients with chronic renal failure (CRF) on conservative treatment (CRF patients), patients with end-stage renal disease (ESRD) on regular hemodialysis therapy (ESRD-HD patients), and healthy controls (CON). CD4(+) cells were isolated from PBMCs by negative selection using a magnetic labeling system. PBMCs and purified CD4(+) cells were cultured in Iscove's medium and Iscove's medium plus mitogens (phytohemagglutinin and lipopolysaccharide). IFN-gamma, IL-12, IL-4, and IL-10 were measured in supernatant. The constitutive release of IL-4 and IL-10 by PBMCs and CD4(+) cells of CRF and ESRD-HD patients was increased by five to eight times in comparison with CON (P < 0.001). Constitutive IFN-gamma release by PBMCs of ESRD-HD patients was undetectable, although they secreted an increased amount of IL-12. Mitogen-stimulated release of IFN-gamma by PBMCs and CD4(+) cells of CRF and ESRD-HD patients was blunted (average PBMCs: CON, 115.8 pg/2 x10(6) cells; CRF, 81.8 pg/2 x10(6) cells; ESRD-HD, 9.3 pg/2 x10(6) cells; CD4(+) cells: CON, 358.0 pg/5 x 10(5) cells; CRF, 165.4 pg/5 x 10(5) cells; ESRD-HD, 43.5 pg/5 x 10(5) cells). The ability of PBMCs of ESRD-HD patients to secrete IFN-gamma was recovered after IL-4 and IL-10 neutralization. Uremia is associated with a prevalence of Th1 over Th2 cells and a configuration of cytokine network that depresses cell-mediated immunity.

  9. Cytokine regulation on the synthesis of nitric oxide in vivo by chronically infected human polymorphonuclear leucocytes.

    PubMed Central

    Takeichi, O; Saito, I; Okamoto, Y; Tsurumachi, T; Saito, T

    1998-01-01

    To determine if nitric oxide (NO) is produced by chronically infected human polymorphonuclear leucocytes (PMNs) in vivo, inflamed exudates (periapical exudates: PE) collected from periapical periodontitis patients were examined. Cell-free supernatants and cells were separated by centrifugation. Significant levels of nitrite concentrations were observed in the supernatants. The production of inducible NO synthase (iNOS) in highly purified PMNs derived from PEs was then immunocytochemically determined using rabbit anti-human iNOS antiserum. In vitro, human peripheral blood PMNs (PB-PMNs) isolated from patients were cultured with a combination of Esherichia coli-lipopolysaccharide (LPS), recombinant human interferon-gamma (rhIFN-gamma) and/or interleukin-1 beta (rhIL-1 beta). The stimulated PB-PMNs showed steady-state levels of nitrite. The stimulation of LPS, rhIFN-gamma and rhIL-1 beta showed more NO induction than that of LPS with either IFN-gamma or IL-1 beta, suggesting the synergistic effects of cytokines. Cryostat sections of surgically removed periapical tissues were also immunohistochemically examined for iNOS, IFN-gamma and IL-1 beta. Two-colour immunohistochemistry revealed the interaction of iNOS-producing PMNs and IFN-gamma- or IL-1 beta-producing mononuclear cells. On the basis of these data, we concluded that with the stimulation of inflammatory cytokines derived from mononuclear cells, PMNs can spontaneously produce NO at the site of chronic infection. The present studies are consistent with a hypothesis suggesting that PMNs could be regulated and delicately balanced to produce NO by mononuclear cell-derived cytokines in vivo. NO-producing cells may play a pivotal role in chronic inflammation. Images Figure 2 Figure 4 Figure 5 Figure 6 PMID:9616379

  10. In vivo treatment with interleukin 12 protects mice from immune abnormalities observed during murine acquired immunodeficiency syndrome (MAIDS)

    PubMed Central

    1994-01-01

    Lymphoproliferation, chronic B cell activation resulting in hypergammaglobulinemia, and profound immunodeficiency are prominent features of a retrovirus-induced syndrome designated murine acquired immunodeficiency syndrome (MAIDS). In vivo treatment of infected mice with recombinant interleukin 12 (IL-12) beginning at the time of infection or up to 9 wk after virus inoculation markedly inhibited the development of splenomegaly and lymphadenopathy, as well as B cell activation and Ig secretion. Treatment with IL-12 also had major effects in preventing induction of several immune defects including impaired production of interferon gamma (IFN-gamma) and IL-2 and depressed proliferative responses to various stimuli. The therapeutic effects of IL-12 on the immune system of mice with MAIDS were also associated with reduced expression of the retrovirus that causes this disease (BM5def), with lesser effects on expression of ecotropic MuLV. IL-12 treatment was not effective in IFN-gamma knockout mice or in infected mice treated simultaneously with IL-12 and anti-IFN-gamma. These results demonstrate that induction and progression of MAIDS are antagonized by IL-12 through high-level expression of IFN-gamma and may provide an experimental basis for developing treatments of retrovirus- induced immune disorders with similar immunopathogenic mechanisms. PMID:7964495

  11. Polyfunctional cytokine production by central memory T cells from cattle in response to Mycobacterium bovis infection and BCG vaccination

    USDA-ARS?s Scientific Manuscript database

    Polyfunctional T cells simultaneously produce IFN-gamma, IL-2 and TNF-alpha and play relevant roles in several chronic infections, including TB. Mycobacterium bovis infection of cattle elicits ex vivo polyfunctional T cell responses. Vaccine-elicited IFN-gamma Tcm (CD4+ CD45RO+ CCR7+) responses corr...

  12. Stress-induced release of HSC70 from human tumors.

    PubMed

    Barreto, Alfonso; Gonzalez, John Mario; Kabingu, Edith; Asea, Alexzander; Fiorentino, Susana

    2003-04-01

    In this study, we demonstrate that the pro-inflammatory cytokine interferon-gamma (IFN-gamma) induces the active release of the constitutive form of the 70-kDa heat shock protein (HSC70) from K562 erythroleukemic cells. Treatment of K562 cells with IFN-gamma induced the upregulation of the inducible form of the 70-kDa heat shock protein (HSP70), but not the constitutive form of HSC70 within the cytosol, in a proteasome-dependent manner. In addition, IFN-gamma induced the downregulation of surface-bound HSC70, but did not significantly alter surface-bound HSP70 expression. These findings indicate that HSC70 can be actively released from tumor cells and is indicative of a previously unknown mechanism by which immune modulators stimulate the release of intracellular HSC70. This mechanism may account for the potent chaperokine activity of heat shock proteins recently observed during heat shock protein-based immunotherapy against a variety of cancers.

  13. SIR2-deficient Leishmania infantum induces a defined IFN-gamma/IL-10 pattern that correlates with protection.

    PubMed

    Silvestre, Ricardo; Cordeiro-Da-Silva, Anabela; Santarém, Nuno; Vergnes, Baptiste; Sereno, Denis; Ouaissi, Ali

    2007-09-01

    The ability to manipulate the Leishmania genome to create genetically modified parasites by introducing or eliminating genes is considered a powerful alternative for developing a new generation vaccine against leishmaniasis. Previously, we showed that the deletion of one allele of the Leishmania infantum silent information regulatory 2 (LiSIR2) locus was sufficient to dramatically affect amastigote axenic proliferation. Furthermore, LiSIR2 single knockout (LiSIR2(+/-)) amastigotes were unable to replicate in vitro inside macrophages. Because this L. infantum mutant persisted in BALB/c mice for up to 6 wk but failed to establish an infection, we tested its ability to provide protection toward a virulent L. infantum challenge. Strikingly, vaccination with a single i.p. injection of LiSIR2(+/-) single knockout elicits complete protection. Thus, vaccinated BALB/c mice showed a reversal of T cell anergy with specific anti-Leishmania cytotoxic activity and high levels of NO production. Moreover, vaccinated mice simultaneously generated specific anti-Leishmania IgG Ab subclasses suggestive of both type 1 and type 2 responses. A strong correlation was found between the elimination of the parasites and an increased Leishmania-specific IFN-gamma/IL-10 ratio. Therefore, we propose that the polarization to a high IFN-gamma/low IL-10 ratio after challenge is a clear indicator of vaccine success. Furthermore these mutants, which presented attenuated virulence, represent a good model to understand the correlatives of protection in visceral leishmaniasis.

  14. Toscana Virus NSs Protein Inhibits the Induction of Type I Interferon by Interacting with RIG-I

    PubMed Central

    Gori-Savellini, Gianni; Valentini, Melissa

    2013-01-01

    Toscana virus (TOSV) is a phlebovirus, of the Bunyaviridae family, that is responsible for central nervous system (CNS) injury in humans. Previous data have shown that the TOSV NSs protein is a gamma interferon (IFN-β) antagonist when transiently overexpressed in mammalian cells, inhibiting IRF-3 induction (G. Gori Savellini, F. Weber, C. Terrosi, M. Habjan, B. Martorelli, and M. G. Cusi, J. Gen. Virol. 92:71–79, 2011). In this study, we investigated whether an upstream sensor, which has a role in the signaling cascade leading to the production of type I IFN, was involved. We found a significant decrease in RIG-I protein levels in cells overexpressing TOSV NSs, suggesting that the nonstructural protein interacts with RIG-I and targets it for proteasomal degradation. In fact, the MG-132 proteasome inhibitor was able to restore IFN-β promoter activation in cells expressing NSs, demonstrating the existence of an evasion mechanism based on inhibition of the RIG-I sensor. Furthermore, a C-terminal truncated NSs protein (ΔNSs), although able to interact with RIG-I, did not affect the RIG-I-mediated IFN-β promoter activation, suggesting that the NSs domains responsible for RIG-I-mediated signaling and interaction with RIG-I are mapped on different regions. These results contribute to identify a novel mechanism for bunyaviruses by which TOSV NSs counteracts the early IFN response. PMID:23552410

  15. Toscana virus NSs protein inhibits the induction of type I interferon by interacting with RIG-I.

    PubMed

    Gori-Savellini, Gianni; Valentini, Melissa; Cusi, Maria Grazia

    2013-06-01

    Toscana virus (TOSV) is a phlebovirus, of the Bunyaviridae family, that is responsible for central nervous system (CNS) injury in humans. Previous data have shown that the TOSV NSs protein is a gamma interferon (IFN-β) antagonist when transiently overexpressed in mammalian cells, inhibiting IRF-3 induction (G. Gori Savellini, F. Weber, C. Terrosi, M. Habjan, B. Martorelli, and M. G. Cusi, J. Gen. Virol. 92:71-79, 2011). In this study, we investigated whether an upstream sensor, which has a role in the signaling cascade leading to the production of type I IFN, was involved. We found a significant decrease in RIG-I protein levels in cells overexpressing TOSV NSs, suggesting that the nonstructural protein interacts with RIG-I and targets it for proteasomal degradation. In fact, the MG-132 proteasome inhibitor was able to restore IFN-β promoter activation in cells expressing NSs, demonstrating the existence of an evasion mechanism based on inhibition of the RIG-I sensor. Furthermore, a C-terminal truncated NSs protein (ΔNSs), although able to interact with RIG-I, did not affect the RIG-I-mediated IFN-β promoter activation, suggesting that the NSs domains responsible for RIG-I-mediated signaling and interaction with RIG-I are mapped on different regions. These results contribute to identify a novel mechanism for bunyaviruses by which TOSV NSs counteracts the early IFN response.

  16. Characterization of CD4 and CD8 T Cell Responses in MuSK Myasthenia Gravis

    PubMed Central

    Yi, JS; Guidon, A; Sparks, S; Osborne, R; Juel, VC; Massey, JM; Sanders, DB; Weinhold, KJ; Guptill, JT

    2014-01-01

    Muscle specific tyrosine kinase myasthenia gravis (MuSK MG) is a form of autoimmune MG that predominantly affects women and has unique clinical features, including prominent bulbar weakness, muscle atrophy, and excellent response to therapeutic plasma exchange. Patients with MuSK MG have predominantly IgG4 autoantibodies directed against MuSK on the postsynaptic muscle membrane. Lymphocyte functionality has not been reported in this condition. The goal of this study was to characterize T-cell responses in patients with MuSK MG. Intracellular production of IFN-gamma, TNF-alpha, IL-2, IL-17, and IL-21 by CD4+ and CD8+ T-cells was measured by polychromatic flow cytometry in peripheral blood samples from 11 Musk MG patients and 10 healthy controls. Only one MuSK MG patient was not receiving immunosuppressive therapy. Regulatory T-cells (Treg) were also included in our analysis to determine if changes in T cell function were due to altered Treg frequencies. CD8+ T-cells from MuSK MG patients had higher frequencies of polyfunctional responses than controls, and CD4+ T-cells had higher IL-2, TNF-alpha, and IL-17. MuSK MG patients had a higher percentage of CD4+ T-cells producing combinations of IFN-gamma/IL-2/TNF-gamma, TNF-alpha/IL-2, and IFN-gamma/TNF-alpha. Interestingly, Treg numbers and CD39 expression were not different from control values. MuSK MG patients had increased frequencies of Th1 and Th17 cytokines and were primed for polyfunctional proinflammatory responses that cannot be explained by a defect in Treg function or number. PMID:24378287

  17. The effect of garlic consumption on Th1/Th2 cytokines in phytohemagglutinin (PHA) activated rat spleen lymphocytes.

    PubMed

    Zamani, Alireza; Vahidinia, Aliasghar; Ghannad, Masoud Sabouri

    2009-04-01

    The balance and regulation of T helper 1 (Th1) and Th2-type cytokines are important in the effective immune response to different diseases. To clarify the effect of garlic (Allium sativum L.) consumption on the Th1/Th2 balance, the secretion of gamma interferon (IFN-gamma) and interleukin-4 (IL-4), as two prototypes of Th1/Th2 cytokines, were compared in serum and supernatant of in vitro phytohemagglutinin activated rat spleen lymphocytes. Thirty male rats were divided equally into two groups. The treatment group received garlic solution in water (600 mg/kg/4 mL) and controls received distilled water by gavage. After 1 month, serum and supernatant of PHA activated spleen lymphocytes were analysed for IFN-gamma and IL-4 by the enzyme-linked immunosorbent assay test and thymus and spleen weights were measured. The garlic treatment group showed significantly decreased production of IFN-gamma from 101.73 +/- 4.62 to 74.64 +/- 4.64 pg/mL and significantly increased IL-4 production from 26.75 +/- 3.35 to 83.92 +/- 6.56 pg/mL (p < 0.001) in the supernatant of PHA induced spleen lymphocytes. The serum level of these cytokines was undetectable. The mean weight of thymuses in the garlic fed animals was significantly reduced from 0.456 +/- 0.016 to 0.368 +/- 0.023 g compared with the control group (p < 0.005). There were no significant differences between the spleen weights in the two groups. In conclusion, oral garlic treatment may favor a Th2 or humoral immune response. (c) 2008 John Wiley & Sons, Ltd.

  18. Diphtheria toxoid loaded poly-(epsilon-caprolactone) nanoparticles as mucosal vaccine delivery systems.

    PubMed

    Singh, Jasvinder; Pandit, Sreenivas; Bramwell, Vincent W; Alpar, H Oya

    2006-02-01

    Poly-(epsilon-caprolactone) (PCL), a poly(lactide-co-glycolide) (PLGA)-PCL blend and co-polymer nanoparticles encapsulating diphtheria toxoid (DT) were investigated for their potential as a mucosal vaccine delivery system. The nanoparticles, prepared using a water-in-oil-in-water (w/o/w) double emulsion solvent evaporation method, demonstrated release profiles which were dependent on the properties of the polymers. An in vitro experiment using Caco-2 cells showed significantly higher uptake of PCL nanoparticles in comparison to polymeric PLGA, the PLGA-PCL blend and co-polymer nanoparticles. The highest uptake mediated by the most hydrophobic nanoparticles using Caco-2 cells was mirrored in the in vivo studies following nasal administration. PCL nanoparticles induced DT serum specific IgG antibody responses significantly higher than PLGA. A significant positive correlation between hydrophobicity of the nanoparticles and the immune response was observed following intramuscular administration. The positive correlation between hydrophobicity of the nanoparticles and serum DT specific IgG antibody response was also observed after intranasal administration of the nanoparticles. The cytokine assays showed that the serum IgG antibody response induced is different according to the route of administration, indicated by the differential levels of IL-6 and IFN-gamma. The nanoparticles eliciting the highest IgG antibody response did not necessarily elicit the highest levels of the cytokines IL-6 and IFN-gamma.

  19. The effect of fermented milk on interferon production in malnourished children and in anorexia nervosa patients undergoing nutritional care.

    PubMed

    Solis, B; Nova, E; Gómez, S; Samartín, S; Mouane, N; Lemtouni, A; Belaoui, H; Marcos, A

    2002-12-01

    For several years cytokine production has been associated with infections but it was not suspected that some types of food could also induce cytokines, even in a state of non-infection. Lactic bacteria can induce interferon (IFN) production in human healthy subjects, thus, a better protection against infections would be expected. Therefore, we planned to evaluate the effect of two diets including yoghurt or milk on IFN-gamma production during nutritional recovery in two different situations of malnutrition: (1) children with diarrhoea; and (2) patients with anorexia nervosa (AN). Both the diet including yoghurt of that including milk seemed to increase IFN-gamma production at the end of nutritional recovery in the malnourished children with diarrhoea. The significance of interferon production and the lymphocyte subset increase should be explored to know if a better resistance against pathogens is related to them. Regulation of intestinal absorption and moderate stimulation of interferon production make the yoghurt-based diet a good choice in the nutritional care of children. In the same way, an increase in the IFN-gamma production was observed in AN patients consuming yoghurt. This increase of IFN-gamma production could be considered a biological marker to detect the effect of probiotics on the immune response, especially in the improvement of a deficient nutritional status.

  20. Effects of Opsonization and Gamma Interferon on Growth of Brucella Melitensis 16M in Mouse Peritoneal Macrophages In Vitro

    DTIC Science & Technology

    2000-01-01

    bacterial CFU (Fig. 3). Macrophages cultured without brucel - lae or cultured with brucellae but without IFN-7 made ɘ.3 nmol of nitrite/200 JJLI well...receptors used for the uptake of nonopsonized brucel - lae are unknown. Synergy between the receptor for the Fc domain of immunoglobulin G (FcR) and

  1. [Experimental study on the activity of Staphyloccocal enterotoxin A liposome for inducing cytotoxicity of TIL from human hepatocellular carcinoma against tumor cells].

    PubMed

    Li, Mao-de; Li, Zhi-yu; He, Sheng; Xue, Hua

    2004-01-01

    To investigate the activity of Staphyloccocal enterotoxin A liposome (L-SEA) for inducing cytotoxicity of tumor infiltrating lymphocytes (TIL) against tumor cells. TIL were isolated from the tumor tissues of five hepatocellular carcinoma patients. L-SEA, SEA and IL-2 were tested in vitro for their activity levels in stimulating TIL proliferation. The TNF-alpha and IFN-gamma secretion and cytotoxicity of TIL against HepG-2 liver cancer cells were estimated by ELISA and MTT, respectively. Both L-SEA and SEA significantly stimulated the proliferation of TIL. The cytokine secretion of L-SEA group was significantly higher than that of IL-2 group (P < 0.05). There was no significantly statistical difference in cytokine secretion between L-SEA group and SEA group (P > 0.05) except that IFN-gamma secretion of L-SEA group was lower than that of SEA group at day 4 (P < 0.05). Both L-SEA and SEA had potent ability to induce TIL cytotoxicity against HepG-2 cells. And no significant difference was observed between these two groups (P > 0.05). These results suggest that L-SEA is as efficient as SEA in activating TIL.

  2. Polarized type 1 cytokine profile in bronchoalveolar lavage T cells of patients with hypersensitivity pneumonitis.

    PubMed

    Yamasaki, H; Ando, M; Brazer, W; Center, D M; Cruikshank, W W

    1999-09-15

    Hypersensitivity pneumonitis (HP) is characterized by an inflammatory lymphocytic alveolitis comprised of both CD8+ and CD4+ T cells. Animal models suggest that HP is facilitated by overproduction of IFN-gamma, and that IL-10 ameliorates severity of the disease, indicating a Th1-type response. To determine whether a Th1 phenotype in HP also exists clinically, bronchoalveolar lavage (BAL) and peripheral blood (PB) T cells were obtained from HP individuals and analyzed for Th1 vs Th2 cytokine profiles. It was determined that soluble OKT3-stimulated BAL T cells cocultured with alveolar macrophages produced more IFN-gamma and less IL-10 than PB T cells cocultured with monocytes, but no difference was observed in IL-4 production. The monocytic cells did not account for this difference, as CD80 and CD86 expressions were similar, and coculturing PB T cells with alveolar macrophages resulted in no difference in IFN-gamma production. Similarly, there was no difference in IL-12 production between stimulated BAL or PB T cells; however, addition of rIL-12 significantly increased production of IFN-gamma by BAL T cells, but not by PB T cells. This effect was due to a difference in IL-12R expression. High affinity IL-12R were only present in association with BAL T cells. These studies indicate that clinical HP is characterized by a predominance of IFN-gamma-producing T cells, perhaps resulting from a reduction in IL-10 production and an increase in high affinity IL-12R compared with blood T cells.

  3. Pharmacokinetic and pharmacodynamic characterization of a new formulation containing synergistic proportions of interferons alpha-2b and gamma (HeberPAG®) in patients with mycosis fungoides: an open-label trial

    PubMed Central

    2012-01-01

    Background The synergistic combination of interferon (IFN) alpha-2b and IFN gamma results in more potent in vitro biological effects mediated by both IFNs. The aim of this investigation was to evaluate by first time the pharmacokinetics and pharmacodynamics of this combination in patients with mycosis fungoides. Methods An exploratory, prospective, open-label clinical trial was conducted. Twelve patients, both genders, 18 to 75 years-old, with mycosis fungoides at stages IB to III, were eligible for the study. All of them received intramuscularly a single high dose (23 × 106 IU) of a novel synergistic IFN mixture (HeberPAG®) for pharmacokinetic and pharmacodynamic studies. Serum IFN alpha-2b and IFN gamma concentrations were measured during 96 hours by commercial enzyme immunoassays (EIA) specific for each IFN. Other blood IFN-inducible markers and laboratory variables were used as pharmacodynamics and safety criteria. Results The pharmacokinetic evaluation by EIA yielded a similar pattern for both IFNs that are also in agreement with the well-known described profiles for these molecules when these are administered separately. The average values for main parameters were: Cmax: 263 and 9.3 pg/mL; Tmax: 9.5 and 6.9 h; AUC: 4483 and 87.5 pg.h/mL, half-life (t1/2): 4.9 and 13.4 h; mean residence time (MRT): 13.9 and 13.5 h, for serum IFN alpha-2b and IFN gamma, respectively. The pharmacodynamic variables were strongly stimulated by simultaneous administration of both IFNs: serum neopterin and beta-2 microglobulin levels (β2M), and stimulation of 2’-5’ oligoadenylate synthetase (OAS1) mRNA expression. The most encouraging data was the high increment of serum neopterin, 8.0 ng/mL at 48 h, not been described before for any unmodified or pegylated IFN. Additionally, β2M concentration doubled the pre-dose value at 24–48 hours. For both variables the values remained clearly upper baseline levels at 96 hours. Conclusions HeberPAG®possesses improved pharmacodynamic properties that may be very useful in the oncologic setting. Efficacy trials can be carried out to confirm these findings. Trial registration Registro Público Cubano de Ensayos Clínicos RPCEC00000130 PMID:23272809

  4. Polyfunctional cytokine production by central memory T cells from cattle in response to Mycobacterium bovis infection and BCG vaccination

    USDA-ARS?s Scientific Manuscript database

    Polyfunctional T cells simultaneously produce IFN-gamma, IL-2 and TNF-alpha and play relevant roles in several chronic infections, including TB. Mycobacterium bovis infection of cattle elicits ex vivo polyfunctional T cell responses. Vaccine-elicited IFN-gamma Tcm (CD4 plus CD45RO plus CCR7 plus) re...

  5. Oral administration of Uncariae rhynchophylla inhibits the development of DNFB-induced atopic dermatitis-like skin lesions via IFN-gamma down-regulation in NC/Nga mice.

    PubMed

    Kim, Dong-Young; Jung, Jung-A; Kim, Tae-Ho; Seo, Sang-Wan; Jung, Sung-Ki; Park, Cheung-Seog

    2009-04-21

    Uncariae rhynchophylla (UR) is an herb which has blood pressure lowering and anti-inflammatory effects and has been prescribed traditionally to treat stroke and vascular dementia. In the present study, we examined whether UR suppress Atopic dermatitis (AD)-like skin lesions in NC/Nga mice treated with 2, 4-dinitrofluorobenzene (DNFB) under SPF conditions. The effect of UR in DNFB- treated NC/Nga mice was determined by measuring the skin symptom severity, levels of serum IgE, and of the amounts of IL-4 and IFN-gamma secreted by activated T cells in draining lymph nodes. Oral administration of UR to DNFB-treated NC/Nga mice was found to inhibit ear thickness increases and the skin lesions induced by DNFB. IFN-gamma production by CD4+ T cells from the lymph nodes of DNFB-treated NC/Nga mice was significantly inhibited by UR treatment, although levels of IL-4 and total IgE in serum were not. UR may suppress the development of AD-like dermatitis in DNFB-treated NC/Nga mice by reducing IFN-gamma production.

  6. [Proliferation and IFN-gamma secretion of autologous T lymphocytes stimulated by myeloid leukemia cells induced with rhGM-CSF and rhIL-4].

    PubMed

    Xie, Yan-Hui; Chen, Qin-Fen; Xie, Yi; Xie, Hong

    2002-12-01

    To observe the proliferation of T lymphocytes stimulated by CML and AML cells which were induced by rhGM-CSF and rhIL-4, and the secretion of IFN-gamma from proliferated T lymphocytes, the expression of CD80, CD86 and HLA-DR on CML and AML cells induced by GM-CSF and IL-4 was assayed by flow cytometry in vitro. Then one-way mixed lymphocyte reaction was carried out, with induced leukemia cells as stimulating cells and auto-T lymphocytes as reactive cells. The secretion of IFN-gamma from T lymphocytes was determined by double antibody sandwich ELISA. The results showed that GM-CSF and IL-4 significantly upregulated the expression of CD80, CD86 and HLA-DR on CML cells and CD80 and CD86 on AML cells, which could stimulate the T lymphocyte proliferation and high secretion of IFN-gamma (in CML group) of autologous T lymphocytes. It is concluded that the CML and AML cells induced by GM-CSF and IL-4 have the ability to present tumor specific antigen to auto-T lymphocyte.

  7. T-cell factor-4 and MHC upregulation in pigs receiving a live attenuated classical swine fever virus (CSFV) vaccine strain with interferon-gamma adjuvant.

    PubMed

    Fan, Y-H; Lin, Y-L; Hwang, Y-C; Yang, H-C; Chiu, H-C; Chiou, S-H; Jong, M-H; Chow, K-C; Lin, C-C

    2016-10-01

    The effect of co-administration of interferon (IFN)-γ in pigs undergoing vaccination with an attenuated strain (LPC) of classical swine fever virus (CSFV) was investigated. Unvaccinated pigs demonstrated pyrexia and died 7-9 days after challenge with virulent CSFV. Pigs receiving the attenuated vaccine remained healthy after virus challenge, except for mild, transient pyrexia, whereas pigs receiving IFN-γ simultaneously with the vaccine demonstrated normal body temperatures after virus challenge. Examination by nested RT-PCR revealed greater viral load in the spleens of the pigs vaccinated with the attenuated CSFV, compared with those that had additionally received IFN-γ. Expression of major histocompatibility complex (MHC) class I and MHC class II molecules was upregulated in the spleens of the IFN-γ treated vaccinated pigs, demonstrated by immunohistochemistry. Based on Western blot analysis, anti-CSFV IgG2 antibodies were elevated in vaccinated pigs by co-administration of IFN-γ (IFN-γ(Hi): P < 0.01; IFN-γ(Lo): P <0.05). By employing the suppression subtractive hybridization technique, RT-PCR, in situ hybridization, and immunohistochemistry, T-cell factor-4 (Tcf-4) mRNA and protein expression were found to be upregulated in the spleens of vaccinated pigs that had received IFN-γ. This study suggests involvement of Tcf-4 in IFN-γ-mediated immune regulation following CSFV vaccination. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Induced expression of mRNA for IL-5, IL-6, TNF-alpha, MIP-2 and IFN-gamma in immunologically activated rat peritoneal mast cells: inhibition by dexamethasone and cyclosporin A.

    PubMed

    Williams, C M; Coleman, J W

    1995-10-01

    We examined the capacity of purified rat peritoneal connective tissue-type mast cells (PMC) to express mRNA for several cytokines. Stimulation of PMC with anti-IgE for 4 hr induced the expression of mRNA encoding interleukin-5 (IL-5), IL-6, tumour necrosis factor-alpha (TNF-alpha), macrophage inflammatory protein-2 (MIP-2) and interferon-gamma (IFN-gamma). Unstimulated PMC expressed detectable mRNA for TNF-alpha but not for the other four cytokines. Incubation of PMC with cyclosporin A (CsA) or dexamethasone (DEX), each at 10(-6) M for 24 hr, significantly inhibited the induced expression of mRNA for each of the five cytokines, and also inhibited release of biologically active TNF-alpha. Throughout these experiments mRNA levels of the housekeeping gene G3PDH were not altered by stimulation with anti-IgE or incubation with CsA or DEX. We conclude that immunological activation of rat PMC induces gene expression of several cytokines and that expression of these genes can be inhibited by immunosuppressive drugs.

  9. Induced expression of mRNA for IL-5, IL-6, TNF-alpha, MIP-2 and IFN-gamma in immunologically activated rat peritoneal mast cells: inhibition by dexamethasone and cyclosporin A.

    PubMed Central

    Williams, C M; Coleman, J W

    1995-01-01

    We examined the capacity of purified rat peritoneal connective tissue-type mast cells (PMC) to express mRNA for several cytokines. Stimulation of PMC with anti-IgE for 4 hr induced the expression of mRNA encoding interleukin-5 (IL-5), IL-6, tumour necrosis factor-alpha (TNF-alpha), macrophage inflammatory protein-2 (MIP-2) and interferon-gamma (IFN-gamma). Unstimulated PMC expressed detectable mRNA for TNF-alpha but not for the other four cytokines. Incubation of PMC with cyclosporin A (CsA) or dexamethasone (DEX), each at 10(-6) M for 24 hr, significantly inhibited the induced expression of mRNA for each of the five cytokines, and also inhibited release of biologically active TNF-alpha. Throughout these experiments mRNA levels of the housekeeping gene G3PDH were not altered by stimulation with anti-IgE or incubation with CsA or DEX. We conclude that immunological activation of rat PMC induces gene expression of several cytokines and that expression of these genes can be inhibited by immunosuppressive drugs. Images Figure 1 Figure 2 Figure 3 PMID:7490125

  10. HLA-E upregulation on IFN-gamma-activated AML blasts impairs CD94/NKG2A-dependent NK cytolysis after haplo-mismatched hematopoietic SCT.

    PubMed

    Nguyen, S; Beziat, V; Dhedin, N; Kuentz, M; Vernant, J P; Debre, P; Vieillard, V

    2009-05-01

    Natural killer (NK) cells generated after haploidentical hematopoietic SCT in patients with AML are characterized by specific phenotypic features and impaired functioning that may affect transplantation outcome. We show that IFN-gamma produced by immature CD56(bright) NK cells upregulates cell surface expression of HLA-E on AML blasts and that this upregulation protects leukemic cells from NK-mediated cell lysis through the mediation of CD94/NKG2A, an inhibitory receptor overexpressed on NK cells after haploidentical SCT. Two years after transplantation, however, maturing NK cells were functionally active, as evidenced by high cytotoxicity and poor IFN-gamma production. This implies that maturation of NK cells is the key to improved immune responses and transplantation outcome.

  11. CD8+ gamma-delta TCR+ and CD4+ T cells produce IFN-γ at 5-7 days after yellow fever vaccination in Indian rhesus macaques, before the induction of classical antigen-specific T cell responses.

    PubMed

    Neves, Patrícia C C; Rudersdorf, Richard A; Galler, Ricardo; Bonaldo, Myrna C; de Santana, Marlon Gilsepp Veloso; Mudd, Philip A; Martins, Maurício A; Rakasz, Eva G; Wilson, Nancy A; Watkins, David I

    2010-11-29

    The yellow fever 17D (YF-17D) vaccine is one of the most efficacious vaccines developed to date. Interestingly, vaccination with YF-17D induces IFN-γ production early after vaccination (days 5-7) before the development of classical antigen-specific CD8(+) and CD4(+) T cell responses. Here we investigated the cellular source of this early IFN-γ production. At days 5 and 7 post-vaccination activated CD8(+) gamma-delta TCR T cells produced IFN-γ and TNF-α. Activated CD4(+) T cells produced IFN-γ and TNF-α at day 7 post-vaccination. This early IFN-γ production was also induced after vaccination with recombinant YF-17D (rYF-17D), but was not observed after recombinant Adenovirus type 5 (rAd5) vaccination. Early IFN-γ production, therefore, might be an important aspect of yellow fever vaccination. Copyright © 2010 Elsevier Ltd. All rights reserved.

  12. Development and testing of species-specific ELISA assays to measure IFN-γ and TNF-α in bottlenose dolphins (Tursiops truncatus)

    PubMed Central

    Eberle, Kirsten C.; Venn-Watson, Stephanie K.; Jensen, Eric D.; LaBresh, Joanna; Sullivan, Yvonne; Kakach, Laura

    2018-01-01

    Monitoring the immune status of cetaceans is important for a variety of health conditions. Assays to quantify cytokines, especially pro-inflammatory cytokines, could be employed, in addition to currently available diagnostic assays, to screen for alterations in the health status of an animal. Though a number of immunological assays are readily available for humans and mice, specific assays for many veterinary species, including cetaceans such as bottlenose dolphins (Tursiops truncatus), are more limited. Herein, we describe the development of IFN-gamma (IFN-γ) and TNF-alpha (TNF-α) enzyme-linked immunosorbent assays (ELISAs) specific to bottlenose dolphins. Utilizing these assays, we monitored the immune status of bottlenose dolphins from a managed population over a period of eleven months. The ELISA assays developed for bottlenose dolphins were used to measure IFN-γ and TNF-α in serum or in culture supernatants from peripheral blood mononuclear cells (PBMCs) stimulated with varying concentrations of mitogens concanavalin A (ConA) or phytohemagglutinin (PHA). Induction of TNF-α in PBMC cultures was consistently highest with 1 μg/mL ConA, while 1 μg/mL PHA induced the highest secretion of IFN-γ. Serum levels of TNF-α and IFN-γ remained relatively constant for each animal over the time period examined. CBC and plasma chemistry variables measured concurrently in the bottlenose dolphins were then examined as independent predictors of cytokine levels. We found these clinical variables were more likely to predict linear changes in serum IFN-γ and TNF-α levels compared to concentrations of these cytokines in mitogen-stimulated PBMC culture supernatants. Cytokine assays developed will be of substantial benefit in monitoring bottlenose dolphin health as an adjunct to currently available diagnostic tests. PMID:29304133

  13. A randomized phase II trial comparing two different sequence combinations of autologous vaccine and human recombinant interferon gamma and human recombinant interferon alpha2B therapy in patients with metastatic renal cell carcinoma: clinical outcome and analysis of immunological parameters.

    PubMed

    Schwaab, T; Heaney, J A; Schned, A R; Harris, R D; Cole, B F; Noelle, R J; Phillips, D M; Stempkowski, L; Ernstoff, M S

    2000-04-01

    The clinical observation of spontaneous regression in patients with renal cell carcinoma (RCC) and the response to various immunotherapeutic therapies strongly suggest a role for the host immune system in this disease. Prior studies showed that sequential administration of interferon (IFN) gamma and IFN alpha to RCC patients was safe. Clinical responses as well as immune changes in the peripheral blood mononuclear cell compartment were observed. Autologous tumor cell vaccines (AV) have also demonstrated activity in renal cell carcinoma. We hypothesize that the addition of AV to sequential IFN gamma and a therapy might improve the tumor-specific immune response by providing an appropriate source of antigen in the appropriate cytokine environment. To our knowledge, this is the first trial using AV combined with IFN alpha and IFN gamma. The purpose of this study was to evaluate the feasibility of manufacturing and administering (AV) from resected tumor samples, and administration of AV with combination IFN gamma and IFN alpha therapy. Finally, the impact on immunological parameters of these treatment options was assessed. Patients with metastatic RCC were randomly assigned to receive AV plus bCG along with a sequential administration of IFN gamma and a either together or after initiation of vaccine. Toxicity and clinical responses were evaluated. Modulations of the immune system were investigated by analyzing phenotype, cytokine mRNA expression, T cell proliferation and cytotoxicity in the peripheral blood mononuclear cell compartment. Fourteen patients with metastatic renal cell carcinoma were enrolled in this study; 9 were available for response evaluation. In a 70 day period, 3 (33%) showed mixed responses, 5 (56%) stable disease and 1 (11%) progression of disease. Toxicities were consistent with previous clinical reports. In the flow-cytometry phenotype analysis, stimulation of distinct subsets of circulating T-lymphocytes and a decrease of CD8+ T cell subsets was demonstrated. T-cell proliferation to allogeneic tumor cell stimulation improved following treatment. IL-4 and IL-5 mRNA levels were reduced in all patients after treatment. Patients who responded to treatment did not produce any IL-4 mRNA at all, before or after treatment. AV with IFNgamma and IFNalpha therapy might induce a MHC class-mediated cytotoxic T lymphocyte (CTL) response. We suggest that adequate therapy might direct T cell response toward a Th1 type response. We hypothesize a state of improved immune readiness in patients who might eventually respond to immunotherapy.

  14. COULD INTERFERON-GAMMA BE A THERAPEUTIC TARGET FOR TREATING HEART FAILURE?

    PubMed Central

    Levick, Scott P.; Goldspink, Paul H.

    2013-01-01

    The cytokine interferon-gamma (IFN-γ), is the only known member of the type II family of interferons, and as such, binds to its own distinct receptor. It is important in host defense against infection, as well as adaptive immune responses. Whilst a wide array of cytokines are known to be involved in adverse remodeling of the heart and the progression to heart failure, the role of IFN-γ is unclear. Recent evidence from clinical studies, animal models of myocarditis and hypertension, as well as isolated cell studies, provide conflicting data as to whether IFN-γ is pathological or protective in the heart. Thus, it is important to highlight these discrepant findings so that areas of future investigation can be identified to more clearly determine the precise role of IFN-γ in the heart. Accordingly, this review will: 1) discuss the source of IFN-γ in the diseased heart; 2) summarize the data from animal studies; 3) discuss the effects of IFN-γ on isolated cardiac fibroblasts and cardiomyocytes; 4) identify signaling mechanisms that may be invoked by IFN-γ in the heart; and 5) present the clinical evidence supporting a role for IFN-γ in heart failure. PMID:23589353

  15. Gamma Interferon Loaded onto Albumin Nanoparticles: In Vitro and In Vivo Activities against Brucella abortus▿

    PubMed Central

    Segura, S.; Gamazo, C.; Irache, J. M.; Espuelas, S.

    2007-01-01

    The aim of this study was to evaluate the activity of gamma interferon (IFN-γ) when it was either adsorbed onto or loaded into albumin nanoparticles. Brucella abortus-infected macrophages and infected BALB/c mice were selected as the models for testing of the therapeutic potentials of these cytokine delivery systems, in view of the well-established role of IFN-γ-activated macrophages for the control of Brucella sp. infections. Whereas the encapsulation of IFN-γ inside the matrix of nanoparticles completely abrogated its activity, adsorbed IFN-γ increased by 0.75 log unit the bactericidal effect induced by RAW macrophages activated with free IFN-γ, along with a higher level of production of nitric oxide. In infected BALB/c-mice, IFN-γ adsorbed onto nanoparticles was also more active than free cytokine in reducing the number of bacteria in the spleens, and the effect was mediated by an increased ratio of IFN-γ-secreting (Th1) to interleukin-4-secreting (Th2) cells. Overall, albumin nanoparticles would be suitable as carriers that target IFN-γ to macrophages and, thus, potentiate their therapeutic activity. PMID:17220401

  16. Malarial pigment haemozoin, IFN-gamma, TNF-alpha, IL-1beta and LPS do not stimulate expression of inducible nitric oxide synthase and production of nitric oxide in immuno-purified human monocytes

    PubMed Central

    Skorokhod, Oleksii A; Schwarzer, Evelin; Ceretto, Monica; Arese, Paolo

    2007-01-01

    Background Enhanced production of nitric oxide (NO) following upmodulation of the inducible isoform of NO synthase (iNOS) by haemozoin (HZ), inflammatory cytokines and LPS may provide protection against Plasmodium falciparum malaria by killing hepatic and blood forms of parasites and inhibiting the cytoadherence of parasitized erythrocytes (RBC) to endothelial cells. Monocytes and macrophages are considered to contribute importantly to protective upregulation of iNOS and production of NO. Data obtained with murine phagocytes fed with human HZ and synthetic HZ (sHZ) indicate that supplemental treatment of those cells with IFN-gamma elicited significant increases in protein and mRNA expression of iNOS and NO production, providing a potential mechanism linking HZ phagocytosis and increased production of NO. Purpose of this study was to analyse the effect of P. falciparum HZ and sHZ supplemental to treatment with IFN-gamma and/or a stimulatory cytokine-LPS mix on iNOS protein and mRNA expression in immuno-purified human monocytes. Methods Adherent immunopurified human monocytes (purity >85%), and murine phagocytic cell lines RAW 264.7, N11 and ANA1 were fed or not with P. falciparum HZ or sHZ and treated or not with IFN-gamma or a stimulatory cytokine-LPS mix. Production of NO was quantified in supernatants, iNOS protein and mRNA expression were measured after immunoprecipitation and Western blotting and quantitative RT-PCT, respectively. Results Phagocytosis of HZ/sHZ by human monocytes did not increase iNOS protein and mRNA expression and NO production either after stimulation by IFN-gamma or the cytokine-LPS mix. By contrast, in HZ/sHZ-laden murine macrophages, identical treatment with IFN-gamma and the cytokine-LPS mix elicited significant increases in protein and mRNA expression of iNOS and NOS metabolites production, in agreement with literature data. Conclusion Results indicate that human monocytes fed or not with HZ/sHZ were constantly unable to express iNOS and generate NOS metabolites even after stimulation with IFN-gamma or a cytokine-LSP mix that were very active on HZ-fed murine phagocytic lines. Present data do not support the hypothesis that monocytes are mediators of anti-parasitic defence in clinical malaria via activation of iNOS and production of NO, and suggest caution in extrapolating data obtained with murine or hybrid systems to human malaria. PMID:17543124

  17. Inhibition of interferon-gamma expression by osmotic shrinkage of peripheral blood lymphocytes.

    PubMed

    Lang, K S; Weigert, C; Braedel, S; Fillon, S; Palmada, M; Schleicher, E; Rammensee, H-G; Lang, F

    2003-01-01

    A hypertonic environment, as it prevails in renal medulla or in hyperosmolar states such as hyperglycemia of diabetes mellitus, has been shown to impair the immune response, thus facilitating the development of infection. The present experiments were performed to test whether hypertonicity influences activation of T lymphocytes. To this end, peripheral blood lymphocytes (PBL) of cytomegalovirus (CMV)-positive donors were stimulated by human leukocyte antigen (HLA)-A2-restricted CMV epitope NLVPMVATV to produce interferon (IFN)-gamma at varying extracellular osmolarity. As a result, increasing extracellular osmolarity during exposure to the CMV antigen indeed decreased IFN-gamma formation. Addition of NaCl was more effective than urea. A 50% inhibition was observed at 350 mosM by addition of NaCl. The combined application of the Ca(2+) ionophore ionomycin (1 microg/ml) and the phorbol ester phorbol 12-myristate 13-acetate (PMA; 5 microg/ml) stimulated IFN-gamma production, an effect again reversed by hyperosmolarity. Moreover, hyperosmolarity abrogated the stimulating effect of ionomycin (1 microg/ml) and PMA (5 microg/ml) on the transcription factors activator protein (AP)-1, nuclear factor of activated T cells (NFAT), and NF-kappaB but not Sp1. In conclusion, osmotic cell shrinkage blunts the stimulatory action of antigen exposure on IFN-gamma production, an effect explained at least partially by suppression of transcription factor activation.

  18. Induction of a T-Helper 1 (Th1) Immune Response in Mice by an Extract from the Pleurotus eryngii (Eringi) Mushroom

    PubMed Central

    Kameyama, Natsuko; Ito, Akira; Imai, Soichi

    2012-01-01

    Abstract To assess the effect of edible mushroom extracts on the induction of T-helper 1 (Th1) immunity, we examined differences in interferon-gamma (IFN-γ) and interleukin (IL)-4 production in mice induced by hot-water extracts of 15 species of edible mushroom. Extracts from Agaricus bisporus, Flammulina velutipes, Hypsizigus marmoreus, Lentinula edodes, and Lyophyllum decastes induced both IFN-γ and IL-4 production in mice, whereas extracts from Pleurotus ostreatus only induced IL-4. In contrast, extracts from Agaricus blazei, Grifola frondosa, Morchella esculenta, Pholiota nameko, Pleurotus citrinopileatus, and Pleurotus eryngii induced only IFN-γ production. In particular, the extract from P. eryngii induced high levels of IFN-γ and reduced levels of IL-4. We further investigated the use of a trial immunogen using the P. eryngii extract as a Th1 immunostimulator. An oil-in-water emulsion of the hot-water extract from P. eryngii (immunostimulator) and ovalbumin (OVA; antigen) was used as a trial immunogen. This immunogen induced strong OVA-specific IgG2a antibody production in mice compared with the negative controls. In addition, OVA-specific IgG1 antibody levels were lower than those for the negative controls. Marked increases in serum IFN-γ levels and high-level production of IFN-γ in the culture supernatant from the CD4+ spleen cells in the trial immunogen group mice were observed. Our results suggested that the hot-water extract from P. eryngii induced Th1 immunity by acting as an immunostimulator. PMID:23134464

  19. Modulation of the humoral and cellular immune response in Abeta immunotherapy by the adjuvants monophosphoryl lipid A (MPL), cholera toxin B subunit (CTB) and E. coli enterotoxin LT(R192G).

    PubMed

    Maier, Marcel; Seabrook, Timothy J; Lemere, Cynthia A

    2005-10-25

    Abeta vaccination or passive transfer of human-specific anti-Abeta antibodies are approaches under investigation to prevent and/or treat Alzheimer's disease (AD). Successful active Abeta vaccination requires a strong and safe adjuvant to induce anti-Abeta antibody formation. We compared the adjuvants monophosphoryl lipid A (MPL)/trehalose dicorynomycolate (TDM), cholera toxin B subunit (CTB) and Escherichia coli heat-labile enterotoxin LT(R192G) for their ability to induce a humoral and cellular immune reaction, using fibrillar Abeta1-40/42 as a common immunogen in wildtype B6D2F1 mice. Subcutaneous (s.c.) administration with MPL/TDM resulted in anti-Abeta antibodies levels up to four times higher compared to s.c. LT(R192G). Using MPL/TDM, the anti-Abeta antibodies induced were mainly IgG2b, IgG1 and lower levels of IgG2a and IgM, with a moderate splenocyte proliferation and IFN-gamma production in vitro upon stimulation with Abeta1-40/42. LT(R192G), previously shown by us to induce robust titers of anti-Abeta antibodies, generated predominantly IgG2b and IgG1 anti-Abeta antibodies with very low splenocyte proliferation and IFN-gamma production. Weekly intranasal (i.n.) administration over 11 weeks of Abeta40/42 with CTB induced only moderate levels of antibodies. All immunogens generated antibodies that recognized mainly the Abeta1-7 epitope and specifically detected amyloid plaques on AD brain sections. In conclusion, MPL/TDM, in addition to LT(R192G), is an effective adjuvant when combined with Abeta40/42 and may aid in the design of Abeta immunotherapy.

  20. The role of IL-1beta in reduced IL-7 production by stromal and epithelial cells: a model for impaired T-cell numbers in the gut during HIV-1 infection.

    PubMed

    Thang, P H; Ruffin, N; Brodin, D; Rethi, B; Cam, P D; Hien, N T; Lopalco, L; Vivar, N; Chiodi, F

    2010-08-01

    Interleukin (IL)-7 is a key cytokine in T-cell homeostasis. Stromal cells, intestinal epithelial cells and keratinocytes are known to produce this cytokine. The mechanisms and cellular factors regulating IL-7 production are still unclear. We assessed whether IL-1beta and interferon (IFN)-gamma, cytokines produced during inflammatory conditions, may impact on IL-7 production. We used human intestinal epithelial cells (DLD-1 cell line) and bone marrow stromal cells (HS27 cell line), known to produce IL-7; IL-7 production was evaluated at the mRNA and protein levels. To assess whether treatment of HS27 cells with IL-1beta and/or IFN-gamma leads to changes in the gene expression of cytokines, Toll-like receptors (TLRs) and chemokines, we analysed gene expression profiles using the whole-genome microarray Human Gene 1.0 ST. We found that IFN-gamma enhanced the expression of IL-7 mRNA (P < 0.001) in both cell lines. IL-1beta treatment led to a significant down-regulation (P < 0.001) of IL-7 mRNA expression in both cell lines. The IL-7 concentration in supernatants collected from treated DLD-1 and HS27 cell cultures reflected the trend of IL-7 mRNA levels. The gene profiles revealed dramatic changes in expression of cytokines and their receptors (IL-7/IL-7R alpha; IL-1alpha,IL-1beta/IL-1R1; IFN-gamma/IFN-gammaR1), of IFN regulatory factors (IRF-1 and 2), of TLRs and of important chemo-attractants for T cells. The microarray results were verified by additional methods. Our results are discussed in the setting of inflammation and T-cell survival in the gut compartment during HIV-1 infection where stromal and epithelial cells may produce factors that contribute to impaired IL-7 homeostasis and homing of T cells.

  1. Increased TNF-alpha/IFN-gamma/IL-2 and decreased TNF-alpha/IFN-gamma production by central memory T cells are associated with protective responses against bovine tuberculosis following BCG vaccination

    USDA-ARS?s Scientific Manuscript database

    Central memory T cells (Tcm’s) and polyfunctional CD4 T responses contribute to vaccine-elicited protection with both human and bovine tuberculosis (TB); however, their combined role in protective immunity to TB is unclear. To address this question, we evaluated polyfunctional cytokine responses by ...

  2. Anomalous Moessbauer Fraction in Superparamagnetic Systems.

    NASA Astrophysics Data System (ADS)

    Mohie-Eldin, Mohie-Eldin Yehia

    The biological molecule ferritin and its proven synthetic counterpart polysaccharide iron complex (P.I.C.) have been shown to contain small (<100 ^circ in diameter) antiferromagnetic cores at their centers. Mossbauer studies of these molecules have revealed an anomalous drop in the Mossbauer fraction (f-factor) as the temperature rises above 30^ circK for mammalian ferritin and 60 ^circK for P.I.C. Above the blocking temperature, superparamagnetic relaxation results in the disappearance of hyperfine splitting. This thesis investigates and attempts to resolve this Lamb-Mossbauer f-Factor anomaly in these superparamagnetically relaxing systems. Chapter I deals with a basic review of theories of Mossbauer spectroscopy and superparamagnetism. The analogies in the composition of the two molecules is examined in Chapter II. The long range order technique of magnetization measurements is used in Chapter III to compare magnetic properties of both molecules and to verify the suggestion that the P.I.C. molecule is a good "biomimic" to ferritin based on the identification of ferrihydrite as the major mineral in both, by short range probing techniques such as X-ray diffraction. The anomaly is confirmed in P.I.C.'s Mossbauer spectra in Chapter IV. Different absorbers are used to experimentally investigate the absorber thickness effect on the Mossbauer spectra. The anomaly persists for thin absorbers. Also in Chapter V, data that is treated with FFT procedures to eliminate the thickness effect still exhibit this anomaly. We then investigated the effect of superparamagnetic relaxation on the f-factor. In Chapter VI, spin-lattice relaxation was excluded based upon a calculation of the rate of energy transfer from the spin system to the lattice. We introduce a theory in Chapter VII based on the following process as a plausible explanation of the anomaly: Superparamagnetic relaxation brings about a dynamical displacement of the Mossbauer nucleus through magnetostriction. These displacements produce a Doppler broadening of the Mossbauer spectrum that reduces the apparent f-factor. The temperature dependence of the theoretically calculated f-factor agrees qualitatively with experiment. Finally, there is semi-quantitative agreement if the as yet unknown dimensionless magnetostriction constant were to be on the order of 10^{-3} .

  3. Functional Haplotypes of Fc gamma (Fcγ) receptor (FcγRIIA and FcγRIIIB) predict risk to repeated episodes of severe malarial anemia and mortality in Kenyan children

    PubMed Central

    Ouma, Collins; Davenport, Gregory C.; Garcia, Steven; Kempaiah, Prakasha; Chaudhary, Ateefa; Were, Tom; Anyona, Samuel B.; Raballah, Evans; Konah, Stephen N.; Hittner, James B.; Vulule, John M.; Ong’echa, John M.; Perkins, Douglas J.

    2011-01-01

    Development of protective immunity against Plasmodium falciparum is partially mediated through binding of malaria-specific IgG to Fc gamma (γ) receptors. Variation in human FcγRIIA-H/R-131 and FcγRIIIB-NA1/NA2 affect differential binding of IgG sub-classes. Since variability in FcγR may play an important role in severe malarial anemia (SMA) pathogenesis by mediating phagocytosis of red blood cells and triggering cytokine production, the relationship between FcγRIIA-H/R131 and FcγRIIIB-NA1/NA2 haplotypes and susceptibility to SMA (Hb<6.0g/dL) was investigated in Kenyan children (n=528) with acute malaria residing in a holoendemic P. falciparum transmission region. In addition, the association between carriage of the haplotypes and repeated episodes of SMA and all-cause mortality were investigated over a three-year follow-up period. Since variability in FcγR can alter interferon (IFN)-γ production, a mediator of innate and adaptive immune responses, functional associations between the haplotypes and IFN-γ were also explored. During acute malaria, children with SMA had elevated peripheral IFN-γ levels (P=0.006). Although multivariate logistic regression analyses (controlling for covariates) revealed no associations between the FcγR haplotypes and susceptibility to SMA during acute infection, the FcγRIIA-131H/FcγRIIIB-NA1 haplotype was associated with decreased peripheral IFN-γ (P=0.046). Longitudinal analyses showed that carriage of the FcγRIIA-131H/FcγRIIIB-NA1 haplotype was associated with reduced risk of SMA (RR; 0.65, 95%CI, 0.46-0.90; P=0.012) and all-cause mortality (P=0.002). In contrast, carriers of the FcγRIIA-131H/FcγRIIIB-NA2 haplotype had increased susceptibility to SMA (RR; 1.47, 95%CI, 1.06-2.04; P=0.020). Results here demonstrate that variation in the FcγR gene alters susceptibility to repeated episodes of SMA and mortality, as well as functional changes in IFN-γ production. PMID:21818580

  4. Cytokine synthesis in occupational allergy to caddisflies in hydroelectric plant workers.

    PubMed

    Warrington, R J; Whitman, C; McPhillips Warrington, S

    2003-10-01

    Workers in hydroelectric plants appear to be readily sensitized to caddisfly allergens. This sensitization probably occurs de novo from occupational exposure. In some workers, sensitization occurs on a non-atopic background. Cytokine synthesis of IFN-gamma, IL-5 and IL-13 in atopic and non-atopic caddisfly-allergic workers was examined to determine if responses were similar or different. Peripheral blood mononuclear cells were isolated from atopic caddisfly-allergic workers, non-atopic caddisfly-allergic workers and non-atopic caddisfly-exposed but non-allergic workers. Stimulation with caddisfly antigens was carried out and synthesis of IFN-gamma, IL-5 and IL-13 was determined by sandwich ELISA. Both caddisfly-allergic and non-allergic subjects responded to stimulation with caddisfly extract. The response in non-atopic caddisfly-non-allergic subjects was TH1 predominant, while that in atopic caddisfly-allergic subjects was TH2 predominant. The response in non-atopic caddisfly-allergic subjects was between that of the atopic caddisfly-allergic workers and the non-atopic caddisfly-non-allergic workers and the trend was to a TH2 response. Work-related symptoms were similarly intermediate between the atopic caddisfly-allergic and non-atopic caddisfly-non-allergic group. Differences were significant for IFN-gamma/IL-5 ratios but not IFN-gamma/IL-13 ratios for atopic and non-atopic caddisfly-allergic individuals, compared to non-atopic caddisfly-non-allergic workers. However, a linear relationship existed between IFN-gamma synthesis and IL-5 and IL-13 synthesis in non-atopic caddisfly-allergic workers but not in atopic caddisfly-allergic subjects. Caddisfly allergy in hydroelectric workers may be a useful model for the development of allergy to a previously unencountered allergen, and points to some interesting differences between atopic and non-atopic subjects who become sensitized to environmental allergens. Copyright 2003 S. Karger AG, Basel

  5. Induction of indolamine 2,3-dioxygenase and kynurenine 3-monooxygenase in rat brain following a systemic inflammatory challenge: a role for IFN-gamma?

    PubMed

    Connor, Thomas J; Starr, Neasa; O'Sullivan, Joan B; Harkin, Andrew

    2008-08-15

    Inflammation-mediated dysregulation of the kynurenine pathway has been implicated as a contributor to a number of major brain disorders. Consequently, we examined the impact of a systemic inflammatory challenge on kynurenine pathway enzyme expression in rat brain. Indoleamine 2,3-dioxygenase (IDO) expression was induced in cortex and hippocampus following systemic lipopolysaccharide (LPS) administration. Whilst IDO expression was paralleled by increased circulating interferon (IFN)-gamma concentrations, IFN-gamma expression in the brain was only modestly altered following LPS administration. In contrast, induction of IDO was associated with increased central tumour necrosis factor (TNF)-alpha and interleukin (IL)-6 expression. Similarly, in cultured glial cells LPS-induced IDO expression was accompanied by increased TNF-alpha and IL-6 expression, whereas IFN-gamma was not detectable. These findings indicate that IFN-gamma is not required for LPS-induced IDO expression in brain. A robust increase in kynurenine-3-monooxygenase (KMO) expression was observed in rat brain 24h post LPS, without any change in kynurenine aminotransferase II (KAT II) expression. In addition, we report that constitutive expression of KAT II is approximately 8-fold higher than KMO in cortex and 20-fold higher in hippocampus. Similarly, in glial cells constitutive expression of KAT II was approximately 16-fold higher than KMO, and expression of KMO but not KAT II was induced by LPS. These data are the first to demonstrate that a systemic inflammatory challenge stimulates KMO expression in brain; a situation that is likely to favour kynurenine metabolism in a neurotoxic direction. However, our observation that expression of KAT II is much higher than KMO in rat brain is likely to counteract potential neurotoxicity that could arise from KMO induction following an acute inflammation.

  6. Dominant expression of interleukin-10 and transforming growth factor-beta genes in activated T-cells of chronic active Epstein-Barr virus infection.

    PubMed

    Ohga, Shouichi; Nomura, Akihiko; Takada, Hidetoshi; Tanaka, Tamami; Furuno, Kenji; Takahata, Yasushi; Kinukawa, Naoko; Fukushima, Noriyasu; Imai, Shosuke; Hara, Toshiro

    2004-11-01

    Chronic active Epstein-Barr virus (EBV) infection is a chronic mononucleosis syndrome associated with clonal proliferation of EBV-carrying T-/natural killer (NK)-cells. High levels of circulating EBV and activated T-cells are sustained during the prolonged disease course, whereas it is not clear how ectopic EBV infection in T-/NK-cells has been established and maintained. To assess the biological role of activated T-cells in chronic active EBV infection (CAEBV), EBV DNA and cellular gene expressions in peripheral T-cells were quantified in CAEBV and infectious mononucleosis (IM) patients. In CAEBV, HLA-DR(+) T-cells had higher viral load and larger amounts of IFN gamma, IL-10, transforming growth factor-beta (TGF beta), and cytotoxic T lymphocyte antigen-4 (CTLA4) mRNA than HLA-DR(-)T-cells. HLA-DR(+) T cells of IM patients transcribed more IFN gamma and IL-10 than their HLA-DR(-)T cells. Expression levels of IFN gamma and forkhead box p3 (Foxp3) in CAEBV HLA-DR(+) T-cells were higher than in IM HLA-DR(+) T-cells. The effective variables to discriminate the positivity of HLA-DR were IL-10, IFN gamma, CTLA4, TGF beta, and IL-2 in the order of statistical weight. EBV load in CAEBV T-cells correlated with the expression levels of only IL-10 and TGF beta. These results suggest that CAEBV T-cells are activated to transcribe IFN gamma, IL-10, and TGF beta excessively, and the latter two genes are expressed preferentially in the EBV-infected subsets. The dominant expression of regulatory cytokines in T-cells may imply a viral evasion mechanism in the disease.

  7. Hypercholesterolemia is associated with a T helper (Th) 1/Th2 switch of the autoimmune response in atherosclerotic apo E-knockout mice.

    PubMed Central

    Zhou, X; Paulsson, G; Stemme, S; Hansson, G K

    1998-01-01

    Atherosclerosis is an inflammatory-fibrotic response to accumulation of cholesterol in the artery wall. In hypercholesterolemia, low density lipoproteins (LDL) accumulate and are oxidized to proinflammatory compounds in the arterial intima, leading to activation of endothelial cells, macrophages, and T lymphocytes. We have studied immune cell activation and the autoimmune response to oxidized LDL in atherosclerotic apo E-knockout mice. Autoantibodies to oxidized LDL exhibited subclass specificities indicative of T cell help, and the increase in antibody titers in peripheral blood was associated with increased numbers of cytokine-expressing T cells in the spleen. In addition to T cell-dependent antibodies, IgM antibodies to oxidized LDL were also increased in apo E-knockout mice. This suggests that both T cell-dependent and T cell-independent epitopes may be present on oxidized LDL. In moderate hypercholesterolemia, IgG antibodies were largely of the IgG2a isotype, suggesting that T cell help was provided by proinflammatory T helper (Th) 1 cells, which are prominent components of atherosclerotic lesions. In severe hypercholesterolemia induced by cholesterol feeding of apo E-knockout mice, a switch to Th2-dependent help was evident. It was associated with a loss of IFN-gamma-producing Th1 cells in the spleen, whereas IL-4-producing Th2 cells were more resistant to hypercholesterolemia. IFN-gamma but not IL-4 mRNA was detected in atherosclerotic lesions of moderately hypercholesterolemic apo E-knockout mice, but IL-4 mRNA appeared in the lesions when mice were made severely hypercholesterolemic by cholesterol feeding. These data show that IFN-gamma-producing Th1 cells infiltrate atherosclerotic lesions and provide T cell help for autoimmune responses to oxidized LDL in apo E-knockout mice. However, severe hypercholesterolemia is associated with a switch from Th1 to Th2, which results not only in the formation of IgG1 autoantibodies to oxidized LDL, but also in the appearance of Th2-type cytokines in the atherosclerotic lesions. Since the two subsets of T cells counteract each other, this switch may have important consequences for the inflammatory/immune process in atherosclerosis. PMID:9541503

  8. Mycobacterium avium Complex Empyema in a Patient with Interferon Gamma Autoantibodies

    PubMed Central

    Chung, Heath H; Opal, Steven M; Dworkin, Jonathan D

    2014-01-01

    Interferon gamma (IFN-γ) autoantibodies are a relatively recently discovered clinical entity, which have been shown to be associated with disseminated non-tuberculous mycobacterial (NTM) infections and other opportunistic infections. Interestingly, isolated NTM infections (without disseminated NTM infection) have not been shown to be a good predictor of the presence of IFN-γ autoantibodies. This case describes an isolated NTM empyema in a patient with IFN-γ autoantibodies and makes the argument that the development of an NTM empyema in a patient with no known immunodeficiency should prompt consideration for IFN-γ testing. Additionally, this case underscores the importance for clinicians to recognize that an unusual infection without the typical cause of impairment in immunity should prompt a more thorough investigation of the patient's immune system. PMID:25285250

  9. Quantifying the risk-reduction potential of new Modified Risk Tobacco Products.

    PubMed

    Martin, Florian; Vuillaume, Gregory; Baker, Gizelle; Sponsiello-Wang, Zheng; Ricci, Paolo F; Lüdicke, Frank; Weitkunat, Rolf

    2018-02-01

    Quantitative risk assessment of novel Modified Risk Tobacco Products (MRTP) must rest on indirect measurements that are indicative of disease development prior to epidemiological data becoming available. For this purpose, a Population Health Impact Model (PHIM) has been developed to estimate the reduction in the number of deaths from smoking-related diseases following the introduction of an MRTP. One key parameter of the model, the F-factor, describes the effective dose upon switching from cigarette smoking to using an MRTP. Biomarker data, collected in clinical studies, can be analyzed to estimate the effects of switching to an MRTP as compared to quitting smoking. Based on transparent assumptions, a link function is formulated that translates these effects into the F-factor. The concepts of 'lack of sufficiency' and 'necessity' are introduced, allowing for a parametrization of a family of link functions. These can be uniformly sampled, thus providing different 'scenarios' on how biomarker-based evidence can be translated into the F-factor to inform the PHIM. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  10. Effects of positive results for Mycobacterium avium subsp paratuberculosis as determined by microbial culture of feces or antibody ELISA on results of caudal fold tuberculin test and interferon-gamma assay for tuberculosis in cattle.

    PubMed

    Dunn, John R; Kaneene, John B; Grooms, Daniel L; Bolin, Steven R; Bolin, Carole A; Bruning-Fann, Colleen S

    2005-02-01

    To determine whether cattle testing positive for Mycobacterium avium subsp paratuberculosis as determined by microbial culture of feces or antibody ELISA were more likely to have false-positive responses on the caudal fold tuberculin (CFT) test or interferon-gamma (IFN-gamma) assay for Mycobacterium bovis than cattle testing negative for M paratuberculosis. 1043 cattle from 10 herds in Michigan. Feces and blood samples for plasma were collected from cattle > or =24 months old on the day the CFT test was read. Fecal samples were submitted for microbial culture for M paratuberculosis. Plasma samples were tested for antibody against M paratuberculosis, and IFN-gamma after stimulation with purified protein derivative tuberculin from M bovis or M avium. Of 1043 cattle, 180 (17.3%) had positive CFT test results (suspects) and 8 (0.8%) had positive IFN-gamma assay results after stimulation with purified protein derivative tuberculin from M bovis. Forty-five (4.3%) and 115 (11.0%) cattle tested positive for M paratuberculosis as determined by microbial culture of feces and antibody ELISA, respectively. Cattle with positive responses for M paratuberculosis appeared to have an increased likelihood of false-positive results on the CFT test, although this association was not significant. No significant association was detected among cattle testing positive for M paratuberculosis as determined by microbial culture of feces and antibody ELISA and positive CFT test and IFN-gamma assay results for M bovis.

  11. Partial interferon-gamma receptor 1 deficiency in a child with tuberculoid bacillus Calmette-Guérin infection and a sibling with clinical tuberculosis.

    PubMed Central

    Jouanguy, E; Lamhamedi-Cherradi, S; Altare, F; Fondanèche, M C; Tuerlinckx, D; Blanche, S; Emile, J F; Gaillard, J L; Schreiber, R; Levin, M; Fischer, A; Hivroz, C; Casanova, J L

    1997-01-01

    Complete interferon-gamma receptor 1 (IFNgammaR1) deficiency has been identified previously as a cause of fatal bacillus Calmette-Guérin (BCG) infection with lepromatoid granulomas, and of disseminated nontuberculous mycobacterial (NTM) infection in children who had not been inoculated with BCG. We report here a kindred with partial IFNgammaR1 deficiency: one child afflicted by disseminated BCG infection with tuberculoid granulomas, and a sibling, who had not been inoculated previously with BCG, with clinical tuberculosis. Both responded to antimicrobials and are currently well without prophylactic therapy. Impaired response to IFN-gamma was documented in B cells by signal transducer and activator of transcription 1 nuclear translocation, in fibroblasts by cell surface HLA class II induction, and in monocytes by cell surface CD64 induction and TNF-alpha secretion. Whereas cells from healthy children responded to even low IFN-gamma concentrations (10 IU/ml), and cells from a child with complete IFNgammaR1 deficiency did not respond to even high IFN-gamma concentrations (10,000 IU/ml), cells from the two siblings did not respond to low or intermediate concentrations, yet responded to high IFN-gamma concentrations. A homozygous missense IFNgR1 mutation was identified, and its pathogenic role was ascertained by molecular complementation. Thus, whereas complete IFNgammaR1 deficiency in previously identified kindreds caused fatal lepromatoid BCG infection and disseminated NTM infection, partial IFNgammaR1 deficiency in this kindred caused curable tuberculoid BCG infection and clinical tuberculosis. PMID:9389728

  12. Respiratory Francisella tularensis live vaccine strain infection induces Th17 cells and prostaglandin E2, which inhibits generation of gamma interferon-positive T cells.

    PubMed

    Woolard, Matthew D; Hensley, Lucinda L; Kawula, Thomas H; Frelinger, Jeffrey A

    2008-06-01

    Two key routes of Francisella tularensis infection are through the skin and airway. We wished to understand how the route of inoculation influenced the primary acute adaptive immune response. We show that an intranasal inoculation of the F. tularensis live vaccine strain (LVS) with a 1,000-fold-smaller dose than an intradermal dose results in similar growth kinetics and peak bacterial burdens. In spite of similar bacterial burdens, we demonstrate a difference in the quality, magnitude, and kinetics of the primary acute T-cell response depending on the route of inoculation. Further, we show that prostaglandin E(2) secretion in the lung is responsible for the difference in the gamma interferon (IFN-gamma) response. Intradermal inoculation led to a large number of IFN-gamma(+) T cells 7 days after infection in both the spleen and the lung. In contrast, intranasal inoculation induced a lower number of IFN-gamma(+) T cells in the spleen and lung but an increased number of Th17 cells in the lung. Intranasal infection also led to a significant increase of prostaglandin E(2) (PGE(2)) in the bronchoalveolar lavage fluid. Inhibition of PGE(2) production with indomethacin treatment resulted in increased numbers of IFN-gamma(+) T cells and decreased bacteremia in the lungs of intranasally inoculated mice. This research illuminates critical differences in acute adaptive immune responses between inhalational and dermal infection with F. tularensis LVS mediated by the innate immune system and PGE(2).

  13. Plasmacytoid dendritic cells (PDC) are the major DC subset innately producing cytokines in human lymph nodes.

    PubMed

    Cox, Karina; North, Margaret; Burke, Michael; Singhal, Hemant; Renton, Sophie; Aqel, Nayef; Islam, Sabita; Knight, Stella C

    2005-11-01

    Plasmacytoid dendritic cells (PDC) constitute a distinct subset of DC found in human peripheral lymph nodes (LN), but little is known about their function. Cell suspensions were prepared from tumor draining LN (n=20) and control LN (n=11) of women undergoing surgical resection for primary breast cancer and elective surgery for benign conditions, respectively. Using four-color flow cytometry, human leukocyte antigen-DR+ DC subsets were identified phenotypically. The proportions and numbers of cells innately producing interleukin (IL)-4, IL-10, IL-12, and interferon-gamma (IFN-gamma) were also measured from intracellular accumulation of cytokine after blocking with monensin. All flow cytometry data were collected without compensation and were compensated off-line using the Winlist algorithm (Verity software). This package also provided the subtraction program to calculate percentage positive cells and intensity of staining. PDC (CD11c-, CD123+) expressed more cytokines than did myeloid DC (CD11c+) or CD1a+ putative "migratory" DC (P<0.001). LN PDC from patients with a good prognosis (px; n=11) demonstrated a relative increase in IL-12 and IFN-gamma expression (median IL-10:IL-12 ratio=0.78 and median IL-4:IFN-gamma ratio=0.7), and PDC from LN draining poor px cancer (n=9) showed a relative increase in IL-10 and IL-4 expression (median IL-10:IL-12 ratio=1.31 and median IL-4:IFN-gamma ratio=2.6). The difference in IL-4:IFN-gamma expression between good and poor px cancer groups was significant (P<0.05). Thus, PDC innately producing cytokines were identified in cell suspensions from human LN, and the character of PDC cytokine secretion may differ between two breast cancer prognostic groups. We speculate that a shift towards PDC IL-10 and IL-4 expression could promote tumor tolerance in LN draining poor px breast cancer.

  14. MPT-51/CpG DNA vaccine protects mice against Mycobacterium tuberculosis.

    PubMed

    Silva, Bruna Daniella de Souza; da Silva, Ediane Batista; do Nascimento, Ivan Pereira; Dos Reis, Michelle Cristina Guerreiro; Kipnis, André; Junqueira-Kipnis, Ana Paula

    2009-07-16

    Tuberculosis (TB) is a severe infectious disease that kills approximately two million people worldwide every year. Because BCG protection is variable and does not protects adults, there is a great need for a new vaccine against TB that does not represent a risk for immunocompromised patients and that is also capable of protecting adult individuals. MPT-51 is a protein found in the genome of mycobacteria and binds to the fibronectin of the extracellular matrix, which may have a role in host tissue attachment and virulence. In order to test the usefulness of MPT-51 as a subunit vaccine, BALB/c were vaccinated and challenged with Mycobacterium tuberculosis. The infection of BALB/c with M. tuberculosis increased the number of IFN-gamma(+) T lymphocytes specific to MPT-51 in the spleen and lungs. Inoculation with rMPT-51/FIA and with rMPT-51/CpG DNA in non-infected BALB/c increased the amounts of IFN-gamma(+) T lymphocytes. Inoculation with rMPT-51/FIA also induced a humoral response specific to MPT-51. CFU counts of lung tissues done 60 days after infection showed a reduction of about 2 log in the bacteria load in the group of animals inoculated with rMPT-51/CpG DNA. These results make MPT-51 a valuable component to be further evaluated in the development of other subunit vaccines.

  15. Effects of SSM (specific substance maruyama) on HBe antigen-positive chronic hepatitis B -clinical efficacy and modulation of cytokines.

    PubMed

    Satomura, K; Yin, M; Sekiyama, T; Fujisaki, S; Aramaki, T; Okumura, H; Ohmoto, Y

    2000-08-01

    Twenty-three patients with HBe antigen-positive chronic hepatitis B were treated with capitalite first letters Maruyama (SSM). HBe antigen turned negative in 15 patients. The levels of various cytokines in pre- and post-treatment frozen serum samples from six patients whose HBe antigen turned negative and from five whose HBe antigen did not were examined. Reduction of serum interleukin (IL) -10 level to below 20 pg/ml was observed after SSM treatment in four of the six patients whose HBe antigen turned negative. SSM was found to stimulate the production of interferon (IFN) -gamma in peripheral blood cells from two healthy volunteers. This stimulatory effect was confirmed in 12 out of 24 healthy volunteers. SSM augmented the production of IFN-gamma in eight out of 10 patients with chronic hepatitis B and nine of 10 with hepatitis C. These results demonstrate for the first time that SSM stimulates the production of IFN-gamma in human peripheral blood cells and also suggest that treatment of HBe antigen-positive chronic hepatitis B patients with SSM leads to the clearance of HBe antigen and normalization of serum aspartate aminotransferase levels through inhibition of IL-10 and stimulation of IFN-gamma.

  16. MOLECULAR CLONING, SEQUENCING, EXPRESSION AND BIOLOGICAL ACTIVITY OF GIANT PANDA (AILUROPODA MELANOLEUCA) INTERFERON-GAMMA.

    PubMed

    Zhu, Hui; Wang, Wen-Xiu; Wang, Bao-Qin; Zhu, Xiao-Fu; Wu, Xu-Jin; Ma, Qing-Yi; Chen, De-Kun

    2012-06-29

    The giant panda (Ailuropoda melanoleuca) is an endangered species and indigenous to China. Interferon-gamma (IFN-γ) is the only member of type □ IFN and is vital for the regulation of host adapted immunity and inflammatory response. Little is known aboutthe FN-γ gene and its roles in giant panda.In this study, IFN-γ gene of Qinling giant panda was amplified from total blood RNA by RT-CPR, cloned, sequenced and analysed. The open reading frame (ORF) of Qinling giant panda IFN-γ encodes 152 amino acidsand is highly similar to Sichuan giant panda with an identity of 99.3% in cDNA sequence. The IFN-γ cDNA sequence was ligated to the pET32a vector and transformed into E. coli BL21 competent cells. Expression of recombinant IFN-γ protein of Qinling giant panda in E. coli was confirmed by SDS-PAGE and Western blot analysis. Biological activity assay indicated that the recombinant IFN-γ protein at the concentration of 4-10 µg/ml activated the giant panda peripheral blood lymphocytes,while at 12 µg/mlinhibited. the activation of the lymphocytes.These findings provide insights into the evolution of giant panda IFN-γ and information regarding amino acid residues essential for their biological activity.

  17. Application of genetically engineered Salmonella typhimurium for interferon-gamma-induced therapy against melanoma.

    PubMed

    Yoon, Wonsuck; Park, Yoo Chang; Kim, Jinseok; Chae, Yang Seok; Byeon, Jung Hye; Min, Sang-Hyun; Park, Sungha; Yoo, Young; Park, Yong Keun; Kim, Byeong Mo

    2017-01-01

    Salmonella have been experimentally used as anti-cancer agents, because they show selective growth in tumours. In this study, we genetically modified attenuated Salmonella typhimurium to express and secrete interferon-gamma (IFN-γ) as a tumouricidal agent to enhance the therapeutic efficacy of Salmonella. IFN-γ was fused to the N-terminal region (residues 1-160) of SipB (SipB160) for secretion from bacterial cells. Attenuated S. typhimurium expressing recombinant IFN-γ (S. typhimurium (IFN-γ)) invaded the melanoma cells and induced cytotoxicity. Subcutaneous administration of S. typhimurium (IFN-γ) also efficiently inhibited tumour growth and prolonged the survival of C57BL/6 mice bearing B16F10 melanoma compared with administration of phosphate-buffered saline (PBS), unmodified S. typhimurium or S. typhimurium expressing empty vector (S. typhimurium [Vec]) in a natural killer (NK) cell-dependent manner. Moreover, genetically modified Salmonella, including S. typhimurium (IFN-γ), showed little toxicity to normal tissues with no observable adverse effects. However, S. typhimurium (IFN-γ)-mediated tumour suppression was attributed to direct killing of tumour cells rather than to stable anti-tumour immunity. Collectively, these results suggest that tumour-targeted therapy using S. typhimurium (IFN-γ) has potential for melanoma treatment. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Gram-positive and gram-negative bacteria induce different patterns of cytokine production in human mononuclear cells irrespective of taxonomic relatedness.

    PubMed

    Skovbjerg, Susann; Martner, Anna; Hynsjö, Lars; Hessle, Christina; Olsen, Ingar; Dewhirst, Floyd E; Tham, Wilhelm; Wold, Agnes E

    2010-01-01

    Upon bacterial stimulation, tissue macrophages produce a variety of cytokines that orchestrate the immune response that clears the infection. We have shown that Gram-positives induce higher levels of interleukin-12 (IL-12), interferon-gamma (IFN-gamma), and tumor necrosis factor (TNF) from human peripheral blood mononuclear cells (PBMCs) than do Gram-negatives, which instead induce more of IL-6, IL-8, and IL-10. Here, we study whether these patterns follows or crosses taxonomic borders. PBMCs from blood donors were incubated with UV-inactivated bacteria representing 37 species from five phyla. IL-12, TNF, IL-1beta, IL-6, IL-8, and IL-10 were measured in the supernatants after 24 h and IFN-gamma after 5 days. Irrespective of phylogenetic position, Gram-positive bacteria induced much more IL-12 (nine times more on average) and IFN-gamma (seven times), more TNF (three times), and slightly more IL-1beta (1.5 times) than did Gram-negatives, which instead induced more IL-6 (1.5 times), IL-8 (1.9 times), and IL-10 (3.3 times) than did Gram-positives. A notable exception was the Gram-positive Listeria monocytogenes, which induced very little IL-12, IFN-gamma, and TNF. The results confirm the fundamental difference in innate immune responses to Gram-positive and Gram-negative bacteria, which crosses taxonomic borders and probably reflects differences in cell wall structure.

  19. Immunogenicity and safety of xenogeneic vascular endothelial growth factor receptor-2 DNA vaccination in mice and dogs

    PubMed Central

    Denies, Sofie; Cicchelero, Laetitia; Polis, Ingeborgh; Sanders, Niek N.

    2016-01-01

    Vascular endothelial growth factor receptor-2 (VEGFR-2) is an attractive target in oncology due to its crucial role in angiogenesis. In this study a DNA vaccine coding for human VEGFR-2 was evaluated in healthy mice and dogs, administered by intradermal injection and electroporation. In mice, three doses and vaccination schedules were evaluated. Cellular immune responses were measured by intracellular IFN-gamma staining and a cytotoxicity assay and antibodies by ELISA. Safety was assessed by measuring regulatory T cells and myeloid derived suppressor cells and a wound healing assay. The vaccine was subsequently evaluated in dogs, which were vaccinated three times with 100μg. Cellular immune responses were measured by intracellular IFN-gamma staining and antibodies by a flow cytometric assay. In mice, maximal cellular responses were observed after two vaccinations with 5μg. Humoral responses continued to increase with higher dose and number of vaccinations. No abnormalities in the measured safety parameters were observed. The vaccine was also capable of eliciting a cellular and humoral immune response in dogs. No adverse effects were observed, but tolerability of the electroporation was poor. This study will facilitate the evaluation of the vaccine in tumor bearing animals, ranging from rodent models to dogs with spontaneous tumors. PMID:26871296

  20. Interleukin 6 production in experimental cerebral malaria: modulation by anticytokine antibodies and possible role in hypergammaglobulinemia

    PubMed Central

    1990-01-01

    The production of Interleukin 6 (IL-6) was studied during experimental cerebral malaria (ECM) induced by Plasmodium berghei ANKA (PbA) infection. IL-6 is present in the serum of mice with ECM, the highest concentrations being observed in mice with full-blown neurological syndrome. High IL-6 levels were also observed, however, in the absence of pathology in nonlethal malaria infection. These data suggest that IL- 6 is produced in large amounts during malaria infection, but does not play a major role in the pathogenesis of ECM. A modulation of IL-6 production in ECM was achieved by in vivo treatment with other anticytokine antibodies: antibodies to interferon (IFN-gamma) or to tumor necrosis factor (TNF) abolished the rise of IL-6, while anti-IL-3 and anti-granulocyte/macrophage colony-stimulating factor antibodies only partially prevented this rise, suggesting that the two cytokines IFN-gamma and TNF are important intermediates in IL-6 production. Passive immunization against IL-6 did not prevent ECM, but significantly reduced serum IgG levels in malaria-infected mice. Thus, by its effects on B cells, IL-6 may be involved in hypergammaglobulinemia and immune-complex diseases, e.g., glomerulonephritis observed during malaria infection. PMID:2121890

  1. Gamma Interferon-Induced T-Cell Loss in Virulent Mycobacterium avium Infection

    PubMed Central

    Flórido, Manuela; Pearl, John E.; Solache, Alejandra; Borges, Margarida; Haynes, Laura; Cooper, Andrea M.; Appelberg, Rui

    2005-01-01

    Infection by virulent Mycobacterium avium caused progressive severe lymphopenia in C57BL/6 mice due to increased apoptosis rates. T-cell depletion did not occur in gamma interferon (IFN-γ)-deficient mice which showed increased T-cell numbers and proliferation; in contrast, deficiency in nitric oxide synthase 2 did not prevent T-cell loss. Although T-cell loss was IFN-γ dependent, expression of the IFN-γ receptor on T cells was not required for depletion. Similarly, while T-cell loss was optimal if the T cells expressed IFN-γ, CD8+ T-cell depletion could occur in the absence of T-cell-derived IFN-γ. Depletion did not require that the T cells be specific for mycobacterial antigen and was not affected by deficiencies in the tumor necrosis factor receptors p55 or p75, the Fas receptor (CD95), or the respiratory burst enzymes or by forced expression of bcl-2 in hematopoietic cells. PMID:15908387

  2. Inhibition of LPS binding to MD-2 co-receptor for suppressing TLR4-mediated expression of inflammatory cytokine by 1-dehydro-10-gingerdione from dietary ginger

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Park, Sun Hong; Kyeong, Min Sik; Hwang, Yuri

    Highlights: Black-Right-Pointing-Pointer 1-Dehydro-10-gingerdione (1D10G) from ginger inhibits LPS binding to MD-2. Black-Right-Pointing-Pointer 1D10G suppresses MyD88- or TRIF-dependent signaling in LPS-activated macrophages. Black-Right-Pointing-Pointer 1D10G down-regulates the expression of NF-{kappa}B-, AP1- or IRF3-target genes. Black-Right-Pointing-Pointer MD-2 is a molecular target in the anti-inflammatory action of 1D10G. -- Abstract: Myeloid differentiation protein 2 (MD-2) is a co-receptor of toll-like receptor 4 (TLR4) for innate immunity. Here, we delineated a new mechanism of 1-dehydro-10-gingerdione (1D10G), one of pungent isolates from ginger (Zingiber officinale), in the suppression of lipopolysaccharide (LPS)-induced gene expression of inflammatory cytokines. 1D10G inhibited LPS binding to MD-2 with higher affinity thanmore » gingerol and shogaol from dietary ginger. Moreover, 1D10G down-regulated TLR4-mediated expression of nuclear factor-{kappa}B (NF-{kappa}B) or activating protein 1 (AP1)-target genes such as tumor necrosis factor {alpha} (TNF-{alpha}) and interleukin-1{beta}, as well as those of interferon (IFN) regulatory factor 3 (IRF3)-target IFN-{beta} gene and IFN-{gamma} inducible protein 10 (IP-10) in LPS-activated macrophages. Taken together, MD-2 is a molecular target in the anti-inflammatory action of 1D10G.« less

  3. CpG-B Oligodeoxynucleotides Inhibit TLR-Dependent and -Independent Induction of Type I IFN in Dendritic Cells

    PubMed Central

    Liu, Yi C.; Gray, Reginald C.; Hardy, Gareth A. D.; Kuchtey, John; Abbott, Derek W.; Emancipator, Steven N.; Harding, Clifford V.

    2010-01-01

    CpG oligodeoxynucleotides (ODNs) signal through TLR9 to induce type I IFN (IFN-αβ) in dendritic cells (DCs). CpG-A ODNs are more efficacious than CpG-B ODNs for induction of IFN-αβ. Because IFN-αβ may contribute to autoimmunity, it is important to identify mechanisms to inhibit induction of IFN-αβ. In our studies, CpG-B ODN inhibited induction of IFN-αβ by CpG-A ODN, whereas induction of TNF-α and IL-12p40 by CpG-A ODN was not affected. CpG-B inhibition of IFN-αβ was observed in FLT3 ligand-induced murine DCs, purified murine myeloid DCs, plasmacytoid DCs, and human PBMCs. CpG-B ODN inhibited induction of IFN-αβ by agonists of multiple receptors, including MyD88-dependent TLRs (CpG-AODN signaling via TLR9, or R837 or Sendai virus signaling via TLR7) and MyD88-independent receptors (polyinosinic:polycytidylic acid signaling via TLR3 or ds break-DNA signaling via a cytosolic pathway). CpG-B ODN did not inhibit the IFN-αβ positive feedback loop second-wave IFN-αβ, because IFN-αβ–induced expression of IFN-αβ was unaffected, and CpG-B inhibition of IFN-αβ was manifested in IFN-αβR−/− DCs, which lack the positive feedback mechanism. Rather, CpG-B ODN inhibited early TLR-induced first wave IFN-α4 and IFN-β. Chromatin immunoprecipitation revealed that association of IFN regulatory factor 1 with the IFN-α4 and IFN-β promoters was induced by CpG-A ODN but not CpG-B ODN. Moreover, CpG-A–induced association of IFN regulatory factor 1 with these promoters was inhibited by CpG-B ODN. Our studies demonstrate a novel mechanism of transcriptional regulation of first-wave IFN-αβ that selectively inhibits induction of IFN-αβ downstream of multiple receptors and may provide targets for future therapeutic inhibition of IFN-αβ expression in vivo. PMID:20181884

  4. Heterogeneity within populations of recombinant Chinese hamster ovary cells expressing human interferon-gamma.

    PubMed

    Coppen, S R; Newsam, R; Bull, A T; Baines, A J

    1995-04-20

    The Chinese hamster ovary (CHO) cell line has great commercial importance in the production of recombinant human proteins, especially those for therapeutic use. Much attention has been paid to CHO cell population physiology in order to define factors affecting product fidelity and yield. Such studies have revealed that recombinant proteins, including human interferon-gamma (IFN-gamma), can be heterogeneous both in glycosylation and in proteolytic processing. The type of heterogeneity observed depends on the growth physiology of the cell population, although the relationship between them is complex. In this article we report results of a cytological study of the CHO320 line which expresses recombinant human IFN-gamma. When grown in suspension culture, this cell line exhibited three types of heterogeneity: (1) heterogeneity of the production of IFN-gamma within the cell population, (2) heterogeneity of the number of nuclei and mitotic spindles in dividing cells, and (3) heterogeneity of cellular environment. The last of these arises from cell aggregates which form in suspension culture: Some cells are exposed to the culture medium; others are fully enclosed within the mass with little or no direct access to the medium. Thus, live cells producing IFN-gamma are heterogeneous in their environment, with variable access to O(2) and nutrients. Within the aggregates, it appears that live cells proliferate on a dead cell mass. The layer of live cells can be several cells deep. Specific cell-cell attachments are observed between the living cells in these aggregates. Two proteins, known to be required for the formation of certain types of intercellular junctions, spectrin and vinculin, have been localized to the regions of cell-cell contact. The aggregation of the cells appears to be an active process requiring protein synthesis. (c) 1995 John Wiley & Sons, Inc.

  5. Tumor necrosis factor alpha mediates resistance to Trypanosoma cruzi infection in mice by inducing nitric oxide production in infected gamma interferon-activated macrophages.

    PubMed Central

    Silva, J S; Vespa, G N; Cardoso, M A; Aliberti, J C; Cunha, F Q

    1995-01-01

    Cell invasion by Trypanosoma cruzi and its intracellular replication are essential for continuation of the parasite life cycle and for production of Chagas' disease. T. cruzi is able to replicate in nucleated cells and can be killed by activated macrophages. Gamma interferon (IFN-gamma) is one of the major stimuli for the activation of macrophages and has been shown to be a key activation factor for the killing of intracellular parasites through a mechanism dependent upon nitric oxide (NO) biosynthesis. We show that although the addition of exogenous tumor necrosis factor alpha (TNF-alpha) does not potentiate the trypanocidal activity of IFN-gamma in vitro, treatment of resistant C57BI/6 mice with an anti-TNF-alpha monoclonal antibody increased parasitemia and mortality. In addition, the anti-TNF-alpha-treated animals had decreased NO production, both in vivo and in vitro, suggesting an important role for TNF-alpha in controlling infection. In order to better understand the role of TNF-alpha in the macrophage-mediating killing of parasites, cultures of T. cruzi-infected macrophages were treated with an anti-TNF-alpha monoclonal antibody. IFN-gamma-activated macrophages failed to kill intracellular parasites following treatment with 100 micrograms of anti-TNF-alpha. In these cultures, the number of parasites released at various time points after infection was significantly increased while NO production was significantly reduced. We conclude that IFN-gamma-activated macrophages produce TNF-alpha after infection by T. cruzi and suggest that this cytokine plays a role in amplifying NO production and parasite killing. PMID:7591147

  6. Lectin of Bacillus subtilis sp. as overinducer of gamma-interferonogenesis.

    PubMed

    Kishko, Ia H; Vasylenko, M I; Pidhors'kyĭ, V S; Kovalenko, E O

    1997-01-01

    It has been demonstrated experimentally that lectin of Bacillus subtilis sp. in comparison with generally accepted Con A, PHA and lectin of "gold rain" grass--Laburnum anagyroides M e d i k in trials on white mice of CBA line gave in 4 hours of induction maximal titers of gamma-IFN in blood serum of animals--153.6 +/- 17.0 IU/ml. Practically identical titers had been obtained after induction by lectin "gold rain", some lower--after Con A and PHA. At swine gamma-IFN synthesis optimal density of cell suspension must contain 2.5 + 10(7) immunocytes in 1 ml, owing to which it is possible to obtain the titer equal 1 : 2150. Materials with using of bacterial lectins at various degree of purification had shown that maximal titers in blood serum of mongrel white mice were registered at administration to animals of non-purified lectin, 4 times lower--at using of half-purified and purified lectins. Data of these trials in vivo were confirmed by materials of gamma-IFN induction by immunocytes of swine, cattle and even man.

  7. Cytotoxic potential of lung CD8(+) T cells increases with chronic obstructive pulmonary disease severity and with in vitro stimulation by IL-18 or IL-15.

    PubMed

    Freeman, Christine M; Han, MeiLan K; Martinez, Fernando J; Murray, Susan; Liu, Lyrica X; Chensue, Stephen W; Polak, Timothy J; Sonstein, Joanne; Todt, Jill C; Ames, Theresa M; Arenberg, Douglas A; Meldrum, Catherine A; Getty, Christi; McCloskey, Lisa; Curtis, Jeffrey L

    2010-06-01

    Lung CD8(+) T cells might contribute to progression of chronic obstructive pulmonary disease (COPD) indirectly via IFN-gamma production or directly via cytolysis, but evidence for either mechanism is largely circumstantial. To gain insights into these potential mechanisms, we analyzed clinically indicated lung resections from three human cohorts, correlating findings with spirometrically defined disease severity. Expression by lung CD8(+) T cells of IL-18R and CD69 correlated with severity, as did mRNA transcripts for perforin and granzyme B, but not Fas ligand. These correlations persisted after correction for age, smoking history, presence of lung cancer, recent respiratory infection, or inhaled corticosteroid use. Analysis of transcripts for killer cell lectin-like receptor G1, IL-7R, and CD57 implied that lung CD8(+) T cells in COPD do not belong to the terminally differentiated effector populations associated with chronic infections or extreme age. In vitro stimulation of lung CD8(+) T cells with IL-18 plus IL-12 markedly increased production of IFN-gamma and TNF-alpha, whereas IL-15 stimulation induced increased intracellular perforin expression. Both IL-15 and IL-18 protein expression could be measured in whole lung tissue homogenates, but neither correlated in concentration with spirometric severity. Although lung CD8(+) T cell expression of mRNA for both T-box transcription factor expressed in T cells and GATA-binding protein 3 (but not retinoic acid receptor-related orphan receptor gamma or alpha) increased with spirometric severity, stimulation of lung CD8(+) T cells via CD3epsilon-induced secretion of IFN-gamma, TNF-alpha, and GM-CSF, but not IL-5, IL-13, and IL-17A. These findings suggest that the production of proinflammatory cytokines and cytotoxic molecules by lung-resident CD8(+) T cells contributes to COPD pathogenesis.

  8. Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice

    PubMed Central

    Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.

    2001-01-01

    Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339

  9. Role of innate and adaptive immunity in the pathogenesis of keratitis.

    PubMed

    Hazlett, Linda D

    2005-01-01

    Pseudomonas aeruginosa is a common organism associated with bacterial keratitis primarily resulting from contact lens usage. Advances in our understanding of host innate and adaptive immune responses to experimental infection have been achieved using animal models, including inbred mouse models that are classed as resistant (cornea heals) vs. susceptible (cornea perforates). Evidence has shown that sustained IL-12-driven IFN-gamma production in dominant Th1 responder strains such as C57BL/6 (B6) contributes to corneal destruction and perforation. In contrast, in Th2-responder BALB/c mice, IL-18-driven IFN-gamma production regulates bacterial killing with less corneal destruction. IL-1 and chemotactic cytokines (e.g., MIP-2) recruit PMN to the cornea. The critical role of these cells in the innate immune response and their regulation after bacterial infection has been established. The studies provide a better understanding of the regulatory mechanisms that operate in the cornea after P. aeruginosa challenge, determining susceptibility vs. resistance to disease, and are consistent with long-term goals of providing targets for better treatment of disease.

  10. Dietary apigenin attenuates the development of atopic dermatitis-like skin lesions in NC/Nga mice.

    PubMed

    Yano, Satomi; Umeda, Daisuke; Yamashita, Shuya; Yamada, Koji; Tachibana, Hirofumi

    2009-11-01

    One of the flavones, apigenin has various physiological functions including anti-inflammatory activities. Atopic dermatitis (AD) is a chronically relapsing inflammatory disorder that is characterized by pruritic and eczematous skin lesions. To evaluate the anti-allergic effect of apigenin in vivo, we examined the effect of dietary apigenin on picrylchloride (PiCl)-induced AD-like pathology in NC/Nga mice. NC/Nga mice were fed experimental diets containing apigenin from Day 18 after sensitized with PiCl for 4 weeks. Dietary apigenin significantly alleviated the development of skin lesions, accompanied by lower serum immunoglobulin (Ig) G1 and IgE levels in NC/Nga mice. Interferon (IFN)-gamma mRNA expression level in spleen cells from NC/Nga mice was reduced by apigenin feeding. Moreover, interleukin 4-induced signal transducers and activators of transcription 6 phosphorylation in primary spleen cells from BALB/c mice was inhibited by treatment with apigenin. These results suggest that apigenin attenuates exacerbation of AD-like symptoms in part through the reduction of serum IgE level and IFN-gamma expression in NC/Nga mice.

  11. [Effect of corticosteroids on the balance of Th cytokines in patients with systemic lupus erythematosus].

    PubMed

    Xie, Hong-fu; Li, Jie; Shi, Wei

    2002-12-28

    To investigate the levels of Th cell-derived cytokines and the effect of corticosteroids on the balance of Th1/Th2 cytokines in patients with systemic lupus erythematosus (SLE). Fifty-eight SLE patients were treated with corticosteroids. Their IFN-gamma, IL-4 and IL-10 levels were detected by ELISA before and after the treatment with corticosteroids respectively; and the SLEDAI scores of the patients were compared before and after the treatment. Before the treatment, the serum levels of IFN-gamma, IL-4 and IL-10 were higher than those of the healthy controls (P < 0.05). After the treatment with corticosteroids, the elevated levels of IFN-gamma, IL-4 and IL-10 in the SLE patients were all significantly reduced than those before the treatment (P < 0.05). At the same time, the SLEDAI scores were significantly lower than those before the treatment (P < 0.01). The serum level of IFN-gamma was significantly decreased in the patients with SLE compared with the healthy controls (P < 0.05). By contrast, the levels of IL-4 and IL-10 of the patients with SLE were significantly increased compared with the healthy controls (P < 0.05). Corticosteroids may induce a shift from the Th1 to Th2 profile of cytokine secretion. This may be one aspect of the mechanisms for corticosteroids treatment.

  12. Type I and type II interferons upregulate functional type I interleukin-1 receptor in a human fibroblast cell line TIG-1.

    PubMed

    Takii, T; Niki, N; Yang, D; Kimura, H; Ito, A; Hayashi, H; Onozaki, K

    1995-12-01

    The regulation of type I interleukin-1 receptor (IL-1R) expression by type I, interferon (IFN)-alpha A/D, and type II IFN, IFN-gamma, in a human fibroblast cell line TIG-1 was investigated. After 2 h stimulation with human IFN-alpha A/D or IFN-gamma, the levels of type I IL-1R mRNA increased. We previously reported that IL-1 upregulates transcription and cell surface molecules of type I IL-1R in TIG-1 cells through induction of prostaglandin (PG) E2 and cAMP accumulation. However, indomethacin was unable to inhibit the effect of IFNs, indicating that IFNs augment IL-1R expression through a pathway distinct from that of IL-1. The augmentation was also observed in other fibroblast cell lines. Nuclear run-on assays and studies of the stability of mRNA suggested that the increase in IL-1R mRNA was a result of the enhanced transcription of IL-1R gene. Binding studies using 125I-IL-1 alpha revealed that the number of cell surface IL-1R increased with no change in binding affinity by treatment with these IFNs. Pretreatment of the cells with IFNs enhanced IL-1-induced IL-6 production, indicating that IFNs upregulate functional IL-1R. IL-1 and IFNs are produced by the same cell types, as well as by the adjacent different cell types, and are concomitantly present in lesions of immune and inflammatory reactions. These results therefore suggest that IFNs exhibit synergistic effects with IL-1 through upregulation of IL-1R. Augmented production of IL-6 may also contribute to the reactions.

  13. CXC ligand 9 response to malaria during pregnancy is associated with low-birth-weight deliveries.

    PubMed

    Dong, Shu; Kurtis, Jonathan D; Pond-Tor, Sunthorn; Kabyemela, Edward; Duffy, Patrick E; Fried, Michal

    2012-09-01

    Placental infection with Plasmodium falciparum is associated with increased levels of proinflammatory cytokines, including tumor necrosis factor alpha (TNF-α) and gamma interferon (IFN-γ), and previous studies have associated increased levels of these cytokines with low birth weight (LBW), especially for malaria-infected primigravidae. To define the contribution of TNF-α and IFN-γ networks to placental-malaria-associated LBW, we measured chemokines induced by TNF-α and IFN-γ and related them to birth weight in a birth cohort of 782 mother-infant pairs residing in an area of P. falciparum holoendemicity in Tanzania. Among primigravidae, levels of CCL2, CXC ligand 9 (CXCL9), and CXCL13 were significantly higher during malaria infection in both the placenta and peripheral blood. Placental CXCL9 and CXCL13 levels were also higher in placental blood from secundigravidae and multigravidae. In multivariate analyses adjusted for known predictors of birth weight, malaria-infected primigravidae with placental CXCL9 levels in the lowest tertile gave birth to babies who weighed 610 g more than babies born to mothers with high CXCL9 levels. CXCL9 expression is induced by IFN-γ, and the strong association between birth weight and placental CXCL9 is consistent with previous observations relating IFN-γ to poor pregnancy outcomes.

  14. Localization of the human indoleamine 2,3-dioxygenase (IDO) gene to the pericentromeric region of human chromosome 8

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Burkin, D.J.; Jones, C.; Kimbro, K.S.

    1993-07-01

    Indoleamine 2,3-dioxygenase (IDO) is the first enzyme in the catabolic pathway for tryptophan. This extrahepatic enzyme differs from the hepatic enzyme, tryptophan 2,3-dioxygenase (TDO), in molecular as well as enzymatic characteristics, although both enzymes catalyze the same reaction: cleavage of tryptophan into N-formylkynurenine. The induction of IDO by IFN-[gamma] plays a role in the antigrowth effect of IFN-[gamma] in cell cultures and in the inhibition of intracellular pathogens, e.g., Toxoplasma gondii and Chlamydia psittaci. Tryptophan is also the precursor for the synthesis of serotonin, and reduced levels of tryptophan and serotonin found in AIDS patients have been correlated with themore » presence of IFN-[gamma] and consequent elevation of IDO activity. The IDO enzyme has been purified and characterized, and its cDNA and genomic DNA clones have been isolated and analyzed. DNA from hybrid cells containing fragments of human chromosome 8 was used to determine the regional localization of the IDO gene on chromosome 8. The hybrids R30-5B and R30-2A contain 8p11 [yields] qter and 8q13 [yields] qter, respectively. Hybrid 229-3A contains the 8pter [yields] q11. The hybrid R30-2A was negative for the IDO gene, whereas R30-5B and 229-3A were positive as analyzed by PCR and verified by Southern blotting. Only the region close to the centromere is shared by R30-5B and 229-3A hybrids. The results indicate that the IDO gene is located on chromosome 8p11 [yields] q11.« less

  15. Association of CMV-Specific T Cell-Mediated Immunity with CMV DNAemia and Development of CMV Disease in HIV-1-Infected Individuals.

    PubMed

    Aichelburg, Maximilian C; Weseslindtner, Lukas; Mandorfer, Mattias; Strassl, Robert; Rieger, Armin; Reiberger, Thomas; Puchhammer-Stöckl, Elisabeth; Grabmeier-Pfistershammer, Katharina

    2015-01-01

    Among HIV-1-infected individuals, cytomegalovirus (CMV) reactivation and disease occur in the setting of advanced immunosuppression. The value of a standardized assessment of CMV-specific T-cell mediated immunity by the CMV QuantiFERON assay (CMV-QFT) has not yet been thoroughly investigated in HIV-1-infected subjects. Prospective, longitudinal study in 153 HIV-1-infected subjects with a CD4+ T cell count < 350/μL who simultaneously underwent CMV-QFT, CMV serology testing and CMV-DNA quantification. Factors associated with CMV-QFT were evaluated. Clinical screening for CMV manifestations was then performed every 3 months. Among the 141 CMV IgG-seropositive individuals the CMV-QFT assay yielded reactive results in 84% (118/141), negative results in 15% (21/141) and indeterminate (negative mitogen IFN-gamma response) results in 1% (2/141) of subjects. The mean actual CD4+ T cell count was significantly higher in CMV-QFT reactive subjects, when compared to CMV-QFT non-reactive individuals (183 ± 102 vs. 126 ± 104 cells/μL, P = 0.015). A significantly lower proportion of CMV-QFT reactive vs. non-reactive patients displayed CMV DNAemia > 100 copies/mL (23% (27/118) vs. 48% (11/23), P = 0.02). Furthermore, a statistically significant inverse association between mitogen IFN-gamma response and CMV-DNAemia > 1000 copies/mL was observed (P < 0.001). During the observational period, 5 CMV end-organ manifestations were observed. In three of the CMV cases the CMV-QFT yielded indeterminate results. While CMV-QFT reactivity indicates CMV-specific immunity, indeterminate results due to negative mitogen IFN-gamma response might reflect HIV-1-induced immunodeficiency. Thus, dependency upon CD4+ T cell count should be considered when interpreting CMV-QFT results.

  16. Effect of ultrafine zinc oxide (ZnO) nanoparticles on induction of oral tolerance in mice.

    PubMed

    Matsumura, Misa; Takasu, Nobuo; Nagata, Masafumi; Nakamura, Kazuichi; Kawai, Motoyuki; Yoshino, Shin

    2010-01-01

    Ultrafine nanoparticles of zinc oxide (ZnO) recently became available as a substitute for larger-size fine ZnO particles. However, the biological activity of ultrafine ZnO currently remains undefined. In the present study, we investigated the effect of ultrafine ZnO on oral tolerance that plays an important role in the prevention of food allergy. Oral tolerance was induced in mice by a single oral administration (i.e., gavage) of 25 mg of ovalbumin (OVA) 5 days prior to a subcutaneous immunization with OVA (Day 0). Varying doses of ultrafine (diameter: approximately 21 nm) as well as fine (diameter: < 5 microm) ZnO particles were given orally at the same time during the OVA gavage. The results indicated that a single oral administration of OVA was followed by significant decreases in serum anti-OVA IgG, IgG(1), IgG(2a), and IgE antibodies and in the proliferative responses to the antigen by these hosts' spleen cells. The decreases in these immune responses to OVA were associated with a marked suppression of secretion of interferon (IFN)gamma, interleukin (IL)-5, and IL-17 by these lymphoid cells. Treatment with either ultrafine or fine ZnO failed to affect the oral OVA-induced suppression of antigen-specific IgG, IgG(1), IgG(2a), and IgE production or lymphoid cell proliferation. The suppression induced by the oral OVA upon secretion of IFN gamma, IL-5, and IL-17 was also unaffected by either size of ZnO. These results indicate that ultrafine particles of ZnO do not appear to modulate the induction of oral tolerance in mice.

  17. Electrochemical impedance spectroscopy based-on interferon-gamma detection

    NASA Astrophysics Data System (ADS)

    Li, Guan-Wei; Kuo, Yi-Ching; Tsai, Pei-I.; Lee, Chih-Kung

    2014-03-01

    Tuberculosis (TB) is an ancient disease constituted a long-term menace to public health. According to World Health Organization (WHO), mycobacterium tuberculosis (MTB) infected nearly a third of people of the world. There is about one new TB occurrence every second. Interferon-gamma (IFN-γ) is associated with susceptibility to TB, and interferongamma release assays (IGRA) is considered to be the best alternative of tuberculin skin test (TST) for diagnosis of latent tuberculosis infection (LTBI). Although significant progress has been made with regard to the design of enzyme immunoassays for IFN-γ, adopting this assay is still labor-intensive and time-consuming. To alleviate these drawbacks, we used IFN-γ antibody to facilitate the detection of IFN-γ. An experimental verification on the performance of IGRA was done in this research. We developed two biosensor configurations, both of which possess high sensitivity, specificity, and rapid IFN-γ diagnoses. The first is the electrochemical method. The second is a circular polarization interferometry configuration, which incorporates two light beams with p-polarization and s-polarization states individually along a common path, a four photo-detector quadrature configuration to arrive at a phase modulated ellipsometer. With these two methods, interaction between IFN-γ antibody and IFN-γ were explored and presented in detail.

  18. Induction of persistent in vivo resistance to Mycobacterium avium infection in BALB/c mice injected with interleukin-18-secreting fibroblasts.

    PubMed

    Chung, Su W; Choi, Sang H; Kim, Tae S

    2004-01-02

    Interferon-gamma (IFN-gamma) is closely associated with the generation of cell-mediated immunity and resistance to intracellular parasites. Interleukin-18 (IL-18) is known to strongly induce IFN-gamma production by T cells and natural killer (NK) cells. To determine whether the paracrine secretion of IL-18 can efficiently stimulate the resistance to Mycobacterium avium complex (MAC) infection, 3T3 fibroblasts were stably transfected to secrete bioactive IL-18 and their effects on MAC infection were investigated in genetically susceptible BALB/c mice, compared with that of free recombinant IL-18. Immunization with IL-18-secreting fibroblasts (3T3/IL-18) during intranasal infection with MAC resulted in a significant decrease in bacterial load of lung during the entire 8-week observation period, while rIL-18 reduced the bacterial load at initial 1 week but not by 8 weeks postinfection. Immunization with the 3T3/IL-18 cells induced and maintained significantly higher levels of cytotoxic activity and nitric oxide production by lung cells than those of rIL-18 immunization. Furthermore, lung cells in mice injected with the 3T3/IL-18 cells showed persistent production of IFN-gamma throughout the 8-week period, suggesting that the 3T3/IL-18 cells induced the resistance to MAC infection via IFN-gamma production. This work suggests that IL-18-secreting fibroblasts may serve as a vehicle for paracrine secretion of IL-18 in immunotherapy of MAC infection.

  19. Effects of cytokines on the pituitary-adrenal axis in cancer patients.

    PubMed

    Nolten, W E; Goldstein, D; Lindstrom, M; McKenna, M V; Carlson, I H; Trump, D L; Schiller, J; Borden, E C; Ehrlich, E N

    1993-10-01

    Cytokines, which include interferons (IFNs), interleukins (ILs), and tumor necrosis factor (TNF), are immunoregulatory proteins produced by lymphocytes and inflammatory cells. Several cytokines, most noteworthy IFNs and ILs, stimulate glucocorticoid secretion. In this study, the effects of variable doses and repetitive administration of IFNs and TNF on secretion of pituitary hormones and cortisol were measured. Patients were given for a period of 15 days on alternating days injections of IFN-beta (IFN-beta ser), 90 or 450 x 10(6) IU, IFN-gamma, 0.1-100 x 10(6) IU, or TNF 125-275 micrograms/m2. Sixty to 120 min after IFN-beta ser injection median levels of cortisol, adrenocorticotropin (ACTH), prolactin (PRL), and growth hormone (GH) rose two-fold. Urinary free cortisol excretion increased significantly during the day following IFN-beta ser administration. IFN-gamma > or = 30 x 10(6) IU caused a comparable rise in plasma cortisol. TNF induced two- to four-fold increases in ACTH and cortisol. The fact that increased cortisol secretion was associated with a rise in the level of ACTH as well as PRL and GH suggests that the cytokines increased cortisol by stimulating the anterior pituitary. The hormonal response induced by cytokines was unrelated to their pyrogenic effect, undiminished with repetitive treatment, and not dose-dependent above a threshold level. These observations reinforce the concept of a physiologic link between the immune system and the hypothalamic-pituitary-adrenal (HPA) axis.

  20. Anti-atopic dermatitis effects and the mechanism of lactic acid bacteria isolated from Mongolian fermented milk.

    PubMed

    Hayashi, Atsushi; Kimura, Makoto; Nakamura, Yusaku; Yasui, Hisako

    2009-05-01

    We investigated the anti-allergic effects of one strain (T120) of a lactic acid bacteria (LAB) isolated from Mongolian fermented milk using atopic dermatitis (AD) model mice (NC/Nga mice). Strain T120 has already been identified as Enterococcus faecium and shown to induce strong production of IL-12 (Kimura et al. 2006). In in vitro studies, strain T120 suppressed total IgE production and induced IL-12 and IFN-gamma production by splenocytes of NC/Nga mice. The additional examination of various neutralization antibodies was performed to elucidate in detail the mechanism of depressed IgE production by strain T120. As a result, it became clear that IL-12 induced by strain T120 increased production of IFN-gamma and total IgE production was mainly controlled by the IFN-gamma. In order to define the cells which produce IL-12 powerfully by this strain, antigen-presenting cells (APCs) such as macrophages and dendritic cells (DCs) were removed from the splenocytes, and the reactivity of these cells to the strain was examined. Induction of IL-12 and IFN-gamma by strain T120 became significantly very low by removal of APCs from splenocytes. Therefore, it was clear that strain T120 acted on APCs and induced production of IL-12. Further, this strain enhanced the production of IL-10 by splenocytes. In in vivo studies, intraperitoneal injection of strain T120 inhibited serum IgE elevation and atopic dermatitis symptoms in NC/Nga mice. These results suggest that an anti-allergic effect of strain T120 depends on the increased production of IL-12 by APCs activated by the strain and following the increased production of IFN-gamma. Further, activation of regulatory T cells by strain T120 may inhibit atopic disease.

  1. Increased Th1 and Th2 allergen-induced cytokine responses in children with atopic disease.

    PubMed

    Smart, J M; Kemp, A S

    2002-05-01

    Polyclonal cytokine responses following stimulation of T cells with mitogens or superantigens provides information on cytokine production from a wide range of T cells. Alternatively allergen-induced T cell responses can provide information on cytokine production by allergen-reactive T cells. While there is evidence of increased Th2 and reduced Th1 cytokine production following T cell stimulation with non-specific mitogens and superantigens, the evidence that Th1 cytokine production to allergens is decreased in line with a postulated imbalance in Th1/Th2 responses is unclear, with studies finding decreased, no difference or increased IFN-gamma responses to allergens in atopic subjects. To examine childhood polyclonal and allergen-induced cytokine responses in parallel to evaluate cytokine imbalances in childhood atopic disease. PBMC cytokine responses were examined in response to a polyclonal stimulus, staphylococcal superantigen (SEB), in parallel with two inhalant allergens, house dust mite (HDM) and rye grass pollen (RYE), and an ingested allergen, ovalbumin (OVA), in (a) 35 healthy children (non-atopic) and (b) 36 children with atopic disease (asthma, eczema and/or rhinitis) (atopic). Atopic children had significantly reduced IFN-gamma and increased IL-4 and IL-5 but not IL13 production to SEB superantigen stimulation when compared with non-atopic children. HDM and RYE allergens stimulated significantly increased IFN-gamma, IL-5 and IL-13, while OVA stimulated significantly increased IFN-gamma production in atopic children. We show that a polyclonal stimulus induces a reduced Th1 (IFN-gamma) and increased Th2 (IL-4 and IL-5) cytokine pattern. In contrast, the allergen-induced cytokine responses in atopic children were associated with both increased Th1 (INF-gamma) and Th2 (IL-5 and IL-13) cytokine production. The increased Th1 response to allergen is likely to reflect prior sensitization and indicates that increases in both Th1 and Th2 cytokine production to allergens exists concomitantly with a decreased Th1 response to a polyclonal stimulus in atopic children.

  2. A randomized, double-blind, phase I/II trial of tumor necrosis factor and interferon-gamma for treatment of AIDS-related complex (Protocol 025 from the AIDS Clinical Trials Group).

    PubMed

    Agosti, J M; Coombs, R W; Collier, A C; Paradise, M A; Benedetti, J K; Jaffe, H S; Corey, L

    1992-05-01

    To determine safety and efficacy of tumor necrosis factor (TNF) and interferon-gamma (IFN gamma) in the treatment of patients with acquired immunodeficiency syndrome (AIDS)-related complex, a randomized, double-blind study was conducted. Twenty-five patients with AIDS-related complex and CD4 lymphocytes less than or equal to 500 x 10(6)/L attended an AIDS Clinical Trials Unit of a tertiary referral center. Patients were administered tumor necrosis factor (TNF) (10 micrograms/m2) or IFN gamma (10 micrograms/m2), or both intramuscularly three times weekly for 16 weeks. Side effects from all three preparations included fever, constitutional symptoms, and local reactions. No significant hematologic, hepatic, renal, or coagulation abnormalities were observed. CD4 lymphocyte counts, beta 2-microglobulin, p24 antigen levels, and anti-p24 antibody did not change significantly during therapy. Similarly, no significant change was noted in rates of HIV isolation from peripheral blood mononuclear cells or plasma. TNF and IFN gamma were tolerable after premedication with acetaminophen; however, no significant change in markers of human immunodeficiency virus infection was demonstrated. These cytokines alone do not appear to be of benefit, nor do they appear to hasten the progression of HIV infection.

  3. Immunomodulatory effects of the herbicide propanil on cytokine production in humans: In vivo and in vitro exposure

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Corsini, Emanuela; Codeca, Ilaria; Mangiaratti, Simona

    Propanil, 3,4-dichloropropionanilide, a commonly used herbicide, has been shown to induce effects on the mouse immune system. The aim of this study was to assess the immunotoxicity of propanil in occupationally exposed agricultural workers and to characterize its molecular mechanism of action. Seven agricultural workers intermittently exposed to propanil and 7 healthy matched controls entered the study. Data were collected through physical examination, and laboratory investigations addressed at the main serum, cellular, and functional immune parameters. The levels of exposure were assessed by determining the urine concentration of the major propanil metabolite, 3,4-dichloroaniline. The investigation of serum, cellular, and functionalmore » immune parameters suggested that propanil exposure results in a modest immunomodulatory effect, characterized by an increase in the plasma level of IgG{sub 1} and in LPS-induced IL-6 release and, by a reduction in PHA-induced IL-10 and IFN release, associated with a reduced IFN/IL-4 ratio. As observed, following in vivo exposure, in vitro treatment of human peripheral blood leukocytes with propanil resulted in a dose-dependent reduction in PHA-induced IFN-gamma and IL-10 production, while LPS-induced TNF-{alpha} production was not affected indicating a direct effect of propanil on selected immune parameters. We demonstrated that propanil interfering with PHA-induced intracellular calcium increase modulated IL-10 and IFN-gamma transcription and translation, which indicates that propanil acts on early events triggered by PHA. Overall, our results suggest that human exposure to propanil has slight immunomodulatory effects, and point out that the inhibition of the PHA-induced intracellular calcium rise is an important target of propanil. These findings improve our understanding of the mechanism underlying propanil-induced immunotoxicity.« less

  4. Nasal tolerance in experimental autoimmune myasthenia gravis (EAMG): induction of protective tolerance in primed animals

    PubMed Central

    Shi, F -D; Bai, X -F; LI, H -L; Huang, Y -M; Van Der Meide, P H; Link, H

    1998-01-01

    Nasal administration of μg doses of acetylcholine receptor (AChR) is effective in preventing the development of B cell-mediated EAMG in the Lewis rat, a model for human MG. In order to investigate whether nasal administration of AChR modulates ongoing EAMG, Lewis rats were treated nasally with AChR 2 weeks after immunization with AChR and Freund's complete adjuvant. Ten-fold higher amounts of AChR given nasally (600 μg/rat) were required to ameliorate the manifestations of EAMG compared with the amounts necessary for prevention of EAMG. In lymph node cells from rats receiving 600 μg/rat of AChR, AChR-induced proliferation and interferon-gamma (IFN-γ) secretion were reduced compared with control EAMG rats receiving PBS only. The anti-AChR antibodies in rats treated nasally with 600 μg/rat of AChR had lower affinity, reduced proportion of IgG2b and reduced capacity to induce AChR degradation. Numbers of AChR-reactive IFN-γ and tumour necrosis factor-alpha (TNF-α) mRNA-expressing lymph node cells from rats treated nasally with 600 μg/rat of AChR were suppressed, while IL-4, IL-10 and transforming growth factor-beta (TGF-β) mRNA-expressing cells were not affected. Collectively, these data indicate that nasal administration of AChR in ongoing EAMG induced selective suppression of Th1 functions, i.e. IFN-γ and IgG2b production, but no influence on Th2 cell functions. The impaired Th1 functions may result in the production of less myasthenic anti-AChR antibodies and contribute to the amelioration of EAMG severity in rats treated with AChR 600 μg/rat by the nasal route. PMID:9528890

  5. Immunological tolerance induced by galectin-1 in rat allogeneic renal transplantation.

    PubMed

    Xu, Gaosi; Tu, Weiping; Xu, Chengyun

    2010-06-01

    The existed literatures indicated that galectin-1 has anti-inflammatory effects and plays a pivotal role in autoimmune diseases. Present study was to identify the roles of galectin-1 in acute animal renal allograft rejection. Rat acute rejection models were erected by allogeneic renal transplantation. Galectin-1 injection was performed in different concentrations in renal recipients post-transplantation. Recipient survivals, CD8+ T cell proliferation, production of IFN-gamma, levels of serum CD30, enzyme-linked immunoabsorbent spot assay (ELISPOT) and immunohistochemistry were observed or tested 7days after renal transplantation. Galectin-1 injection can prolong the recipient animal survival, reduce the serum levels of IFN-gamma, soluble CD30, percentage of CD8+ T cell subset, CD8+ T cell-mediated cytotoxicity, and IFN-gamma ELISPOT frequency for allograft recipients. The therapeutic effects of galectin-1 injection on recipient rats were dose-dependent. Galectin-1 plays an important role in CD8+ T cell-mediated renal rejection by inducing immunological tolerance. Copyright 2010 Elsevier B.V. All rights reserved.

  6. Coxsackievirus B3 vaccines: use as an expression vector for prevention of myocarditis.

    PubMed

    Henke, Andreas; Jarasch, Nadine; Wutzler, Peter

    2008-12-01

    Coxsackievirus B3 (CVB3), a member of the Picornaviridae family, is considered to be one of the most important infectious agents to cause virus-induced myocarditis. Despite improvements in studying virus pathology, structure and molecular biology, as well as the diagnosis of this disease, there is still no virus-specific drug or vaccine in clinical use. During the last 20 years many investigations have been performed to develop classic and modern immunization techniques against CVB3-induced heart disease. One promising approach among others includes the insertion of coding sequences of cytokines into the viral genome. The application of an IFN-gamma-expressing recombinant coxsackievirus vector is especially efficient against CVB3-induced myocarditis. Beside direct IFN-gamma-mediated antiviral effects, the local and simultaneous expression of IFN-gamma by the virus itself activates the immune system in a strong and long-lasting manner, which protects animals completely against subsequent lethal infections independently of the age of the immunized individual and the route of vaccine administration.

  7. Immunodominant epitopes in herpes simplex virus type 2 glycoprotein D are recognized by CD4 lymphocytes from both HSV-1 and HSV-2 seropositive subjects.

    PubMed

    Kim, Min; Taylor, Janette; Sidney, John; Mikloska, Zorka; Bodsworth, Neil; Lagios, Katerina; Dunckley, Heather; Byth-Wilson, Karen; Denis, Martine; Finlayson, Robert; Khanna, Rajiv; Sette, Alessandro; Cunningham, Anthony L

    2008-11-01

    In human recurrent cutaneous herpes simplex, there is a sequential infiltrate of CD4 and then CD8 lymphocytes into lesions. CD4 lymphocytes are the major producers of the key cytokine IFN-gamma in lesions. They recognize mainly structural proteins and especially glycoproteins D and B (gD and gB) when restimulated in vitro. Recent human vaccine trials using recombinant gD showed partial protection of HSV seronegative women against genital herpes disease and also, in placebo recipients, showed protection by prior HSV1 infection. In this study, we have defined immunodominant peptide epitopes recognized by 8 HSV1(+) and/or 16 HSV2(+) patients using (51)Cr-release cytotoxicity and IFN-gamma ELISPOT assays. Using a set of 39 overlapping 20-mer peptides, more than six immunodominant epitopes were defined in gD2 (two to six peptide epitopes were recognized for each subject). Further fine mapping of these responses for 4 of the 20-mers, using a panel of 9 internal 12-mers for each 20-mers, combined with MHC II typing and also direct in vitro binding assay of these peptides to individual DR molecules, showed more than one epitope per 20-mers and promiscuous binding of individual 20-mers and 12-mers to multiple DR types. All four 20-mer peptides were cross-recognized by both HSV1(+)/HSV2(-) and HSV1(-)/HSV2(+) subjects, but the sites of recognition differed within the 20-mers where their sequences were divergent. This work provides a basis for CD4 lymphocyte cross-recognition of gD2 and possibly cross-protection observed in previous clinical studies and in vaccine trials.

  8. Genetic variants of interferon-gamma and its mRNA expression and inflammatory parameters in the pathogenesis of vitiligo.

    PubMed

    Karam, Rehab A; Zidan, Haidy E; Khater, Mohamed H

    2017-08-01

    Although genetics plays an essential role in the pathogenesis of vitiligo, vitiligo pathogenesis is still unclear. Our aim was to investigate the role of IFN-γ expression and polymorphism in vitiligo susceptibility and whether intercellular adhesion molecule-1 (ICAM-1), tumor necrosis factor (TNF)-α, and TNF-β play a role in vitiligo pathogenesis as important inflammatory parameters. Eighty-five patients with vitiligo and 90 controls were investigated for IFN-γ gene expression by quantitative real-time PCR and genotyped for IFN-γ +874T/A (rs2430561) and IFN-γ +2109A/G (rs1861494) gene polymorphisms by sequence-specific primer (SSP)-PCR and PCR-restriction fragment length polymorphism (RFLP), respectively. Serum levels of inflammatory parameters were measured using ELISA. Frequencies of the +874 TT genotype and T allele were significantly higher in patients with active vitiligo than in stable patients (P = 0.01 and 0.03, respectively). Calculation of odds ratio suggested a 1.7-fold increased risk of vitiligo in individuals having the TA haplotype. We observed overexpression of IFN-γ mRNA with elevated serum levels of IFN-γ, ICAM-1, TNF-α, and TNF-β in patients with vitiligo when compared with the control group (P = 0.001, for all). In addition, these levels were elevated in patients with active vitiligo compared with stable patients with vitiligo (P = 0.008, 0.006, 0.01, 0.01, and 0.03, respectively), which suggests the involvement of these cytokines in disease activity. In conclusion, IFN-γ is a promising immunological marker in vitiligo pathogenesis.

  9. NOD2: a potential target for regulating liver injury.

    PubMed

    Body-Malapel, Mathilde; Dharancy, Sébastien; Berrebi, Dominique; Louvet, Alexandre; Hugot, Jean-Pierre; Philpott, Dana J; Giovannini, Marco; Chareyre, Fabrice; Pages, Gilles; Gantier, Emilie; Girardin, Stephen E; Garcia, Irène; Hudault, Sylvie; Conti, Filoména; Sansonetti, Philippe J; Chamaillard, Mathias; Desreumaux, Pierre; Dubuquoy, Laurent; Mathurin, Philippe

    2008-03-01

    The recent discovery of bacterial receptors such as NOD2 that contribute to crosstalk between innate and adaptive immune systems in the digestive tract constitutes an important challenge in our understanding of liver injury mechanisms. The present study focuses on NOD2 functions during liver injury. NOD2, TNF-alpha and IFN-gamma mRNA were quantified using real-time PCR in liver samples from patients and mice with liver injury. We evaluated the susceptibility of concanavalin A (ConA) challenge in NOD2-deficient mice (Nod2-/-) compared to wild-type littermates. We tested the effect of muramyl dipeptide (MDP), the specific activator of NOD2, on ConA-induced liver injury in C57BL/6 mice. We studied the cellular distribution and the role of NOD2 in immune cells and hepatocytes. We demonstrated that NOD2, TNF-alpha and IFN-gamma were upregulated during liver injury in mice and humans. Nod2-/- mice were resistant to ConA-induced hepatitis compared to their wild-type littermates, through reduced IFN-gamma production by immune cells. Conversely, administration of MDP exacerbated ConA-induced liver injury. MDP was a strong inducer of IFN-gamma in freshly isolated human PBMC, splenocytes and hepatocytes. Our study supports the hypothesis that NOD2 contributes to liver injury via a regulatory mechanism affecting immune cells infiltrating the liver and hepatocytes. Taken together, our results indicate that NOD2 may represent a new therapeutic target in liver diseases.

  10. Inflammatory parameters in Caco-2 cells: effect of stimuli nature, concentration, combination and cell differentiation.

    PubMed

    Van De Walle, Jacqueline; Hendrickx, Aurélie; Romier, Béatrice; Larondelle, Yvan; Schneider, Yves-Jacques

    2010-08-01

    Enterocytes regulate gut maintenance and defence by secreting and responding to inflammatory mediators and by modulating the intestinal epithelial permeability. In order to develop an in vitro model of the acute phase of intestinal inflammation, Caco-2 cells were exposed to the inflammatory mediators IL-1beta, TNF-alpha, IFN-gamma and LPS, and the importance of several experimental parameters, i.e. cell differentiation, stimulus nature, concentration and combination on the inflammatory response was assessed by measuring the production of IL-6, IL-8, PGE-2 and NO and by evaluating the monolayer permeability. A maximal increase in IL-8, IL-6 and PGE-2 production and monolayer permeability was observed when using the cytokines simultaneously at their highest level, but this relied mainly on IL-1beta. The effects of TNF-alpha on IL-8 and IL-6 or NO production were stronger upon combination with IL-1beta or IFN-gamma, respectively, whereas cells were unaffected by the presence of LPS. Although NO production, induced by IFN-gamma-containing combinations, was observed only in differentiated cells, general inflammatory response was higher in proliferating cells. The use of a mixture of IL-1beta, TNF-alpha and IFN-gamma thus accurately mimics intestinal inflammatory processes, but cell differentiation and stimuli combination are important parameters to take into account for in vitro studies on intestinal inflammation. Copyright (c) 2010. Published by Elsevier Ltd.

  11. Modulation of the allergen-induced human IgE response in Hu-SCID mice: inhibitory effect of human recombinant IFN-gamma and allergen-derived lipopeptide.

    PubMed

    Duez, C; Gras-Masse, H; Hammad, H; Akoum, H; Didierlaurent, A; André, C; Tonnel, A B; Pestel, J

    2001-01-01

    We have previously established a model to study the in vivo human IgE response using humanized SCID mice. Allergic SCID mice were obtained following intraperitoneal injection with mononuclear cells from Dermatophagoides pteronyssinus (Dpt)-sensitive patients, and sensitization by Dpt allergen intraperitoneal injection (immunization) or Dpt aerosol (inhalation). Human serum IgE was measured in allergic SCID mice after administration of human recombinant IFN-gamma or the lipopeptide LP 52-71 (derived from peptide p52-71 from Der p 1, Dpt major allergen, coupled to a lipophilic moiety), during the immunization or the inhalation phase. IFN-gamma inhibited human IgE production when given at the time of immunization, but not during inhalation. This effect was long-lasting as Dpt aerosol, given one month after immunization and IFN-gamma administration, failed to increase IgE levels. Unlike Dpt or p52-71, LP 52-71 failed to induce human IgE production at day 14 and 21 after its injection, but did inhibit the development of the IgE response after a secondary Dpt-challenge. Moreover, LP 52-71 administration 14 days after Dpt inhalation decreased IgE levels, in contrast to peptide 52-71, which increased IgE levels. Thus, taken together these results indicate that the development of the human IgE response in allergic SCID mice can be modulated by modified allergen and a Th1 cytokine.

  12. Suppression of human anti-inflammatory plasma cytokines IL-10 and IL-1RA with elevation of proinflammatory cytokine IFN-gamma during the isolation of the Antarctic winter

    NASA Technical Reports Server (NTRS)

    Shearer, William T.; Lee, Bang-Ning; Cron, Stanley G.; Rosenblatt, Howard M.; Smith, E. O'Brian; Lugg, Desmond J.; Nickolls, Peter M.; Sharp, Robert M.; Rollings, Karl; Reuben, James M.

    2002-01-01

    Cellular immune function has been shown to be decreased and latent virus shedding to be increased in human beings isolated during the Antarctic winter, a model used for assessing some effects of space flight. However, the balance of proinflammatory (IFN-gamma) and anti-inflammatory (IL-10 and IL-1RA) cytokines has not previously been evaluated. We therefore sought to determine whether isolation during the Antarctic winter would alter the proinflammatory and anti-inflammatory cytokine balance. Cytokine levels were measured with ELISA in monthly plasma samples from January through September 1999 in 21 study subjects in the Antarctic and 7 control subjects on Macquarie Island. There was a significant time-dependent increase in plasma IFN-gamma (P =.039) as well as decreases in IL-10 (P =.042) and IL-1RA (P =.053) in the study subjects compared with the control subjects. The study subjects also had significantly increased plasma IFN-gamma levels (P < or =.045) but decreased IL-10 and IL-1RA levels (P < or =.036) at individual time points of isolation. Isolation of human beings in the Antarctic appears to shift the plasma cytokine balance toward a proinflammatory profile. These observations are consistent with T-cell activation that might be due to activation of latent viruses, and they could hold importance for determining the risks of space flight.

  13. Cytokine activation is predictive of mortality in Zambian patients with AIDS-related diarrhoea.

    PubMed

    Zulu, Isaac; Hassan, Ghaniah; Njobvu R N, Lungowe; Dhaliwal, Winnie; Sianongo, Sandie; Kelly, Paul

    2008-11-13

    Mortality in Zambian AIDS patients is high, especially in patients with diarrhoea, and there is still unacceptably high mortality in Zambian patients just starting anti-retroviral therapy. We set out to determine if high concentrations of serum cytokines correlate with mortality. Serum samples from 30 healthy controls (HIV seropositive and seronegative) and 50 patients with diarrhoea (20 of whom died within 6 weeks) were analysed. Concentrations of tumour necrosis factor receptor p55 (TNFR p55), macrophage migration inhibitory factor (MIF), interleukin (IL)-6, IL-12, interferon (IFN)-gamma and C-reactive protein (CRP) were measured by ELISA, and correlated with mortality after 6 weeks follow-up. Apart from IL-12, concentrations of all cytokines, TNFR p55 and CRP increased with worsening severity of disease, showing highly statistically significant trends. In a multivariable analysis high TNFR p55, IFN-gamma, CRP and low CD4 count (CD4 count <100) were predictive of mortality. Although nutritional status (assessed by body mass index, BMI) was predictive in univariate analysis, it was not an independent predictor in multivariate analysis. High serum concentrations of TNFR p55, IFN-gamma, CRP and low CD4 count correlated with disease severity and short-term mortality in HIV-infected Zambian adults with diarrhoea. These factors were better predictors of survival than BMI. Understanding the cause of TNFR p55, IFN-gamma and CRP elevation may be useful in development of interventions to reduce mortality in AIDS patients with chronic diarrhoea in Africa.

  14. High frequencies of circulating IFN-gamma-secreting CD8 cytotoxic T cells specific for a novel MHC class I-restricted Mycobacterium tuberculosis epitope in M. tuberculosis-infected subjects without disease.

    PubMed

    Pathan, A A; Wilkinson, K A; Wilkinson, R J; Latif, M; McShane, H; Pasvol, G; Hill, A V; Lalvani, A

    2000-09-01

    MHC class I-restricted CD8 cytotoxic T lymphocytes (CTL) are essential for protective immunity to Mycobacterium tuberculosis in animal models but their role in humans remains unclear. We therefore studied subjects who had successfully contained M. tuberculosis infection in vivo, i.e. exposed healthy household contacts and individuals with inactive self-healed pulmonary tuberculosis. Using the ELISPOT assay for IFN-gamma, we screened peptides from ESAT-6, a secreted antigen that is highly specific for M. tuberculosis. We identified a novel nonamer epitope: unstimulated peripheral blood-derived CD8 T cells displayed peptide-specific IFN-gamma release ex vivo while CD8 T cell lines and clones exhibited HLA-A68.02-restricted cytolytic activity and recognized endogenously processed antigen. The frequency of CD8 CTL specific for this single M. tuberculosis epitope, 1/2500 peripheral blood lymphocytes, was equivalent to the combined frequency of all IFN-gamma-secreting purified protein derivative-reactive T cells ex vivo. This highly focused CTL response was maintained in an asymptomatic contact over 2 years and is the most potent antigen-specific antimycobacterial CD8 CTL response hitherto described. Thus, human M. tuberculosis-specific CD8 CTL are not necessarily associated with active disease per se. Rather, our results are consistent with a protective role for these ESAT-6-specific CD8 T cells in the long-term control of M. tuberculosis in vivo in humans.

  15. Role of interleukin 12 in experimental neonatal sepsis caused by group B streptococci.

    PubMed Central

    Mancuso, G; Cusumano, V; Genovese, F; Gambuzza, M; Beninati, C; Teti, G

    1997-01-01

    Cytokines are suspected to play an important role in systemic infections by group B streptococci (GBS), an important cause of neonatal sepsis. This work was undertaken to determine if interleukin 12 (IL-12) is produced in mouse pups infected with GBS and has a role in this sepsis model. IL-12 elevations were measured by both an enzyme-linked immunosorbent assay and a bioassay in plasma samples obtained from 12 to 72 h after GBS challenge. Pretreatment with neutralizing anti-IL-12 antibodies significantly increased lethality and blood CFU (P < 0.05). Conversely, either prophylactically or therapeutically administered recombinant IL-12 (rIL-12) significantly improved survival time and decreased blood CFU. Since these beneficial effects were associated with increased spleen gamma interferon (IFN-gamma) production, we examined whether the latter cytokine mediated the observed rIL-12 effects. Pretreatment with neutralizing anti-IFN-gamma monoclonal antibodies significantly counteracted the beneficial effects of rIL-12 on lethality. Our data indicate that rIL-12 is a possible candidate for treatment of GBS sepsis and that its activities in this model are at least partially mediated by IFN-gamma. PMID:9284145

  16. Anticryptococcal effect of amphotericin B is mediated through macrophage production of nitric oxide.

    PubMed Central

    Tohyama, M; Kawakami, K; Saito, A

    1996-01-01

    Amphotericin B (AmB) is a classical antifungal drug and one of the most effective antifungal drugs for the treatment of systemic fungal infection. It is also known to have various immunomodulating activities other than its direct antifungal effect. In the present study, we demonstrated that AmB augmented gamma interferon (IFN-gamma)-induced killing potentials of murine peritoneal macrophages against Cryptococcus neoformans in a dose-dependent manner. This effect was strongly blocked by NG-monomethyl-L-arginine, a competitive inhibitor of nitric oxide (NO) synthesis. In addition, AmB markedly augmented macrophage NO production induced by IFN-gamma with a dose-response curve similar to that seen with its effect on the anticryptococcal activity. These effects were partially mediated by either tumor necrosis factor alpha or interleukin-1, because AmB enhanced IFN-gamma-induced production of these cytokines by macrophages and their specific antibodies partially inhibited the AmB-induced enhancement of NO generation when they were used separately. Our results indicate that AmB induces the production of tumor necrosis factor alpha and IL-1 by macrophages and augments their anticryptococcal activity through triggering the NO-dependent pathway. PMID:8843304

  17. Evaluating pleural ADA, ADA2, IFN-γ and IGRA for diagnosing tuberculous pleurisy.

    PubMed

    Keng, Li-Ta; Shu, Chin-Chung; Chen, Jason Yao-Ping; Liang, Sheng-Kai; Lin, Ching-Kai; Chang, Lih-Yu; Chang, Chia-Hao; Wang, Jann-Yuan; Yu, Chong-Jen; Lee, Li-Na

    2013-10-01

    Conventional methods for diagnosing tuberculous pleurisy (TB pleurisy) are either invasive or have a long turn-around-time. Performances of pleural adenosine deaminase (ADA), ADA2, interferon-gamma (IFN-γ), and interferon-gamma release assays (IGRA) as diagnostic tools for TB pleurisy were evaluated. Eighty-eight patients with lymphocyte-predominant pleural exudates between June 2010 and March 2011, including 31 with clinically diagnosed TB pleurisy, were prospectively studied. Pleural ADA and ADA2 activity were measured by colorimetric method, IFN-γ levels by enzyme-linked immuno-sorbent assay, and IGRA by enzyme-linked immuno-spot (T-SPOT.TB) assay. Pleural ADA, ADA2, and IFN-γ levels, but not the proportion of positive T-SPOT.TB assay, were significantly higher in patients with TB pleurisy than in those without TB pleurisy. The area under the receiver-operating-characteristic (ROC) curve was 0.920, 0.893, 0.875, and 0.544 for IFN-γ, ADA2, ADA, and T-SPOT.TB assay, respectively. The combination of ADA ≥ 40 IU/L and IFN-γ ≥ 75 pg/mL yielded a specificity of 100%. Pleural ADA, ADA2 and IFN-γ, but not T-SPOT.TB assay, are all sensitive and specific for TB pleurisy. In patients with lymphocyte-predominant pleural exudates, ADA ≥ 40 IU/L and IFN-γ ≥ 75 pg/mL in pleural effusion imply a very high probability of TB pleurisy. Copyright © 2013 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

  18. Effect of proinflammatory cytokines on PIGA- hematopoiesis.

    PubMed

    Kulkarni, Shashikant; Bessler, Monica

    2003-09-01

    Blood cells from patients with paroxysmal nocturnal hemoglobinuria lack glycosyl phosphatidylinositol (GPI)-linked proteins, due to a somatic mutation in the X-linked PIGA gene. It is believed that clonal expansion of PIGA- blood cells is due to a survival advantage in the hostile marrow environment of aplastic anemia. Here we investigated the effects of inhibitory cytokines in mice genetically engineered to have blood cells deficient in GPI-linked proteins. The effect of inhibitory cytokines (tumor necrosis factor-alpha [TNF-alpha], interferon-gamma [IFN-gamma], macrophage inflammatory protein-1 alpha [MIP-1alpha], and transforming growth factor-beta1 [TGF-beta1]) was investigated, using clonogenic assays, competitive repopulation, and in vivo induction of proinflammatory cytokines by double-stranded RNA. The expression of Fas on progenitor cells and its up-regulation by inhibitory cytokines were analyzed by flow cytometry. TNF-alpha, IFN-gamma, MIP-1alpha, and TGF-beta1 suppressed colony formation in a dose-dependent fashion that was similar for PIGA+ and PIGA- blood bone marrow cells. Competitive repopulation of bone marrow cells cultured in IFN-gamma and TNF-alpha resulted in a comparable ability of PIGA+ and PIGA- hematopoietic stem cells to reconstitute hematopoiesis. Fas expression was minimal on PIGA+ and PIGA- progenitor cells and was up-regulated to the same extent in response to IFN-gamma and TNF-alpha as assessed by Fas antibody-mediated apoptosis. Similarly, in vivo induction of proinflammatory cytokines by double-stranded RNA had no effect on the proportion of circulating PIGA- blood cells. These results indicate that PIGA+ and PIGA- hematopoietic progenitor cells respond similarly to inhibitory cytokines, suggesting that other factors are responsible for the clonal expansion of paroxysmal nocturnal hemoglobinuria cells.

  19. Preventive effects of Schistosoma japonicum ova on trinitrobenzenesulfonic acid-induced colitis and bacterial translocation in mice.

    PubMed

    Zhao, Yuan; Zhang, Shuncai; Jiang, Li; Jiang, Jie; Liu, Hongchun

    2009-11-01

    To evaluate the preventive effects of Schistosoma japonicum ova on trinitrobenzenesulfonic acid (TNBS)-induced colitis and bacterial translocation in mice. BALB/c mice were randomly divided into three groups: control group; TNBS(+)Ova(-) group; and TNBS(+)Ova(+) group. Mice of the TNBS(+)Ova(+) group were exposed to 10 000 freeze-killed S. japonicum ova by i.p. injection on day 1 and day 11. On day 15, mice were challenged with TNBS to induce colitis. The following variables were assessed: colon pathological changes; serum expression of tumor necrosis factor-alpha (TNF-alpha), gamma-interferon (IFN-gamma) and interleukin-10 (IL-10); expression of Toll-like receptor 4 (TLR4) in colon; IFN-gamma, IL-10 and TLR4 mRNA expression in colon; and the bacterial translocation rate. Compared to TNBS(+)Ova(-) group, the colonic inflammation in the TNBS(+)Ova(+) group were relieved. A highly significant elevation of IFN-gamma and TNF-alpha were observed in the TNBS-induced colitis group. After exposure to the eggs, IFN-gamma was significantly decreased, while TNF-alpha was similar to that of the TNBS(+)ova(-) group. No obvious variation was seen in IL-10 expression in TNBS-induced colitis, compared to the controls. Exposure to the eggs led to a significant upregulation of IL-10 expression. TLR4 expression was elevated after injected with TNBS and was downregulated in the eggs group. Less intestinal bacterial translocation frequency was observed when exposed to eggs. S. japonicum ova can prevent the TNBS-induced colitis and reduce the bacterial translocation frequency in mice. The mechanisms were supposed to be due to the regulation of T-helper cell 1/2 balance and TLR4 expression.

  20. The profile of immune modulation by cannabidiol (CBD) involves deregulation of nuclear factor of activated T cells (NFAT).

    PubMed

    Kaplan, Barbara L F; Springs, Alison E B; Kaminski, Norbert E

    2008-09-15

    Cannabidiol (CBD) is a cannabinoid compound derived from Cannabis Sativa that does not possess high affinity for either the CB1 or CB2 cannabinoid receptors. Similar to other cannabinoids, we demonstrated previously that CBD suppressed interleukin-2 (IL-2) production from phorbol ester plus calcium ionophore (PMA/Io)-activated murine splenocytes. Thus, the focus of the present studies was to further characterize the effect of CBD on immune function. CBD also suppressed IL-2 and interferon-gamma (IFN-gamma) mRNA expression, proliferation, and cell surface expression of the IL-2 receptor alpha chain, CD25. While all of these observations support the fact that CBD suppresses T cell function, we now demonstrate that CBD suppressed IL-2 and IFN-gamma production in purified splenic T cells. CBD also suppressed activator protein-1 (AP-1) and nuclear factor of activated T cells (NFAT) transcriptional activity, which are critical regulators of IL-2 and IFN-gamma. Furthermore, CBD suppressed the T cell-dependent anti-sheep red blood cell immunoglobulin M antibody forming cell (anti-sRBC IgM AFC) response. Finally, using splenocytes derived from CB1(-/-)/CB2(-/-) mice, it was determined that suppression of IL-2 and IFN-gamma and suppression of the in vitro anti-sRBC IgM AFC response occurred independently of both CB1 and CB2. However, the magnitude of the immune response to sRBC was significantly depressed in CB1(-/-)/CB2(-/-) mice. Taken together, these data suggest that CBD suppresses T cell function and that CB1 and/or CB2 play a critical role in the magnitude of the in vitro anti-sRBC IgM AFC response.

  1. A small peptide (CEL-1000) derived from the beta-chain of the human major histocompatibility complex class II molecule induces complete protection against malaria in an antigen-independent manner.

    PubMed

    Charoenvit, Yupin; Brice, Gary T; Bacon, David; Majam, Victoria; Williams, Jackie; Abot, Esteban; Ganeshan, Harini; Sedegah, Martha; Doolan, Denise L; Carucci, Daniel J; Zimmerman, Daniel H

    2004-07-01

    CEL-1000 (DGQEEKAGVVSTGLIGGG) is a novel potential preventative and therapeutic agent. We report that CEL-1000 confers a high degree of protection against Plasmodium sporozoite challenge in a murine model of malaria, as shown by the total absence of blood stage infection following challenge with 100 sporozoites (100% protection) and by a substantial reduction (400-fold) of liver stage parasite RNA following challenge with 50,000 sporozoites. CEL-1000 protection was demonstrated in A/J (H-2(a)) and C3H/HeJ (H-2(k)) mice but not in BALB/c (H-2(d)) or CAF1 (A/J x BALB/c F(1) hybrid) mice. In CEL-1000-treated and protected mice, high levels of gamma interferon (IFN-gamma) in serum and elevated frequencies of hepatic and splenic CD4+ IFN-gamma-positive T cells were detected 24 h after administration of an additional dose of CEL-1000. Treatment of A/J mice that received CEL-1000 with antibodies against IFN-gamma just prior to challenge abolished the protection, and a similar treatment with antibodies against CD4+ T cells partially reduced the level of protection, while treatment with control antibodies or antibodies specific for interleukin-12 (IL-12), CD8+ T cells, or NK cells had no effect. Our data establish that the protection induced by CEL-1000 is dependent on IFN-gamma and is partially dependent on CD4+ T cells but is independent of CD8+ T cells, NK cells, and IL-12 at the effector phase and does not induce a detectable antibody response.

  2. Cell to cell contact through ICAM-1-LFA-1 and TNF-alpha synergistically contributes to GM-CSF and subsequent cytokine synthesis in DBA/2 mice induced by 1,3-beta-D-Glucan SCG.

    PubMed

    Harada, Toshie; Kawaminami, Hiromi; Miura, Noriko N; Adachi, Yoshiyuki; Nakajima, Mitsuhiro; Yadomae, Toshiro; Ohno, Naohito

    2006-04-01

    SCG is a major 6-branched 1,3-beta-D-glucan in Sparassis crispa Fr. showing antitumor activity. We recently found that the splenocytes from naive DBA/1 and DBA/2 mice are potently induced by SCG to produce interferon- gamma (IFN-gamma), tumor necrosis factor-alpha (TNF-alpha), granulocyte-macrophage colony-stimulating factor (GM-CSF), and interleukin-12p70 (IL-12p70), and that GM-CSF plays a key biologic role among these cytokines. In this study, we investigated the contribution of cell-cell contact and soluble factors to cytokine induction by SCG in DBA/2 mice. Cell-cell contact involving intercellular adhesion molecule-1 (ICAM-1) and lymphocyte function-associated antigen-1 (LFA-1) was an essential step for the induction of GM-CSF and IFN-gamma by SCG but not for the induction of TNF-alpha or IL-12p70 by SCG. SCG directly induced adherent splenocytes to produce TNF-alpha and IL-12p70. GM-CSF was required for the induction of TNF-alpha by SCG, and in turn, TNF-alpha enhanced the release of GM-CSF and thereby augmented the induction of IL-12p70 and IFN-gamma by SCG. Neutralization of IL-12 significantly inhibited the induction of IFN-gamma by SCG. We concluded that induction of GM-CSF production by SCG was mediated through ICAM-1 and LFA-1 interaction, GM-CSF subsequently contributed to further cytokine induction by SCG, and reciprocal actions of the cytokines were essential for enhancement of the overall response to SCG in DBA/2 mice.

  3. Differential chemokine, chemokine receptor and cytokine expression in Epstein-Barr virus-associated lymphoproliferative diseases.

    PubMed

    Ohshima, Koichi; Karube, Kennosuke; Hamasaki, Makoto; Tutiya, Takeshi; Yamaguchi, Takahiro; Suefuji, Hiroaki; Suzuki, Keiko; Suzumiya, Junji; Ohga, Shouichi; Kikuchi, Masahiro

    2003-08-01

    T cell immunity plays an important role in the clinicopathology of Epstein-Barr virus (EBV)-associated diseases. Acute EBV-induced infectious mononucleosis (IM) is a common self-limiting disease, however, other EBV-associated diseases, including chronic active EBV infection (CAEBV), NK cell lymphoma (NKL), and Hodgkin's lymphoma (HL), exhibit distinct clinical features. Chemokines are members of a family of small-secreted proteins. The relationships between chemokines and the chemokine receptor (R) are thought to be important for selectivity of local immunity. Some chemokines, chemokine R and cytokines closely associate with the T cell subtypes, Th1 and Th2 T cells and cytotoxic cells. To clarify the role of T cell immunity in EBV-associated diseases, we conducted gene expression profiling, using chemokine, chemokine R and cytokine DNA chips. Compared to EBV negative non-specific lymphadenitis, CAEBV and NKL exhibited diffuse down- and up-regulation, respectively, of these gene profiles. IM had a predominantly Th1-type profile, whereas HL had a mixed Th1/Th2-type profile. Reduction of the Th1-type cytokine interferon gamma (IFN-gamma) in CAEBV was confirmed by Reverse transcriptase-polymerase chain reaction, whereas IFN-gamma expression was markedly enhanced in NKL, and moderately enhanced in IM. Compared to IM, CAEBV showed slight elevation of "regulated upon activation, normal T expressed and secreted" (RANTES), but almost all other genes assayed were down-regulated. NKL exhibited elevated expression of numerous genes, particularly IFN-gamma-inducible-10 (IP-10) and monokine induced by IFN-gamma (MIG). HL showed variable elevated and reduced expression of various genes, with increased expression of IL-13 receptor and MIG. Our study demonstrated the enormous potential of gene expression profiling for clarifying the pathogenesis of EBV-associated diseases.

  4. Effect of cortisol infusion patterns and castration on metabolic and immunological indices of stress response in cattle.

    PubMed

    Ting, S T L; Earley, B; Crowe, M A

    2004-05-01

    This study tested the hypotheses that: (1) either acute stress induced by Burdizzo castration, or cortisol infusion would modulate plasma glucose, insulin and growth hormone (GH) concentrations; and (2) immune modulation induced by cortisol would be dependent on the pattern, intensity and duration of circulating cortisol concentrations. Fifty 9.2-month-old Holstein x Friesian bulls (232 +/- 2.0 kg) were blocked by weight and randomly assigned to one of five treatments (n = 10 per treatment): (1) sham handled control; (2) Burdizzo castration; (3) hydrocortisone infusion to mimic the castration-induced secretion pattern of cortisol; (4) hourly pulse infusion of hydrocortisone; and (5) sustained infusion of hydrocortisone for 8h. Blood samples were collected intensively on day 0, and weekly from days 1 to 35. Castration acutely increased plasma cortisol, GH and haptoglobin concentrations, suppressed lymphocyte in vitro interferon-gamma (IFN-gamma) production, but had no effect on plasma glucose and insulin concentrations. Cortisol infusion to simulate the castration-induced secretion pattern of cortisol, and pulse infusion of cortisol did not suppress the IFN-gamma production. A sustained infusion of cortisol resulted in the transient suppression of IFN-gamma production. Moreover, the sustained cortisol infusion resulted in increased plasma glucose, insulin and GH concentrations. The overall 14-day feed intakes and 35-day growth rates were not affected by treatments. In conclusion, cortisol infusion to induce immune suppression in vivo occurred only at pharmacological doses. Within physiological ranges, cortisol was not associated with the suppression of immune function, indicating that during castration cortisol per se is not responsible for the suppression of in vitro IFN-gamma production.

  5. Borrelia-primed and -infected mice deficient of interleukin-17 develop arthritis after neutralization of gamma-interferon.

    PubMed

    Kuo, Joseph; Warner, Thomas F; Schell, Ronald F

    2017-03-01

    The immune mechanisms responsible for development of Lyme arthritis are partially understood with interleukin-17 (IL-17) and gamma-interferon (IFN-γ) playing a generally accepted role. Elevated levels of IL-17 and/or IFN-γ have been reported in samples from human Lyme arthritis patients and experimental mice. In addition, IL-17 and IFN-γ have been implicated in the onset of arthritis in Borrelia-primed and -infected C57BL/6 mice. Recently, we showed that IL-17-deficient mice developed swelling and histopathological changes consistent with arthritis in the presence of high levels of IFN-γ. We hypothesized that neutralization of IFN-γ in IL-17-deficient mice would inhibit Borrelia-induced arthritis. Our results, however, showed that swelling of the hind paws and histopathological changes of arthritis did not differ between Borrelia-primed and -infected IL-17-deficient and wild-type mice with or without neutralization of IFN-γ. We also found higher levels of tumor necrosis factor alpha (TNF-α) and IL-6 in the popliteal lymph node cells of Borrelia-primed and -infected IL-17-deficient mice after neutralization of IFN-γ. These results suggest that multiple cytokines interact in the development of Borrelia-induced arthritis. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  6. Role of Gamma Interferon in the Pathogenesis of Severe Schistosomiasis in Interleukin-4-Deficient Mice

    PubMed Central

    La Flamme, Anne Camille; Patton, Elisabeth A.; Pearce, Edward J.

    2001-01-01

    In the absence of interleukin-4 (IL-4), infection with Schistosoma mansoni leads to a severe fatal disease rather than the chronic survivable condition that occurs in wild-type (WT) mice. Because the sustained production of NO most closely correlates to weight loss and fatality in infected IL-4−/− mice and because gamma interferon (IFN-γ) is an important inducer of inducible NO synthase, infected IL-4−/− mice were treated with anti-IFN-γ antibodies to determine the role of IFN-γ during schistosomiasis in WT and IL-4−/− animals. When IFN-γ was neutralized, Th2 responses were enhanced and NO production was reduced in both WT and IL-4−/− mice. The decreased NO production correlated with a rescue of proliferation in splenocytes from infected IL-4−/− mice. Furthermore, the neutralization of IFN-γ in vivo improved the gross appearance of the liver and led to a reduction in granuloma size in infected IL-4−/− but not WT mice. However, the neutralization of IFN-γ in vivo did not affect the development of severe disease in infected IL-4−/− mice. These results suggest that while the increased production of IFN-γ does lead to some of the pathology observed in infected IL-4−/− mice, it is not ultimately responsible for cachexia and death. PMID:11705919

  7. Dynamic Changes in Pro- and Anti-Inflammatory Cytokine Profiles and Gamma Interferon Receptor Signaling Integrity Correlate with Tuberculosis Disease Activity and Response to Curative Treatment▿

    PubMed Central

    Sahiratmadja, Edhyana; Alisjahbana, Bachti; de Boer, Tjitske; Adnan, Iskandar; Maya, Anugrah; Danusantoso, Halim; Nelwan, Ronald H. H.; Marzuki, Sangkot; van der Meer, Jos W. M.; van Crevel, Reinout; van de Vosse, Esther; Ottenhoff, Tom H. M.

    2007-01-01

    Pro- and anti-inflammatory cytokines and their signaling pathways play key roles in protection from and pathogenesis of mycobacterial infection, and their balance and dynamic changes may control or predict clinical outcome. Peripheral blood cells' capacity to produce proinflammatory (tumor necrosis factor alpha [TNF-α], interleukin-12/23p40 [IL-12/23p40], and gamma interferon [IFN-γ]) and anti-inflammatory (IL-10) cytokines in response to Mycobacterium tuberculosis or unrelated stimuli (lipopolysaccharide, phytohemagglutinin) was studied in 93 pulmonary tuberculosis (TB) patients and 127 healthy controls from Indonesia. Their cells' ability to respond to IFN-γ was examined to investigate whether M. tuberculosis infection can also inhibit IFN-γ receptor (IFN-γR) signaling. Although there was interindividual variability in the observed responses, the overall results revealed that M. tuberculosis-induced TNF-α and IFN-γ levels showed opposite trends. Whereas TNF-α production was higher in active-TB patients than in controls, IFN-γ production was strongly depressed during active TB, correlated inversely with TB disease severity, and increased during therapy. By contrast, mitogen-induced IFN-γ production, although lower in patients than in controls, did not change during treatment, suggesting an M. tuberculosis-specific and reversible component in the depression of IFN-γ. Depressed IFN-γ production was not due to decreased IL-12/IL-23 production. Importantly, IFN-γ-inducible responses were also significantly depressed during active TB and normalized during treatment, revealing disease activity-related and reversible impairment in IFN-γR signaling in TB. Finally, IFN-γ/IL-10 ratios significantly correlated with TB cure. Taken together, these results show that M. tuberculosis-specific stimulation of IFN-γ (but not TNF-α) production and IFN-γR signaling are significantly depressed in active TB, correlate with TB disease severity and activity, and normalize during microbiological TB cure. The depression of both IFN-γ production and IFN-γR signaling may synergize in contributing to defective host control in active TB. PMID:17145950

  8. Neutrophils Are Central to Antibody-Mediated Protection against Genital Chlamydia.

    PubMed

    Naglak, Elizabeth K; Morrison, Sandra G; Morrison, Richard P

    2017-10-01

    Determining the effector populations involved in humoral protection against genital chlamydia infection is crucial to development of an effective chlamydial vaccine. Antibody has been implicated in protection studies in multiple animal models, and we previously showed that the passive transfer of immune serum alone does not confer immunity in the mouse. Using the Chlamydia muridarum model of genital infection, we demonstrate a protective role for both Chlamydia -specific immunoglobulin G (IgG) and polymorphonuclear neutrophils and show the importance of an antibody/effector cell interaction in mediating humoral immunity. While neutrophils were found to contribute significantly to antibody-mediated protection in vivo , natural killer (NK) cells were dispensable for protective immunity. Furthermore, gamma interferon (IFN-γ)-stimulated primary peritoneal neutrophils (PPNs) killed chlamydiae in vitro in an antibody-dependent manner. The results from this study support the view that an IFN-γ-activated effector cell population cooperates with antibody to protect against genital chlamydia and establish neutrophils as a key effector cell in this response. Copyright © 2017 Naglak et al.

  9. Protective Role of Gamma Interferon during the Recall Response to Influenza Virus

    PubMed Central

    Bot, Adrian; Bot, Simona; Bona, Constantin A.

    1998-01-01

    During secondary immune responses to influenza virus, virus-specific T memory cells are a major source of gamma interferon (IFN-γ). We assessed the contribution of IFN-γ to heterologous protection against the A/WSN/33 (H1N1) virus of wild-type and IFN-γ−/− mice previously immunized with the A/HK/68 (H3N2) virus. The IFN-γ−/− mice displayed significantly reduced survival rates subsequent to a challenge with various doses of the A/WSN/33 virus. This was associated with an impaired ability of the IFN-γ−/− mice to completely clear the pulmonary virus by day 7 after the challenge, although significant reduction of the virus titers was noted. However, the IFN-γ−/− mice developed type A influenza virus cross-reactive cytotoxic T lymphocytes (CTLs) similar to the wild-type mice, as demonstrated by both cytotoxicity and a limiting-dilution assay for the estimation of CTL precursor frequency. The pulmonary recruitment of T cells in IFN-γ−/− mice was not dramatically affected, and the percentage of CD4+ and CD8+ T cells was similar to that of wild-type mice. The T cells from IFN-γ−/− mice did not display a significant switch toward a Th2 profile. Furthermore, the IFN-γ−/− mice retained the ability to mount significant titers of WSN and HK virus-specific hemagglutination-inhibiting antibodies. Together, these results are consistent with a protective role of IFN-γ during the heterologous response against influenza virus independently of the generation and local recruitment of cross-reactive CTLs. PMID:9658110

  10. [Construction and expression of HSV-2gD-Hsp70 fusion protein gene].

    PubMed

    Fan, Jian-Yong; Yang, Hui-Lan; Wang, Ying; Guan, Lei

    2006-11-01

    To construct and express Hsp70-HSV2gD fusion protein. Genes of Hsp70 and HSV-2gD were subcloned into vectors pGEX-4T-1 respectively. After confirmed by DNA sequence analysis, the recombinant plasmids pGEX-4T-HSP-gD was transformed into E. coli DH5alpha and induced to express with IPTG. The expressed protein was characterized by SDS-PAGE and Western blot after purified. BALB/c mice were immunized with fusion proteins respectively via intra-m uscular injection. The proliferation of spleen lymphocytes, the level of y-IFN in culture and anti-HSV-2gD IgG antibody in serum was detected was detected. The expressed protein was analyzed by SDS-PAGE after induced with IPTG, which showed a new band with an apparent molecular mass corresponding to the predicted size (118 kD). Western Blotting analysis demonstrates that the purified Hsp70-HSV2gD fusion protein had specific binding activity. The stimulation indexes of spleen lymphocytes, the level of gamma-IFN in culture and anti-HSV-2gD IgG antibody in serum of GST-Hsp70-gD group was obviously higher than that of other groups (P < 0.05 respectively). The successful expression of the Hsp70-HSV2gD fusion protein, which can induce immune responses, laid a solid foundation for its further research.

  11. Interferon-gamma response to the treatment of active pulmonary and extra-pulmonary tuberculosis.

    PubMed

    Liang, L; Shi, R; Liu, X; Yuan, X; Zheng, S; Zhang, G; Wang, W; Wang, J; England, K; Via, L E; Cai, Y; Goldfeder, L C; Dodd, L E; Barry, C E; Chen, R Y

    2017-10-01

    Interferon-gamma (IFN-γ) release assays (IGRAs) are used to diagnose tuberculosis (TB) but not to measure treatment response. To measure IFN-γ response to active anti-tuberculosis treatment. Patients from the Henan Provincial Chest Hospital, Henan, China, with TB symptoms and/or signs were enrolled into this prospective, observational cohort study and followed for 6 months of treatment, with blood and sputum samples collected at 0, 2, 4, 6, 8, 16 and 24 weeks. The QuantiFERON® TB-Gold assay was run on collected blood samples. Participants received a follow-up telephone call at 24 months to determine relapse status. Of the 152 TB patients enrolled, 135 were eligible for this analysis: 118 pulmonary (PTB) and 17 extra-pulmonary TB (EPTB) patients. IFN-γ levels declined significantly over time among all patients (P = 0.002), with this decline driven by PTB patients (P = 0.001), largely during the initial 8 weeks of treatment (P = 0.019). IFN-γ levels did not change among EPTB patients over time or against baseline culture or drug resistance status. After 6 months of effective anti-tuberculosis treatment, IFN-γ levels decreased significantly in PTB patients, largely over the initial 8 weeks of treatment. IFN-γ concentrations may offer some value for monitoring anti-tuberculosis treatment response among PTB patients.

  12. Enhanced immune response to gastric cancer specific antigen Peptide by coencapsulation with CpG oligodeoxynucleotides in nanoemulsion.

    PubMed

    Shi, Rui; Hong, Liu; Wu, Daocheng; Ning, Xiaoxuan; Chen, Yu; Lin, Tao; Fan, Daiming; Wu, Kaichun

    2005-02-01

    CpG oligodeoxynucleotides (CpG ODN) have been shown to have potent adjuvant activity for a wide range of antigens. Of particular interest is their improved activity when closely associated with the antigen. The purpose of this study is to construct a nanovaccine coencapsulated with a gastric cancer specific antigen MG7 mimotope peptide and adjuvant CpG ODN 1645 using new nanotechnology as nanoemulsion and evaluate its immunocompetence. Nanoemulsion vaccine was prepared using magnetic ultrasound methods. BALB/c mice were immunized and the in vivo effectiveness was evaluated using tumor challenge assay. It was shown that the tumor masses formed in the mice immunized with coencapsulated nanovaccine (0.0825 g) markedly smaller (P < 0.01) than those formed in the mice immunized with nanovaccine encapsulated with antigen peptide alone (0.4465 g). A tumor inhibiting rate as high as 82.5% of the coencapsulated nanovaccine was obtained, while nanovaccine encapsulated with peptide only could not achieve the same effect (28.5%) (P < 0.01). Enzyme-linked immunospot assay (ELISPOT) showed that immunization using MG7 mimotope peptide coencapsulated with CpG ODN within the same nanoemulsion enhanced the frequency of splenocytes secreting IFN-gamma significantly (P < 0.01) when compared with immunization using MG7 peptide encapsulated in nanoemulsion alone (197spots/1 x 10(6) vs. 73 spots/1 x 10(6)). Cellular ELISA indicated that serum titer of antibody against MG7-Ag was significantly higher (P < 0.01) in mice immunized with coencapsulation form nanovaccine (0.7884) than that in the group immunized with nanovaccine encapsulated with MG7 peptide alone (0.3616). Using intracellular flow cytometric analysis, it was found that the IFN-gamma response was contributed by CD4+ T-cells. Our experiments suggest that a vaccinal approach using nano-delivery system carrying in tumoral epitope and CpG ODN as adjuvant may have important implications for cancer therapy.

  13. Infection of Female BWF1 Lupus Mice with Malaria Parasite Attenuates B Cell Autoreactivity by Modulating the CXCL12/CXCR4 Axis and Its Downstream Signals PI3K/AKT, NFκB and ERK

    PubMed Central

    Badr, Gamal; Sayed, Ayat; Abdel-Maksoud, Mostafa A.; Mohamed, Amany O.; El-Amir, Azza; Abdel-Ghaffar, Fathy A.; Al-Quraishy, Saleh; Mahmoud, Mohamed H.

    2015-01-01

    Systemic lupus erythematosus (SLE) is a prototypic autoimmune disease characterized by abnormal autoreactivity in B cells. Lymphocytes and their soluble mediators contribute to the disease pathogenesis. We recently demonstrated that infecting lupus mice with malaria confers protection against lupus nephritis by attenuating oxidative stress in both liver and kidney tissues. In the current study, we further investigated B cell autoreactivity in female BWF1 lupus mice after infection with either live or gamma-irradiated malaria, using ELISA, flow cytometry and Western blot analysis. The lupus mice exhibited a significant elevation in plasma levels of IL-4, IL-6, IL-7, IL-12, IL-17, IFN-α, IFN-γ, TGF-β, BAFF and APRIL and a marked elevation of IgG2a, IgG3 and ant-dsDNA autoantibodies compared with normal healthy mice. Infecting lupus mice with live but not gamma-irradiated malaria parasite partially and significantly restored the levels of the soluble mediators that contribute to the progression of lupus. Furthermore, the B cells of lupus mice exhibited an increased proliferative capacity; aberrant overexpression of the chemokine receptor CXCR4; and a marked elevation in responsiveness to their cognate ligand (CXCL12) via aberrant activation of the PI3K/AKT, NFκB and ERK signaling pathways. Interestingly, infecting lupus mice with live but not gamma-irradiated malaria parasite restored a normal proliferative capacity, surface expression of CXCR4 and B cell response to CXCL-12. Taken together, our data present interesting findings that clarify, for the first time, the molecular mechanisms of how infection of lupus mice with malaria parasite controls B cell autoreactivity and thus confers protection against lupus severity. PMID:25909640

  14. Infection of Female BWF1 Lupus Mice with Malaria Parasite Attenuates B Cell Autoreactivity by Modulating the CXCL12/CXCR4 Axis and Its Downstream Signals PI3K/AKT, NFκB and ERK.

    PubMed

    Badr, Gamal; Sayed, Ayat; Abdel-Maksoud, Mostafa A; Mohamed, Amany O; El-Amir, Azza; Abdel-Ghaffar, Fathy A; Al-Quraishy, Saleh; Mahmoud, Mohamed H

    2015-01-01

    Systemic lupus erythematosus (SLE) is a prototypic autoimmune disease characterized by abnormal autoreactivity in B cells. Lymphocytes and their soluble mediators contribute to the disease pathogenesis. We recently demonstrated that infecting lupus mice with malaria confers protection against lupus nephritis by attenuating oxidative stress in both liver and kidney tissues. In the current study, we further investigated B cell autoreactivity in female BWF1 lupus mice after infection with either live or gamma-irradiated malaria, using ELISA, flow cytometry and Western blot analysis. The lupus mice exhibited a significant elevation in plasma levels of IL-4, IL-6, IL-7, IL-12, IL-17, IFN-α, IFN-γ, TGF-β, BAFF and APRIL and a marked elevation of IgG2a, IgG3 and ant-dsDNA autoantibodies compared with normal healthy mice. Infecting lupus mice with live but not gamma-irradiated malaria parasite partially and significantly restored the levels of the soluble mediators that contribute to the progression of lupus. Furthermore, the B cells of lupus mice exhibited an increased proliferative capacity; aberrant overexpression of the chemokine receptor CXCR4; and a marked elevation in responsiveness to their cognate ligand (CXCL12) via aberrant activation of the PI3K/AKT, NFκB and ERK signaling pathways. Interestingly, infecting lupus mice with live but not gamma-irradiated malaria parasite restored a normal proliferative capacity, surface expression of CXCR4 and B cell response to CXCL-12. Taken together, our data present interesting findings that clarify, for the first time, the molecular mechanisms of how infection of lupus mice with malaria parasite controls B cell autoreactivity and thus confers protection against lupus severity.

  15. Different roles of protein kinase C alpha and delta isoforms in the regulation of neutral sphingomyelinase activity in HL-60 cells.

    PubMed Central

    Visnjić, D; Batinić, D; Banfić, H

    1999-01-01

    The signalling mechanisms responsible for the hydrolysis of sphingomyelin mediated by 1,25-dihydroxyvitamin D(3) [1, 25(OH)(2)D(3)] and interferon gamma (IFN-gamma) in HL-60 cells were investigated. IFN-gamma was found to increase selectively the activity of cytosolic, Mg(2+)-independent, neutral sphingomyelinase. The treatment of HL-60 cells with the combination of 1,25(OH)(2)D(3) and IFN-gamma had an additive effect on sphingomyelin hydrolysis, ceramide release and the activity of cytosolic, Mg(2+)-independent, neutral sphingomyelinase. The pretreatment of HL-60 cells with staurosporine, chelerythrine chloride and bisindolylmaleimide abolished the activity of sphingomyelinase in response to 1,25(OH)(2)D(3) and IFN-gamma. Calphostin C, which acts on the regulatory site of protein kinase C (PKC), and Gö 6976, a selective inhibitor of Ca(2+)-dependent PKC isoforms, inhibited the effect of 1,25(OH)(2)D(3) but had no effect on the IFN-gamma-mediated increase in activity of sphingomyelinase. Isoform-specific antibodies were used to deplete different PKC isoforms from cytosol before the treatment of the cytosolic fraction with 1,25(OH)(2)D(3), arachidonic acid (AA) and PMA. The depletion of PKC isoforms beta(1), beta(2), epsilon, eta, mu, zeta and lambda had no effect on the activation of sphingomyelinase induced by 1,25(OH)(2)D(3) or by AA. The depletion of PKC alpha from the cytosol completely abolished the effect of 1,25(OH)(2)D(3) on sphingomyelinase activity but had no effect on the AA-induced activity of sphingomyelinase. PMA had no effect on the activity of sphingomyelinase in either untreated or alpha-depleted cytosol but significantly increased the activity of sphingomyelinase when added to cytosol depleted of PKC delta. Moreover, PMA inhibited the effect of 1,25(OH)(2)D(3) on sphingomyelinase activation but the inhibitory effect was abolished by prior depletion of PKC delta from the cytosol. These studies demonstrate that 1,25(OH)(2)D(3)-induced activation of sphingomyelinase is mediated by PKC alpha. Furthermore, PKC delta had an inhibitory effect on sphingomyelinase, suggesting that the difference between the 1,25(OH)(2)D(3)- and PMA-mediated effects on sphingomyelin turnover depends on the specific regulation of the PKC alpha and PKC delta isoforms. PMID:10585882

  16. Enhancement of natural killer cell activity in human immunodeficiency virus-infected subjects by in vitro treatment with biologic response modifier OK-432.

    PubMed Central

    Huang, X L; Fan, Z; Murayama, T; Rinaldo, C

    1995-01-01

    A decrease in natural killer (NK) cell function has been related to the progression of human immunodeficiency virus (HIV) infection. In the present study, we assessed the ability of a streptococcus-derived biologic response modifier, OK-432, to augment NK lysis of uninfected K562 and U937 cells and HIV-infected U937 cells by peripheral blood mononuclear cells (PBMC) from HIV-seropositive homosexual men. Optimal two- to fourfold increases in lysis of the three targets were observed after pretreatment of PBMC from HIV-negative subjects for 4 h with 2 micrograms of OK-432 per ml. This effect was related primarily to gamma interferon (IFN-gamma) production induced by OK-432 and was not linked to production of tumor necrosis factors alpha and beta or to monocytes in the cultures. The enhancing effect of OK-432 on NK cell function was diminished but still evident in PBMC from subjects with relatively early-phase (< 3-year) HIV infection and high CD4+ cell counts and was lower in subjects with longer-term HIV infection (> 3 years), in association with reduced production of IFN-gamma. Augmentation of NK cell activity in HIV-infected men by OK-432 was comparable to that induced by treatment of cells with 1,000 U of IFN-alpha or interleukin 2 per ml. The data suggest that the NK cell-enhancing effects of OK-432 are at least in part mediated by IFN-gamma and that OK-432 may be effective in treatment of patients with early-phase HIV infection. PMID:7719919

  17. Modulation of nitric oxide, hydrogen peroxide and cytokine production in a clonal macrophage model by the trichothecene vomitoxin (deoxynivalenol).

    PubMed

    Ji, G E; Park, S Y; Wong, S S; Pestka, J J

    1998-02-06

    Characterization of how vomitoxin (VT) and other trichothecenes affect macrophage regulatory and effector function may contribute to improved understanding of mechanisms by which these mycotoxins impact the immune system. The RAW 264.7 murine cell line was used as a macrophage model to assess effects of the VT on proliferation and the production of nitric oxide (NO), hydrogen peroxide (H2O2) and cytokines. Using the MTT cleavage assay, VT at concentrations of 50 ng/ml or higher was found to significantly decrease proliferation and viability of RAW 264.7 cells without stimulation or with stimulation by lipopolysaccharide (LPS) or interferon (IFN)-gamma. In the absence of an activation agent, VT (25-250 ng/ml) had negligible effects on the production of NO, H2O2, and cytokines. Upon activation with LPS at concentrations of 10 to 100 ng/ml, VT at 25-100 ng/ml markedly enhanced production of H2O2 but was inhibitory at 250 ng/ml. VT enhancement of H2O2 production was observed as early as 12 h after LPS stimulation. When IFN-gamma was used as the stimulant, VT (25-250 ng/ml) delayed peak H2O2 production. VT (25-250 ng/ml) also markedly decreased NO production in cells activated with LPS or IFN-gamma. Interestingly, VT superinduced TNF-alpha and IL-6 production in LPS-stimulated cells and also elevated TNF-alpha in IFN-gamma stimulated cells. These results suggest that VT can selectively and concurrently upregulate or downregulate critical functions associated with activated macrophages.

  18. Interferon-gamma and interleukin-10 profile of children with tuberculosis in North Sumatera, Indonesia

    NASA Astrophysics Data System (ADS)

    Daulay, R. S.; Daulay, R. M.

    2018-03-01

    Cellular immunity was mediated the host immune response against Mycobacterium tuberculosis, in which cytokine and T-helper (Th) 1 cells play an important role. Interferon-gamma (IFN-γ) is a leading cytokine involved in the immune response of tuberculosis (TB).The primary function of IFN-γ is to activate macrophages in opposition Mycobacterium tuberculosis. Contrast from IFN-γ, interleukin-10 (IL-10) is considered inhibitory cytokine, important to an adequate balance between inflammatory responses. To analyze cytokine profile, particularly IFN-γ and IL-10 of the children with TB in Indonesia, a cross-sectional study was conducted at two general hospitals and seven primary health care located in Medan and Batubara, North Sumatera, Indonesia. Among 51 children with TB disease and 51 healthy children, found that IFN-γ and IL-10 levels were lower in TB patients compared to healthy children. Statistically significant decreased production of the IFN-γ levels (p=0.042) were found in TB patients 9.41 (1.10-28.06) pg/ml contrast to healthy children 6.30 (1.30-89.76) pg/ml. Homologue finding of the IL-10 levels were also found in TB patients 4.93 (0.22-48.01) pg/ml and 4.93 (0.07-81.60) pg/ml in healthy children, but not statistically significant (p=0.784). High levels of IL-10 were not proven to suppress the levels production of IFN-γ in TB patients.

  19. Household food insecurity is associated with low interferon-gamma levels in pregnant Indian women.

    PubMed

    Vaidya, A; Bhosale, R; Sambarey, P; Suryavanshi, N; Young, S; Mave, V; Kanade, S; Kulkarni, V; Deshpande, P; Balasubramanian, U; Elf, J; Gupte, N; Gupta, A; Mathad, J S

    2017-07-01

    Over 20% of tuberculosis (TB) cases during pregnancy occur in India. To determine the association between household food insecurity and interferon-gamma (IFN-γ) levels in pregnancy. Pregnant women in India were administered the Household Food Insecurity Access Scale (HFIAS) questionnaire and underwent an IFN-γ release assay. Logistic regression was used to identify factors associated with food insecurity. Of 538 women, 60 (11%) had household food insecurity, 47 (78%) of which were moderate or severe food insecure. After mitogen stimulation, moderate or severe food insecure women had a median IFN-γ concentration of 4.2 IU/ml (IQR 2.2-9.8) vs. 8.4 IU/ml (IQR 3.0-10) in women with no or mild food insecurity (P = 0.03). In multivariate analysis, higher IFN-γ concentrations were associated with human immunodeficiency virus infection (OR 1.3, 95%CI 0.51-2.1, P = 0.001), and inversely associated with moderate or severe food insecurity (OR -1.6, 95%CI -2.9 to -0.27, P = 0.02) and the number of adults in the household (OR -0.08, 95%CI -0.16 to -0.01, P = 0.03). There was no association between food insecurity and IFN-γ response to Mycobacterium tuberculosis antigen. Food insecurity in pregnancy is associated with low IFN-γ levels. There was no association between food insecurity and IFN-γ response to M. tuberculosis antigen, but our study was underpowered to detect this outcome.

  20. Vaccination with nontoxic mutant toxic shock syndrome toxin 1 protects against Staphylococcus aureus infection.

    PubMed

    Hu, Dong-Liang; Omoe, Katsuhiko; Sasaki, Sanae; Sashinami, Hiroshi; Sakuraba, Hirotake; Yokomizo, Yuichi; Shinagawa, Kunihiro; Nakane, Akio

    2003-09-01

    To investigate whether vaccination with nontoxic mutant toxic shock syndrome toxin 1 (mTSST-1) can protect against Staphylococcus aureus infection, mice were vaccinated with mTSST-1 and challenged with viable S. aureus. Survival in the mTSST-1-vaccinated group was higher, and bacterial counts in organs were significantly lower than those of control mice. Passive transfer of mTSST-1-specific antibodies also provided protection against S. aureus-induced septic death. Interferon (IFN)-gamma production in the serum samples and spleens from vaccinated mice was significantly decreased compared with that in controls, whereas interleukin-10 titers were significantly higher in vaccinated mice. IFN-gamma and tumor necrosis factor-alpha production in vitro were significantly inhibited by serum samples from mTSST-1-immunized mice but not from control mice. These results suggest that vaccination with mTSST-1 devoid of superantigenic properties provides protection against S. aureus infection and that the protection might be mediated by TSST-1-neutralizing antibodies as well as by the down-regulation of IFN-gamma production.

  1. High levels of type 2 cytokine-producing cells in chronic fatigue syndrome.

    PubMed

    Skowera, A; Cleare, A; Blair, D; Bevis, L; Wessely, S C; Peakman, M

    2004-02-01

    The aetiology of chronic fatigue syndrome (CFS) is not known. However, it has been suggested that CFS may be associated with underlying immune activation resulting in a Th2-type response. We measured intracellular production of interferon (IFN)-gamma and interleukin (IL)-2; type 1 cytokines), IL-4 (type 2) and IL-10 (regulatory) by both polyclonally stimulated and non-stimulated CD4 and CD8 lymphocytes from patients with CFS and control subjects by flow cytometry. After polyclonal activation we found evidence of a significant bias towards Th2- and Tc2-type immune responses in CFS compared to controls. In contrast, levels of IFN-gamma, IL-2 and IL-10-producing cells were similar in both study groups. Non-stimulated cultures revealed significantly higher levels of T cells producing IFN-gamma or IL-4 in CFS patients. Concluding, we show evidence for an effector memory cell bias towards type 2 responsiveness in patients with CFS, as well as ongoing type 0 immune activation in unstimulated cultures of peripheral blood cells.

  2. Tomatine adjuvantation of protective immunity to a major pre-erythrocytic vaccine candidate of malaria is mediated via CD8+ T cell release of IFN-gamma.

    PubMed

    Heal, Karen G; Taylor-Robinson, Andrew W

    2010-01-01

    The glycoalkaloid tomatine, derived from the wild tomato, can act as a powerful adjuvant to elicit an antigen-specific cell-mediated immune response to the circumsporozoite (CS) protein, a major pre-erythrocytic stage malaria vaccine candidate antigen. Using a defined MHC-class-I-restricted CS epitope in a Plasmodium berghei rodent model, antigen-specific cytotoxic T lymphocyte activity and IFN-gamma secretion ex vivo were both significantly enhanced compared to responses detected from similarly stimulated splenocytes from naive and tomatine-saline-immunized mice. Further, through lymphocyte depletion it is demonstrated that antigen-specific IFN-gamma is produced exclusively by the CD8(+) T cell subset. We conclude that the processing of the P. berghei CS peptide as an exogenous antigen and its presentation via MHC class I molecules to CD8(+) T cells leads to an immune response that is an in vitro correlate of protection against pre-erythrocytic malaria. Further characterization of tomatine as an adjuvant in malaria vaccine development is indicated.

  3. β-Glucan from Saccharomyces cerevisiae Induces IFN-γ Production In Vivo in BALB/c Mice.

    PubMed

    Javmen, Artur; Nemeikaitė-Čėnienė, Aušra; Bratchikov, Maksim; Grigiškis, Saulius; Grigas, Fortūnatas; Jonauskienė, Irena; Zabulytė, Danguolė; Mauricas, Mykolas

    2015-01-01

    β-Glucan is one of the most abundant polymers in nature and has been established as an immunomodulator. This compound has notable physiological effects on mammalian immune systems, including anti-tumor and anti-infective activities and can activate the immune response. It is considered that the immune-stimulating activities of β-glucan can depend on physicochemical parameters, such as molecular size. Saccharomyces cerevisiae, also known as baker's yeast, is a frequently used source of β-glucan. The aim of the experiments was to investigate how different Saccharomyces cerevisiae β-glucan preparations with different molecular size affect interferon-gamma (IFN-γ) production in BALB/c mice. In vivo and in vitro BALB/c mouse models were used for the investigations. Different β-glucan preparations were orally administrated in the in vivo experiments. IFN-γ production in BALB/c mice was analyzed by enzyme-linked immunosorbent assay and measuring interferon-γ RNA concentration. The results showed that orally-administered β-glucan from S. cerevisiae enhanced IFN-γ production in BALB/c mice in the in vivo model, but not by mouse leukocytes in vitro. Moreover, water-soluble β-glucan enhanced IFN-γ production more effectively than did particulate β-glucan. IFN-γ plays an important role in immunity against viral and bacterial infections. Our experiments have shown that β-glucan preparations enhance IFN-γ production in BALB/c mice and can be potentially used for immune system stimulation in mammals. Current results may be used to develop soluble β-glucan nutritional supplements. Copyright © 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  4. Paeonol attenuates TNBS-induced colitis by inhibiting NF-{kappa}B and STAT1 transactivation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ishiguro, Kazuhiro; Ando, Takafumi; Maeda, Osamu

    2006-11-15

    Paeonol, a major phenolic component of Moutan Cortex, is known to have anti-inflammatory activity. However, the effect of Paeonol on colitis has not been evaluated and the molecular mechanism of its anti-inflammatory action remains unknown. The aim of this study was to determine if Paeonol enema attenuates trinitrobenzene sulfonic acid (TNBS)-induced colitis in mice. We also investigated the effects of Paeonol in colon cancer-derived CW-2 cells and T cell leukemia-derived Jurkat cells treated with tumor necrosis factor {alpha} (TNF{alpha}) and/or interferon {gamma} (IFN{gamma}), which play critical roles in TNBS-induced colitis. Paeonol enema attenuated TNBS-induced colitis judging by body weigh reduction,more » colon length and histological score. Myeloperoxidase activity and inducible nitric oxide synthase (iNOS) production in the colon were also reduced with Paeonol enema. In CW-2 cells, Paeonol inhibited iNOS protein and mRNA expression induced by costimulation of TNF{alpha} and IFN{gamma}. Furthermore, Paeonol reduced TNF{alpha}-induced NF-{kappa}B transactivation and IFN{gamma}-induced STAT1 transactivation in CW-2 cells and also in Jurkat cells. These findings suggest that Paeonol enema may be useful for the treatment of colitis.« less

  5. [Interleukin 8 and interferon gamma in ocular toxoplasmosis].

    PubMed

    Czepiel, Jacek; Biesiada, Grazyna; Sobczyk-Krupiarz, Iwona; Miklasszewska, Grazyna; Fedak, Danuta; Solnica, Bogdan; Mach, Tomasz; Garlicki, Aleksander

    2011-01-01

    Toxoplasmosis is one of the most common parasitic infections in the world, it is caused by Toxoplasma gondii. The infection is typically asymptomatic or the symptoms are very mild. Approximately 10% patients have limphadenopathy, involvement of the others organs, like eyes, nervous system, liver, heart, are observed more rarely. The aim of our study was to assess the level of selected cytokines in blood among patients with ocular toxoplasmosis. We have enrolled in the study 30 patients, 19-42 years old, treated for ocular toxoplasmosis, and 20 healthy volunteers, 20-48 years old, to the control group. Tests for blood morphology, C-reactive protein, the level of IL-8 and IFN-gamma were performed in all patients. The blood parameters in toxoplasmosis group were performed before antiparasitic treatment was given. The level of IFN-gamma in blood was lower among patients with ocular toxoplasmosis comparing with control group (1.52 vs. 4.18 pg/ml; p = 0.002). The level of IL-8 in blood was lower among patients with ocular toxoplasmosis comparing with control group (22.96 vs. 94.3 pg/ml; p = 0,007). There were no correlations between analyzed cytokines and blood morphology or CRP. The low level of IFN-gamma and IL-8 in blood is important factor leading to reactivation of the ocular toxoplasmosis.

  6. Clinical and diagnostic developments of a gamma interferon release assay for use in bovine tuberculosis control programs

    USDA-ARS?s Scientific Manuscript database

    Currently the Bovigam assay is used as an official supplemental test within the bovine tuberculosis eradication program. This assay measures interferon-gamma (IFN-gamma) produced by lymphocytes in response to specific antigens. The objectives of the present study were to evaluate two Mycobacterium ...

  7. Designing of interferon-gamma inducing MHC class-II binders

    PubMed Central

    2013-01-01

    Background The generation of interferon-gamma (IFN-γ) by MHC class II activated CD4+ T helper cells play a substantial contribution in the control of infections such as caused by Mycobacterium tuberculosis. In the past, numerous methods have been developed for predicting MHC class II binders that can activate T-helper cells. Best of author’s knowledge, no method has been developed so far that can predict the type of cytokine will be secreted by these MHC Class II binders or T-helper epitopes. In this study, an attempt has been made to predict the IFN-γ inducing peptides. The main dataset used in this study contains 3705 IFN-γ inducing and 6728 non-IFN-γ inducing MHC class II binders. Another dataset called IFNgOnly contains 4483 IFN-γ inducing epitopes and 2160 epitopes that induce other cytokine except IFN-γ. In addition we have alternate dataset that contains IFN-γ inducing and equal number of random peptides. Results It was observed that the peptide length, positional conservation of residues and amino acid composition affects IFN-γ inducing capabilities of these peptides. We identified the motifs in IFN-γ inducing binders/peptides using MERCI software. Our analysis indicates that IFN-γ inducing and non-inducing peptides can be discriminated using above features. We developed models for predicting IFN-γ inducing peptides using various approaches like machine learning technique, motifs-based search, and hybrid approach. Our best model based on the hybrid approach achieved maximum prediction accuracy of 82.10% with MCC of 0.62 on main dataset. We also developed hybrid model on IFNgOnly dataset and achieved maximum accuracy of 81.39% with 0.57 MCC. Conclusion Based on this study, we have developed a webserver for predicting i) IFN-γ inducing peptides, ii) virtual screening of peptide libraries and iii) identification of IFN-γ inducing regions in antigen (http://crdd.osdd.net/raghava/ifnepitope/). Reviewers This article was reviewed by Prof Kurt Blaser, Prof Laurence Eisenlohr and Dr Manabu Sugai. PMID:24304645

  8. Siglec-1 inhibits RSV-induced interferon gamma production by adult T cells in contrast to newborn T cells.

    PubMed

    Jans, Jop; Unger, Wendy W J; Vissers, Marloes; Ahout, Inge M L; Schreurs, Inge; Wickenhagen, Arthur; de Groot, Ronald; de Jonge, Marien I; Ferwerda, Gerben

    2018-04-01

    Interferon gamma (IFN-γ) plays an important role in the antiviral immune response during respiratory syncytial virus (RSV) infections. Monocytes and T cells are recruited to the site of RSV infection, but it is unclear whether cell-cell interactions between monocytes and T cells regulate IFN-γ production. In this study, micro-array data identified the upregulation of sialic acid-binding immunoglobulin-type lectin 1 (Siglec-1) in human RSV-infected infants. In vitro, RSV increased expression of Siglec-1 on healthy newborn and adult monocytes. RSV-induced Siglec-1 on monocytes inhibited IFN-γ production by adult CD4 + T cells. In contrast, IFN-γ production by RSV in newborns was not affected by Siglec-1. The ligand for Siglec-1, CD43, is highly expressed on adult CD4 + T cells compared to newborns. Our data show that Siglec-1 reduces IFN-γ release by adult T cells possibly by binding to the highly expressed CD43. The Siglec-1-dependent inhibition of IFN-γ in adults and the low expression of CD43 on newborn T cells provides a better understanding of the immune response against RSV in early life and adulthood. © 2017 The Authors. European Journal of Immunology published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Association of CMV-Specific T Cell-Mediated Immunity with CMV DNAemia and Development of CMV Disease in HIV-1–Infected Individuals

    PubMed Central

    Aichelburg, Maximilian C.; Weseslindtner, Lukas; Mandorfer, Mattias; Strassl, Robert; Rieger, Armin; Reiberger, Thomas; Puchhammer-Stöckl, Elisabeth; Grabmeier-Pfistershammer, Katharina

    2015-01-01

    Background Among HIV-1–infected individuals, cytomegalovirus (CMV) reactivation and disease occur in the setting of advanced immunosuppression. The value of a standardized assessment of CMV-specific T-cell mediated immunity by the CMV QuantiFERON assay (CMV-QFT) has not yet been thoroughly investigated in HIV-1–infected subjects. Methods Prospective, longitudinal study in 153 HIV-1–infected subjects with a CD4+ T cell count < 350/μL who simultaneously underwent CMV-QFT, CMV serology testing and CMV-DNA quantification. Factors associated with CMV-QFT were evaluated. Clinical screening for CMV manifestations was then performed every 3 months. Results Among the 141 CMV IgG-seropositive individuals the CMV-QFT assay yielded reactive results in 84% (118/141), negative results in 15% (21/141) and indeterminate (negative mitogen IFN-gamma response) results in 1% (2/141) of subjects. The mean actual CD4+ T cell count was significantly higher in CMV-QFT reactive subjects, when compared to CMV-QFT non-reactive individuals (183 ± 102 vs. 126 ± 104 cells/μL, P = 0.015). A significantly lower proportion of CMV-QFT reactive vs. non-reactive patients displayed CMV DNAemia > 100 copies/mL (23% (27/118) vs. 48% (11/23), P = 0.02). Furthermore, a statistically significant inverse association between mitogen IFN-gamma response and CMV-DNAemia > 1000 copies/mL was observed (P < 0.001). During the observational period, 5 CMV end-organ manifestations were observed. In three of the CMV cases the CMV-QFT yielded indeterminate results. Conclusions While CMV-QFT reactivity indicates CMV-specific immunity, indeterminate results due to negative mitogen IFN-gamma response might reflect HIV-1-induced immunodeficiency. Thus, dependency upon CD4+ T cell count should be considered when interpreting CMV-QFT results. PMID:26322514

  10. The G-protein coupled receptor, GPR84 regulates IL-4 production by T lymphocytes in response to CD3 crosslinking.

    PubMed

    Venkataraman, Chandrasekar; Kuo, Frederick

    2005-11-15

    The orphan G-protein coupled receptor, GPR84 is highly expressed in the bone marrow, and in splenic T cells and B cells. In this study, GPR84-deficient mice were generated to understand the biological function of this orphan receptor. The proliferation of T and B cells in response to various mitogens was normal in GPR84-deficient mice. Interestingly, primary stimulation of T cells with anti-CD3 resulted in increased IL-4 but not IL-2 or IFN-gamma production in GPR84(-/-) mice compared to wild-type mice. Augmented IL-4 production in GPR84-deficient T cells was not related to increased frequency of IL-4-secreting cells in response to anti-CD3 stimulation. In fact, stimulation with anti-CD3 and anti-CD28 resulted in increased levels of IL-4 but not IFN-gamma steady-state mRNA in GPR84(-/-) T cells. In addition, Th2 effector cells generated in vitro from GPR84(-/-) mice produced higher levels of IL-4, IL-5 and IL-13 compared to wild-type mice. However, there was no detectable difference in the extent of IL-4 and IL-5 production between the two groups of mice in response to antigen stimulation of spleen cells, isolated from mice previously immunized with OVA in alum. These studies reveal a novel role for GPR84 in regulating early IL-4 gene expression in activated T cells.

  11. Selective suppression of cytokine secretion in whole blood cell cultures of patients with colorectal cancer.

    PubMed Central

    Lahm, H.; Schindel, M.; Frikart, L.; Cerottini, J. P.; Yilmaz, A.; Givel, J. C.; Fischer, J. R.

    1998-01-01

    We have investigated the secretion of interferon alpha (IFN-alpha), IFN-gamma, interleukin-1alpha (IL-1alpha), IL-1beta, IL-2 and tumour necrosis factor alpha (TNF-alpha) in whole blood cell cultures (WBCCs) of colorectal cancer patients upon mitogen stimulation. Whereas the values for IL-1beta and TNF-alpha remained virtually unchanged in comparison with healthy control subjects, WBCCs of colorectal cancer patients secreted significantly lower amounts of IFN-alpha (P < 0.005), IFN-gamma (P < 0.0001), IL-1alpha (P < 0.0001) and IL-2 (P < 0.05). This reduction correlated with the progression of the disease. The total leucocyte and monocyte population were almost identical in both groups. In contrast, a dramatic depletion of lymphocytes was observed in colorectal cancer patients, which affected both lymphocyte counts (P < 0.0005) and their distribution (P < 0.0001). Our results suggest a selective suppression of cytokines in colorectal cancer patients that is related to tumour burden. Several mechanisms might account for this phenomenon, one of which might be lymphocyte depletion. PMID:9792144

  12. Identification and Characterization of Neospora caninum Cyclophilin That Elicits Gamma Interferon Production

    PubMed Central

    Tuo, Wenbin; Fetterer, Raymond; Jenkins, Mark; Dubey, J. P.

    2005-01-01

    Gamma interferon (IFN-γ) response is essential to the development of a host protective immunity in response to infections by intracellular parasites. Neosporosis, an infection caused by the intracellular protozoan parasite Neospora caninum, is fatal when there is a complete lack of IFN-γ in the infected host. However, the mechanism by which IFN-γ is elicited by the invading parasite is unclear. This study has identified a microbial protein in the N. caninum tachyzoite N. caninum cyclophilin (NcCyP) as a major component of the parasite responsible for the induction of IFN-γ production by bovine peripheral blood mononuclear cells (PBMC) and antigen-specific CD4+ T cells. NcCyP has high sequence homology (86%) with Toxoplasma gondii 18-kDa CyP with a calculated molecular mass of 19.4 kDa. NcCyP is a secretory protein with a predicted signal peptide of 17 amino acids. Abundant NcCyP was detected in whole-cell N. caninum tachyzoite lysate antigen (NcAg) and N. caninum tachyzoite culture supernatant. In N. caninum tachyzoite culture supernatant, three NcCyP bands of 19, 22, and 24 kDa were identified. NcAg stimulated high levels of IFN-γ production by PBMC and CD4+ T cells. The IFN-γ-inducing effect of NcAg was blocked by cyclosporine, a specific ligand for CyP, in a dose-dependent manner. Furthermore, cyclosporine abolished IFN-γ production by PBMC from naïve cows as well as PBMC and CD4+ T cells from infected/immunized cows. These results indicate that the N. caninum tachyzoite naturally produces a potent IFN-γ-inducing protein, NcCyP, which may be important for parasite survival as well as host protection. PMID:16041025

  13. Kinetics of the immune response profile in guinea pigs after vaccination with Mycobacterium bovis BCG and infection with Mycobacterium tuberculosis.

    PubMed

    Grover, Ajay; Taylor, Jennifer; Troudt, JoLynn; Keyser, Andrew; Arnett, Kimberly; Izzo, Linda; Rholl, Drew; Izzo, Angelo

    2009-11-01

    The guinea pig model of tuberculosis is used extensively in assessing novel vaccines, since Mycobacterium bovis BCG vaccination effectively prolongs survival after low-dose aerosol infection with virulent M. tuberculosis. To better understand how BCG extends time to death after pulmonary infection with M. tuberculosis, we examined cytokine responses postvaccination and recruitment of activated T cells and cytokine response postinfection. At 10 weeks postvaccination, splenic gamma interferon (IFN-gamma) mRNA was significantly elevated compared to the levels at 5 weeks in ex vivo stimulation assays. At 15, 40, 60, and 120 days postinfection, T-cell activation (CD4+ CD62Llow and CD8+ CD62Llow) and mRNA expression of IFN-gamma, tumor necrosis factor alpha (TNF-alpha), interleukin-1 (IL-1), IL-10, IL-12, and eomesodermin were assessed. Our data show that at day 40, BCG-vaccinated guinea pigs had significantly increased levels of IFN-gamma mRNA expression but decreased TNF-alpha mRNA expression in their lungs compared to the levels in nonvaccinated animals. At day 120, a time when nonvaccinated guinea pigs succumbed to infection, low levels of IFN-gamma mRNA were observed even though there were increasing levels of IL-1, IL-12, and IL-10, and the numbers of activated T cells did not differ from those in BCG-vaccinated animals. BCG vaccination conferred the advantage of recruiting greater numbers of CD4+ CD62Llow T cells at day 40, although the numbers of CD8+ CD62Llow T cells were not elevated compared to the numbers in nonvaccinated animals. Our data suggest that day 40 postinfection may be a pivotal time point in determining vaccine efficacy and prolonged survival and that BCG promotes the capacity of T cells in the lungs to respond to infection.

  14. A novel role for adiponectin in regulating the immune responses in chronic hepatitis C virus infection.

    PubMed

    Palmer, Clovis; Hampartzoumian, Taline; Lloyd, Andrew; Zekry, Amany

    2008-08-01

    Adipose tissue releases pro-inflammatory and anti-inflammatory mediators, including adiponectin, which elicit a broad range of metabolic and immunological effects. The study aim was to determine in subjects infected with chronic hepatitis C virus (HCV) the effects of total adiponectin and its high-molecular-weight (HMW) and low-molecular-weight isoforms on HCV-specific immune responses. Serum levels of total adiponectin and its isoforms were determined by immunoassay. The ex vivo effect of adiponectin on the HCV-specific T-cell response was examined by interferon gamma (IFN-gamma) enzyme-linked immunosorbent spot and enzyme-linked immunosorbent assay cytokine assays. The role of the mitogen-activated protein kinase (MAPK) signaling pathway in mediating the adiponectin effect on T cells was also evaluated. We found that serum levels of total and HMW adiponectin were significantly decreased in subjects with chronic HCV and increased body mass index (BMI) compared with HCV-infected lean subjects. The presence of an anti-HCV specific immune response was strongly associated with lower BMI (P = 0.004) and higher serum total (P = 0.01) and HMW (P = 0.02) adiponectin. In ex vivo assays, total adiponectin and the HMW adiponectin isoform enhanced HCV-specific IFN-gamma production (P = 0.02 and 0.03, respectively). Adiponectin-R1 receptors were expressed on T cells and monocytes. In depletion experiments, the IFN-gamma response to adiponectin was entirely dependent on the simultaneous presence of both CD4 and CD8 T cells, and to a lesser extent, natural killer cells. Selective inhibition of p38MAPK activity by SB203580 abrogated the IFN-gamma response to adiponectin, whereas extracellular signal-regulated kinase 1/2 inhibition by PD98059 did not affect the response. In chronic HCV, a reciprocal association exists between BMI, adiponectin, and the anti-HCV immune responses, emphasizing the important role played by adiposity in regulating the immune response in HCV infection.

  15. Modulation of allergy incidence in icelandic horses is associated with a change in IL-4-producing T cells.

    PubMed

    Hamza, E; Doherr, M G; Bertoni, G; Jungi, T W; Marti, E

    2007-01-01

    Equine insect bite hypersensitivity (IBH) is an immediate-type hypersensitivity reaction provoked by insect-derived allergens. Icelandic horses living in Iceland do not have IBH due to absence of relevant insects, but acquire it at high frequency after being imported to mainland Europe. In contrast, their offspring born in mainland Europe has reduced IBH incidence. T helper 1 (Th1) and Th2 cells and cytokines were determined in Icelandic horses born in Iceland and on the continent and which either have IBH or are healthy. Peripheral blood mononuclear cells (PBMC) from these horses were stimulated for 18 h during summer and winter with polyclonal T cell stimuli, IBH allergen(s) or irrelevant allergen(s). Cells were analysed by flow cytometry for interferon-gamma (IFN-gamma) and interleukin-4 (IL-4); RNA was analysed for IFN-gamma, IL-4, IL-5 and IL-13 mRNA. During summer, but not during winter, IBH PBMC stimulated polyclonally showed reduced IFN-gamma mRNA and IFN-gamma-producing cells when compared with those of healthy horses, regardless of origin. PBMC stimulated polyclonally or with IBH allergen showed increased IL-4 mRNA levels and higher numbers of IL-4-producing cells when born in Iceland or showing IBH symptoms. IL-5 and IL-13 mRNA were modulated neither by disease nor by origin. Abrogation of IL-4 production in healthy horses born in mainland Europe may be due, at least in part, to IL-10. There was an increased level of IL-10 in supernatants from PBMC of healthy horses born in mainland Europe and stimulated polyclonally or with IBH allergen. Modulation of IBH incidence is governed by altered Th1/Th2 ratio, which might be influenced by IL-10. Copyright 2007 S. Karger AG, Basel.

  16. Dexamethasone but not indomethacin inhibits human phagocyte nicotinamide adenine dinucleotide phosphate oxidase activity by down-regulating expression of genes encoding oxidase components.

    PubMed

    Condino-Neto, A; Whitney, C; Newburger, P E

    1998-11-01

    We investigated the effects of dexamethasone or indomethacin on the NADPH oxidase activity, cytochrome b558 content, and expression of genes encoding the components gp91-phox and p47-phox of the NADPH oxidase system in the human monocytic THP-1 cell line, differentiated with IFN-gamma and TNF-alpha, alone or in combination, for up to 7 days. IFN-gamma and TNF-alpha, alone or in combination, caused a significant up-regulation of the NADPH oxidase system as reflected by an enhancement of the PMA-stimulated superoxide release, cytochrome b558 content, and expression of gp91-phox and p47-phox genes on both days 2 and 7 of cell culture. Noteworthy was the tremendous synergism between IFN-gamma and TNF-alpha for all studied parameters. Dexamethasone down-regulated the NADPH oxidase system of cytokine-differentiated THP-1 cells as assessed by an inhibition on the PMA-stimulated superoxide release, cytochrome b558 content, and expression of the gp91-phox and p47-phox genes. The nuclear run-on assays indicated that dexamethasone down-regulated the NADPH oxidase system at least in part by inhibiting the transcription of gp91-phox and p47-phox genes. Indomethacin inhibited only the PMA-stimulated superoxide release of THP-1 cells differentiated with IFN-gamma and TNF-alpha during 7 days. None of the other parameters was affected by indomethacin. We conclude that dexamethasone down-regulates the NADPH oxidase system at least in part by inhibiting the expression of genes encoding the gp91-phox and p47-phox components of the NADPH oxidase system.

  17. Failure of itraconazole to prevent T-helper type 2 cell immune deviation: Implications for chronic rhinosinusitis.

    PubMed

    Kennedy, Joshua L; Steinke, John W; Liu, Lixia; Negri, Julie; Borish, Larry; Payne, Spencer C

    2016-11-01

    T-helper (Th) type 2 cell inflammation is the hallmark of several disease processes, including asthma, atopic dermatitis, and some forms of chronic rhinosinusitis. Itraconazole has been used as both an antifungal and an anti-inflammatory agent, with some success in many of these diseases, in part, by altering Th2 cytokine expression by T cells. It is not known whether this merely reflects inhibition of established Th2-like cells or the inhibition of differentiation of naive T cells into Th2-like cells. To evaluate the role of itraconazole in the differentiation of naive T cells during activation. Naive CD45RA+ T cells were isolated from peripheral blood mononuclear cells from healthy volunteers. Th1 and Th2 type cells were differentiated in the presence of varying concentrations of itraconazole. After stimulation with anti-CD3 and anti-CD28 beads, carboxyfluorescein succinimidyl ester dilution was performed to evaluate proliferation and intracellular cytokine staining for interleukin (IL) 4 and interferon (IFN) gamma within proliferating T cells was measured along with enzyme-linked immunosorbent assay for secreted IL-5, IL-13, and IFN gamma. Itraconazole had no effect on proliferation of unbiased, Th1, or Th2 cells. Similarly, there was no effect of itraconazole on either intracellular cytokine staining of IL-4 and IFN gamma or secreted cytokine expression of IFN gamma, IL-5, and IL-13 in any of the cell populations. Itraconazole did not alter the ability of naive T cells to proliferate or secrete cytokines under Th1 or Th2 deviating conditions in vitro. As such, reported inhibition of Th2-like lymphocyte function by itraconazole reflected action on mature effector cells and may have underscored why antifungal treatment failed in many clinical trials of eosinophilic chronic rhinosinusitis.

  18. Effect of aspirin desensitization on T-cell cytokines and plasma lipoxins in aspirin-exacerbated respiratory disease.

    PubMed

    Aksu, Kurtuluş; Kurt, Emel; Alatas, Özkan; Gülbas, Zafer

    2014-01-01

    The pathogenesis of aspirin-exacerbated respiratory disease (AERD) is thought to be based on, mainly, overproduction of eicosanoid lipid mediators and on defective anti-inflammatory regulators. Aspirin desensitization treatment, the mainstay of controlling asthma and rhinitis in AERD patients, however, is the least understood aspect of the disease. The study was designed to determine the effect of aspirin desensitization on T-lymphocyte cytokine expression and on plasma lipoxin levels in AERD. Spirometry, skin-prick test and asthma control test were documented and intracellular cytokine expression in T lymphocytes and plasma lipoxin levels were measured in 23 AERD patients, 17 aspirin-tolerant asthmatic (ATA) patients, and 16 healthy controls. In the AERD group nasal symptom and smell scores were assessed. Of the 23 AERD patients 15 accepted to undergo aspirin desensitization protocol and 14 of them were desensitized successfully. In the desensitized AERD group, cytokine and lipoxin measurements were repeated after 1-month aspirin treatment. CD4(+) IL-10 levels were higher in AERD patients than in healthy controls and CD4(+) interferon (IFN) gamma levels were higher in AERD and ATA patients than in controls. Plasma lipoxin-A4 and 15-epi-lipoxin-A4 levels were similar among the three study groups. In the AERD group, subjects underwent aspirin desensitization followed by a 1-month aspirin treatment. Clinical parameters improved and CD4(+) IFN-gamma levels decreased significantly. No significant change in lipoxin levels was recorded. CD4(+) IFN-gamma and CD4(+) IL-10 levels in AERD patients after 1-month aspirin desensitization treatment were similar to the healthy controls. The study confirms aspirin desensitization is effective clinically in AERD patients and suggests that IFN gamma and IL-10 expression in CD4(+) T lymphocytes may be related to the mechanism of action.

  19. T cell-intrinsic requirement for NF-kappa B induction in postdifferentiation IFN-gamma production and clonal expansion in a Th1 response.

    PubMed

    Corn, Radiah A; Aronica, Mark A; Zhang, Fuping; Tong, Yingkai; Stanley, Sarah A; Kim, Se Ryoung Agnes; Stephenson, Linda; Enerson, Ben; McCarthy, Susan; Mora, Ana; Boothby, Mark

    2003-08-15

    NF-kappaB/Rel transcription factors are linked to innate immune responses and APC activation. Whether and how the induction of NF-kappaB signaling in normal CD4(+) T cells regulates effector function are not well-understood. The liberation of NF-kappaB dimers from inhibitors of kappaB (IkappaBs) constitutes a central checkpoint for physiologic regulation of most forms of NF-kappaB. To investigate the role of NF-kappaB induction in effector T cell responses, we targeted inhibition of the NF-kappaB/Rel pathway specifically to T cells. The Th1 response in vivo is dramatically weakened when T cells defective in their NF-kappaB induction (referred to as IkappaBalpha(DeltaN) transgenic cells) are activated by a normal APC population. Analyses in vivo, and IL-12-supplemented T cell cultures in vitro, reveal that the mechanism underlying this T cell-intrinsic requirement for NF-kappaB involves activation of the IFN-gamma gene in addition to clonal expansion efficiency. The role of NF-kappaB in IFN-gamma gene expression includes a modest decrease in Stat4 activation, T box expressed in T cell levels, and differentiation efficiency along with a more prominent postdifferentiation step. Further, induced expression of Bcl-3, a trans-activating IkappaB-like protein, is decreased in T cells as a consequence of NF-kappaB inhibition. Together, these findings indicate that NF-kappaB induction in T cells regulates efficient clonal expansion, Th1 differentiation, and IFN-gamma production by Th1 lymphocytes at a control point downstream from differentiation.

  20. Requirement for distinct Janus kinases and STAT proteins in T cell proliferation versus IFN-gamma production following IL-12 stimulation.

    PubMed

    Ahn, H J; Tomura, M; Yu, W G; Iwasaki, M; Park, W R; Hamaoka, T; Fujiwara, H

    1998-12-01

    While IL-12 is known to activate JAK2 and TYK2 and induce the phosphorylation of STAT4 and STAT3, little is known regarding how the activation of these signaling molecules is related to the biologic effects of IL-12. Using an IL-12-responsive T cell clone (2D6), we investigated their requirements for proliferation and IFN-gamma production of 2D6 cells. 2D6 cells could be maintained with either IL-12 or IL-2. 2D6 lines maintained with IL-12 (2D6(IL-12)) or IL-2 (2D6(IL-2)) exhibited comparable levels of proliferation, but produced large or only small amounts of IFN-gamma, respectively, when restimulated with IL-12 after starvation of either cytokine. 2D6(IL-12) induced TYK2 and STAT4 phosphorylation. In contrast, their phosphorylation was marginally induced in 2D6(IL-2). The reduced STAT4 phosphorylation was due to a progressive decrease in the amount of STAT4 protein along with the passages in IL-2-containing medium. 2D6(IL-12) and 2D6(IL-2) similarly proliferating in response to IL-12 induced comparable levels of JAK2 activation and STAT5 phosphorylation. JAK2 was associated with STAT5, and IL-12-induced STAT5 phosphorylation was elicited in the absence of JAK3 activation. These results indicate that IL-12 has the capacity to induce/maintain STAT4 and STAT5 proteins, and that TYK2 and JAK2 activation correlate with STAT4 phosphorylation/IFN-gamma induction and STAT5 phosphorylation/cellular proliferation, respectively.

  1. Allergen-specific Th1 cells counteract efferent Th2 cell-dependent bronchial hyperresponsiveness and eosinophilic inflammation partly via IFN-gamma.

    PubMed

    Huang, T J; MacAry, P A; Eynott, P; Moussavi, A; Daniel, K C; Askenase, P W; Kemeny, D M; Chung, K F

    2001-01-01

    Th2 T cell immune-driven inflammation plays an important role in allergic asthma. We studied the effect of counterbalancing Th1 T cells in an asthma model in Brown Norway rats that favors Th2 responses. Rats received i.v. transfers of syngeneic allergen-specific Th1 or Th2 cells, 24 h before aerosol exposure to allergen, and were studied 18-24 h later. Adoptive transfer of OVA-specific Th2 cells, but not Th1 cells, and OVA, but not BSA exposure, induced bronchial hyperresponsiveness (BHR) to acetylcholine and eosinophilia in a cell number-dependent manner. Importantly, cotransfer of OVA-specific Th1 cells dose-dependently reversed BHR and bronchoalveolar lavage (BAL) eosinophilia, but not mucosal eosinophilia. OVA-specific Th1 cells transferred alone induced mucosal eosinophilia, but neither BHR nor BAL eosinophilia. Th1 suppression of BHR and BAL eosinophilia was allergen specific, since cotransfer of BSA-specific Th1 cells with the OVA-specific Th2 cells was not inhibitory when OVA aerosol alone was used, but was suppressive with OVA and BSA challenge. Furthermore, recipients of Th1 cells alone had increased gene expression for IFN-gamma in the lungs, while those receiving Th2 cells alone showed increased IL-4 mRNA. Importantly, induction of these Th2 cytokines was inhibited in recipients of combined Th1 and Th2 cells. Anti-IFN-gamma treatment attenuated the down-regulatory effect of Th1 cells. Allergen-specific Th1 cells down-regulate efferent Th2 cytokine-dependent BHR and BAL eosinophilia in an asthma model via mechanisms that depend on IFN-gamma. Therapy designed to control the efferent phase of established asthma by augmenting down-regulatory Th1 counterbalancing mechanisms should be effective.

  2. Continuous in vivo infusion of interferon-gamma (IFN-γ) enhances engraftment of syngeneic wild-type cells in Fanca–/– and Fancg–/– mice

    PubMed Central

    Si, Yue; Ciccone, Samantha; Yang, Feng-Chun; Yuan, Jin; Zeng, Daisy; Chen, Shi; van de Vrugt, Henri J.; Critser, John; Arwert, Fre; Haneline, Laura S.; Clapp, D. Wade

    2006-01-01

    Fanconi anemia (FA) is a heterogeneous genetic disorder characterized by bone marrow (BM) failure and cancer susceptibility. Identification of the cDNAs of FA complementation types allows the potential of using gene transfer technology to introduce functional cDNAs as transgenes into autologous stem cells and provide a cure for the BM failure in FA patients. However, strategies to enhance the mobilization, transduction, and engraftment of exogenous stem cells are required to optimize efficacy prior to widespread clinical use. Hypersensitivity of Fancc–/– cells to interferon-gamma (IFN-γ), a nongenotoxic immune-regulatory cytokine, enhances engraftment of syngeneic wild-type (WT) cells in Fancc–/– mice. However, whether this phenotype is of broad relevance in other FA complementation groups is unresolved. Here we show that primitive and mature myeloid progenitors in Fanca–/– and Fancg–/– mice are hypersensitive to IFN-γ and that in vivo infusion of IFN-γ at clinically relevant concentrations was sufficient to allow consistent long-term engraftment of isogenic WT repopulating stem cells. Given that FANCA, FANCC, and FANCG complementation groups account for more than 90% of all FA patients, these data provide evidence that IFN-γ conditioning may be a useful nongenotoxic strategy for myelopreparation in FA patients. PMID:16946306

  3. Decreased interferon-α production in response to CpG DNA dysregulates cytokine responses in patients with multiple sclerosis.

    PubMed

    Hirotani, Makoto; Niino, Masaaki; Fukazawa, Toshiyuki; Yaguchi, Hiroaki; Nakamura, Masakazu; Kikuchi, Seiji; Sasaki, Hidenao

    2012-05-01

    Type I interferons (IFNs), represented by IFN-α and β, activate immune effector cells belonging to the innate and adaptive immune systems. Plasmacytoid dendritic cells (pDCs) produce IFN-α in response to CpG DNA. We aimed to examine the impact of pDC-produced IFN-α on the adaptive immune system in Multiple Sclerosis (MS). Our results demonstrated that CpG DNA-induced IFN-α production was significantly decreased in PBMCs from MS patients. Decreased levels of IL-12 p70, IFN-γ, and IL-17 and increased level of IL-10 were found in CpG DNA-treated PBMCs of healthy subjects unlike in those from MS patients. In samples pre-treated with IFN-α and IFN-β, decreased levels of IL-12 p70, IFN-γ, and IL-17 and increased level of IL-10 were detected in PBMCs from MS patients. These results suggest that CpG DNA-induced decreased IFN-α production causes pro-inflammatory cytokine secretion, and either IFN-α or IFN-β induces anti-inflammatory cytokine secretion in the adaptive immune system in MS. Copyright © 2012 Elsevier Inc. All rights reserved.

  4. Delayed translational silencing of ceruloplasmin transcript in gamma interferon-activated U937 monocytic cells: role of the 3' untranslated region

    NASA Technical Reports Server (NTRS)

    Mazumder, B.; Fox, P. L.

    1999-01-01

    Ceruloplasmin (Cp) is an acute-phase protein with ferroxidase, amine oxidase, and pro- and antioxidant activities. The primary site of Cp synthesis in human adults is the liver, but it is also synthesized by cells of monocytic origin. We have shown that gamma interferon (IFN-gamma) induces the synthesis of Cp mRNA and protein in monocytic cells. We now report that the induced synthesis of Cp is terminated by a mechanism involving transcript-specific translational repression. Cp protein synthesis in U937 cells ceased after 16 h even in the presence of abundant Cp mRNA. RNA isolated from cells treated with IFN-gamma for 24 h exhibited a high in vitro translation rate, suggesting that the transcript was not defective. Ribosomal association of Cp mRNA was examined by sucrose centrifugation. When Cp synthesis was high, i.e., after 8 h of IFN-gamma treatment, Cp mRNA was primarily associated with polyribosomes. However, after 24 h, when Cp synthesis was low, Cp mRNA was primarily in the nonpolyribosomal fraction. Cytosolic extracts from cells treated with IFN-gamma for 24 h, but not for 8 h, contained a factor which blocked in vitro Cp translation. Inhibitor expression was cell type specific and present in extracts of human cells of myeloid origin, but not in several nonmyeloid cells. The inhibitory factor bound to the 3' untranslated region (3'-UTR) of Cp mRNA, as shown by restoration of in vitro translation by synthetic 3'-UTR added as a "decoy" and detection of a binding complex by RNA gel shift analysis. Deletion mapping of the Cp 3'-UTR indicated an internal 100-nucleotide region of the Cp 3'-UTR that was required for complex formation as well as for silencing of translation. Although transcript-specific translational control is common during development and differentiation and global translational control occurs during responses to cytokines and stress, to our knowledge, this is the first report of translational silencing of a specific transcript following cytokine activation.

  5. Identification and characterization of TF1(phox), a DNA-binding protein that increases expression of gp91(phox) in PLB985 myeloid leukemia cells.

    PubMed

    Eklund, E A; Kakar, R

    1997-04-04

    The CYBB gene encodes gp91(phox), the heavy chain of the phagocyte-specific NADPH oxidase. CYBB is transcriptionally inactive until the promyelocyte stage of myelopoiesis, and in mature phagocytes, expression of gp91(phox) is further increased by interferon-gamma (IFN-gamma) and other inflammatory mediators. The CYBB promoter region contains several lineage-specific cis-elements involved in the IFN-gamma response. We screened a leukocyte cDNA expression library for proteins able to bind to one of these cis-elements (-214 to -262 base pairs) and identified TF1(phox), a protein with sequence-specific binding to the CYBB promoter. Electrophoretic mobility shift assay with nuclear proteins from a variety of cell lines demonstrated binding of a protein to the CYBB promoter that was cross-immunoreactive with TF1(phox). DNA binding of this protein was increased by IFN-gamma treatment in the myeloid cell line PLB985, but not in the non-myeloid cell line HeLa. Overexpression of recombinant TF1(phox) in PLB985 cells increased endogenous gp91(phox) message abundance, but did not lead to cellular differentiation. Overexpression of TF1(phox) in myeloid leukemia cell lines increased reporter gene expression from artificial promoter constructs containing CYBB promoter sequence. These data suggested that TF1(phox) increased expression of gp91(phox).

  6. The effect of high gravidity on the carcinogenesis of mammary gland in TA2 mice.

    PubMed

    Wang, Xuan; Huang, Chun; Sun, Baocun; Gu, Yanjun; Cui, Yanfen; Zhao, Xiulan; Li, Yan; Zhang, Shiwu

    2010-05-01

    Spontaneous breast cancer in Tientsin Albinao 2 (TA2) mice, like human pregnancy-associated breast cancer (PABC), often occurs in pregnancy and puerperium, especially in mice with high gravidity. We hypothesized that the dysfunction of cellular immunity caused by the increase of 17beta-estradiol (E2) and progesterone (P) might be one of the reasons for carcinogenesis of mammary gland. We investigated the T lymphocyte subsets and the concentration of serum hormone and cytokines in cancer-bearing, pregnant or postpartum TA2 mice using flow cytometry, chemiluminescent immunoassay, and enzyme-linked immunosorbent assay (ELISA), respectively. The number of T lymphocytes and the concentration of E2, P, interleukin-2 (IL-2), IL-4, and interferon-gamma (IFN-gamma) changed with the increase of pregnancy and puerperium. During four pregnancies, elevated E2 and P resulted in a decrease in the number of CD3(+), CD4(+) T lymphocytes, CD4(+)/CD8(+) ratio, and the concentration of IL-2, IL-4, and IFN-gamma. Data in the fourth pregnancy were the closest to those of cancer-bearing mice. T lymphocyte subsets and concentration of IL-2, IL-4, and IFN-gamma are affected by E2 and P during multiple pregnancy and delivery to some degree, which may contribute to the genesis of spontaneous breast cancer in TA2 mice.

  7. Adjuvant effects of protopanaxadiol and protopanaxatriol saponins from ginseng roots on the immune responses to ovalbumin in mice.

    PubMed

    Sun, Jianhua; Hu, Songhua; Song, Xiaoming

    2007-01-22

    Protopanaxadiol saponins (Rg3, Rd, Rc, Rb1 and Rb2) and protopanaxatriol saponins (Rg1, Re and Rg2) isolated from the root of Panax ginseng C.A. Meyer were evaluated for their adjuvant effects on the immune responses to ovalbumin (OVA) in mice. BALB/c mice were subcutaneously injected twice at a 3-week interval with 10 microg of ovalbumin or 10 microg of OVA plus 50 microg of ginsenosides Rg3, Rd, Rc, Rb1, Rb2, Rg1, Re or Rg2 or Quil A (n=5). Blood samples were collected for measuring specific total-IgG, IgG1 and IgG2a, and splenocytes were harvested for determining lymphocyte proliferation as well as IFN-gamma and IL-5 production 2 weeks after the boosting. The results indicated that OVA-specific antibody responses were significantly higher in mice immunized with OVA co-administered with Rg1, Re, Rg2, Rg3 and Rb1 but not with Rd, Rc and Rb2 when compared with the control (immunized with OVA only). Significantly enhanced splenocyte proliferative responses to Con A, LPS and OVA as well as the production of both IL-5 and IFN-gamma stimulated by OVA were also detected in mice immunized with OVA co-administered with Rg1 but not with Rb1, Re and Rg3. Of the ginsenosides studied, Rg1, Re, Rg2, Rg3 and Rb1 have more potent adjuvant properties than the others, indicating that they are the major constituents contributing to the adjuvant activities of total ginseng saponins. Varieties of ginsenosides in adjuvant activity might be attributed to the varieties of molecular conformations determined by the side sugar chains attaching to their dammarane skeleton.

  8. IFN-{gamma} sensitizes MIN6N8 insulinoma cells to TNF-{alpha}-induced apoptosis by inhibiting NF-{kappa}B-mediated XIAP upregulation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, Hun Sik; Kim, Sunshin; Lee, Myung-Shik

    2005-10-28

    Although X-linked inhibitor of apoptosis protein (XIAP) is an important intracellular suppressor of apoptosis in a variety of cell types, its role in cytokine-induced pancreatic {beta}-cell apoptosis remains unclear. Here, we found that: (i) XIAP level was inversely correlated with tumor necrosis factor (TNF)-{alpha}-induced apoptosis in MIN6N8 insulinoma cells; (ii) adenoviral XIAP overexpression abrogated the TNF-{alpha}-induced apoptosis through inhibition of caspase activity; (iii) downregulation of XIAP by antisense oligonucleotide or Smac peptide sensitized MIN6N8 cells to TNF-{alpha}-induced apoptosis; (iv) XIAP expression was induced by TNF-{alpha} through a nuclear factor-{kappa}B (NF-{kappa}B)-dependent pathway, and interferon (IFN)-{gamma} prevented such an induction in amore » manner independent of NF-{kappa}B, which presents a potential mechanism underlying cytotoxic IFN-{gamma}/TNF-{alpha} synergism. Taken together, our results suggest that XIAP is an important modulator of TNF-{alpha}-induced apoptosis of MIN6N8 cells, and XIAP regulation in pancreatic {beta}-cells might play an important role in pancreatic {beta}-cell apoptosis and in the pathogenesis of type 1 diabetes.« less

  9. Polyclonal and allergen-induced cytokine responses in children with elevated immunoglobulin E but no atopic disease.

    PubMed

    Smart, J M; Tang, M L K; Kemp, A S

    2002-11-01

    Reduced Th1 and elevated Th2 cytokine responses are considered to be a principal mechanism in the generation of the inflammation leading to the manifestations of atopic disease in the skin of atopic dermatitis and in the airways of asthma. If reduced Th1 and elevated Th2 responses are principal determinants of the manifestation of atopic disease it might be expected that subjects with established disease would exhibit differences in their cytokine profiles as compared with atopic patients without clinical disease. To determine whether asymptomatic atopic children exhibit a cytokine imbalance similar to that seen in patients with established atopic disease or if they behave like non-atopic controls. Cytokine responses in a group of children with elevated IgE but no clinical manifestations of disease, atopic children with established disease and non-atopic controls were compared. We examined allergen-induced (house dust mite, HDM, rye grass pollen and RYE) cytokine responses in parallel with polyclonal (staphylococcal enterotoxin B, SEB) cytokine responses in a group of children with elevated serum IgE levels without current or past evidence of atopic disease (median age 6.6 years) and compared these with a non-atopic control group (median age 6.5 years) and a group of children with atopic disease (median age 6.7 years). Symptomatic atopic children had reduced SEB-induced IFN-gamma and increased SEB-induced IL-4 and IL-5 as compared with non-atopic controls. In contrast, SEB-induced IFN-gamma, IL-4 and IL-5 production in asymptomatic atopics was not significantly different from the non-atopic control subjects. Allergen-induced Th1 (IFN-gamma) and Th2 (IL-5 and IL-13) cytokine production was increased in both symptomatic atopics and asymptomatic atopics when compared with non-atopic controls. The defect in polyclonally induced IFN-gamma production was associated with the clinical manifestation of atopic disease but not the atopic stateper se. This suggests that the global reduction in IFN-gamma is the key determinant of the development of overt atopic disease. In contrast, elevated allergen-induced Th2 cytokine responses in children related to the atopic state per se irrespective of the presence of clinical atopic disease.

  10. CD4+ T-cell clones obtained from cattle chronically infected with Fasciola hepatica and specific for adult worm antigen express both unrestricted and Th2 cytokine profiles.

    PubMed Central

    Brown, W C; Davis, W C; Dobbelaere, D A; Rice-Ficht, A C

    1994-01-01

    The well-established importance of helper T (Th)-cell subsets in immunity and immunoregulation of many experimental helminth infections prompted a detailed study of the cellular immune response against Fasciola hepatica in the natural bovine host. T-cell lines established from two cattle infected with F. hepatica were characterized for the expression of T-cell surface markers and proliferative responses against F. hepatica adult worm antigen. Parasite-specific T-cell lines contained a mixture of CD4+, CD8+, and gamma/delta T-cell-receptor-bearing T cells. However, cell lines containing either fewer than 10% CD8+ T cells or depleted of gamma/delta T cells proliferated vigorously against F. hepatica antigen, indicating that these T-cell subsets are not required for proliferative responses in vitro. Seventeen F. hepatica-specific CD4+ Th-cell clones were examined for cytokine expression following concanavalin A stimulation. Biological assays to measure interleukin-2 (IL-2) or IL-4, gamma interferon (IFN-gamma), and tumor necrosis factor and Northern (RNA) blot analysis to verify the expression of IL-2, IL-4, and IFN-gamma revealed that the Th-cell clones expressed a spectrum of cytokine profiles. Several Th-cell clones were identified as Th2 cells by the strong expression of IL-4 but little or no IL-2 or IFN-gamma mRNA. The majority of Th-cell clones were classified as Th0 cells by the expression of either all three cytokines or combinations of IL-2 and IL-4 or IL-4 and IFN-gamma. No Th1-cell clones were obtained. All of the Th-cell clones expressed a typical memory cell surface phenotype, characterized as CD45Rlow, and all expressed the lymph node homing receptor (L selectin). These results are the first to describe cytokine responses of F. hepatica-specific T cells obtained from infected cattle and extend our previous analysis of Th0 and Th1 cells from cattle immune to Babesia bovis (W. C. Brown, V. M. Woods, D. A. E. Dobbelaere, and K. S. Logan, Infect. Immun. 61:3273-3281, 1993) to include F. hepatica-specific Th2 cells. Images PMID:7509319

  11. Prenatal Dexamethasone and Postnatal High-Fat Diet Decrease Interferon Gamma Production through an Age-Dependent Histone Modification in Male Sprague-Dawley Rats

    PubMed Central

    Yu, Hong-Ren; Tain, You-Lin; Sheen, Jiunn-Ming; Tiao, Mao-Meng; Chen, Chih-Cheng; Kuo, Ho-Chang; Hung, Pi-Lien; Hsieh, Kai-Sheng; Huang, Li-Tung

    2016-01-01

    Overexposure to prenatal glucocorticoid (GC) disturbs hypothalamic-pituitary-adrenocortical axis-associated neuroendocrine metabolism and susceptibility to metabolic syndrome. A high-fat (HF) diet is a major environmental factor that can cause metabolic syndrome. We aimed to investigate whether prenatal GC plus a postnatal HF diet could alter immune programming in rat offspring. Pregnant Sprague-Dawley rats were given intraperitoneal injections of dexamethasone or saline at 14–21 days of gestation. Male offspring were then divided into four groups: vehicle, prenatal dexamethasone exposure, postnatal HF diet (VHF), and prenatal dexamethasone exposure plus a postnatal HF diet (DHF). The rats were sacrificed and adaptive immune function was evaluated. Compared to the vehicle, the DHF group had lower interferon gamma (IFN-γ) production by splenocytes at postnatal day 120. Decreases in H3K9 acetylation and H3K36me3 levels at the IFN-γ promoter correlated with decreased IFN-γ production. The impaired IFN-γ production and aberrant site-specific histone modification at the IFN-γ promoter by prenatal dexamethasone treatment plus a postnatal HF diet resulted in resilience at postnatal day 180. Prenatal dexamethasone and a postnatal HF diet decreased IFN-γ production through a site-specific and an age-dependent histone modification. These findings suggest a mechanism by which prenatal exposure to GC and a postnatal environment exert effects on fetal immunity programming. PMID:27669212

  12. Expression and regulation of complement C1q by human THP-1-derived macrophages.

    PubMed

    Walker, D G

    1998-01-01

    The regulation of C1q expression was examined in the human monocytic cell line THP-1. Since these cells can be differentiated into cells with macrophage properties and induced to express C1q, they were used as models for mature human monocyte/macrophages and indirectly microglia. Interferon-gamma (IFN-gamma) and the anti-inflammatory steroid agents dexamethasone and prednisone were powerful stimulators of C1q production, alone or in combination. Interleukin-6 (IL-6) and lipopolysaccharide (LPS) also had significant stimulatory activity. Phorbol myristate acetate, a protein kinase C activator, reduced C1q expression. Four additional classes of pharmacological agents were tested for their effect on C1q secretion. Tacrine, but not indomethacin, cimetidine, or propentofylline, showed activity in inhibiting C1q secretion by IFN-gamma treated THP-1-derived macrophages.

  13. In vitro stimulatory effect of N-acetyl tryptophan-glucopyranoside against gamma radiation induced immunosuppression.

    PubMed

    Malhotra, Poonam; Singh, Darshana; Kumar, Raj

    2018-03-01

    Radiation-induced manifestations like free radical burst, oxidative damage and apoptosis leading to cell death. In present study, N-acetyl tryptophan glucopyranoside (NATG) was assessed for its immune-radioprotective activities using J774A.1 cells. Clonogenic cell survival, cell cycle progression and cytokines i.e. IFN-γ, TNF-α, IL-2, IL-10, IL-12, IL-13 and IL-17A expression were evaluated in irradiated and NATG pretreated cells using clonogenic formation ability, flow cytometry and ELISA assay. Results indicated that 0.25μg/ml NATG exhibited maximum radioprotection against gamma-radiation (2Gy) without intervening in cell cycle progression. NATG pretreated (-2 h) plus irradiated cells showed significant elevation in IFN-γ (∼38.2%), IL-17A (∼53.7%) and IL-12 (∼58.8%) expression as compared to only irradiated cells. Conversely, significant decrease in TNF-α (∼21.6%), IL-10 (∼31.2%), IL-2 (∼23.7%) and IL-13 expression (∼17.8%) were observed in NATG pretreated plus irradiated cells as compared to irradiated cells. Conclusively, NATG pretreatment to irradiated J774A.1 cells, stimulate Th 1 while diminish Th 2 cytokines that contributes to radioprotection. © 2017 Wiley Periodicals, Inc.

  14. Prolonged illness after infectious mononucleosis is associated with altered immunity but not with increased viral load.

    PubMed

    Cameron, Barbara; Bharadwaj, Mandvi; Burrows, Jacqueline; Fazou, Chrysa; Wakefield, Denis; Hickie, Ian; Ffrench, Rosemary; Khanna, Rajiv; Lloyd, Andrew

    2006-03-01

    Primary Epstein-Barr virus (EBV) infection causes a spectrum of characteristics that range from asymptomatic seroconversion to severe infectious mononucleosis (IM), sometimes with prolonged symptoms and disability. We examined the relationships between clinical course, number of viral copies, and immunological parameters in a prospective cohort of subjects with recent IM. Eight case patients with at least 6 months of disabling symptoms and 31 matched control subjects who had recovered promptly were included. Symptom scores were recorded at regular intervals over the course of 12 months. Cellular EBV load, EBV-specific antibody responses, lymphocyte subsets, and EBV-specific interferon (IFN)- gamma induction were measured. In case patients with prolonged illness, the severity of acute-phase symptoms was greater, the development of anti-EBV nuclear antigen-1 immunoglobulin G was more rapid, and the time to development of the peak IFN- gamma response to the majority of latent-cycle EBV peptides was generally slower than those in control subjects. However, in both groups, neither viral nor immune parameters correlated with the severity or duration of symptoms. The resolution of symptomatic IM is not determined by control of viremia, nor is it easily explained by altered host responses to EBV infection. The detailed determinants of delayed recovery remain to be elucidated.

  15. Production stability of active polysaccharides of Dendrobium huoshanense using long-term cultures of protocorm-like bodies.

    PubMed

    Zha, Xue-Qiang; Luo, Jian-Ping

    2008-01-01

    In this study, the production stability of active polysaccharides in protocorm-like bodies (PLBs) induced from the seedling segments of Dendrobium huoshanense C. Z. Tang et S. J. Cheng was investigated during long-term subculture. Subcultures were conducted once every 30 days. With an average inoculum of 39 g/L fresh PLBs, the increase in biomass ranged from 95.7 g/L to 103.9 g/L in fresh weight and 3.2 g/L to 3.4 g/L in dry weight during eighteen continuous subcultures while polysaccharide content in PLBs was from 0.8 mg/g Fw (mg polysaccharide per gram PLBs in fresh weight) to 1.0 mg/g Fw. In addition, polysaccharides from all cultures showed a similar potential of stimulating interferon gamma (IFN-gamma) release in the supernatant of splenocytes and tumor necrosis factor alpha (TNF-alpha) release in the supernatant of peritoneal macrophages. To elucidate the genetic basis of polysaccharide production stability in long-term subculture of PLBs, the genetic fingerprints by RAPD were further analyzed using plantlets from PLB development. Results showed that there is no evidence of genetic variation both within the plantlets from the different subcultures of PLBs and between long-term subcultures and the donor plants.

  16. A Windshear Hazard Index

    NASA Technical Reports Server (NTRS)

    Proctor, Fred H.; Hinton, David A.; Bowles, Roland L.

    2000-01-01

    An aircraft exposed to hazardous low-level windshear may suffer a critical loss of airspeed and altitude, thus endangering its ability to remain airborne. In order to characterize this hazard, a nondimensional index was developed based oil aerodynamic principals and understanding of windshear phenomena, 'This paper reviews the development and application of the Bowles F-tactor. which is now used by onboard sensors for the detection of hazardous windshear. It was developed and tested during NASA/I:AA's airborne windshear program and is now required for FAA certification of onboard radar windshear detection systems. Reviewed in this paper are: 1) definition of windshear and description of atmospheric phenomena that may cause hazardous windshear. 2) derivation and discussion of the F-factor. 3) development of the F-factor hazard threshold, 4) its testing during field deployments, and 5) its use in accident reconstructions,

  17. Air/ground wind shear information integration: Flight test results

    NASA Technical Reports Server (NTRS)

    Hinton, David A.

    1992-01-01

    An element of the NASA/FAA wind shear program is the integration of ground-based microburst information on the flight deck, to support airborne wind shear alerting and microburst avoidance. NASA conducted a wind shear flight test program in the summer of 1991 during which airborne processing of Terminal Doppler Weather Radar (TDWR) data was used to derive microburst alerts. High level microburst products were extracted from TDWR, transmitted to a NASA Boeing 737 in flight via data link, and processed to estimate the wind shear hazard level (F-factor) that would be experienced by the aircraft in the core of each microburst. The microburst location and F-factor were used to derive a situation display and alerts. The situation display was successfully used to maneuver the aircraft for microburst penetrations, during which in situ 'truth' measurements were made. A total of 19 penetrations were made of TDWR-reported microburst locations, resulting in 18 airborne microburst alerts from the TDWR data and two microburst alerts from the airborne in situ measurements. The primary factors affecting alerting performance were spatial offset of the flight path from the region of strongest shear, differences in TDWR measurement altitude and airplane penetration altitude, and variations in microburst outflow profiles. Predicted and measured F-factors agreed well in penetrations near microburst cores. Although improvements in airborne and ground processing of the TDWR measurement would be required to support an airborne executive-level alerting protocol, the feasibility of airborne utilization of TDWR data link data has been demonstrated.

  18. Airborne derivation of microburst alerts from ground-based Terminal Doppler Weather Radar information: A flight evaluation

    NASA Technical Reports Server (NTRS)

    Hinton, David A.

    1993-01-01

    An element of the NASA/FAA windshear program is the integration of ground-based microburst information on the flight deck, to support airborne windshear alerting and microburst avoidance. NASA conducted a windshear flight test program in the summer of 1991 during which airborne processing of Terminal Doppler Weather Radar (TDWR) data was used to derive microburst alerts. Microburst information was extracted from TDWR, transmitted to a NASA Boeing 737 in flight via data link, and processed to estimate the windshear hazard level (F-factor) that would be experienced by the aircraft in each microburst. The microburst location and F-factor were used to derive a situation display and alerts. The situation display was successfully used to maneuver the aircraft for microburst penetrations, during which atmospheric 'truth' measurements were made. A total of 19 penetrations were made of TDWR-reported microburst locations, resulting in 18 airborne microburst alerts from the TDWR data and two microburst alerts from the airborne reactive windshear detection system. The primary factors affecting alerting performance were spatial offset of the flight path from the region of strongest shear, differences in TDWR measurement altitude and airplane penetration altitude, and variations in microburst outflow profiles. Predicted and measured F-factors agreed well in penetrations near microburst cores. Although improvements in airborne and ground processing of the TDWR measurements would be required to support an airborne executive-level alerting protocol, the practicality of airborne utilization of TDWR data link data has been demonstrated.

  19. SOCS1 and SOCS3 Are Targeted by Hepatitis C Virus Core/gC1qR Ligation To Inhibit T-Cell Function

    PubMed Central

    Yao, Zhi Qiang; Waggoner, Stephen N.; Cruise, Michael W.; Hall, Caroline; Xie, Xuefang; Oldach, David W.; Hahn, Young S.

    2005-01-01

    T cells play an important role in the control of hepatitis C virus (HCV) infection. We have previously demonstrated that the HCV core inhibits T-cell responses through interaction with gC1qR. We show here that core proteins from chronic and resolved HCV patients differ in sequence, gC1qR-binding ability, and T-cell inhibition. Specifically, chronic core isolates bind to gC1qR more efficiently and inhibit T-cell proliferation as well as gamma interferon (IFN-γ) production more profoundly than resolved core isolates. This inhibition is mediated by the disruption of STAT phosphorylation through the induction of SOCS molecules. Silencing either SOCS1 or SOCS3 by small interfering RNA dramatically augments the production of IFN-γ in T cells, thereby abrogating the inhibitory effect of core. Additionally, the ability of core proteins from patients with chronic infections to induce SOCS proteins and suppress STAT activation greatly exceeds that of core proteins from patients with resolved infections. These results suggest that the HCV core/gC1qR-induced T-cell dysfunction involves the induction of SOCS, a powerful inhibitor of cytokine signaling, which represents a novel mechanism by which a virus usurps the host machinery for persistence. PMID:16306613

  20. Curcumin inhibits interferon-{alpha} induced NF-{kappa}B and COX-2 in human A549 non-small cell lung cancer cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Jeeyun; Im, Young-Hyuck; Jung, Hae Hyun

    2005-08-26

    The A549 cells, non-small cell lung cancer cell line from human, were resistant to interferon (IFN)-{alpha} treatment. The IFN-{alpha}-treated A549 cells showed increase in protein expression levels of NF-{kappa}B and COX-2. IFN-{alpha} induced NF-{kappa}B binding activity within 30 min and this increased binding activity was markedly suppressed with inclusion of curcumin. Curcumin also inhibited IFN-{alpha}-induced COX-2 expression in A549 cells. Within 10 min, IFN-{alpha} rapidly induced the binding activity of a {gamma}-{sup 32}P-labeled consensus GAS oligonucleotide probe, which was profoundly reversed by curcumin. Taken together, IFN-{alpha}-induced activations of NF-{kappa}B and COX-2 were inhibited by the addition of curcumin in A549more » cells.« less

  1. Interferon-Gamma and Fas Are Involved in Porphyromonas gingivalis-Induced Apoptosis of Human Extravillous Trophoblast-Derived HTR8/SVneo Cells via Extracellular Signal-Regulated Kinase 1/2 Pathway.

    PubMed

    Ren, Hongyu; Li, Yuhong; Jiang, Han; Du, Minquan

    2016-11-01

    A number of studies recently revealed a link between periodontal disease and preterm birth (PTB). PTB can be induced by dental infection with Porphyromonas gingivalis (Pg), a periodontopathic bacterium. This study aims to investigate responses of human extravillous trophoblast-derived HTR8/SVneo cells to Pg infection. Cell apoptosis, cell viability, protein expression, and cytokine production in HTR8 cells were measured via: 1) flow cytometry, 2) CCK-8 assay, 3) western blot, and 4) enzyme-linked immunosorbent assay methods, respectively. Pg decreased cell viability and increased cell apoptosis, active caspase-3 and Fas expression, and interferon-gamma (IFN-γ) secretion in HTR8 cells. Extracellular signal-regulated kinase (ERK) 1/2 inhibitor U0126 and FasL neutralizing antibody NOK1 that blocks FasL/Fas interaction both significantly suppressed Pg-induced apoptosis. U0126 also inhibited IFN-γ secretion and Fas expression close to control levels. Moreover, treatment with recombinant IFN-γ also significantly decreased number of viable HTR8 cells and increased Fas expression, suggesting IFN-γ may play an important role in Pg-induced apoptosis of HTR8 cells, at least partially through regulation of Fas expression. To the best of the authors' knowledge, this is the first study to demonstrate Pg induces IFN-γ secretion, Fas expression, and apoptosis in human extravillous trophoblast-derived HTR8/SVneo cells in an ERK1/2-dependent manner, and IFN-γ (explored by recombinant IFN-γ) and Fas are involved in Pg-induced apoptosis. The finding that Pg infection abnormally regulates inflammation and apoptosis of human trophoblasts may give new insights into the possible link of PTB with maternal periodontal disease and periodontal pathogens.

  2. ROS mediates interferon gamma induced phosphorylation of Src, through the Raf/ERK pathway, in MCF-7 human breast cancer cell line.

    PubMed

    Zibara, Kazem; Zeidan, Asad; Bjeije, Hassan; Kassem, Nouhad; Badran, Bassam; El-Zein, Nabil

    2017-03-01

    Interferon gamma (IFN-ɣ) is a pleiotropic cytokine which plays dual contrasting roles in cancer. Although IFN-ɣ has been clinically used to treat various malignancies, it was recently shown to have protumorigenic activities. Reactive oxygen species (ROS) are overproduced in cancer cells, mainly due to NADPH oxidase activity, which results into several changes in signaling pathways. In this study, we examined IFN-ɣ effect on the phosphorylation levels of key signaling proteins, through ROS production, in the human breast cancer cell line MCF-7. After treatment by IFN-ɣ, results showed a significant increase in the phosphorylation of STAT1, Src, raf, AKT, ERK1/2 and p38 signaling molecules, in a time specific manner. Src and Raf were found to be involved in early stages of IFN-ɣ signaling since their phosphorylation increased very rapidly. Selective inhibition of Src-family kinases resulted in an immediate significant decrease in the phosphorylation status of Raf and ERK1/2, but not p38 and AKT. On the other hand, IFN-ɣ resulted in ROS generation, through H 2 O 2 production, whereas pre-treatment with the ROS inhibitor NAC caused ROS inhibition and a significant decrease in the phosphorylation levels of AKT, ERK1/2, p38 and STAT1. Moreover, pretreatment with a selective NOX1 inhibitor resulted in a significant decrease of AKT phosphorylation. Finally, no direct relationship was found between ROS production and calcium mobilization. In summary, IFN-ɣ signaling in MCF-7 cell line is ROS-dependent and follows the Src/Raf/ERK pathway whereas its signaling through the AKT pathway is highly dependent on NOX1.

  3. IN VITRO LUNG ALVEOLAR EPITHELIAL CELL INJURY AND INFLAMMATORY RESPONSE TO PARTICULATE MATTER-ASSOCIATED METALS - MODULATION BY EXPOSURE TO TNF-ALPHA, IL-BETA, OR IFN-GAMMA

    EPA Science Inventory

    IN VITRO LUNG ALVEOLAR EPITHELIAL CELL INJURY AND INFLAMMATORY RESPONSE TO PARTICULATE MATTER-ASSOCIATED METALS - MODULATION BY EXPOSURE TO TNF , IL-1 , OR IFN .

    JA Dye, KE Peoples*, CL Hayes?. US EPA, ORD, Pulmonary Toxicology Branch, RTP, NC, *HHMI-SRI, NCSU, Raleigh, NC...

  4. Persistent interferon transgene expression by RNA interference-mediated silencing of interferon receptors.

    PubMed

    Takahashi, Yuki; Vikman, Elin; Nishikawa, Makiya; Ando, Mitsuru; Watanabe, Yoshihiko; Takakura, Yoshinobu

    2010-09-01

    The in vivo half-life of interferons (IFNs) is very short, and its extension would produce a better therapeutic outcome in IFN-based therapy. Delivery of IFN genes is one solution for providing a sustained supply. IFNs have a variety of functions, including the suppression of transgene expression, through interaction with IFN receptors (IFNRs). This suppression could prevent IFNs from being expressed from vectors delivered. Silencing the expression of IFNAR and IFNGR, the receptors for type I and II IFNs, respectively, in cells expressing IFNs may prolong transgene expression of IFNs. Mouse melanoma B16-BL6 cells or mouse liver were selected as a site expressing IFNs (not a target for IFN gene therapy) and IFN-expressing plasmid DNA was delivered with or without small interfering RNA (siRNA) targeting IFNRs. Transfection of B16-BL6 cells with siRNA targeting IFNAR1 subunit (IFNAR1) resulted in the reduced expression of IFNAR on the cell surface. This silencing significantly increased the IFN-beta production in cells that were transfected with IFN-beta-expressing plasmid DNA. Similar results were obtained with the combination of IFN-gamma and IFNGR. Co-injection of IFN-beta-expressing plasmid DNA with siRNA targeting IFNAR1 into mice resulted in sustained plasma concentration of IFN-beta. These results provide experimental evidence that the RNAi-mediated silencing of IFNRs in cells expressing IFN, such as hepatocytes, is an effective approach for improving transgene expression of IFNs when their therapeutic target comprises cells other than those expressing IFNs.

  5. Polyfunctional CD4 T cells in the response to bovine tuberculosis

    USDA-ARS?s Scientific Manuscript database

    Polyfunctional CD4 T cells simultaneously produce interferon-gamma (IFN-gamma), interleukin-2 (IL-2) and tumor necrosis factor-alpha (TNF-alpha) and play relevant roles in several chronic infections, including human TB and HIV. However, the assessment of this response in bovine infections was not fe...

  6. Interferon Gamma as a Biomarker of Exposure to Enteric Viruses

    EPA Science Inventory

    Interferon gamma (IFN-γ) was selected as a biomarker for viral exposure. Twelve-week-old BALB/c mice were intraperitoneally injected with Coxsackievirus B3 or B4 diluted in phosphate-buffered saline (PBS). Control mice were injected with PBS only. Four months after viral infectio...

  7. Effect of the bacillus of Calmette-Guérin, Propionibacter acnes and avridine as immunomodulators in antirabies vaccination of mice using the Fuenzalida-Palacios mouse brain vaccine.

    PubMed

    Megid, J; Peraçolli, M T; Curi, P R; Zanetti, C R; Cabrera, W H; Vassao, R; Ito, F H

    1999-05-14

    Using the laboratory mice, Fuenzalida-Palacios mouse brain human rabies vaccine was administered in groups of animals previously inoculated with rabies virus and then submitted to treatments with the immunomodulators onco-BCG, avridine and Propionibacterium acnes. Humoral and cellular immune responses were evaluated through the macrophage inhibition factor (MIF), intra-pad inoculation (IPI) and serum neutralization (SN) tests and by the detection of gamma-interferon (IFN-gamma). The IPI test was not effective in detecting the response of delayed-type hypersensitivity, contrary to MIF, which showed the immune cellular response. Higher levels of IFN-gamma were observed in the groups of mice vaccinated and treated with avridine and P. acnes. Although immunomodulating activities have been detected, the use of adjuvants with the Fuenzalida-Palacios type vaccine in mice did not reveal any encouraging results.

  8. The elephant interferon gamma assay: a contribution to diagnosis of tuberculosis in elephants.

    PubMed

    Angkawanish, T; Morar, D; van Kooten, P; Bontekoning, I; Schreuder, J; Maas, M; Wajjwalku, W; Sirimalaisuwan, A; Michel, A; Tijhaar, E; Rutten, V

    2013-11-01

    Mycobacterium tuberculosis (M. tb) has been shown to be the main causative agent of tuberculosis in elephants worldwide. M. tb may be transmitted from infected humans to other species including elephants and vice versa, in case of prolonged intensive contact. An accurate diagnostic approach covering all phases of the infection in elephants is required. As M. tb is an intracellular pathogen and cell-mediated immune (CMI) responses are elicited early after infection, the skin test is the CMI assay of choice in humans and cattle. However, this test is not applicable in elephants. The interferon gamma (IFN-γ) assay is considered a good alternative for the skin test in general, validated for use in cattle and humans. This study was aimed at development of an IFN-γ assay applicable for diagnosis of tuberculosis in elephants. Recombinant elephant IFN-γ (rEpIFN-γ) produced in eukaryotic cells was used to immunize mice and generate the monoclonal antibodies. Hybridomas were screened for IFN-γ-specific monoclonal antibody production and subcloned, and antibodies were isotyped and affinity purified. Western blot confirmed recognition of the rEpIFN-γ. The optimal combination of capture and detection antibodies selected was able to detect rEpIFN-γ in concentrations as low as 1 pg/ml. The assay was shown to be able to detect the native elephant IFN-γ, elicited in positive-control cultures (pokeweed mitogen (PWM), phorbol myristate acetate plus ionomycin (PMA/I)) of both Asian and African elephant whole-blood cultures (WBC). Preliminary data were generated using WBC from non-infected elephants, a M. tb infection-suspected elephant and a culture-confirmed M. tb-infected elephant. The latter showed measurable production of IFN-γ after stimulation with ESAT6/CFP10 PPDB and PPDA in concentration ranges as elicited in WBC by Mycobacterium tuberculosis complex (MTBC)-specific antigens in other species. Hence, the IFN-γ assay presented potential as a diagnostic tool for the detection of elephant tuberculosis. Validation of the assay will require its application in large populations of non-infected and infected elephants. © 2013 Blackwell Verlag GmbH.

  9. [The clinical application of quantiferon TB-2G: its usefulness and limitations].

    PubMed

    Sato, Shigeki; Nagai, Hideaki

    2011-02-01

    QuantiFERON TB-2G (QFT) is widely used in clinical settings for the identification of tuberculosis infection because of its high level of utility. It is well known that QFT stimulates peripheral blood lymphocytes in vitro by means of M. tuberculosis-specific protein, and that infection is identified by measuring the interferon-gamma released. Interpretation of QFT results is therefore difficult in immunosuppressed subjects in whom the function of immunocompetent cells, including lymphocytes, is suppressed, making it difficult for them to produce interferon-gamma. There is a high incidence of tuberculosis among hemodialysis patients. It has been conjectured that the use of powerful immunosuppressive agents following kidney transplantation results in a high risk of tuberculosis. How QFT results change immediately following kidney transplantation is an extremely interesting question. In recent years, an increasing number of institutions have been using TNF-alpha inhibitors to treat rheumatoid arthritis patients. Is QTF useful for identifying whether patients have latent tuberculosis infection before the administration of anti-TNF antibodies? In particular, many rheumatoid arthritis patients may have been given methotrexate or glucocorticoids, which suppress the immune system, prior to the administration of TNF-alpha inhibitors, possibly making it difficult to interpret the QFT results. We must be aware of this limitation when performing QFT on immunosuppressed patients. It is also important that we understand the clinical parameters influencing QFT results (such as lymphocyte counts). The morbidity rate of tuberculosis is high among healthcare workers, particularly nurses. A number of studies have reported that QFT is useful in hospital infection control for tuberculosis, but the effectiveness of QFT for monitoring the health of healthcare workers is still not fully understood. In this symposium, we will debate how far QFT can be used and the extent of its usefulness under exceptional circumstances. (1) How do we manage kidney transplant recipients with latent tuberculosis infection?: Norihiko GOTO (Transplant Surgery, Nagoya Daini Red Cross Hospital) It is unclear whether QuantiFERON-second generation (QFT-2G) is useful for diagnostic screening and follow up of latent tuberculosis infection (LTBI) in immunosuppressed kidney transplant (KTx) recipients. The QFT-2G assay that included response to mitogen stimulation was performed before and 6 months after KTx. Non responder was 0 (0%) at baseline, 3 (3%) at 6 months. Response to mitogen stimulation was 9.7 +/- 5.3 IU/mL at baseline vs. 10.4 +/- 5.0 IU/mL at 6 months after KTx (p = 0.29). QFT-2G is a useful screening test for LTBI and active tuberculosis (TB) even during maintenance of immunosuppression of KTx. (2) QuantiFERON-TB Gold in Japanese rheumatoid arthritis patients for assessing latent tuberculosis infection prior treatment of anti-tumor necrosis factor antibody: Shogo BANNO (Division of Rheumatology and Nephrology, Department of Internal Medicine, Aichi Medical School of Medicine) To determine the positive rate of LTBI in RA patients using the QFT-2G test, we divided RA patients into two groups: with or without old TB findings by chest CT. With a cutoff level set at 0.35 IU/ml, the positive rate of QFT-2G in LTBI was detected only 5.8%, when setting cutoff at 0.1 IU/ml (lower cutoff level), 23.1% was detected in LTBI patients. The positive TST results were significantly increased in non-LTBI patients compared than in LTBI patients. The QFT-2G test was not affected by the treatment of MTX, and the incidence of indeterminate result was low. The QFT-2G was useful compared to TST before administration of TNF inhibitors in RA patients, because of superior specificity of QFT-2G. (3) Clinical parameters that influence the sensitivity of T-cell assays: Haruyuki ARIGA (National Hospital Organization Tokyo National Hospital) The detection of tuberculosis (TB) infection in compromised hosts is essential for TB control, but T cell assay might be influenced by the degree of cell-mediated immunosuppression. The relationship between immunocompetence and specific interferon (IFN)-gamma response in whole blood QuantiFERON-TB Gold (QFT) is uncertain. Immune-related clinical indicators associated with the degree of antigen-specific IFN-gamma production were analysed using a large immunologically-unselected population with obvious TB infection. The absolute number of blood lymphocyte in TB patients was significantly associated with specific IFN-gamma production in a linear regression model. Sensitivity of 2 IFN-gamma Release Assays, QFT and ELISPOT, partly depends on peripheral lymphocyte counts. At low lymphocyte count conditions, ELISPOT assay is superior to whole blood QFT for detecting tuberculosis infection. (4) QuantiFERON TB-2G among staffs in the hospitals of Nationao Hospital Organization: Susumu OGURI, Chihiro NISHIO, Kensuke SUMI, Masayoshi MINAGUCHI, Tomomasa TSUBOI, Atuo SATOU, Osamu TOKUNAGA, Takeshi MIYAMOMAE, Takuya KURASAWA (National Hospital Organization Minami-Kyoto National Hospital) To investigate the infection rate of tuberculosis among staffs working in the hospitals of NHO. Questionnaires were sent to the hospitals and the responses were analyzed. Among the staffs working in the hospitals with tuberculosis wards, positive rate of QuantiFERON TB-2G was 6.9%, probable positive rate was 5.6%. On the other hand, among the staffs working in the hospitals without tuberculosis wards, positive rate was 4.4%, probable positive rate was 3.9%. It is necessary to monitor the infection rate among hospital staffs.

  10. Lung function and airway inflammation in rats following exposure to combustion products of carbon-graphite/epoxy composite material: comparison to a rodent model of acute lung injury.

    PubMed

    Whitehead, Gregory S; Grasman, Keith A; Kimmel, Edgar C

    2003-02-01

    Pulmonary function and inflammation in the lungs of rodents exposed by inhalation to carbon/graphite/epoxy advanced composite material (ACM) combustion products were compared to that of a rodent model of acute lung injury (ALI) produced by pneumotoxic paraquat dichloride. This investigation was undertaken to determine if short-term exposure to ACM smoke induces ALI; and to determine if smoke-related responses were similar to the pathogenic mechanisms of a model of lung vascular injury. We examined the time-course for mechanical lung function, infiltration of inflammatory cells into the lung, and the expression of three inflammatory cytokines, tumor necrosis factor-alpha (TNF-alpha), macrophage inflammatory protein-2 (MIP-2) and interferon-gamma (IFN-gamma). Male Fischer-344 rats were either exposed to 26.8-29.8 g/m(3) nominal concentrations of smoke or were given i.p. injections of paraquat dichloride. Measurements were determined at 1, 2, 3, and 7 days post exposure. In the smoke-challenged rats, there were no changes in lung function indicative of ALI throughout the 7-day observation period, despite the acute lethality of the smoke atmosphere. However, the animals showed signs of pulmonary inflammation. The expression of TNF-alpha was significantly increased in the lavage fluid 1 day following exposure, which preceded the maximum leukocyte infiltration. MIP-2 levels were significantly increased in lavage fluid at days 2, 3, and 7. This followed the leukocyte infiltration. IFN-gamma was significantly increased in the lung tissue at day 7, which occurred during the resolution of the inflammatory response. The paraquat, which was also lethal to a small percentage of the animals, caused several physiologic changes characteristic of ALI, including significant decreases in lung compliance, lung volumes/capacities, distribution of ventilation, and gas exchange capacity. The expression of TNF-alpha and MIP-2 increased significantly in the lung tissue as well as in the lavage fluid. Increased MIP-2 levels also preceded the maximum neutrophil infiltration. The differences in the time-course and primary site of TNF-alpha, MIP-2, and IFN-gamma expression; and the differences in the temporal relationship between their expression and infiltration of inflammatory cells may have accounted for the differences in lung function between paraquat treated and ACM smoke exposed animals.

  11. Clearance of Virulent but Not Avirulent Rhodococcus equi from the Lungs of Adult Horses Is Associated with Intracytoplasmic Gamma Interferon Production by CD4+ and CD8+ T Lymphocytes

    PubMed Central

    Hines, Stephen A.; Stone, Diana M.; Hines, Melissa T.; Alperin, Debby C.; Knowles, Donald P.; Norton, Linda K.; Hamilton, Mary J.; Davis, William C.; McGuire, Travis C.

    2003-01-01

    Rhodococcus equi is a gram-positive bacterium that infects alveolar macrophages and causes rhodococcal pneumonia in horses and humans. The virulence plasmid of R. equi appears to be required for both pathogenicity in the horse and the induction of protective immunity. An understanding of the mechanisms by which virulent R. equi circumvents protective host responses and by which bacteria are ultimately cleared is important for development of an effective vaccine. Six adult horses were challenged with either virulent R. equi or an avirulent, plasmid-cured derivative. By using a flow cytometric method for intracytoplasmic detection of gamma interferon (IFN-γ) in equine bronchoalveolar lavage fluid (BALF) cells, clearance of the virulent strain was shown to be associated with increased numbers of pulmonary CD4+ and CD8+ T lymphocytes producing IFN-γ. There was no change in IFN-γ-positive cells in peripheral blood, suggesting that a type 1 recall response at the site of challenge was protective. The plasmid-cured strain of R. equi was cleared in horses without a significant increase in IFN-γ-producing T lymphocytes in BALF. In contrast to these data, a previous report in foals suggested an immunomodulating role for R. equi virulence plasmid-encoded products in downregulating IFN-γ expression by equine CD4+ T lymphocytes. Intracytoplasmic detection of IFN-γ provides a method to better determine whether modulation of macrophage-activating cytokines by virulent strains occurs uniquely in neonates and contributes to their susceptibility to rhodococcal pneumonia. PMID:12626444

  12. Inflammatory cytokine gene variants in coronary artery disease patients in Greece.

    PubMed

    Manginas, Athanassios; Tsiavou, Anastasia; Chaidaroglou, Antigoni; Giamouzis, Grigorios; Degiannis, Dimitrios; Panagiotakos, Demosthenis; Cokkinos, Dennis V

    2008-12-01

    Abundant evidence supports the central role of inflammatory cytokines in immune responses mediating the pathogenesis of atherosclerosis, coronary artery disease, and its complications, such as myocardial infarction and unstable angina. We investigated the association of genetic polymorphisms of the inflammatory cytokines, IL-10, TGF-beta1, IFN-gamma, IL-6, and TNF-alpha with the clinical presentation of coronary artery disease in 26 patients with stable angina, 45 patients with unstable angina and 58 patients who had experienced nonfatal myocardial infarction. Genotyping was performed by the sequence-specific primer polymerase chain reaction method. A significant difference in the frequencies of -174G/C IL-6 alleles was observed, with the low in-vitro producing -174*C allele predominating in patients with myocardial infarction, compared with stable angina and unstable angina patients, after the analysis of genotypes (P=0.024 and 0.022, respectively), phenotypes [P=0.0099, odds ratio (OR)=0.271, 95% confidence interval (CI)=0.1012-0.7292; P=0.03, OR=0.40, respectively] and haplotypes (P=0.007, OR=3.028, 95% CI=1.347-6.806; P=0.0096, OR=2.368, 95% CI=1.262-4.444; respectively). In addition, a predominance of the -1082ACC/ATA IL-10 genotype in the myocardial infarction group compared with the unstable angina group and the -874 A/A IFN-gamma genotype in the stable angina group compared with the unstable angina and the myocardial infarction group, was found. No significant differences in the distribution of genotypes, phenotypes and haplotypes in the three study groups, for the TNF-alpha-308 A/G and TGF-beta1-codon 25 G/C, codon 10 T/C polymorphisms were detected. Our data provide evidence that the IL-6-174G/C polymorphism may be involved in the pathogenesis of coronary artery disease, contributing to genetic susceptibility for myocardial infarction.

  13. Is secretion of IFN-gamma in response to Mycobacterium tuberculosis antigens in youngest children sufficient to play a role in TB diagnostics?

    PubMed

    Bielecka, Teresa; Komorowska-Piotrowska, Anna; Krenke, Katarzyna; Feleszko, Wojciech; Kulus, Marek

    2018-02-01

    To assess whether children ≤5 years of age, produce sufficient amounts of interferon gamma (IFN-ɣ) in response to phytohaemagglutinin (mitogen), and Mycobacterium tuberculosis antigens (TB antigens) in the QuantiFERON-TB Gold in-Tube test (QFT-GIT), (Cellestis Ltd., Australia). Is TB-antigen-induced IFN-ɣ response in children ≤5 years sufficient to consider QFT-GIT a possible tool for TB diagnostics? Study design, patient-subject selection, and methods: We recruited children 0-17 years old suspected of TB infection to this cross-sectional study, in whom QFT-GIT and TST were performed. We analyzed the median IFN-ɣ levels in mitogen and TB antigen tubes in children ≤5 years and >5 years, and the correlation between IFN-ɣ level in both tubes and age. A total of 153 children were enrolled, age median was 7.8 (IQR:8), 45 (29.4%) aged ≤5 years (median 3.4, IQR:1.7), 108 > 5 years (median 10.55, IQR:5.93). In the mitogen tubes, the median IFN-ɣ level was higher in children >5 years (median 17.87, IQR:2.1 vs 16.77, IQR:7.6), but surprisingly in the TB antigen tubes it was higher in the younger group (median 0.12, IQR:0.21vs 0.06, IQR:0.09, P = 0.04). We proved a positive correlation between IFN-ɣ level and age in mitogen tubes (r = 0.18, P = 0.03) and a negative correlation in TB antigen tubes (r = -0.17, P = 0.04). In latent tuberculosis infection patients, the latter correlation was found to be even stronger (r = -0.39, P = 0.01). The youngest children release sufficient amount of IFN-ɣ in response to TB antigens thus QFT-GIT might be a useful tool for TB diagnostics in this age group. © 2017 Wiley Periodicals, Inc.

  14. Interleukin-12 (IL-12)-driven alloimmune responses in vitro and in vivo: requirement for beta1 subunit of the IL-12 receptor.

    PubMed

    Piccotti, J R; Li, K; Chan, S Y; Eichwald, E J; Bishop, D K

    1999-06-15

    Interleukin-12 (IL-12) mediates its biologic activities via binding high-affinity receptors on T and natural killer cells. Although emphasis has been placed on the requirement for IL-12Rbeta2 in IL-12 bioactivity, the role of IL-12Rbeta1 is less well defined. The current study evaluated the effects of exogenous IL-12 on alloantigen-specific immune responses and determined the requirement for IL-12Rbeta1 in IL-12-mediated alloimmunity. The mouse heterotopic cardiac transplant model was employed to evaluate the effects of IL-12 on alloantigen-specific immune responses in vivo. In addition, IFN-gamma production in mixed lymphocyte cultures (MLC) supplemented with IL-12 was measured to assess the effects of IL-12 on Th1 function in vitro. Mice deficient in IL-12Rbeta1 (IL-12Rbeta1-/-) were used to determine the requirement for this receptor component in IL-12-driven alloimmune responses. Addition of IL-12 to MLC consisting of wild-type splenocytes enhanced alloantigen-specific proliferative responses and Th1 development. In contrast, IL-12 did not alter these in vitro immune parameters in IL-12Rbeta1-/- MLC. Treatment of wild-type cardiac allograft recipients with IL-12 resulted in high concentrations of serum interferon-gamma (IFN-gamma) and a 10-fold increase in IFN-gamma production by recipient splenocytes after restimulation in vitro. However, this fulminate Th1 response did not accelerate allograft rejection. Importantly, IL-12 had no effect on serum IFN-gamma or in vivo priming of Thl in IL-12Rbeta1-/- recipients. Finally, administration of IL-12 to WT allograft recipients resulted in a bimodal alloantibody response: antibody production was suppressed at high doses of IL-12, and enhanced at lower doses. IL-12 markedly enhances alloantigen-specific immune function; however, these exaggerated Th1-driven responses do not culminate in accelerated allograft rejection. Further, these data indicate that IL-12Rbeta1 is essential for the enhancement of both in vitro and in vivo alloimmune responses by exogenous IL-12.

  15. SS-A/Ro52 promotes apoptosis by regulating Bcl-2 production

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jauharoh, Siti Nur Aisyah; Faculty of Medicine and Health Science, Syarif Hidayatullah State Islamic University, Jakarta 15412; Saegusa, Jun

    Highlights: Black-Right-Pointing-Pointer Ro52{sup low} HeLa cells are resistant to apoptosis upon various stimulations. Black-Right-Pointing-Pointer Ro52 is upregulated by IFN-{alpha}, etoposide, or IFN-{gamma} and anti-Fas Ab. Black-Right-Pointing-Pointer Ro52-mediated apoptosis is independent of p53. Black-Right-Pointing-Pointer Ro52 selectively regulates Bcl-2 expression. -- Abstract: SS-A/Ro52 (Ro52), an autoantigen in systemic autoimmune diseases such as systemic lupus erythematosus and Sjoegren's syndrome, has E3 ligase activity to ubiquitinate proteins that protect against viral infection. To investigate Ro52's role during stress, we transiently knocked it down in HeLa cells by siRo52 transfection. We found that Ro52{sup low} HeLa cells were significantly more resistant to apoptosis than wild-typemore » HeLa cells when stimulated by H{sub 2}O{sub 2}- or diamide-induced oxidative stress, IFN-{alpha}, IFN-{gamma} and anti-Fas antibody, etoposide, or {gamma}-irradiation. Furthermore, Ro52-mediated apoptosis was not influenced by p53 protein level in HeLa cells. Depleting Ro52 in HeLa cells caused Bcl-2, but not other Bcl-2 family molecules, to be upregulated. Taken together, our data showed that Ro52 is a universal proapoptotic molecule, and that its proapoptotic effect does not depend on p53, but is exerted through negative regulation of the anti-apoptotic protein Bcl-2. These findings shed light on a new physiological role for Ro52 that is important to intracellular immunity.« less

  16. Potential mechanisms of cytosolic calcium modulation in interferon-gamma treated U937 cells

    NASA Technical Reports Server (NTRS)

    Klein, Jon B.; Mcleish, Kenneth R.; Sonnenfeld, Gerald; Dean, William L.

    1987-01-01

    The ability of interferon-gamma (IFN-gamma) to alter cytoplasmic Ca(2+) content in the monocytelike cell line U937 was investigated, using a slow Ca-channel blocker, diltiazem. In addition, the Ca-ATPase and the Ca-uptake activities were measured in isolated U937 membranes, together with the effect of inositol trisphosphate (IP3) upon the Ca(2+) release from Ca-loaded membranes. The addition of 50 U/ml INF-gamma to U937 cultures was found to increase internal Ca(2+) by about 100 percent within 3 min. The increase was significantly reduced by incubation in Ca-free buffer or by the addition of diltiazem. A crude membrane preparation from U937 cells was found to contain significant amounts of Ca-ATPase activity and to sequester Ca(2+) to a level of 8 nmol/mg in 30 sec; the addition of IP3 induced release of a portion of the sequestered Ca(2+) which was then resequestered. The results suggest that IFN-gamma causes an increase of cytoplasmic Ca(2+), in part, by the IP3-induced release from the internal storage sites and, in part, from the entry of extracellular Ca through slow channels.

  17. [Effect of red maca (Lepidium meyenii) on INF-γ levels in ovariectomized rats].

    PubMed

    Leiva-Revilla, Johanna; Guerra-Castañon, Félix; Olcese-Mori, Paola; Lozada, Iván; Rubio, Julio; Gonzales, Carla; Gonzales, Gustavo F

    2014-01-01

    Compare the effect of different doses of red maca on gamma interferon (IFN-γ) levels in ovariectomized rats (OVX). Adult female rats were randomly divided into the following six groups: Group 1: pseudo-ovariectomized rats (PO); Group 2: OVX rats; Group 3: OVX rats treated with 4 ug/kg estradiol; and Group 4, 5 and 6: OVX rats treated with red maca extracts with 2.15, 4.3 and 8.6 mg polyphenols/body weight kilogram, respectively. OVX rats showed low levels of IFN-γ compared to PO rats. Estradiol and red maca reversed the effect of ovariectomy on the IFN-γ levels. A positive dose-response effect of red maca on IFN-γ levels was shown (r = 0.57, p <0.05). Red maca administration increases levels of IFN-γ in ovariectomized rats.

  18. Effect of interferons and other biological response modifiers (BRMS) on macrophage-mediated inhibition of Listeria monocytogenes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Badger, A.M.; Swift, B.; Sung, C.P.

    1986-03-05

    Recombinant murine gamma interferon (IFN-..gamma..) activates oil elicited C57BL/6 peritoneal macrophages to inhibit the growth of Listeria. Maximum activity is obtained with 10-20 units/ml, can be demonstrated in the absence of antibiotics and is not due to LPS contamination. Studies of the kinetics of this phenomenon demonstrate that a 30 minute incubation with IFN-..gamma.. is sufficient to initiate the antiproliferative state and full activity can be obtained with a 4 hour incubation. Alpha/beta interferon (IFN-..cap alpha../..beta..) is also active but requires 100X more units to obtain equivalent activity. The evaluation of a number of other BRMS demonstrated that MDP andmore » LPS could stimulate phagocytosis of Listeria but could not inhibit their growth. Bestatin, tuftsin, Con A, A23187 and Poly I:C did not stimulate either phagocytosis or growth inhibitory activity. These compounds were also tested for their ability to enhance the release of superoxide anion from PMA stimulated macrophages. With the exception of tuftsin and bestatin all of the BRMS tested were able to enhance the production of oxidative burst products confirming the findings of others of the dissociation between the two functions.« less

  19. The IFN-gamma +874T/A gene polymorphism is associated with retinochoroiditis toxoplasmosis susceptibility.

    PubMed

    Albuquerque, Maíra Cavalcanti de; Aleixo, Ana Luisa Quintella do Couto; Benchimol, Eliezer Israel; Leandro, Ana Cristina Câmara S; das Neves, Leandro Batista; Vicente, Regiane Trigueiro; Bonecini-Almeida, Maria da Glória; Amendoeira, Maria Regina Reis

    2009-05-01

    Toxoplasmosis is a worldwide zoonosis that generally produces an asymptomatic infection. In some cases, however, toxoplasmosis infection can lead to ocular damage. The immune system has a crucial role in both the course of the infection and in the evolution of toxoplasmosis disease. In particular, IFN-gamma plays an important role in resistance to toxoplasmosis. Polymorphisms in genes encoding cytokines have been shown to have an association with susceptibility to parasitic diseases. The aim of this work was to analyse the occurrence of polymorphisms in the gene encoding IFN-gamma (+874T/A) among Toxoplasma gondii seropositive individuals, including those with ocular lesions caused by the parasite, from a rural population of Santa Rita de Cássia, Barra Mansa, state of Rio de Janeiro, Brazil. Further, we verified which of these polymorphisms could be related to susceptibility to the development of ocular toxoplasmosis. This study included 34 individuals with ocular toxoplasmosis (ocular group) and 134 without ocular lesions (control group). The differences between A and T allele distributions were not statistically significant between the two groups. However, we observed that a higher frequency of individuals from the ocular group possessed the A/A genotype, when compared with the control group, suggesting that homozygocity for the A allele could enhance susceptibility to ocular toxoplasmosis in T. gondii infection.

  20. Different T-bet expression patterns characterize particular reactive lymphoid tissue lesions.

    PubMed

    Jöhrens, K; Anagnostopoulos, I; Dürkop, H; Stein, H

    2006-03-01

    To investigate T-bet expression profiles in various lymphoid tissue diseases caused by intracellular pathogens and to compare them in disorders without an infective aetiology. Murine and in vitro experiments have shown that the expression/induction of T-bet, the master regulator of Th1 differentiation, can be achieved by obligate intracellular pathogens and high interferon (IFN)-gamma levels. Lymph node biopsies were analysed immunohistochemically employing single and double labelling for T-bet and CD20, CD4, CD8 and CD30 detection. In disorders associated with high IFN-gamma levels and intracellular pathogens (infectious mononucleosis, HIV-associated lymphadenopathy, cat-scratch disease, and toxoplasmic lymphadenitis), T-bet-expressing CD4 cells were accompanied by significant numbers of T-bet-positive CD8 and B cells. A similar profile was also found in histiocytic necrotizing (Kikuchi) lymphadenitis, a disease of unknown cause. In contrast, T-bet expression in disorders without an infective aetiology was observed in only a small portion of lymphocytes. Increased T-bet expression does not only identify intracellular infections in lymphoid tissue associated with high IFN-gamma levels, but also implies that, under these conditions, it becomes induced in B cells, which apparently support the Th1 response. T-bet expression in Kikuchi lymphadenitis underscores the hypothesis that it is caused by an intracellular microorganism.

  1. TLR8-driven IL-12-dependent reciprocal and synergistic activation of NK cells and monocytes by immunostimulatory RNA.

    PubMed

    Berger, Michael; Ablasser, Andrea; Kim, Sarah; Bekeredjian-Ding, Isabelle; Giese, Thomas; Endres, Stefan; Hornung, Veit; Hartmann, Gunther

    2009-04-01

    Immunostimulatory RNA (isRNA) depending on sequence and structure can function as a ligand for Toll-like receptor (TLR) 7 and TLR8. Here we show that isRNA induces high levels of bioactive interleukin-12 in purified human monocytes, whereas purified natural killer (NK) cells did not respond. However, in a coculture of monocytes and NK cells, isRNA dramatically increased NK cell function. Activation of monocytes and NK cells was bidirectional, as monocytes in the presence of NK cells produced higher levels of bioactive interleukin-12. As a result of the monocyte-NK cell interaction in peripheral blood mononuclear cells isRNA induced high levels of interferon (IFN)-gamma in NK cells and strong NK cell-mediated cytotoxic activity. Induction of simultaneous IFN-gamma production and lytic activity by isRNA in NK cells was higher as compared with other established nucleic acid or small molecule TLR ligands. Our studies demonstrate that monocytes play a pivotal role in the orchestration of a strong NK cell response. With early NK cell-dependent IFN-gamma production being critical for the development of antigen-specific cytotoxic T lymphocyte responses, newly developed isRNA-based TLR8 ligands join the list of promising oligonucleotides for immunotherapy of viral infection and cancer.

  2. Effects of interferon-gamma and lipopolysaccharide on macrophage iron metabolism are mediated by nitric oxide-induced degradation of iron regulatory protein 2.

    PubMed

    Kim, S; Ponka, P

    2000-03-03

    Iron regulatory proteins (IRP-1 and IRP-2) control the synthesis of transferrin receptors (TfR) and ferritin by binding to iron-responsive elements, which are located in the 3'-untranslated region and the 5'-untranslated region of their respective mRNAs. Cellular iron levels affect binding of IRPs to iron-responsive elements and consequently expression of TfR and ferritin. Moreover, NO(*), a redox species of nitric oxide that interacts primarily with iron, can activate IRP-1 RNA binding activity resulting in an increase in TfR mRNA levels. Recently we found that treatment of RAW 264.7 cells (a murine macrophage cell line) with NO(+) (nitrosonium ion, which causes S-nitrosylation of thiol groups) resulted in a rapid decrease in RNA binding of IRP-2 followed by IRP-2 degradation, and these changes were associated with a decrease in TfR mRNA levels (Kim, S., and Ponka, P. (1999) J. Biol. Chem. 274, 33035-33042). In this study, we demonstrated that stimulation of RAW 264.7 cells with lipopolysaccharide (LPS) and interferon-gamma (IFN-gamma) increased IRP-1 binding activity, whereas RNA binding of IRP-2 decreased and was followed by a degradation of this protein. Moreover, the decrease of IRP-2 binding/protein levels was associated with a decrease in TfR mRNA levels in LPS/IFN-gamma-treated cells, and these changes were prevented by inhibitors of inducible nitric oxide synthase. Furthermore, LPS/IFN-gamma-stimulated RAW 264.7 cells showed increased rates of ferritin synthesis. These results suggest that NO(+)-mediated degradation of IRP-2 plays a major role in iron metabolism during inflammation.

  3. Gene expression and production of tumor necrosis factor alpha, interleukin 1, interleukin 6, and gamma interferon in C3H/HeN and C57BL/6N mice in acute Mycoplasma pulmonis disease.

    PubMed Central

    Faulkner, C B; Simecka, J W; Davidson, M K; Davis, J K; Schoeb, T R; Lindsey, J R; Everson, M P

    1995-01-01

    Studies were conducted to determine whether the production of various cytokines is associated with Mycoplasma pulmonis disease expression. Susceptible C3H/HeN and resistant C57BL/6N mice were inoculated intranasally with 10(7) CFU of virulent M. pulmonis UAB CT or avirulent M. pulmonis UAB T. Expression of genes for tumor necrosis factor alpha (TNF-alpha), interleukin 1 alpha (IL-1 alpha), IL-1 beta, IL-6, and gamma interferon (IFN-gamma) in whole lung tissue and TNF-alpha gene expression in bronchoalveolar lavage (BAL) cells was determined by reverse transcription-PCR using specific cytokine primers at various times postinoculation. In addition, concentrations of TNF-alpha, IL-1, IL-6, and IFN-gamma were determined in BAL fluid and serum samples at various times postinoculation. Our results showed that there was a sequential appearance of cytokines in the lungs of infected mice: TNF-alpha, produced primarily by BAL cells, appeared first, followed by IL-1 and IL-6, which were followed by IFN-gamma. Susceptible C3H/HeN mice had higher and more persistent concentrations of TNF-alpha and IL-6 in BAL fluid than did resistant C57BL/6N mice, indicating that TNF-alpha and possibly IL-6 are important factors in pathogenesis of acute M. pulmonis disease in mice. Serum concentrations of IL-6 were elevated in C3H/HeN mice, but not C57BL/6N mice, following infection with M. pulmonis, suggesting that IL-6 has both local and systemic effects in M. pulmonis disease. PMID:7558323

  4. Correlations between endotoxin, interferon-gamma, biopterin and serum phospholipase A2-activities during lethal gram negative sepsis in rats.

    PubMed

    Hunsicker, A; Kullich, W; Weissenhofer, W; Lorenz, D; Petermann, J; Rokos, H; Schwesinger, G

    1997-05-01

    To establish a standardised reproducible animal model of intraperitoneal sepsis, and to investigate early immunoserological responses to find a mediator-based system for evaluation and grading of diffuse peritonitis in patients Prospective experimental study 4 Teaching hospitals, Germany and Austria 42 LEW. 1W rats, 12 of which acted as controls Gram negative sepsis was induced by intraperitoneal injection of 6 ml of a mixture of Escherichia coli (K1:H+) 10(10) organisms/ml, autogenous haemoglobin 2.9 ml (haemoglobin concentration 3%), 0.9% sodium chloride 3 ml, and suspension 0.1 ml. Control rats were given physiological saline 6 ml alone. Concentrations of endotoxin, interferon gamma (IFN-gamma), and biopterin, and serum phospholipase A2 (PLA2) activity. There were significant differences between the septic and control rats in concentrations of endotoxin (EU/ml) (median (interquartile range) 21.85 (2.02-159.5) compared with 0, p < 0.0001; IFN-gamma (pg/ml) 1263.0 (271.0-7575.0) compared with 101.0 (89.0-141.0), p < 0.0001; biopterin (nmol/L) 111.0 (66.4-156.3) compared with 53.7 (38.3-67.6), p < 0.001; and PLA2 (U/L) 163.0 (125.8-209.0) compared with 112.5 (88.5-126.5) p < 0.01. Measurements of concentrations of endotoxin, IFN-gamma, pteridines, and PLA2 activity may well be adequate markers for early recognition of sepsis, and perhaps for grading it during the first 6 hours after induction. The allow a clear distinction to be made between septic and non-septic disorders in 87% of cases.

  5. Inhibition by antioxidants of nitric oxide synthase expression in murine macrophages: role of nuclear factor kappa B and interferon regulatory factor 1.

    PubMed Central

    Hecker, M.; Preiss, C.; Klemm, P.; Busse, R.

    1996-01-01

    1. In view of the potential deleterious effects of high amounts of nitric oxide (NO) produced by the inducible isoform of NO synthase (iNOS) in inflammation, the prevention of the expression of this enzyme represents an important therapeutic goal. In cytokine-stimulated cells, activation of nuclear factor kappa B (NF-kappa B) is crucial for the increase in iNOS gene expression. Since NF-kappa B activation appears to involve a redox-sensitive step, we have investigated whether three structurally unrelated antioxidants, 5,7-dihydroxyflavone (chrysin), 3,4-dichloroisocoumarin (DCI) and N-acetyl 5-hydroxytryptamine (N-acetylserotonin, NAS), affect iNOS expression in cultured RAW 264.7 monocyte/macrophages stimulated with bacterial lipopolysaccharide (LPS, 140 ng ml-1) and interferon-gamma (IFN gamma, 5 u ml-1). 2. During a 6 h incubation period neither LPS nor IFN gamma alone exerted a significant effect but when combined, caused a prominent increase in nitrite formation, iNOS mRNA and protein abundance. Co-incubation with chrysin (50 microM), DCI (50 microM) or NAS (1 mM) markedly attenuated this increase in iNOS gene expression. 3. DCI, but not chrysin or NAS, prevented the activation of NF-kappa B in cells exposed to LPS plus IFN gamma for 30 min. In contrast, all three antioxidants significantly blunted the DNA-binding activity of interferon regulatory factor 1 (IRF-1), which mediates the synergistic effect of IFN gamma on iNOS gene expression in cells treated for 2 h with LPS plus IFN gamma. 4. DCI thus appears to inhibit iNOS gene expression at the transcriptional level by preventing the activation of both NF-kappa B and IRF-1. The inhibitory effect of DCI on NF-kappa B activation, however, does not seem to be related to its antioxidative properties, since DCI, unlike chrysin or NAS, is a potent serine protease inhibitor which stabilizes the inactive NF-kappa B complex by protecting the inhibitory I kappa B-alpha subunit from proteolytic degradation. 5. The virtually identical inhibitory effect of chrysin, DCI and NAS on the activation of IRF-1 points to a redox-sensitive step in the activation of this transcription factor, which in contrast to NF-kappa B requires de novo protein synthesis. 6. Since iNOS gene expression in human cells and tissues usually requires the combination of several cytokines, antioxidants such as chrysin and NAS which do not interfere with the activation of NF-kappa B may be of therapeutic value for selectively inhibiting the enhanced expression of this enzyme in inflammation. Images Figure 4 Figure 6 Figure 7 PMID:8864559

  6. Antiallergic effect of milk fermented with lactic acid bacteria in a murine animal model.

    PubMed

    Peng, Sandy; Lin, Jin-Yuarn; Lin, Meei-Yn

    2007-06-27

    The objective of this study was to assess the antiallergic effect of fermented milk prepared, respectively, with Streptococcus thermophilus MC, Lactobacillus acidophilus B, Lactobacillus bulgaricus Lb, L. bulgaricus 448, and Bifidobacterium longum B6. Female BALB/c mice fed fermented milk were immunized intraperitoneally with ovalbumin (OVA)/complete Freund's adjuvant (CFA) to evaluate the immune response by observing the secretion of cytokines IL-2, IL-4, and IFN-gamma and serum antibody IgE. The results showed that supplementation with lactic acid bacteria fermented milk did not significantly change the IL-2 spontaneous and OVA-stimulated secretions of splenocytes. However, both spontaneous and OVA-stimulated secretions of splenocytes from mice fed lactic acid bacteria fermented milk showed significantly (P < 0.05) lower levels of IL-4 (Th2 cytokine) than those from OVA/CFA-immunized mice fed non-fermented milk (OVA/CFA-milk group). The spontaneous secretion of IFN-gamma (Th1 cytokine) by splenocytes from mice fed L. bulgaricus 448 or L. bulgaricus Lb fermented milk significantly increased as compared to that from the OVA/CFA-milk group. The results showed that the ratios of IFN-gamma to IL-4 of both spontaneous and OVA-stimulated secretions in splenocytes from mice fed lactic acid bacteria fermented milk increased significantly as compared to that of PBS- or OVA/CFA-milk groups. The serum levels of OVA-specific IgE in fermented milk fed groups, especially the group fed S. thermophilus MC fermented milk, were significantly lower than those in the OVA/CFA-milk group through a 6 week feeding experiment. The results showed that milk fermented with lactic acid bacteria demonstrated in vivo antiallergic effects on OVA/CFA-immunized mice via increasing the secretion ratio of IFN-gamma/IL-4 (Th1/Th2) by splenocytes and decreasing the serum level of OVA-specific IgE.

  7. IFN-gamma-mediated inhibition of human IgE synthesis by IL-21 is associated with a polymorphism in the IL-21R gene.

    PubMed

    Pène, Jérôme; Guglielmi, Laurence; Gauchat, Jean-François; Harrer, Nathalie; Woisetschläger, Maximilian; Boulay, Vera; Fabre, Jean-Michel; Demoly, Pascal; Yssel, Hans

    2006-10-15

    IL-21 is a cytokine produced by CD4+ T cells that has been reported to regulate human, as well as, mouse T and NK cell function and to inhibit Ag-induced IgE production by mouse B cells. In the present study, we show that human rIL-21 strongly enhances IgE production by both CD19+ CD27- naive, and CD19+ CD27+ memory B cells, stimulated with anti-CD40 mAb and rIL-4 and that it promotes the proliferative responses of these cells. However, rIL-21 does not significantly affect anti-CD40 mAb and rIL-4-induced Cepsilon promoter activation in a gene reporter assay, nor germline Cepsilon mRNA expression in purified human spleen or peripheral blood B cells. In contrast, rIL-21 inhibits rIL-4-induced IgE production in cultures of PBMC or total splenocytes by an IFN-gamma-dependent mechanism. The presence of a polymorphism (T-83C), in donors heterozygous for this mutation was found to be associated not only with lower rIL-21-induced IFN-gamma production levels, but also with a lower sensitivity to the inhibitory effects of IL-21 on the production of IgE, compared with those in donors expressing the wild-type IL-21R. Taken together, these results show that IL-21 differentially regulates IL-4-induced human IgE production, via its growth- and differentiation-promoting capacities on isotype-, including IgE-, committed B cells, as well as via its ability to induce IFN-gamma production, most likely by T and NK cells, whereas the outcome of these IL-21-mediated effects is dependent on the presence of a polymorphism in the IL-21R.

  8. TNF-alpha, but not IFN-gamma, regulates CCN2 (CTGF), collagen type I, and proliferation in mesangial cells: possible roles in the progression of renal fibrosis.

    PubMed

    Cooker, Laurinda A; Peterson, Darryl; Rambow, Joann; Riser, Melisa L; Riser, Rebecca E; Najmabadi, Feridoon; Brigstock, David; Riser, Bruce L

    2007-07-01

    Connective tissue growth factor (CCN2) is a profibrotic factor acting downstream and independently of TGF-beta to mediate renal fibrosis. Although inflammation is often involved in the initiation and/or progression of fibrosis, the role of inflammatory cytokines in regulation of glomerular CCN2 expression, cellular proliferation, and extracellular matrix accumulation is unknown. We studied two such cytokines, TNF-alpha and IFN-gamma, for their effects on cultured mesangial cells in the presence or absence of TGF-beta, as a model for progressive renal fibrosis. Short-term treatment with TNF-alpha, like TGF-beta, significantly increased secreted CCN2 per cell, but unlike TGF-beta inhibited cellular replication. TNF-alpha combined with TGF-beta further increased CCN2 secretion and mRNA levels and reduced proliferation. Surprisingly, however, TNF-alpha treatment decreased baseline collagen type I protein and mRNA levels and largely blocked their stimulation by TGF-beta. Long-term treatment with TGF-beta or TNF-alpha alone no longer increased CCN2 protein levels. However, the combination synergistically increased CCN2. IFN-gamma had no effect on either CCN2 or collagen activity and produced a mild inhibition of TGF-beta-induced collagen only at a high concentration (500 U/ml). In summary, we report a strong positive regulatory role for TNF-alpha, but not IFN-gamma, in CCN2 production and secretion, including that driven by TGF-beta. The stimulation of CCN2 release by TNF-alpha, unlike TGF-beta, is independent of cellular proliferation and not linked to increased collagen type I accumulation. This suggests that the paradigm of TGF-beta-driven CCN2 with subsequent collagen production may be overridden by an as yet undefined inhibitory mechanism acting either directly or indirectly on matrix metabolism.

  9. Polyfunctional CD4 T cells in the response to bovine tuberculosis

    USDA-ARS?s Scientific Manuscript database

    CD4 T cells are crucial in immunity to tuberculosis (TB). Polyfunctional CD4 T cells simultaneously produce interferon-gamma (IFN-gamma), Interleukin-2 (IL-2) and Tumor necrosis factor-alpha (TNF-alpha) and play relevant roles in several chronic infections, including human TB and HIV. However, the a...

  10. Polyfunctional cytokine responses by central memory CD4*T cells in response to bovine tuberculosis

    USDA-ARS?s Scientific Manuscript database

    CD4 T cells are crucial in immunity to tuberculosis (TB). Polyfunctional CD4 T cells simultaneously produce interferon-gamma (IFN-gamma), interleukin-2 (IL-2) and tumor necrosis factor-alpha (TNF-alpha) and play relevant roles in several chronic infections, including human TB. Mycobacterium bovis in...

  11. Polyfunctional cytokine responses by central memory CD4+T cells in response to bovine tuberculosis

    USDA-ARS?s Scientific Manuscript database

    CD4 T cells are crucial in immunity to tuberculosis (TB). Polyfunctional CD4 T cells simultaneously produce interferon-gamma (IFN-gamma), interleukin-2 (IL-2) and tumor necrosis factor-alpha (TNF-alpha) and play relevant roles in several chronic infections, including human TB and HIV. Mycobacterium ...

  12. Polyclonal and allergen-induced cytokine responses in adults with asthma: resolution of asthma is associated with normalization of IFN-gamma responses.

    PubMed

    Smart, Joanne M; Horak, Elisabeth; Kemp, Andrew S; Robertson, Colin F; Tang, Mimi L K

    2002-09-01

    Atopic disease is associated with skewing of immune responses away from a T(H)1 toward a T(H)2 profile. Previous studies have implicated this cytokine imbalance in the development of disease. However, it is not known whether normalization of this imbalance is conversely associated with disease resolution. To further delineate the role of reduced T(H)1 and increased T(H)2 cytokine production in the pathogenesis of atopic disease and to determine whether disease resolution is associated with alteration of cytokine profiles, we investigated cytokine responses in a cohort of adult patients with asthma followed from childhood. A cohort of wheezy children and control subjects aged 7 to 10 years were recruited from 1964 to 1967. Subjects were reevaluated every 7 years to monitor the outcome of childhood asthma. At the 42-year follow-up, 89 subjects from this cohort were evaluated for mitogen and house dust mite (HDM)-induced T(H)1 (IFN-gamma) and T(H)2 (IL-4, IL-5, and IL-13) cytokine responses. Cytokine responses were compared in patients with ongoing asthma, patients with resolved asthma, and control subjects. Patients with severe ongoing asthma had significantly reduced HDM-induced IFN-gamma production compared with that of control subjects and patients with resolved asthma. In contrast, HDM-induced IFN-gamma production in patients with resolved asthma was equivalent to that seen in control subjects. Patients with ongoing and resolved asthma produced significantly higher levels of IL-5 in response to HDM compared with that seen in control subjects, with levels being equivalent in patients with active and resolved asthma. HDM-induced IL-13 production was significantly increased in the patients with resolved asthma when compared with that seen in the control subjects. PHA-induced cytokine responses did not parallel HDM-induced responses. Patients with persistent and severe atopic asthma have a reduced HDM-induced T(H)1 response, whereas those with resolved asthma do not. This suggests that reduced HDM-induced IFN-gamma production might be an important factor contributing to ongoing severe asthma and that normalization of allergen-induced T(H)1 responses might be important for disease resolution. The finding that all subjects with a history of asthma displayed increased HDM-induced T(H)2 (IL-5 and IL-13) cytokine responses, irrespective of the presence or absence of asthma, suggests that increased T(H)2 responses reflect the presence of the atopic state per se rather than being specifically linked to asthma.

  13. Three-dimensional numerical simulation of the 20 June 1991, Orlando microburst

    NASA Technical Reports Server (NTRS)

    Proctor, Fred H.

    1992-01-01

    On 20 June 1991, NASA's Boeing 737, equipped with in-situ and look-ahead wind-shear detection systems, made direct low-level penetrations (300-350 m AGL) through a microburst during several stages of its evolution. This microburst was located roughly 20 km northeast of Orlando International Airport and was monitored by a Terminal Doppler Weather Radar (TDWR) located about 10 km south of the airport. The first NASA encounter with this microburst (Event 142), at approximately 2041 UTC, was during its intensification phase. At flight level, in-situ measurements indicated a peak 1-km (averaged) F-factor of approximately 0.1. The second NASA encounter (Event 143) occurred at approximately 2046 UTC, about the time of microburst peak intensity. It was during this penetration that a peak 1-km F-factor of approximately 17 was encountered, which was the largest in-situ measurement of the 1991 summer deployment. By the third encounter (Event 144), at approximately 2051 UTC, the microburst had expanded into a macroburst. During this phase of evolution, an in-situ 1-km F-factor of 0.08 was measured. The focus of this paper is to examine this microburst via numerical simulation from an unsteady, three-dimensional meteorological cloud model. The simulated high-resolution data fields of wind, temperature, radar reflectivity factor, and precipitation are closely examined so as to derive information not readily available from 'observations' and to enhance our understanding of the actual event. Characteristics of the simulated microburst evolution are compared with TDWR and in-situ measurements.

  14. [Experimental study on the Der f 1 mRNA molecules derived from dermatophagoides farinae for specific immunotherapy on murine model of asthma].

    PubMed

    Jiang, Yu-xin; Yin, Kang; Jin, Wen-jie; Wu, Lu-yi; Li, Chao-pin

    2014-08-01

    To investigate the effect of Der f 1 mRNA molecules for specific immunotherapy on murine model of asthma. Fifty BALB/c mice were randomly divided into 5 groups: PBS group, Der f 1 sensitization group, Der f 1 specific immunotherapy (SIT) group, beta-actin mRNA SIT group, and Derf 1 mRNA SIT group. On days 0, 7 and 14, mice in PBS group received PBS injection; mice in the other groups were intraperitoneally injected with 10 microg Derf 1. At day 21, the mice in the 4 experimental groups were challenged with a 30-min inhaled dose of Der f 1 (100 microg/ml) for 7 successive days. Two weeks after the final sensitization, the mice in the above five groups were im- munized by intradermal injection with PBS, 1 microg Der f 1, 10 microg Der f 1, 2 microg beta-actin mRNA, and 2 microg Der f 1 mRNA, respectively for 3 times at one-week intervals. Two weeks after the last intradermal injection, all mice were sacrificed and bronchoalveolar lavage fluid (BALF) was collected. ELISA was performed to detect the levels of IFN-gamma and IL-13 in BALF, the number of eosinophils in the BALF was recorded. Splenocytes were prepared, and cultured with Der f 1 al- lergen (10 Jg/ml) for 72 h. Splenocytes of PBS group was cultured without Derf 1 allergen. The levels of IFN-gamma and IL-13 in splenocyte culture supernatant were measured by ELISA, as well as serum antibody levels of total IgE, allergen- specific IgE (sIgE), sIgG1, and sIgG2a. Lung sections were stained in hematoxylin and eosin, and observed under the microsope. Except for PBS group, mice in the other 4 group showed symptoms of acute asthma attack. Com- pared with Derf 1 sensitization group [(897.56 +/- 105.73) pg/ml] and beta-actin mRNA SIT group [(219.47 +/- 64.72) pg/ml], the level of IFN-gamma in BALF from Der f 1 mRNA SIT group [(897.56 +/- 105.73) pg/ml] and Derfl SIT group [(864.48 +/- 70.62)pg/ml] significantly increased (P<0.01). However, the level of IL-13 in BALF from Derf 1 mRNA SIT group [(241.64 +/- 31.41) pg/ml] and Derf 1 SIT group [(321.94 +/- 41.07)pg/ml] was significantly lower than that of Der f 1 sensitization group [(520.62 +/- 43.77) pg/ml] and beta-actin mRNA SIT group [(507.22 +/- 42.26) pg/ml](P<0.01). The number of eosinophils in Der f 1 mRNA SIT group [(1.33 +/- 0.44) x 10(5)/ml] and Der f 1 SIT group [(1.48 +/- 0.39) x 10(5)/ml] was also lower than that of Der f 1 sensitization group [(3.54 +/- 0.52)x10(5)/ml] and beta-actin mRNA SIT group [(2.98-0.53) x 10(5)/ml] (P<0.01). The levels of IFN-GAMMA and IL-13 in splenocyte culture supernatant showed that IFN-gamma level in Der f 1 mRNA SIT group [(420.91+69.92) pg/ml] and Der f 1 SIT group [(334.92 +/- 43.72) pg/ml] was significantly higher than that of Der f 1 sensitization group[(123.75 +/- 5.48) pg/ml] and beta-actin mRNA SIT group[(128.84 +/- 59.00) pg/ml] (P<0.01). However, IL-13 level of Der f 1 mRNA SIT group [(268.51 +/- 40.42) pg/ml] and Der f 1 SIT group [(285.26 +/- 62.21) pg/ml] was significantly lower than that of Derf 1 sensitization group [(613.89 +/- 51.54) pg/ml] and beta-actin mRNA SIT group [(524.05 +/- 39.12) pg/ml] (P<0.01). Compared with Der f 1 sensitization group [total IgE: (94.34 +/- 11.66) ng/ml, sIgE: (65.67 +/- 9.47) ng/ml, sIgG1: (75.18 +/- 9.52) ng/ml, sIgG2a: (2.81 +/- 1.17) ng/ml] and beta-actin mRNA SIT group[total IgE: (86.48 +/- 10.26) ng/ml, sIgE: (62.36 +/- 8.35) ng/ml, sIgG1: (69.51 +/- 8.98) ng/ml, IgG2a: (1.06 +/- 0.11) ng/ml], the serum antibody levels of total IgE [(33.72 +/- 9.78) ng/ml], sIgE [(22.76 +/- 8.09) ng/ml], sIgG1 [(17.87 +/- 7.59) ng/ml] of Der f 1 mRNA SIT group decreased significantly (P<0.01), whereas the level of IgG% [(7.74 +/- 0.88) ng/ml] increased (P<0.01). Compared with Der f 1 sensitization group, the asthmatic symptoms were relieved after immunization with Der f 1 mRNA for specific immunotherapy, including intact structure of respiratory and alveolar epithelial cells, decreased inflammatory cell infiltration, and similar to those in Der f 1 SIT group. However, the breakage and detachment of bronchial epithelial cells occurred in beta-actin mRNA SIT group. Derf 1 mRNA vaccine can correct Th1 and Th2 imbalance.

  15. Comparison of the responses of different recombinant fish type I interferons against betanodavirus infection in grouper.

    PubMed

    Kuo, Hsiang-Ping; Chung, Chia-Ling; Hung, Yu-Fang; Lai, Yu-Shen; Chiou, Pinwen P; Lu, Ming-Wei; Kong, Zwe-Ling

    2016-02-01

    The nervous necrosis virus (NNV) is an aquatic virus that can infect more than 30 species including the grouper, which is a valuable fish species in Taiwan. NNV causes up to 90-100% mortality in the aquaculture industry. Interferons (IFNs) are a family of cytokines that stimulate the expression of numerous proteins to protect the host against viruses and possess very unique specific characteristics in fish. The cross-reactivity of heterologous IFNs on grouper cells and larvae has not been well-studied to date. To evaluate and compare the anti-NNV effect of different fish IFNs in grouper, we successfully synthesized, subcloned, expressed and purified several fish type I IFNs in the present study: grouper (gIFN), salmon (sIFN), seabass (sbIFN) and tilapia (tpIFN). The gIFN and sIFN proteins up-regulated myxovirus resistance protein (Mx) gene expression in grouper kidney (GK) cells, but similar effects were not observed for sbIFN and tpIFN. Following co- and pre-treatment with the 4 types of IFNs with NNV infection in GK cells, sIFN exhibited the strongest antiviral ability to suppress NNV gene replication (especially at 24 h) and significantly reduced the cytopathic effect (CPE) at 72 h, followed by gIFN. Unsurprisingly, sbIFN and tpIFN had no significant effect on CPE but slightly suppressed NNV gene replication. The cytotoxicity of these four fish IFNs on GK cells was also examined for the first time. In the in vivo test, we confirmed that gIFN and sIFN had a significant protective effect against NNV when administered by intraperitoneal (IP) injection and the oral route in Malabar grouper (Epinephelus malabaricus) larvae. This study compared the protective effects of IFNs from various fish species against NNV and demonstrated crosstalk between sIFN and grouper cells for the first time. These results provide information concerning the efficacy of fish IFNs for possible therapeutic applications. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. Equine neonates have attenuated humoral and cell-mediated immune responses to a killed adjuvanted vaccine compared to adult horses.

    PubMed

    Ryan, Clare; Giguère, Steeve

    2010-12-01

    The objectives of this study were to compare relative vaccine-specific serum immunoglobulin concentrations, vaccine-specific lymphoproliferative responses, and cytokine profiles of proliferating lymphocytes between 3-day-old foals, 3-month-old foals, and adult horses after vaccination with a killed adjuvanted vaccine. Horses were vaccinated intramuscularly twice at 3-week intervals with a vaccine containing antigens from bovine viral respiratory pathogens to avoid interference from maternal antibody. Both groups of foals and adult horses responded to the vaccine with a significant increase in vaccine-specific IgGa and IgG(T) concentrations. In contrast, only adult horses and 3-month-old foals mounted significant vaccine-specific total IgG, IgGb, and IgM responses. Vaccine-specific concentrations of IgM and IgG(T) were significantly different between all groups, with the highest concentrations occurring in adult horses, followed by 3-month-old foals and, finally, 3-day-old foals. Only the adult horses mounted significant vaccine-specific lymphoproliferative responses. Baseline gamma interferon (IFN-γ) and interleukin-4 (IL-4) concentrations were significantly lower in 3-day-old foals than in adult horses. Vaccination resulted in a significant decrease in IFN-γ concentrations in adult horses and a significant decrease in IL-4 concentrations in 3-day-old foals. After vaccination, the ratio of IFN-γ/IL-4 in both groups of foals was significantly higher than that in adult horses. The results of this study indicate that the humoral and lymphoproliferative immune responses to this killed adjuvanted vaccine are modest in newborn foals. Although immune responses improve with age, 3-month-old foals do not respond with the same magnitude as adult horses.

  17. Promotion of interferon-gamma production by natural killer cells via suppression of murine peritoneal macrophage prostaglandin E₂ production using intravenous anesthetic propofol.

    PubMed

    Inada, Takefumi; Kubo, Kozue; Shingu, Koh

    2010-10-01

    Propofol is an intravenous anesthetic, widely used for general anesthesia during surgery, which inevitably involves tissue trauma with inflammation. At sites of inflammation, prostanoids, especially prostaglandin E₂ (PGE₂), are abundant. This study addresses the effect of propofol on macrophage PGE₂ production. Using thioglycollate-elicited murine peritoneal macrophages, propofol (7.5-30 μM) suppressed lipopolysaccharide-induced PGE₂ production. The suppression was via the direct inhibition of cyclooxygenase (COX) enzyme activity and due neither to the downregulation of COX expression nor the inhibition of arachidonic acid release from plasma membranes. In macrophage:natural killer (NK) cell co-culture, propofol dramatically increased interferon-gamma (IFN-γ) production, and the actions of propofol were mimicked by a selective COX-2 inhibitor, NS-398, as well as the selective EP4 receptor antagonist L-161,982, suggesting a role of PGE₂ suppression in the upregulation of IFN-γ production. Furthermore, in purified NK cell culture, PGE₂ directly suppressed the production of IFN-γ by activated NK cells, which was reversed by selective inhibition of EP4 activity. Taken together, our results show that, in macrophage:NK cell co-culture, propofol, through the suppression of macrophage PGE₂ production, upregulates NK cell IFN-γ production by alleviating EP4 receptor-mediated suppression of IFN-γ production. Propofol may potentially exert considerable influence on inflammation and immunity by suppressing PGE₂ synthesis. Copyright © 2010 Elsevier B.V. All rights reserved.

  18. Lactobacillus plantarum 299V in the treatment and prevention of spontaneous colitis in interleukin-10-deficient mice.

    PubMed

    Schultz, Michael; Veltkamp, Claudia; Dieleman, Levinus A; Grenther, Wetonia B; Wyrick, Pricilla B; Tonkonogy, Susan L; Sartor, R Balfour

    2002-03-01

    Interleukin (IL)-10-deficient (IL-10-/-) mice develop colitis under specific pathogen-free (SPF) conditions and remain disease free if kept sterile (germ free [GF]). We used four different protocols that varied the time-points of oral administration of Lactobacillus plantarum 299v (L. plantarum) relative to colonization with SPF bacteria to determine whether L. plantarum could prevent and treat colitis induced by SPF bacteria in IL-10-/- mice and evaluated the effect of this probiotic organism on mucosal immune activation. Assessment of colitis included blinded histologic scores, measurements of secreted colonic immunoglobulin isotypes, IL-12 (p40 subunit), and interferon (IFN)-gamma production by anti-CD3-stimulated mesenteric lymph node cells. Treating SPF IL-10-/- mice with L. plantarum attenuated previously established colonic inflammation as manifested by decreased mucosal IL-12, IFN-gamma, and immunoglobulin G2a levels. Colonizing GF animals with L. plantarum and SPF flora simultaneously had no protective effects. Gnotobiotic IL-10-/- mice monoassociated with L. plantarum exhibited mild immune system activation but no colitis. Pretreatment of GF mice by colonization with L. plantarum, then exposure to SPF flora and continued probiotic therapy significantly decreased histologic colitis scores. These results demonstrate that L. plantarum can attenuate immune-mediated colitis and suggest a potential therapeutic role for this agent in clinical inflammatory bowel diseases.

  19. Exogenous cytokines released by spleen and Peyer's patch cells removed from mice infected with Giardia muris.

    PubMed

    Djamiatun, K; Faubert, G M

    1998-01-01

    The role that T and B lymphocytes play in the clearance of Giardia muris in the mouse model is well known, but the cytokines produced by CD4+ T cells in response to Giardia antigenic stimulation are unknown. In this study, we have determined how Giardia trophozoite antigenic crude extract and T cell mitogens can trigger the production of cytokines by Peyer's patch and spleen cells removed from infected animals. When Giardia trophozoite proteins were used to challenge the cells in vitro, IL-4, IL-5 and IFN-gamma were not detected in the culture supernatant. When the cells were challenged with Con-A, all three cytokines were released in vitro. However, the level of each cytokine released by the spleen or Peyer's patch cells varied with the latent, acute and elimination phases of the infection. The high levels of IL-4 and IL-5 released by Peyer's patch cells confirm the importance of IgA in the control of the infection. However, we propose that the relative success of G. muris in completing its life cycle in a primary infection might be due, in part, to the stimulation of a Th2-type response (IL-4, IL-5). A stronger Th1 response (IFN-gamma) may lead to a better control of the primary infection.

  20. In vitro effects of CpG oligodeoxynucleotides delivered by gelatin nanoparticles on canine peripheral blood mononuclear cells of atopic and healthy dogs - a pilot study.

    PubMed

    Prélaud, Ana Rostaher; Fuchs, Sebastian; Weber, Karin; Winter, Gerhard; Coester, Conrad; Mueller, Ralf S

    2013-10-01

    Cytosine-phosphate-guanine (CpG) oligodeoxynucleotides offer a novel promising immunotherapeutic approach for atopic dermatitis (AD) both in humans and animals. Gelatin nanoparticles (GNP) enhance and prolong CpG-associated immunomodulatory effects and minimize adverse effects both in vitro and in vivo. Information about the effects of this combination in dogs is lacking. The aim of this study was to evaluate immunological effects of CpG coupled to GNP on canine peripheral blood mononuclear cells (PBMCs) in vitro. Eight dogs with AD, diagnosed by standard criteria and with a concurrent immediate hypersensitivity to house dust mites were included. Control samples were taken from eight healthy, age-matched control dogs without history or evidence of cutaneous or systemic illness. Peripheral blood mononuclear cells of healthy and allergic dogs were incubated with CpG-GNP and the uptake of CpG-GNP was demonstrated using confocal laser scanning microscopy. Cell culture supernatant concentrations of interferon gamma (IFN-γ), interleukin (IL)-4, IL-6 and IL-10 were measured by Canine Cytokine Milliplex. No significant changes in IFN-γ and IL-4 were found when comparing PBMCs incubated with CpG and CpG-GNP with the negative controls in atopic and healthy dogs. Interleukin-6 was not detected in any of the groups. However, a statistically significant increase in IL-10 concentration was found after 24 h stimulation with CpG-GNP compared with CpG alone both in atopic and healthy dogs. As IL-10 is considered an immunosuppressive cytokine playing a key role in peripheral tolerance; the reported CpG-GNP formulation could be a new approach in allergy treatment. © 2013 ESVD and ACVD.

  1. Augmentation of immune cell activity against tumor cells by Rauwolfia radix.

    PubMed

    Jin, Guang-Bi; Hong, Tie; Inoue, Satoshi; Urano, Tomohiko; Cho, Shigefumi; Otsu, Koji; Kitahara, Maya; Ouchi, Yasuyoshi; Cyong, Jong-Chol

    2002-08-01

    In this study, we investigated the effect of Rauwolfia radix on heat shock protein (HSP) 70 expression and cytotoxicity against tumor cells in activated human T cells. When activated T cells were cultured with Rauwolfia radix for 18 h, HSP70 expression after heat shock was remarkably increased, and cytotoxicity against T98G tumor cells was augmented. Moreover, Rauwolfia radix also enhanced the cytotoxicity of heat shocked activated T cells against Molt-4 and T98G tumor cells. Secretions of interferon-gamma (IFN-gamma) and tumor necrosis alpha (TNF-alpha), due to Concanavalin A (Con A) stimulation, were increased by Rauwolfia radix in activated T cells. To investigate the antitumor effect in vivo, EL-4 tumor-bearing mice were administered with Rauwolfia radix in drinking water. The survival period of the Rauwolfia radix treatment group was significantly prolonged compared with that of the control group. Reserpine, the major active ingredient of Rauwolfia radix, also enhanced the cytotoxicity of activated T cells against Molt-4 and T98G tumor cells, and prolonged the survival period of EL-4 tumor-bearing mice. Taken together, our results suggest that Rauwolfia radix can enhance the activity of immune cells against tumor cells.

  2. Evaluation of Gamma Interferon and Antibody Tuberculosis Tests in Alpacas

    PubMed Central

    Holder, Tom; Clifford, Derek; Dexter, Ian; Brewer, Jacky; Smith, Noel; Waring, Laura; Crawshaw, Tim; Gillgan, Steve; Lyashchenko, Konstantin; Lawrence, John; Clarke, John; de la Rua-Domenech, Ricardo; Vordermeier, Martin

    2012-01-01

    We describe the performance of cell-based and antibody blood tests for the antemortem diagnosis of tuberculosis (TB) in South American camelids (SAC). The sensitivity and specificity of the gamma interferon (IFN-γ) release assay, two lateral flow rapid antibody tests (Stat-Pak and Dual Path Platform [DPP]), and two enzyme-linked immunosorbent assay (ELISA)-based antibody tests (Idexx and Enferplex) were determined using diseased alpacas from Mycobacterium bovis culture-confirmed breakdown herds and TB-free alpacas from geographical areas with no history of bovine TB, respectively. Our results show that while the sensitivities of the IFN-γ and antibody tests were similar (range of 57.7% to 66.7%), the specificity of the IFN-γ test (89.1%) was lower than those of any of the antibody tests (range of 96.4% to 97.4%). This lower specificity of the IFN-γ test was at least in part due to undisclosed Mycobacterium microti infection in the TB-free cohort, which stimulates a positive purified protein derivative (PPD) response. The sensitivity of infection detection could be increased by combining two antibody tests, but even the use of all four antibody tests failed to detect all diseased alpacas. These antibody-negative alpacas were IFN-γ positive. We found that the maximum sensitivity could be achieved only by the combination of the IFN-γ test with two antibody tests in a “test package,” although this resulted in decreased specificity. The data from this evaluation of tests with defined sensitivity and specificity provide potential options for antemortem screening of SAC for TB in herd breakdown situations and could also find application in movement testing and tracing investigations. PMID:22914362

  3. Evaluation of gamma interferon and antibody tuberculosis tests in alpacas.

    PubMed

    Rhodes, Shelley; Holder, Tom; Clifford, Derek; Dexter, Ian; Brewer, Jacky; Smith, Noel; Waring, Laura; Crawshaw, Tim; Gillgan, Steve; Lyashchenko, Konstantin; Lawrence, John; Clarke, John; de la Rua-Domenech, Ricardo; Vordermeier, Martin

    2012-10-01

    We describe the performance of cell-based and antibody blood tests for the antemortem diagnosis of tuberculosis (TB) in South American camelids (SAC). The sensitivity and specificity of the gamma interferon (IFN-γ) release assay, two lateral flow rapid antibody tests (Stat-Pak and Dual Path Platform [DPP]), and two enzyme-linked immunosorbent assay (ELISA)-based antibody tests (Idexx and Enferplex) were determined using diseased alpacas from Mycobacterium bovis culture-confirmed breakdown herds and TB-free alpacas from geographical areas with no history of bovine TB, respectively. Our results show that while the sensitivities of the IFN-γ and antibody tests were similar (range of 57.7% to 66.7%), the specificity of the IFN-γ test (89.1%) was lower than those of any of the antibody tests (range of 96.4% to 97.4%). This lower specificity of the IFN-γ test was at least in part due to undisclosed Mycobacterium microti infection in the TB-free cohort, which stimulates a positive purified protein derivative (PPD) response. The sensitivity of infection detection could be increased by combining two antibody tests, but even the use of all four antibody tests failed to detect all diseased alpacas. These antibody-negative alpacas were IFN-γ positive. We found that the maximum sensitivity could be achieved only by the combination of the IFN-γ test with two antibody tests in a "test package," although this resulted in decreased specificity. The data from this evaluation of tests with defined sensitivity and specificity provide potential options for antemortem screening of SAC for TB in herd breakdown situations and could also find application in movement testing and tracing investigations.

  4. T-Cell Mineralocorticoid Receptor Controls Blood Pressure by Regulating Interferon-Gamma.

    PubMed

    Sun, Xue-Nan; Li, Chao; Liu, Yuan; Du, Lin-Juan; Zeng, Meng-Ru; Zheng, Xiao-Jun; Zhang, Wu-Chang; Liu, Yan; Zhu, Mingjiang; Kong, Deping; Zhou, Li; Lu, Limin; Shen, Zhu-Xia; Yi, Yi; Du, Lili; Qin, Mu; Liu, Xu; Hua, Zichun; Sun, Shuyang; Yin, Huiyong; Zhou, Bin; Yu, Ying; Zhang, Zhiyuan; Duan, Sheng-Zhong

    2017-05-12

    Hypertension remains to be a global public health burden and demands novel intervention strategies such as targeting T cells and T-cell-derived cytokines. Mineralocorticoid receptor (MR) antagonists have been clinically used to treat hypertension. However, the function of T-cell MR in blood pressure (BP) regulation has not been elucidated. We aim to determine the role of T-cell MR in BP regulation and to explore the mechanism. Using T-cell MR knockout mouse in combination with angiotensin II-induced hypertensive mouse model, we demonstrated that MR deficiency in T cells strikingly decreased both systolic and diastolic BP and attenuated renal and vascular damage. Flow cytometric analysis showed that T-cell MR knockout mitigated angiotensin II-induced accumulation of interferon-gamma (IFN-γ)-producing T cells, particularly CD8 + population, in both kidneys and aortas. Similarly, eplerenone attenuated angiotensin II-induced elevation of BP and accumulation of IFN-γ-producing T cells in wild-type mice. In cultured CD8 + T cells, T-cell MR knockout suppressed IFN-γ expression whereas T-cell MR overexpression and aldosterone both enhanced IFN-γ expression. At the molecular level, MR interacted with NFAT1 (nuclear factor of activated T-cells 1) and activator protein-1 in T cells. Finally, T-cell MR overexpressing mice manifested more elevated BP compared with control mice after angiotensin II infusion and such difference was abolished by IFN-γ-neutralizing antibodies. MR may interact with NFAT1 and activator protein-1 to control IFN-γ in T cells and to regulate target organ damage and ultimately BP. Targeting MR in T cells specifically may be an effective novel approach for hypertension treatment. © 2017 American Heart Association, Inc.

  5. Antitumor activity of type I and type III interferons in BNL hepatoma model.

    PubMed

    Abushahba, Walid; Balan, Murugabaskar; Castaneda, Ismael; Yuan, Yao; Reuhl, Kenneth; Raveche, Elizabeth; de la Torre, Andrew; Lasfar, Ahmed; Kotenko, Sergei V

    2010-07-01

    Hepatocellular carcinoma (HCC) occurs most commonly secondary to cirrhosis due to chronic hepatitis C or B virus (HCV/HBV) infections. Type I interferon (IFN-alpha) treatment of chronic HCV/HBV infections reduces the incidence of HCC in cirrhotic patients. However, IFN-alpha toxicity limits its tolerability and efficacy highlighting a need for better therapeutic treatments. A recently discovered type III IFN (IFN-lambda) has been shown to possess antiviral properties against HCV and HBV in vitro. In phase I clinical trials, IFN-lambda treatment did not cause significant adverse reactions. Using a gene therapy approach, we compared the antitumor properties of IFN-alpha and IFN-lambda in a transplantable hepatoma model of HCC. BALB/c mice were inoculated with syngeneic BNL hepatoma cells, or BNL cells expressing IFN-lambda (BNL.IFN-lambda cells) or IFN-alpha (BNL.IFN-alpha cells). Despite the lack of antiproliferative activity of IFNs on BNL cells, both BNL.IFN-lambda and BNL.IFN-alpha cells displayed retarded growth kinetics in vivo. Depletion of NK cells from splenocytes inhibited splenocyte-mediated cytotoxicity, demonstrating that NK cells play a role in IFN-induced antitumor responses. However, isolated NK cells did not respond directly to IFN-lambda. There was also a marked NK cell infiltration in IFN-lambda producing tumors. In addition, IFN-lambda and, to a lesser extent, IFN-alpha enhanced immunocytotoxicity of splenocytes primed with irradiated BNL cells. Splenocyte cytotoxicity against BNL cells was dependent on IL-12 and IFN-gamma, and mediated by dendritic cells. In contrast to NK cells, isolated from spleen CD11c+ and mPDCA+ dendritic cells responded directly to IFN-lambda. The antitumor activities of IFN-lambda against hepatoma, in combination with HCV and HBV antiviral activities warrant further investigation into the clinical use of IFN-lambda to prevent HCC in HCV/HBV-infected cirrhotic patients, as well as to treat liver cancer.

  6. Short-term effects of an anti-inflammatory treatment on clinical parameters and serum levels of C-reactive protein and proinflammatory cytokines in subjects with periodontitis.

    PubMed

    Renvert, Stefan; Lindahl, Christel; Roos-Jansåker, Ann-Marie; Lessem, Jan

    2009-06-01

    Periodontal disease is the most common multifactorial disease, afflicting a very large proportion of the adult population. Periodontal disease secondarily causes increases in the serum levels of C-reactive protein (CRP) and other markers of inflammation. An increased level of CRP reflects an increased risk for cardiovascular disease. The aim of the current randomized clinical trial was to evaluate the short-term effect of a combination of dipyridamole and prednisolone (CRx-102) on the levels of high-sensitivity (hs)-CRP, proinflammatory markers in blood, and clinical signs of periodontal disease. Fifty-seven patients with >/=10 pockets with probing depths >/=5 mm were randomized into two groups in this masked single-center placebo-controlled study: CRx-102 (n = 28) and placebo (n = 29). hs-CRP levels, inflammatory markers (interleukin [IL]-6, -1beta, -8, and -12, tumor necrosis factor-alpha, and interferon-gamma [IFN-gamma]), bleeding on probing (BOP), and changes in probing depths were evaluated. The subjects received mechanical non-surgical therapy after 42 days, and the study was completed after 49 days. At day 42, the differences in the hs-CRP, IFN-gamma, and IL-6 levels between the two groups were statistically significant (P <0.05), whereas no difference was found for the other inflammatory markers. There was no change in probing depth or BOP between the two groups. The administration of CRx-102 resulted in significant decreases in hs-CRP, IFN-gamma, and IL-6, but it did not significantly change BOP or probing depths.

  7. Human brucellosis is characterized by an intense Th1 profile associated with a defective monocyte function.

    PubMed

    Rodríguez-Zapata, Manuel; Matías, Marlene J; Prieto, Alfredo; Jonde, Marco A; Monserrat, Jorge; Sánchez, Lorenzo; Reyes, Eduardo; De la Hera, Antonio; Alvarez-Mon, Melchor

    2010-07-01

    In animal models, a defective Th1 response appears to be critical in the pathogenesis of brucellosis, but the Th1 response in human brucellosis patients remains partially undefined. Peripheral blood from 24 brucellosis patients was studied before and 45 days after antibiotherapy. Twenty-four sex- and age-matched healthy donors were analyzed in parallel. Significantly increased levels of interleukin 1beta (IL-1beta), IL-2, IL-4, IL-6, IL-12p40, gamma interferon (IFN-gamma), and tumor necrosis factor alpha (TNF-alpha), but not of IL-10, in serum and/or significantly increased percentages of samples with detectable levels of these cytokines, measured by enzyme-linked immunosorbent assays (ELISA), were found for untreated brucellosis patients, but these levels were reduced and/or normalized after treatment. Flow cytometry studies showed that the intracytoplasmic expression of IFN-gamma, IL-2, and TNF-alpha, but not that of IL-4, by phorbol myristate-activated CD4(+) CD3(+) and CD8(+) CD3(+) T lymphocytes was significantly increased in untreated brucellosis patients and was also partially normalized after antibiotherapy. The percentage of phagocytic cells, the mean phagocytic activity per cell, and the phagocytic indices for monocytes at baseline were defective and had only partially reverted at follow-up. T lymphocytes from untreated brucellosis patients are activated in vivo and show Th1 cytokine production polarization, with strikingly high serum IFN-gamma levels. In spite of this Th1 environment, we found deficient effector phagocytic activity in peripheral blood monocytes.

  8. Treatment of adjuvant arthritis with granulocyte-colony stimulating factor and peptide derived from heat shock protein 65.

    PubMed

    Brendolan, Andrea; Higuchi, Masanori; Sibley, Richard; Strober, Samuel

    2003-01-01

    Adjuvant arthritis in Lewis rats is induced by the subcutaneous injection of Mycobacterium tuberculosis in mineral oil, and the predominant T cell immune reactivity is against the heat shock protein 65 derived peptide 176-190. We treated Lewis rats with human recombinant G-CSF followed by (i.v) administration of peptide 176-190 after induction of adjuvant arthritis (AA), and observed decreased disease severity, joint destruction, new bone formation and joint ankylosis. Treatment with G-CSF alone was also effective, but to a lesser extent. In addition, we found that splenocytes from rats treated with G-CSF had reduced antigen presenting capacity compared with splenocytes from vehicle treated rats. Primed lymph node cells from G-CSF plus peptide treated rats showed a marked reduction in proliferation and secretion of IFN-gamma after stimulation with the heat shock protein peptide in vitro as compared to controls.

  9. Murine J774 Macrophages Recognize LPS/IFN-g, Non-CpG DNA or Two-CpG DNA-containing Sequences as Immunologically Distinct

    PubMed Central

    Crosby, Lynn; Casey, Warren; Morgan, Kevin; Ni, Hong; Yoon, Lawrence; Easton, Marilyn; Misukonis, Mary; Burleson, Gary; Ghosh, Dipak K.

    2010-01-01

    Specific bacterial lipopolysaccharides (LPS), IFN-γ, and unmethylated cytosine or guanosine-phosphorothioate containing DNAs (CpG) activate host immunity, influencing infectious responses. Macrophages detect, inactivate and destroy infectious particles, and synthetic CpG sequences invoke similar responses of the innate immune system. Previously, murine macrophage J774 cells treated with CpG induced the expression of nitric oxide synthase 2 (NOS2) and cyclo-oxygenase 2 (COX2) mRNA and protein. In this study murine J774 macrophages were exposed to vehicle, interferon γ + lipopolysaccharide (IFN-g/LPS), non-CpG (SAK1), or two-CpG sequence-containing DNA (SAK2) for 0–18 hr and gene expression changes measured. A large number of immunostimulatory and inflammatory changes were observed. SAK2 was a stronger activator of TNFα- and chemokine expression-related changes than LPS/IFN-g. Up regulation included tumor necrosis factor receptor superfamily genes (TNFRSF’s), IL-1 receptor signaling via stress-activated protein kinase (SAPK), NF-κB activation, hemopoietic maturation factors and sonic hedgehog/wingless integration site (SHH/Wnt) pathway genes. Genes of the TGF-β pathway were down regulated. In contrast, LPS/IFN-g -treated cells showed increased levels for TGF-β signaling genes, which may be linked to the observed up regulation of numerous collagens and down regulation of Wnt pathway genes. SAK1 produced distinct changes from LPS/IFN-g or SAK2. Therefore, J774 macrophages recognize LPS/IFN-g, non-CpG DNA or two-CpG DNA-containing sequences as immunologically distinct. PMID:20097302

  10. Expression of Interferon Lambda 4 Is Associated with Reduced Proliferation and Increased Cell Death in Human Hepatic Cells

    PubMed Central

    Onabajo, Olusegun O.; Porter-Gill, Patricia; Paquin, Ashley; Rao, Nina; Liu, Luyang; Tang, Wei; Brand, Nathan

    2015-01-01

    Interferon lambda 4 (IFN-λ4) is a novel type-III interferon that can be generated only in individuals carrying a ΔG frame-shift allele of an exonic genetic variant (rs368234815-ΔG/TT). The rs368234815-ΔG allele is strongly associated with decreased clearance of hepatitis C virus (HCV) infection. Here, we further explored the biological function of IFN-λ4 expressed in human hepatic cells—a hepatoma cell line HepG2 and fresh primary human hepatocytes (PHHs). We performed live confocal imaging, cell death and proliferation assays, mRNA expression profiling, protein detection, and antibody blocking assays using transient and inducible stable in vitro systems. Not only did we observe significant intracellular retention of IFN-λ4 but also detected secreted IFN-λ4 in the culture media of expressing cells. Secreted IFN-λ4 induced strong activation of the interferon-stimulated genes (ISGs) in IFN-λ4-expressing and surrounding cells in transwell assays. Specifically, in PHHs, secreted IFN-λ4 induced expression of the CXCL10 transcript and a corresponding pro-inflammatory chemokine, IP-10. In IFN-λ4-expressing HepG2 cells, we also observed decreased proliferation and increased cell death. All IFN-λ4-induced phenotypes—activation of ISGs, decreased proliferation, and increased cell death—could be inhibited by an anti-IFN-λ4-specific antibody. Our study offers new insights into biology of IFN-λ4 and its possible role in HCV clearance. PMID:26134097

  11. Commensal oral bacteria antigens prime human dendritic cells to induce Th1, Th2 or Treg differentiation.

    PubMed

    Kopitar, A N; Ihan Hren, N; Ihan, A

    2006-02-01

    In various immunopathologic conditions, bacterial flora induce an immune response which results in inflammatory manifestations, e.g. periapical granuloma. Dendritic cells provide the main orchestration of specific immune responses. The aim of our study was to test the capacity of distinct oral bacterial antigens (prepared from Streptococcus mitis, Propionibacterium acnes, and Bacteroides spp.) to prime human dendritic cells for stimulation of the T-lymphocyte response. To assess the T-lymphocyte response, the expression of CD25, CD69, intracellular interferon gamma (cIFN-gamma), and intracellular interleukin 4 (cIL-4) was determined. Dendritic cells were prepared from leukocyte buffy coat from healthy blood donors. Monocytes were stimulated with IL-4 and GM-CSF and dendritic cells activated with bacterial lysates. Cell suspensions contained up to 90% dendritic cells, which represented 2-12% of the initial number of mononuclear cells. Lymphocyte subsets that developed in lymphocyte cultures after 1 week of stimulation were analyzed by flow cytometry. Dendritic cells, primed with antigens of Bacteroides fragilis have shown significantly higher activation and expression of intercellular IFN-gamma by T lymphocytes compared to negative controls. The dendritic cells primed with antigens of P. acnes had no effect on T-lymphocyte activation or cytokine production; instead they induced differentiation of T lymphocytes into CD25bright cells (regulatory T cells) with a potentially inhibitory effect on immune response. Dendritic cells primed with antigens of S. mitis induced increased expression of cIL-4. We conclude that commensal oral bacteria antigens prepared from B. fragilis, S. mitis, and P. acnes prime human dendritic cells to induce Th1, Th2, and T(reg) differentiation, respectively. This may advance our understanding of immunopathologic manifestations in the oral cavity and offer new possibilities for redirecting immune responses in mucosal vaccination.

  12. Increased levels of immunological markers in the respiratory tract but not in serum correlate with active pulmonary mycobacterial infection in mice.

    PubMed

    Arko-Mensah, J; Rahman, M J; Julián, E; Horner, G; Singh, M; Fernández, C

    2009-08-01

    Immunological tests for the diagnosis of tuberculosis (TB) have relied mostly on detection of immune markers in serum or release of cytokines by mononuclear cells in vitro. These tests, although useful, sometimes fail to discriminate between active infection and contact with mycobacteria or vaccination. TB is primarily a disease of the lung, and therefore identification of immunological markers in the respiratory tract will be more likely to reflect the infection status or disease activity. In this study, it is demonstrated that active infection of mice with Mycobacterium bovis bacille Calmette-Guérin (BCG), but not exposure to heat-killed BCG, induced production of interleukin-12 (IL-12), interferon-gamma (IFN-gamma) or soluble tumour necrosis factor receptors (sTNFRs) locally in the lungs, as detected in bronchoalveolar lavage (BAL) fluid. There was a strong correlation between bacterial growth in the lung and levels of sTNFRs, and to some extent IL-12 and IFN-gamma, in BAL fluid. Furthermore, sTNFR levels increased significantly in BAL fluid after reactivation of controlled infection with dexamethasone, and this correlated with increased bacterial growth in the lungs. Finally, infection, but not exposure to non-replicating mycobacteria, induced specific IgG and IgA in BAL fluid. Elevated levels of all biomarkers measured were also detected in the serum, but correlation with infection was not as clear as in the case of BAL fluid. Taken together, the detection of sTNFRs and mycobacterium-specific antibodies, especially IgA, locally in the lungs could be used as immunological markers for the diagnosis of TB.

  13. Pathogenesis and immune responses in gnotobiotic calves after infection with the genogroup II.4-HS66 strain of human norovirus.

    PubMed

    Souza, M; Azevedo, M S P; Jung, K; Cheetham, S; Saif, L J

    2008-02-01

    We previously characterized the pathogenesis of two host-specific bovine enteric caliciviruses (BEC), the GIII.2 norovirus (NoV) strain CV186-OH and the phylogenetically unassigned NB strain, in gnotobiotic (Gn) calves. In this study we evaluated the Gn calf as an alternative animal model to study the pathogenesis and host immune responses to the human norovirus (HuNoV) strain GII.4-HS66. The HuNoV HS66 strain caused diarrhea (five/five calves) and intestinal lesions (one/two calves tested) in the proximal small intestine (duodenum and jejunum) of Gn calves, with lesions similar to, but less severe than, those described for the Newbury agent 2 (NA-2) and NB BEC. Viral capsid antigen was also detected in the jejunum of the proximal small intestine of one of two calves tested by immunohistochemistry. All inoculated calves shed virus in feces (five/five calves), and one/five had viremia. Antibodies and cytokine (proinflammatory, tumor necrosis factor alpha [TNF-alpha]; Th1, interleukin-12 [IL-12] and gamma interferon [IFN-gamma]; Th2, IL-4; Th2/T-regulatory, IL-10) profiles were determined in serum, feces, and intestinal contents (IC) of the HuNoV-HS66-inoculated calves (n = 5) and controls (n = 4) by enzyme-linked immunosorbent assay in the acute (postinoculation day 3 [PID 3]) and convalescent (PID 28) stages of infection. The HuNoV-HS66-specific antibody and cytokine-secreting cells (CSCs) were quantitated by ELISPOT in mononuclear cells of local and systemic tissues at PID 28. Sixty-seven percent of the HuNoV-HS66-inoculated calves seroconverted, and 100% coproconverted with immunoglobulin A (IgA) and/or IgG antibodies to HuNoV-HS66, at low titers. The highest numbers of antibody-secreting cells (ASC), both IgA and IgG, were detected locally in intestine, but systemic IgA and IgG ASC responses also occurred in the HuNoV-HS66-inoculated calves. In serum, HuNoV-HS66 induced higher peaks of TNF-alpha and IFN-gamma at PIDs 2, 7, and 10; of IL-4 and IL-10 at PID 4; and of IL-12 at PIDs 7 and 10, compared to controls. In feces, cytokines increased earlier (PID 1) than in serum and TNF-alpha and IL-10 were elevated acutely in the IC of the HS66-inoculated calves. Compared to controls, at PID 28 higher numbers of IFN-gamma and TNF-alpha CSCs were detected in mesenteric lymph nodes (MLN) or spleen and Th2 (IL-4) CSCs were elevated in intestine; IL-10 CSCs were highest in spleen. Our study provides new data confirming HuNoV-HS66 replication and enteropathogenicity in Gn calves and reveals important and comprehensive aspects of the host's local (intestine and MLN) and systemic (spleen and blood) immune responses to HuNoV-HS66.

  14. Prevention of autoantibody-mediated Graves'-like hyperthyroidism in mice with IL-4, a Th2 cytokine.

    PubMed

    Nagayama, Yuji; Mizuguchi, Hiroyuki; Hayakawa, Takao; Niwa, Masami; McLachlan, Sandra M; Rapoport, Basil

    2003-04-01

    Graves' hyperthyroidism has long been considered to be a Th2-type autoimmune disease because it is directly mediated by autoantibodies against the thyrotropin receptor (TSHR). However, several lines of evidence have recently challenged this concept. The present study evaluated the Th1/Th2 paradigm in Graves' disease using a recently established murine model involving injection of adenovirus expressing the TSHR (AdCMVTSHR). Coinjection with adenovirus expressing IL-4 (AdRGDCMVIL-4) decreased the ratio of Th1/Th2-type anti-TSHR Ab subclasses (IgG2a/IgG1) and suppressed the production of IFN-gamma by splenocytes in response to TSHR Ag. Importantly, immune deviation toward Th2 was accompanied by significant inhibition of thyroid-stimulating Ab production and reduction in hyperthyroidism. However, in a therapeutic setting, injection of AdRGDCMVIL-4 alone or in combination with AdCMVTSHR into hyperthyroid mice had no beneficial effect. In contrast, coinjection of adenoviruses expressing IL-12 and the TSHR promoted the differentiation of Th1-type anti-TSHR immune responses as demonstrated by augmented Ag-specific IFN-gamma secretion from splenocytes without changing disease incidence. Coinjection of adenoviral vectors expressing IL-4 or IL-12 had no effect on the titers of anti-TSHR Abs determined by ELISA or thyroid-stimulating hormone-binding inhibiting Ig assays, suggesting that Ab quality, not quantity, is responsible for disease induction. Our observations demonstrate the critical role of Th1 immune responses in a murine model of Graves' hyperthyroidism. These data may raise a cautionary note for therapeutic strategies aimed at reversing Th2-mediated autoimmune responses in Graves' disease in humans.

  15. Effects of gasoline engine emissions on preexisting allergic airway responses in mice.

    PubMed

    Day, Kimberly C; Reed, Matthew D; McDonald, Jacob D; Seilkop, Steven K; Barrett, Edward G

    2008-10-01

    Gasoline-powered vehicle emissions contribute significantly to ambient air pollution. We hypothesized that exposure to gasoline engine emissions (GEE) may exacerbate preexisting allergic airway responses. Male BALB/c mice were sensitized by injection with ovalbumin (OVA) and then received a 10-min aerosolized OVA challenge. Parallel groups were sham-sensitized with saline. Mice were exposed 6 h/day to air (control, C) or GEE containing particulate matter (PM) at low (L), medium (M), or high (H) concentrations, or to the H level with PM removed by filtration (high-filtered, HF). Immediately after GEE exposure mice received another 10-min aerosol OVA challenge (pre-OVA protocol). In a second (post-OVA) protocol, mice were similarly sensitized but only challenged to OVA before air or GEE exposure. Measurements of airway hyperresponsiveness (AHR), bronchoalveolar lavage (BAL), and blood collection were performed approximately 24 h after the last exposure. In both protocols, M, H, and HF GEE exposure significantly decreased BAL neutrophils from nonsensitized mice but had no significant effect on BAL cells from OVA-sensitized mice. In the pre-OVA protocol, GEE exposure increased OVA-specific IgG(1) but had no effect on BAL interleukin (IL)-2, IL-4, IL-13, or interferon (IFN)-gamma in OVA-sensitized mice. Nonsensitized GEE-exposed mice had increased OVA-specific IgG(2a), IgE, and IL-2, but decreased total IgE. In the post-OVA protocol, GEE exposure reduced BAL IL-4, IL-5, and IFN-gamma in nonsensitized mice but had no effect on sensitized mice. These results suggest acute exposure to the gas-vapor phase of GEE suppressed inflammatory cells and cytokines from nonsensitized mice but did not substantially exacerbate allergic responses.

  16. Altered expression and activation of signal transducers and activators of transcription (STATs) in hepatitis C virus infection: in vivo and in vitro studies.

    PubMed

    Larrea, E; Aldabe, R; Molano, E; Fernandez-Rodriguez, C M; Ametzazurra, A; Civeira, M P; Prieto, J

    2006-08-01

    Signal transducers and activators of transcription (STATs) play a critical role in antiviral defence. STAT3 is also important in cell protection against inflammatory damage. STAT proteins are activated by interferons and by hepatoprotective cytokines of the interleukin 6 superfamily, including cardiotrophin 1. We analysed the status of STATs in hepatitis C virus (HCV) infected livers and the relationship between expression and activation of STATs and HCV replication in Huh7 cells transfected with HCV genomic replicon. STAT3alpha expression was reduced in HCV infected livers showing an inverse correlation with serum alanine aminotransferase. In patients with HCV infection, nuclear staining for phosphorylated STAT3 was faint in parenchymal cells (although conspicuous in infiltrating leucocytes), in contrast with strong nuclear staining in hepatocytes from control livers. Expression and activation of STAT1 (a factor activated by both interferon (IFN)-alpha and IFN-gamma) were increased in HCV infected livers, particularly in those with high inflammatory activity. Conversely, phosphorylated STAT2 (a factor selectively activated by IFN-alpha) was undetectable in livers with HCV infection, a finding that was associated with marked downregulation of the two functional subunits of the IFN-alpha receptor. HCV replication in Huh7 cells caused STAT3alpha downregulation and blocked STAT3 phosphorylation by either IFN-alpha or cardiotrophin 1. HCV replication in Huh7 cells also inhibited STAT1 and STAT2 activation by IFN-alpha while there was no impairment of STAT1 phosphorylation by the proinflammatory cytokine IFN-gamma. STAT3 is downregulated in HCV infected livers and in Huh7 cells bearing the full length HCV replicon. HCV replication is associated with impaired Jak-STAT signalling by antiviral and cytoprotective cytokines. These effects may favour viral replication while facilitating the progression of liver disease.

  17. Interferon-gamma, macrophages, and virus spread after HSV-1 injection.

    PubMed

    Cathcart, Heather M; Zheng, Mei; Covar, Jason J; Liu, Yi; Podolsky, Robert; Atherton, Sally S

    2011-06-07

    After uniocular anterior chamber (AC) injection of HSV-1, the anterior segment of BALB/c mice becomes inflamed and infected; however, virus does not spread from the anterior segment to cause retinitis in the injected eye. The purpose of these studies was to determine whether interferon (IFN-)-γ and Mac-1(+) cells play a role in preventing direct anterior-to-posterior spread of HSV-1 in the injected eye. One AC of adult female BALB/c mice was injected with HSV-1 (KOS). The location of IFN-α, IFN-β, and IFN-γ in the injected eye was determined by immunofluorescence, and mRNA expression was quantified by qPCR. Injected eyes of IFN-γ knockout or clodronate-treated macrophage-depleted mice were examined to determine whether the absence of IFN-γ or Mac-1(+) macrophages affected the sites or timing of virus spread. IFN-α, IFN-β, and IFN-γ were observed in the anterior segment of injected eyes through 72 hours and mRNA levels of IFN-β and IFN-γ were increased in virus-infected eyes 48 to 120 hours after infection. However, the absence of IFN-γ or macrophages did not affect either the sites or the timing of HSV-1 infection in injected eyes. Protection of the retina of the injected eye does not depend on a single cell type or cytokine. In addition, in the eye, as in other sites of the body, there are redundancies in the innate response to virus infection.

  18. Differential suppression of glial nitric oxide synthase induction by structurally related tyrosine kinase inhibitors.

    PubMed

    Galea, E; Reddi, J; Feinstein, D L

    1995-11-24

    Incubation of C6 astrocytoma cells with bacterial endotoxin (lipopolysaccharide; LPS) plus interferon-gamma (IFN-gamma), or with a combination of cytokines (TNF-alpha, IL1-beta, and IFN-gamma) leads to high levels of inducible nitric oxide synthase (iNOS) expression. Previous results demonstrated a requirement for tyrosine kinase (TK) activities for iNOS induction. In the present study, a set of structurally related TK inhibitors, the tyrphostins (TYRs), were used to characterize possible differences between LPS and cytokine iNOS induction. All TYRs tested suppressed both types of induction. However, dose-response curves revealed significant differences in the IC50 values obtained for some TYRs (T25 and T56), and significant differences in the IC50 potency rank order when comparing inhibition of LPS versus cytokine-dependent iNOS induction. These results are consistent with differential TK utilization by the LPS versus cytokine pathways of iNOS induction, and establish a basis for developing further selective inhibitors of iNOS expression.

  19. Role of Natural Killer T Cells In Immunogenic Chemotherapy for Breast Cancer

    DTIC Science & Technology

    2012-09-01

    carcinomas, hematopoietic malignancies, and their metastases. This effect is mainly due to the synthesis of IFN-g by NKT cells and to the bystander...promote IFN-g synthesis by splenic gd T cells. In con- trast, combined addition of both cytokines induced IFN-g pro- duction by gd T cells. Taken...GalCer is mainly due to the rapid synthesis of IFN-g by type I NKT cells and the by- stander activation of both NK and CD8+ CTL (15, 16). Thus, we

  20. Interleukin-7 gene-modified dendritic cells reduce pulmonary tumor burden in spontaneous murine bronchoalveolar cell carcinoma.

    PubMed

    Sharma, Sherven; Batra, Raj K; Yang, Seok Chul; Hillinger, Sven; Zhu, Li; Atianzar, Kimberly; Strieter, Robert M; Riedl, Karen; Huang, Min; Dubinett, Steven M

    2003-11-01

    The antitumor efficiency of dendritic cells transduced with an adenovirus vector expressing interleukin (IL)-7 (DC-AdIL-7) was evaluated in a murine model of spontaneous bronchoalveolar cell carcinoma. These transgenic mice (CC-10 TAg), expressing the SV40 large T antigen under the Clara cell promoter, develop bilateral multifocal pulmonary adenocarcinomas and die at 4 months as a result of progressive pulmonary tumor burden. Injection of DC-AdIL-7 in the axillary lymph node region (ALNR) weekly for 3 weeks led to a marked reduction in tumor burden with extensive lymphocytic infiltration of the tumors and enhanced survival. The antitumor responses were accompanied by the enhanced elaboration of interferon (IFN)-gamma and IL-12 as well as an increase in the antiangiogenic chemokines, IFN-gamma-inducible protein 10 (IP-10/CXCL10) and monokine induced by IFN-gamma (MIG/CXCL9). In contrast, production of the immunosuppressive mediators IL-10, transforming growth factor (TGF)-beta, prostaglandin E(2) (PGE(2)), and the proangiogenic modulator vascular endothelial growth factor (VEGF) decreased in response to DC-AdIL-7 treatment. Significant reduction in tumor burden in a model in which tumors develop in an organ-specific manner provides a strong rationale for further evaluation of DC-AdIL-7 in regulation of tumor immunity and its use in lung cancer genetic immunotherapy.

  1. Enhancement of antitumor activity of OK-432 (picibanil) by Triton X-114 phase partitioning.

    PubMed

    Hashimoto, Masahito; Takashige, Katsuhiro; Furuyashiki, Maiko; Yoshidome, Keitaro; Sano, Ryoko; Kawamura, Yutaka; Ijichi, Shinji; Morioka, Hirofumi; Koide, Hiroyuki; Oku, Naoto; Moriya, Yoichiro; Kusumoto, Shoich; Suda, Yasuo

    2008-01-01

    OK-432 (Picibanil), a Streptococcal immunotherapeutic agent, has been used for immunotherapy of various cancers as a biological response modifier (BRM). However, OK-432 contains multiple components consisting of immunotherapeutic ones and contaminants which may weaken the effects or exert side-effects. In this study, we investigated extraction of contaminants from OK-432 using Triton X-114 (TX-114)-water phase partitioning and examined an antitumor effect of the resulting preparation. OK-432 was subjected to TX-114 partitioning to give residual precipitate designated as OK-TX-ppt. OK-TX-ppt exerted no TLR2-mediated activity, but induced interleukin (IL)-6 in human PBMC. OK-TX-ppt also induced tumor necrosis factor (TNF)-alpha, IL-10, IL-12, and interferon (IFN)-gamma in PBMC. Moreover, IFN-gamma-inducing activity of OK-TX-ppt was significantly higher and IL-10 production was lower than that of OK-432. In tumor-bearing mice model, administration of OK-TX-ppt i.p. extended the survival time of Meth-A-bearing mice compared to OK-432. OK-TX-ppt also increased the levels of IL-12 and IFN-gamma in mouse spleen cells in vitro. These results indicated that TX-114 partitioning removed some contaminants, which attenuates the antitumor effect, from OK-432 and increase the immunotherapeutic effects of OK-432.

  2. Analysis of cytotoxic activity of the CD4+ T lymphocytes generated by local immunotherapy.

    PubMed Central

    Katsumoto, Y.; Monden, T.; Takeda, T.; Haba, A.; Ito, Y.; Wakasugi, E.; Wakasugi, T.; Sekimoto, M.; Kobayashi, T.; Shiozaki, H.; Shimano, T.; Monden, M.

    1996-01-01

    We previously reported that the anti-tumour effect of OK-432 is considerably enhanced by its intratumoral injection together with fibrinogen. In the present study, we generated killer T cells by culturing tumour-infiltrating lymphocytes from thyroid cancer patients who had received this local immunotherapy. Phenotypic analysis revealed that the T cells were positive for CD3+, CD4+, Leu8-, CD45RO+ and T-cell receptor (TCR)alpha beta+, as well as showing strong surface expression of HLA-DR, CD25, LFA-1 and ICAM-1. The generated CD4+ T cells secreted interferon (IFN)-gamma, tumour necrosis factor (TNF)-alpha, TNF-beta, and interleukin (IL)-6 (but not IL-4), and exhibited a high level of cytolytic activity against several tumour cell lines. The cytolytic activity of these T cells for Daudi cells was inhibited by preincubation with an anti-intercellular adhesion molecule (ICAM)-1 antibody, but not by preincubation with anti-TCR alpha beta, anti-CD2, or anti-LFA-1 antibodies. Pretreatment with anti-ICAM-1 antibody inhibited T-cell cytolytic activity, but not conjugation with target cells. In addition, incubation with immobilised anti-ICAM-1 enhanced the secretion of IFN-gamma by T cells. We conclude that ICAM-1 expressed on the effector cytotoxic CD4+ T lymphocytes delivers regulatory signals that enhance IFN-gamma secretion. PMID:8554971

  3. Blood concentrations of the cytokines IL-1beta, IL-6, IL-10, TNF-alpha and IFN-gamma during experimentally induced swine dysentery.

    PubMed

    Kruse, Robert; Essén-Gustavsson, Birgitta; Fossum, Caroline; Jensen-Waern, Marianne

    2008-08-12

    Knowledge of the cytokine response at infection with Brachyspira hyodysenteriae can help understanding disease mechanism involved during swine dysentery. Since this knowledge is still limited the aim of the present study was to induce dysentery experimentally in pigs and to monitor the development of important immunoregulatory cytokines in blood collected at various stages of the disease. Ten conventional pigs (~23 kg) were orally inoculated with Brachyspira hyodysenteriae B204T. Eight animals developed muco-haemorrhagic diarrhoea with impaired general body condition. Blood was sampled before inoculation and repeatedly during acute dysentery and recovery periods and cytokine levels of IL-1beta, IL-6, Il-10, TNF-alpha and IFN-gamma were measured by ELISA. IL-1beta was increased at the beginning of the dysentery period and coincided with the appearance of Serum amyloid A and clinical signs of disease. TNF-alpha increased in all animals after inoculation, with a peak during dysentery, and IL-6 was found in 3 animals during dysentery and in the 2 animals that did not develop clinical signs of disease. IL-10 was found in all sick animals during the recovery period. IFN-gamma was not detected on any occasion. B. hyodysenteriae inoculation induced production of systemic levels of IL-1beta during the dysentery period and increased levels of IL-10 coincided with recovery from dysentery.

  4. Monocytes Play an IL-12-Dependent Crucial Role in Driving Cord Blood NK Cells to Produce IFN-g in Response to Trypanosoma cruzi

    PubMed Central

    Guilmot, Aline; Bosse, Julie; Carlier, Yves; Truyens, Carine

    2013-01-01

    We previously reported that foetuses congenitally infected with Trypanosoma cruzi, the agent of Chagas disease, mount an adult-like parasite-specific CD8+ T-cell response, producing IFN-g, and present an altered NK cell phenotype, possibly reflecting a post-activation state supported by the ability of the parasite to trigger IFN-g synthesis by NK cells in vitro. We here extended our knowledge on NK cell activation by the parasite. We compared the ability of T. cruzi to activate cord blood and adult NK cells from healthy individuals. Twenty-four hours co-culture of cord blood mononuclear cells with T. cruzi trypomastigotes and IL-15 induced high accumulation of IFN-g transcripts and IFN-g release. TNF-a, but not IL-10, was also produced. This was associated with up-regulation of CD69 and CD54, and down-regulation of CD62L on NK cells. The CD56bright NK cell subset was the major IFN-g responding subset (up to 70% IFN-g-positive cells), while CD56dim NK cells produced IFN-g to a lesser extent. The response points to a synergy between parasites and IL-15. The neonatal response, observed in all newborns, remained however slightly inferior to that of adults. Activation of IL-15-sensitized cord blood NK cells by the parasite required contacts with live/intact parasites. In addition, it depended on the engagement of TLR-2 and 4 and involved IL-12 and cross-talk with monocytes but not with myeloid dendritic cells, as shown by the use of neutralizing antibodies and cell depletion. This work highlights the ability of T. cruzi to trigger a robust IFN-g response by IL-15-sensitized human neonatal NK cells and the important role of monocytes in it, which might perhaps partially compensate for the neonatal defects of DCs. It suggests that monocyte- and IL-12- dependent IFN-g release by NK cells is a potentially important innate immune response pathway allowing T. cruzi to favour a type 1 immune response in neonates. PMID:23819002

  5. Immunotoxicity of aflatoxin B1: Impairment of the cell-mediated response to vaccine antigen and modulation of cytokine expression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Meissonnier, Guylaine M.; Alltech-France, European Regulatory Department, F-92593 Levallois-Perret; Pinton, Philippe

    Aflatoxin B1 (AFB1), a mycotoxin produced by Aspergillus flavus or A. parasiticus, is a frequent contaminant of food and feed. This toxin is hepatotoxic and immunotoxic. The present study analyzed in pigs the influence of AFB1 on humoral and cellular responses, and investigated whether the immunomodulation observed is produced through interference with cytokine expression. For 28 days, pigs were fed a control diet or a diet contaminated with 385, 867 or 1807 {mu}g pure AFB1/kg feed. At days 4 and 15, pigs were vaccinated with ovalbumin. AFB1 exposure, confirmed by an observed dose-response in blood aflatoxin-albumin adduct, had no majormore » effect on humoral immunity as measured by plasma concentrations of total IgA, IgG and IgM and of anti-ovalbumin IgG. Toxin exposure did not impair the mitogenic response of lymphocytes but delayed and decreased their specific proliferation in response to the vaccine antigen, suggesting impaired lymphocyte activation in pigs exposed to AFB1. The expression level of pro-inflammatory (TNF-{alpha}, IL-1{beta}, IL-6, IFN-{gamma}) and regulatory (IL-10) cytokines was assessed by real-time PCR in spleen. A significant up-regulation of all 5 cytokines was observed in spleen from pigs exposed to the highest dose of AFB1. In pigs exposed to the medium dose, IL-6 expression was increased and a trend towards increased IFN-{gamma} and IL-10 was observed. In addition we demonstrate that IL-6 impaired in vitro the antigenic- but not the mitogenic-induced proliferation of lymphocytes from control pigs vaccinated with ovalbumin. These results indicate that AFB1 dietary exposure decreases cell-mediated immunity while inducing an inflammatory response. These impairments in the immune response could participate in failure of vaccination protocols and increased susceptibility to infections described in pigs exposed to AFB1.« less

  6. Windshear certification data base for forward-look detection systems

    NASA Technical Reports Server (NTRS)

    Switzer, George F.; Hinton, David A.; Proctor, Fred H.

    1994-01-01

    Described is an introduction to a comprehensive database that is to be used for certification testing of airborne forward-look windshear detection systems. The database was developed by NASA Langley Research Center, at the request of the Federal Aviation Administration (FAA), to support the industry initiative to certify and produce forward-looking windshear detection equipment. The database contains high-resolution three-dimensional fields for meteorological variables that may be sensed by forward-looking systems. The database is made up of seven case studies that are generated by the Terminal Area Simulation System, a state-of-the-art numerical system for the realistic modeling of windshear phenomena. The selected cases contained in the certification documentation represent a wide spectrum of windshear events. The database will be used with vendor-developed sensor simulation software and vendor-collected ground-clutter data to demonstrate detection performance in a variety of meteorological conditions using NASA/FAA pre-defined path scenarios for each of the certification cases. A brief outline of the contents and sample plots from the database documentation are included. These plots show fields of hazard factor, or F-factor (Bowles 1990), radar reflectivity, and velocity vectors on a horizontal plane overlayed with the applicable certification paths. For the plot of the F-factor field the region of 0.105 and above signify an area of hazardous, performance decreasing windshear, while negative values indicate regions of performance increasing windshear. The values of F-factor are based on 1-Km averaged segments along horizontal flight paths, assuming an air speed of 150 knots (approx. 75 m/s). The database has been released to vendors participating in the certification process. The database and associated document have been transferred to the FAA for archival storage and distribution.

  7. Effects of lipopolysaccharide on interleukin-2-induced cytotoxic activity of murine splenocyte cultures: role of prostaglandin E2 and interferons.

    PubMed

    Vaillier, D; Daculsi, R; Gualde, N

    1992-01-01

    Splenocytes cultured for 24 h in the presence of interleukin-2 (IL-2), lipopolysaccharide (LPS) or both together expressed a cytotoxic activity against the YAC-1 lymphoma cell line and to a lesser extent against P815 mastocytoma cells. The association of IL-2 and LPS had an additive effect on induction of cytotoxicity. The IL-2-induced cytotoxic activity lasted for the whole of the culture; however, the addition of LPS at the initiation of the culture increased the cytotoxic activity during its the early phase, the increment being followed by a fall of lytic activity after 72 h of culture. Assessment of interferon (IFN) in the culture supernatants showed (a) a production of IFN gamma by IL-2-supplemented cultures, (b) a more potent IFN production by cultures treated with IL-2 plus LPS (including 20% IFN alpha/beta, (c) and that indomethacin (1 microM) potentiated the effect of either IL-2 or LPS used alone but did not significantly increase the cytotoxic activity of cultures treated with IL-2 plus LPS (the one that produced a high level of IFN). When cultures were treated by an anti-IFN gamma antibody we observed no change in the cytotoxic activity; however, in the presence of anti-IFN alpha/beta serum the cytotoxic activity of cultures treated with IL-2 plus LPS was inhibited after 24 h but stimulated after 72 h. When cultures treated with IL-2 plus LPS were supplemented with both indomethacin and anti-IFN alpha/beta the cytotoxic activity assessed after 72 h of culture was maintained at the same level as that of IL-2-treated cultures, hence the fall after 72 h of the cytotoxicity of cultures initiated in the presence of LPS alone was affected by both the immune serum and the cyclooxygenase inhibitor. Altogether these data show that when splenocytes are cultured for more than 72 h in the presence of IL-2 and LPS their cytotoxic activity decreases, and it is likely that this diminution is linked to the endogenous production of prostaglandin E2 and INF alpha/beta.

  8. Trypanosoma congolense: proliferative responses and interleukin production in lymph node cells of infected cattle.

    PubMed

    Lutje, V; Mertens, B; Boulangé, A; Williams, D J; Authié, E

    1995-09-01

    T-cell-mediated immune responses to defined antigens of Trypanosoma congolense were measured in cattle undergoing primary infection. The antigens used were the variable surface glycoprotein and two invariant antigens, a 33-kDa cysteine protease (congopain) and a recombinant form of a 69-kDa heat-shock protein. Proliferative responses were highest during the second week postinfection and were detected in cells obtained from the lymph node draining the site of infection but not in peripheral blood mononuclear cells. Production of IL-2 and IFN-gamma was measured in supernatants from antigen-stimulated lymph node cell cultures. Expression of IL-2, IL-4, and IFN-gamma mRNA was detected in antigen-stimulated lymph node cells by reverse transcription-polymerase chain amplification.

  9. Behavioral conditioning of immunosuppression is possible in humans.

    PubMed

    Goebel, Marion U; Trebst, Almuth E; Steiner, Jan; Xie, Yu F; Exton, Michael S; Frede, Stilla; Canbay, Ali E; Michel, Martin C; Heemann, Uwe; Schedlowski, Manfred

    2002-12-01

    Behavioral conditioned immunosuppression has been described in rodents as the most impressive demonstration of brain-to-immune system interaction. To analyze whether behavioral conditioned immunosuppression is possible in humans, healthy subjects in this double-blind, placebo-controlled study were conditioned in four sessions over 3 consecutive days, receiving the immunosuppressive drug cyclosporin A as an unconditioned stimulus paired with a distinctively flavored drink (conditioned stimulus) each 12 h. In the next week, re-exposure to the conditioned stimulus (drink), but now paired with placebo capsules, induced a suppression of immune functions as analyzed by the IL-2 and IFN-gamma mRNA expression, intracellular production, and in vitro release of IL-2 and IFN-gamma, as well as lymphocyte proliferation. These data demonstrate for the first time that immunosuppression can be behaviorally conditioned in humans.

  10. Effects of the PPAR-beta agonist GW501516 in an in vitro model of brain inflammation and antibody-induced demyelination.

    PubMed

    Defaux, Antoinette; Zurich, Marie-Gabrielle; Braissant, Olivier; Honegger, Paul; Monnet-Tschudi, Florianne

    2009-05-07

    Brain inflammation plays a central role in numerous brain pathologies, including multiple sclerosis (MS). Microglial cells and astrocytes are the effector cells of neuroinflammation. They can be activated also by agents such as interferon-gamma (IFN-gamma) and lipopolysaccharide (LPS). Peroxisome proliferator-associated receptor (PPAR) pathways are involved in the control of the inflammatory processes, and PPAR-beta seems to play an important role in the regulation of central inflammation. In addition, PPAR-beta agonists were shown to have trophic effects on oligodendrocytes in vitro, and to confer partial protection in experimental autoimmune encephalomyelitis (EAE), an animal model of MS. In the present work, a three-dimensional brain cell culture system was used as in vitro model to study antibody-induced demyelination and inflammatory responses. GW 501516, a specific PPAR-beta agonist, was examined for its capacity to protect from antibody-mediated demyelination and to prevent inflammatory responses induced by IFN-gamma and LPS. Aggregating brain cells cultures were prepared from embryonal rat brain, and used to study the inflammatory responses triggered by IFN-gamma and LPS and by antibody-mediated demyelination induced by antibodies directed against myelin-oligodendrocyte glycoprotein (MOG). The effects of GW 501516 on cellular responses were characterized by the quantification of the mRNA expression of tumor necrosis factor-alpha (TNF-alpha), interleukin-6 (IL-6), inducible NO synthase (i-NOS), PPAR-beta, PPAR-gamma, glial fibrillary acidic protein (GFAP), myelin basic protein (MBP), and high molecular weight neurofilament protein (NF-H). GFAP expression was also examined by immunocytochemistry, and microglial cells were visualized by isolectin B4 (IB4) and ED1 labeling. GW 501516 decreased the IFN-gamma-induced up-regulation of TNF-alpha and iNOS in accord with the proposed anti-inflammatory effects of this PPAR-beta agonist. However, it increased IL-6 m-RNA expression. In demyelinating cultures, reactivity of both microglial cells and astrocytes was observed, while the expression of the inflammatory cytokines and iNOS remained unaffected. Furthermore, GW 501516 did not protect against the demyelination-induced changes in gene expression. Although GW 501516 showed anti-inflammatory activity, it did not protect against antibody-mediated demyelination. This suggests that the protective effects of PPAR-beta agonists observed in vivo can be attributed to their anti-inflammatory properties rather than to a direct protective or trophic effect on oligodendrocytes.

  11. Early immune response and regulation of IL-2 receptor subunits

    NASA Technical Reports Server (NTRS)

    Hughes-Fulford, Millie; Sugano, Eiko; Schopper, Thomas; Li, Chai-Fei; Boonyaratanakornkit, J. B.; Cogoli, Augusto

    2005-01-01

    Affymetrix oligonucleotide arrays were used to monitor expression of 8796 genes and probe sets in activated T-cells; analysis revealed that 217 genes were significantly upregulated within 4 h. Induced genes included transcription factors, cytokines and their receptor genes. Analysis by semi-quantitative RT-PCR confirmed the significant induction of IL-2, IL-2R(gamma) and IL-2R(alpha). Forty-eight of the 217 induced genes are known to or predicted to be regulated by a CRE promoter/enhancer. We found that T-cell activation caused a significant increase in CREB phosphorylation furthermore, inhibition of the PKC pathway by GF109203 reduced CREB activation by 50% and inhibition of the PKA pathway caused a total block of CREB phosphorylation and significantly reduced IFN(gamma), IL-2 and IL-2R(alpha) gene expression by approximately 40% (p<0.001). PKC(theta) plays a major role in T-cell activation: inhibition of PKC significantly reduced the expression of IFN(gamma), IL-2 and IL-2R(alpha). Since PKC blocked activation of CREB, we studied potential cross-talk between the PKC and the PKA/MAPK pathways, PMA-stimulated Jurkat cells were studied with specific signal pathway inhibitors. Extracellular signal-regulated kinase-2 (ERK2) pathway was found to be significantly activated greater than seven-fold within 30 min; however, there was little activation of ERK-1 and no activation of JNK or p38 MAPK. Inhibition of the PKA pathway, but not the PKC pathway, resulted in inhibition of ERK1/2 activation at all time points, inhibition of MEK1 and 2 significantly blocked expression of IL-2 and IL-2R(alpha). Gene expression of IL-2R(alpha) and IFN(gamma) was dependent on PKA in S49 wt cells but not in kin- mutants. Using gel shift analysis, we found that forskolin activation of T-cells resulted in activation of AP1 sites; this increase in nuclear extract AP1 was significantly blocked by MEK1 inhibitor U0126. Taken together, these results suggest that the PKA in addition to PKC and MAPK pathways plays a role in early T-cell activation and induction of IL-2, IL-2R(alpha) and IFN(gamma) gene expression.

  12. Expression of alpha-AR subtypes in T lymphocytes and role of the alpha-ARs in mediating modulation of T cell function.

    PubMed

    Bao, Jing-Yin; Huang, Yan; Wang, Feng; Peng, Yu-Ping; Qiu, Yi-Hua

    2007-01-01

    Previous work in our laboratory has shown that alpha-adrenoreceptors (alpha-ARs) and beta-ARs exist on lymphocytes from functional profile, and that the receptors mediate the regulation of lymphocyte function by catecholamines. In the present study, we directly examined the expression of alpha-AR subtypes, alpha(1)-AR and alpha(2)-AR mRNAs, in T lymphocytes and explored the roles of the alpha-AR subtypes and intracellular signal transduction mechanisms linked to the receptors in mediating the modulation of T lymphocyte function. T lymphocytes from mesenteric lymph nodes of rats were purified by using a nylon wool column. Reverse transcription polymerase chain reaction was used to detect the expression of alpha(1)-AR and alpha(2)-AR mRNAs in the freshly isolated T cells and the mitogen concanavalin A (Con A)-activated lymphocytes. Colorimetric methylthiazoletetrazolium assay was employed to measure lymphocyte proliferation induced by Con A. Interferon-gamma (IFN-gamma) and interleukin-4 (IL-4) levels in the Con A-stimulated lymphocyte culture supernatants were examined by enzyme-linked immunosorbent assay. T cells expressed both alpha(1)-AR and alpha(2)-AR mRNAs. The expression of both alpha(1)-AR and alpha(2)-AR mRNAs was significantly higher in the Con A-activated lymphocytes than in the resting lymphocytes. Phenylephrine, a selective alpha(1)-AR agonist, had no evident effect on lymphocyte proliferation nor on IFN-gamma and IL-4 production induced by Con A. However, the selective alpha(2)-AR agonist clonidine attenuated Con A-induced lymphocyte proliferation as well as IFN-gamma and IL-4 production. The inhibited lymphocyte proliferation and IFN-gamma and IL-4 production by clonidine were blocked by yohimbine, an alpha(2)-AR antagonist. Either phospholipase C inhibitor U-73122 or protein kinase C inhibitor chelerythrine partially prevented the suppressive effect of clonidine on Con A-stimulated lymphocyte proliferation and IL-4 production. T lymphocytes express both alpha(1)-ARs and alpha(2)-ARs, but only the alpha(2)-ARs participate in the suppressive modulation of lymphocyte proliferation and cytokine production in vitro. The inhibitory effect of alpha(2)-AR stimulation on lymphocyte function is partially mediated via the phospholipase C-protein kinase C pathway. (c) 2008 S. Karger AG, Basel.

  13. Early immune response and regulation of IL-2 receptor subunits.

    PubMed

    Hughes-Fulford, Millie; Sugano, Eiko; Schopper, Thomas; Li, Chai-Fei; Boonyaratanakornkit, J B; Cogoli, Augusto

    2005-09-01

    Affymetrix oligonucleotide arrays were used to monitor expression of 8796 genes and probe sets in activated T-cells; analysis revealed that 217 genes were significantly upregulated within 4 h. Induced genes included transcription factors, cytokines and their receptor genes. Analysis by semi-quantitative RT-PCR confirmed the significant induction of IL-2, IL-2R(gamma) and IL-2R(alpha). Forty-eight of the 217 induced genes are known to or predicted to be regulated by a CRE promoter/enhancer. We found that T-cell activation caused a significant increase in CREB phosphorylation furthermore, inhibition of the PKC pathway by GF109203 reduced CREB activation by 50% and inhibition of the PKA pathway caused a total block of CREB phosphorylation and significantly reduced IFN(gamma), IL-2 and IL-2R(alpha) gene expression by approximately 40% (p<0.001). PKC(theta) plays a major role in T-cell activation: inhibition of PKC significantly reduced the expression of IFN(gamma), IL-2 and IL-2R(alpha). Since PKC blocked activation of CREB, we studied potential cross-talk between the PKC and the PKA/MAPK pathways, PMA-stimulated Jurkat cells were studied with specific signal pathway inhibitors. Extracellular signal-regulated kinase-2 (ERK2) pathway was found to be significantly activated greater than seven-fold within 30 min; however, there was little activation of ERK-1 and no activation of JNK or p38 MAPK. Inhibition of the PKA pathway, but not the PKC pathway, resulted in inhibition of ERK1/2 activation at all time points, inhibition of MEK1 and 2 significantly blocked expression of IL-2 and IL-2R(alpha). Gene expression of IL-2R(alpha) and IFN(gamma) was dependent on PKA in S49 wt cells but not in kin- mutants. Using gel shift analysis, we found that forskolin activation of T-cells resulted in activation of AP1 sites; this increase in nuclear extract AP1 was significantly blocked by MEK1 inhibitor U0126. Taken together, these results suggest that the PKA in addition to PKC and MAPK pathways plays a role in early T-cell activation and induction of IL-2, IL-2R(alpha) and IFN(gamma) gene expression.

  14. Interferon-γ acts as a regulator in the trade-off between phagocytosis and production performance in dwarf chickens.

    PubMed

    Yuan, Yitong; Liu, Shunqi; Zhao, Yue; Lian, Ling; Lian, Zhengxing

    2018-01-01

    Interferon-γ (IFN-γ) is critical for innate and adaptive immunity against viral and bacterial infections. IFN-γ reportedly affects the phagocytic ability of monocytes and macrophages as well as regulates pituitary function in humans and mice. The present study analyzed the impact of IFN-γ on monocyte and macrophage phagocytosis, production performance, and pituitary function in vivo and in vitro (in dwarf chickens). IFN-γ was injected into dwarf chickens through a vein, and then, the laying rate, average egg weight, and levels of follicle-stimulating hormone (FSH) and IFN-γ were measured in treatment and control groups. For the in vitro experiment, the pituitary tissues were supplemented with IFN-γ, and the mRNA expression levels of follicle-stimulating hormone beta subunit ( FSH-β ), interferon gamma receptor 1 ( IFNGR 1), and interferon gamma receptor 2 ( IFNGR 2) in the pituitary were assessed. Monocyte and macrophage phagocytosis product (PP) was decreased by IFN-γ treatment in a dose-dependent manner in vitro. In the in vivo experiment, the level of IFN-γ in the treatment group was higher than that in the control group at 7 d ( P  < 0.05), 14 d ( P  < 0.01), and 21 d ( P  < 0.01) post-injection. Compared with the control group, monocyte and macrophage PP was lower in the treatment group after injection ( P  < 0.01). The laying rate was higher in the treatment group than in the control group at 2 and 3 wk post-injection ( P  < 0.05). There was a significant difference between the treatment and control groups in the levels of FSH at 1, 3, 7, and 14 d post-injection ( P  < 0.01). In the in vitro experiment, increased mRNA expression levels of FSH-β , IFNGR 1, and IFNGR 2 were observed in the treatment group after stimulation with 100 U/mL IFN-γ for 24 h compared to those in the control group ( P  < 0.05). IFN-γ inhibited the phagocytosis of monocytes and macrophages; up-regulated the mRNA expression levels of the FSH-β , IFNGR 1, and IFNGR 2; enhanced the secretion of FSH; and improved the laying rate. IFN-γ might be an important regulator in the trade-off between the immune effect and production performance in dwarf chickens.

  15. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sigaud, Samuel; Goldsmith, Carroll-Ann W.; Zhou Hongwei

    Epidemiological studies reveal increased incidence of lung infection when air pollution particle levels are increased. We postulate that one risk factor for bacterial pneumonia, prior viral infection, can prime the lung for greater deleterious effects of particles via the interferon-gamma (IFN-{gamma}) characteristic of successful host anti-viral responses. To test this postulate, we developed a mouse model in which mice were treated with {gamma}-interferon aerosol, followed by exposure to concentrated ambient particles (CAPs) collected from urban air. The mice were then infected with Streptococcus pneumoniae and the effect of these treatments on the lung's innate immune response was evaluated. The combinationmore » of IFN-{gamma} priming and CAPs exposure enhanced lung inflammation, manifest as increased polymorphonuclear granulocyte (PMN) recruitment to the lung, and elevated expression of pro-inflammatory cytokine mRNAs. Combined priming and CAPs exposure resulted in impaired pulmonary bacterial clearance, as well as increased oxidant production and diminished bacterial uptake by alveolar macrophages (AMs) and PMNs. The data suggest that priming and CAPs exposure lead to an inflamed alveolar milieu where oxidant stress causes loss of antibacterial functions in AMs and recruited PMNs. The model reported here will allow further analysis of priming and CAPs exposure on lung sensitivity to infection.« less

  16. Local inflammation, lethality and cytokine release in mice injected with Bothrops atrox venom.

    PubMed Central

    Barros, S F; Friedlanskaia, I; Petricevich, V L; Kipnis, T L

    1998-01-01

    We have provided evidence that: (a) lethality of mice to crude Bothrops venom varies according the isogenic strain (A/J > C57Bl/6 > A/Sn > BALB/c > C3H/HePas > DBA/2 > C3H/He); (b)BALB/c mice (LD50=100.0 microg) were injected i.p. with 50 microg of venom produced IL-6, IL-10, INF-gamma, TNF-alpha and NO in the serum. In vitro the cells from the mice injected and challenged with the venom only released IL-10 while peritoneal macrophages released IL-10, INF-gamma and less amounts of IL-6; (c) establishment of local inflammation and necrosis induced by the venom, coincides with the peaks of TNF-alpha, IFN-gamma and NO and the damage was neutralized when the venom was incubated with a monoclonal antibody against a 60 kDa haemorrhagic factor. These results suggest that susceptibility to Bothrops atrox venom is genetically dependent but MHC independent; that IL-6, IL-10, TNF-alpha, IFN-gamma and NO can be involved in the mediation of tissue damage; and that the major venom component inducers of the lesions are haemorrhagins. PMID:9883969

  17. The Predominant CD4+ Th1 Cytokine Elicited to Chlamydia trachomatis Infection in Women Is Tumor Necrosis Factor Alpha and Not Interferon Gamma

    PubMed Central

    Gupta, Kanupriya; Ogendi, Brian M. O.; Bakshi, Rakesh K.; Kapil, Richa; Press, Christen G.; Sabbaj, Steffanie; Lee, Jeannette Y.

    2017-01-01

    ABSTRACT Chlamydia trachomatis infection is the most prevalent bacterial sexually transmitted infection and can cause significant reproductive morbidity in women. There is insufficient knowledge of C. trachomatis-specific immune responses in humans, which could be important in guiding vaccine development efforts. In contrast, murine models have clearly demonstrated the essential role of T helper type 1 (Th1) cells, especially interferon gamma (IFN-γ)-producing CD4+ T cells, in protective immunity to chlamydia. To determine the frequency and magnitude of Th1 cytokine responses elicited to C. trachomatis infection in humans, we stimulated peripheral blood mononuclear cells from 90 chlamydia-infected women with C. trachomatis elementary bodies, Pgp3, and major outer membrane protein and measured IFN-γ-, tumor necrosis factor alpha (TNF-α)-, and interleukin-2 (IL-2)-producing CD4+ and CD8+ T-cell responses using intracellular cytokine staining. The majority of chlamydia-infected women elicited CD4+ TNF-α responses, with frequency and magnitude varying significantly depending on the C. trachomatis antigen used. CD4+ IFN-γ and IL-2 responses occurred infrequently, as did production of any of the three cytokines by CD8+ T cells. About one-third of TNF-α-producing CD4+ T cells coproduced IFN-γ or IL-2. In summary, the predominant Th1 cytokine response elicited to C. trachomatis infection in women was a CD4+ TNF-α response, not CD4+ IFN-γ, and a subset of the CD4+ TNF-α-positive cells produced a second Th1 cytokine. PMID:28100498

  18. Cross-talk between IGF-1 and estrogen receptors attenuates intracellular changes in ventral spinal cord 4.1 motoneuron cells due to interferon-gamma exposure

    PubMed Central

    Park, Sookyoung; Nozaki, Kenkichi; Smith, Joshua A.; Krause, James S.; Banik, Naren L.

    2014-01-01

    Insulin-like growth factor-1 (IGF-1) is a neuroprotective growth factor that promotes neuronal survival by inhibition of apoptosis. In order to examine whether IGF-1 exerts cytoprotective effects against extracellular inflammatory stimulation, ventral spinal cord 4.1 (VSC4.1) motoneuron cells were treated with interferon-gamma (IFN-γ). Our data demonstrated apoptotic changes, increased calpain:calpastatin and Bax:Bcl-2 ratios, and expression of apoptosis related proteases (caspase-3 and −12) in motoneurons rendered by IFN-γ in a dose-dependent manner. Post-treatment with IGF-1 attenuated these changes. In addition, IGF-1 treatment of motoneurons exposed to IFN-γ decreased expression of inflammatory markers (cyclooxygenase-2 and nuclear factor-kappa B:inhibitor of kappa B ratio). Furthermore, IGF-1 attenuated the loss of expression of IGF-1 receptors (IGF-1Rα and IGF-1Rβ) and estrogen receptors (ERα and ERβ) induced by IFN-γ. To determine whether the protective effects of IGF-1 are associated with ERs, ERs antagonist ICI and selective siRNA targeted against ERα and ERβ were used in VSC4.1 motoneurons. Distinctive morphological changes were observed following siRNA knockdown of ERα and ERβ. In particular, apoptotic cell death assessed by TUNEL assay was enhanced in both ERα and ERβ-silenced VSC4.1 motoneurons following IFN-γ and IGF-1 exposure. These results suggest that IGF-1 protects motoneurons from inflammatory insult by a mechanism involving pivotal interactions with ERα and ERβ. PMID:24188094

  19. Cross-talk between IGF-1 and estrogen receptors attenuates intracellular changes in ventral spinal cord 4.1 motoneuron cells because of interferon-gamma exposure.

    PubMed

    Park, Sookyoung; Nozaki, Kenkichi; Smith, Joshua A; Krause, James S; Banik, Naren L

    2014-03-01

    Insulin-like growth factor-1 (IGF-1) is a neuroprotective growth factor that promotes neuronal survival by inhibition of apoptosis. To examine whether IGF-1 exerts cytoprotective effects against extracellular inflammatory stimulation, ventral spinal cord 4.1 (VSC4.1) motoneuron cells were treated with interferon-gamma (IFN-γ). Our data demonstrated apoptotic changes, increased calpain:calpastatin and Bax:Bcl-2 ratios, and expression of apoptosis-related proteases (caspase-3 and -12) in motoneurons rendered by IFN-γ in a dose-dependent manner. Post-treatment with IGF-1 attenuated these changes. In addition, IGF-1 treatment of motoneurons exposed to IFN-γ decreased expression of inflammatory markers (cyclooxygenase-2 and nuclear factor-kappa B:inhibitor of kappa B ratio). Furthermore, IGF-1 attenuated the loss of expression of IGF-1 receptors (IGF-1Rα and IGF-1Rβ) and estrogen receptors (ERα and ERβ) induced by IFN-γ. To determine whether the protective effects of IGF-1 are associated with ERs, ERs antagonist ICI and selective siRNA targeted against ERα and ERβ were used in VSC4.1 motoneurons. Distinctive morphological changes were observed following siRNA knockdown of ERα and ERβ. In particular, apoptotic cell death assessed by TUNEL assay was enhanced in both ERα and ERβ-silenced VSC4.1 motoneurons following IFN-γ and IGF-1 exposure. These results suggest that IGF-1 protects motoneurons from inflammatory insult by a mechanism involving pivotal interactions with ERα and ERβ. © 2013 International Society for Neurochemistry.

  20. T helper cell-mediated interferon-gamma expression after human parvovirus B19 infection: persisting VP2-specific and transient VP1u-specific activity

    PubMed Central

    Franssila, R; Auramo, J; Modrow, S; Möbs, M; Oker-Blom, C; Käpylä, P; Söderlund-Venermo, M; Hedman, K

    2005-01-01

    Human parvovirus B19 is a small non-enveloped DNA virus with an icosahedral capsid consisting of proteins of only two species, the major protein VP2 and the minor protein VP1. VP2 is contained within VP1, which has an additional unique portion (VP1u) of 227 amino acids. We determined the ability of eukaryotically expressed parvovirus B19 virus-like particles consisting of VP1 and VP2 in the ratio recommended for vaccine use, or of VP2 alone, to stimulate, in an HLA class II restricted manner, peripheral blood mononuclear cells (PBMC) to proliferate and to secrete interferon gamma (IFN-γ) and interleukin (IL)-10 cytokines among recently and remotely B19 infected subjects. PBMC reactivity with VP1u was determined specifically with a prokaryotically expressed VP1u antigen. In general, B19-specific IFN-γ responses were stronger than IL-10 responses in both recent and remote infection; however, IL-10 responses were readily detectable among both groups, with the exception of patients with relapsed or persisting symptoms who showed strikingly low IL-10 responses. Whereas VP1u-specific IFN-γ responses were very strong among the recently infected subjects, the VP1u-specific IFN-γ and IL-10 responses were virtually absent among the remotely infected subjects. The disappearance of VP1u-specific IFN-γ expression is surprising, as B-cell immunity against VP1u is well maintained. PMID:16178856

  1. Mechanisms and regulation of polymorphonuclear leukocyte and eosinophil adherence to human airway epithelial cells.

    PubMed

    Jagels, M A; Daffern, P J; Zuraw, B L; Hugli, T E

    1999-09-01

    Polymorphonuclear leukocytes (PMN) and eosinophils (Eos) are important cellular participants in a variety of acute and chronic inflammatory reactions in the airway. Histologic evidence has implicated direct interactions between these two subsets of leukocytes and airway epithelial cells during inflammation. A comprehensive characterization and comparison of physiologic stimuli and adhesion molecule involvement in granulocyte-epithelial-cell interactions done with nontransformed human airway epithelial cells has not been reported. We therefore examined the regulation and biochemical mechanisms governing granulocyte-epithelial-cell adhesion, using either purified PMN or Eos and primary cultures of human bronchial epithelial cells (HBECs). We investigated the involvement of a number of proinflammatory signals associated with allergic and nonallergic airway inflammation, as well as the contribution of several epithelial and leukocyte adhesion molecules, including intercellular adhesion molecule-1 (ICAM-1), vascular cell adhesion molecule-1 (VCAM-1), and members of the beta(1), beta(2), and beta(7) integrin families. ICAM-1 was expressed at low levels on cultured HBECs and was markedly upregulated after stimulation with interferon (IFN)-gamma or, to a lesser extent, with tumor necrosis factor (TNF)-alpha or interleukin (IL)-1. VCAM-1 was not present on resting HBECs, and was not upregulated after stimulation with IFN-gamma, IL-1, IL-4, or TNF-alpha. PMN adhesion to HBECs could be induced either through activation of PMN with IL-8, granulocyte-macrophage colony-stimulating factor (GM-CSF), or C5a, but not with IL-5 or by preactivation of HBECs with TNF-alpha or IFN-gamma. Blocking antibody studies indicated that PMN-HBEC adherence depended on beta(2) integrins, primarily alpha(M)beta(2) (Mac-1). Adherence of Eos to HBECs could be induced through activation of Eos with IL-5, GM-CSF, or C5a, but not with IL-8 or by prior activation of HBECs with TNF-alpha of IFN-gamma. Maximal adhesion of Eos and PMN required pretreatment of HBECs with either TNF-alpha or IFN-gamma in addition to leukocyte activation. Adherence of Eos to unstimulated HBECs was mediated through both beta(1) and beta(2) integrins, whereas adhesion of Eos to activated HBECs was dominated by beta(2) integrins. Adhesion of both Eos and PMN was inhibited by treatment of HBECs with blocking antibodies to ICAM-1. Differential utilization of beta(1) and beta(2) integrins by Eos, depending on the activation state of the epithelium, is a novel finding and may affect activation and/or recruitment of Eos in airway tissue. Mechanisms of adhesion of HBECs to Eos and PMN, as evidenced by the different responsiveness of the two latter types of cells to IL-8 and IL-5, may account for a prevalence of Eos over PMN in certain airway diseases.

  2. Despite Increased Type 1 IFN, Autoimmune Nonobese Diabetic Mice Display Impaired Dendritic Cell Response to CpG and Decreased Nuclear Localization of IFN-Activated STAT1.

    PubMed

    Rahman, M Jubayer; Rahir, Gwendoline; Dong, Matthew B; Zhao, Yongge; Rodrigues, Kameron B; Hotta-Iwamura, Chie; Chen, Ye; Guerrero, Alan; Tarbell, Kristin V

    2016-03-01

    Innate immune signals help break self-tolerance to initiate autoimmune diseases such as type 1 diabetes, but innate contributions to subsequent regulation of disease progression are less clear. Most studies have measured in vitro innate responses of GM-CSF dendritic cells (DCs) that are functionally distinct from conventional DCs (cDCs) and do not reflect in vivo DC subsets. To determine whether autoimmune NOD mice have alterations in type 1 IFN innate responsiveness, we compared cDCs from prediabetic NOD and control C57BL/6 (B6) mice stimulated in vivo with the TLR9 ligand CpG, a strong type 1 IFN inducer. In response to CpG, NOD mice produce more type 1 IFN and express higher levels of CD40, and NOD monocyte DCs make more TNF. However, the overall CpG-induced transcriptional response is muted in NOD cDCs. Of relevance the costimulatory proteins CD80/CD86, signals needed for regulatory T cell homeostasis, are upregulated less on NOD cDCs. Interestingly, NOD Rag1(-/-) mice also display a defect in CpG-induced CD86 upregulation compared with B6 Rag1(-/-), indicating this particular innate alteration precedes adaptive autoimmunity. The impaired response in NOD DCs is likely downstream of the IFN-α/β receptor because DCs from NOD and B6 mice show similar CpG-induced CD86 levels when anti-IFN-α/β receptor Ab is added. IFN-α-induced nuclear localization of activated STAT1 is markedly reduced in NOD CD11c(+) cells, consistent with lower type 1 IFN responsiveness. In conclusion, NOD DCs display altered innate responses characterized by enhanced type 1 IFN and activation of monocyte-derived DCs but diminished cDC type 1 IFN response.

  3. Pleiotrophin (PTN) is expressed in vascularized human atherosclerotic plaques: IFN-γ/JAK/STAT1 signaling is critical for the expression of PTN in macrophages

    PubMed Central

    Li, Fuqiang; Tian, Fang; Wang, Lai; Williamson, Ian K.; Sharifi, Behrooz G.; Shah, Prediman K.

    2010-01-01

    Neovascularization is critical to destabilization of atheroma. We previously reported that the angiogenic growth factor pleiotrophin (PTN) coaxes monocytes to assume the phenotype of functional endothelial cells in vitro and in vivo. In this study we show that PTN expression is colocalized with capillaries of human atherosclerotic plaques. Among the various reagents that are critical to the pathogenesis of atherosclerosis, interferon (IFN)-γ was found to markedly induce PTN mRNA expression in a dose-dependent manner in macrophages. Mechanistic studies revealed that the Janus kinase inhibitors, WHI-P154 and ATA, efficiently blocked STAT1 phosphorylation in a concentration- and time-dependent manner. Notably, the level of phosphorylated STAT1 was found to correlate directly with the PTN mRNA levels. In addition, STAT1/STAT3/p44/42 signaling molecules were found to be phosphorylated by IFN-γ in macrophages, and they were translocated into the nucleus. Further, PTN promoter analysis showed that a gamma-activated sequence (GAS) located at −2086 to −2078 bp is essential for IFN-γ-regulated promoter activity. Moreover, electrophoretic mobility shift, supershift, and chromatin immunoprecipitation analyses revealed that both STAT1 and STAT3 bind to the GAS at the chromatin level in the IFN-γ stimulated cells. Finally, to test whether the combined effect of STAT1/STAT3/p44/42 signaling is required for the expression of PTN in macrophages, gene knockdowns of these transcription factors were performed using siRNA. Cells lacking STAT1, but not STAT3 or p42, have markedly reduced PTN mRNA levels. These data suggest that PTN expression in the human plaques may be in part regulated by IFN-γ and that PTN is involved in the adaptive immunity.—Li, F., Tian, F., Wang, L., Williamson, I. K., Sharifi, B. G., Shah, P. K. Pleiotrophin (PTN) is expressed in vascularized human atherosclerotic plaques: IFN-γ/JAK/STAT1 signaling is critical for the expression of PTN in macrophages PMID:19917672

  4. Progress in obtaining an absolute calibration of a total deuterium-tritium neutron yield diagnostic based on copper activationa)

    NASA Astrophysics Data System (ADS)

    Ruiz, C. L.; Chandler, G. A.; Cooper, G. W.; Fehl, D. L.; Hahn, K. D.; Leeper, R. J.; McWatters, B. R.; Nelson, A. J.; Smelser, R. M.; Snow, C. S.; Torres, J. A.

    2012-10-01

    The 350-keV Cockroft-Walton accelerator at Sandia National laboratory's Ion Beam facility is being used to calibrate absolutely a total DT neutron yield diagnostic based on the 63Cu(n,2n)62Cu(β+) reaction. These investigations have led to first-order uncertainties approaching 5% or better. The experiments employ the associated-particle technique. Deuterons at 175 keV impinge a 2.6 μm thick erbium tritide target producing 14.1 MeV neutrons from the T(d,n)4He reaction. The alpha particles emitted are measured at two angles relative to the beam direction and used to infer the neutron flux on a copper sample. The induced 62Cu activity is then measured and related to the neutron flux. This method is known as the F-factor technique. Description of the associated-particle method, copper sample geometries employed, and the present estimates of the uncertainties to the F-factor obtained are given.

  5. Progress in obtaining an absolute calibration of a total deuterium-tritium neutron yield diagnostic based on copper activation.

    PubMed

    Ruiz, C L; Chandler, G A; Cooper, G W; Fehl, D L; Hahn, K D; Leeper, R J; McWatters, B R; Nelson, A J; Smelser, R M; Snow, C S; Torres, J A

    2012-10-01

    The 350-keV Cockroft-Walton accelerator at Sandia National laboratory's Ion Beam facility is being used to calibrate absolutely a total DT neutron yield diagnostic based on the (63)Cu(n,2n)(62)Cu(β+) reaction. These investigations have led to first-order uncertainties approaching 5% or better. The experiments employ the associated-particle technique. Deuterons at 175 keV impinge a 2.6 μm thick erbium tritide target producing 14.1 MeV neutrons from the T(d,n)(4)He reaction. The alpha particles emitted are measured at two angles relative to the beam direction and used to infer the neutron flux on a copper sample. The induced (62)Cu activity is then measured and related to the neutron flux. This method is known as the F-factor technique. Description of the associated-particle method, copper sample geometries employed, and the present estimates of the uncertainties to the F-factor obtained are given.

  6. Gamma Interferon-Induced Guanylate Binding Protein 1 Is a Novel Actin Cytoskeleton Remodeling Factor

    PubMed Central

    Ostler, Nicole; Britzen-Laurent, Nathalie; Liebl, Andrea; Naschberger, Elisabeth; Lochnit, Günter; Ostler, Markus; Forster, Florian; Kunzelmann, Peter; Ince, Semra; Supper, Verena; Praefcke, Gerrit J. K.; Schubert, Dirk W.; Stockinger, Hannes; Herrmann, Christian

    2014-01-01

    Gamma interferon (IFN-γ) regulates immune defenses against viruses, intracellular pathogens, and tumors by modulating cell proliferation, migration, invasion, and vesicle trafficking processes. The large GTPase guanylate binding protein 1 (GBP-1) is among the cellular proteins that is the most abundantly induced by IFN-γ and mediates its cell biologic effects. As yet, the molecular mechanisms of action of GBP-1 remain unknown. Applying an interaction proteomics approach, we identified actin as a strong and specific binding partner of GBP-1. Furthermore, GBP-1 colocalized with actin at the subcellular level and was both necessary and sufficient for the extensive remodeling of the fibrous actin structure observed in IFN-γ-exposed cells. These effects were dependent on the oligomerization and the GTPase activity of GBP-1. Purified GBP-1 and actin bound to each other, and this interaction was sufficient to impair the formation of actin filaments in vitro, as demonstrated by atomic force microscopy, dynamic light scattering, and fluorescence-monitored polymerization. Cosedimentation and band shift analyses demonstrated that GBP-1 binds robustly to globular actin and slightly to filamentous actin. This indicated that GBP-1 may induce actin remodeling via globular actin sequestering and/or filament capping. These results establish GBP-1 as a novel member within the family of actin-remodeling proteins specifically mediating IFN-γ-dependent defense strategies. PMID:24190970

  7. Gamma interferon-induced guanylate binding protein 1 is a novel actin cytoskeleton remodeling factor.

    PubMed

    Ostler, Nicole; Britzen-Laurent, Nathalie; Liebl, Andrea; Naschberger, Elisabeth; Lochnit, Günter; Ostler, Markus; Forster, Florian; Kunzelmann, Peter; Ince, Semra; Supper, Verena; Praefcke, Gerrit J K; Schubert, Dirk W; Stockinger, Hannes; Herrmann, Christian; Stürzl, Michael

    2014-01-01

    Gamma interferon (IFN-γ) regulates immune defenses against viruses, intracellular pathogens, and tumors by modulating cell proliferation, migration, invasion, and vesicle trafficking processes. The large GTPase guanylate binding protein 1 (GBP-1) is among the cellular proteins that is the most abundantly induced by IFN-γ and mediates its cell biologic effects. As yet, the molecular mechanisms of action of GBP-1 remain unknown. Applying an interaction proteomics approach, we identified actin as a strong and specific binding partner of GBP-1. Furthermore, GBP-1 colocalized with actin at the subcellular level and was both necessary and sufficient for the extensive remodeling of the fibrous actin structure observed in IFN-γ-exposed cells. These effects were dependent on the oligomerization and the GTPase activity of GBP-1. Purified GBP-1 and actin bound to each other, and this interaction was sufficient to impair the formation of actin filaments in vitro, as demonstrated by atomic force microscopy, dynamic light scattering, and fluorescence-monitored polymerization. Cosedimentation and band shift analyses demonstrated that GBP-1 binds robustly to globular actin and slightly to filamentous actin. This indicated that GBP-1 may induce actin remodeling via globular actin sequestering and/or filament capping. These results establish GBP-1 as a novel member within the family of actin-remodeling proteins specifically mediating IFN-γ-dependent defense strategies.

  8. Production of matrix metalloproteinases in response to mycobacterial infection.

    PubMed

    Quiding-Järbrink, M; Smith, D A; Bancroft, G J

    2001-09-01

    Matrix metalloproteinases (MMPs) constitute a large family of enzymes with specificity for the various proteins of the extracellular matrix which are implicated in tissue remodeling processes and chronic inflammatory conditions. To investigate the role of MMPs in immunity to mycobacterial infections, we incubated murine peritoneal macrophages with viable Mycobacterium bovis BCG or Mycobacterium tuberculosis H37Rv and assayed MMP activity in the supernatants by zymography. Resting macrophages secreted only small amounts of MMP-9 (gelatinase B), but secretion increased dramatically in a dose-dependent manner in response to either BCG or M. tuberculosis in vitro. Incubation with mycobacteria also induced increased MMP-2 (gelatinase A) activity. Neutralization of tumor necrosis alpha (TNF-alpha), and to a lesser extent interleukin 18 (IL-18), substantially reduced MMP production in response to mycobacteria. Exogenous addition of TNF-alpha or IL-18 induced macrophages to express MMPs, even in the absence of bacteria. The immunoregulatory cytokines gamma interferon (IFN-gamma), IL-4, and IL-10 all suppressed BCG-induced MMP production, but through different mechanisms. IFN-gamma treatment increased macrophage secretion of TNF-alpha but still reduced their MMP activity. Conversely, IL-4 and IL-10 seemed to act by reducing the amount of TNF-alpha available to the macrophages. Finally, infection of BALB/c or severe combined immunodeficiency (SCID) mice with either BCG or M. tuberculosis induced substantial increases in MMP-9 activity in infected tissues. In conclusion, we show that mycobacterial infection induces MMP-9 activity both in vitro and in vivo and that this is regulated by TNF-alpha, IL-18, and IFN-gamma. These findings indicate a possible contribution of MMPs to tissue remodeling processes that occur in mycobacterial infections.

  9. Repeat tuberculin skin testing leads to desensitisation in naturally infected tuberculous cattle which is associated with elevated interleukin-10 and decreased interleukin-1 beta responses.

    PubMed

    Coad, Michael; Clifford, Derek; Rhodes, Shelley G; Hewinson, R Glyn; Vordermeier, H Martin; Whelan, Adam O

    2010-01-01

    The principal surveillance tool used to control bovine tuberculosis in cattle is the removal of animals that provide a positive response to the tuberculin skin-test. In this study we performed a longitudinal investigation of the immunological and diagnostic consequences of repeated short-interval skin-tests in cattle naturally infected with Mycobacterium bovis. Tuberculin skin-test positive cattle were subjected to up to four further intradermal comparative cervical skin-tests at approximately 60-day intervals. A significant progressive reduction in the strength of the skin-test was observed after successive tests. In contrast, the magnitude of interferon-gamma (IFN-gamma) responses was not influenced by repeat skin-testing either transiently around the time of each skin-test or longitudinally following repeated tests. A significant boost in blood interleukin-10 (IL-10) production was observed within 3 days following each skin-test although the magnitude of this boosted response returned to lower levels by day 10 post-test. The application of a novel multiplex assay to simultaneously measure seven cytokines and chemokines also identified that skin-testing resulted in a significant and progressive reduction in antigen specific interleukin-1beta (IL-1beta) whilst confirming stable IFN-gamma and elevated IL-10 responses in the blood. Therefore, we have demonstrated that in cattle naturally infected with M. bovis, repeat short-interval skin-testing can lead to a progressive reduction in skin-test responsiveness which has potential negative consequences for the detection of infected animals with marginal or inconclusive skin-test responses. The desensitising effect is associated with decreased IL-1beta and elevated IL-10 responses, but importantly, does not influence antigen specific IFN-gamma responses. INRA, EDP Sciences, 2009

  10. CD94 surface density identifies a functional intermediary between the CD56bright and CD56dim human NK-cell subsets.

    PubMed

    Yu, Jianhua; Mao, Hsiaoyin C; Wei, Min; Hughes, Tiffany; Zhang, Jianying; Park, Il-kyoo; Liu, Shujun; McClory, Susan; Marcucci, Guido; Trotta, Rossana; Caligiuri, Michael A

    2010-01-14

    Human CD56(bright) natural killer (NK) cells possess little or no killer immunoglobulin-like receptors (KIRs), high interferon-gamma (IFN-gamma) production, but little cytotoxicity. CD56(dim) NK cells have high KIR expression, produce little IFN-gamma, yet display high cytotoxicity. We hypothesized that, if human NK maturation progresses from a CD56(bright) to a CD56(dim) phenotype, an intermediary NK cell must exist, which demonstrates more functional overlap than these 2 subsets, and we used CD94 expression to test our hypothesis. CD94(high)CD56(dim) NK cells express CD62L, CD2, and KIR at levels between CD56(bright) and CD94(low)CD56(dim) NK cells. CD94(high)CD56(dim) NK cells produce less monokine-induced IFN-gamma than CD56(bright) NK cells but much more than CD94(low)CD56(dim) NK cells because of differential interleukin-12-mediated STAT4 phosphorylation. CD94(high)CD56(dim) NK cells possess a higher level of granzyme B and perforin expression and CD94-mediated redirected killing than CD56(bright) NK cells but lower than CD94(low)CD56(dim) NK cells. Collectively, our data suggest that the density of CD94 surface expression on CD56(dim) NK cells identifies a functional and likely developmental intermediary between CD56(bright) and CD94(low)CD56(dim) NK cells. This supports the notion that, in vivo, human CD56(bright) NK cells progress through a continuum of differentiation that ends with a CD94(low)CD56(dim) phenotype.

  11. Multiple host defense defects in failure of C57BL/6 ep/ep (pale ear) mice to resolve visceral Leishmania donovani infection.

    PubMed Central

    Murray, H W; Hariprashad, J; McDermott, D F; Stoeckle, M Y

    1996-01-01

    Euthymic C57BL/L ep/ep (pale ear [PE]) mice halt the visceral replication of intracellular Leishmania donovani but fail to properly resolve infection. A previous study identified an isolated defect in tissue granuloma formation in these mice; CD4+ and CD8+ cell number, gamma interferon (IFN-gamma) production, and macrophage antimicrobial activity in vitro were all intact. New in vivo results reported here suggest a considerably more complex immune defect, with evidence indicating (i) enhanced control over L. donovani after transfer of normal C57BL/6 spleen cells, (ii) a partially suppressive Th2 cell-associated response mediated by interleukin-4 (IL-4) but not reversed by CD4+ cell depletion, (iii) absent responses to endogenous Th1 cell lymphokines (IFN-gamma and IL-2) but preserved responsiveness to endogenous tumor necrosis factor alpha, (iv) absent responses to exogenous treatment with recognized antileishmanial cytokines (IFN-gamma, IL-2, IL-12, and granulocyte-macrophage colony-stimulating factor [GM-CSF]) not corrected by transfer of C57BL/6 spleen cells, and (v) a deficient response to antimony chemotherapy. Defective hepatic granuloma formation was not corrected by transfer of C57BL/6 spleen cells or by anti-IL-4 administration. While treatment with IL-2 and GM-CSF modified the tissue reaction and induced selected effector cells to encase tissue macrophages, no antileishmanial activity resulted. Together, these observations suggest that the failure of PE mice to resolve visceral L. donovani infection likely represents expression of multiple suboptimal immune responses and/or partial defects, probably involving a combination of T-cell dysfunction, a Th2 cell response, and target cell (macrophage) hyporesponsiveness. PMID:8557335

  12. Expanded adipose-derived stem cells suppress mixed lymphocyte reaction by secretion of prostaglandin E2.

    PubMed

    Cui, Lei; Yin, Shuo; Liu, Wei; Li, Ningli; Zhang, Wenjie; Cao, Yilin

    2007-06-01

    Multipotent mesenchymal stem cells (MSCs) in adult tissue are known to be less immunogenic and immunosuppressive. Previous study showed that primary cultures of human adipose-derived stem cells (ADSCs) shared their immunomodulatory properties with other MSCs. However, whether passaged human ADSCs can retain their immunomodulatory effect after in vitro expansion remains unknown. In addition, the mechanism of ADSC-mediated immunomodulatory effect remains to be elucidated. This study aimed to investigate these issues by using passaged human ADSCs as an in vitro study model. Flow cytometry showed that passaged ADSCs expressed human leukocyte antigen (HLA) class I but not class II molecules, which could be induced to express to a high level with interferon-gamma (IFN-gamma) treatment. The study found that passaged ADSCs could not elicit lymphocyte proliferation after co-culturing with them, even after IFN-gamma treatment. In addition, either IFN-gamma-treated or non-treated ADSCs could inhibit phytohemagglutinin (PHA)-stimulated lymphocyte proliferation. Moreover, passaged ADSCs could serve as the third-party cells to inhibited two-way mixed lymphocyte reaction (MLR). Further study using a transwell system also showed that this type of immunosuppressive effect was not cell-cell contact dependent. In defining possible soluble factors, we found that passaged ADSCs significantly increased their secretion of prostaglandin E2 (PGE2), but not transforming growth factor-beta (TGF-beta) and hepatocyte growth factor (HGF), when they were co-cultured with MLR. Furthermore, the result demonstrated that only PGE2 production inhibitor indomethacine, but not TGF-beta- and HGF-neutralizing antibodies, could significantly counteract ADSC-mediated suppression on allogeneic lymphocyte proliferation. These results indicated that in vitro expanded ADSCs retain low immunogenicity and immunosuppressive effect, and PGE2 might be the major soluble factor involved in the in vitro inhibition of allogeneic lymphocyte reaction.

  13. Vaccination of metastatic colorectal cancer patients with matured dendritic cells loaded with multiple major histocompatibility complex class I peptides.

    PubMed

    Kavanagh, Brian; Ko, Andrew; Venook, Alan; Margolin, Kim; Zeh, Herbert; Lotze, Michael; Schillinger, Brian; Liu, Weihong; Lu, Ying; Mitsky, Peggie; Schilling, Marta; Bercovici, Nadege; Loudovaris, Maureen; Guillermo, Roy; Lee, Sun Min; Bender, James; Mills, Bonnie; Fong, Lawrence

    2007-10-01

    Developing a process to generate dendritic cells (DCs) applicable for multicenter trials would facilitate cancer vaccine development. Moreover, targeting multiple antigens with such a vaccine strategy could enhance the efficacy of such a treatment approach. We performed a phase 1/2 clinical trial administering a DC-based vaccine targeting multiple tumor-associated antigens to patients with advanced colorectal cancer (CRC). A qualified manufacturing process was used to generate DC from blood monocytes using granulocyte macrophage colony-stimulating factor and IL-13, and matured for 6 hours with Klebsiella-derived cell wall fraction and interferon-gamma (IFN-gamma). DCs were also loaded with 6 HLA-A*0201 binding peptides derived from carcinoembryonic antigen (CEA), MAGE, and HER2/neu, as well as keyhole limpet hemocyanin protein and pan-DR epitope peptide. Four planned doses of 35x10(6) cells were administered intradermally every 3 weeks. Immune response was assessed by IFN-gamma enzyme-linked immunosorbent spot (ELISPOT). Matured DC possessed an activated phenotype and could prime T cells in vitro. In the trial, 21 HLA-A2+ patients were apheresed, 13 were treated with the vaccine, and 11 patients were evaluable. No significant treatment-related toxicity was reported. T-cell responses to a CEA-derived peptide were detected by ELISPOT in 3 patients. T cells induced to CEA possessed high avidity T-cell receptors. ELISPOT after in vitro restimulation detected responses to multiple peptides in 2 patients. All patients showed progressive disease. This pilot study in advanced CRC patients demonstrates DC-generated granulocyte macrophage colony-stimulating factor and IL-13 matured with Klebsiella-derived cell wall fraction and IFN-gamma can induce immune responses to multiple tumor-associated antigens in patients with advanced CRC.

  14. Induction of a specific strong polyantigenic cellular immune response after short-term chemotherapy controls bacillary reactivation in murine and guinea pig experimental models of tuberculosis.

    PubMed

    Guirado, Evelyn; Gil, Olga; Cáceres, Neus; Singh, Mahavir; Vilaplana, Cristina; Cardona, Pere-Joan

    2008-08-01

    RUTI is a therapeutic vaccine that is generated from detoxified and liposomed Mycobacterium tuberculosis cell fragments that has demonstrated its efficacy in the control of bacillus reactivation after short-term chemotherapy. The aim of this study was to characterize the cellular immune response generated after the therapeutic administration of RUTI and to corroborate the lack of toxicity of the vaccine. Mouse and guinea pig experimental models were infected with a low-dose M. tuberculosis aerosol. RUTI-treated animals showed the lowest bacillary load in both experimental models. RUTI also decreased the percentage of pulmonary granulomatous infiltration in the mouse and guinea pig models. This was not the case after Mycobacterium bovis BCG treatment. Cellular immunity was studied through the characterization of the intracellular gamma interferon (IFN-gamma)-producing cells after the splenocytes' stimulation with M. tuberculosis-specific structural and growth-related antigens. Our data show that the difference between the therapeutic administration of BCG and RUTI resides mainly in the stronger activation of IFN-gamma(+) CD4(+) cells and CD8(+) cells against tuberculin purified protein derivative, ESAT-6, and Ag85B that RUTI generates. Both vaccines also triggered a specific immune response against the M. tuberculosis structural antigens Ag16kDa and Ag38kDa and a marked mRNA expression of IFN-gamma, tumor necrosis factor, interleukin-12, inducible nitric oxide synthase, and RANTES in the lung. The results show that RUTI's therapeutic effect is linked not only to the induction of a Th1 response but also to the stimulation of a quicker and stronger specific immunity against structural and growth-related antigens that reduces both the bacillary load and the pulmonary pathology.

  15. Comparison of human and rhesus macaque T-cell responses elicited by boosting with NYVAC encoding human immunodeficiency virus type 1 clade C immunogens.

    PubMed

    Mooij, Petra; Balla-Jhagjhoorsingh, Sunita S; Beenhakker, Niels; van Haaften, Patricia; Baak, Ilona; Nieuwenhuis, Ivonne G; Heidari, Shirin; Wolf, Hans; Frachette, Marie-Joelle; Bieler, Kurt; Sheppard, Neil; Harari, Alexandre; Bart, Pierre-Alexandre; Liljeström, Peter; Wagner, Ralf; Pantaleo, Giuseppe; Heeney, Jonathan L

    2009-06-01

    Rhesus macaques (Macaca mulatta) have played a valuable role in the development of human immunodeficiency virus (HIV) vaccine candidates prior to human clinical trials. However, changes and/or improvements in immunogen quality in the good manufacturing practice (GMP) process or changes in adjuvants, schedule, route, dose, or readouts have compromised the direct comparison of T-cell responses between species. Here we report a comparative study in which T-cell responses from humans and macaques to HIV type 1 antigens (Gag, Pol, Nef, and Env) were induced by the same vaccine batches prepared under GMP and administered according to the same schedules in the absence and presence of priming. Priming with DNA (humans and macaques) or alphavirus (macaques) and boosting with NYVAC induced robust and broad antigen-specific responses, with highly similar Env-specific gamma interferon (IFN-gamma) enzyme-linked immunospot assay responses in rhesus monkeys and human volunteers. Persistent cytokine responses of antigen-specific CD4(+) and CD8(+) T cells of the central memory as well as the effector memory phenotype, capable of simultaneously eliciting multiple cytokines (IFN-gamma, interleukin 2, and tumor necrosis factor alpha), were induced. Responses were highly similar in humans and primates, confirming earlier data indicating that priming is essential for inducing robust NYVAC-boosted IFN-gamma T-cell responses. While significant similarities were observed in Env-specific responses in both species, differences were also observed with respect to responses to other HIV antigens. Future studies with other vaccines using identical lots, immunization schedules, and readouts will establish a broader data set of species similarities and differences with which increased confidence in predicting human responses may be achieved.

  16. Induction of interferon-gamma and downstream pathways during establishment of fetal persistent infection with bovine viral diarrhea virus.

    PubMed

    Smirnova, Natalia P; Webb, Brett T; McGill, Jodi L; Schaut, Robert G; Bielefeldt-Ohmann, Helle; Van Campen, Hana; Sacco, Randy E; Hansen, Thomas R

    2014-04-01

    Development of transplacental infection depends on the ability of the virus to cross the placenta and replicate within the fetus while counteracting maternal and fetal immune responses. Unfortunately, little is known about this complex process. Non-cytopathic (ncp) strains of bovine viral diarrhea virus (BVDV), a pestivirus in the Flaviviridae family, cause persistent infection in early gestational fetuses (<150 days; persistently infected, PI), but are cleared by immunocompetent animals and late gestational fetuses (>150 days; transiently infected, TI). Evasion of innate immune response and development of immunotolerance to ncp BVDV have been suggested as possible mechanisms for the establishment of the persistent infection. Previously we have observed a robust temporal induction of interferon (IFN) type I (innate immune response) and upregulation of IFN stimulated genes (ISGs) in BVDV TI fetuses. Modest chronic upregulation of ISGs in PI fetuses and calves reflects a stimulated innate immune response during persistent BVDV infection. We hypothesized that establishing persistent fetal BVDV infection is also accompanied by the induction of IFN-gamma (IFN-γ). The aims of the present study were to determine IFN-γ concentration in blood and amniotic fluid from control, TI and PI fetuses during BVDV infection and analyze induction of the IFN-γ downstream pathways in fetal lymphoid tissues. Two experiments with in vivo BVDV infections were completed. In Experiment 1, pregnant heifers were infected with ncp BVDV type 2 on day 75 or 175 of gestation or kept naïve to generate PI, TI and control fetuses, respectively. Fetuses were collected by Cesarean section on day 190. In Experiment 2, fetuses were collected on days 82, 89, 97, 192 and 245 following infection of pregnant heifers on day 75 of gestation. The results were consistent with the hypothesis that ncp BVDV infection induces IFN-γ secretion during acute infection in both TI and PI fetuses and that lymphoid tissues such as spleen, liver and thymus, serve both as possible sources of IFN-γ and target organs for its effects. Notably, induction of IFN-γ coincides with a decrease in BVDV RNA concentrations in PI fetal blood and tissues. This is the first report indicating the possible presence of an adaptive immune response in persistent BVDV infections, which may be contributing to the observed reduction of viremia in PI fetuses. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. Natural killer cells mediate severe liver injury in a murine model of halothane hepatitis.

    PubMed

    Dugan, Christine M; Fullerton, Aaron M; Roth, Robert A; Ganey, Patricia E

    2011-04-01

    Severe halothane (HAL)-induced hepatotoxicity occurs in one in 6000-30,000 patients by an unknown mechanism. Female sex is a risk factor in humans and rodents. We tested the hypothesis that a sex difference in natural killer (NK) cell activity contributes to HAL-induced liver injury. HAL (15 mmol/kg, ip) treatment resulted in severe liver injury by 12 h in female, wild-type BALB/cJ mice, and the magnitude of liver injury varied with stage of the estrous cycle. Ovariectomized (OVX) mice developed only mild liver injury. Plasma interferon-gamma (IFN-γ) was elevated 10-fold in HAL-treated females compared with similarly treated male mice or with OVX female mice. IFN-γ knockout mice were resistant to severe HAL-induced liver injury. The deactivation of NK cells with anti-asialo GM1 treatment attenuated liver injury and the increase in plasma IFN-γ compared with immunoglobulin G-treated control mice. Mice with a mutated form of perforin, a protein involved in granule-mediated cytotoxicity, were protected from severe liver injury. Furthermore, HAL increased the activity of NK cells in vivo, as indicated by increased surface expression of CD69, an early activation marker. In response to HAL, NK cell receptor ligands on the surface of hepatocytes were expressed in a manner that can activate NK cells. These results confirm the sexual dimorphic hepatotoxic response to HAL in mice and suggest that IFN-γ and NK cells have essential roles in the development of severe HAL-induced hepatotoxicity.

  18. Genetic Variation near IRF8 is Associated with Serologic and Cytokine Profiles in Systemic Lupus Erythematosus and Multiple Sclerosis

    PubMed Central

    Chrabot, Beverly S.; Kariuki, Silvia N.; Zervou, Maria I.; Feng, Xuan; Arrington, Jasmine; Jolly, Meenakshi; Boumpas, Dimitrios T.; Reder, Anthony T.; Goulielmos, George N.; Niewold, Timothy B.

    2013-01-01

    Alleles of IRF8 are associated with susceptibility to both systemic lupus erythematosus (SLE) and multiple sclerosis (MS). While high type I interferon (IFN) is thought to be causal in SLE, type I IFN is used as a therapy in MS. We investigated whether IRF8 alleles were associated with type I IFN levels or serologic profiles in SLE and MS. Alleles which have been previously associated with SLE or MS were genotyped in SLE and MS patients. The MS-associated rs17445836G allele was associated with anti-dsDNA autoantibodies in SLE patients (meta-analysis OR=1.92). The same allele was associated with decreased serum IFN activity in SLE patients with anti-dsDNA antibodies, and with decreased type I IFN-induced gene expression in PBMC from anti-dsDNA negative SLE patients. In secondary progressive MS patients, rs17445836G was associated with decreased serum type I IFN. Rs17445836G was associated with increased IRF8 expression in SLE patient B cells. In summary, IRF8 rs17445836G is associated with human autoimmune disease characterized by low type I IFN levels, and this may have pharmacogenetic relevance as type I IFN is modulated in SLE and MS. The association with autoantibodies and increased IRF8 expression in B cells supports a role for rs17445836G in humoral tolerance. PMID:23965942

  19. Essential Cell-Autonomous Role for Interferon (IFN) Regulatory Factor 1 in IFN-γ-Mediated Inhibition of Norovirus Replication in Macrophages

    PubMed Central

    Maloney, Nicole S.; Thackray, Larissa B.; Goel, Gautam; Hwang, Seungmin; Duan, Erning; Vachharajani, Punit; Xavier, Ramnik

    2012-01-01

    Noroviruses (NVs) cause the majority of cases of epidemic nonbacterial gastroenteritis worldwide and contribute to endemic enteric disease. However, the molecular mechanisms responsible for immune control of their replication are not completely understood. Here we report that the transcription factor interferon regulatory factor 1 (IRF-1) is required for control of murine NV (MNV) replication and pathogenesis in vivo. This led us to studies documenting a cell-autonomous role for IRF-1 in gamma interferon (IFN-γ)-mediated inhibition of MNV replication in primary macrophages. This role of IRF-1 in the inhibition of MNV replication by IFN-γ is independent of IFN-αβ signaling. While the signal transducer and activator of transcription STAT-1 was also required for IFN-γ-mediated inhibition of MNV replication in vitro, class II transactivator (CIITA), interferon regulatory factor 3 (IRF-3), and interferon regulatory factor 7 (IRF-7) were not required. We therefore hypothesized that there must be a subset of IFN-stimulated genes (ISGs) regulated by IFN-γ in a manner dependent only on STAT-1 and IRF-1. Analysis of transcriptional profiles of macrophages lacking various transcription factors confirmed this hypothesis. These studies identify a key role for IRF-1 in IFN-γ-dependent control of norovirus infection in mice and macrophages. PMID:22973039

  20. Successful Application of the Gamma-Interferon Assay in a Bovine Tuberculosis Eradication Program: The French Bullfighting Herd Experience.

    PubMed

    Keck, Nicolas; Boschiroli, Maria-Laura; Smyej, Florence; Vogler, Valérie; Moyen, Jean-Louis; Desvaux, Stéphanie

    2018-01-01

    In the French Camargue region, where bovine tuberculosis had been enzootic for several years in bullfighting cattle herds, the gamma-interferon (IFN) assay was used since 2003 in parallel with the intradermal test in order to increase overall disease detection sensitivity in infected herds. This study presents the results of a field-evaluation of the assay during a 10-year period (2004-2014) of disease control and surveillance program and explores the particular pattern of IFN assay results in bullfight herds in comparison to cattle from other regions of France. The low sensitivity [59.2% (50.6; 67.3)] of IFN assay using the tuberculin stimulation could be related to the poor gamma-IFN production from bullfight cattle blood cells which is significantly lower than in animals of conventional breeds. The characteristics of the assay were progressively adapted to the epidemiological situation and the desired strategic applications. Data analysis with a receiver operating characteristic curve based on a simple S/P value algorithm allowed for the determination of a new cutoff adapted for a global screening, giving a high specificity of 99.9% results and a high accuracy of the assay. Having regularly risen to above 5% since 2005, with a peak around 10% in 2010, the annual incidence dropped to under 1% in 2014. The positive predictive value relative to the bacteriological confirmation evolved during the years, from 33% in 2009 to 12% during the last screening period, a normal trend in a context of decreasing prevalence. The estimated rate of false-positive reactions during screening campaigns was 0.67%, confirming the high specificity of the test, measured in bTB negative herds, in this epidemiological context. The proportion of false-positive reactions decreased with the age and was higher in males than in females. Although these results indicate that the IFN assay is accurate in the field, it also emphasizes great differences between interferon quantities produced by bullfight cattle blood samples compared to those of classical bovine breeds, which underlines the necessity to adapt the algorithms and combinations of the assay according to local epidemiological contexts.

  1. Aberrant T-cell function in vitro and impaired T-cell dependent antibody response in vivo in vitamin A-deficient rats.

    PubMed Central

    Wiedermann, U; Hanson, L A; Kahu, H; Dahlgren, U I

    1993-01-01

    We have previously reported that vitamin A deficiency resulted in a reduced IgA antibody response to cholera toxin (CT) after per-oral immunization. In the present investigation we have studied the in vivo and in vitro immune response in vitamin A-deficient rats to two parenterally applied antigens, beta-lactoglobulin (beta-LG) and picrylsulphonic acid (TNP)-Ficoll. The serum IgG and IgM antibody responses to the T-cell dependent antigen beta-LG were significantly lower in the vitamin A-deficient rats than in the pair-fed control rats. No such differences were seen with the IgG and IgM responses to the T-cell independent antigen TNP-Ficoll. However, the biliary IgA and the serum IgE antibodies against both antigens were decreased in the vitamin A-deficient rats. In vitro lymphocyte stimulation with concanavalin A (Con A) or beta-LG gave higher T-cell proliferation rates in the vitamin A-deficient than in the control rats. Interleukin-2 (IL-2) and interferon-gamma (IFN-gamma) levels in supernatants from Con A-stimulated mesenteric lymph node cells were also higher in the vitamin A-deficient rats, while IL-6 levels were decreased, which is consistent with an up-regulated Th1 activity. Proliferation studies on purified accessory cells and T cells from the deficient and the control rats, mixed in different combinations, showed that the T cells, but not the accessory cells, were disturbed in the vitamin A-deficient rats. Despite the increased T-cell activity in vitro the vitamin A-deficient rats had a lower delayed-type hypersensitivity (DTH) reaction than the pair-fed control rats. In conclusion, the increased IL-2 and IFN-gamma levels may reflect an up-regulation of Th1 cell function, while the decreased IgA, IgE and IL-6 levels indicate a suppression of Th2 cells. The disturbed T-lymphocyte function is manifested in vivo as a decreased DTH reaction and suppressed antibody production, the latter possibly due to a lack of B-cell switching and proliferation factors in vitamin A-deficient rats. PMID:8307607

  2. Effect of conjugated linoleic acid on proliferation and cytokine expression of bovine peripheral blood mononuclear cells and splenocytes ex vivo.

    PubMed

    Renner, Lydia; von Soosten, Dirk; Sipka, Anja; Döll, Susanne; Beineke, Andreas; Schuberth, Hans-Joachim; Dänicke, Sven

    2012-04-01

    Twenty-five primiparous Holstein cows were divided into five experimental groups (five animals per group) by different feeding (control fat preparation [CON] or conjugated linoleic acid [CLA] supplement) and slaughtering times. The daily consumption of CLA was 6.0 g of the trans-10, cis-12 CLA-isomer and 5.7 g cis-9, trans-11 CLA isomer. An initial group (IG) was slaughtered one day post partum (pp) and the remaining 20 animals after 42 and 105 days pp, respectively. Blood for peripheral blood mononuclear cells (PBMC) separation was taken seven days ante partum and immediately before slaughter. The spleen was removed during dissection for isolation of splenocytes and samples for histopathological examination. Cell viability and Concanavalin A-stimulated proliferation was analysed by MTT and Alamar Blue assay. Basal expression of cytokines (interleukin [IL]-4, IL-10, IL-12, tumour necrosis factor alpha [TNF-alpha] and interferon gamma [IFN-gamma]) was measured by quantitative real time polymerase chain reaction (qRT-PCR) in unstimulated PMBC and splenocytes. With PBMC, stimulation indices increased from 1 day pp to 105 days pp with no differences between CLA and CON groups. With splenocytes, the stimulation index of the CLA group was lower compared to CON group 105 days pp. Baseline expression of cytokines was not effected by CLA feeding comparing similar time points. Also, no differences occurred in the expression of IL-4 in PBMC and IL-10 as well as TNF-alpha in both cell populations, when comparing the feeding groups separately with IG. IL-4 was more frequently expressed in CLA group 42 days pp in splenocytes. IFN-gamma expression was increased 105 days pp in CLA group in splenocytes and PBMC. IL-12 was higher expressed 105 days (PBMC) or 42 days pp (splenocytes) when compared to IG. There was no effect of CLA feeding or slaughter time on histopathology of the spleen. In conclusion, the present results demonstrate an inhibiting effect of CLA on the mitogen-induced activation of splenocytes.

  3. Golgi targeting of human guanylate-binding protein-1 requires nucleotide binding, isoprenylation, and an IFN-gamma-inducible cofactor.

    PubMed

    Modiano, Nir; Lu, Yanping E; Cresswell, Peter

    2005-06-14

    Human guanylate-binding protein-1 (hGBP-1) is a large GTPase, similar in structure to the dynamins. Like many smaller GTPases of the Ras/Rab family, it is farnesylated, suggesting it may dock into membranes and perhaps play a role in intracellular trafficking. To date, however, hGBP-1 has never been associated with a specific intracellular compartment. Here we present evidence that hGBP-1 can associate with the Golgi apparatus. Redistribution from the cytosol to the Golgi was observed by immunofluorescence and subcellular fractionation after aluminum fluoride treatment, suggesting that it occurs when hGBP-1 is in its GTP-bound state. Relocalization was blocked by a farnesyl transferase inhibitor. The C589S mutant of hGBP-1, which cannot be farnesylated, and the previously uncharacterized R48P mutant, which cannot bind GTP, both failed to localize to the Golgi. These two mutants had a dominant-negative effect, preventing endogenous wild-type hGBP-1 from efficiently redistributing after aluminum fluoride treatment. Furthermore, hGBP-1 requires another IFN-gamma-induced factor to be targeted to the Golgi, because constitutively expressed hGBP-1 remained cytosolic in cells treated with aluminum fluoride unless the cells were preincubated with IFN-gamma. Finally, two nonhydrolyzing mutants of hGBP-1, corresponding to active mutants of Ras family proteins, failed to constitutively associate with the Golgi; we propose three possible explanations for this surprising result.

  4. Circadian variations of interferon-induced enhancement of human natural killer (NK) cell activity.

    PubMed

    Gatti, G; Cavallo, R; Sartori, M L; Carignola, R; Masera, R; Delponte, D; Salvadori, A; Angeli, A

    1988-01-01

    We searched for circadian changes in the enhancement of the NK activity after exposure to IFN-gamma of peripheral blood mononuclear (PBM) cells obtained serially throughout the 24-h cycle. In August-October 1986, blood was drawn from 7 healthy, diurnally active and nocturnally resting male volunteers (22-34 yr) at 4-h intervals for 24 h starting at 08:00. PBM cells were immediately separated and assayed for NK cell activity, using K 562 cultured cells as a target in a 4-h 51Cr release assay after prior incubation for 20 h with buffer or 300 IU rIFN-gamma. Circadian variations of the spontaneous NK cell cytotoxicity were apparent; the activity was at its maximum at the end of the night or in the early morning and then declined in the afternoon. The 24-h rhythmic pattern was validated with statistical significance by the Cosinor method (p less than 0.02; acrophase 04:22). Maximum enhancement by IFN-gamma was attained in the second part of the night or in the early morning, i.e. in phase with the peak of the spontaneous NK cell activity. A significant circadian rhythm of the percent increase above control levels was validated by the Cosinor method (p less than 0.01; acrophase 04:03). Our findings may be of relevance to a better understanding of the mechanisms of control of human NK activity and warrant consideration as an approach to improve the effectiveness of time-qualified immunotherapy.

  5. Gammadelta T lymphocytes from cystic fibrosis patients and healthy donors are high TNF-alpha and IFN-gamma-producers in response to Pseudomonas aeruginosa.

    PubMed

    Raga, Salvador; Julià, M Rosa; Crespí, Catalina; Figuerola, Joan; Martínez, Natalia; Milà, Joan; Matamoros, Núria

    2003-01-01

    Gammadelta T cells have an important immunoregulatory and effector function through cytokine release. They are involved in the responses to Gram-negative bacterium and in protection of lung epithelium integrity. On the other hand, they have been implicated in airway inflammation. The aim of the present work was to study intracytoplasmic IL-2, IL-4, IFN-gamma and TNF-alpha production by gammadelta and alphabeta T lymphocytes from cystic fibrosis patients and healthy donors in response to Pseudomonas aeruginosa (PA). Flow cytometric detection was performed after peripheral blood mononuclear cells (PBMC) culture with a cytosolic extract from PA and restimulation with phorbol ester plus ionomycine. Proliferative responses, activation markers and receptor usage of gammadelta T cells were also evaluated. The highest production of cytokine was of TNF-alpha and IFN-gamma, gammadelta being better producers than alphabeta. No differences were found between patients and controls. The Vgamma9delta2 subset of gammadelta T cells was preferentially expanded. CD25 and CD45RO expression by the alphabeta T subset and PBMC proliferative response to PA were defective in cystic fibrosis lymphocytes. Our results support the hypothesis that gammadelta T lymphocytes play an important role in the immune response to PA and in the chronic inflammatory lung reaction in cystic fibrosis patients. They do not confirm the involvement of a supressed Th1 cytokine response in the pathogenesis of this disease.

  6. Differential Type I Interferon Signaling Is a Master Regulator of Susceptibility to Postinfluenza Bacterial Superinfection

    PubMed Central

    Larson, Kyle; Morton, Rachelle V.; Prigge, Justin R.; Schmidt, Edward E.; Huber, Victor C.

    2016-01-01

    ABSTRACT Bacterial superinfections are a primary cause of death during influenza pandemics and epidemics. Type I interferon (IFN) signaling contributes to increased susceptibility of mice to bacterial superinfection around day 7 post-influenza A virus (IAV) infection. Here we demonstrate that the reduced susceptibility to methicillin-resistant Staphylococcus aureus (MRSA) at day 3 post-IAV infection, which we previously reported was due to interleukin-13 (IL-13)/IFN-γ responses, is also dependent on type I IFN signaling and its subsequent requirement for protective IL-13 production. We found, through utilization of blocking antibodies, that reduced susceptibility to MRSA at day 3 post-IAV infection was IFN-β dependent, whereas the increased susceptibility at day 7 was IFN-α dependent. IFN-β signaling early in IAV infection was required for MRSA clearance, whereas IFN-α signaling late in infection was not, though it did mediate increased susceptibility to MRSA at that time. Type I IFN receptor (IFNAR) signaling in CD11c+ and Ly6G+ cells was required for the observed reduced susceptibility at day 3 post-IAV infection. Depletion of Ly6G+ cells in mice in which IFNAR signaling was either blocked or deleted indicated that Ly6G+ cells were responsible for the IFNAR signaling-dependent susceptibility to MRSA superinfection at day 7 post-IAV infection. Thus, during IAV infection, the temporal differences in type I IFN signaling increased bactericidal activity of both CD11c+ and Ly6G+ cells at day 3 and reduced effector function of Ly6G+ cells at day 7. The temporal differential outcomes induced by IFN-β (day 3) and IFN-α (day 7) signaling through the same IFNAR resulted in differential susceptibility to MRSA at 3 and 7 days post-IAV infection. PMID:27143388

  7. Reproducibility of Interferon Gamma (IFN-γ) Release Assays. A Systematic Review

    PubMed Central

    Tagmouti, Saloua; Slater, Madeline; Benedetti, Andrea; Kik, Sandra V.; Banaei, Niaz; Cattamanchi, Adithya; Metcalfe, John; Dowdy, David; van Zyl Smit, Richard; Dendukuri, Nandini

    2014-01-01

    Rationale: Interferon gamma (IFN-γ) release assays for latent tuberculosis infection result in a larger-than-expected number of conversions and reversions in occupational screening programs, and reproducibility of test results is a concern. Objectives: Knowledge of the relative contribution and extent of the individual sources of variability (immunological, preanalytical, or analytical) could help optimize testing protocols. Methods: We performed a systematic review of studies published by October 2013 on all potential sources of variability of commercial IFN-γ release assays (QuantiFERON-TB Gold In-Tube and T-SPOT.TB). The included studies assessed test variability under identical conditions and under different conditions (the latter both overall and stratified by individual sources of variability). Linear mixed effects models were used to estimate within-subject SD. Measurements and Main Results: We identified a total of 26 articles, including 7 studies analyzing variability under the same conditions, 10 studies analyzing variability with repeat testing over time under different conditions, and 19 studies reporting individual sources of variability. Most data were on QuantiFERON (only three studies on T-SPOT.TB). A considerable number of conversions and reversions were seen around the manufacturer-recommended cut-point. The estimated range of variability of IFN-γ response in QuantiFERON under identical conditions was ±0.47 IU/ml (coefficient of variation, 13%) and ±0.26 IU/ml (30%) for individuals with an initial IFN-γ response in the borderline range (0.25–0.80 IU/ml). The estimated range of variability in noncontrolled settings was substantially larger (±1.4 IU/ml; 60%). Blood volume inoculated into QuantiFERON tubes and preanalytic delay were identified as key sources of variability. Conclusions: This systematic review shows substantial variability with repeat IFN-γ release assays testing even under identical conditions, suggesting that reversions and conversions around the existing cut-point should be interpreted with caution. PMID:25188809

  8. Perforin and Gamma Interferon Expression Are Required for CD4+ and CD8+ T-Cell-Dependent Protective Immunity against a Human Parasite, Trypanosoma cruzi, Elicited by Heterologous Plasmid DNA Prime-Recombinant Adenovirus 5 Boost Vaccination▿

    PubMed Central

    de Alencar, Bruna C. G.; Persechini, Pedro M.; Haolla, Filipe A.; de Oliveira, Gabriel; Silverio, Jaline C.; Lannes-Vieira, Joseli; Machado, Alexandre V.; Gazzinelli, Ricardo T.; Bruna-Romero, Oscar; Rodrigues, Mauricio M.

    2009-01-01

    A heterologous prime-boost strategy using plasmid DNA, followed by replication-defective recombinant adenovirus 5, is being proposed as a powerful way to elicit CD4+ and CD8+ T-cell-mediated protective immunity against intracellular pathogens. We confirmed this concept and furthered existing research by providing evidence that the heterologous prime-boost regimen using the gene encoding amastigote surface protein 2 elicited CD4+ and CD8+ T-cell-mediated protective immunity (reduction of acute parasitemia and prolonged survival) against experimental infection with Trypanosoma cruzi. Protective immunity correlated with the presence of in vivo antigen-specific cytotoxic activity prior to challenge. Based on this, our second goal was to determine the outcome of infection after heterologous prime-boost immunization of perforin-deficient mice. These mice were highly susceptible to infection. A detailed analysis of the cell-mediated immune responses in immunized perforin-deficient mice showed an impaired gamma interferon (IFN-γ) secretion by immune spleen cells upon restimulation in vitro with soluble recombinant antigen. In spite of a normal numeric expansion, specific CD8+ T cells presented several functional defects detected in vivo (cytotoxicity) and in vitro (simultaneous expression of CD107a/IFN-γ or IFN-γ/tumor necrosis factor alpha) paralleled by a decreased expression of CD44 and KLRG-1. Our final goal was to determine the importance of IFN-γ in the presence of highly cytotoxic T cells. Vaccinated IFN-γ-deficient mice developed highly cytotoxic cells but failed to develop any protective immunity. Our study thus demonstrated a role for perforin and IFN-γ in a number of T-cell-mediated effector functions and in the antiparasitic immunity generated by a heterologous plasmid DNA prime-adenovirus boost vaccination strategy. PMID:19651871

  9. Gamma Interferon Production Is Critical for Protective Immunity to Infection with Blood-Stage Plasmodium berghei XAT but Neither NO Production nor NK Cell Activation Is Critical

    PubMed Central

    Yoneto, Toshihiko; Yoshimoto, Takayuki; Wang, Chrong-Reen; Takahama, Yasuhiro; Tsuji, Moriya; Waki, Seiji; Nariuchi, Hideo

    1999-01-01

    We have examined the roles of gamma interferon (IFN-γ), nitric oxide (NO), and natural killer (NK) cells in the host resistance to infection with the blood-stage malarial parasite Plasmodium berghei XAT, an irradiation-induced attenuated variant of the lethal strain P. berghei NK65. Although the infection with P. berghei XAT enhanced NK cell lytic activity of splenocytes, depletion of NK1.1+ cells caused by the treatment of mice with anti-NK1.1 antibody affected neither parasitemia nor IFN-γ production by their splenocytes. The P. berghei XAT infection induced a large amount of NO production by splenocytes during the first peak of parasitemia, while P. berghei NK65 infection induced a small amount. Unexpectedly, however, mice deficient in inducible nitric oxide synthase (iNOS−/−) cleared P. berghei XAT after two peaks of parasitemia were observed, as occurred for wild-type control mice. Although the infected iNOS−/− mouse splenocytes did not produce a detectable level of NO, they produced an amount of IFN-γ comparable to that produced by wild-type control mouse splenocytes, and treatment of these mice with neutralizing anti-IFN-γ antibody led to the progression of parasitemia and fatal outcome. CD4−/− mice infected with P. berghei XAT could not clear the parasite, and all these mice died with apparently reduced IFN-γ production. Furthermore, treatment with carrageenan increased the susceptibility of mice to P. berghei XAT infection. These results suggest that neither NO production nor NK cell activation is critical for the resistance to P. berghei XAT infection and that IFN-γ plays an important role in the elimination of malarial parasites, possibly by the enhancement of phagocytic activity of macrophages. PMID:10225894

  10. Human immunodeficiency virus (HIV) type 1 Vpr induces differential regulation of T cell costimulatory molecules: Direct effect of Vpr on T cell activation and immune function

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Venkatachari, Narasimhan J.; Majumder, Biswanath; Ayyavoo, Velpandi

    2007-02-20

    Human immunodeficiency virus type 1 (HIV-1) viral proteins disrupt the normal host cellular immune pathways thus exploiting the cellular machinery for replication, survival and to escape host immune attack. Here we evaluated the direct effects of HIV-1 Vpr-mediated immune modulation of infected T cells. Vpr specifically downregulated the expression of CD28 and increased the expression of CTLA-4, whereas no significant difference in the expression of CD25 and HLA-DR was observed. Interferon gamma (IFN-{gamma}) production in T cells was evaluated as a measure of the downstream effector functions. Results indicate that Vpr significantly inhibited IFN-{gamma} production and this may, in part,more » due to Vpr's ability to inhibit the nuclear translocation of NF-{kappa}B, and its transcriptional regulation. Together these results support that HIV-1 Vpr selectively dysregulates the immune functions at multiple levels and exerts its inhibitory effects in the presence of other viral proteins.« less

  11. Natural Killer Cells and Helicobacter pylori Infection: Bacterial Antigens and Interleukin-12 Act Synergistically To Induce Gamma Interferon Production

    PubMed Central

    Yun, Cheol H.; Lundgren, Anna; Azem, Josef; Sjöling, Åsa; Holmgren, Jan; Svennerholm, Ann-Mari; Lundin, B. Samuel

    2005-01-01

    Helicobacter pylori is known to induce a local immune response, which is characterized by activation of lymphocytes and the production of IFN-γ in the stomach mucosa. Since not only T cells, but also natural killer (NK) cells, are potent producers of gamma interferon (IFN-γ), we investigated whether NK cells play a role in the immune response to H. pylori infection. Our results showed that NK cells were present in both the gastric and duodenal mucosae but that H. pylori infection did not affect the infiltration of NK cells into the gastrointestinal area. Furthermore, we could show that NK cells could be activated directly by H. pylori antigens, as H. pylori bacteria, as well as lysate from H. pylori, induced the secretion of IFN-γ by NK cells. NK cells were also activated without direct contact when separated from the bacteria by an epithelial cell layer, indicating that the activation of NK cells by H. pylori can also occur in vivo, in the infected stomach mucosa. Moreover, the production of IFN-γ by NK cells was greatly enhanced when a small amount of interleukin-12 (IL-12) was added, and this synergistic effect was associated with increased expression of the IL-12 receptor β2. It was further evident that bacterial lysate alone was sufficient to induce the activation of cytotoxicity-related molecules. In conclusion, we demonstrated that NK cells are present in the gastroduodenal mucosa of humans and that NK cells produce high levels of IFN-γ when stimulated with a combination of H. pylori antigen and IL-12. We propose that NK cells play an active role in the local immune response to H. pylori infection. PMID:15731046

  12. Antigen presentation under the influence of 'immune evasion' proteins and its modulation by interferon-gamma: implications for immunotherapy of cytomegalovirus infection with antiviral CD8 T cells.

    PubMed

    Fink, Annette; Lemmermann, Niels A W; Gillert-Marien, Dorothea; Thomas, Doris; Freitag, Kirsten; Böhm, Verena; Wilhelmi, Vanessa; Reifenberg, Kurt; Reddehase, Matthias J; Holtappels, Rafaela

    2012-11-01

    Cytomegalovirus (CMV) disease with multiple organ manifestations is the most feared viral complication limiting the success of hematopoietic cell transplantation as a therapy of hematopoietic malignancies. A timely endogenous reconstitution of CD8 T cells controls CMV infection, and adoptive transfer of antiviral CD8 T cells is a therapeutic option to prevent CMV disease by bridging the gap between an early CMV reactivation and delayed endogenous reconstitution of protective immunity. Preclinical research in murine models has provided 'proof of concept' for CD8 T-cell therapy of CMV disease. Protection by CD8 T cells appears to be in conflict with the finding that CMVs encode proteins that inhibit antigen presentation to CD8 T cells by interfering with the constitutive trafficking of peptide-loaded MHC class I molecules (pMHC-I complexes) to the cell surface. Here, we have systematically explored antigen presentation in the presence of the three currently noted immune evasion proteins of murine CMV in all possible combinations and its modulation by pre-treatment of cells with interferon-gamma (IFN-γ). The data reveal improvement in antigen processing by pre-treatment with IFN-γ can almost overrule the inhibitory function of immune evasion molecules in terms of pMHC-I expression levels capable of triggering most of the specific CD8 T cells, though the intensity of stimulation did not retrieve their full functional capacity. Notably, an in vivo conditioning of host tissue cells with IFN-γ in adoptive cell transfer recipients constitutively overexpressing IFN-γ (B6-SAP-IFN-γ mice) enhanced the antiviral efficiency of CD8 T cells in this transgenic cytoimmunotherapy model.

  13. Regulation of Production of Mucosal Antibody to Pneumococcal Protein Antigens by T-Cell-Derived Gamma Interferon and Interleukin-10 in Children

    PubMed Central

    Zhang, Qibo; Bernatoniene, Jolanta; Bagrade, Linda; Paton, James C.; Mitchell, Timothy J.; Hammerschmidt, Sven; Nunez, Desmond A.; Finn, Adam

    2006-01-01

    Nasopharyngeal tonsils (adenoids) are part of human nasopharynx-associated lymphoid tissue, which may play an important role in local defense against pneumococci. Recent studies with animals have suggested that several pneumococcal proteins, including CbpA and pneumolysin (Ply), may be vaccine candidates. Our recent data obtained with children suggest that antibodies to these proteins may protect against carriage. This study was performed to investigate the regulation of the T-cell-dependent antibody responses to CbpA and pneumolysin by cytokines in adenoidal immune cells from children. Adenoidal mononuclear cells (MNC) were cultured with pneumococcal concentrated culture supernatants (CCS) or recombinant proteins. Cytokine expression profiles in adenoidal MNC after antigen stimulation were analyzed by reverse transcription-PCR, protein array analysis, and an immunoassay, along with an antibody production analysis. The roles, interactions, and cellular sources of the main cytokines identified were evaluated further. Pneumococcal CCS induced production of CbpA- and Ply-specific antibodies in association with several chemokines and cytokines, including gamma interferon (IFN-γ) and interleukin-10 (IL-10) in MNC. The antibody production correlated well with the concentrations of these two cytokines. Addition of recombinant IFN-γ or IL-10 enhanced antibody production, and monoclonal antibodies to these two cytokines and T-cell depletion significantly reduced antibody production. Intracellular cytokine staining showed that T cells are a major source of IFN-γ and IL-10. Recombinant Ply and, to a lesser extent, recombinant CbpA induced significant production of IFN-γ and IL-10 in MNC. T-cell-derived IFN-γ and IL-10 may be key regulators of production of mucosal antibody to pneumococcal protein antigens in the nasopharynx and may play an important role in local protection against pneumococcal infection in children. PMID:16861661

  14. Interferon in resistance to bacterial and protozoan infections

    NASA Technical Reports Server (NTRS)

    Sonnenfeld, Gerald; Gould, Cheryl L.; Kierszenbaum, Felipe; Degee, Antonie L. W.; Mansfield, John M.

    1986-01-01

    The effects of genetic differences in mouse strains on the modulation of protozoan infections by interferon (IFN) were investigated. In one set of experiments, three different strains of mice were injected with T. cruzi, and their sera were assayed at five time intervals for IFN titer. A greater quantity of IFN was produced by mouse strains that were susceptible to T. cruzi infection than by the more resistant strain. In another set of experiments, spleen cell cultures from inbred strains of mice were challenged with an antigen made from T.b. rhodesiense. The cells from mice resistant to infection, produced greater amounts of IFN-gamma than did cells from the susceptible mice. In a third set of experiments, it was found that mice injected with T.b. rhodesiense before being infected with a diabetogenic virus (EMC-D) were resistant to the effects of the virus and did not produce virus-specific antibody.

  15. Association between level of interferon gamma and acid-fast bacillipositivity in pulmonary tuberculosis

    NASA Astrophysics Data System (ADS)

    Priwahyuningtyas, N. B.; Sinaga, B. Y. M.; Pandia, P.; Eyanoer, P. C.

    2018-03-01

    Tuberculosis is an infectious disease which caused by Mycobacterium tuberculosis (M. tuberculosis) that infected numerous organ especially the lung. A person’s immunity is very affecting for a person exposed to pulmonary tuberculosis. T-helper-1 cell (Th1) is very influential in the immune system especially in interfering intracellular bacterial infection. One of the cytokines known produced by Th1 cell is interferon gamma (IFN-γ) which is in eliminating M. tuberculosis. The study aims to identify the association between level of IFN-γ and AFB positivity in pulmonary tuberculosis patients in Medan. It is a case-control study. The subjects of the study were 60 new cases of pulmonary tuberculosis with AFB sputum smear- positive that never received ATT consisting 20 cases AFB (+1), 20 cases AFB (+2) and 20 cases AFB (+3).Samples were plasma collected from the venous blood of pulmonary tuberculosis patients. The plasma then underwent laboratory assay with ELISA techniques. Independent t-test was p<0.05 considered significant. Level of IFN-γ in TB AFB (+1) is higher than TB AFB (+2) and (+3), with thesignificant statistical result (p=0.001).

  16. Local Delivery of the Toll-Like Receptor 9 Ligand CpG Downregulates Host Immune and Inflammatory Responses, Ameliorating Established Leishmania (Viannia) panamensis Chronic Infection

    PubMed Central

    Fernández, Olga L.; Rodriguez-Pinto, Daniel; Castilho, Tiago M.; Corral Caridad, Maria J.; Goldsmith-Pestana, Karen; Saravia, Nancy Gore; McMahon-Pratt, Diane

    2017-01-01

    ABSTRACT Infection by Leishmania (Viannia) panamensis, the predominant etiologic agent for cutaneous leishmaniasis in Colombia, is characterized by a chronic mixed inflammatory response. Current treatment options are plagued by toxicity, lengthy treatment regimens, and growing evidence of drug resistance. Immunotherapy, modulating the immune system to mount a protective response, may provide an alternate therapeutic approach. We investigated the ability of the Toll-like receptor 9 (TLR9) ligand CpG to modulate established disease in the L. (V.) panamensis mouse model. Treatment of established infection with a high dose (50 μg) of CpG ameliorated disease and lowered parasite burden. Interestingly, immediately after treatment there was a significant increase in transforming growth factor β (TGF-β) and concomitantly an increase in T regulatory cell (Treg) function. Although a general reduction in cell-mediated immune cytokine and chemokine (gamma interferon [IFN-γ], interleukin 10 [IL-10], IL-13, IL-6, granulocyte-macrophage colony-stimulating factor [GM-CSF], IL-4, and MIP-1α) responses of the treated mice was observed, certain chemokines (RANTES, monocyte chemoattractant protein 1[MCP-1], and IP-10) were increased. Further, in peripheral blood mononuclear cells (PBMCs) from patients with cutaneous leishmaniasis, CpG treatment similarly exhibited a dose-response effect on the production of IFN-γ, IL-17, IL-10, and IL-13, with reductions observed at higher doses. To further understand the underlying mechanisms and cell populations driving the CpG mediated response, we examined the ex vivo dose effects mediated by the TLR9+ cell populations (dendritic cells, macrophages, and B cells) found to accumulate labeled CpG in vivo. Notably, B cells altered the production of IL-17, IL-13, and IFN-γ, supporting a role for B cells functioning as antigen-presenting cells (APCs) and/or regulatory cells during infection. Interestingly, B cells have been previously demonstrated as a primary type of APC in patients infected with L. (V.) panamensis and thus may be useful targets of immunotherapy. Collectively, our results show that CpG-induced immune regulation leads to a dampening of the host immune response and healing in the mouse model, and it may provide an alternate approach to treatment of cutaneous leishmaniasis caused by L. (V.) panamensis. PMID:28052994

  17. IFN-γ regulates human dental pulp stem cells behavior via NF-κB and MAPK signaling

    PubMed Central

    He, Xinyao; Jiang, Wenkai; Luo, Zhirong; Qu, Tiejun; Wang, Zhihua; Liu, Ningning; Zhang, Yaqing; Cooper, Paul R.; He, Wenxi

    2017-01-01

    During caries, dental pulp expresses a range of pro-inflammatory cytokines in response to the infectious challenge. Interferon gamma (IFN-γ) is a dimerized soluble cytokine, which is critical for immune responses. Previous study has demonstrated that IFN-γ at relative high concentration (100 ng/mL) treatment improved the impaired dentinogenic and immunosuppressive regulatory functions of disease-derived dental pulp stem cells (DPSCs). However, little is known about the regulatory effects of IFN-γ at relative low concentration on healthy DPSC behavior (including proliferation, migration, and multiple-potential differentiation). Here we demonstrate that IFN-γ at relatively low concentrations (0.5 ng/mL) promoted the proliferation and migration of DPSCs, but abrogated odonto/osteogenic differentiation. Additionally, we identified that NF-κB and MAPK signaling pathways are both involved in the process of IFN-γ-regulated odonto/osteogenic differentiation of DPSCs. DPSCs treated with IFN-γ and supplemented with pyrrolidine dithiocarbamate (PDTC, an NF-κB inhibitor) or SB203580 (a MAPK inhibitor) showed significantly improved potential for odonto/osteogenic differentiation of DPSCs both in vivo and in vitro. These data provide important insight into the regulatory effects of IFN-γ on the biological behavior of DPSCs and indicate a promising therapeutic strategy for dentin/pulp tissue engineering in future endodontic treatment. PMID:28098169

  18. Human Monocytes in the Presence of Interferons Alpha2a and Gamma Are Potent Killers of Serous Ovarian Cancer Cell Lines in Combination with Paclitaxel and Carboplatin

    PubMed Central

    Johnson, Chase L.; Zoon, Kathryn C.

    2015-01-01

    Interferons (IFNs) play an important role in immune surveillance of tumors; however, their efficacy in the treatment of malignancies has been limited. Monocytes are mononuclear phagocytes that are critical to the generation of an innate immune response to tumors. The authors and others have shown that treatment of tumor cell lines in vitro and in vivo with human monocytes primed with type I and type II IFNs results in killing. We now expand on this work, in an extended panel of ovarian cancer cell lines. In this study, we hypothesized that there would be variable sensitivity amongst cell lines to the killing properties of monocytes and IFNs. To this end, we explored the interactions of IFN primed monocytes in conjunction with the standard of therapy for ovarian cancer, taxane, and platinum-based chemotherapeutics. Using 6 ovarian cancer cell lines, we demonstrated that there is variation from cell line to cell line in the ability of IFN-α2a and IFN-γ primed monocytes to synergistically kill target tumor cells, and further, there is an additive killing effect when target cells are treated with both IFN primed monocytes and chemotherapy. PMID:25068849

  19. Type I IFN augments IL-27-dependent TRIM25 expression to inhibit HBV replication.

    PubMed

    Tan, Guangyun; Xiao, Qingfei; Song, Hongxiao; Ma, Feng; Xu, Fengchao; Peng, Di; Li, Na; Wang, Xiaosong; Niu, Junqi; Gao, Pujun; Qin, F Xiao-Feng; Cheng, Genhong

    2018-03-01

    Hepatitis B virus (HBV) can cause chronic hepatitis B, which may lead to cirrhosis and liver cancer. Type I interferon (IFN) is an approved drug for the treatment of chronic hepatitis B. However, the fundamental mechanisms of antiviral action by type I IFN and the downstream signaling pathway are unclear. TRIM25 is an IFN-stimulated gene (ISG) that has an important role in RIG-I ubiquitination and activation. Whether TRIM25 is induced in liver cells by type I IFN to mediate anti-HBV function remains unclear. Here we report that interleukin-27 (IL-27) has a critical role in IFN-induced TRIM25 upregulation. TRIM25 induction requires both STAT1 and STAT3. In TRIM25 knockout HepG2 cells, type I IFN production was consistently attenuated and HBV replication was increased, whereas overexpression of TRIM25 in HepG2 cells resulted in elevated IFN production and reduced HBV replication. More interestingly, we found that TRIM25 expression was downregulated in HBV patients and the addition of serum samples from HBV patients could inhibit TRIM25 expression in HepG2 cells, suggesting that HBV might have involved a mechanism to inhibit antiviral ISG expression and induce IFN resistance. Collectively, our results demonstrate that type I IFN -induced TRIM25 is an important factor in inhibiting HBV replication, and the IFN-IL-27-TRIM25 axis may represent a new target for treating HBV infection.

  20. Establishment and evaluation of a bead-based luminex assay allowing simultaneous quantification of equine IL-12 and IFN-γ.

    PubMed

    Duran, Maria Carolina; Willenbrock, Saskia; Müller, Jessika-M V; Nolte, Ingo; Feige, Karsten; Murua Escobar, Hugo

    2013-04-01

    Interleukin-12 (IL-12) and interferon gamma (IFN-γ) are key cytokines in immunemediated equine melanoma therapy. Currently, a method for accurate simultaneous quantification of these equine cytokines is lacking. Therefore, we sought to establish an assay that allows for accurate and simultaneous quantification of equine IL-12 (eIL-12) and IFN-γ (eIFN-γ). Several antibodies were evaluated for cross-reactivity to eIL-12 and eIFN-γ and were used to establish a bead-based Luminex assay, which was subsequently applied to quantify cytokine concentrations in biological samples. Cytokine detection ranged from 31.5-5,000 pg/ml and 15-10,000 pg/ml for eIL-12 and eIFN-γ, respectively. eIL-12 was detected in supernatants of stimulated peripheral blood mononuclear cells (PBMCs) and supernatants/cell lysates of eIL-12 expression plasmid-transfected cells. Low or undetectable cytokine concentrations were measured in negative controls. In equine serum samples, the mean measured eIL-12 concentration was 1,374 ± 8 pg/ml. The bead-based assay and ELISA for eIFN-γ used to measure eIFN-γ concentrations, showed similar concentrations. Results demonstrate, to our knowledge for the first time, that cross-reactive antibody pairs to eIL-12 and eIFN-γ and Luminex bead-based technology allow for accurate, simultaneous and multiplexed quantification of these key cytokines in biological samples.

  1. Annexin V Incorporated into Influenza Virus Particles Inhibits Gamma Interferon Signaling and Promotes Viral Replication

    PubMed Central

    Berri, Fatma; Haffar, Ghina; Lê, Vuong Ba; Sadewasser, Anne; Paki, Katharina; Lina, Bruno; Wolff, Thorsten

    2014-01-01

    ABSTRACT During the budding process, influenza A viruses (IAVs) incorporate multiple host cell membrane proteins. However, for most of them, their significance in viral morphogenesis and infectivity remains unknown. We demonstrate here that the expression of annexin V (A5) is upregulated at the cell surface upon IAV infection and that a substantial proportion of the protein is present in lipid rafts, the site of virus budding. Western blotting and immunogold analysis of highly purified IAV particles showed the presence of A5 in the virion. Significantly, gamma interferon (IFN-γ)-induced Stat phosphorylation and IFN-γ-induced 10-kDa protein (IP-10) production in macrophage-derived THP-1 cells was inhibited by purified IAV particles. Disruption of the IFN-γ signaling pathway was A5 dependent since downregulation of its expression or its blockage reversed the inhibition and resulted in decreased viral replication in vitro. The functional significance of these results was also observed in vivo. Thus, IAVs can subvert the IFN-γ antiviral immune response by incorporating A5 into their envelope during the budding process. IMPORTANCE Many enveloped viruses, including influenza A viruses, bud from the plasma membrane of their host cells and incorporate cellular surface proteins into viral particles. However, for the vast majority of these proteins, only the observation of their incorporation has been reported. We demonstrate here that the host protein annexin V is specifically incorporated into influenza virus particles during the budding process. Importantly, we showed that packaged annexin V counteracted the antiviral activity of gamma interferon in vitro and in vivo. Thus, these results showed that annexin V incorporated in the viral envelope of influenza viruses allow viral escape from immune surveillance. Understanding the role of host incorporated protein into virions may reveal how enveloped RNA viruses hijack the host cell machinery for their own purposes. PMID:25031344

  2. Albinterferon Alfa-2b was not inferior to pegylated interferon-α in a randomized trial of patients with chronic hepatitis C virus genotype 1.

    PubMed

    Zeuzem, Stefan; Sulkowski, Mark S; Lawitz, Eric J; Rustgi, Vinod K; Rodriguez-Torres, Maribel; Bacon, Bruce R; Grigorescu, Mircea; Tice, Alan D; Lurie, Yoav; Cianciara, Janusz; Muir, Andrew J; Cronin, Patrick W; Pulkstenis, Erik; Subramanian, G Mani; McHutchison, John G

    2010-10-01

    The current standard of care for patients with chronic hepatitis C virus (HCV) genotype 1 is once-weekly pegylated interferon-α (Peg-IFNα) plus daily ribavirin for 48 weeks. We evaluated the efficacy/safety of albinterferon alfa-2b (albIFN), a novel, long-acting, genetic fusion polypeptide of albumin and IFNα-2b. In the phase 3 ACHIEVE-1 trial, 1331 patients were assigned equally to 3 open-label, 48-week treatment groups: Peg-IFNα-2a 180 μg every week, or albIFN 900 or 1200 μg every 2 weeks administered subcutaneously, with weight-based oral ribavirin 1000-1200 mg/day. During the study, the data monitoring committee recommended dose modification for all patients receiving albIFN 1200 μg to 900 μg because of increased pulmonary adverse events (AEs) in the 1200-μg arms of both ACHIEVE studies. Main outcome measure was sustained virologic response (SVR; undetectable serum HCV RNA at week 72). Intention-to-treat SVR rates were 51.0% (225/441), 48.2% (213/442), and 47.3% (208/440) with Peg-IFNα-2a, and albIFN 900 and 1200 μg, respectively. The primary objective of showing noninferiority of albIFN 900 μg (P < .001) and 1200 μg (P = .003) vs Peg-IFNα-2a for SVR was achieved. Multivariate modeling indicated consistency of treatment effect across subgroups. Serious/severe AE rates were 23.1%, 24.0%, 28.2%; treatment discontinuation rates because of AEs were 4.1%, 10.4%, 10.0%; discontinuation rates because of respiratory AEs were 0%, 0.9%, 1.6%; with Peg-IFNα-2a, and albIFN 900 and 1200 μg, respectively. Hematologic abnormality rates were comparable across the Peg-IFNα-2a and albIFN 900-μg groups. albIFN 900 μg every 2 weeks showed comparable efficacy, with similar serious/severe AE rates, although with a higher discontinuation rate, vs Peg-IFNα-2a in patients with chronic HCV genotype 1. Copyright © 2010 AGA Institute. Published by Elsevier Inc. All rights reserved.

  3. Roles of CD4+ T Cells and Gamma Interferon in Protective Immunity against Babesia microti Infection in Mice

    PubMed Central

    Igarashi, Ikuo; Suzuki, Reiko; Waki, Seiji; Tagawa, Yoh-Ichi; Seng, Seyha; Tum, Sothyra; Omata, Yoshitaka; Saito, Atsushi; Nagasawa, Hideyuki; Iwakura, Yohichiro; Suzuki, Naoyoshi; Mikami, Takeshi; Toyoda, Yutaka

    1999-01-01

    Babesia microti produces a self-limiting infection in mice, and recovered mice are resistant to reinfection. In the present study, the role of T cells in protective immunity against challenge infection was examined. BALB/c mice which recovered from primary infection showed strong protective immunity against challenge infection. In contrast, nude mice which failed to control the primary infection and were cured with an antibabesial drug did not show protection against challenge infection. Treatment of immune mice with anti-CD4 monoclonal antibody (MAb) diminished the protective immunity against challenge infection, but treatment with anti-CD8 MAb had no effect on the protection. Transfer of CD4+ T-cell-depleted spleen cells resulted in higher parasitemia than transfer of CD8+ T-cell-depleted spleen cells. A high level of gamma interferon (IFN-γ), which was produced by CD4+ T cells, was observed for the culture supernatant of spleen cells from immune mice, and treatment of immune mice with anti-IFN-γ MAb partially reduced the protection. Moreover, no protection against challenge infection was found in IFN-γ-deficient mice. On the other hand, treatment of immune mice with MAbs against interleukin-2 (IL-2), IL-4, or tumor necrosis factor alpha did not affect protective immunity. These results suggest essential requirements for CD4+ T cells and IFN-γ in protective immunity against challenge infection with B. microti. PMID:10417185

  4. Topical interferon-gamma neutralization prevents conjunctival goblet cell loss in experimental murine dry eye.

    PubMed

    Zhang, Xiaobo; De Paiva, Cintia S; Su, Zhitao; Volpe, Eugene A; Li, De-Quan; Pflugfelder, Stephen C

    2014-01-01

    Evidence suggests that the cytokine interferon (IFN)-γ released by natural killer and CD4(+) T cells contributes to the conjunctival goblet cell (GC) loss in dry eye. The purpose of this study was to investigate if topical neutralization of IFN-γ prevents or alleviates GC loss in an experimental desiccating stress (DS) model of dry eye. In this study, we found that topical IFN-γ neutralization significantly decreased DS-induced conjunctival GC loss. This was accompanied by decreased epithelial apoptosis, and increased IL-13 and decreased FoxA2 expression in the forniceal conjunctiva. To establish that IFN-γ produced by pathogenic CD4(+) T cells contributes to DS-induced GC loss, adoptive transfer of CD4(+) T cells isolated from DS exposed donors to naïve RAG-1(-/-) recipient mice was performed. Similar to the donor mice, topical IFN-γ neutralization decreased conjunctival GC loss, suppressed apoptosis and increased IL-13 expression in adoptive transfer recipients. In summary, this study demonstrated that topical neutralization of IFN-γ prevents GC loss via modulating apoptosis and maintaining IL-13 signaling. Copyright © 2013 Elsevier Ltd. All rights reserved.

  5. Vitamin D accelerates clinical recovery from tuberculosis: results of the SUCCINCT Study [Supplementary Cholecalciferol in recovery from tuberculosis]. A randomized, placebo-controlled, clinical trial of vitamin D supplementation in patients with pulmonary tuberculosis'.

    PubMed

    Salahuddin, Nawal; Ali, Farheen; Hasan, Zahra; Rao, Nisar; Aqeel, Masooma; Mahmood, Faisal

    2013-01-19

    Vitamin D enhances host protective immune responses to Mycobacterium tuberculosis by suppressing Interferon-gamma (IFN-g) and reducing disease associated inflammation in the host. The objectives of this study were to determine whether vitamin D supplementation to patients with tuberculosis (TB) could influence recovery. Two hundred and fifty nine patients with pulmonary TB were randomized to receive either 600,000 IU of Intramuscular vitamin D3 or placebo for 2 doses. Assessments were performed at 4, 8 and 12 weeks. Early secreted and T cell activated 6 kDa (ESAT6) and Mycobacterium tuberculosis sonicate (MTBs) antigen induced whole blood stimulated IFN-g responses were measured at 0 and 12 weeks. Statistical comparisons between outcome variables at 0 and 12 weeks were performed using Student's t-test and Chi2 tests. After 12 weeks, the vitamin D supplemented arm demonstrated significantly greater mean weight gain (kg)+3.75, (3.16-4.34) versus+2.61 (95% CI 1.99-3.23) p 0.009 and lesser residual disease by chest radiograph; number of zones involved 1.35 v/s 1.82 p 0.004 (95% CI 0.15, 0.79) and 50% or greater reduction in cavity size 106 (89.8%) v/s 111 (94.8%), p 0.035. Vitamin D supplementation led to significant increase in MTBs-induced IFN-g secretion in patients with baseline 'Deficient' 25-hydroxyvitamin D serum levels (p 0.021). Supplementation with high doses of vitamin D accelerated clinical, radiographic improvement in all TB patients and increased host immune activation in patients with baseline 'Deficient' serum vitamin D levels. These results suggest a therapeutic role for vitamin D in the treatment of TB. ClinicalTrials.gov; No. NCT01130311; URL: clinicaltrials.gov.

  6. Cloning of a gene (RIG-G) associated with retinoic acid-induced differentiation of acute promyelocytic leukemia cells and representing a new member of a family of interferon-stimulated genes

    PubMed Central

    Yu, Man; Tong, Jian-Hua; Mao, Mao; Kan, Li-Xin; Liu, Meng-Min; Sun, Yi-Wu; Fu, Gang; Jing, Yong-Kui; Yu, Long; Lepaslier, Denis; Lanotte, Michel; Wang, Zhen-Yi; Chen, Zhu; Waxman, Samuel; Wang, Ya-Xin; Tan, Jia-Zhen; Chen, Sai-Juan

    1997-01-01

    In a cell line (NB4) derived from a patient with acute promyelocytic leukemia, all-trans-retinoic acid (ATRA) and interferon (IFN) induce the expression of a novel gene we call RIG-G (for retinoic acid-induced gene G). This gene codes for a 58-kDa protein containing 490 amino acids with several potential sites for post-translational modification. In untreated NB4 cells, the expression of RIG-G is undetectable. ATRA treatment induces the transcriptional expression of RIG-G relatively late (12–24 hr) in a protein synthesis-dependent manner, whereas IFN-α induces its expression early (30 min to 3 hr). Database search has revealed a high-level homology between RIG-G and several IFN-stimulated genes in human (ISG54K, ISG56K, and IFN-inducible and retinoic acid-inducible 58K gene) and some other species, defining a well conserved gene family. The gene is composed of two exons and has been mapped by fluorescence in situ hybridization to chromosome 10q24, where two other human IFN-stimulated gene members are localized. A synergistic induction of RIG-G expression in NB4 cells by combined treatment with ATRA and IFNs suggests that a collaboration exists between their respective signaling pathways. PMID:9207104

  7. Interferon gamma-dependent intestinal pathology contributes to the lethality in bacterial superantigen-induced toxic shock syndrome.

    PubMed

    Tilahun, Ashenafi Y; Holz, Marah; Wu, Tsung-Teh; David, Chella S; Rajagopalan, Govindarajan

    2011-02-03

    Toxic shock syndrome (TSS) caused by the superantigen exotoxins of Staphylococcus aureus and Streptococcus pyogenes is characterized by robust T cell activation, profound elevation in systemic levels of multiple cytokines, including interferon-γ (IFN-γ), followed by multiple organ dysfunction and often death. As IFN-γ possesses pro- as well as anti-inflammatory properties, we delineated its role in the pathogenesis of TSS. Antibody-mediated in vivo neutralization of IFN-γ or targeted disruption of IFN-γ gene conferred significant protection from lethal TSS in HLA-DR3 transgenic mice. Following systemic high dose SEB challenge, whereas the HLA-DR3.IFN-γ(+/+) mice became sick and succumbed to TSS, HLA-DR3.IFN-γ(-/-) mice appeared healthy and were significantly protected from SEB-induced lethality. SEB-induced systemic cytokine storm was significantly blunted in HLA-DR3.IFN-γ(-/-) transgenic mice. Serum concentrations of several cytokines (IL-4, IL-10, IL-12p40 and IL-17) and chemokines (KC, rantes, eotaxin and MCP-1) were significantly lower in HLA-DR3.IFN-γ(-/-) transgenic mice. However, SEB-induced T cell expansion in the spleens was unaffected and expansion of SEB-reactive TCR Vβ8(+) CD4(+) and CD8(+) T cells was even more pronounced in HLA-DR3.IFN-γ(-/-) transgenic mice when compared to HLA-DR3.IFN-γ(+/+) mice. A systematic histopathological examination of several vital organs revealed that both HLA-DR3.IFN-γ(+/+) and HLA-DR3.IFN-γ(-/-) transgenic mice displayed comparable severe inflammatory changes in lungs, and liver during TSS. Remarkably, whereas the small intestines from HLA-DR3.IFN-γ(+/+) transgenic mice displayed significant pathological changes during TSS, the architecture of small intestines in HLA-DR3.IFN-γ(-/-) transgenic mice was preserved. In concordance with these histopathological changes, the gut permeability to macromolecules was dramatically increased in HLA-DR3.IFN-γ(+/+) but not HLA-DR3.IFN-γ(-/-) mice during TSS. Overall, IFN-γ seemed to play a lethal role in the immunopathogenesis of TSS by inflicting fatal small bowel pathology. Our study thus identifies the important role for IFN-γ in TSS.

  8. Robust Protection against Highly Virulent Foot-and-Mouth Disease Virus in Swine by Combination Treatment with Recombinant Adenoviruses Expressing Porcine Alpha and Gamma Interferons and Multiple Small Interfering RNAs

    PubMed Central

    Park, Jong-Hyeon; Lee, Kwang-Nyeong; Kim, Se-Kyung; You, Su-Hwa; Kim, Taeseong; Tark, Dongseob; Lee, Hyang-Sim; Seo, Min-Goo; Kim, Byounghan

    2015-01-01

    ABSTRACT Because the currently available vaccines against foot-and-mouth disease (FMD) provide no protection until 4 to 7 days postvaccination, the only alternative method to halt the spread of the FMD virus (FMDV) during outbreaks is the application of antiviral agents. Combination treatment strategies have been used to enhance the efficacy of antiviral agents, and such strategies may be advantageous in overcoming viral mechanisms of resistance to antiviral treatments. We have developed recombinant adenoviruses (Ads) for the simultaneous expression of porcine alpha and gamma interferons (Ad-porcine IFN-αγ) as well as 3 small interfering RNAs (Ad-3siRNA) targeting FMDV mRNAs encoding nonstructural proteins. The antiviral effects of Ad-porcine IFN-αγ and Ad-3siRNA expression were tested in combination in porcine cells, suckling mice, and swine. We observed enhanced antiviral effects in porcine cells and mice as well as robust protection against the highly pathogenic strain O/Andong/SKR/2010 and increased expression of cytokines in swine following combination treatment. In addition, we showed that combination treatment was effective against all serotypes of FMDV. Therefore, we suggest that the combined treatment with Ad-porcine IFN-αγ and Ad-3siRNA may offer fast-acting antiviral protection and be used with a vaccine during the period that the vaccine does not provide protection against FMD. IMPORTANCE The use of current foot-and-mouth disease (FMD) vaccines to induce rapid protection provides limited effectiveness because the protection does not become effective until a minimum of 4 days after vaccination. Therefore, during outbreaks antiviral agents remain the only available treatment to confer rapid protection and reduce the spread of foot-and-mouth disease virus (FMDV) in livestock until vaccine-induced protective immunity can become effective. Interferons (IFNs) and small interfering RNAs (siRNAs) have been reported to be effective antiviral agents against FMDV, although the virus has associated mechanisms of resistance to type I interferons and siRNAs. We have developed recombinant adenoviruses for the simultaneous expression of porcine alpha and gamma interferons (Ad-porcine IFN-αγ) as well as 3 small interfering RNAs (Ad-3siRNA) to enhance the inhibitory effects of these antiviral agents observed in previous studies. Here, we show enhanced antiviral effects against FMDV by combination treatment with Ad-porcine IFN-αγ and Ad-3siRNA to overcome the mechanisms of resistance of FMDV in swine. PMID:26041279

  9. Effects of pidotimod soluble powder and immune enhancement of Newcastle disease vaccine in chickens.

    PubMed

    Qu, Shaoqi; Dai, Cunchun; Qiu, Mei; Zhang, Ruili; Wang, Chunyuan; Cui, Liangliang; Hao, Zhihui

    2017-07-01

    The aims of this study were to prepare pidotimod (PDM) soluble powder and to investigate the immune enhancement properties of PDM in chickens vaccinated with Newcastle disease virus vaccine. In vivo experiment, 360 6-day-old chickens were averagely divided into 6 groups. The chickens, except blank control (BC) group, were vaccinated with Newcastle disease vaccine (NDV). At the same time of the vaccination, the chickens in three PDM groups were given water with PDM for 5days, respectively, with the PDM at low, medium and high concentrations (0.25g/L, 0.5g/L, 1g/L), in control drug group was treated with 0.2ml/PDM dose via drinking water, in vaccination control (VC) and BC group, with equal volume physiological saline, once a day for five successive days. On days 14, 21 and 28 after the vaccination, the growth performance, the lymphocyte proliferation, serum antibody titer, the CD4/CD8 cell ratios and interleukin-2 (IL-2) and interferon-gamma (IFN-γ) were measured. The results showed that PDM at suitable dose could significantly promote growth performance, lymphocyte proliferation, enhance serum antibody titer, CD4/CD8 cell ratios and improve serum IL-2 and IFN-γ concentrations. It indicated that PDM could significantly improve the immune efficacy of Newcastle disease vaccine using doses of 0.5g/L, these results are consistent with the drug acting as an immunopotentiator. Copyright © 2017 European Federation of Immunological Societies. Published by Elsevier B.V. All rights reserved.

  10. Protective effects of nicergoline against neuronal cell death induced by activated microglia and astrocytes.

    PubMed

    Mizuno, Tetsuya; Kuno, Reiko; Nitta, Atsumi; Nabeshima, Toshitaka; Zhang, Guiqin; Kawanokuchi, Jun; Wang, Jinyan; Jin, Shijie; Takeuchi, Hideyuki; Suzumura, Akio

    2005-12-20

    We examined the neuroprotective role of nicergoline in neuron-microglia or neuron-astrocytes co-cultures. Nicergoline, an ergoline derivative, significantly suppressed the neuronal cell death induced by co-culture with activated microglia or astrocytes stimulated with lipopolysaccharide (LPS) and interferon (IFN)-gamma. To elucidate the mechanism by which nicergoline exerts a neuroprotective effect, we examined the production of inflammatory mediators and neurotrophic factors in activated microglia and astrocytes following nicergoline treatment. In microglia stimulated with LPS and IFN-gamma, nicergoline suppressed the production of superoxide anions, interleukin (IL)-1beta, IL-6, and tumor necrosis factor (TNF)-alpha in a dose-dependent manner. In astrocytes, nicergoline also suppressed the production of proinflammatory cytokines and enhanced brain-derived neurotrophic factor (BDNF). Thus, nicergoline-mediated neuroprotection resulted primarily from the inhibition of inflammatory mediators and the upregulation of neurotrophic factors by glial cells.

  11. Haploinsufficiency at the human IFNGR2 locus contributes to mycobacterial disease

    PubMed Central

    Kong, Xiao-Fei; Vogt, Guillaume; Itan, Yuval; Macura-Biegun, Anna; Szaflarska, Anna; Kowalczyk, Danuta; Chapgier, Ariane; Abhyankar, Avinash; Furthner, Dieter; Djambas Khayat, Claudia; Okada, Satoshi; Bryant, Vanessa L.; Bogunovic, Dusan; Kreins, Alexandra; Moncada-Vélez, Marcela; Migaud, Mélanie; Al-Ajaji, Sulaiman; Al-Muhsen, Saleh; Holland, Steven M.; Abel, Laurent; Picard, Capucine; Chaussabel, Damien; Bustamante, Jacinta; Casanova, Jean-Laurent; Boisson-Dupuis, Stéphanie

    2013-01-01

    Mendelian susceptibility to mycobacterial diseases (MSMD) is a rare syndrome, the known genetic etiologies of which impair the production of, or the response to interferon-gamma (IFN-γ). We report here a patient (P1) with MSMD whose cells display mildly impaired responses to IFN-γ, at levels, however, similar to those from MSMD patients with autosomal recessive (AR) partial IFN-γR2 or STAT1 deficiency. Whole-exome sequencing (WES) and Sanger sequencing revealed only one candidate variation for both MSMD-causing and IFN-γ-related genes. P1 carried a heterozygous frame-shift IFNGR2 mutation inherited from her father. We show that the mutant allele is intrinsically loss-of-function and not dominant-negative, suggesting haploinsufficiency at the IFNGR2 locus. We also show that Epstein-Barr virus transformed B lymphocyte cells from 10 heterozygous relatives of patients with AR complete IFN-γR2 deficiency respond poorly to IFN-γ, in some cases as poorly as the cells of P1. Naive CD4+ T cells and memory IL-4-producing T cells from these individuals also responded poorly to IFN-γ, whereas monocytes and monocyte-derived macrophages (MDMs) did not. This is consistent with the lower levels of expression of IFN-γR2 in lymphoid than in myeloid cells. Overall, MSMD in this patient is probably due to autosomal dominant (AD) IFN-γR2 deficiency, resulting from haploinsufficiency, at least in lymphoid cells. The clinical penetrance of AD IFN-γR2 deficiency is incomplete, possibly due, at least partly, to the variability of cellular responses to IFN-γ in these individuals. PMID:23161749

  12. Extracellular Vesicles from Neural Stem Cells Transfer IFN-γ via Ifngr1 to Activate Stat1 Signaling in Target Cells

    PubMed Central

    Cossetti, Chiara; Iraci, Nunzio; Mercer, Tim R.; Leonardi, Tommaso; Alpi, Emanuele; Drago, Denise; Alfaro-Cervello, Clara; Saini, Harpreet K.; Davis, Matthew P.; Schaeffer, Julia; Vega, Beatriz; Stefanini, Matilde; Zhao, CongJian; Muller, Werner; Garcia-Verdugo, Jose Manuel; Mathivanan, Suresh; Bachi, Angela; Enright, Anton J.; Mattick, John S.; Pluchino, Stefano

    2015-01-01

    SUMMARY The idea that stem cell therapies work only via cell replacement is challenged by the observation of consistent intercellular molecule exchange between the graft and the host. Here we defined a mechanism of cellular signaling by which neural stem/precursor cells (NPCs) communicate with the microenvironment via extracellular vesicles (EVs), and we elucidated its molecular signature and function. We observed cytokine-regulated pathways that sort proteins and mRNAs into EVs. We described induction of interferon gamma (IFN-γ) pathway in NPCs exposed to proinflammatory cytokines that is mirrored in EVs. We showed that IFN-γ bound to EVs through Ifngr1 activates Stat1 in target cells. Finally, we demonstrated that endogenous Stat1 and Ifngr1 in target cells are indispensable to sustain the activation of Stat1 signaling by EV-associated IFN-γ/Ifngr1 complexes. Our study identifies a mechanism of cellular signaling regulated by EV-associated IFN-γ/Ifngr1 complexes, which grafted stem cells may use to communicate with the host immune system. PMID:25242146

  13. Analysis of Doppler radar windshear data

    NASA Technical Reports Server (NTRS)

    Williams, F.; Mckinney, P.; Ozmen, F.

    1989-01-01

    The objective of this analysis is to process Lincoln Laboratory Doppler radar data obtained during FLOWS testing at Huntsville, Alabama, in the summer of 1986, to characterize windshear events. The processing includes plotting velocity and F-factor profiles, histogram analysis to summarize statistics, and correlation analysis to demonstrate any correlation between different data fields.

  14. Early Experience With CliniMACS Prodigy CCS (IFN-gamma) System in Selection of Virus-specific T Cells From Third-party Donors for Pediatric Patients With Severe Viral Infections After Hematopoietic Stem Cell Transplantation.

    PubMed

    Kállay, Krisztián; Kassa, Csaba; Réti, Marienn; Karászi, Éva; Sinkó, János; Goda, Vera; Stréhn, Anita; Csordás, Katalin; Horváth, Orsolya; Szederjesi, Attila; Tasnády, Szabolcs; Hardi, Apor; Kriván, Gergely

    2018-04-01

    Viral reactivation is a frequent complication of allogeneic hematopoietic stem cell transplantation especially in children. For refractory cases, rapid virus-specific T-cell therapy would be ideally implemented within a few days. Over the course of a year in our pediatric cohort of 43 allogeneic transplantation, 9 patients fulfilled criteria for virus-specific T-cell therapy. Viral infections were due to cytomegalovirus (CMV) in 3, Epstein-Barr virus (EBV) in 2, and adenovirus (AdV) in 1 case, whereas >1 virus was detected in 3 cases. Viral diseases necessitating a T-cell therapy were CMV pneumonitis and colitis, AdV enteritis and cystitis, and EBV-induced posttransplantation lymphoproliferative disease. Cells were produced by the CliniMACS Prodigy CCS (IFN-gamma) System within 24 hours after mononuclear leukapheresis. Eight patients became completely asymptomatic, whereas 7 also cleared the virus. Six patients are alive without viral illness or sequelae demonstrating viral DNA clearance in peripheral blood with a median follow-up of 535 (350-786) days. One patient with CMV pneumonitis died of respiratory insufficiency. In 2 cases the viral illness improved or cleared, however, the patients died of invasive aspergillosis. No cases of graft-versus-host disease, rejection, organ toxicity, or recurrent infection were noticed. Virus-specific T-cell therapy implemented by the CliniMACS Prodigy CCS (IFN-gamma) System is an automated, fast, safe, and probably effective way to control resistant viral diseases after pediatric hematopoietic stem cell transplantation.

  15. Cytokines in the regulation of allograft rejection.

    PubMed

    Huber, C; Irschick, E

    1988-01-01

    Stimulation of T lymphocytes with alloantigen leads to release of both IL-2 and IFN-gamma. IL-2 enhances clonal expansion of alloantigen-activated T cells. This permits it to overcome acquired allograft tolerance which, at the efferent limb of the cellular immune response, is caused by reduced clone size of donor-specific cytotoxic lymphocyte precursor cells. Cells exhibiting a low constitutive expression of class I MHC antigenes are refractory to lysis by cytotoxic T cells. This second type of tolerance located at the level of the allogeneic target cells can be easily broken by exogenous IFN-gamma, which increases the density of class I MHC antigens. There is suggestive evidence for enhanced endogenous production of lymphokines during rejection of cardiac allografts in mice and men. Rejection episodes are also associated with increased expression of class I and elevated frequency of class II MHC antigen-positive cells in the cardiac transplants. Whereas early immune recognition of histoincompatible grafts is primarily related to the presence of genetic barriers between donor and recipient, the further amplification of alloreactivity is driven by the release of antigen-unspecific lymphokines. Production of endogenous lymphokines can be modified by a variety of means: methylprednisone, ciclosporin and specific antibodies against lymphokines or their receptors represent effective inhibitors of this amplification mechanism which can finally lead to irreversible graft damage. It is well established in clinical experience that infectious complications subsequent to allografting may precipitate rejection or graft-vs.-host disease. Our finding of increased endogenous IFN-gamma levels during infections, in particular in those caused by cytomegalovirus, provides an explanation for this association.(ABSTRACT TRUNCATED AT 250 WORDS)

  16. Immunomodulatory properties of human periodontal ligament stem cells.

    PubMed

    Wada, Naohisa; Menicanin, Danijela; Shi, Songtao; Bartold, P Mark; Gronthos, Stan

    2009-06-01

    Tissue engineering utilizing periodontal ligament stem cells (PDLSCs) has recently been proposed for the development of new periodontal regenerative therapies. Although the use of autologous PDLSC transplantation eliminates the potential of a significant host immune response against the donor cells, it is often difficult to generate enough PDLSCs from one donor source due to the variation of stem cell potential between donors and disease state of each patient. In this study, we examined the immunomodulatory properties of PDLSCs as candidates for new allogeneic stem cell-based therapies. Human PDLSCs displayed cell surface marker characteristics and differentiation potential similar to bone marrow stromal stem cells (BMSSCs) and dental pulp stem cells (DPSCs). PDLSCs, BMSSCs, and DPSCs inhibited peripheral blood mononuclear cell (PBMNC) proliferation stimulated with mitogen or in an allogeneic mixed lymphocyte reaction (MLR). Interestingly, gingival fibroblasts (GFs) also suppressed allogeneic PBMNC proliferation under both assay conditions. PDLSCs, BMSSCs, DPSCs, and GFs exhibited non-cell contact dependent suppression of PBMNC proliferation in co-cultures using transwells. Furthermore, conditioned media (CM) derived from each cell type pretreated with IFN-gamma partially suppressed PBMNC proliferation when compared to CMs without IFN-gamma stimulation. In all of these mesenchymal cell types cultured with activated PBMNCs, the expression of TGF-beta1, hepatocyte growth factor (HGF) and indoleamine 2, 3-dioxygenase (IDO) was upregulated while IDO expression was upregulated following stimulation with IFN-gamma. These results suggest that PDLSCs, BMSSCs, DPSCs, and GFs possess immunosuppressive properties mediated, in part, by soluble factors, produced by activated PBMNCs. J. Cell. Physiol. 219: 667-676, 2009. (c) 2009 Wiley-Liss, Inc.

  17. Mesenteric lymph node T cells but not splenic T cells maintain their proliferative response to concanavalin-A following peroral infection with Toxoplasma gondii.

    PubMed

    Neyer, L E; Kang, H; Remington, J S; Suzuki, Y

    1998-12-01

    The suppression of T cell responsiveness which occurs after infection with Toxoplasma gondii in mice has been widely studied using spleen cells. Because the natural route of infection with T. gondii is the peroral route, we examined the proliferative responses of mesenteric lymph node (MLN) cells, in addition to spleen cells, to Concanavalin-A (Con-A) in mice perorally infected with T. gondii. Proliferative responses of spleen cells were significantly suppressed seven and ten days after infection when compared with spleen cells from uninfected mice (62% and 91% reduction, respectively). In contrast, proliferative responses of MLN cells from these infected mice did not differ from those of normal MLN cells. Since IFN-gamma-induced reactive nitrogen intermediate (RNI) production has been reported to play a major role in suppression of proliferative responses in spleen cells of infected mice, we compared production of IFN-gamma and RNI by spleen and MLN cells following infection. MLN cells produced as much IFN-gamma as did spleen cells, but produced 70% less nitrite (as a measure of RNI) after Con-A stimulation. Proliferative responses of MLN cells were suppressed when co-cultured with spleen cells from infected mice, and addition of an inhibitor of RNI to these co-culture inhibited this suppression, suggesting that reduced RNI production by MLN cells contributes to their maintenance of higher proliferative responses. These results demonstrated a clear difference in activity of T cells in the MLN and spleen during the acute stage of the infection.

  18. Age-related T cell responses to allergens in childhood.

    PubMed

    Smart, J M; Suphioglu, C; Kemp, A S

    2003-03-01

    T cell priming, as determined by allergen-induced proliferative responses, is believed to occur principally in early childhood in both atopic and non-atopic infants under the influence of multiple factors including environmental allergen exposure. It is considered that T cell priming with expansion of Th2 cells is a crucial factor in the development of atopic disease. To examine T cell priming to commonly encountered allergens in childhood in relation to age. In a cross-sectional study T cell proliferation in relation to age was examined for three common allergens, ovalbumin (OVA), house dust mite (HDM) and rye grass pollen (RYE), in atopic and non-atopic children. The effect of age on Th1 (IFN-gamma) and Th2 (IL-5 and IL-13) cytokine production in response to these allergens was investigated to examine the possibility of immune deviation with time. A significant increase in T cell proliferation with age was observed with RYE among atopic children only. However, the same was not observed with the two other allergens studied (i.e. OVA and HDM). In addition, RYE-induced (but not HDM or OVA) cytokine production showed an increased Th2 deviation with age as reflected in the increasing IL-5/IFN-gamma and IL-13/IFN-gamma ratios only among the atopic subjects with rye grass pollen sensitivity. These findings suggest that grass pollen sensitivity in childhood is accompanied by a progressive accumulation of allergen-primed T cells and progressive deviation of the allergen-induced cytokine response towards a Th2 response in atopic subjects throughout childhood.

  19. The Pseudorabies Virus Glycoprotein gE/gI Complex Suppresses Type I Interferon Production by Plasmacytoid Dendritic Cells

    PubMed Central

    Lamote, Jochen A. S.; Kestens, Manon; Van Waesberghe, Cliff; Delva, Jonas; De Pelsmaeker, Steffi; Devriendt, Bert

    2017-01-01

    ABSTRACT Plasmacytoid dendritic cells (pDC) play a central role in the antiviral immune response, both in the innate response and in shaping the adaptive response, mainly because of their ability to produce massive amounts of type I interferon (TI-IFN). Here, we report that cells infected with the live attenuated Bartha vaccine strain of porcine alphaherpesvirus pseudorabies virus (PRV) trigger a dramatically increased TI-IFN response by porcine primary pDC compared to cells infected with wild-type PRV strains (Becker and Kaplan). Since Bartha is one of the relatively few examples of a highly successful alphaherpesvirus vaccine, identification of factors that may contribute to its efficacy may provide insights for the rational design of other alphaherpesvirus vaccines. The Bartha vaccine genome displays several mutations compared to the genome of wild-type PRV strains, including a large deletion in the unique short (US) region, encompassing the glycoprotein E (gE), gI, US9, and US2 genes. Using recombinant PRV Becker strains harboring the entire Bartha US deletion or single mutations in the four affected US genes, we demonstrate that the absence of the viral gE/gI complex contributes to the observed increased IFN-α response. Furthermore, we show that the absence of gE leads to an enhanced extracellular signal-regulated kinase 1/2 (ERK1/2) phosphorylation in pDC, which correlates with a higher TI-IFN production by pDC. In conclusion, the PRV Bartha vaccine strain triggers strongly increased TI-IFN production by porcine pDC. Our data further indicate that the gE/gI glycoprotein complex suppresses TI-IFN production by pDC, which represents the first alphaherpesvirus factor that suppresses pDC activity. IMPORTANCE Several alphaherpesviruses, including herpes simpex virus, still lack effective vaccines. However, the highly successful Bartha vaccine has contributed substantially to eradication of the porcine alphaherpesvirus pseudorabies virus (PRV) in several countries. The impact of Bartha on the immune response is still poorly understood. Type I interferon (TI-IFN)-producing plasmacytoid dendritic cells (pDC) may play an important role in vaccine development. Here, we show that Bartha elicits a dramatically increased type I interferon (TI-IFN) response in primary porcine pDC compared to wild-type strains. In addition, we found that the gE/gI complex, which is absent in Bartha, inhibits the pDC TI-IFN response. This is the first description of an immune cell type that is differentially affected by Bartha versus wild-type PRV and is the first report describing an alphaherpesvirus protein that inhibits the TI-IFN response by pDC. These data may therefore contribute to the rational design of other alphaherpesvirus vaccines. PMID:28122975

  20. The Pseudorabies Virus Glycoprotein gE/gI Complex Suppresses Type I Interferon Production by Plasmacytoid Dendritic Cells.

    PubMed

    Lamote, Jochen A S; Kestens, Manon; Van Waesberghe, Cliff; Delva, Jonas; De Pelsmaeker, Steffi; Devriendt, Bert; Favoreel, Herman W

    2017-04-01

    Plasmacytoid dendritic cells (pDC) play a central role in the antiviral immune response, both in the innate response and in shaping the adaptive response, mainly because of their ability to produce massive amounts of type I interferon (TI-IFN). Here, we report that cells infected with the live attenuated Bartha vaccine strain of porcine alphaherpesvirus pseudorabies virus (PRV) trigger a dramatically increased TI-IFN response by porcine primary pDC compared to cells infected with wild-type PRV strains (Becker and Kaplan). Since Bartha is one of the relatively few examples of a highly successful alphaherpesvirus vaccine, identification of factors that may contribute to its efficacy may provide insights for the rational design of other alphaherpesvirus vaccines. The Bartha vaccine genome displays several mutations compared to the genome of wild-type PRV strains, including a large deletion in the unique short (US) region, encompassing the glycoprotein E (gE), gI, US9, and US2 genes. Using recombinant PRV Becker strains harboring the entire Bartha US deletion or single mutations in the four affected US genes, we demonstrate that the absence of the viral gE/gI complex contributes to the observed increased IFN-α response. Furthermore, we show that the absence of gE leads to an enhanced extracellular signal-regulated kinase 1/2 (ERK1/2) phosphorylation in pDC, which correlates with a higher TI-IFN production by pDC. In conclusion, the PRV Bartha vaccine strain triggers strongly increased TI-IFN production by porcine pDC. Our data further indicate that the gE/gI glycoprotein complex suppresses TI-IFN production by pDC, which represents the first alphaherpesvirus factor that suppresses pDC activity. IMPORTANCE Several alphaherpesviruses, including herpes simpex virus, still lack effective vaccines. However, the highly successful Bartha vaccine has contributed substantially to eradication of the porcine alphaherpesvirus pseudorabies virus (PRV) in several countries. The impact of Bartha on the immune response is still poorly understood. Type I interferon (TI-IFN)-producing plasmacytoid dendritic cells (pDC) may play an important role in vaccine development. Here, we show that Bartha elicits a dramatically increased type I interferon (TI-IFN) response in primary porcine pDC compared to wild-type strains. In addition, we found that the gE/gI complex, which is absent in Bartha, inhibits the pDC TI-IFN response. This is the first description of an immune cell type that is differentially affected by Bartha versus wild-type PRV and is the first report describing an alphaherpesvirus protein that inhibits the TI-IFN response by pDC. These data may therefore contribute to the rational design of other alphaherpesvirus vaccines. Copyright © 2017 American Society for Microbiology.

  1. Wild type measles virus attenuation independent of type I IFN.

    PubMed

    Druelle, Johan; Sellin, Caroline I; Waku-Kouomou, Diane; Horvat, Branka; Wild, Fabian T

    2008-02-03

    Measles virus attenuation has been historically performed by adaptation to cell culture. The current dogma is that attenuated virus strains induce more type I IFN and are more resistant to IFN-induced protection than wild type (wt). The adaptation of a measles virus isolate (G954-PBL) by 13 passages in Vero cells induced a strong attenuation of this strain in vivo. The adapted virus (G954-V13) differs from its parental strain by only 5 amino acids (4 in P/V/C and 1 in the M gene). While a vaccine strain, Edmonston Zagreb, could replicate equally well in various primate cells, both G954 strains exhibited restriction to the specific cell type used initially for their propagation. Surprisingly, we observed that both G954 strains induced type I IFN, the wt strain inducing even more than the attenuated ones, particularly in human plasmacytoid Dendritic Cells. Type I IFN-induced protection from the infection of both G954 strains depended on the cell type analyzed, being less efficient in the cells used to grow the viral strain. Thus, mutations in M and P/V/C proteins can critically affect MV pathogenicity, cellular tropism and lead to virus attenuation without interfering with the alpha/beta IFN system.

  2. Wild type measles virus attenuation independent of type I IFN

    PubMed Central

    Druelle, Johan; Sellin, Caroline I; Waku-Kouomou, Diane; Horvat, Branka; Wild, Fabian T

    2008-01-01

    Background Measles virus attenuation has been historically performed by adaptation to cell culture. The current dogma is that attenuated virus strains induce more type I IFN and are more resistant to IFN-induced protection than wild type (wt). Results The adaptation of a measles virus isolate (G954-PBL) by 13 passages in Vero cells induced a strong attenuation of this strain in vivo. The adapted virus (G954-V13) differs from its parental strain by only 5 amino acids (4 in P/V/C and 1 in the M gene). While a vaccine strain, Edmonston Zagreb, could replicate equally well in various primate cells, both G954 strains exhibited restriction to the specific cell type used initially for their propagation. Surprisingly, we observed that both G954 strains induced type I IFN, the wt strain inducing even more than the attenuated ones, particularly in human plasmacytoid Dendritic Cells. Type I IFN-induced protection from the infection of both G954 strains depended on the cell type analyzed, being less efficient in the cells used to grow the viral strain. Conclusion Thus, mutations in M and P/V/C proteins can critically affect MV pathogenicity, cellular tropism and lead to virus attenuation without interfering with the α/β IFN system. PMID:18241351

  3. Tumor cell-released TLR4 ligands stimulate Gr-1+CD11b+F4/80+ cells to induce apoptosis of activated T cells.

    PubMed

    Liu, Yan-Yan; Sun, Ling-Cong; Wei, Jing-Jing; Li, Dong; Yuan, Ye; Yan, Bin; Liang, Zhi-Hui; Zhu, Hui-Fen; Xu, Yong; Li, Bo; Song, Chuan-Wang; Liao, Sheng-Jun; Lei, Zhang; Zhang, Gui-Mei; Feng, Zuo-Hua

    2010-09-01

    Gr-1(+)CD11b(+)F4/80(+) cells play important roles in tumor development and have a negative effect on tumor immunotherapy. So far, the mechanisms underlying the regulation of their immunosuppressive phenotype by classical and alternative macrophage activation stimuli are not well elucidated. In this study, we found that molecules from necrotic tumor cells (NTC-Ms) stimulated Gr-1(+)CD11b(+)F4/80(+) cells to induce apoptosis of activated T cells but not nonstimulated T cells. The apoptosis-inducing capacity was determined by higher expression levels of arginase I and IL-10 relative to those of NO synthase 2 and IL-12 in Gr-1(+)CD11b(+)F4/80(+) cells, which were induced by NTC-Ms through TLR4 signaling. The apoptosis-inducing capacity of NTC-Ms-stimulated Gr-1(+)CD11b(+)F4/80(+) cells could be enhanced by IL-10. IFN-gamma may reduce the apoptosis-inducing capacity of Gr-1(+)CD11b(+)F4/80(+) cells only if their response to IFN-gamma was not attenuated. However, the potential of Gr-1(+)CD11b(+)F4/80(+) cells to express IL-12 in response to IFN-gamma could be attenuated by tumor, partially due to the existence of active STAT3 in Gr-1(+)CD11b(+)F4/80(+) cells and NTC-Ms from tumor. In this situation, IFN-gamma could not effectively reduce the apoptosis-inducing capacity of Gr-1(+)CD11b(+)F4/80(+) cells. Tumor immunotherapy with 4-1BBL/soluble programmed death-1 may significantly reduce, but not abolish the apoptosis-inducing capacity of Gr-1(+)CD11b(+)F4/80(+) cells in local microenvironment. Blockade of TLR4 signaling could further reduce the apoptosis-inducing capacity of Gr-1(+)CD11b(+)F4/80(+) cells and enhance the suppressive effect of 4-1BBL/soluble form of programmed death-1 on tumor growth. These findings indicate the relationship of distinct signaling pathways with apoptosis-inducing capacity of Gr-1(+)CD11b(+)F4/80(+) cells and emphasize the importance of blocking TLR4 signaling to prevent the induction of T cell apoptosis by Gr-1(+)CD11b(+)F4/80(+) cells.

  4. Gateways to clinical trials.

    PubMed

    Bayes, M; Rabasseda, X; Prous, J R

    2005-10-01

    Gateways to Clinical Trials is a guide to the most recent clinical trials in current literature and congresses. The data in the following tables have been retrieved from the Clinical Trials Knowledge Area of Prous Science Integrity, the drug discovery and development portal, http://integrity.prous.com. This issue focuses on the following selection of drugs: (-)-Epigallocatechin gallate, (Z)-4-hydroxytamoxifen; Ad.muIFN-beta AD-237, adalimumab, adefovir dipivoxil, agalsidase alfa, alemtuzumab, almotriptan, ALVAC vCP1452, alvimopan hydrate, ambrisentan, anakinra, anti-IFN-gamma MAb; Bimatoprost, BMS-188797, BMS-214662, bortezomib, bosentan, bovine lactoferrin; Caffeine, canertinib dihydrochloride, canfosfamide hydrochloride, cannabidiol, caspofungin acetate, cetuximab, cH36, ChimeriVax-JE, ciclesonide, cilansetron, cinacalcet hydrochloride, clopidogrel, CpG-7909, Cypher; Daptomycin, darbepoetin alfa, darifenacin hydrobromide, decitabine, denufosol tetrasodium, Dexamet, diindolemethane, drotrecogin alfa (activated), duloxetine hydrochloride, DX-9065a; E-7010, edaravone, efalizumab, eicosapentaenoic acid/docosahexaenoic acid, elacridar, eletriptan, emtricitabine, epratuzumab, erlotinib hydrochloride, ertapenem sodium, eszopiclone, everolimus, ezetimibe; Fludarabine, fondaparinux sodium; gamma-Hydroxybutyrate sodium, gavestinel sodium, gefitinib, granisetron-Biochronomer; Human Albumin, human insulin; Imatinib mesylate, indiplon, interleukin-2 XL, isatoribine, ISS-1018, i.v. gamma-globulin, ivabradine hydrochloride, ixabepilone; Lanthanum carbonate, L-arginine hydrochloride, liposomal doxorubicin, LY-450139; Magnesium sulfate, melatonin, motexafin gadolinium, mycophenolic acid sodium salt; Natalizumab, nesiritide, niacin/lovastatin; OGX-011, olmesartan medoxomil, omalizumab, ospemifene; PACAP38, panitumumab, parathyroid hormone (human recombinant), parecoxib sodium, patupilone, pegfilgrastim, peginterferon alfa-2a, peginterferon alfa-2b, peginterferon alfa-2b/ribavirin, pemetrexed disodium, pimecrolimus, pirfenidone, posaconazole, prasterone, pregabalin; R-112, ramelteon, ranolazine, rasagiline mesilate, rebimastat, roflumilast, rosuvastatin calcium, rotigotine hydrochloride, rupatadine fumarate; S-3013, S-3304, semustine, sitaxsentan sodium, St. John's Wort extract; Tadalafil, tamoxifen, Taxus, Tc-99m-EDDA-HYNIC-TOC, TH-9507, tiotropium bromide, tipifarnib, tocilizumab, tolvaptan, torcetrapib, TR-14035, tramadol hydrochloride/acetaminophen, treprostinil diethanolamine, troglitazone, troxacitabine; Valdecoxib, valganciclovir hydrochloride, vandetanib, vardenafil hydrochloride hydrate, VAS-991, veglin, vinflunine, voriconazole; White sweet potato extract; Ximelagatran. (c) 2005 Prous Science. All rights reserved.

  5. Vaccination with lentiviral vector expressing the nfa1 gene confers a protective immune response to mice infected with Naegleria fowleri.

    PubMed

    Kim, Jong-Hyun; Sohn, Hae-Jin; Lee, Jinyoung; Yang, Hee-Jong; Chwae, Yong-Joon; Kim, Kyongmin; Park, Sun; Shin, Ho-Joon

    2013-07-01

    Naegleria fowleri, a pathogenic free-living amoeba, causes fatal primary amoebic meningoencephalitis (PAM) in humans and animals. The nfa1 gene (360 bp), cloned from a cDNA library of N. fowleri, produces a 13.1-kDa recombinant protein which is located on pseudopodia, particularly the food cup structure. The nfa1 gene plays an important role in the pathogenesis of N. fowleri infection. To examine the effect of nfa1 DNA vaccination against N. fowleri infection, we constructed a lentiviral vector (pCDH) expressing the nfa1 gene. For the in vivo mouse study, BALB/c mice were intranasally vaccinated with viral particles of a viral vector expressing the nfa1 gene. To evaluate the effect of vaccination and immune responses of mice, we analyzed the IgG levels (IgG, IgG1, and IgG2a), cytokine induction (interleukin-4 [IL-4] and gamma interferon [IFN-γ]), and survival rates of mice that developed PAM. The levels of both IgG and IgG subclasses (IgG1 and IgG2a) in vaccinated mice were significantly increased. The cytokine analysis showed that vaccinated mice exhibited greater IL-4 and IFN-γ production than the other control groups, suggesting a Th1/Th2 mixed-type immune response. In vaccinated mice, high levels of Nfa1-specific IgG antibodies continued until 12 weeks postvaccination. The mice vaccinated with viral vector expressing the nfa1 gene also exhibited significantly higher survival rates (90%) after challenge with N. fowleri trophozoites. Finally, the nfa1 vaccination effectively induced protective immunity by humoral and cellular immune responses in N. fowleri-infected mice. These results suggest that DNA vaccination using a viral vector may be a potential tool against N. fowleri infection.

  6. Vaccination with Lentiviral Vector Expressing the nfa1 Gene Confers a Protective Immune Response to Mice Infected with Naegleria fowleri

    PubMed Central

    Kim, Jong-Hyun; Sohn, Hae-Jin; Lee, Jinyoung; Yang, Hee-Jong; Chwae, Yong-Joon; Kim, Kyongmin; Park, Sun

    2013-01-01

    Naegleria fowleri, a pathogenic free-living amoeba, causes fatal primary amoebic meningoencephalitis (PAM) in humans and animals. The nfa1 gene (360 bp), cloned from a cDNA library of N. fowleri, produces a 13.1-kDa recombinant protein which is located on pseudopodia, particularly the food cup structure. The nfa1 gene plays an important role in the pathogenesis of N. fowleri infection. To examine the effect of nfa1 DNA vaccination against N. fowleri infection, we constructed a lentiviral vector (pCDH) expressing the nfa1 gene. For the in vivo mouse study, BALB/c mice were intranasally vaccinated with viral particles of a viral vector expressing the nfa1 gene. To evaluate the effect of vaccination and immune responses of mice, we analyzed the IgG levels (IgG, IgG1, and IgG2a), cytokine induction (interleukin-4 [IL-4] and gamma interferon [IFN-γ]), and survival rates of mice that developed PAM. The levels of both IgG and IgG subclasses (IgG1 and IgG2a) in vaccinated mice were significantly increased. The cytokine analysis showed that vaccinated mice exhibited greater IL-4 and IFN-γ production than the other control groups, suggesting a Th1/Th2 mixed-type immune response. In vaccinated mice, high levels of Nfa1-specific IgG antibodies continued until 12 weeks postvaccination. The mice vaccinated with viral vector expressing the nfa1 gene also exhibited significantly higher survival rates (90%) after challenge with N. fowleri trophozoites. Finally, the nfa1 vaccination effectively induced protective immunity by humoral and cellular immune responses in N. fowleri-infected mice. These results suggest that DNA vaccination using a viral vector may be a potential tool against N. fowleri infection. PMID:23677321

  7. OK-432 synergizes with IFN-γ to confer dendritic cells with enhanced antitumor immunity.

    PubMed

    Pan, Ke; Lv, Lin; Zheng, Hai-xia; Zhao, Jing-jing; Pan, Qiu-zhong; Li, Jian-jun; Weng, De-sheng; Wang, Dan-dan; Jiang, Shan-shan; Chang, Alfred E; Li, Qiao; Xia, Jian-chuan

    2014-03-01

    Generation of functional dendritic cells (DCs) with boosted immunity after the withdrawal of initial activation/maturation conditions remains a significant challenge. In this study, we investigated the impact of a newly developed maturation cocktail consisting of OK-432 and interferon-gamma (IFN-γ) on the function of human monocyte-derived DCs (MoDCs). We found that OK-432 plus IFN-γ stimulation could induce significantly stronger expression of surface molecules, production of cytokines, as well as migration of DCs compared with OK-432 stimulation alone. Most importantly, DCs matured with OK-432 plus IFN-γ-induced maintained secretion of interleukin-12 (IL-12)p70 in secondary culture after stimulus withdrawal. Functionally, OK-432 plus IFN-γ-conditioned DCs induce remarkable Th1 and Tc1 responses more effectively than OK-432 alone, even more than the use of α-type-1 cytokine cocktail. As a result, DCs matured with OK-432 plus IFN-γ can prime stronger cytotoxic lymphocyte (CTL) and natural killer (NK) cell response against tumor cells in vitro. Peripheral blood mononuclear cells activated by DCs matured with OK-432 plus IFN-γ also showed greater tumor growth inhibition in vivo in null mice. Molecular mechanistic analysis showed that DC maturation using IFN-γ in concert with OK-432 involves the activation of p38 and nuclear factor-kappa B (NF-κB) pathways. This study provided a novel strategy to generate more potent immune segments in DC vaccine.

  8. Nipah Virus V Protein Evades Alpha and Gamma Interferons by Preventing STAT1 and STAT2 Activation and Nuclear Accumulation

    PubMed Central

    Rodriguez, Jason J.; Parisien, Jean-Patrick; Horvath, Curt M.

    2002-01-01

    Characterization of recent outbreaks of fatal encephalitis in southeast Asia identified the causative agent to be a previously unrecognized enveloped negative-strand RNA virus of the Paramyxoviridae family, Nipah virus. One feature linking Nipah virus to this family is a conserved cysteine-rich domain that is the hallmark of paramyxovirus V proteins. The V proteins of other paramyxovirus species have been linked with evasion of host cell interferon (IFN) signal transduction and subsequent antiviral responses by inducing proteasomal degradation of the IFN-responsive transcription factors, STAT1 or STAT2. Here we demonstrate that Nipah virus V protein escapes IFN by a distinct mechanism involving direct inhibition of STAT protein function. Nipah virus V protein differs from other paramyxovirus V proteins in its subcellular distribution but not in its ability to inhibit cellular IFN responses. Nipah virus V protein does not induce STAT degradation but instead inhibits IFN responses by forming high-molecular-weight complexes with both STAT1 and STAT2. We demonstrate that Nipah virus V protein accumulates in the cytoplasm by a Crm1-dependent mechanism, alters the STAT protein subcellular distribution in the steady state, and prevents IFN-stimulated STAT redistribution. Consistent with the formation of complexes, STAT protein tyrosine phosphorylation is inhibited in cells expressing the Nipah virus V protein. As a result, Nipah virus V protein efficiently prevents STAT1 and STAT2 nuclear translocation in response to IFN, inhibiting cellular responses to both IFN-α and IFN-γ. PMID:12388709

  9. Fluoxetine regulates cell growth inhibition of interferon-α.

    PubMed

    Lin, Yu-Min; Yu, Bu-Chin; Chiu, Wen-Tai; Sun, Hung-Yu; Chien, Yu-Chieh; Su, Hui-Chen; Yen, Shu-Yang; Lai, Hsin-Wen; Bai, Chyi-Huey; Young, Kung-Chia; Tsao, Chiung-Wen

    2016-10-01

    Fluoxetine, a well-known anti-depression agent, may act as a chemosensitizer to assist and promote cancer therapy. However, how fluoxetine regulates cellular signaling to enhance cellular responses against tumor cell growth remains unclear. In the present study, addition of fluoxetine promoted growth inhibition of interferon-alpha (IFN-α) in human bladder carcinoma cells but not in normal uroepithelial cells through lessening the IFN-α-induced apoptosis but switching to cause G1 arrest, and maintaining the IFN-α-mediated reduction in G2/M phase. Activations and signal transducer and transactivator (STAT)-1 and peroxisome proliferator-activated receptor alpha (PPAR-α) were involved in this process. Chemical inhibitions of STAT-1 or PPAR-α partially rescued bladder carcinoma cells from IFN-α-mediated growth inhibition via blockades of G1 arrest, cyclin D1 reduction, p53 downregulation and p27 upregulation in the presence of fluoxetine. However, the functions of both proteins were not involved in the control of fluoxetine over apoptosis and maintained the declined G2/M phase of IFN-α. These results indicated that activation of PPAR-α and STAT-1 participated, at least in part, in growth inhibition of IFN-α in the presence of fluoxetine.

  10. Stat1-Vitamin D Receptor Interactions Antagonize 1,25-Dihydroxyvitamin D Transcriptional Activity and Enhance Stat1-Mediated Transcription

    PubMed Central

    Vidal, Marcos; Ramana, Chilakamarti V.; Dusso, Adriana S.

    2002-01-01

    The cytokine gamma interferon (IFN-γ) and the calcitropic steroid hormone 1,25-dihydroxyvitamin D (1,25D) are activators of macrophage immune function. In sarcoidosis, tuberculosis, and several granulomatoses, IFN-γ induces 1,25D synthesis by macrophages and inhibits 1,25D induction of 24-hydroxylase, a key enzyme in 1,25D inactivation, causing high levels of 1,25D in serum and hypercalcemia. This study delineates IFN-γ-1,25D cross talk in human monocytes-macrophages. Nuclear accumulation of Stat1 and vitamin D receptor (VDR) by IFN-γ and 1,25D promotes protein-protein interactions between Stat1 and the DNA binding domain of the VDR. This prevents VDR-retinoid X receptor (RXR) binding to the vitamin D-responsive element, thus diverting the VDR from its normal genomic target on the 24-hydroxylase promoter and antagonizing 1,25D-VDR transactivation of this gene. In contrast, 1,25D enhances IFN-γ action. Stat1-VDR interactions, by preventing Stat1 deactivation by tyrosine dephosphorylation, cooperate with IFN-γ/Stat1-induced transcription. This novel 1,25D-IFN-γ cross talk explains the pathogenesis of abnormal 1,25D homeostasis in granulomatous processes and provides new insights into 1,25D immunomodulatory properties. PMID:11909970

  11. A cyclometalated iridium(III) complex used as a conductor for the electrochemical sensing of IFN-γ

    NASA Astrophysics Data System (ADS)

    Miao, Xiangmin; Ko, Chung-Nga; Vellaisamy, Kasipandi; Li, Zongbing; Yang, Guanjun; Leung, Chung-Hang; Ma, Dik-Lung

    2017-02-01

    A novel iridium(III) complex was prepared and used as a conductor for sensitive and enzyme-free electrochemical detection of interferon gamma (IFN-γ). This assay is based on a dual signal amplification mechanism involving positively charged gold nanoparticles ((+)AuNPs) and hybridization chain reaction (HCR). To construct the sensor, nafion (Nf) and (+)AuNPs composite membrane was first immobilized onto the electrode surface. Subsequently, a loop-stem structured capture probe (CP) containing a special IFN-γ interact strand was modified onto the (+)AuNP surface via the formation of Au-S bonds. Upon addition of IFN-γ, the loop-stem structure of CP was opened, and the newly exposed “sticky” region of CP then hybridized with DNA hairpin-1 (H1), which in turn opened its hairpin structure for hybridizing with DNA hairpin-2 (H2). Happen of HCR between H1 and H2 thus generated a polymeric duplex DNA (dsDNA) chain. Meanwhile, the iridium(III) complex could interact with the grooves of the dsDNA polymer, producing a strong current signal that was proportional to IFN-γ concentration. Thus, sensitive detection of IFN-γ could be realized with a detection limit down to 16.3 fM. Moreover, satisfied results were achieved by using this method for the detection of IFN-γ in human serum samples.

  12. Retinoic acid induces signal transducer and activator of transcription (STAT) 1, STAT2, and p48 expression in myeloid leukemia cells and enhances their responsiveness to interferons.

    PubMed

    Matikainen, S; Ronni, T; Lehtonen, A; Sareneva, T; Melén, K; Nordling, S; Levy, D E; Julkunen, I

    1997-06-01

    IFNs are antiproliferative cytokines that have growth-inhibitory effects on various normal and malignant cells. Therefore, they have been used in the treatment of certain forms of cancer, such as chronic myelogenous leukemia and hairy cell leukemia. However, there is little evidence that IFNs would be effective in the treatment of acute myelogenous leukemia, and molecular mechanisms underlying IFN unresponsiveness have not been clarified. Here we have studied the activation and induction of IFN-specific transcription factors signal transducer and activator of transcription (STAT) 1, STAT2, and p48 in all-trans-retinoic acid (ATRA)-differentiated myeloid leukemia cells using promyelocytic NB4, myeloblastic HL-60, and monoblastic U937 cells as model systems. These cells respond to ATRA by growth inhibition and differentiation. We show that in undifferentiated NB4 cells, 2',5'-oligoadenylate synthetase and MxB gene expression is not activated by IFN-alpha, possibly due to a relative lack of signaling molecules, especially p48 protein. However, during ATRA-induced differentiation, steady-state STAT1, STAT2, and especially p48 mRNA and corresponding protein levels were elevated both in NB4 and U937 cells, apparently correlating to an enhanced responsiveness of these cells to IFNs. ATRA treatment of NB4 cells sensitized them to IFN action as seen by increased IFN-gamma activation site DNA-binding activity or by efficient formation of IFN-alpha-specific ISGF3 complex and subsequent oligoadenylate synthetase and MxB gene expression. Lack of p48 expression could be one of the mechanisms of promyelocytic leukemia cell escape from growth-inhibitory effects of IFN-alpha.

  13. Prevalence of Bovine Tuberculosis in Egyptian Cattle and the Standardization of the Interferon-gamma Assay as an Ancillary Test.

    PubMed

    Abdellrazeq, G S; Elnaggar, M M; Osman, H S; Davis, W C; Singh, M

    2016-10-01

    Bovine tuberculosis (bTB) caused primarily by Mycobacterium bovis continues to cause significant losses in the cattle industry and is a major public health problem. Despite its worldwide application, the IFN-γ assay has not been applied in Egypt. The aim of this study was to determine the appropriate cut-off value of IFN-γ assay to complement the skin test screening in Egypt. The relative sensitivity (Ser ) of PPD and antigen cocktail-based IFN-γ assays (IFN-γ-BA and IFN-γ-EC) was analysed retrospectively, relative to bTB confirmatory tests (culture and PCR), using single cervical tuberculin (SCT) test reactors during 2011-2013. The absolute specificity (Sp) was studied using blood samples collected from cattle from one bTB-free herd. Analysis of the bTB database-generated sheets indicates the infection rate had decreased from 2009 to 2012 and then increased in 2013. The disease is concentrated in the Egyptian Nile Delta and Valley relative to elsewhere in the country. The cut-offs for IFN-γ-EC assay could be optimized to provide higher sensitivity, comparable to cut-offs for IFN-γ-BA assay. Data analysis suggests (PPDbOD  > 0.1, PPDbOD  - NILOD  > 0.05 and PPDbOD  > PPDaOD ) and (ECOD  - NILOD  ≥ 0.1) cut-off strategies to get optimal IFN-γ-BA and IFN-γ-EC assays results respectively. To our knowledge, this is the first report describing the prevalence of bTB in cattle in Egypt and pointing out the appropriate cut-off criteria to optimize IFN-γ assay as a routine ancillary test for diagnosis of bTB in Egypt. © 2014 Blackwell Verlag GmbH.

  14. Killing of Human Melanoma Cells Induced by Activation of Class I Interferon–Regulated Signaling Pathways via MDA-7/IL-24

    PubMed Central

    Ekmekcioglu, Suhendan; Mumm, John B.; Udtha, Malini; Chada, Sunil; Grimm, Elizabeth A.

    2008-01-01

    Restoration of the tumor-suppression function by gene transfer of the melanoma differentiation-associated gene 7 (MDA7)/interleukin 24 (IL-24) successfully induces apoptosis in melanoma tumors in vivo. To address the molecular mechanisms involved, we previously revealed that MDA7/IL-24 treatment of melanoma cells down-regulates interferon regulatory factor (IRF)-1 expression and concomitantly up-regulates IRF-2 expression, which competes with the activity of IRF-1 and reverses the induction of IRF-1–regulated inducible nitric oxide synthase (iNOS). Interferons (IFNs) influence melanoma cell survival by modulating apoptosis. A class I IFN (IFN alfa) has been approved for the treatment of advanced melanoma with some limited success. A class II IFN (IFN gamma), on the other hand, supports melanoma cell survival, possibly through constitutive activation of iNOS expression. We therefore conducted this study to explore the molecular pathways of MDA7/IL-24 regulation of apoptosis via the intracellular induction of IFNs in melanoma. We hypothesized that the restoration of the MDA7/IL-24 axis leads to upregulation of Class I IFNs and induction of the apoptotic cascade. We found that MDA7/IL-24 induces the secretion of endogenous IFN beta, another class I IFN, leading to the arrest of melanoma cell growth and apoptosis. We also identified a series of apoptotic markers that play a role in this pathway, including the regulation of tumor necrosis factor–related apoptosis-inducing ligand (TRAIL) and Fas-FasL. In summary, we described a novel pathway of MDA7/IL-24 regulation of apoptosis in melanoma tumors via endogenous IFN beta induction followed by IRF regulation and TRAIL/FasL system activation. PMID:18511292

  15. Histaminergic regulation of interferon-gamma (IFN-γ) production by human natural killer (NK) cells

    PubMed Central

    ASEA, A; HANSSON, M; CZERKINSKY, C; HOUZE, T; HERMODSSON, S; STRANNEGÅRD, Ö; HELLSTRAND, K

    1996-01-01

    Monocytes, recovered from human peripheral blood by counter-current centrifugal elutriation, effectively inhibit the production of IFN-γ by CD3−/56+ NK cells in response to IL-2. This study aimed at defining the nature of the inhibitory signal, particularly the importance of monocyte-derived reactive metabolites of oxygen. It was found that monocytes recovered from patients with chronic granulomatous disease (CGD), a condition characterized by deficient NADPH-oxidase activity of phagocytes, did not inhibit IFN-γ production by NK cells. Further, catalase, a scavenger of hydrogen peroxide, completely reversed the inhibitory signal, whereas scavengers of the superoxide anion, hypohalous acids, the hydroxyl radical, or nitric oxide synthesis inhibitors such as L-NMMA were ineffective. Inhibition of IFN-γ production was operating on a pre-translational level, as indicated by the inability of enriched NK cells to accumulate IFN-γ mRNA in the presence of elutriated monocytes. Hydrogen peroxide, at micromolar concentrations, reconstituted the inhibition of IFN-γ production when added to enriched NK cells. Histamine, a biogenic amine which inhibits the generation of reactive oxygen metabolites in monocytes, abrogated the inhibition of IFN-γ production in NK cells; by this mechanism, histamine strongly synergized with IL-2 to induce IFN-γ in mixtures of NK cells and monocytes. The synergizing effect of histamine was specifically mediated by H2-type histamine receptors. We conclude that: (i) the induction of IFN-γ mRNA in NK cells is effectively down-regulated by products of the oxidative metabolism of monocytes; and (ii) histamine effectively enhances IFN-γ production by preventing monocyte-induced oxidative damage to NK cells. PMID:8706348

  16. Interaction with extracellular matrix proteins influences Lsh/Ity/Bcg (candidate Nramp) gene regulation of macrophage priming/activation for tumour necrosis factor-alpha and nitrite release.

    PubMed

    Formica, S; Roach, T I; Blackwell, J M

    1994-05-01

    The murine resistance gene Lsh/Ity/Bcg regulates activation of macrophages for tumour necrosis factor-alpha (TNF-alpha)-dependent production of nitric oxide mediating antimicrobial activity against Leishmania, Salmonella and Mycobacterium. As Lsh is differentially expressed in macrophages from different tissue sites, experiments were performed to determine whether interaction with extracellular matrix (ECM) proteins would influence the macrophage TNF-alpha response. Plating of bone marrow-derived macrophages onto purified fibrinogen or fibronectin-rich L929 cell-derived matrices, but not onto mannan, was itself sufficient to stimulate TNF-alpha release, with significantly higher levels released from congenic B10.L-Lshr compared to C57BL/10ScSn (Lshs) macrophages. Only macrophages plated onto fibrinogen also released measurable levels of nitrites, again higher in Lshr compared to Lshs macrophages. Addition of interferon-gamma (IFN-gamma), but not bacterial lipopolysaccharide or mycobacterial lipoarabinomannan, as a second signal enhanced the TNF-alpha and nitrite responses of macrophages plated onto fibrinogen, particularly in the Lshr macrophages. Interaction with fibrinogen and fibronectin also primed macrophages for an enhanced TNF-alpha response to leishmanial parasites, but this was only translated into enhanced nitrite responses in the presence of IFN-gamma. In these experiments, Lshr macrophages remained superior in their TNF-alpha responses throughout, but to a degree which reflected the magnitude of the difference observed on ECM alone. Hence, the specificity for the enhanced TNF-alpha responses of Lshr macrophages lay in their interaction with fibrinogen and fibronectin ECM, while a differential nitrite response was only observed with fibrinogen and/or IFN-gamma. The results are discussed in relation to the possible function of the recently cloned candidate gene Nramp, which has structural identity to eukaryote transporters and an N-terminal cytoplasmic proline/serine-rich putative SH3 binding domain.

  17. Changes in barrier function of a model intestinal epithelium by intraepithelial lymphocytes require new protein synthesis by epithelial cells.

    PubMed Central

    Taylor, C T; Murphy, A; Kelleher, D; Baird, A W

    1997-01-01

    BACKGROUND: Elements of the mucosal immune system may play an important part in regulating epithelial barrier function in the intestinal tract. Intraepithelial lymphocytes (IELs) represent a subtype of immunocyte which is strategically placed to regulate epithelial function at most mucosal sites. AIMS AND METHODS: An IEL derived cell line (SC1) was used to examine its effects on the model epithelium T84--a tumour derived cell line which retains the phenotype of colonic crypt cells. Transepithelial electrical resistance (TER) was used as a marker of epithelial integrity. RESULTS: Coculture of T84 cells with SC1 produced a significant fall in TER as did exposure of T84 monolayers to IEL derived supernatant. Recombinant interferon-gamma (rIFN gamma) also reduced TER in T84 monolayers. Cycloheximide prevented the effects of IEL supernatant and of rIFN gamma on TER. The fall in TER in response to rIFN gamma was attenuated by blocking antibodies, which did not alter the fall in resistance induced by IEL supernatant. Fractions of IEL supernatant, separated on the basis of size, evoked temporally distinct changes in TER. Ultrastructural studies support the hypothesis that the slow onset but severe fall in TER indicates catastrophic effects on the monolayer. The more rapid onset fall in TER was not associated with gross changes in monolayer morphology. Reduction of TER by IEL supernatant was not influenced by inhibitors of tyrosine phosphatase or of protein kinase C. Although herbimycin did reduce the rapid onset change in TER, the tyrosine kinase inhibitor genistein did not alter responses to IEL supernatant. CONCLUSIONS: Mucosal T cells may influence barrier function by a process involving new protein synthesis by epithelial cells. This model may have relevance in some inflammatory conditions of the gastrointestinal tract. Images PMID:9203943

  18. Diverse manifestations of tumorigenicity and immunogenicity displayed by the poorly immunogenic B16-BL6 melanoma transduced with cytokine genes.

    PubMed

    Arca, M J; Krauss, J C; Strome, S E; Cameron, M J; Chang, A E

    1996-05-01

    We evaluated the in vivo response to the poorly immunogenic B16-BL6 (BL6) murine melanoma genetically altered to secrete interleukin-2 (IL-2), IL-4, interferon gamma (IFN gamma) and granulocyte/macrophage-colony-stimulating factor (GM-CSF). Three parameters were evaluated: (1) tumorigenicity, (2) vaccination of naive animals, and (3) assessment of antitumor reactivity of T cells derived from tumor-draining lymph nodes (TDLN). Secretion of IL-2 abrogated the tumorigenicity of BL6, while IFN gamma and IL-4 partially reduced tumorigenicity, and GM-CSF had no effect. Protective immunity to wild-type tumor challenge could not be achieved by vaccination with irradiated cytokine-secreting tumors, although IL-2 and IL-4 secretion appeared to retard the growth of the challenge inoculum significantly. An alternative method to evaluate the immunogenicity of the cytokine-secreting tumors was to measure the ability of T cells obtained from TDLN to mediate regression of wild-type tumor in adoptive immunotherapy. Neither IL-2 nor IFN gamma secretion resulted in the induction of immune T cells. By contrast, GM-CSF and IL-4 secretion were found to induce immune T cells in the TDLN with GM-CSF being superior to IL-4. The combined secretion of GM-CSF and IL-4 did not lead to enhanced induction of immune T cells. GM-CSF secretion was found to upregulate B7-1 expression in TDLN, consistent with an increase in the population of antigen-presenting cells. These studies demonstrated that reduced tumorigenicity by cytokine secretion did not correlate with increased immunogenicity. With the cytokines examined, there was limited capability of developing protective immunity against the BL6 tumor. Nevertheless, GM-CSF and IL-4 secretion significantly enhanced T cell immune reactivity to the poorly immunogenic BL6 tumor.

  19. The interaction between Helicobacter pylori and atopy: does inverse association really exist?

    PubMed

    Cam, Sebahat; Ertem, Deniz; Bahceciler, Nerin; Akkoc, Tunc; Barlan, Isil; Pehlivanoglu, Ender

    2009-02-01

    To date, cross-sectional and case-control studies suggest an inverse association between Helicobacter pylori infection and atopic diseases, whereas the immunologic basis has not been studied yet. In this study we investigated T helper (Th) cell function in H. pylori-infected children and compared cytokine responses in atopic and non-atopic groups. The study groups was recruited from a cohort of 327 healthy children evaluated and followed-up for 6 years to assess the natural history of H. pylori infection. Seventy-four of 136 healthy children who underwent (13)C urea breath test were eligible and accepted to participate. All participants were evaluated by a questionnaire, and skin-prick testing. According to the results, children were divided into four groups with respect to the presence or absence of H. pylori and atopy. Peripheral blood mononuclear cells isolated from 34 of 74 children were cultured with H. pylori, Der p 1, and phytohemagglutinin (PHA). Interferon-gamma (IFN-gamma), interleukin (IL)-4 and IL-10, transforming growth factor-beta (TGF-beta) levels were measured in supernatants. The frequency of atopy was lower in H. pylori-infected group (31.9% vs. 48.1, p = .22), while atopic symptoms were similar between infected and non-infected children. While PHA and H. pylori induced IFN-gamma levels were significantly higher in H. pylori-infected children, concomitant presence of both atopy and H. pylori decreased the level of PHA and H. pylori induced IFN-gamma production. PHA and Der p 1-induced IL-4 levels were higher in atopic children, and IL-4 production was suppressed when they were concomitantly infected with H. pylori. The production of TGF-beta was found to be suppressed in atopic children irrespective of the presence of H. pylori infection. The results of the current study demonstrated a counteractive Th1 and Th2 cytokine interaction between H. pylori infection and atopy. However, this counteractive immunologic balance did not protect against atopy.

  20. Effect of dim and bright light exposure on some immunological parameters measured under thermal neutral conditions.

    PubMed

    Hyun, Ki-Ja; Kondo, Masayuki; Koh, Taichin; Tokura, Hiromi; Tamotsu, Satoshi; Oishi, Tadashi

    2005-01-01

    This study assesses the effects of ambient light conditions, under a thermoneutral environment, on selected immunological parameters of 7 healthy young women (aged 19 to 22 yrs). Subjects entered the bioclimatic chamber at 11: 00 h, controlled at 26 degrees C and 60% relative humidity, a "neutral climate". They lead a well-regulated life in the climatic chamber (pre-condition) while exposed to dim (200 lux) or, on the next day, bright (5000 lux) light between 06 : 00 to 12 : 00 h. Just before the end of each period of light exposure, a blood sample was taken for later immunological assay of white blood cell count (WBC), phagocytosis, interferon-gamma (IFN-gamma), interleukin-4 (IL-4), CD69 T cells (CD69), CD4+CD25+ T cells (CD4+CD25+), and transforming growth factor-beta 1 (TGF-beta1). The results, when compared with the pre-condition, were as follows: 1) CD69 and IFN-gamma increased during normal conditions without thermal stress under dim light; 2) WBC increased and IL-4 decreased under bright light; 3) as shown by the highly significant decrease of TGF-beta1, the immune system was activated under bright light; 4) phagocytosis tended to increase under bright light exposure; 5) CD69 and IFN-gamma were significantly higher, and CD4+CD25+ tended to decrease under bright light; 6) phagocytosis tended to be lower and TGF-beta1 significantly higher under dim light, indicating a decline of immune system function. Taken together, this preliminary single time-point sampling study infers that some parameters are activated (CD69) while others are attenuated (phagocytosis, TGF-beta1) according to the environmental light intensity, dim vs. bright, in women adhering to a standardized routine in the absence of thermal stress. These findings are discussed in terms of inhibition of the sympathetic and excitation of the parasympathetic nervous system under the influence of life-style regularity and daytime bright light exposure.

Top