Interferon-Gamma Promotes UV-Induced Melanoma in Mice | Center for Cancer Research

Cancer.gov

Scientists have made an unanticipated discovery in mice that interferon-gamma, a type of protein primarily used by the immune system for intercellular communication, acts as a promoter for the deadly form of skin cancer known as melanoma. This finding resulted from a series of experiments designed to understand how solar ultraviolet (UV) radiation causes melanoma. This study suggests that interferon-gamma, which has been thought to contribute to an innate defense system against cancer, under some circumstances, may instead promote melanoma and incite the development of tumors.

Effect of gamma interferon on resolution of murine chlamydial genital infection.

PubMed Central

Rank, R G; Ramsey, K H; Pack, E A; Williams, D M

1992-01-01

Mice infected in the genital tract with the Chlamydia trachomatis agent of mouse pneumonitis were treated with monoclonal rat anti-gamma interferon (anti-IFN-gamma) antibody to determine whether IFN-gamma participated in the resolution of the infection. In two experiments, anti-IFN-gamma antibody treatment resulted in significantly prolonged infections. In support of these data, passive administration of recombinant IFN-gamma to chronically infected nu/nu mice was able to bring about resolution of the infection in some animals. PMID:1398955

Review of the recombinant human interferon gamma as an immunotherapeutic: Impacts of production platforms and glycosylation.

PubMed

Razaghi, Ali; Owens, Leigh; Heimann, Kirsten

2016-12-20

Human interferon gamma is a cytokine belonging to a diverse group of interferons which have a crucial immunological function against mycobacteria and a wide variety of viral infections. To date, it has been approved for treatment of chronic granulomatous disease and malignant osteopetrosis, and its application as an immunotherapeutic agent against cancer is an increasing prospect. Recombinant human interferon gamma, as a lucrative biopharmaceutical, has been engineered in different expression systems including prokaryotic, protozoan, fungal (yeasts), plant, insect and mammalian cells. Human interferon gamma is commonly expressed in Escherichia coli, marketed as ACTIMMUNE ® , however, the resulting product of the prokaryotic expression system is unglycosylated with a short half-life in the bloodstream; the purification process is tedious and makes the product costlier. Other expression systems also did not show satisfactory results in terms of yields, the biological activity of the protein or economic viability. Thus, the review aims to synthesise available information from previous studies on the production of human interferon gamma and its glycosylation patterns in different expression systems, to provide direction to future research in this field. Copyright © 2016 Elsevier B.V. All rights reserved.

Recent considerations in the use of recombinant interferon gamma for biological therapy of atopic dermatitis.

PubMed

Brar, Kanwaljit; Leung, Donald Y M

2016-01-01

Atopic dermatitis (AD) is the most common inflammatory skin disease in the general population. There are different endophenotypes of AD that likely have a unique immune and molecular basis, such as those who are predisposed to eczema herpeticum, or Staphylococcus aureus infections. In this review, we highlight the endophenotypes of AD where reduced interferon gamma expression may be playing a role. Additionally, we review the potential role of recombinant interferon gamma therapy in the treatment of atopic dermatitis and the particular phenotypes that may benefit from this treatment. Recombinant interferon gamma treatment will likely benefit the pediatric population with AD, as well as those with susceptibilities for skin infections. Future studies are needed to elucidate whether IFN-γ may reduce the prevalence of skin infection in AD.

STING-Dependent Interferon-λ1 Induction in HT29 Cells, a Human Colorectal Cancer Cell Line, After Gamma-Radiation.

PubMed

Chen, Jianzhou; Markelc, Bostjan; Kaeppler, Jakob; Ogundipe, Vivian M L; Cao, Yunhong; McKenna, W Gillies; Muschel, Ruth J

2018-05-01

To investigate the induction of type III interferons (IFNs) in human cancer cells by gamma-rays. Type III IFN expression in human cancer cell lines after gamma-ray irradiation in vitro was assessed by reverse transcription-quantitative polymerase chain reaction and enzyme-linked immunosorbent assay. Signaling pathways mediating type III IFN induction were examined by a variety of means, including immunoblotting, flow cytometry, confocal imaging, and reverse transcription-quantitative polymerase chain reaction. Key mediators in these pathways were further explored and validated using gene CRISPR knockout or short hairpin RNA knockdown. Exposure to gamma-rays directly induced type III IFNs (mainly IFNL1) in human cancer cell lines in dose- and time-dependent fashions. The induction of IFNL1 was primarily mediated by the cytosolic DNA sensors-STING-TBK1-IRF1 signaling axis, with a lesser contribution from the nuclear factor kappa b signaling in HT29 cells. In addition, type III IFN signaling through its receptors serves as a positive feedback loop, further enhancing IFN expression via up-regulation of the kinases in the STING-TBK1 signaling axis. Our results suggest that IFNL1 can be up-regulated in human cancer cell lines after gamma-ray treatment. In HT29 cells this induction occurs via the STING pathway, adding another layer of complexity to the understanding of radiation-induced antitumor immunity, and may provide novel insights into IFN-based cancer treatment. Copyright © 2018 Elsevier Inc. All rights reserved.

An Enzyme-Linked Immunosorbent Spot Assay Measuring Borrelia burgdorferi B31-Specific Interferon Gamma-Secreting T Cells Cannot Discriminate Active Lyme Neuroborreliosis from Past Lyme Borreliosis: a Prospective Study in the Netherlands.

PubMed

van Gorkom, T; Sankatsing, S U C; Voet, W; Ismail, D M; Muilwijk, R H; Salomons, M; Vlaminckx, B J M; Bossink, A W J; Notermans, D W; Bouwman, J J M; Kremer, K; Thijsen, S F T

2018-04-01

Two-tier serology testing is most frequently used for the diagnosis of Lyme borreliosis (LB); however, a positive result is no proof of active disease. To establish a diagnosis of active LB, better diagnostics are needed. Tests investigating the cellular immune system are available, but studies evaluating the utility of these tests on well-defined patient populations are lacking. Therefore, we investigated the utility of an enzyme-linked immunosorbent spot (ELISpot) assay to diagnose active Lyme neuroborreliosis. Peripheral blood mononuclear cells (PBMCs) of various study groups were stimulated by using Borrelia burgdorferi strain B31 and various recombinant antigens, and subsequently, the number of Borrelia -specific interferon gamma (IFN-γ)-secreting T cells was measured. We included 33 active and 37 treated Lyme neuroborreliosis patients, 28 healthy individuals treated for an early manifestation of LB in the past, and 145 untreated healthy individuals. The median numbers of B. burgdorferi B31-specific IFN-γ-secreting T cells/2.5 × 10 5 PBMCs did not differ between active Lyme neuroborreliosis patients (6.0; interquartile range [IQR], 0.5 to 14.0), treated Lyme neuroborreliosis patients (4.5; IQR, 2.0 to 18.6), and treated healthy individuals (7.4; IQR, 2.3 to 14.9) ( P = 1.000); however, the median number of B. burgdorferi B31-specific IFN-γ-secreting T cells/2.5 × 10 5 PBMCs among untreated healthy individuals was lower (2.0; IQR, 0.5 to 3.9) ( P ≤ 0.016). We conclude that the Borrelia ELISpot assay, measuring the number of B. burgdorferi B31-specific IFN-γ-secreting T cells/2.5 × 10 5 PBMCs, correlates with exposure to the Borrelia bacterium but cannot be used for the diagnosis of active Lyme neuroborreliosis. Copyright © 2018 van Gorkom et al.

An Enzyme-Linked Immunosorbent Spot Assay Measuring Borrelia burgdorferi B31-Specific Interferon Gamma-Secreting T Cells Cannot Discriminate Active Lyme Neuroborreliosis from Past Lyme Borreliosis: a Prospective Study in the Netherlands

PubMed Central

van Gorkom, T.; Sankatsing, S. U. C.; Voet, W.; Ismail, D. M.; Muilwijk, R. H.; Salomons, M.; Vlaminckx, B. J. M.; Bossink, A. W. J.; Notermans, D. W.; Bouwman, J. J. M.; Kremer, K.

2018-01-01

ABSTRACT Two-tier serology testing is most frequently used for the diagnosis of Lyme borreliosis (LB); however, a positive result is no proof of active disease. To establish a diagnosis of active LB, better diagnostics are needed. Tests investigating the cellular immune system are available, but studies evaluating the utility of these tests on well-defined patient populations are lacking. Therefore, we investigated the utility of an enzyme-linked immunosorbent spot (ELISpot) assay to diagnose active Lyme neuroborreliosis. Peripheral blood mononuclear cells (PBMCs) of various study groups were stimulated by using Borrelia burgdorferi strain B31 and various recombinant antigens, and subsequently, the number of Borrelia-specific interferon gamma (IFN-γ)-secreting T cells was measured. We included 33 active and 37 treated Lyme neuroborreliosis patients, 28 healthy individuals treated for an early manifestation of LB in the past, and 145 untreated healthy individuals. The median numbers of B. burgdorferi B31-specific IFN-γ-secreting T cells/2.5 × 105 PBMCs did not differ between active Lyme neuroborreliosis patients (6.0; interquartile range [IQR], 0.5 to 14.0), treated Lyme neuroborreliosis patients (4.5; IQR, 2.0 to 18.6), and treated healthy individuals (7.4; IQR, 2.3 to 14.9) (P = 1.000); however, the median number of B. burgdorferi B31-specific IFN-γ-secreting T cells/2.5 × 105 PBMCs among untreated healthy individuals was lower (2.0; IQR, 0.5 to 3.9) (P ≤ 0.016). We conclude that the Borrelia ELISpot assay, measuring the number of B. burgdorferi B31-specific IFN-γ-secreting T cells/2.5 × 105 PBMCs, correlates with exposure to the Borrelia bacterium but cannot be used for the diagnosis of active Lyme neuroborreliosis. PMID:29367297

Effect of leukocyte therapy on tumor necrosis factor-alpha and interferon-gamma production in patients with recurrent spontaneous abortion.

PubMed

Gharesi-Fard, Behrouz; Zolghadri, Jaleh; Kamali-Sarvestani, Eskandar

2008-03-01

Considering the deleterious role of T helper1 (Th1) cells in pregnancy outcome, a successful treatment for recurrent spontaneous abortion (RSA) should be able to make a significant shift away from Th1 responses. Although paternal leukocyte immunization has been used for treatment of RSA for years, because of methodological differences there is no consensus on the mechanism of action and effectiveness of this method. Twenty-five Iranian non-pregnant women with RSA and 16 non-pregnant control women with at least two successful pregnancies were included in this study. All cases were followed up after leukocyte therapy for pregnancy outcome. Mononuclear cells from women were co-cultured with the husband's mononuclear cells before and after immunotherapy. The levels of tumor necrosis factor-alpha (TNF-alpha) and interferon-gamma (IFN-gamma) were checked on culture supernatant by enzyme-linked immunosorbent assay method. The mean concentration of TNF-alpha was significantly higher in patients compared with that in normal controls (P=0.0001). After immunotherapy, the TNF-alpha level was only significantly decreased in women with successful outcome (P=0.0001). Immunotherapy also induced a significant reduction in the IFN-gamma level (P=0.009). The results of this investigation confirm the role of TNF-alpha in RSA and propose the assessment of TNF-alpha production as a valuable prognostic parameter for the prediction of abortion after leukocyte therapy.

Evaluation of gamma interferon (IFN-gamma)-induced protein 10 (IP-10) responses for detection of cattle infected with Mycobacterium bovis: comparisons to IFN-gamma responses

USDA-ARS?s Scientific Manuscript database

Gamma interferon (IFN-gamma)-induced protein 10 (IP-10) has recently shown promise as a diagnostic biomarker of Mycobacterium tuberculosis infection of humans. The aim of the current study was to compare IP-10 and IFN-gamma responses upon Mycobacterium bovis infection in cattle using archived sample...

Immunomodulatory intervention with Gamma interferon in mice with sepsis.

PubMed

Wang, Yu; Kong, Bing-Bing; Yang, Wen-Ping; Zhao, Xin; Zhang, Rong

2017-09-15

Sepsis-triggered immune paralysis including T-cell dysfunction increase susceptibility to infection. Gamma interferon (IFNg) exert beneficial effects in patients with sepsis. Herein, we speculated that IFNg may attenuate T-cell dysfunction induced by sepsis, although the mechanisms remain elusive. To test this hypothesis, we used a model based on cecal ligation and puncture (CLP) to induce sepsis in mice. Male C57BL/6 mice were pretreated with recombinant human IFNg (0.01μg/g of body weight) before CLP. The immunophenotyping of cell surface receptor expression, and regulatory T cells (CD4+CD25+Foxp3+) were quantified by flow cytometry. Immunohistochemical staining was performed to evaluate the loss of immune effector cells. Formation of IFNg and interleukin 4 (IL-4) in the spleen and plasma levels of TNF-α, IL-6, high-mobility group box 1 (HMGB1) were determined using enzyme-linked immunosorbent assay. IFNg markedly inhibited the reduction in cytokine secretion from lipopolysaccharide (LPS)-stimulated splenocytes. IFNg-treated mices had significantly decreased percentages of programmed cell death 1 (PD-1) receptors, increased the percentages of positive costimulatory receptor CD28 on CD4 T cells expressing. IFNg markedly reduced T-cell apoptosis through upregulating the expression of Bcl-2. CLP-induced formation of regulatory T cells in the spleen was abolished in IFNg -treated mices. Moreover, IFNg treatment reduced plasma levels of TNF-α, IL-6, HMGB1. IFNg can be a powerful regulator of immune function under sepsis conditions. Therefore, targeted immune-enhancement with IFNg may be a valid therapeutic approach in sepsis. Copyright © 2017 Elsevier Inc. All rights reserved.

Inhibited interferon-gamma but normal interleukin-3 production from rats flown on the Space Shuttle

NASA Technical Reports Server (NTRS)

Gould, Cheryl L.; Lyte, Mark; Williams, Joann; Mandel, Adrian D.; Sonnenfeld, Gerald

1987-01-01

Rats were flown on Space Shuttle SL-3 for one week. When spleen cells were removed from these rats and challenged with concanavalin-A, interferon-gamma production was severely inhibited, while interleukin-3 production was unaffected compared to ground-based control rats. These data indicate that there is a defect in interferon-gamma production in rats that have been exposed to spaceflight. This defect could contribute to, and be one reason for, immunosuppression observed after spaceflight.

Interferon Gamma as a Biomarker of Exposure to Enteric Viruses

EPA Science Inventory

Interferon gamma (IFN-γ) was selected as a biomarker for viral exposure. Twelve-week-old BALB/c mice were intraperitoneally injected with Coxsackievirus B3 or B4 diluted in phosphate-buffered saline (PBS). Control mice were injected with PBS only. Four months after viral infectio...

Plasmodium falciparum erythrocyte membrane protein-1 specifically suppresses early production of host interferon-gamma.

PubMed

D'Ombrain, Marthe C; Voss, Till S; Maier, Alexander G; Pearce, J Andrew; Hansen, Diana S; Cowman, Alan F; Schofield, Louis

2007-08-16

Plasmodium falciparum erythrocyte membrane protein-1 (PfEMP-1) is a variable antigen expressed by P. falciparum, the malarial parasite. PfEMP-1, present on the surface of infected host erythrocytes, mediates erythrocyte binding to vascular endothelium, enabling the parasite to avoid splenic clearance. In addition, PfEMP-1 is proposed to regulate host immune responses via interactions with the CD36 receptor on antigen-presenting cells. We investigated the immunoregulatory function of PfEMP-1 by comparing host cell responses to erythrocytes infected with either wild-type parasites or transgenic parasites lacking PfEMP-1. We showed that PfEMP-1 suppresses the production of the cytokine interferon-gamma by human peripheral blood mononuclear cells early after exposure to P. falciparum. Suppression of this rapid proinflammatory response was CD36 independent and specific to interferon-gamma production by gammadelta-T, NK, and alphabeta-T cells. These data demonstrate a parasite strategy for downregulating the proinflammatory interferon-gamma response and further establish transgenic parasites lacking PfEMP-1 as powerful tools for elucidating PfEMP-1 functions.

Anti-interferon-gamma antibodies in the treatment of autoimmune diseases.

PubMed

Skurkovich, Boris; Skurkovich, Simon

2003-02-01

Interferon (IFN)-gamma is an important immune regulator in normal immunity. When IFN gamma production is disturbed, various autoimmune diseases (ADs) can develop, in which we suggest that anti-IFN gamma could have a beneficial effect. Depending on the cell type in which IFN gamma synthesis is disturbed, different clinical manifestations may result. We have also proposed to remove tumor necrosis factor (TNF)-alpha, together with certain types of IFNs, to treat various ADs and AIDS, also an autoimmune condition. Anti-IFN gamma has been tested in several T-helper cell (Th1) ADs, including rheumatoid arthritis (RA), multiple sclerosis (MS), corneal transplant rejection, uveitis, Type I diabetes, schizophrenia (anti-IFN gamma and anti-TNF alpha), and various autoimmune skin diseases (alopecia areata, psoriasis vulgaris, vitiligo, pemphigus vulgaris and epidermolysis bullosa). A strong, sometimes striking, therapeutic response followed administration of anti-IFN gamma, indicating that it may be a promising therapy for Th1 ADs.

Interferon-γ Inhibits Ebola Virus Infection.

PubMed

Rhein, Bethany A; Powers, Linda S; Rogers, Kai; Anantpadma, Manu; Singh, Brajesh K; Sakurai, Yasuteru; Bair, Thomas; Miller-Hunt, Catherine; Sinn, Patrick; Davey, Robert A; Monick, Martha M; Maury, Wendy

2015-01-01

Ebola virus outbreaks, such as the 2014 Makona epidemic in West Africa, are episodic and deadly. Filovirus antivirals are currently not clinically available. Our findings suggest interferon gamma, an FDA-approved drug, may serve as a novel and effective prophylactic or treatment option. Using mouse-adapted Ebola virus, we found that murine interferon gamma administered 24 hours before or after infection robustly protects lethally-challenged mice and reduces morbidity and serum viral titers. Furthermore, we demonstrated that interferon gamma profoundly inhibits Ebola virus infection of macrophages, an early cellular target of infection. As early as six hours following in vitro infection, Ebola virus RNA levels in interferon gamma-treated macrophages were lower than in infected, untreated cells. Addition of the protein synthesis inhibitor, cycloheximide, to interferon gamma-treated macrophages did not further reduce viral RNA levels, suggesting that interferon gamma blocks life cycle events that require protein synthesis such as virus replication. Microarray studies with interferon gamma-treated human macrophages identified more than 160 interferon-stimulated genes. Ectopic expression of a select group of these genes inhibited Ebola virus infection. These studies provide new potential avenues for antiviral targeting as these genes that have not previously appreciated to inhibit negative strand RNA viruses and specifically Ebola virus infection. As treatment of interferon gamma robustly protects mice from lethal Ebola virus infection, we propose that interferon gamma should be further evaluated for its efficacy as a prophylactic and/or therapeutic strategy against filoviruses. Use of this FDA-approved drug could rapidly be deployed during future outbreaks.

Gamma Interferon-Induced T-Cell Loss in Virulent Mycobacterium avium Infection

PubMed Central

Flórido, Manuela; Pearl, John E.; Solache, Alejandra; Borges, Margarida; Haynes, Laura; Cooper, Andrea M.; Appelberg, Rui

2005-01-01

Infection by virulent Mycobacterium avium caused progressive severe lymphopenia in C57BL/6 mice due to increased apoptosis rates. T-cell depletion did not occur in gamma interferon (IFN-γ)-deficient mice which showed increased T-cell numbers and proliferation; in contrast, deficiency in nitric oxide synthase 2 did not prevent T-cell loss. Although T-cell loss was IFN-γ dependent, expression of the IFN-γ receptor on T cells was not required for depletion. Similarly, while T-cell loss was optimal if the T cells expressed IFN-γ, CD8+ T-cell depletion could occur in the absence of T-cell-derived IFN-γ. Depletion did not require that the T cells be specific for mycobacterial antigen and was not affected by deficiencies in the tumor necrosis factor receptors p55 or p75, the Fas receptor (CD95), or the respiratory burst enzymes or by forced expression of bcl-2 in hematopoietic cells. PMID:15908387

Evaluation of Gamma Interferon and Antibody Tuberculosis Tests in Alpacas

PubMed Central

Holder, Tom; Clifford, Derek; Dexter, Ian; Brewer, Jacky; Smith, Noel; Waring, Laura; Crawshaw, Tim; Gillgan, Steve; Lyashchenko, Konstantin; Lawrence, John; Clarke, John; de la Rua-Domenech, Ricardo; Vordermeier, Martin

2012-01-01

We describe the performance of cell-based and antibody blood tests for the antemortem diagnosis of tuberculosis (TB) in South American camelids (SAC). The sensitivity and specificity of the gamma interferon (IFN-γ) release assay, two lateral flow rapid antibody tests (Stat-Pak and Dual Path Platform [DPP]), and two enzyme-linked immunosorbent assay (ELISA)-based antibody tests (Idexx and Enferplex) were determined using diseased alpacas from Mycobacterium bovis culture-confirmed breakdown herds and TB-free alpacas from geographical areas with no history of bovine TB, respectively. Our results show that while the sensitivities of the IFN-γ and antibody tests were similar (range of 57.7% to 66.7%), the specificity of the IFN-γ test (89.1%) was lower than those of any of the antibody tests (range of 96.4% to 97.4%). This lower specificity of the IFN-γ test was at least in part due to undisclosed Mycobacterium microti infection in the TB-free cohort, which stimulates a positive purified protein derivative (PPD) response. The sensitivity of infection detection could be increased by combining two antibody tests, but even the use of all four antibody tests failed to detect all diseased alpacas. These antibody-negative alpacas were IFN-γ positive. We found that the maximum sensitivity could be achieved only by the combination of the IFN-γ test with two antibody tests in a “test package,” although this resulted in decreased specificity. The data from this evaluation of tests with defined sensitivity and specificity provide potential options for antemortem screening of SAC for TB in herd breakdown situations and could also find application in movement testing and tracing investigations. PMID:22914362

Evaluation of gamma interferon and antibody tuberculosis tests in alpacas.

PubMed

Rhodes, Shelley; Holder, Tom; Clifford, Derek; Dexter, Ian; Brewer, Jacky; Smith, Noel; Waring, Laura; Crawshaw, Tim; Gillgan, Steve; Lyashchenko, Konstantin; Lawrence, John; Clarke, John; de la Rua-Domenech, Ricardo; Vordermeier, Martin

2012-10-01

We describe the performance of cell-based and antibody blood tests for the antemortem diagnosis of tuberculosis (TB) in South American camelids (SAC). The sensitivity and specificity of the gamma interferon (IFN-γ) release assay, two lateral flow rapid antibody tests (Stat-Pak and Dual Path Platform [DPP]), and two enzyme-linked immunosorbent assay (ELISA)-based antibody tests (Idexx and Enferplex) were determined using diseased alpacas from Mycobacterium bovis culture-confirmed breakdown herds and TB-free alpacas from geographical areas with no history of bovine TB, respectively. Our results show that while the sensitivities of the IFN-γ and antibody tests were similar (range of 57.7% to 66.7%), the specificity of the IFN-γ test (89.1%) was lower than those of any of the antibody tests (range of 96.4% to 97.4%). This lower specificity of the IFN-γ test was at least in part due to undisclosed Mycobacterium microti infection in the TB-free cohort, which stimulates a positive purified protein derivative (PPD) response. The sensitivity of infection detection could be increased by combining two antibody tests, but even the use of all four antibody tests failed to detect all diseased alpacas. These antibody-negative alpacas were IFN-γ positive. We found that the maximum sensitivity could be achieved only by the combination of the IFN-γ test with two antibody tests in a "test package," although this resulted in decreased specificity. The data from this evaluation of tests with defined sensitivity and specificity provide potential options for antemortem screening of SAC for TB in herd breakdown situations and could also find application in movement testing and tracing investigations.

Electrochemical impedance spectroscopy based-on interferon-gamma detection

NASA Astrophysics Data System (ADS)

Li, Guan-Wei; Kuo, Yi-Ching; Tsai, Pei-I.; Lee, Chih-Kung

2014-03-01

Tuberculosis (TB) is an ancient disease constituted a long-term menace to public health. According to World Health Organization (WHO), mycobacterium tuberculosis (MTB) infected nearly a third of people of the world. There is about one new TB occurrence every second. Interferon-gamma (IFN-γ) is associated with susceptibility to TB, and interferongamma release assays (IGRA) is considered to be the best alternative of tuberculin skin test (TST) for diagnosis of latent tuberculosis infection (LTBI). Although significant progress has been made with regard to the design of enzyme immunoassays for IFN-γ, adopting this assay is still labor-intensive and time-consuming. To alleviate these drawbacks, we used IFN-γ antibody to facilitate the detection of IFN-γ. An experimental verification on the performance of IGRA was done in this research. We developed two biosensor configurations, both of which possess high sensitivity, specificity, and rapid IFN-γ diagnoses. The first is the electrochemical method. The second is a circular polarization interferometry configuration, which incorporates two light beams with p-polarization and s-polarization states individually along a common path, a four photo-detector quadrature configuration to arrive at a phase modulated ellipsometer. With these two methods, interaction between IFN-γ antibody and IFN-γ were explored and presented in detail.

Interferon-gamma and interlukin-4 patterns in BALB/c mice suffering from cutaneous leishmaniasis treated with cantharidin.

PubMed

Maroufi, Yahya; Ghaffarifar, Fatemeh; Dalimi, Abdolhosein; Sharifi, Zohreh

2014-06-01

Cutaneous leishmaniasis is a health problem in the world. Lesions should be treated on cosmetically or functionally important sites, such as the face and hands. Cantharidin is a terpenoid compound produced naturally by beetles of Meloidae and Oedemeridae families. The current study aimed to investigate the effect of cantharidin on Cutaneous Leishmaniasis (CL) lesions and IFN-γ and IL-4 patterns in infected BALB/c mice. INFECTED BALB/C MICE WERE DIVIDED INTO FIVE GROUPS AS: untreated (control group), eucerin-treated and 0.05%, 0.1% and 0.5% cantharidin-treated. Lesions diameter was measured by Vernier caliper every three days for four weeks. Cytokines levels were measured by enzyme-linked immunosorbent assay (ELISA) using U-CyTech kit. The results indicated that treatment with cantharidin exacerbates lesions compared with the controls, except for 0.05% cantharidin dose that restrained lesion growth significantly. Interferon gamma level in cantharidin-treated groups was significantly less than that of the control group. But interlukin-4 level was similar among the groups. The current study results indicated that high doses of cantharidin exacerbates leishmaniasis lesion, but low dose of cantharidin inhibits lesion growth.

Interferon-Gamma and Interlukin-4 Patterns in BALB/c Mice Suffering From Cutaneous Leishmaniasis Treated With Cantharidin

PubMed Central

Maroufi, Yahya; Ghaffarifar, Fatemeh; Dalimi, Abdolhosein; Sharifi, Zohreh

2014-01-01

Background: Cutaneous leishmaniasis is a health problem in the world. Lesions should be treated on cosmetically or functionally important sites, such as the face and hands. Cantharidin is a terpenoid compound produced naturally by beetles of Meloidae and Oedemeridae families. Objectives: The current study aimed to investigate the effect of cantharidin on Cutaneous Leishmaniasis (CL) lesions and IFN-γ and IL-4 patterns in infected BALB/c mice. Materials and Methods: Infected BALB/c mice were divided into five groups as: untreated (control group), eucerin-treated and 0.05%, 0.1% and 0.5% cantharidin-treated. Lesions diameter was measured by Vernier caliper every three days for four weeks. Cytokines levels were measured by enzyme-linked immunosorbent assay (ELISA) using U-CyTech kit. Results: The results indicated that treatment with cantharidin exacerbates lesions compared with the controls, except for 0.05% cantharidin dose that restrained lesion growth significantly. Interferon gamma level in cantharidin-treated groups was significantly less than that of the control group. But interlukin-4 level was similar among the groups. Conclusions: The current study results indicated that high doses of cantharidin exacerbates leishmaniasis lesion, but low dose of cantharidin inhibits lesion growth. PMID:25371808

The immunomodulatory effects of interferon-gamma on mature B-lymphocyte responses.

PubMed

Jurado, A; Carballido, J; Griffel, H; Hochkeppel, H K; Wetzel, G D

1989-06-15

Interferon-gamma (IFN-gamma) exerts a broad spectrum of activities which affect the responses of mature B-cells. It strongly inhibits B-cell activation, acts as a B-cell growth factor (BCGF), and also induces final differentiation to immunoglobulin (Ig) production. IFN-gamma is deeply involved in the differential control of isotype expression, as it enhances IgG2a production and suppresses both IgG1 and IgE production. Although it is now possible to draw a general scheme of the effects of IFN-gamma on B-cells, a number of paradoxical results still exist in the field. In this manuscript, different experimental systems are analyzed in an attempt to explain these apparent paradoxes.

Beyond Tryptophan Synthase: Identification of Genes That Contribute to Chlamydia trachomatis Survival during Gamma Interferon-Induced Persistence and Reactivation

PubMed Central

Muramatsu, Matthew K.; Brothwell, Julie A.; Stein, Barry D.; Putman, Timothy E.; Rockey, Daniel D.

2016-01-01

Chlamydia trachomatis can enter a viable but nonculturable state in vitro termed persistence. A common feature of C. trachomatis persistence models is that reticulate bodies fail to divide and make few infectious progeny until the persistence-inducing stressor is removed. One model of persistence that has relevance to human disease involves tryptophan limitation mediated by the host enzyme indoleamine 2,3-dioxygenase, which converts l-tryptophan to N-formylkynurenine. Genital C. trachomatis strains can counter tryptophan limitation because they encode a tryptophan-synthesizing enzyme. Tryptophan synthase is the only enzyme that has been confirmed to play a role in interferon gamma (IFN-γ)-induced persistence, although profound changes in chlamydial physiology and gene expression occur in the presence of persistence-inducing stressors. Thus, we screened a population of mutagenized C. trachomatis strains for mutants that failed to reactivate from IFN-γ-induced persistence. Six mutants were identified, and the mutations linked to the persistence phenotype in three of these were successfully mapped. One mutant had a missense mutation in tryptophan synthase; however, this mutant behaved differently from previously described synthase null mutants. Two hypothetical genes of unknown function, ctl0225 and ctl0694, were also identified and may be involved in amino acid transport and DNA damage repair, respectively. Our results indicate that C. trachomatis utilizes functionally diverse genes to mediate survival during and reactivation from persistence in HeLa cells. PMID:27430273

Effects of chicken interferon Gamma on Newcastle disease virus vaccine immunogenicity

USDA-ARS?s Scientific Manuscript database

More effective vaccines are needed to control avian diseases. The use of chicken interferon gamma (chIFN') during vaccination is a potentially important but controversial approach that may improve the immune response to antigens. In the present study, three different systems to co-deliver chIFN' wit...

Interferon-alpha and interferon-gamma sensitize human tenon fibroblasts to mitomycin-C.

PubMed

Wang, Xiao Yang; Crowston, Jonathan G; Zoellner, Hans; Healey, Paul R

2007-08-01

To investigate the effect of interferon (IFN)-alpha and IFN-gamma pretreatment on mitomycin C (MMC)-induced cell death in human Tenon fibroblasts (HTFs) and the mechanisms by which IFN-alpha and IFN-gamma modulate the susceptibility of HTFs to MMC. HTFs were pretreated with IFN-alpha and IFN-gamma for 48 hours before 5-minute application of 0.4 mg/mL MMC. Cell death after 48 hours was determined by Annexin V/propidium iodide (PI) staining and lactate dehydrogenase (LDH) release assay. Fas, Fas-ligand, and Bcl-2 expression were determined by flow cytometry. Fas associated death domain (FADD), Bax, cytochrome c, and caspase expression were determined by Western blot analysis and immunofluorescence staining. MMC treatment increased cell death and upregulated Fas and FADD expression, but had no effect on Fas-Ligand, Bax, Bcl-2, or cytochrome c. Neither IFN-alpha nor IFN-gamma alone induced HTF death, but each increased cell death 2 days after MMC treatment in a dose-dependent fashion. Combination IFN-alpha and IFN-gamma had a synergistic effect. IFN-alpha and IFN-gamma pretreatment increased Fas expression. Fas upregulation was associated with increased sensitivity to MMC. IFN pretreatment increased procaspase-8, procaspase-9, and procaspase-3 expression, and caspase-3 activation. Caspase-8, caspase-3, and broad caspase inhibitors, but not caspase-9 inhibitor, inhibited MMC-induced cell death in nonpretreated and IFN-pretreated cells. IFN-alpha and IFN-gamma enhance the susceptibility of HTFs to MMC-induced cell death through a Fas-mediated and a caspase-3-dependent pathway. Pretreatment with IFN primed HTFs to MMC, providing a potential means for initially slowing the healing response with IFN and subsequently terminating fibroblast activity through MMC-induced cell death.

Increase in neutrophil Fc gamma receptor I expression following interferon gamma treatment in rheumatoid arthritis.

PubMed Central

Goulding, N J; Knight, S M; Godolphin, J L; Guyre, P M

1992-01-01

The therapeutic potential of interferon gamma (IFN gamma) in a number of disease states is still being explored, but progress is hampered by the lack of a suitable measure of in vivo biological activity. To assess the in vivo biological effects of recombinant human IFN gamma (rhIFN gamma), 14 patients were studied in a randomised, prospective, double blind, placebo controlled trial of this cytokine for the treatment of rheumatoid arthritis. The levels of Fc gamma receptors on peripheral blood neutrophils were measured at baseline and after 21 days of once daily, subcutaneous injections of rhIFN gamma or placebo. An induction of neutrophil Fc gamma receptor type I (Fc gamma RI) was seen in the group of patients receiving recombinant human rhIFN gamma but not in those receiving placebo. No change in the expression of Fc gamma RII or Fc gamma RIII was detected. The amount of induction of Fc gamma RI detected on the neutrophils of patients receiving rhIFN gamma did not correlate with clinical measures of response at either 21 days or at the end of the study (24 weeks). No significant clinical responses were observed in the rhIFN gamma group at these times. These data confirm that the reported in vitro effect of IFN gamma on human neutrophil Fc receptor expression can be reproduced in vivo. PMID:1534001

Increase in neutrophil Fc gamma receptor I expression following interferon gamma treatment in rheumatoid arthritis.

PubMed

Goulding, N J; Knight, S M; Godolphin, J L; Guyre, P M

1992-04-01

The therapeutic potential of interferon gamma (IFN gamma) in a number of disease states is still being explored, but progress is hampered by the lack of a suitable measure of in vivo biological activity. To assess the in vivo biological effects of recombinant human IFN gamma (rhIFN gamma), 14 patients were studied in a randomised, prospective, double blind, placebo controlled trial of this cytokine for the treatment of rheumatoid arthritis. The levels of Fc gamma receptors on peripheral blood neutrophils were measured at baseline and after 21 days of once daily, subcutaneous injections of rhIFN gamma or placebo. An induction of neutrophil Fc gamma receptor type I (Fc gamma RI) was seen in the group of patients receiving recombinant human rhIFN gamma but not in those receiving placebo. No change in the expression of Fc gamma RII or Fc gamma RIII was detected. The amount of induction of Fc gamma RI detected on the neutrophils of patients receiving rhIFN gamma did not correlate with clinical measures of response at either 21 days or at the end of the study (24 weeks). No significant clinical responses were observed in the rhIFN gamma group at these times. These data confirm that the reported in vitro effect of IFN gamma on human neutrophil Fc receptor expression can be reproduced in vivo.

Transforming growth factor-beta controls T helper type 1 cell development through regulation of natural killer cell interferon-gamma.

PubMed

Laouar, Yasmina; Sutterwala, Fayyaz S; Gorelik, Leonid; Flavell, Richard A

2005-06-01

Interferon-gamma and interleukin 12 produced by the innate arm of the immune system are important regulators of T helper type 1 (T(H)1) cell development, but signals that negatively regulate their expression remain controversial. Here we show that transforming growth factor-beta (TGF-beta) controlled T(H)1 differentiation through the regulation of interferon-gamma produced by natural killer (NK) cells. Blockade of TGF-beta signaling in NK cells caused the accumulation of a large pool of NK cells secreting copious interferon-gamma, responsible for T(H)1 differentiation and protection from leishmania infection. In contrast, blockade of TGF-beta signaling in dendritic cells did not affect dendritic cell homeostasis or interleukin 12 production, thus indicating a previously undescribed demarcation of the function of TGF-beta in NK cells versus dendritic cells.

Interferon-gamma enhances radiation-induced cell death via downregulation of Chk1

PubMed Central

Kim, Kwang Seok; Choi, Kyu Jin; Bae, Sangwoo

2012-01-01

Interferon-gamma (IFNγ) is a cytokine with roles in immune responses as well as in tumor control. Interferon is often used in cancer treatment together with other therapies. Here we report a novel approach to enhancement of cancer cell killing by combined treatment of IFNγ with ionizing radiation. We found that IFNγ treatment alone in HeLa cells induced phosphorylation of Chk1 in a time- and dose-dependent manner, and resulted in cell arrest. Moreover IFNγ treatment was correlated with attenuation of Chk1 as the treatment shortened protein half-life of Chk1. As Chk1 is an essential cell cycle regulator for viability after DNA damage, attenuation of Chk1 by IFNγ pre-treatment in HeLa cells resulted in increased cell death following ionizing radiation about 2-folds than ionizing radiation treatment alone whereas IFNγ treatment alone had little effect on cell death. X-linked inhibitor of apoptosis-associated factor 1 (XAF1), an IFN-induced gene, seems to partly regulate IFNγ-induced Chk1 destabilization and radiation sensitivity because transient depletion of XAF1 by siRNA prevented IFNγ-induced Chk1 attenuation and partly protected cells from IFNγ-enhanced radiation cell killing. Therefore the results provide a novel rationale to combine IFNγ pretreatment and DNA-damaging anti-cancer drugs such as ionizing radiation to enhance cancer cell killing. PMID:22825336

Clinical and diagnostic developments of a gamma interferon release assay for use in bovine tuberculosis control programs

USDA-ARS?s Scientific Manuscript database

Currently the Bovigam assay is used as an official supplemental test within the bovine tuberculosis eradication program. This assay measures interferon-gamma (IFN-gamma) produced by lymphocytes in response to specific antigens. The objectives of the present study were to evaluate two Mycobacterium ...

Alternative activation of STAT1 and STAT3 in response to interferon-gamma.

PubMed

Qing, Yulan; Stark, George R

2004-10-01

Interferon-gamma (IFNgamma) is a pluripotent cytokine whose major biological effects are mediated through a pathway in which STAT1 is the predominant and essential transcription factor. STAT3 can also be activated weakly by IFNgamma, but the mechanism of activation and function of STAT3 as a part of the interferon response are not known. Here we show that STAT3 activation is much stronger and more prolonged in STAT1-null mouse embryo fibroblasts than in wild-type cells. In response to IFNgamma, SRC-family kinases are required to activate STAT3 (but not STAT1) through tyrosine phosphorylation, whereas the receptor-bound kinases JAK1 and JAK2 are required to activate both STATs. Tyrosine 419 of the IFNgamma receptor subunit 1 (IFNGR1) is required to activate both STATs, suggesting that STAT1 and STAT3 compete with each other for the same receptor phosphotyrosine motif. Activated STAT3 can replace STAT1 in STAT1-null cells to drive the transcription of certain genes, for example, socs-3 and c/ebpdelta, which have gamma-activated sequence motifs in their promoters. Work from Ian Kerr's laboratory reveals that the gp130-linked interleukin-6 receptor, which usually activates STAT3 predominantly, activates STAT1 efficiently when STAT3 is absent. Because STAT1 and STAT3 have opposing biological effects (STAT3 is an oncogene, and STAT1 is a tumor suppressor), the reciprocal activation of these two transcription factors in response to IFNgamma or interleukin-6 suggests that their relative abundance, which may vary substantially in different normal cell types, under different conditions or in tumors is likely to have a major impact on how cells behave in response to different cytokines.

Interferon-Gamma Promotes UV-Induced Melanoma in Mice | Center for Cancer Research

Cancer.gov

Scientists have made an unanticipated discovery in mice that interferon-gamma, a type of protein primarily used by the immune system for intercellular communication, acts as a promoter for the deadly form of skin cancer known as melanoma. This finding resulted from a series of experiments designed to understand how solar ultraviolet (UV) radiation causes melanoma. This study

N1N8-bis(gamma-glutamyl)spermidine cross-linking in epidermal-cell envelopes. Comparison of cross-link levels in normal and psoriatic cell envelopes.

PubMed Central

Martinet, N; Beninati, S; Nigra, T P; Folk, J E

1990-01-01

N1N8-Bis(gamma-glutamyl)spermidine was found in exhaustive proteolytic digests of isolated cell envelopes from human epidermis at levels comparable with those of epsilon-(gamma-glutamyl)lysine. Significantly higher than normal amounts of these compounds, particularly the bis(gamma-glutamyl)polyamine, were observed in envelopes from afflicted areas (scales) of psoriatic patients. These findings support the notions that N1N8-bis(gamma-glutamyl)spermidine, like epsilon-(gamma-glutamyl)lysine, functions in cell envelopes as an enzyme-generated protein cross-link and stabilizing force and that individuals with the chronic, recurrent skin disease, psoriasis, exhibit in involved epidermis abnormal cell-envelope-protein cross-linking. PMID:2241917

Double-blind trial of recombinant gamma-interferon versus placebo in the treatment of rheumatoid arthritis. 1989.

PubMed

Cannon, Grant W; Pincus, Seth H; Emkey, Ronald D; Denes, Alex; Cohen, Selwyn A; Wolfe, Frederick; Saway, P Anthony; Jaffer, Adrian M; Weaver, Arthur L; Cogen, Lewis; Schindler, John D

2008-02-01

One hundred five patients were enrolled in a 12-week, randomized, prospective, double-blind, placebo-controlled trial of recombinant human gamma-interferon (rHu gamma-IFN) for the treatment of rheumatoid arthritis. Fifty-four patients received rHu gamma-IFN and 51 received placebo. Forty-two patients in each group completed the 12-week trial. Some clinical improvement occurred in both groups of patients. Although the improvement with rHu gamma-IFN was greater than that with placebo, the differences were generally not statistically significant.

Enhanced gamma interferon responses of mouse spleen cells following immunotherapy for tuberculosis relapse.

PubMed

Gil, Olga; Vilaplana, Cristina; Guirado, Evelyn; Díaz, Jorge; Cáceres, Neus; Singh, Mahavir; Cardona, Pere-Joan

2008-11-01

Gamma interferon responses of spleen cells in mice were examined during postchemotherapy relapse of intraperitoneally induced latent tuberculous infection. The mycobacterial extract RUTI, which prevented the relapse, significantly enhanced the immune responses to secreted and structural recombinant mycobacterial antigens, suggesting that RUTI-mediated protection was mediated by activated T cells.

Evaluation of pre- and posttransplantation serum interferon-gamma and soluble CD30 for predicting liver allograft rejection.

PubMed

Kim, K H; Oh, E-J; Jung, E-S; Park, Y-J; Choi, J Y; Kim, D-G; Lee, K Y; Kang, C S

2006-06-01

The aim of the present study was to identify whether the serum interferon-gamma (IFNgamma), a Th1 cytokine, or soluble CD30 (sCD30), a marker for activation of Th2 cytokine-producing T cells, predict acute cellular rejection episodes among liver graft patients. Pretransplant and posttransplant sera from 32 living donor liver transplant recipients obtained on days 1, 3, and 7 after surgery were tested for serum IFNgamma and sCD30 concentrations using commercial enzyme-linked immunosorbent assay kits. Recipients with an acute rejection episode (ARE) (n=14) displayed significantly higher IFNgamma concentrations pretransplant than did the patients with no ARE (n=18) (P<.05). The pretransplant serum levels of sCD30 were not different between the non-ARE and ARE groups. However, in comparison with the non-ARE group, who showed steadily decreasing serum sCD30 levels after transplantation, 12 among the 14 patients in the ARE group showed increasing sCD30 levels from day 1 to day 3 after transplantation (P<.05). These results suggest that the sCD30 increment during the early period after liver transplantation affects the immune response of rejection. This observation emphasizes the clinical relevance of serum sCD30, in addition to serum IFNgamma, as predictive markers for acute liver graft rejection.

Role of gamma interferon in a neonatal mouse model of group B streptococcal disease.

PubMed Central

Cusumano, V; Mancuso, G; Genovese, F; Delfino, D; Beninati, C; Losi, E; Teti, G

1996-01-01

The aim of this study was to assess the role of gamma interferon (IFN-gamma) in a neonatal mouse model of group B streptococcal (GBS) sepsis. IFN-gamma was produced by spleen cells at 24, 48, and 72 h after GBS challenge. Treatment with anti-IFN-gamma at 6 h before challenge totally abrogated the IFN-gamma response but did not affect survival. Subcutaneous administration of recombinant IFN-gamma (2,500 IU per pup) at 18 h after challenge resulted in increased survival time and reduced blood colony counts at 48 and 72 h. In vitro preincubation of neonatal whole blood with IFN-gamma before the addition of GBS resulted in significant restriction of bacterial growth. These data indicate that administration of recombinant IFN-gamma can partially restore impaired host defenses against GBS in neonatal mice. This cytokine may be useful for the treatment of neonatal infections. PMID:8757817

Interferon Gamma potentiates the injury caused by MPP(+) on SH-SY5Y cells, which is attenuated by the nitric oxide synthases inhibition.

PubMed

Titze-de-Almeida, Simoneide S; Lustosa, Cátia Faria; Horst, Camila Hillesheim; Bel, Elaine Del; Titze-de-Almeida, Ricardo

2014-12-01

This study examined whether the cytokine interferon (IFN) gamma plays a role in the injury of SH-SY5Y cells caused by MPP(+) (1-methyl-4-phenylpyridinium). First of all, IFN-gamma sensitized cells to the neurotoxin MPP(+), as determined by MTT (3-(4,5-dimethylthiazol-2-y1)-2,5-diphenyltetrazolium bromide) assay. MPP(+)-injured cells showed higher reactive oxygen species (ROS) levels, which was reinforced by IFN-gamma. The injury triggered a marked expression of the neuronal NOS (nNOS) enzyme. L-NAME [N(ω)-nitro-L-arginine methyl ester, a non-specific NOS inhibitor] reestablished the cell viability after IFN-gamma challenging, and recovered cells from MPP(+) injury (95.0 vs. 84.7 %; P < 0.05). Seven-NI (7-nitroindazole, a nNOS inhibitor) protected cells against the injury by MPP(+) co-administered with IFN-gamma. Both inhibitors restrained the apoptosis of SH-SY5Y cells caused by MPP(+)/IFN-gamma. Regarding oxidative stress, L-NAME and 7-NI attenuated the increase in ROS levels caused by MPP(+) (45.3 or 48.4 vs. 87.9 %, P < 0.05). Indeed, L-NAME was more effective than 7-NI for reducing oxidative stress caused by MPP(+) under IFN-gamma exposition. The nNOS gene silencing by small-interfering RNAs recovered cells challenged by IFN-gamma (24 h), or MPP(+) (8 h). In conclusion, IFN-gamma sensitizes cells to MPP(+)-induced injury, also causing an increase in ROS levels. Pretreating cells with L-NAME or 7-NI reverts both the oxidative stress and apoptosis triggered by the neurotoxin MPP(+). Taking together, our data reinforce that IFN-gamma and NOS enzymes play a role in oxidative stress and dopaminergic cell death triggered by MPP(+).

Enzyme linked immunoassay with stabilized polymer saccharide enzyme conjugates

DOEpatents

Callstrom, Matthew R.; Bednarski, Mark D.; Gruber, Patrick R.

1997-01-01

An improvement in enzyme linked immunoassays is disclosed wherein the enzyme is in the form of a water soluble polymer saccharide conjugate which is stable in hostile environments. The conjugate comprises the enzyme which is linked to the polymer at multiple points through saccharide linker groups.

Enzyme linked immunoassay with stabilized polymer saccharide enzyme conjugates

DOEpatents

Callstrom, M.R.; Bednarski, M.D.; Gruber, P.R.

1997-11-25

An improvement in enzyme linked immunoassays is disclosed wherein the enzyme is in the form of a water soluble polymer saccharide conjugate which is stable in hostile environments. The conjugate comprises the enzyme which is linked to the polymer at multiple points through saccharide linker groups. 19 figs.

Effects of peritoneal fluid from endometriosis patients on interferon-gamma-induced protein-10 (CXCL10) and interleukin-8 (CXCL8) released by neutrophils and CD4+ T cells.

PubMed

Kim, Ji-Yeon; Lee, Dong-Hyung; Joo, Jong-Kil; Jin, Jun-O; Wang, Ji-Won; Hong, Young-Seoub; Kwak, Jong-Young; Lee, Kyu-Sup

2009-09-01

Intraperitoneal immuno-inflammatory changes may be associated with the pathogenesis of endometriosis. We evaluated the effects of peritoneal fluid obtained from patients with endometriosis (ePF) on the release of interferon-gamma-induced protein-10 (IP-10/CXCL10) and interleukin-8 (IL-8/CXCL8) by neutrophils, CD4(+) T cells, and monocytes. Neutrophils, CD4(+) T cells, and monocytes were cultured with ePF and the chemokine levels in the supernatants were then measured using enzyme-linked immunosorbent assay. The addition of ePF to cultures of CD4(+) T cells led to a significant increase in the release of IP-10 when compared with control PF without endometriosis (cPF). There was a positive correlation between the levels of IL-8 and IP-10 in ePF (R = 0.89, P = 0.041), but not between the levels of IP-10 and IL-8 released by neutrophils, CD4(+) T cells, and monocytes. The levels of IP-10 in ePF were positively correlated with the release of IP-10 by ePF-treated neutrophils (R = 0.89, P < 0.001), CD4(+) T cells (R = 0.93, P < 0.001), and monocytes (R = 0.70, P = 0.01). Moreover, the addition of ePF significantly enhanced the interferon-gamma-induced release of IP-10 by nuetrophils and CD4(+) T cells. These findings suggest that neutrophils and T cells release differential levels of IP-10 and IL-8 in response to stimulation with ePF, and that these cells are a major source of IP-10 in the PF of endometriosis patients.

The effect of co-administration of DNA carrying chicken interferon-gamma gene on protection of chickens against infectious bursal disease by DNA-mediated vaccination.

PubMed

Hsieh, Ming Kun; Wu, Ching Ching; Lin, Tsang Long

2006-11-17

The purpose of the present study was to determine whether DNA vaccination by co-administration of DNA coding for chicken interferon-gamma (IFN-gamma) gene and DNA encoding for the VP243 gene of IBDV could enhance immune response and protection efficacy of chickens against challenge by IBDV. Plasmids carrying VP243 gene of IBDV strain variant E (VE) (P/VP243/E) and chicken IFN-gamma gene (P/cIFN-gamma) were constructed, respectively. One-day-old chickens were intramuscularly injected with P/VP243/E, or P/cIFN-gamma, or both once, twice, or three times into the thigh muscle of one leg or the thigh muscles of two separate legs at weekly intervals. Chickens were orally challenged with IBDV strain VE at 3 weeks of age and observed for 10 days. Chickens receiving two plasmids in the same site two times had significantly higher (P<0.05) bursal lesion scores and significantly lower (P<0.05) bursa weight/body weight ratios than those that only received P/VP243/E two or three times. Chickens inoculated with two plasmids separately in the thigh muscles of different legs or P/VP243/E two times had 33-50% protection and those receiving two plasmids in the same sites did not have any protection against IBD. The enzyme-linked immunosorbent assay (ELISA) and virus neutralization (VN) titers to IBDV of chickens in the groups with three doses of P/VP243/E were significantly higher (P<0.05) than those in groups receiving two doses of P/VP243/E or P/VP243/E and P/cIFN-gamma. Chickens protected by DNA vaccination did not have detectable IBDV antigen in the bursae as determined by immunofluorescent antibody assay (IFA). The results indicated that co-administration of plasmid encoding chicken IFN-gamma gene with plasmid encoding a large segment gene of the IBDV did not enhance immune response and protection against challenge by IBDV.

Utility of an interferon-gamma release assay for latent tuberculosis diagnosis in a case of bullous pemphigoid.

PubMed

Goodfellow, Alfred; Keeling, Douglas N; Hayes, Robert C; Webster, Duncan

2009-01-01

With increasing use of immunosuppressive therapy, including tumor necrosis factor alpha inhibitors, there is concern about infectious complications, including reactivation of latent Mycobacterium tuberculosis infection. Routine testing prior to administration of systemic immunosuppression includes the tuberculin skin test, which lacks sensitivity and specificity and may be difficult to interpret in the presence of extensive cutaneous disease. Treatment of individuals with latent tuberculosis infection is recommended when immunosuppressive medications are to be employed. We report a case in which a diagnosis of latent tuberculosis infection in a patient with extensive bullous pemphigoid was clarified by the use of an interferon-gamma release assay after equivocal tuberculin skin test results. Interferon-gamma release assays are useful adjuncts to the tuberculin skin test in the diagnosis of latent tuberculosis infection in the setting of extensive cutaneous disease.

[Aerosolized recombinant interferon-gamma prevent antigen-induced eosinophil recruitment in guinea pig trachea].

PubMed

Gao, Y; Chenping; Lin, X P

1997-10-01

In order to determine whether interferon-gamma (IFN-gamma) inhibits eosinphil infiltration in the trachea of asthmatic guinea pigs induced by Rhizopus nigricans. We had administered aerosolized rIFN-gamma in the tracheas of 30 sensitized guinea pigs which had been divided into six groups, then teated animal inhaled rIFN-gamma of 5 x 10(4), 20 x 10(4), and 40 x 10(4) concentration, BDP and normal saline respectively at 24 h, 12 h, 2 h before being challenged. (1) Provocation positive rates decreased in 40 x 10(4) rIFN-gamma and BDP group compared with that in normal saline group and before intervention (P < 0.05), airway resistence decreased (P < 0.01). (2) The administration of aerosolized rIFN-gamma (40 x 10(4)) and BDP also decreased fungus-induced eosnophils but not other cells infiltration in the trachea. (3) In BALF, Eos count and ECP level were obviously lower than those in other groups. However, eosinophil numbers did not show significant change in the peripheral blood. Local administration of rIFN-gamma (40 x 10(4)) may reduce airway inflammation and intervene asthmatic attack by inhibition of Eos, ECP infiltration in airways.

Development of an aptamer beacon for detection of interferon-gamma.

PubMed

Tuleuova, Nazgul; Jones, Caroline N; Yan, Jun; Ramanculov, Erlan; Yokobayashi, Yohei; Revzin, Alexander

2010-03-01

Traditional antibody-based affinity sensing strategies employ multiple reagents and washing steps and are unsuitable for real-time detection of analyte binding. Aptamers, on the other hand, may be designed to monitor binding events directly, in real-time, without the need for secondary labels. The goal of the present study was to design an aptamer beacon for fluorescence resonance energy transfer (FRET)-based detection of interferon-gamma (IFN-gamma)--an important inflammatory cytokine. Variants of DNA aptamer modified with biotin moieties and spacers were immobilized on avidin-coated surfaces and characterized by surface plasmon resonance (SPR). The SPR studies showed that immobilization of aptamer via the 3' end resulted in the best binding IFN-gamma (K(d) = 3.44 nM). This optimal aptamer variant was then used to construct a beacon by hybridizing fluorophore-labeled aptamer with an antisense oligonucleotide strand carrying a quencher. SPR studies revealed that IFN-gamma binding with an aptamer beacon occurred within 15 min of analyte introduction--suggesting dynamic replacement of the quencher-complementary strand by IFN-gamma molecules. To further highlight biosensing applications, aptamer beacon molecules were immobilized inside microfluidic channels and challenged with varying concentration of analyte. Fluorescence microscopy revealed low fluorescence in the absence of analyte and high fluorescence after introduction of IFN-gamma. Importantly, unlike traditional antibody-based immunoassays, the signal was observed directly upon binding of analyte without the need for multiple washing steps. The surface immobilized aptamer beacon had a linear range from 5 to 100 nM and a lower limit of detection of 5 nM IFN-gamma. In conclusion, we designed a FRET-based aptamer beacon for monitoring of an inflammatory cytokine-IFN-gamma. In the future, this biosensing strategy will be employed to monitor dynamics of cytokine production by the immune cells.

Effect of gamma interferon on lung function of mustard gas exposed patients, after 15 years.

PubMed

Ghanei, Mostafa; Panahi, Yoones; Mojtahedzadeh, Mojtaba; Khalili, Ali Reza Hosseini; Aslani, Jafar

2006-01-01

Bronchiolitis has been known to be among the main the pathological features of lung lesions in Mustard Gas (MG) exposed patients. The purpose of this research was to evaluate the efficacy of interferon gamma-1b on the lung function in MG exposed patients with bronchiolitis. Thirty-six bronchiolitis patients, whose lung lesion had been diagnosed through High Resolution Computerized Tomography (HRCT) of the chest and also pathological study, were divided into two 18-member case and control groups. Both groups were receiving their conventional treatment (inhaled Felixotide and Servent). The case group were treated for 6 months with a combination of 200 microg of interferon gamma-1b (given three times per week subcutaneously) plus 7.5 mg of prednisolone (given once a day), while the control group received their previous conventional medications. Lung function was measured at base line and after 1, 3 and 6 months of treatment. In case and control groups, Forced Expiratory Volume in first second (FEV1) did not have statistical differences at the base line (49.3 +/- 2.9 and 48.7 +/- 4.1, respectively = 0.6), whereas a significant increase was seen in the case group (66.3 +/- 5.4) compared control group (57.3 +/- 8.6) at the subsequent months (P = 0.001 for the difference between the groups). Similar pattern of increase was observed in Forced Vital Capacity (FVC). The findings of this study indicate that a 6-month treatment with interferon gamma-1b plus a low-dose prednisolone is associated with an improvement in the lung function in mustard-gas exposed patients with bronchiolitis.

Interferon-gamma induces apoptosis and augments the expression of Fas and Fas ligand by microglia in vitro.

PubMed

Badie, B; Schartner, J; Vorpahl, J; Preston, K

2000-04-01

Activation of microglia by interferon-gamma (IFN-gamma) has been implicated in a number of central nervous system (CNS) inflammatory disease processes. Because IFN-gamma has also been shown to play a role in programmed cell death, we investigated its cytotoxicity and its effect on the Fas apoptotic pathway in microglia. Flow cytometry was used to quantify the IFN-gamma-mediated apoptotic response and Fas and Fas ligand (FasL) expression in two well-characterized murine microglia cell lines (BV-2 and N9). Nuclear fragmentation, suggestive of apoptosis, was noted within 24 h of incubation of microglia with IFN-gamma (10 U/ml). After a 72-h incubation, almost every BV-2 and N9 microglia, but not GL261 glioma cells, underwent cell death and detached from the culture plates. This cytotoxicity occurred even at low IFN-gamma concentrations (1 U/ml) and was inhibited by BAF, a pan-caspase inhibitor. Incubation of BV-2 and N9 microglia, but not GL261 glioma cells, with IFN-gamma also potentiated the expression of Fas and FasL in a similar dose-response and time-course manner, as seen for the apoptotic response. Whereas Fas expression increased by 100% in both microglia cells, FasL upregulation was more pronounced and increased by as much as 200% in the N9 cells. These findings suggest that in addition to its role as a microglia activator, IFN-gamma may also induce apoptosis of microglia, possibly through simultaneous upregulation of Fas and FasL. Interferon-gamma modulation of the Fas pathway and apoptosis in microglia may be important in the pathogenesis of inflammatory CNS disease processes. Copyright 2000 Academic Press.

[Adenovirus-mediated canine interferon-gamma expression and its antiviral activity against canine parvovirus].

PubMed

Zhang, Kao; Jin, Huijun; Zhong, Fei; Li, Xiujin; Neng, Changai; Chen, Huihui; Li, Wenyan; Wen, Jiexia

2012-11-04

To construct recombinant adenovirus containing canine interferon-gamma (cIFN-gamma) gene and to investigate its antiviral activity against canine parvovirus in Madin-Darby canine kidney cells (MDCK). [Methods] The cIFN-gamma gene was inserted into adenovirus shuttle plasmid to construct pShuttle3-cIFN-gamma expression vector, from which the cIFN-gamma expression cassette was transferred into the adenovirus genomic plasmid pAdeno-X by specific restriction sites to generate recombinant adenovirus genomic plasmid pAd-cIFN-gamma. The pAd-cIFN-gamma plasmid was linearized by digestion and transfected into human embryonic kidney (HEK) 293T cells to generate the replication-defective cIFN-gamma recombinant adenovirus (Ad-cIFN-gamma). To analyze its anti-canine parvovirus activity, the MDCK cells were pre-infected by Ad-cIFN-gamma recombinant adenovirus, and then infected by canine parvovirus. The antiviral activity of the Ad-cIFN-gamma recombinant adenovirus against parvovirus was analyzed. The recombinant adenovirus containing cIFN-gamma gene was constructed by the ligation method. The recombinant adenovirus could mediates recombinant cIFN-gamma secretory expression in MDCK cells. The Ad-cIFN-gamma recombinant adenovirus could significantly inhibit canine parvovirus replication in MDCK cells pre-infected with the recombinant adenovirus. These results indicate that the Ad-cIFN-gamma recombinant adenovirus has the potent antiviral activity against canine parvovirus. The Ad-cIFN-gamma recombinant adenovirus was successfully constructed by the ligation method and possessed a powerful antiviral activity against canine parvovirus.

[The expression of interferon-lambda1 in CHO cell].

PubMed

Yuan, Wu-Mei; Ma, Fen-Lian; Zhang, Qian; Zheng, Wen-Zhi; Zheng, Li-Shu

2013-06-01

To construct the eukaryotic expression vector PCI-dhfr-lambda1 and PCI-dhfr-SP163-lambda1 which linked the enhancer SP163 with interferon lambda1. Then express the interferon lambda1 in CHO (dhfr-) cells. Using PCR method to introduce the restriction enzyme sites and through the fusion PCR binding the enhancer with the interferon Lambda1. After sequenced, lambda1 and SP163-lambda1 was inserted into PCI-dhfr forming the expression vector PCI-dhfr-lambda1 and PCI-dhfr-SP163-lambda1 which was constructed successfully confirming by sequencing. Then the expressing vectors were transfected into CHO (dhfr-) cells using liposome transfection method and interferon lambda1 protein was assayed with indirect immunofluorescence and Western Blot. Using cytopathic effect inhibition evaluated the antiviral activity of interferon lambda1. Successfully constructing the eukaryotic expression vectors of interferon lambda and the vectors could express interferon lambda1. The result of immunofluorescence showed the enhancer developed the expression of interferon lambda1. Detecting the interferon lambda1 in CHO (dhfr-) cells after transfecting 48 hour using Western Blot. The cytopathic effect inhibition showed the expressed interferon lambda1 has the antiviral activity. Successfully expressed the interferon lambda1 in CHO (dhfr-) cells and the protein possesses antiviral activity, which may supply a valuable basis for building the stable cell line of interferon lambda1.

[IFN-gamma enzyme-linked immunospot assay versus PPD tuberculin skin test in the diagnosis of tuberculous epididymitis].

PubMed

Huang, Hao; Yang, Xi-Fei; Deng, Qun-Yi; Li, Bing; Liu, Guo-Hui; Zhang, Jie-Yun; Yang, Da-Fei

2012-06-01

To explore the potential application of IFN-gamma enzyme-linked immunospot (ELISPOT) assay in the diagnosis of tuberculous epididymitis (TE) by comparing ELISPOT assay with the traditional purified protein derivative (PPD) tuberculin skin test. We examined 13 TE patients using an in-house ELISPOT kit, another 11 TE patients by PPD skin testing, and 57 healthy male volunteers by parallel test with both the methods. Twelve (92.3%) of the 13 TE cases were positive on ELISPOT assay, and 10 (90.9%) of the 11 TE cases positive on PPD skin test, with no statistically significant differences between the two groups (P > 0.05). Among the 57 healthy male volunteers, 8 (14.0%) were positive on ELISPOT, and 28 (49.1%) positive on PPD test, the latter significantly higher than the former (P < 0.001). In terms of sensitivity, ELISPOT assay is similar to PPD test in the examination of tuberculous epididymitis. As for specificity, ELISPOT assay seems better than PPD test in differentiating tuberculous epididymitis patients from healthy males.

The structure and function of Alzheimer's gamma secretase enzyme complex.

PubMed

Krishnaswamy, Sudarsan; Verdile, Giuseppe; Groth, David; Kanyenda, Limbikani; Martins, Ralph N

2009-01-01

The production and accumulation of the beta amyloid protein (Abeta) is a key event in the cascade of oxidative and inflammatory processes that characterizes Alzheimer's disease (AD). A multi-subunit enzyme complex, referred to as gamma (gamma) secretase, plays a pivotal role in the generation of Abeta from its parent molecule, the amyloid precursor protein (APP). Four core components (presenilin, nicastrin, aph-1, and pen-2) interact in a high-molecular-weight complex to perform intramembrane proteolysis on a number of membrane-bound proteins, including APP and Notch. Inhibitors and modulators of this enzyme have been assessed for their therapeutic benefit in AD. However, although these agents reduce Abeta levels, the majority have been shown to have severe side effects in pre-clinical animal studies, most likely due to the enzymes role in processing other proteins involved in normal cellular function. Current research is directed at understanding this enzyme and, in particular, at elucidating the roles that each of the core proteins plays in its function. In addition, a number of interacting proteins that are not components of gamma-secretase also appear to play important roles in modulating enzyme activity. This review will discuss the structural and functional complexity of the gamma-secretase enzyme and the effects of inhibiting its activity.

Immunomodulatory Factors Galectin-9 and Interferon-Gamma Synergize to Induce Expression of Rate-Limiting Enzymes of the Kynurenine Pathway in the Mouse Hippocampus

PubMed Central

Brooks, Alexandra K.; Lawson, Marcus A.; Rytych, Jennifer L.; Yu, Kevin C.; Janda, Tiffany M.; Steelman, Andrew J.; McCusker, Robert H.

2016-01-01

Elevated levels of circulating pro-inflammatory cytokines are associated with symptomology of several psychiatric disorders, notably major depressive disorder. Symptomology has been linked to inflammation/cytokine-dependent induction of the Kynurenine Pathway. Galectins, like pro-inflammatory cytokines, play a role in neuroinflammation and the pathogenesis of several neurological disorders but without a clearly defined mechanism of action. Their involvement in the Kynurenine Pathway has not been investigated. Thus, we searched for a link between galectins and the Kynurenine Pathway using in vivo and ex vivo models. Mice were administered LPS and pI:C to determine if galectins (Gal’s) were upregulated in the brain following in vivo inflammatory challenges. We then used organotypic hippocampal slice cultures (OHSCs) to determine if Gal’s, alone or with inflammatory mediators [interferon-gamma (IFNγ), tumor necrosis factor-alpha (TNFα), interleukin-1beta (IL-1β), polyinosine-polycytidylic acid (pI:C), and dexamethasone (Dex; synthetic glucocorticoid)], would increase expression of indoleamine/tryptophan-2,3-dioxygenases (DO’s: Ido1, Ido2, and Tdo2; Kynurenine Pathway rate-limiting enzymes). In vivo, hippocampal expression of cytokines (IL-1β, TNFα, and IFNγ), Gal-3, and Gal-9 along with Ido1 and Ido2 were increased by LPS and pI:C (bacterial and viral mimetics). Of the cytokines induced in vivo, only IFNγ increased expression of two Ido1 transcripts (Ido1-FL and Ido1-v1) by OHSCs. Although ineffective alone, Gal-9 accentuated IFNγ-induced expression of only Ido1-FL. Similarly, IFNγ induced expression of several Ido2 transcripts (Ido2-v1, Ido2-v3, Ido2-v4, Ido2-v5, and Ido2-v6). Gal-9 accentuated IFNγ-induced expression of only Ido2-v1. Surprisingly, Gal-9 alone, slightly but significantly, induced expression of Tdo2 (Tdo2-v1 and Tdo2-v2, but not Tdo2-FL). These effects were specific to Gal-9 as Gal-1 and Gal-3 did not alter DO expression. These results

Intact Pneumococci Trigger Transcription of Interferon-Related Genes in Human Monocytes, while Fragmented, Autolyzed Bacteria Subvert This Response

PubMed Central

Nordén, Rickard; Martner, Anna; Samuelsson, Ebba; Hynsjö, Lars; Wold, Agnes E.

2017-01-01

ABSTRACT A peculiar trait of pneumococci (Streptococcus pneumoniae) is their propensity to undergo spontaneous lysis during stationary growth due to activation of the enzyme autolysin (LytA), which fragments the peptidoglycan cell wall. The fragments that are generated upon autolysis impair phagocytosis and reduce production of interleukin-12 (IL-12) and gamma interferon (IFN-γ) by human leukocytes in response to intact pneumococci, thereby impeding crucial host defenses. The objective was to identify additional monocyte genes whose transcription is induced by intact pneumococci and subverted by autolyzed bacteria. Monocytes were isolated from healthy blood donors and stimulated for 3 h with UV-inactivated S. pneumoniae (Rx1PLY− LytA+ strain), which is capable of autolyzing, its LytA− isogenic autolysin-deficient mutant, or a mixture of the two (containing twice the initial bacterial concentration). Gene expression was assessed by Illumina microarray, and selected findings were confirmed by reverse transcription-quantitative real-time PCR (RT-qPCR), enzyme-linked immunosorbent assay (ELISA), and flow cytometry. In all, we identified 121 genes that were upregulated to a significantly higher degree by intact than autolyzed pneumococci. These included IFNB1 and a large set of interferon-induced genes, such as IFIT3, RSAD2, CFCL1, and CXCL10 genes, as well as IL12B and CD40 genes. RT-qPCR revealed that transcription of these genes in response to intact pneumococci diminished when autolyzed pneumococci were admixed and that this pattern was independent of pneumolysin. Thus, transcription of interferon-related genes is triggered by intact pneumococci and subverted by fragments generated by spontaneous bacterial autolysis. We suggest that interferon-related pathways are important for elimination of pneumococci and that autolysis contributes to virulence by extinguishing these pathways. PMID:28223347

Interferon system in women with genital papillomavirus infection receiving immunomodulatory therapy.

PubMed

Rogovskaya, S I; Zhdanov, A V; Loginova, N S; Faizullin, L Z; Prilepskaya, V N; Van'ko, L V; Sukhikh, G T

2002-11-01

The interferon system was studied in women with genital papillomavirus infection. In most patients the interferon system was activated, while the ability of lymphocytes to respond to inductors decreased. Laserotherapy and immunomodulatory therapy with larifan, ridostin, and viferon for 1 month normalized blood interferon concentration (39.4% patients) and interferon-gamma production by lymphocytes in response to inductors (87.9% patients). After laser monotherapy these parameters returned to normal only in 13.2 and 7.6% patients, respectively. Correlation and regression analyses showed that changes in the interferon system were synchronized after immunomodulatory therapy. These data indicate that immunomodulatory therapy produces a complex effect on the interferon system. Measurements of blood interferon level can be used to predict the effect of further treatment with interferon-gamma inductors.

Thermometric enzyme linked immunosorbent assay: TELISA.

PubMed

Mattiasson, B; Borrebaeck, C; Sanfridson, B; Mosbach, K

1977-08-11

A new method, thermometric enzyme linked immunosorbent assay (TELISA), for the assay of endogenous and exogenous compounds in biological fluids is described. It is based on the previously described enzyme linked immunosorbent assay technique, ELISA, but utilizes enzymic heat formation which is measured in an enzyme thermistor unit. In the model system studied determination of human serum albumin down to a concentration of 10(-10) M (5 ng/ml) was achieved, with both normal and catalase labelled human serum albumin competing for the binding sites on the immunosorbent, which was rabbit antihuman serum albumin immobilized onto Sepharose CL-4B.

Potential mechanisms of cytosolic calcium modulation in interferon-gamma treated U937 cells

NASA Technical Reports Server (NTRS)

Klein, Jon B.; Mcleish, Kenneth R.; Sonnenfeld, Gerald; Dean, William L.

1987-01-01

The ability of interferon-gamma (IFN-gamma) to alter cytoplasmic Ca(2+) content in the monocytelike cell line U937 was investigated, using a slow Ca-channel blocker, diltiazem. In addition, the Ca-ATPase and the Ca-uptake activities were measured in isolated U937 membranes, together with the effect of inositol trisphosphate (IP3) upon the Ca(2+) release from Ca-loaded membranes. The addition of 50 U/ml INF-gamma to U937 cultures was found to increase internal Ca(2+) by about 100 percent within 3 min. The increase was significantly reduced by incubation in Ca-free buffer or by the addition of diltiazem. A crude membrane preparation from U937 cells was found to contain significant amounts of Ca-ATPase activity and to sequester Ca(2+) to a level of 8 nmol/mg in 30 sec; the addition of IP3 induced release of a portion of the sequestered Ca(2+) which was then resequestered. The results suggest that IFN-gamma causes an increase of cytoplasmic Ca(2+), in part, by the IP3-induced release from the internal storage sites and, in part, from the entry of extracellular Ca through slow channels.

Evidence for a gamma-interferon receptor that regulates macrophage tumoricidal activity

PubMed Central

1984-01-01

Gamma-interferon (IFN-gamma) is the macrophage-activating factor (MAF) produced by normal murine splenic cells and the murine T cell hybridoma 24/G1 that induces nonspecific tumoricidal activity in macrophages. Incubation of 24/G1 supernatants diluted to 8.3 IRU IFN-gamma/ml with 6 X 10(6) elicited peritoneal macrophages or bone marrow-derived macrophages for 4 h at 37 degrees C, resulted in removal of 80% of the MAF activity from the lymphokine preparation. Loss of activity appeared to result from absorption and not consumption because (a) 40% of the activity was removed after exposure to macrophage for 30 min at 4 degrees C, (b) no reduction of MAF activity was detected when the 24/G1 supernatant was incubated with macrophage culture supernatants, and (c) macrophage-treated supernatants showed a selective loss of MAF activity but not interleukin 2 (IL-2) activity. Absorption was dependent on the input of either IFN-gamma or macrophages and was time dependent at 37 degrees C but not at 4 degrees C. With four rodent species tested, absorption of murine IFN-gamma displayed species specificity. However, cultured human peripheral blood monocytes and the human histiocytic lymphoma cell line U937 were able to absorb the murine lymphokine. Although the majority of murine cell lines tested absorbed 24/G1 MAF activity, two murine macrophage cell lines, P388D1 and J774, were identified which absorbed significantly reduced amounts of natural IFN- gamma. Purified murine recombinant IFN-gamma was absorbed by elicited macrophages but not by P388D1. Normal macrophages but not P388D1 bound fluoresceinated microspheres coated with recombinant IFN-gamma and binding was inhibited by pretreatment of the normal cells with 24/G1 supernatants. Scatchard plot analysis showed that 12,000 molecules of soluble 125I-recombinant IFN-gamma bound per bone marrow macrophage with a Ka of 0.9 X 10(8) M-1. Binding was quantitatively inhibitable by natural IFN-gamma but not by murine IFN alpha. IFN

A short 2 week dose titration regimen reduces the severity of flu-like symptoms with initial interferon gamma-1b treatment.

PubMed

Devane, John G; Martin, Mary L; Matson, Mark A

2014-06-01

Flu-like symptoms (FLS) are commonly experienced by patients receiving interferon gamma-1b which may cause discontinuation or disruption of dosing during initial therapy or on re-initiation following a break in therapy. In contrast to Type I interferons, the impact of dose-titration on FLS has not been reported and is not a practice described or included in the approved prescribing information for interferon gamma-1b.The objective of this study was to assess the effect of a 2 week titration regimen on the severity of FLS during the initial 3 weeks of therapy with three times weekly subcutaneous injections of interferon gamma-1b. Healthy men and women were randomized into a double-blind, two-period, crossover study. Each study period was 3 weeks in duration and there was a minimum 15 day washout between treatment periods. Two treatment regimens were compared: No Titration dosing (full 50 mcg/m(2) subcutaneously [s.c.] three times weekly for 3 weeks) and Titration (15 mcg/m(2) s.c. three times weekly during week 1, 30 mcg/m(2) s.c. three times weekly during week 2 followed by the full dose of 50 mcg/m(2) s.c. three times weekly during week 3). Subjects remained in the clinic for at least 12 hours following each injection. FLS was based on a composite score for fever, chills, tiredness and muscle aches assessed at baseline and 4, 8 and 12 hours following each injection. Acetaminophen was allowed at the discretion of the PI. The primary endpoint was the change from baseline in FLS severity at 8 hours averaged over the 3 weeks of treatment. Additional endpoints included FLS at 4 and 12 hours, individual flu-like symptoms, rates of discontinuation, incidence of FLS and acetaminophen use. NCT 01929382. Of the 40 subjects randomized, there were 15 (37.5%) discontinuations. Titration resulted in a significant reduction in FLS severity at 8 hours (p = 0.023) averaged over the 3 week treatment period. The difference in 3 week FLS severity reflects differences

Executive Summary of the Guidelines for the Use of interferon-gamma Release Assays in the Diagnosis of Tuberculosis Infection.

PubMed

Santin, Miguel; García-García, José-María; Rigau, David; Altet, Neus; Anibarro, Luis; Casas, Irma; Díez, Nuria; García-Gasalla, Mercedes; Martínez-Lacasa, Xavier; Penas, Antón; Pérez-Escolano, Elvira; Sánchez, Francisca; Domínguez, José

2016-09-01

Interferon-gamma release assays are widely used for the diagnosis of tuberculosis infection in Spain. However, there is no consensus on their application in specific clinical scenarios. To develop a guide-line for their use, a panel of experts comprising specialists in infectious diseases, respiratory diseases, microbiology, pediatrics and preventive medicine, together with a methodologist, conducted a systematic literature search, summarized the findings, rated the quality of the evidence, and formulated recommendations following the Grading of Recommendations of Assessment Development and Evaluations methodology. This document provides evidence-based guidance on the use of interferon-gamma release assays for the diagnosis of tuberculosis infection in patients at risk of tuberculosis or suspected of having active disease. The guidelines will be applicable to specialist and primary care, and public health. Copyright © 2016 SEPAR. Publicado por Elsevier España, S.L.U. All rights reserved.

Differential effects of human interferon alpha and interferon gamma on xenografted human thyroid tissue in severe combined immunodeficient mice and nude mice.

PubMed

Kawai, K; Enomoto, T; Fornasier, V; Resetkova, E; Volpé, R

1997-03-01

We have studied the in vivo effects of human interferon alpha (IFN-alpha) and interferon gamma (IFN-gamma) administration on human thyroid tissue xenografted into two mouse strains: severe combined immunodeficient (SCID) mice and nude mice. Human lymphocytes survive in SCID mice but are lysed in nude mice. Thyroid tissues from Graves' disease or Hashimoto's thyroiditis, or paranodular [normal, (N)] tissue was xenografted into SCID mice (0.8 g/mouse) pretreated with anti-asialo GM-1 antiserum and radiation and also into nude mice. One week after xenografting, SCID and nude mice were divided into three groups. Group A was treated with IFN-alpha intraperitoneally (2,000 units/mouse) three times weekly; group B was treated with IFN-gamma similarly; group C was treated with phosphate buffered saline (PBS) only (control). Autologous human peripheral blood mononuclear cells (PBMCs) were added to mice receiving N xenografts. Blood was taken every 2 weeks for levels of IgG and thyroid antibodies (TAb). After 6 weeks of treatment, mice were sacrificed, and xenograft thyrocyte histocompatibility leukocyte antigen (HLA-DR) and intercellular adhesion molecule (ICAM-1) expression were measured. In addition, thyrocyte cultures were stimulated in vitro with 200 units/ml of either IFN-alpha or IFN-gamma or PBS (control). SCID mice xenografted with autoimmune thyroid disease (AITD) in group A showed a significantly higher TAb production than group C, whereas in group B, TAb production was not statistically increased compared to control (group C). SCID mice xenografted with N did not produce TAb in any group, nor did nude mice xenografted with AITD. Thyrocyte HLA-DR expression was markedly increased in group A and B in SCID mice xenografted with Graves' disease, Hashimoto's thyroiditis, and N tissue compared to group C. In contrast, only group B (IFN-gamma) showed an increase in thyrocyte HLA-DR in nude mice. In the in vitro studies, only IFN-gamma (not IFN-alpha) stimulated

Dual specific oral tolerance induction using interferon gamma for IgE-mediated anaphylactic food allergy and the dissociation of local skin allergy and systemic oral allergy: tolerance or desensitization?

PubMed

Noh, G; Jang, E H

2014-01-01

Specific oral tolerance induction (SOTI) for IgE-mediated food allergy (IFA) can be successfully achieved using interfero gamma (classic SOTI). In this study, a tolerable dose was introduced during tolerance induction with interferon gamma (dual SOTI), and its effectiveness was evaluated. The study population comprised 25 IFA patients. Blood samples were taken for analysis, including complete blood count with differential counts of eosinophils, serum total IgE levels, and specific IgE for allergenic foods. Skin prick tests were conducted with the allergens. Oral food challenges were performed to diagnose IFA. Ten patients received dual SOTI, 5 received classic SOTI, 5 received SOTI without interferon gamma (original SOTI), and 5 were not treated (controls). Patients treated with dual SOTI and classic SOTI using interferon gamma became tolerant to the allergenic food. The tolerable dose was introduced successfully in dual SOTI. It was difficult to proceed with the same dosing protocol used for classic SOTI in cases treated with original SOTI. Following dual SOTI, the systemic reaction to oral intake subsided, but the local skin reaction to contact with the allergenic food persisted. Dual SOTI is an improved protocol for SOTI using interferon gamma for IFA.The local skin reaction and systemic reaction to oral intake were dissociated following dual SOTI. In cases of food allergy, tolerance appears to result from desensitization to allergens.

Inhibition of interferon-gamma expression by osmotic shrinkage of peripheral blood lymphocytes.

PubMed

Lang, K S; Weigert, C; Braedel, S; Fillon, S; Palmada, M; Schleicher, E; Rammensee, H-G; Lang, F

2003-01-01

A hypertonic environment, as it prevails in renal medulla or in hyperosmolar states such as hyperglycemia of diabetes mellitus, has been shown to impair the immune response, thus facilitating the development of infection. The present experiments were performed to test whether hypertonicity influences activation of T lymphocytes. To this end, peripheral blood lymphocytes (PBL) of cytomegalovirus (CMV)-positive donors were stimulated by human leukocyte antigen (HLA)-A2-restricted CMV epitope NLVPMVATV to produce interferon (IFN)-gamma at varying extracellular osmolarity. As a result, increasing extracellular osmolarity during exposure to the CMV antigen indeed decreased IFN-gamma formation. Addition of NaCl was more effective than urea. A 50% inhibition was observed at 350 mosM by addition of NaCl. The combined application of the Ca(2+) ionophore ionomycin (1 microg/ml) and the phorbol ester phorbol 12-myristate 13-acetate (PMA; 5 microg/ml) stimulated IFN-gamma production, an effect again reversed by hyperosmolarity. Moreover, hyperosmolarity abrogated the stimulating effect of ionomycin (1 microg/ml) and PMA (5 microg/ml) on the transcription factors activator protein (AP)-1, nuclear factor of activated T cells (NFAT), and NF-kappaB but not Sp1. In conclusion, osmotic cell shrinkage blunts the stimulatory action of antigen exposure on IFN-gamma production, an effect explained at least partially by suppression of transcription factor activation.

COULD INTERFERON-GAMMA BE A THERAPEUTIC TARGET FOR TREATING HEART FAILURE?

PubMed Central

Levick, Scott P.; Goldspink, Paul H.

2013-01-01

The cytokine interferon-gamma (IFN-γ), is the only known member of the type II family of interferons, and as such, binds to its own distinct receptor. It is important in host defense against infection, as well as adaptive immune responses. Whilst a wide array of cytokines are known to be involved in adverse remodeling of the heart and the progression to heart failure, the role of IFN-γ is unclear. Recent evidence from clinical studies, animal models of myocarditis and hypertension, as well as isolated cell studies, provide conflicting data as to whether IFN-γ is pathological or protective in the heart. Thus, it is important to highlight these discrepant findings so that areas of future investigation can be identified to more clearly determine the precise role of IFN-γ in the heart. Accordingly, this review will: 1) discuss the source of IFN-γ in the diseased heart; 2) summarize the data from animal studies; 3) discuss the effects of IFN-γ on isolated cardiac fibroblasts and cardiomyocytes; 4) identify signaling mechanisms that may be invoked by IFN-γ in the heart; and 5) present the clinical evidence supporting a role for IFN-γ in heart failure. PMID:23589353

Vertebral osteomyelitis due to Aspergillus fumigatus in a patient with chronic granulomatous disease successfully treated with antifungal agents and interferon-gamma.

PubMed

Al-Tawfiq, Jaffar A; Al-Abdely, Hail M

2010-05-01

We report a case of invasive aspergillosis due to Aspergillus fumigatus involving the cervical and thoracic vertebrae and upper mediastinum of a 17 year-old Saudi male with chronic granulomatous disease (CGD). The patient did not respond to a long course of liposomal amphotericin B but did to surgical drainage and a combination of caspofungin and itraconazole with subsequent suppression with oral voriconazole. Fourteen months after the start of therapy, the patient had anterior dislocation of T2 thoracic vertebra with cord transection and quadriplegia. He was then treated intravenously with liquid itraconazole and interferon-gamma. The patient made a remarkable recovery over a 2-year period and was eventually able to walk independently. Thus, a combination of antifungals and interferon-gamma may have resulted in the positive outcome in this case.

Interleukin-12- and interferon-gamma-mediated natural killer cell activation by Agaricus blazei Murill.

PubMed

Yuminamochi, Eri; Koike, Taisuke; Takeda, Kazuyoshi; Horiuchi, Isao; Okumura, Ko

2007-06-01

Dried fruiting bodies of Agaricus blazei Murill (A. blazei) and its extracts have generally used as complementary and alternative medicines (CAMs). Here, we report that the oral administration of A. blazei augmented cytotoxicity of natural killer (NK) cells in wild-type (WT) C57BL/6, C3H/HeJ, and BALB/c mice. Augmented cytotoxicity was demonstrated by purified NK cells from treated wild-type (WT) and RAG-2-deficient mice, but not from interferon-gamma (IFN-gamma) deficient mice. NK cell activation and IFN-gamma production was also observed in vitro when dendritic cell (DC)-rich splenocytes of WT mice were coincubation with an extract of A. blazei. Both parameters were largely inhibited by neutralizing anti-interleukin-12 (IL-12) monoclonal antibody (mAb) and completely inhibited when anti-IL-12 mAb and anti-IL-18 mAb were used in combination. An aqueous extract of the hemicellulase-digested compound of A. blazei particle; (ABPC) induced IFN-gamma production more effectively, and this was completely inhibited by anti-IL-12 mAb alone. NK cell cytotoxicty was augmented with the same extracts, again in an IL-12 and IFN-gamma-dependent manner. These results clearly demonstrated that A. blazei and ABPC augmented NK cell activation through IL-12-mediated IFN-gamma production.

Production and characterization of guinea pig recombinant gamma interferon and its effect on macrophage activation.

PubMed

Jeevan, A; McFarland, C T; Yoshimura, T; Skwor, T; Cho, H; Lasco, T; McMurray, D N

2006-01-01

Gamma interferon (IFN-gamma) plays a critical role in the protective immune responses against mycobacteria. We previously cloned a cDNA coding for guinea pig IFN-gamma (gpIFN-gamma) and reported that BCG vaccination induced a significant increase in the IFN-gamma mRNA expression in guinea pig cells in response to living mycobacteria and that the virulent H37Rv strain of Mycobacterium tuberculosis stimulated less IFN-gamma mRNA than did the attenuated H37Ra strain. In this study, we successfully expressed and characterized recombinant gpIFN-gamma with a histidine tag at the N terminus (His-tagged rgpIFN-gamma) in Escherichia coli. rgpIFN-gamma was identified as an 18-kDa band in the insoluble fraction; therefore, the protein was purified under denaturing conditions and renatured. N-terminal amino acid sequencing of the recombinant protein yielded the sequence corresponding to the N terminus of His-tagged gpIFN-gamma. The recombinant protein upregulated major histocompatibility complex class II expression in peritoneal macrophages. The antiviral activity of rgpIFN-gamma was demonstrated with a guinea pig fibroblast cell line (104C1) infected with encephalomyocarditis virus. Interestingly, peritoneal macrophages treated with rgpIFN-gamma did not produce any nitric oxide but did produce hydrogen peroxide and suppressed the intracellular growth of mycobacteria. Furthermore, rgpIFN-gamma induced morphological alterations in cultured macrophages. Thus, biologically active rgpIFN-gamma has been successfully produced and characterized in our laboratory. The study of rgpIFN-gamma will further increase our understanding of the cellular and molecular responses induced by BCG vaccination in the guinea pig model of pulmonary tuberculosis.

Production of interferon-gamma by in vivo tumor-sensitized T cells: Association with active antitumor immunity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bursuker, I.; Pearce, M.T.

1990-02-01

The state of active immunity to Meth A fibrosarcoma in mice immunized with an admixture of Meth A cells and Propionibacterium acnes is associated with possession by the host of spleen cells capable of producing interferon-gamma (IFN-gamma) upon in vitro restimulation with irradiated tumor cells. The ability of spleen cells from immunized mice to produce IFN-gamma in response to irradiated Meth A cells decays as active antitumor immunity is replaced by a state of immunological memory. The IFN-producing cells are L3T4+Ly2+, cyclophosphamide-sensitive and radiosensitive T cells, as determined by their sensitivity to corresponding monoclonal antibodies and complement. The induction ofmore » IFN-gamma production by in vivo tumor-sensitized T cells is tumor specific, in that spleen cells from mice immunized against Meth A fibrosarcoma can produce IFN in response to irradiated Meth A cells but not in response to another syngeneic tumor M109 lung carcinoma.« less

Continuous in vivo infusion of interferon-gamma (IFN-gamma) enhances engraftment of syngeneic wild-type cells in Fanca-/- and Fancg-/- mice.

PubMed

Si, Yue; Ciccone, Samantha; Yang, Feng-Chun; Yuan, Jin; Zeng, Daisy; Chen, Shi; van de Vrugt, Henri J; Critser, John; Arwert, Fre; Haneline, Laura S; Clapp, D Wade

2006-12-15

Fanconi anemia (FA) is a heterogeneous genetic disorder characterized by bone marrow (BM) failure and cancer susceptibility. Identification of the cDNAs of FA complementation types allows the potential of using gene transfer technology to introduce functional cDNAs as transgenes into autologous stem cells and provide a cure for the BM failure in FA patients. However, strategies to enhance the mobilization, transduction, and engraftment of exogenous stem cells are required to optimize efficacy prior to widespread clinical use. Hypersensitivity of Fancc-/- cells to interferon-gamma (IFN-gamma), a nongenotoxic immune-regulatory cytokine, enhances engraftment of syngeneic wild-type (WT) cells in Fancc-/- mice. However, whether this phenotype is of broad relevance in other FA complementation groups is unresolved. Here we show that primitive and mature myeloid progenitors in Fanca-/- and Fancg-/- mice are hypersensitive to IFN-gamma and that in vivo infusion of IFN-gamma at clinically relevant concentrations was sufficient to allow consistent long-term engraftment of isogenic WT repopulating stem cells. Given that FANCA, FANCC, and FANCG complementation groups account for more than 90% of all FA patients, these data provide evidence that IFN-gamma conditioning may be a useful nongenotoxic strategy for myelopreparation in FA patients.

Interferon Gamma in African Trypanosome Infections: Friends or Foes?

PubMed

Wu, Hui; Liu, Gongguan; Shi, Meiqing

2017-01-01

African trypanosomes cause fatal infections in both humans and livestock. Interferon gamma (IFN-γ) plays an essential role in resistance to African trypanosomes. However, increasing evidence suggests that IFN-γ, when excessively synthesized, also induces immunopathology, enhancing susceptibility to the infection. Thus, production of IFN-γ must be tightly regulated during infections with African trypanosomes to ensure that a robust immune response is elicited without tissue destruction. Early studies have shown that secretion of IFN-γ is downregulated by interleukin 10 (IL-10). More recently, IL-27 has been identified as a negative regulator of IFN-γ production during African trypanosome infections. In this review, we discuss the current state of our understanding of the role of IFN-γ in African trypanosome infections. We have focused on the cellular source of IFN-γ, its beneficial and detrimental effects, and mechanisms involved in regulation of its production, highlighting some recent advances and offering some perspectives on future directions.

Interferon-gamma promotes the survival and Fc epsilon RI-mediated histamine release in cultured human mast cells.

PubMed Central

Yanagida, M; Fukamachi, H; Takei, M; Hagiwara, T; Uzumaki, H; Tokiwa, T; Saito, H; Iikura, Y; Nakahata, T

1996-01-01

We examined the effects of interferon-gamma (IFN-gamma) on 100% pure human mast cells generated in suspension cultures of umbilical cord blood mononuclear cells in the presence of stem cell factor (SCF) and interleukin-6 (IL-6). When mast cells were suspended in serum-free medium without any cytokine after the withdrawal of SCF and IL-6, they died over a period of 5 days because of apoptosis. IFN-gamma in the cultures suppressed apoptosis and prolonged their survival in a dose-dependent manner. This survival-promoting effect of IFN-gamma was blocked by neutralizing antibodies to IFN-gamma or to IFN-gamma receptor (IFN-gamma R). When mast cells were incubated with IFN-gamma in serum-free medium for more than 4 hr during sensitization, immunoglobulin E (IgE)/anti-IgE antibody-induced histamine release was effectively enhanced. Polymerase chain reaction (PCR) amplification of the alpha-chain of IFN-gamma R (IFN-gamma R alpha) yielded products of the correct size predicted from the sequence of the receptor. In addition, flow cytometry using anti-IFN-gamma R monoclonal antibodies (mAbs) indicated that these mast cells bear IFN-gamma R on their surface. These findings suggested that IFN-gamma activates human mast cells via specific receptors in certain aspects of inflammatory reactions. Images Figure 2 Figure 4 PMID:9014819

Interleukin-28B polymorphisms and interferon gamma inducible protein-10 serum levels in seronegative occult hepatitis C virus infection.

PubMed

Bartolomé, Javier; Castillo, Inmaculada; Quiroga, Juan Antonio; Carreño, Vicente

2016-02-01

Polymorphisms upstream interleukin (IL)-28B gene and serum levels of interferon gamma inducible protein-10 (IP-10) are associated with spontaneous and treatment-induced hepatitis C virus (HCV) clearance. Patients with seronegative occult HCV infection are anti-HCV and serum HCV-RNA negative but have viral RNA in liver and abnormal values of liver enzymes. We examined if the rs12979860 polymorphism of IL-28B and serum IP-10 levels differ between chronic and seronegative occult CV infection. IL-28B polymorphism was determined with allele specific TaqMan probes in total DNA isolated from peripheral blood mononuclear cells and IP-10 by an enzyme-linked immunosorbent assay in serum from 99 patients with seronegative occult HCV infection and 130 untreated patients with chronic hepatitis C. IL-28B genotypes were also determined in 54 healthy volunteers. Prevalence of the IL-28B CC genotype was significantly higher in seronegative occult HCV infection (52/99; 52.5%) than in chronic hepatitis C (32/130; 24.6%, P < 0.0001) or healthy controls (19/54: 32.5%, P = 0.039). Among patients with seronegative occult HCV infection, HCV-RNA load in liver was significantly lower in those with the IL-28B CC genotype than in those with CT + TT genotypes (2.8 × 10(5)  ± 5.8 × 10(4) vs. 4.1 × 10(5)  ± 5.9 × 10(4)  copies/μg of total RNA respectively; P = 0.023). Mean serum IP-10 levels were significantly lower in patients with seronegative occult HCV infection than in patients with chronic hepatitis C (160.8 ± 17.9 vs. 288.7 ± 13.3 pg/ml respectively; P < 0.0001). These findings suggest that the host immune response plays an important role in seronegative occult HCV infection in comparison with chronic hepatitis C. © 2015 Wiley Periodicals, Inc.

Equine interferon gamma synthesis in lymphocytes after in vivo infection and in vitro stimulation with EHV-1.

PubMed

Paillot, R; Daly, J M; Juillard, V; Minke, J M; Hannant, D; Kydd, J H

2005-08-22

Equine cytotoxic T lymphocyte (CTL) responses to equine herpesvirus-1 (EHV-1) are well characterised but little is known about the cytokine response after infection or vaccination. EHV-1 is common in horses and infects lymphocytes in vivo. This virus was used as a model to measure the synthesis of interferon gamma (IFN-gamma) by equine peripheral blood mononuclear cells (PBMC) after in vivo infection and/or in vitro stimulation with EHV-1. Both flow cytometry and ELISPOT assays were used to quantify equine IFN-gamma using a mouse anti-bovine IFN-gamma monoclonal antibody (clone CC302; shown to cross-react with recombinant equine IFN-gamma) and a rabbit anti-canine IFN-gamma polyclonal antibody. The percentage of PBMC synthesising IFN-gamma after in vitro stimulation with EHV-1 increased with age. In yearlings infected experimentally with EHV-1, PBMC showed two peaks of IFN-gamma synthesis, 11 and 56 days after infection. The IFN-gamma synthesis was principally associated with CD8(+) cells. The patterns of IFN-gamma synthesis detected by intracellular IFN-gamma staining or ELISPOT were compared with CTL data and shown to be similar. These methods were also applied successfully to frozen samples of PBMC. Measurement of equine IFN-gamma using these simple techniques can now be applied to future studies on protective cellular immune responses following virus infection and/or vaccination of horses.

Pilot study of whole-blood gamma interferon response to the Vibrio cholerae toxin B subunit and resistance to enterotoxigenic Escherichia coli-associated diarrhea.

PubMed

Flores, Jose; DuPont, Herbert L; Paredes-Paredes, Mercedes; Aguirre-Garcia, M Magdalena; Rojas, Araceli; Gonzalez, Alexei; Okhuysen, Pablo C

2010-05-01

Enterotoxigenic Escherichia coli (ETEC), which produces heat-labile toxin (LT), is a common cause of travelers' diarrhea (TD). The B subunit of ETEC LT is immunologically related to the B subunit of Vibrio cholerae toxin (CT). In this pilot study we evaluated the whole-blood gamma interferon response to CT B in 17 U.S. adults traveling to Mexico. Only one of nine subjects who demonstrated a cellular immune response as determined by whole-blood gamma interferon production to CT B on arrival to Mexico developed diarrhea, whereas five of eight without a cellular response developed diarrhea. Markers of the cellular immune response to ETEC LT could help in identifying individuals immune to ETEC LT, and these markers deserve additional study.

Evaluation of a computer-assisted, kinetics-based enzyme-linked immunosorbent assay for detection of coronavirus antibodies in cats.

PubMed Central

Barlough, J E; Jacobson, R H; Downing, D R; Marcella, K L; Lynch, T J; Scott, F W

1983-01-01

A computer-assisted, kinetics-based enzyme-linked immunosorbent assay was adapted for the detection of coronavirus antibodies in feline serum. An alkaline antigen diluent (carbonate-bicarbonate buffer, pH 9.6) used in initial experiments produced diffuse, nonspecific color reactions in both viral and control antigen cuvettes which were correlated, paradoxically, with coronavirus antibody levels in test sera. These interfering reactions were minimized by use of lower-pH antigen diluents such as water and phosphate-buffered saline. Background kinetics-based enzyme-linked immunosorbent assay reactivity directed against a noncoronaviral component of antigen tissue culture fluids could then detected in numerous sera, particularly in samples with lower titers. Much of this reactivity was shown to be associated with bovine gamma globulins in cell culture fluid. It was not serum lot or species specific, since a variety of bovine serum lots as well as individual lots of serum from other mammalian and avian species reacted. Reactivity was markedly reduced when cells for antigen preparation were grown in gamma globulin-free bovine serum. Generation of corrected slope values from the kinetics-based enzyme-linked immunosorbent assay made it possible to correct for residual background reactivity in individual test sera and thus eliminate a potentially major source of false-positive reactions. Collectively, these studies indicated that the control of nonspecific reactivity in feline coronavirus serology is absolutely essential to obtain useful estimates of specific antibody responses. PMID:6300184

Evaluation of a computer-assisted, kinetics-based enzyme-linked immunosorbent assay for detection of coronavirus antibodies in cats.

PubMed

Barlough, J E; Jacobson, R H; Downing, D R; Marcella, K L; Lynch, T J; Scott, F W

1983-02-01

A computer-assisted, kinetics-based enzyme-linked immunosorbent assay was adapted for the detection of coronavirus antibodies in feline serum. An alkaline antigen diluent (carbonate-bicarbonate buffer, pH 9.6) used in initial experiments produced diffuse, nonspecific color reactions in both viral and control antigen cuvettes which were correlated, paradoxically, with coronavirus antibody levels in test sera. These interfering reactions were minimized by use of lower-pH antigen diluents such as water and phosphate-buffered saline. Background kinetics-based enzyme-linked immunosorbent assay reactivity directed against a noncoronaviral component of antigen tissue culture fluids could then detected in numerous sera, particularly in samples with lower titers. Much of this reactivity was shown to be associated with bovine gamma globulins in cell culture fluid. It was not serum lot or species specific, since a variety of bovine serum lots as well as individual lots of serum from other mammalian and avian species reacted. Reactivity was markedly reduced when cells for antigen preparation were grown in gamma globulin-free bovine serum. Generation of corrected slope values from the kinetics-based enzyme-linked immunosorbent assay made it possible to correct for residual background reactivity in individual test sera and thus eliminate a potentially major source of false-positive reactions. Collectively, these studies indicated that the control of nonspecific reactivity in feline coronavirus serology is absolutely essential to obtain useful estimates of specific antibody responses.

CD4 T lymphocytes from patients with chronic fatigue syndrome have decreased interferon-gamma production and increased sensitivity to dexamethasone.

PubMed

Visser, J; Blauw, B; Hinloopen, B; Brommer, E; de Kloet, E R; Kluft, C; Nagelkerken, L

1998-02-01

A disturbed hypothalamus-pituitary-adrenal gland axis and alterations at the immune system level have been observed in patients with chronic fatigue syndrome (CFS). Glucocorticoids are known to modulate T cell responses; therefore, purified CD4 T cells from CFS patients were studied to determine whether they have an altered sensitivity to dexamethasone (DEX). CD4 T cells from CFS patients produced less interferon-gamma than did cells from controls; by contrast, interleukin-4 production and cell proliferation were comparable. With CD4 T cells from CFS patients (compared with cells from controls), a 10- to 20-fold lower DEX concentration was needed to achieve 50% inhibition of interleukin-4 production and proliferation, indicating an increased sensitivity to DEX in CFS patients. Surprisingly, interferon-gamma production in patients and controls was equally sensitive to DEX. A differential sensitivity of cytokines or CD4 T cell subsets to glucocorticoids might explain an altered immunologic function in CFS patients.

Effects of type I/type II interferons and transforming growth factor-beta on B-cell differentiation and proliferation. Definition of costimulation and cytokine requirements for immunoglobulin synthesis and expression.

PubMed

Estes, D M; Tuo, W; Brown, W C; Goin, J

1998-12-01

In this report, we sought to determine the role of selected type I interferons [interferon-alpha (IFN-alpha) and interferon-tau (IFN-tau)], IFN-gamma and transforming growth factor-beta (TGF-beta) in the regulation of bovine antibody responses. B cells were stimulated via CD40 in the presence or absence of B-cell receptor (BCR) cross-linking. IFN-alpha enhanced IgM, IgG2 and IgA responses but did not enhance IgG1 responses. BCR signalling alone was more effective at inducing IgG2 responses with IFN-alpha than dual cross-linking with CD40. Recombinant ovine IFN-tau was less effective at inducing IgG2 responses when compared with IFN-alpha, though IgA responses were similar in magnitude following BCR cross-linking. At higher concentrations, IFN-tau enhanced IgA responses greater than twofold over the levels observed with IFN-alpha. Previous studies have shown that addition of IFN-gamma to BCR or pokeweed mitogen-activated bovine B cells stimulates IgG2 production. However, following CD40 stimulation alone, IFN-gamma was relatively ineffective at stimulating high-rate synthesis of any non-IgM isotype. Dual cross-linking via CD40 and the BCR resulted in decreased synthesis of IgM with a concomitant increase in IgA and similar levels of IgG2 production to those obtained via the BCR alone. We also assessed the effects of endogenous and exogenous TGF-beta on immunoglobulin synthesis by bovine B cells. Exogenous TGF-beta stimulates both IgG2 and IgA production following CD40 and BCR cross-linking in the presence of IL-2. Blocking endogenous TGF-beta did not inhibit the up-regulation of IgG2 or IgA by interferons.

Mycobacterium avium Complex Empyema in a Patient with Interferon Gamma Autoantibodies

PubMed Central

Chung, Heath H; Opal, Steven M; Dworkin, Jonathan D

2014-01-01

Interferon gamma (IFN-γ) autoantibodies are a relatively recently discovered clinical entity, which have been shown to be associated with disseminated non-tuberculous mycobacterial (NTM) infections and other opportunistic infections. Interestingly, isolated NTM infections (without disseminated NTM infection) have not been shown to be a good predictor of the presence of IFN-γ autoantibodies. This case describes an isolated NTM empyema in a patient with IFN-γ autoantibodies and makes the argument that the development of an NTM empyema in a patient with no known immunodeficiency should prompt consideration for IFN-γ testing. Additionally, this case underscores the importance for clinicians to recognize that an unusual infection without the typical cause of impairment in immunity should prompt a more thorough investigation of the patient's immune system. PMID:25285250

Development of a lion-specific interferon-gamma assay.

PubMed

Maas, M; van Kooten, P J S; Schreuder, J; Morar, D; Tijhaar, E; Michel, A L; Rutten, V P M G

2012-10-15

The ongoing spread of bovine tuberculosis (BTB) in African free-ranging lion populations, for example in the Kruger National Park, raises the need for diagnostic assays for BTB in lions. These, in addition, would be highly relevant for zoological gardens worldwide that want to determine the BTB status of their lions, e.g. for translocations. The present study concerns the development of a lion-specific IFN-γ assay, following the production and characterization of monoclonal antibodies specific for lion interferon-gamma (IFN-γ). Recombinant lion IFN-γ (rLIFN-γ) was produced in mammalian cells and used to immunize mice to establish hybridoma cell lines producing monoclonal antibodies. These were used to develop a sensitive, lion IFN-γ-specific capture ELISA, able to detect rLIFN-γ to the level of 160 pg/ml. Recognition of native lion IFN-γ was shown in an initial assessment of supernatants of mitogen stimulated whole blood cultures of 11 known BTB-negative lions. In conclusion, the capture ELISA shows potential as a diagnostic assay for bovine tuberculosis in lions. Preliminary results also indicate the possible use of the test for other (feline) species. Copyright © 2012 Elsevier B.V. All rights reserved.

Graft-versus-host disease causes failure of donor hematopoiesis and lymphopoiesis in interferon-gamma receptor-deficient hosts.

PubMed

Delisle, Jean-Sébastien; Gaboury, Louis; Bélanger, Marie-Pier; Tassé, Eliane; Yagita, Hideo; Perreault, Claude

2008-09-01

The immunopathologic condition known as graft-versus-host disease (GVHD) results from a type I T-cell process. However, a prototypical type I cytokine, interferon-gamma (IFN-gamma), can protect against several manifestations of GVHD in recipients of major histocompatibility complex (MHC)-mismatched hematopoietic cells. We transplanted hematopoietic cells from C3H.SW donors in wild-type (wt) and IFN-gamma-receptor-deficient (IFN-gammaRKO) MHC-matched C57BL/6 recipients. In IFN-gammaRKO recipients, host cells were unresponsive to IFN-gamma, whereas wt donor cells were exposed to exceptionally high levels of IFN-gamma. From an IFN-gamma perspective, we could therefore evaluate the impact of a loss-of-function on host cells and gain-of-function on donor cells. We found that lack of IFN-gammaR prevented up-regulation of MHC proteins on host cells but did not mitigate damage to most target organs. Two salient phenotypes in IFN-gammaRKO recipients involved donor cells: lymphoid hypoplasia and hematopoietic failure. Lymphopenia was due to FasL-induced apoptosis and decreased cell proliferation. Bone marrow aplasia resulted from a decreased proliferation of hematopoietic stem/progenitor cells that was associated with down-regulation of 2 genes negatively regulated by IFN-gamma: Ccnd1 and Myc. We conclude that IFN-gamma produced by alloreactive T cells may entail a severe graft-versus-graft reaction and could be responsible for cytopenias that are frequently observed in subjects with GVHD.

Biosynthesis and N-glycosylation of human interferon-gamma. Asn25 and Asn97 differ markedly in how efficiently they are glycosylated and in their oligosaccharide composition.

PubMed

Sareneva, T; Mørtz, E; Tölö, H; Roepstorff, P; Julkunen, I

1996-12-01

Interferon-gamma (IFN-gamma) is a secretory glycoprotein produced by T cells in response to antigenic or mitogenic stimuli. We studied the kinetics of the synthesis, N-glycosylation, and secretion of IFN-gamma in human CD8+ T lymphocytes stimulated via T-cell receptor. Highly elevated IFN-gamma mRNA levels were found as early as 1 h after stimulation. Maximal IFN-gamma protein synthesis was observed 2-4 h after induction and appeared to correlate to steady-state IFN-gamma mRNA levels. As analyzed by pulse/chase experiments, the secretion of IFN-gamma from T cells was very rapid, the secretion half-time being approximately 20-25 min. Inhibition of N-glycosylation by tunicamycin dramatically reduced the expression of IFN-gamma, but did not block its secretion. Natural IFN-gamma is heterogeneously glycosylated and doubly, singly, and unglycosylated forms exist. Experiments performed in a cell-free translation/glycosylation system with mutated IFN-gamma constructs lacking either one of the potential glycosylation sites suggested that Asn25 is more efficiently glycosylated than Asn97. Site-specific oligosaccharide analysis of natural IFN-gamma by glycosidase treatment followed by matrix-assisted-laser-desorption-ionization mass spectrometry revealed considerable variation in the carbohydrate structures, with more than 30 different forms. The glycans at Asn25 consisted of fucosylated, mainly complex-type oligosaccharides, whereas the glycans at Asn97 were more heterogeneous, with hybrid and high-mannose structures. Our results emphasize the essential role of N-linked glycans in the biology of IFN-gamma and show that there is a considerable heterogeneity in the individual sugar chains of this important human cytokine.

Ex-vivo whole blood secretion of interferon (IFN)-γ and IFN-γ-inducible protein-10 measured by enzyme-linked immunosorbent assay are as sensitive as IFN-γ enzyme-linked immunospot for the detection of gluten-reactive T cells in human leucocyte antigen (HLA)-DQ2·5+-associated coeliac disease

PubMed Central

Ontiveros, N; Tye-Din, J A; Hardy, M Y; Anderson, R P

2014-01-01

T cell cytokine release assays are used to diagnose infectious diseases, but not autoimmune or allergic disease. Coeliac disease (CD) is a common T cell-mediated disease diagnosed by the presence of gluten-dependent intestinal inflammation and serology. Many patients cannot be diagnosed with CD because they reduce dietary gluten before medical workup. Oral gluten challenge in CD patients treated with gluten-free diet (GFD) mobilizes gluten-reactive T cells measurable by interferon (IFN)-γ enzyme-linked immunospot (ELISPOT) or major histocompatibility complex (MHC) class II tetramers. Immunodominant peptides are quite consistent in the 90% of patients who possess HLA-DQ2·5. We aimed to develop whole blood assays to detect gluten-specific T cells. Blood was collected before and after gluten challenge from GFD donors confirmed to have CD (n = 27, all HLA-DQ2·5+), GFD donors confirmed not to have CD (n = 6 HLA-DQ2·5+, 11 HLA-DQ2·5−) and donors with CD not following GFD (n = 4, all HLA-DQ2·5+). Plasma IFN-γ and IFN-γ inducible protein-10 (IP-10) were measured by enzyme-linked immunosorbent assay (ELISA) after whole blood incubation with peptides or gliadin, and correlated with IFN-γ ELISPOT. No T cell assay could distinguish between CD patients and controls prior to gluten challenge, but after gluten challenge the whole blood IFN-γ ELISA and the ELISPOT were both 85% sensitive and 100% specific for HLA-DQ2·5+ CD patients; the whole blood IP-10 ELISA was 94% sensitive and 100% specific. We conclude that whole blood cytokine release assays are sensitive and specific for detection of gluten-reactive T cells in CD; further clinical studies addressing the utility of these tests in patients with an uncertain diagnosis of CD is warranted. PMID:24192268

DNA polymerase-α regulates type I interferon activation through cytosolic RNA:DNA synthesis

PubMed Central

Starokadomskyy, Petro; Gemelli, Terry; Rios, Jonathan J.; Xing, Chao; Wang, Richard C.; Li, Haiying; Pokatayev, Vladislav; Dozmorov, Igor; Khan, Shaheen; Miyata, Naoteru; Fraile, Guadalupe; Raj, Prithvi; Xu, Zhe; Xu, Zigang; Ma, Lin; Lin, Zhimiao; Wang, Huijun; Yang, Yong; Ben-Amitai, Dan; Orenstein, Naama; Mussaffi, Huda; Baselga, Eulalia; Tadini, Gianluca; Grunebaum, Eyal; Sarajlija, Adrijan; Krzewski, Konrad; Wakeland, Edward K.; Yan, Nan; de la Morena, Maria Teresa; Zinn, Andrew R.; Burstein, Ezra

2016-01-01

Aberrant nucleic acids generated during viral replication are the main trigger for antiviral immunity, and mutations disrupting nucleic acid metabolism can lead to autoinflammatory disorders. Here we investigated the etiology of X-linked reticulate pigmentary disorder (XLPDR), a primary immunodeficiency with autoinflammatory features. We discovered that XLPDR is caused by an intronic mutation that disrupts expression of POLA1, the gene encoding the catalytic subunit of DNA polymerase-α. Unexpectedly, POLA1 deficiency results in increased type I interferon production. This enzyme is necessary for RNA:DNA primer synthesis during DNA replication and strikingly, POLA1 is also required for the synthesis of cytosolic RNA:DNA, which directly modulates interferon activation. Altogether, this work identified POLA1 as a critical regulator of the type I interferon response. PMID:27019227

The Effectiveness of Screening with Interferon-Gamma Release Assays in a University Health Care Setting with a Diverse Global Population

ERIC Educational Resources Information Center

Birch, Samantha J.; Golbeck, Amanda L.

2015-01-01

Objective: This analysis examined the effectiveness of utilizing interferon-gamma release assay (IGRA) technology in a TB (TB) screening program at a university. Participants: Participants were 2299 students at a Montana university who had presented to the university health center for TB screening during 2012 and 2013. Methods: A retrospective…

Interferon-Gamma and Fas Are Involved in Porphyromonas gingivalis-Induced Apoptosis of Human Extravillous Trophoblast-Derived HTR8/SVneo Cells via Extracellular Signal-Regulated Kinase 1/2 Pathway.

PubMed

Ren, Hongyu; Li, Yuhong; Jiang, Han; Du, Minquan

2016-11-01

A number of studies recently revealed a link between periodontal disease and preterm birth (PTB). PTB can be induced by dental infection with Porphyromonas gingivalis (Pg), a periodontopathic bacterium. This study aims to investigate responses of human extravillous trophoblast-derived HTR8/SVneo cells to Pg infection. Cell apoptosis, cell viability, protein expression, and cytokine production in HTR8 cells were measured via: 1) flow cytometry, 2) CCK-8 assay, 3) western blot, and 4) enzyme-linked immunosorbent assay methods, respectively. Pg decreased cell viability and increased cell apoptosis, active caspase-3 and Fas expression, and interferon-gamma (IFN-γ) secretion in HTR8 cells. Extracellular signal-regulated kinase (ERK) 1/2 inhibitor U0126 and FasL neutralizing antibody NOK1 that blocks FasL/Fas interaction both significantly suppressed Pg-induced apoptosis. U0126 also inhibited IFN-γ secretion and Fas expression close to control levels. Moreover, treatment with recombinant IFN-γ also significantly decreased number of viable HTR8 cells and increased Fas expression, suggesting IFN-γ may play an important role in Pg-induced apoptosis of HTR8 cells, at least partially through regulation of Fas expression. To the best of the authors' knowledge, this is the first study to demonstrate Pg induces IFN-γ secretion, Fas expression, and apoptosis in human extravillous trophoblast-derived HTR8/SVneo cells in an ERK1/2-dependent manner, and IFN-γ (explored by recombinant IFN-γ) and Fas are involved in Pg-induced apoptosis. The finding that Pg infection abnormally regulates inflammation and apoptosis of human trophoblasts may give new insights into the possible link of PTB with maternal periodontal disease and periodontal pathogens.

Dysregulation of Serum Gamma Interferon Levels in Vascular Chronic Q Fever Patients Provides Insights into Disease Pathogenesis

PubMed Central

Kremers, Marjolein N. T.; Hodemaekers, Hennie M.; Hagenaars, Julia C. J. P.; Koning, Olivier H. J.; Renders, Nicole H. M.; Hermans, Mirjam H. A.; de Klerk, Arja; Notermans, Daan W.; Wever, Peter C.; Janssen, Riny

2015-01-01

A large community outbreak of Q fever occurred in the Netherlands in the period 2007 to 2010. Some of the infected patients developed chronic Q fever, which typically includes pathogen dissemination to predisposed cardiovascular sites, with potentially fatal consequences. To identify the immune mechanisms responsible for ineffective clearance of Coxiella burnetii in patients who developed chronic Q fever, we compared serum concentrations of 47 inflammation-associated markers among patients with acute Q fever, vascular chronic Q fever, and past resolved Q fever. Serum levels of gamma interferon were strongly increased in acute but not in vascular chronic Q fever patients, compared to past resolved Q fever patients. Interleukin-18 levels showed a comparable increase in acute as well as vascular chronic Q fever patients. Additionally, vascular chronic Q fever patients had lower serum levels of gamma interferon-inducible protein 10 (IP-10) and transforming growth factor β (TGF-β) than did acute Q fever patients. Serum responses for these and other markers indicate that type I immune responses to C. burnetii are affected in chronic Q fever patients. This may be attributed to an affected immune system in cardiovascular patients, which enables local C. burnetii replication at affected cardiovascular sites. PMID:25924761

Ionizing radiation potentiates the induction of nitric oxide synthase by interferon-gamma (Ifn-gamma) or Ifn-gamma and lipopolysaccharide in bnl cl.2 murine embryonic liver cells: role of hydrogen peroxide.

PubMed

Yoo, J C; Pae, H O; Choi, B M; Kim, W I; Kim, J D; Kim, Y M; Chung, H T

2000-02-01

The effects of ionizing irradiation on the nitric oxide (NO) production in murine embryonic liver cell line, BNL CL.2 cells, were investigated. Various doses (5-40 Gy) of radiation made BNL CL.2 cells responsive to interferon-gamma alone for the production of NO in a dose-dependent manner. Small amounts of lipopolysaccharide (LPS) or tumor necrosis factor-alpha (TNF-alpha) synergized with IFN-gamma in the production of NO from irradiated BNL CL.2 cells, even though LPS or TNF-alpha alone did not induce NO production from the same cells. Immunoblots showed parallel induction of inducible nitric oxide synthase (iNOS). NO production in irradiated BNL CL.2 cells by IFN-gamma or IFN-gamma plus LPS was decreased by the addition of catalase, suggesting that H(2)O(2) produced by ionizing irradiation primed the cells to trigger NO production in response to IFN-gamma or IFN-gamma plus LPS. Furthermore, the treatment of nongamma-irradiated BNL CL.2 cells with H(2)O(2) made the cells responsive to IFN-gamma or IFN-gamma plus LPS for the production of NO. This study shows that ionizing irradiation has the ability to induce iNOS gene expression in responsive to IFN-gamma via the formation of H(2)O(2) in BNL CL.2 murine embryonic liver cells.

Features of Postoperative Immune Suppression Are Reversible With Interferon Gamma and Independent of Interleukin-6 Pathways.

PubMed

Longbottom, E Rebecca; Torrance, Hew D T; Owen, Helen C; Fragkou, Paraskevi C; Hinds, Charles J; Pearse, Rupert M; O'Dwyer, Michael J

2016-08-01

The aim of this study was to evaluate the role of interleukin (IL)-6 pathways in postoperative immune suppression and to assess the reversibility of this phenomenon. The postoperative period is characterized by increased IL-6 production and features of immune suppression. In vitro, IL-6 mediates anti-inflammatory effects through inhibition of interferon gamma (IFN-γ) pathways. The significance of the immunomodulatory effects of IL-6 in the clinical setting of postoperative immune suppression remains unclear. Patients over 45 years old undergoing elective surgery, involving the gastrointestinal tract, were recruited. IL-6 levels were assayed using an enzyme linked immunosorbent assay preoperatively, and at 24 and 48 hours. Peripheral blood mononuclear cells from healthy volunteers were cultured in perioperative serum and CD14Human Leukocyte Antigen-DR (HLA-DR) [monocyte HLA-DR (mHLA-DR)] geometric mean florescent intensity was measured in the presence and absence of IL-6 neutralizing antibody and recombinant IFN-γ. Of the 108 patients, 41 developed a postoperative infection. The IL-6 levels increased 19-fold from the preoperative sample to 24 hours postoperatively (P < 0.0001). Higher IL-6 levels at 24 (P = 0.0002) and 48 hours (P = 0.003) were associated with subsequent postoperative infectious complications. mHLA-DR mean florescent intensity fell when healthy peripheral blood mononuclear cells were cultured with postoperative serum compared with preoperative serum (P = 0.008). This decrease was prevented by the presence of IFN-γ in the culture media, but not by the presence of IL-6-neutralizing antibody. IL-6 levels increase after a major surgery and are associated with an increased susceptibility to postoperative infections. Serum obtained from postoperative patients induces an immunosuppressive response, reflected in reduced mHLA-DR levels, mediated through IL-6 independent pathways and is reversible with IFN-γ. These data may have

Heterogeneity within populations of recombinant Chinese hamster ovary cells expressing human interferon-gamma.

PubMed

Coppen, S R; Newsam, R; Bull, A T; Baines, A J

1995-04-20

The Chinese hamster ovary (CHO) cell line has great commercial importance in the production of recombinant human proteins, especially those for therapeutic use. Much attention has been paid to CHO cell population physiology in order to define factors affecting product fidelity and yield. Such studies have revealed that recombinant proteins, including human interferon-gamma (IFN-gamma), can be heterogeneous both in glycosylation and in proteolytic processing. The type of heterogeneity observed depends on the growth physiology of the cell population, although the relationship between them is complex. In this article we report results of a cytological study of the CHO320 line which expresses recombinant human IFN-gamma. When grown in suspension culture, this cell line exhibited three types of heterogeneity: (1) heterogeneity of the production of IFN-gamma within the cell population, (2) heterogeneity of the number of nuclei and mitotic spindles in dividing cells, and (3) heterogeneity of cellular environment. The last of these arises from cell aggregates which form in suspension culture: Some cells are exposed to the culture medium; others are fully enclosed within the mass with little or no direct access to the medium. Thus, live cells producing IFN-gamma are heterogeneous in their environment, with variable access to O(2) and nutrients. Within the aggregates, it appears that live cells proliferate on a dead cell mass. The layer of live cells can be several cells deep. Specific cell-cell attachments are observed between the living cells in these aggregates. Two proteins, known to be required for the formation of certain types of intercellular junctions, spectrin and vinculin, have been localized to the regions of cell-cell contact. The aggregation of the cells appears to be an active process requiring protein synthesis. (c) 1995 John Wiley & Sons, Inc.

Inhibited interferon production after space flight

NASA Technical Reports Server (NTRS)

Sonnenfeld, G.; Gould, C. L.; Williams, J.; Mandel, A. D.

1988-01-01

Several studies have been performed in our laboratories indicating that interferon production may be impaired in rodents after space flight. Using an antiorthostatic suspension model that simulates some of the effects of microgravity seen during space flight, we have shown that interferon-alpha/beta production was inhibited. The inhibition was not due solely to the stress of suspension. The inhibited interferon production was transient, as suspended animals returned to normal caging recovered the ability to produce interferon. Antiorthostatic suspension of mice also resulted in a loss of resistance to infection with the diabetogenic strain of encephalomyocarditis virus, which correlated with the drop in interferon production. In rats flown in US Space Shuttle mission SL-3, interferon-gamma production was inhibited severely when spleen cells were challenged with concanavalin-A upon return to earth. In contrast, interleukin-3 production by these cells was normal. These results suggest that immune responses may be altered after antiorthostatic modeling or space flight, and the resistance to viral infections may be especially affected.

Mice with Pulmonary Tuberculosis Treated with Mycobacterium vaccae Develop Strikingly Enhanced Recall Gamma Interferon Responses to M. vaccae Cell Wall Skeleton▿

PubMed Central

Rodríguez-Güell, Elisabeth; Agustí, Gemma; Corominas, Mercè; Cardona, Pere-Joan; Luquin, Marina; Julián, Esther

2008-01-01

Whole heat-killed Mycobacterium vaccae is used as an immunotherapeutic agent in tuberculosis (TB), but the compound(s) that triggers its immunostimulatory ability is not known. Here, we show that among different subcellular fractions, the cell wall skeleton induced a prominent expression of gamma interferon in splenocytes from both non-TB and TB M. vaccae-treated mice. PMID:18337379

Reversal in fatigued athletes of a defect in interferon gamma secretion after administration of Lactobacillus acidophilus.

PubMed

Clancy, R L; Gleeson, M; Cox, A; Callister, R; Dorrington, M; D'Este, C; Pang, G; Pyne, D; Fricker, P; Henriksson, A

2006-04-01

Fatigue and impaired performance in athletes is well recognised and has been loosely linked to "overtraining". Reduced concentration of IgA in the saliva and increased shedding of Epstein Barr virus (EBV) have been associated with intense training in elite athletes. To determine whether athletes presenting with fatigue and impaired performance had an immune defect relevant to defective containment of EBV infection, and whether a probiotic preparation (Lactobacillus acidophilus) shown to enhance mucosal immunity in animal models could reverse any detected abnormality. The fatigued athletes had clinical characteristics consistent with re-activation of EBV infection and significantly (p = 0.02) less secretion of interferon (IFN) gamma from blood CD4 positive T cells. After one month of daily capsules containing 2 x 10(10) colony forming units of L acidophilus, secretion of IFNgamma from T cells had increased significantly (p = 0.01) to levels found in healthy control athletes. A significant (p = 0.03) increase in salivary IFNgamma concentrations in healthy control athletes after the one month course of L acidophilus demonstrated in man the capacity for this probiotic to enhance the mucosal IFNgamma concentration. This is the first evidence of a T cell defect in fatigued athletes, and of its reversal following probiotic therapy.

[Regulating human interferon-gamma gene expression in marrow stromal cells in mice by Tet-off system].

PubMed

Qin, Xin-Tian; Lu, Yue; Tan, Yin-Duo; Chen, Xiao-Qin; Gen, Qi-Rong

2008-01-01

We have constructed plasmid "pTre-IFN-gamma" and proved that the Tet-off system could regulate the expression of human interferon-gamma (IFN-gamma) gene in murine marrow stromal cells in vitro. This study was to investigate the regulatory reversibility of Tet-off system and its effect on the expression of human IFN-gamma gene in murine marrow stromal cells in mice. Plasmids pTet-off and pTre-IFN-gamma were co-transfected into murine marrow stromal cells. The expression of IFN-gamma in marrow stromal cells was detected with ELISA. The marrow stromal cells were transfused into BABL/c naked mice after co-transfection. The expression of IFN-gamma mRNA in the spleen was detected by real-time fluorescent quantitative reverse transcription-polymerase chain reaction (RT-PCR). IFN-gamma protein was detected in the culture solution of marrow stromal cells after co-transfection. The secretion peak appeared within the first 72 h. The protein level of IFN-gamma was significantly lower in 300 ng/ml tetracycline hydrochloride-treated marrow stroma cells than in untreated cells [(67.11+/-22.14) pg/1 x 10(7) cells vs. (319.96+/-29.04) pg/1 x 10(7) cells, P<0.001]; its expression was increased when removed tetracycline hydrochloride (P=0.032). The expression of human IFN-gamma mRNA was detected in the spleen. The mRNA level of IFN-gamma was significantly higher in untreated group than in continuous tetracycline hydrochloride-treated group [(1.5+/-0.7)x10(5) copies . (100 mg)(-1) vs. (6.9+/-5.3)x10(2) copies . (100 mg)(-1), P<0.001]; its expression in the mice received tetracycline hydrochloride for one single time lay between the above two groups with significant difference. In mice, Tet-off system could rapidly, efficiently and reversibly regulate the expression of human IFN-gamma gene in marrow stromal cells in vitro and in vivo.

Interleukin-4 but not gamma interferon production correlates with the severity of murine cutaneous leishmaniasis.

PubMed Central

Morris, L; Troutt, A B; McLeod, K S; Kelso, A; Handman, E; Aebischer, T

1993-01-01

For murine cutaneous leishmaniasis, data to date suggest a correlation between the presence of gamma interferon (IFN-gamma) and resistance in C57BL/6 mice and the presence of interleukin-4 (IL-4) and disease in BALB/c mice. In this study, 13 inbred strains of mice covering the range of susceptibility to disease were infected with Leishmania major to determine whether the subsequent expression of IFN-gamma or IL-4 is a reliable indicator of cure or progressive disease. The presence of IL-4 and IFN-gamma mRNAs in the draining lymph nodes was examined 9 weeks after infection, when differences in disease severity became obvious. There were large differences in the levels of IL-4 mRNA among the different strains, whereas IFN-gamma mRNA was detected at similar levels in all strains. The levels of IL-4 mRNA correlated with lesion score, with susceptible and intermediate strains containing up to 100-fold more than any of the resistant strains. Differences in the levels of IFN-gamma mRNA were within only a fourfold range, with significant overlap among susceptible, intermediate, and resistant strains. Similarly, the levels of IFN-gamma secreted in vitro by lymph node cells from infected mice in response to L. major antigens were within a 10-fold range for most strains, and there was no correlation with lesion score. Analysis of Leishmania-specific antibody levels revealed a correlation between immunoglobulin G1 (IgG1) titers and lesion score, consistent with the role of IL-4 as a switch factor for IgG1. In contrast, there was no correlation between IgG2a titers and lesion score, supporting the notion that IFN-gamma synthesis (which promotes IgG2a production) is not correlated with disease state. These data suggest that along the spectrum of murine cutaneous leishmaniasis, IL-4 is a reliable indicator of disease, but IFN-gamma is not prognostic for resistance. Images PMID:8335376

Cross-Linked Enzyme Aggregates for Applications in Aqueous and Nonaqueous Media.

PubMed

Roy, Ipsita; Mukherjee, Joyeeta; Gupta, Munishwar N

2017-01-01

Extensive cross-linking of a precipitate of a protein by a cross-linking reagent (glutaraldehyde has been most commonly used) creates an insoluble enzyme preparation called cross-linked enzyme aggregates (CLEAs). CLEAs show high stability and performance in conventional aqueous as well as nonaqueous media. These are also stable at fairly high temperatures. CLEAs with more than one kind of enzyme activity can be prepared, and such CLEAs are called combi-CLEAs or multipurpose CLEAs. Extent of cross-linking often influences their morphology, stability, activity, and enantioselectivity.

Characterization of phospholipase C gamma enzymes with gain-of-function mutations.

PubMed

Everett, Katy L; Bunney, Tom D; Yoon, Youngdae; Rodrigues-Lima, Fernando; Harris, Richard; Driscoll, Paul C; Abe, Koichiro; Fuchs, Helmut; de Angelis, Martin Hrabé; Yu, Philipp; Cho, Wohnwa; Katan, Matilda

2009-08-21

Phospholipase C gamma isozymes (PLC gamma 1 and PLC gamma 2) have a crucial role in the regulation of a variety of cellular functions. Both enzymes have also been implicated in signaling events underlying aberrant cellular responses. Using N-ethyl-N-nitrosourea (ENU) mutagenesis, we have recently identified single point mutations in murine PLC gamma 2 that lead to spontaneous inflammation and autoimmunity. Here we describe further, mechanistic characterization of two gain-of-function mutations, D993G and Y495C, designated as ALI5 and ALI14. The residue Asp-993, mutated in ALI5, is a conserved residue in the catalytic domain of PLC enzymes. Analysis of PLC gamma 1 and PLC gamma 2 with point mutations of this residue showed that removal of the negative charge enhanced PLC activity in response to EGF stimulation or activation by Rac. Measurements of PLC activity in vitro and analysis of membrane binding have suggested that ALI5-type mutations facilitate membrane interactions without compromising substrate binding and hydrolysis. The residue mutated in ALI14 (Tyr-495) is within the spPH domain. Replacement of this residue had no effect on folding of the domain and enhanced Rac activation of PLC gamma 2 without increasing Rac binding. Importantly, the activation of the ALI14-PLC gamma 2 and corresponding PLC gamma 1 variants was enhanced in response to EGF stimulation and bypassed the requirement for phosphorylation of critical tyrosine residues. ALI5- and ALI14-type mutations affected basal activity only slightly; however, their combination resulted in a constitutively active PLC. Based on these data, we suggest that each mutation could compromise auto-inhibition in the inactive PLC, facilitating the activation process; in addition, ALI5-type mutations could enhance membrane interaction in the activated state.

Monitoring acute phase proteins in retrovirus infected cats undergoing feline interferon-ω therapy.

PubMed

Leal, R O; Gil, S; Sepúlveda, N; McGahie, D; Duarte, A; Niza, M M R E; Tavares, L

2014-01-01

Recombinant feline interferon-ω therapy is an immunomodulator currently used in the treatment of different retroviral diseases including feline immune deficiency virus and feline leukaemia virus. Although its mechanism of action remains unclear, this drug appears to potentiate the innate response. Acute phase proteins are one of the key components of innate immunity and studies describing their use as a monitoring tool for the immune system in animals undergoing interferon-ω therapy are lacking. This study aimed to determine whether interferon-ω therapy influences acute phase protein concentrations namely serum amyloid-A, α-1-glycoprotein and C-reactive protein. A single-arm study was performed using 16 cats, living in an animal shelter, naturally infected with retroviruses and subjected to the interferon-ω therapy licensed protocol. Samples were collected before (D0), during (D10 and D30) and after therapy (D65). Serum amyloid-A and C-reactive protein were measured by specific enzyme-linked immunosorbent assay kits and α-1-glycoprotein by single radial immunodiffusion. All the acute phase proteins significantly increased in cats undergoing interferon-ω therapy (D0/D65: P<0·05) CLINICAL SIGNIFICANCE: Acute phase proteins appear to be reasonable predictors of innate-immune stimulation and may be useful in the individual monitoring of naturally retroviral infected cats undergoing interferon-ω therapy. © 2013 British Small Animal Veterinary Association.

Treatment of trypanosome-infected mice with exogenous interferon, interferon inducers, or antibody to interferon

NASA Technical Reports Server (NTRS)

Degee, Antonie L. W.; Mansfield, John M.; Sonnenfeld, Gerald

1986-01-01

Earlier studies have demonstrated that mice resistant to Trypanosoma brucei rhodesiense (the B10.BR/SgSnJ strain) produces, upon infection by this parasite, two peaks of serum interferon (IFN), while the susceptible mice (C3HeB/FeJ) produces no IFN. In the present study, survival times were compared for B10.BR/SgSnJ, C3HeB/FeJ, and CBA/J (an intermediately resistant strain) mice that were injected, prior to infection with the parasite, with either of the following three preparations (1) IFN-gamma, (2) an antibody to IFN-gamma and (3) polyriboinosinic-polyribocytidylic acid (to induce IFN-alpha/beta). No effect on the survival times of mice by any of these preparations could be demonstrated, contrary to some previous reports.

Annexin V Incorporated into Influenza Virus Particles Inhibits Gamma Interferon Signaling and Promotes Viral Replication

PubMed Central

Berri, Fatma; Haffar, Ghina; Lê, Vuong Ba; Sadewasser, Anne; Paki, Katharina; Lina, Bruno; Wolff, Thorsten

2014-01-01

ABSTRACT During the budding process, influenza A viruses (IAVs) incorporate multiple host cell membrane proteins. However, for most of them, their significance in viral morphogenesis and infectivity remains unknown. We demonstrate here that the expression of annexin V (A5) is upregulated at the cell surface upon IAV infection and that a substantial proportion of the protein is present in lipid rafts, the site of virus budding. Western blotting and immunogold analysis of highly purified IAV particles showed the presence of A5 in the virion. Significantly, gamma interferon (IFN-γ)-induced Stat phosphorylation and IFN-γ-induced 10-kDa protein (IP-10) production in macrophage-derived THP-1 cells was inhibited by purified IAV particles. Disruption of the IFN-γ signaling pathway was A5 dependent since downregulation of its expression or its blockage reversed the inhibition and resulted in decreased viral replication in vitro. The functional significance of these results was also observed in vivo. Thus, IAVs can subvert the IFN-γ antiviral immune response by incorporating A5 into their envelope during the budding process. IMPORTANCE Many enveloped viruses, including influenza A viruses, bud from the plasma membrane of their host cells and incorporate cellular surface proteins into viral particles. However, for the vast majority of these proteins, only the observation of their incorporation has been reported. We demonstrate here that the host protein annexin V is specifically incorporated into influenza virus particles during the budding process. Importantly, we showed that packaged annexin V counteracted the antiviral activity of gamma interferon in vitro and in vivo. Thus, these results showed that annexin V incorporated in the viral envelope of influenza viruses allow viral escape from immune surveillance. Understanding the role of host incorporated protein into virions may reveal how enveloped RNA viruses hijack the host cell machinery for their own purposes. PMID

Gamma Interferon Release Assays for Detection of Mycobacterium tuberculosis Infection

PubMed Central

Denkinger, Claudia M.; Kik, Sandra V.; Rangaka, Molebogeng X.; Zwerling, Alice; Oxlade, Olivia; Metcalfe, John Z.; Cattamanchi, Adithya; Dowdy, David W.; Dheda, Keertan; Banaei, Niaz

2014-01-01

SUMMARY Identification and treatment of latent tuberculosis infection (LTBI) can substantially reduce the risk of developing active disease. However, there is no diagnostic gold standard for LTBI. Two tests are available for identification of LTBI: the tuberculin skin test (TST) and the gamma interferon (IFN-γ) release assay (IGRA). Evidence suggests that both TST and IGRA are acceptable but imperfect tests. They represent indirect markers of Mycobacterium tuberculosis exposure and indicate a cellular immune response to M. tuberculosis. Neither test can accurately differentiate between LTBI and active TB, distinguish reactivation from reinfection, or resolve the various stages within the spectrum of M. tuberculosis infection. Both TST and IGRA have reduced sensitivity in immunocompromised patients and have low predictive value for progression to active TB. To maximize the positive predictive value of existing tests, LTBI screening should be reserved for those who are at sufficiently high risk of progressing to disease. Such high-risk individuals may be identifiable by using multivariable risk prediction models that incorporate test results with risk factors and using serial testing to resolve underlying phenotypes. In the longer term, basic research is necessary to identify highly predictive biomarkers. PMID:24396134

Effect of treatment with interferon-gamma and concanavalin A on the course of infection of mice with Salmonella typhimurium strain LT-2

NASA Technical Reports Server (NTRS)

Gould, Cheryl L.; Sonnenfeld, Gerald

1987-01-01

The effect of pretreatment of mice with 34 units/day, for five days, of interferon-gamma (IFN-gamma) on the course of infection with LD50 of Salmonella typhimurium strain LT-2 was assessed, using two IFN preparations: (1) a hybridoma supernatant fluid containing concanavalin-A-induced IFN-gamma activity and (2) pure murine IFN-gamma produced by recombinant DNA technology. The hybridoma supernatant-treated Salmonella-infected mice were found to die faster than mice treated only with Salmonella. Pure murine IFN-gamma was found to protect infected mice significantly, with 95 percent of mice surviving LD50 infection. In contrast, the Salmonella-infected mice treated with hybridoma supernatant were found to die faster than the Salmonella-infected untreated controls. Mice treated with concanavalin A alone prior to infection with S. typhimurium died more quickly than the untreated infected controls, suggesting that contamination with concanavalin A had a detrimental effect on mice survival.

Use of interferon-gamma release assays in a health care worker screening program: experience from a tertiary care centre in the United States.

PubMed

Joshi, Manish; Monson, Thomas P; Woods, Gail L

2012-01-01

Interferon-gamma release assays including the QuantiFERON-TB Gold In-Tube test (QFT-GIT [Cellestis Ltd, Australia]) may be used in place of the tuberculin skin test (TST) in surveillance programs for Mycobacterium tuberculosis infection control. However, data on performance and practicality of the QFT-GIT in such programs for health care workers (HCWs) are limited. To assess the performance, practicality and reversion rate of the QFT-GIT among HCWs at a tertiary health care institution in the United States. Retrospective chart review of HCWs at Central Arkansas Veterans Healthcare System (Arkansas, USA) who underwent QFT-GIT testing as a part of their employee screening between November 1, 2008 and October 31, 2009. QFT-GIT was used to screen 3290 HCWs. The initial QFT-GIT was interpreted as positive for 129 (3.9%) HCWs, negative for 3155 (95.9%) and indeterminate for six (0.2%). Testing with QFT-GIT was repeated in 45 HCWs who had positive results on the initial test. The QFT-GIT reverted to negative in 18 (40.0%) HCWs, all of whom had negative TST status and initial interferon-gamma values of 0.35 IU⁄mL to 2.0 IU⁄mL. The QFT-GIT test is feasible in large health care setting as an alternative to TST for M tuberculosis infection screening in HCWs but is not free from challenges. The major concerns are the high number of positive test results and high reversion rates on repeat testing, illustrating poor short-term reproducibility of positive QFT-GIT test results. These results suggest adopting a borderline zone between interferon-gamma values of 0.35 IU⁄mL to 2.0 IU⁄mL, and cautious clinical interpretation of values in this range.

Use of Piezoelectric Immunosensors for Detection of Interferon-Gamma Interaction with Specific Antibodies in the Presence of Released-Active Forms of Antibodies to Interferon-Gamma

PubMed Central

Don, Elena; Farafonova, Olga; Pokhil, Suzanna; Barykina, Darya; Nikiforova, Marina; Shulga, Darya; Borshcheva, Alena; Tarasov, Sergey; Ermolaeva, Tatyana; Epstein, Oleg

2016-01-01

In preliminary ELISA studies where released-active forms (RAF) of antibodies (Abs) to interferon-gamma (IFNg) were added to the antigen-antibody system, a statistically significant difference in absorbance signals obtained in their presence in comparison to placebo was observed. A piezoelectric immunosensor assay was developed to support these data and investigate the effects of RAF Abs to IFNg on the specific interaction between Abs to IFNg and IFNg. The experimental conditions were designed and optimal electrode coating, detection circumstances and suitable chaotropic agents for electrode regeneration were selected. The developed technique was found to provide high repeatability, intermediate precision and specificity. The difference between the analytical signals of RAF Ab samples and those of the placebo was up to 50.8%, whereas the difference between non-specific controls and the placebo was within 5%–6%. Thus, the piezoelectric immunosensor as well as ELISA has the potential to be used for detecting the effects of RAF Abs to IFNg on the antigen-antibody interaction, which might be the result of RAF’s ability to modify the affinity of IFNg to specific/related Abs. PMID:26791304

Stress-induced alterations in interferon production and class II histocompatibility antigen expression

NASA Technical Reports Server (NTRS)

Sonnenfeld, G.; Cunnick, J. E.; Armfield, A. V.; Wood, P. G.; Rabin, B. S.

1992-01-01

Mild electric foot-shock has been shown to be a stressor that can alter immune responses. Male Lewis rats were exposed to one session of 16 5.0-s 1.6-mA foot-shocks. Production of interferon-gamma by splenocytes in response to concanavalin-A was decreased in spleens from the shocked rats compared to control spleens. Spleen cells from rats treated with nadolol, a peripherally acting beta-adrenergic receptor antagonist, and then shocked, showed dose-dependent attenuation of the suppression of interferon-gamma production. This suggests that catecholamines mediate shock-induced suppression of interferon-gamma production. The percentage of splenic mononuclear cells expressing class II histocompatibility (Ia) antigens on their surfaces from spleens of shocked rats was determined by flow cytometry. Significantly decreased class II positive mononuclear cells were present in the spleens of shocked rats in comparison to the spleens of control rats. This may reflect an alteration of cell trafficking or decreased production of class II antigens.

Co-expression of antioxidant enzymes with expression of p53, DNA repair, and heat shock protein genes in the gamma ray-irradiated hermaphroditic fish Kryptolebias marmoratus larvae.

PubMed

Rhee, Jae-Sung; Kim, Bo-Mi; Kim, Ryeo-Ok; Seo, Jung Soo; Kim, Il-Chan; Lee, Young-Mi; Lee, Jae-Seong

2013-09-15

To investigate effects of gamma ray irradiation in the hermaphroditic fish, Kryptolebias marmoratus larvae, we checked expression of p53, DNA repair, and heat shock protein genes with several antioxidant enzyme activities by quantitative real-time RT-PCR and biochemical methods in response to different doses of gamma radiation. As a result, the level of gamma radiation-induced DNA damage was initiated after 4Gy of radiation, and biochemical and molecular damage became substantial from 8Gy. In particular, several DNA repair mechanism-related genes were significantly modulated in the 6Gy gamma radiation-exposed fish larvae, suggesting that upregulation of such DNA repair genes was closely associated with cell survival after gamma irradiation. The mRNA expression of p53 and most hsps was also significantly upregulated at high doses of gamma radiation related to cellular damage. This finding indicates that gamma radiation can induce oxidative stress with associated antioxidant enzyme activities, and linked to modulation of the expression of DNA repair-related genes as one of the defense mechanisms against radiation damage. This study provides a better understanding of the molecular mode of action of defense mechanisms upon gamma radiation in fish larvae. Copyright © 2013 Elsevier B.V. All rights reserved.

Interferon-gamma alone triggers the production of nitric oxide from serum-starved BNL CL.2, murine embryonic liver cells.

PubMed

Pae, H O; Yoo, J C; Choi, B M; Paik, S G; Kim, Y H; Jin, H S; Chung, H T

1999-01-01

A previous study has demonstrated that both interferon-gamma (IFN-gamma) and lipopolysaccharide (LPS) were needed to induce the production of nitric oxide (NO) in BNL CL.2 cells, murine embryonic liver cells. We here demonstrate that when BNL CL.2 cells were cultured with serum-free medium, they were induced to produce NO by the stimulation of IFN-gamma alone. BNL CL.2 cells were cultured with serum-free or serum-containing medium for 1-3 days and then stimulated to synthesize NO by IFN-gamma. Surprisingly, only serum-starved cells showed significant amount of nitrite accumulation and iNOS protein expression in response to IFN-gamma in dose- and time-dependent manners, but serum-supplied cells did not. When the cells were stimulated with IFN-gamma, tumor necrosis factor-alpha (TNF-alpha), or LPS in combinations, only the combination of IFN-gamma and LPS produced more NO than that produced by IFN-gamma alone. The production of NO by the cells stimulated with IFN-gamma or IFN-gamma plus LPS was blocked by the addition of N(G)-monomethyl-L-arginine (N(G)MMA), a NO synthesis inhibitor. To address the intracellular signal pathway responsible for the production of NO by the cells stimulated with IFN-gamma aloneor IFN-gamma plus LPS, we examined the effects of several protein kinase inhibitors on the production of NO from the cells. The production of NO was significantly inhibited by protein tyrosine kinase (PTK) inhibitors, genistein and herbimycin A, but not by protein kinase A or C inhibitors. These results suggest that the deprivation of serum from BNL CL.2 cell culture medium might prime the cells to induce NO synthesis when the cells are triggered by IFN-gamma and the involvement of PTK signal transduction pathway in the expression of inducible NO synthase gene in murine hepatoma cells.

Interferon-gamma exerts its negative regulatory effect primarily on the earliest stages of murine erythroid progenitor cell development.

PubMed

Wang, C Q; Udupa, K B; Lipschitz, D A

1995-01-01

Interferon-gamma (INF-gamma) has been shown to suppress erythropoiesis and perhaps to contribute to the anemia of chronic disease. In this study we demonstrated that the concentration of INF gamma required to suppress murine burst forming unit-erythroid (BFU-E) growth was significantly less than that required to suppress colony forming unit-erythroid (CFU-E) growth. INF gamma acted at the most primitive step in erythroid progenitor cell differentiation and proliferation, as inhibition was maximal when added at the time of BFU-E culture initiation. Inhibition was progressively less if INF gamma addition was delayed after culture initiation. The effects of INF gamma on BFU-E did not require the presence of interleukin-1 alpha (IL-1 alpha), tumor necrosis factor-alpha (TNF alpha), or granulocyte macrophage colony stimulating factor (GM-CSF), as its effects were not neutralized by monoclonal antibodies against IL-1 alpha, TNF alpha, or GM-CSF. This applied whether INF gamma was added to culture with individual antibodies or with a combination of all three antibodies. INF gamma was not required for IL-1 alpha- or TNF alpha-induced suppression of BFU-E, as their effects were not neutralized by a monoclonal anti-INF gamma antibody. In contrast, GM-CSF-induced suppression of BFU-E was negated by the simultaneous addition of anti-INF gamma. We have previously shown that the addition of TNF alpha does not suppress BFU-E growth in cultures from marrow depleted of macrophages. Suppression did occur, however, if a small concentration of INF gamma that does not inhibit and increasing concentration of TNF alpha were added to culture, suggesting a synergistic effect between INF-gamma and TNF alpha. These observations suggest that INF gamma is a potent direct inhibitor of erythroid colony growth in vitro. It exerts its negative regulatory effect primarily on the earliest stages of erythroid progenitor cell differentiation and proliferation, as much higher doses are required to

Differential co-promoting activities of alpha, beta and gamma interferons in the murine skin two-stage carcinogenesis model.

PubMed

Reiners, J J; Cantu, A; Thai, G; Pavone, A

1993-03-01

SENCAR mice develop more papillomas in two-stage skin carcinogenesis protocols if gamma interferon (IFN-gamma) is co-administered with 12-O-tetradecanoylphorbol-13-acetate (TPA) during the promotion phase. In the current study preparations of murine alpha, beta and gamma IFNs were surveyed for their abilities to modulate TPA-dependent promotion and induction of epidermal hyperplasia, inflammation and ornithine decarboxylase activity (ODC). Single or multiple i.p. administrations of IFN-alpha, -beta or -gamma (< or = 2500 units) did not induce epidermal hyperplasia, inflammation or ODC activity. Single or multiple i.p. administrations of IFN-alpha, -beta or -gamma (2500 units) to mice being topically promoted with 0.1 or 1 microgram of TPA did not alter the epidermal hyperplasia induced by the phorbol ester. The vascular permeability of the skin, as evaluated by the extravasation of Evans blue dye, was increased in a dose-dependent fashion by TPA over the range of 0.1-1 microgram. Treatment of mice promoted with 0.1 microgram of TPA with IFN-gamma (> or = 2500 units) significantly increased the skin's vascular permeability. Comparable effects were not obtained with IFN-beta (IFN-alpha not tested). Treatment of TPA-promoted mice with IFN-gamma, and to a lesser extent IFN-beta, weakly potentiated the TPA-dependent induction of epidermal ODC activity. Under conditions in which IFN-gamma had co-promoting activities in an initiation-promotion protocol, co-treatment of initiated mice with 1 microgram of TPA and IFN-alpha or -beta (100-5000 units) did not reproducibly alter tumor latency., or papilloma and carcinoma multiplicities. These findings suggest that the co-promoting activities of IFNs are restricted to the gamma class, and are not uniformly reflected by parameters commonly employed as short-term markers of tumor promotion.

[Gamma interferon: basics aspects, clinic significance and terapeutic uses].

PubMed

Mata-Espinosa, Dulce A; Hernández-Pando, Rogelio

2008-01-01

Interferons are a family of pleiotropic cytokines, their name was assigned because of their anti-replicative viral activity. IFNgamma or immune type II interferon does not share receptors with the type I interferon, its structure is different and its gene is located in different chromosome, although its biologic effects are similar. Along of several years of research, it has been found that IFNgamma enhances the transcription of genes involved in immunomodulation, antiviral responses and antitumoral activities. Regarding to the immune system, IFNgamma increases the cytotoxic and phagocytic activity of macrophages and upregulates the expression of major histocompatibility complex (MHC) class I and class II molecules in dendritics cells and other antigen presenting cells. IFNgamma also promotes the development and differentiation of naive CD4+ T lymphocytes to Th1 helper subset. Indeed, this cytokine has a key role in the control of bacterial, micotic, viral and parasitic infections. Depending of the micro-environment, IFNgamma has a dual role as pro or anti inflammatory cytokine. Novel therapeutic strategies are currently being developed with the aim to enhance the immune response or replace IFNgamma gene abnormal expression with beneficial results in humans, being recombinant IFNgamma safe and well tolerated.

Host Defense against Viral Infection Involves Interferon Mediated Down-Regulation of Sterol Biosynthesis

PubMed Central

Blanc, Mathieu; Hsieh, Wei Yuan; Robertson, Kevin A.; Watterson, Steven; Shui, Guanghou; Lacaze, Paul; Khondoker, Mizanur; Dickinson, Paul; Sing, Garwin; Rodríguez-Martín, Sara; Phelan, Peter; Forster, Thorsten; Strobl, Birgit; Müller, Matthias; Riemersma, Rudolph; Osborne, Timothy; Wenk, Markus R.; Angulo, Ana; Ghazal, Peter

2011-01-01

Little is known about the protective role of inflammatory processes in modulating lipid metabolism in infection. Here we report an intimate link between the innate immune response to infection and regulation of the sterol metabolic network characterized by down-regulation of sterol biosynthesis by an interferon regulatory loop mechanism. In time-series experiments profiling genome-wide lipid-associated gene expression of macrophages, we show a selective and coordinated negative regulation of the complete sterol pathway upon viral infection or cytokine treatment with IFNγ or β but not TNF, IL1β, or IL6. Quantitative analysis at the protein level of selected sterol metabolic enzymes upon infection shows a similar level of suppression. Experimental testing of sterol metabolite levels using lipidomic-based measurements shows a reduction in metabolic output. On the basis of pharmacologic and RNAi inhibition of the sterol pathway we show augmented protection against viral infection, and in combination with metabolite rescue experiments, we identify the requirement of the mevalonate-isoprenoid branch of the sterol metabolic network in the protective response upon statin or IFNβ treatment. Conditioned media experiments from infected cells support an involvement of secreted type 1 interferon(s) to be sufficient for reducing the sterol pathway upon infection. Moreover, we show that infection of primary macrophages containing a genetic knockout of the major type I interferon, IFNβ, leads to only a partial suppression of the sterol pathway, while genetic knockout of the receptor for all type I interferon family members, ifnar1, or associated signaling component, tyk2, completely abolishes the reduction of the sterol biosynthetic activity upon infection. Levels of the proteolytically cleaved nuclear forms of SREBP2, a key transcriptional regulator of sterol biosynthesis, are reduced upon infection and IFNβ treatment at both the protein and de novo transcription level. The

Comparison of Tuberculin Skin Test result and interferon gamma response to human PPD in BCG scar positive and negative children.

PubMed

Sayyahfar, Shirin; Karimi, Abdollah; Fahimzad, Alireza; Shamshiri, Ahmad Reza

2014-03-01

The aim of this study is to compare Tuberculin Skin Test (TST) result and interferon gamma response to human PPD (purified protein derivative), in scar positive and scar negative BCG-vaccinated children. Between August 2007 and May 2008 a total of 236 children aged 1-168 months (mean 21 months) admitted to Mofid Children's Hospital, Tehran, Iran, were enrolled in a cross-sectional study. Each patient was examined for BCG vaccine scar and tested with TST and human PPD-based Interferon Gamma Release Assay (IGRA). Two hundred and twenty one cases out of 236 (44% female, 1-168 months, mean age 21 months) were scar positive of whom 95% TST result was negative. Human PPD-based IGRA was positive in 110 (49.8%), negative in 85 (38.4 %) and indeterminate in 26 (11.8%) of scar positive patients. Fifteen children (40% female, 1-156 months; mean age 42 months) were scar negative. All the scar negative cases were TST negative. Human PPD-based IGRA was positive in 10 (66.7%), negative in 4 (26.7%) and indeterminate in 1 (6.7%) of scar negative patients. Immune responsiveness to human PPD antigens in scar positive and negative children may not correspond with results of the Tuberculin Skin Test. Copyright © 2013 Ministry of Health, Saudi Arabia. Published by Elsevier Ltd. All rights reserved.

Interferon-gamma inhibits intestinal restitution by preventing gap junction communication between enterocytes.

PubMed

Leaphart, Cynthia L; Qureshi, Faisal; Cetin, Selma; Li, Jun; Dubowski, Theresa; Baty, Catherine; Batey, Catherine; Beer-Stolz, Donna; Guo, Fengli; Murray, Sandra A; Hackam, David J

2007-06-01

Necrotizing enterocolitis (NEC) is characterized by interferon-gamma (IFN-gamma) release and inadequate intestinal restitution. Because enterocytes migrate together, mucosal healing may require interenterocyte communication via connexin 43-mediated gap junctions. We hypothesize that enterocyte migration requires interenterocyte communication, that IFN impairs migration by impairing connexin 43, and that impaired healing during NEC is associated with reduced gap junctions. NEC was induced in Swiss-Webster or IFN(-/-) mice, and restitution was determined in the presence of the gap junction inhibitor oleamide, or via time-lapse microscopy of IEC-6 cells. Connexin 43 expression, trafficking, and localization were detected in cultured or primary enterocytes or mouse or human intestine by confocal microscopy and (35)S-labeling, and gap junction communication was assessed using live microscopy with oleamide or connexin 43 siRNA. Enterocytes expressed connexin 43 in vitro and in vivo, and exchanged fluorescent dye via gap junctions. Gap junction inhibition significantly reduced enterocyte migration in vitro and in vivo. NEC was associated with IFN release and loss of enterocyte connexin 43 expression. IFN inhibited enterocyte migration by reducing gap junction communication through the dephosphorylation and internalization of connexin 43. Gap junction inhibition significantly increased NEC severity, whereas reversal of the inhibitory effects of IFN on gap junction communication restored enterocyte migration after IFN exposure. Strikingly, IFN(-/-) mice were protected from the development of NEC, and showed restored connexin 43 expression and intestinal restitution. IFN inhibits enterocyte migration by preventing interenterocyte gap junction communication. Connexin 43 loss may provide insights into the development of NEC, in which restitution is impaired.

Complementation of a mutant cell line: central role of the 91 kDa polypeptide of ISGF3 in the interferon-alpha and -gamma signal transduction pathways.

PubMed Central

Müller, M; Laxton, C; Briscoe, J; Schindler, C; Improta, T; Darnell, J E; Stark, G R; Kerr, I M

1993-01-01

Mutants in complementation group U3, completely defective in the response of all genes tested to interferons (IFNs) alpha and gamma, do not express the 91 and 84 kDa polypeptide components of interferon-stimulated gene factor 3 (ISGF3), a transcription factor known to play a primary role in the IFN-alpha response pathway. The 91 and 84 kDa polypeptides are products of a single gene. They result from differential splicing and differ only in a 38 amino acid extension at the C-terminus of the 91 kDa polypeptide. Complementation of U3 mutants with cDNA constructs expressing the 91 kDa product at levels comparable to those observed in induced wild-type cells completely restored the response to both IFN-alpha and -gamma and the ability to form ISGF3. Complementation with the 84 kDa component similarly restored the ability to form ISGF3 and, albeit to a lower level, the IFN-alpha response of all genes tested so far. It failed, however, to restore the IFN-gamma response of any gene analysed. The precise nature of the DNA motifs and combination of factors required for the transcriptional response of all genes inducible by IFN-alpha and -gamma remains to be established. The results presented here, however, emphasize the apparent general requirement of the 91 kDa polypeptide in the primary transcriptional response to both types of IFN. Images PMID:7693454

[Allergic asthma and interleukins 2, 4, 5, 6 and 12 and gamma interferon levels].

PubMed

Bastida Segura, Diana Lyzbeth; López Velásquez, Benjamin; Castrejón Vázquez, María Isabel; Galicia Tapía, Jorge; Cano Altamirano, Silvia; Miranda Feria, Alfonso Javier

2004-01-01

Asthma is an inflammatory chronic illness, in which mastocyt cells, basophils, T lymphocytes, eosinophils and cytokines play a role. Its association with the production of TH2 cytokines is not well known, but it is considered an aberrant immune response, yielding the activation and recruitment of a number of effector cells (mastocyts/eosinophils) and the appearance of clinical symptoms. To determine the serum values of the interleukins 2, 4, 5, 6 and 12 and gamma interferon in relation to the severity degree of asthma and the time of immunotherapy in patients with stable chronic allergic bronchial asthma. Clinical records of allergic asthmatic patients from the external consultation at Servicio de Alergia e Immunología Clínica were reviewed in a period of 12 months (1st January 2002 to 1st January 2003) and those of healthy volunteers, forming three groups: Group 1, allergic asthmatics with immunotherapy less than 24 months; Group 2, allergic asthmatics with more than 24 months of immunotherapy, and Group 3, healthy volunteers (control group). Previous informed consent, a serum sample was taken of all subjects. Ninety-two subjects were included: 41 (45%) allergic asthmatics and 51 (55%) healthy volunteers. Significant differences were found in interleukins 2, 4, 5, 6 and 12 levels between healthy volunteers and asthmatics without relating the immunotherapy time. In the total group gamma interferon levels were not found. A relation of interleukins Th2 levels with the severity degree of asthma was not found. Differences of serum interleukins Th1 and Th2 in allergic patients related to immunotherapy time were not significant; even though, irrespective of immunotherapy time, IgG levels were always high. Patients with allergic asthma have a predominance of serum interleukins Th2 and, despite of the immunotherapy, in the maintaining phase, these continue high, which may be due to an immune system dysregulation maybe including other factors. Immunotherapy continues

Gelam honey protects against gamma-irradiation damage to antioxidant enzymes in human diploid fibroblasts.

PubMed

Ahmad, Tengku Ahbrizal Farizal Tengku; Jubri, Zakiah; Rajab, Nor Fadilah; Rahim, Khairuddin Abdul; Yusof, Yasmin Anum Mohd; Makpol, Suzana

2013-02-11

The present study was designed to determine the radioprotective effects of Malaysian Gelam honey on gene expression and enzyme activity of superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GPx) of human diploid fibroblasts (HDFs) subjected to gamma-irradiation. Six groups of HDFs were studied: untreated control, irradiated HDFs, Gelam honey-treated HDFs and HDF treated with Gelam honey pre-, during- and post-irradiation. HDFs were treated with 6 mg/mL of sterilized Gelam honey (w/v) for 24 h and exposed to 1 Gray (Gy) of gamma rays at the dose rate of 0.25 Gy/min. Gamma-irradiation was shown to down-regulate SOD1, SOD2, CAT and GPx1 gene expressions (p < 0.05). Conversely, HDFs treated with Gelam honey alone showed up-regulation of all genes studied. Similarly, SOD, CAT and GPx enzyme activities in HDFs decreased with gamma-irradiation and increased when cells were treated with Gelam honey (p < 0.05). Furthermore, of the three different stages of study treatment, pre-treatment with Gelam honey caused up-regulation of SOD1, SOD2 and CAT genes expression and increased the activity of SOD and CAT. As a conclusion, Gelam honey modulates the expression of antioxidant enzymes at gene and protein levels in irradiated HDFs indicating its potential as a radioprotectant agent.

Effect of interferon-gamma on complement gene expression in different cell types.

PubMed

Lappin, D F; Guc, D; Hill, A; McShane, T; Whaley, K

1992-01-15

We have studied the expression of the complement components C2, C3, factor B, C1 inhibitor (C1-inh), C4-binding protein (C4-bp) and factor H in human peripheral blood monocytes, skin fibroblasts, umbilical vein endothelial cells (HUVEC) and the human hepatoma cell line G2 (Hep G2) in the absence and the presence of interferon-gamma (IFN-gamma). E.l.i.s.a. performed on culture fluids, run-on transcription assays, Northern blot and double-dilution dot-blot techniques confirmed that monocytes expressed all six components, whereas fibroblasts, HUVEC and HepG2 each expressed five of the six components. Fibroblasts and HUVEC did not synthesize C4-bp, and Hep G2 did not produce factor H. In addition to these differences, the synthesis rates of C3, C1-inh and factor H were not the same in all cell types. However, the synthesis rates of C2 and factor B were similar in all four cell types. The half-lives of the mRNAs were shorter in monocytes than in other cell types. Monocyte factor H mRNA had a half-life of 12 min in monocytes, compared with over 3 h in fibroblasts and HUVEC. The instability of factor H mRNA in monocytes may contribute to their low factor H secretion rate. IFN-gamma produced dose-dependent stimulation of C2, factor B, C1-inh, C4-bp and factor H synthesis by all cell types expressing these proteins, but decreased C3 synthesis in all four cell types. Cell-specific differences in the response to IFN-gamma were observed. The increased rates of transcription of the C1-inh and factor H genes in HUVEC were greater than in other cell types, while the increased rate of transcription of the C2, factor B and C1-inh genes in Hep G2 cells was less than in other cell types. IFN-gamma did not affect the stability of C3, factor H or C4 bp mRNAs, but increased the stability of factor B and C1-inh mRNAs and decreased the stability of C2 mRNA. Although these changes occurred in all four cell types studied, the half-life of C1-inh mRNA in monocytes was increased almost 4-fold

Association of monoclonal expansion of Epstein-Barr virus-negative CD158a+ NK cells secreting large amounts of gamma interferon with hemophagocytic lymphohistiocytosis.

PubMed

López-Alvarez, María R; Martínez-Sánchez, María V; Salgado-Cecilia, María G; Campillo, José A; Heine-Suñer, Damian; Villar-Permuy, Florentina; Fuster, José L; Bas, Agueda; Gil-Herrera, Juana; Muro, Manuel; García-Alonso, Ana M; Alvarez-López, María R; Minguela, Alfredo

2009-01-01

We report the first case of hemophagocytic lymphohistiocytosis (HLH) induced by the monoclonal expansion of Epstein-Barr virus (EBV)-negative NK cells. Consanguinity of the patient's parents made it necessary to discard familial HLH in the patient and her sister with identical HLA markers and demonstrate that no cause other than the expansion of NK cells, which secrete high levels of gamma interferon, was inducing HLH in this patient.

Interferon-gamma interferes with transforming growth factor-beta signaling through direct interaction of YB-1 with Smad3.

PubMed

Higashi, Kiyoshi; Inagaki, Yutaka; Fujimori, Ko; Nakao, Atsuhito; Kaneko, Hideo; Nakatsuka, Iwao

2003-10-31

Transforming growth factor-beta (TGF-beta) and interferon-gamma (IFN-gamma) exert antagonistic effects on collagen synthesis in human dermal fibroblasts. We have recently shown that Y box-binding protein YB-1 mediates the inhibitory effects of IFN-gamma on alpha2(I) procollagen gene (COL1A2) transcription through the IFN-gamma response element located between -161 and -150. Here we report that YB-1 counter-represses TGF-beta-stimulated COL1A2 transcription by interfering with Smad3 bound to the upstream sequence around -265 and subsequently by interrupting the Smad3-p300 interaction. Western blot and immunofluorescence analyses using inhibitors for Janus kinases or casein kinase II suggested that the casein kinase II-dependent signaling pathway mediates IFN-gamma-induced nuclear translocation of YB-1. Down-regulation of endogenous YB-1 expression by double-stranded YB-1-specific RNA abrogated the transcriptional repression of COL1A2 by IFN-gamma in the absence and presence of TGF-beta. In transient transfection assays, overexpression of YB-1 in human dermal fibroblasts exhibited antagonistic actions against TGF-beta and Smad3. Physical interaction between Smad3 and YB-1 was demonstrated by immunoprecipitation-Western blot analyses, and electrophoretic mobility shift assays using the recombinant Smad3 and YB-1 proteins indicated that YB-1 forms a complex with Smad3 bound to the Smad-binding element. Glutathione S-transferase pull-down assays showed that YB-1 binds to the MH1 domain of Smad3, whereas the central and carboxyl-terminal regions of YB-1 were required for its interaction with Smad3. YB-1 also interferes with the Smad3-p300 interaction by its preferential binding to p300. Altogether, the results provide a novel insight into the mechanism by which IFN-gamma/YB-1 counteracts TGF-beta/Smad3. They also indicate that IFN-gamma/YB-1 inhibits COL1A2 transcription by dual actions: via the IFN-gamma response element and through a cross-talk with the TGF

Sphingosine kinase inhibitor suppresses IL-18-induced interferon-gamma production through inhibition of p38 MAPK activation in human NK cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cheon, Soyoung; Song, Seok Bean; Jung, Minkyung

2008-09-12

Natural killer (NK) cells play an important role in the innate immune response. Interleukin-18 (IL-18) is a well-known interferon-gamma (IFN-{gamma} inducing factor, which stimulates immune response in NK and T cells. Sphingosine kinase (SPHK) catalyzes the formation of sphingosine 1-phosphate (S1P), which acts as a second messenger to function as an anti-apoptotic factor and proliferation stimulator of immune cells. In this study, to elucidate whether SPHK is involved in IL-18-induced IFN-{gamma} production, we measured IL-18-induced IFN-{gamma} production after pre-treatment with SPHK inhibitor (SKI) in NK-92MI cells. We found that IL-18-induced IFN-{gamma} expression was blocked by SKI pre-treatment in both mRNAmore » and protein levels. In addition, the increased IFN-{gamma} production by stimulation with IL-18 is mediated through both SPHK and p38 MAPK. To determine the upstream signals of SKI and p38 MAPK in IL-18-induced IFN-{gamma} production, phosphorylation levels of p38 MAPK was measured after SKI pre-treatment. As a result, inhibition of SPHK by SKI blocked phosphorylation of p38 MAPK, showing that SPHK activation by IL-18 is an upstream signal of p38 MAPK activation. Inhibition of SPHK by SKI also inhibited IL-18-induced IFN-{gamma} production in human primary NK cells. In conclusion, SPHK activation is an essential factor for IL-18-induced IFN-{gamma} production via p38 MAPK.« less

Protein-linked Ubiquitin Chain Structure Restricts Activity of Deubiquitinating Enzymes*

PubMed Central

Schaefer, Jonathan B.; Morgan, David O.

2011-01-01

The attachment of lysine 48 (Lys48)-linked polyubiquitin chains to proteins is a universal signal for degradation by the proteasome. Here, we report that long Lys48-linked chains are resistant to many deubiquitinating enzymes (DUBs). Representative enzymes from this group, Ubp15 from yeast and its human ortholog USP7, rapidly remove mono- and diubiquitin from substrates but are slow to remove longer Lys48-linked chains. This resistance is lost if the structure of Lys48-linked chains is disrupted by mutation of ubiquitin or if chains are linked through Lys63. In contrast to Ubp15 and USP7, Ubp12 readily cleaves the ends of long chains, regardless of chain structure. We propose that the resistance to many DUBs of long, substrate-attached Lys48-linked chains helps ensure that proteins are maintained free from ubiquitin until a threshold of ubiquitin ligase activity enables degradation. PMID:22072716

Myxoma virus M-T7, a secreted homolog of the interferon-gamma receptor, is a critical virulence factor for the development of myxomatosis in European rabbits.

PubMed

Mossman, K; Nation, P; Macen, J; Garbutt, M; Lucas, A; McFadden, G

1996-01-01

little, if any, cellular activation of germinal centers of spleen and lymph node by Day 4. We conclude that M-T7 functions early in infection to (1) retard inflammatory cell migration into infected tissues and (2) disrupt the communication between sentinel immune cells at the site of primary virus infection in the subdermis and lymphocytes in the secondary lymphoid organs, thereby disabling the host from mounting an effective cellular immune response. To summarize, in addition to neutralizing host interferon-gamma at infected sites, we propose that M-T7 protein also modifies leukocyte traffic in the vicinity of virus lesions, thus effectively severing the link between antigen presenting cells of the infected tissue and the effector lymphocytes of the peripheral immune organs.

Interferon-gamma: biologic functions and HCV therapy (type I/II) (1 of 2 parts).

PubMed

Gattoni, A; Parlato, A; Vangieri, B; Bresciani, M; Derna, R

2006-01-01

This review is aimed at exhaustively presenting and discussing the interferon-gamma (IFN-gamma), a cytokine that plays an important role in inducing and modulating an array of immune responses. A review of the most significant and recent clinical trials was performed. Although IFN-gamma has some antiviral activity, it is much less active in this regard than type I IFNs. IFN-gamma is involved in the regulation of nearly all phases of the immune and inflammatory responses, including the activation and differentiation of T cells, B cells, NK cells, macrophages, and others. It is therefore best regarded as a distint immunoregulatory cytokine. IFN-gamma secretion is a hallmark of Th1 lymphocytes. It is also secreted by nearly all CD8 T cells, by some Th0 cells, and by NK cells. Each of these cell types secretes IFN-gamma only when activated, usually as part of immune response and especially in response to IL-2 and IL-12. IFN-gamma production is inhibited by IL-4, IL-10, TGFbeta, glucocorticoids, cyclosporin A and FK506. Nearly all cell types express the heterodimeric receptor for IFN-beta and respond to this cytokine by increasing the surface expression of class I MHC proteins. As a result, virtually any cell in the vicinity of an IFN-beta-secreting cell becomes more efficient at presenting endogenous antigens and hence a better target for cytotoxic killing if it harbors an intracellular pathogen. Unlike the type I IFNs, IFN-gamma also increases the expression of class II MHC proteins on professional APCs, and so promotes antigen presentation to helper T cells as well. It also induces de novo expression of class II MHC proteins on venular endothelial cells and on some other epithelial and connective tissue cells that do not otherwise express them, thus enabling these cell types to function as temporary APCs at sites of intense immune reactions. The effector functions of NK cells are to lyse virus-infected cells and to secrete IFN-gamma, which activates macrofages to

Effects of tumor necrosis factor-alpha and interferon-gamma on expressions of matrix metalloproteinase-2 and -9 in human bladder cancer cells.

PubMed

Shin, K Y; Moon, H S; Park, H Y; Lee, T Y; Woo, Y N; Kim, H J; Lee, S J; Kong, G

2000-10-31

We have investigated the effects of tumor necrosis factor-alpha (TNF-alpha) and interferon (INF-gamma), the potent Bacillus Calmette-Guerin (BCG)-induced cytokines on the production of MMP-2, MMP-9, TIMP-1, TIMP-2 and MT1-MMP in high grade human bladder cancer cell lines, T-24, J-82 and HT-1376 cell lines. MMP-2 expression and activity were decreased in T-24 cells treated with both cytokines in a dose dependent manner. However, J-82 cells treated with TNF-alpha and INF-gamma revealed dose dependent increases of MMP-9 expression and activity with similar baseline expression and activity of MMP-2. HT-1376 cells after exposure to TNF-alpha only enhanced the expression and activity of MMP-9. These results indicate that TNF-alpha and INF-gamma could regulate the production of MMP-2 or MMP-9 on bladder cancer cells and their patterns of regulation are cell specific. Furthermore, this diverse response of bladder cancer cells to TNF-alpha and INF-gamma suggests that BCG immunotherapy may enhance the invasiveness of bladder cancer in certain conditions with induction of MMPs.

[Influence of Kudou Shencha decotion on INF-gamma, ICAM-1, MCP-1 levels of prostate tissue homogenate in immunity prostatitis model rats].

PubMed

Xia, Li-Ying; Liu, Wei-Jia; Li, Ming-Xi; Ge, Wen-Jin; Gao, Xue-Min; Zhang, Jian-Jun

2014-05-01

To investigate the influence of Kudou Shencha decotion on INF-y, ICAM-1, MCP-1 levels of prostate tissue homogenate in immunity prostatitis model rats. Forty Wistar male rats were divided into 5 groups randomly: Kudou Shencha decotion group with high dosage and low dosage, Qianleitai group, the model control group and normal group. The rat model of chronic nonbacterial prostatitis was established by multiple hypodermical injection of the suspension of prostatic protein purification with Freund's completed adjuvant. The level of intercellular adhesion molecule (ICAM-1), interferon gamma (INF-gamma) and monocyte chemotactic protein-1 (MCP-1) were measured by enzyme linked immunosorbent assay (ELISA). The content of ICAM-1 and MCP-1 in the model group was higher than that of the normal group (P < 0.05), the content of ICAM-1 was obviously decreased in Kudou Shencha decotion group with high dosage (P <0.05), the contents of MCP-1 were all obviously decreased in Kudou Shencha decotion groups and Qianlietai group. Compared with the model group, the contents of INF-gamma in all treatment groups were decreased insignificantly. Kudou Shencha decotion has the action of lowering the level of ICAM-1 and MCP-1, which may be one of the mechanisms of Kudou Shencha decotion in the therapy of chronic prostatitis.

USP15 regulates type I interferon response and is required for pathogenesis of neuroinflammation.

PubMed

Torre, Sabrina; Polyak, Maria J; Langlais, David; Fodil, Nassima; Kennedy, James M; Radovanovic, Irena; Berghout, Joanne; Leiva-Torres, Gabriel A; Krawczyk, Connie M; Ilangumaran, Subburaj; Mossman, Karen; Liang, Chen; Knobeloch, Klaus-Peter; Healy, Luke M; Antel, Jack; Arbour, Nathalie; Prat, Alexandre; Majewski, Jacek; Lathrop, Mark; Vidal, Silvia M; Gros, Philippe

2017-01-01

Genes and pathways in which inactivation dampens tissue inflammation present new opportunities for understanding the pathogenesis of common human inflammatory diseases, including inflammatory bowel disease, rheumatoid arthritis and multiple sclerosis. We identified a mutation in the gene encoding the deubiquitination enzyme USP15 (Usp15 L749R ) that protected mice against both experimental cerebral malaria (ECM) induced by Plasmodium berghei and experimental autoimmune encephalomyelitis (EAE). Combining immunophenotyping and RNA sequencing in brain (ECM) and spinal cord (EAE) revealed that Usp15 L749R -associated resistance to neuroinflammation was linked to dampened type I interferon responses in situ. In hematopoietic cells and in resident brain cells, USP15 was coexpressed with, and functionally acted together with the E3 ubiquitin ligase TRIM25 to positively regulate type I interferon responses and to promote pathogenesis during neuroinflammation. The USP15-TRIM25 dyad might be a potential target for intervention in acute or chronic states of neuroinflammation.

Enhancing effects of gamma interferon on phagocytic cell association with and killing of Trypanosoma cruzi

NASA Technical Reports Server (NTRS)

Wirth, J. J.; Kierszenbaum, F.; Sonnenfeld, G.; Zlotnik, A.

1985-01-01

Results are reported from a study of the influence gamma interferon (GIFN) and interleukin 2 (IL2) have on the capability of P388D1 cells and mouse resident peritoneal macrophages (MPM) to attach to the blood-resident parasites Trypanosoma cruzi and kill them. Cultures of trypomastigote forms of the Tulahuen strain of T. cruzi grown in bovine serum were introduced into peritoneal cells of mice, along with P388D1 cells incubated with GIFN, IL2 and both. Control cells were also maintained. Statistical analysis were then performed on data on counts of the number of dead T. Cruzi cells. The GIFN enhanced the interaction of MPM and P388D1 cells with the surface of T. Cruzi, provided the interaction was given over 12 hr to take place. A depression of the cytotoxicity of P388D1 cells was attributed to mediation by H2O2, an effect partially offset by incubation with the lymphokine GIFN.

Association between level of interferon gamma and acid-fast bacillipositivity in pulmonary tuberculosis

NASA Astrophysics Data System (ADS)

Priwahyuningtyas, N. B.; Sinaga, B. Y. M.; Pandia, P.; Eyanoer, P. C.

2018-03-01

Tuberculosis is an infectious disease which caused by Mycobacterium tuberculosis (M. tuberculosis) that infected numerous organ especially the lung. A person’s immunity is very affecting for a person exposed to pulmonary tuberculosis. T-helper-1 cell (Th1) is very influential in the immune system especially in interfering intracellular bacterial infection. One of the cytokines known produced by Th1 cell is interferon gamma (IFN-γ) which is in eliminating M. tuberculosis. The study aims to identify the association between level of IFN-γ and AFB positivity in pulmonary tuberculosis patients in Medan. It is a case-control study. The subjects of the study were 60 new cases of pulmonary tuberculosis with AFB sputum smear- positive that never received ATT consisting 20 cases AFB (+1), 20 cases AFB (+2) and 20 cases AFB (+3).Samples were plasma collected from the venous blood of pulmonary tuberculosis patients. The plasma then underwent laboratory assay with ELISA techniques. Independent t-test was p<0.05 considered significant. Level of IFN-γ in TB AFB (+1) is higher than TB AFB (+2) and (+3), with thesignificant statistical result (p=0.001).

Interferon-gamma promoter hypomethylation and increased expression in chronic periodontitis

PubMed Central

Zhang, Shaoping; Crivello, Antonino; Offenbacher, Steven; Moretti, Antonio; Paquette, David W.; Barros, Silvana P.

2011-01-01

Aim The goal of this investigation was to determine whether epigenetic modifications in the IFNG promoter are associated with an increase of IFNG transcription in different stages of periodontal diseases. Materials and Methods DNA was extracted from gingival biopsy samples collected from 47 total sites from 47 different subjects: 23 periodontally healthy sites, 12 experimentally induced gingivitis sites and 12 chronic periodontitis sites. Levels of DNA methylation within the IFNG promoter containing six CpG dinucleotides were determined using pyrosequencing technology. Interferon gamma mRNA expression was analysed by quantitative polymerase chain reactions using isolated RNA from part of the biological samples mentioned above. Results The methylation level of all six analysed CpG sites within the IFNG promoter region in the periodontitis biopsies {52% [interquartile range, IQR (43.8%, 63%)]} was significantly lower than periodontally healthy samples {62% [IQR (51.3%, 74%)], p =0.007} and gingivitis biopsies {63% [IQR (55%, 74%)], p =0.02}. The transcriptional level of IFNG in periodontitis biopsies was 1.96-fold and significantly higher than tissues with periodontal health (p =0.04). Although the mRNA level from experimental gingivitis samples exhibited an 8.5-fold increase as compared with periodontally healthy samples, no significant methylation difference was observed in experimental gingivitis sample. Conclusions A hypomethylation profile within IFNG promoter region is related to an increase of IFNG transcription present in the chronic periodontitis biopsies, while such an increase of IFNG in experimentally induced gingivitis seems independent of promoter methylation alteration. PMID:20958339

Role of interferon in resistance and immunity to protozoa

NASA Technical Reports Server (NTRS)

Sonnenfeld, G.; Degee, A. L. W.; Mansfield, J. M.; Newsome, A. L.; Arnold, R. R.

1985-01-01

Production of interferon (I) in response to protozoan infection, and the interferon-mediated inhibition of parasite replication were studied in order to determine if these effects may be related to immunologic-mediated resistance of the hosts. Two extracellular parasites-Trypanosoma brucei rhodesiense and Naegleria fowlei were used. Upon infection with the trypanosome, only resistant strains of mice produced I. An early peak of alpha/beta I is followed by appearance of gamma I, which coincided with antibody production and a drop in parasitemia. In case of the amoeba, pretreatment of its suspension with alpha/beta I inhibits its replication in vitro, and appears to protect mice from the infection and the disease. It is proposed that production of interferon, with its regulatory effect on the immune responses, may play a major role in regulating the processes of protozoan-caused diseases.

Inhibition of human mast cell growth and differentiation by interferon gamma-1b.

PubMed

Kirshenbaum, A S; Worobec, A S; Davis, T A; Goff, J P; Semere, T; Metcalfe, D D

1998-03-01

In an effort to identify cytokines that inhibit human mast cell growth, we cultured HMC-1 cells and recombinant human stem cell factor (rhSCF)-dependent human bone marrow-derived mast cells (HBMCs) in the presence of interferon gamma (IFNgamma)-1b and interferon alpha (IFNalpha)-2b. HMC-1 cell numbers decreased in the presence of 1000 U/mL IFNgamma-1b but were unaffected by 1000 U/mL of IFNalpha-2b. HBMCs were then cultured for 0 to 7 days with 100 ng/mL rhSCF and 10 ng/mL recombinant human IL-3 (rhIL-3), followed by culture in rhSCF and administration of either 1000 U/mL IFNalpha-2b or 1000 U/mL IFNgamma-1b. HBMCs appearing in cultures with rhSCF alone or in combination with IFNalpha-2b were virtually identical in number through 8 weeks of culture. In cultures supplemented with IFNgamma-1b, HBMCs significantly decreased in number and incidence of granular metachromasia by 4 to 5 weeks (p<0.001). Similar results were obtained when human marrow was cultured from day 0 with rhSCF and IFNgamma-1b. Mature rhSCF-dependent HBMCs were also cultured at 5 weeks with rhSCF alone or in combination with IFNgamma-1b. Compared with cells cultured in rhSCF, mature 5-week HBMC cultures treated with rhSCF plus IFNgamma-1b revealed a decrease in mast cells, and those mast cells that remained had fewer toluidine blue- and tryptase-positive granules after 5 to 8 weeks. FACS analysis of rhSCF plus IFNgamma-1b-treated mature HBMCs revealed increased c-kit and Fc(epsilon)RI expression. Mast cell releasibility was not increased. IFNgamma-lb was thus able to suppress mast cell growth from CD34+ cells, suggesting that this agent should be considered as a candidate cytokine for the treatment of disorders of mast cell proliferation.

A futile cycle, formed between two ATP-dependant gamma-glutamyl cycle enzymes, gamma-glutamyl cysteine synthetase and 5-oxoprolinase: the cause of cellular ATP depletion in nephrotic cystinosis?

PubMed

Kumar, Akhilesh; Bachhawat, Anand Kumar

2010-03-01

Cystinosis, an inherited disease caused by a defect in the lysosomal cystine transporter (CTNS), is characterized by renal proximal tubular dysfunction. Adenosine triphosphate (ATP) depletion appears to be a key event in the pathophysiology of the disease, even though the manner in which ATP depletion occurs is still a puzzle. We present a model that explains how a futile cycle that is generated between two ATP-utilizing enzymes of the gamma-glutamyl cycle leads to ATP depletion. The enzyme gamma-glutamyl cysteine synthetase (gamma-GCS), in the absence of cysteine, forms 5-oxoproline (instead of the normal substrate, gamma-glutamyl cysteine) and the 5-oxoproline is converted into glutamate by the ATP-dependant enzyme, 5-oxoprolinase. Thus, in cysteine-limiting conditions, glutamate is cycled back into glutamate via 5-oxoproline at the cost of two ATP molecules without production of glutathione and is the cause of the decreased levels of glutathione synthesis, as well as the ATP depletion observed in these cells. The model is also compatible with the differences seen in the human patients and the mouse model of cystinosis, where renal failure is not observed.

[The usefulness of in vitro interferon-gamma assay for differential diagnosis between intestinal tuberculosis and Crohns disease].

PubMed

Lee, Jung Nam; Ryu, Dong Yup; Park, Sung Han; You, Hyun Seok; Lee, Bong Eun; Kim, Dong Uk; Kim, Tae Oh; Heo, Jeong; Kim, Gwang Ha; Song, Geun Am; Kim, Suk; Park, Do Youn

2010-06-01

It is difficult to clinically and endoscopically differentiate intestinal tuberculosis (ITB) and Crohns disease (CD). The aim of this study was to evaluate the usefulness of in vitro interferon-gamma (INF-gamma) assay for differential diagnosis between ITB and CD. Sixty patients for whom differential diagnosis between ITB and CD was difficult were enrolled between January 2007 and January 2009. The INF-gamma-producing T-cell response to early secreted antigenic target 6 and culture filtrate protein 10 were measured by T-SPOT.TB blood test in vitro. We evaluated the usefulness of T-SPOT.TB blood test by comparing its results with the final diagnosis. Twenty and forty patients were revealed to be positive and negative in T-SPOT.TB blood test, respectively. Of the 20 patients found to be positive, 12 patients (60%) were finally diagnosed as ITB, 6 patients as CD, and 2 patients as Behcets enterocolitis. Of the 40 patients with negative results, 38 patients (95%) were diagnosed as CD; one as Behcets enterocolitis; one as nonspecific colitis; none as ITB. The sensitivity and specificity of T-SPOT.TB blood test for ITB were 100% and 83.3%, respectively. Positive and negative predictive values of T-SPOT.TB blood test for ITB were 60.0% and 100%, respectively. When differential diagnosis between ITB and CD is difficult, T-SPOT.TB blood test may be a helpful and rapid diagnostic tool to exclude ITB. Prospective large-scaled studies are required for further evaluation of the usefulness of T-SPOT.TB blood test for differential diagnosis between ITB and CD.

Mitochondria-dependent and -independent mechanisms in tumour necrosis factor-related apoptosis-inducing ligand (TRAIL)-induced apoptosis are both regulated by interferon-gamma in human breast tumour cells.

PubMed Central

Ruiz-Ruiz, Carmen; López-Rivas, Abelardo

2002-01-01

Tumour necrosis factor-related apoptosis-inducing ligand (TRAIL/APO-2L) induces apoptosis in a variety of tumour cells upon binding to death receptors TRAIL-R1 and TRAIL-R2. Here we describe the sensitization by interferon (IFN)-gamma to TRAIL-induced apoptosis in the breast tumour cell lines MCF-7 and MDA-MB231. IFN-gamma promoted TRAIL-mediated activation of caspase-8, Bcl-2 interacting domain death agonist (Bid) degradation, Bcl-2-associated X protein (Bax) translocation to mitochondria, cytochrome c release to the cytosol and activation of caspase-9 in these cell lines. No changes in the expression of TRAIL receptors were observed upon IFN-gamma treatment. Overexpression of Bcl-2 in MCF-7 cells completely inhibited IFN-gamma-induced sensitization to TRAIL-mediated cell death. Interestingly, TRAIL-induced apoptosis was also clearly enhanced by IFN-gamma in caspase-3-overexpressing MCF-7 cells, in the absence of Bax translocation to mitochondria and cytochrome c release to the cytosol. In summary, our results suggest that IFN-gamma facilitates TRAIL-induced activation of mitochondria-regulated as well as mitochondria-independent apoptotic pathways in breast tumour cells. PMID:11936954

CMOS image sensor for detection of interferon gamma protein interaction as a point-of-care approach.

PubMed

Marimuthu, Mohana; Kandasamy, Karthikeyan; Ahn, Chang Geun; Sung, Gun Yong; Kim, Min-Gon; Kim, Sanghyo

2011-09-01

Complementary metal oxide semiconductor (CMOS)-based image sensors have received increased attention owing to the possibility of incorporating them into portable diagnostic devices. The present research examined the efficiency and sensitivity of a CMOS image sensor for the detection of antigen-antibody interactions involving interferon gamma protein without the aid of expensive instruments. The highest detection sensitivity of about 1 fg/ml primary antibody was achieved simply by a transmission mechanism. When photons are prevented from hitting the sensor surface, a reduction in digital output occurs in which the number of photons hitting the sensor surface is approximately proportional to the digital number. Nanoscale variation in substrate thickness after protein binding can be detected with high sensitivity by the CMOS image sensor. Therefore, this technique can be easily applied to smartphones or any clinical diagnostic devices for the detection of several biological entities, with high impact on the development of point-of-care applications.

Interferon-gamma and T-bet expression in a patient with toxoplasmic lymphadenopathy.

PubMed

Jöhrens, Korinna; Moos, Verena; Schneider, Thomas; Stein, Harald; Anagnostopoulos, Ioannis

2010-04-01

Infection with Toxoplasma gondii (TG) presents in some individuals as a self-limited disease with a predominant lymphadenopathy characterized by prominent B-cell activation. As this is in contrast to the in vitro based concept of a T(h)1-immune response against TG, we investigated native lymphoid tissue and peripheral blood of a patient with serologic evidence of toxoplasmosis to verify which cells show T(h)1-response features. High-level expression of T-bet in monocytoid B-cells, in germinal center B-cells, and in a lesser amount in T cells could be demonstrated by immunohistochemistry. In vitro stimulation of lymph node cells with either TG, staphylococcus enterotoxin B, or phorbol 12-myristate 13-acetate/ionomycin revealed an interferon-gamma expression in T-bet(+) B cells only in the patient and not in controls. Similar results were found for T-bet(+) T cells which were also present in controls. CD4(+) peripheral blood cells stimulated with TG antigens showed a TG-specific but attenuated T(h)1-reactivity in the patient associated with a reduced expression of IL-2 when compared with controls. We conclude that the pathogenesis and course of toxoplasmic lymphadenopathy is based on a T(h)1-cell defect, which becomes compensated by the B cells mounting a T(h)1-like immune response.

Delayed growth of EL4 lymphoma in SR-A-deficient mice is due to upregulation of nitric oxide and interferon-gamma production by tumor-associated macrophages.

PubMed

Komohara, Yoshihiro; Takemura, Kenichi; Lei, Xiao Feng; Sakashita, Naomi; Harada, Mamoru; Suzuki, Hiroshi; Kodama, Tatsuhiko; Takeya, Motohiro

2009-11-01

Class A scavenger receptors (SR-A, CD204) are highly expressed in tumor-associated macrophages (TAM). To investigate the function of SR-A in TAM, wild-type and SR-A-deficient (SR-A(-/-)) mice were injected with EL4 cells. Although these groups of mice did not differ in the numbers of infiltrating macrophages and lymphocytes and in neovascularization, SR-A(-/-) mice had delayed growth of EL4 tumors. Expression of inducible nitric oxide (NO) synthase and interferon (IFN)-gamma mRNA increased significantly in tumor tissues from SR-A(-/-) mice. Engulfment of necrotic EL4 cells induced upregulation of NO and IFN-gamma production by cultured macrophages, and production of NO and IFN-gamma increased in SR-A(-/-) macrophages in vitro. IFN-beta production by cultured macrophages was also elevated in SR-A(-/-) macrophages in vitro. These results suggested that the antitumor activity of macrophages increased in SR-A(-/-) mice because of upregulation of NO and IFN-gamma production. These data indicate an important role of SR-A in regulating TAM function by inhibiting toll-like receptor (TLR)4-IFN-beta signaling.

Application of genetically engineered Salmonella typhimurium for interferon-gamma-induced therapy against melanoma.

PubMed

Yoon, Wonsuck; Park, Yoo Chang; Kim, Jinseok; Chae, Yang Seok; Byeon, Jung Hye; Min, Sang-Hyun; Park, Sungha; Yoo, Young; Park, Yong Keun; Kim, Byeong Mo

2017-01-01

Salmonella have been experimentally used as anti-cancer agents, because they show selective growth in tumours. In this study, we genetically modified attenuated Salmonella typhimurium to express and secrete interferon-gamma (IFN-γ) as a tumouricidal agent to enhance the therapeutic efficacy of Salmonella. IFN-γ was fused to the N-terminal region (residues 1-160) of SipB (SipB160) for secretion from bacterial cells. Attenuated S. typhimurium expressing recombinant IFN-γ (S. typhimurium (IFN-γ)) invaded the melanoma cells and induced cytotoxicity. Subcutaneous administration of S. typhimurium (IFN-γ) also efficiently inhibited tumour growth and prolonged the survival of C57BL/6 mice bearing B16F10 melanoma compared with administration of phosphate-buffered saline (PBS), unmodified S. typhimurium or S. typhimurium expressing empty vector (S. typhimurium [Vec]) in a natural killer (NK) cell-dependent manner. Moreover, genetically modified Salmonella, including S. typhimurium (IFN-γ), showed little toxicity to normal tissues with no observable adverse effects. However, S. typhimurium (IFN-γ)-mediated tumour suppression was attributed to direct killing of tumour cells rather than to stable anti-tumour immunity. Collectively, these results suggest that tumour-targeted therapy using S. typhimurium (IFN-γ) has potential for melanoma treatment. Copyright © 2016 Elsevier Ltd. All rights reserved.

Mussel-Inspired Electro-Cross-Linking of Enzymes for the Development of Biosensors.

PubMed

El-Maiss, Janwa; Cuccarese, Marco; Maerten, Clément; Lupattelli, Paolo; Chiummiento, Lucia; Funicello, Maria; Schaaf, Pierre; Jierry, Loïc; Boulmedais, Fouzia

2018-06-06

In medical diagnosis and environmental monitoring, enzymatic biosensors are widely applied because of their high sensitivity, potential selectivity, and their possibility of miniaturization/automation. Enzyme immobilization is a critical process in the development of this type of biosensors with the necessity to avoid the denaturation of the enzymes and ensuring their accessibility toward the analyte. Electrodeposition of macromolecules is increasingly considered to be the most suitable method for the design of biosensors. Being simple and attractive, it finely controls the immobilization of enzymes on electrode surfaces, usually by entrapment or adsorption, using an electrical stimulus. Performed manually, enzyme immobilization by cross-linking prevents enzyme leaching and was never done using an electrochemical stimulus. In this work, we present a mussel-inspired electro-cross-linking process using glucose oxidase (GOX) and a homobifunctionalized catechol ethylene oxide spacer as a cross-linker in the presence of ferrocene methanol (FC) acting as a mediator of the buildup. Performed in one pot, the process takes place in three steps: (i) electro-oxidation of FC, by the application of cyclic voltammetry, creating a gradient of ferrocenium (FC + ); (ii) oxidation of bis-catechol into a bis-quinone molecule by reaction with the electrogenerated FC + ; and (iii) a chemical reaction of bis-quinone with free amino moieties of GOX through Michael addition and a Schiff's base condensation reaction. Employed for the design of a second-generation glucose biosensor using ferrocene methanol (FC) as a mediator, this new enzyme immobilization process presents several advantages. The cross-linked enzymatic film (i) is obtained in a one-pot process with nonmodified GOX, (ii) is strongly linked to the metallic electrode surface thanks to catechol moieties, and (iii) presents no leakage issues. The developed GOX/bis-catechol film shows a good response to glucose with a quite wide

Interferon-gamma regulates nucleoside transport systems in macrophages through signal transduction and activator of transduction factor 1 (STAT1)-dependent and -independent signalling pathways.

PubMed Central

Soler, Concepció; Felipe, Antonio; García-Manteiga, José; Serra, Maria; Guillén-Gómez, Elena; Casado, F Javier; MacLeod, Carol; Modolell, Manuel; Pastor-Anglada, Marçal; Celada, Antonio

2003-01-01

The expressions of CNT and ENT (concentrative and equilibrative nucleoside transporters) in macrophages are differentially regulated by IFN-gamma (interferon-gamma). This cytokine controls gene expression through STAT1-dependent and/or -independent pathways (where STAT1 stands for signal transduction and activator of transcription 1). In the present study, the role of STAT1 in the response of nucleoside transporters to IFN-gamma was studied using macrophages from STAT1 knockout mice. IFN-gamma triggered an inhibition of ENT1-related nucleoside transport activity through STAT1-dependent mechanisms. Such inhibition of macrophage growth and ENT1 activity by IFN-gamma is required for DNA synthesis. Interestingly, IFN-gamma led to an induction of the CNT1- and CNT2-related nucleoside transport activities independent of STAT1, thus ensuring the supply of extracellular nucleosides for the STAT1-independent RNA synthesis. IFN-gamma up-regulated CNT2 mRNA and CNT1 protein levels and down-regulated ENT1 mRNA in both wild-type and STAT1 knockout macrophages. This is consistent with a STAT1-independent, long-term-mediated, probably transcription-dependent, regulation of nucleoside transporter genes. Moreover, STAT1-dependent post-transcriptional mechanisms are implicated in the regulation of ENT1 activity. Although nitric oxide is involved in the regulation of ENT1 activity in B-cells at a post-transcriptional level, our results show that STAT1-dependent induction of nitric oxide by IFN-gamma is not implicated in the regulation of ENT1 activity in macrophages. Our results indicate that both STAT1-dependent and -independent pathways are involved in the regulation of nucleoside transporters by IFN-gamma in macrophages. PMID:12868960

Promotion of interferon-gamma production by natural killer cells via suppression of murine peritoneal macrophage prostaglandin E₂ production using intravenous anesthetic propofol.

PubMed

Inada, Takefumi; Kubo, Kozue; Shingu, Koh

2010-10-01

Propofol is an intravenous anesthetic, widely used for general anesthesia during surgery, which inevitably involves tissue trauma with inflammation. At sites of inflammation, prostanoids, especially prostaglandin E₂ (PGE₂), are abundant. This study addresses the effect of propofol on macrophage PGE₂ production. Using thioglycollate-elicited murine peritoneal macrophages, propofol (7.5-30 μM) suppressed lipopolysaccharide-induced PGE₂ production. The suppression was via the direct inhibition of cyclooxygenase (COX) enzyme activity and due neither to the downregulation of COX expression nor the inhibition of arachidonic acid release from plasma membranes. In macrophage:natural killer (NK) cell co-culture, propofol dramatically increased interferon-gamma (IFN-γ) production, and the actions of propofol were mimicked by a selective COX-2 inhibitor, NS-398, as well as the selective EP4 receptor antagonist L-161,982, suggesting a role of PGE₂ suppression in the upregulation of IFN-γ production. Furthermore, in purified NK cell culture, PGE₂ directly suppressed the production of IFN-γ by activated NK cells, which was reversed by selective inhibition of EP4 activity. Taken together, our results show that, in macrophage:NK cell co-culture, propofol, through the suppression of macrophage PGE₂ production, upregulates NK cell IFN-γ production by alleviating EP4 receptor-mediated suppression of IFN-γ production. Propofol may potentially exert considerable influence on inflammation and immunity by suppressing PGE₂ synthesis. Copyright © 2010 Elsevier B.V. All rights reserved.

Coexposure of mice to trovafloxacin and lipopolysaccharide, a model of idiosyncratic hepatotoxicity, results in a unique gene expression profile and interferon gamma-dependent liver injury.

PubMed

Shaw, Patrick J; Ditewig, Amy C; Waring, Jeffrey F; Liguori, Michael J; Blomme, Eric A; Ganey, Patricia E; Roth, Robert A

2009-01-01

The antibiotic trovafloxacin (TVX) has caused severe idiosyncratic hepatotoxicity in people, whereas levofloxacin (LVX) has not. Mice cotreated with TVX and lipopolysaccharide (LPS), but not with LVX and LPS, develop severe hepatocellular necrosis. Mice were treated with TVX and/or LPS, and hepatic gene expression changes were measured before liver injury using gene array. Hepatic gene expression profiles from mice treated with TVX/LPS clustered differently from those treated with LPS or TVX alone. Several of the probe sets expressed differently in TVX/LPS-treated mice were involved in interferon (IFN) signaling and the janus kinase/signal transducers and activators of transcription (JAK/STAT) pathway. A time course of plasma concentrations of IFN-gamma and interleukin (IL)-18, which directly induces IFN-gamma production, revealed that both cytokines were selectively increased in TVX/LPS-treated mice. Both IL-18(-/-) and IFN-gamma(-/-) mice were significantly protected from TVX/LPS-induced liver injury. In addition, IFN-gamma(-/-) mice had decreased plasma concentrations of tumor necrosis factor-alpha, IL-18, and IL-1beta when compared to wild-type mice. In conclusion, the altered expression of genes involved in IFN signaling in TVX/LPS-treated mice led to the finding that IL-18 and IFN-gamma play a critical role in TVX/LPS-induced liver injury.

Correlations between endotoxin, interferon-gamma, biopterin and serum phospholipase A2-activities during lethal gram negative sepsis in rats.

PubMed

Hunsicker, A; Kullich, W; Weissenhofer, W; Lorenz, D; Petermann, J; Rokos, H; Schwesinger, G

1997-05-01

To establish a standardised reproducible animal model of intraperitoneal sepsis, and to investigate early immunoserological responses to find a mediator-based system for evaluation and grading of diffuse peritonitis in patients Prospective experimental study 4 Teaching hospitals, Germany and Austria 42 LEW. 1W rats, 12 of which acted as controls Gram negative sepsis was induced by intraperitoneal injection of 6 ml of a mixture of Escherichia coli (K1:H+) 10(10) organisms/ml, autogenous haemoglobin 2.9 ml (haemoglobin concentration 3%), 0.9% sodium chloride 3 ml, and suspension 0.1 ml. Control rats were given physiological saline 6 ml alone. Concentrations of endotoxin, interferon gamma (IFN-gamma), and biopterin, and serum phospholipase A2 (PLA2) activity. There were significant differences between the septic and control rats in concentrations of endotoxin (EU/ml) (median (interquartile range) 21.85 (2.02-159.5) compared with 0, p < 0.0001; IFN-gamma (pg/ml) 1263.0 (271.0-7575.0) compared with 101.0 (89.0-141.0), p < 0.0001; biopterin (nmol/L) 111.0 (66.4-156.3) compared with 53.7 (38.3-67.6), p < 0.001; and PLA2 (U/L) 163.0 (125.8-209.0) compared with 112.5 (88.5-126.5) p < 0.01. Measurements of concentrations of endotoxin, IFN-gamma, pteridines, and PLA2 activity may well be adequate markers for early recognition of sepsis, and perhaps for grading it during the first 6 hours after induction. The allow a clear distinction to be made between septic and non-septic disorders in 87% of cases.

Interferon effects on protozoan infections

NASA Technical Reports Server (NTRS)

Sonnenfeld, G.; Wirth, J.; Kierszenbaum, F.; Degee, A. L. W.; Mansfield, J. M.

1985-01-01

The effects of interferon (IFN) on mice infected with two different parasitic protozoans, Trypanosoma cruzi and Trypanosoma brucei rhodesiense, are investigated experimentally. The preparation of the cell cultures, IFN and assays, antibody, and the experimental procedures are described. It is observed that in cells treated with IFN-gamma there is an increased association of T. cruzi with murine macrophages and an increase in the killing of T. cruzi by IFN-gamma-treated murine macrophages. For spleen cells infected with T.b. rhodesiense in vitro, it is detected that live trypanosomes cannot induce IFN in cells from normal mice, but can in cells from immunized mice; and that trypanosome-lysates induce IFN in vitro in cells from normal mice. The data suggest that there is a two-step mechanism for mice against T. cruzi and T.b. rhodesiense.

Magnetic cross-linked enzyme aggregates (CLEAs): a novel concept towards carrier free immobilization of lignocellulolytic enzymes.

PubMed

Bhattacharya, Abhishek; Pletschke, Brett I

2014-01-01

The enzymatic conversion of lignocellulosic biomass into biofuels has been identified as an excellent strategy to generate clean energy. However, the current process is cost-intensive as an effective immobilization approach to reuse the enzyme(s) has been a major challenge. The present study introduces the concept and application of novel magnetic cross-linked enzyme aggregates (mag-CLEAs). Both mag-CLEAs and calcium-mag-CLEAs (Ca-mag-CLEAs) exhibited a 1.35 fold higher xylanase activity compared to the free enzyme and retained more than 80.0% and 90.0% activity, respectively, after 136h of incubation at 50°C, compared to 50% activity retained by CLEAs. A 7.4 and 9.0 fold higher sugar release from lime-pretreated and NH4OH pre-treated sugar bagasse, respectively, was achieved with Ca-mag-CLEAs compared to the free enzymes. The present study promotes the successful application of mag-CLEAs and Ca-mag-CLEAs as carrier free immobilized enzymes for the effective hydrolysis of lignocellulolytic biomass and associated biofuel feedstocks. Copyright © 2014 Elsevier Inc. All rights reserved.

Histaminergic regulation of interferon-gamma (IFN-gamma) production by human natural killer (NK) cells.

PubMed

Asea, A; Hansson, M; Czerkinsky, C; Houze, T; Hermodsson, S; Strannegård, O; Hellstrand, K

1996-08-01

Monocytes, recovered from human peripheral blood by counter-current centrifugal elutriation, effectively inhibit the production of IFN-gamma by CD3-/56+ NK cells in response to IL-2. This study aimed at defining the nature of the inhibitory signal, particularly the importance of monocyte-derived reactive metabolites of oxygen. It was found that monocytes recovered from patients with chronic granulomatous disease (CGD), a condition characterized by deficient NADPH-oxidase activity of phagocytes, did not inhibit IFN-gamma production by NK cells. Further, catalase, a scavenger of hydrogen peroxide, completely reversed the inhibitory signal whereas scavengers of the superoxide anion, hypohalous acids, the hydroxyl radical, or nitric oxide synthesis inhibitors such as L-NMMA were ineffective. Inhibition of IFN-gamma production was operating on a pretranslational level, as indicated by the inability of enriched NK cells to accumulate IFN-gamma mRNA in the presence of elutriated monocytes. Hydrogen peroxide, at micromolar concentrations, reconstituted the inhibition of IFN-gamma production when added to enriched NK cells. Histamine, a biogenic amine which inhibits the generation of reactive oxygen metabolites in monocytes, abrogated the inhibition of IFN-gamma production in NK cells; by this mechanism, histamine strongly synergized with IL-2 to induce IFN-gamma in mixtures of NK cells and monocytes. The synergizing effect of histamine was specifically mediated by H2-type histamine receptors. We conclude that: (i) the induction of IFN-gamma mRNA in NK cells is effectively down-regulated by products of the oxidative metabolism of monocytes; and (ii) histamine effectively enhances IFN-gamma production by preventing monocyte-induced oxidative damage to NK cells.

Partial interferon-gamma receptor 1 deficiency in a child with tuberculoid bacillus Calmette-Guérin infection and a sibling with clinical tuberculosis.

PubMed Central

Jouanguy, E; Lamhamedi-Cherradi, S; Altare, F; Fondanèche, M C; Tuerlinckx, D; Blanche, S; Emile, J F; Gaillard, J L; Schreiber, R; Levin, M; Fischer, A; Hivroz, C; Casanova, J L

1997-01-01

Complete interferon-gamma receptor 1 (IFNgammaR1) deficiency has been identified previously as a cause of fatal bacillus Calmette-Guérin (BCG) infection with lepromatoid granulomas, and of disseminated nontuberculous mycobacterial (NTM) infection in children who had not been inoculated with BCG. We report here a kindred with partial IFNgammaR1 deficiency: one child afflicted by disseminated BCG infection with tuberculoid granulomas, and a sibling, who had not been inoculated previously with BCG, with clinical tuberculosis. Both responded to antimicrobials and are currently well without prophylactic therapy. Impaired response to IFN-gamma was documented in B cells by signal transducer and activator of transcription 1 nuclear translocation, in fibroblasts by cell surface HLA class II induction, and in monocytes by cell surface CD64 induction and TNF-alpha secretion. Whereas cells from healthy children responded to even low IFN-gamma concentrations (10 IU/ml), and cells from a child with complete IFNgammaR1 deficiency did not respond to even high IFN-gamma concentrations (10,000 IU/ml), cells from the two siblings did not respond to low or intermediate concentrations, yet responded to high IFN-gamma concentrations. A homozygous missense IFNgR1 mutation was identified, and its pathogenic role was ascertained by molecular complementation. Thus, whereas complete IFNgammaR1 deficiency in previously identified kindreds caused fatal lepromatoid BCG infection and disseminated NTM infection, partial IFNgammaR1 deficiency in this kindred caused curable tuberculoid BCG infection and clinical tuberculosis. PMID:9389728

Designing of interferon-gamma inducing MHC class-II binders

PubMed Central

2013-01-01

Background The generation of interferon-gamma (IFN-γ) by MHC class II activated CD4+ T helper cells play a substantial contribution in the control of infections such as caused by Mycobacterium tuberculosis. In the past, numerous methods have been developed for predicting MHC class II binders that can activate T-helper cells. Best of author’s knowledge, no method has been developed so far that can predict the type of cytokine will be secreted by these MHC Class II binders or T-helper epitopes. In this study, an attempt has been made to predict the IFN-γ inducing peptides. The main dataset used in this study contains 3705 IFN-γ inducing and 6728 non-IFN-γ inducing MHC class II binders. Another dataset called IFNgOnly contains 4483 IFN-γ inducing epitopes and 2160 epitopes that induce other cytokine except IFN-γ. In addition we have alternate dataset that contains IFN-γ inducing and equal number of random peptides. Results It was observed that the peptide length, positional conservation of residues and amino acid composition affects IFN-γ inducing capabilities of these peptides. We identified the motifs in IFN-γ inducing binders/peptides using MERCI software. Our analysis indicates that IFN-γ inducing and non-inducing peptides can be discriminated using above features. We developed models for predicting IFN-γ inducing peptides using various approaches like machine learning technique, motifs-based search, and hybrid approach. Our best model based on the hybrid approach achieved maximum prediction accuracy of 82.10% with MCC of 0.62 on main dataset. We also developed hybrid model on IFNgOnly dataset and achieved maximum accuracy of 81.39% with 0.57 MCC. Conclusion Based on this study, we have developed a webserver for predicting i) IFN-γ inducing peptides, ii) virtual screening of peptide libraries and iii) identification of IFN-γ inducing regions in antigen (http://crdd.osdd.net/raghava/ifnepitope/). Reviewers This article was reviewed by Prof Kurt

Enzyme-Linked Immunosorbent Assay (ELISA).

PubMed

Konstantinou, George N

2017-01-01

Food allergy is a public health concern especially after recognizing its constantly increased prevalence and severity. Despite careful reading of food ingredient statements, food allergic individuals may experience reactions caused by "hidden", "masked", or "contaminated" proteins that are known major allergens. Many techniques have been developed to detect even small traces of food allergens, for clinical or laboratory purposes. Enzyme-linked immunosorbent assay (ELISA) is one of the best validated and most routinely used immunoassay in allergy research, in allergy diagnosis in allergy-related quality control in various industries. Although as a technique it has been implemented for the last 45 years, the evolution in biochemistry allowed the development of ultrasensitive ELISA variations that are capable of measuring quantities in the scale of picograms, rendering ELISA attractive, robust, and very famous.

Average capacity of the ground to train communication link of a curved track in the turbulence of gamma-gamma distribution

NASA Astrophysics Data System (ADS)

Yang, Yanqiu; Yu, Lin; Zhang, Yixin

2017-04-01

A model of the average capacity of optical wireless communication link with pointing errors for the ground-to-train of the curved track is established based on the non-Kolmogorov. By adopting the gamma-gamma distribution model, we derive the average capacity expression for this channel. The numerical analysis reveals that heavier fog reduces the average capacity of link. The strength of atmospheric turbulence, the variance of pointing errors, and the covered track length need to be reduced for the larger average capacity of link. The normalized beamwidth and the average signal-to-noise ratio (SNR) of the turbulence-free link need to be increased. We can increase the transmit aperture to expand the beamwidth and enhance the signal intensity, thereby decreasing the impact of the beam wander accordingly. As the system adopting the automatic tracking of beam at the receiver positioned on the roof of the train, for eliminating the pointing errors caused by beam wander and train vibration, the equivalent average capacity of the channel will achieve a maximum value. The impact of the non-Kolmogorov spectral index's variation on the average capacity of link can be ignored.

Mycobacterium tuberculosis infection in health care workers in rural India: comparison of a whole-blood interferon gamma assay with tuberculin skin testing.

PubMed

Pai, Madhukar; Gokhale, Kaustubh; Joshi, Rajnish; Dogra, Sandeep; Kalantri, Shriprakash; Mendiratta, Deepak K; Narang, Pratibha; Daley, Charles L; Granich, Reuben M; Mazurek, Gerald H; Reingold, Arthur L; Riley, Lee W; Colford, John M

2005-06-08

Mycobacterium tuberculosis infection in health care workers has not been adequately studied in developing countries using newer diagnostic tests. To estimate latent tuberculosis infection prevalence in health care workers using the tuberculin skin test (TST) and a whole-blood interferon gamma (IFN-gamma) assay; to determine agreement between the tests; and to compare their correlation with risk factors. A cross-sectional comparison study of 726 health care workers aged 18 to 61 years (median age, 22 years) with no history of active tuberculosis conducted from January to May 2004, at a rural medical school in India. A total of 493 (68%) of the health care workers had direct contact with patients with tuberculosis and 514 (71%) had BCG vaccine scars. Tuberculin skin testing was performed using 1-TU dose of purified protein derivative RT23, and the IFN-gamma assay was performed by measuring IFN-gamma response to early secreted antigenic target 6, culture filtrate protein 10, and a portion of tuberculosis antigen TB7.7. Agreement between TST and the IFN-gamma assay, and comparison of the tests with respect to their association with risk factors. A large proportion of the health care workers were latently infected; 360 (50%) were positive by either TST or IFN-gamma assay, and 226 (31%) were positive by both tests. The prevalence estimates of TST and IFN-gamma assay positivity were comparable (41%; 95% confidence interval [CI], 38%-45% and 40%; 95% CI, 37%-43%, respectively). Agreement between the tests was high (81.4%; kappa = 0.61; 95% CI, 0.56-0.67). Increasing age and years in the health profession were significant risk factors for both IFN-gamma assay and TST positivity. BCG vaccination had little impact on TST and IFN-gamma assay results. Our study showed high latent tuberculosis infection prevalence in Indian health care workers, high agreement between TST and IFN-gamma assay, and similar association between positive test results and risk factors. Although TST and

The effect of fermented milk on interferon production in malnourished children and in anorexia nervosa patients undergoing nutritional care.

PubMed

Solis, B; Nova, E; Gómez, S; Samartín, S; Mouane, N; Lemtouni, A; Belaoui, H; Marcos, A

2002-12-01

For several years cytokine production has been associated with infections but it was not suspected that some types of food could also induce cytokines, even in a state of non-infection. Lactic bacteria can induce interferon (IFN) production in human healthy subjects, thus, a better protection against infections would be expected. Therefore, we planned to evaluate the effect of two diets including yoghurt or milk on IFN-gamma production during nutritional recovery in two different situations of malnutrition: (1) children with diarrhoea; and (2) patients with anorexia nervosa (AN). Both the diet including yoghurt of that including milk seemed to increase IFN-gamma production at the end of nutritional recovery in the malnourished children with diarrhoea. The significance of interferon production and the lymphocyte subset increase should be explored to know if a better resistance against pathogens is related to them. Regulation of intestinal absorption and moderate stimulation of interferon production make the yoghurt-based diet a good choice in the nutritional care of children. In the same way, an increase in the IFN-gamma production was observed in AN patients consuming yoghurt. This increase of IFN-gamma production could be considered a biological marker to detect the effect of probiotics on the immune response, especially in the improvement of a deficient nutritional status.

Amplification of the enzyme-linked immunosorbent assay (ELISA) in the detection of class-specific antibodies.

PubMed

Butler, J E; McGivern, P L; Swanson, P

1978-01-01

A modification of the standard enzyme-linked immunosorbent assay (ELISA) is described which circumvents the requirement for specifically purified antibodies from which antibody-enzyme complexes are made. The assay utilizes the principle of a soluble anti-alkaline phosphatase immune complex (AP-A-AP) and has been called the amplified ELISA. Methods for preparing and evidence for the specificity of rabbit anti-rat gamma-FC, IgM (mu) and IgA (alpha) are presented. These reagents are used to measure anti-DNP antibodies belonging to classes IgG, IgM and IgA in rat serum. Using antiglobulin and anti-enzyme reagents prepared in guinea pigs, anti-ovalbumin antibodies are measured in rabbit serum. Titration curves are similar when the amplified ELISA is compared to the standard ELISA. A change in slope suggesting an effect of saturation of antigen sites, occurs at the same input antibody concentration for both assays. Determination of the anti-DNP concentration of unknown sera by extrapopulation from titration graphs of a known serum suggests that the value is overestimated, i.e., amplified when the amplified ELISA is used. In addition, the amplified ELISA has an improved ability to detect low levels of antibody. Evidence is presented which illustrates how the use of optimally conjugated DNP-proteins, age of conjugates, and optimal dilutions of secondary antiglobulins and the AP-A-AP reduce non-specific binding in the amplified ELISA. The amplified ELISA is capable of detecting 2.4 ng of antibody to ovalbumin in a one: one million dilution of rabbit serum with high reproducibility and low background.

Cross-linked enzyme aggregates of phenylalanine ammonia lyase: novel biocatalysts for synthesis of L-phenylalanine.

PubMed

Cui, Jian-Dong; Zhang, Si; Sun, Li-Mei

2012-06-01

Cross-linked enzyme aggregates of phenylalanine ammonia lyase (PAL-CLEAs) from Rhodotorula glutinis were prepared. The effects of the type of aggregating agent, its concentration, and that of cross-linking agent were studied. PAL-CLEAs production was most effective using ammonium sulfate (40 % saturation), followed by cross-linking for 1 h with 0.2 % (v/v) glutaraldehyde. Moreover, the storage and operational stability of the resulting PAL-CLEAs were also investigated. Compared to the free enzyme, the PAL-CLEAs exhibited the expected increased stability of the enzyme against various deactivating conditions such as pH, temperature, denaturants, and organic solvents and showed higher storage stability than its soluble counterpart. Additionally, the reusability of PAL-CLEAs with respect to the biotransformation of L-phenylalanine was evaluated. PAL-CLEAs could be recycled at least for 12 consecutive batch reactions without dramatic activity loss, which should dramatically increase the commercial potential of PAL for synthesis of L: -phenylalanine. To the best of our knowledge, this is the first report of immobilization of PAL as cross-linked enzyme aggregates.

Successful Application of the Gamma-Interferon Assay in a Bovine Tuberculosis Eradication Program: The French Bullfighting Herd Experience.

PubMed

Keck, Nicolas; Boschiroli, Maria-Laura; Smyej, Florence; Vogler, Valérie; Moyen, Jean-Louis; Desvaux, Stéphanie

2018-01-01

In the French Camargue region, where bovine tuberculosis had been enzootic for several years in bullfighting cattle herds, the gamma-interferon (IFN) assay was used since 2003 in parallel with the intradermal test in order to increase overall disease detection sensitivity in infected herds. This study presents the results of a field-evaluation of the assay during a 10-year period (2004-2014) of disease control and surveillance program and explores the particular pattern of IFN assay results in bullfight herds in comparison to cattle from other regions of France. The low sensitivity [59.2% (50.6; 67.3)] of IFN assay using the tuberculin stimulation could be related to the poor gamma-IFN production from bullfight cattle blood cells which is significantly lower than in animals of conventional breeds. The characteristics of the assay were progressively adapted to the epidemiological situation and the desired strategic applications. Data analysis with a receiver operating characteristic curve based on a simple S/P value algorithm allowed for the determination of a new cutoff adapted for a global screening, giving a high specificity of 99.9% results and a high accuracy of the assay. Having regularly risen to above 5% since 2005, with a peak around 10% in 2010, the annual incidence dropped to under 1% in 2014. The positive predictive value relative to the bacteriological confirmation evolved during the years, from 33% in 2009 to 12% during the last screening period, a normal trend in a context of decreasing prevalence. The estimated rate of false-positive reactions during screening campaigns was 0.67%, confirming the high specificity of the test, measured in bTB negative herds, in this epidemiological context. The proportion of false-positive reactions decreased with the age and was higher in males than in females. Although these results indicate that the IFN assay is accurate in the field, it also emphasizes great differences between interferon quantities produced by

Interferon action: two (2'-5')(A)n synthetases specified by distinct mRNAs in Ehrlich ascites tumor cells treated with interferon.

PubMed

St Laurent, G; Yoshie, O; Floyd-Smith, G; Samanta, H; Sehgal, P B; Lengyel, P

1983-05-01

(2'-5')(A)n synthetase and RNAase L (a latent endoribonuclease) are among the mediators of interferon action. The product of (2'-5')(A)n synthetase (i.e., (2'-5')(A)n) binds, and thereby activates RNAase L. Interferons induce in Ehrlich ascites tumor (EAT) cells two mRNAs (sizes 1.5 kb and 3.8 kb), which can be translated in Xenopus oocytes into (2'-5')(A)n synthetases of 20,000 to 30,000 daltons and 85,000 to 100,000 daltons, respectively. (2'-5')(A)n synthetases of corresponding sizes are induced by interferons in EAT cells. In the cell extract the bulk of the larger enzyme is in the cytoplasmic fraction, and the bulk of the smaller one in the nuclear fraction. The only known function of (2'-5')(A)n is the activation of RNAase L, and RNAase L can be selectively crosslinked to a (2'-5')(A)n derivative in a cytoplasmic extract from EAT cells. The same (2'-5')(A)n derivative can be crosslinked to several proteins in the nuclear extract of EAT cells, and some of these proteins are induced by interferon.

Inhibition by antioxidants of nitric oxide synthase expression in murine macrophages: role of nuclear factor kappa B and interferon regulatory factor 1.

PubMed Central

Hecker, M.; Preiss, C.; Klemm, P.; Busse, R.

1996-01-01

1. In view of the potential deleterious effects of high amounts of nitric oxide (NO) produced by the inducible isoform of NO synthase (iNOS) in inflammation, the prevention of the expression of this enzyme represents an important therapeutic goal. In cytokine-stimulated cells, activation of nuclear factor kappa B (NF-kappa B) is crucial for the increase in iNOS gene expression. Since NF-kappa B activation appears to involve a redox-sensitive step, we have investigated whether three structurally unrelated antioxidants, 5,7-dihydroxyflavone (chrysin), 3,4-dichloroisocoumarin (DCI) and N-acetyl 5-hydroxytryptamine (N-acetylserotonin, NAS), affect iNOS expression in cultured RAW 264.7 monocyte/macrophages stimulated with bacterial lipopolysaccharide (LPS, 140 ng ml-1) and interferon-gamma (IFN gamma, 5 u ml-1). 2. During a 6 h incubation period neither LPS nor IFN gamma alone exerted a significant effect but when combined, caused a prominent increase in nitrite formation, iNOS mRNA and protein abundance. Co-incubation with chrysin (50 microM), DCI (50 microM) or NAS (1 mM) markedly attenuated this increase in iNOS gene expression. 3. DCI, but not chrysin or NAS, prevented the activation of NF-kappa B in cells exposed to LPS plus IFN gamma for 30 min. In contrast, all three antioxidants significantly blunted the DNA-binding activity of interferon regulatory factor 1 (IRF-1), which mediates the synergistic effect of IFN gamma on iNOS gene expression in cells treated for 2 h with LPS plus IFN gamma. 4. DCI thus appears to inhibit iNOS gene expression at the transcriptional level by preventing the activation of both NF-kappa B and IRF-1. The inhibitory effect of DCI on NF-kappa B activation, however, does not seem to be related to its antioxidative properties, since DCI, unlike chrysin or NAS, is a potent serine protease inhibitor which stabilizes the inactive NF-kappa B complex by protecting the inhibitory I kappa B-alpha subunit from proteolytic degradation. 5. The

Direct Competitive Enzyme-Linked Immunosorbent Assay (ELISA).

PubMed

Kohl, Thomas O; Ascoli, Carl A

2017-07-05

The competitive enzyme-linked immunosorbent assay (ELISA) (cELISA; also called an inhibition ELISA) is designed so that purified antigen competes with antigen in the test sample for binding to an antibody that has been immobilized in microtiter plate wells. The same concept works if the immobilized molecule is antigen and the competing molecules are purified labeled antibody versus antibody in a test sample. Direct cELISAs incorporate labeled antigen or antibody, whereas indirect assay configurations use reporter-labeled secondary antibodies. The cELISA is very useful for determining the concentration of small-molecule antigens in complex sample mixtures. In the direct cELISA, antigen-specific capture antibody is adsorbed onto the microtiter plate before incubation with either known standards or unknown test samples. Enzyme-linked antigen (i.e., labeled antigen) is also added, which can bind to the capture antibody only when the antibody's binding site is not occupied by either the antigen standard or antigen in the test samples. Unbound labeled and unlabeled antigens are washed away and substrate is added. The amount of antigen in the standard or the test sample determines the amount of reporter-labeled antigen bound to antibody, yielding a signal that is inversely proportional to antigen concentration within the sample. Thus, the higher the antigen concentration in the test sample, the less labeled antigen is bound to the capture antibody, and hence the weaker is the resultant signal. © 2017 Cold Spring Harbor Laboratory Press.

Full activation of RNaseL in animal cells requires binding of 2-5A within ankyrin repeats 6 to 9 of this interferon-inducible enzyme.

PubMed

Díaz-Guerra, M; Rivas, C; Esteban, M

1999-02-01

To define protein domains important for activation of the interferon (IFN)-induced enzyme 2-5A-dependent RNaseL, we have generated vaccinia virus (VV) recombinants able to express in cultured cells truncated forms of this protein and compared their biologic activities with those producing the wild-type enzyme, with and without coexpression of 2-5A synthetase. Our results show that full activation of RNaseL requires binding of 2-5A oligonucleotides within amino acid positions 212-339, corresponding to ankyrin repeats 6 to 9. The protein kinase and ribonuclease domains of RNaseL, amino acids 340-741, are sufficient for a constitutively active enzyme that is unresponsive to excess 2-5A. These results demonstrate in vivo the importance of the ankyrin domains in the biologic function of RNaseL. We suggest that ankyrin repeats act as key modulators of RNaseL activity.

Interferon-gamma response to the treatment of active pulmonary and extra-pulmonary tuberculosis.

PubMed

Liang, L; Shi, R; Liu, X; Yuan, X; Zheng, S; Zhang, G; Wang, W; Wang, J; England, K; Via, L E; Cai, Y; Goldfeder, L C; Dodd, L E; Barry, C E; Chen, R Y

2017-10-01

Interferon-gamma (IFN-γ) release assays (IGRAs) are used to diagnose tuberculosis (TB) but not to measure treatment response. To measure IFN-γ response to active anti-tuberculosis treatment. Patients from the Henan Provincial Chest Hospital, Henan, China, with TB symptoms and/or signs were enrolled into this prospective, observational cohort study and followed for 6 months of treatment, with blood and sputum samples collected at 0, 2, 4, 6, 8, 16 and 24 weeks. The QuantiFERON® TB-Gold assay was run on collected blood samples. Participants received a follow-up telephone call at 24 months to determine relapse status. Of the 152 TB patients enrolled, 135 were eligible for this analysis: 118 pulmonary (PTB) and 17 extra-pulmonary TB (EPTB) patients. IFN-γ levels declined significantly over time among all patients (P = 0.002), with this decline driven by PTB patients (P = 0.001), largely during the initial 8 weeks of treatment (P = 0.019). IFN-γ levels did not change among EPTB patients over time or against baseline culture or drug resistance status. After 6 months of effective anti-tuberculosis treatment, IFN-γ levels decreased significantly in PTB patients, largely over the initial 8 weeks of treatment. IFN-γ concentrations may offer some value for monitoring anti-tuberculosis treatment response among PTB patients.

Comparison of the Cytomegalovirus (CMV) Enzyme-Linked Immunosorbent Spot and CMV QuantiFERON Cell-Mediated Immune Assays in CMV-Seropositive and -Seronegative Pregnant and Nonpregnant Women

PubMed Central

Saldan, Alda; Forner, Gabriella; Mengoli, Carlo; Tinto, Daniel; Fallico, Loredana; Peracchi, Marta; Gussetti, Nadia

2016-01-01

Human cytomegalovirus (CMV) infection is a major cause of congenital infection leading to birth defects and sensorineural anomalies, including deafness. Recently, cell-mediated immunity (CMI) in pregnant women has been shown to correlate with congenital CMV transmission. In this study, two interferon gamma release assays (IGRA), the CMV enzyme-linked immunosorbent spot (ELISPOT) and CMV QuantiFERON assays, detecting CMV-specific CMI were compared. These assays were performed for 80 CMV-infected (57 primarily and 23 nonprimarily) pregnant women and 115 controls, including 89 healthy CMV-seropositive pregnant women without active CMV infection, 15 CMV-seronegative pregnant women, and 11 seropositive or seronegative nonpregnant women. Statistical tests, including frequency distribution analysis, nonparametric Kruskal-Wallis equality-of-populations rank test, Wilcoxon rank sum test for equality on unmatched data, and lowess smoothing local regression, were employed to determine statistical differences between groups and correlation between the assays. The CMV ELISPOT and CMV QuantiFERON assay data were not normally distributed and did not display equal variance. The CMV ELISPOT but not CMV QuantiFERON assay displayed significant higher values for primarily CMV-infected women than for the healthy seropositive pregnant and nonpregnant groups (P = 0.0057 and 0.0379, respectively) and those with nonprimary infections (P = 0.0104). The lowess local regression model comparing the assays on an individual basis showed a value bandwidth of 0.8. Both assays were highly accurate in discriminating CMV-seronegative pregnant women. The CMV ELISPOT assay was more effective than CMV-QuantiFERON in differentiating primary from the nonprimary infections. A substantial degree of variability exists between CMV ELISPOT and CMV QuantiFERON assay results for CMV-seropositive pregnant women. PMID:26962091

Highly specific detection of genetic modification events using an enzyme-linked probe hybridization chip.

PubMed

Zhang, M Z; Zhang, X F; Chen, X M; Chen, X; Wu, S; Xu, L L

2015-08-10

The enzyme-linked probe hybridization chip utilizes a method based on ligase-hybridizing probe chip technology, with the principle of using thio-primers for protection against enzyme digestion, and using lambda DNA exonuclease to cut multiple PCR products obtained from the sample being tested into single-strand chains for hybridization. The 5'-end amino-labeled probe was fixed onto the aldehyde chip, and hybridized with the single-stranded PCR product, followed by addition of a fluorescent-modified probe that was then enzymatically linked with the adjacent, substrate-bound probe in order to achieve highly specific, parallel, and high-throughput detection. Specificity and sensitivity testing demonstrated that enzyme-linked probe hybridization technology could be applied to the specific detection of eight genetic modification events at the same time, with a sensitivity reaching 0.1% and the achievement of accurate, efficient, and stable results.

Immobilization of cross-linked tannase enzyme on multiwalled carbon nanotubes and its catalytic behavior.

PubMed

Ong, Chong-Boon; Annuar, Mohamad S M

2018-02-07

Immobilization of cross-linked tannase on pristine multiwalled carbon nanotubes (MWCNT) was successfully performed. Cross-linking of tannase molecules was made through glutaraldehyde. The immobilized tannase exhibited significantly improved pH, thermal, and recycling stability. The optimal pH for both free and immobilized tannase was observed at pH 5.0 with optimal operating temperature at 30°C. Moreover, immobilized enzyme retained greater biocatalytic activities upon 10 repeated uses compared to free enzyme in solution. Immobilization of tannase was accomplished by strong hydrophobic interaction most likely between hydrophobic amino acid moieties of the glutaraldehyde-cross-linked tannase to the MWCNT.

MOLECULAR CLONING, SEQUENCING, EXPRESSION AND BIOLOGICAL ACTIVITY OF GIANT PANDA (AILUROPODA MELANOLEUCA) INTERFERON-GAMMA.

PubMed

Zhu, Hui; Wang, Wen-Xiu; Wang, Bao-Qin; Zhu, Xiao-Fu; Wu, Xu-Jin; Ma, Qing-Yi; Chen, De-Kun

2012-06-29

The giant panda (Ailuropoda melanoleuca) is an endangered species and indigenous to China. Interferon-gamma (IFN-γ) is the only member of type □ IFN and is vital for the regulation of host adapted immunity and inflammatory response. Little is known aboutthe FN-γ gene and its roles in giant panda.In this study, IFN-γ gene of Qinling giant panda was amplified from total blood RNA by RT-CPR, cloned, sequenced and analysed. The open reading frame (ORF) of Qinling giant panda IFN-γ encodes 152 amino acidsand is highly similar to Sichuan giant panda with an identity of 99.3% in cDNA sequence. The IFN-γ cDNA sequence was ligated to the pET32a vector and transformed into E. coli BL21 competent cells. Expression of recombinant IFN-γ protein of Qinling giant panda in E. coli was confirmed by SDS-PAGE and Western blot analysis. Biological activity assay indicated that the recombinant IFN-γ protein at the concentration of 4-10 µg/ml activated the giant panda peripheral blood lymphocytes,while at 12 µg/mlinhibited. the activation of the lymphocytes.These findings provide insights into the evolution of giant panda IFN-γ and information regarding amino acid residues essential for their biological activity.

Respiratory Francisella tularensis live vaccine strain infection induces Th17 cells and prostaglandin E2, which inhibits generation of gamma interferon-positive T cells.

PubMed

Woolard, Matthew D; Hensley, Lucinda L; Kawula, Thomas H; Frelinger, Jeffrey A

2008-06-01

Two key routes of Francisella tularensis infection are through the skin and airway. We wished to understand how the route of inoculation influenced the primary acute adaptive immune response. We show that an intranasal inoculation of the F. tularensis live vaccine strain (LVS) with a 1,000-fold-smaller dose than an intradermal dose results in similar growth kinetics and peak bacterial burdens. In spite of similar bacterial burdens, we demonstrate a difference in the quality, magnitude, and kinetics of the primary acute T-cell response depending on the route of inoculation. Further, we show that prostaglandin E(2) secretion in the lung is responsible for the difference in the gamma interferon (IFN-gamma) response. Intradermal inoculation led to a large number of IFN-gamma(+) T cells 7 days after infection in both the spleen and the lung. In contrast, intranasal inoculation induced a lower number of IFN-gamma(+) T cells in the spleen and lung but an increased number of Th17 cells in the lung. Intranasal infection also led to a significant increase of prostaglandin E(2) (PGE(2)) in the bronchoalveolar lavage fluid. Inhibition of PGE(2) production with indomethacin treatment resulted in increased numbers of IFN-gamma(+) T cells and decreased bacteremia in the lungs of intranasally inoculated mice. This research illuminates critical differences in acute adaptive immune responses between inhalational and dermal infection with F. tularensis LVS mediated by the innate immune system and PGE(2).

Gamma Interferon Loaded onto Albumin Nanoparticles: In Vitro and In Vivo Activities against Brucella abortus▿

PubMed Central

Segura, S.; Gamazo, C.; Irache, J. M.; Espuelas, S.

2007-01-01

The aim of this study was to evaluate the activity of gamma interferon (IFN-γ) when it was either adsorbed onto or loaded into albumin nanoparticles. Brucella abortus-infected macrophages and infected BALB/c mice were selected as the models for testing of the therapeutic potentials of these cytokine delivery systems, in view of the well-established role of IFN-γ-activated macrophages for the control of Brucella sp. infections. Whereas the encapsulation of IFN-γ inside the matrix of nanoparticles completely abrogated its activity, adsorbed IFN-γ increased by 0.75 log unit the bactericidal effect induced by RAW macrophages activated with free IFN-γ, along with a higher level of production of nitric oxide. In infected BALB/c-mice, IFN-γ adsorbed onto nanoparticles was also more active than free cytokine in reducing the number of bacteria in the spleens, and the effect was mediated by an increased ratio of IFN-γ-secreting (Th1) to interleukin-4-secreting (Th2) cells. Overall, albumin nanoparticles would be suitable as carriers that target IFN-γ to macrophages and, thus, potentiate their therapeutic activity. PMID:17220401

Frequency of indeterminate results from an interferon-gamma release assay among HIV-infected individuals.

PubMed

Oliveira, Sandra Maria do Valle Leone de; Trajman, Anete; Paniago, Anamaria Mello Miranda; Motta-Castro, Ana Rita Coimbra; Ruffino-Netto, Antonio; Maciel, Ethel Leonor Noia; Croda, Julio; Bonecini-Almeida, Maria da Gloria

2017-01-01

To evaluate the frequency of and factors associated with indeterminate interferon-gamma release assay (IGRA) results in people living with HIV/AIDS (PLWHA). We tested 81 PLWHA in the central-west region of Brazil, using the tuberculin skin test and an IGRA. Information on sociodemographic and clinical variables was gathered through the use of questionnaires and from medical records. The association of those variables with indeterminate results was analyzed by calculating the adjusted ORs in a multivariate logistic regression model. Concordance was evaluated by determining the kappa statistic. Among the 81 patients evaluated, the tuberculin skin test results were positive in 18 (22.2%) of the patients, and the IGRA results were positive in 10 (12.3%), with a kappa of 0.62. The IGRA results were indeterminate in 22 (27.1%) of the patients (95% CI: 17.8-38.1%). The odds of obtaining indeterminate results were significantly higher in smokers (adjusted OR = 6.0; 95% CI: 1.4-26.7) and in samples stored for less than 35 days (adjusted OR = 14.0; 95% CI: 3.1-64.2). Patients with advanced immunosuppression (CD4+ T-cell count < 200 cells/mm3) were at a higher risk for indeterminate results (OR adjusted for smoking and inadequate duration of sample storage = 4.7; 95% CI: 0.91-24.0), although the difference was not significant. The high prevalence of indeterminate results can be a major limitation for the routine use of IGRAs in PLWHA. The need to repeat the test increases its costs and should be taken into account in cost-effectiveness studies. The processing of samples can significantly alter the results. Avaliar a frequência de resultados indeterminados de um interferon-gamma release assay (IGRA, ensaio de liberação de interferon-gama) e os fatores relacionados com esses resultados em pessoas vivendo com HIV/AIDS (PVHA). Foram avaliadas 81 PVHA na região Centro-Oeste do Brasil, por meio do teste tuberculínico e de um IGRA. Informações a respeito de vari

Tumor necrosis factor alpha mediates resistance to Trypanosoma cruzi infection in mice by inducing nitric oxide production in infected gamma interferon-activated macrophages.

PubMed Central

Silva, J S; Vespa, G N; Cardoso, M A; Aliberti, J C; Cunha, F Q

1995-01-01

Cell invasion by Trypanosoma cruzi and its intracellular replication are essential for continuation of the parasite life cycle and for production of Chagas' disease. T. cruzi is able to replicate in nucleated cells and can be killed by activated macrophages. Gamma interferon (IFN-gamma) is one of the major stimuli for the activation of macrophages and has been shown to be a key activation factor for the killing of intracellular parasites through a mechanism dependent upon nitric oxide (NO) biosynthesis. We show that although the addition of exogenous tumor necrosis factor alpha (TNF-alpha) does not potentiate the trypanocidal activity of IFN-gamma in vitro, treatment of resistant C57BI/6 mice with an anti-TNF-alpha monoclonal antibody increased parasitemia and mortality. In addition, the anti-TNF-alpha-treated animals had decreased NO production, both in vivo and in vitro, suggesting an important role for TNF-alpha in controlling infection. In order to better understand the role of TNF-alpha in the macrophage-mediating killing of parasites, cultures of T. cruzi-infected macrophages were treated with an anti-TNF-alpha monoclonal antibody. IFN-gamma-activated macrophages failed to kill intracellular parasites following treatment with 100 micrograms of anti-TNF-alpha. In these cultures, the number of parasites released at various time points after infection was significantly increased while NO production was significantly reduced. We conclude that IFN-gamma-activated macrophages produce TNF-alpha after infection by T. cruzi and suggest that this cytokine plays a role in amplifying NO production and parasite killing. PMID:7591147

A novel cross-linked enzyme aggregates (CLEAs) of papain and neutrase-production, partial characterization and application.

PubMed

Chen, Zhongqin; Wang, Yanwei; Liu, Wei; Wang, Jingya; Chen, Haixia

2017-02-01

The neutrase (EC 3.4.24.4) and papain (EC 3.4.22.2) were together immobilized ascross-linked enzyme aggregates (N-P-CLEAs) and their properties were characterized. The influence of the precipitant, cross-linking ratio of glutaraldehyde and cross-linking time were investigated. Ethanol was selected as the more efficient precipitant compared with ammonium sulfate. The proper cross-linking ratio of enzyme and glutaraldehyde was 1:5 (v/v) and the optimized cross-linking time was 4h. N-P-CLEAs showed obvious improvement in thermal stability and pH stability than the free enzyme (P<0.05) and could hold relatively high activity retention in nonpolar and hydrophilic solvents and without activity loss at 4°C for more than six months. The cross-linking reaction had been appeared in N-P-CLEAs and more orderly microscopic surface morphology of N-P-CLEAs was observed. The molecular weight and thermal denaturation temperature of N-P-CLEAs were increased while the isoelectric point was decreased compared with those of the free enzymes. Application of N-P-CLEAs in bean proteins and zein showed a higher degree of hydrolysis, such as the hydrolysis degree of mung bean protein hydrolyzed by N-P-CLEAs was 12%, increased by approximately 4.5% compared to that of free enzyme. The results demonstrated that the N-P-CLEAs was suitable for application in food protein hydrolysis. Copyright © 2016 Elsevier B.V. All rights reserved.

Genipin Cross-Linked Glucose Oxidase and Catalase Multi-enzyme for Gluconic Acid Synthesis.

PubMed

Cui, Caixia; Chen, Haibin; Chen, Biqiang; Tan, Tianwei

2017-02-01

In this work, glucose oxidase (GOD) and catalase (CAT) were used simultaneously to produce gluconic acid from glucose. In order to reduce the distance between the two enzymes, and therefore improve efficiency, GOD and CAT were cross-linked together using genipin. Improvements in gluconic acid production were due to quick removal of harmful intermediate hydrogen peroxide by CAT. GOD activity was significantly affected by the proportion of CAT in the system, with GOD activity in the cross-linked multi-enzyme (CLME) being 10 times higher than that in an un-cross-linked GOD/CAT mixture. The glucose conversion rate after 15 h using 15 % glucose was also 10 % higher using the CLME than was measured using a GOD/CAT mixture.

Characteristic features and biotechnological applications of cross-linked enzyme aggregates (CLEAs).

PubMed

Sheldon, Roger A

2011-11-01

Cross-linked enzyme aggregates (CLEAs) have many economic and environmental benefits in the context of industrial biocatalysis. They are easily prepared from crude enzyme extracts, and the costs of (often expensive) carriers are circumvented. They generally exhibit improved storage and operational stability towards denaturation by heat, organic solvents, and autoproteolysis and are stable towards leaching in aqueous media. Furthermore, they have high catalyst productivities (kilograms product per kilogram biocatalyst) and are easy to recover and recycle. Yet another advantage derives from the possibility to co-immobilize two or more enzymes to provide CLEAs that are capable of catalyzing multiple biotransformations, independently or in sequence as catalytic cascade processes.

Establishment of a novel endothelial target mouse model of a typhus group rickettsiosis: evidence for critical roles for gamma interferon and CD8 T lymphocytes.

PubMed

Walker, D H; Popov, V L; Feng, H M

2000-09-01

A mouse model of typhus rickettsiosis that reproduces the hematogenous dissemination to the critical target organs, including brain, lungs, heart, and kidneys, primary endothelial and, to a lesser degree, macrophage intracellular rickettsial infection, and typical vascular-based lesions of louse-borne typhus and murine typhus was established. Intravenous inoculation of C3H/HeN mice with Rickettsia typhi caused disease with a duration of the incubation period and mortality rate that were dependent on the infective dose of rickettsiae. Lethal infection was associated with high concentrations of R. typhi in the lungs and brain, despite a brisker humoral immune response to the rickettsiae than in the sublethal infection. Gamma interferon and CD8 T lymphocytes were demonstrated to be crucial to clearance of the rickettsiae and recovery from infection in experiments in which specific monoclonal antibodies were administered to deplete these components. Death of animals depleted of gamma interferon or CD8 T lymphocytes was associated with overwhelming rickettsial infection demonstrated by titers of infectious rickettsiae and by immunohistochemistry. An effective antirickettsial immune response was associated with elevated serum concentrations of IL-12 on Day 5 and increased secretion of IL-12 by concanavalin-A-stimulated spleen cells on Day 5. Evidence for transient suppression of the immune response consisted of marked reduction in the secretion of IL-2 and IL-12 by concanavalin-A-stimulated spleen cells on Days 10 and 15. This model offers excellent opportunities for study of attenuation and pathogenetic mechanisms of typhus rickettsiae, which are established biologic weapons of potential use in bioterrorism.

Effect of recombinant human gamma interferon on intracellular activities of antibiotics against Listeria monocytogenes in the human macrophage cell line THP-1.

PubMed Central

Scorneaux, B; Ouadrhiri, Y; Anzalone, G; Tulkens, P M

1996-01-01

Listeria monocytogenes is a facultative intracellular pathogen which enters cells by endocytosis and reaches phagolysosomes from where it escapes and multiplies in the cytosol of untreated cells. Exposure of macrophages to gamma interferon (IFN-gamma) restricts L. monocytogenes to phagosomes and prevents its intracellular multiplication. We have tested whether IFN-gamma also modulates the susceptibility of L. monocytogenes to antibiotics. We selected drugs from three different classes displaying marked properties concerning their cellular accumulation and subcellular distribution, namely, ampicillin (not accumulated by cells but present in cytosol), azithromycin (largely accumulated by cells but mostly restricted to lysosomes), and sparfloxacin (accumulated to a fair extent but detected only in cytosol). We used a continuous line of myelomonocytic cells (THP-1 macrophages), which display specific surface receptors for IFN-gamma, and examined the activity of these antibiotics against L. monocytogenes Hly+ (virulent variant) and L. monocytogenes Hly- (a nonvirulent variant defective in hemolysin production). Untreated THP-1 and phorbol myristate acetate-differentiated THP-1 were permissive for infection and multiplication of intracellular L. monocytogenes Hly+ (virulent variant). All three antibiotics tested were bactericidal against this Listeria strain when added to an extracellular concentration of 10x their MIC. After preexposure of THP-1 to IFN-gamma, L. monocytogenes Hly+ was still phagocytosed but no longer grew intracellularly. The activity of ampicillin became almost undetectable (antagonistic effect), and that of azithromycin was unchanged (additive effect with that of IFN-gamma), whereas that of sparfloxacin was markedly enhanced (synergy). A similar behavior (lack of bacterial growth, associated with a loss of activity of ampicillin, an enhanced activity of sparfloxacin, and unchanged activity of azithromycin) was observed in cells infected with L

Interferon-gamma inducible protein-10 as a potential biomarker in localized scleroderma.

PubMed

Magee, Kelsey E; Kelsey, Christina E; Kurzinski, Katherine L; Ho, Jonhan; Mlakar, Logan R; Feghali-Bostwick, Carol A; Torok, Kathryn S

2013-01-01

The purpose of this study was to evaluate the presence and levels of interferon-gamma inducible protein-10 (IP-10) in the plasma and skin of pediatric localized scleroderma (LS) patients compared to those of healthy pediatric controls and to determine if IP-10 levels correlate to clinical disease activity measures. The presence of IP-10 in the plasma was analyzed using a Luminex panel in 69 pediatric patients with LS and compared to 71 healthy pediatric controls. Of these patients, five had available skin biopsy specimens with concurrent clinical and serological data during the active disease phase, which were used to analyze the presence and location of IP-10 in the skin by immunohistochemistry (IHC). IP-10 levels were significantly elevated in the plasma of LS patients compared to that of healthy controls and correlated to clinical disease activity measures in LS. Immunohistochemistry staining of IP-10 was present in the dermal infiltrate of LS patients and was similar to that found in psoriasis skin specimens, the positive disease control. Elevation of IP-10 levels in the plasma compared to those of healthy controls and the presence of IP-10 staining in the affected skin of LS patients indicates that IP-10 is a potential biomarker in LS. Furthermore, significant elevation of IP-10 in LS patients with active versus inactive disease and correlations between IP-10 levels and standardized disease outcome measures of activity in LS strongly suggest that IP-10 may be a biomarker for disease activity in LS.

Interferon-gamma inducible protein-10 as a potential biomarker in localized scleroderma

PubMed Central

2013-01-01

Introduction The purpose of this study was to evaluate the presence and levels of interferon-gamma inducible protein-10 (IP-10) in the plasma and skin of pediatric localized scleroderma (LS) patients compared to those of healthy pediatric controls and to determine if IP-10 levels correlate to clinical disease activity measures. Methods The presence of IP-10 in the plasma was analyzed using a Luminex panel in 69 pediatric patients with LS and compared to 71 healthy pediatric controls. Of these patients, five had available skin biopsy specimens with concurrent clinical and serological data during the active disease phase, which were used to analyze the presence and location of IP-10 in the skin by immunohistochemistry (IHC). Results IP-10 levels were significantly elevated in the plasma of LS patients compared to that of healthy controls and correlated to clinical disease activity measures in LS. Immunohistochemistry staining of IP-10 was present in the dermal infiltrate of LS patients and was similar to that found in psoriasis skin specimens, the positive disease control. Conclusions Elevation of IP-10 levels in the plasma compared to those of healthy controls and the presence of IP-10 staining in the affected skin of LS patients indicates that IP-10 is a potential biomarker in LS. Furthermore, significant elevation of IP-10 in LS patients with active versus inactive disease and correlations between IP-10 levels and standardized disease outcome measures of activity in LS strongly suggest that IP-10 may be a biomarker for disease activity in LS. PMID:24499523

[Action of human leukocyte interferon on poliomyelitis virus reproduction in resistant MIO(r) cells].

PubMed

Gulevich, N E; Orlova, N G; Pokidysheva, L N

1981-01-01

The effect of human leukocyte interferon on reproduction of poliomyelitis virus in MIO cells resistant to this virus (MIOr) and sensitive MIO cells was studied. Interferon was shown to exert a short-time protective effect in the sensitive cells and to induce virus reproduction in the resistant cells. It is suggested that poliomyelitis virus reproduction in the resistant cells is due to activation of lysosomal enzyme, cathepsin D, in this system.

Delayed translational silencing of ceruloplasmin transcript in gamma interferon-activated U937 monocytic cells: role of the 3' untranslated region

NASA Technical Reports Server (NTRS)

Mazumder, B.; Fox, P. L.

1999-01-01

Ceruloplasmin (Cp) is an acute-phase protein with ferroxidase, amine oxidase, and pro- and antioxidant activities. The primary site of Cp synthesis in human adults is the liver, but it is also synthesized by cells of monocytic origin. We have shown that gamma interferon (IFN-gamma) induces the synthesis of Cp mRNA and protein in monocytic cells. We now report that the induced synthesis of Cp is terminated by a mechanism involving transcript-specific translational repression. Cp protein synthesis in U937 cells ceased after 16 h even in the presence of abundant Cp mRNA. RNA isolated from cells treated with IFN-gamma for 24 h exhibited a high in vitro translation rate, suggesting that the transcript was not defective. Ribosomal association of Cp mRNA was examined by sucrose centrifugation. When Cp synthesis was high, i.e., after 8 h of IFN-gamma treatment, Cp mRNA was primarily associated with polyribosomes. However, after 24 h, when Cp synthesis was low, Cp mRNA was primarily in the nonpolyribosomal fraction. Cytosolic extracts from cells treated with IFN-gamma for 24 h, but not for 8 h, contained a factor which blocked in vitro Cp translation. Inhibitor expression was cell type specific and present in extracts of human cells of myeloid origin, but not in several nonmyeloid cells. The inhibitory factor bound to the 3' untranslated region (3'-UTR) of Cp mRNA, as shown by restoration of in vitro translation by synthetic 3'-UTR added as a "decoy" and detection of a binding complex by RNA gel shift analysis. Deletion mapping of the Cp 3'-UTR indicated an internal 100-nucleotide region of the Cp 3'-UTR that was required for complex formation as well as for silencing of translation. Although transcript-specific translational control is common during development and differentiation and global translational control occurs during responses to cytokines and stress, to our knowledge, this is the first report of translational silencing of a specific transcript following cytokine

Radiation-induced enzyme efflux from rat heart: sedentary animals. [Gamma radiation, lactate dehydrogenase, creative kinase, glutamate oxaloacetate transaminase

DOE Office of Scientific and Technical Information (OSTI.GOV)

MacWilliam, L.D.; Bhakthan, N.M.G.

1976-01-01

Serum levels of lactate dehydrogenase, creatine kinase, and glutamate oxaloacetate transaminase show initial elevations within 12 hr of exposure to 2,000 rads of ..gamma..-radiation to the thoracic region of rats. Significant decreases in heart muscle homogenate levels of these enzymes parallel initial elevations in the serum and may suggest that enhanced leakage of enzymes is a consequence of radiation injury to heart muscle. Insignificant alterations in mitochondrial glutamate oxaloacetate transaminase levels after exposure indicate that in vivo injury to the mitochondria from therapeutic levels of ..gamma..-radiation is questionable. The results support the contention that ionizing radiation instigates alterations in themore » dynamic permeability of membranes, allowing leakage of biologically active material out of the injured cell.« less

Results of space experiment program "Interferon". II. Influence of spaceflight conditions on the activity of interferon preparations and interferon inducers ("Interferon II").

PubMed

Tálas, M; Bátkai, L; Stöger, I; Nagy, K; Hiros, L; Konstantinova, I; Kozharinov, V

1983-01-01

The influence of spaceflight conditions on the biological activity of HuIFN-alpha preparations (lyophilized, in solution and in ointment) and interferon inducers was studied. In antiviral activity no difference was observed between the samples kept aboard the spaceship and the controls kept under ground conditions. The interferon inducers poly I:C, poly G:C and gossipol placed in the space laboratory for 7 days maintained their interferon-inducing capacity. The circulating interferon level in mice was the same irrespective of the induction being performed with flight or ground-control samples of inducers.

Effects of Chicken Interferon Gamma on Newcastle Disease Virus Vaccine Immunogenicity

PubMed Central

Cardenas-Garcia, Stivalis; Dunwoody, Robert P.; Marcano, Valerie; Diel, Diego G.; Williams, Robert J.; Gogal, Robert M.; Brown, Corrie C.; Miller, Patti J.; Afonso, Claudio L.

2016-01-01

More effective vaccines are needed to control avian diseases. The use of chicken interferon gamma (chIFNγ) during vaccination is a potentially important but controversial approach that may improve the immune response to antigens. In the present study, three different systems to co-deliver chIFNγ with Newcastle disease virus (NDV) antigens were evaluated for their ability to enhance the avian immune response and their protective capacity upon challenge with virulent NDV. These systems consisted of: 1) a DNA vaccine expressing the Newcastle disease virus fusion (F) protein co-administered with a vector expressing the chIFNγ gene for in ovo and booster vaccination, 2) a recombinant Newcastle disease virus expressing the chIFNγ gene (rZJ1*L/IFNγ) used as a live vaccine delivered in ovo and into juvenile chickens, and 3) the same rZJ1*L/IFNγ virus used as an inactivated vaccine for juvenile chickens. Co-administration of chIFNγ with a DNA vaccine expressing the F protein resulted in higher levels of morbidity and mortality, and higher amounts of virulent virus shed after challenge when compared to the group that did not receive chIFNγ. The live vaccine system co-delivering chIFNγ did not enhanced post-vaccination antibody response, nor improved survival after hatch, when administered in ovo, and did not affect survival after challenge when administered to juvenile chickens. The low dose of the inactivated vaccine co-delivering active chIFNγ induced lower antibody titers than the groups that did not receive the cytokine. The high dose of this vaccine did not increase the antibody titers or antigen-specific memory response, and did not reduce the amount of challenge virus shed or mortality after challenge. In summary, regardless of the delivery system, chIFNγ, when administered simultaneously with the vaccine antigen, did not enhance Newcastle disease virus vaccine immunogenicity. PMID:27409587

T-Cell Mineralocorticoid Receptor Controls Blood Pressure by Regulating Interferon-Gamma.

PubMed

Sun, Xue-Nan; Li, Chao; Liu, Yuan; Du, Lin-Juan; Zeng, Meng-Ru; Zheng, Xiao-Jun; Zhang, Wu-Chang; Liu, Yan; Zhu, Mingjiang; Kong, Deping; Zhou, Li; Lu, Limin; Shen, Zhu-Xia; Yi, Yi; Du, Lili; Qin, Mu; Liu, Xu; Hua, Zichun; Sun, Shuyang; Yin, Huiyong; Zhou, Bin; Yu, Ying; Zhang, Zhiyuan; Duan, Sheng-Zhong

2017-05-12

Hypertension remains to be a global public health burden and demands novel intervention strategies such as targeting T cells and T-cell-derived cytokines. Mineralocorticoid receptor (MR) antagonists have been clinically used to treat hypertension. However, the function of T-cell MR in blood pressure (BP) regulation has not been elucidated. We aim to determine the role of T-cell MR in BP regulation and to explore the mechanism. Using T-cell MR knockout mouse in combination with angiotensin II-induced hypertensive mouse model, we demonstrated that MR deficiency in T cells strikingly decreased both systolic and diastolic BP and attenuated renal and vascular damage. Flow cytometric analysis showed that T-cell MR knockout mitigated angiotensin II-induced accumulation of interferon-gamma (IFN-γ)-producing T cells, particularly CD8 + population, in both kidneys and aortas. Similarly, eplerenone attenuated angiotensin II-induced elevation of BP and accumulation of IFN-γ-producing T cells in wild-type mice. In cultured CD8 + T cells, T-cell MR knockout suppressed IFN-γ expression whereas T-cell MR overexpression and aldosterone both enhanced IFN-γ expression. At the molecular level, MR interacted with NFAT1 (nuclear factor of activated T-cells 1) and activator protein-1 in T cells. Finally, T-cell MR overexpressing mice manifested more elevated BP compared with control mice after angiotensin II infusion and such difference was abolished by IFN-γ-neutralizing antibodies. MR may interact with NFAT1 and activator protein-1 to control IFN-γ in T cells and to regulate target organ damage and ultimately BP. Targeting MR in T cells specifically may be an effective novel approach for hypertension treatment. © 2017 American Heart Association, Inc.

Gamma Interferon-Induced Guanylate Binding Protein 1 Is a Novel Actin Cytoskeleton Remodeling Factor

PubMed Central

Ostler, Nicole; Britzen-Laurent, Nathalie; Liebl, Andrea; Naschberger, Elisabeth; Lochnit, Günter; Ostler, Markus; Forster, Florian; Kunzelmann, Peter; Ince, Semra; Supper, Verena; Praefcke, Gerrit J. K.; Schubert, Dirk W.; Stockinger, Hannes; Herrmann, Christian

2014-01-01

Gamma interferon (IFN-γ) regulates immune defenses against viruses, intracellular pathogens, and tumors by modulating cell proliferation, migration, invasion, and vesicle trafficking processes. The large GTPase guanylate binding protein 1 (GBP-1) is among the cellular proteins that is the most abundantly induced by IFN-γ and mediates its cell biologic effects. As yet, the molecular mechanisms of action of GBP-1 remain unknown. Applying an interaction proteomics approach, we identified actin as a strong and specific binding partner of GBP-1. Furthermore, GBP-1 colocalized with actin at the subcellular level and was both necessary and sufficient for the extensive remodeling of the fibrous actin structure observed in IFN-γ-exposed cells. These effects were dependent on the oligomerization and the GTPase activity of GBP-1. Purified GBP-1 and actin bound to each other, and this interaction was sufficient to impair the formation of actin filaments in vitro, as demonstrated by atomic force microscopy, dynamic light scattering, and fluorescence-monitored polymerization. Cosedimentation and band shift analyses demonstrated that GBP-1 binds robustly to globular actin and slightly to filamentous actin. This indicated that GBP-1 may induce actin remodeling via globular actin sequestering and/or filament capping. These results establish GBP-1 as a novel member within the family of actin-remodeling proteins specifically mediating IFN-γ-dependent defense strategies. PMID:24190970

Gamma interferon-induced guanylate binding protein 1 is a novel actin cytoskeleton remodeling factor.

PubMed

Ostler, Nicole; Britzen-Laurent, Nathalie; Liebl, Andrea; Naschberger, Elisabeth; Lochnit, Günter; Ostler, Markus; Forster, Florian; Kunzelmann, Peter; Ince, Semra; Supper, Verena; Praefcke, Gerrit J K; Schubert, Dirk W; Stockinger, Hannes; Herrmann, Christian; Stürzl, Michael

2014-01-01

Gamma interferon (IFN-γ) regulates immune defenses against viruses, intracellular pathogens, and tumors by modulating cell proliferation, migration, invasion, and vesicle trafficking processes. The large GTPase guanylate binding protein 1 (GBP-1) is among the cellular proteins that is the most abundantly induced by IFN-γ and mediates its cell biologic effects. As yet, the molecular mechanisms of action of GBP-1 remain unknown. Applying an interaction proteomics approach, we identified actin as a strong and specific binding partner of GBP-1. Furthermore, GBP-1 colocalized with actin at the subcellular level and was both necessary and sufficient for the extensive remodeling of the fibrous actin structure observed in IFN-γ-exposed cells. These effects were dependent on the oligomerization and the GTPase activity of GBP-1. Purified GBP-1 and actin bound to each other, and this interaction was sufficient to impair the formation of actin filaments in vitro, as demonstrated by atomic force microscopy, dynamic light scattering, and fluorescence-monitored polymerization. Cosedimentation and band shift analyses demonstrated that GBP-1 binds robustly to globular actin and slightly to filamentous actin. This indicated that GBP-1 may induce actin remodeling via globular actin sequestering and/or filament capping. These results establish GBP-1 as a novel member within the family of actin-remodeling proteins specifically mediating IFN-γ-dependent defense strategies.

Construction of a Simple, Inexpensive Multiple Enzyme-Linked Immunosorbent Assay Microdilution Plate Washer

PubMed Central

Stobbs, L. W.

1990-01-01

In this paper, plans are given for the construction of an inexpensive enzyme-linked immunosorbent assay plate washer from readily available materials. The wash unit uses an intermittent wash cycle based on a wash manifold cycling over the microdilution plates for a predetermined time. Laboratory tests showed that the unit provided reliable, rapid washing of plates with tap water, with no detectable contamination between wells. Substrate absorbance values for test samples from machine-washed plates were equal to or greater than absorbance values for corresponding samples from plates washed manually by an accepted protocol, by using either enzyme-linked immunosorbent assay wash buffer or tap water. Images PMID:16348216

Tuberculin Skin Tests versus Interferon-Gamma Release Assays in Tuberculosis Screening among Immigrant Visa Applicants.

PubMed

Chuke, Stella O; Yen, Nguyen Thi Ngoc; Laserson, Kayla F; Phuoc, Nguyen Huu; Trinh, Nguyen An; Nhung, Duong Thi Cam; Mai, Vo Thi Chi; Qui, An Dang; Hai, Hoang Hoa; Loan, Le Thien Huong; Jones, Warren G; Whitworth, William C; Shah, J Jina; Painter, John A; Mazurek, Gerald H; Maloney, Susan A

2014-01-01

Objective. Use of tuberculin skin tests (TSTs) and interferon gamma release assays (IGRAs) as part of tuberculosis (TB) screening among immigrants from high TB-burden countries has not been fully evaluated. Methods. Prevalence of Mycobacterium tuberculosis infection (MTBI) based on TST, or the QuantiFERON-TB Gold test (QFT-G), was determined among immigrant applicants in Vietnam bound for the United States (US); factors associated with test results and discordance were assessed; predictive values of TST and QFT-G for identifying chest radiographs (CXRs) consistent with TB were calculated. Results. Of 1,246 immigrant visa applicants studied, 57.9% were TST positive, 28.3% were QFT-G positive, and test agreement was 59.4%. Increasing age was associated with positive TST results, positive QFT-G results, TST-positive but QFT-G-negative discordance, and abnormal CXRs consistent with TB. Positive predictive values of TST and QFT-G for an abnormal CXR were 25.9% and 25.6%, respectively. Conclusion. The estimated prevalence of MTBI among US-bound visa applicants in Vietnam based on TST was twice that based on QFT-G, and 14 times higher than a TST-based estimate of MTBI prevalence reported for the general US population in 2000. QFT-G was not better than TST at predicting abnormal CXRs consistent with TB.

Card9- and MyD88-Mediated Gamma Interferon and Nitric Oxide Production Is Essential for Resistance to Subcutaneous Coccidioides posadasii Infection.

PubMed

Hung, Chiung-Yu; Castro-Lopez, Natalia; Cole, Garry T

2016-04-01

Coccidioidomycosis is a potentially life-threatening respiratory disease which is endemic to the southwestern United States and arid regions of Central and South America. It is responsible for approximately 150,000 infections annually in the United States alone. Almost every human organ has been reported to harbor parasitic cells of Coccidioides spp. in collective cases of the disseminated form of this mycosis. Current understanding of the mechanisms of protective immunity against lung infection has been largely derived from murine models of pulmonary coccidioidomycosis. However, little is known about the nature of the host response to Coccidioides in extrapulmonary tissue. Primary subcutaneous coccidioidal infection is rare but has been reported to result in disseminated disease. Here, we show that activation of MyD88 and Card9 signal pathways are required for resistance to Coccidioides infection following subcutaneous challenge of C57BL/6 mice, which correlates with earlier findings of the protective response to pulmonary infection. MyD88(-/-) andCard9(-/-) mice recruited reduced numbers of T cells, B cells, and neutrophils to the Coccidioides-infected hypodermis com pared to wild-type mice; however, neutrophils were dispensable for resistance to skin infection. Further studies have shown that gamma interferon (IFN-γ) production and activation of Th1 cells characterize resistance to subcutaneous infection. Furthermore, activation of a phagosomal enzyme, inducible nitric oxide synthase, which is necessary for NO production, is a requisite for fungal clearance in the hypodermis. Collectively, our data demonstrate that MyD88- and Card9-mediated IFN-γ and nitric oxide production is essential for protection against subcutaneous Coccidioides infection. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Protective Role of Gamma Interferon during the Recall Response to Influenza Virus

PubMed Central

Bot, Adrian; Bot, Simona; Bona, Constantin A.

1998-01-01

During secondary immune responses to influenza virus, virus-specific T memory cells are a major source of gamma interferon (IFN-γ). We assessed the contribution of IFN-γ to heterologous protection against the A/WSN/33 (H1N1) virus of wild-type and IFN-γ−/− mice previously immunized with the A/HK/68 (H3N2) virus. The IFN-γ−/− mice displayed significantly reduced survival rates subsequent to a challenge with various doses of the A/WSN/33 virus. This was associated with an impaired ability of the IFN-γ−/− mice to completely clear the pulmonary virus by day 7 after the challenge, although significant reduction of the virus titers was noted. However, the IFN-γ−/− mice developed type A influenza virus cross-reactive cytotoxic T lymphocytes (CTLs) similar to the wild-type mice, as demonstrated by both cytotoxicity and a limiting-dilution assay for the estimation of CTL precursor frequency. The pulmonary recruitment of T cells in IFN-γ−/− mice was not dramatically affected, and the percentage of CD4+ and CD8+ T cells was similar to that of wild-type mice. The T cells from IFN-γ−/− mice did not display a significant switch toward a Th2 profile. Furthermore, the IFN-γ−/− mice retained the ability to mount significant titers of WSN and HK virus-specific hemagglutination-inhibiting antibodies. Together, these results are consistent with a protective role of IFN-γ during the heterologous response against influenza virus independently of the generation and local recruitment of cross-reactive CTLs. PMID:9658110

[Effects of recombinant human alpha-2b and gamma interferons on bone marrow megakaryocyte progenitors (CFU-Meg) from patients with chronic myelocytic leukemia].

PubMed

Tanabe, Y; Dan, K; Kuriya, S; Nomura, T

1989-10-01

The effects of recombinant human interferon (IFN) alpha-2b and gamma on the bone marrow megakaryocyte progenitors (CFU-Meg) were compared between eight patients in the chronic phase of Ph1-positive chronic myelocytic leukemia (CML) and five hematologically normal patients. CFU-Meg was assayed in plasma clot culture added with phytohemagglutinin-stimulated leukocyte-conditioned medium as a source of colony stimulating activity. The average count of CFU-Meg colonies formed from the bone marrow of CML patients was 5.5 times that of normal controls. Spontaneous CFU-Meg colonies were grown in seven of eight CML patients, but in none of five controls. Colony formation by CFU-Meg in CML as well as normal bone marrow was suppressed by the two preparations of IFN in a dose dependent fashion. Their suppressive influence on colonies from CFU-Meg was comparable between CML and normal bone marrow at lower concentrations, but was less marked for CML than normal bone marrow at higher concentrations. The formation of CFU-Meg colonies from CML bone marrow was more severely suppressed by IFN-gamma than IFN-alpha-2b. Depletion of either T lymphocytes or adherent cells from the CML bone marrow cells diminished the suppressive effects of IFN-gamma, but had no influence on the effects of IFN-alpha-2b.

Effects of interferon-gamma and lipopolysaccharide on macrophage iron metabolism are mediated by nitric oxide-induced degradation of iron regulatory protein 2.

PubMed

Kim, S; Ponka, P

2000-03-03

Iron regulatory proteins (IRP-1 and IRP-2) control the synthesis of transferrin receptors (TfR) and ferritin by binding to iron-responsive elements, which are located in the 3'-untranslated region and the 5'-untranslated region of their respective mRNAs. Cellular iron levels affect binding of IRPs to iron-responsive elements and consequently expression of TfR and ferritin. Moreover, NO(*), a redox species of nitric oxide that interacts primarily with iron, can activate IRP-1 RNA binding activity resulting in an increase in TfR mRNA levels. Recently we found that treatment of RAW 264.7 cells (a murine macrophage cell line) with NO(+) (nitrosonium ion, which causes S-nitrosylation of thiol groups) resulted in a rapid decrease in RNA binding of IRP-2 followed by IRP-2 degradation, and these changes were associated with a decrease in TfR mRNA levels (Kim, S., and Ponka, P. (1999) J. Biol. Chem. 274, 33035-33042). In this study, we demonstrated that stimulation of RAW 264.7 cells with lipopolysaccharide (LPS) and interferon-gamma (IFN-gamma) increased IRP-1 binding activity, whereas RNA binding of IRP-2 decreased and was followed by a degradation of this protein. Moreover, the decrease of IRP-2 binding/protein levels was associated with a decrease in TfR mRNA levels in LPS/IFN-gamma-treated cells, and these changes were prevented by inhibitors of inducible nitric oxide synthase. Furthermore, LPS/IFN-gamma-stimulated RAW 264.7 cells showed increased rates of ferritin synthesis. These results suggest that NO(+)-mediated degradation of IRP-2 plays a major role in iron metabolism during inflammation.

A review of Cry protein detection with enzyme-linked immunosorbent assays

USDA-ARS?s Scientific Manuscript database

Several detection methods are available to monitor the fate of Cry proteins in the environment, enzyme-linked immunosorbent assays (ELISAs) have emerged as the preferred detection method, due to their cost-effectiveness, ease of use, and rapid results. Validation of ELISAs is necessary to ensure acc...

Fabrication of fiber-optic localized surface plasmon resonance sensor and its application to detect antibody-antigen reaction of interferon-gamma

NASA Astrophysics Data System (ADS)

Jeong, Hyeon-Ho; Erdene, Norov; Lee, Seung-Ki; Jeong, Dae-Hong; Park, Jae-Hyoung

2011-12-01

A fiber-optic localized surface plasmon (FO LSPR) sensor was fabricated by gold nanoparticles (Au NPs) immobilized on the end-face of an optical fiber. When Au NPs were formed on the end-face of an optical fiber by chemical reaction, Au NPs aggregation occurred and the Au NPs were immobilized in various forms such as monomers, dimers, trimers, etc. The component ratio of the Au NPs on the end-face of the fabricated FO LSPR sensor was slightly changed whenever the sensors were fabricated in the same condition. Including this phenomenon, the FO LSPR sensor was fabricated with high sensitivity by controlling the density of Au NPs. Also, the fabricated sensors were measured for the resonance intensity for the different optical systems and analyzed for the effect on sensitivity. Finally, for application as a biosensor, the sensor was used for detecting the antibody-antigen reaction of interferon-gamma.

An Improved Ultrasensitive Enzyme-Linked Immunosorbent Assay Using Hydrangea-Like Antibody-Enzyme-Inorganic Three-in-One Nanocomposites.

PubMed

Wei, Tianxiang; Du, Dan; Zhu, Mei-Jun; Lin, Yuehe; Dai, Zhihui

2016-03-01

Protein-inorganic nanoflowers, composed of protein and copper(II) phosphate (Cu3(PO4)2), have recently grabbed people's attention. Because the synthetic method requires no organic solvent and because of the distinct hierarchical nanostructure, protein-inorganic nanoflowers display enhanced catalytic activity and stability and would be a promising tool in biocatalytical processes and biological and biomedical fields. In this work, we first coimmobilized the enzyme, antibody, and Cu3(PO4)2 into a three-in-one hybrid protein-inorganic nanoflower to enable it to possess dual functions: (1) the antibody portion retains the ability to specifically capture the corresponding antigen; (2) the nanoflower has enhanced enzymatic activity and stability to produce an amplified signal. The prepared antibody-enzyme-inorganic nanoflower was first applied in an enzyme-linked immunosorbent assay to serve as a novel enzyme-labeled antibody for Escherichia coli O157:H7 (E. coli O157:H7) determination. The detection limit is 60 CFU L(-1), which is far superior to commercial ELISA systems. The three-in-one antibody (anti-E. coli O157:H7 antibody)-enzyme (horseradish peroxidase)-inorganic (Cu3(PO4)2) nanoflower has some advantages over commercial enzyme-antibody conjugates. First, it is much easier to prepare and does not need any complex covalent modification. Second, it has fairly high capture capability and catalytic activity because it is presented as aggregates of abundant antibodies and enzymes. Third, it has enhanced enzymatic stability compared to the free form of enzyme due to the unique hierarchical nanostructure.

Identifying Mechanisms by Which Escherichia coli O157:H7 Subverts Interferon-γ Mediated Signal Transducer and Activator of Transcription-1 Activation

PubMed Central

Ho, Nathan K.; Crandall, Ian; Sherman, Philip M.

2012-01-01

Enterohemorrhagic Escherichia coli serotype O157:H7 is a food borne enteric bacterial pathogen that causes significant morbidity and mortality in both developing and industrialized nations. E. coli O157:H7 infection of host epithelial cells inhibits the interferon gamma pro-inflammatory signaling pathway, which is important for host defense against microbial pathogens, through the inhibition of Stat-1 tyrosine phosphorylation. The aim of this study was to determine which bacterial factors are involved in the inhibition of Stat-1 tyrosine phosphorylation. Human epithelial cells were challenged with either live bacteria or bacterial-derived culture supernatants, stimulated with interferon-gamma, and epithelial cell protein extracts were then analyzed by immunoblotting. The results show that Stat-1 tyrosine phosphorylation was inhibited by E. coli O157:H7 secreted proteins. Using sequential anion exchange and size exclusion chromatography, YodA was identified, but not confirmed to mediate subversion of the Stat-1 signaling pathway using isogenic mutants. We conclude that E. coli O157:H7 subverts Stat-1 tyrosine phosphorylation in response to interferon-gamma through a still as yet unidentified secreted bacterial protein. PMID:22253910

Persistently retained interferon-gamma responsiveness in individuals with a history of pulmonary tuberculosis.

PubMed

Seo, Kwang Won; Ahn, Jong-Joon; Ra, Seung Won; Kwon, Woon-Jung; Jegal, Yangjin

2014-06-01

The interferon gamma (IFN-γ) release assays (IGRAs) are the best method of detecting Mycobacterium tuberculosis infection. However, reports on IGRAs results obtained during and right after the treatment of tuberculosis (TB) have presented differing results. Some studies have shown declining responses, whereas other reports described persistent, fluctuating, or increasing responses. We postulated that the IGRA-positivity will decrease or revert long time after treatment of TB, and thus, evaluated the response of IGRA in subjects with a history of pulmonary TB. Seventy subjects (M:F = 51:19; age = 53.2 ± 11.8 years) underwent tuberculin skin tests (TSTs) and IGRA. The interval of time elapsed after the completion of anti-TB treatment was < 10 years for 16 subjects, 10-20 years for 13 subjects, 20-30 years for 16 subjects, and ≥ 30 years for 25 subjects. The TST was positive in 49 subjects (74%) and negative in 17 subjects (26%). The IGRA was positive in 52 subjects (74%) and negative in 18 subjects (26%). The IFN-γ level and the size of induration showed good correlation (r = 0.525, P < 0.001). However, the correlation between time elapsed after the completion of anti-TB treatment and the size of induration or that between time and the IFN-γ level was not significant. The TST and IGRA were positive in 72.7% and 68.0% of subjects ≥ 30 years after the treatment of pulmonary TB. In conclusion, majority of subjects with a history of pulmonary TB are IGRA-positive, even a few decades after the completion of anti-TB treatment.

Assessment of safety and interferon gamma responses of Mycobacterium bovis BCG vaccine in goat kids and milking goats.

PubMed

Pérez de Val, Bernat; Vidal, Enric; López-Soria, Sergio; Marco, Alberto; Cervera, Zoraida; Martín, Maite; Mercader, Irene; Singh, Mahavir; Raeber, Alex; Domingo, Mariano

2016-02-10

Vaccination of domestic animals has emerged as an alternative long-term strategy for the control of tuberculosis (TB). A trial under field conditions was conducted in a TB-free goat herd to assess the safety of the Mycobacterium bovis BCG vaccine. Eleven kids and 10 milking goats were vaccinated with BCG. Bacterial shedding and interferon gamma (IFN-γ) responses were monitored throughout the study. Comprehensive pathological examination and mycobacterial culture of target tissues were performed. BCG vaccine strain was only isolated from the draining lymph node of the injection site of a kid euthanized at week 8 post-vaccination. The remaining animals were euthanized at week 24. Six out of 20 showed small granulomas at the injection site. BCG shedding was not detected in either faeces or in milk throughout the study. All vaccinated kids showed BCG-induced IFN-γ responses at week 8 post-vaccination. BCG vaccination of goats showed no lack of biological safety for the animals, environment and public health, and local adverse reactions were negligible. Copyright © 2016 Elsevier Ltd. All rights reserved.

The role of interferon gamma release assays in the monitoring of response to anti-tuberculosis treatment in children.

PubMed

Shaik, Junaid; Pillay, Manormoney; Jeena, Prakash

2014-09-01

Successful control of childhood TB requires early diagnosis, effective chemotherapy and a method of evaluating the response to therapy. Identification of suitable biomarkers that predict the response to anti-TB therapy may allow the duration of treatment to be shortened. The majority of biomarker studies in paediatric TB have focused on the role of T cell-based interferon-gamma (IFN-γ) release assays (IGRAs) in the diagnosis of either latent or active disease. Little has been published on the role of IGRAs in the monitoring response to therapy in children. We reviewed the available literature to ascertain the value of IGRAs in the monitoring of response to anti-TB therapy in children. We explored the results of the few studies that have investigated the role of IGRAs as markers of response to anti-TB treatment in children. We conclude that the role of IGRAs as surrogate markers appears promising. Robust clinical trials are, however, needed to entrench the value of IGRAs as surrogate biomarkers of response to anti-TB therapy in children. Copyright © 2013 Elsevier Ltd. All rights reserved.

A case of reversible dilated cardiomyopathy after alpha-interferon therapy in a patient with renal cell carcinoma.

PubMed

Kuwata, Akiko; Ohashi, Masuo; Sugiyama, Masaya; Ueda, Ryuzo; Dohi, Yasuaki

2002-12-01

A 47-year-old man with renal cell carcinoma underwent nephrectomy, and postoperative chemotherapy was performed with recombinant alpha-interferon. Five years later, he experienced dyspnea during physical exertion. An echocardiogram revealed dilatation and systolic dysfunction of the left ventricle, and thallium-201 myocardial scintigraphy showed diffuse heterogeneous perfusion. We diagnosed congestive heart failure because of cardiomyopathy induced by alpha-interferon therapy. Withdrawal of interferon therapy and the combination of an angiotensin-converting enzyme inhibitor, diuretics, and digitalis improved left ventricular systolic function. Furthermore, myocardial scintigraphy using [123I] beta-methyl-p-iodophenylpentadecanoic acid (123I-BMIPP) or [123 I]metaiodobenzylguanidine (123I-MIBG) revealed normal perfusion after the improvement of congestive heart failure. This is a rare case of interferon-induced cardiomyopathy that resulted in normal myocardial images in 123I-BMIPP and 123I-MIBG scintigrams after withdrawal of interferon therapy.

Enzyme-linked, aptamer-based, competitive biolayer interferometry biosensor for palytoxin.

PubMed

Gao, Shunxiang; Zheng, Xin; Hu, Bo; Sun, Mingjuan; Wu, Jihong; Jiao, Binghua; Wang, Lianghua

2017-03-15

In this study, we coupled biolayer interferometry (BLI) with competitive binding assay through an enzyme-linked aptamer and developed a real-time, ultra-sensitive, rapid quantitative method for detection of the marine biotoxin palytoxin. Horseradish peroxidase-labeled aptamers were used as biorecognition receptors to competitively bind with palytoxin, which was immobilized on the biosensor surface. The palytoxin: horseradish peroxidase-aptamer complex was then submerged in a 3,3'-diaminobenzidine solution, which resulted in formation of a precipitated polymeric product directly on the biosensor surface and a large change in the optical thickness of the biosensor layer. This change could obviously shift the interference pattern and generate a response profile on the BLI biosensor. The biosensor showed a broad linear range for palytoxin (200-700pg/mL) with a low detection limit (0.04pg/mL). Moreover, the biosensor was applied to the detection of palytoxin in spiked extracts and showed a high degree of selectivity for palytoxin, good reproducibility, and stability. This enzyme-linked, aptamer-based, competitive BLI biosensor offers a promising method for rapid and sensitive detection of palytoxin and other analytes. Copyright © 2016 Elsevier B.V. All rights reserved.

Three-dimensional crystal structure of recombinant murine interferon-beta.

PubMed Central

Senda, T; Shimazu, T; Matsuda, S; Kawano, G; Shimizu, H; Nakamura, K T; Mitsui, Y

1992-01-01

The crystal structure of recombinant murine interferon-beta (IFN-beta) has been solved by the multiple isomorphous replacement method and refined to an R-factor of 20.5% against 2.6 A X-ray diffraction data. The structure shows a variant of the alpha-helix bundle with a new chain-folding topology, which seems to represent a basic structural framework of all the IFN-alpha and IFN-beta molecules belonging to the type I family. Functionally important segments of the polypeptide chain, as implied through numerous gene manipulation studies carried out so far, are spatially clustered indicating the binding site(s) to the receptor(s). Comparison of the present structure with those of other alpha-helical cytokine proteins, including porcine growth hormone, interleukin 2 and interferon gamma, indicated either a topological similarity in chain folding or a similar spatial arrangement of the alpha-helices. Images PMID:1505514

[Interleukin 8 and interferon gamma in ocular toxoplasmosis].

PubMed

Czepiel, Jacek; Biesiada, Grazyna; Sobczyk-Krupiarz, Iwona; Miklasszewska, Grazyna; Fedak, Danuta; Solnica, Bogdan; Mach, Tomasz; Garlicki, Aleksander

2011-01-01

Toxoplasmosis is one of the most common parasitic infections in the world, it is caused by Toxoplasma gondii. The infection is typically asymptomatic or the symptoms are very mild. Approximately 10% patients have limphadenopathy, involvement of the others organs, like eyes, nervous system, liver, heart, are observed more rarely. The aim of our study was to assess the level of selected cytokines in blood among patients with ocular toxoplasmosis. We have enrolled in the study 30 patients, 19-42 years old, treated for ocular toxoplasmosis, and 20 healthy volunteers, 20-48 years old, to the control group. Tests for blood morphology, C-reactive protein, the level of IL-8 and IFN-gamma were performed in all patients. The blood parameters in toxoplasmosis group were performed before antiparasitic treatment was given. The level of IFN-gamma in blood was lower among patients with ocular toxoplasmosis comparing with control group (1.52 vs. 4.18 pg/ml; p = 0.002). The level of IL-8 in blood was lower among patients with ocular toxoplasmosis comparing with control group (22.96 vs. 94.3 pg/ml; p = 0,007). There were no correlations between analyzed cytokines and blood morphology or CRP. The low level of IFN-gamma and IL-8 in blood is important factor leading to reactivation of the ocular toxoplasmosis.

Interferon-gamma and interleukin-10 profile of children with tuberculosis in North Sumatera, Indonesia

NASA Astrophysics Data System (ADS)

Daulay, R. S.; Daulay, R. M.

2018-03-01

Cellular immunity was mediated the host immune response against Mycobacterium tuberculosis, in which cytokine and T-helper (Th) 1 cells play an important role. Interferon-gamma (IFN-γ) is a leading cytokine involved in the immune response of tuberculosis (TB).The primary function of IFN-γ is to activate macrophages in opposition Mycobacterium tuberculosis. Contrast from IFN-γ, interleukin-10 (IL-10) is considered inhibitory cytokine, important to an adequate balance between inflammatory responses. To analyze cytokine profile, particularly IFN-γ and IL-10 of the children with TB in Indonesia, a cross-sectional study was conducted at two general hospitals and seven primary health care located in Medan and Batubara, North Sumatera, Indonesia. Among 51 children with TB disease and 51 healthy children, found that IFN-γ and IL-10 levels were lower in TB patients compared to healthy children. Statistically significant decreased production of the IFN-γ levels (p=0.042) were found in TB patients 9.41 (1.10-28.06) pg/ml contrast to healthy children 6.30 (1.30-89.76) pg/ml. Homologue finding of the IL-10 levels were also found in TB patients 4.93 (0.22-48.01) pg/ml and 4.93 (0.07-81.60) pg/ml in healthy children, but not statistically significant (p=0.784). High levels of IL-10 were not proven to suppress the levels production of IFN-γ in TB patients.

Household food insecurity is associated with low interferon-gamma levels in pregnant Indian women.

PubMed

Vaidya, A; Bhosale, R; Sambarey, P; Suryavanshi, N; Young, S; Mave, V; Kanade, S; Kulkarni, V; Deshpande, P; Balasubramanian, U; Elf, J; Gupte, N; Gupta, A; Mathad, J S

2017-07-01

Over 20% of tuberculosis (TB) cases during pregnancy occur in India. To determine the association between household food insecurity and interferon-gamma (IFN-γ) levels in pregnancy. Pregnant women in India were administered the Household Food Insecurity Access Scale (HFIAS) questionnaire and underwent an IFN-γ release assay. Logistic regression was used to identify factors associated with food insecurity. Of 538 women, 60 (11%) had household food insecurity, 47 (78%) of which were moderate or severe food insecure. After mitogen stimulation, moderate or severe food insecure women had a median IFN-γ concentration of 4.2 IU/ml (IQR 2.2-9.8) vs. 8.4 IU/ml (IQR 3.0-10) in women with no or mild food insecurity (P = 0.03). In multivariate analysis, higher IFN-γ concentrations were associated with human immunodeficiency virus infection (OR 1.3, 95%CI 0.51-2.1, P = 0.001), and inversely associated with moderate or severe food insecurity (OR -1.6, 95%CI -2.9 to -0.27, P = 0.02) and the number of adults in the household (OR -0.08, 95%CI -0.16 to -0.01, P = 0.03). There was no association between food insecurity and IFN-γ response to Mycobacterium tuberculosis antigen. Food insecurity in pregnancy is associated with low IFN-γ levels. There was no association between food insecurity and IFN-γ response to M. tuberculosis antigen, but our study was underpowered to detect this outcome.

Robust Protection against Highly Virulent Foot-and-Mouth Disease Virus in Swine by Combination Treatment with Recombinant Adenoviruses Expressing Porcine Alpha and Gamma Interferons and Multiple Small Interfering RNAs

PubMed Central

Park, Jong-Hyeon; Lee, Kwang-Nyeong; Kim, Se-Kyung; You, Su-Hwa; Kim, Taeseong; Tark, Dongseob; Lee, Hyang-Sim; Seo, Min-Goo; Kim, Byounghan

2015-01-01

ABSTRACT Because the currently available vaccines against foot-and-mouth disease (FMD) provide no protection until 4 to 7 days postvaccination, the only alternative method to halt the spread of the FMD virus (FMDV) during outbreaks is the application of antiviral agents. Combination treatment strategies have been used to enhance the efficacy of antiviral agents, and such strategies may be advantageous in overcoming viral mechanisms of resistance to antiviral treatments. We have developed recombinant adenoviruses (Ads) for the simultaneous expression of porcine alpha and gamma interferons (Ad-porcine IFN-αγ) as well as 3 small interfering RNAs (Ad-3siRNA) targeting FMDV mRNAs encoding nonstructural proteins. The antiviral effects of Ad-porcine IFN-αγ and Ad-3siRNA expression were tested in combination in porcine cells, suckling mice, and swine. We observed enhanced antiviral effects in porcine cells and mice as well as robust protection against the highly pathogenic strain O/Andong/SKR/2010 and increased expression of cytokines in swine following combination treatment. In addition, we showed that combination treatment was effective against all serotypes of FMDV. Therefore, we suggest that the combined treatment with Ad-porcine IFN-αγ and Ad-3siRNA may offer fast-acting antiviral protection and be used with a vaccine during the period that the vaccine does not provide protection against FMD. IMPORTANCE The use of current foot-and-mouth disease (FMD) vaccines to induce rapid protection provides limited effectiveness because the protection does not become effective until a minimum of 4 days after vaccination. Therefore, during outbreaks antiviral agents remain the only available treatment to confer rapid protection and reduce the spread of foot-and-mouth disease virus (FMDV) in livestock until vaccine-induced protective immunity can become effective. Interferons (IFNs) and small interfering RNAs (siRNAs) have been reported to be effective antiviral agents against

Interferon-induced 2'-5' adenylate synthetase in vivo and interferon production in vitro by lymphocytes from systemic lupus erythematosus patients with and without circulating interferon

DOE Office of Scientific and Technical Information (OSTI.GOV)

Preble, O.T.; Rothko, K.; Klippel, J.H.

1983-06-01

The interferon (IFN)-induced enzyme 2-5A synthetase was elevated in mononuclear cells from both serum IFN-positive and -negative systemic lupus erythematosus (SLE) patients. This suggests that a much higher percentage of patients than previously thought produce endogenous IFN. These results may partly explain findings that mononuclear cells from SLE patients are deficient in IFN production in vitro in response to certain IFN inducers. Although normal lymphocytes can produce an acid-labile alpha IFN after stimulation with C. parvum in vitro, the reason for endogenous production of this unusual alpha IFN by SLE patients remains unknown.

A cross-linking study of the Ca2+, Mg2+-activated adenosine triphosphatase of Escherichia coli.

PubMed

Bragg, P D; Hou, C

1980-05-01

The solubilized Ca2+,Mg2+-activated adenosine triphosphatase of Escherichia coli is composed of five subunits designated alpha, beta, gamma, delta and epsilon in order of decreasing molecular weight. The subunit structure of the enzyme has been investigated by the use of the cleavable cross-linking agents dithiobis(succinimidyl propionate), methyl-4-mercaptobutyrimidate, dimethyl-3,3'-dithiobispropionimidate, disuccinimidyl tartarate, and cupric 1,10-phenanthrolinate. The products of cross-linking were analyzed by two different two-dimensional gel electrophoresis systems. The following cross-linked subunit dimers were observed: alpha 2, beta 2, alpha beta, alpha delta, beta gamma, beta delta, beta epsilon and gamma epsilon. These results, together with other published data, are discussed in relation to a model of the arrangement of the subunits in the ATPase molecule.

Identification and Characterization of Neospora caninum Cyclophilin That Elicits Gamma Interferon Production

PubMed Central

Tuo, Wenbin; Fetterer, Raymond; Jenkins, Mark; Dubey, J. P.

2005-01-01

Gamma interferon (IFN-γ) response is essential to the development of a host protective immunity in response to infections by intracellular parasites. Neosporosis, an infection caused by the intracellular protozoan parasite Neospora caninum, is fatal when there is a complete lack of IFN-γ in the infected host. However, the mechanism by which IFN-γ is elicited by the invading parasite is unclear. This study has identified a microbial protein in the N. caninum tachyzoite N. caninum cyclophilin (NcCyP) as a major component of the parasite responsible for the induction of IFN-γ production by bovine peripheral blood mononuclear cells (PBMC) and antigen-specific CD4+ T cells. NcCyP has high sequence homology (86%) with Toxoplasma gondii 18-kDa CyP with a calculated molecular mass of 19.4 kDa. NcCyP is a secretory protein with a predicted signal peptide of 17 amino acids. Abundant NcCyP was detected in whole-cell N. caninum tachyzoite lysate antigen (NcAg) and N. caninum tachyzoite culture supernatant. In N. caninum tachyzoite culture supernatant, three NcCyP bands of 19, 22, and 24 kDa were identified. NcAg stimulated high levels of IFN-γ production by PBMC and CD4+ T cells. The IFN-γ-inducing effect of NcAg was blocked by cyclosporine, a specific ligand for CyP, in a dose-dependent manner. Furthermore, cyclosporine abolished IFN-γ production by PBMC from naïve cows as well as PBMC and CD4+ T cells from infected/immunized cows. These results indicate that the N. caninum tachyzoite naturally produces a potent IFN-γ-inducing protein, NcCyP, which may be important for parasite survival as well as host protection. PMID:16041025

Added value of interferon-gamma release assays in screening for tuberculous infection in the Netherlands.

PubMed

Erkens, C G M; Dinmohamed, A G; Kamphorst, M; Toumanian, S; van Nispen-Dobrescu, R; Alink, M; Oudshoorn, N; Mensen, M; van den Hof, S; Borgdorff, M; Verver, S

2014-04-01

Interferon-gamma release assays (IGRAs) are reported to be more specific for the diagnosis of latent tuberculous infection (LTBI) than the tuberculin skin test (TST). The two-step procedure, TST followed by an IGRA, is reported to be cost-effective in high-income countries, but it requires more financial resources. To assess the added value of IGRA compared to TST alone in the Netherlands. Test results and background data on persons tested with an IGRA were recorded by the Public Municipal Health Services in a web-based database. The number of persons diagnosed with LTBI using different screening algorithms was calculated. In those tested with an IGRA, at least 60% of persons who would have been diagnosed with LTBI based on TST alone had a negative IGRA. Among those with a TST reaction below the cut-off for the diagnosis of LTBI, 13% had a positive IGRA. For 41% of persons tested with an IGRA after TST, the IGRA influenced whether or not an LTBI diagnosis would be made. With the IGRA as reference standard, a high proportion of persons in low-prevalence settings are treated unnecessarily for LTBI if tested with TST alone, while a small proportion eligible for preventive treatment are missed. Incremental costs of the two-step strategy seem to be balanced by the improved targeting of preventive treatment.

Stimulated peripheral production of interferon-gamma is related to fatigue and depression in multiple sclerosis.

PubMed

Pokryszko-Dragan, A; Frydecka, I; Kosmaczewska, A; Ciszak, L; Bilińska, M; Gruszka, E; Podemski, R; Frydecka, D

2012-10-01

The aim of the study was to evaluate the stimulated production of interferon-gamma (IFNγ) by peripheral CD3+CD4+ T lymphocytes in patients with multiple sclerosis (MS) with regard to the degree of fatigue, and to investigate relationships between immunological parameters, level of depression and clinical variables. Forty MS patients (30 women, 10 men, aged 22-60 years): 20 fatigued and 20 non-fatigued were involved in the study. Fatigue was evaluated using the Fatigue Severity Scale (FSS) and Modified Fatigue Impact Scale (MFIS), depression level - using Beck Depression Inventory (BDI). Production of IFNγ by stimulated peripheral blood CD3+CD4+ T lymphocytes, assessed using flow cytometry, was compared between MS patients with different levels of fatigue and controls. Correlations were searched out between immunological findings and BDI, age, duration and course of MS, relapse rate, disability (assessed in Expanded Disability Status Scale - EDSS) and its progression. Stimulated production of IFNγ by CD3+CD4+ T lymphocytes was higher in severely fatigued patients in comparison with non-fatigued ones and controls, tended to correlate with FSS and MFIS, and correlated with BDI. No relationships were found between immunological findings and disease-related variables. Stimulated production of IFNγ by peripheral CD3+CD4+ T lymphocytes is related to fatigue and depression in MS patients. Copyright © 2012 Elsevier B.V. All rights reserved.

Tuberculin Skin Tests versus Interferon-Gamma Release Assays in Tuberculosis Screening among Immigrant Visa Applicants

PubMed Central

Chuke, Stella O.; Yen, Nguyen Thi Ngoc; Laserson, Kayla F.; Phuoc, Nguyen Huu; Trinh, Nguyen An; Nhung, Duong Thi Cam; Mai, Vo Thi Chi; Qui, An Dang; Hai, Hoang Hoa; Loan, Le Thien Huong; Jones, Warren G.; Whitworth, William C.; Shah, J. Jina; Painter, John A.; Mazurek, Gerald H.; Maloney, Susan A.

2014-01-01

Objective. Use of tuberculin skin tests (TSTs) and interferon gamma release assays (IGRAs) as part of tuberculosis (TB) screening among immigrants from high TB-burden countries has not been fully evaluated. Methods. Prevalence of Mycobacterium tuberculosis infection (MTBI) based on TST, or the QuantiFERON-TB Gold test (QFT-G), was determined among immigrant applicants in Vietnam bound for the United States (US); factors associated with test results and discordance were assessed; predictive values of TST and QFT-G for identifying chest radiographs (CXRs) consistent with TB were calculated. Results. Of 1,246 immigrant visa applicants studied, 57.9% were TST positive, 28.3% were QFT-G positive, and test agreement was 59.4%. Increasing age was associated with positive TST results, positive QFT-G results, TST-positive but QFT-G-negative discordance, and abnormal CXRs consistent with TB. Positive predictive values of TST and QFT-G for an abnormal CXR were 25.9% and 25.6%, respectively. Conclusion. The estimated prevalence of MTBI among US-bound visa applicants in Vietnam based on TST was twice that based on QFT-G, and 14 times higher than a TST-based estimate of MTBI prevalence reported for the general US population in 2000. QFT-G was not better than TST at predicting abnormal CXRs consistent with TB. PMID:24738031

The tuberculin skin test increases the responses measured by T cell interferon-gamma release assays.

PubMed

Vilaplana, C; Ruiz-Manzano, J; Gil, O; Cuchillo, F; Montané, E; Singh, M; Spallek, R; Ausina, V; Cardona, P J

2008-06-01

RUTI is a vaccine consisting of Mycobacterium tuberculosis bacilli grown in stress conditions that is fragmented, detoxified and liposomed. RUTI was designed to shorten the treatment of latent tuberculosis infection (LTBI) with isoniazid from 9 months to just 1 month, by additional treatment with two inoculations of RUTI 4 weeks apart. During the validation process for monitoring the immunogenicity of administration of RUTI in a Phase I clinical trial, the question arose whether to introduce the tuberculin skin test (TST) in the screening of non-LTBI volunteers. This study was designed to evaluate the effect of TST on subsequent different T-cell interferon-gamma release assay (TIGRA) responses, using a spectrum of M. tuberculosis-related antigens (ESAT-6, CFP-10, 16 kDa, 19 kDa, MPT64, Ag 85B, 38 kDa, hsp65, PPD and BCG). The results showed an increase in post-TST response even in non-LTBI subjects for most antigens tested, as measured both by whole blood assay (WBA) and ELISPOT. Increased ELISPOT response decreased toward pre-TST levels within 1 month whereas the WBA response did not. Taking into account that there is no definitive correlation between TST and TIGRA tests to diagnose LTBI and the feasibility that TST might alter the immune monitoring included in clinical trials, these data suggest that TST determination should be carefully planned to avoid any interference with TIGRA.

Cross-linking of type I collagen with microbial transglutaminase: identification of cross-linking sites.

PubMed

Stachel, Ines; Schwarzenbolz, Uwe; Henle, Thomas; Meyer, Michael

2010-03-08

Collagen is a popular biomaterial. To deal with its lack of thermal stability and its weak resistance to proteolytic degradation, collagen-based materials are stabilized via different cross-linking procedures. Regarding the potential toxicity of residual cross-linking agents, enzyme-mediated cross-linking would provide an alternative and nontoxic method for collagen stabilization. The results of this study show that type I collagen is a substrate for mTG. However, epsilon-(gamma-glutamyl)lysine cross-links are only incorporated at elevated temperatures when the protein is partially or completely denatured. A maximum number of 5.4 cross-links per collagen monomer were found for heat-denatured collagen. Labeling with the primary amine monodansylcadaverine revealed that at least half of the cross-links are located within the triple helical region of the collagen molecule. Because the triple helix is highly ordered in its native state, this finding might explain why the glutamine residues are inaccessible for mTG under nondenaturing conditions.

Reproducibility of Interferon Gamma (IFN-γ) Release Assays. A Systematic Review

PubMed Central

Tagmouti, Saloua; Slater, Madeline; Benedetti, Andrea; Kik, Sandra V.; Banaei, Niaz; Cattamanchi, Adithya; Metcalfe, John; Dowdy, David; van Zyl Smit, Richard; Dendukuri, Nandini

2014-01-01

Rationale: Interferon gamma (IFN-γ) release assays for latent tuberculosis infection result in a larger-than-expected number of conversions and reversions in occupational screening programs, and reproducibility of test results is a concern. Objectives: Knowledge of the relative contribution and extent of the individual sources of variability (immunological, preanalytical, or analytical) could help optimize testing protocols. Methods: We performed a systematic review of studies published by October 2013 on all potential sources of variability of commercial IFN-γ release assays (QuantiFERON-TB Gold In-Tube and T-SPOT.TB). The included studies assessed test variability under identical conditions and under different conditions (the latter both overall and stratified by individual sources of variability). Linear mixed effects models were used to estimate within-subject SD. Measurements and Main Results: We identified a total of 26 articles, including 7 studies analyzing variability under the same conditions, 10 studies analyzing variability with repeat testing over time under different conditions, and 19 studies reporting individual sources of variability. Most data were on QuantiFERON (only three studies on T-SPOT.TB). A considerable number of conversions and reversions were seen around the manufacturer-recommended cut-point. The estimated range of variability of IFN-γ response in QuantiFERON under identical conditions was ±0.47 IU/ml (coefficient of variation, 13%) and ±0.26 IU/ml (30%) for individuals with an initial IFN-γ response in the borderline range (0.25–0.80 IU/ml). The estimated range of variability in noncontrolled settings was substantially larger (±1.4 IU/ml; 60%). Blood volume inoculated into QuantiFERON tubes and preanalytic delay were identified as key sources of variability. Conclusions: This systematic review shows substantial variability with repeat IFN-γ release assays testing even under identical conditions, suggesting that reversions

Important role of interferon regulatory factor (IRF)-3 in the interferon response of mouse macrophages upon infection by Newcastle disease virus.

PubMed

Wilden, Holger; Schirrmacher, Volker; Fournier, Philippe

2011-08-01

Newcastle disease virus (NDV) is an interesting agent for activating innate immune activity in macrophages including secretion of TNF-α and IFN-α, upregulation of TRAIL and activation of NF-κB and iNOS. However, the molecular mechanism of such cellular activities remains largely unknown. Tumor selectivity of replication of NDV has been described to be linked to deviations in tumor cells of the type I interferon response. We therefore focused on the interferon response to NDV of macrophages as part of innate anti-viral and anti-tumor activity. In particular, we investigated the functional significance of the interferon regulatory factor genes (IRF)-3 and IRF-7. Deletion of the IRF-3 or IRF-7 gene was found to increase susceptibility of mouse macrophages to virus infection. Surprisingly, NDV replicated better in IRF-3 KO than in IRF-7 KO macrophages. Further analysis showed that IRF-3 KO macrophages have a lower basal and NDV-induced RIG-I expression in comparison to IRF-7 KO macrophages. This might explain why, in IRF-3 KO macrophages, the secretion of type I interferons after NDV infection is delayed, when compared to IRF-7 KO and wild-type macrophages. In addition, IRF-3 KO cells showed reduced NDV-induced levels of IRF-7. This effect could be prevented by priming the cells first by interferon-α. Further results indicated that an early production of type I interferon rather than high maximal levels at later time points are important for resistance to infection by NDV. In conclusion, these results demonstrate an important role of IRF-3 for the innate anti-viral response to NDV of mouse macrophages.

Associations of Self-Reported Sleep Quality with Circulating Interferon Gamma-Inducible Protein 10, Interleukin 6, and High-Sensitivity C-Reactive Protein in Healthy Menopausal Women

PubMed Central

Chang, Chia-Chu; Kor, Chew-Teng; Chen, Ting-Yu; Wu, Hung-Ming

2017-01-01

Introduction Sleep disturbance is very common in menopausal women and poor sleep quality has been linked to systemic inflammation. However, the impact of poor sleep quality on health outcomes of menopausal women remains unclear. This study evaluated the relationships between sleep quality and inflammation in menopausal women. Participants and design This cross-sectional study enrolled 281 healthy women aged 45 to 60 years. The Pittsburgh Sleep Quality Index (PSQI) was used to measure quality of sleep. Multiplex assays were used to measure the levels of 9 cytokines in morning fasting plasma samples. Other variables measured in this study included clinical characteristics and high-sensitivity C-reactive protein (hs-CRP). Setting The study was performed at a medical center. Results The 281 participants comprised 79 (28%) perimenopausal women and 202 (72%) postmenopausal women. Global PSQI scores were positively correlated with plasma hs-CRP levels (P = 0.012) and were marginally associated with interferon gamma-inducible protein-10 (IP10), interleukin 6 (IL6), and macrophage inflammatory protein-1beta (MIP-1β) levels. After adjusting for age, body mass index, menopause duration, and follicle stimulating hormone, multiple linear regression analysis revealed that high PSQI scores and sleep efficiency < 65% were associated with elevated plasma levels of hs-CRP, IP10, and IL6. In addition, sleep duration < 5 hours was associated with high hs-CRP levels. Conclusion Our data show that poor sleep quality and low sleep efficiency are associated with elevated levels of circulating inflammatory factors IP10, IL6 and hs-CRP and that short sleep duration is associated with high levels of hs-CRP in menopausal women. These findings provide novel evidence that poor sleep quality is linked to low-grade systemic inflammation in menopausal women. PMID:28060925

Droplet Digital Enzyme-Linked Oligonucleotide Hybridization Assay for Absolute RNA Quantification.

PubMed

Guan, Weihua; Chen, Liben; Rane, Tushar D; Wang, Tza-Huei

2015-09-03

We present a continuous-flow droplet-based digital Enzyme-Linked Oligonucleotide Hybridization Assay (droplet digital ELOHA) for sensitive detection and absolute quantification of RNA molecules. Droplet digital ELOHA incorporates direct hybridization and single enzyme reaction via the formation of single probe-RNA-probe (enzyme) complex on magnetic beads. It enables RNA detection without reverse transcription and PCR amplification processes. The magnetic beads are subsequently encapsulated into a large number of picoliter-sized droplets with enzyme substrates in a continuous-flow device. This device is capable of generating droplets at high-throughput. It also integrates in-line enzymatic incubation and detection of fluorescent products. Our droplet digital ELOHA is able to accurately quantify (differentiate 40% difference) as few as ~600 RNA molecules in a 1 mL sample (equivalent to 1 aM or lower) without molecular replication. The absolute quantification ability of droplet digital ELOHA is demonstrated with the analysis of clinical Neisseria gonorrhoeae 16S rRNA to show its potential value in real complex samples.

Droplet Digital Enzyme-Linked Oligonucleotide Hybridization Assay for Absolute RNA Quantification

PubMed Central

Guan, Weihua; Chen, Liben; Rane, Tushar D.; Wang, Tza-Huei

2015-01-01

We present a continuous-flow droplet-based digital Enzyme-Linked Oligonucleotide Hybridization Assay (droplet digital ELOHA) for sensitive detection and absolute quantification of RNA molecules. Droplet digital ELOHA incorporates direct hybridization and single enzyme reaction via the formation of single probe-RNA-probe (enzyme) complex on magnetic beads. It enables RNA detection without reverse transcription and PCR amplification processes. The magnetic beads are subsequently encapsulated into a large number of picoliter-sized droplets with enzyme substrates in a continuous-flow device. This device is capable of generating droplets at high-throughput. It also integrates in-line enzymatic incubation and detection of fluorescent products. Our droplet digital ELOHA is able to accurately quantify (differentiate 40% difference) as few as ~600 RNA molecules in a 1 mL sample (equivalent to 1 aM or lower) without molecular replication. The absolute quantification ability of droplet digital ELOHA is demonstrated with the analysis of clinical Neisseria gonorrhoeae 16S rRNA to show its potential value in real complex samples. PMID:26333806

Droplet Digital Enzyme-Linked Oligonucleotide Hybridization Assay for Absolute RNA Quantification

NASA Astrophysics Data System (ADS)

Guan, Weihua; Chen, Liben; Rane, Tushar D.; Wang, Tza-Huei

2015-09-01

We present a continuous-flow droplet-based digital Enzyme-Linked Oligonucleotide Hybridization Assay (droplet digital ELOHA) for sensitive detection and absolute quantification of RNA molecules. Droplet digital ELOHA incorporates direct hybridization and single enzyme reaction via the formation of single probe-RNA-probe (enzyme) complex on magnetic beads. It enables RNA detection without reverse transcription and PCR amplification processes. The magnetic beads are subsequently encapsulated into a large number of picoliter-sized droplets with enzyme substrates in a continuous-flow device. This device is capable of generating droplets at high-throughput. It also integrates in-line enzymatic incubation and detection of fluorescent products. Our droplet digital ELOHA is able to accurately quantify (differentiate 40% difference) as few as ~600 RNA molecules in a 1 mL sample (equivalent to 1 aM or lower) without molecular replication. The absolute quantification ability of droplet digital ELOHA is demonstrated with the analysis of clinical Neisseria gonorrhoeae 16S rRNA to show its potential value in real complex samples.

Sensitivity of African swine fever virus to type I interferon is linked to genes within multigene families 360 and 505.

PubMed

Golding, Josephine P; Goatley, Lynnette; Goodbourn, Steve; Dixon, Linda K; Taylor, Geraldine; Netherton, Christopher L

2016-06-01

African swine fever virus (ASFV) causes a lethal haemorrhagic disease of pigs. There are conflicting reports on the role of interferon in ASFV infection. We therefore analysed the interaction of ASFV with porcine interferon, in vivo and in vitro. Virulent ASFV induced biologically active IFN in the circulation of pigs from day 3-post infection, whereas low virulent OUR T88/3, which lacks genes from multigene family (MGF) 360 and MGF505, did not. Infection of porcine leucocytes enriched for dendritic cells, with ASFV, in vitro, induced high levels of interferon, suggesting a potential source of interferon in animals undergoing acute ASF. Replication of OUR T88/3, but not virulent viruses, was reduced in interferon pretreated macrophages and a recombinant virus lacking similar genes to those absent in OUR T88/3 was also inhibited. These findings suggest that as well as inhibiting the induction of interferon, MGF360 and MGF505 genes also enable ASFV to overcome the antiviral state. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

A randomized, double-blind, phase I/II trial of tumor necrosis factor and interferon-gamma for treatment of AIDS-related complex (Protocol 025 from the AIDS Clinical Trials Group).

PubMed

Agosti, J M; Coombs, R W; Collier, A C; Paradise, M A; Benedetti, J K; Jaffe, H S; Corey, L

1992-05-01

To determine safety and efficacy of tumor necrosis factor (TNF) and interferon-gamma (IFN gamma) in the treatment of patients with acquired immunodeficiency syndrome (AIDS)-related complex, a randomized, double-blind study was conducted. Twenty-five patients with AIDS-related complex and CD4 lymphocytes less than or equal to 500 x 10(6)/L attended an AIDS Clinical Trials Unit of a tertiary referral center. Patients were administered tumor necrosis factor (TNF) (10 micrograms/m2) or IFN gamma (10 micrograms/m2), or both intramuscularly three times weekly for 16 weeks. Side effects from all three preparations included fever, constitutional symptoms, and local reactions. No significant hematologic, hepatic, renal, or coagulation abnormalities were observed. CD4 lymphocyte counts, beta 2-microglobulin, p24 antigen levels, and anti-p24 antibody did not change significantly during therapy. Similarly, no significant change was noted in rates of HIV isolation from peripheral blood mononuclear cells or plasma. TNF and IFN gamma were tolerable after premedication with acetaminophen; however, no significant change in markers of human immunodeficiency virus infection was demonstrated. These cytokines alone do not appear to be of benefit, nor do they appear to hasten the progression of HIV infection.

A novel mechanism of skin tumor promotion involving interferon-gamma (IFNγ)/signal transducer and activator of transcription-1 (Stat1) signaling.

PubMed

Bozeman, Ronald; Abel, Erika L; Macias, Everardo; Cheng, Tianyi; Beltran, Linda; DiGiovanni, John

2015-08-01

The current study was designed to explore the role of signal transducer and activator of transcription 1 (Stat1) during tumor promotion using the mouse skin multistage carcinogenesis model. Topical treatment with both 12-O-tetradecanoylphorbol-13-acetate (TPA) and 3-methyl-1,8-dihydroxy-9-anthrone (chrysarobin or CHRY) led to rapid phosphorylation of Stat1 on both tyrosine (Y701) and serine (S727) residues in epidermis. CHRY treatment also led to upregulation of unphosphorylated Stat1 (uStat1) at later time points. CHRY treatment also led to upregulation of interferon regulatory factor 1 (IRF-1) mRNA and protein, which was dependent on Stat1. Further analyses demonstrated that topical treatment with CHRY but not TPA upregulated interferon-gamma (IFNγ) mRNA in the epidermis and that the induction of both IRF-1 and uStat1 was dependent on IFNγ signaling. Stat1 deficient (Stat1(-/-) ) mice were highly resistant to skin tumor promotion by CHRY. In contrast, the tumor response (in terms of both papillomas and squamous cell carcinomas) was similar in Stat1(-/-) mice and wild-type littermates with TPA as the promoter. Maximal induction of both cyclooxygenase-2 and inducible nitric oxide synthase in epidermis following treatment with CHRY was also dependent on the presence of functional Stat1. These studies define a novel mechanism associated with skin tumor promotion by the anthrone class of tumor promoters involving upregulation of IFNγ signaling in the epidermis and downstream signaling through activated (phosphorylated) Stat1, IRF-1 and uStat1. © 2014 Wiley Periodicals, Inc.

Comparative study of indirect immunofluorescence, enzyme-linked immunosorbent assay, and the Tzanck smear test for the diagnosis of pemphigus.

PubMed

Zhou, Tingting; Fang, Siyue; Li, Chunlei; Hua, Hong

2016-11-01

Pemphigus is one of the potentially fatal autoimmune blistering diseases. An early and accurate diagnosis is important for prognosis and therapy. It may be difficult to diagnosis based on clinical grounds alone. Direct and indirect immunofluorescence, enzyme-linked immunosorbent assay, the Tzanck smear test, or histopathology are all available for the diagnosis of pemphigus. However, there are no generally accepted diagnostic criteria for the diagnosis of this condition at present. To evaluate the diagnostic value of indirect immunofluorescence, enzyme-linked immunosorbent assay, and the Tzanck smear test for the diagnosis of pemphigus in dental clinics. A single-center retrospective study was conducted, and the clinical data of 33 patients with pemphigus and 61 controls were collected and analyzed from the Department of Oral Medicine, Peking University School of Stomatology, during 2010-2014. The sensitivities and specificities of indirect immunofluorescence, enzyme-linked immunosorbent assay, and the Tzanck smear test were calculated and compared in two groups. Sensitivities for the Tzanck smear test, indirect immunofluorescence, and enzyme-linked immunosorbent assay were 96.7%, 84.8%, and 84.8%, respectively, whereas the specificities of these tests were 60%, 91.8%, and 96.7%, respectively. The serial tests for the Tzanck smear test and enzyme-linked immunosorbent assay showed 82% sensitivity and 98.7% specificity. The serial test for the Tzanck smear test and enzyme-linked immunosorbent assay may represent a simple, rapid, and reliable way to definitive diagnosis of pemphigus. It is recommended as a common test for the diagnosis of pemphigus in dental clinics. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

An enzyme-linked immunosorbent assay for determination of dicyclanil in animal tissue

USDA-ARS?s Scientific Manuscript database

Dicyclanil is a pyrimidine-derived insect growth regulator used in veterinary medicine for the prevention of myiasis or fly-strike. It is toxic to animals and humans. In this paper, for the first time, a competitive indirect enzyme-linked immunosorbent assay was developed for the determination of ...

Microvolume, kinetic-dependent enzyme-linked immunosorbent assay for amoeba antibodies.

PubMed Central

Mathews, H M; Walls, K W; Huong, A Y

1984-01-01

We describe a microvolume enzyme-linked immunosorbent assay based on enzyme rate kinetics. Antigens from Entamoeba histolytica were adsorbed in wells of disposable polystyrene strips containing 12 flat-bottom wells. After exposure to the serum of a patient and peroxidase-labeled anti-human immunoglobulin G, the rate of color change in specific substrate was determined by eight sequential readings of individual wells over a 2-min period with a microcomputer-controlled model MR-600 automated plate reader. The changes in absorbance readings were converted to slope values for each well by the microcomputer. Thus, 12 samples were read, and results were printed in ca. 3.5 min. Assay conditions are described and data are presented to show that this assay is quantitative for antibody and antigen concentration with a single-tube (well) dilution. PMID:6321547

Enzyme-Linked Antibodies: A Laboratory Introduction to the ELISA Assay

NASA Astrophysics Data System (ADS)

Anderson, Gretchen L.; McNellis, Leo A.

1998-10-01

A fast and economical laboratory exercise is presented that qualitatively demonstrates the power of enzyme-linked antibodies to detect a specific antigen. Although ELISAs are commonly used in disease diagnosis in clinical settings, this application uses biotin, covalently attached to albumin, to take advantage of readily available reagents and avoids problems associated with potentially pathogenic antigens. The laboratory exercise is suitable for high school or freshman level biochemistry courses, and can be completed within two hours.

Role of Gamma Interferon in the Pathogenesis of Severe Schistosomiasis in Interleukin-4-Deficient Mice

PubMed Central

La Flamme, Anne Camille; Patton, Elisabeth A.; Pearce, Edward J.

2001-01-01

In the absence of interleukin-4 (IL-4), infection with Schistosoma mansoni leads to a severe fatal disease rather than the chronic survivable condition that occurs in wild-type (WT) mice. Because the sustained production of NO most closely correlates to weight loss and fatality in infected IL-4−/− mice and because gamma interferon (IFN-γ) is an important inducer of inducible NO synthase, infected IL-4−/− mice were treated with anti-IFN-γ antibodies to determine the role of IFN-γ during schistosomiasis in WT and IL-4−/− animals. When IFN-γ was neutralized, Th2 responses were enhanced and NO production was reduced in both WT and IL-4−/− mice. The decreased NO production correlated with a rescue of proliferation in splenocytes from infected IL-4−/− mice. Furthermore, the neutralization of IFN-γ in vivo improved the gross appearance of the liver and led to a reduction in granuloma size in infected IL-4−/− but not WT mice. However, the neutralization of IFN-γ in vivo did not affect the development of severe disease in infected IL-4−/− mice. These results suggest that while the increased production of IFN-γ does lead to some of the pathology observed in infected IL-4−/− mice, it is not ultimately responsible for cachexia and death. PMID:11705919

Reversion and conversion of Mycobacterium tuberculosis IFN-gamma ELISpot results during anti-tuberculous treatment in HIV-infected children.

PubMed

Connell, Tom G; Davies, Mary-Ann; Johannisen, Christine; Wood, Kathryn; Pienaar, Sandy; Wilkinson, Katalin A; Wilkinson, Robert J; Zar, Heather J; Beatty, David; Nicol, Mark P; Curtis, Nigel; Eley, Brian

2010-05-27

Recent interest has focused on the potential use of serial interferon gamma (IFN-gamma) release assay (IGRA) measurements to assess the response to anti-tuberculous (TB) treatment. The kinetics of IFN-gamma responses to Mycobacterium tuberculosis (MTB) antigens in HIV-infected children during treatment have not however been previously investigated. IFN-gamma responses to the MTB antigens, ESAT-6, CFP-10 and PPD were measured by an enzyme-linked immunospot assay (IFN-gamma ELISpot) at presentation and at one, two and six months after starting anti-tuberculous treatment in HIV-infected children with definite or probable TB. Responses at different time points were compared using a Mann-Whitney U test with paired data analysed using the Wilcoxon signed rank test. A Fisher's exact or Chi-squared test was used to compare proportions when test results were analysed as dichotomous outcomes. Of 102 children with suspected TB, 22 (21%) had definite TB and 24 (23%) probable TB. At least one follow up IFN-gamma ELISpot assay result was available for 31 (67%) of the 46 children. In children with definite or probable TB in whom the IFN-gamma ELISpot assay result was positive at presentation, anti-tuberculous treatment was accompanied by a significant decrease in both the magnitude of the IFN-gamma response to individual or combined MTB-specific antigens (ESAT-6 median 110 SFCs/106 PBMC (IQR 65-305) at presentation vs. 15 (10-115) at six months, p = 0.04; CFP-10 177 (48-508) vs. 20 (5-165), p = 0.004, ESAT-6 or CFP-10 median 250 SFCs/106 PBMC (IQR 94-508) vs. 25 (10-165), p = 0.004) and in the proportion of children with a positive IFN-gamma ELISpot assay (Fisher's exact test: ESAT-6 15/0 vs 5/11, p = 0.0002, CFP-10 22/0 vs 8/17, p = 0.0001, ESAT-6 or CFP-10 22/0 vs. 9/17, p= 0.002). However almost half of the children had a positive IFN-gamma ELISpot assay after six months of anti-tuberculous treatment. In addition, there was conversion of the IFN-gamma ELISpot assay result

Tuberculosis screening of new hospital employees: compliance, clearance to work time, and cost using tuberculin skin test and interferon-gamma release assays.

PubMed

Foster-Chang, Sarah A; Manning, Mary L; Chandler, Laura

2014-11-01

Selection of the most suitable test(s) for detection of Mycobacterium tuberculosis (TB) infection should be based on purpose, setting, effectiveness, and cost. Two tests are available to screen for latent TB: the tuberculin skin test (TST) and the more recent interferon-gamma release assays (IGRAs). Based on the administrative, logistic, and technical ease of use, an IGRA trial was initiated by the occupational health department at an urban Veteran's Administration health care facility for TB screening of new employees. As a result, new employees completing the pre-placement process within the organization's designated 14 days increased from 77% to 97%, new employee clearance to work time decreased from 13.18 to 5.91 days, and new employee TB screening costs were reduced by 40%. The IGRA is an acceptable alternative to the TST and has significant potential to improve the process of pre-placement TB screening. Copyright 2014, SLACK Incorporated.

Fish oil feeding delays influenza virus clearance and impairs production of interferon-gamma and virus-specific immunoglobulin A in the lungs of mice.

PubMed

Byleveld, P M; Pang, G T; Clancy, R L; Roberts, D C

1999-02-01

Ingestion of fish oil can suppress the inflammatory response to injury and may impair host resistance to infection. To investigate the effect of a diet containing fish oil on immunity to viral infection, 148 BALB/c mice were fed diets containing 3 g/100 g of sunflower oil with either 17 g/100 g of fish oil or beef tallow for 14 d before intranasal challenge with live influenza virus. At d 1 and d 5 after infection, the mice fed fish oil had higher lung viral load and lower body weight (P < 0.05). In addition to the greater viral load and weight loss at d 5 after infection, the fish oil group consumed less food (P < 0.05) while the beef tallow group was clearing the virus, had regained their preinfection weights and was returning to their preinfection food consumption. The fish oil group had impaired production of lung interferon-gamma (IFN-gamma), serum immunoglobulin (Ig) G and lung IgA-specific antibodies (all P < 0. 05) although lung IFN-alpha/beta and the relative proportions of bronchial lymph node CD4+ and CD8+ T lymphocytes did not differ between groups after infection. The present study demonstrates a delay in virus clearance in mice fed fish oil associated with reduced IFN-gamma and antibody production and a greater weight loss and suppression of appetite following influenza virus infection. However, differences observed during the course of infection did not affect the ultimate outcome as both groups cleared the virus and returned to preinfection food consumption and body weight by d 7.

Borrelia-primed and -infected mice deficient of interleukin-17 develop arthritis after neutralization of gamma-interferon.

PubMed

Kuo, Joseph; Warner, Thomas F; Schell, Ronald F

2017-03-01

The immune mechanisms responsible for development of Lyme arthritis are partially understood with interleukin-17 (IL-17) and gamma-interferon (IFN-γ) playing a generally accepted role. Elevated levels of IL-17 and/or IFN-γ have been reported in samples from human Lyme arthritis patients and experimental mice. In addition, IL-17 and IFN-γ have been implicated in the onset of arthritis in Borrelia-primed and -infected C57BL/6 mice. Recently, we showed that IL-17-deficient mice developed swelling and histopathological changes consistent with arthritis in the presence of high levels of IFN-γ. We hypothesized that neutralization of IFN-γ in IL-17-deficient mice would inhibit Borrelia-induced arthritis. Our results, however, showed that swelling of the hind paws and histopathological changes of arthritis did not differ between Borrelia-primed and -infected IL-17-deficient and wild-type mice with or without neutralization of IFN-γ. We also found higher levels of tumor necrosis factor alpha (TNF-α) and IL-6 in the popliteal lymph node cells of Borrelia-primed and -infected IL-17-deficient mice after neutralization of IFN-γ. These results suggest that multiple cytokines interact in the development of Borrelia-induced arthritis. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Development of an Enzyme Linked Immunosorbent Assay to Detect Chicken Parvovirus Specific Antibodies

USDA-ARS?s Scientific Manuscript database

Here we report the development and application of an enzyme linked immunosorbent assay to detect parvovirus-specific antibodies in chicken sera. We used an approach previously described for other parvoviruses to clone and express viral structural proteins in insect cells from recombinant baculovirus...

Evaluating pleural ADA, ADA2, IFN-γ and IGRA for diagnosing tuberculous pleurisy.

PubMed

Keng, Li-Ta; Shu, Chin-Chung; Chen, Jason Yao-Ping; Liang, Sheng-Kai; Lin, Ching-Kai; Chang, Lih-Yu; Chang, Chia-Hao; Wang, Jann-Yuan; Yu, Chong-Jen; Lee, Li-Na

2013-10-01

Conventional methods for diagnosing tuberculous pleurisy (TB pleurisy) are either invasive or have a long turn-around-time. Performances of pleural adenosine deaminase (ADA), ADA2, interferon-gamma (IFN-γ), and interferon-gamma release assays (IGRA) as diagnostic tools for TB pleurisy were evaluated. Eighty-eight patients with lymphocyte-predominant pleural exudates between June 2010 and March 2011, including 31 with clinically diagnosed TB pleurisy, were prospectively studied. Pleural ADA and ADA2 activity were measured by colorimetric method, IFN-γ levels by enzyme-linked immuno-sorbent assay, and IGRA by enzyme-linked immuno-spot (T-SPOT.TB) assay. Pleural ADA, ADA2, and IFN-γ levels, but not the proportion of positive T-SPOT.TB assay, were significantly higher in patients with TB pleurisy than in those without TB pleurisy. The area under the receiver-operating-characteristic (ROC) curve was 0.920, 0.893, 0.875, and 0.544 for IFN-γ, ADA2, ADA, and T-SPOT.TB assay, respectively. The combination of ADA ≥ 40 IU/L and IFN-γ ≥ 75 pg/mL yielded a specificity of 100%. Pleural ADA, ADA2 and IFN-γ, but not T-SPOT.TB assay, are all sensitive and specific for TB pleurisy. In patients with lymphocyte-predominant pleural exudates, ADA ≥ 40 IU/L and IFN-γ ≥ 75 pg/mL in pleural effusion imply a very high probability of TB pleurisy. Copyright © 2013 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

The effects of altered N-linked oligosaccharide structures on maturation and targeting of lysosomal enzymes in Dictyostelium discoideum.

PubMed

Freeze, H H; Koza-Taylor, P; Saunders, A; Cardelli, J A

1989-11-15

We have examined the relationship of N-linked oligosaccharide structures to the proper targeting and proteolytic processing of two lysosomal enzymes, alpha-mannosidase and beta-glucosidase, in the slime mold Dictyostelium discoideum. Two different mutant strains, HL241 and HL243, each synthesize the same nonglucosylated, truncated, lipid-linked oligosaccharide precursor, Man6GlcNAc2. [3H]Mannose-labeled N-linked oligosaccharides were studied following their release from immunoprecipitated alpha-mannosidase and beta-glucosidase by digestion with peptide:N-glycosidase F. The oligosaccharides from both mutants resembled each other, but they were smaller and contained fewer anionic groups than those from the wild-type. The oligosaccharides from the mutants strains were reduced in sulfate and Man-6-P content, and all Man-6-P was in the form of acid-stable phosphodiesters. Pulse-chase radiolabeling experiments using [35S] methionine indicated that the precursor forms of both enzymes were smaller than wild-type, and that this difference was due solely to differences in N-linked oligosaccharides. The precursor forms of the enzymes were not over-secreted, but appeared to be proteolytically processed into mature forms at approximately 50% the rate of wild-type. This is mainly due to their prolonged retention in the rough endoplasmic reticulum, but, ultimately, both enzymes were properly targeted to lysosomes. These studies indicate that a reduction in the amount of sulfation, phosphorylation or size of the N-linked oligosaccharides in these mutants is not critical for the proteolytic processing and targeting of the lysosomal enzymes, but that these changes may influence their rate of exit from the rough endoplasmic reticulum.

Effect of interferons and other biological response modifiers (BRMS) on macrophage-mediated inhibition of Listeria monocytogenes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Badger, A.M.; Swift, B.; Sung, C.P.

1986-03-05

Recombinant murine gamma interferon (IFN-..gamma..) activates oil elicited C57BL/6 peritoneal macrophages to inhibit the growth of Listeria. Maximum activity is obtained with 10-20 units/ml, can be demonstrated in the absence of antibiotics and is not due to LPS contamination. Studies of the kinetics of this phenomenon demonstrate that a 30 minute incubation with IFN-..gamma.. is sufficient to initiate the antiproliferative state and full activity can be obtained with a 4 hour incubation. Alpha/beta interferon (IFN-..cap alpha../..beta..) is also active but requires 100X more units to obtain equivalent activity. The evaluation of a number of other BRMS demonstrated that MDP andmore » LPS could stimulate phagocytosis of Listeria but could not inhibit their growth. Bestatin, tuftsin, Con A, A23187 and Poly I:C did not stimulate either phagocytosis or growth inhibitory activity. These compounds were also tested for their ability to enhance the release of superoxide anion from PMA stimulated macrophages. With the exception of tuftsin and bestatin all of the BRMS tested were able to enhance the production of oxidative burst products confirming the findings of others of the dissociation between the two functions.« less

Functional Enzyme-Based Approach for Linking Microbial Community Functions with Biogeochemical Process Kinetics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Minjing; Qian, Wei-jun; Gao, Yuqian

The kinetics of biogeochemical processes in natural and engineered environmental systems are typically described using Monod-type or modified Monod-type models. These models rely on biomass as surrogates for functional enzymes in microbial community that catalyze biogeochemical reactions. A major challenge to apply such models is the difficulty to quantitatively measure functional biomass for constraining and validating the models. On the other hand, omics-based approaches have been increasingly used to characterize microbial community structure, functions, and metabolites. Here we proposed an enzyme-based model that can incorporate omics-data to link microbial community functions with biogeochemical process kinetics. The model treats enzymes asmore » time-variable catalysts for biogeochemical reactions and applies biogeochemical reaction network to incorporate intermediate metabolites. The sequences of genes and proteins from metagenomes, as well as those from the UniProt database, were used for targeted enzyme quantification and to provide insights into the dynamic linkage among functional genes, enzymes, and metabolites that are necessary to be incorporated in the model. The application of the model was demonstrated using denitrification as an example by comparing model-simulated with measured functional enzymes, genes, denitrification substrates and intermediates« less

Quantitation of antibodies to Haemophilus influenzae type b in humans by enzyme-linked immunosorbent assay.

PubMed Central

Dahlberg, T

1981-01-01

The enzyme-linked immunosorbent assay was adapted to detect serum immunoglobulin G, immunoglobulin M, immunoglobulin A, and secretory immunoglobulin A antibodies to Haemophilus influenzae type b capsular polysaccharide in humans. I studied serum samples from 92 healthy children of various ages, 50 healthy adults, 24 patients with various H. influenzae type b infections, and 16 patients with clinical signs of epiglottis and cellulitis suspected to be caused by H. influenzae type b. The mean antibody titers of the sera from healthy children increased with age and reached adult levels in children more than 6 years old. A significant antibody response to capsular polysaccharide was observed in serum samples from the majority of patients with infections due to H. influenzae type b and in 4 of 16 patients with clinical signs of epiglottis and cellulitis. In addition to the enzyme-linked immunosorbent assay, the antibody responses of patients were tested by a bactericidal assay. When the two methods were compared, there was no evident correlation (r, about 0.22). The enzyme-linked immunosorbent assay was further adapted to test secretory immunoglobulin A antibodies specific to capsular polysaccharide in nasopharynx secretions and in milk samples from lactating women. Antibodies were detected in 12 of 24 secretions and 9 of 11 milk samples. PMID:7019237

Macromolecular cross-linked enzyme aggregates (M-CLEAs) of α-amylase.

PubMed

Nadar, Shamraja S; Muley, Abhijeet B; Ladole, Mayur R; Joshi, Pranoti U

2016-03-01

Macromolecular cross-linked enzyme aggregates (M-CLEAs) of α-amylase were prepared by precipitation and subsequent cross-linking. The non-toxic, biodegradable, biocompatible, renewable polysaccharide based macromolecular cross-linkers viz. agar, chitosan, dextran, and gum arabic were used as a substitute for traditional glutaraldehyde to augment activity recovery toward macromolecular substrate. Macromolecular cross-linkers were prepared by periodate mediated controlled oxidation of polysaccharides. The effects of precipitating agent, concentration and different cross-linkers on activity recovery of α-amylase CLEAs were investigated. α-Amylase aggregated with ammonium sulphate and cross-linked by dextran showed 91% activity recovery, whereas glutaraldehyde CLEAs (G-CLEAs) exhibited 42% activity recovery. M-CLEAs exhibited higher thermal stability in correlation with α-amylase and G-CLEAs. Moreover, dextran and chitosan M-CLEAs showed same affinity for starch hydrolysis as of free α-amylase. The changes in secondary structures revealed the enhancements in structural and conformational rigidity attributed by cross-linkers. Finally, after five consecutive cycles dextran M-CLEAs retained 1.25 times higher initial activity than G-CLEAs. Copyright © 2015 Elsevier B.V. All rights reserved.

The effect of centaurein on interferon-{gamma} expression and Listeria infection in mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chang, S.-L.; Department of Biological Science and Technology, National Chiao Tung University, 1001, Ta Hsueh Road, Hsinchu 300, Taiwan; Yeh, H.-H.

2007-02-15

We previously found that centaurein enhanced IFN-{gamma} transcription in T cells. Here, we demonstrate that centaurein increased the IFN-{gamma} expression in T and NK cells and the serum IFN-{gamma} level in mice. Centaurein elevated the transcription of T-bet but not GATA-3, which is consistent with its effect on that of IFN-{gamma} but not IL-4. Additionally, centaurein effectively protected mice against Listeria infection. Moreover, centaurein per se or in combination with antibiotics could treat Listeria infection. Our mechanistic studies suggest that centaurein augments IFN-{gamma} expression via a transcriptional up-regulation of T-bet and that centaurein protects against or treats Listeria infection viamore » a modulation of IFN-{gamma} expression.« less

Enzyme-linked immunosorbent assay detection and bioactivity of Cry1Ab protein fragments

USDA-ARS?s Scientific Manuscript database

Enzyme-linked immunosorbent assay (ELISA) has emerged as the preferred detection method for Cry proteins in environmental matrices. Concerns exist that ELISAs are capable of detecting fragments of Cry proteins, which may lead to an over-estimation of the concentration of these proteins in the enviro...

Human Atopic Dermatitis Complicated by Eczema Herpeticum is Associated with Abnormalities in Gamma Interferon Response

PubMed Central

Leung, Donald YM; Gao, Pei-Song; Grigoryev, Dmitry N; Rafaels, Nicholas M; Streib, Joanne E; Howell, Michael D; Taylor, Patricia A; Boguniewicz, Mark; Canniff, Jennifer; Armstrong, Brian; Zaccaro, Daniel J; Schneider, Lynda C; Hata, Tissa R; Hanifin, Jon M; Beck, Lisa A; Weinberg, Adriana; Barnes, Kathleen C

2011-01-01

Background The basis for increased susceptibility of atopic dermatitis (AD) patients to develop disseminated viral skin infections such as eczema herpeticum (ADEH+) is poorly understood. Objective We sought to determine whether atopic dermatitis subjects prone to disseminated viral skin infections have defects in their interferon responses. Methods GeneChip profiling was used to identify differences in gene expression of peripheral blood mononuclear cells (PBMC) from patients with a history of ADEH+ as compared to ADEH− and non-atopic controls. Key differences in protein expression were verified by ELISPOT and/or ELISA. Clinical relevance was further demonstrated by a mouse model of disseminated viral skin infection and genetic association analysis for genetic variants in IFNG and IFNGR1 and ADEH among 435 cases and controls. Results We demonstrate by global gene expression analysis selective transcriptomic changes within the interferon (IFN) superfamily of PBMCs from ADEH+ subjects reflecting low IFNγ and IFNγ receptor gene expression. IFNγ protein production was also significantly lower in ADEH+ (N=24) compared to ADEH− (N=20) and non-atopic (NA; N=20) controls. IFNγ receptor knockout (KO) mice developed disseminated viral skin infection after epicutaneous challenge with vaccinia virus (VV). Genetic variants in IFNG and IFNGR1 SNPs were significantly associated with ADEH (112 cases, 166 controls) and IFNγ production: a 2-SNP (A–G) IFNGR1 haplotype (rs10457655 and rs7749390) showed the strongest association with a reduced risk of ADEH+ ((13.2% ADEH+ vs 25.5% ADEH−, P = 0.00057). Conclusions ADEH+ patients have reduced IFNγ production, and IFNG and IFNGR1 SNPs are significantly associated with ADEH+ and may contribute to an impaired immune response to herpes simplex virus (HSV). Clinical Implications Atopic dermatitis subjects prone to disseminated viral skin infections have defects in their interferon responses. Capsule summary Using genomic

[Effectiveness of interferon-gamma release assays in the tuberculosis contact investigation of elderly people].

PubMed

Seto, Junji; Ahiko, Tadayuki

2014-04-01

To confirm the effectiveness of interferon-gamma release assays (IGRAs) in the tuberculosis (TB) contact investigation of elderly people, we analyzed the results of the QuantiFERON TB Gold in tube (QFT-3G) test, which is a commercially available IGRA. We analyzed the results of the QFT-3G test in 2,420 subjects who were in close contact with TB patients. We investigated subjects with latent TB infection and those showing the onset of TB among the QFT-3G-positive subjects. The QFT-3G-positive rate was 7.3% (95% confidence interval, 6.2%-8.3%). In addition, we demonstrated that the QFT-3G-positive rate increased with age (P < 0.001). The QFT-3G-positive rate was high, particularly in elderly people (> or = 60 years), but the rate was significantly lower than the predicted prevalence of TB infection. Therefore, it was assumed that the QFT-3G test does not always provide a positive result, even in cases of subjects with a previous TB infection. Furthermore, data from the QFT-3G-positive subjects indicated that approximately one half of subjects aged 60-69 years, approximately one-third of those aged 70-79 years, and approximately one-quarter of those aged over 80 years have had recent TB infections. In conclusion, the results of the QFT-3G test in elderly people need to be carefully evaluated according to the contact situation with TB patients; nevertheless, the QFT-3G test is useful for the screening of latent TB infection in elderly people who were in close contact with TB patients.

Lion (Panthera leo) and cheetah (Acinonyx jubatus) IFN-gamma sequences.

PubMed

Maas, Miriam; Van Rhijn, Ildiko; Allsopp, Maria T E P; Rutten, Victor P M G

2010-04-15

Cloning and sequencing of the full length lion and cheetah interferon-gamma (IFN-gamma) transcript will enable the expression of the recombinant cytokine, to be used for production of monoclonal antibodies and to set up lion and cheetah-specific IFN-gamma ELISAs. These are relevant in blood-based diagnosis of bovine tuberculosis, an important threat to lions in the Kruger National Park. Alignment of nucleotide and amino acid sequences of lion and cheetah and that of domestic cats showed homologies of 97-100%. Copyright 2009 Elsevier B.V. All rights reserved.

Combined cross-linked enzyme aggregates of horseradish peroxidase and glucose oxidase for catalyzing cascade chemical reactions.

PubMed

Nguyen, Le Truc; Yang, Kun-Lin

2017-05-01

Cascade reactions involved unstable intermediates are often encountered in biological systems. In this study, we developed combined cross-linked enzyme aggregates (combi-CLEA) to catalyze a cascade reaction which involves unstable hydrogen peroxide as an intermediate. The combi-CLEA contains two enzymes̶ glucose oxidase (GOx) and horseradish peroxidase (HRP) which are cross-linked together as solid aggregates. The first enzyme GOx catalyzes the oxidation of glucose and produces hydrogen peroxide, which is used by the second enzyme HRP to oxidize 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS). The apparent reaction rate of the cascade reaction reaches 10.5±0.5μM/min when the enzyme ratio is 150:1 (GOx:HRP). Interestingly, even in the presence of catalase, an enzyme that quickly decomposes hydrogen peroxide, the reaction rate only decreases by 18.7% to 8.3±0.3μM/min. This result suggests that the intermediate hydrogen peroxide is not decomposed by catalase due to a short diffusion distance between GOx and HRP in the combi-CLEA. Scanning electron microscopy images suggest that combi-CLEA particles are hollow spheres and have an average diameter around 250nm. Because of their size, combi-CLEA particles can be entrapped inside a nylon membrane for detecting glucose by using the cascade reaction. Copyright © 2017 Elsevier Inc. All rights reserved.

AN ENZYME LINKED IMMUNOSORBENT ASSAY FOR THE HO-1 ISOFORM OF HEME OXYGENASE

EPA Science Inventory

AN ENZYME LINKED IMMUNOSORBENT ASSAY FOR THE HO-1 ISOFORM OF HEME OXYGENASE

Heme oxygenase (HO) occurs in biological tissues as two major isoforms HO-1 and HO-2. HO-1 is inducible by many treatments, particularly oxidative stress-related conditions such as depletion of gl...

Interferon modulation of c-myc expression in cloned Daudi cells: relationship to the phenotype of interferon resistance.

PubMed

Dron, M; Modjtahedi, N; Brison, O; Tovey, M G

1986-05-01

Treatment of interferon-sensitive Daudi cell with electrophoretically pure human interferon alpha markedly reduced the level of c-myc mRNA, increased the level of class I histocompatibility antigen (HLA) mRNA, and did not affect the level of actin mRNA within the same cells. In contrast, the level of c-myc mRNA or HLA mRNA did not change significantly following interferon treatment in different clones of Daudi cells selected for resistance to the antiproliferative action of interferon. These cells possessed interferon receptors, however, and responded to interferon modulation of other genes, including 2',5' oligoisoadenylate synthetase (M. G. Tovey, M. Dron, K. E. Mogensen, B. Lebleu, N. Metchi, and J. Begon-Lours, Guymarho, J. Gen. Virol., 64:2649-2653, 1983; M. Dron, M. G. Tovey, and P. Eid, J. Gen. Virol., 66:787-795, 1985). A clone of interferon-resistant Daudi cells which had reverted to almost complete sensitivity to both the antiproliferative action of interferon and the interferon-enhanced expression of HLA mRNA remained refractory, however, to interferon modulation of c-myc expression, suggesting that a reduced level of c-myc mRNA may not be a prerequisite for inhibition of cell proliferation in interferon-treated cells. Our results do not exclude the possibility, however, that posttranscriptional modification(s) of c-myc expression may precede an inhibition of cell proliferation in interferon-treated cells.

Revealing a Novel Otubain-like Enzyme from Leishmania infantum with Deubiquitinating Activity toward K48-linked Substrate

NASA Astrophysics Data System (ADS)

Azevedo, Clênia S.; Guido, Bruna C.; Pereira, Jhonata L.; Nolasco, Diego O.; Corrêa, Rafael; Magalhães, Kelly G.; Motta, Flávia N.; Santana, Jaime M.; Grellier, Philippe; Bastos, Izabela M. D.

2017-03-01

Deubiquitinating enzymes (DUBs) play an important role in regulating a variety of eukaryotic processes. In this context, exploring the role of deubiquitination in Leishmania infantum could be a promising alternative to search new therapeutic targets for leishmaniasis. Here we present the first characterization of a DUB from L. infantum, otubain (OtuLi), and its localization within parasite. The recombinant OtuLi (rOtuLi) showed improved activity on lysine 48 (K48)-linked over K63-linked tetra-ubiquitin (Ub) and site-directed mutations on amino acids close to the catalytic site (F82) or involved in Ub interaction (L265 and F182) caused structural changes as shown by molecular dynamics, resulting in a reduction or loss of enzyme activity, respectively. Furthermore, rOtuLi stimulates lipid droplet biogenesis (an inflammatory marker) in peritoneal macrophages and induces IL-6 and TNF-α secretion in peritoneal macrophages, both proinflammatory cytokines. Our findings suggest that OtuLi is a cytoplasmic enzyme with K48-linked substrate specificity that could play a part in proinflammatory response in stimulated murine macrophages.

Siglec-1 inhibits RSV-induced interferon gamma production by adult T cells in contrast to newborn T cells.

PubMed

Jans, Jop; Unger, Wendy W J; Vissers, Marloes; Ahout, Inge M L; Schreurs, Inge; Wickenhagen, Arthur; de Groot, Ronald; de Jonge, Marien I; Ferwerda, Gerben

2018-04-01

Interferon gamma (IFN-γ) plays an important role in the antiviral immune response during respiratory syncytial virus (RSV) infections. Monocytes and T cells are recruited to the site of RSV infection, but it is unclear whether cell-cell interactions between monocytes and T cells regulate IFN-γ production. In this study, micro-array data identified the upregulation of sialic acid-binding immunoglobulin-type lectin 1 (Siglec-1) in human RSV-infected infants. In vitro, RSV increased expression of Siglec-1 on healthy newborn and adult monocytes. RSV-induced Siglec-1 on monocytes inhibited IFN-γ production by adult CD4 + T cells. In contrast, IFN-γ production by RSV in newborns was not affected by Siglec-1. The ligand for Siglec-1, CD43, is highly expressed on adult CD4 + T cells compared to newborns. Our data show that Siglec-1 reduces IFN-γ release by adult T cells possibly by binding to the highly expressed CD43. The Siglec-1-dependent inhibition of IFN-γ in adults and the low expression of CD43 on newborn T cells provides a better understanding of the immune response against RSV in early life and adulthood. © 2017 The Authors. European Journal of Immunology published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Interferon-gamma improves impaired dentinogenic and immunosuppressive functions of irreversible pulpitis-derived human dental pulp stem cells

PubMed Central

Sonoda, Soichiro; Yamaza, Haruyoshi; Ma, Lan; Tanaka, Yosuke; Tomoda, Erika; Aijima, Reona; Nonaka, Kazuaki; Kukita, Toshio; Shi, Songtao; Nishimura, Fusanori; Yamaza, Takayoshi

2016-01-01

Clinically, irreversible pulpitis is treated by the complete removal of pulp tissue followed by replacement with artificial materials. There is considered to be a high potential for autologous transplantation of human dental pulp stem cells (DPSCs) in endodontic treatment. The usefulness of DPSCs isolated from healthy teeth is limited. However, DPSCs isolated from diseased teeth with irreversible pulpitis (IP-DPSCs) are considered to be suitable for dentin/pulp regeneration. In this study, we examined the stem cell potency of IP-DPSCs. In comparison with healthy DPSCs, IP-DPSCs expressed lower colony-forming capacity, population-doubling rate, cell proliferation, multipotency, in vivo dentin regeneration, and immunosuppressive activity, suggesting that intact IP-DPSCs may be inadequate for dentin/pulp regeneration. Therefore, we attempted to improve the impaired in vivo dentin regeneration and in vitro immunosuppressive functions of IP-DPSCs to enable dentin/pulp regeneration. Interferon gamma (IFN-γ) treatment enhanced in vivo dentin regeneration and in vitro T cell suppression of IP-DPSCs, whereas treatment with tumor necrosis factor alpha did not. Therefore, these findings suggest that IFN-γ may be a feasible modulator to improve the functions of impaired IP-DPSCs, suggesting that autologous transplantation of IFN-γ-accelerated IP-DPSCs might be a promising new therapeutic strategy for dentin/pulp tissue engineering in future endodontic treatment. PMID:26775677

Interferon modulation of c-myc expression in cloned Daudi cells: relationship to the phenotype of interferon resistance.

PubMed Central

Dron, M; Modjtahedi, N; Brison, O; Tovey, M G

1986-01-01

Treatment of interferon-sensitive Daudi cell with electrophoretically pure human interferon alpha markedly reduced the level of c-myc mRNA, increased the level of class I histocompatibility antigen (HLA) mRNA, and did not affect the level of actin mRNA within the same cells. In contrast, the level of c-myc mRNA or HLA mRNA did not change significantly following interferon treatment in different clones of Daudi cells selected for resistance to the antiproliferative action of interferon. These cells possessed interferon receptors, however, and responded to interferon modulation of other genes, including 2',5' oligoisoadenylate synthetase (M. G. Tovey, M. Dron, K. E. Mogensen, B. Lebleu, N. Metchi, and J. Begon-Lours, Guymarho, J. Gen. Virol., 64:2649-2653, 1983; M. Dron, M. G. Tovey, and P. Eid, J. Gen. Virol., 66:787-795, 1985). A clone of interferon-resistant Daudi cells which had reverted to almost complete sensitivity to both the antiproliferative action of interferon and the interferon-enhanced expression of HLA mRNA remained refractory, however, to interferon modulation of c-myc expression, suggesting that a reduced level of c-myc mRNA may not be a prerequisite for inhibition of cell proliferation in interferon-treated cells. Our results do not exclude the possibility, however, that posttranscriptional modification(s) of c-myc expression may precede an inhibition of cell proliferation in interferon-treated cells. Images PMID:3785169

Contradictory results in interferon research

NASA Technical Reports Server (NTRS)

Sonnenfeld, G.

1984-01-01

Several reports on immunologically related interferon research, both in the areas of basic science and clinical research, are briefly reviewed, and it is noted that in many cases the results obtained are contradictory. It is argued, however, that the contradictory results are not surprising since interferon is a biological response modifier and has been known to produce opposite results even when the same interferon prepartion is used. It is emphasized that dosage, timing, route, and other experimental conditions are essential factors in planning immunological studies with interferon. Careful planning of future experiments with interferon should be required to prevent the possible generation of effects that are opposite to those expected.

Comparison of five commercial anti-tetanus toxoid immunoglobulin G enzyme-linked immunosorbent assays.

PubMed

Perry, A L; Hayes, A J; Cox, H A; Alcock, F; Parker, A R

2009-12-01

Five commercially available enzyme-linked immunosorbent assays for the measurement of anti-tetanus toxoid immunoglobulin G (IgG) antibodies were evaluated for performance. The data suggest that there are manufacturer-dependent differences in sensitivity and accuracy for the determination of tetanus toxoid IgG antibodies that could result in different diagnostic interpretations.

Glycoprotein-Based Enzyme-Linked Immunosorbent Assays for Serodiagnosis of Infectious Laryngotracheitis

PubMed Central

Kanabagatte Basavarajappa, Mallikarjuna; Song, Haichen; Lamichhane, Chinta

2015-01-01

For detection of infectious laryngotracheitis virus (ILTV) antibody, glycoprotein B-, C-, and D-based enzyme-linked immunosorbent assays (B-, C-, and D-ELISAs, respectively) were developed. The B- and D-ELISAs showed enhanced detection of anti-ILTV antibodies in infected chickens compared to that of the commercial ELISA. Furthermore, the D-ELISA was efficient in detecting seroconversion with vectored vaccine, using recombinant Newcastle disease virus (rNDV) expressing glycoprotein D (gD) as the vaccine vector. PMID:25694519

Enzyme-linked electrochemical DNA ligation assay using magnetic beads.

PubMed

Stejskalová, Eva; Horáková, Petra; Vacek, Jan; Bowater, Richard P; Fojta, Miroslav

2014-07-01

DNA ligases are essential enzymes in all cells and have been proposed as targets for novel antibiotics. Efficient DNA ligase activity assays are thus required for applications in biomedical research. Here we present an enzyme-linked electrochemical assay based on two terminally tagged probes forming a nicked junction upon hybridization with a template DNA. Nicked DNA bearing a 5' biotin tag is immobilized on the surface of streptavidin-coated magnetic beads, and ligated product is detected via a 3' digoxigenin tag recognized by monoclonal antibody-alkaline phosphatase conjugate. Enzymatic conversion of napht-1-yl phosphate to napht-1-ol enables sensitive detection of the voltammetric signal on a pyrolytic graphite electrode. The technique was tested under optimal conditions and various situations limiting or precluding the ligation reaction (such as DNA substrates lacking 5'-phosphate or containing a base mismatch at the nick junction, or application of incompatible cofactor), and utilized for the analysis of the nick-joining activity of a range of recombinant Escherichia coli DNA ligase constructs. The novel technique provides a fast, versatile, specific, and sensitive electrochemical assay of DNA ligase activity.

A morphological screening of protein crystals for interferon delivery by metal ion-chelate technology.

PubMed

Jiang, Yanbo; Shi, Kai; Wang, Shuo; Li, Xuefeng; Cui, Fude

2010-12-01

This study presents a preliminary exploration on extending the half-life of therapeutic proteins by crystallization strategy without new molecular entities generation. Recombinant human interferon (rhIFN) α-2b, a model protein drug in this case, was crystallized using a hanging-drop vapor diffusion method. A novel chelating technique with metal ions was employed to promote crystals formation. The effects of key factors such as seeding protein concentration, pH of the hanging drop, ionic strength of the equilibration solution, and precipitants were investigated. Size-exclusion liquid chromatography, antiviral activity determination, and enzyme-linked immunosorbent assay indicated that both the molecular integrity and biological potency of rhIFN were not significantly affected by crystallization process. In addition, the in vitro release behavior of rhIFN from crystal lattice was characterized by an initial fast release, followed by a sustained release up to 48 hour. The work described here suggested an exciting possibility of therapeutic protein crystals as a long-acting formulation.

Interferon Alfa-2b Injection

MedlinePlus

Interferon alfa-2b injection is used to treat a number of conditions.Interferon alfa-2b injection is used alone or in combination ... lymphoma (NHL; a slow-growing blood cancer). Interferon alfa-2b is in a class of medications called ...

Pharmacokinetic and pharmacodynamic characterization of a new formulation containing synergistic proportions of interferons alpha-2b and gamma (HeberPAG®) in patients with mycosis fungoides: an open-label trial

PubMed Central

2012-01-01

Background The synergistic combination of interferon (IFN) alpha-2b and IFN gamma results in more potent in vitro biological effects mediated by both IFNs. The aim of this investigation was to evaluate by first time the pharmacokinetics and pharmacodynamics of this combination in patients with mycosis fungoides. Methods An exploratory, prospective, open-label clinical trial was conducted. Twelve patients, both genders, 18 to 75 years-old, with mycosis fungoides at stages IB to III, were eligible for the study. All of them received intramuscularly a single high dose (23 × 106 IU) of a novel synergistic IFN mixture (HeberPAG®) for pharmacokinetic and pharmacodynamic studies. Serum IFN alpha-2b and IFN gamma concentrations were measured during 96 hours by commercial enzyme immunoassays (EIA) specific for each IFN. Other blood IFN-inducible markers and laboratory variables were used as pharmacodynamics and safety criteria. Results The pharmacokinetic evaluation by EIA yielded a similar pattern for both IFNs that are also in agreement with the well-known described profiles for these molecules when these are administered separately. The average values for main parameters were: Cmax: 263 and 9.3 pg/mL; Tmax: 9.5 and 6.9 h; AUC: 4483 and 87.5 pg.h/mL, half-life (t1/2): 4.9 and 13.4 h; mean residence time (MRT): 13.9 and 13.5 h, for serum IFN alpha-2b and IFN gamma, respectively. The pharmacodynamic variables were strongly stimulated by simultaneous administration of both IFNs: serum neopterin and beta-2 microglobulin levels (β2M), and stimulation of 2’-5’ oligoadenylate synthetase (OAS1) mRNA expression. The most encouraging data was the high increment of serum neopterin, 8.0 ng/mL at 48 h, not been described before for any unmodified or pegylated IFN. Additionally, β2M concentration doubled the pre-dose value at 24–48 hours. For both variables the values remained clearly upper baseline levels at 96 hours. Conclusions HeberPAG®possesses improved

Myeloid interferon-γ receptor deficiency does not affect atherosclerosis in LDLR(-/-) mice.

PubMed

Boshuizen, Marieke C S; Neele, Annette E; Gijbels, Marion J J; van der Velden, Saskia; Hoeksema, Marten A; Forman, Ruth A; Muller, Werner; Van den Bossche, Jan; de Winther, Menno P J

2016-03-01

Atherosclerosis is a chronic lipid-driven inflammatory disease of the arterial wall. Interferon gamma (IFNγ) is an important immunomodulatory cytokine and a known pro-atherosclerotic mediator. However, cell-specific targeting of IFNγ or its signaling in atherosclerosis development has not been studied yet. As macrophages are important IFNγ targets, we here addressed the involvement of myeloid IFNγ signaling in murine atherosclerosis. Bone marrow was isolated from interferon gamma receptor 2 chain (IFNγR2) wildtype and myeloid IFNγR2 deficient mice and injected into lethally irradiated LDLR(-/-) mice. After recovery mice were put on a high fat diet for 10 weeks after which atherosclerotic lesion analysis was performed. In addition, the accompanying liver inflammation was assessed. Even though absence of myeloid IFNγ signaling attenuated the myeloid IFNγ response, no significant differences in atherosclerotic lesion size or phenotype were found. Also, when examining the liver inflammatory state no effects of IFNγR2 deficiency could be observed. Overall, our data argue against a role for myeloid IFNγR2 in atherosclerosis development. Since myeloid IFNγ signaling seems to be nonessential throughout atherogenesis, it is important to understand the mechanisms by which IFNγ acts in atherogenesis. In the future new studies should be performed considering other cell-specific targets. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Mutation in rod PDE6 linked to congenital stationary night blindness impairs the enzyme inhibition by its gamma-subunit.

PubMed

Muradov, Khakim G; Granovsky, Alexey E; Artemyev, Nikolai O

2003-03-25

Photoreceptor cGMP phosphodiesterase (PDE6) is the effector enzyme in the vertebrate visual transduction cascade. The activity of rod PDE6 catalytic alpha- and beta-subunits is blocked in the dark by two inhibitory Pgamma-subunits. The inhibition is released upon light-stimulation of photoreceptor cells. Mutation H258N in PDE6beta has been linked to congenital stationary night blindness (CSNB) in a large Danish family (Rambusch pedigree) (Gal, A., Orth, U., Baehr, W., Schwinger, E., and Rosenberg, T. (1994) Nat. Genet. 7, 64-67.) We have analyzed the consequences of this mutation for PDE6 function using a Pgamma-sensitive PDE6alpha'/PDE5 chimera, Chi16. Biochemical analysis of the H257N mutant, an equivalent of PDE6betaH258N, demonstrates that this substitution does not alter the ability of chimeric PDE to dimerize or the enzyme's catalytic properties. The sensitivity of H257N to a competitive inhibitor zaprinast was also unaffected. However, the mutant displayed a significant impairment in the inhibitory interaction with Pgamma, which was apparent from a approximately 20-fold increase in the K(i) value (46 nM) and incomplete maximal inhibition. The inhibitory defect of H257N is not due to perturbation of noncatalytic cGMP binding to the PDE6alpha' GAF domains. The noncatalytic cGMP-binding characteristics of the H257N mutant were similar to those of the parent PDE6alpha'/PDE5 chimera. Since rod PDE6 in the Rambusch CSNB is a catalytic heterodimer of the wild-type PDE6alpha and mutant PDE6beta, Chi16 and H257N were coexpressed, and a heterodimeric PDE, Chi16/H257N, was isolated. It displayed two Pgamma inhibitory sites with the K(i) values of 5 and 57 nM. Our results support the hypothesis that mutation H258N in PDE6beta causes CSNB through incomplete inhibition of PDE6 activity by Pgamma, which leads to desensitization of rod photoreceptors.

Enzyme-Linked Immunofiltration Assay To Estimate Attachment of Thiobacilli to Pyrite

PubMed Central

Dziurla, Marie-Antoinette; Achouak, Wafa; Lam, Bach-Tuyet; Heulin, Thierry; Berthelin, Jacques

1998-01-01

An enzyme-linked immunofiltration assay (ELIFA) has been developed in order to estimate directly and specifically Thiobacillus ferrooxidans attachment on sulfide minerals. This method derives from the enzyme-linked immunosorbent assay but is performed on filtration membranes which allow the retention of mineral particles for a subsequent immunoenzymatic reaction in microtiter plates. The polyclonal antiserum used in this study was raised against T. ferrooxidans DSM 583 and recognized cell surface antigens present on bacteria belonging to the genus Thiobacillus. This antiserum and the ELIFA allowed the direct quantification of attached bacteria with high sensitivity (104 bacteria were detected per well of the microtiter plate). The mean value of bacterial attachment has been estimated to be about 105 bacteria mg−1 of pyrite at a particle size of 56 to 65 μm. The geometric coverage ratio of pyrite by T. ferrooxidans ranged from 0.25 to 2.25%. This suggests an attachment of T. ferrooxidans on the pyrite surface to well-defined limited sites with specific electrochemical or surface properties. ELIFA was shown to be compatible with the measurement of variable levels of adhesion. Therefore, this method may be used to establish adhesion isotherms of T. ferrooxidans on various sulfide minerals exhibiting different physicochemical properties in order to understand the mechanisms of bacterial interaction with mineral surfaces. PMID:9687454

Pre-immune state induced by chicken interferon gamma inhibits the replication of H1N1 human and H9N2 avian influenza viruses in chicken embryo fibroblasts.

PubMed

Yuk, Seong-Su; Lee, Dong-Hun; Park, Jae-Keun; Tseren-Ochir, Erdene-Ochir; Kwon, Jung-Hoon; Noh, Jin-Yong; Lee, Joong-Bok; Park, Seung-Yong; Choi, In-Soo; Song, Chang-Seon

2016-04-27

Interferon gamma (IFN-γ), an immunoregulatory cytokine, is known to control many microbial infections. In a previous study, chicken interferon gamma (chIFN-γ) was found to be up-regulated following avian influenza virus (AIV) infection in specific pathogen-free chickens. We aimed to investigate whether the pre-immune state induced by chIFN-γ could generate an antiviral response against influenza virus. We generated a chIFN-γ-expressing plasmid and transfected it into chicken embryo fibroblasts (CEFs) and then infected the cells with human origin H1N1 or avian origin H9N2 influenza viruses. Viral titers of culture medium were evaluated in MDCK cell and the viral RNA and IFN-stimulated genes (ISGs) were then quantified by real-time reverse transcriptase polymerase. To further evaluate the role of the antiviral effect of chIFN-γ by using a backward approach, synthetic small interfering RNAs (siRNA) targeting chIFN-γ were used to suppress chIFN-γ. The chIFN-γ-stimulated CEFs inhibited the replication of viral RNA (vRNA) and showed a mild decrease in the infectious virus load released in the culture medium. Compared to the mock-transfected control, the messenger RNA (mRNA) levels of type I IFNs and IFN-stimulated genes were up-regulated in the cells expressing chIFN-γ. After treatment with the siRNA, we detected a higher expression of viral genes than that observed in the mock-transfected control. Our results suggest that apart from the important role played by chIFN-γ in the antiviral state generated against influenza virus infection, the pre-immune state induced by chIFN-γ can be helpful in mitigating the propagation of influenza virus.

Frequency of indeterminate results from an interferon-gamma release assay among HIV-infected individuals

PubMed Central

de Oliveira, Sandra Maria do Valle Leone; Trajman, Anete; Paniago, Anamaria Mello Miranda; Motta-Castro, Ana Rita Coimbra; Ruffino-Netto, Antonio; Maciel, Ethel Leonor Noia; Croda, Julio; Bonecini-Almeida, Maria da Gloria

2017-01-01

ABSTRACT Objective: To evaluate the frequency of and factors associated with indeterminate interferon-gamma release assay (IGRA) results in people living with HIV/AIDS (PLWHA). Methods: We tested 81 PLWHA in the central-west region of Brazil, using the tuberculin skin test and an IGRA. Information on sociodemographic and clinical variables was gathered through the use of questionnaires and from medical records. The association of those variables with indeterminate results was analyzed by calculating the adjusted ORs in a multivariate logistic regression model. Concordance was evaluated by determining the kappa statistic. Results: Among the 81 patients evaluated, the tuberculin skin test results were positive in 18 (22.2%) of the patients, and the IGRA results were positive in 10 (12.3%), with a kappa of 0.62. The IGRA results were indeterminate in 22 (27.1%) of the patients (95% CI: 17.8-38.1%). The odds of obtaining indeterminate results were significantly higher in smokers (adjusted OR = 6.0; 95% CI: 1.4-26.7) and in samples stored for less than 35 days (adjusted OR = 14.0; 95% CI: 3.1-64.2). Patients with advanced immunosuppression (CD4+ T-cell count < 200 cells/mm3) were at a higher risk for indeterminate results (OR adjusted for smoking and inadequate duration of sample storage = 4.7; 95% CI: 0.91-24.0), although the difference was not significant. Conclusions: The high prevalence of indeterminate results can be a major limitation for the routine use of IGRAs in PLWHA. The need to repeat the test increases its costs and should be taken into account in cost-effectiveness studies. The processing of samples can significantly alter the results. PMID:28746533

Molecular characterization and development of Sarcocystis speeri sarcocysts in gamma interferon gene knockout mice.

PubMed

Dubey, J P; Verma, S K; Dunams, D; Calero-Bernal, R; Rosenthal, B M

2015-11-01

The North American opossum (Didelphis virginiana) is the definitive host for at least three named species of Sarcocystis: Sarcocystis falcatula, Sarcocystis neurona and Sarcocystis speeri. The South American opossums (Didelphis albiventris, Didelphis marsupialis and Didelphis aurita) are definitive hosts for S. falcatula and S. lindsayi. The sporocysts of these Sarcocystis species are similar morphologically. They are also not easily distinguished genetically because of the difficulties of DNA extraction from sporocysts and availability of distinguishing genetic markers. Some of these species can be distinguished by bioassay; S. neurona and S. speeri are infective to gamma interferon gene knockout (KO) mice, but not to budgerigars (Melopsittacus undulatus); whereas S. falcatula and S. lindsayi are infective to budgerigars but not to KO mice. The natural intermediate host of S. speeri is unknown. In the present study, development of sarcocysts of S. speeri in the KO mice is described. Sarcocysts were first seen at 12 days post-inoculation (p.i.), and they became macroscopic (up to 4 mm long) by 25 days p.i. The structure of the sarcocyst wall did not change from the time bradyzoites had formed at 50-220 days p.i. Sarcocysts contained unique villar protrusions, 'type 38'. The polymerase chain reaction amplifications and sequences analysis of three nuclear loci (18S rRNA, 28S rRNA and ITS1) and two mitochondrial loci (cox1 and cytb) of S. speeri isolate from an Argentinean opossum (D. albiventris) confirmed its membership among species of Sarcocystis and indicated an especially close relationship to another parasite in this genus that employs opossums as its definitive host, S. neurona. These results should be useful in finding natural intermediate host of S. speeri.

The Jak-STAT pathway stimulated by interferon alpha or interferon beta.

PubMed

Horvath, Curt M

2004-11-23

Type I interferons, such as interferon alpha and interferon beta (IFN-alpha and beta), signal through a Janus kinase (Jak) to signal transduction and activator of transcription (STAT) pathway to stimulate gene expression. In response to ligand binding, the receptors dimerize, Jaks phosphorylate STAT1 and STAT2, which then dimerize and interact with a third transcriptional regulator IFN regulatory factor 9 (IRF9) to stimulate gene expression. IFN-alpha is the main innate antiviral cytokine and is essential for effective immune response to viral infection. The animation shows activation of STAT-responsive gene expression in response to type I IFNs.

Increased Interleukin-4 production by CD8 and gammadelta T cells in health-care workers is associated with the subsequent development of active tuberculosis.

PubMed

Ordway, Diane J; Costa, Leonor; Martins, Marta; Silveira, Henrique; Amaral, Leonard; Arroz, Maria J; Ventura, Fernando A; Dockrell, Hazel M

2004-08-15

We evaluated immune responses to Mycobacterium tuberculosis in 10 health-care workers (HCWs) and 10 non-HCWs and correlated their immune status with the development of active tuberculosis (TB). Twenty individuals were randomly recruited, tested, and monitored longitudinally for TB presentation. Peripheral blood mononuclear cells (PBMCs) from donors were stimulated with M. tuberculosis and tested for cell proliferation and the production of interferon (IFN)- gamma, interleukin (IL)-5, and IL-4, by use of enzyme-linked immunosorbent or flow-cytometric assays. HCWs had higher levels of cell proliferation (24,258 cpm) and IFN- gamma (6373 pg/mL) to M. tuberculosis than did non-HCWs (cell proliferation, 11,462 cpm; IFN- gamma, 3228 pg/mL). Six of 10 HCWs showed increased median percentages of CD8+IL-4+ (4.7%) and gammadelta +IL-4+ (2.3%) T cells and progressed to active TB. HCWs who remained healthy showed increased median percentages of CD8+IFN- gamma+ (25.0%) and gammadelta +IFN- gamma+ (8.0%) and lower percentages of CD8+IL-4+ (0.05%) and gammadelta +IL-4+ (0.03%) T cells.

Vaccination with dendritic cells pulsed with hepatitis C pseudo particles induces specific immune responses in mice

PubMed Central

Weigand, Kilian; Voigt, Franziska; Encke, Jens; Hoyler, Birgit; Stremmel, Wolfgang; Eisenbach, Christoph

2012-01-01

AIM: To explore dendritic cells (DCs) multiple functions in immune modulation. METHODS: We used bone-marrow derived dendritic cells from BALB/c mice pulsed with pseudo particles from the hepatitis C virus to vaccinate naive BALB/c mice. Hepatitis C virus (HCV) pseudo particles consist of the genotype 1b derived envelope proteins E1 and E2, covering a non-HCV core structure. Thus, not a single epitope, but the whole “viral surface” induces immunogenicity. For vaccination, mature and activated DC were injected subcutaneously twice. RESULTS: Humoral and cellular immune responses measured by enzyme-linked immunosorbent assay and interferon-gamma enzyme-linked immunosorbent spot test showed antibody production as well as T-cells directed against HCV. Furthermore, T-cell responses confirmed two highly immunogenic regions in E1 and E2 outside the hypervariable region 1. CONCLUSION: Our results indicate dendritic cells as a promising vaccination model for HCV infection that should be evaluated further. PMID:22371638

Induction of gamma delta T cells using zoledronate plus interleukin-2 in patients with metastatic cancer.

PubMed

Nagamine, Ichiro; Yamaguchi, Yoshiyuki; Ohara, Masahiro; Ikeda, Takuhiro; Okada, Morihito

2009-03-01

A loss of human leukocyte antigen (HLA) expression in clinical tumors is one of their escape mechanisms from immune attack by HLA-restricted effector cells. In this study, the induction of HLA-unrestricted effector cells, gamma delta T cells, using zoledronate (ZOL) and interleukin (IL)-2 in vitro was investigated in patients with metastatic cancer. Peripheral blood mononuclear cells (PBMCs) from 10 cancer patients (8 colorectal and 2 esophageal) with multiple metastases and ascites lymphocytes from 3 cancer patients (1 gastric and 2 colorectal) were stimulated with varied concentrations of ZOL plus 100 U/ml IL-2 for 48 hr followed by culturing with IL-2 alone for 12 days. Lymphocyte proliferative responses were determined using 3H-TdR uptakes and interferon (IFN)-gamma production was evaluated using enzyme-linked immunosorbent assay. Surface phenotyping was performed using flow cytometry. Cytotoxic activity of effector cells was determined using 51Cr-releasing assay. It was found that proliferative responses of PBMCs were significantly stimulated with ZOL plus IL-2 when compared with IL-2 alone, showing 200 to 500-fold expansions for 2 weeks, although ZOL alone induced no response. The optimal concentration of ZOL was 1-5 microM. Ascites lymphocytes could also be stimulated with ZOL plus IL-2. The proliferative responses were remarkable in patients whose PBMCs could produce high levels of IFN-gamma during an initial 48-hr stimulation using ZOL plus IL-2. Removal of an adherent cell fraction before the induction augmented the proliferative responses in patients who otherwise had low-grade proliferative responses. Generated cells comprising approximately 90 or 20% in PBMCs from healthy donors or cancer patients, respectively, expressed gamma delta-type T-cell receptor. Gamma delta T cells showed high cytotoxic activity against CD166-positive TE12 and TE13 cancer cells but not against CD166-negative MKN45 cells. The cytotoxic activity against TE13 cells was augmented

Smartphone instrument for portable enzyme-linked immunosorbent assays

PubMed Central

Long, Kenneth D.; Yu, Hojeong; Cunningham, Brian T.

2014-01-01

We demonstrate the utilization of a smartphone camera as a spectrometer that is capable of measuring Enzyme Linked Immunosorbent Assays (ELISA) at biologically-relevant concentrations with the aid of a custom cradle that aligns a diffraction grating and a collimating lens between a light source and the imaging sensor. Two example biomarkers are assayed using conventional ELISA protocols: IL-6, a protein used diagnostically for several types of cancer, and Ara h 1, one of the principle peanut allergens. In addition to the demonstration of limits of detection at medically-relevant concentrations, a screening of various cookies was completed to measure levels of peanut cross-contamination in local bakeries. The results demonstrate the utility of the instrument for quantitatively performing broad classes of homogeneous colorimetric assays, in which the endpoint readout is the color change of a liquid sample. PMID:25426311

Cerebrospinal fluid interferon-gamma-inducible protein 10 (IP-10, CXCL10) in HIV-1 infection.

PubMed

Cinque, Paola; Bestetti, Arabella; Marenzi, Roberta; Sala, Serena; Gisslen, Magnus; Hagberg, Lars; Price, Richard W

2005-11-01

Interferon-gamma-inducible protein (IP-10 or CXCL10) is a potent chemoattractant and has been suggested to enhance retrovirus infection and mediate neuronal injury. In order to assess this chemokine in central nervous system (CNS) HIV infection, we measured the cerebrospinal fluid (CSF) and plasma concentrations of CXCL10 by immunoassay in samples derived from 97 HIV-infected subjects across a spectrum of immunological progression and CNS complications and from 16 HIV seronegative control subjects studied at three clinical centers between 1994 and 2001. We also examined changes in the CSF and plasma CXCL10 concentrations in 30 subjects starting and three stopping antiretroviral therapy. CSF CXCL10 concentrations: (1) correlated with CSF HIV RNA and white blood cell (WBC) counts, but not with blood CXCL10, HIV RNA, or CD4 counts; (2) were increased in subjects with primary and asymptomatic HIV infections and AIDS dementia complex, but less frequently in those with more advanced infection, with or without CNS opportunistic diseases except cytomegalovirus encephalitis; (3) decreased in subjects starting antiretroviral in association with decreases in CSF and plasma HIV RNA and CSF WBCs; and (4) conversely, increased in subjects stopping treatment in parallel with CSF HIV RNA and WBCs. These results confirm that CSF CXCL10 associates closely with both CSF HIV and WBCs and suggest that this chemokine may be both a response to and contributing determinant of local infection. High CSF levels may be useful in the diagnosis of ADC in subjects with advanced immunosuppression in whom CMV encephalitis has been ruled out, though this issue requires further study.

Biological Monitoring of 3-Phenoxybenzoic Acid in Urine by an Enzyme -Linked Immunosorbent Assay

EPA Science Inventory

An enzyme-linked immunosorbent assay (ELISA) method was employed for determination of the pyrethroid biomarker, 3-phenoxybenzoic acid (3-PBA) in human urine samples. The optimized coating antigen concentration was 0.5 ng/mL with a dilution of 1:4000 for the 3-PBA antibody and 1:6...

OTUB1 Co-opts Lys48-Linked Ubiquitin Recognition to Suppress E2 Enzyme Function

DOE Office of Scientific and Technical Information (OSTI.GOV)

Juang, Yu-Chi; Landry, Marie-Claude; Sanches, Mario

2012-03-26

Ubiquitylation entails the concerted action of E1, E2, and E3 enzymes. We recently reported that OTUB1, a deubiquitylase, inhibits the DNA damage response independently of its isopeptidase activity. OTUB1 does so by blocking ubiquitin transfer by UBC13, the cognate E2 enzyme for RNF168. OTUB1 also inhibits E2s of the UBE2D and UBE2E families. Here we elucidate the structural mechanism by which OTUB1 binds E2s to inhibit ubiquitin transfer. OTUB1 recognizes ubiquitin-charged E2s through contacts with both donor ubiquitin and the E2 enzyme. Surprisingly, free ubiquitin associates with the canonical distal ubiquitin-binding site on OTUB1 to promote formation of the inhibitedmore » E2 complex. Lys48 of donor ubiquitin lies near the OTUB1 catalytic site and the C terminus of free ubiquitin, a configuration that mimics the products of Lys48-linked ubiquitin chain cleavage. OTUB1 therefore co-opts Lys48-linked ubiquitin chain recognition to suppress ubiquitin conjugation and the DNA damage response.« less

Effects of interferon on antibody formation

NASA Technical Reports Server (NTRS)

Sonnenfeld, G.

1984-01-01

Studies of the effects of interferon on primary and secondary antibody responses and of the relationship of interferon to other cytokines, or cell products, are presented. Dosage- and timing-dependent immunoenhancing and immunosuppressive activities of interferon are documented for mouse spleen cell cultures and for mice infected with murine hepatitis virus (MHV-3). A possibility that altered interferon production might lead to immunopathological disorders, such as lupus erythematosus, AIDS, arthritis, etc., is discussed. Latest technological developments are presented that indicate that interferon does apparently play a major role in the regulation of antibody responses.

Interferon-gamma receptor-deficiency renders mice highly susceptible to toxoplasmosis by decreased macrophage activation.

PubMed

Deckert-Schlüter, M; Rang, A; Weiner, D; Huang, S; Wiestler, O D; Hof, H; Schlüter, D

1996-12-01

Toxoplasma gondii may cause severe infections in immunocompromised patients including fetuses and those with AIDS. Among the factors mediating protection against T. gondii, IFN-gamma has gained special attention. To analyze the role of IFN-gamma in the early phase of toxoplasmosis, IFN-gamma receptor-deficient (IFN-gamma R0/0) mice were orally infected with low-virulent toxoplasms. IFN-gamma R0/0 mice died of the disease up to day 10 postinfection, whereas immunocompetent wild-type (WT) mice developed a chronic toxoplasmosis. Histopathology revealed that in IFN-gamma R0/0 mice, the parasite multiplied unrestrictedly in the small intestine, the intestinal lymphatic tissue, the liver, and the spleen. Ultimately, animals died of a necrotizing hepatitis. In WT mice, the same organs were effected, but multiplication of the parasite was effectively limited. Compared with WT mice, immunohistochemistry and flow cytometry demonstrated that in IFN-gamma R0/0 mice, macrophages were only marginally activated in response to the infection, as evidenced by a reduced expression of major histocompatability complex class II antigens. In addition, immunohistochemistry and RT-PCR showed a reduced production of the macrophage-derived cytokines tumor necrosis factor-alpha, inducible nitric oxide synthase, and IL-1 beta in the liver of IFN-gamma R0/0 mice. In contrast, activation of T cells, recruitment of immune cells to inflammatory foci, and anti-T. gondii IgM antibody production were unaffected by the mutation of the IFN-gamma R. Moreover, induction of IL-2, IL-4, and IL-10 mRNA transcripts in the liver was normal in IFN-gamma R0/0 mice. Adoptive transfer experiments revealed that the immune T cells of WT animals did not protect IFN-gamma R0/0 mice from lethal infection with highly virulent toxoplasms, whereas WT mice were significantly protected by the adoptive transfer. Based on these studies, we conclude that IFN-gamma is absolutely required for an efficient activation of

Glycoprotein-based enzyme-linked immunosorbent assays for serodiagnosis of infectious laryngotracheitis.

PubMed

Kanabagatte Basavarajappa, Mallikarjuna; Song, Haichen; Lamichhane, Chinta; Samal, Siba K

2015-05-01

For detection of infectious laryngotracheitis virus (ILTV) antibody, glycoprotein B-, C-, and D-based enzyme-linked immunosorbent assays (B-, C-, and D-ELISAs, respectively) were developed. The B- and D-ELISAs showed enhanced detection of anti-ILTV antibodies in infected chickens compared to that of the commercial ELISA. Furthermore, the D-ELISA was efficient in detecting seroconversion with vectored vaccine, using recombinant Newcastle disease virus (rNDV) expressing glycoprotein D (gD) as the vaccine vector. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

HLA-DRB1 and HLA-DQB1 Are Associated with Adult-Onset Immunodeficiency with Acquired Anti-Interferon-Gamma Autoantibodies

PubMed Central

Pithukpakorn, Manop; Roothumnong, Ekkapong; Angkasekwinai, Nasikarn; Suktitipat, Bhoom; Assawamakin, Anunchai; Luangwedchakarn, Voravich; Umrod, Pinklow; Thongnoppakhun, Wanna; Foongladda, Suporn; Suputtamongkol, Yupin

2015-01-01

Recently a newly identified clinical syndrome of disseminated non-tuberculous mycobacterial diseases (with or without other opportunistic infections in adult patients who were previously healthy, has been recognized in association with an acquired autoantibody to interferon-gamma. This syndrome is emerging as an important cause of morbidity and mortality, especially among people of Asian descent. Trigger for the production of this autoantibody remains unknown, but genetic factors are strongly suspected to be involved. We compared HLA genotyping between 32 patients with this clinical syndrome, and 38 controls. We found that this clinical syndrome was associated with very limited allele polymorphism, with HLA-DRB1 and DQB1 alleles, especially HLA-DRB1*15:01, DRB1*16:02, DQB1*05:01 and DQB1*05:02. Odds ratio of DRB1*15:01, DRB1*16:02, DQB1*05:01 and DQB1*05:02 were 7.03 (95% CI, 2.18–22.69, P<0.0001, 9.06 (95% CI, 2.79–29.46, P<0.0001), 6.68 (95% CI, 2.29–19.52, P = 0.0004), and 6.64 (95% CI, 2.30–19.20, P = 0.0004), respectively. Further investigation is warranted to provide better understanding on pathogenesis of this association. PMID:26011559

Mink parvoviruses and interferons: in vitro studies.

PubMed Central

Wiedbrauk, D L; Bloom, M E; Lodmell, D L

1986-01-01

Although interferons can inhibit the replication of a number of viruses, little is known about their ability to inhibit parvovirus replication. Therefore, in vitro experiments were done to determine if Aleutian disease virus and mink enteritis virus, two autonomously replicating mink parvoviruses, induced interferon, were sensitive to the effects of interferon, or inhibited the production of interferon. The results indicated that these parvoviruses neither induced nor were sensitive to the effects of interferon. Furthermore, preexisting parvovirus infections did not inhibit poly(I).poly(C)-induced interferon production. This independence from the interferon system may, therefore, be a general property of the autonomously replicating parvoviruses. PMID:2431162

Secretion of interferon gamma from human immune cells is altered by exposure to tributyltin and dibutyltin.

PubMed

Lawrence, Shanieek; Reid, Jacqueline; Whalen, Margaret

2015-05-01

Tributyltin (TBT) and dibutyltin (DBT) are widespread environmental contaminants found in food, beverages, and human blood samples. Both of these butyltins (BTs) interfere with the ability of human natural killer (NK) cells to lyse target cells and alter secretion of the pro-inflammatory cytokine tumor necrosis factor alpha (TNFα) from human immune cells in vitro. The capacity of BTs to interfere with secretion of other pro-inflammatory cytokines has not been examined. Interferon gamma (IFNγ) is a modulator of adaptive and innate immune responses, playing an important role in overall immune competence. This study shows that both TBT and DBT alter secretion of IFNγ from human immune cells. Peripheral blood cell preparations that were increasingly reconstituted were used to determine if exposures to either TBT or DBT affected IFNγ secretion and how the makeup of the cell preparation influenced that effect. IFNγ secretion was examined after 24 h, 48 h, and 6 day exposures to TBT (200 - 2.5 nM) and DBT (5 - 0.05 µM) in highly enriched human NK cells, a monocyte-depleted preparation of PBMCs, and monocyte-containing PBMCs. Both BTs altered IFNγ secretion from immune cells at most of the conditions tested (either increasing or decreasing secretion). However, there was significant variability among donors as to the concentrations and time points that showed changes as well as the baseline secretion of IFNγ. The majority of donors showed an increase in IFNγ secretion in response to at least one concentration of TBT or DBT at a minimum of one length of exposure. © 2013 Wiley Periodicals, Inc.

Effects of non-starch polysaccharides enzymes on pancreatic and small intestinal digestive enzyme activities in piglet fed diets containing high amounts of barley.

PubMed

Li, Wei-Fen; Feng, Jie; Xu, Zi-Rong; Yang, Cai-Mei

2004-03-15

To investigate effects of non-starch polysaccharides(NSP) enzymes on pancreatic and small intestinal digestive enzyme activities in piglet fed diets containing high amounts of barley. Sixty crossbred piglets averaging 13.5 kg were randomly assigned to two treatment groups with three replications (pens) based on sex and mass. Each group was fed on the diet based on barley with or without added NSP enzymes (0.15%) for a 40-d period. At the end of the experiment the pigs were weighed. Three piglets of each group were chosen and slaughtered. Pancreas, digesta from the distal end of the duodenum and jejunal mucosa were collected for determination. Activities of the digestive enzymes trypsin, chymotrypsin, amylase and lipase were determined in the small intestinal sections as well as in homogenates of pancreatic tissue. Maltase, sucrase, lactase and gamma-glutamyl transpeptidase (gamma-GT) activities were analyzed in jejunal mucosa. Supplementation with NSP enzymes improved growth performance of piglets. It showed that NSP enzymes had no effect on digestive enzyme activities in pancreas, but decreased the activities of proteolytic enzyme, trypsin, amylase and lipase in duodenal contents by 57.56%, 76.08%, 69.03% and 40.22%(P<0.05) compared with control, and increased gamma-GT activities in jejunal mucosa by 118.75%(P<0.05). Supplementation with NSP enzymes in barley based diets could improve piglets' growth performance, decrease activities of proteolytic enzyme, trypsin, amylase and lipase in duodenal contents and increase gamma-GT activities in jejunal mucosa.

The interferons.

PubMed Central

Toy, J L

1983-01-01

An overview of the interferons is presented. A description of something of what is known about them is given, including: their genes; their protein structures and characteristics; their mechanisms of actions; and their varied biological effects emphasising particularly their immunomodulatory actions. Finally, a brief summary is made of the current status of human clinical studies that have been conducted with interferons in the oncological and viral fields, mentioning also recent findings in patients who have the acquired immunodeficiency syndrome (AIDS). PMID:6193915

Changes in serum hepatitis C virus RNA in interferon nonresponders retreated with interferon plus ribavirin: a preliminary report.

PubMed

Nyberg, L; Albrecht, J; Glue, P; Gianelli, G; Zambas, D; Elliot, M; Conrad, A; McHutchison, J

1999-06-01

Ribavirin, a nucleoside analogue, inhibits replication of RNA and DNA viruses and may control hepatitis C virus (HCV) infection through modulation of anti-inflammatory and antiviral actions. Ribavirin monotherapy has no effect on serum HCV RNA levels. In combination with interferon, this agent appears to enhance the efficacy of interferon. The aim of this study was to monitor serum HCV RNA levels early during therapy with interferon and ribavirin compared with that previously seen in the same patients during interferon monotherapy. Five patients who previously showed no response to therapy with interferon alfa 3 MU three times weekly for 6 months were retreated with the identical dose of interferon alfa 2b in combination with oral ribavirin 1,000 mg/day. Serum HCV RNA levels were monitored at baseline, week 4, week 8, and week 12 of therapy by a quantitative multicycle polymerase chain reaction assay. In the first 8 to 12 weeks, serum HCV RNA levels showed a greater decrease in all patients when retreated with combination therapy compared with interferon alone. Mean (+/- SEM) serum HCV RNA levels for interferon therapy alone were 3.3 +/- 0.95, 1.2 +/- 0.95, 1.6 +/- 1.2, and 2.3 +/- 1.2 x 10(6) copies/ml at week 0, 4, 8, and 12, respectively. This was compared with 3.3 +/- 0.83, 0.3 +/- 0.2, 0.03 +/- 0.02, and 0.15 +/- 0.14 x 10(6), respectively, for the interferon and ribavirin group (p < 0.07 at week 8). Two of five patients had undetectable serum HCV RNA during combination therapy. Combination therapy with interferon and ribavirin in prior interferon nonresponders reduces serum HCV RNA levels compared with interferon alone. This may suggest some additional antiviral effect of ribavirin when given with interferon.

Private sector tuberculosis prevention in the US: Characteristics associated with interferon-gamma release assay or tuberculin skin testing.

PubMed

Stockbridge, Erica L; Miller, Thaddeus L; Carlson, Erin K; Ho, Christine

2018-01-01

To determine whether latent tuberculosis infection risk factors are associated with an increased likelihood of latent tuberculosis infection testing in the US private healthcare sector. A national sample of medical and pharmacy claims representing services rendered January 2011 through December 2013 for 3,997,986 commercially insured individuals in the US who were 0 to 64 years of age. We used multivariable logistic regression models to determine whether TB/LTBI risk factors were associated with an increased likelihood of Interferon-Gamma Release Assay (IGRA) or Tuberculin Skin Test (TST) testing in the private sector. 4.31% (4.27-4.34%) received at least one TST/IGRA test between 2011 and 2013 while 1.69% (1.67-1.72%) received a TST/IGRA test in 2013. Clinical risk factors associated with a significantly increased likelihood of testing included HIV, immunosuppressive therapy, exposure to tuberculosis, a history of tuberculosis, diabetes, tobacco use, end stage renal disease, and alcohol use disorder. Other significant variables included gender, age, asthma, the state tuberculosis rate, population density, and percent of foreign-born persons in a county. Private sector TST/IGRA testing is not uncommon and testing varies with clinical risk indicators. Thus, the private sector can be a powerful resource in the fight against tuberculosis. Analyses of administrative data can inform how best to leverage private sector healthcare toward tuberculosis prevention activities.

Cosmological Gamma-Ray Bursts and Hypernovae Conclusively Linked

NASA Astrophysics Data System (ADS)

2003-06-01

-ray radiation. The team concludes that it is likely to be due to the nearly instantaneous, non-symmetrical collapse of the inner region of a highly developed star (known as the "collapsar" model) . The March 29 gamma-ray burst will pass into the annals of astrophysics as a rare "type-defining event", providing conclusive evidence of a direct link between cosmological gamma-ray bursts and explosions of very massive stars . PR Photo 17a/03 : Image of the optical afterglow of GRB 030329 (VLT FORS1+2). PR Photo 17b/03 : A series of VLT spectra of the optical afterglow of GRB 030329. What are Gamma-Ray Bursts? One of the currently most active fields of astrophysics is the study of the dramatic events known as "gamma-ray bursts (GRBs)" . They were first detected in the late 1960's by sensitive instruments on-board orbiting military satellites, launched for the surveillance and detection of nuclear tests. Originating, not on the Earth, but far out in space, these short flashes of energetic gamma-rays last from less than a second to several minutes. Despite major observational efforts, it is only within the last six years that it has become possible to pinpoint with some accuracy the sites of some of these events. With the invaluable help of comparatively accurate positional observations of the associated X-ray emission by various X-ray satellite observatories since early 1997, astronomers have until now identified about fifty short-lived sources of optical light associated with GRBs (the "optical afterglows"). Most GRBs have been found to be situated at extremely large ("cosmological") distances. This implies that the energy released in a few seconds during such an event is larger than that of the Sun during its entire lifetime of more than 10,000 million years. The GRBs are indeed the most powerful events since the Big Bang known in the Universe, cf. ESO PR 08/99 and ESO PR 20/00 . During the past years circumstantial evidence has mounted that GRBs signal the collapse of massive

ANALYSIS OF SOIL AND DUST SAMPLES FOR POLYCHLORINATED BIPHENYLS BY ENZYME LINKED IMMUNOSORBENT ASSAY (ELISA)

EPA Science Inventory

An inhibition enzyme-linked immunosorbent assay (ELISA) was used to determine polychlorinated biphenyls (PCBs) in house dust and soil. Soil and house dust samples were analyzed for PCB by both gas chromatography/electron capture detection (GC/ECD) and ELISA methods. A correlati...

Mangiferin inhibits macrophage classical activation via downregulating interferon regulatory factor 5 expression

PubMed Central

Wei, Zhiquan; Yan, Li; Chen, Yixin; Bao, Chuanhong; Deng, Jing; Deng, Jiagang

2016-01-01

Mangiferin is a natural polyphenol and the predominant effective component of Mangifera indica Linn. leaves. For hundreds of years, Mangifera indica Linn. leaf has been used as an ingredient in numerous traditional Chinese medicine preparations for the treatment of bronchitis. However, the pharmacological mechanism of mangiferin in the treatment of bronchitis remains to be elucidated. Macrophage classical activation is important role in the process of bronchial airway inflammation, and interferon regulatory factor 5 (IRF5) has been identified as a key regulatory factor for macrophage classical activation. The present study used the THP-1 human monocyte cell line to investigate whether mangiferin inhibits macrophage classical activation via suppressing IRF5 expression in vitro. THP-1 cells were differentiated to macrophages by phorbol 12-myristate 13-acetate. Macrophages were polarized to M1 macrophages following stimulation with lipopolysaccharide (LPS)/interferon-γ (IFN-γ). Flow cytometric analysis was conducted to detect the M1 macrophages. Reverse transcription-quantitative polymerase chain reaction was used to investigate cellular IRF5 gene expression. Levels of proinflammatory cytokines and IRF5 were assessed following cell culture and cellular homogenization using enzyme-linked immunosorbent assay. IRF5 protein and nuclei co-localization was performed in macrophages with laser scanning confocal microscope immunofluorescence analysis. The results of the present study demonstrated that mangiferin significantly inhibits LPS/IFN-γ stimulation-induced classical activation of macrophages in vitro and markedly decreases proinflammatory cytokine release. In addition, cellular IRF5 expression was markedly downregulated. These results suggest that the inhibitory effect of mangiferin on classical activation of macrophages may be exerted via downregulation of cellular IRF5 expression levels. PMID:27277156

The importance of communication in promoting voluntary participation in an experimental trial: A qualitative study based on the assessment of the gamma-interferon test for the diagnosis of bovine tuberculosis in France

PubMed Central

Dufour, Barbara; Praud, Anne

2017-01-01

Understanding the factors leading each stakeholder to participate in an experimental trial is a key element for improving trial set-up and for identifying selection bias in statistical analyses. An experimental protocol, validated by the European Commission, was developed in France to assess the ability of the gamma-interferon test in terms of accuracy to replace the second intradermal skin test in cases of suspected bovine tuberculosis. Implemented between 2013 and 2015, this experimental trial was based on voluntary participation. To determine and understand the motivation or reluctance of farmers to take part in this trial, we carried out a sociological survey in France. Our study was based on semi-structured interviews with the farmers and other stakeholders involved. The analysis of findings demonstrated that shortening the lock-up period during tuberculosis suspicion, following the use of a gamma-interferon test, was an important aim and a genuine challenge for the animal health stakeholders. However, some farmers did not wish to continue the trial because it could potentially have drastic consequences for them. Moreover, misunderstandings and confusion concerning the objectives and consequences of the trial led stakeholders to reject it forcefully. Based on our results, we offer some recommendations: clear and appropriate communication tools should be prepared to explain the protocol and its aims. In addition, these types of animal health trials should be designed with the stakeholders’ interests in mind. This study provides a better understanding of farmer motivations and stakeholder influences on trial participation and outcomes. The findings can be used to help design trials so that they promote participation by farmers and by all animal health stakeholders in general. PMID:28973018

Gold nanoparticle-based enzyme-linked antibody-aptamer sandwich assay for detection of Salmonella Typhimurium.

PubMed

Wu, Wenhe; Li, Jun; Pan, Dun; Li, Jiang; Song, Shiping; Rong, Mingge; Li, Zixi; Gao, Jimin; Lu, Jianxin

2014-10-08

Enzyme-linked immunosorbent assay (ELISA) provides a convenient means for the detection of Salmonella enterica serovar Typhimurium (STM), which is important for rapid diagnosis of foodborne pathogens. However, conventional ELISA is limited by antibody-antigen immunoreactions and suffers from poor sensitivity and tedious sample pretreatment. Therefore, development of novel ELISA remains challenging. Herein, we designed a comprehensive strategy for rapid, sensitive, and quantitative detection of STM with high specificity by gold nanoparticle-based enzyme-linked antibody-aptamer sandwich (nano-ELAAS) method. STM was captured and preconcentrated from samples with aptamer-modified magnetic particles, followed by binding with detector antibodies. Then nanoprobes carrying a large amount of reporter antibodies and horseradish peroxidase molecules were used for colorimetric signal amplification. Under the optimized reaction conditions, the nano-ELAAS assay had a quantitative detection range from 1 × 10(3) to 1 × 10(8) CFU mL(-1), a limit of detection of 1 × 10(3) CFU mL(-1), and a selectivity of >10-fold for STM in samples containing other bacteria at higher concentration with an assay time less than 3 h. In addition, the developed nanoprobes were improved in terms of detection range and/or sensitivity when compared with two commercial enzyme-labeled antibody signal reporters. Finally, the nano-ELAAS method was demonstrated to work well in milk samples, a common source of STM contamination.

Interleukin-17A-Deficient Mice Are Highly Susceptible to Toxoplasma gondii Infection Due to Excessively Induced T. gondii HSP70 and Interferon Gamma Production.

PubMed

Moroda, Masataka; Takamoto, Masaya; Iwakura, Yoichiro; Nakayama, Jun; Aosai, Fumie

2017-12-01

Interleukin17A (IL-17A) is known to be involved in the host defense against pathogens and the pathogenesis of autoimmune diseases. Previously, we showed that excessive amounts of interferon gamma (IFN-γ) play an important role in the pathogenesis of the lethal effects of Toxoplasma gondii by inducing anaphylactic responses. In the study described in this report, we examined the effects of IL-17A deficiency on murine host defense against oral T. gondii infection. IL-17A-deficient C57BL/6 (B6) mice exhibited higher rates of mortality than wild-type (WT) mice during the acute phase of T. gondii infection. CD4 + T cells in the mesenteric lymph nodes (mLNs) and ileum of T. gondii -infected IL-17A-deficient mice produced higher levels of IFN-γ than did those of WT mice. In addition, the level of T. gondii HSP70 ( T.g HSP70) expression was also significantly increased in the ileum, mLNs, liver, and spleen of infected IL-17A-deficient mice compared with that in WT mice. These elevated levels of expression of T.g HSP70 and IFN-γ in infected IL-17A-deficient mice were presumably linked to the IL-17A defect since they decreased to WT levels after treatment with recombinant IL-17A. Furthermore, IL-17A-deficient mice were highly susceptible to the anaphylactic effect of T.g HSP70, and the survival of IL-17A-deficient mice during the acute phase was improved by treatment with an anti- T.g HSP70 monoclonal antibody. These results suggest that IL-17A plays an important role in host survival against T. gondii infection by protecting the host from an anaphylactic reaction via the downregulation of T.g HSP70 and IFN-γ production. Copyright © 2017 American Society for Microbiology.

An asymmetric energetic type Ic supernova viewed off-axis, and a link to gamma ray bursts.

PubMed

Mazzali, Paolo A; Kawabata, Koji S; Maeda, Keiichi; Nomoto, Ken'ichi; Filippenko, Alexei V; Ramirez-Ruiz, Enrico; Benetti, Stefano; Pian, Elena; Deng, Jinsong; Tominaga, Nozomu; Ohyama, Youichi; Iye, Masanori; Foley, Ryan J; Matheson, Thomas; Wang, Lifan; Gal-Yam, Avishay

2005-05-27

Type Ic supernovae, the explosions after the core collapse of massive stars that have previously lost their hydrogen and helium envelopes, are particularly interesting because of their link with long-duration gamma ray bursts. Although indications exist that these explosions are aspherical, direct evidence has been missing. Late-time observations of supernova SN 2003jd, a luminous type Ic supernova, provide such evidence. Recent Subaru and Keck spectra reveal double-peaked profiles in the nebular lines of neutral oxygen and magnesium. These profiles are different from those of known type Ic supernovae, with or without a gamma ray burst, and they can be understood if SN 2003jd was an aspherical axisymmetric explosion viewed from near the equatorial plane. If SN 2003jd was associated with a gamma ray burst, we missed the burst because it was pointing away from us.

Thymoquinone Suppresses IRF-3-Mediated Expression of Type I Interferons via Suppression of TBK1

PubMed Central

Cho, Jae Youl

2018-01-01

Interferon regulatory factor (IRF)-3 is known to have a critical role in viral and bacterial innate immune responses by regulating the production of type I interferon (IFN). Thymoquinone (TQ) is a compound derived from black cumin (Nigella sativa L.) and is known to regulate immune responses by affecting transcription factors associated with inflammation, including nuclear factor-κB (NF-κB) and activator protein-1 (AP-1). However, the role of TQ in the IRF-3 signaling pathway has not been elucidated. In this study, we explored the molecular mechanism of TQ-dependent regulation of enzymes in IRF-3 signaling pathways using the lipopolysaccharide (LPS)-stimulated murine macrophage-like RAW264.7 cell line. TQ decreased mRNA expression of the interferon genes IFN-α and IFN-β in these cells. This inhibition was due to its suppression of the transcriptional activation of IRF-3, as shown by inhibition of IRF-3 PRD (III-I) luciferase activity as well as the phosphorylation pattern of IRF-3 in the immunoblotting experiment. Moreover, TQ targeted the autophosphorylation of TANK-binding kinase 1 (TBK1), an upstream key enzyme responsible for IRF-3 activation. Taken together, these findings suggest that TQ can downregulate IRF-3 activation via inhibition of TBK1, which would subsequently decrease the production of type I IFN. TQ also regulated IRF-3, one of the inflammatory transcription factors, providing a novel insight into its anti-inflammatory activities. PMID:29751576

Detection of bacterial pyrogens on the basis of their effects on gamma interferon-mediated formation of neopterin or nitrite in cultured monocyte cell lines.

PubMed Central

Werner-Felmayer, G; Baier-Bitterlich, G; Fuchs, D; Hausen, A; Murr, C; Reibnegger, G; Werner, E R; Wachter, H

1995-01-01

In a number of mammalian cell types, pteridine biosynthesis from guanosine 5'-triphosphate and formation of nitric oxide from L-arginine are induced by gamma interferon (IFN-gamma) and bacterial lipopolysaccharide (LPS). We assessed the possibility of using such metabolic alterations for the in vitro detection of pyrogens. Products from gram-negative and gram-positive bacteria and related synthetic compounds were tested for their potential to induce either of these pathways. Stimulation of pteridine biosynthesis was monitored as the formation of neopterin in the human myelomonocytic cell line THP-1. The formation of nitric oxide was determined as nitrite in murine J774A.1 macrophage cultures. The substances tested included toxic and detoxified parts of LPS and lipid A from Escherichia coli, Salmonella typhimurium, Salmonella minnesota, and Klebsiella pneumoniae as well as lipoteichoic acid and toxic shock syndrome toxin 1 from Staphylococcus aureus. Furthermore, two cell wall compounds from Mycobacterium tuberculosis, trehalose 6,6'-dimycolate and N-acetylmuramyl-L-alanyl-D-isoglutamine, which are active components of Freund's adjuvant, were used. When applied as a single stimulus, only the whole LPS molecule potently stimulated neopterin or nitrite formation. Lipid A and products from gram-positive bacteria were weakly active. For neopterin formation, lipid A required the presence of fetal calf serum. Besides detoxified LPS and independently from the presence of serum, all bacterial compounds tested strongly increased the effects mediated by IFN-gamma. Our results show that bacterial pyrogens can be detected by monitoring the formation of neopterin or nitrite. This may provide a basis for the development of an in vitro assay for the detection of pyrogenic contamination with the aim of replacing the currently used animal test. PMID:7664177

Linking protein motion to enzyme catalysis.

PubMed

Singh, Priyanka; Abeysinghe, Thelma; Kohen, Amnon

2015-01-13

Enzyme motions on a broad range of time scales can play an important role in various intra- and intermolecular events, including substrate binding, catalysis of the chemical conversion, and product release. The relationship between protein motions and catalytic activity is of contemporary interest in enzymology. To understand the factors influencing the rates of enzyme-catalyzed reactions, the dynamics of the protein-solvent-ligand complex must be considered. The current review presents two case studies of enzymes-dihydrofolate reductase (DHFR) and thymidylate synthase (TSase)-and discusses the role of protein motions in their catalyzed reactions. Specifically, we will discuss the utility of kinetic isotope effects (KIEs) and their temperature dependence as tools in probing such phenomena.

[Association between Fok I vitamin D receptor (VDR) gene polymorphism and plasmatic concentrations of transforming growth factor-beta1 and interferon gamma in type 1 diabetes mellitus].

PubMed

López, Tatiana; García, Diego; Angel, Bárbara; Carrasco, Elena; Codner, Ethel; Ugarte, Francisca; Pérez-Bravo, Francisco

2008-02-02

In order to assess whether Fok I vitamin D receptor gene (VDR) polymorphism is involved in the genetic susceptibility of type 1 diabetes, a case-control study was conducted and VDR genotypes were related to serum concentrations of 25(OH) vitamin D and cytokines transforming growth factor beta1 (TGF-beta1) and interferon gamma (INF-gamma). 151 incident cases of type 1 diabetes and 182 non related healthy controls from Santiago were studied for VDR polymorphisms in peripheral blood DNA. Exon 2 (Fok I) segments were amplified by polimerase chain reaction and analyzed by means of restriction fragment length polymorphism to determine each corresponding genotype. Differences for allele, genotype and serological markers as 25(OH) vitamin D, TGF-beta1 and INF-gamma levels distribution between patients and controls were analyzed. Fok I polymorphism distribution analysis showed no differences between patients and controls. Among diabetics, higher levels of TGF-beta1 (median, 282.6 pg/ml; range, 131.8-3,031.4) were observed compared with healthy children (median, 232.2 pg/ml; range, 135.7-506.5) (p < 0.0038). Similar results were observed for INF-gamma concentrations (median, 121.1 pg/ml, and range, 5.3-228.8, in cases, and median, 89.6 pg/ml, and range, 10.9-117.2 in controls) (p < 0.0004). The diabetic carriers of the ff genotype showed low levels of 25(OH) vitamin D compared with the carriers of the F allele: mean (standard deviation), 23.1 (5.9) versus 27.9 (10.3) ng/ml (p < 0.03). A similar result was observed for TGF-beta1 concentrations in diabetic carriers of ff genotype and patients carriers of the F allele (298.5 versus 276.6; p < 0.05). Fok I polymorphism of VDR could have a marginal role in the immunologic disturbance in type 1 diabetes.

Effects of positive results for Mycobacterium avium subsp paratuberculosis as determined by microbial culture of feces or antibody ELISA on results of caudal fold tuberculin test and interferon-gamma assay for tuberculosis in cattle.

PubMed

Dunn, John R; Kaneene, John B; Grooms, Daniel L; Bolin, Steven R; Bolin, Carole A; Bruning-Fann, Colleen S

2005-02-01

To determine whether cattle testing positive for Mycobacterium avium subsp paratuberculosis as determined by microbial culture of feces or antibody ELISA were more likely to have false-positive responses on the caudal fold tuberculin (CFT) test or interferon-gamma (IFN-gamma) assay for Mycobacterium bovis than cattle testing negative for M paratuberculosis. 1043 cattle from 10 herds in Michigan. Feces and blood samples for plasma were collected from cattle > or =24 months old on the day the CFT test was read. Fecal samples were submitted for microbial culture for M paratuberculosis. Plasma samples were tested for antibody against M paratuberculosis, and IFN-gamma after stimulation with purified protein derivative tuberculin from M bovis or M avium. Of 1043 cattle, 180 (17.3%) had positive CFT test results (suspects) and 8 (0.8%) had positive IFN-gamma assay results after stimulation with purified protein derivative tuberculin from M bovis. Forty-five (4.3%) and 115 (11.0%) cattle tested positive for M paratuberculosis as determined by microbial culture of feces and antibody ELISA, respectively. Cattle with positive responses for M paratuberculosis appeared to have an increased likelihood of false-positive results on the CFT test, although this association was not significant. No significant association was detected among cattle testing positive for M paratuberculosis as determined by microbial culture of feces and antibody ELISA and positive CFT test and IFN-gamma assay results for M bovis.

Plasma interferon-gamma-inducible protein-10 (IP-10) levels during acute hepatitis C virus infection

PubMed Central

Grebely, Jason; Feld, Jordan J.; Applegate, Tanya; Matthews, Gail V.; Hellard, Margaret; Sherker, Alana; Petoumenos, Kathy; Zang, Geng; Shaw, Ineke; Yeung, Barbara; George, Jacob; Teutsch, Suzy; Kaldor, John M.; Cherepanov, Vera; Bruneau, Julie; Shoukry, Naglaa H.; Lloyd, Andrew R.; Dore, Gregory J.

2013-01-01

Systemic levels of interferon-gamma-inducible protein-10 (IP-10) are predictive of treatment-induced clearance in chronic HCV. In the present study, factors associated with plasma IP-10 levels at the time of acute HCV detection and the association between IP-10 levels and spontaneous clearance were assessed in three cohorts of acute HCV infection. Among 300 individuals, 245 (181 male, 47 HIV+) were HCV RNA+ at acute HCV detection. In adjusted analysis, factors independently associated with IP-10 levels ≥150 pg/mL (median level) included HCV RNA levels >6 log IU/mL, HIV co-infection and non-Aboriginal ethnicity. Among 245 HCV RNA+ at acute HCV detection, 214 were untreated (n=137) or had persistent infection (infection duration ≥26 weeks) at treatment initiation (n=77). Spontaneous clearance occurred in 14% (29 of 214). Individuals without spontaneous clearance had significantly higher mean plasma IP-10 levels at the time of acute HCV detection than those with clearance (248±32 vs. 142±22 pg/mL, P=0.008). The proportion of individuals with spontaneous clearance was 0% (0 of 22, P=0.048) and 16% (27 of 165) and in those in those with and without plasma IP-10 levels ≥380 pg/mL. In adjusted analyses, favourable IL28B genotype was associated with spontaneous clearance, while higher HCV RNA level was independently associated with lower odds of spontaneous clearance. Conclusion High IP-10 levels at acute HCV detection were associated with failure to spontaneously clear HCV. Patients with acute HCV and high baseline IP-10 levels, particularly >380 pg/mL, should be considered for early therapeutic intervention, and those with low levels should defer therapy for potential spontaneous clearance. PMID:23325615

A Direct, Competitive Enzyme-Linked Immunosorbent Assay (ELISA) as a Quantitative Technique for Small Molecules

ERIC Educational Resources Information Center

Powers, Jennifer L.; Rippe, Karen Duda; Imarhia, Kelly; Swift, Aileen; Scholten, Melanie; Islam, Naina

2012-01-01

ELISA (enzyme-linked immunosorbent assay) is a widely used technique with applications in disease diagnosis, detection of contaminated foods, and screening for drugs of abuse or environmental contaminants. However, published protocols with a focus on quantitative detection of small molecules designed for teaching laboratories are limited. A…

Failure of isotretinoin and interferon-alpha combination therapy for HPV-linked severe vulvar dysplasia. A report of two cases.

PubMed

Vilmer, C; Havard, S; Cavelier-Balloy, B; Pelisse, M; Dubertret, L; Leibowitch, M

1998-08-01

Retinoids (RA) and interferon (IFN) have been reported to be active against a variety of tumors and human papillomavirus (HPV)-related lesions. Because chronic and recurrent HPV-linked vulvar intraepithelial neoplasia 3 (VIN 3) have a high risk of invasion, we evaluated combined therapy of IFN-alpha with 13-cis-retinoic acid (13 cRA) in the treatment of two VIN 3 cases of this type. Two patients with chronic and recurrent VIN 3 were treated with combined therapy of IFN-alpha (4.5 x 10(6) five times a week) and 13 cRA (1 mg/kg/d) for six months. Clinical regression was observed at the end of treatment in both cases, but histologic features of VIN 3 were still present. These data demonstrate the ineffectiveness of the combined regimen of IFN-alpha and 13 cRA with this schedule for a period of six months in recurrent and chronic VIN 3.

VDR, RXR, Coronin-1 and Interferonγ Levels in PBMCs of Type-2 Diabetes Patients: Molecular Link between Diabetes and Tuberculosis.

PubMed

Syal, Kirtimaan; Srinivasan, Anand; Banerjee, Dibyajyoti

2015-07-01

Diabetes and tuberculosis are world's most deadly epidemics. People suffering from diabetes are susceptible to tuberculosis. Molecular link between the two is largely unknown. It is known that Vitamin A receptor (RXR) heterodimerizes with Vitamin D receptor (VDR) and Peroxisome proliferator-activator receptor-γ (PPARγ) to regulate Tryptophan-aspartate containing coat protein (TACO) expression and fatty acid metabolism respectively, so it would be interesting to check the expression of these genes in diabetes mellitus (DM) patients which might explain the susceptibility of diabetics to tuberculosis. In this study, we checked the expression of RXR, VDR, TACO and Interferon-γ (IFNγ) genes in type-2 DM patients for understanding the link between the two diseases. We observed down regulation of RXR gene and corresponding up regulation of TACO gene expression. We have not observed significant change in expression of VDR and IFNγ genes in type-2 DM patients. Repression of RXR gene could hamper VDR-RXR heterodimer formation and thus would up regulate TACO gene expression which may predispose the type-2 DM patients to tuberculosis. Also, decrease in RXR-PPARγ heterodimer could be involved in DM.

Novel fluorescent probe for highly sensitive bioassay using sequential enzyme-linked immunosorbent assay-capillary isoelectric focusing (ELISA-cIEF).

PubMed

Henares, Terence G; Uenoyama, Yuta; Nogawa, Yuto; Ikegami, Ken; Citterio, Daniel; Suzuki, Koji; Funano, Shun-ichi; Sueyoshi, Kenji; Endo, Tatsuro; Hisamoto, Hideaki

2013-06-07

This paper presents a novel rhodamine diphosphate molecule that allows highly sensitive detection of proteins by employing sequential enzyme-linked immunosorbent assay and capillary isoelectric focusing (ELISA-cIEF). Seven-fold improvement in the immunoassay sensitivity and a 1-2 order of magnitude lower detection limit has been demonstrated by taking advantage of the combination of the enzyme-based signal amplification of ELISA and the concentration of enzyme reaction products by cIEF.

The RNA-Editing Enzyme ADAR1 Controls Innate Immune Responses to RNA

PubMed Central

Mannion, Niamh M.; Greenwood, Sam M.; Young, Robert; Cox, Sarah; Brindle, James; Read, David; Nellåker, Christoffer; Vesely, Cornelia; Ponting, Chris P.; McLaughlin, Paul J.; Jantsch, Michael F.; Dorin, Julia; Adams, Ian R.; Scadden, A.D.J.; Öhman, Marie; Keegan, Liam P.; O’Connell, Mary A.

2014-01-01

Summary The ADAR RNA-editing enzymes deaminate adenosine bases to inosines in cellular RNAs. Aberrant interferon expression occurs in patients in whom ADAR1 mutations cause Aicardi-Goutières syndrome (AGS) or dystonia arising from striatal neurodegeneration. Adar1 mutant mouse embryos show aberrant interferon induction and die by embryonic day E12.5. We demonstrate that Adar1 embryonic lethality is rescued to live birth in Adar1; Mavs double mutants in which the antiviral interferon induction response to cytoplasmic double-stranded RNA (dsRNA) is prevented. Aberrant immune responses in Adar1 mutant mouse embryo fibroblasts are dramatically reduced by restoring the expression of editing-active cytoplasmic ADARs. We propose that inosine in cellular RNA inhibits antiviral inflammatory and interferon responses by altering RLR interactions. Transfecting dsRNA oligonucleotides containing inosine-uracil base pairs into Adar1 mutant mouse embryo fibroblasts reduces the aberrant innate immune response. ADAR1 mutations causing AGS affect the activity of the interferon-inducible cytoplasmic isoform more severely than the nuclear isoform. PMID:25456137

The RNA-editing enzyme ADAR1 controls innate immune responses to RNA.

PubMed

Mannion, Niamh M; Greenwood, Sam M; Young, Robert; Cox, Sarah; Brindle, James; Read, David; Nellåker, Christoffer; Vesely, Cornelia; Ponting, Chris P; McLaughlin, Paul J; Jantsch, Michael F; Dorin, Julia; Adams, Ian R; Scadden, A D J; Ohman, Marie; Keegan, Liam P; O'Connell, Mary A

2014-11-20

The ADAR RNA-editing enzymes deaminate adenosine bases to inosines in cellular RNAs. Aberrant interferon expression occurs in patients in whom ADAR1 mutations cause Aicardi-Goutières syndrome (AGS) or dystonia arising from striatal neurodegeneration. Adar1 mutant mouse embryos show aberrant interferon induction and die by embryonic day E12.5. We demonstrate that Adar1 embryonic lethality is rescued to live birth in Adar1; Mavs double mutants in which the antiviral interferon induction response to cytoplasmic double-stranded RNA (dsRNA) is prevented. Aberrant immune responses in Adar1 mutant mouse embryo fibroblasts are dramatically reduced by restoring the expression of editing-active cytoplasmic ADARs. We propose that inosine in cellular RNA inhibits antiviral inflammatory and interferon responses by altering RLR interactions. Transfecting dsRNA oligonucleotides containing inosine-uracil base pairs into Adar1 mutant mouse embryo fibroblasts reduces the aberrant innate immune response. ADAR1 mutations causing AGS affect the activity of the interferon-inducible cytoplasmic isoform more severely than the nuclear isoform. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

EVALUATION OF AN ENZYME-LINKED IMMUNOSORBENT ASSAY FOR BIOLOGICAL MONITORING OF 3-PHENOXYBENZOIC ACID IN URINE

EPA Science Inventory

Abstract describes the development of an enzyme-linked immunosorbent assay (ELISA) method for monitoring 2,4-dichlorophenoxyacetic acid (2,4-D exposures). The ELISA is compared with a gas chromatograhy/mass spectrometry procedure. ELISA method development steps and comparative ...

An Asymmetric Hypernova (SN 2003jd) Viewed Off-Axis, and a Link to Gamma-Ray Bursts

NASA Astrophysics Data System (ADS)

Maeda, K.; et al.

2006-02-01

Authors: Keiichi Maeda, Ken Nomoto, Nozomu Tominaga (Tokyo), Paolo Mazzali, Elena Pian (Trieste), Jinsong Deng (Beijing) Type Ic supernovae, the explosions following the core collapse ofmassive stars that have previously lost their hydrogen and heliumenvelopes, are particularly interesting because of the link withlong-duration gamma-ray bursts. Although indications exist that theseexplosions are aspherical, direct evidence has still been missing.Late-time observations of SN 2003jd, a luminous hypernova, providesuch evidence. Recent Subaru and Keck spectra reveal double-peakedprofiles in the nebular lines of neutral oxygen and magnesium. Theseprofiles are different from those of known Type Ic supernovae, with orwithout a gamma-ray burst, and they can be understood if SN 2003jd wasan aspherical, axisymmetric explosion viewed from near the equatorialplane. If SN 2003jd was associated with a gamma-ray burst, we missedthe burst as it was pointing away from us.

Blood Interferon Signatures Putatively Link Lack of Protection Conferred by the RTS,S Recombinant Malaria Vaccine to an Antigen-specific IgE Response

PubMed Central

Rinchai, Darawan; Presnell, Scott; Vidal, Marta; Dutta, Sheetij; Chauhan, Virander; Cavanagh, David; Moncunill, Gemma; Dobaño, Carlota; Chaussabel, Damien

2017-01-01

Malaria remains a major cause of mortality and morbidity worldwide. Progress has been made in recent years with the development of vaccines that could pave the way towards protection of hundreds of millions of exposed individuals. Here we used a modular repertoire approach to re-analyze a publically available microarray blood transcriptome dataset monitoring the response to malaria vaccination. We report the seminal identification of interferon signatures in the blood of subjects on days 1, 3 and 14 following administration of the third dose of the RTS,S recombinant malaria vaccine. These signatures at day 1 correlate with protection, and at days 3 and 14 to susceptibility to subsequent challenge of study subjects with live parasites. In addition we putatively link the decreased abundance of interferon-inducible transcripts observed at days 3 and 14 post-vaccination with the elicitation of an antigen-specific IgE response in a subset of vaccine recipients that failed to be protected by the RTS,S vaccine. Furthermore, profiling of antigen-specific levels of IgE in a Mozambican cohort of malaria-exposed children vaccinated with RTS,S identified an association between elevated baseline IgE levels and subsequent development of naturally acquired malaria infection during follow up. Taken together these findings warrant further investigation of the role of antigen-specific IgE in conferring susceptibility to malaria infection. PMID:28883910

No Love Lost Between Viruses and Interferons.

PubMed

Fensterl, Volker; Chattopadhyay, Saurabh; Sen, Ganes C

2015-11-01

The interferon system protects mammals against virus infections. There are several types of interferons, which are characterized by their ability to inhibit virus replication and resultant pathogenesis by triggering both innate and cell-mediated immune responses. Virus infection is sensed by a variety of cellular pattern-recognition receptors and triggers the synthesis of interferons, which are secreted by the infected cells. In uninfected cells, cell surface receptors recognize the secreted interferons and activate intracellular signaling pathways that induce the expression of interferon-stimulated genes; the proteins encoded by these genes inhibit different stages of virus replication. To avoid extinction, almost all viruses have evolved mechanisms to defend themselves against the interferon system. Consequently, a dynamic equilibrium of survival is established between the virus and its host, an equilibrium that can be shifted to the host's favor by the use of exogenous interferon as a therapeutic antiviral agent.

Enzyme-linked immunosorbent assay for the quantitative/qualitative analysis of plant secondary metabolites.

PubMed

Sakamoto, Seiichi; Putalun, Waraporn; Vimolmangkang, Sornkanok; Phoolcharoen, Waranyoo; Shoyama, Yukihiro; Tanaka, Hiroyuki; Morimoto, Satoshi

2018-01-01

Immunoassays are antibody-based analytical methods for quantitative/qualitative analysis. Since the principle of immunoassays is based on specific antigen-antibody reaction, the assays have been utilized worldwide for diagnosis, pharmacokinetic studies by drug monitoring, and the quality control of commercially available products. Berson and Yalow were the first to develop an immunoassay, known as radioimmunoassay (RIA), for detecting endogenous plasma insulin [1], a development for which Yalow was awarded the Nobel Prize in Physiology or Medicine in 1977. Even today, after half a century, immunoassays are widely utilized with some modifications from the originally proposed system, e.g., radioisotopes have been replaced with enzymes because of safety concerns regarding the use of radioactivity, which is referred to as enzyme immunoassay/enzyme-linked immunosorbent assay (ELISA). In addition, progress has been made in ELISA with the recent advances in recombinant DNA technology, leading to increase in the range of antibodies, probes, and even systems. This review article describes ELISA and its applications for the detection of plant secondary metabolites.

Adenoviral mediated interferon-alpha 2b gene therapy suppresses the pro-angiogenic effect of vascular endothelial growth factor in superficial bladder cancer.

PubMed

Adam, Liana; Black, Peter C; Kassouf, Wassim; Eve, Beryl; McConkey, David; Munsell, Mark F; Benedict, William F; Dinney, Colin P N

2007-05-01

Intravesical adenovirus mediated interferon-alpha gene transfer has a potent therapeutic effect against superficial human bladder carcinoma xenografts growing in the bladder of athymic nude mice. We determined whether the inhibition of angiogenesis might contribute to the antitumor effect. We treated several human urothelial carcinoma cells with adenovirus mediated interferon-alpha 2b and monitored its effects on the production of angiogenic factors using real-time reverse-transcription polymerase chain reaction, Western blotting, and immunohistochemical analysis and a gel shift based transcription factor array. To assess the role of adenovirus mediated interferon 2b in angiogenic activity we used in vitro invasion assays and evaluated the anti-angiogenic effects of adenovirus mediated interferon gene therapy in an orthotopic murine model of human superficial bladder cancer. In adenovirus mediated interferon-alpha infected 253J B-V cells vascular endothelial growth factor was decreased and anti-angiogenic interferon-gamma inducible protein 10 was up-regulated. In contrast, the addition of as much as 100,000 IU recombinant interferon had no apparent effect on vascular endothelial growth factor production. Conditioned medium derived from adenovirus mediated interferon 2b infected 253J B-V cells greatly decreased the invasive potential of human endothelial cells and down-regulated their matrix metalloproteinase 2 expression compared to controls. Furthermore, adenovirus mediated interferon 2b blocked pro-angiogenic nuclear signals, such as the transcription factors activating protein-1 and 2, stimulating protein-1, nuclear factor kappaB and c-myb. In vivo experiments revealed significant vascular endothelial growth factor down-regulation and decreased tumor vessel density in the adenovirus mediated interferon 2b treated group compared to controls. Treatment with adenovirus mediated interferon 2b increases the angiostatic activity of the bladder cancer microenvironment

Allergic contact dermatitis to nickel: modified in vitro test protocols for better detection of allergen-specific response.

PubMed

Spiewak, Radoslaw; Moed, Heleen; von Blomberg, Brigitta Mary E; Bruynzeel, Derk P; Scheper, Rik J; Gibbs, Susan; Rustemeyer, Thomas

2007-02-01

To date, no in vitro test is suitable for routine diagnosis of contact allergy. The aim of our study was to establish improved in vitro test protocol for the detection of antigen-specific responses of lymphocytes from patients with allergic contact dermatitis to nickel (Ni-ACD). Blood leucocytes from 14 Ni-ACD patients and 14 controls were cultured in the presence of 'cytokine cocktails' skewing lymphocytes towards 'type 1' [interferon-gamma (IFN-gamma)-secreting] or 'type 2' [interleukin (IL)-5 and IL-13-secreting] phenotypes. The cocktails consisted of IL-7 and, respectively, either IL-12 or IL-4. Cell responses to nickel were measured with enzyme-linked immunospot assay (ELISpot), enzyme-linked immunosorbent assay (ELISA), and lymphocyte proliferation test (LPT). Significant differences between patients with Ni-ACD and controls were found for the 'type 2' cytokines IL-13 and IL-5, with further increase of allergen-specific responses occurring when cultures were supplemented with IL-7 and IL-4. No significant differences were found for IFN-gamma. The best correlate to clinical diagnosis was LPT with 'type 2' skewing (r= 0.739, P < 0.001), followed by IL-13 ELISpot with 'type 2' skewing (r= 0.654, P < 0.001). The non-radioactive method that correlated best with LPT was IL-2 ELISpot (r= 0.809, P < 0.001). Overall, we conclude that combining ELISpot assay with proposed modifications of culture conditions improves detection of specific lymphocyte responses in contact allergy to nickel.

[Plasma levels of interferon gamma and interleukin 10 in patients with lymphonodular toxoplasmosis].

PubMed

Bielec, D; Patorska-Mach, E; Semczuk, G; Toruń, E

1997-01-01

The concentrations of IFN gamma and IL 10 in plasma of sixteen patients with toxoplasmic lymphadenopathy were measured. These examinations were carried out two times in the interval of a month. We found increased level of IFN gamma and normal concentrations of IL 10 in both of these terms.

Roles of CD4+ T Cells and Gamma Interferon in Protective Immunity against Babesia microti Infection in Mice

PubMed Central

Igarashi, Ikuo; Suzuki, Reiko; Waki, Seiji; Tagawa, Yoh-Ichi; Seng, Seyha; Tum, Sothyra; Omata, Yoshitaka; Saito, Atsushi; Nagasawa, Hideyuki; Iwakura, Yohichiro; Suzuki, Naoyoshi; Mikami, Takeshi; Toyoda, Yutaka

1999-01-01

Babesia microti produces a self-limiting infection in mice, and recovered mice are resistant to reinfection. In the present study, the role of T cells in protective immunity against challenge infection was examined. BALB/c mice which recovered from primary infection showed strong protective immunity against challenge infection. In contrast, nude mice which failed to control the primary infection and were cured with an antibabesial drug did not show protection against challenge infection. Treatment of immune mice with anti-CD4 monoclonal antibody (MAb) diminished the protective immunity against challenge infection, but treatment with anti-CD8 MAb had no effect on the protection. Transfer of CD4+ T-cell-depleted spleen cells resulted in higher parasitemia than transfer of CD8+ T-cell-depleted spleen cells. A high level of gamma interferon (IFN-γ), which was produced by CD4+ T cells, was observed for the culture supernatant of spleen cells from immune mice, and treatment of immune mice with anti-IFN-γ MAb partially reduced the protection. Moreover, no protection against challenge infection was found in IFN-γ-deficient mice. On the other hand, treatment of immune mice with MAbs against interleukin-2 (IL-2), IL-4, or tumor necrosis factor alpha did not affect protective immunity. These results suggest essential requirements for CD4+ T cells and IFN-γ in protective immunity against challenge infection with B. microti. PMID:10417185

The elephant interferon gamma assay: a contribution to diagnosis of tuberculosis in elephants.

PubMed

Angkawanish, T; Morar, D; van Kooten, P; Bontekoning, I; Schreuder, J; Maas, M; Wajjwalku, W; Sirimalaisuwan, A; Michel, A; Tijhaar, E; Rutten, V

2013-11-01

Mycobacterium tuberculosis (M. tb) has been shown to be the main causative agent of tuberculosis in elephants worldwide. M. tb may be transmitted from infected humans to other species including elephants and vice versa, in case of prolonged intensive contact. An accurate diagnostic approach covering all phases of the infection in elephants is required. As M. tb is an intracellular pathogen and cell-mediated immune (CMI) responses are elicited early after infection, the skin test is the CMI assay of choice in humans and cattle. However, this test is not applicable in elephants. The interferon gamma (IFN-γ) assay is considered a good alternative for the skin test in general, validated for use in cattle and humans. This study was aimed at development of an IFN-γ assay applicable for diagnosis of tuberculosis in elephants. Recombinant elephant IFN-γ (rEpIFN-γ) produced in eukaryotic cells was used to immunize mice and generate the monoclonal antibodies. Hybridomas were screened for IFN-γ-specific monoclonal antibody production and subcloned, and antibodies were isotyped and affinity purified. Western blot confirmed recognition of the rEpIFN-γ. The optimal combination of capture and detection antibodies selected was able to detect rEpIFN-γ in concentrations as low as 1 pg/ml. The assay was shown to be able to detect the native elephant IFN-γ, elicited in positive-control cultures (pokeweed mitogen (PWM), phorbol myristate acetate plus ionomycin (PMA/I)) of both Asian and African elephant whole-blood cultures (WBC). Preliminary data were generated using WBC from non-infected elephants, a M. tb infection-suspected elephant and a culture-confirmed M. tb-infected elephant. The latter showed measurable production of IFN-γ after stimulation with ESAT6/CFP10 PPDB and PPDA in concentration ranges as elicited in WBC by Mycobacterium tuberculosis complex (MTBC)-specific antigens in other species. Hence, the IFN-γ assay presented potential as a diagnostic tool for the

[Fish interferon response and its molecular regulation: a review].

PubMed

Zhang, Yibing; Gui, Jianfang

2011-05-01

Interferon response is the first line of host defense against virus infection. Recent years have witnessed tremendous progress in understanding of fish innate response to virus infection, especially in fish interferon antiviral response. A line of fish genes involved in interferon antiviral response have been identified and functional studies further reveal that fish possess an IFN antiviral system similar to mammals. However, fish virus-induced interferon genes contain introns similar to mammalian type III interferon genes although they encode proteins similar to type I interferons, which makes it hard to understand the evolution of vertebrate interferon genes directly resulting in a debate on nomenclature of fish interferon genes. Actually, fish display some unique mechanisms underlying interferon antiviral response. This review documents the recent progress on fish interferon response and its molecular mechanism.

Magnetic Affinity Enzyme-Linked Immunoassay for Diagnosis of Schistosomiasis Japonicum in Persons with Low-Intensity Infection

PubMed Central

Yu, Qin; Yang, Hai; Feng, Youmei; Zhu, Yanhong; Yang, Xiangliang

2012-01-01

Most schistosome-endemic areas in China are characterized by low-intensity infections that are independent of prevalence. To establish an effective diagnostic method, we developed a magnetic affinity enzyme-linked immunoassay based on soluble egg antigens (SEA-MEIA) for diagnosing schistosomiasis in persons with low-intensity infection with Schistosoma japonicum by comparing it with a conventional enzyme-linked immunosorbent assay (ELISA). Our results showed that the SEA-MEIA had a higher sensitivity and greater precision in the diagnosis of low-intensity S. japonicum infections than the ELISA. In addition, when we used Pearson's correlation in associating SEA-MEIA with ELISA, a significant correlation existed between the two assays (r = 0.845, P < 0.001). Our data indicated that SEA-MEIA, with a higher sensitivity and greater ease of performance, would be valuable for diagnosis of schistosomiasis japonicum in persons with low-intensity infections. PMID:22869635

Magnetically responsive enzyme powders

NASA Astrophysics Data System (ADS)

Pospiskova, Kristyna; Safarik, Ivo

2015-04-01

Powdered enzymes were transformed into their insoluble magnetic derivatives retaining their catalytic activity. Enzyme powders (e.g., trypsin and lipase) were suspended in various liquid media not allowing their solubilization (e.g., saturated ammonium sulfate and highly concentrated polyethylene glycol solutions, ethanol, methanol, 2-propanol) and subsequently cross-linked with glutaraldehyde. Magnetic modification was successfully performed at low temperature in a freezer (-20 °C) using magnetic iron oxides nano- and microparticles prepared by microwave-assisted synthesis from ferrous sulfate. Magnetized cross-linked enzyme powders were stable at least for two months in water suspension without leakage of fixed magnetic particles. Operational stability of magnetically responsive enzymes during eight repeated reaction cycles was generally without loss of enzyme activity. Separation of magnetically modified cross-linked powdered enzymes from reaction mixtures was significantly simplified due to their magnetic properties.

Effects of isolation on interferon production and hematological and immunological parameters

NASA Technical Reports Server (NTRS)

Sonnenfeld, G.; Measel, J.; Loken, M. R.; Degioanni, J.; Follini, S.; Galvagno, A.; Montalbini, M.

1992-01-01

A 27-year-old woman was maintained in an isolated state for 131 days in Carlsbad Caverns, New Mexico. Her diet was vitamin D-depleted. Determinations on the effects of such isolation on levels and activities of peripheral blood cells that are important for hematological homeostasis and immunological function were carried out. Throughout the duration of the study, the percentage of lymphoid cells that expressed CD3, CD4, CD8, CD19, Leu 8, and other markers remained relatively constant although the absolute numbers of these cells varied. Although the percentage of natural killer (NK) cells did not vary, the activity of these cells did change. NK cell activity became elevated as the isolation study progressed. Production of interferon-gamma (IFN-gamma) in response to mitogen stimulation was higher than expected throughout the isolation periods, but returned to the normal range after termination of the isolation. Red and white cell counts dropped significantly upon entering isolation, but soon returned to normal.

Human macrophage gamma interferon decreases gene expression but not replication of Mycobacterium tuberculosis: analysis of the host-pathogen reciprocal influence on transcription in a comparison of strains H37Rv and CMT97.

PubMed

Cappelli, G; Volpe, P; Sanduzzi, A; Sacchi, A; Colizzi, V; Mariani, F

2001-12-01

Mycobacterium tuberculosis is an intracellular pathogen that readily survives and replicates in human macrophages (MPhi). Host cells have developed different mycobactericidal mechanisms, including the production of inflammatory cytokines. The aim of this study was to compare the MPhi response, in terms of cytokine gene expression, to infection with the M. tuberculosis laboratory strain H37Rv and the clinical M. tuberculosis isolate CMT97. Both strains induce the production of interleukin-12 (IL-12) and IL-16 at comparable levels. However, the clinical isolate induces a significantly higher and more prolonged MPhi activation, as shown by reverse transcription-PCR analysis of IL-1beta, IL-6, IL-10, transforming growth factor beta, tumor necrosis factor alpha, and gamma interferon (IFN-gamma) transcripts. Interestingly, when IFN-gamma transcription is high, the number of M. tuberculosis genes expressed decreases and vice versa, whereas no mycobactericidal effect was observed in terms of bacterial growth. Expression of 11 genes was also studied in the two M. tuberculosis strains by infecting resting or activated MPhi and compared to bacterial intracellular survival. In both cases, a peculiar inverse correlation between expression of these genes and multiplication was observed. The number and type of genes expressed by the two strains differed significantly.

Immunity to human cytomegalovirus measured and compared by complement fixation, indirect fluorescent-antibody, indirect hemagglutination, and enzyme-linked immunosorbent assays.

PubMed Central

Brandt, J A; Kettering, J D; Lewis, J E

1984-01-01

The complement fixation test is currently the test employed most frequently to determine the presence of antibody to human cytomegalovirus. Several other techniques have been adapted for this purpose. A comparison of cytomegalovirus antibody titers was made between the complement fixation test, a commercially available enzyme-linked immunosorbent assay, an indirect immunofluorescent technique, and a modified indirect hemagglutination test. Forty-three serum samples were tested for antibodies by each of the above procedures. The enzyme-linked immunosorbent, immunofluorescent, and indirect hemagglutination assays were in close agreement on all samples tested; the titers obtained with these methods were all equal to or greater than the complement fixation titer for 38 of the 41 samples (92.6%). Two samples were anticomplementary in the complement fixation test but gave readable results in the other tests. The complement fixation test was the least sensitive of the procedures examined. The commercial enzyme-linked immunosorbent assay system was the most practical method and offered the highest degree of sensitivity in detecting antibodies to cytomegalovirus. PMID:6321544

QUANTITATIVE ENZYME-LINKED IMMUNOSORBENT ASSAY FOR DETERMINATION OF POLYCHLORINATED BIPHENYLS IN ENVIRONMENTAL SOIL AND SEDIMENT SAMPLES

EPA Science Inventory

An enzyme-linked immunosorbent assay (ELISA) for the quantitative determination of Aroclors 1242, 1248, 1254, and 1260 in soil and sediments was developed and its performance compared with that of gas chromatography (GC). The detection limits for Aroclors 1242 and 1248 in soil ar...

Dual-mode lensless imaging device for digital enzyme linked immunosorbent assay

NASA Astrophysics Data System (ADS)

Sasagawa, Kiyotaka; Kim, Soo Heyon; Miyazawa, Kazuya; Takehara, Hironari; Noda, Toshihiko; Tokuda, Takashi; Iino, Ryota; Noji, Hiroyuki; Ohta, Jun

2014-03-01

Digital enzyme linked immunosorbent assay (ELISA) is an ultra-sensitive technology for detecting biomarkers and viruses etc. As a conventional ELISA technique, a target molecule is bonded to an antibody with an enzyme by antigen-antibody reaction. In this technology, a femto-liter droplet chamber array is used as reaction chambers. Due to its small volume, the concentration of fluorescent product by single enzyme can be sufficient for detection by a fluorescent microscopy. In this work, we demonstrate a miniaturized lensless imaging device for digital ELISA by using a custom image sensor. The pixel array of the sensor is coated with a 20 μm-thick yellow filter to eliminate excitation light at 470 nm and covered by a fiber optic plate (FOP) to protect the sensor without resolution degradation. The droplet chamber array formed on a 50μm-thick glass plate is directly placed on the FOP. In the digital ELISA, microbeads coated with antibody are loaded into the droplet chamber array, and the ratio of the fluorescent to the non-fluorescent chambers with the microbeads are observed. In the fluorescence imaging, the spatial resolution is degraded by the spreading through the glass plate because the fluorescence is irradiated omnidirectionally. This degradation is compensated by image processing and the resolution of ~35 μm was achieved. In the bright field imaging, the projected images of the beads with collimated illumination are observed. By varying the incident angle and image composition, microbeads were successfully imaged.

Controlling nuclear JAKs and STATs for specific gene activation by IFN{gamma}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Noon-Song, Ezra N.; Ahmed, Chulbul M.; Dabelic, Rea

2011-07-08

Highlights: {yields} Gamma interferon (IFN{gamma}) and its receptor subunit, IFNGR1, interact with the promoter region of IFN{gamma}-associated genes along with transcription factor STAT1{alpha}. {yields} We show that activated Janus kinases pJAK2 and pJAK1 also associate with IFNGR1 in the nucleus. {yields} The activated Janus kinases are responsible for phosphorylation of tyrosine 41 on histone H3, an important epigenetic event for specific gene activation. -- Abstract: We previously showed that gamma interferon (IFN{gamma}) and its receptor subunit, IFNGR1, interacted with the promoter region of IFN{gamma}-activated genes along with transcription factor STAT1{alpha}. Recent studies have suggested that activated Janus kinases pJAK2 andmore » pJAK1 also played a role in gene activation by phosphorylation of histone H3 on tyrosine 41. This study addresses the question of the role of activated JAKs in specific gene activation by IFN{gamma}. We carried out chromatin immunoprecipitation (ChIP) followed by PCR in IFN{gamma} treated WISH cells and showed association of pJAK1, pJAK2, IFNGR1, and STAT1 on the same DNA sequence of the IRF-1 gene promoter. The {beta}-actin gene, which is not activated by IFN{gamma}, did not show this association. The movement of activated JAK to the nucleus and the IRF-1 promoter was confirmed by the combination of nuclear fractionation, confocal microscopy and DNA precipitation analysis using the biotinylated GAS promoter. Activated JAKs in the nucleus was associated with phosphorylated tyrosine 41 on histone H3 in the region of the GAS promoter. Unphosphorylated JAK2 was found to be constitutively present in the nucleus and was capable of undergoing activation in IFN{gamma} treated cells, most likely via nuclear IFNGR1. Association of pJAK2 and IFNGR1 with histone H3 in IFN{gamma} treated cells was demonstrated by histone H3 immunoprecipitation. Unphosphorylated STAT1 protein was associated with histone H3 of untreated cells. IFN{gamma

Combination alpha-interferon and lamivudine therapy for alpha-interferon-resistant chronic hepatitis B infection: results of a pilot study.

PubMed

Mutimer, D; Naoumov, N; Honkoop, P; Marinos, G; Ahmed, M; de Man, R; McPhillips, P; Johnson, M; Williams, R; Elias, E; Schalm, S

1998-06-01

Alpha-interferon achieves seroconversion in about one third of naive patients. Attempts to achieve seroconversion in patients who have previously failed alpha-interferon have proved disappointing. Combination chemotherapy (alpha-interferon with a nucleoside analogue) might provide a treatment alternative for these patients. We have undertaken a phase 2 study in 20 patients who had previously failed at least one course of alpha-interferon. The study was designed to assess the safety, tolerability and efficacy of the combination. All patients were treated for 16 weeks with alpha-interferon in combination with 12 or 16 weeks of Lamivudine (3'TC). Patients were followed for 16 weeks post-treatment. Pharmacokinetic studies were performed to identify/exclude significant pharmacokinetic drug interaction. The combination was well tolerated, and side-effects of the combination were indistinguishable from the recognised side-effects of alpha-interferon. Pharmacokinetic studies performed on days 1 and 29 did not show any significant interaction. All patients achieved HBV DNA clearance during treatment, but 19 relapsed at the end of treatment. HBeAg/anti-HBe seroconversion was observed for four patients, but was sustained for a single patient (who also had sustained DNA clearance). Combination therapy with alpha-interferon and lamivudine given for 16 weeks appears safe and is well tolerated. However, for this group of patients who had previously failed interferon monotherapy, the efficacy of combination interferon/lamivudine therapy appears disappointing, and other treatment strategies should be investigated.

Early cognitive and language skills are linked to resting frontal gamma power across the first 3 years.

PubMed

Benasich, April A; Gou, Zhenkun; Choudhury, Naseem; Harris, Kenneth D

2008-12-22

High-frequency cortical activity in humans and animals has been linked to a wide variety of higher cognitive processes. This research suggests that specific changes in neuronal synchrony occur during cognitive processing, distinguished by emergence of fast oscillations in the gamma frequency range. To determine whether the development of high-frequency brain oscillations can be related to the development of cognitive abilities, we studied the power spectra of resting EEG in children 16, 24 and 36 months of age. Individual differences in the distribution of frontal gamma power during rest were highly correlated with concurrent language and cognitive skills at all ages. Gamma power was also associated with attention measures; children who were observed as having better inhibitory control and more mature attention shifting abilities had higher gamma power density functions. We included a group of children with a family history of language impairment (FH+) and thus at higher risk for language disorders. FH+ children, as a group, showed consistently lower gamma over frontal regions than the well-matched FH- controls with no such family history (FH-). We suggest that the emergence of high-frequency neural synchrony may be critical for cognitive and linguistic development, and that children at risk for language impairments may lag in this process.

A randomized phase II trial comparing two different sequence combinations of autologous vaccine and human recombinant interferon gamma and human recombinant interferon alpha2B therapy in patients with metastatic renal cell carcinoma: clinical outcome and analysis of immunological parameters.

PubMed

Schwaab, T; Heaney, J A; Schned, A R; Harris, R D; Cole, B F; Noelle, R J; Phillips, D M; Stempkowski, L; Ernstoff, M S

2000-04-01

The clinical observation of spontaneous regression in patients with renal cell carcinoma (RCC) and the response to various immunotherapeutic therapies strongly suggest a role for the host immune system in this disease. Prior studies showed that sequential administration of interferon (IFN) gamma and IFN alpha to RCC patients was safe. Clinical responses as well as immune changes in the peripheral blood mononuclear cell compartment were observed. Autologous tumor cell vaccines (AV) have also demonstrated activity in renal cell carcinoma. We hypothesize that the addition of AV to sequential IFN gamma and a therapy might improve the tumor-specific immune response by providing an appropriate source of antigen in the appropriate cytokine environment. To our knowledge, this is the first trial using AV combined with IFN alpha and IFN gamma. The purpose of this study was to evaluate the feasibility of manufacturing and administering (AV) from resected tumor samples, and administration of AV with combination IFN gamma and IFN alpha therapy. Finally, the impact on immunological parameters of these treatment options was assessed. Patients with metastatic RCC were randomly assigned to receive AV plus bCG along with a sequential administration of IFN gamma and a either together or after initiation of vaccine. Toxicity and clinical responses were evaluated. Modulations of the immune system were investigated by analyzing phenotype, cytokine mRNA expression, T cell proliferation and cytotoxicity in the peripheral blood mononuclear cell compartment. Fourteen patients with metastatic renal cell carcinoma were enrolled in this study; 9 were available for response evaluation. In a 70 day period, 3 (33%) showed mixed responses, 5 (56%) stable disease and 1 (11%) progression of disease. Toxicities were consistent with previous clinical reports. In the flow-cytometry phenotype analysis, stimulation of distinct subsets of circulating T-lymphocytes and a decrease of CD8+ T cell subsets was

Perforin and gamma interferon expression are required for CD4+ and CD8+ T-cell-dependent protective immunity against a human parasite, Trypanosoma cruzi, elicited by heterologous plasmid DNA prime-recombinant adenovirus 5 boost vaccination.

PubMed

de Alencar, Bruna C G; Persechini, Pedro M; Haolla, Filipe A; de Oliveira, Gabriel; Silverio, Jaline C; Lannes-Vieira, Joseli; Machado, Alexandre V; Gazzinelli, Ricardo T; Bruna-Romero, Oscar; Rodrigues, Mauricio M

2009-10-01

A heterologous prime-boost strategy using plasmid DNA, followed by replication-defective recombinant adenovirus 5, is being proposed as a powerful way to elicit CD4(+) and CD8(+) T-cell-mediated protective immunity against intracellular pathogens. We confirmed this concept and furthered existing research by providing evidence that the heterologous prime-boost regimen using the gene encoding amastigote surface protein 2 elicited CD4(+) and CD8(+) T-cell-mediated protective immunity (reduction of acute parasitemia and prolonged survival) against experimental infection with Trypanosoma cruzi. Protective immunity correlated with the presence of in vivo antigen-specific cytotoxic activity prior to challenge. Based on this, our second goal was to determine the outcome of infection after heterologous prime-boost immunization of perforin-deficient mice. These mice were highly susceptible to infection. A detailed analysis of the cell-mediated immune responses in immunized perforin-deficient mice showed an impaired gamma interferon (IFN-gamma) secretion by immune spleen cells upon restimulation in vitro with soluble recombinant antigen. In spite of a normal numeric expansion, specific CD8(+) T cells presented several functional defects detected in vivo (cytotoxicity) and in vitro (simultaneous expression of CD107a/IFN-gamma or IFN-gamma/tumor necrosis factor alpha) paralleled by a decreased expression of CD44 and KLRG-1. Our final goal was to determine the importance of IFN-gamma in the presence of highly cytotoxic T cells. Vaccinated IFN-gamma-deficient mice developed highly cytotoxic cells but failed to develop any protective immunity. Our study thus demonstrated a role for perforin and IFN-gamma in a number of T-cell-mediated effector functions and in the antiparasitic immunity generated by a heterologous plasmid DNA prime-adenovirus boost vaccination strategy.

Epstein-Barr Virus Promotes Interferon-α Production by Plasmacytoid Dendritic Cells

PubMed Central

Quan, Timothy E.; Roman, Robert M.; Rudenga, Benjamin J.; Holers, V. Michael; Craft, Joe

2010-01-01

Objective Epstein-Barr virus (EBV) infection has been linked to systemic lupus erythematosus (SLE) as demonstrated by the presence of increased seroprevalence and elevated viral loads, but the mechanism of this linkage has not been elucidated. Increased IFN-α levels and signatures, associated with innate immune responses, have been found in patients with SLE. Plasmacytoid dendritic cells (pDC) are innate immune cells that mediate viral immunity by producing large quantities of interferon alpha (IFN-α), but the role they play during infection with EBV remains unclear. To address this issue, we investigated the ability of EBV to promote IFN-α production by pDC in healthy subjects. Methods Human pDC were sorted and cultured in the presence of EBV, EBV small RNA (EBER), and EBV double-stranded DNA (dsDNA). IFN-α production by pDC was measured by enzyme-linked immunosorbent assay (ELISA), with activation of these cells measured by flow cytometry. Results We demonstrate that EBV DNA and RNA promote IFN-α production by human pDC through engagement of Toll-like receptor (TLR) 9 and TLR7, respectively, with initial viral recognition by pDC mediated by binding to major histocompatibility (MHC) class II molecules. Conclusion These data demonstrate that MHC class II-specific engagement by virus and subsequent viral nucleic acid recognition mediates IFN-α production by pDC. Our results suggest that elevated levels of IFN-α found in lupus patients may be a result of aberrantly controlled chronic viral infection. PMID:20178121

Interferon gamma peptidomimetic targeted to hepatic stellate cells ameliorates acute and chronic liver fibrosis in vivo.

PubMed

Bansal, Ruchi; Prakash, Jai; De Ruiter, Marieke; Poelstra, Klaas

2014-04-10

Hepatic stellate cells play a crucial role in the pathogenesis of hepatic fibrosis. Thus, pharmacological inhibition of pro-fibrotic activities of these cells might lead to an effective therapy for this disease. Among the potent anti-fibrotics, interferon gamma (IFNγ), a proinflammatory cytokine, is highly efficacious but it failed in clinical trials due to the poor efficacy and multiple adverse effects attributed to the ubiquitous IFNγ receptor (IFNγR) expression. To resolve these drawbacks, we chemically synthesized a chimeric molecule containing (a) IFNγ signaling peptide (IFNγ peptidomimetic, mimγ) that retains the agonistic activities of IFNγ but lacks an extracellular receptor recognition sequence for IFNγR; coupled via heterobifunctional PEG linker to (b) bicyclic platelet derived growth factor beta receptor (PDGFβR)-binding peptide (BiPPB) to induce internalization into the stellate cells that express PDGFβR. The synthesized targeted IFNγ peptidomimetic (mimγ-BiPPB) was extensively investigated for its anti-fibrotic and adverse effects in acute and chronic CCl4-induced liver fibrosis models in mice. Treatment with mimγ-BiPPB, after the onset of disease, markedly inhibited both early and established hepatic fibrosis as reflected by a reduced intrahepatic α-SMA, desmin and collagen-I mRNA expression and protein levels. While untargeted mimγ and BiPPB had no effect, and native IFNγ only induced a moderate reduction. Additionally, no off-target effects, e.g. systemic inflammation, were found with mimγ-BiPPB, which were substantially observed in mice treated with native IFNγ. The present study highlights the beneficial effects of a novel BiPPB mediated cell-specific targeting of IFNγ peptidomimetic to the disease-inducing cells and therefore represents a highly potential therapeutic approach to treat fibrotic diseases. Copyright © 2014 Elsevier B.V. All rights reserved.

A link between prompt optical and prompt gamma-ray emission in gamma-ray bursts.

PubMed

Vestrand, W T; Wozniak, P R; Wren, J A; Fenimore, E E; Sakamoto, T; White, R R; Casperson, D; Davis, H; Evans, S; Galassi, M; McGowan, K E; Schier, J A; Asa, J W; Barthelmy, S D; Cummings, J R; Gehrels, N; Hullinger, D; Krimm, H A; Markwardt, C B; McLean, K; Palmer, D; Parsons, A; Tueller, J

2005-05-12

The prompt optical emission that arrives with the gamma-rays from a cosmic gamma-ray burst (GRB) is a signature of the engine powering the burst, the properties of the ultra-relativistic ejecta of the explosion, and the ejecta's interactions with the surroundings. Until now, only GRB 990123 had been detected at optical wavelengths during the burst phase. Its prompt optical emission was variable and uncorrelated with the prompt gamma-ray emission, suggesting that the optical emission was generated by a reverse shock arising from the ejecta's collision with surrounding material. Here we report prompt optical emission from GRB 041219a. It is variable and correlated with the prompt gamma-rays, indicating a common origin for the optical light and the gamma-rays. Within the context of the standard fireball model of GRBs, we attribute this new optical component to internal shocks driven into the burst ejecta by variations of the inner engine. The correlated optical emission is a direct probe of the jet isolated from the medium. The timing of the uncorrelated optical emission is strongly dependent on the nature of the medium.

Risk of tuberculosis among air passengers estimated by interferon gamma release assay: survey of contact investigations, Japan, 2012 to 2015

PubMed Central

Ota, Masaki; Kato, Seiya

2017-01-01

Although the World Health Organization recommends contact investigations around air travel-associated sputum smear-positive tuberculosis (TB) patients, evidence suggests that the information thus obtained may have overestimated the risk of TB infection because it involved some contacts born in countries with high TB burden who were likely to have been infected with TB in the past, or because tuberculin skin tests were used, which are less specific than the interferon gamma release assay (IGRA) particularly in areas where Bacillus Calmette-Guérin (BCG) vaccination coverage is high. We conducted a questionnaire survey on air travel-associated TB contact investigations in local health offices of Japan from 2012 to 2015, focusing on IGRA positivity. Among 651 air travel-associated TB contacts, average positivity was 3.8% (95% confidence interval (CI): 2.5–5.6) with a statistically significant increasing trend with older age (p < 0.0094). Positivity among 0–34 year-old contacts was 1.0% (95% CI: 0.12–3.5%), suggesting their risk of TB infection is as small as among Japanese young adults with low risk of TB infection (positivity: 0.85–0.90%). Limiting the contact investigation to fewer passengers (within two seats surrounding the index case, rather than two rows) seems reasonable in the case of aircraft with many seats per row. PMID:28367799

Analyzing the Utilization of Interferon-Gamma Screening for Tuberculosis at Recruit Training Command, Great Lakes

DTIC Science & Technology

2006-05-31

the project through a business case analysis conducted on this same subject. CAPT Monestersky, Preventive Medicine; LCDR Jacobs, Occupational Medicine...TB and LTBI (Taylor, Nolan, & Blumberg , Interferon-y screening for TB 8 2005). They are based on science founded in the 1 9 th century. The current...identify individuals who may not be suitable for service. For the majority who are suitable, the "P" days allow time to complete necessary business

Enzyme-linked immunosorbent assay for Escherichia coli heat-stable enterotoxin type II.

PubMed Central

Handl, C; Rönnberg, B; Nilsson, B; Olsson, E; Jonsson, H; Flock, J I

1988-01-01

The gene for Escherichia coli heat-stable enterotoxin type II (STII) was fused to the genes for protein A from Staphylococcus aureus and beta-galactosidase in two different expression systems. Antibodies raised in rabbits against the protein A-STII fusion protein recognized the beta-galactosidase-STII fusion protein. The latter fusion protein was used as the immobilized antigen in an enzyme-linked immunosorbent assay (ELISA) for detection of STII. The correlation between the results of the ELISA and the intestinal loop test in piglets was 95%, suggesting that the ELISA can be used to reliably detect STII. Images PMID:3049659

Determination of PCBs in fish using enzyme-linked immunosorbent assay (ELISA)

USGS Publications Warehouse

Lasrado, J.A.; Santerre, C.R.; Zajicek, J.L.; Stahl, J.R.; Tillitt, D.E.; Deardorff, D.

2003-01-01

Polychlorinated biphenyls (PCBs) were determined in fish tissue using an enzyme-linked immunosorbent assay (ELISA). Standard curves for Aroclor 1248, 1254, and 1260 in catfish tissue were developed with ranges from 0.05 to 0.5 ppm and 0.5 to 5.0 ppm. Wild fish were initially analyzed using gas chromatography/electron-capture detection (GC/ECD) and those having residues within the standard curve ranges were analyzed with ELISA. Results obtained using ELISA and GC/ECD were not significantly different (p < 0.05) from 0.05 to 0.5 ppm. From 0.5 to 5.0 ppm, the standard curve for Aroclor 1254 was the best predictor of total PCB in wild fish samples.

A complete thermodynamic analysis of enzyme turnover links the free energy landscape to enzyme catalysis.

PubMed

Jones, Hannah B L; Wells, Stephen A; Prentice, Erica J; Kwok, Anthony; Liang, Liyin L; Arcus, Vickery L; Pudney, Christopher R

2017-09-01

Our understanding of how enzymes work is coloured by static structure depictions where the enzyme scaffold is presented as either immobile, or in equilibrium between well-defined static conformations. Proteins, however, exhibit a large degree of motion over a broad range of timescales and magnitudes and this is defined thermodynamically by the enzyme free energy landscape (FEL). The role and importance of enzyme motion is extremely contentious. Much of the challenge is in the experimental detection of so called 'conformational sampling' involved in enzyme turnover. Herein we apply combined pressure and temperature kinetics studies to elucidate the full suite of thermodynamic parameters defining an enzyme FEL as it relates to enzyme turnover. We find that the key thermodynamic parameters governing vibrational modes related to enzyme turnover are the isobaric expansivity term and the change in heat capacity for enzyme catalysis. Variation in the enzyme FEL affects these terms. Our analysis is supported by a range of biophysical and computational approaches that specifically capture information on protein vibrational modes and the FEL (all atom flexibility calculations, red edge excitation shift spectroscopy and viscosity studies) that provide independent evidence for our findings. Our data suggest that restricting the enzyme FEL may be a powerful strategy when attempting to rationally engineer enzymes, particularly to alter thermal activity. Moreover, we demonstrate how rational predictions can be made with a rapid computational approach. © 2017 Federation of European Biochemical Societies.

Essential Cell-Autonomous Role for Interferon (IFN) Regulatory Factor 1 in IFN-γ-Mediated Inhibition of Norovirus Replication in Macrophages

PubMed Central

Maloney, Nicole S.; Thackray, Larissa B.; Goel, Gautam; Hwang, Seungmin; Duan, Erning; Vachharajani, Punit; Xavier, Ramnik

2012-01-01

Noroviruses (NVs) cause the majority of cases of epidemic nonbacterial gastroenteritis worldwide and contribute to endemic enteric disease. However, the molecular mechanisms responsible for immune control of their replication are not completely understood. Here we report that the transcription factor interferon regulatory factor 1 (IRF-1) is required for control of murine NV (MNV) replication and pathogenesis in vivo. This led us to studies documenting a cell-autonomous role for IRF-1 in gamma interferon (IFN-γ)-mediated inhibition of MNV replication in primary macrophages. This role of IRF-1 in the inhibition of MNV replication by IFN-γ is independent of IFN-αβ signaling. While the signal transducer and activator of transcription STAT-1 was also required for IFN-γ-mediated inhibition of MNV replication in vitro, class II transactivator (CIITA), interferon regulatory factor 3 (IRF-3), and interferon regulatory factor 7 (IRF-7) were not required. We therefore hypothesized that there must be a subset of IFN-stimulated genes (ISGs) regulated by IFN-γ in a manner dependent only on STAT-1 and IRF-1. Analysis of transcriptional profiles of macrophages lacking various transcription factors confirmed this hypothesis. These studies identify a key role for IRF-1 in IFN-γ-dependent control of norovirus infection in mice and macrophages. PMID:22973039

Rapid activation of the interferon system in vivo.

PubMed Central

Dianzani, F; Gullino, P; Baron, S

1978-01-01

Experiments were carried out to study the kinetics of local interferon production in the subcutaneous tissues of rats stimulated with Newcastle disease virus. Specifically, the interferon produced and released in the extracellular fluids was collected at various intervals of time in micropore chambers implanted into the subcutaneous tissue of rats. Interferon was detected at moderate titers 1 h after induction, and it was present at high titer at 2 h. The interferon levels remained remarkably high in the samples collected after 3, 5, and 24 h, and in some rats it was still detectable after 48 and 72 h. Since control experiments showed that it requires 2 to 3 h for interferon to penetrate the chambers, it may be concluded that high concentrations of interferon are present in the extracellular fluid within 1 h of induction. The evaluation of the kinetics of production and of the concentrations attained in the extracellular fluid suggests that in a solid tissue a cell infected by a potent interferon inducer may produce interferon early enough and in sufficient quantity to protect neighboring cells before the production of progeny virions. PMID:669799

Nipah Virus V Protein Evades Alpha and Gamma Interferons by Preventing STAT1 and STAT2 Activation and Nuclear Accumulation

PubMed Central

Rodriguez, Jason J.; Parisien, Jean-Patrick; Horvath, Curt M.

2002-01-01

Characterization of recent outbreaks of fatal encephalitis in southeast Asia identified the causative agent to be a previously unrecognized enveloped negative-strand RNA virus of the Paramyxoviridae family, Nipah virus. One feature linking Nipah virus to this family is a conserved cysteine-rich domain that is the hallmark of paramyxovirus V proteins. The V proteins of other paramyxovirus species have been linked with evasion of host cell interferon (IFN) signal transduction and subsequent antiviral responses by inducing proteasomal degradation of the IFN-responsive transcription factors, STAT1 or STAT2. Here we demonstrate that Nipah virus V protein escapes IFN by a distinct mechanism involving direct inhibition of STAT protein function. Nipah virus V protein differs from other paramyxovirus V proteins in its subcellular distribution but not in its ability to inhibit cellular IFN responses. Nipah virus V protein does not induce STAT degradation but instead inhibits IFN responses by forming high-molecular-weight complexes with both STAT1 and STAT2. We demonstrate that Nipah virus V protein accumulates in the cytoplasm by a Crm1-dependent mechanism, alters the STAT protein subcellular distribution in the steady state, and prevents IFN-stimulated STAT redistribution. Consistent with the formation of complexes, STAT protein tyrosine phosphorylation is inhibited in cells expressing the Nipah virus V protein. As a result, Nipah virus V protein efficiently prevents STAT1 and STAT2 nuclear translocation in response to IFN, inhibiting cellular responses to both IFN-α and IFN-γ. PMID:12388709

A novel collagen hydrogel cross-linked by gamma-ray irradiation in acidic pH conditions.

PubMed

Inoue, Naoki; Bessho, Masahiko; Furuta, Masakazu; Kojima, Takao; Okuda, Shuichi; Hara, Masayuki

2006-01-01

We made a new type of collagen gel by gamma-ray irradiation of an acidic solution of type-I collagen, and performed comparative studies on a conventional gel and the new type of gel. The neutral gel, a conventional 0.3% (w/v) collagen gel, was formed at neutral pH and then irradiated by gamma-rays. The acidic gel, a 0.3% (w/v) collagen gel, was formed directly from the acidic solution of collagen by y-ray irradiation. Both types of gel were prepared, swollen in water and then dried for the measurement of specific water content. The neutral gel showed a relatively high specific water content and shrunk moderately, depending on the dose, while the acidic gel showed lower specific water content and shrunk clearly by y-ray irradiation. A three-dimensional tangled network of microfibrils was clearly observed in the neutral gels by scanning electron microscopy, but not in the acidic gels. From these results, we concluded that the acidic gel was quite different from a conventional collagen gel. Sodium dodecylsulfate-polyacrylamide gel electrophoresis showed that the alpha1 subunit and alpha2 subunit of the collagen molecule were cross-linked. The triple-helical structure of collagen was only partially perturbed, but not denatured completely, because the circular dichroism spectrum of the collagen solution irradiated at 1.3 kGy was similar to that of native collagen solution. Amino-acid analysis revealed that tyrosine, phenylalanine and histidine decreased by irradiation in the neutral gel. In the case of the acidic gel, these three amino acids and methionine decreased. We considered that these amino acids were cross-linking points between the collagen subunits during the gamma-ray irradiation.

Human B cells fail to secrete type I interferons upon cytoplasmic DNA exposure.

PubMed

Gram, Anna M; Sun, Chenglong; Landman, Sanne L; Oosenbrug, Timo; Koppejan, Hester J; Kwakkenbos, Mark J; Hoeben, Rob C; Paludan, Søren R; Ressing, Maaike E

2017-11-01

Most cells are believed to be capable of producing type I interferons (IFN I) as part of an innate immune response against, for instance, viral infections. In macrophages, IFN I is potently induced upon cytoplasmic exposure to foreign nucleic acids. Infection of these cells with herpesviruses leads to triggering of the DNA sensors interferon-inducible protein 16 (IFI16) and cyclic GMP-AMP (cGAMP) synthase (cGAS). Thereby, the stimulator of interferon genes (STING) and the downstream molecules TANK-binding kinase 1 (TBK1) and interferon regulatory factor 3 (IRF3) are sequentially activated culminating in IFN I secretion. Human gamma-herpesviruses, such as Epstein-Barr virus (EBV), exploit B cells as a reservoir for persistent infection. In this study, we investigated whether human B cells, similar to macrophages, engage the cytoplasmic DNA sensing pathway to induce an innate immune response. We found that the B cells fail to secrete IFN I upon cytoplasmic DNA exposure, although they express the DNA sensors cGAS and IFI16 and the signaling components TBK1 and IRF3. In primary human B lymphocytes and EBV-negative B cell lines, this deficiency is explained by a lack of detectable levels of the central adaptor protein STING. In contrast, EBV-transformed B cell lines did express STING, yet both these lines as well as STING-reconstituted EBV-negative B cells did not produce IFN I upon dsDNA or cGAMP stimulation. Our combined data show that the cytoplasmic DNA sensing pathway is dysfunctional in human B cells. This exemplifies that certain cell types cannot induce IFN I in response to cytoplasmic DNA exposure providing a potential niche for viral persistence. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

In vivo induction of interferon gamma expression in grey horses with metastatic melanoma resulting from direct injection of plasmid DNA coding for equine interleukin 12.

PubMed

Müller, J-M V; Wissemann, J; Meli, M L; Dasen, G; Lutz, H; Heinzerling, L; Feige, K

2011-11-01

Whole blood pharmacokinetics of intratumourally injected naked plasmid DNA coding for equine Interleukin 12 (IL-12) was assessed as a means of in vivo gene transfer in the treatment of melanoma in grey horses. The expression of induced interferon gamma (IFN-g) was evaluated in order to determine the pharmacodynamic properties of in vivo gene transduction. Seven grey horses bearing melanoma were injected intratumourally with 250 µg naked plasmid DNA coding for IL-12. Peripheral blood and biopsies from the injection site were taken at 13 time points until day 14 post injection (p.i.). Samples were analysed using quantitative real-time PCR. Plasmid DNA was quantified in blood samples and mRNA expression for IFN-g in tissue samples. Plasmid DNA showed fast elimination kinetics with more than 99 % of the plasmid disappearing within 36 hours. IFN-g expression increased quickly after IL-12 plasmid injection, but varied between individual horses. Intratumoural injection of plasmid DNA is a feasible method for inducing transgene expression in vivo. Biological activity of the transgene IL-12 was confirmed by measuring expression of IFN-g.

Facile fabrication of core cross-linked micelles by RAFT polymerization and enzyme-mediated reaction.

PubMed

Wu, Yukun; Lai, Quanyong; Lai, Shuqi; Wu, Jing; Wang, Wei; Yuan, Zhi

2014-06-01

Polymeric micelles formed in aqueous solution by assembly of amphiphilic block copolymers have been extensively investigated due to their great potential as drug carriers. However, the stability of polymeric assembly is still one of the major challenges in delivering drugs to tissues and cells. Here, we report a facile route to fabricate core cross-linked (CCL) micelles using an enzymatic polymerization as the cross-linking method. We present synthesis of poly(ethylene glycol)-block-poly(N-isopropyl acrylamide-co-N-(4-hydroxyphenethyl) acrylamide) diblock copolymer PEG-b-P(NIPAAm-co-NHPAAm) via reversible addition-fragmentation chain transfer (RAFT) polymerization. The diblock copolymer was then self-assembled into non-cross-linked (NCL) micelles upon heating above the lower critical solution temperature (LCST), and subsequently cross-linked using horseradish peroxidase (HRP) and hydrogen peroxide (H2O2) as enzyme and oxidant. The characterization of the diblock copolymer and micelles were studied by NMR, DLS, UV-vis, and fluorescence spectroscopy. The fluorescence study reveals that the cross-linking process endows the micelles with much lower critical micelle concentration (CMC). In addition, the drug release study shows that the CCL micelles have lower release amount of doxorubicin (DOX) than the NCL micelles due to the enhanced stability of the CCL micelles by core cross-linking process. Copyright © 2014 Elsevier B.V. All rights reserved.

[Effects of interferon-gamma on cytotoxicity of murine activated macrophages against murine glioma cells].

PubMed

Ohyama, K; Kikuchi, H; Oda, Y; Moritake, K; Yamasaki, T

1993-06-01

We studied the effects of mouse IFN-gamma on the cytotoxic activity of murine activated macrophages (M phi) against mouse VM-Glioma cells (H-2b). Activated M phi were obtained from peritoneal exudate cells of mice from four strains, C57BL/6 (H-2b), C3H/He(H-2k), DBA/2 (H-2d), and BALB/c (H-2d), following intraperitoneal injection of (1) LPS 200 micrograms, (2) BCG 200 micrograms, (3) C. parvum 200 micrograms, or (4) MDP 350 micrograms 7 days prior to 20-hr 51Cr release-assay. Of the various combination of mouse strains and activating agents tested, that of activated M phi of the C3H/He mouse with induction by LPS had the most tumoricidal effect against the glioma cells, which was not MHC restricted. Although LPS-activated M phi underwent marked loss of cytotoxicity following initiation of in vitro culture, this 24 hr pretreatment with IFN-gamma inhibited this reduction in tumoricidal effects in a dose-dependent fashion. On the other hand, 24 hr pretreatment of target cells with IFN-gamma did not increase their susceptibility to lysis by activated M phi. These findings suggest that IFN-gamma augments the in vitro tumoricidal activation of M phi; This effect appears to be unrelated to any influence of IFN-gamma on target sensitivity to lysis by macrophages.

Epitope-blocking enzyme-linked immunosorbent assay for detection of antibodies to Ross River virus in vertebrate sera.

PubMed

Oliveira, Nidia M M; Broom, Annette K; Mackenzie, John S; Smith, David W; Lindsay, Michael D A; Kay, Brian H; Hall, Roy A

2006-07-01

We describe the development of an epitope-blocking enzyme-linked immunosorbent assay (ELISA) for the sensitive and rapid detection of antibodies to Ross River virus (RRV) in human sera and known vertebrate host species. This ELISA provides an alternative method for the serodiagnosis of RRV infections.

Enzyme-Linked Immunosorbent Assay and Serologic Responses to Pneumocystis jiroveci

PubMed Central

Koch, Judy; Levin, Linda; Walzer, Peter D.

2004-01-01

Seroepidemiologic studies of Pneumocystis pneumonia (PCP) in humans have been limited by inadequate reagents. We have developed an enzyme-linked immunosorbent assay (ELISA) using three overlapping recombinant fragments of the human Pneumocystis major surface glycoprotein (MsgA, MsgB, and MsgC) for analysis of antibody responses in HIV-positive patients and healthy blood donors. HIV-positive patients had significantly higher antibody levels to all Msg fragments. Furthermore, HIV-positive patients who experienced a previous episode of PCP (PCP-positive) had higher level of antibodies to MsgC than patients who never had PCP. A significant association was found between ELISA antibody level and reactivity by Western blot in HIV-positive patients, especially those who were PCP-positive. Thus, this ELISA will be useful in studying serum antibody responses to Pneumocystis in different human populations. PMID:15200818

Validation of a KHV antibody enzyme-linked immunosorbent assay (ELISA).

PubMed

Bergmann, S M; Wang, Q; Zeng, W; Li, Y; Wang, Y; Matras, M; Reichert, M; Fichtner, D; Lenk, M; Morin, T; Olesen, N J; Skall, H F; Lee, P-Y; Zheng, S; Monaghan, S; Reiche, S; Fuchs, W; Kotler, M; Way, K; Bräuer, G; Böttcher, K; Kappe, A; Kielpinska, J

2017-11-01

Koi herpesvirus (KHV) causes KHV disease (KHVD). The virus is highly contagious in carp or koi and can induce a high mortality. Latency and, in some cases, a lack of signs presents a challenge for virus detection. Appropriate immunological detection methods for anti-KHV antibodies have not yet been fully validated for KHV. Therefore, it was developed and validated an enzyme-linked immunosorbent assay (ELISA) to detect KHV antibodies. The assay was optimized with respect to plates, buffers, antigens and assay conditions. It demonstrated high diagnostic and analytical sensitivity and specificity and was particularly useful at the pond or farm levels. Considering the scale of the carp and koi industry worldwide, this assay represents an important practical tool for the indirect detection of KHV, also in the absence of clinical signs. © 2017 John Wiley & Sons Ltd.

Lack of induction of tissue transglutaminase but activation of the preexisting enzyme in c-Myc-induced apoptosis of CHO cells.

PubMed

Balajthy, Z; Kedei, N; Nagy, L; Davies, P J; Fésüs, L

1997-07-18

The intracellular activity and expression of tissue transglutaminase, which crosslinks proteins through epsilon(gamma-glutamyl)lysine isodipeptide bond, was investigated in CHO cells and those stably transfected with either inducible c-Myc (which leads to apoptosis) or with c-myc and the apoptosis inhibitor Bcl-2. Protein-bound cross-link content was significantly higher when apoptosis was induced by c-Myc while the concomitant presence of Bcl-2 markedly reduced both apoptosis and enzymatic protein cross-linking. The expression of tissue transglutaminase did not change following the initiation of apoptosis by c-Myc or when it was blocked by Bcl-2. Studying transiently co-transfected elements of the mouse tissue transglutaminase promoter linked to a reporter enzyme revealed their overall repression in cells expressing c-Myc. This repression was partially suspended in cells also carrying Bcl-2. Our data suggest that tissue transglutaminase is not induced when c-Myc initiates apoptosis but the pre-existing endogenous enzyme is activated.

Enzyme-linked immunosorbent assays for determination of plasma aldosterone using highly specific polyclonal antibodies.

PubMed

Schwartz, F; Hadas, E; Harnik, M; Solomon, B

1990-01-01

Two enzyme-linked immunosorbent assays were established and compared for the estimation of plasma aldosterone. In the first method immobilized aldosterone-protein complexes on the ELISA plates compete with aldosterone to be determined for the binding of certain amount of anti-aldosterone antibodies. The sensitivity of this method depends on the protein carrier used to conjugate with aldosterone. In the second method, anti-aldosterone antibodies adsorbed on ELISA plates compete for binding of known amount of the enzyme-labeled aldosterone and aldosterone to be determined. The highly specific rabbit anti-aldosterone antibodies were obtained by injection of aldosterone-oxime thyroglobulin. The detection limit of aldosterone in both methods ranged between 2-20 pg. The proposed assays are suitable for the determination of aldosterone in biological fluids compared with other reported ELISA assays, as well as with RIA.

Role of interleukin 12 in experimental neonatal sepsis caused by group B streptococci.

PubMed Central

Mancuso, G; Cusumano, V; Genovese, F; Gambuzza, M; Beninati, C; Teti, G

1997-01-01

Cytokines are suspected to play an important role in systemic infections by group B streptococci (GBS), an important cause of neonatal sepsis. This work was undertaken to determine if interleukin 12 (IL-12) is produced in mouse pups infected with GBS and has a role in this sepsis model. IL-12 elevations were measured by both an enzyme-linked immunosorbent assay and a bioassay in plasma samples obtained from 12 to 72 h after GBS challenge. Pretreatment with neutralizing anti-IL-12 antibodies significantly increased lethality and blood CFU (P < 0.05). Conversely, either prophylactically or therapeutically administered recombinant IL-12 (rIL-12) significantly improved survival time and decreased blood CFU. Since these beneficial effects were associated with increased spleen gamma interferon (IFN-gamma) production, we examined whether the latter cytokine mediated the observed rIL-12 effects. Pretreatment with neutralizing anti-IFN-gamma monoclonal antibodies significantly counteracted the beneficial effects of rIL-12 on lethality. Our data indicate that rIL-12 is a possible candidate for treatment of GBS sepsis and that its activities in this model are at least partially mediated by IFN-gamma. PMID:9284145

C-Reactive Protein (CRP), Interferon Gamma-Inducible Protein 10 (IP-10), and Lipopolysaccharide (LPS) Are Associated with Risk of Tuberculosis after Initiation of Antiretroviral Therapy in Resource-Limited Settings

PubMed Central

Tenforde, Mark W.; Gupte, Nikhil; Dowdy, David W.; Asmuth, David M.; Balagopal, Ashwin; Pollard, Richard B.; Sugandhavesa, Patcharaphan; Lama, Javier R.; Pillay, Sandy; Cardoso, Sandra W.; Pawar, Jyoti; Santos, Breno; Riviere, Cynthia; Mwelase, Noluthando; Kanyama, Cecilia; Kumwenda, Johnstone; Hakim, James G.; Kumarasamy, Nagalingeswaran; Bollinger, Robert; Semba, Richard D.; Campbell, Thomas B.; Gupta, Amita

2015-01-01

Objective The association between pre-antiretroviral (ART) inflammation and immune activation and risk for incident tuberculosis (TB) after ART initiation among adults is uncertain. Design Nested case-control study (n = 332) within ACTG PEARLS trial of three ART regimens among 1571 HIV-infected, treatment-naïve adults in 9 countries. We compared cases (participants with incident TB diagnosed by 96 weeks) to a random sample of controls (participants who did not develop TB, stratified by country and treatment arm). Methods We measured pre-ART C-reactive protein (CRP), EndoCab IgM, ferritin, interferon gamma (IFN-γ), interleukin 6 (IL-6), interferon gamma-inducible protein 10 (IP-10), lipopolysaccharide (LPS), soluble CD14 (sCD14), tumor necrosis factor alpha (TNF-α), and CD4/DR+/38+ and CD8/DR+/38+ T cells. Markers were defined according to established cutoff definitions when available, 75th percentile of measured values when not, and detectable versus undetectable for LPS. Using logistic regression, we measured associations between biomarkers and incident TB, adjusting for age, sex, study site, treatment arm, baseline CD4 and log10 viral load. We assessed the discriminatory value of biomarkers using receiver operating characteristic (ROC) analysis. Results Seventy-seven persons (4.9%) developed incident TB during follow-up. Elevated baseline CRP (aOR 3.25, 95% CI: 1.55–6.81) and IP-10 (aOR 1.89, 95% CI: 1.05–3.39), detectable plasma LPS (aOR 2.39, 95% CI: 1.13–5.06), and the established TB risk factors anemia and hypoalbuminemia were independently associated with incident TB. In ROC analysis, CRP, albumin, and LPS improved discrimination only modestly for TB risk when added to baseline routine patient characteristics including CD4 count, body mass index, and prior TB. Conclusion Incident TB occurs commonly after ART initiation. Although associated with higher post-ART TB risk, baseline CRP, IP-10, and LPS add limited value to routine patient characteristics

Gene expression and production of tumor necrosis factor alpha, interleukin 1, interleukin 6, and gamma interferon in C3H/HeN and C57BL/6N mice in acute Mycoplasma pulmonis disease.

PubMed Central

Faulkner, C B; Simecka, J W; Davidson, M K; Davis, J K; Schoeb, T R; Lindsey, J R; Everson, M P

1995-01-01

Studies were conducted to determine whether the production of various cytokines is associated with Mycoplasma pulmonis disease expression. Susceptible C3H/HeN and resistant C57BL/6N mice were inoculated intranasally with 10(7) CFU of virulent M. pulmonis UAB CT or avirulent M. pulmonis UAB T. Expression of genes for tumor necrosis factor alpha (TNF-alpha), interleukin 1 alpha (IL-1 alpha), IL-1 beta, IL-6, and gamma interferon (IFN-gamma) in whole lung tissue and TNF-alpha gene expression in bronchoalveolar lavage (BAL) cells was determined by reverse transcription-PCR using specific cytokine primers at various times postinoculation. In addition, concentrations of TNF-alpha, IL-1, IL-6, and IFN-gamma were determined in BAL fluid and serum samples at various times postinoculation. Our results showed that there was a sequential appearance of cytokines in the lungs of infected mice: TNF-alpha, produced primarily by BAL cells, appeared first, followed by IL-1 and IL-6, which were followed by IFN-gamma. Susceptible C3H/HeN mice had higher and more persistent concentrations of TNF-alpha and IL-6 in BAL fluid than did resistant C57BL/6N mice, indicating that TNF-alpha and possibly IL-6 are important factors in pathogenesis of acute M. pulmonis disease in mice. Serum concentrations of IL-6 were elevated in C3H/HeN mice, but not C57BL/6N mice, following infection with M. pulmonis, suggesting that IL-6 has both local and systemic effects in M. pulmonis disease. PMID:7558323

Multicenter comparison of levels of antibody to the Neisseria meningitidis group A capsular polysaccharide measured by using an enzyme-linked immunosorbent assay.

PubMed Central

Carlone, G M; Frasch, C E; Siber, G R; Quataert, S; Gheesling, L L; Turner, S H; Plikaytis, B D; Helsel, L O; DeWitt, W E; Bibb, W F

1992-01-01

There is no standard immunoassay for evaluating immune responses to meningococcal vaccines. We developed an enzyme-linked immunosorbent assay to measure total levels of antibody to Neisseria meningitidis group A capsular polysaccharide. Five laboratories measured the antibody levels in six paired pre- and postvaccination serum samples by using the enzyme-linked immunosorbent assay. Methylated human serum albumin was used to bind native group A polysaccharide to microtiter plate surfaces. The between-laboratory coefficients of variation for pre- and postvaccination sera had ranges of 31 to 91 and 17 to 31, respectively. The mean laboratory coefficients of variation for pre- and postvaccination sera, respectively, were 17 and 11 (Molecular Biology Laboratory, Centers for Disease Control), 12 and 15 (Immunodiagnostic Methods Laboratory, Centers for Disease Control), 22 and 19 (Dana-Farber Cancer Institute), 38 and 38 (Bacterial Polysaccharide Laboratory, U.S. Food and Drug Administration), and 11 and 10 (Praxis Biologics, Inc.). Standardization of this enzyme-linked immunosorbent assay should allow interlaboratory comparison of meningococcal vaccine immunogenicity, thus providing a laboratory-based assessment tool for evaluating meningococcal vaccines. PMID:1734048

Interferon-gamma increased epithelial barrier function via upregulating claudin-7 expression in human submandibular gland duct epithelium.

PubMed

Abe, Ayumi; Takano, Kenichi; Kojima, Takashi; Nomura, Kazuaki; Kakuki, Takuya; Kaneko, Yakuto; Yamamoto, Motohisa; Takahashi, Hiroki; Himi, Tetsuo

2016-06-01

Tight junctions (TJs) are necessary for salivary gland function and may serve as indicators of salivary gland epithelial dysfunction. IgG4-related disease (IgG4-RD) is a newly recognized fibro-inflammatory condition which disrupts the TJ associated epithelial barrier. The salivary glands are one of the most frequently involved organs in IgG4-RD, however, changes of the TJ associated epithelial barrier in salivary gland duct epithelium is poorly understood. Here, we investigated the regulation and function of TJs in human submandibular gland ductal epithelial cells (HSDECs) in normal and IgG4-RD. We examined submandibular gland (SMG) tissue from eight control individuals and 22 patients with IgG4-RD and established an HSDEC culture system. Immunohistochemistry, immunocytochemistry, western blotting, and measurement of transepithelial electrical resistance (TER) were performed. Claudin-4, claudin-7, occludin, and JAM-A were expressed at the apical side of the duct epithelium in submandibular gland (SMG) tissue and at the cell borders in HSDECs of normal and IgG4-RD. The expression and distribution of TJs in SMG tissue were not different in control individuals and patients with IgG4-RD in vivo and in vitro. Although interferon-gamma (IFNγ) generally disrupts the integrity and function of TJs, as manifested by decreased epithelial barrier function, IFNγ markedly increased the epithelial barrier function of HSDECs via upregulation of claudin-7 expression in HSDECs from patients with IgG4-RD. This is the first report showing an IFNγ-dependent increase in epithelial barrier function in the salivary gland duct epithelium. Our results provide insights into the functional significance of TJs in salivary gland duct epithelium in physiological and pathological conditions, including IgG4-RD.

Expression of the Kynurenine Pathway in Human Peripheral Blood Mononuclear Cells: Implications for Inflammatory and Neurodegenerative Disease.

PubMed

Jones, Simon P; Franco, Nunzio F; Varney, Bianca; Sundaram, Gayathri; Brown, David A; de Bie, Josien; Lim, Chai K; Guillemin, Gilles J; Brew, Bruce J

2015-01-01

The kynurenine pathway is a fundamental mechanism of immunosuppression and peripheral tolerance. It is increasingly recognized as playing a major role in the pathogenesis of a wide variety of inflammatory, neurodegenerative and malignant disorders. However, the temporal dynamics of kynurenine pathway activation and metabolite production in human immune cells is currently unknown. Here we report the novel use of flow cytometry, combined with ultra high-performance liquid chromatography and gas chromatography-mass spectrometry, to sensitively quantify the intracellular expression of three key kynurenine pathway enzymes and the main kynurenine pathway metabolites in a time-course study. This is the first study to show that up-regulation of indoleamine 2,3-dioxygenase (IDO-1), kynurenine 3-monoxygenase (KMO) and quinolinate phosphoribosyltransferase (QPRT) is lacking in lymphocytes treated with interferon gamma. In contrast, peripheral monocytes showed a significant elevation of kynurenine pathway enzymes and metabolites when treated with interferon gamma. Expression of IDO-1, KMO and QPRT correlated significantly with activation of the kynurenine pathway (kynurenine:tryptophan ratio), quinolinic acid concentration and production of the monocyte derived, pro-inflammatory immune response marker: neopterin. Our results also describe an original and sensitive methodological approach to quantify kynurenine pathway enzyme expression in cells. This has revealed further insights into the potential role of these enzymes in disease processes.

The kinetics-based enzyme-linked immunosorbent assay for coronavirus antibodies in cats: calibration to the indirect immunofluorescence assay and computerized standardization of results through normalization to control values.

PubMed

Barlough, J E; Jacobson, R H; Downing, D R; Lynch, T J; Scott, F W

1987-01-01

The computer-assisted, kinetics-based enzyme-linked immunosorbent assay for coronavirus antibodies in cats was calibrated to the conventional indirect immunofluorescence assay by linear regression analysis and computerized interpolation (generation of "immunofluorescence assay-equivalent" titers). Procedures were developed for normalization and standardization of kinetics-based enzyme-linked immunosorbent assay results through incorporation of five different control sera of predetermined ("expected") titer in daily runs. When used with such sera and with computer assistance, the kinetics-based enzyme-linked immunosorbent assay minimized both within-run and between-run variability while allowing also for efficient data reduction and statistical analysis and reporting of results.

Gamma Oscillations and Visual Binding

NASA Astrophysics Data System (ADS)

Robinson, Peter A.; Kim, Jong Won

2006-03-01

At the root of visual perception is the mechanism the brain uses to analyze features in a scene and bind related ones together. Experiments show this process is linked to oscillations of brain activity in the 30-100 Hz gamma band. Oscillations at different sites have correlation functions (CFs) that often peak at zero lag, implying simultaneous firing, even when conduction delays are large. CFs are strongest between cells stimulated by related features. Gamma oscillations are studied here by modeling mm-scale patchy interconnections in the visual cortex. Resulting predictions for gamma responses to stimuli account for numerous experimental findings, including why oscillations and zero-lag synchrony are associated, observed connections with feature preferences, the shape of the zero-lag peak, and variations of CFs with attention. Gamma waves are found to obey the Schroedinger equation, opening the possibility of cortical analogs of quantum phenomena. Gamma instabilities are tied to observations of gamma activity linked to seizures and hallucinations.

GammaM23K, gammaM232K, and gammaL77K single substitutions in the TF1-ATPase lower ATPase activity by disrupting a cluster of hydrophobic side chains.

PubMed

Bandyopadhyay, Sanjay; Allison, William S

2004-07-27

In crystal structures of the bovine F(1)-ATPase (MF(1)), the side chains of gammaMet(23), gammaMet(232), and gammaLeu(77) interact in a cluster. Substitution of the corresponding residues in the alpha(3)beta(3)gamma subcomplex of TF(1) with lysine lowers the ATPase activity to 2.3, 11, and 15%, respectively, of that displayed by wild-type. In contrast, TF(1) subcomplexes containing the gammaM(23)C, gammaM(232)C, and gammaL(77)C substitutions display 36, 36, and 130%, respectively, of the wild-type ATPase activity. The ATPase activity of the gammaM(23)C/gammaM(232)C double mutant subcomplex is 36% that of the wild-type subcomplex before and after cross-linking the introduced cysteines, whereas the ATPase activity of the gammaM(23)C/L(77)C double mutant increased from 50 to 85% that of wild-type after cross-linking the introduced cysteines. Only beta-beta cross-links formed when the alpha(3)(betaE(395)C)(3)gammaM(23)C double mutant was inactivated with CuCl(2). The overall results suggest that the attenuated ATPase of the mutant subcomplexes containing the gammaM(23)K, gammaL(77)K, and gammaM(232)K substitutions is caused by disruption of the cluster of hydrophobic amino acid side chains and that the midregion of the coiled-coil comprised of the amino- and carboxyl-terminal alpha helices of the gamma subunit does not undergo unwinding or major displacement from the side chain of gammaLeu(77) during ATP-driven rotation of the gamma subunit.

A sensitive monoclonal antibody-based enzyme-linked immunosorbent assay for chlorpyrifos residue determination in Chinese agricultural smaples

USDA-ARS?s Scientific Manuscript database

A monoclonal antibody-based competitive antibody-coated enzyme-linked immunosorbent assay (ELISA) was developed and optimized for determining chlorpyrifos residue in agricultural products. The IC50 and IC10 of this ELISA were 3.3 ng/mL and 0.1 ng/mL respectively. The average recoveries recovery rate...

Interferon-gamma +874 T/A and interleukin-10 -1082 A/G single nucleotide polymorphism in Egyptian children with tuberculosis.

PubMed

Mosaad, Y M; Soliman, O E; Tawhid, Z E; Sherif, D M

2010-10-01

The aim was to investigate the association of interferon-gamma (IFN-γ) +874 T/A and interleukin-10 (IL-10)-1082 A/G single nucleotide polymorphisms with tuberculous infection and post-BCG lymphadenitis in Egyptian children. IFN-γ +874 T/A and IL-10 -1082 A/G polymorphism detection by amplification refractory mutation system technique was carried out for 110 patients with TB, 40 patients with post-BCG lymphadenitis and 118 healthy controls. IFN-γ +874 A allele was higher in TB and post-BCG patients than those in healthy controls (Pc=0.006 and 0.002, respectively). IFN-γ +874 genotype AA was significantly higher in patients with TB than that in control (Pc=0.015), in extrapulmonary than patients with pulmonary TB (PTB) (Pc=0.009), and young children with TB below 5 years (Pc=0.024). No statistically significant differences were observed between patients with TB and controls for the frequency of IL-10(-1082) alleles or genotypes (P>0.05); however, a statistically significant difference in the frequency of IL-10 (-1082) GG genotype was found between patients with pulmonary and extrapulmonary TB (Pc=0.003). Low producer IFN-γ +874 A/A genotype is associated with post-BCG lymphadenitis and TB disease especially in younger children below 5 years. IL-10-1082 G/G genotype did not exhibit significant association except for increased GG frequency in PTB. Both cytokine polymorphisms have no relation to tuberculin reaction in patients with TB. © 2010 The Authors. Scandinavian Journal of Immunology © 2010 Blackwell Publishing Ltd.

CXCR6 promotes atherosclerosis by supporting T-cell homing, interferon-gamma production, and macrophage accumulation in the aortic wall.

PubMed

Galkina, Elena; Harry, Brian L; Ludwig, Andreas; Liehn, Elisa A; Sanders, John M; Bruce, Anthony; Weber, Christian; Ley, Klaus

2007-10-16

T lymphocytes are thought to be important in atherosclerosis, but very little is known about the mechanisms of lymphocyte recruitment into atherosclerosis-prone aortas. In this study we tested the hypothesis that CXCR6, a chemokine receptor that is expressed on a subset of CD4+ T helper 1 cells and natural killer T cells, is involved in lymphocyte homing into the aortic wall and modulates the development and progression of atherosclerosis. To investigate the role of CXCR6 in the development and progression of atherosclerosis, we bred CXCR6-deficient (CXCR6(GFP/GFP)) mice with apolipoprotein E-deficient (ApoE(-/-)) mice. We found that CXCR6(GFP/GFP)/ApoE(-/-) mice fed a Western diet for 17 weeks or a chow diet for 56 weeks had decreased atherosclerosis compared with ApoE(-/-) controls. Flow cytometry analysis of the aortas from CXCR6(GFP/GFP)/ApoE(-/-) mice showed that the reduction of atherosclerosis was accompanied by a decreased percentage of CXCR6+ T cells within the aortas. Short-term homing experiments demonstrated that CXCR6 is involved in the recruitment of CXCR6+ leukocytes into the atherosclerosis-prone aortic wall. The reduced percentage of CXCR6+ T cells within the aortas resulted in significantly diminished production of interferon-gamma and reduction of CD11b+/CD68+ macrophages in the aorta. These data provide evidence for a proatherosclerotic role of CXCR6. Absence of CXCR6 alters the recruitment of CXCR6+ leukocytes and modulates the local immune response within the aortic wall.

Secretion of Interferon gamma (IFNγ) from Human Immune Cells is Altered by Exposure to Tributyltin (TBT) and Dibutyltin (DBT)

PubMed Central

Lawrence, Shanieek; Reid, Jacqueline; Whalen, Margaret

2013-01-01

Tributyltin (TBT) and dibutyltin (DBT) are widespread environmental contaminants found in food, beverages, and human blood samples. Both of these butyltins (BTs) interfere with the ability of human natural killer (NK) cells to lyse target cells and also alter secretion of the pro-inflammatory cytokine tumor necrosis factor alpha (TNFα) from human immune cells in vitro. The capacity of BTs to interfere with secretion of other pro-inflammatory cytokines has not been examined. Interferon gamma (IFNγ) is a modulator of adaptive and innate immune responses, playing an important role in overall immune competence. This study shows that both TBT and DBT alter secretion of IFNγ from human immune cells. Peripheral blood cell preparations that were increasingly reconstituted were used to determine if exposures to either TBT or DBT affected IFNγ secretion and how the makeup of the cell preparation influenced that effect. IFNγ secretion was examined after 24 h, 48 h and 6 day exposures to TBT (200- 2.5 nM) and DBT (5- 0.05 μM) in highly enriched human NK cells, a monocyte-depleted preparation of PBMCs, and monocyte-containing PBMCs. Both BTs altered IFNγ secretion from NK cells at most of the conditions tested (either increasing or decreasing secretion). However, there was significant variability among donors as to the concentrations and time points that showed changes as well as the baseline secretion of IFNγ. The majority of donors showed an increase in IFNγ secretion in response to at least one concentration of TBT or DBT at a minimum of one length of exposure. PMID:24357260

Engineering the intracellular metabolism of Escherichia coli to produce gamma-aminobutyric acid by co-localization of GABA shunt enzymes.

PubMed

Pham, Van Dung; Somasundaram, Sivachandiran; Lee, Seung Hwan; Park, Si Jae; Hong, Soon Ho

2016-02-01

To direct the carbon flux from Krebs cycle into the gamma-aminobutyric acid (GABA) shunt pathway for the production of GABA by protein scaffold introduction in Escherichia coli. Escherichia coli was engineered to produce GABA from glucose by the co-localization of enzymes succinate semialdehyde dehydrogenase (GadD), GABA aminotransferase (PuuE) and GABA transporter (GadC) by protein scaffold. 0.7 g GABA l(-1) was produced from 10 g glucose l(-1) while no GABA was produced in wild type E. coli. pH 6 and 30 °C were optimum for GABA production, and GABA concentration increased to 1.12 g GABA l(-1) when 20 g glucose l(-1) was used. When competing metabolic networks were inactivated, GABA increased by 24 % (0.87 g GABA l(-1)). The novel GABA production system was constructed by co-localization of GABA shunt enzymes.

Enzyme-linked small-molecule detection using split aptamer ligation.

PubMed

Sharma, Ashwani K; Kent, Alexandra D; Heemstra, Jennifer M

2012-07-17

Here we report an aptamer-based analogue of the widely used sandwich enzyme-linked immunosorbent assay (ELISA). This assay utilizes the cocaine split aptamer, which is comprised of two DNA strands that only assemble in the presence of the target small molecule. One split aptamer fragment is immobilized on a microplate, then a test sample is added containing the second split aptamer fragment. If cocaine is present in the test sample, it directs assembly of the split aptamer and promotes a chemical ligation between azide and cyclooctyne functional groups appended to the termini of the split aptamer fragments. Ligation results in covalent attachment of biotin to the microplate and provides a colorimetric output upon conjugation to streptavidin-horseradish peroxidase. Using this assay, we demonstrate detection of cocaine at concentrations of 100 nM-100 μM in buffer and 1-100 μM human blood serum. The detection limit of 1 μM in serum represents an improvement of two orders of magnitude over previously reported split aptamer-based sensors and highlights the utility of covalently trapping split aptamer assembly events.

A conformational switch in the inhibitory gamma-subunit of PDE6 upon enzyme activation by transducin.

PubMed

Granovsky, A E; Artemyev, N O

2001-11-06

In response to light, a photoreceptor G protein, transducin, activates cGMP-phosphodiesterase (PDE6) by displacing the inhibitory gamma-subunits (Pgamma) from the enzyme's catalytic sites. Evidence suggests that the activation of PDE6 involves a conformational change of the key inhibitory C-terminal domain of Pgamma. In this study, the C-terminal region of Pgamma, Pgamma-73-85, has been targeted for Ala-scanning mutagenesis to identify the point-to-point interactions between Pgamma and the PDE6 catalytic subunits and to probe the nature of the conformational change. Pgamma mutants were tested for their ability to inhibit PDE6 and a chimeric PDE5-conePDE6 enzyme containing the Pgamma C-terminus-binding site of cone PDE. This analysis has revealed that in addition to previously characterized Ile86 and Ile87, important inhibitory contact residues of Pgamma include Asn74, His75, and Leu78. The patterns of mutant PDE5-conePDE6 enzyme inhibition suggest the interaction between the PgammaAsn74/His75 sequence and Met758 of the cone PDE6alpha' catalytic subunit. This interaction, and the interaction between the PgammaIle86/Ile87 and PDE6alpha'Phe777/Phe781 residues, is most consistent with an alpha-helical structure of the Pgamma C-terminus. The analysis of activation of PDE6 enzymes containing Pgamma mutants with Ala-substituted transducin-contact residues demonstrated the critical role of PgammaLeu76. Accordingly, we hypothesize that the initial step in PDE6 activation involves an interaction of transducin-alpha with PgammaLeu76. This interaction introduces a bend into the alpha-helical structure of the Pgamma C-terminus, allowing transducin-alpha to further twist the C-terminus thereby uncovering the catalytic pocket of PDE6.

Review on enzyme-linked immunosorbent assays for sulfonamide residues in edible animal products.

PubMed

Zhang, Hongyan; Wang, Shuo

2009-10-31

The current status of enzyme-linked immunosorbent assays (ELISAs) for sulfonamides in edible animal products is reviewed. The attention was focused on the design and synthesis of haptens, conjugation to carrier protein, production of antibody, application of homologous and heterologous systems, as well as the molecular modeling of the haptens and sulfonamides. Researches have shown that sulfonamides seem to be particularly resistant to attempts to produce broad specificity antibodies. By summarizing the available research on sulfonamide ELISAs, it is hoped that it can be considered as a basis for further investigation aimed at developing the most efficient approaches for detection.

Evasion of interferon responses by Ebola and Marburg viruses.

PubMed

Basler, Christopher F; Amarasinghe, Gaya K

2009-09-01

The filoviruses, Ebola virus (EBOV) and Marburg virus (MARV), cause frequently lethal viral hemorrhagic fever. These infections induce potent cytokine production, yet these host responses fail to prevent systemic virus replication. Consistent with this, filoviruses have been found to encode proteins VP35 and VP24 that block host interferon (IFN)-alpha/beta production and inhibit signaling downstream of the IFN-alpha/beta and the IFN-gamma receptors, respectively. VP35, which is a component of the viral nucleocapsid complex and plays an essential role in viral RNA synthesis, acts as a pseudosubstrate for the cellular kinases IKK-epsilon and TBK-1, which phosphorylate and activate interferon regulatory factor 3 (IRF-3) and interferon regulatory factor 7 (IRF-7). VP35 also promotes SUMOylation of IRF-7, repressing IFN gene transcription. In addition, VP35 is a dsRNA-binding protein, and mutations that disrupt dsRNA binding impair VP35 IFN-antagonist activity while leaving its RNA replication functions intact. The phenotypes of recombinant EBOV bearing mutant VP35s unable to inhibit IFN-alpha/beta demonstrate that VP35 IFN-antagonist activity is critical for full virulence of these lethal pathogens. The structure of the VP35 dsRNA-binding domain, which has recently become available, is expected to provide insight into how VP35 IFN-antagonist and dsRNA-binding functions are related. The EBOV VP24 protein inhibits IFN signaling through an interaction with select host cell karyopherin-alpha proteins, preventing the nuclear import of otherwise activated STAT1. It remains to be determined to what extent VP24 may also modulate the nuclear import of other host cell factors and to what extent this may influence the outcome of infection. Notably, the Marburg virus VP24 protein does not detectably block STAT1 nuclear import, and, unlike EBOV, MARV infection inhibits STAT1 and STAT2 phosphorylation. Thus, despite their similarities, there are fundamental differences by which

[Interferon alpha-2b modified with polyethylene glycol].

PubMed

Wu, Yingxin; Zhai, Yanqin; Lei, Jiandu; Ma, Guanghui; Su, Zhiguo

2008-09-01

In order to obtain a more stable PEGylated interferon alpha-2b, and prolong its half life, interferon alpha-2b (IFN alpha-2b) was modified with monomethoxy polyethylene glycol propionaldehyde (mPEG-ALD) 20000. It was found that the optimized reaction condition for the maximum bioactivity and highest PEGylation degree of the mono PEGylated interferon alpha-2b was as follows: in 20 mmol/L, pH 6.5, citric acid and sodium dihydrogen phosphate buffer, the concentration of IFN alpha-2b was 4 mg/mL, and the molar ratio of PEG/IFN alpha-2b was 8:1, and the reaction time was 20 h at 4 degrees C. Under the optimized reaction condition, the mono PEGylation degree reached to 55%. Ion exchange chromatography was used to separate and purify mono PEGylated interferon alpha-2b from the reaction mixture. The purity of mono PEGylated interferon alpha-2b was higher than 97% characterized by HPLC. The bioactivity of the mono PEGylated interferon alpha-2b was 13.4% of the native IFN alpha-2b, while its half life in SD rat is much longer than the native IFN alpha-2b. The mono PEGylated interferon alpha-2b is also stable in aqueous.

The kinetics-based enzyme-linked immunosorbent assay for coronavirus antibodies in cats: calibration to the indirect immunofluorescence assay and computerized standardization of results through normalization to control values.

PubMed Central

Barlough, J E; Jacobson, R H; Downing, D R; Lynch, T J; Scott, F W

1987-01-01

The computer-assisted, kinetics-based enzyme-linked immunosorbent assay for coronavirus antibodies in cats was calibrated to the conventional indirect immunofluorescence assay by linear regression analysis and computerized interpolation (generation of "immunofluorescence assay-equivalent" titers). Procedures were developed for normalization and standardization of kinetics-based enzyme-linked immunosorbent assay results through incorporation of five different control sera of predetermined ("expected") titer in daily runs. When used with such sera and with computer assistance, the kinetics-based enzyme-linked immunosorbent assay minimized both within-run and between-run variability while allowing also for efficient data reduction and statistical analysis and reporting of results. PMID:3032390

Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice

PubMed Central

Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.

2001-01-01

Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339

Site-Specific Photoconjugation of Beta-Lactamase Fragments to Monoclonal Antibodies Enables Sensitive Analyte Detection via Split-Enzyme Complementation.

PubMed

Yu, Feifan; Alesand, Veronica; Nygren, Per-Åke

2018-02-27

Protein fragment complementation assays (PCA) rely on a proximity-driven reconstitution of a split reporter protein activity, typically via interaction between bait and prey units separately fused to the reporter protein halves. The PCA principle can also be formatted for use in immunossays for analyte detection, e.g., via the use of small immunoglobulin binding proteins (IgBp) as fusion partners to split-reporter protein fragments for conversion of pairs of antibodies into split-protein half-probes. However, the non-covalent binding between IgBp and antibodies is not ideal for development of robust assays. Here, the authors describe how split-enzyme reporter halves can be both site-specifically and covalently photoconjugated at antibody Fc-parts for use in homogeneous dual-antibody in vitro immunoassays based on analyte-dependent split-enzyme fragment complementation. The half-probes consist of parts of a beta-lactamase split-protein reporter fused to an immunoglobulin Fc binding domain equipped with a unique cysteine residue at which a photoactivable maleimide benzophenone group (MBP) is attached. Using such antibody conjugates the authors obtain an analyte-driven complementation of the reporter enzyme fragments monitored via conversion of a chromogenic substrate. Results from detection of human interferon-gamma and the extracellular domain of HER2 is shown. The described principles for site-specific conjugation of proteins to antibodies should be broadly applicable. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Continuous in vivo infusion of interferon-gamma (IFN-γ) enhances engraftment of syngeneic wild-type cells in Fanca–/– and Fancg–/– mice

PubMed Central

Si, Yue; Ciccone, Samantha; Yang, Feng-Chun; Yuan, Jin; Zeng, Daisy; Chen, Shi; van de Vrugt, Henri J.; Critser, John; Arwert, Fre; Haneline, Laura S.; Clapp, D. Wade

2006-01-01

Fanconi anemia (FA) is a heterogeneous genetic disorder characterized by bone marrow (BM) failure and cancer susceptibility. Identification of the cDNAs of FA complementation types allows the potential of using gene transfer technology to introduce functional cDNAs as transgenes into autologous stem cells and provide a cure for the BM failure in FA patients. However, strategies to enhance the mobilization, transduction, and engraftment of exogenous stem cells are required to optimize efficacy prior to widespread clinical use. Hypersensitivity of Fancc–/– cells to interferon-gamma (IFN-γ), a nongenotoxic immune-regulatory cytokine, enhances engraftment of syngeneic wild-type (WT) cells in Fancc–/– mice. However, whether this phenotype is of broad relevance in other FA complementation groups is unresolved. Here we show that primitive and mature myeloid progenitors in Fanca–/– and Fancg–/– mice are hypersensitive to IFN-γ and that in vivo infusion of IFN-γ at clinically relevant concentrations was sufficient to allow consistent long-term engraftment of isogenic WT repopulating stem cells. Given that FANCA, FANCC, and FANCG complementation groups account for more than 90% of all FA patients, these data provide evidence that IFN-γ conditioning may be a useful nongenotoxic strategy for myelopreparation in FA patients. PMID:16946306

COMPARISON OF BIOASSAY AND ENZYME-LINKED IMMUNOSORBENT ASSAY FOR QUANTIFICATION OF 'SPODOPTERA FRUGIPERDA' NUCLEAR POLYHEDROSIS VIRUS IN SOIL

EPA Science Inventory

Standard curves with known amounts of Spodoptera frugiperda nuclear polyhedrosis virus (NPV) in soil were established with a bioassay and with an enzyme-linked immunosorbent assay (ELISA). The bioassay detected as few as 4 x 10 to the 4th power polyhedral inclusion bodies (PIB)/g...

Enzymatically Regulated Peptide Pairing and Catalysis for the Bioanalysis of Extracellular Prometastatic Activities of Functionally Linked Enzymes

NASA Astrophysics Data System (ADS)

Li, Hao; Huang, Yue; Yu, Yue; Li, Tianqi; Li, Genxi; Anzai, Jun-Ichi

2016-05-01

Diseases such as cancer arise from systematical reconfiguration of interactions of exceedingly large numbers of proteins in cell signaling. The study of such complicated molecular mechanisms requires multiplexed detection of the inter-connected activities of several proteins in a disease-associated context. However, the existing methods are generally not well-equipped for this kind of application. Here a method for analyzing functionally linked protein activities is developed based on enzyme controlled pairing between complementary peptide helix strands, which simultaneously enables elaborate regulation of catalytic activity of the paired peptides. This method has been used to detect three different types of protein modification enzymes that participate in the modification of extracellular matrix and the formation of invasion front in tumour. In detecting breast cancer tissue samples using this method, up-regulated activity can be observed for two of the assessed enzymes, while the third enzyme is found to have a subtle fluctuation of activity. These results may point to the application of this method in evaluating prometastatic activities of proteins in tumour.

Angiotensin I-Converting Enzyme Inhibitor Derived from Cross-Linked Oyster Protein

PubMed Central

Xie, Cheng-Liang; Kim, Jin-Soo; Ha, Jong-Myung; Choung, Se-Young

2014-01-01

Following cross-linking by microbial transglutaminase, modified oyster proteins were hydrolyzed to improve inhibitory activity against angiotensin-converting enzyme (ACE) inhibitory activity with the use of a single protease, or a combination of six proteases. The oyster hydrolysate with the lowest 50% ACE inhibitory concentration (IC50) of 0.40 mg/mL was obtained by two-step hydrolysis of the cross-linked oyster protein using Protamex and Neutrase. Five ACE inhibitory peptides were purified from the oyster hydrolysate using a multistep chromatographic procedure comprised of ion-exchange, size exclusion, and reversed-phase liquid chromatography. Their sequences were identified as TAY, VK, KY, FYN, and YA, using automated Edman degradation and mass spectrometry. These peptides were synthesized, and their IC50 values were measured to be 16.7, 29.0, 51.5, 68.2, and 93.9 μM, respectively. Toxicity of the peptides on the HepG2 cell line was not detected. The oyster hydrolysate also significantly decreased the systolic blood pressure of spontaneously hypertensive rats (SHR). The antihypertensive effect of the oyster hydrolysate on SHR was rapid and long-lasting, compared to commercially obtained sardine hydrolysate. These results suggest that the oyster hydrolysate could be a source of effective nutraceuticals against hypertension. PMID:25140307

Interferon-based treatment of chronic hepatitis C.

PubMed

Souvignet, Claude; Lejeune, Olivier; Trepo, Christian

2007-01-01

The treatment of patients with chronic hepatitis C has rapidly evolved in the past 10 years centered on the use of interferon alpha 2 as an antiviral and immunomodulatory agent against hepatitis C virus. Firstly used as a monotherapy associated with a deceiving long-term efficacy, interferon alpha was then combined with ribavirin, a nucleoside analog with large antiviral properties. Combination of both drugs dramatically improved the efficacy of treatment with 50% of patients reaching a sustained viral response, characterized by the final eradication of the virus from the infected individual. Surprisingly, this synergistic effect remains greatly unexplained. The third step consisted in the use of pegylated interferon in order to adapt its pharmacokinetics and to allow a better efficacy with a more tolerable dosing schedule: once weekly subcutaneous injection instead of thrice weekly. Pegylated interferon combined with ribavirin during 24-48 weeks of treatment is the current standard of care with nearly 60% of sustained virologic response, overall. Development of new forms of interferon alpha are on the way with promising preliminary results.

Cross-linked collagen sponges loaded with plant polyphenols with inhibitory activity towards chronic wound enzymes.

PubMed

Antonio, Francesko; Guillem, Rocasalbas; Sonia, Touriño; Clara, Mattu; Piergiorgio, Gentile; Valeria, Chiono; Gianluca, Ciardelli; Tzanov, Tzanko

2011-10-01

Collagen sponges loaded with polyphenols from Hamamelis virginiana were investigated as active materials for chronic wound dressings, evaluating in vitro the inhibition of two major enzymes that impair the wound healing process - myeloperoxidase (MPO) and collagenase. Prior to polyphenols loading, collagen was cross-linked with genipin to improve its biostability. The effect of genipin cross-linking and polyphenol concentration in the development of mechanically and enzymatically stable sponges was studied. The tensile strength of the cross-linked collagen increased with the increase of the cross-linking degree, coupled to decrease in the elongation and the swelling capacity of the sponges. The stability of the sponges to collagenase digestion reached maximum when 1 mM genipin was used. However, the biostability decreased more than 10-fold after loading the sponges with polyphenols (0.5 mg/mL), nevertheless, this effect was partially overcome using higher concentration of polyphenols (1 and 2 mg/mL) to inhibit collagenase. Moreover, the polyphenols released from the sponges were sufficient for complete inhibition of MPO activity. No considerable cytotoxicity of the genipin cross-linked collagen loaded with polyphenols was observed evaluating the NIH 3T3 fibroblasts viability. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Immunogenicity of an interferon-beta1a product.

PubMed

Kauffman, M A; Sterin-Prync, A; Papouchado, M; González, E; Vidal, A J; Grossberg, S E; Chuppa, S; Odoriz, B; Vrech, C; Diez, R A; Ferro, H H

2011-01-01

In order to determine whether Blastoferon®, a biosimilar interferon (IFN)- beta 1a formulation, shares epitopes with other known IFN-beta products, a series of neutralization bioassays were performed with a set of well-characterized anti-IFN- beta monoclonal antibodies and human sera (World Health Organization Reference Reagents). The bioassay was the interferon-induced inhibition of virus cytopathic effect on human cells in culture (EMC virus and A-549 cells). Computer-calculated results were reported as Tenfold Reduction Units (TRU)/ml. To further assess Blastoferon® immunogenicity, in vivo production of anti-IFN beta antibodies was determined in sera of patients included in the pharmacovigilance plan of Blastoferon® by the level of IFN- beta 1a binding antibodies (by enzyme immunoassay -EIA) and neutralizing antibodies (in the Wish-VSV system). The highly characterized neutralizing monoclonal antibodies A1 and A5 that bind to specific regions of the IFN- beta molecule reacted positively with the three beta 1a IFNs: Blastoferon®, Rebif®, and the IFN- beta WHO Second International Standard 00/572. As expected, the non-neutralizing monoclonal antibodies B4 and B7 did not neutralize any of the IFN- beta preparations. The commercially available monoclonal antibody B-02 reacted essentially equally with Rebif® and Blastoferon®. The WHO Reference Reagent human serum anti-IFN- beta polyclonal antibody neutralized all the IFN- beta products, whereas the WHO Reference Reagent human serum anti-IFN-alpha polyclonal antibody G037-501-572 appropriately failed to react with any of the IFN- beta products. On the basis of in vitro reactivity with known, well-characterized monoclonal and polyclonal antibody preparations, Blastoferon® shares immunological determinants with other human interferon- beta products, especially IFN- beta 1a. In vivo antibodies were detected by EIA in 72.9% of 37 chronically treated multiple sclerosis patients, whereas neutralizing antibodies were

Stability of human interferon-beta 1: oligomeric human interferon-beta 1 is inactive but is reactivated by monomerization.

PubMed

Utsumi, J; Yamazaki, S; Kawaguchi, K; Kimura, S; Shimizu, H

1989-10-05

Human interferon-beta 1 is extremely stable is a low ionic strength solution of pH 2 such as 10 mM HCl at 37 degrees C. However, the presence of 0.15 M NaCl led to a remarkable loss of antiviral activity. The molecular-sieve high-performance liquid chromatography revealed that, whereas completely active human interferon-beta 1 eluted as a 25 kDa species (monomeric form), the inactivated preparation eluted primarily as a 90 kDa species (oligomeric form). The specific activity (units per mg protein) of the oligomeric form was approx. 10% of that of the monomeric form. This observation shows that oligomeric human interferon-beta 1 is apparently in an inactive form. When the oligomeric eluate was resolved by polyacrylamide gel containing sodium dodecyl sulphate (SDS), it appeared to be monomeric under non-reducing conditions. Monomerization of the oligomeric human interferon-beta 1 by treatment with 1% SDS, fully regenerated its antiviral activity. These results suggest that the inactivation of the human interferon-beta 1 preparation was caused by its oligomerization via hydrophobic interactions without the formation of intermolecular disulphide bonds. These oligomers can be dissociated by SDS to restore biological activity.

Immunodiagnosis of toxocarosis in humans: evaluation of a new enzyme-linked immunosorbent assay kit.

PubMed Central

Jacquier, P; Gottstein, B; Stingelin, Y; Eckert, J

1991-01-01

Excretory/secretory (E/S) antigen derived from second-stage larvae of Toxocara canis maintained in defined medium in vitro has been well established worldwide for the immunodiagnosis of human toxocarosis by enzyme-linked immunosorbent assay. Such an enzyme-linked immunosorbent assay, based on the detection of human anti-T. canis (E/S antigen) serum immunoglobulin G, has recently been commercialized by Biokema-Affinity Products (Crissier-Lausanne, Switzerland). This commercial test kit was evaluated with regard to its application in a routine diagnostic laboratory and the reliability of the results. Of 78 patients with suspected clinical toxocarosis, 71 had anti-T. canis antibodies (positive serological result) corresponding to a diagnostic sensitivity of 91%; 14% of serum samples (n = 199) from patients with protozoan or with helminthic infections also showed positive reactions mainly related to infections with Trichinella, Strongyloides, and Fasciola species. An epidemiological study with 1,000 serum samples from randomly selected healthy blood donors and children in Switzerland demonstrated a seroprevalence of 2.7%. The test kit under evaluation had an overall diagnostic sensitivity of 91% and a relative specificity of 86%, the latter being related to some protozoan and helminthic infections. Because of the scarcity of such infections, potential cross-reactivity does not play a major role under the conditions found in the middle part of Europe. In conclusion, the application of the test kit provided for use in this study can be recommended for routine diagnostic use. PMID:1774303

Combined therapy with danazol, pegilated interferon, and ribavirin improves thrombocytopenia and liver injury in rats with fibrosis.

PubMed

Alvarez, Guillermo Cabrera; Madrid-Marina, Vicente; Jimenez-Mendez, Ricardo; Buitimea, Angel Leon; Román, Margarita Bahena; Cortez-Gomez, Rudyard; Esparza, Jorge Reyes; Rodríguez-Fragoso, Lourdes

2007-01-01

The aim of this study was to investigate the effects of combinations of pegilated-interferon (PEG-IFN), ribavirin, and danazol on thrombocytopenia and liver injury in rats with fibrosis. Male adult Wistar rats were treated with either mineral oil, danazol (0.83 mg/kg per day), PEG-interferon alpha-2a (PEG-IFN, 0.3 microg/ week) + ribavirin (12 mg/kg per day), PEG-IFN + ribavirin + danazol, CCl(4) (4 g/kg for eight weeks), CCl(4) + PEG-IFN + ribavirin, or CCl(4) + PEG-IFN + ribavirin+ danazol. The following assays were conducted: hematology, clinical chemistry, liver function, liver fibrosis, lymphocyte cytokine mRNA expression, and bone-marrow DNA content. Platelet counts were low in sham-treated animals and animals treated with PEG- IFN + ribavirin (30% and 25% respectively; P < 0.05). PEG-IFN + ribavirin + danazol reduced platelet counts of fibrotic animals by only 9% (P < 0.05). PEG- IFN + ribavirin reduced hepatic collagen content by 50%, whereas danazol + PEG-IFN + ribavirin reduced hepatic collagen content by 60% (P < 0.05). PEG-IFN + ribavirin reduced the total bilirubin concentration by 27%, alanine amino transferase (ALT) activity by 75% and gamma-glutamyl transpeptidase (gamma-GTP) activity by 74% (P < 0.05). In contrast, danazol + PEG-IFN + ribavirin reduced total bilirubin levels by 61%, alkaline phosphatase activity by 45%, ALT activity by 76%, and gamma-GTP activity by 74% (P < 0.05). The only treatment that increased interleukin 10 (IL-10) mRNA in fibrotic rats was PEG-IFN + ribavirin. However, danazol + PEG-IFN + ribavirin reduced the expression of IL-6, IL-10, tumor necrosis factor alpha and transforming growth factor ss. Bone-marrow DNA content was not altered by any treatment. In conclusion, PEG-IFN + ribavirin + danazol could be a new therapeutic option for patients with liver injury, fibrosis, and thrombocytopenia.

Immunological Tools: Engaging Students in the Use and Analysis of Flow Cytometry and Enzyme-linked Immunosorbent Assay (ELISA)

ERIC Educational Resources Information Center

Ott, Laura E.; Carson, Susan

2014-01-01

Flow cytometry and enzyme-linked immunosorbent assay (ELISA) are commonly used techniques associated with clinical and research applications within the immunology and medical fields. The use of these techniques is becoming increasingly valuable in many life science and engineering disciplines as well. Herein, we report the development and…

Identification of Interferon-Stimulated Gene Proteins That Inhibit Human Parainfluenza Virus Type 3

PubMed Central

Rabbani, M. A. G.; Ribaudo, Michael; Guo, Ju-Tao

2016-01-01

ABSTRACT A major arm of cellular innate immunity is type I interferon (IFN), represented by IFN-α and IFN-β. Type I IFN transcriptionally induces a large number of cellular genes, collectively known as IFN-stimulated gene (ISG) proteins, which act as antivirals. The IFIT (interferon-induced proteins with tetratricopeptide repeats) family proteins constitute a major subclass of ISG proteins and are characterized by multiple tetratricopeptide repeats (TPRs). In this study, we have interrogated IFIT proteins for the ability to inhibit the growth of human parainfluenza virus type 3 (PIV3), a nonsegmented negative-strand RNA virus of the Paramyxoviridae family and a major cause of respiratory disease in children. We found that IFIT1 significantly inhibited PIV3, whereas IFIT2, IFIT3, and IFIT5 were less effective or not at all. In further screening a set of ISG proteins we discovered that several other such proteins also inhibited PIV3, including IFITM1, IDO (indoleamine 2,3-dioxygenase), PKR (protein kinase, RNA activated), and viperin (virus inhibitory protein, endoplasmic reticulum associated, interferon inducible)/Cig5. The antiviral effect of IDO, the enzyme that catalyzes the first step of tryptophan degradation, could be counteracted by tryptophan. These results advance our knowledge of diverse ISG proteins functioning as antivirals and may provide novel approaches against PIV3. IMPORTANCE The innate immunity of the host, typified by interferon (IFN), is a major antiviral defense. IFN inhibits virus growth by inducing a large number of IFN-stimulated gene (ISG) proteins, several of which have been shown to have specific antiviral functions. Parainfluenza virus type 3 (PIV3) is major pathogen of children, and no reliable vaccine or specific antiviral against it currently exists. In this article, we report several ISG proteins that strongly inhibit PIV3 growth, the use of which may allow a better antiviral regimen targeting PIV3. PMID:27707917

Prenatal Dexamethasone and Postnatal High-Fat Diet Decrease Interferon Gamma Production through an Age-Dependent Histone Modification in Male Sprague-Dawley Rats

PubMed Central

Yu, Hong-Ren; Tain, You-Lin; Sheen, Jiunn-Ming; Tiao, Mao-Meng; Chen, Chih-Cheng; Kuo, Ho-Chang; Hung, Pi-Lien; Hsieh, Kai-Sheng; Huang, Li-Tung

2016-01-01

Overexposure to prenatal glucocorticoid (GC) disturbs hypothalamic-pituitary-adrenocortical axis-associated neuroendocrine metabolism and susceptibility to metabolic syndrome. A high-fat (HF) diet is a major environmental factor that can cause metabolic syndrome. We aimed to investigate whether prenatal GC plus a postnatal HF diet could alter immune programming in rat offspring. Pregnant Sprague-Dawley rats were given intraperitoneal injections of dexamethasone or saline at 14–21 days of gestation. Male offspring were then divided into four groups: vehicle, prenatal dexamethasone exposure, postnatal HF diet (VHF), and prenatal dexamethasone exposure plus a postnatal HF diet (DHF). The rats were sacrificed and adaptive immune function was evaluated. Compared to the vehicle, the DHF group had lower interferon gamma (IFN-γ) production by splenocytes at postnatal day 120. Decreases in H3K9 acetylation and H3K36me3 levels at the IFN-γ promoter correlated with decreased IFN-γ production. The impaired IFN-γ production and aberrant site-specific histone modification at the IFN-γ promoter by prenatal dexamethasone treatment plus a postnatal HF diet resulted in resilience at postnatal day 180. Prenatal dexamethasone and a postnatal HF diet decreased IFN-γ production through a site-specific and an age-dependent histone modification. These findings suggest a mechanism by which prenatal exposure to GC and a postnatal environment exert effects on fetal immunity programming. PMID:27669212

Highly broad-specific and sensitive enzyme-linked immunosorbent assay for screening sulfonamides: Assay optimization and application to milk samples

USDA-ARS?s Scientific Manuscript database

A broad-specific and sensitive immunoassay for the detection of sulfonamides was developed by optimizing the conditions of an enzyme-linked immunosorbent assay (ELISA) in regard to different monoclonal antibodies (MAbs), assay format, immunoreagents, and several physicochemical factors (pH, salt, de...

Interferon in resistance to bacterial and protozoan infections

NASA Technical Reports Server (NTRS)

Sonnenfeld, Gerald; Gould, Cheryl L.; Kierszenbaum, Felipe; Degee, Antonie L. W.; Mansfield, John M.

1986-01-01

The effects of genetic differences in mouse strains on the modulation of protozoan infections by interferon (IFN) were investigated. In one set of experiments, three different strains of mice were injected with T. cruzi, and their sera were assayed at five time intervals for IFN titer. A greater quantity of IFN was produced by mouse strains that were susceptible to T. cruzi infection than by the more resistant strain. In another set of experiments, spleen cell cultures from inbred strains of mice were challenged with an antigen made from T.b. rhodesiense. The cells from mice resistant to infection, produced greater amounts of IFN-gamma than did cells from the susceptible mice. In a third set of experiments, it was found that mice injected with T.b. rhodesiense before being infected with a diabetogenic virus (EMC-D) were resistant to the effects of the virus and did not produce virus-specific antibody.

Reduced NK cell IFN-γ secretion and psychological stress are independently associated with herpes zoster.

PubMed

Kim, Choon Kwan; Choi, Youn Mi; Bae, Eunsin; Jue, Mihn Sook; So, Hyung Seok; Hwang, Eung-Soo

2018-01-01

The pathogenesis of herpes zoster is closely linked to reduced varicella-zoster virus-specific cell-mediated immunity. However, little is known about the interplay between natural killer cells and psychological stress in the pathogenesis of herpes zoster. This study aimed to investigate possible associations among natural killer cells, T cells and psychological stress in herpes zoster. Interferon-gamma secretion from natural killer cell, psychological stress events, stress cognition scale scores and cytomegalovirus-specific cell-mediated immunity were compared between 44 patients with herpes zoster and 44 age- and gender-matched control subjects. A significantly lower median level of interferon-gamma secreted by natural killer cells was observed in patients with a recent diagnosis of herpes zoster than in control subjects (582.7 pg/ml vs. 1783 pg/ml; P = 0.004), whereas cytomegalovirus-specific cell-mediated immunity was not associated with herpes zoster. Psychological stress events and high stress cognition scale scores were significantly associated in patients with herpes zoster (P<0.001 and P = 0.037, respectively). However, reduced interferon-gamma secretion from natural killer cell and psychological stress were not associated. In conclusion, patients with a recent diagnosis of herpes zoster display reduced interferon-gamma secretion from natural killer cells and frequent previous psychological stress events compared with controls. However, reduced natural killer cell activity is not an immunological mediator between psychological stress and herpes zoster.

Reduced NK cell IFN-γ secretion and psychological stress are independently associated with herpes zoster

PubMed Central

Kim, Choon Kwan; Choi, Youn Mi; Bae, Eunsin; Jue, Mihn Sook; So, Hyung Seok

2018-01-01

The pathogenesis of herpes zoster is closely linked to reduced varicella-zoster virus-specific cell-mediated immunity. However, little is known about the interplay between natural killer cells and psychological stress in the pathogenesis of herpes zoster. This study aimed to investigate possible associations among natural killer cells, T cells and psychological stress in herpes zoster. Interferon-gamma secretion from natural killer cell, psychological stress events, stress cognition scale scores and cytomegalovirus-specific cell-mediated immunity were compared between 44 patients with herpes zoster and 44 age- and gender-matched control subjects. A significantly lower median level of interferon-gamma secreted by natural killer cells was observed in patients with a recent diagnosis of herpes zoster than in control subjects (582.7 pg/ml vs. 1783 pg/ml; P = 0.004), whereas cytomegalovirus-specific cell-mediated immunity was not associated with herpes zoster. Psychological stress events and high stress cognition scale scores were significantly associated in patients with herpes zoster (P<0.001 and P = 0.037, respectively). However, reduced interferon-gamma secretion from natural killer cell and psychological stress were not associated. In conclusion, patients with a recent diagnosis of herpes zoster display reduced interferon-gamma secretion from natural killer cells and frequent previous psychological stress events compared with controls. However, reduced natural killer cell activity is not an immunological mediator between psychological stress and herpes zoster. PMID:29466462

Determination of metallothionein in biological fluids using enzyme-linked immunoassay with commercial antibody.

PubMed

Milnerowicz, Halina; Bizoń, Anna

2010-01-01

Metallothionein (MT) is a low molecular weight cysteine-rich protein with a number of roles in the pro/antioxidant balance and homeostasis of essential metals, such as zinc and copper, and in the detoxification of heavy metals, such as cadmium and mercury. Until now, detection of metallothionein in biological fluids remained difficult because of a lack of a broadly reactive commercial test. Meaningful comparison of the values of metallothionein concentrations reported by different authors using their specific isolation procedures and different conditions of enzyme-linked immunoassay is difficult due to the absence of a reference material for metallothionein. Therefore in the present study, we describe a quantitative assay for metallothionein in biological fluids such as plasma and urine performed by a direct enzyme-linked immunoassay using a commercially available monoclonal mouse anti-metallothionein clone E9 antibody and commercial standards of metallothionein from rabbit liver and a custom preparation of metallothionein from human liver. The sensitivity of the assay for the standard containing two isoforms MT-I and MT-II from human liver was 140 pg/well. The reactivity of the commercial standards and standards containing two isoforms MT-I and MT-II isolated from human liver in our laboratory with a commercial monoclonal mouse anti-metallothionein clone E9 antibody were similar. This suggests that the described ELISA test can be useful for determination of metallothionein concentration in biological fluids. The concentrations of metallothionein in human plasma, erythrocyte lysate and in urine of smoking and non-smoking healthy volunteers are reported. Tobacco smoking increases the extracellular metallothionein concentration (plasma and urine) but does not affect the intracellular concentration (erythrocyte lysate).

Effects of traditionally used anxiolytic botanicals on enzymes of the gamma-aminobutyric acid (GABA) system.

PubMed

Awad, R; Levac, D; Cybulska, P; Merali, Z; Trudeau, V L; Arnason, J T

2007-09-01

In Canada, the use of botanical natural health products (NHPs) for anxiety disorders is on the rise, and a critical evaluation of their safety and efficacy is required. The purpose of this study was to determine whether commercially available botanicals directly affect the primary brain enzymes responsible for gamma-aminobutyric acid (GABA) metabolism. Anxiolytic plants may interact with either glutamic acid decarboxylase (GAD) or GABA transaminase (GABA-T) and ultimately influence brain GABA levels and neurotransmission. Two in vitro rat brain homogenate assays were developed to determine the inhibitory concentrations (IC50) of aqueous and ethanolic plant extracts. Approximately 70% of all extracts that were tested showed little or no inhibitory effect (IC50 values greater than 1 mg/mL) and are therefore unlikely to affect GABA metabolism as tested. The aqueous extract of Melissa officinalis (lemon balm) exhibited the greatest inhibition of GABA-T activity (IC50 = 0.35 mg/mL). Extracts from Centella asiatica (gotu kola) and Valeriana officinalis (valerian) stimulated GAD activity by over 40% at a dose of 1 mg/mL. On the other hand, both Matricaria recutita (German chamomile) and Humulus lupulus (hops) showed significant inhibition of GAD activity (0.11-0.65 mg/mL). Several of these species may therefore warrant further pharmacological investigation. The relation between enzyme activity and possible in vivo mode of action is discussed.

Serum profile of cytokines interferon gamma and interleukin-10 in ewes subjected to artificial insemination by cervical retraction.

PubMed

Alvares, C T G; Cruz, J F; Romano, C C; Brandão, F Z

2016-04-15

This study evaluated the influence of artificial insemination (AI) by cervical retraction (CRI) on serum levels of interferon gamma (IFNγ) and interleukin-10 (IL-10) in ewes. Synchronized pluriparous Santa Inês ewes were subjected to natural mating (NM, n = 8) and AI, which was performed for a fixed time (55 ± 1 hour) by CRI (n = 8) or laparoscopy (n = 8). Ewes were classified as pregnant, with return to estrus (RE) or with embryonic loss (EL). Blood samples were collected on Day 0, Day 3, Day 5, Day 12, and Day 17 (Day 0 = AI/NM) for progesterone dosage and cytokines were quantified from Day 0 to Day 12. Progesterone levels were constant, except for a decrease in ewes with RE at Day 17 (P < 0.05). Regardless of the reproductive method used, there was no difference in the IFNγ and IL-10 levels at any time, with averages of 642.1, 713.2, and 741.2 pg/mL for IFNγ and 667.1, 616.8, and 721.1 pg/mL for IL-10 when using CRI, laproscopy, and NM, respectively. Regarding the physiological status, ewes with EL had lower serum levels of IFNγ and IL-10 than pregnant ewes and ewes with RE, regardless of the reproductive method used, with averages of 769.1, 714.9, and 555.7 pg/mL for IFNγ and 713.8, 699.3, and 578.7 pg/mL for IL-10 in pregnant ewes, ewes with RE and EL, respectively (P < 0.01). In conclusion, AI by CRI in Santa Inês ewes does not alter the profile of serum cytokines IFNγ and IL-10 and does not induce an inflammatory reaction that can compromise pregnancy. Copyright © 2016 Elsevier Inc. All rights reserved.

Nylon bead enzyme-linked immunosorbent assay for detection of sub-picogram quantities of Brucella antigens.

PubMed Central

Perera, V Y; Creasy, M T; Winter, A J

1983-01-01

An indirect sandwich enzyme-linked immunosorbent assay, using antibody covalently coupled to nylon beads, has been adapted for the detection of Brucella antigens. Optimum conditions were achieved by incubation of 1 ml of reaction mixture with a single bead, and by minimizing nonspecific interactions through the use of beads coated with purified bovine antibodies, preabsorption of third layer rabbit antibodies with normal bovine serum, and treatment of beads with normal goat serum before addition of the goat anti-rabbit enzyme conjugate. Beta-galactosidase was selected for use with clinical samples primarily because of low levels of endogenous enzyme in bovine leukocytes. Use of a fluorogenic substrate enhanced sensitivity 20-fold. Under these conditions, 100 fg of solubilized crude lipopolysaccharide or 8 to 10 Brucella cells was detectable in a fixed volume of 1 ml. A system was also devised for concentrating antigen which permitted ready detection of 2 pg of lipopolysaccharide in a volume of 50 ml (40 fg/ml). Attempts to detect lipopolysaccharide in the presence of concentrated serum or plasma were unsuccessful, but 10 brucellae added to a suspension of leukocytes from 100 ml of normal bovine blood were easily measured. PMID:6415094

Parasite-mediated upregulation of NK cell-derived gamma interferon protects against severe highly pathogenic H5N1 influenza virus infection.

PubMed

O'Brien, Kevin B; Schultz-Cherry, Stacey; Knoll, Laura J

2011-09-01

Outbreaks of influenza A viruses are associated with significant human morbidity worldwide. Given the increasing resistance to the available influenza drugs, new therapies for the treatment of influenza virus infection are needed. An alternative approach is to identify products that enhance a protective immune response. In these studies, we demonstrate that infecting mice with the Th1-inducing parasite Toxoplasma gondii prior to highly pathogenic avian H5N1 influenza virus infection led to decreased lung viral titers and enhanced survival. A noninfectious fraction of T. gondii soluble antigens (STAg) elicited an immune response similar to that elicited by live parasites, and administration of STAg 2 days after H5N1 influenza virus infection enhanced survival, lowered viral titers, and reduced clinical disease. STAg administration protected H5N1 virus-infected mice lacking lymphocytes, suggesting that while the adaptive immune response was not required for enhanced survival, it was necessary for STAg-mediated viral clearance. Mechanistically, we found that administration of STAg led to increased production of gamma interferon (IFN-γ) from natural killer (NK) cells, which were both necessary and sufficient for survival. Further, administration of exogenous IFN-γ alone enhanced survival from H5N1 influenza virus infection, although not to the same level as STAg treatment. These studies demonstrate that a noninfectious T. gondii extract enhances the protective immune response against severe H5N1 influenza virus infections even when a single dose is administered 2 days postinfection.

Interferon-alpha in the treatment of multiple myeloma.

PubMed

Khoo, Teh Liane; Vangsted, Annette Juul; Joshua, Douglas; Gibson, John

2011-03-01

Interferons are soluble proteins produced naturally by cells in response to viruses. It has both anti-proliferative and immunomodulating properties and is one of the first examples of a biological response modifier use to treat the haematological malignancy multiple myeloma. Interferon has been used in this clinical practice for over thirty years. However, despite considerable efforts, numerous clinical trials and two large meta-analysis, its exact role in the management of multiple myeloma still remains unclear. Its role in the treatment of multiple myeloma has been as a single induction agent, a co-induction agent with other chemotherapy regimens, and as maintenance therapy after conventional chemotherapy or complete remission after autologous or allogeneic transplantation. Interferon as a single induction agent or co-induction agent with other chemotherapy agents appears only to have minimal benefit in myeloma. Its role as maintenance therapy in the plateau phase of myeloma also remains uncertain. More recently, the use of interferon must now compete with the "new drugs"--thalidomide, lenalidomide and bortezomib in myeloma treatment. Will there be a future role of interferon in the treatment of multiple myeloma or will interferon be resigned to the history books remains to be seen.

Enhancement in the sensitivity of microfluidic enzyme-linked immunosorbent assays through analyte preconcentration.

PubMed

Yanagisawa, Naoki; Dutta, Debashis

2012-08-21

In this Article, we describe a microfluidic enzyme-linked immunosorbent assay (ELISA) method whose sensitivity can be substantially enhanced through preconcentration of the target analyte around a semipermeable membrane. The reported preconcentration has been accomplished in our current work via electrokinetic means allowing a significant increase in the amount of captured analyte relative to nonspecific binding in the trapping/detection zone. Upon introduction of an enzyme substrate into this region, the rate of generation of the ELISA reaction product (resorufin) was observed to increase by over a factor of 200 for the sample and 2 for the corresponding blank compared to similar assays without analyte trapping. Interestingly, in spite of nonuniformities in the amount of captured analyte along the surface of our analysis channel, the measured fluorescence signal in the preconcentration zone increased linearly with time over an enzyme reaction period of 30 min and at a rate that was proportional to the analyte concentration in the bulk sample. In our current study, the reported technique has been shown to reduce the smallest detectable concentration of the tumor marker CA 19-9 and Blue Tongue Viral antibody by over 2 orders of magnitude compared to immunoassays without analyte preconcentration. When compared to microwell based ELISAs, the reported microfluidic approach not only yielded a similar improvement in the smallest detectable analyte concentration but also reduced the sample consumption in the assay by a factor of 20 (5 μL versus 100 μL).

Variation of human intestinal gamma-glutamyl transpeptidase in ontogenetic development.

PubMed

Sobiech, K A; Szewczuk, A

1977-01-01

Activity of gamma-glutamyl transpeptidase in human intestines was measured against alpha-naphthylamide and 12 gamma-glutamyl amino acids and peptides as substrate. Distinctly altered activity was found to accompany ontogenetic development. The ratio of the transpeptidase activity tested against monoglutamyl substrates in the intestines of 7-month fetuses, newborns and adults was 15:1:4, whereas the ratio of gamma-glutamyl cyclotransferase activities in the same age groups was 1-0:1-2:1-6. Distinct differences were found in resistance to heating, sensitivity to L-serine plus borate, and other effectors, and electrophoretic mobility, between fetal gamma-glutamyl transpeptidase and the enzyme from adults, which supports the hypothesis of existence of two forms of the enzyme in the human intestines. The results suggest involvement of gamma-glutamyl transpeptidase in the pathomechanism of celiakia in children.

Soybean phenolic-rich extracts inhibit key-enzymes linked to type 2 diabetes (α-amylase and α-glucosidase) and hypertension (angiotensin I converting enzyme) in vitro.

PubMed

Ademiluyi, Adedayo O; Oboh, Ganiyu

2013-03-01

This study sought to assess the inhibitory activities of phenolic-rich extracts from soybean on α-amylase, α-glucosidase and angiotensin I converting enzyme (ACE) activities in vitro. The free phenolic extract of the soybean was obtained by extraction with 80% acetone, while that of the bound phenolic extract was done by extracting the alkaline and acid hydrolyzed residue with ethyl acetate. The inhibitory action of these extracts on the enzymes activity as well as their antioxidant properties was assessed. Both phenolic-rich extracts inhibited α-amylase, α-glucosidase and ACE enzyme activities in a dose dependent pattern. However, the bound phenolic extract exhibited significantly (P < 0.05) higher α-amylase and ACE inhibition while the free phenolic extract had significantly (P < 0.05) higher α-glucosidase inhibitory activity. Nevertheless, the free phenolic extract had higher α-glucosidase inhibitory activity when compared to that of α-amylase; this property confer an advantage on soybean phenolic-rich extracts over commercial antidiabetic drugs with little or no side effect. And inhibition of ACE suggests the antihypertension potential of soybean phenolic-rich extracts. Furthermore, the enzyme inhibitory activities of the phenolic-rich extracts were not associated with their phenolic content. Therefore, phenolic-rich extracts of soybean could inhibit key-enzyme linked to type 2 diabetes (α-amylase and α-glucosidase) and hypertension (ACE) and thus could explain in part the mechanism by which soybean renders these health promoting effect. Copyright © 2011 Elsevier GmbH. All rights reserved.

Use of the Falcon assay screening test--enzyme-linked immunosorbent assay (FAST-ELISA) and the enzyme-linked immunoelectrotransfer blot (EITB) to determine the prevalence of human fascioliasis in the Bolivian Altiplano.

PubMed

Hillyer, G V; Soler de Galanes, M; Rodriguez-Perez, J; Bjorland, J; Silva de Lagrava, M; Ramirez Guzman, S; Bryan, R T

1992-05-01

A collaborative study between the University of Puerto Rico School of Medicine, the Centers for Disease Control, the Bolivian Ministry of Health, and private voluntary organizations (Foster Parents Plan International and Danchurchaid) working in Bolivia has identified a region in the northwestern Altiplano of Bolivia near Lake Titicaca as harboring the highest prevalence of human fascioliasis in the world reported to date. Two serologic techniques (the Falcon assay screening test-enzyme-linked immunosorbent assay [FAST-ELISA] and the enzyme-linked immunoelectrotransfer blot [EITB]) were used in the determination of its prevalence. One hundred serum samples and 73 stool samples were obtained from Aymara Indians from Corapata, Bolivia. Antibody absorbance levels to Fasciola hepatica excretion-secretion antigens were compared with EITB banding patterns using the same antigen preparation. A positive FAST-ELISA result was defined as an absorbance value greater than the mean plus three standard deviations of two sets of normal negative controls (Puerto Rican and Bolivian). Using this criterion, 53 of 100 sera tested were found positive by this technique. Within this group, 19 (95%) of 20 individuals who were parasite positive were also positive by FAST-ELISA. An additional 24 individuals who were negative for F. hepatica eggs and 10 individuals for whom no specimens were received were also positive by FAST-ELISA. Among the 53 individuals negative for F. hepatica eggs, 29 were also negative by FAST-ELISA. The EITB analysis of the sera from confirmed infected individuals revealed at least three F. hepatica (Fh) bands with molecular weights of 12, 17, and 63 kD, respectively.(ABSTRACT TRUNCATED AT 250 WORDS)

Simultaneous determination of 13 fluoroquinolone and 22 sulfonamide residues in milk by a dual-colorimetric enzyme-linked immunosorbent assay

USDA-ARS?s Scientific Manuscript database

Enzyme-linked immunosorbent assays (ELISAs) usually focus on the detection of a single analyte or a single group of analytes, e.g., fluoroquinolones or sulfonamides. However, it is often necessary to simultaneously monitor the two classes of antimicrobial residues in different food matrices. In th...

Effect of carprofen administration during banding or burdizzo castration of bulls on plasma cortisol, in vitro interferon-gamma production, acute-phase proteins, feed intake, and growth.

PubMed

Pang, W Y; Earley, B; Sweeney, T; Crowe, M A

2006-02-01

The objective of this study was to determine the effect of carprofen (C) administration before banding or burdizzo castration of bulls on cortisol, in vitro interferon-gamma (IFN-gamma) production, acute-phase proteins, feed intake, and growth. Fifty Holstein Friesian bulls (5.5 mo old; 191 +/- 3.7 kg) were blocked by weight and assigned randomly to 1 of 5 treatments (n = 10/treatment): 1) untreated control (2) banding castration at 0 min (Band); 3) Band following an i.v. injection of 1.4 mg/kg of BW of C at -20 min (Band+C); 4) Burdizzo castration at 0 min (Burd); or 5) Burd following 1.4 mg/kg of BW of C at -20 min (Burd+C). Castration acutely increased plasma cortisol concentrations compared with control; no significant differences occurred in peak and interval to peak cortisol responses between Band and Band+C or Burd and Burd+C groups. The administration of C in Band+C reduced (P < 0.05) the cortisol concentration between 6 and 12 h postcastration compared with Band animals. Overall, the integrated cortisol response was greater (P < 0.05) in the castrates than in control, whereas C treatments tended to reduce this response compared with Band (P = 0.08) and Burd (P = 0.07), respectively. Plasma fibrinogen was elevated in Band animals on d 14 and in Burd animals on d 3 and 14. Carprofen administration reduced Band- and Burd-induced fibrinogen production on d 14 and 3, respectively. Plasma haptoglobin was elevated in Band animals on d 3 and 35 compared with control, and C administration was effective in reducing the haptoglobin elevation on d 35 in Band+C compared with Band. There were no differences among treatments in in vitro IFN-gamma production induced by concanavalin A and phytohemagglutinin on d 1 and 2. Overall from d -1 to 16, there were no DMI differences among treatments. From d -1 to 35, there were no ADG differences among treatments. In conclusion, banding and burdizzo castration increased plasma cortisol with no change in in vitro IFN-gamma

Distinct Th1, Th2 and Treg cytokines balance in chronic periapical granulomas and radicular cysts.

PubMed

Teixeira-Salum, Tatiana Beber; Rodrigues, Denise Bertulucci Rocha; Gervásio, Aurélia M; Souza, Cássio J A; Rodrigues, Virmondes; Loyola, Adriano Motta

2010-03-01

Periapical lesions are a host response that involves immune reaction to prevent dissemination of bacteria from an infected root canal. The purpose of this study was to evaluate the levels of nitric oxide (NO), IL-4, TGF-beta, tumor necrosis factor-alpha (TNF-alpha), and interferon-gamma (IFN-gamma) in chronic periapical lesions and to determine their possible association with clinical and radiographic parameters. Seventeen human radicular cysts and 30 periapical granulomas were used in this study. Cytokines and NO were assessed by enzyme-linked immunosorbent assay and by the Griess reaction respectively confirmed by immunohistochemical. TNF-alpha and IFN-gamma were detected in 10% of granulomas and in 41.2% and 70% of radicular cysts. IL-4 was reactive in 24% of cysts, and TGF-beta was positive in all samples. Patients with tenderness showed significantly higher levels of IFN-gamma and IL-4 (P < 0.05). Swelling was associated with high levels of TNF-alpha, IFN-gamma, and IL-4 (P < 0.05). Lesions presenting bone resorption were associated with high levels of NO (P < 0.05). Periapical granulomas display a regulatory environment characterized by high TGF-beta and low inflammatory cytokine levels, while radicular cysts has mist Th1 and Th2 inflammatory reaction with the presence of IFN-gamma, TNF-alpha, and IL-4.

Dual-color plasmonic enzyme-linked immunosorbent assay based on enzyme-mediated etching of Au nanoparticles

NASA Astrophysics Data System (ADS)

Guo, Longhua; Xu, Shaohua; Ma, Xiaoming; Qiu, Bin; Lin, Zhenyu; Chen, Guonan

2016-09-01

Colorimetric enzyme-linked immunosorbent assay utilizing 3‧-3-5‧-5-tetramethylbenzidine(TMB) as the chromogenic substrate has been widely used in the hospital for the detection of all kinds of disease biomarkers. Herein, we demonstrate a strategy to change this single-color display into dual-color responses to improve the accuracy of visual inspection. Our investigation firstly reveals that oxidation state of 3‧-3-5‧-5-tetramethylbenzidine (TMB2+) can quantitatively etch gold nanoparticles. Therefore, the incorporation of gold nanoparticles into a commercial TMB-based ELISA kit could generate dual-color responses: the solution color varied gradually from wine red (absorption peak located at ~530 nm) to colorless, and then from colorless to yellow (absorption peak located at ~450 nm) with the increase amount of targets. These dual-color responses effectively improved the sensitivity as well as the accuracy of visual inspection. For example, the proposed dual-color plasmonic ELISA is demonstrated for the detection of prostate-specific antigen (PSA) in human serum with a visual limit of detection (LOD) as low as 0.0093 ng/mL.

Specificity, cross-talk and adaptation in Interferon signaling

NASA Astrophysics Data System (ADS)

Zilman, Anton

Innate immune system is the first line of defense of higher organisms against pathogens. It coordinates the behavior of millions of cells of multiple types, achieved through numerous signaling molecules. This talk focuses on the signaling specificity of a major class of signaling molecules - Type I Interferons - which are also used therapeutically in the treatment of a number of diseases, such as Hepatitis C, multiple sclerosis and some cancers. Puzzlingly, different Interferons act through the same cell surface receptor but have different effects on the target cells. They also exhibit a strange pattern of temporal cross-talk resulting in a serious clinical problem - loss of response to Interferon therapy. We combined mathematical modeling with quantitative experiments to develop a quantitative model of specificity and adaptation in the Interferon signaling pathway. The model resolves several outstanding experimental puzzles and directly affects the clinical use of Type I Interferons in treatment of viral hepatitis and other diseases.

Application of long-term cultured interferon-gamma enzyme-linked immunospot assay for assessing effector and memory T cell responses in cattle

USDA-ARS?s Scientific Manuscript database

Effector and memory T cells are generated through developmental programing of naïve cells following antigen recognition. If the infection is controlled, up to 95% of the T cells generated during the expansion phase are eliminated (i.e., contraction phase) and memory T cells remain, sometimes for a l...

Transfer of interferon alfa into human breast milk.

PubMed

Kumar, A R; Hale, T W; Mock, R E

2000-08-01

Originally assumed to be antiviral substances, the efficacy of interferons in a number of pathologies, including malignancies, multiple sclerosis, and other immune syndromes, is increasingly recognized. This study provides data on the transfer of interferon alfa (2B) into human milk of a patient receiving massive intravenous doses for the treatment of malignant melanoma. Following an intravenous dose of 30 million IU, the amount of interferon transferred into human milk was only slightly elevated (1551 IU/mL) when compared to control milk (1249 IU/mL). These data suggest that even following enormous doses, interferon is probably too large in molecular weight to transfer into human milk in clinically relevant amounts.

AN ENZYME LINKED IMMUNOSORBENT ASSAY (ELISA) METHOD FOR THE URINARY BIOMONITORING OF 2,4-DICHLOROPHRENOCYACETIC ACID (2,4-D)

EPA Science Inventory

An enzyme-linked immunosorbent assay (ELISA) method was developed to quantitatively measure 2,4-dichlorophenoyacetic acid (2,4-D) in human urine. Samples were diluted (1:5) with phosphate-buffered saline, 0.05% Tween 20, with 0.02% sodium azide, and analyzed by a 96-microwekk pl...

Sulfated N-linked oligosaccharides affect secretion but are not essential for the transport, proteolytic processing, and sorting of lysosomal enzymes in Dictyostelium discoideum.

PubMed

Cardelli, J A; Bush, J M; Ebert, D; Freeze, H H

1990-05-25

Although previous studies have indicated that N-linked oligosaccharides on lysosomal enzymes in Dictyostelium discoideum are extensively phosphorylated and sulfated, the role of these modifications in the sorting and function of these enzymes remains to be determined. We have used radiolabel pulse-chase, subcellular fractionation, and immunofluorescence microscopy to analyze the transport, processing, secretion, and sorting of two lysosomal enzymes in a mutant, HL244, which is almost completely defective in sulfation. [3H]Mannose-labeled N-linked oligosaccharides were released from immunoprecipitated alpha-mannosidase and beta-glucosidase of HL244 by digestion with peptide: N-glycosidase. The size, Man9-10GlcNAc2, and processing of the neutral species were similar to that found in the wild type, but the anionic oligosaccharides were less charged than those from the wild-type enzymes. All of the negative charges on the oligosaccharides for HL244 were due to the presence of 1, 2, or 3 phosphodiesters and not to sulfate esters. The rate of proteolytic processing of precursor forms of alpha-mannosidase and beta-glucosidase to mature forms in HL244 was identical to wild type. The precursor polypeptides in the mutant and the wild type were membrane associated until being processed to mature forms; therefore, sulfated sugars are not essential for this association. Furthermore, the rate of transport of alpha-mannosidase and beta-glucosidase from the endoplasmic reticulum to the Golgi complex was normal in the mutant as determined by the rate at which the newly synthesized proteins became resistant to the enzyme, endo-beta-N-acetylglucosaminidase H. There was no increase in the percentage of newly synthesized mutant precursors which escaped sorting and were secreted, and the intracellularly retained lysosomal enzymes were properly localized to lysosomes as determined by fractionation of cell organelles on Percoll gradients and immunofluorescence microscopy. However, the

Functional Study of the Vitamin K Cycle Enzymes in Live Cells

PubMed Central

Tie, J.-K.; Stafford, D.W.

2018-01-01

Vitamin K-dependent carboxylation, an essential posttranslational modification catalyzed by gamma-glutamyl carboxylase, is required for the biological functions of proteins that control blood coagulation, vascular calcification, bone metabolism, and other important physiological processes. Concomitant with carboxylation, reduced vitamin K (KH2) is oxidized to vitamin K epoxide (KO). KO must be recycled back to KH2 by the enzymes vitamin K epoxide reductase and vitamin K reductase in a pathway known as the vitamin K cycle. Our current knowledge about the enzymes of the vitamin K cycle is mainly based on in vitro studies of each individual enzymes under artificial conditions, which are of limited usefulness in understanding how the complex carboxylation process is carried out in the physiological environment. In this chapter, we review the current in vitro activity assays for vitamin K cycle enzymes. We describe the rationale, establishment, and application of cell-based assays for the functional study of these enzymes in the native cellular milieu. In these cell-based assays, different vitamin K-dependent proteins were designed and stably expressed in mammalian cells as reporter proteins to accommodate the readily used enzyme-linked immunosorbent assay for carboxylation efficiency evaluation. Additionally, recently emerged genome-editing techniques TALENs and CRISPR-Cas9 were used to knock out the endogenous enzymes in the reporter cell lines to eliminate the background. These cell-based assays are easy to scale up for high-throughput screening of inhibitors of vitamin K cycle enzymes and have been successfully used to clarify the genotypes and their clinical phenotypes of enzymes of the vitamin K cycle. PMID:28065270

Droplet-Free Digital Enzyme-Linked Immunosorbent Assay Based on a Tyramide Signal Amplification System.

PubMed

Akama, Kenji; Shirai, Kentaro; Suzuki, Seigo

2016-07-19

Digital enzyme-linked immunosorbent assay (ELISA) is a single molecule counting technology and is one of the most sensitive immunoassay methods. The key aspect of this technology is to concentrate enzyme reaction products from a single target molecule in femtoliter droplets. This study presents a novel Digital ELISA that does not require droplets; instead, enzyme reaction products are concentrated using a tyramide signal amplification system. In our method, tyramide substrate reacts with horseradish peroxidase (HRP) labeled with an immunocomplex on beads, and the substrate is converted into short-lived radical intermediates. By adjusting the bead concentration in the HRP-tyramide reaction and conducting the reaction using freely moving beads, tyramide radicals are deposited only on beads labeled with HRP and there is no diffusion to other beads. Consequently, the fluorescence signal is localized on a portion of the beads, making it possible to count the number of labeled beads digitally. The performance of our method was demonstrated by detecting hepatitis B surface antigen with a limit of detection of 0.09 mIU/mL (139 aM) and a dynamic range of over 4 orders of magnitude. The obtained limit of detection represents a >20-fold higher sensitivity than conventional ELISA. Our method has potential applications in simple in vitro diagnostic systems for detecting ultralow concentrations of protein biomarkers.

Expression of the Kynurenine Pathway in Human Peripheral Blood Mononuclear Cells: Implications for Inflammatory and Neurodegenerative Disease

PubMed Central

Jones, Simon P.; Franco, Nunzio F.; Varney, Bianca; Sundaram, Gayathri; Brown, David A.; de Bie, Josien; Lim, Chai K.; Guillemin, Gilles J.; Brew, Bruce J.

2015-01-01

The kynurenine pathway is a fundamental mechanism of immunosuppression and peripheral tolerance. It is increasingly recognized as playing a major role in the pathogenesis of a wide variety of inflammatory, neurodegenerative and malignant disorders. However, the temporal dynamics of kynurenine pathway activation and metabolite production in human immune cells is currently unknown. Here we report the novel use of flow cytometry, combined with ultra high-performance liquid chromatography and gas chromatography-mass spectrometry, to sensitively quantify the intracellular expression of three key kynurenine pathway enzymes and the main kynurenine pathway metabolites in a time-course study. This is the first study to show that up-regulation of indoleamine 2,3-dioxygenase (IDO-1), kynurenine 3-monoxygenase (KMO) and quinolinate phosphoribosyltransferase (QPRT) is lacking in lymphocytes treated with interferon gamma. In contrast, peripheral monocytes showed a significant elevation of kynurenine pathway enzymes and metabolites when treated with interferon gamma. Expression of IDO-1, KMO and QPRT correlated significantly with activation of the kynurenine pathway (kynurenine:tryptophan ratio), quinolinic acid concentration and production of the monocyte derived, pro-inflammatory immune response marker: neopterin. Our results also describe an original and sensitive methodological approach to quantify kynurenine pathway enzyme expression in cells. This has revealed further insights into the potential role of these enzymes in disease processes. PMID:26114426

Oral administration of pentachlorophenol induces interferon signaling mRNAs in C57BL/6 male mouse liver.

PubMed

Kanno, Jun; Aisaki, Ken-ichi; Igarashi, Katsuhide; Kitajima, Satoshi; Matsuda, Nae; Morita, Koichi; Tsuji, Masaki; Moriyama, Noriko; Furukawa, Yusuke; Otsuka, Maki; Tachihara, Erika; Nakatsu, Noriyuki; Kodama, Yukio

2013-01-01

Pentachlorophenol (PCP) was monitored for transcriptome responses in adult mouse liver at 2, 4, 8 and 24 hr after a single oral administration at four dose levels, 0, 10, 30 and 100 mg/kg. The expression data obtained using Affymetrix GeneChip MOE430 2.0 were absolutized by the Percellome method and expressed as three dimensional (3D) surface graphs with axes of time, dose and copy numbers of mRNA per cell. We developed the programs RSort, for comprehensive screening of the 3D surface data and PercellomeExploror for cross-referencing and confirmed the significant responses by visual inspection. In the first 8 hr, approximately 100 probe sets (PSs) related to PXR/SXR and Cyp2a4 and other metabolic enzymes were induced whereas Fos and JunB were suppressed. At 24 hr, about 1,200 PSs were strongly induced. We cross-referenced the Percellome database consisting of 111 chemicals on the liver transcriptome and found that about half of the PSs belonged to the metabolic pathways including Nrf2-mediated oxidative stress response networks shared with some of the 111 chemicals. The other half of the induced genes were interferon signaling network genes (ISG) and their induction was unique to PCP. Toll like receptors and other pattern recognition receptors, interferon regulatory factors and interferon alpha itself were included but inflammatory cytokines were not induced. In summary, these data indicated that functional symptoms of PCP treatment, such as hyperthermia and profuse sweating might be mediated by the ISG rather than the previously documented mitochondrial uncoupling mechanism. PCP might become a hint for developing low molecular weight orally available interferon mimetic drugs following imiquimod and RO4948191 as agonists of toll-like receptor and interferon receptor.

Interferon in lyssavirus infection.

PubMed

Rieder, Martina; Finke, Stefan; Conzelmann, Karl-Klaus

2012-01-01

Rabies is a zoonosis still claiming more than 50 000 human deaths per year. Typically, human cases are due to infection with rabies virus, the prototype of the Lyssavirus genus, but sporadic cases of rabies-like encephalitis caused by other lyssaviruses have been reported. In contrast to rabies virus, which has an extremely broad host range including many terrestrial warm-blooded animals, rabies-related viruses are associated predominantly with bats and rarely infect terrestrial species. In spite of a very close genetic relationship of rabies and rabies-related viruses, the factors determining the limited host range of rabies-related viruses are not clear. In the past years the importance of viral countermeasures against the host type I interferon system for establishment of an infection became evident. The rabies virus phosphoprotein (P) has emerged as a critical factor required for paralysing the signalling cascades leading to transcriptional activation of interferon genes as well as interferon signalling pathways, thereby limiting expression of antiviral and immune stimulatory genes. Comparative studies would be of interest in order to determine whether differential abilities of the lyssavirus P proteins contribute to the restricted host range of lyssaviruses.

Enzyme-linked immunosorbent assay compared with neutralization tests for evaluation of live mumps vaccines.

PubMed Central

Sakata, H; Hishiyama, M; Sugiura, A

1984-01-01

Mumps-specific antibody levels before and after vaccination with live mumps vaccines were determined by enzyme-linked immunosorbent assay (ELISA) and neutralization tests. A correlation was found between neutralization titers and optical density in ELISA. However, postvaccination sera from some vaccinees who failed to seroconvert by neutralization contained significant levels of mumps-specific antibody detectable by ELISA. In some of these serum specimens, the antibody directed to the F polypeptide of mumps virus was predominant. Most sera positive in ELISA neutralized mumps virus upon the addition of fresh guinea pig serum to the virus-serum mixture. Images PMID:6361060

INF-gamma rearranges membrane topography of MHC-I and ICAM-1 in colon carcinoma cells.

PubMed

Bacsó, Zsolt; Bene, László; Damjanovich, László; Damjanovich, Sándor

2002-01-18

Flow-cytometric fluorescence energy transfer (FCET) measurements between fluorescently labeled cell surface MHC-I and ICAM-1 molecules indicated similar receptor patterns in the plasma membrane of interferon-gamma (INF-gamma)-treated colon carcinoma cells as those observed earlier at the surface of lymphoid cells. INF-gamma activation significantly increased the density of MHC-I and ICAM-1 proteins in the membrane. This increase in receptor density was accompanied by decreased proximity level of the homo-associated MHC-I receptors. Hetero-association of MHC-I and ICAM-1 molecules was increased by INF-gamma treatment. INF-gamma changed neither hetero- nor homo-association of transferrin receptors. By staining the sphingomyelin/cholesterol-enriched lipid microdomains with fluorescently labeled cholera toxin B subunit, we found an increase in the amount of lipid-raft associated G(M1)-gangliosides due to INF-gamma treatment. Confocal microscopic results and FCET measurements show that MHC-I and ICAM-1 are components of G(M1)-ganglioside containing lipid-rafts and also support an increase in the size of these lipid-rafts upon INF-gamma treatment.

Aging Mechanisms and Nondestructive Aging Indicator of Filled Cross-linked Polyethylene (XLPE) Exposed to Simultaneous Thermal and Gamma Radiation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Shuaishuai; Fifield, Leonard S.; Bowler, Nicola

Aging mechanisms and a nondestructive aging indicator of filled cross-linked polyethylene (XLPE) cable insulation material used in nuclear power plants (NPPs) are studied. Using various material characterization techniques, likely candidates and functions for the main additives in a commercial filled-XLPE insulation material have been identified. These include decabromodiphenyl ether and Sb2O3 as flame retardants, ZnS as white pigment and polymerized 1,2-dihydro-2,2,4-trimethylquinoline as antioxidant. Gas chromatography-mass spectrometry, differential scanning calorimetry, oxidation induction time and measurements of dielectric loss tangent are utilized to monitor property changes as a function of thermal and radiation exposure of the cable material. Small-molecular-weight hydrocarbons are evolvemore » with gamma radiation aging at 90 °C. The level of antioxidant decreases with aging by volatilization and chemical reaction with free radicals. Thermal aging at 90 °C for 25 days or less causes no observable change to the cross-linked polymer structure. Gamma radiation causes damage to crystalline polymer regions and introduces defects. Dielectric loss tangent is shown to be an effective and reliable nondestructive indicator of the aging severity of the filled-XLPE insulation material.« less

Interferon-gamma, macrophages, and virus spread after HSV-1 injection.

PubMed

Cathcart, Heather M; Zheng, Mei; Covar, Jason J; Liu, Yi; Podolsky, Robert; Atherton, Sally S

2011-06-07

After uniocular anterior chamber (AC) injection of HSV-1, the anterior segment of BALB/c mice becomes inflamed and infected; however, virus does not spread from the anterior segment to cause retinitis in the injected eye. The purpose of these studies was to determine whether interferon (IFN-)-γ and Mac-1(+) cells play a role in preventing direct anterior-to-posterior spread of HSV-1 in the injected eye. One AC of adult female BALB/c mice was injected with HSV-1 (KOS). The location of IFN-α, IFN-β, and IFN-γ in the injected eye was determined by immunofluorescence, and mRNA expression was quantified by qPCR. Injected eyes of IFN-γ knockout or clodronate-treated macrophage-depleted mice were examined to determine whether the absence of IFN-γ or Mac-1(+) macrophages affected the sites or timing of virus spread. IFN-α, IFN-β, and IFN-γ were observed in the anterior segment of injected eyes through 72 hours and mRNA levels of IFN-β and IFN-γ were increased in virus-infected eyes 48 to 120 hours after infection. However, the absence of IFN-γ or macrophages did not affect either the sites or the timing of HSV-1 infection in injected eyes. Protection of the retina of the injected eye does not depend on a single cell type or cytokine. In addition, in the eye, as in other sites of the body, there are redundancies in the innate response to virus infection.

Individual and combined tumoricidal effects of dexamethasone and interferons on human leukocyte cell lines.

PubMed

Pan, L Y; Guyre, P M

1988-02-01

We investigated the influence of glucocorticoids on two effects of interferons (IFNs) which are thought to relate to their antitumor actions: cytotoxic activity and induction of HLA antigen expression. We treated human myeloid cell lines (U-937, HL-60, THP-1, K-562, and KG-1a), and T-(MOLT-4) and B- (Daudi) lymphoblastic cell lines with concentrations of IFN-alpha, IFN-gamma, and dexamethasone (Dex) which are commonly achieved in the circulation following therapeutic administration. The results show that for every cell line except Daudi, the greatest inhibition of cell growth occurred when IFN-gamma and Dex treatments were combined. The advantage of combined IFN-gamma and Dex treatment over treatment with either agent alone was most dramatic for the three cell lines (U-937, HL-60, and THP-1) which have monocytoid characteristics. There was also more growth inhibition by the combination of IFN-alpha and Dex than by either agent alone for all seven cell lines tested. The induction of HLA antigen expression by IFN-alpha and IFN-gamma, an effect which could increase recognition of the tumor cells by the immune system, was as great or greater in the presence of Dex as in its absence. These results demonstrate that glucocorticoids do not inhibit, and in some cases enhance, two effects of IFNs that appear to be related to their antitumor actions: inhibition of tumor cell proliferation and enhancement of HLA antigen expression.

Shift in disparities in hepatitis C treatment from interferon to DAA era: A population-based cohort study.

PubMed

Janjua, N Z; Islam, N; Wong, J; Yoshida, E M; Ramji, A; Samji, H; Butt, Z A; Chong, M; Cook, D; Alvarez, M; Darvishian, M; Tyndall, M; Krajden, M

2017-08-01

We evaluated the shift in the characteristics of people who received interferon-based hepatitis C virus (HCV) treatments and those who received recently introduced direct-acting antivirals (DAAs) in British Columbia (BC), Canada. The BC Hepatitis Testers Cohort includes 1.5 million individuals tested for HCV or HIV, or reported cases of hepatitis B and active tuberculosis in BC from 1990 to 2013 linked to medical visits, hospitalization, cancer, prescription drugs and mortality data. This analysis included all patients who filled at least one prescription for HCV treatment until 31 July 2015. HCV treatments were classified as older interferon-based treatments including pegylated interferon/ribavirin (PegIFN/RBV) with/without boceprevir or telaprevir, DAAs with RBV or PegIFN/RBV, and newer interferon-free DAAs. Of 11 886 people treated for HCV between 2000 and 2015, 1164 (9.8%) received interferon-free DAAs (ledipasvir/sofosbuvir: n=1075; 92.4%), while 452 (3.8%) received a combination of DAAs and RBV or PegIFN/RBV. Compared to those receiving interferon-based treatment, people with HIV co-infection (adjusted odds ratio [aOR]: 2.96, 95% CI: 2.31-3.81), cirrhosis (aOR: 1.77, 95% CI: 1.45-2.15), decompensated cirrhosis (aOR: 1.72, 95% CI: 1.31-2.28), diabetes (aOR: 1.30, 95% CI: 1.10-1.54), a history of injection drug use (aOR: 1.34, 95% CI: 1.09-1.65) and opioid substitution therapy (aOR: 1.30, 95% CI: 1.01-1.67) were more likely to receive interferon-free DAAs. Socio-economically marginalized individuals were significantly less likely (most deprived vs most privileged: aOR: 0.71, 95% CI: 0.58-0.87) to receive DAAs. In conclusion, there is a shift in prescription of new HCV treatments to previously excluded groups (eg HIV-co-infected), although gaps remain for the socio-economically marginalized populations. © 2017 John Wiley & Sons Ltd.

Interferon Induced Transfer of Viral Resistance

DTIC Science & Technology

1981-02-01

necseeary and Identify by block number) - Interferon, Cell Communication, Resistance Transfer, Viruses , Antibody Production, Polypeptide Hormones...lymphocytes and the foreign cells, but not mycoplasmas or endogenous viruses , appears to be required for induction. The kinetics of production of leukocyte...interferon by nonsensitized lymphocytes in response to foreign cells is similar to that induced by viruses . We have shown that a component probably of Vie

Interferon Induced Transfer of Viral Resistance

DTIC Science & Technology

1982-02-01

released from the cell membrane. We have also shown that CM’s activity is removed by a gelatin /sepharose affinity column which selectively binds...interferon preparation adsorbing to the WISH cells, interferon was subjected to gelatin /sepharose affinity chromatography to remove endogenous...caused an increase in the amount of H-.amnino acids incorporated into a gelatin binding protein, presumably fibronectin. This suggests that in addition to

[Interferons--its method of administration and adverse effect related to pharmacokinetics ].

PubMed

Furue, H

1984-02-01

The potential role of interferons in the treatment of malignant diseases is currently being evaluated. This paper reviews experimental and clinical findings regarding pharmacokinetics, method of administration, and side reactions of interferons. Interferon in the blood is rapidly cleared from the circulation. Intramuscular injection of alpha-interferon causes low but stable interferon levels in the blood. However, in the case of beta-interferon, interferon is never detected consistently in the blood after intramuscular or subcutaneous administration. The studies with animal models suggest that doses higher than those given in current clinical trials will be necessary to obtain clearly beneficial effects in human. The maximum safely tolerated daily dose is appreciably higher than that used in most previous studies, although even at this level, considerable toxicity may be encountered. Adequate method of administration, route, dose and interval are not yet established at all. Exact mechanism of anticancer activity is not yet well defined. The most frequent side reaction is fever. However, the exact mechanism to cause these side reactions is also not yet clarified. Dose limiting central nervous system toxicities, hypotension, hypocalcaemia etc. are occasionally encountered in some instances. Antibody to interferon is demonstrated in some cases. Purification of interferon does not always causes reduction of side reactions. The treatment of cancer cases with interferon has just started and there are many problems to be solved. However, therapeutic beneficial may be achieved in the treatment of malignant tumors by appropriate combinations of interferon with conventional treatment. More laboratory studies as well as carefully controlled clinical observations are warranted.

Development of horseradish peroxidase-based cross-linked enzyme aggregates and their environmental exploitation for bioremediation purposes.

PubMed

Bilal, Muhammad; Iqbal, Hafiz M N; Hu, Hongbo; Wang, Wei; Zhang, Xuehong

2017-03-01

In the present study, horseradish peroxidase (HRP), in-house isolated crude cocktail enzyme, from Armoracia rusticana was cross-linked using a new type of cross-linking agent, i.e., ethylene glycol-bis [succinic acid N-hydroxysuccinimide, (EG-NHS)], which is mild in nature as compared to the glutaraldehyde (GA). The HRP-immobilized cross-linked enzyme aggregates (HRP-CLEAs) were developed using a wider range of EG-NHS and notably no adverse effect was observed. In a comparative evaluation, in the case of EG-NHS, a high-level stability in the residual activity was recorded, whereas a sharp decrease was observed in the case of glutaraldehyde. Following initial cross-linker evaluation, the HRP-CLEAs were tested to investigate their bio-catalytic efficacy for bioremediation purposes using a newly developed packed bed reactor system (PBRS). A maximal of 94.26% degradation of textile-based methyl orange dye was recorded within the shortest time frame, following 91.73% degradation of basic red 9, 84.35% degradation of indigo, 81.47% degradation of Rhodamin B, and 73.6% degradation of Rhodamine 6G, respectively, under the same working environment. Notably, the HRP-CLEAs retained almost 60% of its original activity after methyl orange dye degradation in seven consecutive cycles using PBRS. Furthermore, after HRP-CLEAs-mediated treatment in the PBRS, a significant toxicity reduction in the dye samples was recorded as compared to their pristine counterparts. In conclusion, the results suggest that the newly developed HRP-CLEAs have a great potential for industrial exploitation, to tackle numerous industrial dye-based emergent pollutants. Copyright © 2016 Elsevier Ltd. All rights reserved.

Enzyme nanoparticle fabrication: magnetic nanoparticle synthesis and enzyme immobilization.

PubMed

Johnson, Patrick A; Park, Hee Joon; Driscoll, Ashley J

2011-01-01

Immobilized enzymes are drawing significant attention for potential commercial applications as biocatalysts by reducing operational expenses and by increasing process utilization of the enzymes. Typically, immobilized enzymes have greater thermal and operational stability at various pH values, ionic strengths and are more resistant to denaturation that the soluble native form of the enzyme. Also, immobilized enzymes can be recycled by utilizing the physical or chemical properties of the supporting material. Magnetic nanoparticles provide advantages as the supporting material for immobilized enzymes over competing materials such as: higher surface area that allows for greater enzyme loading, lower mass transfer resistance, less fouling effect, and selective, nonchemical separation from the reaction mixture by an applied a magnetic field. Various surface modifications of magnetic nanoparticles, such as silanization, carbodiimide activation, and PEG or PVA spacing, aid in the binding of single or multienzyme systems to the particles, while cross-linking using glutaraldehyde can also stabilize the attached enzymes.

Allocation of Interferon Gamma mRNA Positive Cells in Caecum Hallmarks a Protective Trait Against Histomonosis.

PubMed

Kidane, Fana Alem; Mitra, Taniya; Wernsdorf, Patricia; Hess, Michael; Liebhart, Dieter

2018-01-01

Histomonosis is a parasitic disease of gallinaceous birds characterized by necrotic lesions in cacum and liver that usually turns fatal in turkeys while it is less severe in chickens. Vaccination using in vitro attenuated Histomonas meleagridis has been experimentally shown to confer protection against histomonosis. The protective mechanisms that underpin the vaccine-induced immune response are not resolved so far. Therefore, the actual study aimed to evaluate the location and quantitative distribution patterns of signature cytokines of type 1 [interferon gamma (IFN-γ)] or type 2 [interleukin (IL)-13] immune responses in vaccinated or infected hosts. An intergroup and interspecies difference in the spatial and temporal distribution patterns of cytokine mRNA positive cells was evident. Quantification of cells showed a significantly decreased percentage of IFN-γ mRNA positive cells at 4 days post-inoculation (DPI) in caeca of turkeys inoculated exclusively with the attenuated or the virulent inocula, compared to control birds. The decrement was followed by a surge of cells expressing mRNA for IFN-γ or IL-13, reaching a peak of increment at 10 DPI. By contrast, turkeys challenged following vaccination showed a slight increment of cecal IFN-γ mRNA positive cells at 4 DPI after which positive cell counts became comparable to control birds. The increase in infected birds was accompanied by an extensive distribution of positively stained cells up to the muscularis layer of cecal tissue whereas the vaccine group maintained an intact mucosal structure. In chickens, the level of changes of positive cells was generally lower compared to turkeys. However, control chickens were found with a higher percentage of IFN-γ mRNA positive cells in cecum compared to their turkey counterparts indicating a higher resistance to histomonosis, similar to the observation in immunized turkeys. In chickens, it could be shown that the changes of cytokine-positive cells were related to

Thermometric enzyme linked immunosorbent assay in continuous flow system: optimization and evaluation using human serum albumin as a model system.

PubMed

Borrebaeck, C; Börjeson, J; Mattiasson, B

1978-06-15

Thermometric enzyme-linked immunosorbent assay (TELISA) is described. After the procedure of optimization, human serum albumin was assayed using anti-human serum albumin bound to Sepharose CL 4-B in the enzyme thermistor unit and catalase as label on the free antigen. The model system was used for assays down to 10(-13)M and the preparation of immobilized antibodies was used repeatedly up to 100 times. Comparative studies of the TELISA technique with bromocresol green, immunoturbidimetric and rocket immunoelectrophoretic methods were carried out and showed that TELISA could be used as an alternative method.

A novel microfluidic microplate as the next generation assay platform for enzyme linked immunoassays (ELISA).

PubMed

Kai, Junhai; Puntambekar, Aniruddha; Santiago, Nelson; Lee, Se Hwan; Sehy, David W; Moore, Victor; Han, Jungyoup; Ahn, Chong H

2012-11-07

In this work we introduce a novel microfluidic enzyme linked immunoassays (ELISA) microplate as the next generation assay platform for unparalleled assay performances. A combination of microfluidic technology with standard SBS-configured 96-well microplate architecture, in the form of microfluidic microplate technology, allows for the improvement of ELISA workflows, conservation of samples and reagents, improved reaction kinetics, and the ability to improve the sensitivity of the assay by multiple analyte loading. This paper presents the design and characterization of the microfluidic microplate, and its application in ELISA.

Method for synthesizing peptides with saccharide linked enzyme polymer conjugates

DOEpatents

Callstrom, Matthew R.; Bednarski, Mark D.; Gruber, Patrick R.

1997-01-01

A method is disclosed for synthesizing peptides using water soluble enzyme polymer conjugates. The method comprises catalyzing the peptide synthesis with enzyme which has been covalently bonded to a polymer through at least three linkers which linkers have three or more hydroxyl groups. The enzyme is conjugated at lysines or arginines.

Genes from the medicinal leech (Hirudo medicinalis) coding for unusual enzymes that specifically cleave endo-epsilon (gamma-Glu)-Lys isopeptide bonds and help to dissolve blood clots.

PubMed

Zavalova, L; Lukyanov, S; Baskova, I; Snezhkov, E; Akopov, S; Berezhnoy, S; Bogdanova, E; Barsova, E; Sverdlov, E D

1996-11-27

We previously detected in salivary gland secretions of the medicinal leech (Hirudo medicinalis) a novel enzymatic activity, endo-epsilon(gamma-Glu)-Lys isopeptidase, which cleaves isopeptide bonds formed by transglutaminase (Factor XIIIa) between glutamine gamma-carboxamide and the epsilon-amino group of lysine. Such isopeptide bonds, either within or between protein polypeptide chains are formed in many biological processes. However, before we started our work no enzymes were known to be capable of specifically splitting isopeptide bonds in proteins. The isopeptidase activity we detected was specific for isopeptide bonds. The enzyme was termed destabilase. Here we report the first purification of destabilase, part of its amino acid sequence isolation and sequencing of two related cDNAs derived from the gene family that encodes destabilase proteins, and the detection of isopeptidase activity encoded by one of these cDNAs cloned in a baculovirus expression vector. The deduced mature protein products of these cDNAs contain 115 and 116 amino acid residues, including 14 highly conserved Cys residues, and are formed from precursors containing specific leader peptides. No homologous sequences were found in public databases.

Beta-interferon inhibits cell infection by Trypanosoma cruzi

NASA Technical Reports Server (NTRS)

Kierszenbaum, F.; Sonnenfeld, G.

1984-01-01

Beta interferon has been shown to inhibit the capacity of bloodstream forms of the flagellate Trypanosoma cruzi, the causative agent of Chagas' disease, to associate with and infect mouse peritoneal macrophages and rat heart myoblasts. The inhibitory effect was abrogated in the presence of specific antibodies to the interferon. Pretreatment of the parasites with interferon reduced their infectivity for untreated host cells, whereas pretreament of either type of host cell did not affect the interaction. The effect of interferon on the trypanosomes was reversible; the extent of the inhibitory effect was significantly reduced afer 20 min, and was undetectable after 60 min when macrophages were used as host cells. For the myoblasts, 60 min elapsed before the inhibitory effect began to subside and 120 min elapsed before it became insignificant or undetectable.

Natural Killer Cells and Helicobacter pylori Infection: Bacterial Antigens and Interleukin-12 Act Synergistically To Induce Gamma Interferon Production

PubMed Central

Yun, Cheol H.; Lundgren, Anna; Azem, Josef; Sjöling, Åsa; Holmgren, Jan; Svennerholm, Ann-Mari; Lundin, B. Samuel

2005-01-01

Helicobacter pylori is known to induce a local immune response, which is characterized by activation of lymphocytes and the production of IFN-γ in the stomach mucosa. Since not only T cells, but also natural killer (NK) cells, are potent producers of gamma interferon (IFN-γ), we investigated whether NK cells play a role in the immune response to H. pylori infection. Our results showed that NK cells were present in both the gastric and duodenal mucosae but that H. pylori infection did not affect the infiltration of NK cells into the gastrointestinal area. Furthermore, we could show that NK cells could be activated directly by H. pylori antigens, as H. pylori bacteria, as well as lysate from H. pylori, induced the secretion of IFN-γ by NK cells. NK cells were also activated without direct contact when separated from the bacteria by an epithelial cell layer, indicating that the activation of NK cells by H. pylori can also occur in vivo, in the infected stomach mucosa. Moreover, the production of IFN-γ by NK cells was greatly enhanced when a small amount of interleukin-12 (IL-12) was added, and this synergistic effect was associated with increased expression of the IL-12 receptor β2. It was further evident that bacterial lysate alone was sufficient to induce the activation of cytotoxicity-related molecules. In conclusion, we demonstrated that NK cells are present in the gastroduodenal mucosa of humans and that NK cells produce high levels of IFN-γ when stimulated with a combination of H. pylori antigen and IL-12. We propose that NK cells play an active role in the local immune response to H. pylori infection. PMID:15731046

CD8+ T Cell Exhaustion, Suppressed Gamma Interferon Production, and Delayed Memory Response Induced by Chronic Brucella melitensis Infection

PubMed Central

Durward-Diioia, Marina; Harms, Jerome; Khan, Mike; Hall, Cherisse; Smith, Judith A.

2015-01-01

Brucella melitensis is a well-adapted zoonotic pathogen considered a scourge of mankind since recorded history. In some cases, initial infection leads to chronic and reactivating brucellosis, incurring significant morbidity and economic loss. The mechanism by which B. melitensis subverts adaptive immunological memory is poorly understood. Previous work has shown that Brucella-specific CD8+ T cells express gamma interferon (IFN-γ) and can transition to long-lived memory cells but are not polyfunctional. In this study, chronic infection of mice with B. melitensis led to CD8+ T cell exhaustion, manifested by programmed cell death 1 (PD-1) and lymphocyte activation gene 3 (LAG-3) expression and a lack of IFN-γ production. The B. melitensis-specific CD8+ T cells that produced IFN-γ expressed less IFN-γ per cell than did CD8+ cells from uninfected mice. Both memory precursor (CD8+ LFA1HI CD127HI KLRG1LO) and long-lived memory (CD8+ CD27HI CD127HI KLRG1LO) cells were identified during chronic infection. Interestingly, after adoptive transfer, mice receiving cells from chronically infected animals were able to contain infection more rapidly than recipients of cells from acutely infected or uninfected donors, although the proportions of exhausted CD8+ T cells increased after adoptive transfer in both challenged and unchallenged recipients. CD8+ T cells of challenged recipients initially retained the stunted IFN-γ production found prior to transfer, and cells from acutely infected mice were never seen to transition to either memory subset at all time points tested, up to 30 days post-primary infection, suggesting a delay in the generation of memory. Here we have identified defects in Brucella-responsive CD8+ T cells that allow chronic persistence of infection. PMID:26416901

Knockdown of hTERT and concurrent treatment with interferon-gamma inhibited proliferation and invasion of human glioblastoma cell lines

PubMed Central

George, Joseph; Banik, Naren L.; Ray, Swapan K.

2011-01-01

Human telomerase reverse transcriptase (hTERT) is the catalytic component of telomerase that facilitates tumor cell invasion and proliferation. Telomerase and hTERT are remarkably upregulated in majority of cancers including glioblastoma. Interferon-gamma (IFN-γ) modulates several cellular activities including cell cycle and multiplication through transcriptional regulation. The present investigation was designed to unravel the molecular mechanisms of the inhibition of cell proliferation, migration, and invasion of human glioblastoma SNB-19 and LN-18 cell lines after knockdown of hTERT using a plasmid vector based siRNA and concurrent treatment with IFN-γ. We observed more than 80% inhibition of cell proliferation, migration, and invasion of both cell lines after the treatment with combination of hTERT siRNA and IFN-γ. Our studies also showed accumulation of apoptotic cells in subG1 phase and an increase in cell population in G0/G1 with a reduction in G2/M phase indicating cell cycle arrest in G0/G1 phase for apoptosis. Semiquantitative and real-time RT-PCR analyses demonstrated significant downregulation of c- Myc and upregulation of p21 Waf1 and p27 Kip1. Western blotting confirmed the downregulation of the molecules involved in cell proliferation, migration, and invasion and also showed upregulation of cell cycle inhibitors. In conclusion, our study demonstrated that knockdown of hTERT siRNA and concurrent treatment with IFN-γ effectively inhibited cell proliferation, migration, and invasion in glioblastoma cells through downregulation of the molecules involved in these processes and cell cycle inhibition. Therefore, the combination of hTERT siRNA and IFN-γ offers a potential therapeutic strategy for controlling growth of human glioblastoma cells. PMID:20394835

A novel role for adiponectin in regulating the immune responses in chronic hepatitis C virus infection.

PubMed

Palmer, Clovis; Hampartzoumian, Taline; Lloyd, Andrew; Zekry, Amany

2008-08-01

Adipose tissue releases pro-inflammatory and anti-inflammatory mediators, including adiponectin, which elicit a broad range of metabolic and immunological effects. The study aim was to determine in subjects infected with chronic hepatitis C virus (HCV) the effects of total adiponectin and its high-molecular-weight (HMW) and low-molecular-weight isoforms on HCV-specific immune responses. Serum levels of total adiponectin and its isoforms were determined by immunoassay. The ex vivo effect of adiponectin on the HCV-specific T-cell response was examined by interferon gamma (IFN-gamma) enzyme-linked immunosorbent spot and enzyme-linked immunosorbent assay cytokine assays. The role of the mitogen-activated protein kinase (MAPK) signaling pathway in mediating the adiponectin effect on T cells was also evaluated. We found that serum levels of total and HMW adiponectin were significantly decreased in subjects with chronic HCV and increased body mass index (BMI) compared with HCV-infected lean subjects. The presence of an anti-HCV specific immune response was strongly associated with lower BMI (P = 0.004) and higher serum total (P = 0.01) and HMW (P = 0.02) adiponectin. In ex vivo assays, total adiponectin and the HMW adiponectin isoform enhanced HCV-specific IFN-gamma production (P = 0.02 and 0.03, respectively). Adiponectin-R1 receptors were expressed on T cells and monocytes. In depletion experiments, the IFN-gamma response to adiponectin was entirely dependent on the simultaneous presence of both CD4 and CD8 T cells, and to a lesser extent, natural killer cells. Selective inhibition of p38MAPK activity by SB203580 abrogated the IFN-gamma response to adiponectin, whereas extracellular signal-regulated kinase 1/2 inhibition by PD98059 did not affect the response. In chronic HCV, a reciprocal association exists between BMI, adiponectin, and the anti-HCV immune responses, emphasizing the important role played by adiposity in regulating the immune response in HCV infection.

How Methodologic Differences Affect Results of Economic Analyses: A Systematic Review of Interferon Gamma Release Assays for the Diagnosis of LTBI

PubMed Central

Oxlade, Olivia; Pinto, Marcia; Trajman, Anete; Menzies, Dick

2013-01-01

Introduction Cost effectiveness analyses (CEA) can provide useful information on how to invest limited funds, however they are less useful if different analysis of the same intervention provide unclear or contradictory results. The objective of our study was to conduct a systematic review of methodologic aspects of CEA that evaluate Interferon Gamma Release Assays (IGRA) for the detection of Latent Tuberculosis Infection (LTBI), in order to understand how differences affect study results. Methods A systematic review of studies was conducted with particular focus on study quality and the variability in inputs used in models used to assess cost-effectiveness. A common decision analysis model of the IGRA versus Tuberculin Skin Test (TST) screening strategy was developed and used to quantify the impact on predicted results of observed differences of model inputs taken from the studies identified. Results Thirteen studies were ultimately included in the review. Several specific methodologic issues were identified across studies, including how study inputs were selected, inconsistencies in the costing approach, the utility of the QALY (Quality Adjusted Life Year) as the effectiveness outcome, and how authors choose to present and interpret study results. When the IGRA versus TST test strategies were compared using our common decision analysis model predicted effectiveness largely overlapped. Implications Many methodologic issues that contribute to inconsistent results and reduced study quality were identified in studies that assessed the cost-effectiveness of the IGRA test. More specific and relevant guidelines are needed in order to help authors standardize modelling approaches, inputs, assumptions and how results are presented and interpreted. PMID:23505412

Role of T Cells and Gamma Interferon during Induction of Hypersensitivity to Lipopolysaccharide by Toxic Shock Syndrome Toxin 1 in Mice

PubMed Central

Dinges, Martin M.; Schlievert, Patrick M.

2001-01-01

The superantigenic function of toxic shock syndrome toxin 1 (TSST-1) is generally regarded as an important determinant of its lethal effects in humans or experimental animals. This study examined the role of superantigenicity in a BALB/c mouse model of lethal TSST-1-induced hypersensitivity to lipopolysaccharide (LPS). In this model, TSST-1 greatly potentiated both LPS-induced lethality, as well as LPS-induced serum tumor necrosis factor alpha (TNF-α) activity. Although BALB/c-SCID mice were resistant to these LPS enhancement effects of TSST-1, BALB/c-SCID mice reconstituted with T cells were completely susceptible to the enhancement effect of TSST-1 on LPS-induced serum TNF-α. Mice pretreated with cyclosporine (Cs) or neutralizing antibodies against gamma interferon (IFN-γ) did not develop lethal LPS hypersensitivity when injected with TSST-1, and these agents reduced the enhancement effect of TSST-1 on LPS-induced serum TNF-α by 99 and 85%, respectively. Cs pretreatment also completely inhibited the known capacity of TSST-1 to amplify LPS-induced levels of IFN-γ in serum. In contrast, mice given Cs after a priming injection of TSST-1, but before LPS, still exhibited lethal hypersensitivity to LPS. Cs given after TSST-1 also did not inhibit enhancement of LPS-induced serum TNF-α by TSST-1 but inhibited the enhancement effect of TSST-1 on LPS-induced serum IFN-γ by 50%. These experiments support the theory that TSST-1-induced hypersensitivity to LPS is mediated primarily by IFN-γ derived from superantigen-activated T cells. PMID:11179286

Environmental Technology Verification Report for Abraxis Ecologenia® 17β-Estradiol (E2) Microplate Enzyme-Linked Immunosorbent Assay (ELISA) Test Kits

EPA Science Inventory

This verification test was conducted according to procedures specifiedin the Test/QA Planfor Verification of Enzyme-Linked Immunosorbent Assay (ELISA) Test Kis for the Quantitative Determination of Endocrine Disrupting Compounds (EDCs) in Aqueous Phase Samples. Deviations to the...

Method for synthesizing peptides with saccharide linked enzyme polymer conjugates

DOEpatents

Callstrom, M.R.; Bednarski, M.D.; Gruber, P.R.

1997-06-17

A method is disclosed for synthesizing peptides using water soluble enzyme polymer conjugates. The method comprises catalyzing the peptide synthesis with enzyme which has been covalently bonded to a polymer through at least three linkers which linkers have three or more hydroxyl groups. The enzyme is conjugated at lysines or arginines. 19 figs.

Resting Gamma Power Is Linked to Reading Ability in Adolescents

ERIC Educational Resources Information Center

Tierney, Adam; Strait, Dana L.; Kraus, Nina

2014-01-01

Infants who have more power within the gamma frequency range at rest develop better language and cognitive abilities over their first 3 years of life (Benasich et al., 2008). This positive trend may reflect the gradual increase in resting gamma power that peaks at about 4 years (Takano & Ogawa, 1998): infants further along the maturational…

Arthritis is inhibited in Borrelia-primed and infected interleukin-17A-deficient mice after administration of anti-gamma-interferon, anti-tumor necrosis factor alpha and anti-interleukin-6 antibodies.

PubMed

Kuo, Joseph; Warner, Thomas F; Schell, Ronald F

2017-08-31

The role that cytokines play in the induction of Lyme arthritis is gradually being delineated. We showed previously that severe arthritis developed in a T-cell-driven murine model, even in mice lacking interleukin-17A (IL-17A) and administered anti-gamma-interferon (IFN-γ) antibody. Increased levels of tumor necrosis factor alpha (TNF-α) and interleukin-6 (IL-6), two pro-inflammatory cytokines, were detected in cultures of popliteal lymph node cells obtained from these mice. We hypothesized that concomitantly administered anti-IL-6, anti-TNF-α and anti-IFN-γ antibodies would inhibit the development of arthritis in IL-17A-deficient mice. Our results showed that swelling of the hind paws and histopathological changes consistent with arthritis were significantly reduced in IL-17A-deficient mice that administered the three anti-cytokine antibodies. These results suggest that treatment with multiple anti-cytokine antibodies can abrogate the induction of Lyme arthritis in mice. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Analysis of simultaneous thermal/gamma radiation aging of cross-linked polyethylene (XLPE) insulation—interim status report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fifield, Leonard S.; Correa, Miguel

Cross-linked polyethylene (XLPE) is the most common cable insulation found in nuclear containment, and is therefore a priority material for investigation of long term aging effect from elevated temperature combined with gamma radiation exposure. Prior work has identified the possibility of anomalous aging behavior in XLPE such as the inverse temperature effect in which radiation exposure is more damaging at lower temperatures than at higher temperatures. We explored simultaneous aging of XLPE insulation from modern Firewall® III nuclear cables at 60, 90, and 115 °C, at gamma dose rates from 116 to 540 Gy/h, for exposure periods up to 25more » d. XLPE samples exposed in this way were characterized using the percent gel and uptake factor method. For the conditions and material examine, degradation behavior was seen to track proportionally with increasing temperature, rather than to exhibit greater degradation at lower temperatures. Ongoing work including similar aging at 25 °C and characterization of the XLPE samples using other methods will further elucidate these initial results« less

Ferredoxin-thioredoxin reductase: a catalytically active dithiol group links photoreduced ferredoxin to thioredoxin functional in photosynthetic enzyme regulation.

PubMed

Droux, M; Miginiac-Maslow, M; Jacquot, J P; Gadal, P; Crawford, N A; Kosower, N S; Buchanan, B B

1987-07-01

The mechanism by which the ferredoxin-thioredoxin system activates the target enzyme, NADP-malate dehydrogenase, was investigated by analyzing the sulfhydryl status of individual protein components with [14C]iodoacetate and monobromobimane. The data indicate that ferredoxin-thioredoxin reductase (FTR)--an iron-sulfur enzyme present in oxygenic photosynthetic organisms--is the first member of a thiol chain that links light to enzyme regulation. FTR possesses a catalytically active dithiol group localized on the 13 kDa (similar) subunit, that occurs in all species investigated and accepts reducing equivalents from photoreduced ferredoxin and transfers them stoichiometrically to the disulfide form of thioredoxin m. The reduced thioredoxin m, in turn, reduces NADP-malate dehydrogenase, thereby converting it from an inactive (S-S) to an active (SH) form. The means by which FTR is able to combine electrons (from photoreduced ferredoxin) with protons (from the medium) to reduce its active disulfide group remains to be determined.

Ferredoxin-thioredoxin reductase: a catalytically active dithiol group links photoreduced ferredoxin to thioredoxin functional in photosynthetic enzyme regulation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Droux, M.; Miginiac-Maslow, M.; Jacquot, J.P.

The mechanism by which the ferredoxin-thioredoxin system activates the target enzyme, NADP-malate dehydrogenase, was investigated by analyzing the sulfhydryl status of individual protein components with (/sup 14/C)iodoacetate and monobromobimane. The data indicate that ferredoxin-thioredoxin reductase (FTR)--an iron-sulfur enzyme present in oxygenic photosynthetic organisms--is the first member of a thiol chain that links light to enzyme regulation. FTR possesses a catalytically active dithiol group localized on the 13 kDa (similar) subunit, that occurs in all species investigated and accepts reducing equivalents from photoreduced ferredoxin and transfers them stoichiometrically to the disulfide form of thioredoxin m. The reduced thioredoxin m, in turn,more » reduces NADP-malate dehydrogenase, thereby converting it from an inactive (S-S) to an active (SH) form. The means by which FTR is able to combine electrons (from photoreduced ferredoxin) with protons (from the medium) to reduce its active disulfide group remains to be determined.« less

Interferon for the treatment of genital warts: a systematic review

PubMed Central

2009-01-01

Background Interferon has been widely used in the treatment of genital warts for its immunomodulatory, antiproliferative and antiviral properties. Currently, no evidence that interferon improves the complete response rate or reduces the recurrence rate of genital warts has been generally provided. The aim of this review is to assess, from randomized control trials (RCTs), the efficacy and safety of interferon in curing genital warts. Methods We searched Cochrane Sexually Transmitted Diseases Group's Trials Register (January, 2009), Cochrane Central Register of Controlled Trials (2009, issue 1), PubMed (1950-2009), EMBASE (1974-2009), Chinese Biomedical Literature Database (CBM) (1975-2009), China National Knowledge Infrastructure (CNKI) (1979-2009), VIP database (1989-2009), as well as reference lists of relevant studies. Two reviewers independently screened searched studies, extracted data and evaluated their methodological qualities. RevMan 4.2.8 software was used for meta-analysis Results 12 RCTs involving 1445 people were included. Among them, 7 studies demonstrated the complete response rate of locally-used interferon as compared to placebo for treating genital warts. Based on meta-analysis, the rate of Complete response of the two interventions differed significantly (locally-used interferon:44.4%; placebo:16.1%). The difference between the two groups had statistical significance (RR 2.68, 95% CI 1.79 to 4.02, P < 0.00001). 5 studies demonstrated the complete response rate of systemically-used interferon as compared to placebo for treating genital warts. Based on meta-analysis, the rate of Complete response of the two interventions had no perceivable discrepancy (systemically-used interferon:27.4%; placebo:26.4%). The difference between the two groups had no statistical significance (RR1.25, 95% CI 0.80 to 1.95, P > 0.05). 7 studies demonstrated the recurrence rate of interferon as compared to placebo for treating genital warts. Based on meta-analysis, the

Interferon for the treatment of genital warts: a systematic review.

PubMed

Yang, Jin; Pu, Yu-Guo; Zeng, Zhong-Ming; Yu, Zhi-Jian; Huang, Na; Deng, Qi-Wen

2009-09-21

Interferon has been widely used in the treatment of genital warts for its immunomodulatory, antiproliferative and antiviral properties. Currently, no evidence that interferon improves the complete response rate or reduces the recurrence rate of genital warts has been generally provided. The aim of this review is to assess, from randomized control trials (RCTs), the efficacy and safety of interferon in curing genital warts. We searched Cochrane Sexually Transmitted Diseases Group's Trials Register (January, 2009), Cochrane Central Register of Controlled Trials (2009, issue 1), PubMed (1950-2009), EMBASE (1974-2009), Chinese Biomedical Literature Database (CBM) (1975-2009), China National Knowledge Infrastructure (CNKI) (1979-2009), VIP database (1989-2009), as well as reference lists of relevant studies. Two reviewers independently screened searched studies, extracted data and evaluated their methodological qualities. RevMan 4.2.8 software was used for meta-analysis 12 RCTs involving 1445 people were included. Among them, 7 studies demonstrated the complete response rate of locally-used interferon as compared to placebo for treating genital warts. Based on meta-analysis, the rate of Complete response of the two interventions differed significantly (locally-used interferon:44.4%; placebo:16.1%). The difference between the two groups had statistical significance (RR 2.68, 95% CI 1.79 to 4.02, P < 0.00001). 5 studies demonstrated the complete response rate of systemically-used interferon as compared to placebo for treating genital warts. Based on meta-analysis, the rate of Complete response of the two interventions had no perceivable discrepancy (systemically-used interferon:27.4%; placebo:26.4%). The difference between the two groups had no statistical significance (RR1.25, 95% CI 0.80 to 1.95, P > 0.05). 7 studies demonstrated the recurrence rate of interferon as compared to placebo for treating genital warts. Based on meta-analysis, the recurrence rate of the two

Development of a biomimetic enzyme-linked immunosorbent assay based on molecularly imprinted polymers on paper for the detection of carbaryl.

PubMed

Zhang, Can; Cui, Hanyu; Han, Yufeng; Yu, Fangfang; Shi, Xiaoman

2018-02-01

A biomimetic enzyme-linked immunosorbent assay (BELISA) which was based on molecularly imprinted polymers on paper (MIPs-paper) with specific recognition was developed. As a detector, the surface of paper was modified with γ-MAPS by hydrolytic action and anchored the MIP layer on γ-MAPS modified-paper by copolymerization to construct the artificial antibody Through a series of experimentation and verification, we successful got the MIPs-paper and established BELISA for the detection of carbaryl. The development of MIPs-paper based on BELISA was applied to detect carbaryl in real samples and validated by an enzyme-linked immunosorbent assay (ELISA) based on anti-carbaryl biological antibody. The results of these two methods (BELISA and ELISA) were well correlated (R 2 =0.944). The established method of MIPs-paper BELISA exhibits the advantages of low cost, higher stability and being re-generable, which can be applied as a convenient tool for the fast and efficient detection of carbaryl. Copyright © 2017. Published by Elsevier Ltd.

Identification of Interferon-Stimulated Gene Proteins That Inhibit Human Parainfluenza Virus Type 3.

PubMed

Rabbani, M A G; Ribaudo, Michael; Guo, Ju-Tao; Barik, Sailen

2016-12-15

A major arm of cellular innate immunity is type I interferon (IFN), represented by IFN-α and IFN-β. Type I IFN transcriptionally induces a large number of cellular genes, collectively known as IFN-stimulated gene (ISG) proteins, which act as antivirals. The IFIT (interferon-induced proteins with tetratricopeptide repeats) family proteins constitute a major subclass of ISG proteins and are characterized by multiple tetratricopeptide repeats (TPRs). In this study, we have interrogated IFIT proteins for the ability to inhibit the growth of human parainfluenza virus type 3 (PIV3), a nonsegmented negative-strand RNA virus of the Paramyxoviridae family and a major cause of respiratory disease in children. We found that IFIT1 significantly inhibited PIV3, whereas IFIT2, IFIT3, and IFIT5 were less effective or not at all. In further screening a set of ISG proteins we discovered that several other such proteins also inhibited PIV3, including IFITM1, IDO (indoleamine 2,3-dioxygenase), PKR (protein kinase, RNA activated), and viperin (virus inhibitory protein, endoplasmic reticulum associated, interferon inducible)/Cig5. The antiviral effect of IDO, the enzyme that catalyzes the first step of tryptophan degradation, could be counteracted by tryptophan. These results advance our knowledge of diverse ISG proteins functioning as antivirals and may provide novel approaches against PIV3. The innate immunity of the host, typified by interferon (IFN), is a major antiviral defense. IFN inhibits virus growth by inducing a large number of IFN-stimulated gene (ISG) proteins, several of which have been shown to have specific antiviral functions. Parainfluenza virus type 3 (PIV3) is major pathogen of children, and no reliable vaccine or specific antiviral against it currently exists. In this article, we report several ISG proteins that strongly inhibit PIV3 growth, the use of which may allow a better antiviral regimen targeting PIV3. Copyright © 2016, American Society for Microbiology

Inflammation activates the interferon signaling pathways in taste bud cells.

PubMed

Wang, Hong; Zhou, Minliang; Brand, Joseph; Huang, Liquan

2007-10-03

Patients with viral and bacterial infections or other inflammatory illnesses often experience taste dysfunctions. The agents responsible for these taste disorders are thought to be related to infection-induced inflammation, but the mechanisms are not known. As a first step in characterizing the possible role of inflammation in taste disorders, we report here evidence for the presence of interferon (IFN)-mediated signaling pathways in taste bud cells. IFN receptors, particularly the IFN-gamma receptor IFNGR1, are coexpressed with the taste cell-type markers neuronal cell adhesion molecule and alpha-gustducin, suggesting that both the taste receptor cells and synapse-forming cells in the taste bud can be stimulated by IFN. Incubation of taste bud-containing lingual epithelia with recombinant IFN-alpha and IFN-gamma triggered the IFN-mediated signaling cascades, resulting in the phosphorylation of the downstream STAT1 (signal transducer and activator of transcription protein 1) transcription factor. Intraperitoneal injection of lipopolysaccharide or polyinosinic:polycytidylic acid into mice, mimicking bacterial and viral infections, respectively, altered gene expression patterns in taste bud cells. Furthermore, the systemic administration of either IFN-alpha or IFN-gamma significantly increased the number of taste bud cells undergoing programmed cell death. These findings suggest that bacterial and viral infection-induced IFNs can act directly on taste bud cells, affecting their cellular function in taste transduction, and that IFN-induced apoptosis in taste buds may cause abnormal cell turnover and skew the representation of different taste bud cell types, leading to the development of taste disorders. To our knowledge, this is the first study providing direct evidence that inflammation can affect taste buds through cytokine signaling pathways.

A novel cell-based assay for measuring neutralizing autoantibodies against type I interferons in patients with autoimmune polyendocrine syndrome type 1.

PubMed

Breivik, Lars; Oftedal, Bergithe E V; Bøe Wolff, Anette S; Bratland, Eirik; Orlova, Elizaveta M; Husebye, Eystein S

2014-07-01

An important characteristic of autoimmune polyendocrine syndrome type 1 (APS 1) is the existence of neutralizing autoantibodies (nAbs) against the type I interferons (IFN) -α2 and -ω at frequencies close to 100%. Type 1 IFN autoantibodies are detected by antiviral neutralizing assays (AVA), binding assays with radiolabelled antigens (RLBA), enzyme-linked immunosorbent assay (ELISA), or by reporter-based cell assays. We here present a simple and reliable version of the latter utilizing a commercially available cell line (HEK-Blue IFN-α/β). All 67 APS 1 patients were positive for IFN-ω nAbs, while 90% were positive for IFN-α2 nAbs, a 100% and 96% correlation with RLBA, respectively. All blood donors and non-APS 1 patients were negative. The dilution titer required to reduce the effect of IFN-ω nAbs correlated with the RLBA index. This cell-based autoantibody assay (CBAA) is easy to perform, suitable for high throughput, while providing high specificity and sensitivity. Copyright © 2014 Elsevier Inc. All rights reserved.

Crystal structure of Bacillus anthracis transpeptidase enzyme CapD.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, R.; Richter, S.; Zhang, R.

2009-09-04

Bacillus anthracis elaborates a poly-{gamma}-d-glutamic acid capsule that protects bacilli from phagocytic killing during infection. The enzyme CapD generates amide bonds with peptidoglycan cross-bridges to anchor capsular material within the cell wall envelope of B. anthracis. The capsular biosynthetic pathway is essential for virulence during anthrax infections and can be targeted for anti-infective inhibition with small molecules. Here, we present the crystal structures of the {gamma}-glutamyltranspeptidase CapD with and without {alpha}-l-Glu-l-Glu dipeptide, a non-hydrolyzable analog of poly-{gamma}-d-glutamic acid, in the active site. Purified CapD displays transpeptidation activity in vitro, and its structure reveals an active site broadly accessible for poly-{gamma}-glutamatemore » binding and processing. Using structural and biochemical information, we derive a mechanistic model for CapD catalysis whereby Pro{sup 427}, Gly{sup 428}, and Gly{sup 429} activate the catalytic residue of the enzyme, Thr{sup 352}, and stabilize an oxyanion hole via main chain amide hydrogen bonds.« less

[Alpha-interferon and mental disorders].

PubMed

Debien, C; De Chouly De Lenclave, M B; Foutrein, P; Bailly, D

2001-01-01

The interferon alpha stands as a reference both in oncology and virology. But its efficiency is limited by frequent somatic as well as neuropsychic side effects. As a matter of fact, the reduction or the ending of a chemotherapy treatment come chiefly from the psychiatric complications caused by the use of interferon. For about 30% of patients, various psychic disorders are noticed: personality disorders, mood disorders, anxiety states, suicidal tendencies, manic and psychotic symptoms. We thus propose a review which shall be completed by a discussion on wether the interferon is responsible or not of the appearance of the described mental disorders. We shall conclude with a synthesis of the proposed practical management when confronted with such disorders. Psychiatric complications under interferon-Alpha. The appearance of psychiatric complications caused by interferon has been the subject of many publications. They have also raised the question of the toxicity mechanism which is still misunderstood today. This toxicity appears to be dose-dependent with variations depending on the daily dose given, the mode of administration, the combination with other chemotherapy treatments, the concomitance with a cerebral radiotherapy or a medical history of psychiatric disorders. Most of these effects occur after three weeks of treatment but non specific neuropsychic symptoms can be observed earlier. Non specific symptoms. They appear early but are difficult to detect, though they bring together a whole lot of clinical signs: asthenia, irritability, psychomotor slowdown, depressive mood or even a real "subsyndromic" depressive syndrome, anorexia, decline of the libido, concentration and attention problems, dizzy spells and headaches. Some authors have described intense and fluctuating of personality, mixing anxiety, irritability and disorder of drive control. Depression. Depression is the most frequently found psychiatric pathology in studies but the real frequency of clear

Competitive and blocking enzyme-linked immunoassay for detection of fetal bovine serum antibodies to bovine viral diarrhea virus.

PubMed

Katz, J B; Hanson, S K

1987-02-01

A competitive blocking enzyme-linked immunoassay (CELIA) was developed to detect bovine viral diarrhea virus (BVDV) antibodies in undiluted fetal bovine serum (FBS). The CELIA was based on competition of serum BVDV antibodies with biotin-labelled anti-BVDV immunoglobulins (Ig) for a limited quantity of solid-phase BVDV antigen. Antigen preparation was simple, FBS could be tested undiluted, and detergent-containing washes were unnecessary. A series of dilutions of postnatal bovine BVDV antiserum prepared in FBS and a set of 147 undiluted abbatoir FBS samples were tested by both CELIA and serum neutralization tests (SNT). CELIA results on both sets of specimens correlated positively with SNT titers (r = 0.99 and r = 0.85). Relative to the SNT, CELIA sensitivity was 100%; specificity was 76%. CELIA detected a level of BVDV antibody below the 1:2-titer threshold detectable with the SNT. Advantages, limitations, and theoretical differences between the CELIA and SNT are discussed. A similar comparison of CELIA with non-competitive enzyme-linked immunoassay approaches to BVDV serodiagnosis is made. It is concluded that the CELIA is valuable in selecting only BVDV-seronegative FBS for use in virologic cell culture media.

IFN-{gamma} sensitizes MIN6N8 insulinoma cells to TNF-{alpha}-induced apoptosis by inhibiting NF-{kappa}B-mediated XIAP upregulation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Hun Sik; Kim, Sunshin; Lee, Myung-Shik

2005-10-28

Although X-linked inhibitor of apoptosis protein (XIAP) is an important intracellular suppressor of apoptosis in a variety of cell types, its role in cytokine-induced pancreatic {beta}-cell apoptosis remains unclear. Here, we found that: (i) XIAP level was inversely correlated with tumor necrosis factor (TNF)-{alpha}-induced apoptosis in MIN6N8 insulinoma cells; (ii) adenoviral XIAP overexpression abrogated the TNF-{alpha}-induced apoptosis through inhibition of caspase activity; (iii) downregulation of XIAP by antisense oligonucleotide or Smac peptide sensitized MIN6N8 cells to TNF-{alpha}-induced apoptosis; (iv) XIAP expression was induced by TNF-{alpha} through a nuclear factor-{kappa}B (NF-{kappa}B)-dependent pathway, and interferon (IFN)-{gamma} prevented such an induction in amore » manner independent of NF-{kappa}B, which presents a potential mechanism underlying cytotoxic IFN-{gamma}/TNF-{alpha} synergism. Taken together, our results suggest that XIAP is an important modulator of TNF-{alpha}-induced apoptosis of MIN6N8 cells, and XIAP regulation in pancreatic {beta}-cells might play an important role in pancreatic {beta}-cell apoptosis and in the pathogenesis of type 1 diabetes.« less

Microbubble Enzyme-Linked Immunosorbent Assay for the Detection of Targeted Microbubbles in in Vitro Static Binding Assays.

PubMed

Wischhusen, Jennifer; Padilla, Frederic

2017-07-01

Targeted microbubbles (MBs) are ultrasound contrast agents that are functionalized with a ligand for ultrasound molecular imaging of endothelial markers. Novel targeted MBs are characterized in vitro by incubation in protein-coated wells, followed by binding quantification by microscopy or ultrasound imaging. Both methods provide operator-dependent results: Between 3 and 20 fields of view from a heterogeneous sample are typically selected for analysis by microscopy, and in ultrasound imaging, different acoustic settings affect signal intensities. This study proposes a new method to reproducibly quantify MB binding based on enzyme-linked immunosorbent assay (ELISA), in which bound MBs are revealed with an enzyme-linked antibody. MB-ELISA was adapted to in vitro static binding assays, incubating the MBs in inverted position or by agitation, and compared with microscopy. The specificity and sensitivity of MB-ELISA enable the reliable quantification of MB binding in a rapid, high-throughput and whole-well analysis, facilitating the characterization of new targeted contrast agents. Copyright © 2017 World Federation for Ultrasound in Medicine & Biology. Published by Elsevier Inc. All rights reserved.

Design of a compact disk-like microfluidic platform for enzyme-linked immunosorbent assay.

PubMed

Lai, Siyi; Wang, Shengnian; Luo, Jun; Lee, L James; Yang, Shang-Tian; Madou, Marc J

2004-04-01

This paper presents an integrated microfluidic device on a compact disk (CD) that performs an enzyme-linked immunosorbent assay (ELISA) for rat IgG from a hybridoma cell culture. Centrifugal and capillary forces were used to control the flow sequence of different solutions involved in the ELISA process. The microfluidic device was fabricated on a plastic CD. Each step of the ELISA process was carried out automatically by controlling the rotation speed of the CD. The work on analysis of rat IgG from hybridoma culture showed that the microchip-based ELISA has the same detection range as the conventional method on the 96-well microtiter plate but has advantages such as less reagent consumption and shorter assay time over the conventional method.

Methionine biosynthesis in higher plants. I. Purification and characterization of cystathionine gamma-synthase from spinach chloroplasts.

PubMed

Ravanel, S; Droux, M; Douce, R

1995-01-10

Cystathionine gamma-synthase, the first enzyme specific for the methionine biosynthetic pathway, was purified to apparent homogeneity from spinach leaf chloroplasts. A nonradioactive assay based on O-phthaldialdehyde derivatization of L-cystathionine and fluorescence detection was developed to determine the cystathionine gamma-synthase activity. A unique cystathionine gamma-synthase activity was located in the stromal fraction of chloroplasts while cystathionine beta-lyase, the second enzyme of the transsulfuration pathway, was associated with both the chloroplastic and cytosolic compartments (see companion manuscript). The purified enzyme exhibited a specific activity of 13 U mg-1. As estimated by gel filtration and polyacrylamide gel electrophoresis (PAGE) under nondenaturing conditions followed by activity staining, the native enzyme had an apparent M(r) of 215,000. On the basis of sodium dodecyl sulfate-PAGE, purified cystathionine gamma-synthase migrated as two molecular species of M(r) 53,000 and 50,000 that are identical in their N-termini. The absorption spectrum obtained at pH 7.5 exhibited a peak at 425 nm due to pyridoxal 5'-phosphate (PLP). The purified enzyme catalyzed the formation of L-cystathionine or L-homocysteine depending on the sulfur-containing substrate, L-cysteine or sulfide. Maximal cystathionine gamma-synthase activity was found at pH 7.4. The apparent Km values for O-phospho-L-homoserine (the unique homoserine ester synthesized in the chloroplast), L-cysteine, and sulfide were 1.4, 0.18, and 0.6 mM, respectively. Inactivation of cystathionine gamma-synthase by DL-propargylglycine (PAG) showed pseudo-first-order kinetics and data were consistent with the existence of an intermediate reversible enzyme-inhibitor complex (Kappi = 140 microM) preceding the formation of a final enzyme-inhibitor complex (kd = 24 x 10(-3) s-1). The irreversibility of the inhibition and the partial restoration of the activity by pyridoxal-phosphate suggest that

Comparison of a neutralization enzyme immunoassay and an enzyme-linked immunosorbent assay for evaluation of immune status of children vaccinated for mumps.

PubMed Central

Harmsen, T; Jongerius, M C; van der Zwan, C W; Plantinga, A D; Kraaijeveld, C A; Berbers, G A

1992-01-01

A 50% neutralization enzyme immunoassay (N50-EIA) was compared with an indirect enzyme-linked immunosorbent assay (ELISA) for determining mumps virus antibodies in three consecutive serum samples from 138 children vaccinated with a live mumps vaccine at the age (in years) of 1.5. By the N50-EIA, most (132 of 138) preserum samples did not show neutralizing activity. Eight to 12 weeks after vaccination, 17 of the children were still negative, but only 7 remained so after 2.5 years, resulting in a seroconversion rate of 125 of 132 (95%). Over the same period, the neutralization geometric mean titer rose from 3.6 to 9.9. By an indirect ELISA, 128 of 138 preserum samples were found negative. The early and late postvaccination sera of 8 children were ELISA negative, resulting in a seroconversion rate of 120 of 128 (94%). Only two children remained seronegative by both methods. Seven of the late postvaccination serum samples yielded noncorresponding results, reflecting 95% correlation between both methods. Due to cross-reactivity with parainfluenza viruses, the ELISA proved to be less specific, but on the other hand, it showed a greater sensitivity than the N50-EIA. PMID:1500523

Interactions of the interferon system with cellular metabolism

NASA Technical Reports Server (NTRS)

Sonnenfeld, Gerald

1986-01-01

The results of studies concerning the interaction of the interferon (Inf) system with the activities of carcinogens, tumor promoters, and cytochrome P-450 are presented. The results show that the addition of a tumor promoter (TPA or 4-O-methyl-TPA) to a tissue culture enhances virus-induced Inf-gamma production, suggesting a potential value of tumor promoters in the biosynthesis of commercial Inf. On the other hand, the carcinogens were reported to inhibit the induction of Inf-alpha/beta in cultured cells and in intact animals (with no effect on the administered or preformed Inf). The demonstration of a correlation between the carcinogenic potential of a compound and its inhibitive effect on Inf production suggests a possible use of the Inf production assay in the evaluation of the carcinogenicity of chemicals. In addition, it was shown that the induction of Inf-alpha/beta as well as the administration of this Inf depresses the levels of rat liver cytochrome P-450 which is responsible for binding lipophilic drugs, steroids, and carcinogens, thus increasing the toxicity of the respective chemical.

Interleukin-6, interleukin-8, and soluble tumor necrosis factor receptor-I in the cord blood as predictors of chronic lung disease in premature infants.

PubMed

An, Hiromi; Nishimaki, Shigeru; Ohyama, Makiko; Haruki, Atsushi; Naruto, Takuya; Kobayashi, Naoki; Sugai, Toshiyuki; Kobayashi, Yoshinori; Mori, Masaaki; Seki, Kazuo; Yokota, Shumpei