Sample records for gamma interferon expression

  1. [Expression of gamma interferon during HPV and Chlamydia trachomatis infection in cervical samples].

    PubMed

    Colín-Ferreyra, María Del Carmen; Mendieta-Zerón, Hugo; Romero-Figueroa, María Del Socorro; Martínez-Madrigal, Migdania; Martínez-Pérez, Sergio; Domínguez-García, María Victoria

    2015-02-01

    The aim of this study was to mesure the expression of gamma interferon in HPV and Chlamydia trachomatis infection in squamous intraepithelial lesions. Samples from 100 patients diagnosed by colposcopy with or without squamous intraepithelial lesions were used in the present study. Each patient was found to be infected by HPV and C.trachomatis. Relative gamma interferon mRNA expression was assessed using a real-time reverse transcriptase PCR assay (RT-PCR). The relative units of expression of gamma interferon mRNA were 13, 1.8 and 0.3, for HPV and C.trachomatis co-infection, or HPV or C.trachomatis infection, respectively. HPV and C.trachomatis could overstimulate the expression of gamma interferon. Copyright © 2014 Elsevier España, S.L.U. y Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

  2. Interferon-alpha and interferon-gamma modulate Fas-mediated apoptosis in mitomycin-C-resistant human Tenon's fibroblasts.

    PubMed

    Wang, Xiao Yang; Crowston, Jonathan G; White, Andrew J R; Zoellner, Hans; Healey, Paul R

    2014-08-01

    The aim of the study was to investigate, using a native mitomycin-C-resistant human Tenon's fibroblast cell line, the possibility that interferon-alpha and gamma could be used with Fas agonists as an alternative anti-fibrotic strategy to mitomycin-C in trabeculectomy. A clinically resistant and in vitro verified mitomycin-C-resistant human Tenon's fibroblast cell line was pretreated with interferon-alpha and interferon-gamma for 48 h before stimulation with an agonistic Fas antibody (CH11) for 2 days to induce cell death. Cell death assays were undertaken. Changes in apoptosis-related proteins were determined by flow cytometry and Western blot. Pretreatment with interferon-alpha or interferon-gamma for 48 h increased Fas, Fas-associated protein with death domain and caspase-8 expression. Protein expression was further increased by combined exposure to interferon-alpha and gamma. Pretreatment with cytokines had no effect on Fas-L and Bcl-2. Interferon-alpha alone did not change the rate of induced cell death. A combination of interferon-alpha and gamma synergistically increased the sensitivity of mitomycin-C-resistant human Tenon's fibroblast cell line to induced cell death. An antagonistic anti-Fas antibody (ZB4) completely blocked induced cell death. Broad caspase inhibitors specific for caspases-8 and -3 reduced induced deaths in interferon pretreated mitomycin-C-resistant human Tenon's fibroblast cell line in a dose-dependent manner. Interferon-alpha and interferon-gamma render mitomycin-C-resistant human Tenon's fibroblast cell line sensitive to Fas-mediated apoptosis. The mechanism involves increased death-inducing signalling complex formation by upregulation of Fas, Fas-associated protein with death domain and caspase-8 expression. © 2013 Royal Australian and New Zealand College of Ophthalmologists.

  3. [Interferon. An overview of the state of basic research with special regard to interferon-gamma].

    PubMed

    Günther, G; Otto, B

    1993-02-01

    Interferons / An overview on the state of basic research with special regard to interferon-gamma Interferons are multifunctional glycoproteins with a broad range of antiviral, antiproliferative and immunoregulatory effects on the target cell. This review deals with the basics as well as with more recent developments in interferon research. A historic overview of 35 years of interferon research since the discovery of interferons by Isaacs and Lindenmann in 1957 introduces the most important milestones in this field and appreciates the work of the participating researchers. A brief description of the classification of interferons based on different tissue sources, different antigenic properties and different induction behaviour is made. The main part of this review focuses on human interferon-gamma. We discuss recent work on the structure-function relationship of interferon-gamma. The interferon-gamma receptor and its role in signal transduction is another part of this paper. The structure and length of the C-terminal region of interferon-gamma seems to be important for receptor binding and expression of biological activities. A conservative estimate is that the family of IFN-activated genes numbers 15-20 in most cells.

  4. Increase in neutrophil Fc gamma receptor I expression following interferon gamma treatment in rheumatoid arthritis.

    PubMed Central

    Goulding, N J; Knight, S M; Godolphin, J L; Guyre, P M

    1992-01-01

    The therapeutic potential of interferon gamma (IFN gamma) in a number of disease states is still being explored, but progress is hampered by the lack of a suitable measure of in vivo biological activity. To assess the in vivo biological effects of recombinant human IFN gamma (rhIFN gamma), 14 patients were studied in a randomised, prospective, double blind, placebo controlled trial of this cytokine for the treatment of rheumatoid arthritis. The levels of Fc gamma receptors on peripheral blood neutrophils were measured at baseline and after 21 days of once daily, subcutaneous injections of rhIFN gamma or placebo. An induction of neutrophil Fc gamma receptor type I (Fc gamma RI) was seen in the group of patients receiving recombinant human rhIFN gamma but not in those receiving placebo. No change in the expression of Fc gamma RII or Fc gamma RIII was detected. The amount of induction of Fc gamma RI detected on the neutrophils of patients receiving rhIFN gamma did not correlate with clinical measures of response at either 21 days or at the end of the study (24 weeks). No significant clinical responses were observed in the rhIFN gamma group at these times. These data confirm that the reported in vitro effect of IFN gamma on human neutrophil Fc receptor expression can be reproduced in vivo. PMID:1534001

  5. Increase in neutrophil Fc gamma receptor I expression following interferon gamma treatment in rheumatoid arthritis.

    PubMed

    Goulding, N J; Knight, S M; Godolphin, J L; Guyre, P M

    1992-04-01

    The therapeutic potential of interferon gamma (IFN gamma) in a number of disease states is still being explored, but progress is hampered by the lack of a suitable measure of in vivo biological activity. To assess the in vivo biological effects of recombinant human IFN gamma (rhIFN gamma), 14 patients were studied in a randomised, prospective, double blind, placebo controlled trial of this cytokine for the treatment of rheumatoid arthritis. The levels of Fc gamma receptors on peripheral blood neutrophils were measured at baseline and after 21 days of once daily, subcutaneous injections of rhIFN gamma or placebo. An induction of neutrophil Fc gamma receptor type I (Fc gamma RI) was seen in the group of patients receiving recombinant human rhIFN gamma but not in those receiving placebo. No change in the expression of Fc gamma RII or Fc gamma RIII was detected. The amount of induction of Fc gamma RI detected on the neutrophils of patients receiving rhIFN gamma did not correlate with clinical measures of response at either 21 days or at the end of the study (24 weeks). No significant clinical responses were observed in the rhIFN gamma group at these times. These data confirm that the reported in vitro effect of IFN gamma on human neutrophil Fc receptor expression can be reproduced in vivo.

  6. [Adenovirus-mediated canine interferon-gamma expression and its antiviral activity against canine parvovirus].

    PubMed

    Zhang, Kao; Jin, Huijun; Zhong, Fei; Li, Xiujin; Neng, Changai; Chen, Huihui; Li, Wenyan; Wen, Jiexia

    2012-11-04

    To construct recombinant adenovirus containing canine interferon-gamma (cIFN-gamma) gene and to investigate its antiviral activity against canine parvovirus in Madin-Darby canine kidney cells (MDCK). [Methods] The cIFN-gamma gene was inserted into adenovirus shuttle plasmid to construct pShuttle3-cIFN-gamma expression vector, from which the cIFN-gamma expression cassette was transferred into the adenovirus genomic plasmid pAdeno-X by specific restriction sites to generate recombinant adenovirus genomic plasmid pAd-cIFN-gamma. The pAd-cIFN-gamma plasmid was linearized by digestion and transfected into human embryonic kidney (HEK) 293T cells to generate the replication-defective cIFN-gamma recombinant adenovirus (Ad-cIFN-gamma). To analyze its anti-canine parvovirus activity, the MDCK cells were pre-infected by Ad-cIFN-gamma recombinant adenovirus, and then infected by canine parvovirus. The antiviral activity of the Ad-cIFN-gamma recombinant adenovirus against parvovirus was analyzed. The recombinant adenovirus containing cIFN-gamma gene was constructed by the ligation method. The recombinant adenovirus could mediates recombinant cIFN-gamma secretory expression in MDCK cells. The Ad-cIFN-gamma recombinant adenovirus could significantly inhibit canine parvovirus replication in MDCK cells pre-infected with the recombinant adenovirus. These results indicate that the Ad-cIFN-gamma recombinant adenovirus has the potent antiviral activity against canine parvovirus. The Ad-cIFN-gamma recombinant adenovirus was successfully constructed by the ligation method and possessed a powerful antiviral activity against canine parvovirus.

  7. Interferon-gamma of the giant panda (Ailuropoda melanoleuca): complementary DNA cloning, expression, and phylogenetic analysis.

    PubMed

    Tao, Yaqiong; Zeng, Bo; Xu, Liu; Yue, Bisong; Yang, Dong; Zou, Fangdong

    2010-01-01

    Interferon-gamma (IFN-gamma) is the only member of type II IFN and is vital in the regulation of immune and inflammatory responses. Herein we report the cloning, expression, and sequence analysis of IFN-gamma from the giant panda (Ailuropoda melanoleuca). The open reading frame of this gene is 501 base pair in length and encodes a polypeptide consisting of 166 amino acids. All conserved N-linked glycosylation sites and cysteine residues among carnivores were found in the predicted amino acid sequence of the giant panda. Recombinant giant panda IFN-gamma with a V5 epitope and polyhistidine tag was expressed in HEK293 host cells and confirmed by Western blotting. Phylogenetic analysis of mammalian IFN-gamma-coding sequences indicated that the giant panda IFN-gamma was closest to that of carnivores, then to ungulates and dolphin, and shared a distant relationship with mouse and human. These results represent a first step into the study of IFN-gamma in giant panda.

  8. Interferon-gamma induces apoptosis and augments the expression of Fas and Fas ligand by microglia in vitro.

    PubMed

    Badie, B; Schartner, J; Vorpahl, J; Preston, K

    2000-04-01

    Activation of microglia by interferon-gamma (IFN-gamma) has been implicated in a number of central nervous system (CNS) inflammatory disease processes. Because IFN-gamma has also been shown to play a role in programmed cell death, we investigated its cytotoxicity and its effect on the Fas apoptotic pathway in microglia. Flow cytometry was used to quantify the IFN-gamma-mediated apoptotic response and Fas and Fas ligand (FasL) expression in two well-characterized murine microglia cell lines (BV-2 and N9). Nuclear fragmentation, suggestive of apoptosis, was noted within 24 h of incubation of microglia with IFN-gamma (10 U/ml). After a 72-h incubation, almost every BV-2 and N9 microglia, but not GL261 glioma cells, underwent cell death and detached from the culture plates. This cytotoxicity occurred even at low IFN-gamma concentrations (1 U/ml) and was inhibited by BAF, a pan-caspase inhibitor. Incubation of BV-2 and N9 microglia, but not GL261 glioma cells, with IFN-gamma also potentiated the expression of Fas and FasL in a similar dose-response and time-course manner, as seen for the apoptotic response. Whereas Fas expression increased by 100% in both microglia cells, FasL upregulation was more pronounced and increased by as much as 200% in the N9 cells. These findings suggest that in addition to its role as a microglia activator, IFN-gamma may also induce apoptosis of microglia, possibly through simultaneous upregulation of Fas and FasL. Interferon-gamma modulation of the Fas pathway and apoptosis in microglia may be important in the pathogenesis of inflammatory CNS disease processes. Copyright 2000 Academic Press.

  9. Review of the recombinant human interferon gamma as an immunotherapeutic: Impacts of production platforms and glycosylation.

    PubMed

    Razaghi, Ali; Owens, Leigh; Heimann, Kirsten

    2016-12-20

    Human interferon gamma is a cytokine belonging to a diverse group of interferons which have a crucial immunological function against mycobacteria and a wide variety of viral infections. To date, it has been approved for treatment of chronic granulomatous disease and malignant osteopetrosis, and its application as an immunotherapeutic agent against cancer is an increasing prospect. Recombinant human interferon gamma, as a lucrative biopharmaceutical, has been engineered in different expression systems including prokaryotic, protozoan, fungal (yeasts), plant, insect and mammalian cells. Human interferon gamma is commonly expressed in Escherichia coli, marketed as ACTIMMUNE ® , however, the resulting product of the prokaryotic expression system is unglycosylated with a short half-life in the bloodstream; the purification process is tedious and makes the product costlier. Other expression systems also did not show satisfactory results in terms of yields, the biological activity of the protein or economic viability. Thus, the review aims to synthesise available information from previous studies on the production of human interferon gamma and its glycosylation patterns in different expression systems, to provide direction to future research in this field. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. [Peptide Ala-Glu-Asp-Gly and interferon gamma: their role in immune response during aging].

    PubMed

    Lin'kova, N S; Kuznik, B I; Khavinson, V Kh

    2012-01-01

    The decrease of lymphocyte interferon gamma expression during aging is one of the main mechanisms leading to the immunodeficiency state in the elderly. Cell penetrating geroprotective peptide Ala-Glu-Asp-Gly has the capability to activate the proliferation of lymphocytes in thymus during its aging. The nucleotide sequence which is complementary contacted with peptide Ala-Glu-Asp-Gly was found in promoter region of interferon gamma gene. Thus, the immune protection of this peptide can be explained by its activation of the interferon gamma production in T-cells.

  11. [Regulating human interferon-gamma gene expression in marrow stromal cells in mice by Tet-off system].

    PubMed

    Qin, Xin-Tian; Lu, Yue; Tan, Yin-Duo; Chen, Xiao-Qin; Gen, Qi-Rong

    2008-01-01

    We have constructed plasmid "pTre-IFN-gamma" and proved that the Tet-off system could regulate the expression of human interferon-gamma (IFN-gamma) gene in murine marrow stromal cells in vitro. This study was to investigate the regulatory reversibility of Tet-off system and its effect on the expression of human IFN-gamma gene in murine marrow stromal cells in mice. Plasmids pTet-off and pTre-IFN-gamma were co-transfected into murine marrow stromal cells. The expression of IFN-gamma in marrow stromal cells was detected with ELISA. The marrow stromal cells were transfused into BABL/c naked mice after co-transfection. The expression of IFN-gamma mRNA in the spleen was detected by real-time fluorescent quantitative reverse transcription-polymerase chain reaction (RT-PCR). IFN-gamma protein was detected in the culture solution of marrow stromal cells after co-transfection. The secretion peak appeared within the first 72 h. The protein level of IFN-gamma was significantly lower in 300 ng/ml tetracycline hydrochloride-treated marrow stroma cells than in untreated cells [(67.11+/-22.14) pg/1 x 10(7) cells vs. (319.96+/-29.04) pg/1 x 10(7) cells, P<0.001]; its expression was increased when removed tetracycline hydrochloride (P=0.032). The expression of human IFN-gamma mRNA was detected in the spleen. The mRNA level of IFN-gamma was significantly higher in untreated group than in continuous tetracycline hydrochloride-treated group [(1.5+/-0.7)x10(5) copies . (100 mg)(-1) vs. (6.9+/-5.3)x10(2) copies . (100 mg)(-1), P<0.001]; its expression in the mice received tetracycline hydrochloride for one single time lay between the above two groups with significant difference. In mice, Tet-off system could rapidly, efficiently and reversibly regulate the expression of human IFN-gamma gene in marrow stromal cells in vitro and in vivo.

  12. Interferon-gamma inhibits HIV-induced invasiveness of monocytes.

    PubMed

    Dhawan, S; Wahl, L M; Heredia, A; Zhang, Y; Epstein, J S; Meltzer, M S; Hewlett, I K

    1995-12-01

    HIV-infected monocytes form highly invasive network on basement membrane matrix and secrete high levels of 92-kd metalloproteinase (MMP-9), an enzyme that degrades basement membrane proteins. In the present study, using matrigel as a model basement membrane system, we demonstrate that treatment of human immunodeficiency virus (HIV)-infected monocytes with interferon-gamma at 50 U/ml inhibited the ability of infected monocytes to form an invasive network on matrigel and their invasion through the matrigel matrix. These effects were associated with a significant reduction in the levels of MMP-9 produced by HIV-infected monocytes treated with interferon-gamma 1 day prior to infection with HIV as compared with that of untreated HIV-infected monocytes. Monocytes treated with interferon-gamma 1 day after HIV infection showed the presence of integrated HIV sequences; however, the levels of MMP-9 were substantially lower than those produced by monocytes inoculated with live HIV, heat-inactivated HIV, or even the control uninfected monocytes. Exposure of monocytes to heat-inactivated HIV did not result in increased invasiveness or high MMP-9 production, suggesting that regulation of metalloproteinase by monocytes was independent of CD4-gp120 interactions and required active virus infection. Furthermore, addition of interferon-gamma to monocytes on day 10 after infection inhibited MMP-9 production by more than threefold with no significant reduction of virus replication. These results indicate that the mechanism of interferon-gamma-induced down-regulation of MMP-9 levels and reduced monocyte invasiveness may be mediated by a mechanism independent of antiviral activity of IFN-gamma in monocytes. Down-regulation of MMP-9 in HIV-infected monocytes by interferon-gamma may play an important role in the control of HIV pathogenesis.

  13. Interferon-alpha and interferon-gamma sensitize human tenon fibroblasts to mitomycin-C.

    PubMed

    Wang, Xiao Yang; Crowston, Jonathan G; Zoellner, Hans; Healey, Paul R

    2007-08-01

    To investigate the effect of interferon (IFN)-alpha and IFN-gamma pretreatment on mitomycin C (MMC)-induced cell death in human Tenon fibroblasts (HTFs) and the mechanisms by which IFN-alpha and IFN-gamma modulate the susceptibility of HTFs to MMC. HTFs were pretreated with IFN-alpha and IFN-gamma for 48 hours before 5-minute application of 0.4 mg/mL MMC. Cell death after 48 hours was determined by Annexin V/propidium iodide (PI) staining and lactate dehydrogenase (LDH) release assay. Fas, Fas-ligand, and Bcl-2 expression were determined by flow cytometry. Fas associated death domain (FADD), Bax, cytochrome c, and caspase expression were determined by Western blot analysis and immunofluorescence staining. MMC treatment increased cell death and upregulated Fas and FADD expression, but had no effect on Fas-Ligand, Bax, Bcl-2, or cytochrome c. Neither IFN-alpha nor IFN-gamma alone induced HTF death, but each increased cell death 2 days after MMC treatment in a dose-dependent fashion. Combination IFN-alpha and IFN-gamma had a synergistic effect. IFN-alpha and IFN-gamma pretreatment increased Fas expression. Fas upregulation was associated with increased sensitivity to MMC. IFN pretreatment increased procaspase-8, procaspase-9, and procaspase-3 expression, and caspase-3 activation. Caspase-8, caspase-3, and broad caspase inhibitors, but not caspase-9 inhibitor, inhibited MMC-induced cell death in nonpretreated and IFN-pretreated cells. IFN-alpha and IFN-gamma enhance the susceptibility of HTFs to MMC-induced cell death through a Fas-mediated and a caspase-3-dependent pathway. Pretreatment with IFN primed HTFs to MMC, providing a potential means for initially slowing the healing response with IFN and subsequently terminating fibroblast activity through MMC-induced cell death.

  14. Recent considerations in the use of recombinant interferon gamma for biological therapy of atopic dermatitis.

    PubMed

    Brar, Kanwaljit; Leung, Donald Y M

    2016-01-01

    Atopic dermatitis (AD) is the most common inflammatory skin disease in the general population. There are different endophenotypes of AD that likely have a unique immune and molecular basis, such as those who are predisposed to eczema herpeticum, or Staphylococcus aureus infections. In this review, we highlight the endophenotypes of AD where reduced interferon gamma expression may be playing a role. Additionally, we review the potential role of recombinant interferon gamma therapy in the treatment of atopic dermatitis and the particular phenotypes that may benefit from this treatment. Recombinant interferon gamma treatment will likely benefit the pediatric population with AD, as well as those with susceptibilities for skin infections. Future studies are needed to elucidate whether IFN-γ may reduce the prevalence of skin infection in AD.

  15. Cloning, sequencing and expression of white rhinoceros (Ceratotherium simum) interferon-gamma (IFN-gamma) and the production of rhinoceros IFN-gamma specific antibodies.

    PubMed

    Morar, D; Tijhaar, E; Negrea, A; Hendriks, J; van Haarlem, D; Godfroid, J; Michel, A L; Rutten, V P M G

    2007-01-15

    Bovine tuberculosis (BTB) is endemic in African buffalo (Syncerus caffer) in the Kruger National Park (KNP). In addition to buffalo, Mycobacterium bovis has been found in at least 14 other mammalian species in South Africa, including kudu (Tragelaphus strepsiceros), Chacma baboon (Papio ursinus) and lion (Panthera leo). This has raised concern about the spillover into other potentially susceptible species like rhinoceros, thus jeopardising breeding and relocation projects aiming at the conservation of biodiversity. Hence, procedures to screen for and diagnose BTB in black rhinoceros (Diceros bicornis) and white rhinoceros (Ceratotherium simum) need to be in place. The Interferon-gamma (IFN-gamma) assay is used as a routine diagnostic tool to determine infection of cattle and recently African buffalo, with M. bovis and other mycobacteria. The aim of the present work was to develop reagents to set up a rhinoceros IFN-gamma (RhIFN-gamma) assay. The white rhinoceros IFN-gamma gene was cloned, sequenced and expressed as a mature protein. Amino acid (aa) sequence analysis revealed that RhIFN-gamma shares a homology of 90% with equine IFN-gamma. Monoclonal antibodies, as well as polyclonal chicken antibodies (Yolk Immunoglobulin-IgY) with specificity for recombinant RhIFN-gamma were produced. Using the monoclonals as capture antibodies and the polyclonal IgY for detection, it was shown that recombinant as well as native white rhinoceros IFN-gamma was recognised. This preliminary IFN-gamma enzyme-linked immunosorbent assay (ELISA), has the potential to be developed into a diagnostic assay for M. bovis infection in rhinoceros.

  16. Interferon Gamma-1b Injection

    MedlinePlus

    ... in people with severe, malignant osteopetrosis (an inherited bone disease). Interferon gamma-1b is in a class of ... you may have flu-like symptoms such as headache, fever, chills, muscle aches, and tiredness after your ...

  17. Effect of interferon-gamma on complement gene expression in different cell types.

    PubMed

    Lappin, D F; Guc, D; Hill, A; McShane, T; Whaley, K

    1992-01-15

    We have studied the expression of the complement components C2, C3, factor B, C1 inhibitor (C1-inh), C4-binding protein (C4-bp) and factor H in human peripheral blood monocytes, skin fibroblasts, umbilical vein endothelial cells (HUVEC) and the human hepatoma cell line G2 (Hep G2) in the absence and the presence of interferon-gamma (IFN-gamma). E.l.i.s.a. performed on culture fluids, run-on transcription assays, Northern blot and double-dilution dot-blot techniques confirmed that monocytes expressed all six components, whereas fibroblasts, HUVEC and HepG2 each expressed five of the six components. Fibroblasts and HUVEC did not synthesize C4-bp, and Hep G2 did not produce factor H. In addition to these differences, the synthesis rates of C3, C1-inh and factor H were not the same in all cell types. However, the synthesis rates of C2 and factor B were similar in all four cell types. The half-lives of the mRNAs were shorter in monocytes than in other cell types. Monocyte factor H mRNA had a half-life of 12 min in monocytes, compared with over 3 h in fibroblasts and HUVEC. The instability of factor H mRNA in monocytes may contribute to their low factor H secretion rate. IFN-gamma produced dose-dependent stimulation of C2, factor B, C1-inh, C4-bp and factor H synthesis by all cell types expressing these proteins, but decreased C3 synthesis in all four cell types. Cell-specific differences in the response to IFN-gamma were observed. The increased rates of transcription of the C1-inh and factor H genes in HUVEC were greater than in other cell types, while the increased rate of transcription of the C2, factor B and C1-inh genes in Hep G2 cells was less than in other cell types. IFN-gamma did not affect the stability of C3, factor H or C4 bp mRNAs, but increased the stability of factor B and C1-inh mRNAs and decreased the stability of C2 mRNA. Although these changes occurred in all four cell types studied, the half-life of C1-inh mRNA in monocytes was increased almost 4-fold

  18. Stress-induced alterations in interferon production and class II histocompatibility antigen expression

    NASA Technical Reports Server (NTRS)

    Sonnenfeld, G.; Cunnick, J. E.; Armfield, A. V.; Wood, P. G.; Rabin, B. S.

    1992-01-01

    Mild electric foot-shock has been shown to be a stressor that can alter immune responses. Male Lewis rats were exposed to one session of 16 5.0-s 1.6-mA foot-shocks. Production of interferon-gamma by splenocytes in response to concanavalin-A was decreased in spleens from the shocked rats compared to control spleens. Spleen cells from rats treated with nadolol, a peripherally acting beta-adrenergic receptor antagonist, and then shocked, showed dose-dependent attenuation of the suppression of interferon-gamma production. This suggests that catecholamines mediate shock-induced suppression of interferon-gamma production. The percentage of splenic mononuclear cells expressing class II histocompatibility (Ia) antigens on their surfaces from spleens of shocked rats was determined by flow cytometry. Significantly decreased class II positive mononuclear cells were present in the spleens of shocked rats in comparison to the spleens of control rats. This may reflect an alteration of cell trafficking or decreased production of class II antigens.

  19. The immunomodulatory effects of interferon-gamma on mature B-lymphocyte responses.

    PubMed

    Jurado, A; Carballido, J; Griffel, H; Hochkeppel, H K; Wetzel, G D

    1989-06-15

    Interferon-gamma (IFN-gamma) exerts a broad spectrum of activities which affect the responses of mature B-cells. It strongly inhibits B-cell activation, acts as a B-cell growth factor (BCGF), and also induces final differentiation to immunoglobulin (Ig) production. IFN-gamma is deeply involved in the differential control of isotype expression, as it enhances IgG2a production and suppresses both IgG1 and IgE production. Although it is now possible to draw a general scheme of the effects of IFN-gamma on B-cells, a number of paradoxical results still exist in the field. In this manuscript, different experimental systems are analyzed in an attempt to explain these apparent paradoxes.

  20. Plasmodium falciparum erythrocyte membrane protein-1 specifically suppresses early production of host interferon-gamma.

    PubMed

    D'Ombrain, Marthe C; Voss, Till S; Maier, Alexander G; Pearce, J Andrew; Hansen, Diana S; Cowman, Alan F; Schofield, Louis

    2007-08-16

    Plasmodium falciparum erythrocyte membrane protein-1 (PfEMP-1) is a variable antigen expressed by P. falciparum, the malarial parasite. PfEMP-1, present on the surface of infected host erythrocytes, mediates erythrocyte binding to vascular endothelium, enabling the parasite to avoid splenic clearance. In addition, PfEMP-1 is proposed to regulate host immune responses via interactions with the CD36 receptor on antigen-presenting cells. We investigated the immunoregulatory function of PfEMP-1 by comparing host cell responses to erythrocytes infected with either wild-type parasites or transgenic parasites lacking PfEMP-1. We showed that PfEMP-1 suppresses the production of the cytokine interferon-gamma by human peripheral blood mononuclear cells early after exposure to P. falciparum. Suppression of this rapid proinflammatory response was CD36 independent and specific to interferon-gamma production by gammadelta-T, NK, and alphabeta-T cells. These data demonstrate a parasite strategy for downregulating the proinflammatory interferon-gamma response and further establish transgenic parasites lacking PfEMP-1 as powerful tools for elucidating PfEMP-1 functions.

  1. Heterogeneity within populations of recombinant Chinese hamster ovary cells expressing human interferon-gamma.

    PubMed

    Coppen, S R; Newsam, R; Bull, A T; Baines, A J

    1995-04-20

    The Chinese hamster ovary (CHO) cell line has great commercial importance in the production of recombinant human proteins, especially those for therapeutic use. Much attention has been paid to CHO cell population physiology in order to define factors affecting product fidelity and yield. Such studies have revealed that recombinant proteins, including human interferon-gamma (IFN-gamma), can be heterogeneous both in glycosylation and in proteolytic processing. The type of heterogeneity observed depends on the growth physiology of the cell population, although the relationship between them is complex. In this article we report results of a cytological study of the CHO320 line which expresses recombinant human IFN-gamma. When grown in suspension culture, this cell line exhibited three types of heterogeneity: (1) heterogeneity of the production of IFN-gamma within the cell population, (2) heterogeneity of the number of nuclei and mitotic spindles in dividing cells, and (3) heterogeneity of cellular environment. The last of these arises from cell aggregates which form in suspension culture: Some cells are exposed to the culture medium; others are fully enclosed within the mass with little or no direct access to the medium. Thus, live cells producing IFN-gamma are heterogeneous in their environment, with variable access to O(2) and nutrients. Within the aggregates, it appears that live cells proliferate on a dead cell mass. The layer of live cells can be several cells deep. Specific cell-cell attachments are observed between the living cells in these aggregates. Two proteins, known to be required for the formation of certain types of intercellular junctions, spectrin and vinculin, have been localized to the regions of cell-cell contact. The aggregation of the cells appears to be an active process requiring protein synthesis. (c) 1995 John Wiley & Sons, Inc.

  2. Interferon-gamma and T-bet expression in a patient with toxoplasmic lymphadenopathy.

    PubMed

    Jöhrens, Korinna; Moos, Verena; Schneider, Thomas; Stein, Harald; Anagnostopoulos, Ioannis

    2010-04-01

    Infection with Toxoplasma gondii (TG) presents in some individuals as a self-limited disease with a predominant lymphadenopathy characterized by prominent B-cell activation. As this is in contrast to the in vitro based concept of a T(h)1-immune response against TG, we investigated native lymphoid tissue and peripheral blood of a patient with serologic evidence of toxoplasmosis to verify which cells show T(h)1-response features. High-level expression of T-bet in monocytoid B-cells, in germinal center B-cells, and in a lesser amount in T cells could be demonstrated by immunohistochemistry. In vitro stimulation of lymph node cells with either TG, staphylococcus enterotoxin B, or phorbol 12-myristate 13-acetate/ionomycin revealed an interferon-gamma expression in T-bet(+) B cells only in the patient and not in controls. Similar results were found for T-bet(+) T cells which were also present in controls. CD4(+) peripheral blood cells stimulated with TG antigens showed a TG-specific but attenuated T(h)1-reactivity in the patient associated with a reduced expression of IL-2 when compared with controls. We conclude that the pathogenesis and course of toxoplasmic lymphadenopathy is based on a T(h)1-cell defect, which becomes compensated by the B cells mounting a T(h)1-like immune response.

  3. Effects of tumor necrosis factor-alpha and interferon-gamma on expressions of matrix metalloproteinase-2 and -9 in human bladder cancer cells.

    PubMed

    Shin, K Y; Moon, H S; Park, H Y; Lee, T Y; Woo, Y N; Kim, H J; Lee, S J; Kong, G

    2000-10-31

    We have investigated the effects of tumor necrosis factor-alpha (TNF-alpha) and interferon (INF-gamma), the potent Bacillus Calmette-Guerin (BCG)-induced cytokines on the production of MMP-2, MMP-9, TIMP-1, TIMP-2 and MT1-MMP in high grade human bladder cancer cell lines, T-24, J-82 and HT-1376 cell lines. MMP-2 expression and activity were decreased in T-24 cells treated with both cytokines in a dose dependent manner. However, J-82 cells treated with TNF-alpha and INF-gamma revealed dose dependent increases of MMP-9 expression and activity with similar baseline expression and activity of MMP-2. HT-1376 cells after exposure to TNF-alpha only enhanced the expression and activity of MMP-9. These results indicate that TNF-alpha and INF-gamma could regulate the production of MMP-2 or MMP-9 on bladder cancer cells and their patterns of regulation are cell specific. Furthermore, this diverse response of bladder cancer cells to TNF-alpha and INF-gamma suggests that BCG immunotherapy may enhance the invasiveness of bladder cancer in certain conditions with induction of MMPs.

  4. Transforming growth factor-beta controls T helper type 1 cell development through regulation of natural killer cell interferon-gamma.

    PubMed

    Laouar, Yasmina; Sutterwala, Fayyaz S; Gorelik, Leonid; Flavell, Richard A

    2005-06-01

    Interferon-gamma and interleukin 12 produced by the innate arm of the immune system are important regulators of T helper type 1 (T(H)1) cell development, but signals that negatively regulate their expression remain controversial. Here we show that transforming growth factor-beta (TGF-beta) controlled T(H)1 differentiation through the regulation of interferon-gamma produced by natural killer (NK) cells. Blockade of TGF-beta signaling in NK cells caused the accumulation of a large pool of NK cells secreting copious interferon-gamma, responsible for T(H)1 differentiation and protection from leishmania infection. In contrast, blockade of TGF-beta signaling in dendritic cells did not affect dendritic cell homeostasis or interleukin 12 production, thus indicating a previously undescribed demarcation of the function of TGF-beta in NK cells versus dendritic cells.

  5. Interferon-γ Inhibits Ebola Virus Infection.

    PubMed

    Rhein, Bethany A; Powers, Linda S; Rogers, Kai; Anantpadma, Manu; Singh, Brajesh K; Sakurai, Yasuteru; Bair, Thomas; Miller-Hunt, Catherine; Sinn, Patrick; Davey, Robert A; Monick, Martha M; Maury, Wendy

    2015-01-01

    Ebola virus outbreaks, such as the 2014 Makona epidemic in West Africa, are episodic and deadly. Filovirus antivirals are currently not clinically available. Our findings suggest interferon gamma, an FDA-approved drug, may serve as a novel and effective prophylactic or treatment option. Using mouse-adapted Ebola virus, we found that murine interferon gamma administered 24 hours before or after infection robustly protects lethally-challenged mice and reduces morbidity and serum viral titers. Furthermore, we demonstrated that interferon gamma profoundly inhibits Ebola virus infection of macrophages, an early cellular target of infection. As early as six hours following in vitro infection, Ebola virus RNA levels in interferon gamma-treated macrophages were lower than in infected, untreated cells. Addition of the protein synthesis inhibitor, cycloheximide, to interferon gamma-treated macrophages did not further reduce viral RNA levels, suggesting that interferon gamma blocks life cycle events that require protein synthesis such as virus replication. Microarray studies with interferon gamma-treated human macrophages identified more than 160 interferon-stimulated genes. Ectopic expression of a select group of these genes inhibited Ebola virus infection. These studies provide new potential avenues for antiviral targeting as these genes that have not previously appreciated to inhibit negative strand RNA viruses and specifically Ebola virus infection. As treatment of interferon gamma robustly protects mice from lethal Ebola virus infection, we propose that interferon gamma should be further evaluated for its efficacy as a prophylactic and/or therapeutic strategy against filoviruses. Use of this FDA-approved drug could rapidly be deployed during future outbreaks.

  6. Plasma interferon-gamma and interleukin-10 concentrations in systemic meningococcal disease compared with severe systemic Gram-positive septic shock.

    PubMed

    Bjerre, Anna; Brusletto, Berit; Høiby, Ernst Arne; Kierulf, Peter; Brandtzaeg, Petter

    2004-02-01

    To analyze plasma interferon-gamma and interleukin-10 concentrations in patients with systemic meningococcal disease and patients with severe Gram-positive septic shock caused by Streptococcus pneumoniae or Staphylococcus aureus. To study the in vitro cytokine (interferon-gamma and interleukin-10) responses in a whole blood model boosted with heat-killed Neisseria meningitidis, S. pneumoniae, and S. aureus before and after treatment with recombinant interleukin-10 or recombinant interferon-gamma. Experimental study. Laboratory. Plasma samples were collected from patients with systemic meningococcal disease (n = 66) and patients with severe Gram-positive septic shock caused by S. pneumoniae (n = 4) or S. aureus (n = 3). Whole blood was boosted with heat-killed N. meningitidis, S. pneumoniae, and S. aureus (1 x 106 colony forming units/mL), and plasmas were analyzed for interleukin-10 or interferon-gamma at 0, 5, 12, and 24 hrs. Furthermore, recombinant interleukin-10 or recombinant interferon-gamma was added before bacteria, and the effect on the secretion of interferon-gamma and interleukin-10, respectively, was analyzed after 24 hrs. The median concentration of interferon-gamma was 15 pg/mL and of interleukin-10 was 10,269 pg/mL in patients with meningococcal septic shock (n = 24) compared with median interferon-gamma concentration of 3400 pg/mL and interleukin-10 concentration of 465 pg/mL in patients with severe Gram-positive shock (p =.001). Increased interferon-gamma concentrations were associated with case fatality (p =.011). In a whole blood model we demonstrated that 1 x 106 colony forming units/mL of N. meningitidis induced more interleukin-10 but less interferon-gamma than S. pneumoniae. S. aureus induced minimal secretion of both cytokines. Recombinant interleukin-10 efficiently down-regulated the secretion of interferon-gamma, and vice versa, as shown in a whole blood model. We speculate whether high concentrations of interleukin-10 contribute to the

  7. Whole-exome sequencing reveals a rare interferon gamma receptor 1 mutation associated with myasthenia gravis.

    PubMed

    Qi, Guoyan; Liu, Peng; Gu, Shanshan; Yang, Hongxia; Dong, Huimin; Xue, Yinping

    2018-04-01

    Our study is aimed to explore the underlying genetic basis of myasthenia gravis. We collected a Chinese pedigree with myasthenia gravis, and whole-exome sequencing was performed on the two affected siblings and their parents. The candidate pathogenic gene was identified by bioinformatics filtering, which was further verified by Sanger sequencing. The homozygous mutation c.G40A (p.V14M) in interferon gamma receptor 1was identified. Moreover, the mutation was also detected in 3 cases of 44 sporadic myasthenia gravis patients. The p.V14M substitution in interferon gamma receptor 1 may affect the signal peptide function and the translocation on cell membrane, which could disrupt the binding of the ligand of interferon gamma and antibody production, contributing to myasthenia gravis susceptibility. We discovered that a rare variant c.G40A in interferon gamma receptor 1 potentially contributes to the myasthenia gravis pathogenesis. Further functional studies are needed to confirm the effect of the interferon gamma receptor 1 on the myasthenia gravis phenotype.

  8. Coexposure of mice to trovafloxacin and lipopolysaccharide, a model of idiosyncratic hepatotoxicity, results in a unique gene expression profile and interferon gamma-dependent liver injury.

    PubMed

    Shaw, Patrick J; Ditewig, Amy C; Waring, Jeffrey F; Liguori, Michael J; Blomme, Eric A; Ganey, Patricia E; Roth, Robert A

    2009-01-01

    The antibiotic trovafloxacin (TVX) has caused severe idiosyncratic hepatotoxicity in people, whereas levofloxacin (LVX) has not. Mice cotreated with TVX and lipopolysaccharide (LPS), but not with LVX and LPS, develop severe hepatocellular necrosis. Mice were treated with TVX and/or LPS, and hepatic gene expression changes were measured before liver injury using gene array. Hepatic gene expression profiles from mice treated with TVX/LPS clustered differently from those treated with LPS or TVX alone. Several of the probe sets expressed differently in TVX/LPS-treated mice were involved in interferon (IFN) signaling and the janus kinase/signal transducers and activators of transcription (JAK/STAT) pathway. A time course of plasma concentrations of IFN-gamma and interleukin (IL)-18, which directly induces IFN-gamma production, revealed that both cytokines were selectively increased in TVX/LPS-treated mice. Both IL-18(-/-) and IFN-gamma(-/-) mice were significantly protected from TVX/LPS-induced liver injury. In addition, IFN-gamma(-/-) mice had decreased plasma concentrations of tumor necrosis factor-alpha, IL-18, and IL-1beta when compared to wild-type mice. In conclusion, the altered expression of genes involved in IFN signaling in TVX/LPS-treated mice led to the finding that IL-18 and IFN-gamma play a critical role in TVX/LPS-induced liver injury.

  9. Inhibition of interferon-gamma expression by osmotic shrinkage of peripheral blood lymphocytes.

    PubMed

    Lang, K S; Weigert, C; Braedel, S; Fillon, S; Palmada, M; Schleicher, E; Rammensee, H-G; Lang, F

    2003-01-01

    A hypertonic environment, as it prevails in renal medulla or in hyperosmolar states such as hyperglycemia of diabetes mellitus, has been shown to impair the immune response, thus facilitating the development of infection. The present experiments were performed to test whether hypertonicity influences activation of T lymphocytes. To this end, peripheral blood lymphocytes (PBL) of cytomegalovirus (CMV)-positive donors were stimulated by human leukocyte antigen (HLA)-A2-restricted CMV epitope NLVPMVATV to produce interferon (IFN)-gamma at varying extracellular osmolarity. As a result, increasing extracellular osmolarity during exposure to the CMV antigen indeed decreased IFN-gamma formation. Addition of NaCl was more effective than urea. A 50% inhibition was observed at 350 mosM by addition of NaCl. The combined application of the Ca(2+) ionophore ionomycin (1 microg/ml) and the phorbol ester phorbol 12-myristate 13-acetate (PMA; 5 microg/ml) stimulated IFN-gamma production, an effect again reversed by hyperosmolarity. Moreover, hyperosmolarity abrogated the stimulating effect of ionomycin (1 microg/ml) and PMA (5 microg/ml) on the transcription factors activator protein (AP)-1, nuclear factor of activated T cells (NFAT), and NF-kappaB but not Sp1. In conclusion, osmotic cell shrinkage blunts the stimulatory action of antigen exposure on IFN-gamma production, an effect explained at least partially by suppression of transcription factor activation.

  10. [The expression of interferon-lambda1 in CHO cell].

    PubMed

    Yuan, Wu-Mei; Ma, Fen-Lian; Zhang, Qian; Zheng, Wen-Zhi; Zheng, Li-Shu

    2013-06-01

    To construct the eukaryotic expression vector PCI-dhfr-lambda1 and PCI-dhfr-SP163-lambda1 which linked the enhancer SP163 with interferon lambda1. Then express the interferon lambda1 in CHO (dhfr-) cells. Using PCR method to introduce the restriction enzyme sites and through the fusion PCR binding the enhancer with the interferon Lambda1. After sequenced, lambda1 and SP163-lambda1 was inserted into PCI-dhfr forming the expression vector PCI-dhfr-lambda1 and PCI-dhfr-SP163-lambda1 which was constructed successfully confirming by sequencing. Then the expressing vectors were transfected into CHO (dhfr-) cells using liposome transfection method and interferon lambda1 protein was assayed with indirect immunofluorescence and Western Blot. Using cytopathic effect inhibition evaluated the antiviral activity of interferon lambda1. Successfully constructing the eukaryotic expression vectors of interferon lambda and the vectors could express interferon lambda1. The result of immunofluorescence showed the enhancer developed the expression of interferon lambda1. Detecting the interferon lambda1 in CHO (dhfr-) cells after transfecting 48 hour using Western Blot. The cytopathic effect inhibition showed the expressed interferon lambda1 has the antiviral activity. Successfully expressed the interferon lambda1 in CHO (dhfr-) cells and the protein possesses antiviral activity, which may supply a valuable basis for building the stable cell line of interferon lambda1.

  11. (PCG) Protein Crystal Growth Gamma-Interferon

    NASA Technical Reports Server (NTRS)

    1989-01-01

    (PCG) Protein Crystal Growth Gamma-Interferon. Stimulates the body's immune system and is used clinically in the treatment of cancer. Potential as an anti-tumor agent against solid tumors as well as leukemia's and lymphomas. It has additional utility as an anti-ineffective agent, including antiviral, anti-bacterial, and anti-parasitic activities. Principal Investigator on STS-26 was Charles Bugg.

  12. Differential effects of human interferon alpha and interferon gamma on xenografted human thyroid tissue in severe combined immunodeficient mice and nude mice.

    PubMed

    Kawai, K; Enomoto, T; Fornasier, V; Resetkova, E; Volpé, R

    1997-03-01

    We have studied the in vivo effects of human interferon alpha (IFN-alpha) and interferon gamma (IFN-gamma) administration on human thyroid tissue xenografted into two mouse strains: severe combined immunodeficient (SCID) mice and nude mice. Human lymphocytes survive in SCID mice but are lysed in nude mice. Thyroid tissues from Graves' disease or Hashimoto's thyroiditis, or paranodular [normal, (N)] tissue was xenografted into SCID mice (0.8 g/mouse) pretreated with anti-asialo GM-1 antiserum and radiation and also into nude mice. One week after xenografting, SCID and nude mice were divided into three groups. Group A was treated with IFN-alpha intraperitoneally (2,000 units/mouse) three times weekly; group B was treated with IFN-gamma similarly; group C was treated with phosphate buffered saline (PBS) only (control). Autologous human peripheral blood mononuclear cells (PBMCs) were added to mice receiving N xenografts. Blood was taken every 2 weeks for levels of IgG and thyroid antibodies (TAb). After 6 weeks of treatment, mice were sacrificed, and xenograft thyrocyte histocompatibility leukocyte antigen (HLA-DR) and intercellular adhesion molecule (ICAM-1) expression were measured. In addition, thyrocyte cultures were stimulated in vitro with 200 units/ml of either IFN-alpha or IFN-gamma or PBS (control). SCID mice xenografted with autoimmune thyroid disease (AITD) in group A showed a significantly higher TAb production than group C, whereas in group B, TAb production was not statistically increased compared to control (group C). SCID mice xenografted with N did not produce TAb in any group, nor did nude mice xenografted with AITD. Thyrocyte HLA-DR expression was markedly increased in group A and B in SCID mice xenografted with Graves' disease, Hashimoto's thyroiditis, and N tissue compared to group C. In contrast, only group B (IFN-gamma) showed an increase in thyrocyte HLA-DR in nude mice. In the in vitro studies, only IFN-gamma (not IFN-alpha) stimulated

  13. Interferon-gamma promoter hypomethylation and increased expression in chronic periodontitis

    PubMed Central

    Zhang, Shaoping; Crivello, Antonino; Offenbacher, Steven; Moretti, Antonio; Paquette, David W.; Barros, Silvana P.

    2011-01-01

    Aim The goal of this investigation was to determine whether epigenetic modifications in the IFNG promoter are associated with an increase of IFNG transcription in different stages of periodontal diseases. Materials and Methods DNA was extracted from gingival biopsy samples collected from 47 total sites from 47 different subjects: 23 periodontally healthy sites, 12 experimentally induced gingivitis sites and 12 chronic periodontitis sites. Levels of DNA methylation within the IFNG promoter containing six CpG dinucleotides were determined using pyrosequencing technology. Interferon gamma mRNA expression was analysed by quantitative polymerase chain reactions using isolated RNA from part of the biological samples mentioned above. Results The methylation level of all six analysed CpG sites within the IFNG promoter region in the periodontitis biopsies {52% [interquartile range, IQR (43.8%, 63%)]} was significantly lower than periodontally healthy samples {62% [IQR (51.3%, 74%)], p =0.007} and gingivitis biopsies {63% [IQR (55%, 74%)], p =0.02}. The transcriptional level of IFNG in periodontitis biopsies was 1.96-fold and significantly higher than tissues with periodontal health (p =0.04). Although the mRNA level from experimental gingivitis samples exhibited an 8.5-fold increase as compared with periodontally healthy samples, no significant methylation difference was observed in experimental gingivitis sample. Conclusions A hypomethylation profile within IFNG promoter region is related to an increase of IFNG transcription present in the chronic periodontitis biopsies, while such an increase of IFNG in experimentally induced gingivitis seems independent of promoter methylation alteration. PMID:20958339

  14. The effect of centaurein on interferon-{gamma} expression and Listeria infection in mice

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chang, S.-L.; Department of Biological Science and Technology, National Chiao Tung University, 1001, Ta Hsueh Road, Hsinchu 300, Taiwan; Yeh, H.-H.

    2007-02-15

    We previously found that centaurein enhanced IFN-{gamma} transcription in T cells. Here, we demonstrate that centaurein increased the IFN-{gamma} expression in T and NK cells and the serum IFN-{gamma} level in mice. Centaurein elevated the transcription of T-bet but not GATA-3, which is consistent with its effect on that of IFN-{gamma} but not IL-4. Additionally, centaurein effectively protected mice against Listeria infection. Moreover, centaurein per se or in combination with antibiotics could treat Listeria infection. Our mechanistic studies suggest that centaurein augments IFN-{gamma} expression via a transcriptional up-regulation of T-bet and that centaurein protects against or treats Listeria infection viamore » a modulation of IFN-{gamma} expression.« less

  15. The Role of the Interferon-Gamma-Jak/STAT Pathway in Rheumatoid Arthritis

    DTIC Science & Technology

    2017-09-01

    AWARD NUMBER: W81XWH-16-1-0537 TITLE: The Role of the Interferon-Gamma-Jak/STAT Pathway in Rheumatoid Arthritis PRINCIPAL INVESTIGATOR: Stanley...Sep 2016 - 31 Aug 2017 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER The Role of the Interferon-Gamma-Jak/STAT Pathway in Rheumatoid Arthritis 5b...subsets that likely counteracts IL-2 regulator activity and contribute to the pathogenesis of RA. 15. SUBJECT TERMS Rheumatoid arthritis ; Autoimmunity; T

  16. Interferon-Gamma Promotes UV-Induced Melanoma in Mice | Center for Cancer Research

    Cancer.gov

    Scientists have made an unanticipated discovery in mice that interferon-gamma, a type of protein primarily used by the immune system for intercellular communication, acts as a promoter for the deadly form of skin cancer known as melanoma. This finding resulted from a series of experiments designed to understand how solar ultraviolet (UV) radiation causes melanoma. This study suggests that interferon-gamma, which has been thought to contribute to an innate defense system against cancer, under some circumstances, may instead promote melanoma and incite the development of tumors.

  17. Effect of gamma interferon on resolution of murine chlamydial genital infection.

    PubMed Central

    Rank, R G; Ramsey, K H; Pack, E A; Williams, D M

    1992-01-01

    Mice infected in the genital tract with the Chlamydia trachomatis agent of mouse pneumonitis were treated with monoclonal rat anti-gamma interferon (anti-IFN-gamma) antibody to determine whether IFN-gamma participated in the resolution of the infection. In two experiments, anti-IFN-gamma antibody treatment resulted in significantly prolonged infections. In support of these data, passive administration of recombinant IFN-gamma to chronically infected nu/nu mice was able to bring about resolution of the infection in some animals. PMID:1398955

  18. Production and characterization of guinea pig recombinant gamma interferon and its effect on macrophage activation.

    PubMed

    Jeevan, A; McFarland, C T; Yoshimura, T; Skwor, T; Cho, H; Lasco, T; McMurray, D N

    2006-01-01

    Gamma interferon (IFN-gamma) plays a critical role in the protective immune responses against mycobacteria. We previously cloned a cDNA coding for guinea pig IFN-gamma (gpIFN-gamma) and reported that BCG vaccination induced a significant increase in the IFN-gamma mRNA expression in guinea pig cells in response to living mycobacteria and that the virulent H37Rv strain of Mycobacterium tuberculosis stimulated less IFN-gamma mRNA than did the attenuated H37Ra strain. In this study, we successfully expressed and characterized recombinant gpIFN-gamma with a histidine tag at the N terminus (His-tagged rgpIFN-gamma) in Escherichia coli. rgpIFN-gamma was identified as an 18-kDa band in the insoluble fraction; therefore, the protein was purified under denaturing conditions and renatured. N-terminal amino acid sequencing of the recombinant protein yielded the sequence corresponding to the N terminus of His-tagged gpIFN-gamma. The recombinant protein upregulated major histocompatibility complex class II expression in peritoneal macrophages. The antiviral activity of rgpIFN-gamma was demonstrated with a guinea pig fibroblast cell line (104C1) infected with encephalomyocarditis virus. Interestingly, peritoneal macrophages treated with rgpIFN-gamma did not produce any nitric oxide but did produce hydrogen peroxide and suppressed the intracellular growth of mycobacteria. Furthermore, rgpIFN-gamma induced morphological alterations in cultured macrophages. Thus, biologically active rgpIFN-gamma has been successfully produced and characterized in our laboratory. The study of rgpIFN-gamma will further increase our understanding of the cellular and molecular responses induced by BCG vaccination in the guinea pig model of pulmonary tuberculosis.

  19. MOLECULAR CLONING, SEQUENCING, EXPRESSION AND BIOLOGICAL ACTIVITY OF GIANT PANDA (AILUROPODA MELANOLEUCA) INTERFERON-GAMMA.

    PubMed

    Zhu, Hui; Wang, Wen-Xiu; Wang, Bao-Qin; Zhu, Xiao-Fu; Wu, Xu-Jin; Ma, Qing-Yi; Chen, De-Kun

    2012-06-29

    The giant panda (Ailuropoda melanoleuca) is an endangered species and indigenous to China. Interferon-gamma (IFN-γ) is the only member of type □ IFN and is vital for the regulation of host adapted immunity and inflammatory response. Little is known aboutthe FN-γ gene and its roles in giant panda.In this study, IFN-γ gene of Qinling giant panda was amplified from total blood RNA by RT-CPR, cloned, sequenced and analysed. The open reading frame (ORF) of Qinling giant panda IFN-γ encodes 152 amino acidsand is highly similar to Sichuan giant panda with an identity of 99.3% in cDNA sequence. The IFN-γ cDNA sequence was ligated to the pET32a vector and transformed into E. coli BL21 competent cells. Expression of recombinant IFN-γ protein of Qinling giant panda in E. coli was confirmed by SDS-PAGE and Western blot analysis. Biological activity assay indicated that the recombinant IFN-γ protein at the concentration of 4-10 µg/ml activated the giant panda peripheral blood lymphocytes,while at 12 µg/mlinhibited. the activation of the lymphocytes.These findings provide insights into the evolution of giant panda IFN-γ and information regarding amino acid residues essential for their biological activity.

  20. Evaluation of gamma interferon (IFN-gamma)-induced protein 10 (IP-10) responses for detection of cattle infected with Mycobacterium bovis: comparisons to IFN-gamma responses

    USDA-ARS?s Scientific Manuscript database

    Gamma interferon (IFN-gamma)-induced protein 10 (IP-10) has recently shown promise as a diagnostic biomarker of Mycobacterium tuberculosis infection of humans. The aim of the current study was to compare IP-10 and IFN-gamma responses upon Mycobacterium bovis infection in cattle using archived sample...

  1. Interferon modulation of c-myc expression in cloned Daudi cells: relationship to the phenotype of interferon resistance.

    PubMed

    Dron, M; Modjtahedi, N; Brison, O; Tovey, M G

    1986-05-01

    Treatment of interferon-sensitive Daudi cell with electrophoretically pure human interferon alpha markedly reduced the level of c-myc mRNA, increased the level of class I histocompatibility antigen (HLA) mRNA, and did not affect the level of actin mRNA within the same cells. In contrast, the level of c-myc mRNA or HLA mRNA did not change significantly following interferon treatment in different clones of Daudi cells selected for resistance to the antiproliferative action of interferon. These cells possessed interferon receptors, however, and responded to interferon modulation of other genes, including 2',5' oligoisoadenylate synthetase (M. G. Tovey, M. Dron, K. E. Mogensen, B. Lebleu, N. Metchi, and J. Begon-Lours, Guymarho, J. Gen. Virol., 64:2649-2653, 1983; M. Dron, M. G. Tovey, and P. Eid, J. Gen. Virol., 66:787-795, 1985). A clone of interferon-resistant Daudi cells which had reverted to almost complete sensitivity to both the antiproliferative action of interferon and the interferon-enhanced expression of HLA mRNA remained refractory, however, to interferon modulation of c-myc expression, suggesting that a reduced level of c-myc mRNA may not be a prerequisite for inhibition of cell proliferation in interferon-treated cells. Our results do not exclude the possibility, however, that posttranscriptional modification(s) of c-myc expression may precede an inhibition of cell proliferation in interferon-treated cells.

  2. Persistent interferon transgene expression by RNA interference-mediated silencing of interferon receptors.

    PubMed

    Takahashi, Yuki; Vikman, Elin; Nishikawa, Makiya; Ando, Mitsuru; Watanabe, Yoshihiko; Takakura, Yoshinobu

    2010-09-01

    The in vivo half-life of interferons (IFNs) is very short, and its extension would produce a better therapeutic outcome in IFN-based therapy. Delivery of IFN genes is one solution for providing a sustained supply. IFNs have a variety of functions, including the suppression of transgene expression, through interaction with IFN receptors (IFNRs). This suppression could prevent IFNs from being expressed from vectors delivered. Silencing the expression of IFNAR and IFNGR, the receptors for type I and II IFNs, respectively, in cells expressing IFNs may prolong transgene expression of IFNs. Mouse melanoma B16-BL6 cells or mouse liver were selected as a site expressing IFNs (not a target for IFN gene therapy) and IFN-expressing plasmid DNA was delivered with or without small interfering RNA (siRNA) targeting IFNRs. Transfection of B16-BL6 cells with siRNA targeting IFNAR1 subunit (IFNAR1) resulted in the reduced expression of IFNAR on the cell surface. This silencing significantly increased the IFN-beta production in cells that were transfected with IFN-beta-expressing plasmid DNA. Similar results were obtained with the combination of IFN-gamma and IFNGR. Co-injection of IFN-beta-expressing plasmid DNA with siRNA targeting IFNAR1 into mice resulted in sustained plasma concentration of IFN-beta. These results provide experimental evidence that the RNAi-mediated silencing of IFNRs in cells expressing IFN, such as hepatocytes, is an effective approach for improving transgene expression of IFNs when their therapeutic target comprises cells other than those expressing IFNs.

  3. Gamma Interferon-Induced T-Cell Loss in Virulent Mycobacterium avium Infection

    PubMed Central

    Flórido, Manuela; Pearl, John E.; Solache, Alejandra; Borges, Margarida; Haynes, Laura; Cooper, Andrea M.; Appelberg, Rui

    2005-01-01

    Infection by virulent Mycobacterium avium caused progressive severe lymphopenia in C57BL/6 mice due to increased apoptosis rates. T-cell depletion did not occur in gamma interferon (IFN-γ)-deficient mice which showed increased T-cell numbers and proliferation; in contrast, deficiency in nitric oxide synthase 2 did not prevent T-cell loss. Although T-cell loss was IFN-γ dependent, expression of the IFN-γ receptor on T cells was not required for depletion. Similarly, while T-cell loss was optimal if the T cells expressed IFN-γ, CD8+ T-cell depletion could occur in the absence of T-cell-derived IFN-γ. Depletion did not require that the T cells be specific for mycobacterial antigen and was not affected by deficiencies in the tumor necrosis factor receptors p55 or p75, the Fas receptor (CD95), or the respiratory burst enzymes or by forced expression of bcl-2 in hematopoietic cells. PMID:15908387

  4. Interferon modulation of c-myc expression in cloned Daudi cells: relationship to the phenotype of interferon resistance.

    PubMed Central

    Dron, M; Modjtahedi, N; Brison, O; Tovey, M G

    1986-01-01

    Treatment of interferon-sensitive Daudi cell with electrophoretically pure human interferon alpha markedly reduced the level of c-myc mRNA, increased the level of class I histocompatibility antigen (HLA) mRNA, and did not affect the level of actin mRNA within the same cells. In contrast, the level of c-myc mRNA or HLA mRNA did not change significantly following interferon treatment in different clones of Daudi cells selected for resistance to the antiproliferative action of interferon. These cells possessed interferon receptors, however, and responded to interferon modulation of other genes, including 2',5' oligoisoadenylate synthetase (M. G. Tovey, M. Dron, K. E. Mogensen, B. Lebleu, N. Metchi, and J. Begon-Lours, Guymarho, J. Gen. Virol., 64:2649-2653, 1983; M. Dron, M. G. Tovey, and P. Eid, J. Gen. Virol., 66:787-795, 1985). A clone of interferon-resistant Daudi cells which had reverted to almost complete sensitivity to both the antiproliferative action of interferon and the interferon-enhanced expression of HLA mRNA remained refractory, however, to interferon modulation of c-myc expression, suggesting that a reduced level of c-myc mRNA may not be a prerequisite for inhibition of cell proliferation in interferon-treated cells. Our results do not exclude the possibility, however, that posttranscriptional modification(s) of c-myc expression may precede an inhibition of cell proliferation in interferon-treated cells. Images PMID:3785169

  5. Inhibited interferon-gamma but normal interleukin-3 production from rats flown on the Space Shuttle

    NASA Technical Reports Server (NTRS)

    Gould, Cheryl L.; Lyte, Mark; Williams, Joann; Mandel, Adrian D.; Sonnenfeld, Gerald

    1987-01-01

    Rats were flown on Space Shuttle SL-3 for one week. When spleen cells were removed from these rats and challenged with concanavalin-A, interferon-gamma production was severely inhibited, while interleukin-3 production was unaffected compared to ground-based control rats. These data indicate that there is a defect in interferon-gamma production in rats that have been exposed to spaceflight. This defect could contribute to, and be one reason for, immunosuppression observed after spaceflight.

  6. Interferon Gamma as a Biomarker of Exposure to Enteric Viruses

    EPA Science Inventory

    Interferon gamma (IFN-γ) was selected as a biomarker for viral exposure. Twelve-week-old BALB/c mice were intraperitoneally injected with Coxsackievirus B3 or B4 diluted in phosphate-buffered saline (PBS). Control mice were injected with PBS only. Four months after viral infectio...

  7. Anti-interferon-gamma antibodies in the treatment of autoimmune diseases.

    PubMed

    Skurkovich, Boris; Skurkovich, Simon

    2003-02-01

    Interferon (IFN)-gamma is an important immune regulator in normal immunity. When IFN gamma production is disturbed, various autoimmune diseases (ADs) can develop, in which we suggest that anti-IFN gamma could have a beneficial effect. Depending on the cell type in which IFN gamma synthesis is disturbed, different clinical manifestations may result. We have also proposed to remove tumor necrosis factor (TNF)-alpha, together with certain types of IFNs, to treat various ADs and AIDS, also an autoimmune condition. Anti-IFN gamma has been tested in several T-helper cell (Th1) ADs, including rheumatoid arthritis (RA), multiple sclerosis (MS), corneal transplant rejection, uveitis, Type I diabetes, schizophrenia (anti-IFN gamma and anti-TNF alpha), and various autoimmune skin diseases (alopecia areata, psoriasis vulgaris, vitiligo, pemphigus vulgaris and epidermolysis bullosa). A strong, sometimes striking, therapeutic response followed administration of anti-IFN gamma, indicating that it may be a promising therapy for Th1 ADs.

  8. Gamma-interferon causes a selective induction of the lysosomal proteases, cathepsins B and L, in macrophages

    NASA Technical Reports Server (NTRS)

    Lah, T. T.; Hawley, M.; Rock, K. L.; Goldberg, A. L.

    1995-01-01

    Previous studies have indicated that acid-optimal cysteine proteinase(s) in the endosomal-lysosomal compartments, cathepsins, play a critical role in the proteolytic processing of endocytosed proteins to generate the antigenic peptides presented to the immune system on major histocompatibility complex (MHC) class II molecules. The presentation of these peptides and the expression of MHC class II molecules by macrophages and lymphocytes are stimulated by gamma-interferon (gamma-IFN). We found that treatment of human U-937 monocytes with gamma-IFN increased the activities and the content of the two major lysosomal cysteine proteinases, cathepsins B and L. Assays of protease activity, enzyme-linked immunosorbant assays (ELISA) and immunoblotting showed that this cytokine increased the amount of cathepsin B 5-fold and cathepsin L 3-fold in the lysosomal fraction. By contrast, the aspartic proteinase, cathepsin D, in this fraction was not significantly altered by gamma-IFN treatment. An induction of cathepsins B and L was also observed in mouse macrophages, but not in HeLa cells. These results suggest coordinate regulation in monocytes of the expression of cathepsins B and L and MHC class II molecules. Presumably, this induction of cysteine proteases contributes to the enhancement of antigen presentation by gamma-IFN.

  9. Robust Protection against Highly Virulent Foot-and-Mouth Disease Virus in Swine by Combination Treatment with Recombinant Adenoviruses Expressing Porcine Alpha and Gamma Interferons and Multiple Small Interfering RNAs

    PubMed Central

    Park, Jong-Hyeon; Lee, Kwang-Nyeong; Kim, Se-Kyung; You, Su-Hwa; Kim, Taeseong; Tark, Dongseob; Lee, Hyang-Sim; Seo, Min-Goo; Kim, Byounghan

    2015-01-01

    ABSTRACT Because the currently available vaccines against foot-and-mouth disease (FMD) provide no protection until 4 to 7 days postvaccination, the only alternative method to halt the spread of the FMD virus (FMDV) during outbreaks is the application of antiviral agents. Combination treatment strategies have been used to enhance the efficacy of antiviral agents, and such strategies may be advantageous in overcoming viral mechanisms of resistance to antiviral treatments. We have developed recombinant adenoviruses (Ads) for the simultaneous expression of porcine alpha and gamma interferons (Ad-porcine IFN-αγ) as well as 3 small interfering RNAs (Ad-3siRNA) targeting FMDV mRNAs encoding nonstructural proteins. The antiviral effects of Ad-porcine IFN-αγ and Ad-3siRNA expression were tested in combination in porcine cells, suckling mice, and swine. We observed enhanced antiviral effects in porcine cells and mice as well as robust protection against the highly pathogenic strain O/Andong/SKR/2010 and increased expression of cytokines in swine following combination treatment. In addition, we showed that combination treatment was effective against all serotypes of FMDV. Therefore, we suggest that the combined treatment with Ad-porcine IFN-αγ and Ad-3siRNA may offer fast-acting antiviral protection and be used with a vaccine during the period that the vaccine does not provide protection against FMD. IMPORTANCE The use of current foot-and-mouth disease (FMD) vaccines to induce rapid protection provides limited effectiveness because the protection does not become effective until a minimum of 4 days after vaccination. Therefore, during outbreaks antiviral agents remain the only available treatment to confer rapid protection and reduce the spread of foot-and-mouth disease virus (FMDV) in livestock until vaccine-induced protective immunity can become effective. Interferons (IFNs) and small interfering RNAs (siRNAs) have been reported to be effective antiviral agents against

  10. Effects of chicken interferon Gamma on Newcastle disease virus vaccine immunogenicity

    USDA-ARS?s Scientific Manuscript database

    More effective vaccines are needed to control avian diseases. The use of chicken interferon gamma (chIFN') during vaccination is a potentially important but controversial approach that may improve the immune response to antigens. In the present study, three different systems to co-deliver chIFN' wit...

  11. Mice with Pulmonary Tuberculosis Treated with Mycobacterium vaccae Develop Strikingly Enhanced Recall Gamma Interferon Responses to M. vaccae Cell Wall Skeleton▿

    PubMed Central

    Rodríguez-Güell, Elisabeth; Agustí, Gemma; Corominas, Mercè; Cardona, Pere-Joan; Luquin, Marina; Julián, Esther

    2008-01-01

    Whole heat-killed Mycobacterium vaccae is used as an immunotherapeutic agent in tuberculosis (TB), but the compound(s) that triggers its immunostimulatory ability is not known. Here, we show that among different subcellular fractions, the cell wall skeleton induced a prominent expression of gamma interferon in splenocytes from both non-TB and TB M. vaccae-treated mice. PMID:18337379

  12. Interferon-gamma (INF-gamma) release test can detect cutaneous adverse effects to statins.

    PubMed

    Goldberg, Ilan; Isman, Gila; Shirazi, Idit; Brenner, Sarah

    2009-12-01

    An increasing number of cutaneous adverse effects are being reported as use of statins becomes more widespread. A study was undertaken to establish the relationship between statin and a cutaneous reaction by the in vitro interferon-gamma (INF-gamma) release test. The lymphocytes of 20 patients with suspected drug-induced skin reaction were incubated with and without the drug. The level of INF-gamma from the supernatant was measured by enzyme-linked immunosorbent assay (ELISA), and the increase calculated. Response was positive in 27 (21.43%) of the 126 drugs. Statin was the only drug with a positive response in 80% of those cases. Nine of 20 patients (45.0%) had complete resolution after discontinuation of the drug; 6 (30.0%) who replaced one drug by another statin had partial or no resolution; and 5 (20.0%) had no resolution despite cessation of statins of all kinds. A positive INF-gamma release test was found in patients who developed skin reactions while taking statins; the test's reliability was strengthened by prompt improvement following elimination of the suspected drug in the majority of patients.

  13. In vivo induction of interferon gamma expression in grey horses with metastatic melanoma resulting from direct injection of plasmid DNA coding for equine interleukin 12.

    PubMed

    Müller, J-M V; Wissemann, J; Meli, M L; Dasen, G; Lutz, H; Heinzerling, L; Feige, K

    2011-11-01

    Whole blood pharmacokinetics of intratumourally injected naked plasmid DNA coding for equine Interleukin 12 (IL-12) was assessed as a means of in vivo gene transfer in the treatment of melanoma in grey horses. The expression of induced interferon gamma (IFN-g) was evaluated in order to determine the pharmacodynamic properties of in vivo gene transduction. Seven grey horses bearing melanoma were injected intratumourally with 250 µg naked plasmid DNA coding for IL-12. Peripheral blood and biopsies from the injection site were taken at 13 time points until day 14 post injection (p.i.). Samples were analysed using quantitative real-time PCR. Plasmid DNA was quantified in blood samples and mRNA expression for IFN-g in tissue samples. Plasmid DNA showed fast elimination kinetics with more than 99 % of the plasmid disappearing within 36 hours. IFN-g expression increased quickly after IL-12 plasmid injection, but varied between individual horses. Intratumoural injection of plasmid DNA is a feasible method for inducing transgene expression in vivo. Biological activity of the transgene IL-12 was confirmed by measuring expression of IFN-g.

  14. Interferon-gamma inhibits intestinal restitution by preventing gap junction communication between enterocytes.

    PubMed

    Leaphart, Cynthia L; Qureshi, Faisal; Cetin, Selma; Li, Jun; Dubowski, Theresa; Baty, Catherine; Batey, Catherine; Beer-Stolz, Donna; Guo, Fengli; Murray, Sandra A; Hackam, David J

    2007-06-01

    Necrotizing enterocolitis (NEC) is characterized by interferon-gamma (IFN-gamma) release and inadequate intestinal restitution. Because enterocytes migrate together, mucosal healing may require interenterocyte communication via connexin 43-mediated gap junctions. We hypothesize that enterocyte migration requires interenterocyte communication, that IFN impairs migration by impairing connexin 43, and that impaired healing during NEC is associated with reduced gap junctions. NEC was induced in Swiss-Webster or IFN(-/-) mice, and restitution was determined in the presence of the gap junction inhibitor oleamide, or via time-lapse microscopy of IEC-6 cells. Connexin 43 expression, trafficking, and localization were detected in cultured or primary enterocytes or mouse or human intestine by confocal microscopy and (35)S-labeling, and gap junction communication was assessed using live microscopy with oleamide or connexin 43 siRNA. Enterocytes expressed connexin 43 in vitro and in vivo, and exchanged fluorescent dye via gap junctions. Gap junction inhibition significantly reduced enterocyte migration in vitro and in vivo. NEC was associated with IFN release and loss of enterocyte connexin 43 expression. IFN inhibited enterocyte migration by reducing gap junction communication through the dephosphorylation and internalization of connexin 43. Gap junction inhibition significantly increased NEC severity, whereas reversal of the inhibitory effects of IFN on gap junction communication restored enterocyte migration after IFN exposure. Strikingly, IFN(-/-) mice were protected from the development of NEC, and showed restored connexin 43 expression and intestinal restitution. IFN inhibits enterocyte migration by preventing interenterocyte gap junction communication. Connexin 43 loss may provide insights into the development of NEC, in which restitution is impaired.

  15. Effects of interferon-gamma and tumor necrosis factor-alpha on macrophage enzyme levels

    NASA Technical Reports Server (NTRS)

    Pierangeli, Silvia S.; Sonnenfeld, Gerald

    1989-01-01

    Murine peritoneal macrophages were treated with interferon-gamma (IFN-gamma) or tumor necrosis factor-alpha (TNF). Measurements of changes in acid phosphatase and beta-glucuronidase levels were made as an indication of activation by cytokine treatment. IFN-gamma or TNF-gamma treatment resulted in a significant increase in the activities of both enzymes measured in the cell lysates. This increase was observable after 6 h of incubation, but reached its maximum level after 24 h of incubation. The effect of the treatment of the cell with both cytokines together was additive. No synergistic effect of addition of both cytokines on the enzyme levels was observed.

  16. Human macrophage gamma interferon decreases gene expression but not replication of Mycobacterium tuberculosis: analysis of the host-pathogen reciprocal influence on transcription in a comparison of strains H37Rv and CMT97.

    PubMed

    Cappelli, G; Volpe, P; Sanduzzi, A; Sacchi, A; Colizzi, V; Mariani, F

    2001-12-01

    Mycobacterium tuberculosis is an intracellular pathogen that readily survives and replicates in human macrophages (MPhi). Host cells have developed different mycobactericidal mechanisms, including the production of inflammatory cytokines. The aim of this study was to compare the MPhi response, in terms of cytokine gene expression, to infection with the M. tuberculosis laboratory strain H37Rv and the clinical M. tuberculosis isolate CMT97. Both strains induce the production of interleukin-12 (IL-12) and IL-16 at comparable levels. However, the clinical isolate induces a significantly higher and more prolonged MPhi activation, as shown by reverse transcription-PCR analysis of IL-1beta, IL-6, IL-10, transforming growth factor beta, tumor necrosis factor alpha, and gamma interferon (IFN-gamma) transcripts. Interestingly, when IFN-gamma transcription is high, the number of M. tuberculosis genes expressed decreases and vice versa, whereas no mycobactericidal effect was observed in terms of bacterial growth. Expression of 11 genes was also studied in the two M. tuberculosis strains by infecting resting or activated MPhi and compared to bacterial intracellular survival. In both cases, a peculiar inverse correlation between expression of these genes and multiplication was observed. The number and type of genes expressed by the two strains differed significantly.

  17. Clinical and diagnostic developments of a gamma interferon release assay for use in bovine tuberculosis control programs

    USDA-ARS?s Scientific Manuscript database

    Currently the Bovigam assay is used as an official supplemental test within the bovine tuberculosis eradication program. This assay measures interferon-gamma (IFN-gamma) produced by lymphocytes in response to specific antigens. The objectives of the present study were to evaluate two Mycobacterium ...

  18. [Gamma interferon: basics aspects, clinic significance and terapeutic uses].

    PubMed

    Mata-Espinosa, Dulce A; Hernández-Pando, Rogelio

    2008-01-01

    Interferons are a family of pleiotropic cytokines, their name was assigned because of their anti-replicative viral activity. IFNgamma or immune type II interferon does not share receptors with the type I interferon, its structure is different and its gene is located in different chromosome, although its biologic effects are similar. Along of several years of research, it has been found that IFNgamma enhances the transcription of genes involved in immunomodulation, antiviral responses and antitumoral activities. Regarding to the immune system, IFNgamma increases the cytotoxic and phagocytic activity of macrophages and upregulates the expression of major histocompatibility complex (MHC) class I and class II molecules in dendritics cells and other antigen presenting cells. IFNgamma also promotes the development and differentiation of naive CD4+ T lymphocytes to Th1 helper subset. Indeed, this cytokine has a key role in the control of bacterial, micotic, viral and parasitic infections. Depending of the micro-environment, IFNgamma has a dual role as pro or anti inflammatory cytokine. Novel therapeutic strategies are currently being developed with the aim to enhance the immune response or replace IFNgamma gene abnormal expression with beneficial results in humans, being recombinant IFNgamma safe and well tolerated.

  19. Interferon-gamma increased epithelial barrier function via upregulating claudin-7 expression in human submandibular gland duct epithelium.

    PubMed

    Abe, Ayumi; Takano, Kenichi; Kojima, Takashi; Nomura, Kazuaki; Kakuki, Takuya; Kaneko, Yakuto; Yamamoto, Motohisa; Takahashi, Hiroki; Himi, Tetsuo

    2016-06-01

    Tight junctions (TJs) are necessary for salivary gland function and may serve as indicators of salivary gland epithelial dysfunction. IgG4-related disease (IgG4-RD) is a newly recognized fibro-inflammatory condition which disrupts the TJ associated epithelial barrier. The salivary glands are one of the most frequently involved organs in IgG4-RD, however, changes of the TJ associated epithelial barrier in salivary gland duct epithelium is poorly understood. Here, we investigated the regulation and function of TJs in human submandibular gland ductal epithelial cells (HSDECs) in normal and IgG4-RD. We examined submandibular gland (SMG) tissue from eight control individuals and 22 patients with IgG4-RD and established an HSDEC culture system. Immunohistochemistry, immunocytochemistry, western blotting, and measurement of transepithelial electrical resistance (TER) were performed. Claudin-4, claudin-7, occludin, and JAM-A were expressed at the apical side of the duct epithelium in submandibular gland (SMG) tissue and at the cell borders in HSDECs of normal and IgG4-RD. The expression and distribution of TJs in SMG tissue were not different in control individuals and patients with IgG4-RD in vivo and in vitro. Although interferon-gamma (IFNγ) generally disrupts the integrity and function of TJs, as manifested by decreased epithelial barrier function, IFNγ markedly increased the epithelial barrier function of HSDECs via upregulation of claudin-7 expression in HSDECs from patients with IgG4-RD. This is the first report showing an IFNγ-dependent increase in epithelial barrier function in the salivary gland duct epithelium. Our results provide insights into the functional significance of TJs in salivary gland duct epithelium in physiological and pathological conditions, including IgG4-RD.

  20. Ionizing radiation potentiates the induction of nitric oxide synthase by interferon-gamma (Ifn-gamma) or Ifn-gamma and lipopolysaccharide in bnl cl.2 murine embryonic liver cells: role of hydrogen peroxide.

    PubMed

    Yoo, J C; Pae, H O; Choi, B M; Kim, W I; Kim, J D; Kim, Y M; Chung, H T

    2000-02-01

    The effects of ionizing irradiation on the nitric oxide (NO) production in murine embryonic liver cell line, BNL CL.2 cells, were investigated. Various doses (5-40 Gy) of radiation made BNL CL.2 cells responsive to interferon-gamma alone for the production of NO in a dose-dependent manner. Small amounts of lipopolysaccharide (LPS) or tumor necrosis factor-alpha (TNF-alpha) synergized with IFN-gamma in the production of NO from irradiated BNL CL.2 cells, even though LPS or TNF-alpha alone did not induce NO production from the same cells. Immunoblots showed parallel induction of inducible nitric oxide synthase (iNOS). NO production in irradiated BNL CL.2 cells by IFN-gamma or IFN-gamma plus LPS was decreased by the addition of catalase, suggesting that H(2)O(2) produced by ionizing irradiation primed the cells to trigger NO production in response to IFN-gamma or IFN-gamma plus LPS. Furthermore, the treatment of nongamma-irradiated BNL CL.2 cells with H(2)O(2) made the cells responsive to IFN-gamma or IFN-gamma plus LPS for the production of NO. This study shows that ionizing irradiation has the ability to induce iNOS gene expression in responsive to IFN-gamma via the formation of H(2)O(2) in BNL CL.2 murine embryonic liver cells.

  1. Enhancement of antiproliferative activity of interferons by RNA interference-mediated silencing of SOCS gene expression in tumor cells.

    PubMed

    Takahashi, Yuki; Kaneda, Haruka; Takasuka, Nana; Hattori, Kayoko; Nishikawa, Makiya; Watanabe, Yoshihiko; Takakura, Yoshinobu

    2008-08-01

    The suppressor of cytokine signaling (SOCS) proteins, negative regulators of interferon (IFN)-induced signaling pathways, is involved in IFN resistance of tumor cells. To improve the growth inhibitory effect of IFN-beta and IFN-gamma on a murine melanoma cell line, B16-BL6, and a murine colon carcinoma cell line, Colon26 cells, SOCS-1 and SOCS-3 gene expression in tumor cells was downregulated by transfection of plasmid DNA expressing short hairpin RNA targeting one of these genes (pshSOCS-1 and pshSOCS-3, respectively). Transfection of pshSOCS-1 significantly increased the antiproliferative effect of IFN-gamma on B16-BL6 cells. However, any other combinations of plasmids and IFN had little effect on the growth of B16-BL6 cells. In addition, transfection of pshSOCS-1 and pshSOCS-3 produced little improvement in the effect of IFN on Colon26 cells. To understand the mechanism underlining these findings, the level of SOCS gene expression was measured by real time polymerase chain reaction. Addition of IFN-gamma greatly increased the SOCS-1 mRNA expression in B16-BL6 cells. Taking into account the synergistic effect of pshSOCS-1 and IFN-gamma on the growth of B16-BL6 cells, these findings suggest that IFN-gamma-induced high SOCS-1 gene expression in B16-BL6 cells significantly interferes with the antiproliferative effect of IFN-gamma. These results indicate that silencing SOCS gene expression can be an effective strategy to enhance the antitumor effect of IFN under conditions in which the SOCS gene expression is upregulated by IFN.

  2. Interferon-Gamma Promotes UV-Induced Melanoma in Mice | Center for Cancer Research

    Cancer.gov

    Scientists have made an unanticipated discovery in mice that interferon-gamma, a type of protein primarily used by the immune system for intercellular communication, acts as a promoter for the deadly form of skin cancer known as melanoma. This finding resulted from a series of experiments designed to understand how solar ultraviolet (UV) radiation causes melanoma. This study

  3. Annexin V Incorporated into Influenza Virus Particles Inhibits Gamma Interferon Signaling and Promotes Viral Replication

    PubMed Central

    Berri, Fatma; Haffar, Ghina; Lê, Vuong Ba; Sadewasser, Anne; Paki, Katharina; Lina, Bruno; Wolff, Thorsten

    2014-01-01

    ABSTRACT During the budding process, influenza A viruses (IAVs) incorporate multiple host cell membrane proteins. However, for most of them, their significance in viral morphogenesis and infectivity remains unknown. We demonstrate here that the expression of annexin V (A5) is upregulated at the cell surface upon IAV infection and that a substantial proportion of the protein is present in lipid rafts, the site of virus budding. Western blotting and immunogold analysis of highly purified IAV particles showed the presence of A5 in the virion. Significantly, gamma interferon (IFN-γ)-induced Stat phosphorylation and IFN-γ-induced 10-kDa protein (IP-10) production in macrophage-derived THP-1 cells was inhibited by purified IAV particles. Disruption of the IFN-γ signaling pathway was A5 dependent since downregulation of its expression or its blockage reversed the inhibition and resulted in decreased viral replication in vitro. The functional significance of these results was also observed in vivo. Thus, IAVs can subvert the IFN-γ antiviral immune response by incorporating A5 into their envelope during the budding process. IMPORTANCE Many enveloped viruses, including influenza A viruses, bud from the plasma membrane of their host cells and incorporate cellular surface proteins into viral particles. However, for the vast majority of these proteins, only the observation of their incorporation has been reported. We demonstrate here that the host protein annexin V is specifically incorporated into influenza virus particles during the budding process. Importantly, we showed that packaged annexin V counteracted the antiviral activity of gamma interferon in vitro and in vivo. Thus, these results showed that annexin V incorporated in the viral envelope of influenza viruses allow viral escape from immune surveillance. Understanding the role of host incorporated protein into virions may reveal how enveloped RNA viruses hijack the host cell machinery for their own purposes. PMID

  4. Structural analysis and localization of the carbohydrate moieties of a soluble human interferon gamma receptor produced in baculovirus-infected insect cells.

    PubMed Central

    Manneberg, M.; Friedlein, A.; Kurth, H.; Lahm, H. W.; Fountoulakis, M.

    1994-01-01

    A soluble form of the human interferon gamma receptor that is required for the identification of interferon gamma antagonists was expressed in baculovirus-infected insect cells. The protein carried N-linked carbohydrate and showed a heterogeneity on denaturing polyacrylamide gels. We investigated the utilization of the potential sites for N-linked glycosylation and the structure of the carbohydrate moieties of this soluble receptor. Amino acid sequence analysis and ion spray mass spectrometry revealed that of the five potential sites for N-linked glycosylation, Asn17 and Asn69 were always utilized, whereas Asn62 and Asn162 were utilized in approximately one-third of the protein population. Asn223 was never found to be glycosylated. The soluble receptor was treated with N-glycosidase F and the oligosaccharides released were analyzed by matrix-assisted laser desorption mass spectrometry, which showed that the protein carried six types of short carbohydrate chains. The predominant species was a hexasaccharide of molecular mass 1,039, containing a fucose subunit linked to the proximal N-acetylglucosamine residue: [formula: see text] PMID:8142896

  5. Double-blind trial of recombinant gamma-interferon versus placebo in the treatment of rheumatoid arthritis. 1989.

    PubMed

    Cannon, Grant W; Pincus, Seth H; Emkey, Ronald D; Denes, Alex; Cohen, Selwyn A; Wolfe, Frederick; Saway, P Anthony; Jaffer, Adrian M; Weaver, Arthur L; Cogen, Lewis; Schindler, John D

    2008-02-01

    One hundred five patients were enrolled in a 12-week, randomized, prospective, double-blind, placebo-controlled trial of recombinant human gamma-interferon (rHu gamma-IFN) for the treatment of rheumatoid arthritis. Fifty-four patients received rHu gamma-IFN and 51 received placebo. Forty-two patients in each group completed the 12-week trial. Some clinical improvement occurred in both groups of patients. Although the improvement with rHu gamma-IFN was greater than that with placebo, the differences were generally not statistically significant.

  6. Enhanced gamma interferon responses of mouse spleen cells following immunotherapy for tuberculosis relapse.

    PubMed

    Gil, Olga; Vilaplana, Cristina; Guirado, Evelyn; Díaz, Jorge; Cáceres, Neus; Singh, Mahavir; Cardona, Pere-Joan

    2008-11-01

    Gamma interferon responses of spleen cells in mice were examined during postchemotherapy relapse of intraperitoneally induced latent tuberculous infection. The mycobacterial extract RUTI, which prevented the relapse, significantly enhanced the immune responses to secreted and structural recombinant mycobacterial antigens, suggesting that RUTI-mediated protection was mediated by activated T cells.

  7. Role of gamma interferon in a neonatal mouse model of group B streptococcal disease.

    PubMed Central

    Cusumano, V; Mancuso, G; Genovese, F; Delfino, D; Beninati, C; Losi, E; Teti, G

    1996-01-01

    The aim of this study was to assess the role of gamma interferon (IFN-gamma) in a neonatal mouse model of group B streptococcal (GBS) sepsis. IFN-gamma was produced by spleen cells at 24, 48, and 72 h after GBS challenge. Treatment with anti-IFN-gamma at 6 h before challenge totally abrogated the IFN-gamma response but did not affect survival. Subcutaneous administration of recombinant IFN-gamma (2,500 IU per pup) at 18 h after challenge resulted in increased survival time and reduced blood colony counts at 48 and 72 h. In vitro preincubation of neonatal whole blood with IFN-gamma before the addition of GBS resulted in significant restriction of bacterial growth. These data indicate that administration of recombinant IFN-gamma can partially restore impaired host defenses against GBS in neonatal mice. This cytokine may be useful for the treatment of neonatal infections. PMID:8757817

  8. Interferon-gamma alone triggers the production of nitric oxide from serum-starved BNL CL.2, murine embryonic liver cells.

    PubMed

    Pae, H O; Yoo, J C; Choi, B M; Paik, S G; Kim, Y H; Jin, H S; Chung, H T

    1999-01-01

    A previous study has demonstrated that both interferon-gamma (IFN-gamma) and lipopolysaccharide (LPS) were needed to induce the production of nitric oxide (NO) in BNL CL.2 cells, murine embryonic liver cells. We here demonstrate that when BNL CL.2 cells were cultured with serum-free medium, they were induced to produce NO by the stimulation of IFN-gamma alone. BNL CL.2 cells were cultured with serum-free or serum-containing medium for 1-3 days and then stimulated to synthesize NO by IFN-gamma. Surprisingly, only serum-starved cells showed significant amount of nitrite accumulation and iNOS protein expression in response to IFN-gamma in dose- and time-dependent manners, but serum-supplied cells did not. When the cells were stimulated with IFN-gamma, tumor necrosis factor-alpha (TNF-alpha), or LPS in combinations, only the combination of IFN-gamma and LPS produced more NO than that produced by IFN-gamma alone. The production of NO by the cells stimulated with IFN-gamma or IFN-gamma plus LPS was blocked by the addition of N(G)-monomethyl-L-arginine (N(G)MMA), a NO synthesis inhibitor. To address the intracellular signal pathway responsible for the production of NO by the cells stimulated with IFN-gamma aloneor IFN-gamma plus LPS, we examined the effects of several protein kinase inhibitors on the production of NO from the cells. The production of NO was significantly inhibited by protein tyrosine kinase (PTK) inhibitors, genistein and herbimycin A, but not by protein kinase A or C inhibitors. These results suggest that the deprivation of serum from BNL CL.2 cell culture medium might prime the cells to induce NO synthesis when the cells are triggered by IFN-gamma and the involvement of PTK signal transduction pathway in the expression of inducible NO synthase gene in murine hepatoma cells.

  9. Monoclonal antibody against interferon gamma can prevent experimental cerebral malaria and its associated overproduction of tumor necrosis factor.

    PubMed Central

    Grau, G E; Heremans, H; Piguet, P F; Pointaire, P; Lambert, P H; Billiau, A; Vassalli, P

    1989-01-01

    Experimental cerebral malaria (ECM), a lethal hyperacute neurological syndrome associated with high blood levels of tumor necrosis factor, develops in genetically susceptible (CBA/Ca) mice 7 days after infection with Plasmodium berghei ANKA strain. Injections of neutralizing monoclonal antibody against recombinant murine interferon gamma, not later than 4 days after infection, markedly reduced the incidence of ECM and the elevation in serum levels of tumor necrosis factor. This treatment prevented the cerebral lesions (plugging of brain vessels by monocytes, lymphocytes, and parasitized erythrocytes). In contrast, the extent of macrophage infiltration in lymphoid organs (which is a characteristic feature of mice developing ECM), as well as the course of infection, remained unaffected by the antibody treatment. Protected mice died at a later time of severe anemia and overwhelming parasitemia, the usual outcome of P. berghei infection in mice that are not susceptible to ECM. The present data indicate that interferon gamma constitutes an important link in the cytokine network that leads to brain vessel inflammation in experimental malaria. It is proposed that interferon gamma released by activated CD4+ T cells acts by augmenting both production and action of tumor necrosis factor. PMID:2501793

  10. Complementation of a mutant cell line: central role of the 91 kDa polypeptide of ISGF3 in the interferon-alpha and -gamma signal transduction pathways.

    PubMed Central

    Müller, M; Laxton, C; Briscoe, J; Schindler, C; Improta, T; Darnell, J E; Stark, G R; Kerr, I M

    1993-01-01

    Mutants in complementation group U3, completely defective in the response of all genes tested to interferons (IFNs) alpha and gamma, do not express the 91 and 84 kDa polypeptide components of interferon-stimulated gene factor 3 (ISGF3), a transcription factor known to play a primary role in the IFN-alpha response pathway. The 91 and 84 kDa polypeptides are products of a single gene. They result from differential splicing and differ only in a 38 amino acid extension at the C-terminus of the 91 kDa polypeptide. Complementation of U3 mutants with cDNA constructs expressing the 91 kDa product at levels comparable to those observed in induced wild-type cells completely restored the response to both IFN-alpha and -gamma and the ability to form ISGF3. Complementation with the 84 kDa component similarly restored the ability to form ISGF3 and, albeit to a lower level, the IFN-alpha response of all genes tested so far. It failed, however, to restore the IFN-gamma response of any gene analysed. The precise nature of the DNA motifs and combination of factors required for the transcriptional response of all genes inducible by IFN-alpha and -gamma remains to be established. The results presented here, however, emphasize the apparent general requirement of the 91 kDa polypeptide in the primary transcriptional response to both types of IFN. Images PMID:7693454

  11. Immunomodulatory intervention with Gamma interferon in mice with sepsis.

    PubMed

    Wang, Yu; Kong, Bing-Bing; Yang, Wen-Ping; Zhao, Xin; Zhang, Rong

    2017-09-15

    Sepsis-triggered immune paralysis including T-cell dysfunction increase susceptibility to infection. Gamma interferon (IFNg) exert beneficial effects in patients with sepsis. Herein, we speculated that IFNg may attenuate T-cell dysfunction induced by sepsis, although the mechanisms remain elusive. To test this hypothesis, we used a model based on cecal ligation and puncture (CLP) to induce sepsis in mice. Male C57BL/6 mice were pretreated with recombinant human IFNg (0.01μg/g of body weight) before CLP. The immunophenotyping of cell surface receptor expression, and regulatory T cells (CD4+CD25+Foxp3+) were quantified by flow cytometry. Immunohistochemical staining was performed to evaluate the loss of immune effector cells. Formation of IFNg and interleukin 4 (IL-4) in the spleen and plasma levels of TNF-α, IL-6, high-mobility group box 1 (HMGB1) were determined using enzyme-linked immunosorbent assay. IFNg markedly inhibited the reduction in cytokine secretion from lipopolysaccharide (LPS)-stimulated splenocytes. IFNg-treated mices had significantly decreased percentages of programmed cell death 1 (PD-1) receptors, increased the percentages of positive costimulatory receptor CD28 on CD4 T cells expressing. IFNg markedly reduced T-cell apoptosis through upregulating the expression of Bcl-2. CLP-induced formation of regulatory T cells in the spleen was abolished in IFNg -treated mices. Moreover, IFNg treatment reduced plasma levels of TNF-α, IL-6, HMGB1. IFNg can be a powerful regulator of immune function under sepsis conditions. Therefore, targeted immune-enhancement with IFNg may be a valid therapeutic approach in sepsis. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Downregulation of Interleukin-18-Mediated Cell Signaling and Interferon Gamma Expression by the Hepatitis B Virus e Antigen

    PubMed Central

    Jegaskanda, S.; Ahn, S. H.; Skinner, N.; Thompson, A. J.; Ngyuen, T.; Holmes, J.; De Rose, R.; Navis, M.; Winnall, W. R.; Kramski, M.; Bernardi, G.; Bayliss, J.; Colledge, D.; Sozzi, V.; Visvanathan, K.; Locarnini, S. A.; Kent, S. J.

    2014-01-01

    ABSTRACT The mechanisms by which hepatitis B virus (HBV) establishes and maintains chronic hepatitis B infection (CHB) are poorly defined. Innate immune responses play an important role in reducing HBV replication and pathogenesis. HBV has developed numerous mechanisms to escape these responses, including the production of the secreted hepatitis B e antigen (HBeAg), which has been shown to regulate antiviral toll-like receptor (TLR) and interleukin-1 (IL-1) signaling. IL-18 is a related cytokine that inhibits HBV replication in hepatoma cell lines and in the liver through the induction of gamma interferon (IFN-γ) by NK cells and T cells. We hypothesized that HBV or HBV proteins inhibit IFN-γ expression by NK cells as an accessory immunomodulatory function. We show that HBeAg protein inhibits the NF-κB pathway and thereby downregulates NK cell IFN-γ expression. Additionally, IFN-γ expression was significantly inhibited by exposure to serum from individuals with HBeAg-positive but not HBeAg-negative chronic HBV infection. Further, we show that the HBeAg protein suppresses IL-18-mediated NF-κB signaling in NK and hepatoma cells via modulation of the NF-κB pathway. Together, these findings show that the HBeAg inhibits IL-18 signaling and IFN-γ expression, which may play an important role in the establishment and/or maintenance of persistent HBV infection. IMPORTANCE It is becoming increasingly apparent that NK cells play a role in the establishment and/or maintenance of chronic hepatitis B infection. The secreted HBeAg is an important regulator of innate and adaptive immune responses. We now show that the HBeAg downregulates NK cell-mediated IFN-γ production and IL-18 signaling, which may contribute to the establishment of infection and/or viral persistence. Our findings build on previous studies showing that the HBeAg also suppresses the TLR and IL-1 signaling pathways, suggesting that this viral protein is a key regulator of antiviral innate immune responses

  13. Interferon-gamma: biologic functions and HCV therapy (type I/II) (1 of 2 parts).

    PubMed

    Gattoni, A; Parlato, A; Vangieri, B; Bresciani, M; Derna, R

    2006-01-01

    This review is aimed at exhaustively presenting and discussing the interferon-gamma (IFN-gamma), a cytokine that plays an important role in inducing and modulating an array of immune responses. A review of the most significant and recent clinical trials was performed. Although IFN-gamma has some antiviral activity, it is much less active in this regard than type I IFNs. IFN-gamma is involved in the regulation of nearly all phases of the immune and inflammatory responses, including the activation and differentiation of T cells, B cells, NK cells, macrophages, and others. It is therefore best regarded as a distint immunoregulatory cytokine. IFN-gamma secretion is a hallmark of Th1 lymphocytes. It is also secreted by nearly all CD8 T cells, by some Th0 cells, and by NK cells. Each of these cell types secretes IFN-gamma only when activated, usually as part of immune response and especially in response to IL-2 and IL-12. IFN-gamma production is inhibited by IL-4, IL-10, TGFbeta, glucocorticoids, cyclosporin A and FK506. Nearly all cell types express the heterodimeric receptor for IFN-beta and respond to this cytokine by increasing the surface expression of class I MHC proteins. As a result, virtually any cell in the vicinity of an IFN-beta-secreting cell becomes more efficient at presenting endogenous antigens and hence a better target for cytotoxic killing if it harbors an intracellular pathogen. Unlike the type I IFNs, IFN-gamma also increases the expression of class II MHC proteins on professional APCs, and so promotes antigen presentation to helper T cells as well. It also induces de novo expression of class II MHC proteins on venular endothelial cells and on some other epithelial and connective tissue cells that do not otherwise express them, thus enabling these cell types to function as temporary APCs at sites of intense immune reactions. The effector functions of NK cells are to lyse virus-infected cells and to secrete IFN-gamma, which activates macrofages to

  14. Disseminated Penicilliosis, Recurrent Bacteremic Nontyphoidal Salmonellosis, and Burkholderiosis Associated with Acquired Immunodeficiency Due to Autoantibody against Gamma Interferon

    PubMed Central

    Tang, Bone Siu-Fai; Chan, Jasper Fuk-Woo; Chen, Min; Tsang, Owen Tak-Yin; Mok, M. Y.; Lai, Raymond Wai-Man; Lee, Rodney; Que, Tak-Lun; Tse, Herman; Li, Iris Wai-Sum; To, Kelvin Kai-Wang; Cheng, Vincent Chi-Chung; Chan, Eric Yuk-Tat; Zheng, Bojian; Yuen, Kwok-Yung

    2010-01-01

    Acquired immunodeficiency due to autoantibody against gamma interferon has recently been associated with opportunistic nontuberculous mycobacteriosis, especially among Southeast Asians. We report another 8 cases, all except one apparently immunocompetent hosts who suffered from concomitant or sequential infections by other intracellular pathogens causing penicilliosis, extraintestinal nontyphoidal salmonellosis, and burkholderiosis. The only case with an underlying immunodeficiency syndrome had systemic lupus erythematosus that was quiescent throughout the multiple infective episodes. Eight out of 10 (80.0%) patients with serological evidence of penicilliosis, 5 out of 7 (71.4%) with culture-positive extraintestinal nontyphoidal salmonellosis, 5 out of 28 (17.9%) with serological evidence of melioidosis, and 7 out of 13 (53.8%) with culture-positive nontuberculous mycobacteriosis possessed autoantibody against gamma interferon, whereas only 1 out of 100 patients with systemic lupus erythematosus did. Our study represents the first and largest case series linking this emerging immunodeficiency syndrome with these atypical infections in apparently immunocompetent hosts. Thus, we advocate that any patient with unexplained recurrent or polymicrobial infections due to these intracellular pathogens should be screened for acquired immunodeficiency due to autoantibody against gamma interferon. PMID:20445006

  15. Application of genetically engineered Salmonella typhimurium for interferon-gamma-induced therapy against melanoma.

    PubMed

    Yoon, Wonsuck; Park, Yoo Chang; Kim, Jinseok; Chae, Yang Seok; Byeon, Jung Hye; Min, Sang-Hyun; Park, Sungha; Yoo, Young; Park, Yong Keun; Kim, Byeong Mo

    2017-01-01

    Salmonella have been experimentally used as anti-cancer agents, because they show selective growth in tumours. In this study, we genetically modified attenuated Salmonella typhimurium to express and secrete interferon-gamma (IFN-γ) as a tumouricidal agent to enhance the therapeutic efficacy of Salmonella. IFN-γ was fused to the N-terminal region (residues 1-160) of SipB (SipB160) for secretion from bacterial cells. Attenuated S. typhimurium expressing recombinant IFN-γ (S. typhimurium (IFN-γ)) invaded the melanoma cells and induced cytotoxicity. Subcutaneous administration of S. typhimurium (IFN-γ) also efficiently inhibited tumour growth and prolonged the survival of C57BL/6 mice bearing B16F10 melanoma compared with administration of phosphate-buffered saline (PBS), unmodified S. typhimurium or S. typhimurium expressing empty vector (S. typhimurium [Vec]) in a natural killer (NK) cell-dependent manner. Moreover, genetically modified Salmonella, including S. typhimurium (IFN-γ), showed little toxicity to normal tissues with no observable adverse effects. However, S. typhimurium (IFN-γ)-mediated tumour suppression was attributed to direct killing of tumour cells rather than to stable anti-tumour immunity. Collectively, these results suggest that tumour-targeted therapy using S. typhimurium (IFN-γ) has potential for melanoma treatment. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Utility of an interferon-gamma release assay for latent tuberculosis diagnosis in a case of bullous pemphigoid.

    PubMed

    Goodfellow, Alfred; Keeling, Douglas N; Hayes, Robert C; Webster, Duncan

    2009-01-01

    With increasing use of immunosuppressive therapy, including tumor necrosis factor alpha inhibitors, there is concern about infectious complications, including reactivation of latent Mycobacterium tuberculosis infection. Routine testing prior to administration of systemic immunosuppression includes the tuberculin skin test, which lacks sensitivity and specificity and may be difficult to interpret in the presence of extensive cutaneous disease. Treatment of individuals with latent tuberculosis infection is recommended when immunosuppressive medications are to be employed. We report a case in which a diagnosis of latent tuberculosis infection in a patient with extensive bullous pemphigoid was clarified by the use of an interferon-gamma release assay after equivocal tuberculin skin test results. Interferon-gamma release assays are useful adjuncts to the tuberculin skin test in the diagnosis of latent tuberculosis infection in the setting of extensive cutaneous disease.

  17. [Aerosolized recombinant interferon-gamma prevent antigen-induced eosinophil recruitment in guinea pig trachea].

    PubMed

    Gao, Y; Chenping; Lin, X P

    1997-10-01

    In order to determine whether interferon-gamma (IFN-gamma) inhibits eosinphil infiltration in the trachea of asthmatic guinea pigs induced by Rhizopus nigricans. We had administered aerosolized rIFN-gamma in the tracheas of 30 sensitized guinea pigs which had been divided into six groups, then teated animal inhaled rIFN-gamma of 5 x 10(4), 20 x 10(4), and 40 x 10(4) concentration, BDP and normal saline respectively at 24 h, 12 h, 2 h before being challenged. (1) Provocation positive rates decreased in 40 x 10(4) rIFN-gamma and BDP group compared with that in normal saline group and before intervention (P < 0.05), airway resistence decreased (P < 0.01). (2) The administration of aerosolized rIFN-gamma (40 x 10(4)) and BDP also decreased fungus-induced eosnophils but not other cells infiltration in the trachea. (3) In BALF, Eos count and ECP level were obviously lower than those in other groups. However, eosinophil numbers did not show significant change in the peripheral blood. Local administration of rIFN-gamma (40 x 10(4)) may reduce airway inflammation and intervene asthmatic attack by inhibition of Eos, ECP infiltration in airways.

  18. Development of an aptamer beacon for detection of interferon-gamma.

    PubMed

    Tuleuova, Nazgul; Jones, Caroline N; Yan, Jun; Ramanculov, Erlan; Yokobayashi, Yohei; Revzin, Alexander

    2010-03-01

    Traditional antibody-based affinity sensing strategies employ multiple reagents and washing steps and are unsuitable for real-time detection of analyte binding. Aptamers, on the other hand, may be designed to monitor binding events directly, in real-time, without the need for secondary labels. The goal of the present study was to design an aptamer beacon for fluorescence resonance energy transfer (FRET)-based detection of interferon-gamma (IFN-gamma)--an important inflammatory cytokine. Variants of DNA aptamer modified with biotin moieties and spacers were immobilized on avidin-coated surfaces and characterized by surface plasmon resonance (SPR). The SPR studies showed that immobilization of aptamer via the 3' end resulted in the best binding IFN-gamma (K(d) = 3.44 nM). This optimal aptamer variant was then used to construct a beacon by hybridizing fluorophore-labeled aptamer with an antisense oligonucleotide strand carrying a quencher. SPR studies revealed that IFN-gamma binding with an aptamer beacon occurred within 15 min of analyte introduction--suggesting dynamic replacement of the quencher-complementary strand by IFN-gamma molecules. To further highlight biosensing applications, aptamer beacon molecules were immobilized inside microfluidic channels and challenged with varying concentration of analyte. Fluorescence microscopy revealed low fluorescence in the absence of analyte and high fluorescence after introduction of IFN-gamma. Importantly, unlike traditional antibody-based immunoassays, the signal was observed directly upon binding of analyte without the need for multiple washing steps. The surface immobilized aptamer beacon had a linear range from 5 to 100 nM and a lower limit of detection of 5 nM IFN-gamma. In conclusion, we designed a FRET-based aptamer beacon for monitoring of an inflammatory cytokine-IFN-gamma. In the future, this biosensing strategy will be employed to monitor dynamics of cytokine production by the immune cells.

  19. Effect of gamma interferon on lung function of mustard gas exposed patients, after 15 years.

    PubMed

    Ghanei, Mostafa; Panahi, Yoones; Mojtahedzadeh, Mojtaba; Khalili, Ali Reza Hosseini; Aslani, Jafar

    2006-01-01

    Bronchiolitis has been known to be among the main the pathological features of lung lesions in Mustard Gas (MG) exposed patients. The purpose of this research was to evaluate the efficacy of interferon gamma-1b on the lung function in MG exposed patients with bronchiolitis. Thirty-six bronchiolitis patients, whose lung lesion had been diagnosed through High Resolution Computerized Tomography (HRCT) of the chest and also pathological study, were divided into two 18-member case and control groups. Both groups were receiving their conventional treatment (inhaled Felixotide and Servent). The case group were treated for 6 months with a combination of 200 microg of interferon gamma-1b (given three times per week subcutaneously) plus 7.5 mg of prednisolone (given once a day), while the control group received their previous conventional medications. Lung function was measured at base line and after 1, 3 and 6 months of treatment. In case and control groups, Forced Expiratory Volume in first second (FEV1) did not have statistical differences at the base line (49.3 +/- 2.9 and 48.7 +/- 4.1, respectively = 0.6), whereas a significant increase was seen in the case group (66.3 +/- 5.4) compared control group (57.3 +/- 8.6) at the subsequent months (P = 0.001 for the difference between the groups). Similar pattern of increase was observed in Forced Vital Capacity (FVC). The findings of this study indicate that a 6-month treatment with interferon gamma-1b plus a low-dose prednisolone is associated with an improvement in the lung function in mustard-gas exposed patients with bronchiolitis.

  20. Inhibition by antioxidants of nitric oxide synthase expression in murine macrophages: role of nuclear factor kappa B and interferon regulatory factor 1.

    PubMed Central

    Hecker, M.; Preiss, C.; Klemm, P.; Busse, R.

    1996-01-01

    1. In view of the potential deleterious effects of high amounts of nitric oxide (NO) produced by the inducible isoform of NO synthase (iNOS) in inflammation, the prevention of the expression of this enzyme represents an important therapeutic goal. In cytokine-stimulated cells, activation of nuclear factor kappa B (NF-kappa B) is crucial for the increase in iNOS gene expression. Since NF-kappa B activation appears to involve a redox-sensitive step, we have investigated whether three structurally unrelated antioxidants, 5,7-dihydroxyflavone (chrysin), 3,4-dichloroisocoumarin (DCI) and N-acetyl 5-hydroxytryptamine (N-acetylserotonin, NAS), affect iNOS expression in cultured RAW 264.7 monocyte/macrophages stimulated with bacterial lipopolysaccharide (LPS, 140 ng ml-1) and interferon-gamma (IFN gamma, 5 u ml-1). 2. During a 6 h incubation period neither LPS nor IFN gamma alone exerted a significant effect but when combined, caused a prominent increase in nitrite formation, iNOS mRNA and protein abundance. Co-incubation with chrysin (50 microM), DCI (50 microM) or NAS (1 mM) markedly attenuated this increase in iNOS gene expression. 3. DCI, but not chrysin or NAS, prevented the activation of NF-kappa B in cells exposed to LPS plus IFN gamma for 30 min. In contrast, all three antioxidants significantly blunted the DNA-binding activity of interferon regulatory factor 1 (IRF-1), which mediates the synergistic effect of IFN gamma on iNOS gene expression in cells treated for 2 h with LPS plus IFN gamma. 4. DCI thus appears to inhibit iNOS gene expression at the transcriptional level by preventing the activation of both NF-kappa B and IRF-1. The inhibitory effect of DCI on NF-kappa B activation, however, does not seem to be related to its antioxidative properties, since DCI, unlike chrysin or NAS, is a potent serine protease inhibitor which stabilizes the inactive NF-kappa B complex by protecting the inhibitory I kappa B-alpha subunit from proteolytic degradation. 5. The

  1. Interleukin-4 but not gamma interferon production correlates with the severity of murine cutaneous leishmaniasis.

    PubMed Central

    Morris, L; Troutt, A B; McLeod, K S; Kelso, A; Handman, E; Aebischer, T

    1993-01-01

    For murine cutaneous leishmaniasis, data to date suggest a correlation between the presence of gamma interferon (IFN-gamma) and resistance in C57BL/6 mice and the presence of interleukin-4 (IL-4) and disease in BALB/c mice. In this study, 13 inbred strains of mice covering the range of susceptibility to disease were infected with Leishmania major to determine whether the subsequent expression of IFN-gamma or IL-4 is a reliable indicator of cure or progressive disease. The presence of IL-4 and IFN-gamma mRNAs in the draining lymph nodes was examined 9 weeks after infection, when differences in disease severity became obvious. There were large differences in the levels of IL-4 mRNA among the different strains, whereas IFN-gamma mRNA was detected at similar levels in all strains. The levels of IL-4 mRNA correlated with lesion score, with susceptible and intermediate strains containing up to 100-fold more than any of the resistant strains. Differences in the levels of IFN-gamma mRNA were within only a fourfold range, with significant overlap among susceptible, intermediate, and resistant strains. Similarly, the levels of IFN-gamma secreted in vitro by lymph node cells from infected mice in response to L. major antigens were within a 10-fold range for most strains, and there was no correlation with lesion score. Analysis of Leishmania-specific antibody levels revealed a correlation between immunoglobulin G1 (IgG1) titers and lesion score, consistent with the role of IL-4 as a switch factor for IgG1. In contrast, there was no correlation between IgG2a titers and lesion score, supporting the notion that IFN-gamma synthesis (which promotes IgG2a production) is not correlated with disease state. These data suggest that along the spectrum of murine cutaneous leishmaniasis, IL-4 is a reliable indicator of disease, but IFN-gamma is not prognostic for resistance. Images PMID:8335376

  2. STING-Dependent Interferon-λ1 Induction in HT29 Cells, a Human Colorectal Cancer Cell Line, After Gamma-Radiation.

    PubMed

    Chen, Jianzhou; Markelc, Bostjan; Kaeppler, Jakob; Ogundipe, Vivian M L; Cao, Yunhong; McKenna, W Gillies; Muschel, Ruth J

    2018-05-01

    To investigate the induction of type III interferons (IFNs) in human cancer cells by gamma-rays. Type III IFN expression in human cancer cell lines after gamma-ray irradiation in vitro was assessed by reverse transcription-quantitative polymerase chain reaction and enzyme-linked immunosorbent assay. Signaling pathways mediating type III IFN induction were examined by a variety of means, including immunoblotting, flow cytometry, confocal imaging, and reverse transcription-quantitative polymerase chain reaction. Key mediators in these pathways were further explored and validated using gene CRISPR knockout or short hairpin RNA knockdown. Exposure to gamma-rays directly induced type III IFNs (mainly IFNL1) in human cancer cell lines in dose- and time-dependent fashions. The induction of IFNL1 was primarily mediated by the cytosolic DNA sensors-STING-TBK1-IRF1 signaling axis, with a lesser contribution from the nuclear factor kappa b signaling in HT29 cells. In addition, type III IFN signaling through its receptors serves as a positive feedback loop, further enhancing IFN expression via up-regulation of the kinases in the STING-TBK1 signaling axis. Our results suggest that IFNL1 can be up-regulated in human cancer cell lines after gamma-ray treatment. In HT29 cells this induction occurs via the STING pathway, adding another layer of complexity to the understanding of radiation-induced antitumor immunity, and may provide novel insights into IFN-based cancer treatment. Copyright © 2018 Elsevier Inc. All rights reserved.

  3. Gene expression and production of tumor necrosis factor alpha, interleukin 1, interleukin 6, and gamma interferon in C3H/HeN and C57BL/6N mice in acute Mycoplasma pulmonis disease.

    PubMed Central

    Faulkner, C B; Simecka, J W; Davidson, M K; Davis, J K; Schoeb, T R; Lindsey, J R; Everson, M P

    1995-01-01

    Studies were conducted to determine whether the production of various cytokines is associated with Mycoplasma pulmonis disease expression. Susceptible C3H/HeN and resistant C57BL/6N mice were inoculated intranasally with 10(7) CFU of virulent M. pulmonis UAB CT or avirulent M. pulmonis UAB T. Expression of genes for tumor necrosis factor alpha (TNF-alpha), interleukin 1 alpha (IL-1 alpha), IL-1 beta, IL-6, and gamma interferon (IFN-gamma) in whole lung tissue and TNF-alpha gene expression in bronchoalveolar lavage (BAL) cells was determined by reverse transcription-PCR using specific cytokine primers at various times postinoculation. In addition, concentrations of TNF-alpha, IL-1, IL-6, and IFN-gamma were determined in BAL fluid and serum samples at various times postinoculation. Our results showed that there was a sequential appearance of cytokines in the lungs of infected mice: TNF-alpha, produced primarily by BAL cells, appeared first, followed by IL-1 and IL-6, which were followed by IFN-gamma. Susceptible C3H/HeN mice had higher and more persistent concentrations of TNF-alpha and IL-6 in BAL fluid than did resistant C57BL/6N mice, indicating that TNF-alpha and possibly IL-6 are important factors in pathogenesis of acute M. pulmonis disease in mice. Serum concentrations of IL-6 were elevated in C3H/HeN mice, but not C57BL/6N mice, following infection with M. pulmonis, suggesting that IL-6 has both local and systemic effects in M. pulmonis disease. PMID:7558323

  4. Distinct interferon-gamma and interleukin-9 expression in cutaneous and oral lichen planus.

    PubMed

    Weber, B; Schlapbach, C; Stuck, M; Simon, H-U; Borradori, L; Beltraminelli, H; Simon, D

    2017-05-01

    Cutaneous (CLP) and oral lichen planus (OLP) as the main subtypes of lichen planus (LP) present with different clinical manifestation and disease course, although their histopathologic features such as the band-like lymphocyte infiltrate and keratinocyte apoptosis are similar. So far, the underlying cellular and molecular mechanisms remain poorly understood. The aim of this study was to characterize and compare the in situ cellular infiltrates, cytokine expression profiles and apoptosis markers in CLP and OLP. Using immunofluorescence staining and laser scanning microscopy, we evaluated the cellular infiltrate (CD1a, CD3, CD4, CD8, CD21, CD57, CD123), cytokine expression (interleukin (IL)-1, IL-6, IL-9, IL-10, IL-17, IL-22, IL-23, tumour necrosis factor-α, transforming growth factor-β, interferon (IFN)-γ), and apoptosis markers (Fas, Fas ligand, cleaved caspase-3, TUNEL) of 21 anonymized biopsy specimens of LP (11 CLP, 10 OLP). Among infiltrating cells mainly T cells and natural killer (NK) cells as well as plasmacytoid dendritic cells (DC) were observed. A predominance of CD8+ T cells was noted in OLP. In both CLP and OLP, T helper (Th)1, Th9, Th17, and Th22-type cytokines were expressed. The expression of IL-9, IFN-γ and IL-22 was higher in CLP compared to that of OLP (P = 0.0165; P = 0.0016; P = 0.052 respectively). Expression of Fas and Fas ligand as well as cleaved caspase-3-positive cells was observed in the epithelium of all LP samples. The cell and cytokine patterns of CLP and OLP were partially distinct and generally resembled those reported for autoimmune diseases. The presence of CD8+ and NK cells as well as Fas/Fas ligand expression suggested that various pathways involved in keratinocyte apoptosis are relevant for LP. These results might help to establish targeted therapies for LP. © 2016 European Academy of Dermatology and Venereology.

  5. Delayed growth of EL4 lymphoma in SR-A-deficient mice is due to upregulation of nitric oxide and interferon-gamma production by tumor-associated macrophages.

    PubMed

    Komohara, Yoshihiro; Takemura, Kenichi; Lei, Xiao Feng; Sakashita, Naomi; Harada, Mamoru; Suzuki, Hiroshi; Kodama, Tatsuhiko; Takeya, Motohiro

    2009-11-01

    Class A scavenger receptors (SR-A, CD204) are highly expressed in tumor-associated macrophages (TAM). To investigate the function of SR-A in TAM, wild-type and SR-A-deficient (SR-A(-/-)) mice were injected with EL4 cells. Although these groups of mice did not differ in the numbers of infiltrating macrophages and lymphocytes and in neovascularization, SR-A(-/-) mice had delayed growth of EL4 tumors. Expression of inducible nitric oxide (NO) synthase and interferon (IFN)-gamma mRNA increased significantly in tumor tissues from SR-A(-/-) mice. Engulfment of necrotic EL4 cells induced upregulation of NO and IFN-gamma production by cultured macrophages, and production of NO and IFN-gamma increased in SR-A(-/-) macrophages in vitro. IFN-beta production by cultured macrophages was also elevated in SR-A(-/-) macrophages in vitro. These results suggested that the antitumor activity of macrophages increased in SR-A(-/-) mice because of upregulation of NO and IFN-gamma production. These data indicate an important role of SR-A in regulating TAM function by inhibiting toll-like receptor (TLR)4-IFN-beta signaling.

  6. The highly virulent variola and monkeypox viruses express secreted inhibitors of type I interferon

    PubMed Central

    Fernández de Marco, María del Mar; Alejo, Alí; Hudson, Paul; Damon, Inger K.; Alcami, Antonio

    2010-01-01

    Variola virus (VARV) caused smallpox, one of the most devastating human diseases and the first to be eradicated, but its deliberate release represents a dangerous threat. Virulent orthopoxviruses infecting humans, such as monkeypox virus (MPXV), could fill the niche left by smallpox eradication and the cessation of vaccination. However, immunomodulatory activities and virulence determinants of VARV and MPXV remain largely unexplored. We report the molecular characterization of the VARV- and MPXV-secreted type I interferon-binding proteins, which interact with the cell surface after secretion and prevent type I interferon responses. The proteins expressed in the baculovirus system have been purified, and their interferon-binding properties characterized by surface plasmon resonance. The ability of these proteins to inhibit a broad range of interferons was investigated to identify potential adaptation to the human immune system. Furthermore, we demonstrate by Western blot and activity assays the expression of the type I interferon inhibitor during VARV and MPXV infections. These findings are relevant for the design of new vaccines and therapeutics to smallpox and emergent virulent orthopoxviruses because the type I interferon-binding protein is a major virulence factor in animal models, vaccination with this protein induces protective immunity, and its neutralization prevents disease progression.—Fernández de Marco, M. M., Alejo, A., Hudson, P., Damon, I. K., Alcami, A. The highly virulent variola and monkeypox viruses express secreted inhibitors of type I interferon. PMID:20019241

  7. Effects of Chicken Interferon Gamma on Newcastle Disease Virus Vaccine Immunogenicity

    PubMed Central

    Cardenas-Garcia, Stivalis; Dunwoody, Robert P.; Marcano, Valerie; Diel, Diego G.; Williams, Robert J.; Gogal, Robert M.; Brown, Corrie C.; Miller, Patti J.; Afonso, Claudio L.

    2016-01-01

    More effective vaccines are needed to control avian diseases. The use of chicken interferon gamma (chIFNγ) during vaccination is a potentially important but controversial approach that may improve the immune response to antigens. In the present study, three different systems to co-deliver chIFNγ with Newcastle disease virus (NDV) antigens were evaluated for their ability to enhance the avian immune response and their protective capacity upon challenge with virulent NDV. These systems consisted of: 1) a DNA vaccine expressing the Newcastle disease virus fusion (F) protein co-administered with a vector expressing the chIFNγ gene for in ovo and booster vaccination, 2) a recombinant Newcastle disease virus expressing the chIFNγ gene (rZJ1*L/IFNγ) used as a live vaccine delivered in ovo and into juvenile chickens, and 3) the same rZJ1*L/IFNγ virus used as an inactivated vaccine for juvenile chickens. Co-administration of chIFNγ with a DNA vaccine expressing the F protein resulted in higher levels of morbidity and mortality, and higher amounts of virulent virus shed after challenge when compared to the group that did not receive chIFNγ. The live vaccine system co-delivering chIFNγ did not enhanced post-vaccination antibody response, nor improved survival after hatch, when administered in ovo, and did not affect survival after challenge when administered to juvenile chickens. The low dose of the inactivated vaccine co-delivering active chIFNγ induced lower antibody titers than the groups that did not receive the cytokine. The high dose of this vaccine did not increase the antibody titers or antigen-specific memory response, and did not reduce the amount of challenge virus shed or mortality after challenge. In summary, regardless of the delivery system, chIFNγ, when administered simultaneously with the vaccine antigen, did not enhance Newcastle disease virus vaccine immunogenicity. PMID:27409587

  8. T helper cell-mediated interferon-gamma expression after human parvovirus B19 infection: persisting VP2-specific and transient VP1u-specific activity

    PubMed Central

    Franssila, R; Auramo, J; Modrow, S; Möbs, M; Oker-Blom, C; Käpylä, P; Söderlund-Venermo, M; Hedman, K

    2005-01-01

    Human parvovirus B19 is a small non-enveloped DNA virus with an icosahedral capsid consisting of proteins of only two species, the major protein VP2 and the minor protein VP1. VP2 is contained within VP1, which has an additional unique portion (VP1u) of 227 amino acids. We determined the ability of eukaryotically expressed parvovirus B19 virus-like particles consisting of VP1 and VP2 in the ratio recommended for vaccine use, or of VP2 alone, to stimulate, in an HLA class II restricted manner, peripheral blood mononuclear cells (PBMC) to proliferate and to secrete interferon gamma (IFN-γ) and interleukin (IL)-10 cytokines among recently and remotely B19 infected subjects. PBMC reactivity with VP1u was determined specifically with a prokaryotically expressed VP1u antigen. In general, B19-specific IFN-γ responses were stronger than IL-10 responses in both recent and remote infection; however, IL-10 responses were readily detectable among both groups, with the exception of patients with relapsed or persisting symptoms who showed strikingly low IL-10 responses. Whereas VP1u-specific IFN-γ responses were very strong among the recently infected subjects, the VP1u-specific IFN-γ and IL-10 responses were virtually absent among the remotely infected subjects. The disappearance of VP1u-specific IFN-γ expression is surprising, as B-cell immunity against VP1u is well maintained. PMID:16178856

  9. Expression Profile of Interferon Regulatory Factor 1 in Chronic Hepatitis B Virus-Infected Liver Transplant Patients.

    PubMed

    Janfeshan, Sahar; Yaghobi, Ramin; Eidi, Akram; Karimi, Mohammad Hossein; Geramizadeh, Bita; Malekhosseini, Seyed Ali; Kafilzadeh, Farshid

    2017-12-01

    Hepatitis B virus, which mainly affects normal liver function, leads to severe acute and chronic hepatitis, resulting in cirrhosis and hepatocellular carcinoma, but can be safely treated after liver transplant. Evaluation of determinative biomarkers may facilitate more effective treatment of posttransplant rejection. Therefore, we investigated interferon regulatory factor 1 expression in hepatitis B virus-infected liver transplant patients with and without previous rejection compared with controls. Hepatitis B virus-infected liver recipients were divided into those with (20 patients) and without a rejection (26 patients), confirmed by pathologic analyses in those who had a rejection. In addition, a healthy control group composed of 13 individuals was included. Expression levels of interferon regulatory factor 1 were evaluated during 3 follow-ups after transplant using an in-house comparative SYBR green real-time polymerase chain reaction method. Statistical analyses were performed with SPSS software (SPSS: An IBM Company, version 16.0, IBM Corporation, Armonk, NY, USA). Modifications of interferon regulatory factor 1 gene expression levels in patient groups with and without rejection were not significant between days 1, 4, and 7 after liver transplant. Interferon regulatory factor 1 mRNA expression levels were down-regulated in patients without rejection versus patients with rejection, although not significantly at day 1 (P = .234) and day 4 (P = .302) but significantly at day 7 (P = .004) after liver transplant. Down-regulation of interferon regulatory factor 1 gene expression in hepatitis B virus patients without rejection emphasized counteraction between hepatitis B virus replication and interferon regulatory factor 1 production. On the other hand, interferon regulatory factor 1 gene overexpression in patients with rejection may result in inflammatory reactions and ischemic-reperfusion injury. Therefore, a better understanding of the association between

  10. Perforin and gamma interferon expression are required for CD4+ and CD8+ T-cell-dependent protective immunity against a human parasite, Trypanosoma cruzi, elicited by heterologous plasmid DNA prime-recombinant adenovirus 5 boost vaccination.

    PubMed

    de Alencar, Bruna C G; Persechini, Pedro M; Haolla, Filipe A; de Oliveira, Gabriel; Silverio, Jaline C; Lannes-Vieira, Joseli; Machado, Alexandre V; Gazzinelli, Ricardo T; Bruna-Romero, Oscar; Rodrigues, Mauricio M

    2009-10-01

    A heterologous prime-boost strategy using plasmid DNA, followed by replication-defective recombinant adenovirus 5, is being proposed as a powerful way to elicit CD4(+) and CD8(+) T-cell-mediated protective immunity against intracellular pathogens. We confirmed this concept and furthered existing research by providing evidence that the heterologous prime-boost regimen using the gene encoding amastigote surface protein 2 elicited CD4(+) and CD8(+) T-cell-mediated protective immunity (reduction of acute parasitemia and prolonged survival) against experimental infection with Trypanosoma cruzi. Protective immunity correlated with the presence of in vivo antigen-specific cytotoxic activity prior to challenge. Based on this, our second goal was to determine the outcome of infection after heterologous prime-boost immunization of perforin-deficient mice. These mice were highly susceptible to infection. A detailed analysis of the cell-mediated immune responses in immunized perforin-deficient mice showed an impaired gamma interferon (IFN-gamma) secretion by immune spleen cells upon restimulation in vitro with soluble recombinant antigen. In spite of a normal numeric expansion, specific CD8(+) T cells presented several functional defects detected in vivo (cytotoxicity) and in vitro (simultaneous expression of CD107a/IFN-gamma or IFN-gamma/tumor necrosis factor alpha) paralleled by a decreased expression of CD44 and KLRG-1. Our final goal was to determine the importance of IFN-gamma in the presence of highly cytotoxic T cells. Vaccinated IFN-gamma-deficient mice developed highly cytotoxic cells but failed to develop any protective immunity. Our study thus demonstrated a role for perforin and IFN-gamma in a number of T-cell-mediated effector functions and in the antiparasitic immunity generated by a heterologous plasmid DNA prime-adenovirus boost vaccination strategy.

  11. Expression of interferon-gamma and tumour necrosis factor-alpha messenger RNA does not correlate with protection in guinea pigs challenged with virulent Mycobacterium tuberculosis by the respiratory route.

    PubMed

    Jeevan, Amminikutty; Bonilla, Diana Lucia; McMurray, David Neil

    2009-09-01

    Cytokine messenger RNA (mRNA) expression was investigated in the spleen and lung digest cells of bacillus Calmette-Guérin (BCG)-vaccinated and non-vaccinated guinea pigs following low-dose, pulmonary exposure to virulent Mycobacterium tuberculosis. After purified protein derivative (PPD) stimulation, the levels of lung cell interferon-gamma (IFN-gamma), tumour necrosis factor-alpha (TNF-alpha) and spleen cell interleukin-12 (IL-12) p40 mRNAs were significantly increased in the non-vaccinated M. tuberculosis-infected guinea pigs compared to the BCG-vaccinated guinea pigs. In contrast, the expression of anti-inflammatory transforming growth factor-beta and IL-10 mRNAs was significantly enhanced in the spleens of BCG-vaccinated animals. Despite the presence of protective cytokine mRNA expression, the non-vaccinated guinea pigs had significantly higher lung and spleen bacterial burdens. In contrast, BCG-vaccinated guinea pigs controlled the bacterial multiplication in their lungs and spleens, indicating that both protective as well as anti-inflammatory cytokine responses are associated with a reduction in bacteria. In addition, lung digest cells from non-vaccinated guinea pigs contained a significantly higher percentage of neutrophils, CD3(+) and CD8(+) T cells, while the percentage of macrophages was increased in the BCG-vaccinated animals. Total and purified lung digest T cells co-cultured with lung macrophages (LMøs) proliferated poorly after PPD stimulation in both non-vaccinated and BCG-vaccinated animals while robust proliferation to PPD was observed when T cells were co-cultured with peritoneal macrophages (PMøs). Macrophages within the lung compartment appear to regulate the response of T cells irrespective of the vaccination status in guinea pigs. Taken together, our results suggest that type I cytokine mRNA expression is not associated with vaccine-induced protection in the low-dose guinea pig model of tuberculosis.

  12. Interferon system in women with genital papillomavirus infection receiving immunomodulatory therapy.

    PubMed

    Rogovskaya, S I; Zhdanov, A V; Loginova, N S; Faizullin, L Z; Prilepskaya, V N; Van'ko, L V; Sukhikh, G T

    2002-11-01

    The interferon system was studied in women with genital papillomavirus infection. In most patients the interferon system was activated, while the ability of lymphocytes to respond to inductors decreased. Laserotherapy and immunomodulatory therapy with larifan, ridostin, and viferon for 1 month normalized blood interferon concentration (39.4% patients) and interferon-gamma production by lymphocytes in response to inductors (87.9% patients). After laser monotherapy these parameters returned to normal only in 13.2 and 7.6% patients, respectively. Correlation and regression analyses showed that changes in the interferon system were synchronized after immunomodulatory therapy. These data indicate that immunomodulatory therapy produces a complex effect on the interferon system. Measurements of blood interferon level can be used to predict the effect of further treatment with interferon-gamma inductors.

  13. Potential mechanisms of cytosolic calcium modulation in interferon-gamma treated U937 cells

    NASA Technical Reports Server (NTRS)

    Klein, Jon B.; Mcleish, Kenneth R.; Sonnenfeld, Gerald; Dean, William L.

    1987-01-01

    The ability of interferon-gamma (IFN-gamma) to alter cytoplasmic Ca(2+) content in the monocytelike cell line U937 was investigated, using a slow Ca-channel blocker, diltiazem. In addition, the Ca-ATPase and the Ca-uptake activities were measured in isolated U937 membranes, together with the effect of inositol trisphosphate (IP3) upon the Ca(2+) release from Ca-loaded membranes. The addition of 50 U/ml INF-gamma to U937 cultures was found to increase internal Ca(2+) by about 100 percent within 3 min. The increase was significantly reduced by incubation in Ca-free buffer or by the addition of diltiazem. A crude membrane preparation from U937 cells was found to contain significant amounts of Ca-ATPase activity and to sequester Ca(2+) to a level of 8 nmol/mg in 30 sec; the addition of IP3 induced release of a portion of the sequestered Ca(2+) which was then resequestered. The results suggest that IFN-gamma causes an increase of cytoplasmic Ca(2+), in part, by the IP3-induced release from the internal storage sites and, in part, from the entry of extracellular Ca through slow channels.

  14. Interferon-gamma regulates nucleoside transport systems in macrophages through signal transduction and activator of transduction factor 1 (STAT1)-dependent and -independent signalling pathways.

    PubMed Central

    Soler, Concepció; Felipe, Antonio; García-Manteiga, José; Serra, Maria; Guillén-Gómez, Elena; Casado, F Javier; MacLeod, Carol; Modolell, Manuel; Pastor-Anglada, Marçal; Celada, Antonio

    2003-01-01

    The expressions of CNT and ENT (concentrative and equilibrative nucleoside transporters) in macrophages are differentially regulated by IFN-gamma (interferon-gamma). This cytokine controls gene expression through STAT1-dependent and/or -independent pathways (where STAT1 stands for signal transduction and activator of transcription 1). In the present study, the role of STAT1 in the response of nucleoside transporters to IFN-gamma was studied using macrophages from STAT1 knockout mice. IFN-gamma triggered an inhibition of ENT1-related nucleoside transport activity through STAT1-dependent mechanisms. Such inhibition of macrophage growth and ENT1 activity by IFN-gamma is required for DNA synthesis. Interestingly, IFN-gamma led to an induction of the CNT1- and CNT2-related nucleoside transport activities independent of STAT1, thus ensuring the supply of extracellular nucleosides for the STAT1-independent RNA synthesis. IFN-gamma up-regulated CNT2 mRNA and CNT1 protein levels and down-regulated ENT1 mRNA in both wild-type and STAT1 knockout macrophages. This is consistent with a STAT1-independent, long-term-mediated, probably transcription-dependent, regulation of nucleoside transporter genes. Moreover, STAT1-dependent post-transcriptional mechanisms are implicated in the regulation of ENT1 activity. Although nitric oxide is involved in the regulation of ENT1 activity in B-cells at a post-transcriptional level, our results show that STAT1-dependent induction of nitric oxide by IFN-gamma is not implicated in the regulation of ENT1 activity in macrophages. Our results indicate that both STAT1-dependent and -independent pathways are involved in the regulation of nucleoside transporters by IFN-gamma in macrophages. PMID:12868960

  15. Sphingosine kinase inhibitor suppresses IL-18-induced interferon-gamma production through inhibition of p38 MAPK activation in human NK cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cheon, Soyoung; Song, Seok Bean; Jung, Minkyung

    2008-09-12

    Natural killer (NK) cells play an important role in the innate immune response. Interleukin-18 (IL-18) is a well-known interferon-gamma (IFN-{gamma} inducing factor, which stimulates immune response in NK and T cells. Sphingosine kinase (SPHK) catalyzes the formation of sphingosine 1-phosphate (S1P), which acts as a second messenger to function as an anti-apoptotic factor and proliferation stimulator of immune cells. In this study, to elucidate whether SPHK is involved in IL-18-induced IFN-{gamma} production, we measured IL-18-induced IFN-{gamma} production after pre-treatment with SPHK inhibitor (SKI) in NK-92MI cells. We found that IL-18-induced IFN-{gamma} expression was blocked by SKI pre-treatment in both mRNAmore » and protein levels. In addition, the increased IFN-{gamma} production by stimulation with IL-18 is mediated through both SPHK and p38 MAPK. To determine the upstream signals of SKI and p38 MAPK in IL-18-induced IFN-{gamma} production, phosphorylation levels of p38 MAPK was measured after SKI pre-treatment. As a result, inhibition of SPHK by SKI blocked phosphorylation of p38 MAPK, showing that SPHK activation by IL-18 is an upstream signal of p38 MAPK activation. Inhibition of SPHK by SKI also inhibited IL-18-induced IFN-{gamma} production in human primary NK cells. In conclusion, SPHK activation is an essential factor for IL-18-induced IFN-{gamma} production via p38 MAPK.« less

  16. Evidence for a gamma-interferon receptor that regulates macrophage tumoricidal activity

    PubMed Central

    1984-01-01

    Gamma-interferon (IFN-gamma) is the macrophage-activating factor (MAF) produced by normal murine splenic cells and the murine T cell hybridoma 24/G1 that induces nonspecific tumoricidal activity in macrophages. Incubation of 24/G1 supernatants diluted to 8.3 IRU IFN-gamma/ml with 6 X 10(6) elicited peritoneal macrophages or bone marrow-derived macrophages for 4 h at 37 degrees C, resulted in removal of 80% of the MAF activity from the lymphokine preparation. Loss of activity appeared to result from absorption and not consumption because (a) 40% of the activity was removed after exposure to macrophage for 30 min at 4 degrees C, (b) no reduction of MAF activity was detected when the 24/G1 supernatant was incubated with macrophage culture supernatants, and (c) macrophage-treated supernatants showed a selective loss of MAF activity but not interleukin 2 (IL-2) activity. Absorption was dependent on the input of either IFN-gamma or macrophages and was time dependent at 37 degrees C but not at 4 degrees C. With four rodent species tested, absorption of murine IFN-gamma displayed species specificity. However, cultured human peripheral blood monocytes and the human histiocytic lymphoma cell line U937 were able to absorb the murine lymphokine. Although the majority of murine cell lines tested absorbed 24/G1 MAF activity, two murine macrophage cell lines, P388D1 and J774, were identified which absorbed significantly reduced amounts of natural IFN- gamma. Purified murine recombinant IFN-gamma was absorbed by elicited macrophages but not by P388D1. Normal macrophages but not P388D1 bound fluoresceinated microspheres coated with recombinant IFN-gamma and binding was inhibited by pretreatment of the normal cells with 24/G1 supernatants. Scatchard plot analysis showed that 12,000 molecules of soluble 125I-recombinant IFN-gamma bound per bone marrow macrophage with a Ka of 0.9 X 10(8) M-1. Binding was quantitatively inhibitable by natural IFN-gamma but not by murine IFN alpha. IFN

  17. A short 2 week dose titration regimen reduces the severity of flu-like symptoms with initial interferon gamma-1b treatment.

    PubMed

    Devane, John G; Martin, Mary L; Matson, Mark A

    2014-06-01

    Flu-like symptoms (FLS) are commonly experienced by patients receiving interferon gamma-1b which may cause discontinuation or disruption of dosing during initial therapy or on re-initiation following a break in therapy. In contrast to Type I interferons, the impact of dose-titration on FLS has not been reported and is not a practice described or included in the approved prescribing information for interferon gamma-1b.The objective of this study was to assess the effect of a 2 week titration regimen on the severity of FLS during the initial 3 weeks of therapy with three times weekly subcutaneous injections of interferon gamma-1b. Healthy men and women were randomized into a double-blind, two-period, crossover study. Each study period was 3 weeks in duration and there was a minimum 15 day washout between treatment periods. Two treatment regimens were compared: No Titration dosing (full 50 mcg/m(2) subcutaneously [s.c.] three times weekly for 3 weeks) and Titration (15 mcg/m(2) s.c. three times weekly during week 1, 30 mcg/m(2) s.c. three times weekly during week 2 followed by the full dose of 50 mcg/m(2) s.c. three times weekly during week 3). Subjects remained in the clinic for at least 12 hours following each injection. FLS was based on a composite score for fever, chills, tiredness and muscle aches assessed at baseline and 4, 8 and 12 hours following each injection. Acetaminophen was allowed at the discretion of the PI. The primary endpoint was the change from baseline in FLS severity at 8 hours averaged over the 3 weeks of treatment. Additional endpoints included FLS at 4 and 12 hours, individual flu-like symptoms, rates of discontinuation, incidence of FLS and acetaminophen use. NCT 01929382. Of the 40 subjects randomized, there were 15 (37.5%) discontinuations. Titration resulted in a significant reduction in FLS severity at 8 hours (p = 0.023) averaged over the 3 week treatment period. The difference in 3 week FLS severity reflects differences

  18. The highly virulent variola and monkeypox viruses express secreted inhibitors of type I interferon.

    PubMed

    Fernández de Marco, María del Mar; Alejo, Alí; Hudson, Paul; Damon, Inger K; Alcami, Antonio

    2010-05-01

    Variola virus (VARV) caused smallpox, one of the most devastating human diseases and the first to be eradicated, but its deliberate release represents a dangerous threat. Virulent orthopoxviruses infecting humans, such as monkeypox virus (MPXV), could fill the niche left by smallpox eradication and the cessation of vaccination. However, immunomodulatory activities and virulence determinants of VARV and MPXV remain largely unexplored. We report the molecular characterization of the VARV- and MPXV-secreted type I interferon-binding proteins, which interact with the cell surface after secretion and prevent type I interferon responses. The proteins expressed in the baculovirus system have been purified, and their interferon-binding properties characterized by surface plasmon resonance. The ability of these proteins to inhibit a broad range of interferons was investigated to identify potential adaptation to the human immune system. Furthermore, we demonstrate by Western blot and activity assays the expression of the type I interferon inhibitor during VARV and MPXV infections. These findings are relevant for the design of new vaccines and therapeutics to smallpox and emergent virulent orthopoxviruses because the type I interferon-binding protein is a major virulence factor in animal models, vaccination with this protein induces protective immunity, and its neutralization prevents disease progression.

  19. Executive Summary of the Guidelines for the Use of interferon-gamma Release Assays in the Diagnosis of Tuberculosis Infection.

    PubMed

    Santin, Miguel; García-García, José-María; Rigau, David; Altet, Neus; Anibarro, Luis; Casas, Irma; Díez, Nuria; García-Gasalla, Mercedes; Martínez-Lacasa, Xavier; Penas, Antón; Pérez-Escolano, Elvira; Sánchez, Francisca; Domínguez, José

    2016-09-01

    Interferon-gamma release assays are widely used for the diagnosis of tuberculosis infection in Spain. However, there is no consensus on their application in specific clinical scenarios. To develop a guide-line for their use, a panel of experts comprising specialists in infectious diseases, respiratory diseases, microbiology, pediatrics and preventive medicine, together with a methodologist, conducted a systematic literature search, summarized the findings, rated the quality of the evidence, and formulated recommendations following the Grading of Recommendations of Assessment Development and Evaluations methodology. This document provides evidence-based guidance on the use of interferon-gamma release assays for the diagnosis of tuberculosis infection in patients at risk of tuberculosis or suspected of having active disease. The guidelines will be applicable to specialist and primary care, and public health. Copyright © 2016 SEPAR. Publicado por Elsevier España, S.L.U. All rights reserved.

  20. Dual specific oral tolerance induction using interferon gamma for IgE-mediated anaphylactic food allergy and the dissociation of local skin allergy and systemic oral allergy: tolerance or desensitization?

    PubMed

    Noh, G; Jang, E H

    2014-01-01

    Specific oral tolerance induction (SOTI) for IgE-mediated food allergy (IFA) can be successfully achieved using interfero gamma (classic SOTI). In this study, a tolerable dose was introduced during tolerance induction with interferon gamma (dual SOTI), and its effectiveness was evaluated. The study population comprised 25 IFA patients. Blood samples were taken for analysis, including complete blood count with differential counts of eosinophils, serum total IgE levels, and specific IgE for allergenic foods. Skin prick tests were conducted with the allergens. Oral food challenges were performed to diagnose IFA. Ten patients received dual SOTI, 5 received classic SOTI, 5 received SOTI without interferon gamma (original SOTI), and 5 were not treated (controls). Patients treated with dual SOTI and classic SOTI using interferon gamma became tolerant to the allergenic food. The tolerable dose was introduced successfully in dual SOTI. It was difficult to proceed with the same dosing protocol used for classic SOTI in cases treated with original SOTI. Following dual SOTI, the systemic reaction to oral intake subsided, but the local skin reaction to contact with the allergenic food persisted. Dual SOTI is an improved protocol for SOTI using interferon gamma for IFA.The local skin reaction and systemic reaction to oral intake were dissociated following dual SOTI. In cases of food allergy, tolerance appears to result from desensitization to allergens.

  1. COULD INTERFERON-GAMMA BE A THERAPEUTIC TARGET FOR TREATING HEART FAILURE?

    PubMed Central

    Levick, Scott P.; Goldspink, Paul H.

    2013-01-01

    The cytokine interferon-gamma (IFN-γ), is the only known member of the type II family of interferons, and as such, binds to its own distinct receptor. It is important in host defense against infection, as well as adaptive immune responses. Whilst a wide array of cytokines are known to be involved in adverse remodeling of the heart and the progression to heart failure, the role of IFN-γ is unclear. Recent evidence from clinical studies, animal models of myocarditis and hypertension, as well as isolated cell studies, provide conflicting data as to whether IFN-γ is pathological or protective in the heart. Thus, it is important to highlight these discrepant findings so that areas of future investigation can be identified to more clearly determine the precise role of IFN-γ in the heart. Accordingly, this review will: 1) discuss the source of IFN-γ in the diseased heart; 2) summarize the data from animal studies; 3) discuss the effects of IFN-γ on isolated cardiac fibroblasts and cardiomyocytes; 4) identify signaling mechanisms that may be invoked by IFN-γ in the heart; and 5) present the clinical evidence supporting a role for IFN-γ in heart failure. PMID:23589353

  2. Vertebral osteomyelitis due to Aspergillus fumigatus in a patient with chronic granulomatous disease successfully treated with antifungal agents and interferon-gamma.

    PubMed

    Al-Tawfiq, Jaffar A; Al-Abdely, Hail M

    2010-05-01

    We report a case of invasive aspergillosis due to Aspergillus fumigatus involving the cervical and thoracic vertebrae and upper mediastinum of a 17 year-old Saudi male with chronic granulomatous disease (CGD). The patient did not respond to a long course of liposomal amphotericin B but did to surgical drainage and a combination of caspofungin and itraconazole with subsequent suppression with oral voriconazole. Fourteen months after the start of therapy, the patient had anterior dislocation of T2 thoracic vertebra with cord transection and quadriplegia. He was then treated intravenously with liquid itraconazole and interferon-gamma. The patient made a remarkable recovery over a 2-year period and was eventually able to walk independently. Thus, a combination of antifungals and interferon-gamma may have resulted in the positive outcome in this case.

  3. Expression of biologically active human interferon alpha 2 in aloe vera

    USDA-ARS?s Scientific Manuscript database

    We have developed a system for transgenic expression of proteins in Aloe Vera. Using this approach we have generated plants expressing the human gene interferon alpha 2, IFNa2. IFNa2 is a small secreted cytokine that plays a vital role in regulating the body’s immune response to viral infections a...

  4. Interleukin-12- and interferon-gamma-mediated natural killer cell activation by Agaricus blazei Murill.

    PubMed

    Yuminamochi, Eri; Koike, Taisuke; Takeda, Kazuyoshi; Horiuchi, Isao; Okumura, Ko

    2007-06-01

    Dried fruiting bodies of Agaricus blazei Murill (A. blazei) and its extracts have generally used as complementary and alternative medicines (CAMs). Here, we report that the oral administration of A. blazei augmented cytotoxicity of natural killer (NK) cells in wild-type (WT) C57BL/6, C3H/HeJ, and BALB/c mice. Augmented cytotoxicity was demonstrated by purified NK cells from treated wild-type (WT) and RAG-2-deficient mice, but not from interferon-gamma (IFN-gamma) deficient mice. NK cell activation and IFN-gamma production was also observed in vitro when dendritic cell (DC)-rich splenocytes of WT mice were coincubation with an extract of A. blazei. Both parameters were largely inhibited by neutralizing anti-interleukin-12 (IL-12) monoclonal antibody (mAb) and completely inhibited when anti-IL-12 mAb and anti-IL-18 mAb were used in combination. An aqueous extract of the hemicellulase-digested compound of A. blazei particle; (ABPC) induced IFN-gamma production more effectively, and this was completely inhibited by anti-IL-12 mAb alone. NK cell cytotoxicty was augmented with the same extracts, again in an IL-12 and IFN-gamma-dependent manner. These results clearly demonstrated that A. blazei and ABPC augmented NK cell activation through IL-12-mediated IFN-gamma production.

  5. Interferon-gamma interferes with transforming growth factor-beta signaling through direct interaction of YB-1 with Smad3.

    PubMed

    Higashi, Kiyoshi; Inagaki, Yutaka; Fujimori, Ko; Nakao, Atsuhito; Kaneko, Hideo; Nakatsuka, Iwao

    2003-10-31

    Transforming growth factor-beta (TGF-beta) and interferon-gamma (IFN-gamma) exert antagonistic effects on collagen synthesis in human dermal fibroblasts. We have recently shown that Y box-binding protein YB-1 mediates the inhibitory effects of IFN-gamma on alpha2(I) procollagen gene (COL1A2) transcription through the IFN-gamma response element located between -161 and -150. Here we report that YB-1 counter-represses TGF-beta-stimulated COL1A2 transcription by interfering with Smad3 bound to the upstream sequence around -265 and subsequently by interrupting the Smad3-p300 interaction. Western blot and immunofluorescence analyses using inhibitors for Janus kinases or casein kinase II suggested that the casein kinase II-dependent signaling pathway mediates IFN-gamma-induced nuclear translocation of YB-1. Down-regulation of endogenous YB-1 expression by double-stranded YB-1-specific RNA abrogated the transcriptional repression of COL1A2 by IFN-gamma in the absence and presence of TGF-beta. In transient transfection assays, overexpression of YB-1 in human dermal fibroblasts exhibited antagonistic actions against TGF-beta and Smad3. Physical interaction between Smad3 and YB-1 was demonstrated by immunoprecipitation-Western blot analyses, and electrophoretic mobility shift assays using the recombinant Smad3 and YB-1 proteins indicated that YB-1 forms a complex with Smad3 bound to the Smad-binding element. Glutathione S-transferase pull-down assays showed that YB-1 binds to the MH1 domain of Smad3, whereas the central and carboxyl-terminal regions of YB-1 were required for its interaction with Smad3. YB-1 also interferes with the Smad3-p300 interaction by its preferential binding to p300. Altogether, the results provide a novel insight into the mechanism by which IFN-gamma/YB-1 counteracts TGF-beta/Smad3. They also indicate that IFN-gamma/YB-1 inhibits COL1A2 transcription by dual actions: via the IFN-gamma response element and through a cross-talk with the TGF

  6. Production of interferon-gamma by in vivo tumor-sensitized T cells: Association with active antitumor immunity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bursuker, I.; Pearce, M.T.

    1990-02-01

    The state of active immunity to Meth A fibrosarcoma in mice immunized with an admixture of Meth A cells and Propionibacterium acnes is associated with possession by the host of spleen cells capable of producing interferon-gamma (IFN-gamma) upon in vitro restimulation with irradiated tumor cells. The ability of spleen cells from immunized mice to produce IFN-gamma in response to irradiated Meth A cells decays as active antitumor immunity is replaced by a state of immunological memory. The IFN-producing cells are L3T4+Ly2+, cyclophosphamide-sensitive and radiosensitive T cells, as determined by their sensitivity to corresponding monoclonal antibodies and complement. The induction ofmore » IFN-gamma production by in vivo tumor-sensitized T cells is tumor specific, in that spleen cells from mice immunized against Meth A fibrosarcoma can produce IFN in response to irradiated Meth A cells but not in response to another syngeneic tumor M109 lung carcinoma.« less

  7. The Jak-STAT pathway stimulated by interferon alpha or interferon beta.

    PubMed

    Horvath, Curt M

    2004-11-23

    Type I interferons, such as interferon alpha and interferon beta (IFN-alpha and beta), signal through a Janus kinase (Jak) to signal transduction and activator of transcription (STAT) pathway to stimulate gene expression. In response to ligand binding, the receptors dimerize, Jaks phosphorylate STAT1 and STAT2, which then dimerize and interact with a third transcriptional regulator IFN regulatory factor 9 (IRF9) to stimulate gene expression. IFN-alpha is the main innate antiviral cytokine and is essential for effective immune response to viral infection. The animation shows activation of STAT-responsive gene expression in response to type I IFNs.

  8. Continuous in vivo infusion of interferon-gamma (IFN-gamma) enhances engraftment of syngeneic wild-type cells in Fanca-/- and Fancg-/- mice.

    PubMed

    Si, Yue; Ciccone, Samantha; Yang, Feng-Chun; Yuan, Jin; Zeng, Daisy; Chen, Shi; van de Vrugt, Henri J; Critser, John; Arwert, Fre; Haneline, Laura S; Clapp, D Wade

    2006-12-15

    Fanconi anemia (FA) is a heterogeneous genetic disorder characterized by bone marrow (BM) failure and cancer susceptibility. Identification of the cDNAs of FA complementation types allows the potential of using gene transfer technology to introduce functional cDNAs as transgenes into autologous stem cells and provide a cure for the BM failure in FA patients. However, strategies to enhance the mobilization, transduction, and engraftment of exogenous stem cells are required to optimize efficacy prior to widespread clinical use. Hypersensitivity of Fancc-/- cells to interferon-gamma (IFN-gamma), a nongenotoxic immune-regulatory cytokine, enhances engraftment of syngeneic wild-type (WT) cells in Fancc-/- mice. However, whether this phenotype is of broad relevance in other FA complementation groups is unresolved. Here we show that primitive and mature myeloid progenitors in Fanca-/- and Fancg-/- mice are hypersensitive to IFN-gamma and that in vivo infusion of IFN-gamma at clinically relevant concentrations was sufficient to allow consistent long-term engraftment of isogenic WT repopulating stem cells. Given that FANCA, FANCC, and FANCG complementation groups account for more than 90% of all FA patients, these data provide evidence that IFN-gamma conditioning may be a useful nongenotoxic strategy for myelopreparation in FA patients.

  9. Interferon Gamma in African Trypanosome Infections: Friends or Foes?

    PubMed

    Wu, Hui; Liu, Gongguan; Shi, Meiqing

    2017-01-01

    African trypanosomes cause fatal infections in both humans and livestock. Interferon gamma (IFN-γ) plays an essential role in resistance to African trypanosomes. However, increasing evidence suggests that IFN-γ, when excessively synthesized, also induces immunopathology, enhancing susceptibility to the infection. Thus, production of IFN-γ must be tightly regulated during infections with African trypanosomes to ensure that a robust immune response is elicited without tissue destruction. Early studies have shown that secretion of IFN-γ is downregulated by interleukin 10 (IL-10). More recently, IL-27 has been identified as a negative regulator of IFN-γ production during African trypanosome infections. In this review, we discuss the current state of our understanding of the role of IFN-γ in African trypanosome infections. We have focused on the cellular source of IFN-γ, its beneficial and detrimental effects, and mechanisms involved in regulation of its production, highlighting some recent advances and offering some perspectives on future directions.

  10. Interferon-gamma promotes the survival and Fc epsilon RI-mediated histamine release in cultured human mast cells.

    PubMed Central

    Yanagida, M; Fukamachi, H; Takei, M; Hagiwara, T; Uzumaki, H; Tokiwa, T; Saito, H; Iikura, Y; Nakahata, T

    1996-01-01

    We examined the effects of interferon-gamma (IFN-gamma) on 100% pure human mast cells generated in suspension cultures of umbilical cord blood mononuclear cells in the presence of stem cell factor (SCF) and interleukin-6 (IL-6). When mast cells were suspended in serum-free medium without any cytokine after the withdrawal of SCF and IL-6, they died over a period of 5 days because of apoptosis. IFN-gamma in the cultures suppressed apoptosis and prolonged their survival in a dose-dependent manner. This survival-promoting effect of IFN-gamma was blocked by neutralizing antibodies to IFN-gamma or to IFN-gamma receptor (IFN-gamma R). When mast cells were incubated with IFN-gamma in serum-free medium for more than 4 hr during sensitization, immunoglobulin E (IgE)/anti-IgE antibody-induced histamine release was effectively enhanced. Polymerase chain reaction (PCR) amplification of the alpha-chain of IFN-gamma R (IFN-gamma R alpha) yielded products of the correct size predicted from the sequence of the receptor. In addition, flow cytometry using anti-IFN-gamma R monoclonal antibodies (mAbs) indicated that these mast cells bear IFN-gamma R on their surface. These findings suggested that IFN-gamma activates human mast cells via specific receptors in certain aspects of inflammatory reactions. Images Figure 2 Figure 4 PMID:9014819

  11. Siglec-1 inhibits RSV-induced interferon gamma production by adult T cells in contrast to newborn T cells.

    PubMed

    Jans, Jop; Unger, Wendy W J; Vissers, Marloes; Ahout, Inge M L; Schreurs, Inge; Wickenhagen, Arthur; de Groot, Ronald; de Jonge, Marien I; Ferwerda, Gerben

    2018-04-01

    Interferon gamma (IFN-γ) plays an important role in the antiviral immune response during respiratory syncytial virus (RSV) infections. Monocytes and T cells are recruited to the site of RSV infection, but it is unclear whether cell-cell interactions between monocytes and T cells regulate IFN-γ production. In this study, micro-array data identified the upregulation of sialic acid-binding immunoglobulin-type lectin 1 (Siglec-1) in human RSV-infected infants. In vitro, RSV increased expression of Siglec-1 on healthy newborn and adult monocytes. RSV-induced Siglec-1 on monocytes inhibited IFN-γ production by adult CD4 + T cells. In contrast, IFN-γ production by RSV in newborns was not affected by Siglec-1. The ligand for Siglec-1, CD43, is highly expressed on adult CD4 + T cells compared to newborns. Our data show that Siglec-1 reduces IFN-γ release by adult T cells possibly by binding to the highly expressed CD43. The Siglec-1-dependent inhibition of IFN-γ in adults and the low expression of CD43 on newborn T cells provides a better understanding of the immune response against RSV in early life and adulthood. © 2017 The Authors. European Journal of Immunology published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Mitochondria-dependent and -independent mechanisms in tumour necrosis factor-related apoptosis-inducing ligand (TRAIL)-induced apoptosis are both regulated by interferon-gamma in human breast tumour cells.

    PubMed Central

    Ruiz-Ruiz, Carmen; López-Rivas, Abelardo

    2002-01-01

    Tumour necrosis factor-related apoptosis-inducing ligand (TRAIL/APO-2L) induces apoptosis in a variety of tumour cells upon binding to death receptors TRAIL-R1 and TRAIL-R2. Here we describe the sensitization by interferon (IFN)-gamma to TRAIL-induced apoptosis in the breast tumour cell lines MCF-7 and MDA-MB231. IFN-gamma promoted TRAIL-mediated activation of caspase-8, Bcl-2 interacting domain death agonist (Bid) degradation, Bcl-2-associated X protein (Bax) translocation to mitochondria, cytochrome c release to the cytosol and activation of caspase-9 in these cell lines. No changes in the expression of TRAIL receptors were observed upon IFN-gamma treatment. Overexpression of Bcl-2 in MCF-7 cells completely inhibited IFN-gamma-induced sensitization to TRAIL-mediated cell death. Interestingly, TRAIL-induced apoptosis was also clearly enhanced by IFN-gamma in caspase-3-overexpressing MCF-7 cells, in the absence of Bax translocation to mitochondria and cytochrome c release to the cytosol. In summary, our results suggest that IFN-gamma facilitates TRAIL-induced activation of mitochondria-regulated as well as mitochondria-independent apoptotic pathways in breast tumour cells. PMID:11936954

  13. Equine interferon gamma synthesis in lymphocytes after in vivo infection and in vitro stimulation with EHV-1.

    PubMed

    Paillot, R; Daly, J M; Juillard, V; Minke, J M; Hannant, D; Kydd, J H

    2005-08-22

    Equine cytotoxic T lymphocyte (CTL) responses to equine herpesvirus-1 (EHV-1) are well characterised but little is known about the cytokine response after infection or vaccination. EHV-1 is common in horses and infects lymphocytes in vivo. This virus was used as a model to measure the synthesis of interferon gamma (IFN-gamma) by equine peripheral blood mononuclear cells (PBMC) after in vivo infection and/or in vitro stimulation with EHV-1. Both flow cytometry and ELISPOT assays were used to quantify equine IFN-gamma using a mouse anti-bovine IFN-gamma monoclonal antibody (clone CC302; shown to cross-react with recombinant equine IFN-gamma) and a rabbit anti-canine IFN-gamma polyclonal antibody. The percentage of PBMC synthesising IFN-gamma after in vitro stimulation with EHV-1 increased with age. In yearlings infected experimentally with EHV-1, PBMC showed two peaks of IFN-gamma synthesis, 11 and 56 days after infection. The IFN-gamma synthesis was principally associated with CD8(+) cells. The patterns of IFN-gamma synthesis detected by intracellular IFN-gamma staining or ELISPOT were compared with CTL data and shown to be similar. These methods were also applied successfully to frozen samples of PBMC. Measurement of equine IFN-gamma using these simple techniques can now be applied to future studies on protective cellular immune responses following virus infection and/or vaccination of horses.

  14. A Recombinant Adenovirus Expressing Ovine Interferon Tau Prevents Influenza Virus-Induced Lethality in Mice.

    PubMed

    Martín, V; Pascual, E; Avia, M; Rangel, G; de Molina, A; Alejo, A; Sevilla, N

    2016-01-06

    Ovine interferon tau (IFN-τ) is a unique type I interferon with low toxicity and a broad host range in vivo. We report the generation of a nonreplicative recombinant adenovirus expressing biologically active IFN-τ. Using the B6.A2G-Mx1 mouse model, we showed that single-dose intranasal administration of recombinant Ad5-IFN-τ can effectively prevent lethality and disease induced by highly virulent hv-PR8 influenza virus by activating the interferon response and preventing viral replication. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  15. Pilot study of whole-blood gamma interferon response to the Vibrio cholerae toxin B subunit and resistance to enterotoxigenic Escherichia coli-associated diarrhea.

    PubMed

    Flores, Jose; DuPont, Herbert L; Paredes-Paredes, Mercedes; Aguirre-Garcia, M Magdalena; Rojas, Araceli; Gonzalez, Alexei; Okhuysen, Pablo C

    2010-05-01

    Enterotoxigenic Escherichia coli (ETEC), which produces heat-labile toxin (LT), is a common cause of travelers' diarrhea (TD). The B subunit of ETEC LT is immunologically related to the B subunit of Vibrio cholerae toxin (CT). In this pilot study we evaluated the whole-blood gamma interferon response to CT B in 17 U.S. adults traveling to Mexico. Only one of nine subjects who demonstrated a cellular immune response as determined by whole-blood gamma interferon production to CT B on arrival to Mexico developed diarrhea, whereas five of eight without a cellular response developed diarrhea. Markers of the cellular immune response to ETEC LT could help in identifying individuals immune to ETEC LT, and these markers deserve additional study.

  16. CD4 T lymphocytes from patients with chronic fatigue syndrome have decreased interferon-gamma production and increased sensitivity to dexamethasone.

    PubMed

    Visser, J; Blauw, B; Hinloopen, B; Brommer, E; de Kloet, E R; Kluft, C; Nagelkerken, L

    1998-02-01

    A disturbed hypothalamus-pituitary-adrenal gland axis and alterations at the immune system level have been observed in patients with chronic fatigue syndrome (CFS). Glucocorticoids are known to modulate T cell responses; therefore, purified CD4 T cells from CFS patients were studied to determine whether they have an altered sensitivity to dexamethasone (DEX). CD4 T cells from CFS patients produced less interferon-gamma than did cells from controls; by contrast, interleukin-4 production and cell proliferation were comparable. With CD4 T cells from CFS patients (compared with cells from controls), a 10- to 20-fold lower DEX concentration was needed to achieve 50% inhibition of interleukin-4 production and proliferation, indicating an increased sensitivity to DEX in CFS patients. Surprisingly, interferon-gamma production in patients and controls was equally sensitive to DEX. A differential sensitivity of cytokines or CD4 T cell subsets to glucocorticoids might explain an altered immunologic function in CFS patients.

  17. Mycobacterium avium Complex Empyema in a Patient with Interferon Gamma Autoantibodies

    PubMed Central

    Chung, Heath H; Opal, Steven M; Dworkin, Jonathan D

    2014-01-01

    Interferon gamma (IFN-γ) autoantibodies are a relatively recently discovered clinical entity, which have been shown to be associated with disseminated non-tuberculous mycobacterial (NTM) infections and other opportunistic infections. Interestingly, isolated NTM infections (without disseminated NTM infection) have not been shown to be a good predictor of the presence of IFN-γ autoantibodies. This case describes an isolated NTM empyema in a patient with IFN-γ autoantibodies and makes the argument that the development of an NTM empyema in a patient with no known immunodeficiency should prompt consideration for IFN-γ testing. Additionally, this case underscores the importance for clinicians to recognize that an unusual infection without the typical cause of impairment in immunity should prompt a more thorough investigation of the patient's immune system. PMID:25285250

  18. Development of a lion-specific interferon-gamma assay.

    PubMed

    Maas, M; van Kooten, P J S; Schreuder, J; Morar, D; Tijhaar, E; Michel, A L; Rutten, V P M G

    2012-10-15

    The ongoing spread of bovine tuberculosis (BTB) in African free-ranging lion populations, for example in the Kruger National Park, raises the need for diagnostic assays for BTB in lions. These, in addition, would be highly relevant for zoological gardens worldwide that want to determine the BTB status of their lions, e.g. for translocations. The present study concerns the development of a lion-specific IFN-γ assay, following the production and characterization of monoclonal antibodies specific for lion interferon-gamma (IFN-γ). Recombinant lion IFN-γ (rLIFN-γ) was produced in mammalian cells and used to immunize mice to establish hybridoma cell lines producing monoclonal antibodies. These were used to develop a sensitive, lion IFN-γ-specific capture ELISA, able to detect rLIFN-γ to the level of 160 pg/ml. Recognition of native lion IFN-γ was shown in an initial assessment of supernatants of mitogen stimulated whole blood cultures of 11 known BTB-negative lions. In conclusion, the capture ELISA shows potential as a diagnostic assay for bovine tuberculosis in lions. Preliminary results also indicate the possible use of the test for other (feline) species. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. T-Cell Mineralocorticoid Receptor Controls Blood Pressure by Regulating Interferon-Gamma.

    PubMed

    Sun, Xue-Nan; Li, Chao; Liu, Yuan; Du, Lin-Juan; Zeng, Meng-Ru; Zheng, Xiao-Jun; Zhang, Wu-Chang; Liu, Yan; Zhu, Mingjiang; Kong, Deping; Zhou, Li; Lu, Limin; Shen, Zhu-Xia; Yi, Yi; Du, Lili; Qin, Mu; Liu, Xu; Hua, Zichun; Sun, Shuyang; Yin, Huiyong; Zhou, Bin; Yu, Ying; Zhang, Zhiyuan; Duan, Sheng-Zhong

    2017-05-12

    Hypertension remains to be a global public health burden and demands novel intervention strategies such as targeting T cells and T-cell-derived cytokines. Mineralocorticoid receptor (MR) antagonists have been clinically used to treat hypertension. However, the function of T-cell MR in blood pressure (BP) regulation has not been elucidated. We aim to determine the role of T-cell MR in BP regulation and to explore the mechanism. Using T-cell MR knockout mouse in combination with angiotensin II-induced hypertensive mouse model, we demonstrated that MR deficiency in T cells strikingly decreased both systolic and diastolic BP and attenuated renal and vascular damage. Flow cytometric analysis showed that T-cell MR knockout mitigated angiotensin II-induced accumulation of interferon-gamma (IFN-γ)-producing T cells, particularly CD8 + population, in both kidneys and aortas. Similarly, eplerenone attenuated angiotensin II-induced elevation of BP and accumulation of IFN-γ-producing T cells in wild-type mice. In cultured CD8 + T cells, T-cell MR knockout suppressed IFN-γ expression whereas T-cell MR overexpression and aldosterone both enhanced IFN-γ expression. At the molecular level, MR interacted with NFAT1 (nuclear factor of activated T-cells 1) and activator protein-1 in T cells. Finally, T-cell MR overexpressing mice manifested more elevated BP compared with control mice after angiotensin II infusion and such difference was abolished by IFN-γ-neutralizing antibodies. MR may interact with NFAT1 and activator protein-1 to control IFN-γ in T cells and to regulate target organ damage and ultimately BP. Targeting MR in T cells specifically may be an effective novel approach for hypertension treatment. © 2017 American Heart Association, Inc.

  20. Graft-versus-host disease causes failure of donor hematopoiesis and lymphopoiesis in interferon-gamma receptor-deficient hosts.

    PubMed

    Delisle, Jean-Sébastien; Gaboury, Louis; Bélanger, Marie-Pier; Tassé, Eliane; Yagita, Hideo; Perreault, Claude

    2008-09-01

    The immunopathologic condition known as graft-versus-host disease (GVHD) results from a type I T-cell process. However, a prototypical type I cytokine, interferon-gamma (IFN-gamma), can protect against several manifestations of GVHD in recipients of major histocompatibility complex (MHC)-mismatched hematopoietic cells. We transplanted hematopoietic cells from C3H.SW donors in wild-type (wt) and IFN-gamma-receptor-deficient (IFN-gammaRKO) MHC-matched C57BL/6 recipients. In IFN-gammaRKO recipients, host cells were unresponsive to IFN-gamma, whereas wt donor cells were exposed to exceptionally high levels of IFN-gamma. From an IFN-gamma perspective, we could therefore evaluate the impact of a loss-of-function on host cells and gain-of-function on donor cells. We found that lack of IFN-gammaR prevented up-regulation of MHC proteins on host cells but did not mitigate damage to most target organs. Two salient phenotypes in IFN-gammaRKO recipients involved donor cells: lymphoid hypoplasia and hematopoietic failure. Lymphopenia was due to FasL-induced apoptosis and decreased cell proliferation. Bone marrow aplasia resulted from a decreased proliferation of hematopoietic stem/progenitor cells that was associated with down-regulation of 2 genes negatively regulated by IFN-gamma: Ccnd1 and Myc. We conclude that IFN-gamma produced by alloreactive T cells may entail a severe graft-versus-graft reaction and could be responsible for cytopenias that are frequently observed in subjects with GVHD.

  1. Human Atopic Dermatitis Complicated by Eczema Herpeticum is Associated with Abnormalities in Gamma Interferon Response

    PubMed Central

    Leung, Donald YM; Gao, Pei-Song; Grigoryev, Dmitry N; Rafaels, Nicholas M; Streib, Joanne E; Howell, Michael D; Taylor, Patricia A; Boguniewicz, Mark; Canniff, Jennifer; Armstrong, Brian; Zaccaro, Daniel J; Schneider, Lynda C; Hata, Tissa R; Hanifin, Jon M; Beck, Lisa A; Weinberg, Adriana; Barnes, Kathleen C

    2011-01-01

    Background The basis for increased susceptibility of atopic dermatitis (AD) patients to develop disseminated viral skin infections such as eczema herpeticum (ADEH+) is poorly understood. Objective We sought to determine whether atopic dermatitis subjects prone to disseminated viral skin infections have defects in their interferon responses. Methods GeneChip profiling was used to identify differences in gene expression of peripheral blood mononuclear cells (PBMC) from patients with a history of ADEH+ as compared to ADEH− and non-atopic controls. Key differences in protein expression were verified by ELISPOT and/or ELISA. Clinical relevance was further demonstrated by a mouse model of disseminated viral skin infection and genetic association analysis for genetic variants in IFNG and IFNGR1 and ADEH among 435 cases and controls. Results We demonstrate by global gene expression analysis selective transcriptomic changes within the interferon (IFN) superfamily of PBMCs from ADEH+ subjects reflecting low IFNγ and IFNγ receptor gene expression. IFNγ protein production was also significantly lower in ADEH+ (N=24) compared to ADEH− (N=20) and non-atopic (NA; N=20) controls. IFNγ receptor knockout (KO) mice developed disseminated viral skin infection after epicutaneous challenge with vaccinia virus (VV). Genetic variants in IFNG and IFNGR1 SNPs were significantly associated with ADEH (112 cases, 166 controls) and IFNγ production: a 2-SNP (A–G) IFNGR1 haplotype (rs10457655 and rs7749390) showed the strongest association with a reduced risk of ADEH+ ((13.2% ADEH+ vs 25.5% ADEH−, P = 0.00057). Conclusions ADEH+ patients have reduced IFNγ production, and IFNG and IFNGR1 SNPs are significantly associated with ADEH+ and may contribute to an impaired immune response to herpes simplex virus (HSV). Clinical Implications Atopic dermatitis subjects prone to disseminated viral skin infections have defects in their interferon responses. Capsule summary Using genomic

  2. The Effectiveness of Screening with Interferon-Gamma Release Assays in a University Health Care Setting with a Diverse Global Population

    ERIC Educational Resources Information Center

    Birch, Samantha J.; Golbeck, Amanda L.

    2015-01-01

    Objective: This analysis examined the effectiveness of utilizing interferon-gamma release assay (IGRA) technology in a TB (TB) screening program at a university. Participants: Participants were 2299 students at a Montana university who had presented to the university health center for TB screening during 2012 and 2013. Methods: A retrospective…

  3. Dysregulation of Serum Gamma Interferon Levels in Vascular Chronic Q Fever Patients Provides Insights into Disease Pathogenesis

    PubMed Central

    Kremers, Marjolein N. T.; Hodemaekers, Hennie M.; Hagenaars, Julia C. J. P.; Koning, Olivier H. J.; Renders, Nicole H. M.; Hermans, Mirjam H. A.; de Klerk, Arja; Notermans, Daan W.; Wever, Peter C.; Janssen, Riny

    2015-01-01

    A large community outbreak of Q fever occurred in the Netherlands in the period 2007 to 2010. Some of the infected patients developed chronic Q fever, which typically includes pathogen dissemination to predisposed cardiovascular sites, with potentially fatal consequences. To identify the immune mechanisms responsible for ineffective clearance of Coxiella burnetii in patients who developed chronic Q fever, we compared serum concentrations of 47 inflammation-associated markers among patients with acute Q fever, vascular chronic Q fever, and past resolved Q fever. Serum levels of gamma interferon were strongly increased in acute but not in vascular chronic Q fever patients, compared to past resolved Q fever patients. Interleukin-18 levels showed a comparable increase in acute as well as vascular chronic Q fever patients. Additionally, vascular chronic Q fever patients had lower serum levels of gamma interferon-inducible protein 10 (IP-10) and transforming growth factor β (TGF-β) than did acute Q fever patients. Serum responses for these and other markers indicate that type I immune responses to C. burnetii are affected in chronic Q fever patients. This may be attributed to an affected immune system in cardiovascular patients, which enables local C. burnetii replication at affected cardiovascular sites. PMID:25924761

  4. Alternative activation of STAT1 and STAT3 in response to interferon-gamma.

    PubMed

    Qing, Yulan; Stark, George R

    2004-10-01

    Interferon-gamma (IFNgamma) is a pluripotent cytokine whose major biological effects are mediated through a pathway in which STAT1 is the predominant and essential transcription factor. STAT3 can also be activated weakly by IFNgamma, but the mechanism of activation and function of STAT3 as a part of the interferon response are not known. Here we show that STAT3 activation is much stronger and more prolonged in STAT1-null mouse embryo fibroblasts than in wild-type cells. In response to IFNgamma, SRC-family kinases are required to activate STAT3 (but not STAT1) through tyrosine phosphorylation, whereas the receptor-bound kinases JAK1 and JAK2 are required to activate both STATs. Tyrosine 419 of the IFNgamma receptor subunit 1 (IFNGR1) is required to activate both STATs, suggesting that STAT1 and STAT3 compete with each other for the same receptor phosphotyrosine motif. Activated STAT3 can replace STAT1 in STAT1-null cells to drive the transcription of certain genes, for example, socs-3 and c/ebpdelta, which have gamma-activated sequence motifs in their promoters. Work from Ian Kerr's laboratory reveals that the gp130-linked interleukin-6 receptor, which usually activates STAT3 predominantly, activates STAT1 efficiently when STAT3 is absent. Because STAT1 and STAT3 have opposing biological effects (STAT3 is an oncogene, and STAT1 is a tumor suppressor), the reciprocal activation of these two transcription factors in response to IFNgamma or interleukin-6 suggests that their relative abundance, which may vary substantially in different normal cell types, under different conditions or in tumors is likely to have a major impact on how cells behave in response to different cytokines.

  5. Inhibition of human mast cell growth and differentiation by interferon gamma-1b.

    PubMed

    Kirshenbaum, A S; Worobec, A S; Davis, T A; Goff, J P; Semere, T; Metcalfe, D D

    1998-03-01

    In an effort to identify cytokines that inhibit human mast cell growth, we cultured HMC-1 cells and recombinant human stem cell factor (rhSCF)-dependent human bone marrow-derived mast cells (HBMCs) in the presence of interferon gamma (IFNgamma)-1b and interferon alpha (IFNalpha)-2b. HMC-1 cell numbers decreased in the presence of 1000 U/mL IFNgamma-1b but were unaffected by 1000 U/mL of IFNalpha-2b. HBMCs were then cultured for 0 to 7 days with 100 ng/mL rhSCF and 10 ng/mL recombinant human IL-3 (rhIL-3), followed by culture in rhSCF and administration of either 1000 U/mL IFNalpha-2b or 1000 U/mL IFNgamma-1b. HBMCs appearing in cultures with rhSCF alone or in combination with IFNalpha-2b were virtually identical in number through 8 weeks of culture. In cultures supplemented with IFNgamma-1b, HBMCs significantly decreased in number and incidence of granular metachromasia by 4 to 5 weeks (p<0.001). Similar results were obtained when human marrow was cultured from day 0 with rhSCF and IFNgamma-1b. Mature rhSCF-dependent HBMCs were also cultured at 5 weeks with rhSCF alone or in combination with IFNgamma-1b. Compared with cells cultured in rhSCF, mature 5-week HBMC cultures treated with rhSCF plus IFNgamma-1b revealed a decrease in mast cells, and those mast cells that remained had fewer toluidine blue- and tryptase-positive granules after 5 to 8 weeks. FACS analysis of rhSCF plus IFNgamma-1b-treated mature HBMCs revealed increased c-kit and Fc(epsilon)RI expression. Mast cell releasibility was not increased. IFNgamma-lb was thus able to suppress mast cell growth from CD34+ cells, suggesting that this agent should be considered as a candidate cytokine for the treatment of disorders of mast cell proliferation.

  6. Interferon Gamma potentiates the injury caused by MPP(+) on SH-SY5Y cells, which is attenuated by the nitric oxide synthases inhibition.

    PubMed

    Titze-de-Almeida, Simoneide S; Lustosa, Cátia Faria; Horst, Camila Hillesheim; Bel, Elaine Del; Titze-de-Almeida, Ricardo

    2014-12-01

    This study examined whether the cytokine interferon (IFN) gamma plays a role in the injury of SH-SY5Y cells caused by MPP(+) (1-methyl-4-phenylpyridinium). First of all, IFN-gamma sensitized cells to the neurotoxin MPP(+), as determined by MTT (3-(4,5-dimethylthiazol-2-y1)-2,5-diphenyltetrazolium bromide) assay. MPP(+)-injured cells showed higher reactive oxygen species (ROS) levels, which was reinforced by IFN-gamma. The injury triggered a marked expression of the neuronal NOS (nNOS) enzyme. L-NAME [N(ω)-nitro-L-arginine methyl ester, a non-specific NOS inhibitor] reestablished the cell viability after IFN-gamma challenging, and recovered cells from MPP(+) injury (95.0 vs. 84.7 %; P < 0.05). Seven-NI (7-nitroindazole, a nNOS inhibitor) protected cells against the injury by MPP(+) co-administered with IFN-gamma. Both inhibitors restrained the apoptosis of SH-SY5Y cells caused by MPP(+)/IFN-gamma. Regarding oxidative stress, L-NAME and 7-NI attenuated the increase in ROS levels caused by MPP(+) (45.3 or 48.4 vs. 87.9 %, P < 0.05). Indeed, L-NAME was more effective than 7-NI for reducing oxidative stress caused by MPP(+) under IFN-gamma exposition. The nNOS gene silencing by small-interfering RNAs recovered cells challenged by IFN-gamma (24 h), or MPP(+) (8 h). In conclusion, IFN-gamma sensitizes cells to MPP(+)-induced injury, also causing an increase in ROS levels. Pretreating cells with L-NAME or 7-NI reverts both the oxidative stress and apoptosis triggered by the neurotoxin MPP(+). Taking together, our data reinforce that IFN-gamma and NOS enzymes play a role in oxidative stress and dopaminergic cell death triggered by MPP(+).

  7. Production of human interferon alfa 2b in plants of Nicotiana excelsior by Agrobacterium-mediated transient expression.

    PubMed

    Sindarovska, Y R; Gerasymenko, I M; Sheludko, Y V; Olevinskaya, Z M; Spivak, N Y; Kuchuk, N V

    2010-01-01

    Human interferon alpha2b gene was transiently expressed in Nicotiana excelsior plants. Fusion with N. plumbaginifolia calreticulin signal peptide for improved apoplast targeting and carrying out the expression under optimized conditions resulted in maximal interferon activity of 3.2 x 10(3) IU/g fresh weight (FW) with an average of 2.1 +/- 0.8 x 10(3) IU/g FW. It proves that N. excelsior is a suitable host for Agrobacterium-mediated transient expression of genes encoding physiologically active human proteins. The transient expression conditions optimized for GFP marker protein were confirmed to be preferable for hIFN alpha2b.

  8. Interferon-gamma enhances radiation-induced cell death via downregulation of Chk1

    PubMed Central

    Kim, Kwang Seok; Choi, Kyu Jin; Bae, Sangwoo

    2012-01-01

    Interferon-gamma (IFNγ) is a cytokine with roles in immune responses as well as in tumor control. Interferon is often used in cancer treatment together with other therapies. Here we report a novel approach to enhancement of cancer cell killing by combined treatment of IFNγ with ionizing radiation. We found that IFNγ treatment alone in HeLa cells induced phosphorylation of Chk1 in a time- and dose-dependent manner, and resulted in cell arrest. Moreover IFNγ treatment was correlated with attenuation of Chk1 as the treatment shortened protein half-life of Chk1. As Chk1 is an essential cell cycle regulator for viability after DNA damage, attenuation of Chk1 by IFNγ pre-treatment in HeLa cells resulted in increased cell death following ionizing radiation about 2-folds than ionizing radiation treatment alone whereas IFNγ treatment alone had little effect on cell death. X-linked inhibitor of apoptosis-associated factor 1 (XAF1), an IFN-induced gene, seems to partly regulate IFNγ-induced Chk1 destabilization and radiation sensitivity because transient depletion of XAF1 by siRNA prevented IFNγ-induced Chk1 attenuation and partly protected cells from IFNγ-enhanced radiation cell killing. Therefore the results provide a novel rationale to combine IFNγ pretreatment and DNA-damaging anti-cancer drugs such as ionizing radiation to enhance cancer cell killing. PMID:22825336

  9. Electrochemical impedance spectroscopy based-on interferon-gamma detection

    NASA Astrophysics Data System (ADS)

    Li, Guan-Wei; Kuo, Yi-Ching; Tsai, Pei-I.; Lee, Chih-Kung

    2014-03-01

    Tuberculosis (TB) is an ancient disease constituted a long-term menace to public health. According to World Health Organization (WHO), mycobacterium tuberculosis (MTB) infected nearly a third of people of the world. There is about one new TB occurrence every second. Interferon-gamma (IFN-γ) is associated with susceptibility to TB, and interferongamma release assays (IGRA) is considered to be the best alternative of tuberculin skin test (TST) for diagnosis of latent tuberculosis infection (LTBI). Although significant progress has been made with regard to the design of enzyme immunoassays for IFN-γ, adopting this assay is still labor-intensive and time-consuming. To alleviate these drawbacks, we used IFN-γ antibody to facilitate the detection of IFN-γ. An experimental verification on the performance of IGRA was done in this research. We developed two biosensor configurations, both of which possess high sensitivity, specificity, and rapid IFN-γ diagnoses. The first is the electrochemical method. The second is a circular polarization interferometry configuration, which incorporates two light beams with p-polarization and s-polarization states individually along a common path, a four photo-detector quadrature configuration to arrive at a phase modulated ellipsometer. With these two methods, interaction between IFN-γ antibody and IFN-γ were explored and presented in detail.

  10. Biosynthesis and N-glycosylation of human interferon-gamma. Asn25 and Asn97 differ markedly in how efficiently they are glycosylated and in their oligosaccharide composition.

    PubMed

    Sareneva, T; Mørtz, E; Tölö, H; Roepstorff, P; Julkunen, I

    1996-12-01

    Interferon-gamma (IFN-gamma) is a secretory glycoprotein produced by T cells in response to antigenic or mitogenic stimuli. We studied the kinetics of the synthesis, N-glycosylation, and secretion of IFN-gamma in human CD8+ T lymphocytes stimulated via T-cell receptor. Highly elevated IFN-gamma mRNA levels were found as early as 1 h after stimulation. Maximal IFN-gamma protein synthesis was observed 2-4 h after induction and appeared to correlate to steady-state IFN-gamma mRNA levels. As analyzed by pulse/chase experiments, the secretion of IFN-gamma from T cells was very rapid, the secretion half-time being approximately 20-25 min. Inhibition of N-glycosylation by tunicamycin dramatically reduced the expression of IFN-gamma, but did not block its secretion. Natural IFN-gamma is heterogeneously glycosylated and doubly, singly, and unglycosylated forms exist. Experiments performed in a cell-free translation/glycosylation system with mutated IFN-gamma constructs lacking either one of the potential glycosylation sites suggested that Asn25 is more efficiently glycosylated than Asn97. Site-specific oligosaccharide analysis of natural IFN-gamma by glycosidase treatment followed by matrix-assisted-laser-desorption-ionization mass spectrometry revealed considerable variation in the carbohydrate structures, with more than 30 different forms. The glycans at Asn25 consisted of fucosylated, mainly complex-type oligosaccharides, whereas the glycans at Asn97 were more heterogeneous, with hybrid and high-mannose structures. Our results emphasize the essential role of N-linked glycans in the biology of IFN-gamma and show that there is a considerable heterogeneity in the individual sugar chains of this important human cytokine.

  11. Autophagy diminishes the early interferon-β response to influenza A virus resulting in differential expression of interferon-stimulated genes.

    PubMed

    Perot, Brieuc P; Boussier, Jeremy; Yatim, Nader; Rossman, Jeremy S; Ingersoll, Molly A; Albert, Matthew L

    2018-05-10

    Influenza A virus (IAV) infection perturbs metabolic pathways such as autophagy, a stress-induced catabolic pathway that crosstalks with cellular inflammatory responses. However, the impact of autophagy perturbation on IAV gene expression or host cell responses remains disputed. Discrepant results may be a reflection of in vivo studies using cell-specific autophagy-related (Atg) gene-deficient mouse strains, which do not delineate modification of developmental programmes from more proximal effects on inflammatory response. In vitro experiments can be confounded by gene expression divergence in wild-type cultivated cell lines, as compared to those experiencing long-term absence of autophagy. With the goal to investigate cellular processes within cells that are competent or incompetent for autophagy, we generated a novel experimental cell line in which autophagy can be restored by ATG5 protein stabilization in an otherwise Atg5-deficient background. We confirmed that IAV induced autophagosome formation and p62 accumulation in infected cells and demonstrated that perturbation of autophagy did not impact viral infection or replication in ATG5-stablized cells. Notably, the induction of interferon-stimulated genes (ISGs) by IAV was diminished when cells were autophagy competent. We further demonstrated that, in the absence of ATG5, IAV-induced interferon-β (IFN-β) expression was increased as compared to levels in autophagy-competent lines, a mechanism that was independent of IAV non-structural protein 1. In sum, we report that induction of autophagy by IAV infection reduces ISG expression in infected cells by limiting IFN-β expression, which may benefit viral replication and spread.

  12. The POU Transcription Factor Oct-1 Represses Virus-Induced Interferon A Gene Expression

    PubMed Central

    Mesplède, Thibault; Island, Marie-Laure; Christeff, Nicolas; Petek, Fahrettin; Doly, Janine; Navarro, Sébastien

    2005-01-01

    Alpha interferon (IFN-α) and IFN-β are able to interfere with viral infection. They exert a vast array of biologic functions, including growth arrest, cell differentiation, and immune system regulation. This regulation extends from innate immunity to cellular and humoral adaptive immune responses. A strict control of expression is needed to prevent detrimental effects of unregulated IFN. Multiple IFN-A subtypes are coordinately induced in human and mouse cells infected by virus and exhibit differences in expression of their individual mRNAs. We demonstrated that the weakly expressed IFN-A11 gene is negatively regulated after viral infection, due to a distal negative regulatory element, binding homeoprotein pituitary homeobox 1 (Pitx1). Here we show that the POU protein Oct-1 binds in vitro and in vivo to the IFN-A11 promoter and represses IFN-A expression upon interferon regulatory factor overexpression. Furthermore, we show that Oct-1-deficient MEFs exhibit increased in vivo IFN-A gene expression and increased antiviral activity. Finally, the IFN-A expression pattern is modified in Oct-1-deficient MEFs. The broad representation of effective and potent octamer-like sequences within IFN-A promoters suggests an important role for Oct-1 in IFN-A regulation. PMID:16166650

  13. Inhibited interferon production after space flight

    NASA Technical Reports Server (NTRS)

    Sonnenfeld, G.; Gould, C. L.; Williams, J.; Mandel, A. D.

    1988-01-01

    Several studies have been performed in our laboratories indicating that interferon production may be impaired in rodents after space flight. Using an antiorthostatic suspension model that simulates some of the effects of microgravity seen during space flight, we have shown that interferon-alpha/beta production was inhibited. The inhibition was not due solely to the stress of suspension. The inhibited interferon production was transient, as suspended animals returned to normal caging recovered the ability to produce interferon. Antiorthostatic suspension of mice also resulted in a loss of resistance to infection with the diabetogenic strain of encephalomyocarditis virus, which correlated with the drop in interferon production. In rats flown in US Space Shuttle mission SL-3, interferon-gamma production was inhibited severely when spleen cells were challenged with concanavalin-A upon return to earth. In contrast, interleukin-3 production by these cells was normal. These results suggest that immune responses may be altered after antiorthostatic modeling or space flight, and the resistance to viral infections may be especially affected.

  14. Pre-immune state induced by chicken interferon gamma inhibits the replication of H1N1 human and H9N2 avian influenza viruses in chicken embryo fibroblasts.

    PubMed

    Yuk, Seong-Su; Lee, Dong-Hun; Park, Jae-Keun; Tseren-Ochir, Erdene-Ochir; Kwon, Jung-Hoon; Noh, Jin-Yong; Lee, Joong-Bok; Park, Seung-Yong; Choi, In-Soo; Song, Chang-Seon

    2016-04-27

    Interferon gamma (IFN-γ), an immunoregulatory cytokine, is known to control many microbial infections. In a previous study, chicken interferon gamma (chIFN-γ) was found to be up-regulated following avian influenza virus (AIV) infection in specific pathogen-free chickens. We aimed to investigate whether the pre-immune state induced by chIFN-γ could generate an antiviral response against influenza virus. We generated a chIFN-γ-expressing plasmid and transfected it into chicken embryo fibroblasts (CEFs) and then infected the cells with human origin H1N1 or avian origin H9N2 influenza viruses. Viral titers of culture medium were evaluated in MDCK cell and the viral RNA and IFN-stimulated genes (ISGs) were then quantified by real-time reverse transcriptase polymerase. To further evaluate the role of the antiviral effect of chIFN-γ by using a backward approach, synthetic small interfering RNAs (siRNA) targeting chIFN-γ were used to suppress chIFN-γ. The chIFN-γ-stimulated CEFs inhibited the replication of viral RNA (vRNA) and showed a mild decrease in the infectious virus load released in the culture medium. Compared to the mock-transfected control, the messenger RNA (mRNA) levels of type I IFNs and IFN-stimulated genes were up-regulated in the cells expressing chIFN-γ. After treatment with the siRNA, we detected a higher expression of viral genes than that observed in the mock-transfected control. Our results suggest that apart from the important role played by chIFN-γ in the antiviral state generated against influenza virus infection, the pre-immune state induced by chIFN-γ can be helpful in mitigating the propagation of influenza virus.

  15. Expression of peroxisome proliferator-activated receptor gamma (PPAR-gamma) in canine nasal carcinomas.

    PubMed

    Paciello, O; Borzacchiello, G; Varricchio, E; Papparella, S

    2007-10-01

    Peroxisome proliferator-activated receptor gamma (PPAR-gamma) is a ligand-activated transcriptional factor belonging to the steroid receptor superfamily. PPAR-gamma is expressed in multiple normal and neoplastic tissues, such as the breast, colon, lung, ovary and placenta. In addition to adipogenic and anti-inflammatory effects, PPAR-gamma activation has been shown to be anti-proliferative by its differentiation-promoting effect, suggesting that activation of PPAR-gamma may be useful in slowing or arresting the proliferation of de-differentiated tumour cells. In this study, we investigated the expression of PPAR-gamma in normal and neoplastic canine nasal epithelium. Twenty-five samples composed of five normal nasal epithelia and 20 canine nasal carcinomas, were immunohistochemically stained for PPAR-gamma. The specificity of the antibody was verified by Western Blot analysis. Confocal laser scanning microscopical investigation was also performed. In normal epithelium, the staining pattern was cytoplasmic and polarized at the cellular free edge. In carcinomas, the neoplastic cells showed mainly strong cytoplasmatic PPAR-gamma expression; moreover, perinuclear immunoreactivity was also detected and few neoplastic cells exhibited a nuclear positivity. Our results demonstrate different patterns of PPAR-gamma expression in normal canine nasal epithelium when compared with canine nasal carcinoma. The importance of this transcription factor in the pathophysiology of several different tumours has stimulated much research in this field and has opened new opportunities for the treatment of the tumours.

  16. Immunomodulatory Factors Galectin-9 and Interferon-Gamma Synergize to Induce Expression of Rate-Limiting Enzymes of the Kynurenine Pathway in the Mouse Hippocampus

    PubMed Central

    Brooks, Alexandra K.; Lawson, Marcus A.; Rytych, Jennifer L.; Yu, Kevin C.; Janda, Tiffany M.; Steelman, Andrew J.; McCusker, Robert H.

    2016-01-01

    Elevated levels of circulating pro-inflammatory cytokines are associated with symptomology of several psychiatric disorders, notably major depressive disorder. Symptomology has been linked to inflammation/cytokine-dependent induction of the Kynurenine Pathway. Galectins, like pro-inflammatory cytokines, play a role in neuroinflammation and the pathogenesis of several neurological disorders but without a clearly defined mechanism of action. Their involvement in the Kynurenine Pathway has not been investigated. Thus, we searched for a link between galectins and the Kynurenine Pathway using in vivo and ex vivo models. Mice were administered LPS and pI:C to determine if galectins (Gal’s) were upregulated in the brain following in vivo inflammatory challenges. We then used organotypic hippocampal slice cultures (OHSCs) to determine if Gal’s, alone or with inflammatory mediators [interferon-gamma (IFNγ), tumor necrosis factor-alpha (TNFα), interleukin-1beta (IL-1β), polyinosine-polycytidylic acid (pI:C), and dexamethasone (Dex; synthetic glucocorticoid)], would increase expression of indoleamine/tryptophan-2,3-dioxygenases (DO’s: Ido1, Ido2, and Tdo2; Kynurenine Pathway rate-limiting enzymes). In vivo, hippocampal expression of cytokines (IL-1β, TNFα, and IFNγ), Gal-3, and Gal-9 along with Ido1 and Ido2 were increased by LPS and pI:C (bacterial and viral mimetics). Of the cytokines induced in vivo, only IFNγ increased expression of two Ido1 transcripts (Ido1-FL and Ido1-v1) by OHSCs. Although ineffective alone, Gal-9 accentuated IFNγ-induced expression of only Ido1-FL. Similarly, IFNγ induced expression of several Ido2 transcripts (Ido2-v1, Ido2-v3, Ido2-v4, Ido2-v5, and Ido2-v6). Gal-9 accentuated IFNγ-induced expression of only Ido2-v1. Surprisingly, Gal-9 alone, slightly but significantly, induced expression of Tdo2 (Tdo2-v1 and Tdo2-v2, but not Tdo2-FL). These effects were specific to Gal-9 as Gal-1 and Gal-3 did not alter DO expression. These results

  17. Lion (Panthera leo) and cheetah (Acinonyx jubatus) IFN-gamma sequences.

    PubMed

    Maas, Miriam; Van Rhijn, Ildiko; Allsopp, Maria T E P; Rutten, Victor P M G

    2010-04-15

    Cloning and sequencing of the full length lion and cheetah interferon-gamma (IFN-gamma) transcript will enable the expression of the recombinant cytokine, to be used for production of monoclonal antibodies and to set up lion and cheetah-specific IFN-gamma ELISAs. These are relevant in blood-based diagnosis of bovine tuberculosis, an important threat to lions in the Kruger National Park. Alignment of nucleotide and amino acid sequences of lion and cheetah and that of domestic cats showed homologies of 97-100%. Copyright 2009 Elsevier B.V. All rights reserved.

  18. A recombinant adenovirus bicistronically expressing porcine interferon-α and interferon-γ enhances antiviral effects against foot-and-mouth disease virus.

    PubMed

    Kim, Su-Mi; Kim, Se-Kyung; Park, Jong-Hyeon; Lee, Kwang-Nyeong; Ko, Young-Joon; Lee, Hyang-Sim; Seo, Min-Goo; Shin, Yeun-Kyung; Kim, Byounghan

    2014-04-01

    Foot-and-mouth disease (FMD) is a virulent and economically costly disease in domestic livestock. Since the current vaccine available against FMD provides no protection until 7days postvaccination, the only alternative method to halt the spread of the FMD virus (FMDV) during outbreaks is by the application of anti-viral agents. The combination of recombinant adenovirus expressing type I interferon (IFN-α) and adenovirus expressing type II IFN (IFN-γ) has been reported to be an effective anti-viral treatment strategy against FMDV. Nevertheless, the recombinant adenovirus mixture may be inefficient because of the low anti-viral efficiency of IFN-γ compared to that of IFN-α. In this study, we generated a recombinant adenovirus co-expressing porcine IFN-α and IFN-γ in tandem using an FMDV 2A sequence to mediate effective cleavage of the two proteins (referred to as Ad-porcine IFN-αγ). We demonstrated that both recombinant porcine IFN-α and IFN-γ were expressed and interferon stimulated gene (ISG)s related with IFN-α and IFN-γ were induced in porcine kidney (IBRS-2) cells infected with Ad-porcine IFN-αγ. Additionally, the anti-viral effects of Ad-porcine IFN-αγ against FMDV were enhanced both in IBRS-2 cells and in CD-1 (ICR) suckling mice compared to that of adenovirus expressing only a single protein. We propose that Ad-porcine IFN-αγ could be a rapid, highly efficient, convenient anti-viral agent against FMDV. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Treatment of trypanosome-infected mice with exogenous interferon, interferon inducers, or antibody to interferon

    NASA Technical Reports Server (NTRS)

    Degee, Antonie L. W.; Mansfield, John M.; Sonnenfeld, Gerald

    1986-01-01

    Earlier studies have demonstrated that mice resistant to Trypanosoma brucei rhodesiense (the B10.BR/SgSnJ strain) produces, upon infection by this parasite, two peaks of serum interferon (IFN), while the susceptible mice (C3HeB/FeJ) produces no IFN. In the present study, survival times were compared for B10.BR/SgSnJ, C3HeB/FeJ, and CBA/J (an intermediately resistant strain) mice that were injected, prior to infection with the parasite, with either of the following three preparations (1) IFN-gamma, (2) an antibody to IFN-gamma and (3) polyriboinosinic-polyribocytidylic acid (to induce IFN-alpha/beta). No effect on the survival times of mice by any of these preparations could be demonstrated, contrary to some previous reports.

  20. Gamma Interferon Release Assays for Detection of Mycobacterium tuberculosis Infection

    PubMed Central

    Denkinger, Claudia M.; Kik, Sandra V.; Rangaka, Molebogeng X.; Zwerling, Alice; Oxlade, Olivia; Metcalfe, John Z.; Cattamanchi, Adithya; Dowdy, David W.; Dheda, Keertan; Banaei, Niaz

    2014-01-01

    SUMMARY Identification and treatment of latent tuberculosis infection (LTBI) can substantially reduce the risk of developing active disease. However, there is no diagnostic gold standard for LTBI. Two tests are available for identification of LTBI: the tuberculin skin test (TST) and the gamma interferon (IFN-γ) release assay (IGRA). Evidence suggests that both TST and IGRA are acceptable but imperfect tests. They represent indirect markers of Mycobacterium tuberculosis exposure and indicate a cellular immune response to M. tuberculosis. Neither test can accurately differentiate between LTBI and active TB, distinguish reactivation from reinfection, or resolve the various stages within the spectrum of M. tuberculosis infection. Both TST and IGRA have reduced sensitivity in immunocompromised patients and have low predictive value for progression to active TB. To maximize the positive predictive value of existing tests, LTBI screening should be reserved for those who are at sufficiently high risk of progressing to disease. Such high-risk individuals may be identifiable by using multivariable risk prediction models that incorporate test results with risk factors and using serial testing to resolve underlying phenotypes. In the longer term, basic research is necessary to identify highly predictive biomarkers. PMID:24396134

  1. Effect of treatment with interferon-gamma and concanavalin A on the course of infection of mice with Salmonella typhimurium strain LT-2

    NASA Technical Reports Server (NTRS)

    Gould, Cheryl L.; Sonnenfeld, Gerald

    1987-01-01

    The effect of pretreatment of mice with 34 units/day, for five days, of interferon-gamma (IFN-gamma) on the course of infection with LD50 of Salmonella typhimurium strain LT-2 was assessed, using two IFN preparations: (1) a hybridoma supernatant fluid containing concanavalin-A-induced IFN-gamma activity and (2) pure murine IFN-gamma produced by recombinant DNA technology. The hybridoma supernatant-treated Salmonella-infected mice were found to die faster than mice treated only with Salmonella. Pure murine IFN-gamma was found to protect infected mice significantly, with 95 percent of mice surviving LD50 infection. In contrast, the Salmonella-infected mice treated with hybridoma supernatant were found to die faster than the Salmonella-infected untreated controls. Mice treated with concanavalin A alone prior to infection with S. typhimurium died more quickly than the untreated infected controls, suggesting that contamination with concanavalin A had a detrimental effect on mice survival.

  2. Use of interferon-gamma release assays in a health care worker screening program: experience from a tertiary care centre in the United States.

    PubMed

    Joshi, Manish; Monson, Thomas P; Woods, Gail L

    2012-01-01

    Interferon-gamma release assays including the QuantiFERON-TB Gold In-Tube test (QFT-GIT [Cellestis Ltd, Australia]) may be used in place of the tuberculin skin test (TST) in surveillance programs for Mycobacterium tuberculosis infection control. However, data on performance and practicality of the QFT-GIT in such programs for health care workers (HCWs) are limited. To assess the performance, practicality and reversion rate of the QFT-GIT among HCWs at a tertiary health care institution in the United States. Retrospective chart review of HCWs at Central Arkansas Veterans Healthcare System (Arkansas, USA) who underwent QFT-GIT testing as a part of their employee screening between November 1, 2008 and October 31, 2009. QFT-GIT was used to screen 3290 HCWs. The initial QFT-GIT was interpreted as positive for 129 (3.9%) HCWs, negative for 3155 (95.9%) and indeterminate for six (0.2%). Testing with QFT-GIT was repeated in 45 HCWs who had positive results on the initial test. The QFT-GIT reverted to negative in 18 (40.0%) HCWs, all of whom had negative TST status and initial interferon-gamma values of 0.35 IU⁄mL to 2.0 IU⁄mL. The QFT-GIT test is feasible in large health care setting as an alternative to TST for M tuberculosis infection screening in HCWs but is not free from challenges. The major concerns are the high number of positive test results and high reversion rates on repeat testing, illustrating poor short-term reproducibility of positive QFT-GIT test results. These results suggest adopting a borderline zone between interferon-gamma values of 0.35 IU⁄mL to 2.0 IU⁄mL, and cautious clinical interpretation of values in this range.

  3. Use of Piezoelectric Immunosensors for Detection of Interferon-Gamma Interaction with Specific Antibodies in the Presence of Released-Active Forms of Antibodies to Interferon-Gamma

    PubMed Central

    Don, Elena; Farafonova, Olga; Pokhil, Suzanna; Barykina, Darya; Nikiforova, Marina; Shulga, Darya; Borshcheva, Alena; Tarasov, Sergey; Ermolaeva, Tatyana; Epstein, Oleg

    2016-01-01

    In preliminary ELISA studies where released-active forms (RAF) of antibodies (Abs) to interferon-gamma (IFNg) were added to the antigen-antibody system, a statistically significant difference in absorbance signals obtained in their presence in comparison to placebo was observed. A piezoelectric immunosensor assay was developed to support these data and investigate the effects of RAF Abs to IFNg on the specific interaction between Abs to IFNg and IFNg. The experimental conditions were designed and optimal electrode coating, detection circumstances and suitable chaotropic agents for electrode regeneration were selected. The developed technique was found to provide high repeatability, intermediate precision and specificity. The difference between the analytical signals of RAF Ab samples and those of the placebo was up to 50.8%, whereas the difference between non-specific controls and the placebo was within 5%–6%. Thus, the piezoelectric immunosensor as well as ELISA has the potential to be used for detecting the effects of RAF Abs to IFNg on the antigen-antibody interaction, which might be the result of RAF’s ability to modify the affinity of IFNg to specific/related Abs. PMID:26791304

  4. Local expression of interferon-alpha and interferon receptors in cervical intraepithelial neoplasia.

    PubMed

    Tirone, Nelson R; Peghini, Bethanea C; Barcelos, Ana Cristina M; Murta, Eddie F C; Michelin, Marcia A

    2009-12-01

    The present study evaluated mRNA expression of interferon-alpha (IFN-alpha), IFN-alpha receptor subunits (IFNAR-1 and IFNAR-2) and an IFN-stimulated gene encoding the enzyme 2',5'-oligoadenylate synthetase (2'5'OAS) in biopsies on patients with varying grades of cervical intraepithelial neoplasia (CIN I, II and III). Uterine cervix biopsies were collected from women with CIN I, II and III (n = 28) and controls without CIN lesions or human papilloma virus (HPV) infection (n = 17). The presence of high and low-risk HPV DNA was determined using hybrid capture. The mRNA levels of IFNAR-1, IFNAR-2, IFN-alpha and 2'5'OAS were determined by RT-PCR with specific primers. The control group exhibited a greater frequency of IFNAR-1 expression (10/17; 58.3%) than the CIN samples (4/28; 14.2%) (P = 0.0018), while, the expression of IFNAR-2 was also greater in the control samples (11/17; 64.7%) than in the patients with lesions (2/28; 7.1%) (P = 0.0018). Importantly, simultaneous expression of both receptors was observed only in the control group (8/17; 47.0%) (P = 0.0001). Among the CIN samples, there was one case of low expression of mRNA of IFNAR-1 and IFNAR-2. IFN-alpha was present in 14.2% (4/28) of the CIN samples but was not expressed in the control group. mRNA 2'5'OAS were expressed in 28.5% (8/28) of the CIN samples and 11.7% (2/17) of the control samples (not statistically significant). Fifty percent (14/28) of the CIN samples were positive for HPV DNA. Cervical biopsy samples from control women or those without neoplasia or HPV infection displayed higher IFN-alpha receptor expression than those with CIN, while simultaneous expression of both IFN-alpha receptor subunits was found only in the control group. There was no significant difference in mRNA expression of IFN-alpha and 2'5'OAS between the control and CIN groups. Then we concluded that the samples obtained from patients with CIN present low levels of the IFN-alpha receptor mRNA.

  5. Delayed translational silencing of ceruloplasmin transcript in gamma interferon-activated U937 monocytic cells: role of the 3' untranslated region

    NASA Technical Reports Server (NTRS)

    Mazumder, B.; Fox, P. L.

    1999-01-01

    Ceruloplasmin (Cp) is an acute-phase protein with ferroxidase, amine oxidase, and pro- and antioxidant activities. The primary site of Cp synthesis in human adults is the liver, but it is also synthesized by cells of monocytic origin. We have shown that gamma interferon (IFN-gamma) induces the synthesis of Cp mRNA and protein in monocytic cells. We now report that the induced synthesis of Cp is terminated by a mechanism involving transcript-specific translational repression. Cp protein synthesis in U937 cells ceased after 16 h even in the presence of abundant Cp mRNA. RNA isolated from cells treated with IFN-gamma for 24 h exhibited a high in vitro translation rate, suggesting that the transcript was not defective. Ribosomal association of Cp mRNA was examined by sucrose centrifugation. When Cp synthesis was high, i.e., after 8 h of IFN-gamma treatment, Cp mRNA was primarily associated with polyribosomes. However, after 24 h, when Cp synthesis was low, Cp mRNA was primarily in the nonpolyribosomal fraction. Cytosolic extracts from cells treated with IFN-gamma for 24 h, but not for 8 h, contained a factor which blocked in vitro Cp translation. Inhibitor expression was cell type specific and present in extracts of human cells of myeloid origin, but not in several nonmyeloid cells. The inhibitory factor bound to the 3' untranslated region (3'-UTR) of Cp mRNA, as shown by restoration of in vitro translation by synthetic 3'-UTR added as a "decoy" and detection of a binding complex by RNA gel shift analysis. Deletion mapping of the Cp 3'-UTR indicated an internal 100-nucleotide region of the Cp 3'-UTR that was required for complex formation as well as for silencing of translation. Although transcript-specific translational control is common during development and differentiation and global translational control occurs during responses to cytokines and stress, to our knowledge, this is the first report of translational silencing of a specific transcript following cytokine

  6. Effects of interferon-gamma and lipopolysaccharide on macrophage iron metabolism are mediated by nitric oxide-induced degradation of iron regulatory protein 2.

    PubMed

    Kim, S; Ponka, P

    2000-03-03

    Iron regulatory proteins (IRP-1 and IRP-2) control the synthesis of transferrin receptors (TfR) and ferritin by binding to iron-responsive elements, which are located in the 3'-untranslated region and the 5'-untranslated region of their respective mRNAs. Cellular iron levels affect binding of IRPs to iron-responsive elements and consequently expression of TfR and ferritin. Moreover, NO(*), a redox species of nitric oxide that interacts primarily with iron, can activate IRP-1 RNA binding activity resulting in an increase in TfR mRNA levels. Recently we found that treatment of RAW 264.7 cells (a murine macrophage cell line) with NO(+) (nitrosonium ion, which causes S-nitrosylation of thiol groups) resulted in a rapid decrease in RNA binding of IRP-2 followed by IRP-2 degradation, and these changes were associated with a decrease in TfR mRNA levels (Kim, S., and Ponka, P. (1999) J. Biol. Chem. 274, 33035-33042). In this study, we demonstrated that stimulation of RAW 264.7 cells with lipopolysaccharide (LPS) and interferon-gamma (IFN-gamma) increased IRP-1 binding activity, whereas RNA binding of IRP-2 decreased and was followed by a degradation of this protein. Moreover, the decrease of IRP-2 binding/protein levels was associated with a decrease in TfR mRNA levels in LPS/IFN-gamma-treated cells, and these changes were prevented by inhibitors of inducible nitric oxide synthase. Furthermore, LPS/IFN-gamma-stimulated RAW 264.7 cells showed increased rates of ferritin synthesis. These results suggest that NO(+)-mediated degradation of IRP-2 plays a major role in iron metabolism during inflammation.

  7. Interferon-gamma exerts its negative regulatory effect primarily on the earliest stages of murine erythroid progenitor cell development.

    PubMed

    Wang, C Q; Udupa, K B; Lipschitz, D A

    1995-01-01

    Interferon-gamma (INF-gamma) has been shown to suppress erythropoiesis and perhaps to contribute to the anemia of chronic disease. In this study we demonstrated that the concentration of INF gamma required to suppress murine burst forming unit-erythroid (BFU-E) growth was significantly less than that required to suppress colony forming unit-erythroid (CFU-E) growth. INF gamma acted at the most primitive step in erythroid progenitor cell differentiation and proliferation, as inhibition was maximal when added at the time of BFU-E culture initiation. Inhibition was progressively less if INF gamma addition was delayed after culture initiation. The effects of INF gamma on BFU-E did not require the presence of interleukin-1 alpha (IL-1 alpha), tumor necrosis factor-alpha (TNF alpha), or granulocyte macrophage colony stimulating factor (GM-CSF), as its effects were not neutralized by monoclonal antibodies against IL-1 alpha, TNF alpha, or GM-CSF. This applied whether INF gamma was added to culture with individual antibodies or with a combination of all three antibodies. INF gamma was not required for IL-1 alpha- or TNF alpha-induced suppression of BFU-E, as their effects were not neutralized by a monoclonal anti-INF gamma antibody. In contrast, GM-CSF-induced suppression of BFU-E was negated by the simultaneous addition of anti-INF gamma. We have previously shown that the addition of TNF alpha does not suppress BFU-E growth in cultures from marrow depleted of macrophages. Suppression did occur, however, if a small concentration of INF gamma that does not inhibit and increasing concentration of TNF alpha were added to culture, suggesting a synergistic effect between INF-gamma and TNF alpha. These observations suggest that INF gamma is a potent direct inhibitor of erythroid colony growth in vitro. It exerts its negative regulatory effect primarily on the earliest stages of erythroid progenitor cell differentiation and proliferation, as much higher doses are required to

  8. Differential co-promoting activities of alpha, beta and gamma interferons in the murine skin two-stage carcinogenesis model.

    PubMed

    Reiners, J J; Cantu, A; Thai, G; Pavone, A

    1993-03-01

    SENCAR mice develop more papillomas in two-stage skin carcinogenesis protocols if gamma interferon (IFN-gamma) is co-administered with 12-O-tetradecanoylphorbol-13-acetate (TPA) during the promotion phase. In the current study preparations of murine alpha, beta and gamma IFNs were surveyed for their abilities to modulate TPA-dependent promotion and induction of epidermal hyperplasia, inflammation and ornithine decarboxylase activity (ODC). Single or multiple i.p. administrations of IFN-alpha, -beta or -gamma (< or = 2500 units) did not induce epidermal hyperplasia, inflammation or ODC activity. Single or multiple i.p. administrations of IFN-alpha, -beta or -gamma (2500 units) to mice being topically promoted with 0.1 or 1 microgram of TPA did not alter the epidermal hyperplasia induced by the phorbol ester. The vascular permeability of the skin, as evaluated by the extravasation of Evans blue dye, was increased in a dose-dependent fashion by TPA over the range of 0.1-1 microgram. Treatment of mice promoted with 0.1 microgram of TPA with IFN-gamma (> or = 2500 units) significantly increased the skin's vascular permeability. Comparable effects were not obtained with IFN-beta (IFN-alpha not tested). Treatment of TPA-promoted mice with IFN-gamma, and to a lesser extent IFN-beta, weakly potentiated the TPA-dependent induction of epidermal ODC activity. Under conditions in which IFN-gamma had co-promoting activities in an initiation-promotion protocol, co-treatment of initiated mice with 1 microgram of TPA and IFN-alpha or -beta (100-5000 units) did not reproducibly alter tumor latency., or papilloma and carcinoma multiplicities. These findings suggest that the co-promoting activities of IFNs are restricted to the gamma class, and are not uniformly reflected by parameters commonly employed as short-term markers of tumor promotion.

  9. Interferon gamma peptidomimetic targeted to hepatic stellate cells ameliorates acute and chronic liver fibrosis in vivo.

    PubMed

    Bansal, Ruchi; Prakash, Jai; De Ruiter, Marieke; Poelstra, Klaas

    2014-04-10

    Hepatic stellate cells play a crucial role in the pathogenesis of hepatic fibrosis. Thus, pharmacological inhibition of pro-fibrotic activities of these cells might lead to an effective therapy for this disease. Among the potent anti-fibrotics, interferon gamma (IFNγ), a proinflammatory cytokine, is highly efficacious but it failed in clinical trials due to the poor efficacy and multiple adverse effects attributed to the ubiquitous IFNγ receptor (IFNγR) expression. To resolve these drawbacks, we chemically synthesized a chimeric molecule containing (a) IFNγ signaling peptide (IFNγ peptidomimetic, mimγ) that retains the agonistic activities of IFNγ but lacks an extracellular receptor recognition sequence for IFNγR; coupled via heterobifunctional PEG linker to (b) bicyclic platelet derived growth factor beta receptor (PDGFβR)-binding peptide (BiPPB) to induce internalization into the stellate cells that express PDGFβR. The synthesized targeted IFNγ peptidomimetic (mimγ-BiPPB) was extensively investigated for its anti-fibrotic and adverse effects in acute and chronic CCl4-induced liver fibrosis models in mice. Treatment with mimγ-BiPPB, after the onset of disease, markedly inhibited both early and established hepatic fibrosis as reflected by a reduced intrahepatic α-SMA, desmin and collagen-I mRNA expression and protein levels. While untargeted mimγ and BiPPB had no effect, and native IFNγ only induced a moderate reduction. Additionally, no off-target effects, e.g. systemic inflammation, were found with mimγ-BiPPB, which were substantially observed in mice treated with native IFNγ. The present study highlights the beneficial effects of a novel BiPPB mediated cell-specific targeting of IFNγ peptidomimetic to the disease-inducing cells and therefore represents a highly potential therapeutic approach to treat fibrotic diseases. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. Comparison of Tuberculin Skin Test result and interferon gamma response to human PPD in BCG scar positive and negative children.

    PubMed

    Sayyahfar, Shirin; Karimi, Abdollah; Fahimzad, Alireza; Shamshiri, Ahmad Reza

    2014-03-01

    The aim of this study is to compare Tuberculin Skin Test (TST) result and interferon gamma response to human PPD (purified protein derivative), in scar positive and scar negative BCG-vaccinated children. Between August 2007 and May 2008 a total of 236 children aged 1-168 months (mean 21 months) admitted to Mofid Children's Hospital, Tehran, Iran, were enrolled in a cross-sectional study. Each patient was examined for BCG vaccine scar and tested with TST and human PPD-based Interferon Gamma Release Assay (IGRA). Two hundred and twenty one cases out of 236 (44% female, 1-168 months, mean age 21 months) were scar positive of whom 95% TST result was negative. Human PPD-based IGRA was positive in 110 (49.8%), negative in 85 (38.4 %) and indeterminate in 26 (11.8%) of scar positive patients. Fifteen children (40% female, 1-156 months; mean age 42 months) were scar negative. All the scar negative cases were TST negative. Human PPD-based IGRA was positive in 10 (66.7%), negative in 4 (26.7%) and indeterminate in 1 (6.7%) of scar negative patients. Immune responsiveness to human PPD antigens in scar positive and negative children may not correspond with results of the Tuberculin Skin Test. Copyright © 2013 Ministry of Health, Saudi Arabia. Published by Elsevier Ltd. All rights reserved.

  11. Expression of Interferon Lambda 4 Is Associated with Reduced Proliferation and Increased Cell Death in Human Hepatic Cells

    PubMed Central

    Onabajo, Olusegun O.; Porter-Gill, Patricia; Paquin, Ashley; Rao, Nina; Liu, Luyang; Tang, Wei; Brand, Nathan

    2015-01-01

    Interferon lambda 4 (IFN-λ4) is a novel type-III interferon that can be generated only in individuals carrying a ΔG frame-shift allele of an exonic genetic variant (rs368234815-ΔG/TT). The rs368234815-ΔG allele is strongly associated with decreased clearance of hepatitis C virus (HCV) infection. Here, we further explored the biological function of IFN-λ4 expressed in human hepatic cells—a hepatoma cell line HepG2 and fresh primary human hepatocytes (PHHs). We performed live confocal imaging, cell death and proliferation assays, mRNA expression profiling, protein detection, and antibody blocking assays using transient and inducible stable in vitro systems. Not only did we observe significant intracellular retention of IFN-λ4 but also detected secreted IFN-λ4 in the culture media of expressing cells. Secreted IFN-λ4 induced strong activation of the interferon-stimulated genes (ISGs) in IFN-λ4-expressing and surrounding cells in transwell assays. Specifically, in PHHs, secreted IFN-λ4 induced expression of the CXCL10 transcript and a corresponding pro-inflammatory chemokine, IP-10. In IFN-λ4-expressing HepG2 cells, we also observed decreased proliferation and increased cell death. All IFN-λ4-induced phenotypes—activation of ISGs, decreased proliferation, and increased cell death—could be inhibited by an anti-IFN-λ4-specific antibody. Our study offers new insights into biology of IFN-λ4 and its possible role in HCV clearance. PMID:26134097

  12. Identification, Characterization, and Developmental Expression Pattern of Type III Interferon Receptor Gene in the Chinese Goose

    PubMed Central

    Zhou, Qin; Chen, Shun; Qi, Yulin; Zhou, Hao; Wang, Mingshu; Jia, Renyong; Zhu, Dekang; Liu, Mafeng; Liu, Fei; Chen, Xiaoyue; Zhou, Xue; Cheng, Anchun

    2015-01-01

    Interferons, as the first line of defense against the viral infection, play an important role in innate immune responses. Type III interferon (IFN-λ) was a newly identified member of IFN family, which plays IFN-like antiviral activity. Towards a better understanding of the type III interferon system in birds, type III interferon lambda receptor (IFNLR1) was first identified in the Chinese goose. In this paper, we had cloned 1952 bp for goose IFNLR1 (goIFNLR1), including an ORF of 1539 bp, encoding a 512-amino acid protein with a 20 aa predict signal peptide at its N terminal and a 23 aa transmembrane region. The predicted amino acid sequence of goIFNLR1 has 90%, 73%, and 34% identity with duck IFNLR1 (predicted sequence), chicken IFNLR1, and human IFNLR1, respectively. And the age-related tissue distribution of goIFNLR1 was identified by Real Time quantitative PCR (RT-qPCR), we found that the goIFNLR1 has a mainly expression in epithelium-rich tissues similar to other species', such as small intestinal, lung, liver, and stomach. Moreover, a relatively high expression of goIFNLR1 was also observed in the secondary immune tissues (harderian gland and cecal tonsil). The identification and tissue distribution of goIFNLR1 will facilitate further study of the role of IFN-λ in goose antiviral defense. PMID:26064884

  13. Molecular cloning, expression and characterization of Pekin duck interferon-λ.

    PubMed

    Yao, Qingxia; Fischer, Karl P; Arnesen, Karina; Tyrrell, D Lorne; Gutfreund, Klaus S

    2014-09-10

    Interferons (IFNs) are the first line of defense against viral infections in vertebrates. Type III interferon (IFN-λ) is recognized for its key role in innate immunity of tissues of epithelial origin. Here we describe the identification of the Pekin duck IFN-λ ortholog (duIFN-λ). The predicted duIFN-λ protein has an amino acid identity of 63%, 38%, 37% and 33% with chicken IFN-λ and human IFN-λ3, IFN-λ2 and IFN-λ1, respectively. The duck genome contains a single IFN-λ gene that is comprised of five exons and four introns. Recombinant duIFN-λ up-regulated OASL and Mx-1 mRNA in primary duck hepatocytes. Our observations suggest evolutionary conservation of genomic organization and structural features implicated in receptor binding and antiviral activity. The identification and expression of duIFN-λ will facilitate further study of the role of type III IFN in antiviral defense and inflammatory responses of the Pekin duck, a non-mammalian vertebrate and pathogen host with relevance for human and animal health. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. Tim-3-expressing macrophages are functionally suppressed and expanded in oral squamous cell carcinoma due to virus-induced Gal-9 expression.

    PubMed

    Dong, Jianfeng; Cheng, Lijun; Zhao, Minchao; Pan, Xiangfeng; Feng, Zhiqiang; Wang, Dawei

    2017-05-01

    Oropharyngeal head and neck squamous cell carcinoma is a common malignant tumor in the oral cavity. High-risk human papillomavirus 16 infection is a major cause of oropharyngeal head and neck squamous cell carcinoma development. Strong antitumor immune responses, especially CD8 + T cell responses, are thought to be essential to effective cancer treatment and are associated with better prognosis in oropharyngeal head and neck squamous cell carcinoma. In this study, we examined the role of the Tim-3/Gal-9 pathway in oropharyngeal head and neck squamous cell carcinoma patients. We found that Gal-9 expression by CD4 + T cells was increased in human papillomavirus-positive oropharyngeal head and neck squamous cell carcinoma patients, but not in human papillomavirus-negative oropharyngeal head and neck squamous cell carcinoma patients. Increased Gal-9 secretion by CD4 + T cells presented multiple immunosuppressive effects. Coculturing monocytes with high Gal-9-expressing CD4 + T cells resulted in the expansion of Tim-3 + monocytes, which suppressed interferon gamma production by activated CD8 + T cells. Subsequently, total monocytes incubated with exogenous Gal-9, or high Gal-9-expressing CD4 + T cells, suppressed the expression of interferon gamma by CD8 + T cells. Exogenous Gal-9 and high Gal-9-expressing CD4 + T cells also suppressed the secretion of both interleukin 10 and interleukin 12 by monocytes. These effects are Tim-3/Gal-9-dependent because blocking Tim-3 and/or Gal-9 could enhance the support of CD8 + T cell interferon gamma production and the interleukin 10 and interleukin 12 secretion by monocytes. Together, these data suggest that the high Tim-3 expression in monocytes could be utilized by tumor-promoting Gal-9 expression on CD4 + T cells. Immunotherapy in human papillomavirus-positive oropharyngeal head and neck squamous cell carcinoma patients therefore faces an additional challenge posed by Tim-3 and Gal-9 and likely requires the blockade of these

  15. Human endogenous retrovirus expression is inversely related with the up-regulation of interferon-inducible genes in the skin of patients with lichen planus.

    PubMed

    Nogueira, Marcelle Almeida de Sousa; Gavioli, Camila Fátima Biancardi; Pereira, Nátalli Zanete; de Carvalho, Gabriel Costa; Domingues, Rosana; Aoki, Valéria; Sato, Maria Notomi

    2015-04-01

    Lichen planus (LP) is a common inflammatory skin disease of unknown etiology. Reports of a common transactivation of quiescent human endogenous retroviruses (HERVs) support the connection of viruses to the disease. HERVs are ancient retroviral sequences in the human genome and their transcription is often deregulated in cancer and autoimmune diseases. We explored the transcriptional activity of HERV sequences as well as the antiviral restriction factor and interferon-inducible genes in the skin from LP patients and healthy control (HC) donors. The study included 13 skin biopsies from patients with LP and 12 controls. Real-time PCR assay identified significant decrease in the HERV-K gag and env mRNA expression levels in LP subjects, when compared to control group. The expressions of HERV-K18 and HERV-W env were also inhibited in the skin of LP patients. We observed a strong correlation between HERV-K gag with other HERV sequences, regardless the down-modulation of transcripts levels in LP group. In contrast, a significant up-regulation of the cytidine deaminase APOBEC 3G (apolipoprotein B mRNA-editing), and the GTPase MxA (Myxovirus resistance A) mRNA expression level was identified in the LP skin specimens. Other transcript expressions, such as the master regulator of type I interferon-dependent immune responses, STING (stimulator of interferon genes) and IRF-7 (interferon regulatory factor 7), IFN-β and the inflammassome NALP3, had increased levels in LP, when compared to HC group. Our study suggests that interferon-inducible factors, in addition to their role in innate immunity against exogenous pathogens, contribute to the immune control of HERVs. Evaluation of the balance between HERV and interferon-inducible factor expression could possibly contribute to surveillance of inflammatory/malignant status of skin diseases.

  16. Cloning, sequencing, and expression of interferon-γ from elk in North America

    USGS Publications Warehouse

    Sweeney, Steven J.; Emerson, Carlene; Eriks, Inge S.

    2001-01-01

    Eradication of Mycobacterium bovis relies on accurate detection of infected animals, including potential domestic and wildlife reservoirs. Available diagnostic tests lack the sensitivity and specificity necessary for accurate detection, particularly in infected wildlife populations. Recently, an in vitro diagnostic test for cattle which measures plasma interferon-gamma (IFN-γ) levels in blood following in vitro incubation with M. bovis purified protein derivative has been enveloped. This test appears to have increased sensitivity over traditional testing. Unfortunately, it does not detect IFN-γ from Cervidae. To begin to address this problem, the IFN-γ gene from elk (Cervus elaphus) was cloned, sequenced, expressed, and characterized. cDNA was cloned from mitogen stimulated peripheral blood mononuclear cells. The predicted amino acid (aa) sequence was compared to known sequences from cattle, sheep, goats, red deer (Cervus elaphus), humans, and mice. Biological activity of the recombinant elk IFN-γ (rElkIFN-γ) was confirmed in a vesicular stomatitis virus cytopathic effect reduction assay. Production of monoclonal antibodies to IFN-γ epitopes conserved between ruminant species could provide an important tool for the development of reliable, practical diagnostic assays for detection of a delayed type hypersensitivity response to a variety of persistent infectious agents in ruminants, including M. bovis and Brucella abortus. Moreover, development of these reagents will aid investigators in studies to explore immunological responses of elk that are associated with resistance to infectious diseases.

  17. Aging is Associated with Impaired Renal Function, INF-gamma Induced Inflammation and with Alterations in Iron Regulatory Proteins Gene Expression.

    PubMed

    Costa, Elísio; Fernandes, João; Ribeiro, Sandra; Sereno, José; Garrido, Patrícia; Rocha-Pereira, Petronila; Coimbra, Susana; Catarino, Cristina; Belo, Luís; Bronze-da-Rocha, Elsa; Vala, Helena; Alves, Rui; Reis, Flávio; Santos-Silva, Alice

    2014-12-01

    Our aim was to contribute to a better understanding of the pathophysiology of anemia in elderly, by studying how aging affects renal function, iron metabolism, erythropoiesis and the inflammatory response, using an experimental animal model. The study was performed in male Wistar, a group of young rats with 2 months age and an old one with 18 months age. Old rats presented a significant higher urea, creatinine, interferon (INF)-gamma, ferritin and soluble transferrin receptor serum levels, as well as increased counts of reticulocytes and RDW. In addition, these rats showed significant lower erythropoietin (EPO) and iron serum levels. Concerning gene expression of iron regulatory proteins, old rats presented significantly higher mRNA levels of hepcidin (Hamp), transferrin (TF), transferrin receptor 2 (TfR2) and hemojuvelin (HJV); divalent metal transporter 1 (DMT1) mRNA levels were significantly higher in duodenal tissue; EPO gene expression was significantly higher in liver and lower in kidney, and the expression of the EPOR was significantly higher in both liver and kidney. Our results showed that aging is associated with impaired renal function, which could be in turn related with the inflammatory process and with a decline in EPO renal production. Moreover, we also propose that aging may be associated with INF-gamma-induced inflammation and with alterations upon iron regulatory proteins gene expression.

  18. Induced expression of mRNA for IL-5, IL-6, TNF-alpha, MIP-2 and IFN-gamma in immunologically activated rat peritoneal mast cells: inhibition by dexamethasone and cyclosporin A.

    PubMed

    Williams, C M; Coleman, J W

    1995-10-01

    We examined the capacity of purified rat peritoneal connective tissue-type mast cells (PMC) to express mRNA for several cytokines. Stimulation of PMC with anti-IgE for 4 hr induced the expression of mRNA encoding interleukin-5 (IL-5), IL-6, tumour necrosis factor-alpha (TNF-alpha), macrophage inflammatory protein-2 (MIP-2) and interferon-gamma (IFN-gamma). Unstimulated PMC expressed detectable mRNA for TNF-alpha but not for the other four cytokines. Incubation of PMC with cyclosporin A (CsA) or dexamethasone (DEX), each at 10(-6) M for 24 hr, significantly inhibited the induced expression of mRNA for each of the five cytokines, and also inhibited release of biologically active TNF-alpha. Throughout these experiments mRNA levels of the housekeeping gene G3PDH were not altered by stimulation with anti-IgE or incubation with CsA or DEX. We conclude that immunological activation of rat PMC induces gene expression of several cytokines and that expression of these genes can be inhibited by immunosuppressive drugs.

  19. Induced expression of mRNA for IL-5, IL-6, TNF-alpha, MIP-2 and IFN-gamma in immunologically activated rat peritoneal mast cells: inhibition by dexamethasone and cyclosporin A.

    PubMed Central

    Williams, C M; Coleman, J W

    1995-01-01

    We examined the capacity of purified rat peritoneal connective tissue-type mast cells (PMC) to express mRNA for several cytokines. Stimulation of PMC with anti-IgE for 4 hr induced the expression of mRNA encoding interleukin-5 (IL-5), IL-6, tumour necrosis factor-alpha (TNF-alpha), macrophage inflammatory protein-2 (MIP-2) and interferon-gamma (IFN-gamma). Unstimulated PMC expressed detectable mRNA for TNF-alpha but not for the other four cytokines. Incubation of PMC with cyclosporin A (CsA) or dexamethasone (DEX), each at 10(-6) M for 24 hr, significantly inhibited the induced expression of mRNA for each of the five cytokines, and also inhibited release of biologically active TNF-alpha. Throughout these experiments mRNA levels of the housekeeping gene G3PDH were not altered by stimulation with anti-IgE or incubation with CsA or DEX. We conclude that immunological activation of rat PMC induces gene expression of several cytokines and that expression of these genes can be inhibited by immunosuppressive drugs. Images Figure 1 Figure 2 Figure 3 PMID:7490125

  20. [Allergic asthma and interleukins 2, 4, 5, 6 and 12 and gamma interferon levels].

    PubMed

    Bastida Segura, Diana Lyzbeth; López Velásquez, Benjamin; Castrejón Vázquez, María Isabel; Galicia Tapía, Jorge; Cano Altamirano, Silvia; Miranda Feria, Alfonso Javier

    2004-01-01

    Asthma is an inflammatory chronic illness, in which mastocyt cells, basophils, T lymphocytes, eosinophils and cytokines play a role. Its association with the production of TH2 cytokines is not well known, but it is considered an aberrant immune response, yielding the activation and recruitment of a number of effector cells (mastocyts/eosinophils) and the appearance of clinical symptoms. To determine the serum values of the interleukins 2, 4, 5, 6 and 12 and gamma interferon in relation to the severity degree of asthma and the time of immunotherapy in patients with stable chronic allergic bronchial asthma. Clinical records of allergic asthmatic patients from the external consultation at Servicio de Alergia e Immunología Clínica were reviewed in a period of 12 months (1st January 2002 to 1st January 2003) and those of healthy volunteers, forming three groups: Group 1, allergic asthmatics with immunotherapy less than 24 months; Group 2, allergic asthmatics with more than 24 months of immunotherapy, and Group 3, healthy volunteers (control group). Previous informed consent, a serum sample was taken of all subjects. Ninety-two subjects were included: 41 (45%) allergic asthmatics and 51 (55%) healthy volunteers. Significant differences were found in interleukins 2, 4, 5, 6 and 12 levels between healthy volunteers and asthmatics without relating the immunotherapy time. In the total group gamma interferon levels were not found. A relation of interleukins Th2 levels with the severity degree of asthma was not found. Differences of serum interleukins Th1 and Th2 in allergic patients related to immunotherapy time were not significant; even though, irrespective of immunotherapy time, IgG levels were always high. Patients with allergic asthma have a predominance of serum interleukins Th2 and, despite of the immunotherapy, in the maintaining phase, these continue high, which may be due to an immune system dysregulation maybe including other factors. Immunotherapy continues

  1. Mangiferin inhibits macrophage classical activation via downregulating interferon regulatory factor 5 expression

    PubMed Central

    Wei, Zhiquan; Yan, Li; Chen, Yixin; Bao, Chuanhong; Deng, Jing; Deng, Jiagang

    2016-01-01

    Mangiferin is a natural polyphenol and the predominant effective component of Mangifera indica Linn. leaves. For hundreds of years, Mangifera indica Linn. leaf has been used as an ingredient in numerous traditional Chinese medicine preparations for the treatment of bronchitis. However, the pharmacological mechanism of mangiferin in the treatment of bronchitis remains to be elucidated. Macrophage classical activation is important role in the process of bronchial airway inflammation, and interferon regulatory factor 5 (IRF5) has been identified as a key regulatory factor for macrophage classical activation. The present study used the THP-1 human monocyte cell line to investigate whether mangiferin inhibits macrophage classical activation via suppressing IRF5 expression in vitro. THP-1 cells were differentiated to macrophages by phorbol 12-myristate 13-acetate. Macrophages were polarized to M1 macrophages following stimulation with lipopolysaccharide (LPS)/interferon-γ (IFN-γ). Flow cytometric analysis was conducted to detect the M1 macrophages. Reverse transcription-quantitative polymerase chain reaction was used to investigate cellular IRF5 gene expression. Levels of proinflammatory cytokines and IRF5 were assessed following cell culture and cellular homogenization using enzyme-linked immunosorbent assay. IRF5 protein and nuclei co-localization was performed in macrophages with laser scanning confocal microscope immunofluorescence analysis. The results of the present study demonstrated that mangiferin significantly inhibits LPS/IFN-γ stimulation-induced classical activation of macrophages in vitro and markedly decreases proinflammatory cytokine release. In addition, cellular IRF5 expression was markedly downregulated. These results suggest that the inhibitory effect of mangiferin on classical activation of macrophages may be exerted via downregulation of cellular IRF5 expression levels. PMID:27277156

  2. Dietary Selenium Levels Affect Selenoprotein Expression and Support the Interferon-γ and IL-6 Immune Response Pathways in Mice

    PubMed Central

    Tsuji, Petra A.; Carlson, Bradley A.; Anderson, Christine B.; Seifried, Harold E.; Hatfield, Dolph L.; Howard, Michael T.

    2015-01-01

    Selenium is an essential element that is required to support a number of cellular functions and biochemical pathways. The objective of this study was to examine the effects of reduced dietary selenium levels on gene expression to assess changes in expression of non-selenoprotein genes that may contribute to the physiological consequences of selenium deficiency. Mice were fed diets that were either deficient in selenium or supplemented with selenium in the form of sodium selenite for six weeks. Differences in liver mRNA expression and translation were measured using a combination of ribosome profiling, RNA-Seq, microarrays, and qPCR. Expression levels and translation of mRNAs encoding stress-related selenoproteins were shown to be up-regulated by increased selenium status, as were genes involved in inflammation and response to interferon-γ. Changes in serum cytokine levels were measured which confirmed that interferon-γ, as well as IL-6, were increased in selenium adequate mice. Finally, microarray and qPCR analysis of lung tissue demonstrated that the selenium effects on immune function are not limited to liver. These data are consistent with previous reports indicating that adequate selenium levels can support beneficial immune responses, and further identify the IL-6 and interferon-γ pathways as being responsive to dietary selenium intake. PMID:26258789

  3. Association of monoclonal expansion of Epstein-Barr virus-negative CD158a+ NK cells secreting large amounts of gamma interferon with hemophagocytic lymphohistiocytosis.

    PubMed

    López-Alvarez, María R; Martínez-Sánchez, María V; Salgado-Cecilia, María G; Campillo, José A; Heine-Suñer, Damian; Villar-Permuy, Florentina; Fuster, José L; Bas, Agueda; Gil-Herrera, Juana; Muro, Manuel; García-Alonso, Ana M; Alvarez-López, María R; Minguela, Alfredo

    2009-01-01

    We report the first case of hemophagocytic lymphohistiocytosis (HLH) induced by the monoclonal expansion of Epstein-Barr virus (EBV)-negative NK cells. Consanguinity of the patient's parents made it necessary to discard familial HLH in the patient and her sister with identical HLA markers and demonstrate that no cause other than the expansion of NK cells, which secrete high levels of gamma interferon, was inducing HLH in this patient.

  4. Interferon gamma, an important marker of response to immune checkpoint blockade in non-small cell lung cancer and melanoma patients

    PubMed Central

    Karachaliou, Niki; Gonzalez-Cao, Maria; Crespo, Guillermo; Drozdowskyj, Ana; Aldeguer, Erika; Gimenez-Capitan, Ana; Teixido, Cristina; Molina-Vila, Miguel Angel; Viteri, Santiago; De Los Llanos Gil, Maria; Algarra, Salvador Martin; Perez-Ruiz, Elisabeth; Marquez-Rodas, Ivan; Rodriguez-Abreu, Delvys; Blanco, Remedios; Puertolas, Teresa; Royo, Maria Angeles; Rosell, Rafael

    2018-01-01

    Background: Programmed death-ligand 1 (PD-L1) may be induced by oncogenic signals or can be upregulated via interferon gamma (IFN-γ). We have explored whether the expression of IFNG, the gene encoding IFN-γ, is associated with clinical response to the immune checkpoint blockade in non-small cell lung cancer (NSCLC) and melanoma patients. The role of inflammation-associated transcription factors STAT3, IKBKE, STAT1 and other associated genes has also been examined. Methods: Total RNA from 17 NSCLC and 21 melanoma patients was analyzed by quantitative reverse transcription PCR. STAT3 and Rantes, YAP1 and CXCL5, DNMT1, RIG1 and TET1, EOMES, IFNG, PD-L1 and CTLA4, IKBKE and NFATC1 mRNA were examined. PD-L1 protein expression in tumor and immune cells and stromal infiltration of CD8+ T-cells were also evaluated. Progression-free survival and overall survival were estimated. Results: A total of 17 NSCLC patients received nivolumab and 21 melanoma patients received pembrolizumab. Progression-free survival with nivolumab was significantly longer in NSCLC patients with high versus low IFNG expression (5.1 months versus 2 months, p = 0.0124). Progression-free survival with pembrolizumab was significantly longer in melanoma patients with high versus low IFNG expression (5.0 months versus 1.9 months, p = 0.0099). Significantly longer overall survival was observed for melanoma patients with high versus low IFNG expression (not reached versus 10.2 months p = 0.0183). There was a trend for longer overall survival for NSCLC patients with high versus low IFNG expression. Conclusions: IFN-γ is an important marker for prediction of response to immune checkpoint blockade. Further research is warranted in order to validate whether IFNG is more accurate than PD-L1. PMID:29383037

  5. Expression profiles of adult T-cell leukemia–lymphoma and associations with clinical responses to zidovudine and interferon α

    PubMed Central

    ALIZADEH, ASH A.; BOHEN, SEAN P.; LOSSOS, CHEN; MARTINEZ-CLIMENT, JOSE A.; RAMOS, JUAN CARLOS; CUBEDO-GIL, ELENA; HARRINGTON, WILLIAM J.; LOSSOS, IZIDORE S.

    2014-01-01

    Adult T-cell leukemia–lymphoma (ATLL) is an HTLV-1-associated lymphoproliferative malignancy that is frequently fatal. We compared gene expression profiles (GEPs) of leukemic specimens from nine patients with ATLL at the time of diagnosis and immediately after combination therapy with zidovudine (AZT) and interferon α (IFNα). GEPs were also related to genetic aberrations determined by comparative genomic hybridization. We identified several genes anomalously over-expressed in the ATLL leukemic cells at the mRNA level, including LYN, CSPG2, and LMO2, and confirmed LMO2 expression in ATLL cells at the protein level. In vivo AZT–IFNα therapy evoked a marked induction of interferon-induced genes accompanied by repression of cell-cycle regulated genes, including those encoding ribosomal proteins. Remarkably, patients not responding to AZT–IFNα differed most from responding patients in lower expression of these same IFN-responsive genes, as well as components of the antigen processing and presentation apparatus. Demonstration of specific gene expression signatures associated with response to AZT–IFNα therapy may provide novel insights into the mechanisms of action in ATLL. PMID:20370541

  6. Interferon-gamma improves impaired dentinogenic and immunosuppressive functions of irreversible pulpitis-derived human dental pulp stem cells

    PubMed Central

    Sonoda, Soichiro; Yamaza, Haruyoshi; Ma, Lan; Tanaka, Yosuke; Tomoda, Erika; Aijima, Reona; Nonaka, Kazuaki; Kukita, Toshio; Shi, Songtao; Nishimura, Fusanori; Yamaza, Takayoshi

    2016-01-01

    Clinically, irreversible pulpitis is treated by the complete removal of pulp tissue followed by replacement with artificial materials. There is considered to be a high potential for autologous transplantation of human dental pulp stem cells (DPSCs) in endodontic treatment. The usefulness of DPSCs isolated from healthy teeth is limited. However, DPSCs isolated from diseased teeth with irreversible pulpitis (IP-DPSCs) are considered to be suitable for dentin/pulp regeneration. In this study, we examined the stem cell potency of IP-DPSCs. In comparison with healthy DPSCs, IP-DPSCs expressed lower colony-forming capacity, population-doubling rate, cell proliferation, multipotency, in vivo dentin regeneration, and immunosuppressive activity, suggesting that intact IP-DPSCs may be inadequate for dentin/pulp regeneration. Therefore, we attempted to improve the impaired in vivo dentin regeneration and in vitro immunosuppressive functions of IP-DPSCs to enable dentin/pulp regeneration. Interferon gamma (IFN-γ) treatment enhanced in vivo dentin regeneration and in vitro T cell suppression of IP-DPSCs, whereas treatment with tumor necrosis factor alpha did not. Therefore, these findings suggest that IFN-γ may be a feasible modulator to improve the functions of impaired IP-DPSCs, suggesting that autologous transplantation of IFN-γ-accelerated IP-DPSCs might be a promising new therapeutic strategy for dentin/pulp tissue engineering in future endodontic treatment. PMID:26775677

  7. Arsenic enhances the apoptosis induced by interferon gamma: key role of IRF-1.

    PubMed

    El Bougrini, J; Pampin, M; Chelbi-Alix, M K

    2006-05-15

    Interferons (IFNs) and arsenic trioxide (As2O3) are known inhibitors of cell proliferation and have been used in the treatment of certain forms of malignancy. IFNgamma treatment of cells leads to tyrosine phosphorylation of STAT1 followed by dimerization that accumulates in the nucleus. This is followed by DNA binding, activation of target gene transcription, dephosphorylation, and return to the cytoplasm. We have shown earlier that IFNgamma and As2O3 act synergistically in acute promyelocytic leukemia cells to upregulate IRF-1 expression and to induce apoptosis. Here, we show that in the human fibrosarcoma cell line 2fTGH, As2O3 prolongs IFNgamma-induced STAT1 phosphorylation resulting in persistent binding of STAT1 to GAS motif leading to an increase in IRF-1 expression which correlated with both higher anti-proliferative effect and increased apoptosis. These biological responses induced by IFNgamma alone or in combination with As2O3 were abolished when IRF-1 expression was down-regulated by RNA interference, thus demonstrating the key role of IRF-1.

  8. No Love Lost Between Viruses and Interferons.

    PubMed

    Fensterl, Volker; Chattopadhyay, Saurabh; Sen, Ganes C

    2015-11-01

    The interferon system protects mammals against virus infections. There are several types of interferons, which are characterized by their ability to inhibit virus replication and resultant pathogenesis by triggering both innate and cell-mediated immune responses. Virus infection is sensed by a variety of cellular pattern-recognition receptors and triggers the synthesis of interferons, which are secreted by the infected cells. In uninfected cells, cell surface receptors recognize the secreted interferons and activate intracellular signaling pathways that induce the expression of interferon-stimulated genes; the proteins encoded by these genes inhibit different stages of virus replication. To avoid extinction, almost all viruses have evolved mechanisms to defend themselves against the interferon system. Consequently, a dynamic equilibrium of survival is established between the virus and its host, an equilibrium that can be shifted to the host's favor by the use of exogenous interferon as a therapeutic antiviral agent.

  9. Individual and combined tumoricidal effects of dexamethasone and interferons on human leukocyte cell lines.

    PubMed

    Pan, L Y; Guyre, P M

    1988-02-01

    We investigated the influence of glucocorticoids on two effects of interferons (IFNs) which are thought to relate to their antitumor actions: cytotoxic activity and induction of HLA antigen expression. We treated human myeloid cell lines (U-937, HL-60, THP-1, K-562, and KG-1a), and T-(MOLT-4) and B- (Daudi) lymphoblastic cell lines with concentrations of IFN-alpha, IFN-gamma, and dexamethasone (Dex) which are commonly achieved in the circulation following therapeutic administration. The results show that for every cell line except Daudi, the greatest inhibition of cell growth occurred when IFN-gamma and Dex treatments were combined. The advantage of combined IFN-gamma and Dex treatment over treatment with either agent alone was most dramatic for the three cell lines (U-937, HL-60, and THP-1) which have monocytoid characteristics. There was also more growth inhibition by the combination of IFN-alpha and Dex than by either agent alone for all seven cell lines tested. The induction of HLA antigen expression by IFN-alpha and IFN-gamma, an effect which could increase recognition of the tumor cells by the immune system, was as great or greater in the presence of Dex as in its absence. These results demonstrate that glucocorticoids do not inhibit, and in some cases enhance, two effects of IFNs that appear to be related to their antitumor actions: inhibition of tumor cell proliferation and enhancement of HLA antigen expression.

  10. Type-I interferon receptor expression: its circadian rhythm and downregulation after interferon-alpha administration in peripheral blood cells from renal cancer patients.

    PubMed

    Shiba, Masahiro; Nonomura, Norio; Nakai, Yasutomo; Nakayama, Masashi; Takayama, Hitoshi; Inoue, Hitoshi; Tsujimura, Akira; Nishimura, Kazuo; Okuyama, Akihiko

    2009-04-01

    To investigate the regulation of interferon-alpha (IFN-alpha) receptor expression in metastatic renal cell carcinoma (RCC) after IFN-alpha administration. Blood sampling was carried out in eight patients with metastatic RCC and six healthy volunteers. Flow-cytometric analysis using a monoclonal antibody against the active subunit of the type-I IFN-alpha receptor (IFNAR2) was carried out to examine the circadian rhythm of IFNAR2 expression in peripheral blood mononuclear cells (PBMC) as well as its downregulation after IFN-alpha administration. According to its circadian rhythm IFNAR2 in PBMC had a peak expression at night. Once IFN-alpha is administered, IFNAR2 levels in PBMC showed downregulation within 48 h and recovered within another 48 h. Our findings might support the establishment of an optimal schedule for IFN-alpha administration.

  11. Myxoma virus M-T7, a secreted homolog of the interferon-gamma receptor, is a critical virulence factor for the development of myxomatosis in European rabbits.

    PubMed

    Mossman, K; Nation, P; Macen, J; Garbutt, M; Lucas, A; McFadden, G

    1996-01-01

    Myxoma virus is a leporipoxvirus of New World rabbits (Sylvilagus sp.) that induces a rapidly lethal infection known as myxomatosis in the European rabbit (Oryctolagus cuniculus). Like all poxviruses, myxoma virus encodes a plethora of proteins to circumvent or inhibit a variety of host antiviral immune mechanisms. M-T7, the most abundantly secreted protein of myxoma virus-infected cells, was originally identified as an interferon-gamma receptor homolog (Upton, Mossman, and McFadden, Science 258, 1369-1372, 1992). Here, we demonstrate that M-T7 is dispensable for virus replication in cultured cells but is a critical virulence factor for virus pathogenesis in European rabbits. Disruption of both copies of the M-T7 gene in myxoma virus was achieved by the deletion of 372 bp of M-T7 coding sequences, replacement with a selectable marker, p7.5Ecogpt, and selection of a recombinant virus (vMyxlac-T7gpt) resistant to mycophenolic acid. vMyxlac-T7gpt expressed no detectable M-T7 protein and infected cells supernatants were devoid of any detectable interferon-gamma binding activities. Immunohistochemical staining with anti-beta-galactosidase and anti-CD43 antibodies demonstrated that in vMyxlac-T7gpt-infected rabbits the loss of M-T7 not only caused a dramatic reduction in disease symptoms and viral dissemination to secondary sites, but also dramatically influenced host leukocyte behavior. Notably, primary lesions in wild-type virus infections were generally underlayed by large masses of inflammatory cells that did not effectively migrate into the dermal sites of viral replication, whereas in vMyxlac-T7gpt infections this apparent block to leukocyte influx was relieved. A second major phenotypic distinction noted for the M-T7 knockout virus was the extensive activation of lymphocytes in secondary immune organs, particularly the spleen and lymph nodes, by Day 4 of the infection. This is in stark contrast to infection by wild-type myxoma virus, which results in relatively

  12. Human B cells fail to secrete type I interferons upon cytoplasmic DNA exposure.

    PubMed

    Gram, Anna M; Sun, Chenglong; Landman, Sanne L; Oosenbrug, Timo; Koppejan, Hester J; Kwakkenbos, Mark J; Hoeben, Rob C; Paludan, Søren R; Ressing, Maaike E

    2017-11-01

    Most cells are believed to be capable of producing type I interferons (IFN I) as part of an innate immune response against, for instance, viral infections. In macrophages, IFN I is potently induced upon cytoplasmic exposure to foreign nucleic acids. Infection of these cells with herpesviruses leads to triggering of the DNA sensors interferon-inducible protein 16 (IFI16) and cyclic GMP-AMP (cGAMP) synthase (cGAS). Thereby, the stimulator of interferon genes (STING) and the downstream molecules TANK-binding kinase 1 (TBK1) and interferon regulatory factor 3 (IRF3) are sequentially activated culminating in IFN I secretion. Human gamma-herpesviruses, such as Epstein-Barr virus (EBV), exploit B cells as a reservoir for persistent infection. In this study, we investigated whether human B cells, similar to macrophages, engage the cytoplasmic DNA sensing pathway to induce an innate immune response. We found that the B cells fail to secrete IFN I upon cytoplasmic DNA exposure, although they express the DNA sensors cGAS and IFI16 and the signaling components TBK1 and IRF3. In primary human B lymphocytes and EBV-negative B cell lines, this deficiency is explained by a lack of detectable levels of the central adaptor protein STING. In contrast, EBV-transformed B cell lines did express STING, yet both these lines as well as STING-reconstituted EBV-negative B cells did not produce IFN I upon dsDNA or cGAMP stimulation. Our combined data show that the cytoplasmic DNA sensing pathway is dysfunctional in human B cells. This exemplifies that certain cell types cannot induce IFN I in response to cytoplasmic DNA exposure providing a potential niche for viral persistence. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  13. Dynamic expression profiling of type I and type III interferon-stimulated hepatocytes reveals a stable hierarchy of gene expression.

    PubMed

    Bolen, Christopher R; Ding, Siyuan; Robek, Michael D; Kleinstein, Steven H

    2014-04-01

    Despite activating similar signaling cascades, the type I and type III interferons (IFNs) differ in their ability to antagonize virus replication. However, it is not clear whether these cytokines induce unique antiviral states, particularly in the liver, where the clinically important hepatitis B and C viruses cause persistent infection. Here, clustering and promoter analyses of microarray-based gene expression profiling were combined with mechanistic studies of signaling pathways to dynamically characterize the transcriptional responses induced by these cytokines in Huh7 hepatoma cells and primary human hepatocytes. Type I and III IFNs differed greatly in their level of interferon-stimulated gene (ISG) induction with a clearly detectable hierarchy (IFN-β > IFN-α > IFN-λ3 > IFN-λ1 > IFN-λ2). Notably, although the hierarchy identified varying numbers of differentially expressed genes when quantified using common statistical thresholds, further analysis of gene expression over multiple timepoints indicated that the individual IFNs do not in fact regulate unique sets of genes. The kinetic profiles of IFN-induced gene expression were also qualitatively similar with the important exception of IFN-α. While stimulation with either IFN-β or IFN-λs resulted in a similar long-lasting ISG induction, IFN-α signaling peaked early after stimulation then declined due to a negative feedback mechanism. The quantitative expression hierarchy and unique kinetics of IFN-α reveal potential specific roles for individual IFNs in the immune response, and elucidate the mechanism behind previously observed differences in IFN antiviral activity. While current clinical trials are focused on IFN-λ1 as a potential antiviral therapy, the finding that IFN-λ3 invariably possesses the highest activity among type III IFNs suggests that this cytokine may have superior clinical activity. © 2014 by the American Association for the Study of Liver Diseases.

  14. Effects of isolation on interferon production and hematological and immunological parameters

    NASA Technical Reports Server (NTRS)

    Sonnenfeld, G.; Measel, J.; Loken, M. R.; Degioanni, J.; Follini, S.; Galvagno, A.; Montalbini, M.

    1992-01-01

    A 27-year-old woman was maintained in an isolated state for 131 days in Carlsbad Caverns, New Mexico. Her diet was vitamin D-depleted. Determinations on the effects of such isolation on levels and activities of peripheral blood cells that are important for hematological homeostasis and immunological function were carried out. Throughout the duration of the study, the percentage of lymphoid cells that expressed CD3, CD4, CD8, CD19, Leu 8, and other markers remained relatively constant although the absolute numbers of these cells varied. Although the percentage of natural killer (NK) cells did not vary, the activity of these cells did change. NK cell activity became elevated as the isolation study progressed. Production of interferon-gamma (IFN-gamma) in response to mitogen stimulation was higher than expected throughout the isolation periods, but returned to the normal range after termination of the isolation. Red and white cell counts dropped significantly upon entering isolation, but soon returned to normal.

  15. Comparative gene expression profiles induced by PPAR{gamma} and PPAR{alpha}/{gamma} agonists in rat hepatocytes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rogue, Alexandra; Universite de Rennes 1, 35065 Rennes Cedex; Biologie Servier, 45520 Gidy

    2011-07-01

    Species-differential toxic effects have been described with PPAR{alpha} and PPAR{gamma} agonists between rodent and human liver. PPAR{alpha} agonists (fibrates) are potent hypocholesterolemic agents in humans while they induce peroxisome proliferation and tumors in rodent liver. By contrast, PPAR{gamma} agonists (glitazones) and even dual PPAR{alpha}/{gamma} agonists (glitazars) have caused idiosyncratic hepatic and nonhepatic toxicities in human without evidence of any damage in rodent during preclinical studies. The mechanisms involved in such differences remain largely unknown. Several studies have identified the major target genes of PPAR{alpha} agonists in rodent liver while no comprehensive analysis has been performed on gene expression changes inducedmore » by PPAR{gamma} and dual PPAR{alpha}/{gamma} agonists. Here, we investigated transcriptomes of rat hepatocytes after 24 h treatment with two PPAR{gamma} (troglitazone and rosiglitazone) and two PPAR{alpha}/{gamma} (muraglitazar and tesaglitazar) agonists. Although, hierarchical clustering revealed a gene expression profile characteristic of each PPAR agonist class, only a limited number of genes was specifically deregulated by glitazars. Functional analyses showed that many genes known as PPAR{alpha} targets were also modulated by both PPAR{gamma} and PPAR{alpha}/{gamma} agonists and quantitative differences in gene expression profiles were observed between these two classes. Moreover, most major genes modulated in rat hepatocytes were also found to be deregulated in rat liver after tesaglitazar treatment. Taken altogether, these results support the conclusion that differential toxic effects of PPAR{alpha} and PPAR{gamma} agonists in rodent liver do not result from transcriptional deregulation of major PPAR target genes but rather from qualitative and/or quantitative differential responses of a small subset of genes.« less

  16. Major histocompatibility complex class II molecule expression on muscle cells is regulated by differentiation: implications for the immunopathogenesis of muscle autoimmune diseases.

    PubMed

    Mantegazza, R; Gebbia, M; Mora, M; Barresi, R; Bernasconi, P; Baggi, F; Cornelio, F

    1996-08-01

    Major histocompatibility complex (MHC) class II molecules are expressed on myoblasts after interferon-gamma (IFN-gamma) treatment, suggesting a muscle cell involvement in antigen presentation in inflammatory myopathies. However, they were not observed on normal or pathological myofibers. This discrepancy might be related to different responsiveness of developmentally differentiated muscle cells to IFN-gamma. Myoblasts expressed class II transcripts and proteins after IFN-gamma, while myotubes and innervated contracting muscle cells did not show staining for class II molecules. At all cell stages no loss of IFN-gamma receptor was detected indicating that myofiber maturation blocks their capacity to express MHC class II molecules. This suggests that completely differentiated myofibers cannot participate in class II restricted immunological reactions.

  17. Effects of type I/type II interferons and transforming growth factor-beta on B-cell differentiation and proliferation. Definition of costimulation and cytokine requirements for immunoglobulin synthesis and expression.

    PubMed

    Estes, D M; Tuo, W; Brown, W C; Goin, J

    1998-12-01

    In this report, we sought to determine the role of selected type I interferons [interferon-alpha (IFN-alpha) and interferon-tau (IFN-tau)], IFN-gamma and transforming growth factor-beta (TGF-beta) in the regulation of bovine antibody responses. B cells were stimulated via CD40 in the presence or absence of B-cell receptor (BCR) cross-linking. IFN-alpha enhanced IgM, IgG2 and IgA responses but did not enhance IgG1 responses. BCR signalling alone was more effective at inducing IgG2 responses with IFN-alpha than dual cross-linking with CD40. Recombinant ovine IFN-tau was less effective at inducing IgG2 responses when compared with IFN-alpha, though IgA responses were similar in magnitude following BCR cross-linking. At higher concentrations, IFN-tau enhanced IgA responses greater than twofold over the levels observed with IFN-alpha. Previous studies have shown that addition of IFN-gamma to BCR or pokeweed mitogen-activated bovine B cells stimulates IgG2 production. However, following CD40 stimulation alone, IFN-gamma was relatively ineffective at stimulating high-rate synthesis of any non-IgM isotype. Dual cross-linking via CD40 and the BCR resulted in decreased synthesis of IgM with a concomitant increase in IgA and similar levels of IgG2 production to those obtained via the BCR alone. We also assessed the effects of endogenous and exogenous TGF-beta on immunoglobulin synthesis by bovine B cells. Exogenous TGF-beta stimulates both IgG2 and IgA production following CD40 and BCR cross-linking in the presence of IL-2. Blocking endogenous TGF-beta did not inhibit the up-regulation of IgG2 or IgA by interferons.

  18. Two distinct interferon-γ genes in Tetraodon nigroviridis: Functional analysis during Vibrio parahaemolyticus infection.

    PubMed

    Peng, Wan; Lu, Dan-Qi; Li, Gao-Fei; Zhang, Xu; Yao, Mi; Zhang, Yong; Lin, Hao-Ran

    2016-02-01

    Interferon gamma (IFNγ) is a Th1 cytokine that plays a very important role in almost all phases of immune and inflammatory responses. In this study, we explored the functions of IFNγ1 and IFNγ2 of Tetraodon nigroviridis. Treating T. nigroviridis spleen and head kidney cells in vitro with recombinant T. nigroviridis IFNγ1 protein (rTn IFNγ1) or recombinant T. nigroviridis IFNγ2 protein (rTn IFNγ2) enhanced their nitric oxide responses. Both rTn IFNγ1 and rTn IFNγ2 also induced the expression of interferon-stimulated gene 15 (ISG15), a common anti-viral gene, although the expression of the interferon-inducible Mx gene was markedly inhibited by rTn IFNγ1 and was induced by rTn IFNγ2. The in vivo effects of rTn IFNγ1 and rTn IFNγ2 on Vibrio parahaemolyticus (V. parahaemolyticus) infection were assessed by intraperitoneally injecting rTn IFNγ1 or rTn IFNγ2 (100 ng) and V. parahaemolyticus (8 × 10(10)CFU/mL) into T. nigroviridis. A comparison of the group treated only with V. parahaemolyticus and those also treated with rTn IFNγ1 or rTn IFNγ2 showed that neither of these IFNγs protected T. nigroviridis from V. parahaemolyticus infection. However, rTn IFNγ1 more rapidly and robustly promoted inflammatory responses compared with rTn IFNγ2, whereas rTn IFNγ2 was involved in inducing the host to develop a more effective response earlier during the later stage of a V. parahaemolyticus infection. Moreover, microRNA-29b (miR-29b) expression is inversely correlated with IFNγ2 expression in T. nigroviridis. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. Recombinant interferon-gamma secreted by Chinese hamster ovary-320 cells cultivated in suspension in protein-free media is protected against extracellular proteolysis by the expression of natural protease inhibitors and by the addition of plant protein hydrolysates to the culture medium.

    PubMed

    Mols, J; Peeters-Joris, C; Wattiez, R; Agathos, S N; Schneider, Y-J

    2005-01-01

    Biosafety requirements increasingly restrict the cultivation of mammalian cells producing therapeutic glycoproteins to conditions that are devoid of any compound of animal origin. On cultivation in serum-free media, the proteases inhibitors, usually found in serum, cannot protect secreted recombinant proteins against unwanted endogenous proteolysis. Chinese hamster ovary (CHO) cells, secreting recombinant human interferon-gamma (CHO-320 cell line) and cultivated in suspension in an original protein-free medium, expressed at least two members of the matrix metalloproteinases (MMP), either at the cell surface (proMMP-14 and MMP-14) or secreted (proMMP-9). In addition, tissue- and urinary-type plasminogen activators were also secreted in such culture conditions. At the cell surface, dipeptidyl peptidase IV and tripeptidyl peptidase II (TPPII) activities were also detected, and their activities decreased during time course of batch cultures. The proteolytic activities of these proteins were counterbalanced by (1) their expression as zymogens (proMMP-9, proMMP-14), (2) the expression of their natural inhibitors, tissue inhibitors of metalloproteinases-1 and -2 and plasminogen activator inhibitor-1 (PAI-1), or (3) the addition of plant protein hydrolysates to the culture medium, acting as a nonspecific source of TPPII inhibitors. This study points out that, even in protein-free media, recombinant proteins secreted by CHO cells are actively protected against physiological and unwanted extracellular proteolysis either by endogenous or by exogenous inhibitors.

  20. Early gene expression profiles of patients with chronic hepatitis C treated with pegylated interferon-alfa and ribavirin.

    PubMed

    Younossi, Zobair M; Baranova, Ancha; Afendy, Arian; Collantes, Rochelle; Stepanova, Maria; Manyam, Ganiraju; Bakshi, Anita; Sigua, Christopher L; Chan, Joanne P; Iverson, Ayuko A; Santini, Christopher D; Chang, Sheng-Yung P

    2009-03-01

    Responsiveness to hepatitis C virus (HCV) therapy depends on viral and host factors. Our aim was to assess sustained virologic response (SVR)-associated early gene expression in patients with HCV receiving pegylated interferon-alpha2a (PEG-IFN-alpha2a) or PEG-IFN-alpha2b and ribavirin with the duration based on genotypes. Blood samples were collected into PAXgene tubes prior to treatment as well as 1, 7, 28, and 56 days after treatment. From the peripheral blood cells, total RNA was extracted, quantified, and used for one-step reverse transcription polymerase chain reaction to profile 154 messenger RNAs. Expression levels of messenger RNAs were normalized with six "housekeeping" genes and a reference RNA. Multiple regression and stepwise selection were performed to assess differences in gene expression at different time points, and predictive performance was evaluated for each model. A total of 68 patients were enrolled in the study and treated with combination therapy. The results of gene expression showed that SVR could be predicted by the gene expression of signal transducer and activator of transcription-6 (STAT-6) and suppressor of cytokine signaling-1 in the pretreatment samples. After 24 hours, SVR was predicted by the expression of interferon-dependent genes, and this dependence continued to be prominent throughout the treatment. Early gene expression during anti-HCV therapy may elucidate important molecular pathways that may be influencing the probability of achieving virologic response.

  1. Enhancing effects of gamma interferon on phagocytic cell association with and killing of Trypanosoma cruzi

    NASA Technical Reports Server (NTRS)

    Wirth, J. J.; Kierszenbaum, F.; Sonnenfeld, G.; Zlotnik, A.

    1985-01-01

    Results are reported from a study of the influence gamma interferon (GIFN) and interleukin 2 (IL2) have on the capability of P388D1 cells and mouse resident peritoneal macrophages (MPM) to attach to the blood-resident parasites Trypanosoma cruzi and kill them. Cultures of trypomastigote forms of the Tulahuen strain of T. cruzi grown in bovine serum were introduced into peritoneal cells of mice, along with P388D1 cells incubated with GIFN, IL2 and both. Control cells were also maintained. Statistical analysis were then performed on data on counts of the number of dead T. Cruzi cells. The GIFN enhanced the interaction of MPM and P388D1 cells with the surface of T. Cruzi, provided the interaction was given over 12 hr to take place. A depression of the cytotoxicity of P388D1 cells was attributed to mediation by H2O2, an effect partially offset by incubation with the lymphokine GIFN.

  2. Mucosal tolerance to experimental autoimmune myasthenia gravis is associated with down-regulation of AChR-specific IFN-gamma-expressing Th1-like cells and up-regulation of TGF-beta mRNA in mononuclear cells.

    PubMed

    Ma, C G; Zhang, G X; Xiao, B G; Wang, Z Y; Link, J; Olsson, T; Link, H

    1996-02-13

    Oral and nasal administration of nicotinic acetylcholine receptor (AChR) to Lewis rats prior to myasthenogenic immunization with AChR and complete Freund's adjuvant (CFA) resulted in prevention or marked decrease of the severity of experimental autoimmune myasthenia gravis (EAMG) and suppression of AChR-specific B-cell responses and of AChR-reactive T-cell function. To examine the involvement of immunoregulatory cytokines and the underlying mechanisms involved in tolerance induction, in situ hybridization with radiolabeled cDNA oligonucleotide proves was adopted to enumerate mononuclear cells (MNC) expressing mRNA for the proinflammatory cytokine interferon-gamma (IFN-gamma), the B cell-stimulating interleukin-4 (IL-4), and the immunosuppressive transforming growth factor-beta (TGF-beta). Popliteal and inguinal lymph nodes from EAMG rats contained elevated numbers of AChR-reactive IFN-gamma, IL-4, and TGF-beta mRNA-expressing cells, compared to control rats receiving PBS orally or nasally and injected with CFA only. Oral and nasal tolerance was accompanied by decreased numbers of AChR-reactive IFN-gamma and IL-4 mRNA-expressing cells and strong up-regulation of TGF-beta mRNA-positive cells in lymphoid organs when compared to nontolerized EAMG control rats. The results suggest that IFN-gamma and IL-4 are central effector molecules in the development of EAMG and that TGF-beta plays an important role in tolerance induction to EAMG.

  3. CD8+ T Cell Exhaustion, Suppressed Gamma Interferon Production, and Delayed Memory Response Induced by Chronic Brucella melitensis Infection

    PubMed Central

    Durward-Diioia, Marina; Harms, Jerome; Khan, Mike; Hall, Cherisse; Smith, Judith A.

    2015-01-01

    Brucella melitensis is a well-adapted zoonotic pathogen considered a scourge of mankind since recorded history. In some cases, initial infection leads to chronic and reactivating brucellosis, incurring significant morbidity and economic loss. The mechanism by which B. melitensis subverts adaptive immunological memory is poorly understood. Previous work has shown that Brucella-specific CD8+ T cells express gamma interferon (IFN-γ) and can transition to long-lived memory cells but are not polyfunctional. In this study, chronic infection of mice with B. melitensis led to CD8+ T cell exhaustion, manifested by programmed cell death 1 (PD-1) and lymphocyte activation gene 3 (LAG-3) expression and a lack of IFN-γ production. The B. melitensis-specific CD8+ T cells that produced IFN-γ expressed less IFN-γ per cell than did CD8+ cells from uninfected mice. Both memory precursor (CD8+ LFA1HI CD127HI KLRG1LO) and long-lived memory (CD8+ CD27HI CD127HI KLRG1LO) cells were identified during chronic infection. Interestingly, after adoptive transfer, mice receiving cells from chronically infected animals were able to contain infection more rapidly than recipients of cells from acutely infected or uninfected donors, although the proportions of exhausted CD8+ T cells increased after adoptive transfer in both challenged and unchallenged recipients. CD8+ T cells of challenged recipients initially retained the stunted IFN-γ production found prior to transfer, and cells from acutely infected mice were never seen to transition to either memory subset at all time points tested, up to 30 days post-primary infection, suggesting a delay in the generation of memory. Here we have identified defects in Brucella-responsive CD8+ T cells that allow chronic persistence of infection. PMID:26416901

  4. Association between level of interferon gamma and acid-fast bacillipositivity in pulmonary tuberculosis

    NASA Astrophysics Data System (ADS)

    Priwahyuningtyas, N. B.; Sinaga, B. Y. M.; Pandia, P.; Eyanoer, P. C.

    2018-03-01

    Tuberculosis is an infectious disease which caused by Mycobacterium tuberculosis (M. tuberculosis) that infected numerous organ especially the lung. A person’s immunity is very affecting for a person exposed to pulmonary tuberculosis. T-helper-1 cell (Th1) is very influential in the immune system especially in interfering intracellular bacterial infection. One of the cytokines known produced by Th1 cell is interferon gamma (IFN-γ) which is in eliminating M. tuberculosis. The study aims to identify the association between level of IFN-γ and AFB positivity in pulmonary tuberculosis patients in Medan. It is a case-control study. The subjects of the study were 60 new cases of pulmonary tuberculosis with AFB sputum smear- positive that never received ATT consisting 20 cases AFB (+1), 20 cases AFB (+2) and 20 cases AFB (+3).Samples were plasma collected from the venous blood of pulmonary tuberculosis patients. The plasma then underwent laboratory assay with ELISA techniques. Independent t-test was p<0.05 considered significant. Level of IFN-γ in TB AFB (+1) is higher than TB AFB (+2) and (+3), with thesignificant statistical result (p=0.001).

  5. Expression Analysis of Interferon-Stimulated Gene 15 in the Rock Bream Oplegnathus fasciatus against Rock Bream Iridovirus (RSIV) Challenge.

    PubMed

    Kim, Kyung-Hee; Yang, In Jung; Kim, Woo-Jin; Park, Choul-Ji; Park, Jong-Won; Noh, Gyeong Eon; Lee, Seunghyung; Lee, Young Mee; Hwang, Hyung Kyu; Kim, Hyun Chul

    2017-12-01

    Interferon-stimulated gene 15 (ISG15) is known to interfere with viral replication and infection by limiting the viral infection of cells. Interferon-stimulated gene 15 (ISG15) interferes with viral replication and infectivity by limiting viral infection in cells. It also plays an important role in the immune response. In this study, tissue-specific expression of ISG15 in healthy rock bream samples and spatial and temporal expression analysis of rock bream ISG15 (RbISG15) were performed following rock bream iridovirus (RSIV) infection. RbISG15 expression was significantly higher in the eye, gill, intestine, kidney, liver, muscle, spleen, and stomach, but low in the brain. There were particularly high levels of expression in the liver and muscle. RbISG15 expression was also examined in several tissues and at various times following RSIV infection. ISG15 expression increased within 3 h in the whole body and decreased at 24 h after infection. In addition, temporal expression of several tissues following RSIV infection showed a similar pattern in the muscle, kidney, and spleen, increasing at 3 h and decreasing at 72 h. These results suggest that ISG15 plays an important role in the immune response of rock bream. Overall, this study characterizes the response of RbISG15 following RSIV infection.

  6. Role of interferon in resistance and immunity to protozoa

    NASA Technical Reports Server (NTRS)

    Sonnenfeld, G.; Degee, A. L. W.; Mansfield, J. M.; Newsome, A. L.; Arnold, R. R.

    1985-01-01

    Production of interferon (I) in response to protozoan infection, and the interferon-mediated inhibition of parasite replication were studied in order to determine if these effects may be related to immunologic-mediated resistance of the hosts. Two extracellular parasites-Trypanosoma brucei rhodesiense and Naegleria fowlei were used. Upon infection with the trypanosome, only resistant strains of mice produced I. An early peak of alpha/beta I is followed by appearance of gamma I, which coincided with antibody production and a drop in parasitemia. In case of the amoeba, pretreatment of its suspension with alpha/beta I inhibits its replication in vitro, and appears to protect mice from the infection and the disease. It is proposed that production of interferon, with its regulatory effect on the immune responses, may play a major role in regulating the processes of protozoan-caused diseases.

  7. Type I Interferon Receptor Expression in Human Pancreatic and Periampullary Cancer Tissue.

    PubMed

    Booy, Stephanie; Hofland, Leo J; Waaijers, A Marlijn; Croze, Ed; van Koetsveld, Peter M; de Vogel, Lisette; Biermann, Katharina; van Eijck, Casper H J

    2015-01-01

    Interferons (IFNs) have several anticancer mechanisms. A number of clinical trials have been conducted regarding adjuvant IFN-α therapy in pancreatic cancer. Type I IFNs exert their effect via the type I IFN receptor (IFNAR-1, IFNAR-2c). The aims of the present study were to determine the type I IFN receptor expression in pancreatic and periampullary cancer tissues and to study its relation with clinicopathological factors. Receptor expression was determined by immunohistochemistry in paraffin-embedded cancer tissue of 47 pancreatic and 54 periampullary cancer patients. The results demonstrated that 91.5% of the pancreatic tumors and 88.9% of the periampullary tumors showed expression of IFNAR-1, of which 23.4% and 13.0% were strongly positive, respectively. Regarding IFNAR-2c expression, 68.1% of the pancreatic tumors and 68.5% of the periampullary tumors were positive, of which 4.3% of the pancreatic tumors and none of the periampullary tumors had a strong expression. No statistically significant associations were found between type I IFN receptor expression and clinicopathological factors or survival. Type I IFN receptors are expressed in pancreatic and periampullary cancer tissues although with great intertumoral and intratumoral variability. A small proportion of both tumors showed a strong expression of the IFNAR-1; only a very small percentage of the pancreatic tumors showed strong expression of the IFNAR-2c.

  8. [The usefulness of in vitro interferon-gamma assay for differential diagnosis between intestinal tuberculosis and Crohns disease].

    PubMed

    Lee, Jung Nam; Ryu, Dong Yup; Park, Sung Han; You, Hyun Seok; Lee, Bong Eun; Kim, Dong Uk; Kim, Tae Oh; Heo, Jeong; Kim, Gwang Ha; Song, Geun Am; Kim, Suk; Park, Do Youn

    2010-06-01

    It is difficult to clinically and endoscopically differentiate intestinal tuberculosis (ITB) and Crohns disease (CD). The aim of this study was to evaluate the usefulness of in vitro interferon-gamma (INF-gamma) assay for differential diagnosis between ITB and CD. Sixty patients for whom differential diagnosis between ITB and CD was difficult were enrolled between January 2007 and January 2009. The INF-gamma-producing T-cell response to early secreted antigenic target 6 and culture filtrate protein 10 were measured by T-SPOT.TB blood test in vitro. We evaluated the usefulness of T-SPOT.TB blood test by comparing its results with the final diagnosis. Twenty and forty patients were revealed to be positive and negative in T-SPOT.TB blood test, respectively. Of the 20 patients found to be positive, 12 patients (60%) were finally diagnosed as ITB, 6 patients as CD, and 2 patients as Behcets enterocolitis. Of the 40 patients with negative results, 38 patients (95%) were diagnosed as CD; one as Behcets enterocolitis; one as nonspecific colitis; none as ITB. The sensitivity and specificity of T-SPOT.TB blood test for ITB were 100% and 83.3%, respectively. Positive and negative predictive values of T-SPOT.TB blood test for ITB were 60.0% and 100%, respectively. When differential diagnosis between ITB and CD is difficult, T-SPOT.TB blood test may be a helpful and rapid diagnostic tool to exclude ITB. Prospective large-scaled studies are required for further evaluation of the usefulness of T-SPOT.TB blood test for differential diagnosis between ITB and CD.

  9. Effect of leukocyte therapy on tumor necrosis factor-alpha and interferon-gamma production in patients with recurrent spontaneous abortion.

    PubMed

    Gharesi-Fard, Behrouz; Zolghadri, Jaleh; Kamali-Sarvestani, Eskandar

    2008-03-01

    Considering the deleterious role of T helper1 (Th1) cells in pregnancy outcome, a successful treatment for recurrent spontaneous abortion (RSA) should be able to make a significant shift away from Th1 responses. Although paternal leukocyte immunization has been used for treatment of RSA for years, because of methodological differences there is no consensus on the mechanism of action and effectiveness of this method. Twenty-five Iranian non-pregnant women with RSA and 16 non-pregnant control women with at least two successful pregnancies were included in this study. All cases were followed up after leukocyte therapy for pregnancy outcome. Mononuclear cells from women were co-cultured with the husband's mononuclear cells before and after immunotherapy. The levels of tumor necrosis factor-alpha (TNF-alpha) and interferon-gamma (IFN-gamma) were checked on culture supernatant by enzyme-linked immunosorbent assay method. The mean concentration of TNF-alpha was significantly higher in patients compared with that in normal controls (P=0.0001). After immunotherapy, the TNF-alpha level was only significantly decreased in women with successful outcome (P=0.0001). Immunotherapy also induced a significant reduction in the IFN-gamma level (P=0.009). The results of this investigation confirm the role of TNF-alpha in RSA and propose the assessment of TNF-alpha production as a valuable prognostic parameter for the prediction of abortion after leukocyte therapy.

  10. Cross-talk between IGF-1 and estrogen receptors attenuates intracellular changes in ventral spinal cord 4.1 motoneuron cells due to interferon-gamma exposure

    PubMed Central

    Park, Sookyoung; Nozaki, Kenkichi; Smith, Joshua A.; Krause, James S.; Banik, Naren L.

    2014-01-01

    Insulin-like growth factor-1 (IGF-1) is a neuroprotective growth factor that promotes neuronal survival by inhibition of apoptosis. In order to examine whether IGF-1 exerts cytoprotective effects against extracellular inflammatory stimulation, ventral spinal cord 4.1 (VSC4.1) motoneuron cells were treated with interferon-gamma (IFN-γ). Our data demonstrated apoptotic changes, increased calpain:calpastatin and Bax:Bcl-2 ratios, and expression of apoptosis related proteases (caspase-3 and −12) in motoneurons rendered by IFN-γ in a dose-dependent manner. Post-treatment with IGF-1 attenuated these changes. In addition, IGF-1 treatment of motoneurons exposed to IFN-γ decreased expression of inflammatory markers (cyclooxygenase-2 and nuclear factor-kappa B:inhibitor of kappa B ratio). Furthermore, IGF-1 attenuated the loss of expression of IGF-1 receptors (IGF-1Rα and IGF-1Rβ) and estrogen receptors (ERα and ERβ) induced by IFN-γ. To determine whether the protective effects of IGF-1 are associated with ERs, ERs antagonist ICI and selective siRNA targeted against ERα and ERβ were used in VSC4.1 motoneurons. Distinctive morphological changes were observed following siRNA knockdown of ERα and ERβ. In particular, apoptotic cell death assessed by TUNEL assay was enhanced in both ERα and ERβ-silenced VSC4.1 motoneurons following IFN-γ and IGF-1 exposure. These results suggest that IGF-1 protects motoneurons from inflammatory insult by a mechanism involving pivotal interactions with ERα and ERβ. PMID:24188094

  11. Biased expression, under the control of single promoter, of human interferon α-2b and Escherichia coli methionine amino peptidase genes in E. coli, irrespective of their distance from the promoter.

    PubMed

    Arif, Amina; Rashid, Naeem; Aslam, Farheen; Mahmood, Nasir; Akhtar, Muhammad

    2016-03-01

    Human interferon α-2b and Escherichia coli methionine amino peptidase genes were cloned independently as well as bicistronically in expression plasmid pET-21a (+). Production of human interferon α-2b was comparable to that of E. coli methionine amino peptidase when these genes were expressed independently in E. coli BL21-CodonPlus (DE3)-RIL. However, human interferon α-2b was produced in a much less amount whereas there was no difference in the production of methionine amino peptidase when the encoding genes were expressed bicistronically. It is important to note that human interferon α-2b was the first gene in order, after the promoter and E. coli methionine amino peptidase was the next with a linker sequence of 27 nucleotides between them.

  12. Combined therapy with danazol, pegilated interferon, and ribavirin improves thrombocytopenia and liver injury in rats with fibrosis.

    PubMed

    Alvarez, Guillermo Cabrera; Madrid-Marina, Vicente; Jimenez-Mendez, Ricardo; Buitimea, Angel Leon; Román, Margarita Bahena; Cortez-Gomez, Rudyard; Esparza, Jorge Reyes; Rodríguez-Fragoso, Lourdes

    2007-01-01

    The aim of this study was to investigate the effects of combinations of pegilated-interferon (PEG-IFN), ribavirin, and danazol on thrombocytopenia and liver injury in rats with fibrosis. Male adult Wistar rats were treated with either mineral oil, danazol (0.83 mg/kg per day), PEG-interferon alpha-2a (PEG-IFN, 0.3 microg/ week) + ribavirin (12 mg/kg per day), PEG-IFN + ribavirin + danazol, CCl(4) (4 g/kg for eight weeks), CCl(4) + PEG-IFN + ribavirin, or CCl(4) + PEG-IFN + ribavirin+ danazol. The following assays were conducted: hematology, clinical chemistry, liver function, liver fibrosis, lymphocyte cytokine mRNA expression, and bone-marrow DNA content. Platelet counts were low in sham-treated animals and animals treated with PEG- IFN + ribavirin (30% and 25% respectively; P < 0.05). PEG-IFN + ribavirin + danazol reduced platelet counts of fibrotic animals by only 9% (P < 0.05). PEG- IFN + ribavirin reduced hepatic collagen content by 50%, whereas danazol + PEG-IFN + ribavirin reduced hepatic collagen content by 60% (P < 0.05). PEG-IFN + ribavirin reduced the total bilirubin concentration by 27%, alanine amino transferase (ALT) activity by 75% and gamma-glutamyl transpeptidase (gamma-GTP) activity by 74% (P < 0.05). In contrast, danazol + PEG-IFN + ribavirin reduced total bilirubin levels by 61%, alkaline phosphatase activity by 45%, ALT activity by 76%, and gamma-GTP activity by 74% (P < 0.05). The only treatment that increased interleukin 10 (IL-10) mRNA in fibrotic rats was PEG-IFN + ribavirin. However, danazol + PEG-IFN + ribavirin reduced the expression of IL-6, IL-10, tumor necrosis factor alpha and transforming growth factor ss. Bone-marrow DNA content was not altered by any treatment. In conclusion, PEG-IFN + ribavirin + danazol could be a new therapeutic option for patients with liver injury, fibrosis, and thrombocytopenia.

  13. Interferon-gamma receptor-deficiency renders mice highly susceptible to toxoplasmosis by decreased macrophage activation.

    PubMed

    Deckert-Schlüter, M; Rang, A; Weiner, D; Huang, S; Wiestler, O D; Hof, H; Schlüter, D

    1996-12-01

    Toxoplasma gondii may cause severe infections in immunocompromised patients including fetuses and those with AIDS. Among the factors mediating protection against T. gondii, IFN-gamma has gained special attention. To analyze the role of IFN-gamma in the early phase of toxoplasmosis, IFN-gamma receptor-deficient (IFN-gamma R0/0) mice were orally infected with low-virulent toxoplasms. IFN-gamma R0/0 mice died of the disease up to day 10 postinfection, whereas immunocompetent wild-type (WT) mice developed a chronic toxoplasmosis. Histopathology revealed that in IFN-gamma R0/0 mice, the parasite multiplied unrestrictedly in the small intestine, the intestinal lymphatic tissue, the liver, and the spleen. Ultimately, animals died of a necrotizing hepatitis. In WT mice, the same organs were effected, but multiplication of the parasite was effectively limited. Compared with WT mice, immunohistochemistry and flow cytometry demonstrated that in IFN-gamma R0/0 mice, macrophages were only marginally activated in response to the infection, as evidenced by a reduced expression of major histocompatability complex class II antigens. In addition, immunohistochemistry and RT-PCR showed a reduced production of the macrophage-derived cytokines tumor necrosis factor-alpha, inducible nitric oxide synthase, and IL-1 beta in the liver of IFN-gamma R0/0 mice. In contrast, activation of T cells, recruitment of immune cells to inflammatory foci, and anti-T. gondii IgM antibody production were unaffected by the mutation of the IFN-gamma R. Moreover, induction of IL-2, IL-4, and IL-10 mRNA transcripts in the liver was normal in IFN-gamma R0/0 mice. Adoptive transfer experiments revealed that the immune T cells of WT animals did not protect IFN-gamma R0/0 mice from lethal infection with highly virulent toxoplasms, whereas WT mice were significantly protected by the adoptive transfer. Based on these studies, we conclude that IFN-gamma is absolutely required for an efficient activation of

  14. Expression of interferon-induced antiviral genes is delayed in a STAT1 knockout mouse model of Crimean-Congo hemorrhagic fever.

    PubMed

    Bowick, Gavin C; Airo, Adriana M; Bente, Dennis A

    2012-06-19

    Crimean Congo hemorrhagic fever (CCHF) is a tick-borne hemorrhagic zoonosis associated with high mortality. Pathogenesis studies and the development of vaccines and antivirals against CCHF have been severely hampered by the lack of suitable animal model. We recently developed and characterized a mature mouse model for CCHF using mice carrying STAT1 knockout (KO). Given the importance of interferons in controlling viral infections, we investigated the expression of interferon pathway-associated genes in KO and wild-type (WT) mice challenged with CCHF virus. We expected that the absence of the STAT1 protein would result in minimal expression of IFN-related genes. Surprisingly, the KO mice showed high levels of IFN-stimulated gene expression, beginning on day 2 post-infection, while in WT mice challenged with virus the same genes were expressed at similar levels on day 1. We conclude that CCHF virus induces similar type I IFN responses in STAT1 KO and WT mice, but the delayed response in the KO mice permits rapid viral dissemination and fatal illness.

  15. Cross-talk between interferon-gamma and interleukin-18 in melanogenesis.

    PubMed

    Zhou, Jia; Ling, Jingjing; Wang, Yong; Shang, Jing; Ping, Fengfeng

    2016-10-01

    Skin is the largest organ in our body and strategically placed to provide a metabolically active biological barrier against a range of noxious stressors. A lot of inflammatory cytokines, which are increased after ultraviolet (UV) irradiation produced by keratinocytes or other immunocytes, are closely related to pigmentary changes, including interleukin-18 (IL-18) and interferon-γ (IFN-γ). In this study, the effect of cross-talk between IL-18 and IFN-γ on melanogenesis was investigated. Treatment with IL-18 resulted in a dose-dependent increase of melanogenesis, while IFN-γ made an opposite effect. This influence of IL-18 and IFN-γ was mediated by regulations of microphthalmia-associated transcription factor (MITF) and its downstream enzymatic cascade expressions. Furthermore, IFN-γ inhibited basal and IL-18-induced melanogenesis. IFN-γ increased signal transducer and activator of transcription-1 (STAT-1) phosphorylation to play its position in regulating melanin pigmentation, and its inhibitory effect could be prevented by Janus Kinase 1 (JAK 1) inhibitor. IFN-γ could inhibit melanogenesis by decreasing melanocyte dendrite formation. In addition, IFN-γ inhibited the expressions of Rab Pases to suppress the mature and transport of melanosomes. IL-18 could rapidly induce Akt and PTEN phosphorylation and p65 expression in B16F10 cells. When treatment with IL-18 and IFN-γ together, the phosphorylation level of Protein Kinase B (Akt) and phosphatase and tensin homolog deleted on chromosome ten (PTEN) and expression of p65 NF-κB were inhibited, compared with treated with IL-18 only. Our studies indicated that IFN-γ could directly induce B16F10 cells apoptosis in vitro. Furthermore, we demonstrated that IFN-γ markedly up-regulated IL-18 binding protein (BP) production in normal human foreskin-derived epidermal keratinocytes in dose-dependent manner. UVB irradiation induced protease-activated receptor-2 (PAR-2) expression in NHEK, IFN-γ could inhibit this

  16. Nuclear receptor ERR alpha and coactivator PGC-1 beta are effectors of IFN-gamma-induced host defense.

    PubMed

    Sonoda, Junichiro; Laganière, Josée; Mehl, Isaac R; Barish, Grant D; Chong, Ling-Wa; Li, Xiangli; Scheffler, Immo E; Mock, Dennis C; Bataille, Alain R; Robert, Francois; Lee, Chih-Hao; Giguère, Vincent; Evans, Ronald M

    2007-08-01

    Macrophage activation by the proinflammatory cytokine interferon-gamma (IFN-gamma) is a critical component of the host innate response to bacterial pathogenesis. However, the precise nature of the IFN-gamma-induced activation pathway is not known. Here we show using genome-wide expression and chromatin-binding profiling that IFN-gamma induces the expression of many nuclear genes encoding mitochondrial respiratory chain machinery via activation of the nuclear receptor ERR alpha (estrogen-related receptor alpha, NR3B1). Studies with macrophages lacking ERR alpha demonstrate that it is required for induction of mitochondrial reactive oxygen species (ROS) production and efficient clearance of Listeria monocytogenes (LM) in response to IFN-gamma. As a result, mice lacking ERR alpha are susceptible to LM infection, a phenotype that is localized to bone marrow-derived cells. Furthermore, we found that IFN-gamma-induced activation of ERR alpha depends on coactivator PGC-1 beta (peroxisome proliferator-activated receptor gamma coactivator-1 beta), which appears to be a direct target for the IFN-gamma/STAT-1 signaling cascade. Thus, ERR alpha and PGC-1 beta act together as a key effector of IFN-gamma-induced mitochondrial ROS production and host defense.

  17. Hematopoietic stem cell loss and hematopoietic failure in severe aplastic anemia is driven by macrophages and aberrant podoplanin expression.

    PubMed

    McCabe, Amanda; Smith, Julianne N P; Costello, Angelica; Maloney, Jackson; Katikaneni, Divya; MacNamara, Katherine C

    2018-05-17

    Severe aplastic anemia results from profound hematopoietic stem cell loss. T cells and interferon gamma have long been associated with severe aplastic anemia, yet the underlying mechanisms driving hematopoietic stem cell loss remain unknown. Using a mouse model of severe aplastic anemia, we demonstrate that interferon gamma-dependent hematopoietic stem cell loss required macrophages. Interferon gamma was necessary for bone marrow macrophage persistence, despite loss of other myeloid cells and hematopoietic stem cells. Depleting macrophages or abrogating interferon gamma signaling specifically in macrophages did not impair T cell activation or interferon gamma production in the bone marrow but rescued hematopoietic stem cells and reduced mortality. Thus, macrophages are not required for induction of interferon gamma in severe aplastic anemia and rather act as sensors of interferon gamma. Macrophage depletion rescued thrombocytopenia, increased bone marrow megakaryocytes, preserved platelet-primed stem cells, and increased the platelet-repopulating capacity of transplanted hematopoietic stem cells. In addition to the hematopoietic effects, severe aplastic anemia induced loss of non-hematopoietic stromal populations, including podoplanin-positive stromal cells. However, a subset of podoplanin-positive macrophages was increased during disease, and blockade of podoplanin in mice was sufficient to rescue disease. Our data further our understanding of disease pathogenesis demonstrating a novel role for macrophages as sensors of interferon gamma, thus illustrating an important role for the microenvironment in pathogenesis of severe aplastic anemia. Copyright © 2018, Ferrata Storti Foundation.

  18. Evaluation of Gamma Interferon and Antibody Tuberculosis Tests in Alpacas

    PubMed Central

    Holder, Tom; Clifford, Derek; Dexter, Ian; Brewer, Jacky; Smith, Noel; Waring, Laura; Crawshaw, Tim; Gillgan, Steve; Lyashchenko, Konstantin; Lawrence, John; Clarke, John; de la Rua-Domenech, Ricardo; Vordermeier, Martin

    2012-01-01

    We describe the performance of cell-based and antibody blood tests for the antemortem diagnosis of tuberculosis (TB) in South American camelids (SAC). The sensitivity and specificity of the gamma interferon (IFN-γ) release assay, two lateral flow rapid antibody tests (Stat-Pak and Dual Path Platform [DPP]), and two enzyme-linked immunosorbent assay (ELISA)-based antibody tests (Idexx and Enferplex) were determined using diseased alpacas from Mycobacterium bovis culture-confirmed breakdown herds and TB-free alpacas from geographical areas with no history of bovine TB, respectively. Our results show that while the sensitivities of the IFN-γ and antibody tests were similar (range of 57.7% to 66.7%), the specificity of the IFN-γ test (89.1%) was lower than those of any of the antibody tests (range of 96.4% to 97.4%). This lower specificity of the IFN-γ test was at least in part due to undisclosed Mycobacterium microti infection in the TB-free cohort, which stimulates a positive purified protein derivative (PPD) response. The sensitivity of infection detection could be increased by combining two antibody tests, but even the use of all four antibody tests failed to detect all diseased alpacas. These antibody-negative alpacas were IFN-γ positive. We found that the maximum sensitivity could be achieved only by the combination of the IFN-γ test with two antibody tests in a “test package,” although this resulted in decreased specificity. The data from this evaluation of tests with defined sensitivity and specificity provide potential options for antemortem screening of SAC for TB in herd breakdown situations and could also find application in movement testing and tracing investigations. PMID:22914362

  19. Evaluation of gamma interferon and antibody tuberculosis tests in alpacas.

    PubMed

    Rhodes, Shelley; Holder, Tom; Clifford, Derek; Dexter, Ian; Brewer, Jacky; Smith, Noel; Waring, Laura; Crawshaw, Tim; Gillgan, Steve; Lyashchenko, Konstantin; Lawrence, John; Clarke, John; de la Rua-Domenech, Ricardo; Vordermeier, Martin

    2012-10-01

    We describe the performance of cell-based and antibody blood tests for the antemortem diagnosis of tuberculosis (TB) in South American camelids (SAC). The sensitivity and specificity of the gamma interferon (IFN-γ) release assay, two lateral flow rapid antibody tests (Stat-Pak and Dual Path Platform [DPP]), and two enzyme-linked immunosorbent assay (ELISA)-based antibody tests (Idexx and Enferplex) were determined using diseased alpacas from Mycobacterium bovis culture-confirmed breakdown herds and TB-free alpacas from geographical areas with no history of bovine TB, respectively. Our results show that while the sensitivities of the IFN-γ and antibody tests were similar (range of 57.7% to 66.7%), the specificity of the IFN-γ test (89.1%) was lower than those of any of the antibody tests (range of 96.4% to 97.4%). This lower specificity of the IFN-γ test was at least in part due to undisclosed Mycobacterium microti infection in the TB-free cohort, which stimulates a positive purified protein derivative (PPD) response. The sensitivity of infection detection could be increased by combining two antibody tests, but even the use of all four antibody tests failed to detect all diseased alpacas. These antibody-negative alpacas were IFN-γ positive. We found that the maximum sensitivity could be achieved only by the combination of the IFN-γ test with two antibody tests in a "test package," although this resulted in decreased specificity. The data from this evaluation of tests with defined sensitivity and specificity provide potential options for antemortem screening of SAC for TB in herd breakdown situations and could also find application in movement testing and tracing investigations.

  20. CMOS image sensor for detection of interferon gamma protein interaction as a point-of-care approach.

    PubMed

    Marimuthu, Mohana; Kandasamy, Karthikeyan; Ahn, Chang Geun; Sung, Gun Yong; Kim, Min-Gon; Kim, Sanghyo

    2011-09-01

    Complementary metal oxide semiconductor (CMOS)-based image sensors have received increased attention owing to the possibility of incorporating them into portable diagnostic devices. The present research examined the efficiency and sensitivity of a CMOS image sensor for the detection of antigen-antibody interactions involving interferon gamma protein without the aid of expensive instruments. The highest detection sensitivity of about 1 fg/ml primary antibody was achieved simply by a transmission mechanism. When photons are prevented from hitting the sensor surface, a reduction in digital output occurs in which the number of photons hitting the sensor surface is approximately proportional to the digital number. Nanoscale variation in substrate thickness after protein binding can be detected with high sensitivity by the CMOS image sensor. Therefore, this technique can be easily applied to smartphones or any clinical diagnostic devices for the detection of several biological entities, with high impact on the development of point-of-care applications.

  1. Human pDCs display sex-specific differences in type I interferon subtypes and interferon α/β receptor expression.

    PubMed

    Ziegler, Susanne M; Beisel, Claudia; Sutter, Kathrin; Griesbeck, Morgane; Hildebrandt, Heike; Hagen, Sven H; Dittmer, Ulf; Altfeld, Marcus

    2017-02-01

    The outcomes of many diseases differ between women and men, with women experiencing a higher incidence and more severe pathogenesis of autoimmune and some infectious diseases. It has been suggested that this is partially due to activation of plasmacytoid dendritic cells (pDCs), the main producers of interferon (IFN)-α, in response to toll-like receptor (TLR)7 stimulation. We investigated the induction of type I IFN (IFN-I) subtypes upon TLR7 stimulation on isolated pDCs. Our data revealed a sex-specific differential expression of IFN-Is, with pDCs from females showing a significantly higher mRNA expression of all 13 IFN-α subtypes. In addition, pDCs from females had higher levels of IFN-β mRNA after stimulation, indicating that sex differences in IFN-I production by pDCs were mediated by a signaling event upstream of the first loop of IFN-I mRNA transcription. Furthermore, the surface expression levels of the common IFN-α/β receptor subunit 2 were significantly higher on pDCs from females in comparison to males. These data indicate that higher IFN-α production is already established at the mRNA level and propose a contribution of higher IFN-α/β receptor 2 expression on pDCs to the immunological differences in IFN-I production observed between females and males. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Prokaryotic expression of chicken interferon-γ fusion protein and its effect on expression of poultry heat shock protein 70 under heat stress.

    PubMed

    Sun, Jinhua; Chen, Yinglin; Qin, Feiyue; Guan, Xueting; Xu, Wei; Xu, Liangmei

    2017-06-01

    Interferons have attracted considerable attention due to their vital roles in the host immune response and low induction of antibiotic resistance. In this study, total RNA was extracted from spleen cells of chicken embryos inoculated with Newcastle disease vaccine, and the full-length chicken interferon-γ (ChIFN-γ) gene was amplified by RT-PCR. The full complementary DNA sequence of the ChIFN-γ gene was 495 bp long and was cloned into the prokaryotic expression vector pProEX™HT b . The plasmid was transformed into Escherichia coli DH5α and the expression of ChIFN-γ was induced by isopropyl β-D-1-thiogalactopyranoside. Sodium dodecyl sulfate - polyacrylamide gel electrophoresis and Western blot results showed the expressed fusion protein had a molecular weight of approximately 18 kDa and was recognized by an anti-His mAb. Moreover, ChIFN-γ was found to demonstrate anti-viral activity in vitro. To test the in vivo function of ChIFN-γ in broilers under heat stress, a total of 100 broilers were randomly assigned to either a control group or a treated group, in which they were hypodermically injected with recombinant ChIFN-γ. Results demonstrated ChIFN-γ affects the messenger RNA expression levels of heat shock protein 70 (HSP70) in the heart and lung tissues, and decreases the concentration of HSP70 in serum. Therefore, we conclude recombinant ChIFN-γ can reduce heat stress to some extent in vivo. © 2016 Japanese Society of Animal Science.

  3. Correlations between endotoxin, interferon-gamma, biopterin and serum phospholipase A2-activities during lethal gram negative sepsis in rats.

    PubMed

    Hunsicker, A; Kullich, W; Weissenhofer, W; Lorenz, D; Petermann, J; Rokos, H; Schwesinger, G

    1997-05-01

    To establish a standardised reproducible animal model of intraperitoneal sepsis, and to investigate early immunoserological responses to find a mediator-based system for evaluation and grading of diffuse peritonitis in patients Prospective experimental study 4 Teaching hospitals, Germany and Austria 42 LEW. 1W rats, 12 of which acted as controls Gram negative sepsis was induced by intraperitoneal injection of 6 ml of a mixture of Escherichia coli (K1:H+) 10(10) organisms/ml, autogenous haemoglobin 2.9 ml (haemoglobin concentration 3%), 0.9% sodium chloride 3 ml, and suspension 0.1 ml. Control rats were given physiological saline 6 ml alone. Concentrations of endotoxin, interferon gamma (IFN-gamma), and biopterin, and serum phospholipase A2 (PLA2) activity. There were significant differences between the septic and control rats in concentrations of endotoxin (EU/ml) (median (interquartile range) 21.85 (2.02-159.5) compared with 0, p < 0.0001; IFN-gamma (pg/ml) 1263.0 (271.0-7575.0) compared with 101.0 (89.0-141.0), p < 0.0001; biopterin (nmol/L) 111.0 (66.4-156.3) compared with 53.7 (38.3-67.6), p < 0.001; and PLA2 (U/L) 163.0 (125.8-209.0) compared with 112.5 (88.5-126.5) p < 0.01. Measurements of concentrations of endotoxin, IFN-gamma, pteridines, and PLA2 activity may well be adequate markers for early recognition of sepsis, and perhaps for grading it during the first 6 hours after induction. The allow a clear distinction to be made between septic and non-septic disorders in 87% of cases.

  4. The effects of interferon-alpha/beta in a model of rat heart transplantation

    NASA Technical Reports Server (NTRS)

    Slater, A. D.; Klein, J. B.; Sonnenfeld, G.; Ogden, L. L. 2nd; Gray, L. A. Jr

    1992-01-01

    Interferons have multiple immunologic effects. One such effect is the activation of expression of cell surface antigens. Interferon alpha/beta enhance expression of class I but not class II histocompatibility antigens. Contradictory information has been published regarding the effect of interferon-alpha/beta administration in patients with kidney transplantation. In a model of rat heart transplantation we demonstrated that administration of interferon-alpha/beta accelerated rejection in a dose-dependent fashion in the absence of maintenance cyclosporine. Animals treated with maintenance cyclosporine had evidence of increased rejection at 20 days that was resolved completely at 45 days with cyclosporine alone.

  5. Type I interferons modulate methotrexate resistance in gestational trophoblastic neoplasia.

    PubMed

    Elias, Kevin M; Harvey, Richard A; Hasselblatt, Kathleen T; Seckl, Michael J; Berkowitz, Ross S

    2017-06-01

    Resistance to methotrexate is a leading clinical problem in gestational trophoblastic neoplasia (GTN), but there are limited laboratory models for this condition. We created isogenic trophoblastic cell lines resistant to methotrexate and compared these to the parent cell lines using gene expression microarrays and qRT-PCR followed by mechanistic studies using recombinant cytokines, pathway inhibitors, and patient sera. Gene expression microarrays and focused analysis by qRT-PCR revealed methotrexate led to type I interferon upregulation, in particular interferon alpha 2 (IFNA2), and methotrexate resistance was associated with chronic low level increases in type I interferon expression. Recombinant IFNA2 imparted chemosensitive choriocarcinoma cells with partial resistance to methotrexate, while chemoresistant choriocarcinoma cells were uniquely sensitive to fludarabine, a STAT1 inhibitor. In pre-treatment patient sera, IFNA2 levels correlated with subsequent resistance to methotrexate chemotherapy. Methotrexate resistance is influenced by type I interferon signaling with prognostic and therapeutic implications for treating women with GTN. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  6. Interferon effects on protozoan infections

    NASA Technical Reports Server (NTRS)

    Sonnenfeld, G.; Wirth, J.; Kierszenbaum, F.; Degee, A. L. W.; Mansfield, J. M.

    1985-01-01

    The effects of interferon (IFN) on mice infected with two different parasitic protozoans, Trypanosoma cruzi and Trypanosoma brucei rhodesiense, are investigated experimentally. The preparation of the cell cultures, IFN and assays, antibody, and the experimental procedures are described. It is observed that in cells treated with IFN-gamma there is an increased association of T. cruzi with murine macrophages and an increase in the killing of T. cruzi by IFN-gamma-treated murine macrophages. For spleen cells infected with T.b. rhodesiense in vitro, it is detected that live trypanosomes cannot induce IFN in cells from normal mice, but can in cells from immunized mice; and that trypanosome-lysates induce IFN in vitro in cells from normal mice. The data suggest that there is a two-step mechanism for mice against T. cruzi and T.b. rhodesiense.

  7. Histaminergic regulation of interferon-gamma (IFN-gamma) production by human natural killer (NK) cells.

    PubMed

    Asea, A; Hansson, M; Czerkinsky, C; Houze, T; Hermodsson, S; Strannegård, O; Hellstrand, K

    1996-08-01

    Monocytes, recovered from human peripheral blood by counter-current centrifugal elutriation, effectively inhibit the production of IFN-gamma by CD3-/56+ NK cells in response to IL-2. This study aimed at defining the nature of the inhibitory signal, particularly the importance of monocyte-derived reactive metabolites of oxygen. It was found that monocytes recovered from patients with chronic granulomatous disease (CGD), a condition characterized by deficient NADPH-oxidase activity of phagocytes, did not inhibit IFN-gamma production by NK cells. Further, catalase, a scavenger of hydrogen peroxide, completely reversed the inhibitory signal whereas scavengers of the superoxide anion, hypohalous acids, the hydroxyl radical, or nitric oxide synthesis inhibitors such as L-NMMA were ineffective. Inhibition of IFN-gamma production was operating on a pretranslational level, as indicated by the inability of enriched NK cells to accumulate IFN-gamma mRNA in the presence of elutriated monocytes. Hydrogen peroxide, at micromolar concentrations, reconstituted the inhibition of IFN-gamma production when added to enriched NK cells. Histamine, a biogenic amine which inhibits the generation of reactive oxygen metabolites in monocytes, abrogated the inhibition of IFN-gamma production in NK cells; by this mechanism, histamine strongly synergized with IL-2 to induce IFN-gamma in mixtures of NK cells and monocytes. The synergizing effect of histamine was specifically mediated by H2-type histamine receptors. We conclude that: (i) the induction of IFN-gamma mRNA in NK cells is effectively down-regulated by products of the oxidative metabolism of monocytes; and (ii) histamine effectively enhances IFN-gamma production by preventing monocyte-induced oxidative damage to NK cells.

  8. Partial interferon-gamma receptor 1 deficiency in a child with tuberculoid bacillus Calmette-Guérin infection and a sibling with clinical tuberculosis.

    PubMed Central

    Jouanguy, E; Lamhamedi-Cherradi, S; Altare, F; Fondanèche, M C; Tuerlinckx, D; Blanche, S; Emile, J F; Gaillard, J L; Schreiber, R; Levin, M; Fischer, A; Hivroz, C; Casanova, J L

    1997-01-01

    Complete interferon-gamma receptor 1 (IFNgammaR1) deficiency has been identified previously as a cause of fatal bacillus Calmette-Guérin (BCG) infection with lepromatoid granulomas, and of disseminated nontuberculous mycobacterial (NTM) infection in children who had not been inoculated with BCG. We report here a kindred with partial IFNgammaR1 deficiency: one child afflicted by disseminated BCG infection with tuberculoid granulomas, and a sibling, who had not been inoculated previously with BCG, with clinical tuberculosis. Both responded to antimicrobials and are currently well without prophylactic therapy. Impaired response to IFN-gamma was documented in B cells by signal transducer and activator of transcription 1 nuclear translocation, in fibroblasts by cell surface HLA class II induction, and in monocytes by cell surface CD64 induction and TNF-alpha secretion. Whereas cells from healthy children responded to even low IFN-gamma concentrations (10 IU/ml), and cells from a child with complete IFNgammaR1 deficiency did not respond to even high IFN-gamma concentrations (10,000 IU/ml), cells from the two siblings did not respond to low or intermediate concentrations, yet responded to high IFN-gamma concentrations. A homozygous missense IFNgR1 mutation was identified, and its pathogenic role was ascertained by molecular complementation. Thus, whereas complete IFNgammaR1 deficiency in previously identified kindreds caused fatal lepromatoid BCG infection and disseminated NTM infection, partial IFNgammaR1 deficiency in this kindred caused curable tuberculoid BCG infection and clinical tuberculosis. PMID:9389728

  9. Designing of interferon-gamma inducing MHC class-II binders

    PubMed Central

    2013-01-01

    Background The generation of interferon-gamma (IFN-γ) by MHC class II activated CD4+ T helper cells play a substantial contribution in the control of infections such as caused by Mycobacterium tuberculosis. In the past, numerous methods have been developed for predicting MHC class II binders that can activate T-helper cells. Best of author’s knowledge, no method has been developed so far that can predict the type of cytokine will be secreted by these MHC Class II binders or T-helper epitopes. In this study, an attempt has been made to predict the IFN-γ inducing peptides. The main dataset used in this study contains 3705 IFN-γ inducing and 6728 non-IFN-γ inducing MHC class II binders. Another dataset called IFNgOnly contains 4483 IFN-γ inducing epitopes and 2160 epitopes that induce other cytokine except IFN-γ. In addition we have alternate dataset that contains IFN-γ inducing and equal number of random peptides. Results It was observed that the peptide length, positional conservation of residues and amino acid composition affects IFN-γ inducing capabilities of these peptides. We identified the motifs in IFN-γ inducing binders/peptides using MERCI software. Our analysis indicates that IFN-γ inducing and non-inducing peptides can be discriminated using above features. We developed models for predicting IFN-γ inducing peptides using various approaches like machine learning technique, motifs-based search, and hybrid approach. Our best model based on the hybrid approach achieved maximum prediction accuracy of 82.10% with MCC of 0.62 on main dataset. We also developed hybrid model on IFNgOnly dataset and achieved maximum accuracy of 81.39% with 0.57 MCC. Conclusion Based on this study, we have developed a webserver for predicting i) IFN-γ inducing peptides, ii) virtual screening of peptide libraries and iii) identification of IFN-γ inducing regions in antigen (http://crdd.osdd.net/raghava/ifnepitope/). Reviewers This article was reviewed by Prof Kurt

  10. Expression and regulation of complement C1q by human THP-1-derived macrophages.

    PubMed

    Walker, D G

    1998-01-01

    The regulation of C1q expression was examined in the human monocytic cell line THP-1. Since these cells can be differentiated into cells with macrophage properties and induced to express C1q, they were used as models for mature human monocyte/macrophages and indirectly microglia. Interferon-gamma (IFN-gamma) and the anti-inflammatory steroid agents dexamethasone and prednisone were powerful stimulators of C1q production, alone or in combination. Interleukin-6 (IL-6) and lipopolysaccharide (LPS) also had significant stimulatory activity. Phorbol myristate acetate, a protein kinase C activator, reduced C1q expression. Four additional classes of pharmacological agents were tested for their effect on C1q secretion. Tacrine, but not indomethacin, cimetidine, or propentofylline, showed activity in inhibiting C1q secretion by IFN-gamma treated THP-1-derived macrophages.

  11. Beyond Tryptophan Synthase: Identification of Genes That Contribute to Chlamydia trachomatis Survival during Gamma Interferon-Induced Persistence and Reactivation

    PubMed Central

    Muramatsu, Matthew K.; Brothwell, Julie A.; Stein, Barry D.; Putman, Timothy E.; Rockey, Daniel D.

    2016-01-01

    Chlamydia trachomatis can enter a viable but nonculturable state in vitro termed persistence. A common feature of C. trachomatis persistence models is that reticulate bodies fail to divide and make few infectious progeny until the persistence-inducing stressor is removed. One model of persistence that has relevance to human disease involves tryptophan limitation mediated by the host enzyme indoleamine 2,3-dioxygenase, which converts l-tryptophan to N-formylkynurenine. Genital C. trachomatis strains can counter tryptophan limitation because they encode a tryptophan-synthesizing enzyme. Tryptophan synthase is the only enzyme that has been confirmed to play a role in interferon gamma (IFN-γ)-induced persistence, although profound changes in chlamydial physiology and gene expression occur in the presence of persistence-inducing stressors. Thus, we screened a population of mutagenized C. trachomatis strains for mutants that failed to reactivate from IFN-γ-induced persistence. Six mutants were identified, and the mutations linked to the persistence phenotype in three of these were successfully mapped. One mutant had a missense mutation in tryptophan synthase; however, this mutant behaved differently from previously described synthase null mutants. Two hypothetical genes of unknown function, ctl0225 and ctl0694, were also identified and may be involved in amino acid transport and DNA damage repair, respectively. Our results indicate that C. trachomatis utilizes functionally diverse genes to mediate survival during and reactivation from persistence in HeLa cells. PMID:27430273

  12. Cross-talk between IGF-1 and estrogen receptors attenuates intracellular changes in ventral spinal cord 4.1 motoneuron cells because of interferon-gamma exposure.

    PubMed

    Park, Sookyoung; Nozaki, Kenkichi; Smith, Joshua A; Krause, James S; Banik, Naren L

    2014-03-01

    Insulin-like growth factor-1 (IGF-1) is a neuroprotective growth factor that promotes neuronal survival by inhibition of apoptosis. To examine whether IGF-1 exerts cytoprotective effects against extracellular inflammatory stimulation, ventral spinal cord 4.1 (VSC4.1) motoneuron cells were treated with interferon-gamma (IFN-γ). Our data demonstrated apoptotic changes, increased calpain:calpastatin and Bax:Bcl-2 ratios, and expression of apoptosis-related proteases (caspase-3 and -12) in motoneurons rendered by IFN-γ in a dose-dependent manner. Post-treatment with IGF-1 attenuated these changes. In addition, IGF-1 treatment of motoneurons exposed to IFN-γ decreased expression of inflammatory markers (cyclooxygenase-2 and nuclear factor-kappa B:inhibitor of kappa B ratio). Furthermore, IGF-1 attenuated the loss of expression of IGF-1 receptors (IGF-1Rα and IGF-1Rβ) and estrogen receptors (ERα and ERβ) induced by IFN-γ. To determine whether the protective effects of IGF-1 are associated with ERs, ERs antagonist ICI and selective siRNA targeted against ERα and ERβ were used in VSC4.1 motoneurons. Distinctive morphological changes were observed following siRNA knockdown of ERα and ERβ. In particular, apoptotic cell death assessed by TUNEL assay was enhanced in both ERα and ERβ-silenced VSC4.1 motoneurons following IFN-γ and IGF-1 exposure. These results suggest that IGF-1 protects motoneurons from inflammatory insult by a mechanism involving pivotal interactions with ERα and ERβ. © 2013 International Society for Neurochemistry.

  13. Adenoviral mediated interferon-alpha 2b gene therapy suppresses the pro-angiogenic effect of vascular endothelial growth factor in superficial bladder cancer.

    PubMed

    Adam, Liana; Black, Peter C; Kassouf, Wassim; Eve, Beryl; McConkey, David; Munsell, Mark F; Benedict, William F; Dinney, Colin P N

    2007-05-01

    Intravesical adenovirus mediated interferon-alpha gene transfer has a potent therapeutic effect against superficial human bladder carcinoma xenografts growing in the bladder of athymic nude mice. We determined whether the inhibition of angiogenesis might contribute to the antitumor effect. We treated several human urothelial carcinoma cells with adenovirus mediated interferon-alpha 2b and monitored its effects on the production of angiogenic factors using real-time reverse-transcription polymerase chain reaction, Western blotting, and immunohistochemical analysis and a gel shift based transcription factor array. To assess the role of adenovirus mediated interferon 2b in angiogenic activity we used in vitro invasion assays and evaluated the anti-angiogenic effects of adenovirus mediated interferon gene therapy in an orthotopic murine model of human superficial bladder cancer. In adenovirus mediated interferon-alpha infected 253J B-V cells vascular endothelial growth factor was decreased and anti-angiogenic interferon-gamma inducible protein 10 was up-regulated. In contrast, the addition of as much as 100,000 IU recombinant interferon had no apparent effect on vascular endothelial growth factor production. Conditioned medium derived from adenovirus mediated interferon 2b infected 253J B-V cells greatly decreased the invasive potential of human endothelial cells and down-regulated their matrix metalloproteinase 2 expression compared to controls. Furthermore, adenovirus mediated interferon 2b blocked pro-angiogenic nuclear signals, such as the transcription factors activating protein-1 and 2, stimulating protein-1, nuclear factor kappaB and c-myb. In vivo experiments revealed significant vascular endothelial growth factor down-regulation and decreased tumor vessel density in the adenovirus mediated interferon 2b treated group compared to controls. Treatment with adenovirus mediated interferon 2b increases the angiostatic activity of the bladder cancer microenvironment

  14. Mycobacterium tuberculosis infection in health care workers in rural India: comparison of a whole-blood interferon gamma assay with tuberculin skin testing.

    PubMed

    Pai, Madhukar; Gokhale, Kaustubh; Joshi, Rajnish; Dogra, Sandeep; Kalantri, Shriprakash; Mendiratta, Deepak K; Narang, Pratibha; Daley, Charles L; Granich, Reuben M; Mazurek, Gerald H; Reingold, Arthur L; Riley, Lee W; Colford, John M

    2005-06-08

    Mycobacterium tuberculosis infection in health care workers has not been adequately studied in developing countries using newer diagnostic tests. To estimate latent tuberculosis infection prevalence in health care workers using the tuberculin skin test (TST) and a whole-blood interferon gamma (IFN-gamma) assay; to determine agreement between the tests; and to compare their correlation with risk factors. A cross-sectional comparison study of 726 health care workers aged 18 to 61 years (median age, 22 years) with no history of active tuberculosis conducted from January to May 2004, at a rural medical school in India. A total of 493 (68%) of the health care workers had direct contact with patients with tuberculosis and 514 (71%) had BCG vaccine scars. Tuberculin skin testing was performed using 1-TU dose of purified protein derivative RT23, and the IFN-gamma assay was performed by measuring IFN-gamma response to early secreted antigenic target 6, culture filtrate protein 10, and a portion of tuberculosis antigen TB7.7. Agreement between TST and the IFN-gamma assay, and comparison of the tests with respect to their association with risk factors. A large proportion of the health care workers were latently infected; 360 (50%) were positive by either TST or IFN-gamma assay, and 226 (31%) were positive by both tests. The prevalence estimates of TST and IFN-gamma assay positivity were comparable (41%; 95% confidence interval [CI], 38%-45% and 40%; 95% CI, 37%-43%, respectively). Agreement between the tests was high (81.4%; kappa = 0.61; 95% CI, 0.56-0.67). Increasing age and years in the health profession were significant risk factors for both IFN-gamma assay and TST positivity. BCG vaccination had little impact on TST and IFN-gamma assay results. Our study showed high latent tuberculosis infection prevalence in Indian health care workers, high agreement between TST and IFN-gamma assay, and similar association between positive test results and risk factors. Although TST and

  15. The effect of fermented milk on interferon production in malnourished children and in anorexia nervosa patients undergoing nutritional care.

    PubMed

    Solis, B; Nova, E; Gómez, S; Samartín, S; Mouane, N; Lemtouni, A; Belaoui, H; Marcos, A

    2002-12-01

    For several years cytokine production has been associated with infections but it was not suspected that some types of food could also induce cytokines, even in a state of non-infection. Lactic bacteria can induce interferon (IFN) production in human healthy subjects, thus, a better protection against infections would be expected. Therefore, we planned to evaluate the effect of two diets including yoghurt or milk on IFN-gamma production during nutritional recovery in two different situations of malnutrition: (1) children with diarrhoea; and (2) patients with anorexia nervosa (AN). Both the diet including yoghurt of that including milk seemed to increase IFN-gamma production at the end of nutritional recovery in the malnourished children with diarrhoea. The significance of interferon production and the lymphocyte subset increase should be explored to know if a better resistance against pathogens is related to them. Regulation of intestinal absorption and moderate stimulation of interferon production make the yoghurt-based diet a good choice in the nutritional care of children. In the same way, an increase in the IFN-gamma production was observed in AN patients consuming yoghurt. This increase of IFN-gamma production could be considered a biological marker to detect the effect of probiotics on the immune response, especially in the improvement of a deficient nutritional status.

  16. Thymoquinone Suppresses IRF-3-Mediated Expression of Type I Interferons via Suppression of TBK1

    PubMed Central

    Cho, Jae Youl

    2018-01-01

    Interferon regulatory factor (IRF)-3 is known to have a critical role in viral and bacterial innate immune responses by regulating the production of type I interferon (IFN). Thymoquinone (TQ) is a compound derived from black cumin (Nigella sativa L.) and is known to regulate immune responses by affecting transcription factors associated with inflammation, including nuclear factor-κB (NF-κB) and activator protein-1 (AP-1). However, the role of TQ in the IRF-3 signaling pathway has not been elucidated. In this study, we explored the molecular mechanism of TQ-dependent regulation of enzymes in IRF-3 signaling pathways using the lipopolysaccharide (LPS)-stimulated murine macrophage-like RAW264.7 cell line. TQ decreased mRNA expression of the interferon genes IFN-α and IFN-β in these cells. This inhibition was due to its suppression of the transcriptional activation of IRF-3, as shown by inhibition of IRF-3 PRD (III-I) luciferase activity as well as the phosphorylation pattern of IRF-3 in the immunoblotting experiment. Moreover, TQ targeted the autophosphorylation of TANK-binding kinase 1 (TBK1), an upstream key enzyme responsible for IRF-3 activation. Taken together, these findings suggest that TQ can downregulate IRF-3 activation via inhibition of TBK1, which would subsequently decrease the production of type I IFN. TQ also regulated IRF-3, one of the inflammatory transcription factors, providing a novel insight into its anti-inflammatory activities. PMID:29751576

  17. Successful Application of the Gamma-Interferon Assay in a Bovine Tuberculosis Eradication Program: The French Bullfighting Herd Experience.

    PubMed

    Keck, Nicolas; Boschiroli, Maria-Laura; Smyej, Florence; Vogler, Valérie; Moyen, Jean-Louis; Desvaux, Stéphanie

    2018-01-01

    In the French Camargue region, where bovine tuberculosis had been enzootic for several years in bullfighting cattle herds, the gamma-interferon (IFN) assay was used since 2003 in parallel with the intradermal test in order to increase overall disease detection sensitivity in infected herds. This study presents the results of a field-evaluation of the assay during a 10-year period (2004-2014) of disease control and surveillance program and explores the particular pattern of IFN assay results in bullfight herds in comparison to cattle from other regions of France. The low sensitivity [59.2% (50.6; 67.3)] of IFN assay using the tuberculin stimulation could be related to the poor gamma-IFN production from bullfight cattle blood cells which is significantly lower than in animals of conventional breeds. The characteristics of the assay were progressively adapted to the epidemiological situation and the desired strategic applications. Data analysis with a receiver operating characteristic curve based on a simple S/P value algorithm allowed for the determination of a new cutoff adapted for a global screening, giving a high specificity of 99.9% results and a high accuracy of the assay. Having regularly risen to above 5% since 2005, with a peak around 10% in 2010, the annual incidence dropped to under 1% in 2014. The positive predictive value relative to the bacteriological confirmation evolved during the years, from 33% in 2009 to 12% during the last screening period, a normal trend in a context of decreasing prevalence. The estimated rate of false-positive reactions during screening campaigns was 0.67%, confirming the high specificity of the test, measured in bTB negative herds, in this epidemiological context. The proportion of false-positive reactions decreased with the age and was higher in males than in females. Although these results indicate that the IFN assay is accurate in the field, it also emphasizes great differences between interferon quantities produced by

  18. Underlying pathways for interferon risk to type II diabetes mellitus.

    PubMed

    Abdel-Hamid, Nabil; Jubori, Taghreed Al; Farhan, Amaal; Mahrous, Mariam; Gouri, Adel; Awad, Ezzat; Breuss, Johannes

    2013-11-01

    It has been known that chronic liver treatments interfere with blood glucose metabolism. It was recognized that diabetes mellitus among chronic hepatitis C was greater in other types of chronic liver diseases. Hepatitis C directly promotes insulin resistance through the proteosomal degradation of insulin resistance substrate. It suppressed hepatocyte glucose uptake through down-regulation of surface expression of glucose transporter. Long-term exposure to cytokine over expression seems to be cytotoxic to both beta cells of the pancreas and to hepatocytes. Elevated tumor necrosis factor-a, or its neutralization, increased insulin sensitivity. Interferon-a may also elevate the serum level of interleukin-1 which is cytotoxic to pancreatic islet cells. Both diabetes mellitus and resistance to interferon-a therapy are abnormally mediated by over-expression of suppressor of cytokine signaling-1 in hepatocytes of chronic hepatitis C patients. These data suggest that interferon-a therapy should be administered with caution in patients showing any predisposition to Diabetes mellitus. Anti inflammatory therapy is critically recommended as a protector against disease development due to cytokine mediated Diabetes mellitus during hepatitis C therapy, since inflammation seems to be a main candidate to interferon suspected diabetogenesis.

  19. Interferon-gamma response to the treatment of active pulmonary and extra-pulmonary tuberculosis.

    PubMed

    Liang, L; Shi, R; Liu, X; Yuan, X; Zheng, S; Zhang, G; Wang, W; Wang, J; England, K; Via, L E; Cai, Y; Goldfeder, L C; Dodd, L E; Barry, C E; Chen, R Y

    2017-10-01

    Interferon-gamma (IFN-γ) release assays (IGRAs) are used to diagnose tuberculosis (TB) but not to measure treatment response. To measure IFN-γ response to active anti-tuberculosis treatment. Patients from the Henan Provincial Chest Hospital, Henan, China, with TB symptoms and/or signs were enrolled into this prospective, observational cohort study and followed for 6 months of treatment, with blood and sputum samples collected at 0, 2, 4, 6, 8, 16 and 24 weeks. The QuantiFERON® TB-Gold assay was run on collected blood samples. Participants received a follow-up telephone call at 24 months to determine relapse status. Of the 152 TB patients enrolled, 135 were eligible for this analysis: 118 pulmonary (PTB) and 17 extra-pulmonary TB (EPTB) patients. IFN-γ levels declined significantly over time among all patients (P = 0.002), with this decline driven by PTB patients (P = 0.001), largely during the initial 8 weeks of treatment (P = 0.019). IFN-γ levels did not change among EPTB patients over time or against baseline culture or drug resistance status. After 6 months of effective anti-tuberculosis treatment, IFN-γ levels decreased significantly in PTB patients, largely over the initial 8 weeks of treatment. IFN-γ concentrations may offer some value for monitoring anti-tuberculosis treatment response among PTB patients.

  20. Suppressive effect of zinc ion on iNOS expression induced by interferon-gamma or tumor necrosis factor-alpha in murine keratinocytes.

    PubMed

    Yamaoka, J; Kume, T; Akaike, A; Miyachi, Y

    2000-05-01

    Zinc, an essential metal, is a critical component of zinc binding proteins such as zinc fingers, zinc enzymes and metallothioneins. Recently, evidence for its anti-inflammatory property in skin has been accumulating, as shown in the treatment of acne, alopecia and zinc deficiency. In cutaneous inflammations, a large amount of nitric oxide (NO) is produced through induction of inducible nitric oxide synthase (iNOS) under the influence of proinflammatory cytokines, resulting in tissue damages in skin, as clarified in other organs. Therefore, we asked if the effect of zinc on NO production and/or on iNOS expression in keratinocytes may explain the anti-inflammatory property of zinc in skin. Accordingly, we sought to determine in this study whether zinc ion may have effect on IFN-gamma or TNF-alpha induced NO production and iNOS expression in cultured murine keratinocytes. Ten microM of zinc ion remarkably suppressed cytokine-induced NO production in keratinocytes. Furthermore, zinc ion also suppressed cytokine-induced iNOS expression in the protein level as well as in the messenger RNA level. These results suggest the possibility that the suppressive effect of zinc ion on cytokine-induced NO production in keratinocytes may be in part implicated in the anti-inflammatory property of zinc in some of skin disorders.

  1. Respiratory Francisella tularensis live vaccine strain infection induces Th17 cells and prostaglandin E2, which inhibits generation of gamma interferon-positive T cells.

    PubMed

    Woolard, Matthew D; Hensley, Lucinda L; Kawula, Thomas H; Frelinger, Jeffrey A

    2008-06-01

    Two key routes of Francisella tularensis infection are through the skin and airway. We wished to understand how the route of inoculation influenced the primary acute adaptive immune response. We show that an intranasal inoculation of the F. tularensis live vaccine strain (LVS) with a 1,000-fold-smaller dose than an intradermal dose results in similar growth kinetics and peak bacterial burdens. In spite of similar bacterial burdens, we demonstrate a difference in the quality, magnitude, and kinetics of the primary acute T-cell response depending on the route of inoculation. Further, we show that prostaglandin E(2) secretion in the lung is responsible for the difference in the gamma interferon (IFN-gamma) response. Intradermal inoculation led to a large number of IFN-gamma(+) T cells 7 days after infection in both the spleen and the lung. In contrast, intranasal inoculation induced a lower number of IFN-gamma(+) T cells in the spleen and lung but an increased number of Th17 cells in the lung. Intranasal infection also led to a significant increase of prostaglandin E(2) (PGE(2)) in the bronchoalveolar lavage fluid. Inhibition of PGE(2) production with indomethacin treatment resulted in increased numbers of IFN-gamma(+) T cells and decreased bacteremia in the lungs of intranasally inoculated mice. This research illuminates critical differences in acute adaptive immune responses between inhalational and dermal infection with F. tularensis LVS mediated by the innate immune system and PGE(2).

  2. Gamma Interferon Loaded onto Albumin Nanoparticles: In Vitro and In Vivo Activities against Brucella abortus▿

    PubMed Central

    Segura, S.; Gamazo, C.; Irache, J. M.; Espuelas, S.

    2007-01-01

    The aim of this study was to evaluate the activity of gamma interferon (IFN-γ) when it was either adsorbed onto or loaded into albumin nanoparticles. Brucella abortus-infected macrophages and infected BALB/c mice were selected as the models for testing of the therapeutic potentials of these cytokine delivery systems, in view of the well-established role of IFN-γ-activated macrophages for the control of Brucella sp. infections. Whereas the encapsulation of IFN-γ inside the matrix of nanoparticles completely abrogated its activity, adsorbed IFN-γ increased by 0.75 log unit the bactericidal effect induced by RAW macrophages activated with free IFN-γ, along with a higher level of production of nitric oxide. In infected BALB/c-mice, IFN-γ adsorbed onto nanoparticles was also more active than free cytokine in reducing the number of bacteria in the spleens, and the effect was mediated by an increased ratio of IFN-γ-secreting (Th1) to interleukin-4-secreting (Th2) cells. Overall, albumin nanoparticles would be suitable as carriers that target IFN-γ to macrophages and, thus, potentiate their therapeutic activity. PMID:17220401

  3. Frequency of indeterminate results from an interferon-gamma release assay among HIV-infected individuals.

    PubMed

    Oliveira, Sandra Maria do Valle Leone de; Trajman, Anete; Paniago, Anamaria Mello Miranda; Motta-Castro, Ana Rita Coimbra; Ruffino-Netto, Antonio; Maciel, Ethel Leonor Noia; Croda, Julio; Bonecini-Almeida, Maria da Gloria

    2017-01-01

    To evaluate the frequency of and factors associated with indeterminate interferon-gamma release assay (IGRA) results in people living with HIV/AIDS (PLWHA). We tested 81 PLWHA in the central-west region of Brazil, using the tuberculin skin test and an IGRA. Information on sociodemographic and clinical variables was gathered through the use of questionnaires and from medical records. The association of those variables with indeterminate results was analyzed by calculating the adjusted ORs in a multivariate logistic regression model. Concordance was evaluated by determining the kappa statistic. Among the 81 patients evaluated, the tuberculin skin test results were positive in 18 (22.2%) of the patients, and the IGRA results were positive in 10 (12.3%), with a kappa of 0.62. The IGRA results were indeterminate in 22 (27.1%) of the patients (95% CI: 17.8-38.1%). The odds of obtaining indeterminate results were significantly higher in smokers (adjusted OR = 6.0; 95% CI: 1.4-26.7) and in samples stored for less than 35 days (adjusted OR = 14.0; 95% CI: 3.1-64.2). Patients with advanced immunosuppression (CD4+ T-cell count < 200 cells/mm3) were at a higher risk for indeterminate results (OR adjusted for smoking and inadequate duration of sample storage = 4.7; 95% CI: 0.91-24.0), although the difference was not significant. The high prevalence of indeterminate results can be a major limitation for the routine use of IGRAs in PLWHA. The need to repeat the test increases its costs and should be taken into account in cost-effectiveness studies. The processing of samples can significantly alter the results. Avaliar a frequência de resultados indeterminados de um interferon-gamma release assay (IGRA, ensaio de liberação de interferon-gama) e os fatores relacionados com esses resultados em pessoas vivendo com HIV/AIDS (PVHA). Foram avaliadas 81 PVHA na região Centro-Oeste do Brasil, por meio do teste tuberculínico e de um IGRA. Informações a respeito de vari

  4. Tumor necrosis factor alpha mediates resistance to Trypanosoma cruzi infection in mice by inducing nitric oxide production in infected gamma interferon-activated macrophages.

    PubMed Central

    Silva, J S; Vespa, G N; Cardoso, M A; Aliberti, J C; Cunha, F Q

    1995-01-01

    Cell invasion by Trypanosoma cruzi and its intracellular replication are essential for continuation of the parasite life cycle and for production of Chagas' disease. T. cruzi is able to replicate in nucleated cells and can be killed by activated macrophages. Gamma interferon (IFN-gamma) is one of the major stimuli for the activation of macrophages and has been shown to be a key activation factor for the killing of intracellular parasites through a mechanism dependent upon nitric oxide (NO) biosynthesis. We show that although the addition of exogenous tumor necrosis factor alpha (TNF-alpha) does not potentiate the trypanocidal activity of IFN-gamma in vitro, treatment of resistant C57BI/6 mice with an anti-TNF-alpha monoclonal antibody increased parasitemia and mortality. In addition, the anti-TNF-alpha-treated animals had decreased NO production, both in vivo and in vitro, suggesting an important role for TNF-alpha in controlling infection. In order to better understand the role of TNF-alpha in the macrophage-mediating killing of parasites, cultures of T. cruzi-infected macrophages were treated with an anti-TNF-alpha monoclonal antibody. IFN-gamma-activated macrophages failed to kill intracellular parasites following treatment with 100 micrograms of anti-TNF-alpha. In these cultures, the number of parasites released at various time points after infection was significantly increased while NO production was significantly reduced. We conclude that IFN-gamma-activated macrophages produce TNF-alpha after infection by T. cruzi and suggest that this cytokine plays a role in amplifying NO production and parasite killing. PMID:7591147

  5. How Does Vaccinia Virus Interfere With Interferon?

    PubMed

    Smith, Geoffrey L; Talbot-Cooper, Callum; Lu, Yongxu

    2018-01-01

    Interferons (IFNs) are secreted glycoproteins that are produced by cells in response to virus infection and other stimuli and induce an antiviral state in cells bearing IFN receptors. In this way, IFNs restrict virus replication and spread before an adaptive immune response is developed. Viruses are very sensitive to the effects of IFNs and consequently have evolved many strategies to interfere with interferon. This is particularly well illustrated by poxviruses, which have large dsDNA genomes and encode hundreds of proteins. Vaccinia virus is the prototypic poxvirus and expresses many proteins that interfere with IFN and are considered in this review. These proteins act either inside or outside the cell and within the cytoplasm or nucleus. They function by restricting the production of IFN by blocking the signaling pathways leading to transcription of IFN genes, stopping IFNs binding to their receptors, blocking IFN-induced signal transduction leading to expression of interferon-stimulated genes (ISGs), or inhibiting the antiviral activity of ISG products. © 2018 Elsevier Inc. All rights reserved.

  6. Allocation of Interferon Gamma mRNA Positive Cells in Caecum Hallmarks a Protective Trait Against Histomonosis.

    PubMed

    Kidane, Fana Alem; Mitra, Taniya; Wernsdorf, Patricia; Hess, Michael; Liebhart, Dieter

    2018-01-01

    Histomonosis is a parasitic disease of gallinaceous birds characterized by necrotic lesions in cacum and liver that usually turns fatal in turkeys while it is less severe in chickens. Vaccination using in vitro attenuated Histomonas meleagridis has been experimentally shown to confer protection against histomonosis. The protective mechanisms that underpin the vaccine-induced immune response are not resolved so far. Therefore, the actual study aimed to evaluate the location and quantitative distribution patterns of signature cytokines of type 1 [interferon gamma (IFN-γ)] or type 2 [interleukin (IL)-13] immune responses in vaccinated or infected hosts. An intergroup and interspecies difference in the spatial and temporal distribution patterns of cytokine mRNA positive cells was evident. Quantification of cells showed a significantly decreased percentage of IFN-γ mRNA positive cells at 4 days post-inoculation (DPI) in caeca of turkeys inoculated exclusively with the attenuated or the virulent inocula, compared to control birds. The decrement was followed by a surge of cells expressing mRNA for IFN-γ or IL-13, reaching a peak of increment at 10 DPI. By contrast, turkeys challenged following vaccination showed a slight increment of cecal IFN-γ mRNA positive cells at 4 DPI after which positive cell counts became comparable to control birds. The increase in infected birds was accompanied by an extensive distribution of positively stained cells up to the muscularis layer of cecal tissue whereas the vaccine group maintained an intact mucosal structure. In chickens, the level of changes of positive cells was generally lower compared to turkeys. However, control chickens were found with a higher percentage of IFN-γ mRNA positive cells in cecum compared to their turkey counterparts indicating a higher resistance to histomonosis, similar to the observation in immunized turkeys. In chickens, it could be shown that the changes of cytokine-positive cells were related to

  7. Establishment of a novel endothelial target mouse model of a typhus group rickettsiosis: evidence for critical roles for gamma interferon and CD8 T lymphocytes.

    PubMed

    Walker, D H; Popov, V L; Feng, H M

    2000-09-01

    A mouse model of typhus rickettsiosis that reproduces the hematogenous dissemination to the critical target organs, including brain, lungs, heart, and kidneys, primary endothelial and, to a lesser degree, macrophage intracellular rickettsial infection, and typical vascular-based lesions of louse-borne typhus and murine typhus was established. Intravenous inoculation of C3H/HeN mice with Rickettsia typhi caused disease with a duration of the incubation period and mortality rate that were dependent on the infective dose of rickettsiae. Lethal infection was associated with high concentrations of R. typhi in the lungs and brain, despite a brisker humoral immune response to the rickettsiae than in the sublethal infection. Gamma interferon and CD8 T lymphocytes were demonstrated to be crucial to clearance of the rickettsiae and recovery from infection in experiments in which specific monoclonal antibodies were administered to deplete these components. Death of animals depleted of gamma interferon or CD8 T lymphocytes was associated with overwhelming rickettsial infection demonstrated by titers of infectious rickettsiae and by immunohistochemistry. An effective antirickettsial immune response was associated with elevated serum concentrations of IL-12 on Day 5 and increased secretion of IL-12 by concanavalin-A-stimulated spleen cells on Day 5. Evidence for transient suppression of the immune response consisted of marked reduction in the secretion of IL-2 and IL-12 by concanavalin-A-stimulated spleen cells on Days 10 and 15. This model offers excellent opportunities for study of attenuation and pathogenetic mechanisms of typhus rickettsiae, which are established biologic weapons of potential use in bioterrorism.

  8. Interferon-Gamma and Fas Are Involved in Porphyromonas gingivalis-Induced Apoptosis of Human Extravillous Trophoblast-Derived HTR8/SVneo Cells via Extracellular Signal-Regulated Kinase 1/2 Pathway.

    PubMed

    Ren, Hongyu; Li, Yuhong; Jiang, Han; Du, Minquan

    2016-11-01

    A number of studies recently revealed a link between periodontal disease and preterm birth (PTB). PTB can be induced by dental infection with Porphyromonas gingivalis (Pg), a periodontopathic bacterium. This study aims to investigate responses of human extravillous trophoblast-derived HTR8/SVneo cells to Pg infection. Cell apoptosis, cell viability, protein expression, and cytokine production in HTR8 cells were measured via: 1) flow cytometry, 2) CCK-8 assay, 3) western blot, and 4) enzyme-linked immunosorbent assay methods, respectively. Pg decreased cell viability and increased cell apoptosis, active caspase-3 and Fas expression, and interferon-gamma (IFN-γ) secretion in HTR8 cells. Extracellular signal-regulated kinase (ERK) 1/2 inhibitor U0126 and FasL neutralizing antibody NOK1 that blocks FasL/Fas interaction both significantly suppressed Pg-induced apoptosis. U0126 also inhibited IFN-γ secretion and Fas expression close to control levels. Moreover, treatment with recombinant IFN-γ also significantly decreased number of viable HTR8 cells and increased Fas expression, suggesting IFN-γ may play an important role in Pg-induced apoptosis of HTR8 cells, at least partially through regulation of Fas expression. To the best of the authors' knowledge, this is the first study to demonstrate Pg induces IFN-γ secretion, Fas expression, and apoptosis in human extravillous trophoblast-derived HTR8/SVneo cells in an ERK1/2-dependent manner, and IFN-γ (explored by recombinant IFN-γ) and Fas are involved in Pg-induced apoptosis. The finding that Pg infection abnormally regulates inflammation and apoptosis of human trophoblasts may give new insights into the possible link of PTB with maternal periodontal disease and periodontal pathogens.

  9. Effect of recombinant human gamma interferon on intracellular activities of antibiotics against Listeria monocytogenes in the human macrophage cell line THP-1.

    PubMed Central

    Scorneaux, B; Ouadrhiri, Y; Anzalone, G; Tulkens, P M

    1996-01-01

    Listeria monocytogenes is a facultative intracellular pathogen which enters cells by endocytosis and reaches phagolysosomes from where it escapes and multiplies in the cytosol of untreated cells. Exposure of macrophages to gamma interferon (IFN-gamma) restricts L. monocytogenes to phagosomes and prevents its intracellular multiplication. We have tested whether IFN-gamma also modulates the susceptibility of L. monocytogenes to antibiotics. We selected drugs from three different classes displaying marked properties concerning their cellular accumulation and subcellular distribution, namely, ampicillin (not accumulated by cells but present in cytosol), azithromycin (largely accumulated by cells but mostly restricted to lysosomes), and sparfloxacin (accumulated to a fair extent but detected only in cytosol). We used a continuous line of myelomonocytic cells (THP-1 macrophages), which display specific surface receptors for IFN-gamma, and examined the activity of these antibiotics against L. monocytogenes Hly+ (virulent variant) and L. monocytogenes Hly- (a nonvirulent variant defective in hemolysin production). Untreated THP-1 and phorbol myristate acetate-differentiated THP-1 were permissive for infection and multiplication of intracellular L. monocytogenes Hly+ (virulent variant). All three antibiotics tested were bactericidal against this Listeria strain when added to an extracellular concentration of 10x their MIC. After preexposure of THP-1 to IFN-gamma, L. monocytogenes Hly+ was still phagocytosed but no longer grew intracellularly. The activity of ampicillin became almost undetectable (antagonistic effect), and that of azithromycin was unchanged (additive effect with that of IFN-gamma), whereas that of sparfloxacin was markedly enhanced (synergy). A similar behavior (lack of bacterial growth, associated with a loss of activity of ampicillin, an enhanced activity of sparfloxacin, and unchanged activity of azithromycin) was observed in cells infected with L

  10. Interferon-gamma inducible protein-10 as a potential biomarker in localized scleroderma.

    PubMed

    Magee, Kelsey E; Kelsey, Christina E; Kurzinski, Katherine L; Ho, Jonhan; Mlakar, Logan R; Feghali-Bostwick, Carol A; Torok, Kathryn S

    2013-01-01

    The purpose of this study was to evaluate the presence and levels of interferon-gamma inducible protein-10 (IP-10) in the plasma and skin of pediatric localized scleroderma (LS) patients compared to those of healthy pediatric controls and to determine if IP-10 levels correlate to clinical disease activity measures. The presence of IP-10 in the plasma was analyzed using a Luminex panel in 69 pediatric patients with LS and compared to 71 healthy pediatric controls. Of these patients, five had available skin biopsy specimens with concurrent clinical and serological data during the active disease phase, which were used to analyze the presence and location of IP-10 in the skin by immunohistochemistry (IHC). IP-10 levels were significantly elevated in the plasma of LS patients compared to that of healthy controls and correlated to clinical disease activity measures in LS. Immunohistochemistry staining of IP-10 was present in the dermal infiltrate of LS patients and was similar to that found in psoriasis skin specimens, the positive disease control. Elevation of IP-10 levels in the plasma compared to those of healthy controls and the presence of IP-10 staining in the affected skin of LS patients indicates that IP-10 is a potential biomarker in LS. Furthermore, significant elevation of IP-10 in LS patients with active versus inactive disease and correlations between IP-10 levels and standardized disease outcome measures of activity in LS strongly suggest that IP-10 may be a biomarker for disease activity in LS.

  11. Interferon-gamma inducible protein-10 as a potential biomarker in localized scleroderma

    PubMed Central

    2013-01-01

    Introduction The purpose of this study was to evaluate the presence and levels of interferon-gamma inducible protein-10 (IP-10) in the plasma and skin of pediatric localized scleroderma (LS) patients compared to those of healthy pediatric controls and to determine if IP-10 levels correlate to clinical disease activity measures. Methods The presence of IP-10 in the plasma was analyzed using a Luminex panel in 69 pediatric patients with LS and compared to 71 healthy pediatric controls. Of these patients, five had available skin biopsy specimens with concurrent clinical and serological data during the active disease phase, which were used to analyze the presence and location of IP-10 in the skin by immunohistochemistry (IHC). Results IP-10 levels were significantly elevated in the plasma of LS patients compared to that of healthy controls and correlated to clinical disease activity measures in LS. Immunohistochemistry staining of IP-10 was present in the dermal infiltrate of LS patients and was similar to that found in psoriasis skin specimens, the positive disease control. Conclusions Elevation of IP-10 levels in the plasma compared to those of healthy controls and the presence of IP-10 staining in the affected skin of LS patients indicates that IP-10 is a potential biomarker in LS. Furthermore, significant elevation of IP-10 in LS patients with active versus inactive disease and correlations between IP-10 levels and standardized disease outcome measures of activity in LS strongly suggest that IP-10 may be a biomarker for disease activity in LS. PMID:24499523

  12. Topical interferon-gamma neutralization prevents conjunctival goblet cell loss in experimental murine dry eye.

    PubMed

    Zhang, Xiaobo; De Paiva, Cintia S; Su, Zhitao; Volpe, Eugene A; Li, De-Quan; Pflugfelder, Stephen C

    2014-01-01

    Evidence suggests that the cytokine interferon (IFN)-γ released by natural killer and CD4(+) T cells contributes to the conjunctival goblet cell (GC) loss in dry eye. The purpose of this study was to investigate if topical neutralization of IFN-γ prevents or alleviates GC loss in an experimental desiccating stress (DS) model of dry eye. In this study, we found that topical IFN-γ neutralization significantly decreased DS-induced conjunctival GC loss. This was accompanied by decreased epithelial apoptosis, and increased IL-13 and decreased FoxA2 expression in the forniceal conjunctiva. To establish that IFN-γ produced by pathogenic CD4(+) T cells contributes to DS-induced GC loss, adoptive transfer of CD4(+) T cells isolated from DS exposed donors to naïve RAG-1(-/-) recipient mice was performed. Similar to the donor mice, topical IFN-γ neutralization decreased conjunctival GC loss, suppressed apoptosis and increased IL-13 expression in adoptive transfer recipients. In summary, this study demonstrated that topical neutralization of IFN-γ prevents GC loss via modulating apoptosis and maintaining IL-13 signaling. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. Interferon regulatory factor 3 (IRF-3) in Japanese flounder, Paralichthys olivaceus: sequencing, limited tissue distribution, inducible expression and induction of fish type I interferon promoter.

    PubMed

    Hu, Guobin; Yin, Xiangyan; Lou, Huimin; Xia, Jun; Dong, Xianzhi; Zhang, Jianyie; Liu, Qiuming

    2011-02-01

    Two cDNAs with different 3'-untranslated region (UTR) encoding an interferon regulatory factor 3 (IRF-3) were cloned from head kidney of Japanese flounder, Paralichthys olivaceus, by reverse transcription polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE) methods. Sequence analysis reveals that they were generated by alternative polyadenylation. The predicted protein consists of 467 amino acid residues which shares the highest identity of 50.7-57.6% to fish IRF-3 and possesses a DNA-binding domain (DBD), an IRF association domain (IAD) and a serine-rich domain (SRD) of vertebrate IRF-3. The presence of these domains along with phylogenetic analysis places it into the IRF-3 group of the IRF-3 subfamily. RT-PCR analysis revealed that flounder IRF-3 was expressed constitutively in limited tissue types including head kidney, spleen, kidney, heart, gill, intestine and liver. A quantitative real time PCR assay was employed to monitor expression of IRF-3, type I interferon (IFN) and Mx in flounder head kidney and gill. All three genes were up-regulated by polyinosinic:polycytidylic acid (polyI:C) and lymphocystis disease virus (LCDV) with an earlier but slight and less persistent increase in transcription levels seen for the IRF-3. Finally, flounder IRF-3 was proved to induce fish type I IFN promoter in FG9307 cells, a flounder gill cell line, by a luciferase assay. These results provide insights into the roles of fish IRF-3 in the antiviral immunity. Copyright © 2010 Elsevier Ltd. All rights reserved.

  14. CXCR6 promotes atherosclerosis by supporting T-cell homing, interferon-gamma production, and macrophage accumulation in the aortic wall.

    PubMed

    Galkina, Elena; Harry, Brian L; Ludwig, Andreas; Liehn, Elisa A; Sanders, John M; Bruce, Anthony; Weber, Christian; Ley, Klaus

    2007-10-16

    T lymphocytes are thought to be important in atherosclerosis, but very little is known about the mechanisms of lymphocyte recruitment into atherosclerosis-prone aortas. In this study we tested the hypothesis that CXCR6, a chemokine receptor that is expressed on a subset of CD4+ T helper 1 cells and natural killer T cells, is involved in lymphocyte homing into the aortic wall and modulates the development and progression of atherosclerosis. To investigate the role of CXCR6 in the development and progression of atherosclerosis, we bred CXCR6-deficient (CXCR6(GFP/GFP)) mice with apolipoprotein E-deficient (ApoE(-/-)) mice. We found that CXCR6(GFP/GFP)/ApoE(-/-) mice fed a Western diet for 17 weeks or a chow diet for 56 weeks had decreased atherosclerosis compared with ApoE(-/-) controls. Flow cytometry analysis of the aortas from CXCR6(GFP/GFP)/ApoE(-/-) mice showed that the reduction of atherosclerosis was accompanied by a decreased percentage of CXCR6+ T cells within the aortas. Short-term homing experiments demonstrated that CXCR6 is involved in the recruitment of CXCR6+ leukocytes into the atherosclerosis-prone aortic wall. The reduced percentage of CXCR6+ T cells within the aortas resulted in significantly diminished production of interferon-gamma and reduction of CD11b+/CD68+ macrophages in the aorta. These data provide evidence for a proatherosclerotic role of CXCR6. Absence of CXCR6 alters the recruitment of CXCR6+ leukocytes and modulates the local immune response within the aortic wall.

  15. Enhanced antitumor reactivity of tumor-sensitized T cells by interferon alfa

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vander Woude, D.L.; Wagner, P.D.; Shu, S.

    Tumor-draining lymph node cells from mice bearing the methylcholanthrene-induced MCA 106 tumors can be sensitized in vitro to acquire antitumor reactivity. We examined the effect of interferon alfa on the function of cells that underwent in vitro sensitization in adoptive immunotherapy. Interferon alfa increased the antitumor reactivity of in vitro sensitized cells in the treatment of MCA 106 pulmonary metastases. This effect was evident in irradiated mice, indicating that a host response to the interferon alfa was not required. Interferon alfa treatment increased class I major histocompatibility complex antigen expression on tumor cells and increased their susceptibility to lysis bymore » in vitro sensitized cells. These results suggest that interferon alfa enhancement of adoptive immunotherapy was mediated by its effect on tumor cells. Interferon alfa may be a useful adjunct to the adoptive immunotherapy of human cancer.« less

  16. Interferon in lyssavirus infection.

    PubMed

    Rieder, Martina; Finke, Stefan; Conzelmann, Karl-Klaus

    2012-01-01

    Rabies is a zoonosis still claiming more than 50 000 human deaths per year. Typically, human cases are due to infection with rabies virus, the prototype of the Lyssavirus genus, but sporadic cases of rabies-like encephalitis caused by other lyssaviruses have been reported. In contrast to rabies virus, which has an extremely broad host range including many terrestrial warm-blooded animals, rabies-related viruses are associated predominantly with bats and rarely infect terrestrial species. In spite of a very close genetic relationship of rabies and rabies-related viruses, the factors determining the limited host range of rabies-related viruses are not clear. In the past years the importance of viral countermeasures against the host type I interferon system for establishment of an infection became evident. The rabies virus phosphoprotein (P) has emerged as a critical factor required for paralysing the signalling cascades leading to transcriptional activation of interferon genes as well as interferon signalling pathways, thereby limiting expression of antiviral and immune stimulatory genes. Comparative studies would be of interest in order to determine whether differential abilities of the lyssavirus P proteins contribute to the restricted host range of lyssaviruses.

  17. Inhibition of Interferon-beta Responses in Multiple Sclerosis Immune Cells Associated With High-Dose Statins

    PubMed Central

    Feng, Xuan; Han, Diana; Kilaru, Bharat K.; Franek, Beverly S.; Niewold, Timothy B.; Reder, Anthony T.

    2014-01-01

    Objective To determine whether statins affect type 1 interferon responses in relapsing-remitting multiple sclerosis (RRMS). Design Study effects of atorvastatin on type 1 interferon responses in Jurkat cells, mononuclear cells (MNCs) from therapy-naive patients with RRMS in vitro, and MNCs from interferon-treated RRMS patients in vivo in 4 conditions: no drug, statin only, interferon-beta only, and statin added on to interferon-beta therapy. Patients The study examined clinically stable patients with RRMS: 21 therapy-naive patients and 14 patients receiving interferon-beta with a statin. Interventions Statin effects on in vitro and in vivo interferon-beta–induced STAT1 transcription factor activation, expression of interferon-stimulated proteins in MNCs, and serum type 1 interferon activity. Results In vitro, atorvastatin dose dependently inhibited expression of interferon-stimulated P-Y-STAT1 by 44% (P< .001), interferon regulatory factor 1 protein by 30% (P= .006), and myxovirus resistance 1 protein by 32% (P=.004) compared with no-statin control in MNCs from therapy-naive RRMS patients. In vivo, 9 of 10 patients who received high-dose statins (80 mg) had a significant reduction in interferon-beta therapy–induced serum interferon-α/β activity, whereas only 2 of 4 patients who received medium-dose statins (40 mg) had reductions. High-dose add-on statin therapy significantly blocked interferon-beta function, with less P-Y-STAT1 transcription factor activation, and reduced myxovirus resistance 1 protein and viperin protein production. Medium doses of statins did not change STAT1 activation. Conclusions High-dose add-on statin therapy significantly reduces interferon-beta function and type 1 interferon responses in RRMS patients. These data provide a putative mechanism for how statins could counteract the beneficial effects of interferon-beta and worsen disease. PMID:22801747

  18. Results of space experiment program "Interferon". II. Influence of spaceflight conditions on the activity of interferon preparations and interferon inducers ("Interferon II").

    PubMed

    Tálas, M; Bátkai, L; Stöger, I; Nagy, K; Hiros, L; Konstantinova, I; Kozharinov, V

    1983-01-01

    The influence of spaceflight conditions on the biological activity of HuIFN-alpha preparations (lyophilized, in solution and in ointment) and interferon inducers was studied. In antiviral activity no difference was observed between the samples kept aboard the spaceship and the controls kept under ground conditions. The interferon inducers poly I:C, poly G:C and gossipol placed in the space laboratory for 7 days maintained their interferon-inducing capacity. The circulating interferon level in mice was the same irrespective of the induction being performed with flight or ground-control samples of inducers.

  19. A randomized phase II trial comparing two different sequence combinations of autologous vaccine and human recombinant interferon gamma and human recombinant interferon alpha2B therapy in patients with metastatic renal cell carcinoma: clinical outcome and analysis of immunological parameters.

    PubMed

    Schwaab, T; Heaney, J A; Schned, A R; Harris, R D; Cole, B F; Noelle, R J; Phillips, D M; Stempkowski, L; Ernstoff, M S

    2000-04-01

    The clinical observation of spontaneous regression in patients with renal cell carcinoma (RCC) and the response to various immunotherapeutic therapies strongly suggest a role for the host immune system in this disease. Prior studies showed that sequential administration of interferon (IFN) gamma and IFN alpha to RCC patients was safe. Clinical responses as well as immune changes in the peripheral blood mononuclear cell compartment were observed. Autologous tumor cell vaccines (AV) have also demonstrated activity in renal cell carcinoma. We hypothesize that the addition of AV to sequential IFN gamma and a therapy might improve the tumor-specific immune response by providing an appropriate source of antigen in the appropriate cytokine environment. To our knowledge, this is the first trial using AV combined with IFN alpha and IFN gamma. The purpose of this study was to evaluate the feasibility of manufacturing and administering (AV) from resected tumor samples, and administration of AV with combination IFN gamma and IFN alpha therapy. Finally, the impact on immunological parameters of these treatment options was assessed. Patients with metastatic RCC were randomly assigned to receive AV plus bCG along with a sequential administration of IFN gamma and a either together or after initiation of vaccine. Toxicity and clinical responses were evaluated. Modulations of the immune system were investigated by analyzing phenotype, cytokine mRNA expression, T cell proliferation and cytotoxicity in the peripheral blood mononuclear cell compartment. Fourteen patients with metastatic renal cell carcinoma were enrolled in this study; 9 were available for response evaluation. In a 70 day period, 3 (33%) showed mixed responses, 5 (56%) stable disease and 1 (11%) progression of disease. Toxicities were consistent with previous clinical reports. In the flow-cytometry phenotype analysis, stimulation of distinct subsets of circulating T-lymphocytes and a decrease of CD8+ T cell subsets was

  20. Perforin and Gamma Interferon Expression Are Required for CD4+ and CD8+ T-Cell-Dependent Protective Immunity against a Human Parasite, Trypanosoma cruzi, Elicited by Heterologous Plasmid DNA Prime-Recombinant Adenovirus 5 Boost Vaccination▿

    PubMed Central

    de Alencar, Bruna C. G.; Persechini, Pedro M.; Haolla, Filipe A.; de Oliveira, Gabriel; Silverio, Jaline C.; Lannes-Vieira, Joseli; Machado, Alexandre V.; Gazzinelli, Ricardo T.; Bruna-Romero, Oscar; Rodrigues, Mauricio M.

    2009-01-01

    A heterologous prime-boost strategy using plasmid DNA, followed by replication-defective recombinant adenovirus 5, is being proposed as a powerful way to elicit CD4+ and CD8+ T-cell-mediated protective immunity against intracellular pathogens. We confirmed this concept and furthered existing research by providing evidence that the heterologous prime-boost regimen using the gene encoding amastigote surface protein 2 elicited CD4+ and CD8+ T-cell-mediated protective immunity (reduction of acute parasitemia and prolonged survival) against experimental infection with Trypanosoma cruzi. Protective immunity correlated with the presence of in vivo antigen-specific cytotoxic activity prior to challenge. Based on this, our second goal was to determine the outcome of infection after heterologous prime-boost immunization of perforin-deficient mice. These mice were highly susceptible to infection. A detailed analysis of the cell-mediated immune responses in immunized perforin-deficient mice showed an impaired gamma interferon (IFN-γ) secretion by immune spleen cells upon restimulation in vitro with soluble recombinant antigen. In spite of a normal numeric expansion, specific CD8+ T cells presented several functional defects detected in vivo (cytotoxicity) and in vitro (simultaneous expression of CD107a/IFN-γ or IFN-γ/tumor necrosis factor alpha) paralleled by a decreased expression of CD44 and KLRG-1. Our final goal was to determine the importance of IFN-γ in the presence of highly cytotoxic T cells. Vaccinated IFN-γ-deficient mice developed highly cytotoxic cells but failed to develop any protective immunity. Our study thus demonstrated a role for perforin and IFN-γ in a number of T-cell-mediated effector functions and in the antiparasitic immunity generated by a heterologous plasmid DNA prime-adenovirus boost vaccination strategy. PMID:19651871

  1. Differential IFN-gamma stimulation of HLA-A gene expression through CRM-1-dependent nuclear RNA export.

    PubMed

    Browne, Sarah K; Roesser, James R; Zhu, Sheng Zu; Ginder, Gordon D

    2006-12-15

    IFNs regulate most MHC class I genes by stimulating transcription initiation. As shown previously, IFN-gamma controls HLA-A expression primarily at the posttranscriptional level. We have defined two 8-base sequences in a 39-nucleotide region in the 3'-transcribed region of the HLA-A gene that are required for the posttranscriptional response to IFN-gamma. Stimulation of HLA-A expression by IFN-gamma requires nuclear export of HLA-A mRNA by chromosome maintenance region 1 (CRM-1). Treatment of cells with leptomycin B, a specific inhibitor of CRM-1, completely inhibited IFN-gamma induction of HLA-A. Expression of a truncated, dominant-negative form of the nucleoporin NUP214/CAN, DeltaCAN, that specifically interacts with CRM-1, also prevented IFN-gamma stimulation of HLA-A, providing confirmation of the role of CRM-1. Increased expression of HLA-A induced by IFN-gamma also requires protein methylation, as shown by the fact that treatment of SK-N-MC cells or HeLa cells with the PRMT1 inhibitor 5'-methyl-5'-thioadenosine abolished the cellular response to IFN-gamma. In contrast with HLA-A, IFN-gamma-induced expression of the HLA class Ib gene, HLA-E, was not affected by either 5'-methyl-5'-thioadenosine or leptomycin B. These results provide proof of principle that it is possible to differentially modulate the IFN-gamma-induced expression of the HLA-E and HLA-A genes, whose products often mediate opposing effects on cellular immunity to tumor cells, pathogens, and autoantigens.

  2. JC virus induces altered patterns of cellular gene expression: Interferon-inducible genes as major transcriptional targets

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Verma, Saguna; Ziegler, Katja; Ananthula, Praveen

    2006-02-20

    Human polyomavirus JC (JCV) infects 80% of the population worldwide. Primary infection, typically occurring during childhood, is asymptomatic in immunocompetent individuals and results in lifelong latency and persistent infection. However, among the severely immunocompromised, JCV may cause a fatal demyelinating disease, progressive multifocal leukoencephalopathy (PML). Virus-host interactions influencing persistence and pathogenicity are not well understood, although significant regulation of JCV activity is thought to occur at the level of transcription. Regulation of the JCV early and late promoters during the lytic cycle is a complex event that requires participation of both viral and cellular factors. We have used cDNA microarraymore » technology to analyze global alterations in gene expression in JCV-permissive primary human fetal glial cells (PHFG). Expression of more than 400 cellular genes was altered, including many that influence cell proliferation, cell communication and interferon (IFN)-mediated host defense responses. Genes in the latter category included signal transducer and activator of transcription 1 (STAT1), interferon stimulating gene 56 (ISG56), myxovirus resistance 1 (MxA), 2'5'-oligoadenylate synthetase (OAS), and cig5. The expression of these genes was further confirmed in JCV-infected PHFG cells and the human glioblastoma cell line U87MG to ensure the specificity of JCV in inducing this strong antiviral response. Results obtained by real-time RT-PCR and Western blot analyses supported the microarray data and provide temporal information related to virus-induced changes in the IFN response pathway. Our data indicate that the induction of an antiviral response may be one of the cellular factors regulating/controlling JCV replication in immunocompetent hosts and therefore constraining the development of PML.« less

  3. Gamma Interferon-Induced Guanylate Binding Protein 1 Is a Novel Actin Cytoskeleton Remodeling Factor

    PubMed Central

    Ostler, Nicole; Britzen-Laurent, Nathalie; Liebl, Andrea; Naschberger, Elisabeth; Lochnit, Günter; Ostler, Markus; Forster, Florian; Kunzelmann, Peter; Ince, Semra; Supper, Verena; Praefcke, Gerrit J. K.; Schubert, Dirk W.; Stockinger, Hannes; Herrmann, Christian

    2014-01-01

    Gamma interferon (IFN-γ) regulates immune defenses against viruses, intracellular pathogens, and tumors by modulating cell proliferation, migration, invasion, and vesicle trafficking processes. The large GTPase guanylate binding protein 1 (GBP-1) is among the cellular proteins that is the most abundantly induced by IFN-γ and mediates its cell biologic effects. As yet, the molecular mechanisms of action of GBP-1 remain unknown. Applying an interaction proteomics approach, we identified actin as a strong and specific binding partner of GBP-1. Furthermore, GBP-1 colocalized with actin at the subcellular level and was both necessary and sufficient for the extensive remodeling of the fibrous actin structure observed in IFN-γ-exposed cells. These effects were dependent on the oligomerization and the GTPase activity of GBP-1. Purified GBP-1 and actin bound to each other, and this interaction was sufficient to impair the formation of actin filaments in vitro, as demonstrated by atomic force microscopy, dynamic light scattering, and fluorescence-monitored polymerization. Cosedimentation and band shift analyses demonstrated that GBP-1 binds robustly to globular actin and slightly to filamentous actin. This indicated that GBP-1 may induce actin remodeling via globular actin sequestering and/or filament capping. These results establish GBP-1 as a novel member within the family of actin-remodeling proteins specifically mediating IFN-γ-dependent defense strategies. PMID:24190970

  4. Gamma interferon-induced guanylate binding protein 1 is a novel actin cytoskeleton remodeling factor.

    PubMed

    Ostler, Nicole; Britzen-Laurent, Nathalie; Liebl, Andrea; Naschberger, Elisabeth; Lochnit, Günter; Ostler, Markus; Forster, Florian; Kunzelmann, Peter; Ince, Semra; Supper, Verena; Praefcke, Gerrit J K; Schubert, Dirk W; Stockinger, Hannes; Herrmann, Christian; Stürzl, Michael

    2014-01-01

    Gamma interferon (IFN-γ) regulates immune defenses against viruses, intracellular pathogens, and tumors by modulating cell proliferation, migration, invasion, and vesicle trafficking processes. The large GTPase guanylate binding protein 1 (GBP-1) is among the cellular proteins that is the most abundantly induced by IFN-γ and mediates its cell biologic effects. As yet, the molecular mechanisms of action of GBP-1 remain unknown. Applying an interaction proteomics approach, we identified actin as a strong and specific binding partner of GBP-1. Furthermore, GBP-1 colocalized with actin at the subcellular level and was both necessary and sufficient for the extensive remodeling of the fibrous actin structure observed in IFN-γ-exposed cells. These effects were dependent on the oligomerization and the GTPase activity of GBP-1. Purified GBP-1 and actin bound to each other, and this interaction was sufficient to impair the formation of actin filaments in vitro, as demonstrated by atomic force microscopy, dynamic light scattering, and fluorescence-monitored polymerization. Cosedimentation and band shift analyses demonstrated that GBP-1 binds robustly to globular actin and slightly to filamentous actin. This indicated that GBP-1 may induce actin remodeling via globular actin sequestering and/or filament capping. These results establish GBP-1 as a novel member within the family of actin-remodeling proteins specifically mediating IFN-γ-dependent defense strategies.

  5. Role for herpes simplex virus 1 ICP27 in the inhibition of type I interferon signaling

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Johnson, Karen E.; Song, Byeongwoon; Knipe, David M.

    2008-05-10

    Host cells respond to viral infection by many mechanisms, including the production of type I interferons which act in a paracrine and autocrine manner to induce the expression of antiviral interferon-stimulated genes (ISGs). Viruses have evolved means to inhibit interferon signaling to avoid induction of the innate immune response. Herpes simplex virus 1 (HSV-1) has several mechanisms to inhibit type I interferon production, the activities of ISGs, and the interferon signaling pathway itself. We report that the inhibition of the Jak/STAT pathway by HSV-1 requires viral gene expression and that viral immediate-early protein ICP27 plays a role in downregulating STAT-1more » phosphorylation and in preventing the accumulation of STAT-1 in the nucleus. We also show that expression of ICP27 by transfection causes an inhibition of IFN-induced STAT-1 nuclear accumulation. Therefore, ICP27 is necessary and sufficient for at least some of the effects of HSV infection on STAT-1.« less

  6. Soluble expression and one-step purification of recombinant mouse interferon-λ3 in Escherichia coli.

    PubMed

    Wang, Y Q; Zhou, M; Zeng, L M; Gao, Q Y; Yuan, X L; Li, Y; Li, M C

    2015-02-01

    Interferon (IFN)-λ3, a member of the type III IFN family, is a pleiotropic cytokine that exhibits potent antiproliferative, antiviral, and immunoregulatory activities. For further functional study of IFN-λ3, we developed an efficient procedure that includes cloning, expression, and purification to obtain relatively large quantity of mouse IFN-λ3 fusion protein. The mature IFN-λ3 protein-coding region was cloned into the prokaryotic expression vector pET-44. IFN-λ3 contains a hexahistidine tag at its C-terminus. We used Ni(2+)-nitrilotriacetic acid agarose-affinity chromatography to purify the expressed soluble protein. The purified IFN-λ3 inhibited significantly IL-13 production in stimulated RAW264.7 macrophages. Our findings show that the production of soluble IFN-λ3 proteins by the pET-44 vector in Escherichia coli is a good alternative for the production of native IFN-λ3 and could be useful for the production of other IFN proteins.

  7. Ebola virus-like particles stimulate type I interferons and proinflammatory cytokine expression through the toll-like receptor and interferon signaling pathways.

    PubMed

    Ayithan, Natarajan; Bradfute, Steven B; Anthony, Scott M; Stuthman, Kelly S; Dye, John M; Bavari, Sina; Bray, Mike; Ozato, Keiko

    2014-02-01

    Ebola viruses (EBOV) can cause severe hemorrhagic disease with high case fatality rates. Currently, no vaccines or therapeutics are approved for use in humans. Ebola virus-like particles (eVLP) comprising of virus protein (VP40), glycoprotein, and nucleoprotein protect rodents and nonhuman primates from lethal EBOV infection, representing as a candidate vaccine for EBOV infection. Previous reports have shown that eVLP stimulate the expression of proinflammatory cytokines in dendritic cells (DCs) and macrophages (MΦs) in vitro. However, the molecular mechanisms and signaling pathways through which eVLP induce innate immune responses remain obscure. In this study, we show that eVLP stimulate not only the expression of proinflammatory cytokines but also the expression of type I interferons (IFNs) and IFN-stimulated genes (ISGs) in murine bone marrow-derived DCs (BMDCs) and MΦs. Our data indicate that eVLP trigger host responses through toll-like receptor (TLR) pathway utilizing 2 distinct adaptors, MyD88 and TRIF. More interestingly, eVLP activated the IFN signaling pathway by inducing a set of potent antiviral ISGs. Last, eVLP and synthetic adjuvants, Poly I:C and CpG DNA, cooperatively increased the expression of cytokines and ISGs. Further supporting this synergy, eVLP when administered together with Poly I:C conferred mice enhanced protection against EBOV infection. These results indicate that eVLP stimulate early innate immune responses through TLR and type I IFN signaling pathways to protect the host from EBOV infection.

  8. Tuberculin Skin Tests versus Interferon-Gamma Release Assays in Tuberculosis Screening among Immigrant Visa Applicants.

    PubMed

    Chuke, Stella O; Yen, Nguyen Thi Ngoc; Laserson, Kayla F; Phuoc, Nguyen Huu; Trinh, Nguyen An; Nhung, Duong Thi Cam; Mai, Vo Thi Chi; Qui, An Dang; Hai, Hoang Hoa; Loan, Le Thien Huong; Jones, Warren G; Whitworth, William C; Shah, J Jina; Painter, John A; Mazurek, Gerald H; Maloney, Susan A

    2014-01-01

    Objective. Use of tuberculin skin tests (TSTs) and interferon gamma release assays (IGRAs) as part of tuberculosis (TB) screening among immigrants from high TB-burden countries has not been fully evaluated. Methods. Prevalence of Mycobacterium tuberculosis infection (MTBI) based on TST, or the QuantiFERON-TB Gold test (QFT-G), was determined among immigrant applicants in Vietnam bound for the United States (US); factors associated with test results and discordance were assessed; predictive values of TST and QFT-G for identifying chest radiographs (CXRs) consistent with TB were calculated. Results. Of 1,246 immigrant visa applicants studied, 57.9% were TST positive, 28.3% were QFT-G positive, and test agreement was 59.4%. Increasing age was associated with positive TST results, positive QFT-G results, TST-positive but QFT-G-negative discordance, and abnormal CXRs consistent with TB. Positive predictive values of TST and QFT-G for an abnormal CXR were 25.9% and 25.6%, respectively. Conclusion. The estimated prevalence of MTBI among US-bound visa applicants in Vietnam based on TST was twice that based on QFT-G, and 14 times higher than a TST-based estimate of MTBI prevalence reported for the general US population in 2000. QFT-G was not better than TST at predicting abnormal CXRs consistent with TB.

  9. Interferon-γ acts as a regulator in the trade-off between phagocytosis and production performance in dwarf chickens.

    PubMed

    Yuan, Yitong; Liu, Shunqi; Zhao, Yue; Lian, Ling; Lian, Zhengxing

    2018-01-01

    Interferon-γ (IFN-γ) is critical for innate and adaptive immunity against viral and bacterial infections. IFN-γ reportedly affects the phagocytic ability of monocytes and macrophages as well as regulates pituitary function in humans and mice. The present study analyzed the impact of IFN-γ on monocyte and macrophage phagocytosis, production performance, and pituitary function in vivo and in vitro (in dwarf chickens). IFN-γ was injected into dwarf chickens through a vein, and then, the laying rate, average egg weight, and levels of follicle-stimulating hormone (FSH) and IFN-γ were measured in treatment and control groups. For the in vitro experiment, the pituitary tissues were supplemented with IFN-γ, and the mRNA expression levels of follicle-stimulating hormone beta subunit ( FSH-β ), interferon gamma receptor 1 ( IFNGR 1), and interferon gamma receptor 2 ( IFNGR 2) in the pituitary were assessed. Monocyte and macrophage phagocytosis product (PP) was decreased by IFN-γ treatment in a dose-dependent manner in vitro. In the in vivo experiment, the level of IFN-γ in the treatment group was higher than that in the control group at 7 d ( P  < 0.05), 14 d ( P  < 0.01), and 21 d ( P  < 0.01) post-injection. Compared with the control group, monocyte and macrophage PP was lower in the treatment group after injection ( P  < 0.01). The laying rate was higher in the treatment group than in the control group at 2 and 3 wk post-injection ( P  < 0.05). There was a significant difference between the treatment and control groups in the levels of FSH at 1, 3, 7, and 14 d post-injection ( P  < 0.01). In the in vitro experiment, increased mRNA expression levels of FSH-β , IFNGR 1, and IFNGR 2 were observed in the treatment group after stimulation with 100 U/mL IFN-γ for 24 h compared to those in the control group ( P  < 0.05). IFN-γ inhibited the phagocytosis of monocytes and macrophages; up-regulated the mRNA expression levels of the FSH

  10. Protective Role of Gamma Interferon during the Recall Response to Influenza Virus

    PubMed Central

    Bot, Adrian; Bot, Simona; Bona, Constantin A.

    1998-01-01

    During secondary immune responses to influenza virus, virus-specific T memory cells are a major source of gamma interferon (IFN-γ). We assessed the contribution of IFN-γ to heterologous protection against the A/WSN/33 (H1N1) virus of wild-type and IFN-γ−/− mice previously immunized with the A/HK/68 (H3N2) virus. The IFN-γ−/− mice displayed significantly reduced survival rates subsequent to a challenge with various doses of the A/WSN/33 virus. This was associated with an impaired ability of the IFN-γ−/− mice to completely clear the pulmonary virus by day 7 after the challenge, although significant reduction of the virus titers was noted. However, the IFN-γ−/− mice developed type A influenza virus cross-reactive cytotoxic T lymphocytes (CTLs) similar to the wild-type mice, as demonstrated by both cytotoxicity and a limiting-dilution assay for the estimation of CTL precursor frequency. The pulmonary recruitment of T cells in IFN-γ−/− mice was not dramatically affected, and the percentage of CD4+ and CD8+ T cells was similar to that of wild-type mice. The T cells from IFN-γ−/− mice did not display a significant switch toward a Th2 profile. Furthermore, the IFN-γ−/− mice retained the ability to mount significant titers of WSN and HK virus-specific hemagglutination-inhibiting antibodies. Together, these results are consistent with a protective role of IFN-γ during the heterologous response against influenza virus independently of the generation and local recruitment of cross-reactive CTLs. PMID:9658110

  11. Arctigenin from Arctium lappa inhibits interleukin-2 and interferon gene expression in primary human T lymphocytes.

    PubMed

    Tsai, Wei-Jern; Chang, Chu-Ting; Wang, Guei-Jane; Lee, Tzong-Huei; Chang, Shwu-Fen; Lu, Shao-Chun; Kuo, Yuh-Chi

    2011-03-25

    Arctium lappa (Niubang), a Chinese herbal medicine, is used to treat tissue inflammation. This study investigates the effects of arctigenin (AC), isolated from A. lappa, on anti-CD3/CD28 Ab-stimulated cell proliferation and cytokine gene expression in primary human T lymphocytes. Cell proliferation was determined with enzyme immunoassays and the tritiated thymidine uptake method. Cytokine production and gene expression were analyzed with reverse transcription-polymerase chain reaction. AC inhibited primary human T lymphocytes proliferation activated by anti-CD3/CD28 Ab. Cell viability test indicated that the inhibitory effects of AC on primary human T lymphocyte proliferation were not due to direct cytotoxicity. AC suppressed interleukin-2 (IL-2) and interferon-γ (IFN-γ) production in a concentration-dependent manner. Furthermore, AC decreased the IL-2 and IFN-γ gene expression in primary human T lymphocytes induced by anti-CD3/CD28 Ab. Reporter gene analyses revealed that AC decreased NF-AT-mediated reporter gene expression. AC inhibited T lymphocyte proliferation and decreased the gene expression of IL-2, IFN-γ and NF-AT.

  12. [Effects of recombinant human alpha-2b and gamma interferons on bone marrow megakaryocyte progenitors (CFU-Meg) from patients with chronic myelocytic leukemia].

    PubMed

    Tanabe, Y; Dan, K; Kuriya, S; Nomura, T

    1989-10-01

    The effects of recombinant human interferon (IFN) alpha-2b and gamma on the bone marrow megakaryocyte progenitors (CFU-Meg) were compared between eight patients in the chronic phase of Ph1-positive chronic myelocytic leukemia (CML) and five hematologically normal patients. CFU-Meg was assayed in plasma clot culture added with phytohemagglutinin-stimulated leukocyte-conditioned medium as a source of colony stimulating activity. The average count of CFU-Meg colonies formed from the bone marrow of CML patients was 5.5 times that of normal controls. Spontaneous CFU-Meg colonies were grown in seven of eight CML patients, but in none of five controls. Colony formation by CFU-Meg in CML as well as normal bone marrow was suppressed by the two preparations of IFN in a dose dependent fashion. Their suppressive influence on colonies from CFU-Meg was comparable between CML and normal bone marrow at lower concentrations, but was less marked for CML than normal bone marrow at higher concentrations. The formation of CFU-Meg colonies from CML bone marrow was more severely suppressed by IFN-gamma than IFN-alpha-2b. Depletion of either T lymphocytes or adherent cells from the CML bone marrow cells diminished the suppressive effects of IFN-gamma, but had no influence on the effects of IFN-alpha-2b.

  13. Regulation of CD93 cell surface expression by protein kinase C isoenzymes.

    PubMed

    Ikewaki, Nobunao; Kulski, Jerzy K; Inoko, Hidetoshi

    2006-01-01

    Human CD93, also known as complement protein 1, q subcomponent, receptor (C1qRp), is selectively expressed by cells with a myeloid lineage, endothelial cells, platelets, and microglia and was originally reported to be involved in the complement protein 1, q subcomponent (C1q)-mediated enhancement of phagocytosis. The intracellular molecular events responsible for the regulation of its expression on the cell surface, however, have not been determined. In this study, the effect of protein kinases in the regulation of CD93 expression on the cell surface of a human monocyte-like cell line (U937), a human NK-like cell line (KHYG-1), and a human umbilical vein endothelial cell line (HUV-EC-C) was investigated using four types of protein kinase inhibitors, the classical protein kinase C (cPKC) inhibitor Go6976, the novel PKC (nPKC) inhibitor Rottlerin, the protein kinase A (PKA) inhibitor H-89 and the protein tyrosine kinase (PTK) inhibitor herbimycin A at their optimum concentrations for 24 hr. CD93 expression was analyzed using flow cytometry and glutaraldehyde-fixed cellular enzyme-linked immunoassay (EIA) techniques utilizing a CD93 monoclonal antibody (mAb), mNI-11, that was originally established in our laboratory as a CD93 detection probe. The nPKC inhibitor Rottlerin strongly down-regulated CD93 expression on the U937 cells in a dose-dependent manner, whereas the other inhibitors had little or no effect. CD93 expression was down-regulated by Go6976, but not by Rottlerin, in the KHYG-1 cells and by both Rottlerin and Go6976 in the HUV-EC-C cells. The PKC stimulator, phorbol myristate acetate (PMA), strongly up-regulated CD93 expression on the cell surface of all three cell-lines and induced interleukin-8 (IL-8) production by the U937 cells and interferon-gamma (IFN-gamma) production by the KHYG-1 cells. In addition, both Go6976 and Rottlerin inhibited the up-regulation of CD93 expression induced by PMA and IL-8 or IFN-gamma production in the respective cell

  14. Molecular stress response in the CNS of mice after systemic exposureto interferon-alpha, ionizing radiation and ketamine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lowe, Xiu R.; Marchetti, Francesco; Lu, Xiaochen

    2009-03-03

    We previously showed that the expression of troponin T1 (Tnnt 1) was induced in the central nervous system (CNS) of adultmice 30 min after treatment with ketamine, a glutamate N-methyl-D-aspartic acid (NMDA) receptor antagonist. We hypothesized that Tnnt 1 expression may be an early molecular biomarker of stress response in the CNS of mice. To further evaluate this hypothesis, we investigated the regional expression of Tnnt 1 in the mouse brain using RNA in situ hybridization 4 h after systemic exposure to interferon-a (IFN-a) and gamma ionizing radiation, both of which have be associated with wide ranges of neuropsychiatric complications.more » Adult B6C3F1 male mice were treated with either human IFN-a (a single i.p. injection at 1 x 105 IU/kg) or whole body gamma-radiation (10 cGy or 2 Gy). Patterns of Tnnt 1 transcript expression were compared in various CNS regions after IFN-a, radiation and ketamine treatments (previous study). Tnnt 1 expression was consistently induced in pyramidal neurons of cerebral cortex and hippocampus after all treatment regimens including 10 cGy of ionizing radiation. Regional expression of Tnnt 1 was induced in Purkinje cells of cerebellum after ionizing radiation and ketamine treatment; but not after IFN-a treatment. None of the three treatments induced Tnnt 1 expression in glial cells. The patterns of Tnnt 1 expression in pyramidal neurons of cerebral cortex andhippocampus, which are both known to play important roles in cognitive function, memory and emotion, suggest that the expression of Tnnt 1 may be an early molecular biomarker of induced CNS stress.« less

  15. Fabrication of fiber-optic localized surface plasmon resonance sensor and its application to detect antibody-antigen reaction of interferon-gamma

    NASA Astrophysics Data System (ADS)

    Jeong, Hyeon-Ho; Erdene, Norov; Lee, Seung-Ki; Jeong, Dae-Hong; Park, Jae-Hyoung

    2011-12-01

    A fiber-optic localized surface plasmon (FO LSPR) sensor was fabricated by gold nanoparticles (Au NPs) immobilized on the end-face of an optical fiber. When Au NPs were formed on the end-face of an optical fiber by chemical reaction, Au NPs aggregation occurred and the Au NPs were immobilized in various forms such as monomers, dimers, trimers, etc. The component ratio of the Au NPs on the end-face of the fabricated FO LSPR sensor was slightly changed whenever the sensors were fabricated in the same condition. Including this phenomenon, the FO LSPR sensor was fabricated with high sensitivity by controlling the density of Au NPs. Also, the fabricated sensors were measured for the resonance intensity for the different optical systems and analyzed for the effect on sensitivity. Finally, for application as a biosensor, the sensor was used for detecting the antibody-antigen reaction of interferon-gamma.

  16. Bletilla striata polysaccharide stimulates inducible nitric oxide synthase and proinflammatory cytokine expression in macrophages.

    PubMed

    Diao, Huajia; Li, Xin; Chen, Jiangning; Luo, Yi; Chen, Xi; Dong, Lei; Wang, Chunming; Zhang, Chenyu; Zhang, Junfeng

    2008-02-01

    Bletilla striata, a traditional Chinese medicine, has been used for the treatment of alimentary canal mucosal damage, ulcers, bleeding, bruises and burns. B. striata polysaccharide (BSP) isolated from B. striata was found to enhance vascular endothelial cell (EC) proliferation and vascular endothelial growth factor (VEGF) expression. However, the wound healing mechanism of BSP is not well understood. In this study, the results show that treatment with BSP induces coordinate changes in inducible nitric oxide synthase (iNOS), tumor necrosis factor alpha (TNF-alpha) and interleukin 1 beta (IL-1beta) mRNA levels and enhances the expression of these cytokines, but has no effect on interferon gamma (IFN-gamma) level. In this study, we partially elucidate the wound healing mechanism of BSP.

  17. Identifying Mechanisms by Which Escherichia coli O157:H7 Subverts Interferon-γ Mediated Signal Transducer and Activator of Transcription-1 Activation

    PubMed Central

    Ho, Nathan K.; Crandall, Ian; Sherman, Philip M.

    2012-01-01

    Enterohemorrhagic Escherichia coli serotype O157:H7 is a food borne enteric bacterial pathogen that causes significant morbidity and mortality in both developing and industrialized nations. E. coli O157:H7 infection of host epithelial cells inhibits the interferon gamma pro-inflammatory signaling pathway, which is important for host defense against microbial pathogens, through the inhibition of Stat-1 tyrosine phosphorylation. The aim of this study was to determine which bacterial factors are involved in the inhibition of Stat-1 tyrosine phosphorylation. Human epithelial cells were challenged with either live bacteria or bacterial-derived culture supernatants, stimulated with interferon-gamma, and epithelial cell protein extracts were then analyzed by immunoblotting. The results show that Stat-1 tyrosine phosphorylation was inhibited by E. coli O157:H7 secreted proteins. Using sequential anion exchange and size exclusion chromatography, YodA was identified, but not confirmed to mediate subversion of the Stat-1 signaling pathway using isogenic mutants. We conclude that E. coli O157:H7 subverts Stat-1 tyrosine phosphorylation in response to interferon-gamma through a still as yet unidentified secreted bacterial protein. PMID:22253910

  18. Persistently retained interferon-gamma responsiveness in individuals with a history of pulmonary tuberculosis.

    PubMed

    Seo, Kwang Won; Ahn, Jong-Joon; Ra, Seung Won; Kwon, Woon-Jung; Jegal, Yangjin

    2014-06-01

    The interferon gamma (IFN-γ) release assays (IGRAs) are the best method of detecting Mycobacterium tuberculosis infection. However, reports on IGRAs results obtained during and right after the treatment of tuberculosis (TB) have presented differing results. Some studies have shown declining responses, whereas other reports described persistent, fluctuating, or increasing responses. We postulated that the IGRA-positivity will decrease or revert long time after treatment of TB, and thus, evaluated the response of IGRA in subjects with a history of pulmonary TB. Seventy subjects (M:F = 51:19; age = 53.2 ± 11.8 years) underwent tuberculin skin tests (TSTs) and IGRA. The interval of time elapsed after the completion of anti-TB treatment was < 10 years for 16 subjects, 10-20 years for 13 subjects, 20-30 years for 16 subjects, and ≥ 30 years for 25 subjects. The TST was positive in 49 subjects (74%) and negative in 17 subjects (26%). The IGRA was positive in 52 subjects (74%) and negative in 18 subjects (26%). The IFN-γ level and the size of induration showed good correlation (r = 0.525, P < 0.001). However, the correlation between time elapsed after the completion of anti-TB treatment and the size of induration or that between time and the IFN-γ level was not significant. The TST and IGRA were positive in 72.7% and 68.0% of subjects ≥ 30 years after the treatment of pulmonary TB. In conclusion, majority of subjects with a history of pulmonary TB are IGRA-positive, even a few decades after the completion of anti-TB treatment.

  19. Several fibroblast growth factors are expressed during pre-attachment bovine conceptus development and regulate interferon-tau expression from trophectoderm.

    PubMed

    Cooke, Flavia N T; Pennington, Kathleen A; Yang, Qien; Ealy, Alan D

    2009-02-01

    The trophectoderm-derived factor interferon tau (IFNT) maintains the uterus in a pregnancy-receptive state in cattle and sheep. Fibroblast growth factors (FGFs) are implicated in regulating IFNT expression and potentially other critical events associated with early conceptus development in cattle. The overall objectives of this work were to identify the various FGFs and FGF receptors (FGFRs) expressed in elongating pre-attachment bovine conceptuses and determine if these FGFs regulate conceptus development and/or mediate IFNT production. In vitro-derived bovine blastocysts and in vivo-derived elongated conceptuses collected at day 17 of pregnancy express at least four FGFR subtypes (R1c, R2b, R3c, R4). In addition, transcripts for FGF1, 2, and 10 but not FGF7 are present in elongated bovine conceptuses. The expression pattern of FGF10 most closely resembled that of IFNT, with both transcripts remaining low in day 8 and day 11 conceptuses and increasing substantially in day 14 and day 17 conceptuses. Supplementation with recombinant FGF1, 2 or 10 increased IFNT mRNA levels in bovine trophectoderm cells and bovine blastocysts and increased IFNT protein concentrations in trophectoderm-conditioned medium. Blastocyst development was not affected by any of the FGFs. In summary, at least four FGFRs reside in pre- and peri-attachment bovine conceptuses. Moreover, conceptuses express at least three candidate FGFs during elongation, the time of peak IFNT expression. These findings provide new insight for how conceptus-derived factors such as FGF1, 2, and 10 may control IFNT expression during early pregnancy in cattle.

  20. Expression of the Kynurenine Pathway in Human Peripheral Blood Mononuclear Cells: Implications for Inflammatory and Neurodegenerative Disease.

    PubMed

    Jones, Simon P; Franco, Nunzio F; Varney, Bianca; Sundaram, Gayathri; Brown, David A; de Bie, Josien; Lim, Chai K; Guillemin, Gilles J; Brew, Bruce J

    2015-01-01

    The kynurenine pathway is a fundamental mechanism of immunosuppression and peripheral tolerance. It is increasingly recognized as playing a major role in the pathogenesis of a wide variety of inflammatory, neurodegenerative and malignant disorders. However, the temporal dynamics of kynurenine pathway activation and metabolite production in human immune cells is currently unknown. Here we report the novel use of flow cytometry, combined with ultra high-performance liquid chromatography and gas chromatography-mass spectrometry, to sensitively quantify the intracellular expression of three key kynurenine pathway enzymes and the main kynurenine pathway metabolites in a time-course study. This is the first study to show that up-regulation of indoleamine 2,3-dioxygenase (IDO-1), kynurenine 3-monoxygenase (KMO) and quinolinate phosphoribosyltransferase (QPRT) is lacking in lymphocytes treated with interferon gamma. In contrast, peripheral monocytes showed a significant elevation of kynurenine pathway enzymes and metabolites when treated with interferon gamma. Expression of IDO-1, KMO and QPRT correlated significantly with activation of the kynurenine pathway (kynurenine:tryptophan ratio), quinolinic acid concentration and production of the monocyte derived, pro-inflammatory immune response marker: neopterin. Our results also describe an original and sensitive methodological approach to quantify kynurenine pathway enzyme expression in cells. This has revealed further insights into the potential role of these enzymes in disease processes.

  1. Assessment of safety and interferon gamma responses of Mycobacterium bovis BCG vaccine in goat kids and milking goats.

    PubMed

    Pérez de Val, Bernat; Vidal, Enric; López-Soria, Sergio; Marco, Alberto; Cervera, Zoraida; Martín, Maite; Mercader, Irene; Singh, Mahavir; Raeber, Alex; Domingo, Mariano

    2016-02-10

    Vaccination of domestic animals has emerged as an alternative long-term strategy for the control of tuberculosis (TB). A trial under field conditions was conducted in a TB-free goat herd to assess the safety of the Mycobacterium bovis BCG vaccine. Eleven kids and 10 milking goats were vaccinated with BCG. Bacterial shedding and interferon gamma (IFN-γ) responses were monitored throughout the study. Comprehensive pathological examination and mycobacterial culture of target tissues were performed. BCG vaccine strain was only isolated from the draining lymph node of the injection site of a kid euthanized at week 8 post-vaccination. The remaining animals were euthanized at week 24. Six out of 20 showed small granulomas at the injection site. BCG shedding was not detected in either faeces or in milk throughout the study. All vaccinated kids showed BCG-induced IFN-γ responses at week 8 post-vaccination. BCG vaccination of goats showed no lack of biological safety for the animals, environment and public health, and local adverse reactions were negligible. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. The role of interferon gamma release assays in the monitoring of response to anti-tuberculosis treatment in children.

    PubMed

    Shaik, Junaid; Pillay, Manormoney; Jeena, Prakash

    2014-09-01

    Successful control of childhood TB requires early diagnosis, effective chemotherapy and a method of evaluating the response to therapy. Identification of suitable biomarkers that predict the response to anti-TB therapy may allow the duration of treatment to be shortened. The majority of biomarker studies in paediatric TB have focused on the role of T cell-based interferon-gamma (IFN-γ) release assays (IGRAs) in the diagnosis of either latent or active disease. Little has been published on the role of IGRAs in the monitoring response to therapy in children. We reviewed the available literature to ascertain the value of IGRAs in the monitoring of response to anti-TB therapy in children. We explored the results of the few studies that have investigated the role of IGRAs as markers of response to anti-TB treatment in children. We conclude that the role of IGRAs as surrogate markers appears promising. Robust clinical trials are, however, needed to entrench the value of IGRAs as surrogate biomarkers of response to anti-TB therapy in children. Copyright © 2013 Elsevier Ltd. All rights reserved.

  3. A cell-ELISA for the quantification of adherent murine macrophages and the surface expression of antigens.

    PubMed

    Nibbering, P H; Van de Gevel, J S; Van Furth, R

    1990-07-20

    The present study was performed in order to establish whether a cell-ELISA could be used to determine the expression of antigens by adherent murine peritoneal macrophages and also quantify the numbers of such macrophages. Accurate determination of the number of adherent macrophages proved to be possible with a cell-ELISA designed to assess complement receptor type III (CRIII) expression. Expression of CRIII was considerably more sensitive than determination of the cell-protein or DNA content as a measure of the number of adherent macrophages. For the calculation of the expression of CRIII, Ia antigen, and antigen F4/80 by resident and activated macrophages, use was made of the linear part of the curve obtained when the numbers of macrophages were plotted against the absorbance values for each of the antigens. The values for CRIII expression did not differ significantly between resident macrophages, macrophages activated with recombinant interferon-gamma (rIFN-gamma) and macrophages activated with BCG/PPD. IFN-gamma-activated and BCG/PPD-activated macrophages expressed Ia antigen significantly more intensely than did resident peritoneal macrophages. In contrast the activated macrophages expressed F4/80 significantly less intensely than resident peritoneal macrophages.

  4. Synergistic induction of apoptosis in primary rat decidual cells by INF-gamma and TNF.

    PubMed

    Almeida, A; Correia-da-Silva, G; Cepa, M; Bell, S C; Teixeira, N A

    2007-03-01

    In the rat, in response to blastocyst implantation, stromal cells of the endometrium proliferate and differentiate into decidual cells, forming the decidua. After reaching its maximum development, the decidua undergoes regression. This phenomenon appears to be due to an active process involving apoptosis. As there is sparse knowledge concerning the mechanisms of induction of decidual cell death, the potential role of cytokines present in the uterine environment during pregnancy, such as tumor necrosis factor (TNF) and interferon-gamma (INF-gamma) was explored in primary cultures of rat decidual cells. The effects of these factors upon cellular viability, nuclear morphologic alterations, expression, and enzymatic activities of the effector caspases-3/7 were evaluated. The results obtained demonstrated that in contrast to TNF, which did not induce any alteration, INF-gamma and in association with TNF caused a decrease in cell viability and an increase in the appearance of apoptotic bodies in a time-dependent manner that was augmented in the co-presence of TNF. An increase in caspase-3/7 activities after 12 hr of TNF/INF-gamma treatment was also observed. These findings suggest that INF-gamma expressed in the uterine environment may play an important role in regulating apoptosis through potential synergistic mechanisms with TNF and thereby modulate decidual stability and regression during pregnancy. (c) 2006 Wiley-Liss, Inc.

  5. Promotion of interferon-gamma production by natural killer cells via suppression of murine peritoneal macrophage prostaglandin E₂ production using intravenous anesthetic propofol.

    PubMed

    Inada, Takefumi; Kubo, Kozue; Shingu, Koh

    2010-10-01

    Propofol is an intravenous anesthetic, widely used for general anesthesia during surgery, which inevitably involves tissue trauma with inflammation. At sites of inflammation, prostanoids, especially prostaglandin E₂ (PGE₂), are abundant. This study addresses the effect of propofol on macrophage PGE₂ production. Using thioglycollate-elicited murine peritoneal macrophages, propofol (7.5-30 μM) suppressed lipopolysaccharide-induced PGE₂ production. The suppression was via the direct inhibition of cyclooxygenase (COX) enzyme activity and due neither to the downregulation of COX expression nor the inhibition of arachidonic acid release from plasma membranes. In macrophage:natural killer (NK) cell co-culture, propofol dramatically increased interferon-gamma (IFN-γ) production, and the actions of propofol were mimicked by a selective COX-2 inhibitor, NS-398, as well as the selective EP4 receptor antagonist L-161,982, suggesting a role of PGE₂ suppression in the upregulation of IFN-γ production. Furthermore, in purified NK cell culture, PGE₂ directly suppressed the production of IFN-γ by activated NK cells, which was reversed by selective inhibition of EP4 activity. Taken together, our results show that, in macrophage:NK cell co-culture, propofol, through the suppression of macrophage PGE₂ production, upregulates NK cell IFN-γ production by alleviating EP4 receptor-mediated suppression of IFN-γ production. Propofol may potentially exert considerable influence on inflammation and immunity by suppressing PGE₂ synthesis. Copyright © 2010 Elsevier B.V. All rights reserved.

  6. The effect of co-administration of DNA carrying chicken interferon-gamma gene on protection of chickens against infectious bursal disease by DNA-mediated vaccination.

    PubMed

    Hsieh, Ming Kun; Wu, Ching Ching; Lin, Tsang Long

    2006-11-17

    The purpose of the present study was to determine whether DNA vaccination by co-administration of DNA coding for chicken interferon-gamma (IFN-gamma) gene and DNA encoding for the VP243 gene of IBDV could enhance immune response and protection efficacy of chickens against challenge by IBDV. Plasmids carrying VP243 gene of IBDV strain variant E (VE) (P/VP243/E) and chicken IFN-gamma gene (P/cIFN-gamma) were constructed, respectively. One-day-old chickens were intramuscularly injected with P/VP243/E, or P/cIFN-gamma, or both once, twice, or three times into the thigh muscle of one leg or the thigh muscles of two separate legs at weekly intervals. Chickens were orally challenged with IBDV strain VE at 3 weeks of age and observed for 10 days. Chickens receiving two plasmids in the same site two times had significantly higher (P<0.05) bursal lesion scores and significantly lower (P<0.05) bursa weight/body weight ratios than those that only received P/VP243/E two or three times. Chickens inoculated with two plasmids separately in the thigh muscles of different legs or P/VP243/E two times had 33-50% protection and those receiving two plasmids in the same sites did not have any protection against IBD. The enzyme-linked immunosorbent assay (ELISA) and virus neutralization (VN) titers to IBDV of chickens in the groups with three doses of P/VP243/E were significantly higher (P<0.05) than those in groups receiving two doses of P/VP243/E or P/VP243/E and P/cIFN-gamma. Chickens protected by DNA vaccination did not have detectable IBDV antigen in the bursae as determined by immunofluorescent antibody assay (IFA). The results indicated that co-administration of plasmid encoding chicken IFN-gamma gene with plasmid encoding a large segment gene of the IBDV did not enhance immune response and protection against challenge by IBDV.

  7. Interferon-gamma, macrophages, and virus spread after HSV-1 injection.

    PubMed

    Cathcart, Heather M; Zheng, Mei; Covar, Jason J; Liu, Yi; Podolsky, Robert; Atherton, Sally S

    2011-06-07

    After uniocular anterior chamber (AC) injection of HSV-1, the anterior segment of BALB/c mice becomes inflamed and infected; however, virus does not spread from the anterior segment to cause retinitis in the injected eye. The purpose of these studies was to determine whether interferon (IFN-)-γ and Mac-1(+) cells play a role in preventing direct anterior-to-posterior spread of HSV-1 in the injected eye. One AC of adult female BALB/c mice was injected with HSV-1 (KOS). The location of IFN-α, IFN-β, and IFN-γ in the injected eye was determined by immunofluorescence, and mRNA expression was quantified by qPCR. Injected eyes of IFN-γ knockout or clodronate-treated macrophage-depleted mice were examined to determine whether the absence of IFN-γ or Mac-1(+) macrophages affected the sites or timing of virus spread. IFN-α, IFN-β, and IFN-γ were observed in the anterior segment of injected eyes through 72 hours and mRNA levels of IFN-β and IFN-γ were increased in virus-infected eyes 48 to 120 hours after infection. However, the absence of IFN-γ or macrophages did not affect either the sites or the timing of HSV-1 infection in injected eyes. Protection of the retina of the injected eye does not depend on a single cell type or cytokine. In addition, in the eye, as in other sites of the body, there are redundancies in the innate response to virus infection.

  8. Apoptosis of Trypanosoma musculi co-cultured with LPS activated macrophages: enhanced expression of nitric oxide synthase INF-gamma and caspase.

    PubMed

    Gugssa, A; Gebru, S; Lee, C M; Baccetti, B; Anderson, W

    2005-08-01

    Trypanosoma musculi-macrophage co-cultures were studied to investigate the biological role of lipopolysaccharide (LPS) induced cytokines in controlling the proliferation of parasites in vitro. Macrophages, isolated by peritoneal lavage, sustained the growth and proliferation of the parasites. Macrophages activated with LPS were characterized by up-regulation of nitric oxide synthase (iNOS) and phagocytosis of fluorescent latex spheres. Activated macrophages showed marked inhibition of the association and proliferation of the parasites. The LPS treated macrophages produced cytokines, especially interferon gamma (INF-gamma), which was detected by Western blot. Trypanosomes, inhibited from association with macrophages, did not proliferate and instead formed clusters held together by their flagella. Cells in these clusters were apoptotic, as demonstrated by the Apoptag reaction and gel fragmentation assay. In addition, high levels of caspase 8 and caspase 3 were shown in floating trypanosome clusters. The results would suggest that INF-gamma and other cytokines released by activated macrophages, possibly functioning through the INF-gammaR1, Fas ligand, CD95 or other death ligands in the trypanosome plasma membrane initiates the apoptosis cascade in trypanosomes.

  9. Three-dimensional crystal structure of recombinant murine interferon-beta.

    PubMed Central

    Senda, T; Shimazu, T; Matsuda, S; Kawano, G; Shimizu, H; Nakamura, K T; Mitsui, Y

    1992-01-01

    The crystal structure of recombinant murine interferon-beta (IFN-beta) has been solved by the multiple isomorphous replacement method and refined to an R-factor of 20.5% against 2.6 A X-ray diffraction data. The structure shows a variant of the alpha-helix bundle with a new chain-folding topology, which seems to represent a basic structural framework of all the IFN-alpha and IFN-beta molecules belonging to the type I family. Functionally important segments of the polypeptide chain, as implied through numerous gene manipulation studies carried out so far, are spatially clustered indicating the binding site(s) to the receptor(s). Comparison of the present structure with those of other alpha-helical cytokine proteins, including porcine growth hormone, interleukin 2 and interferon gamma, indicated either a topological similarity in chain folding or a similar spatial arrangement of the alpha-helices. Images PMID:1505514

  10. [Interleukin 8 and interferon gamma in ocular toxoplasmosis].

    PubMed

    Czepiel, Jacek; Biesiada, Grazyna; Sobczyk-Krupiarz, Iwona; Miklasszewska, Grazyna; Fedak, Danuta; Solnica, Bogdan; Mach, Tomasz; Garlicki, Aleksander

    2011-01-01

    Toxoplasmosis is one of the most common parasitic infections in the world, it is caused by Toxoplasma gondii. The infection is typically asymptomatic or the symptoms are very mild. Approximately 10% patients have limphadenopathy, involvement of the others organs, like eyes, nervous system, liver, heart, are observed more rarely. The aim of our study was to assess the level of selected cytokines in blood among patients with ocular toxoplasmosis. We have enrolled in the study 30 patients, 19-42 years old, treated for ocular toxoplasmosis, and 20 healthy volunteers, 20-48 years old, to the control group. Tests for blood morphology, C-reactive protein, the level of IL-8 and IFN-gamma were performed in all patients. The blood parameters in toxoplasmosis group were performed before antiparasitic treatment was given. The level of IFN-gamma in blood was lower among patients with ocular toxoplasmosis comparing with control group (1.52 vs. 4.18 pg/ml; p = 0.002). The level of IL-8 in blood was lower among patients with ocular toxoplasmosis comparing with control group (22.96 vs. 94.3 pg/ml; p = 0,007). There were no correlations between analyzed cytokines and blood morphology or CRP. The low level of IFN-gamma and IL-8 in blood is important factor leading to reactivation of the ocular toxoplasmosis.

  11. Interferon-gamma and interleukin-10 profile of children with tuberculosis in North Sumatera, Indonesia

    NASA Astrophysics Data System (ADS)

    Daulay, R. S.; Daulay, R. M.

    2018-03-01

    Cellular immunity was mediated the host immune response against Mycobacterium tuberculosis, in which cytokine and T-helper (Th) 1 cells play an important role. Interferon-gamma (IFN-γ) is a leading cytokine involved in the immune response of tuberculosis (TB).The primary function of IFN-γ is to activate macrophages in opposition Mycobacterium tuberculosis. Contrast from IFN-γ, interleukin-10 (IL-10) is considered inhibitory cytokine, important to an adequate balance between inflammatory responses. To analyze cytokine profile, particularly IFN-γ and IL-10 of the children with TB in Indonesia, a cross-sectional study was conducted at two general hospitals and seven primary health care located in Medan and Batubara, North Sumatera, Indonesia. Among 51 children with TB disease and 51 healthy children, found that IFN-γ and IL-10 levels were lower in TB patients compared to healthy children. Statistically significant decreased production of the IFN-γ levels (p=0.042) were found in TB patients 9.41 (1.10-28.06) pg/ml contrast to healthy children 6.30 (1.30-89.76) pg/ml. Homologue finding of the IL-10 levels were also found in TB patients 4.93 (0.22-48.01) pg/ml and 4.93 (0.07-81.60) pg/ml in healthy children, but not statistically significant (p=0.784). High levels of IL-10 were not proven to suppress the levels production of IFN-γ in TB patients.

  12. Household food insecurity is associated with low interferon-gamma levels in pregnant Indian women.

    PubMed

    Vaidya, A; Bhosale, R; Sambarey, P; Suryavanshi, N; Young, S; Mave, V; Kanade, S; Kulkarni, V; Deshpande, P; Balasubramanian, U; Elf, J; Gupte, N; Gupta, A; Mathad, J S

    2017-07-01

    Over 20% of tuberculosis (TB) cases during pregnancy occur in India. To determine the association between household food insecurity and interferon-gamma (IFN-γ) levels in pregnancy. Pregnant women in India were administered the Household Food Insecurity Access Scale (HFIAS) questionnaire and underwent an IFN-γ release assay. Logistic regression was used to identify factors associated with food insecurity. Of 538 women, 60 (11%) had household food insecurity, 47 (78%) of which were moderate or severe food insecure. After mitogen stimulation, moderate or severe food insecure women had a median IFN-γ concentration of 4.2 IU/ml (IQR 2.2-9.8) vs. 8.4 IU/ml (IQR 3.0-10) in women with no or mild food insecurity (P = 0.03). In multivariate analysis, higher IFN-γ concentrations were associated with human immunodeficiency virus infection (OR 1.3, 95%CI 0.51-2.1, P = 0.001), and inversely associated with moderate or severe food insecurity (OR -1.6, 95%CI -2.9 to -0.27, P = 0.02) and the number of adults in the household (OR -0.08, 95%CI -0.16 to -0.01, P = 0.03). There was no association between food insecurity and IFN-γ response to Mycobacterium tuberculosis antigen. Food insecurity in pregnancy is associated with low IFN-γ levels. There was no association between food insecurity and IFN-γ response to M. tuberculosis antigen, but our study was underpowered to detect this outcome.

  13. Interferon-gamma and interlukin-4 patterns in BALB/c mice suffering from cutaneous leishmaniasis treated with cantharidin.

    PubMed

    Maroufi, Yahya; Ghaffarifar, Fatemeh; Dalimi, Abdolhosein; Sharifi, Zohreh

    2014-06-01

    Cutaneous leishmaniasis is a health problem in the world. Lesions should be treated on cosmetically or functionally important sites, such as the face and hands. Cantharidin is a terpenoid compound produced naturally by beetles of Meloidae and Oedemeridae families. The current study aimed to investigate the effect of cantharidin on Cutaneous Leishmaniasis (CL) lesions and IFN-γ and IL-4 patterns in infected BALB/c mice. INFECTED BALB/C MICE WERE DIVIDED INTO FIVE GROUPS AS: untreated (control group), eucerin-treated and 0.05%, 0.1% and 0.5% cantharidin-treated. Lesions diameter was measured by Vernier caliper every three days for four weeks. Cytokines levels were measured by enzyme-linked immunosorbent assay (ELISA) using U-CyTech kit. The results indicated that treatment with cantharidin exacerbates lesions compared with the controls, except for 0.05% cantharidin dose that restrained lesion growth significantly. Interferon gamma level in cantharidin-treated groups was significantly less than that of the control group. But interlukin-4 level was similar among the groups. The current study results indicated that high doses of cantharidin exacerbates leishmaniasis lesion, but low dose of cantharidin inhibits lesion growth.

  14. Interferon-Gamma and Interlukin-4 Patterns in BALB/c Mice Suffering From Cutaneous Leishmaniasis Treated With Cantharidin

    PubMed Central

    Maroufi, Yahya; Ghaffarifar, Fatemeh; Dalimi, Abdolhosein; Sharifi, Zohreh

    2014-01-01

    Background: Cutaneous leishmaniasis is a health problem in the world. Lesions should be treated on cosmetically or functionally important sites, such as the face and hands. Cantharidin is a terpenoid compound produced naturally by beetles of Meloidae and Oedemeridae families. Objectives: The current study aimed to investigate the effect of cantharidin on Cutaneous Leishmaniasis (CL) lesions and IFN-γ and IL-4 patterns in infected BALB/c mice. Materials and Methods: Infected BALB/c mice were divided into five groups as: untreated (control group), eucerin-treated and 0.05%, 0.1% and 0.5% cantharidin-treated. Lesions diameter was measured by Vernier caliper every three days for four weeks. Cytokines levels were measured by enzyme-linked immunosorbent assay (ELISA) using U-CyTech kit. Results: The results indicated that treatment with cantharidin exacerbates lesions compared with the controls, except for 0.05% cantharidin dose that restrained lesion growth significantly. Interferon gamma level in cantharidin-treated groups was significantly less than that of the control group. But interlukin-4 level was similar among the groups. Conclusions: The current study results indicated that high doses of cantharidin exacerbates leishmaniasis lesion, but low dose of cantharidin inhibits lesion growth. PMID:25371808

  15. Heroin use is associated with lower levels of restriction factors and type I interferon expression and facilitates HIV-1 replication.

    PubMed

    Zhu, Jia-Wu; Liu, Feng-Liang; Mu, Dan; Deng, De-Yao; Zheng, Yong-Tang

    Heroin use is associated with increased incidence of infectious diseases such as HIV-1 infection, as a result of immunosuppression to a certain extent. Host restriction factors are recently identified cellular proteins with potent antiviral activities. Whether heroin use impacts on the in vivo expression of restriction factors that result in facilitating HIV-1 replication is poorly understood. Here we recruited 432 intravenous drug users (IDUs) and 164 non-IDUs at high-risk behaviors. Based on serological tests, significantly higher prevalence of HIV-1 infection was observed among IDUs compared with non-IDUs. We included those IDUs and non-IDUs without HIV-1 infection, and found IDUs had significantly lower levels of TRIM5α, TRIM22, APOBEC3G, and IFN-α, -β expression than did non-IDUs. We also directly examined plasma viral load in HIV-1 mono-infected IDUs and non-IDUs and found HIV-1 mono-infected IDUs had significantly higher plasma viral load than did non-IDUs. Moreover, intrinsically positive correlation between type I interferon and TRIM5α or TRIM22 was observed, however, which was dysregulated following heroin use. Collectively, heroin use benefits HIV-1 replication that may be partly due to suppression of host restriction factors and type I interferon expression. Copyright © 2017 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  16. Identification and Characterization of Neospora caninum Cyclophilin That Elicits Gamma Interferon Production

    PubMed Central

    Tuo, Wenbin; Fetterer, Raymond; Jenkins, Mark; Dubey, J. P.

    2005-01-01

    Gamma interferon (IFN-γ) response is essential to the development of a host protective immunity in response to infections by intracellular parasites. Neosporosis, an infection caused by the intracellular protozoan parasite Neospora caninum, is fatal when there is a complete lack of IFN-γ in the infected host. However, the mechanism by which IFN-γ is elicited by the invading parasite is unclear. This study has identified a microbial protein in the N. caninum tachyzoite N. caninum cyclophilin (NcCyP) as a major component of the parasite responsible for the induction of IFN-γ production by bovine peripheral blood mononuclear cells (PBMC) and antigen-specific CD4+ T cells. NcCyP has high sequence homology (86%) with Toxoplasma gondii 18-kDa CyP with a calculated molecular mass of 19.4 kDa. NcCyP is a secretory protein with a predicted signal peptide of 17 amino acids. Abundant NcCyP was detected in whole-cell N. caninum tachyzoite lysate antigen (NcAg) and N. caninum tachyzoite culture supernatant. In N. caninum tachyzoite culture supernatant, three NcCyP bands of 19, 22, and 24 kDa were identified. NcAg stimulated high levels of IFN-γ production by PBMC and CD4+ T cells. The IFN-γ-inducing effect of NcAg was blocked by cyclosporine, a specific ligand for CyP, in a dose-dependent manner. Furthermore, cyclosporine abolished IFN-γ production by PBMC from naïve cows as well as PBMC and CD4+ T cells from infected/immunized cows. These results indicate that the N. caninum tachyzoite naturally produces a potent IFN-γ-inducing protein, NcCyP, which may be important for parasite survival as well as host protection. PMID:16041025

  17. Added value of interferon-gamma release assays in screening for tuberculous infection in the Netherlands.

    PubMed

    Erkens, C G M; Dinmohamed, A G; Kamphorst, M; Toumanian, S; van Nispen-Dobrescu, R; Alink, M; Oudshoorn, N; Mensen, M; van den Hof, S; Borgdorff, M; Verver, S

    2014-04-01

    Interferon-gamma release assays (IGRAs) are reported to be more specific for the diagnosis of latent tuberculous infection (LTBI) than the tuberculin skin test (TST). The two-step procedure, TST followed by an IGRA, is reported to be cost-effective in high-income countries, but it requires more financial resources. To assess the added value of IGRA compared to TST alone in the Netherlands. Test results and background data on persons tested with an IGRA were recorded by the Public Municipal Health Services in a web-based database. The number of persons diagnosed with LTBI using different screening algorithms was calculated. In those tested with an IGRA, at least 60% of persons who would have been diagnosed with LTBI based on TST alone had a negative IGRA. Among those with a TST reaction below the cut-off for the diagnosis of LTBI, 13% had a positive IGRA. For 41% of persons tested with an IGRA after TST, the IGRA influenced whether or not an LTBI diagnosis would be made. With the IGRA as reference standard, a high proportion of persons in low-prevalence settings are treated unnecessarily for LTBI if tested with TST alone, while a small proportion eligible for preventive treatment are missed. Incremental costs of the two-step strategy seem to be balanced by the improved targeting of preventive treatment.

  18. Stimulated peripheral production of interferon-gamma is related to fatigue and depression in multiple sclerosis.

    PubMed

    Pokryszko-Dragan, A; Frydecka, I; Kosmaczewska, A; Ciszak, L; Bilińska, M; Gruszka, E; Podemski, R; Frydecka, D

    2012-10-01

    The aim of the study was to evaluate the stimulated production of interferon-gamma (IFNγ) by peripheral CD3+CD4+ T lymphocytes in patients with multiple sclerosis (MS) with regard to the degree of fatigue, and to investigate relationships between immunological parameters, level of depression and clinical variables. Forty MS patients (30 women, 10 men, aged 22-60 years): 20 fatigued and 20 non-fatigued were involved in the study. Fatigue was evaluated using the Fatigue Severity Scale (FSS) and Modified Fatigue Impact Scale (MFIS), depression level - using Beck Depression Inventory (BDI). Production of IFNγ by stimulated peripheral blood CD3+CD4+ T lymphocytes, assessed using flow cytometry, was compared between MS patients with different levels of fatigue and controls. Correlations were searched out between immunological findings and BDI, age, duration and course of MS, relapse rate, disability (assessed in Expanded Disability Status Scale - EDSS) and its progression. Stimulated production of IFNγ by CD3+CD4+ T lymphocytes was higher in severely fatigued patients in comparison with non-fatigued ones and controls, tended to correlate with FSS and MFIS, and correlated with BDI. No relationships were found between immunological findings and disease-related variables. Stimulated production of IFNγ by peripheral CD3+CD4+ T lymphocytes is related to fatigue and depression in MS patients. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. Tuberculin Skin Tests versus Interferon-Gamma Release Assays in Tuberculosis Screening among Immigrant Visa Applicants

    PubMed Central

    Chuke, Stella O.; Yen, Nguyen Thi Ngoc; Laserson, Kayla F.; Phuoc, Nguyen Huu; Trinh, Nguyen An; Nhung, Duong Thi Cam; Mai, Vo Thi Chi; Qui, An Dang; Hai, Hoang Hoa; Loan, Le Thien Huong; Jones, Warren G.; Whitworth, William C.; Shah, J. Jina; Painter, John A.; Mazurek, Gerald H.; Maloney, Susan A.

    2014-01-01

    Objective. Use of tuberculin skin tests (TSTs) and interferon gamma release assays (IGRAs) as part of tuberculosis (TB) screening among immigrants from high TB-burden countries has not been fully evaluated. Methods. Prevalence of Mycobacterium tuberculosis infection (MTBI) based on TST, or the QuantiFERON-TB Gold test (QFT-G), was determined among immigrant applicants in Vietnam bound for the United States (US); factors associated with test results and discordance were assessed; predictive values of TST and QFT-G for identifying chest radiographs (CXRs) consistent with TB were calculated. Results. Of 1,246 immigrant visa applicants studied, 57.9% were TST positive, 28.3% were QFT-G positive, and test agreement was 59.4%. Increasing age was associated with positive TST results, positive QFT-G results, TST-positive but QFT-G-negative discordance, and abnormal CXRs consistent with TB. Positive predictive values of TST and QFT-G for an abnormal CXR were 25.9% and 25.6%, respectively. Conclusion. The estimated prevalence of MTBI among US-bound visa applicants in Vietnam based on TST was twice that based on QFT-G, and 14 times higher than a TST-based estimate of MTBI prevalence reported for the general US population in 2000. QFT-G was not better than TST at predicting abnormal CXRs consistent with TB. PMID:24738031

  20. The tuberculin skin test increases the responses measured by T cell interferon-gamma release assays.

    PubMed

    Vilaplana, C; Ruiz-Manzano, J; Gil, O; Cuchillo, F; Montané, E; Singh, M; Spallek, R; Ausina, V; Cardona, P J

    2008-06-01

    RUTI is a vaccine consisting of Mycobacterium tuberculosis bacilli grown in stress conditions that is fragmented, detoxified and liposomed. RUTI was designed to shorten the treatment of latent tuberculosis infection (LTBI) with isoniazid from 9 months to just 1 month, by additional treatment with two inoculations of RUTI 4 weeks apart. During the validation process for monitoring the immunogenicity of administration of RUTI in a Phase I clinical trial, the question arose whether to introduce the tuberculin skin test (TST) in the screening of non-LTBI volunteers. This study was designed to evaluate the effect of TST on subsequent different T-cell interferon-gamma release assay (TIGRA) responses, using a spectrum of M. tuberculosis-related antigens (ESAT-6, CFP-10, 16 kDa, 19 kDa, MPT64, Ag 85B, 38 kDa, hsp65, PPD and BCG). The results showed an increase in post-TST response even in non-LTBI subjects for most antigens tested, as measured both by whole blood assay (WBA) and ELISPOT. Increased ELISPOT response decreased toward pre-TST levels within 1 month whereas the WBA response did not. Taking into account that there is no definitive correlation between TST and TIGRA tests to diagnose LTBI and the feasibility that TST might alter the immune monitoring included in clinical trials, these data suggest that TST determination should be carefully planned to avoid any interference with TIGRA.

  1. Reversal in fatigued athletes of a defect in interferon gamma secretion after administration of Lactobacillus acidophilus.

    PubMed

    Clancy, R L; Gleeson, M; Cox, A; Callister, R; Dorrington, M; D'Este, C; Pang, G; Pyne, D; Fricker, P; Henriksson, A

    2006-04-01

    Fatigue and impaired performance in athletes is well recognised and has been loosely linked to "overtraining". Reduced concentration of IgA in the saliva and increased shedding of Epstein Barr virus (EBV) have been associated with intense training in elite athletes. To determine whether athletes presenting with fatigue and impaired performance had an immune defect relevant to defective containment of EBV infection, and whether a probiotic preparation (Lactobacillus acidophilus) shown to enhance mucosal immunity in animal models could reverse any detected abnormality. The fatigued athletes had clinical characteristics consistent with re-activation of EBV infection and significantly (p = 0.02) less secretion of interferon (IFN) gamma from blood CD4 positive T cells. After one month of daily capsules containing 2 x 10(10) colony forming units of L acidophilus, secretion of IFNgamma from T cells had increased significantly (p = 0.01) to levels found in healthy control athletes. A significant (p = 0.03) increase in salivary IFNgamma concentrations in healthy control athletes after the one month course of L acidophilus demonstrated in man the capacity for this probiotic to enhance the mucosal IFNgamma concentration. This is the first evidence of a T cell defect in fatigued athletes, and of its reversal following probiotic therapy.

  2. MHC class I, beta2 microglobulin, and the INF-gamma receptor are upregulated in aged motoneurons.

    PubMed

    Edström, Erik; Kullberg, Susanna; Ming, Yu; Zheng, Huaiyu; Ulfhake, Brun

    2004-12-15

    During aging, spinal cord motoneurons show characteristic changes including the loss of afferent boutons, a selective process that associates with gliosis and behavioral motor impairment. Evidence suggests that the major histocompatibility complex Class I (MHC I) system may be involved in synaptic plasticity of neurons during development and regeneration. In search of a mechanism governing senescent changes in synaptic connectivity, we report evidence for increased expression of MHC I and beta2 microglobulin (beta2M) in motoneurons and glial-like profiles of 30-month-old rats. The regulatory signal(s) for MHC I expression in normal neurons remains unresolved but among tentative molecules are cytokines such as interferon-gamma (INF-gamma) and tumor necrosis factor alpha (TNF-alpha). Interestingly, aged motoneurons, overlapping with those showing increased levels of MHC I, contained increased levels of INF-gamma receptor message. INF-gamma mRNA was detected at low levels in most (8/9) of the aged spinal cords but only infrequently (2/9) in young adult spinal cords; however, the cellular localization of INF-gamma mRNA could not be determined. Our data also indicates that TNF-alpha is upregulated in the senescent spinal cord but that TNF-alpha immunoreactive protein does not associate with motoneurons. We report evidence for an increased expression of MHC I and beta2M in senescent spinal motoneurons and discuss the possibility that this regulation associates with INF-gamma or changes in neurotrophin signaling and neuron activity in senescence. (c) 2004 Wiley-Liss, Inc.

  3. Reproducibility of Interferon Gamma (IFN-γ) Release Assays. A Systematic Review

    PubMed Central

    Tagmouti, Saloua; Slater, Madeline; Benedetti, Andrea; Kik, Sandra V.; Banaei, Niaz; Cattamanchi, Adithya; Metcalfe, John; Dowdy, David; van Zyl Smit, Richard; Dendukuri, Nandini

    2014-01-01

    Rationale: Interferon gamma (IFN-γ) release assays for latent tuberculosis infection result in a larger-than-expected number of conversions and reversions in occupational screening programs, and reproducibility of test results is a concern. Objectives: Knowledge of the relative contribution and extent of the individual sources of variability (immunological, preanalytical, or analytical) could help optimize testing protocols. Methods: We performed a systematic review of studies published by October 2013 on all potential sources of variability of commercial IFN-γ release assays (QuantiFERON-TB Gold In-Tube and T-SPOT.TB). The included studies assessed test variability under identical conditions and under different conditions (the latter both overall and stratified by individual sources of variability). Linear mixed effects models were used to estimate within-subject SD. Measurements and Main Results: We identified a total of 26 articles, including 7 studies analyzing variability under the same conditions, 10 studies analyzing variability with repeat testing over time under different conditions, and 19 studies reporting individual sources of variability. Most data were on QuantiFERON (only three studies on T-SPOT.TB). A considerable number of conversions and reversions were seen around the manufacturer-recommended cut-point. The estimated range of variability of IFN-γ response in QuantiFERON under identical conditions was ±0.47 IU/ml (coefficient of variation, 13%) and ±0.26 IU/ml (30%) for individuals with an initial IFN-γ response in the borderline range (0.25–0.80 IU/ml). The estimated range of variability in noncontrolled settings was substantially larger (±1.4 IU/ml; 60%). Blood volume inoculated into QuantiFERON tubes and preanalytic delay were identified as key sources of variability. Conclusions: This systematic review shows substantial variability with repeat IFN-γ release assays testing even under identical conditions, suggesting that reversions

  4. Arctigenin from Arctium lappa inhibits interleukin-2 and interferon gene expression in primary human T lymphocytes

    PubMed Central

    2011-01-01

    Background Arctium lappa (Niubang), a Chinese herbal medicine, is used to treat tissue inflammation. This study investigates the effects of arctigenin (AC), isolated from A. lappa, on anti-CD3/CD28 Ab-stimulated cell proliferation and cytokine gene expression in primary human T lymphocytes. Methods Cell proliferation was determined with enzyme immunoassays and the tritiated thymidine uptake method. Cytokine production and gene expression were analyzed with reverse transcription-polymerase chain reaction. Results AC inhibited primary human T lymphocytes proliferation activated by anti-CD3/CD28 Ab. Cell viability test indicated that the inhibitory effects of AC on primary human T lymphocyte proliferation were not due to direct cytotoxicity. AC suppressed interleukin-2 (IL-2) and interferon-γ (IFN-γ) production in a concentration-dependent manner. Furthermore, AC decreased the IL-2 and IFN-γ gene expression in primary human T lymphocytes induced by anti-CD3/CD28 Ab. Reporter gene analyses revealed that AC decreased NF-AT-mediated reporter gene expression. Conclusion AC inhibited T lymphocyte proliferation and decreased the gene expression of IL-2, IFN-γ and NF-AT. PMID:21435270

  5. Curcumin inhibits interferon-{alpha} induced NF-{kappa}B and COX-2 in human A549 non-small cell lung cancer cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Jeeyun; Im, Young-Hyuck; Jung, Hae Hyun

    2005-08-26

    The A549 cells, non-small cell lung cancer cell line from human, were resistant to interferon (IFN)-{alpha} treatment. The IFN-{alpha}-treated A549 cells showed increase in protein expression levels of NF-{kappa}B and COX-2. IFN-{alpha} induced NF-{kappa}B binding activity within 30 min and this increased binding activity was markedly suppressed with inclusion of curcumin. Curcumin also inhibited IFN-{alpha}-induced COX-2 expression in A549 cells. Within 10 min, IFN-{alpha} rapidly induced the binding activity of a {gamma}-{sup 32}P-labeled consensus GAS oligonucleotide probe, which was profoundly reversed by curcumin. Taken together, IFN-{alpha}-induced activations of NF-{kappa}B and COX-2 were inhibited by the addition of curcumin in A549more » cells.« less

  6. Different T-bet expression patterns characterize particular reactive lymphoid tissue lesions.

    PubMed

    Jöhrens, K; Anagnostopoulos, I; Dürkop, H; Stein, H

    2006-03-01

    To investigate T-bet expression profiles in various lymphoid tissue diseases caused by intracellular pathogens and to compare them in disorders without an infective aetiology. Murine and in vitro experiments have shown that the expression/induction of T-bet, the master regulator of Th1 differentiation, can be achieved by obligate intracellular pathogens and high interferon (IFN)-gamma levels. Lymph node biopsies were analysed immunohistochemically employing single and double labelling for T-bet and CD20, CD4, CD8 and CD30 detection. In disorders associated with high IFN-gamma levels and intracellular pathogens (infectious mononucleosis, HIV-associated lymphadenopathy, cat-scratch disease, and toxoplasmic lymphadenitis), T-bet-expressing CD4 cells were accompanied by significant numbers of T-bet-positive CD8 and B cells. A similar profile was also found in histiocytic necrotizing (Kikuchi) lymphadenitis, a disease of unknown cause. In contrast, T-bet expression in disorders without an infective aetiology was observed in only a small portion of lymphocytes. Increased T-bet expression does not only identify intracellular infections in lymphoid tissue associated with high IFN-gamma levels, but also implies that, under these conditions, it becomes induced in B cells, which apparently support the Th1 response. T-bet expression in Kikuchi lymphadenitis underscores the hypothesis that it is caused by an intracellular microorganism.

  7. A randomized, double-blind, phase I/II trial of tumor necrosis factor and interferon-gamma for treatment of AIDS-related complex (Protocol 025 from the AIDS Clinical Trials Group).

    PubMed

    Agosti, J M; Coombs, R W; Collier, A C; Paradise, M A; Benedetti, J K; Jaffe, H S; Corey, L

    1992-05-01

    To determine safety and efficacy of tumor necrosis factor (TNF) and interferon-gamma (IFN gamma) in the treatment of patients with acquired immunodeficiency syndrome (AIDS)-related complex, a randomized, double-blind study was conducted. Twenty-five patients with AIDS-related complex and CD4 lymphocytes less than or equal to 500 x 10(6)/L attended an AIDS Clinical Trials Unit of a tertiary referral center. Patients were administered tumor necrosis factor (TNF) (10 micrograms/m2) or IFN gamma (10 micrograms/m2), or both intramuscularly three times weekly for 16 weeks. Side effects from all three preparations included fever, constitutional symptoms, and local reactions. No significant hematologic, hepatic, renal, or coagulation abnormalities were observed. CD4 lymphocyte counts, beta 2-microglobulin, p24 antigen levels, and anti-p24 antibody did not change significantly during therapy. Similarly, no significant change was noted in rates of HIV isolation from peripheral blood mononuclear cells or plasma. TNF and IFN gamma were tolerable after premedication with acetaminophen; however, no significant change in markers of human immunodeficiency virus infection was demonstrated. These cytokines alone do not appear to be of benefit, nor do they appear to hasten the progression of HIV infection.

  8. A novel mechanism of skin tumor promotion involving interferon-gamma (IFNγ)/signal transducer and activator of transcription-1 (Stat1) signaling.

    PubMed

    Bozeman, Ronald; Abel, Erika L; Macias, Everardo; Cheng, Tianyi; Beltran, Linda; DiGiovanni, John

    2015-08-01

    The current study was designed to explore the role of signal transducer and activator of transcription 1 (Stat1) during tumor promotion using the mouse skin multistage carcinogenesis model. Topical treatment with both 12-O-tetradecanoylphorbol-13-acetate (TPA) and 3-methyl-1,8-dihydroxy-9-anthrone (chrysarobin or CHRY) led to rapid phosphorylation of Stat1 on both tyrosine (Y701) and serine (S727) residues in epidermis. CHRY treatment also led to upregulation of unphosphorylated Stat1 (uStat1) at later time points. CHRY treatment also led to upregulation of interferon regulatory factor 1 (IRF-1) mRNA and protein, which was dependent on Stat1. Further analyses demonstrated that topical treatment with CHRY but not TPA upregulated interferon-gamma (IFNγ) mRNA in the epidermis and that the induction of both IRF-1 and uStat1 was dependent on IFNγ signaling. Stat1 deficient (Stat1(-/-) ) mice were highly resistant to skin tumor promotion by CHRY. In contrast, the tumor response (in terms of both papillomas and squamous cell carcinomas) was similar in Stat1(-/-) mice and wild-type littermates with TPA as the promoter. Maximal induction of both cyclooxygenase-2 and inducible nitric oxide synthase in epidermis following treatment with CHRY was also dependent on the presence of functional Stat1. These studies define a novel mechanism associated with skin tumor promotion by the anthrone class of tumor promoters involving upregulation of IFNγ signaling in the epidermis and downstream signaling through activated (phosphorylated) Stat1, IRF-1 and uStat1. © 2014 Wiley Periodicals, Inc.

  9. Type I interferon regulates pDC maturation and Ly49Q expression.

    PubMed

    Toma-Hirano, Makiko; Namiki, Sahori; Miyatake, Shoichiro; Arai, Ken-Ichi; Kamogawa-Schifter, Yumiko

    2007-10-01

    Ly49Q is expressed on peripheral mouse plasmacytoid dendritic cells (pDC). Immature Ly49Q-negative pDC precursors acquire Ly49Q in the bone marrow and then migrate into the periphery. While searching for molecules that regulate pDC maturation, we found that type I interferon (IFN) inhibited Ly49Q acquisition in vitro. Infections that induce type I IFN production by cells other than pDC (a condition mimicked by poly(I:C) injection in vivo) increase the prevalence of Ly49Q(-) pDC in the bone marrow and peripheral lymphoid organs in wild-type but not IFN-alpha/beta receptor knockout BALB/c mice. Moreover, in vivo exposure to type I IFN causes some Ly49Q(-), but not Ly49Q(+), pDC to convert to conventional DC, defined as B220(-) CD11c(+) CD11b(+) cells. These data suggest that type I IFN regulates pDC development and affects their distribution in the body.

  10. gga-miR-155 Enhances Type I Interferon Expression and Suppresses Infectious Burse Disease Virus Replication via Targeting SOCS1 and TANK

    PubMed Central

    Wang, Bin; Fu, Mengjiao; Liu, Yanan; Wang, Yongqiang; Li, Xiaoqi; Cao, Hong; Zheng, Shijun J.

    2018-01-01

    Infectious bursal disease (IBD) is an acute, highly contagious, and immunosuppressive avian disease caused by IBD virus (IBDV). MicroRNAs (miRNAs) are involved in host-pathogen interactions and innate immune response to viral infection. However, the role of miRNAs in host response to IBDV infection is not clear. We report here that gga-miR-155 acts as an anti-virus host factor inhibiting IBDV replication. We found that transfection of DF-1 cells with gga-miR-155 suppressed IBDV replication, while blockage of the endogenous gga-miR-155 by inhibitors enhanced IBDV replication. Furthermore, our data showed that gga-miR-155 enhanced the expression of type I interferon in DF-1 cells post IBDV infection. Importantly, we found that gga-miR-155 enhanced type I interferon expression via targeting SOCS1 and TANK, two negative regulators of type I IFN signaling. These results indicate that gga-miR-155 plays a critical role in cell response to IBDV infection. PMID:29564226

  11. Sex differences in learned fear expression and extinction involve altered gamma oscillations in medial prefrontal cortex.

    PubMed

    Fenton, Georgina E; Halliday, David M; Mason, Rob; Bredy, Timothy W; Stevenson, Carl W

    2016-11-01

    Sex differences in learned fear expression and extinction involve the medial prefrontal cortex (mPFC). We recently demonstrated that enhanced learned fear expression during auditory fear extinction and its recall is linked to persistent theta activation in the prelimbic (PL) but not infralimbic (IL) cortex of female rats. Emerging evidence indicates that gamma oscillations in mPFC are also implicated in the expression and extinction of learned fear. Therefore we re-examined our in vivo electrophysiology data and found that females showed persistent PL gamma activation during extinction and a failure of IL gamma activation during extinction recall. Altered prefrontal gamma oscillations thus accompany sex differences in learned fear expression and its extinction. These findings are relevant for understanding the neural basis of post-traumatic stress disorder, which is more prevalent in women and involves impaired extinction and mPFC dysfunction. Copyright © 2016 Elsevier Inc. All rights reserved.

  12. Natural Killer Cells and Helicobacter pylori Infection: Bacterial Antigens and Interleukin-12 Act Synergistically To Induce Gamma Interferon Production

    PubMed Central

    Yun, Cheol H.; Lundgren, Anna; Azem, Josef; Sjöling, Åsa; Holmgren, Jan; Svennerholm, Ann-Mari; Lundin, B. Samuel

    2005-01-01

    Helicobacter pylori is known to induce a local immune response, which is characterized by activation of lymphocytes and the production of IFN-γ in the stomach mucosa. Since not only T cells, but also natural killer (NK) cells, are potent producers of gamma interferon (IFN-γ), we investigated whether NK cells play a role in the immune response to H. pylori infection. Our results showed that NK cells were present in both the gastric and duodenal mucosae but that H. pylori infection did not affect the infiltration of NK cells into the gastrointestinal area. Furthermore, we could show that NK cells could be activated directly by H. pylori antigens, as H. pylori bacteria, as well as lysate from H. pylori, induced the secretion of IFN-γ by NK cells. NK cells were also activated without direct contact when separated from the bacteria by an epithelial cell layer, indicating that the activation of NK cells by H. pylori can also occur in vivo, in the infected stomach mucosa. Moreover, the production of IFN-γ by NK cells was greatly enhanced when a small amount of interleukin-12 (IL-12) was added, and this synergistic effect was associated with increased expression of the IL-12 receptor β2. It was further evident that bacterial lysate alone was sufficient to induce the activation of cytotoxicity-related molecules. In conclusion, we demonstrated that NK cells are present in the gastroduodenal mucosa of humans and that NK cells produce high levels of IFN-γ when stimulated with a combination of H. pylori antigen and IL-12. We propose that NK cells play an active role in the local immune response to H. pylori infection. PMID:15731046

  13. NF-kappaB mediates FGF signal regulation of msx-1 expression.

    PubMed

    Bushdid, P B; Chen, C L; Brantley, D M; Yull, F; Raghow, R; Kerr, L D; Barnett, J V

    2001-09-01

    The nuclear factor-kappaB (NF-kappaB) family of transcription factors is involved in proliferation, differentiation, and apoptosis in a stage- and cell-dependent manner. Recent evidence has shown that NF-kappaB activity is necessary for both chicken and mouse limb development. We report here that the NF-kappaB family member c-rel and the homeodomain gene msx-1 have partially overlapping expression patterns in the developing chick limb. In addition, inhibition of NF-kappaB activity resulted in a decrease in msx-1 mRNA expression. Sequence analysis of the msx-1 promoter revealed three potential kappaB-binding sites similar to the interferon-gamma (IFN-gamma) kappaB-binding site. These sites bound to c-Rel, as shown by electrophoretic mobility shift assay (EMSA). Furthermore, inhibition of NF-kappaB activity significantly reduced transactivation of the msx-1 promoter in response to FGF-2/-4, known stimulators of msx-1 expression. These results suggest that NF-kappaB mediates the FGF-2/-4 signal regulation of msx-1 gene expression. Copyright 2001 Academic Press.

  14. Inhibition of interferon-inducible MxA protein expression by hepatitis B virus capsid protein.

    PubMed

    Rosmorduc, O; Sirma, H; Soussan, P; Gordien, E; Lebon, P; Horisberger, M; Bréchot, C; Kremsdorf, D

    1999-05-01

    Chronic hepatitis B treatment has been significantly improved by interferon (IFN) treatment. However, some studies have suggested that hepatitis B virus (HBV) might have a direct effect on the resistance to IFN. Defective particles, generated by spliced HBV RNA and associated with chronic hepatitis B, have been previously characterized; expression of these particles leads to cytoplasmic accumulation of the capsid protein. The aim of this study was to investigate the role of these defective genomes in IFN resistance. The global antiviral activity of IFN was studied by virus yield reduction assays, the expression of three IFN-induced antiviral proteins was analysed by Western blotting and confocal microscopy, and the regulation of MxA gene expression was studied by Northern blotting and the luciferase assay, in Huh7 cells transfected with a complete or the defective HBV genome. Results showed that the expression of the defective genome reduces the antiviral activity of IFN and that this modulation involves a selective inhibition of MxA protein induction by the HBV capsid protein. Our results also show the trans-suppressive effect of the HBV capsid on the MxA promoter, which might participate in this phenomenon. In conclusion, this study shows a direct interplay between the IFN-sensitive pathway and the capsid protein and might implicate this defective HBV genome in virus persistence.

  15. Inflammation activates the interferon signaling pathways in taste bud cells.

    PubMed

    Wang, Hong; Zhou, Minliang; Brand, Joseph; Huang, Liquan

    2007-10-03

    Patients with viral and bacterial infections or other inflammatory illnesses often experience taste dysfunctions. The agents responsible for these taste disorders are thought to be related to infection-induced inflammation, but the mechanisms are not known. As a first step in characterizing the possible role of inflammation in taste disorders, we report here evidence for the presence of interferon (IFN)-mediated signaling pathways in taste bud cells. IFN receptors, particularly the IFN-gamma receptor IFNGR1, are coexpressed with the taste cell-type markers neuronal cell adhesion molecule and alpha-gustducin, suggesting that both the taste receptor cells and synapse-forming cells in the taste bud can be stimulated by IFN. Incubation of taste bud-containing lingual epithelia with recombinant IFN-alpha and IFN-gamma triggered the IFN-mediated signaling cascades, resulting in the phosphorylation of the downstream STAT1 (signal transducer and activator of transcription protein 1) transcription factor. Intraperitoneal injection of lipopolysaccharide or polyinosinic:polycytidylic acid into mice, mimicking bacterial and viral infections, respectively, altered gene expression patterns in taste bud cells. Furthermore, the systemic administration of either IFN-alpha or IFN-gamma significantly increased the number of taste bud cells undergoing programmed cell death. These findings suggest that bacterial and viral infection-induced IFNs can act directly on taste bud cells, affecting their cellular function in taste transduction, and that IFN-induced apoptosis in taste buds may cause abnormal cell turnover and skew the representation of different taste bud cell types, leading to the development of taste disorders. To our knowledge, this is the first study providing direct evidence that inflammation can affect taste buds through cytokine signaling pathways.

  16. Characteristics of the interferon regulatory factor 5 (IRF5) and its expression in response to LCDV and poly I:C challenges in Japanese flounder, Paralichthys olivaceus.

    PubMed

    Hu, Guo-Bin; Lou, Hui-Min; Dong, Xian-Zhi; Liu, Qiu-Ming; Zhang, Shi-Cui

    2012-10-01

    Interferon regulatory factor 5 (IRF5) has been identified as a key transcriptional mediator regulating expression of both type I interferons (IFNs) and proinflammatory cytokines. In this study, the cDNA and genomic sequences of IRF5 were isolated from Japanese flounder, Paralichthys olivaceus. The gene of Japanese flounder (Jf)IRF5 is 7326 bp long, contains 9 exons and 8 introns and encodes a putative protein of 472 amino acids. The predicted protein sequence shares 61.1-81.9% identity to fish IRF5 and possesses a DNA-binding domain (DBD), a middle region (MR), an IRF association domain (IAD), a virus activated domain (VAD) and two nuclear localization signals (NLSs) conserved in all known IRF5s. Phylogenetic analysis clustered it into the teleost IRF5 subgroup within vertebrate IRF5 group. JfIRF5 mRNA was constitutively expressed in all tissues examined, with higher levels observed in the gills and head kidney. Gene expression of JfIRF5 was analyzed over a 7-day time course in the gills, head kidney, spleen and muscle of Japanese flounders challenged with lymphocystis disease virus (LCDV) and polyinosinic:polycytidylic acid (poly I:C). The data showed that JfIRF5 expression was slightly up-regulated by LCDV, but its induction time was clearly moved up; in contrast, the induction upon poly I:C challenge started not earlier than day 2 post-injection and was stronger and more persistent with a later peak time in all four organs. The late and long-lasting inductive expression of JfIRF5 following poly I:C challenge suggests that it might be an interferon stimulated gene (ISG), the induction of which is driven by poly I:C-induced type I IFNs. Copyright © 2012 Elsevier Ltd. All rights reserved.

  17. Human epidermal langerhans cells express the immunoregulatory enzyme indoleamine 2,3-dioxygenase.

    PubMed

    von Bubnoff, Dagmar; Bausinger, Huguette; Matz, Heike; Koch, Susanne; Häcker, Georg; Takikawa, Osamu; Bieber, Thomas; Hanau, Daniel; de la Salle, Henri

    2004-08-01

    Langerhans cells (LC) are a special subset of dendritic cells integrating cutaneous immunity. The study of LC function is of major interest not only for efforts of vaccine design and immunotherapy but also for gaining an insight into the pathogenesis of immune-mediated cutaneous diseases and neoplasias. Recently, defined antigen-presenting cells were described that express indoleamine 2,3-dioxygenase (IDO) and inhibit T cell proliferation in vitro and in vivo. Here, we show that stimulation with interferon-gamma (IFN-gamma) induces the expression of functionally active IDO in highly purified human epidermal LC. The induction of IDO after stimulation of LC with IFN-gamma seems to follow a defined kinetic with rapid upregulation followed by a downregulation after about 24 h of culture. Accordingly, proliferation of T cells induced by anti-CD3 antibodies was modulated by supernatants of IFN-gamma-activated human epidermal LC. Importantly, downregulation of T cell proliferation by supernatants of 24 h IFN-gamma-activated LC was prevented by inhibition of IDO. These results indicate that LC not only have the capacity to stimulate but also to inhibit T cells, and suggest that LC possess an immunoregulatory function in promoting T cell tolerance by production of IDO.

  18. Expression of the Kynurenine Pathway in Human Peripheral Blood Mononuclear Cells: Implications for Inflammatory and Neurodegenerative Disease

    PubMed Central

    Jones, Simon P.; Franco, Nunzio F.; Varney, Bianca; Sundaram, Gayathri; Brown, David A.; de Bie, Josien; Lim, Chai K.; Guillemin, Gilles J.; Brew, Bruce J.

    2015-01-01

    The kynurenine pathway is a fundamental mechanism of immunosuppression and peripheral tolerance. It is increasingly recognized as playing a major role in the pathogenesis of a wide variety of inflammatory, neurodegenerative and malignant disorders. However, the temporal dynamics of kynurenine pathway activation and metabolite production in human immune cells is currently unknown. Here we report the novel use of flow cytometry, combined with ultra high-performance liquid chromatography and gas chromatography-mass spectrometry, to sensitively quantify the intracellular expression of three key kynurenine pathway enzymes and the main kynurenine pathway metabolites in a time-course study. This is the first study to show that up-regulation of indoleamine 2,3-dioxygenase (IDO-1), kynurenine 3-monoxygenase (KMO) and quinolinate phosphoribosyltransferase (QPRT) is lacking in lymphocytes treated with interferon gamma. In contrast, peripheral monocytes showed a significant elevation of kynurenine pathway enzymes and metabolites when treated with interferon gamma. Expression of IDO-1, KMO and QPRT correlated significantly with activation of the kynurenine pathway (kynurenine:tryptophan ratio), quinolinic acid concentration and production of the monocyte derived, pro-inflammatory immune response marker: neopterin. Our results also describe an original and sensitive methodological approach to quantify kynurenine pathway enzyme expression in cells. This has revealed further insights into the potential role of these enzymes in disease processes. PMID:26114426

  19. A subdose of fluconazole alters the virulence of Cryptococcus gattii during murine cryptococcosis and modulates type I interferon expression.

    PubMed

    Fontes, Alide Caroline Lima; Bretas Oliveira, Danilo; Santos, Juliana Ribeiro Alves; Carneiro, Hellem Cristina Silva; Ribeiro, Noelly de Queiroz; Oliveira, Lorena Vívien Neves de; Barcellos, Vanessa Abreu; Paixão, Tatiane Alves; Abrahão, Jonatas Santos; Resende-Stoianoff, Maria Aparecida; Vainstein, Marilene Henning; Santos, Daniel Assis

    2017-02-01

    Cryptococcosis is an invasive infection caused by yeast-like fungus of the genera Cryptococcus spp. The antifungal therapy for this disease provides some toxicity and the incidence of infections caused by resistant strains increased. Thus, we aimed to assess the consequences of fluconazole subdoses during the treatment of cryptococcosis in the murine inflammatory response and in the virulence factors of Cryptococcus gattii. Mice infected with Cryptococcus gattii were treated with subdoses of fluconazole. We determined the behavior of mice and type 1 interferon expression during the treatment; we also studied the virulence factors and susceptibility to fluconazole for the colonies recovered from the animals. A subdose of fluconazole prolonged the survival of mice, but the morbidity of cryptococcosis was higher in treated animals. These data were linked to the increase in: (i) fluconazole minimum inhibitory concentration, (ii) capsule size and (iii) melanization of C. gattii, which probably led to the increased expression of type I interferons in the brains of mice but not in the lungs. In conclusion, a subdose of fluconazole altered fungal virulence factors and susceptibility to this azole, leading to an altered inflammatory host response and increased morbidity. © The Author 2016. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  20. Role of Gamma Interferon in the Pathogenesis of Severe Schistosomiasis in Interleukin-4-Deficient Mice

    PubMed Central

    La Flamme, Anne Camille; Patton, Elisabeth A.; Pearce, Edward J.

    2001-01-01

    In the absence of interleukin-4 (IL-4), infection with Schistosoma mansoni leads to a severe fatal disease rather than the chronic survivable condition that occurs in wild-type (WT) mice. Because the sustained production of NO most closely correlates to weight loss and fatality in infected IL-4−/− mice and because gamma interferon (IFN-γ) is an important inducer of inducible NO synthase, infected IL-4−/− mice were treated with anti-IFN-γ antibodies to determine the role of IFN-γ during schistosomiasis in WT and IL-4−/− animals. When IFN-γ was neutralized, Th2 responses were enhanced and NO production was reduced in both WT and IL-4−/− mice. The decreased NO production correlated with a rescue of proliferation in splenocytes from infected IL-4−/− mice. Furthermore, the neutralization of IFN-γ in vivo improved the gross appearance of the liver and led to a reduction in granuloma size in infected IL-4−/− but not WT mice. However, the neutralization of IFN-γ in vivo did not affect the development of severe disease in infected IL-4−/− mice. These results suggest that while the increased production of IFN-γ does lead to some of the pathology observed in infected IL-4−/− mice, it is not ultimately responsible for cachexia and death. PMID:11705919

  1. Effects of peritoneal fluid from endometriosis patients on interferon-gamma-induced protein-10 (CXCL10) and interleukin-8 (CXCL8) released by neutrophils and CD4+ T cells.

    PubMed

    Kim, Ji-Yeon; Lee, Dong-Hyung; Joo, Jong-Kil; Jin, Jun-O; Wang, Ji-Won; Hong, Young-Seoub; Kwak, Jong-Young; Lee, Kyu-Sup

    2009-09-01

    Intraperitoneal immuno-inflammatory changes may be associated with the pathogenesis of endometriosis. We evaluated the effects of peritoneal fluid obtained from patients with endometriosis (ePF) on the release of interferon-gamma-induced protein-10 (IP-10/CXCL10) and interleukin-8 (IL-8/CXCL8) by neutrophils, CD4(+) T cells, and monocytes. Neutrophils, CD4(+) T cells, and monocytes were cultured with ePF and the chemokine levels in the supernatants were then measured using enzyme-linked immunosorbent assay. The addition of ePF to cultures of CD4(+) T cells led to a significant increase in the release of IP-10 when compared with control PF without endometriosis (cPF). There was a positive correlation between the levels of IL-8 and IP-10 in ePF (R = 0.89, P = 0.041), but not between the levels of IP-10 and IL-8 released by neutrophils, CD4(+) T cells, and monocytes. The levels of IP-10 in ePF were positively correlated with the release of IP-10 by ePF-treated neutrophils (R = 0.89, P < 0.001), CD4(+) T cells (R = 0.93, P < 0.001), and monocytes (R = 0.70, P = 0.01). Moreover, the addition of ePF significantly enhanced the interferon-gamma-induced release of IP-10 by nuetrophils and CD4(+) T cells. These findings suggest that neutrophils and T cells release differential levels of IP-10 and IL-8 in response to stimulation with ePF, and that these cells are a major source of IP-10 in the PF of endometriosis patients.

  2. Tuberculosis screening of new hospital employees: compliance, clearance to work time, and cost using tuberculin skin test and interferon-gamma release assays.

    PubMed

    Foster-Chang, Sarah A; Manning, Mary L; Chandler, Laura

    2014-11-01

    Selection of the most suitable test(s) for detection of Mycobacterium tuberculosis (TB) infection should be based on purpose, setting, effectiveness, and cost. Two tests are available to screen for latent TB: the tuberculin skin test (TST) and the more recent interferon-gamma release assays (IGRAs). Based on the administrative, logistic, and technical ease of use, an IGRA trial was initiated by the occupational health department at an urban Veteran's Administration health care facility for TB screening of new employees. As a result, new employees completing the pre-placement process within the organization's designated 14 days increased from 77% to 97%, new employee clearance to work time decreased from 13.18 to 5.91 days, and new employee TB screening costs were reduced by 40%. The IGRA is an acceptable alternative to the TST and has significant potential to improve the process of pre-placement TB screening. Copyright 2014, SLACK Incorporated.

  3. Fish oil feeding delays influenza virus clearance and impairs production of interferon-gamma and virus-specific immunoglobulin A in the lungs of mice.

    PubMed

    Byleveld, P M; Pang, G T; Clancy, R L; Roberts, D C

    1999-02-01

    Ingestion of fish oil can suppress the inflammatory response to injury and may impair host resistance to infection. To investigate the effect of a diet containing fish oil on immunity to viral infection, 148 BALB/c mice were fed diets containing 3 g/100 g of sunflower oil with either 17 g/100 g of fish oil or beef tallow for 14 d before intranasal challenge with live influenza virus. At d 1 and d 5 after infection, the mice fed fish oil had higher lung viral load and lower body weight (P < 0.05). In addition to the greater viral load and weight loss at d 5 after infection, the fish oil group consumed less food (P < 0.05) while the beef tallow group was clearing the virus, had regained their preinfection weights and was returning to their preinfection food consumption. The fish oil group had impaired production of lung interferon-gamma (IFN-gamma), serum immunoglobulin (Ig) G and lung IgA-specific antibodies (all P < 0. 05) although lung IFN-alpha/beta and the relative proportions of bronchial lymph node CD4+ and CD8+ T lymphocytes did not differ between groups after infection. The present study demonstrates a delay in virus clearance in mice fed fish oil associated with reduced IFN-gamma and antibody production and a greater weight loss and suppression of appetite following influenza virus infection. However, differences observed during the course of infection did not affect the ultimate outcome as both groups cleared the virus and returned to preinfection food consumption and body weight by d 7.

  4. Genotyping and expression analysis of IDO2 in human pancreatic cancer: a novel, active target.

    PubMed

    Witkiewicz, Agnieszka K; Costantino, Christina L; Metz, Richard; Muller, Alexander J; Prendergast, George C; Yeo, Charles J; Brody, Jonathan R

    2009-05-01

    The recently discovered indoleamine 2,3-dioxygenase-2 (IDO2) gene has 2 functional polymorphisms that abolish its enzymatic activity. We hypothesize that expression of the IDO2 enzyme in primary pancreatic ductal adenocarcinomas (PDA) can help cancer cells evade immune detection. Because the IDO2 enzyme might be the preferential target of d-1-methyl-tryptophan, a clinical lead inhibitor of IDO currently being evaluated in phase I trials, we sequenced IDO2 in 36 pancreatic specimens and evaluated its expression. We found that 58% (21 of 36) of cases were heterozygous for the R248W polymorphism; 28% (10 of 36) were homozygous wild-type; and only 14% (5 of 36) were homozygous for the functionally inactive polymorphism. As for the Y359STOP polymorphism, we found that 27% (10 of 36) of cases were heterozygous, 62% (22 of 36) were homozygous wild-type, and only 11% (4 of 36) were homozygous for this functionally inactive allele. Ruling out the possibility of compound polymorphic variants, we estimated 75% of our resected patient cohort had an active IDO2 enzyme, with a conservative estimate that 58% of the patients had at least 1 functional allele. IDO2 was expressed in PDA tissue from each genetically polymorphic subgroup. We also detected IDO2 protein expression in the genetically distinct pancreatic cancer cell lines after exposure with interferon-gamma. This is the first study to report IDO2 expression in PDA and related cancers indicating that IDO2 genetic polymorphisms do not negate interferon-gamma-inducible protein expression. Taken together, our data strongly suggest that the clinical lead compound d-1-methyl-tryptophan might be useful in treatment of PDA.

  5. Borrelia-primed and -infected mice deficient of interleukin-17 develop arthritis after neutralization of gamma-interferon.

    PubMed

    Kuo, Joseph; Warner, Thomas F; Schell, Ronald F

    2017-03-01

    The immune mechanisms responsible for development of Lyme arthritis are partially understood with interleukin-17 (IL-17) and gamma-interferon (IFN-γ) playing a generally accepted role. Elevated levels of IL-17 and/or IFN-γ have been reported in samples from human Lyme arthritis patients and experimental mice. In addition, IL-17 and IFN-γ have been implicated in the onset of arthritis in Borrelia-primed and -infected C57BL/6 mice. Recently, we showed that IL-17-deficient mice developed swelling and histopathological changes consistent with arthritis in the presence of high levels of IFN-γ. We hypothesized that neutralization of IFN-γ in IL-17-deficient mice would inhibit Borrelia-induced arthritis. Our results, however, showed that swelling of the hind paws and histopathological changes of arthritis did not differ between Borrelia-primed and -infected IL-17-deficient and wild-type mice with or without neutralization of IFN-γ. We also found higher levels of tumor necrosis factor alpha (TNF-α) and IL-6 in the popliteal lymph node cells of Borrelia-primed and -infected IL-17-deficient mice after neutralization of IFN-γ. These results suggest that multiple cytokines interact in the development of Borrelia-induced arthritis. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  6. Interleukin-17A-Deficient Mice Are Highly Susceptible to Toxoplasma gondii Infection Due to Excessively Induced T. gondii HSP70 and Interferon Gamma Production.

    PubMed

    Moroda, Masataka; Takamoto, Masaya; Iwakura, Yoichiro; Nakayama, Jun; Aosai, Fumie

    2017-12-01

    Interleukin17A (IL-17A) is known to be involved in the host defense against pathogens and the pathogenesis of autoimmune diseases. Previously, we showed that excessive amounts of interferon gamma (IFN-γ) play an important role in the pathogenesis of the lethal effects of Toxoplasma gondii by inducing anaphylactic responses. In the study described in this report, we examined the effects of IL-17A deficiency on murine host defense against oral T. gondii infection. IL-17A-deficient C57BL/6 (B6) mice exhibited higher rates of mortality than wild-type (WT) mice during the acute phase of T. gondii infection. CD4 + T cells in the mesenteric lymph nodes (mLNs) and ileum of T. gondii -infected IL-17A-deficient mice produced higher levels of IFN-γ than did those of WT mice. In addition, the level of T. gondii HSP70 ( T.g HSP70) expression was also significantly increased in the ileum, mLNs, liver, and spleen of infected IL-17A-deficient mice compared with that in WT mice. These elevated levels of expression of T.g HSP70 and IFN-γ in infected IL-17A-deficient mice were presumably linked to the IL-17A defect since they decreased to WT levels after treatment with recombinant IL-17A. Furthermore, IL-17A-deficient mice were highly susceptible to the anaphylactic effect of T.g HSP70, and the survival of IL-17A-deficient mice during the acute phase was improved by treatment with an anti- T.g HSP70 monoclonal antibody. These results suggest that IL-17A plays an important role in host survival against T. gondii infection by protecting the host from an anaphylactic reaction via the downregulation of T.g HSP70 and IFN-γ production. Copyright © 2017 American Society for Microbiology.

  7. Intact Pneumococci Trigger Transcription of Interferon-Related Genes in Human Monocytes, while Fragmented, Autolyzed Bacteria Subvert This Response

    PubMed Central

    Nordén, Rickard; Martner, Anna; Samuelsson, Ebba; Hynsjö, Lars; Wold, Agnes E.

    2017-01-01

    ABSTRACT A peculiar trait of pneumococci (Streptococcus pneumoniae) is their propensity to undergo spontaneous lysis during stationary growth due to activation of the enzyme autolysin (LytA), which fragments the peptidoglycan cell wall. The fragments that are generated upon autolysis impair phagocytosis and reduce production of interleukin-12 (IL-12) and gamma interferon (IFN-γ) by human leukocytes in response to intact pneumococci, thereby impeding crucial host defenses. The objective was to identify additional monocyte genes whose transcription is induced by intact pneumococci and subverted by autolyzed bacteria. Monocytes were isolated from healthy blood donors and stimulated for 3 h with UV-inactivated S. pneumoniae (Rx1PLY− LytA+ strain), which is capable of autolyzing, its LytA− isogenic autolysin-deficient mutant, or a mixture of the two (containing twice the initial bacterial concentration). Gene expression was assessed by Illumina microarray, and selected findings were confirmed by reverse transcription-quantitative real-time PCR (RT-qPCR), enzyme-linked immunosorbent assay (ELISA), and flow cytometry. In all, we identified 121 genes that were upregulated to a significantly higher degree by intact than autolyzed pneumococci. These included IFNB1 and a large set of interferon-induced genes, such as IFIT3, RSAD2, CFCL1, and CXCL10 genes, as well as IL12B and CD40 genes. RT-qPCR revealed that transcription of these genes in response to intact pneumococci diminished when autolyzed pneumococci were admixed and that this pattern was independent of pneumolysin. Thus, transcription of interferon-related genes is triggered by intact pneumococci and subverted by fragments generated by spontaneous bacterial autolysis. We suggest that interferon-related pathways are important for elimination of pneumococci and that autolysis contributes to virulence by extinguishing these pathways. PMID:28223347

  8. Effect of interferons and other biological response modifiers (BRMS) on macrophage-mediated inhibition of Listeria monocytogenes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Badger, A.M.; Swift, B.; Sung, C.P.

    1986-03-05

    Recombinant murine gamma interferon (IFN-..gamma..) activates oil elicited C57BL/6 peritoneal macrophages to inhibit the growth of Listeria. Maximum activity is obtained with 10-20 units/ml, can be demonstrated in the absence of antibiotics and is not due to LPS contamination. Studies of the kinetics of this phenomenon demonstrate that a 30 minute incubation with IFN-..gamma.. is sufficient to initiate the antiproliferative state and full activity can be obtained with a 4 hour incubation. Alpha/beta interferon (IFN-..cap alpha../..beta..) is also active but requires 100X more units to obtain equivalent activity. The evaluation of a number of other BRMS demonstrated that MDP andmore » LPS could stimulate phagocytosis of Listeria but could not inhibit their growth. Bestatin, tuftsin, Con A, A23187 and Poly I:C did not stimulate either phagocytosis or growth inhibitory activity. These compounds were also tested for their ability to enhance the release of superoxide anion from PMA stimulated macrophages. With the exception of tuftsin and bestatin all of the BRMS tested were able to enhance the production of oxidative burst products confirming the findings of others of the dissociation between the two functions.« less

  9. Adjuvant immunotherapy of feline fibrosarcoma with recombinant feline interferon-omega.

    PubMed

    Hampel, Verena; Schwarz, Bianca; Kempf, Christine; Köstlin, Roberto; Schillinger, Ulrike; Küchenhoff, Helmut; Fenske, Nora; Brill, Thomas; Hirschberger, Johannes

    2007-01-01

    Recombinant feline interferon-omega (rFeIFN-omega) was tested as a treatment option for cats with fibrosarcoma to assess safety and feasibility. Treatment with rFeIFN-omega in cats with fibrosarcoma is safe and feasible. Twenty domestic cats. In an open-labeled uncontrolled clinical trial 12 injections of 1 x 10(6) U/kg rFeIFN-omega were administered over a 5-week period: the 1st through 4th injections were given intratumorally, and the 5th through 12th injections were administered subcutaneously at the tumor excision site. Wide surgical excision of the tumors was carried out after the 4th injection and before the 5th injection of rFeIFN-omega. A Common Terminology Criteria for Adverse Events (CTCAE) analysis was conducted. Flow cytometry of fibrosarcoma cells after incubation with rFeIFN-omega and recombinant feline interferon-gamma was performed to assess the biological effect of rFeIFN-omega. Changes in blood cell count, increases in serum aspartate-amino-transferase activity, serum bilirubin concentration, serum creatinine and serum electrolyte concentrations, weight loss, anorexia, increased body temperature, and reduced general condition were observed but were mostly minor (grade 1 and 2) and self limiting. Eosinophilia (P = .025), neutropenia (P = .021), and weight loss (P < .001) were statistically correlated with rFeIFN-omega-treatment (analysis of parameters before treatment and after 3 injections of rFeIFN-omega). Flow cytometry of 5 unrelated feline fibrosarcoma cell lines showed increased expression of major histocompatibility complex (MHC) class I molecules (P = .026) in response to in vitro incubation with rFeIFN-omega, whereas expression of MHC class II molecules was not affected significantly. RFeIFN-omega for the treatment of feline fibrosarcoma is safe, well tolerated, and can be easily performed in practice. To assess the efficacy of the treatment, it should be tested in a placebo-controlled trial.

  10. Interferon lambda 1-3 expression in infants hospitalized for RSV or HRV associated bronchiolitis.

    PubMed

    Selvaggi, Carla; Pierangeli, Alessandra; Fabiani, Marco; Spano, Lucia; Nicolai, Ambra; Papoff, Paola; Moretti, Corrado; Midulla, Fabio; Antonelli, Guido; Scagnolari, Carolina

    2014-05-01

    The airway expression of type III interferons (IFNs) was evaluated in infants hospitalized for respiratory syncytial virus (RSV) or rhinovirus (HRV) bronchiolitis. As an additional objective we sought to determine whether a different expression of IFN lambda 1-3 was associated with different harboring viruses, the clinical course of bronchiolitis or with the levels of well established IFN stimulated genes (ISGs), such as mixovirus resistance A (MxA) and ISG56. The analysis was undertaken in 118 infants with RSV or HRV bronchiolitis. Nasopharyngeal washes were collected for virological studies and molecular analysis of type III IFN responses. RSV elicited higher levels of IFN lambda subtypes when compared with HRV. A similar expression of type III IFN was found in RSVA or RSVB infected infants and in those infected with HRVA or HRVC viruses. Results also indicate that IFN lambda 1 and IFN lambda 2-3 levels were correlated with each other and with MxA and ISG56-mRNAs. In addition, a positive correlation exists between the IFN lambda1 levels and the clinical score index during RSV infection. In particular, higher IFN lambda 1 levels are associated to an increase of respiratory rate. These findings show that differences in the IFN lambda 1-3 levels in infants with RSV or HRV infections are present and that the expression of IFN lambda 1 correlates with the severity of RSV bronchiolitis. Copyright © 2014 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

  11. Important role of interferon regulatory factor (IRF)-3 in the interferon response of mouse macrophages upon infection by Newcastle disease virus.

    PubMed

    Wilden, Holger; Schirrmacher, Volker; Fournier, Philippe

    2011-08-01

    Newcastle disease virus (NDV) is an interesting agent for activating innate immune activity in macrophages including secretion of TNF-α and IFN-α, upregulation of TRAIL and activation of NF-κB and iNOS. However, the molecular mechanism of such cellular activities remains largely unknown. Tumor selectivity of replication of NDV has been described to be linked to deviations in tumor cells of the type I interferon response. We therefore focused on the interferon response to NDV of macrophages as part of innate anti-viral and anti-tumor activity. In particular, we investigated the functional significance of the interferon regulatory factor genes (IRF)-3 and IRF-7. Deletion of the IRF-3 or IRF-7 gene was found to increase susceptibility of mouse macrophages to virus infection. Surprisingly, NDV replicated better in IRF-3 KO than in IRF-7 KO macrophages. Further analysis showed that IRF-3 KO macrophages have a lower basal and NDV-induced RIG-I expression in comparison to IRF-7 KO macrophages. This might explain why, in IRF-3 KO macrophages, the secretion of type I interferons after NDV infection is delayed, when compared to IRF-7 KO and wild-type macrophages. In addition, IRF-3 KO cells showed reduced NDV-induced levels of IRF-7. This effect could be prevented by priming the cells first by interferon-α. Further results indicated that an early production of type I interferon rather than high maximal levels at later time points are important for resistance to infection by NDV. In conclusion, these results demonstrate an important role of IRF-3 for the innate anti-viral response to NDV of mouse macrophages.

  12. Importance of correlation between gene expression levels: application to the type I interferon signature in rheumatoid arthritis.

    PubMed

    Reynier, Frédéric; Petit, Fabien; Paye, Malick; Turrel-Davin, Fanny; Imbert, Pierre-Emmanuel; Hot, Arnaud; Mougin, Bruno; Miossec, Pierre

    2011-01-01

    The analysis of gene expression data shows that many genes display similarity in their expression profiles suggesting some co-regulation. Here, we investigated the co-expression patterns in gene expression data and proposed a correlation-based research method to stratify individuals. Using blood from rheumatoid arthritis (RA) patients, we investigated the gene expression profiles from whole blood using Affymetrix microarray technology. Co-expressed genes were analyzed by a biclustering method, followed by gene ontology analysis of the relevant biclusters. Taking the type I interferon (IFN) pathway as an example, a classification algorithm was developed from the 102 RA patients and extended to 10 systemic lupus erythematosus (SLE) patients and 100 healthy volunteers to further characterize individuals. We developed a correlation-based algorithm referred to as Classification Algorithm Based on a Biological Signature (CABS), an alternative to other approaches focused specifically on the expression levels. This algorithm applied to the expression of 35 IFN-related genes showed that the IFN signature presented a heterogeneous expression between RA, SLE and healthy controls which could reflect the level of global IFN signature activation. Moreover, the monitoring of the IFN-related genes during the anti-TNF treatment identified changes in type I IFN gene activity induced in RA patients. In conclusion, we have proposed an original method to analyze genes sharing an expression pattern and a biological function showing that the activation levels of a biological signature could be characterized by its overall state of correlation.

  13. Effect of pro-inflammatory mediators on membrane-associated mucins expressed by human ocular surface epithelial cells.

    PubMed

    Albertsmeyer, Ann-Christin; Kakkassery, Vinodh; Spurr-Michaud, Sandra; Beeks, Olivia; Gipson, Ilene K

    2010-03-01

    Membrane-associated mucins are altered on the ocular surface in non-Sjögren's dry eye. This study sought to determine if inflammatory mediators, present in tears of dry eye patients, regulate membrane-associated mucins MUC1 and -16 at the level of gene expression, protein biosynthesis and/or ectodomain release. A human corneal limbal epithelial cell line (HCLE), which produces membrane-associated mucins, was used. Cells were treated with interleukin (IL)-6, -8, or -17, tumor necrosis factor-alpha (TNF-alpha), and Interferon-gamma (IFN-gamma), or a combination of TNF-alpha and IFN-gamma, or IFN-gamma and IL-17, for 1, 6, 24, or 48 h. Presence of receptors for these mediators was verified by RT-PCR. Effects of the cytokines on expression levels of MUC1 and -16 were determined by real-time PCR, and on mucin protein biosynthesis and ectodomain release in cell lysates and culture media, respectively, by immunoblot analysis. TNF-alpha and IFN-gamma each significantly induced MUC1 expression, cellular protein content and ectodomain release over time. Combined treatment with the two cytokines was not additive. By comparison, one of the inflammatory mediators, IFN-gamma, affected all three parameters-gene expression, cellular protein, and ectodomain release-for MUC16. Combined treatment with TNF-alpha and IFN-gamma showed effects similar to IFN-gamma alone, except that ectodomain release followed that of TNF-alpha, which induced MUC16 ectodomain release. In conclusion, inflammatory mediators present in tears of dry eye patients can affect MUC1 and -16 on corneal epithelial cells and may be responsible for alterations of surface mucins in dry eye.

  14. Comparison of Cytomegalovirus (CMV) Enzyme-Linked Immunosorbent Spot and CMV Quantiferon Gamma Interferon-Releasing Assays in Assessing Risk of CMV Infection in Kidney Transplant Recipients

    PubMed Central

    Saldan, Alda; Mengoli, Carlo; Fiscon, Marta; Silvestre, Cristina; Fallico, Loredana; Peracchi, Marta; Furian, Lucrezia; Cusinato, Riccardo; Bonfante, Luciana; Rossi, Barbara; Marchini, Francesco; Sgarabotto, Dino; Rigotti, Paolo; Palù, Giorgio

    2013-01-01

    Assessing cytomegalovirus (CMV)-specific cell-mediated immunity (CMI) represents an appealing strategy for identifying transplant recipients at risk of infection. In this study, we compared two gamma interferon-releasing assays (IGRAs), Quantiferon-CMV and CMV enzyme-linked immunosorbent spot (ELISPOT), to determine the ability of each test to predict protective CMV-specific T-cell responses. Two hundred twenty-one Quantiferon-CMV and ELISPOT tests were conducted on 120 adult kidney transplant recipients (KTRs), including 100 CMV-seropositive transplant recipients (R+) and 20 CMV-seronegative transplant recipients of a CMV-positive donor (D+/R−). As a control cohort, 39 healthy adult subjects (including 33 CMV-seropositive and 6 CMV-seronegative subjects) were enrolled. CMV IgG serology was used as a reference for both tests. In the CMV-seropositive individuals, the ELISPOT and Quantiferon-CMV assays provided 46% concordance with the serology, 12% discordance, 18% disagreement between ELISPOT or Quantiferon-CMV and the serology, and 24% gray areas when one or both tests resulted in weak positives. None of the CMV-seronegative subjects showed detectable responses in the ELISPOT or the Quantiferon-CMV test. In transplant recipients, both the ELISPOT and Quantiferon-CMV assays positively correlated with each other and negatively correlated with CMV DNAemia in a significant way (P < 0.05). During the antiviral prophylaxis, all 20 D+/R− KTRs we examined displayed undetectable Quantiferon-CMV and ELISPOT results, and there was no evidence of CMV seroconversion. The receiving operator curve (ROC) statistical analysis revealed similar specificities and sensitivities in predicting detectable viremia (areas under the curve [AUC], 0.66 and 0.62 for Quantiferon-CMV and ELISPOT, respectively). ELISPOT and Quantiferon-CMV values of >150 spots/200,000 peripheral blood mononuclear cells (PBMCs) and >1 to 6 IU gamma interferon (IFN-γ) were associated with protection from CMV

  15. [Effectiveness of interferon-gamma release assays in the tuberculosis contact investigation of elderly people].

    PubMed

    Seto, Junji; Ahiko, Tadayuki

    2014-04-01

    To confirm the effectiveness of interferon-gamma release assays (IGRAs) in the tuberculosis (TB) contact investigation of elderly people, we analyzed the results of the QuantiFERON TB Gold in tube (QFT-3G) test, which is a commercially available IGRA. We analyzed the results of the QFT-3G test in 2,420 subjects who were in close contact with TB patients. We investigated subjects with latent TB infection and those showing the onset of TB among the QFT-3G-positive subjects. The QFT-3G-positive rate was 7.3% (95% confidence interval, 6.2%-8.3%). In addition, we demonstrated that the QFT-3G-positive rate increased with age (P < 0.001). The QFT-3G-positive rate was high, particularly in elderly people (> or = 60 years), but the rate was significantly lower than the predicted prevalence of TB infection. Therefore, it was assumed that the QFT-3G test does not always provide a positive result, even in cases of subjects with a previous TB infection. Furthermore, data from the QFT-3G-positive subjects indicated that approximately one half of subjects aged 60-69 years, approximately one-third of those aged 70-79 years, and approximately one-quarter of those aged over 80 years have had recent TB infections. In conclusion, the results of the QFT-3G test in elderly people need to be carefully evaluated according to the contact situation with TB patients; nevertheless, the QFT-3G test is useful for the screening of latent TB infection in elderly people who were in close contact with TB patients.

  16. Dengue subgenomic RNA binds TRIM25 to inhibit interferon expression for epidemiological fitness

    PubMed Central

    Manokaran, Gayathri; Finol, Esteban; Wang, Chunling; Gunaratne, Jayantha; Bahl, Justin; Ong, Eugenia Z.; Tan, Hwee Cheng; Sessions, October M.; Ward, Alex M.; Gubler, Duane J.; Harris, Eva; Garcia-Blanco, Mariano A.; Ooi, Eng Eong

    2016-01-01

    The global spread of dengue virus (DENV) infections has increased viral genetic diversity, some of which appears associated with greater epidemic potential. The mechanisms governing viral fitness in epidemiological settings, however, remain poorly defined. We identified a determinant of fitness in a foreign dominant (PR-2B) DENV serotype 2 (DENV-2) clade, which emerged during the 1994 epidemic in Puerto Rico and replaced an endemic (PR-1) DENV-2 clade. The PR-2B DENV-2 produced increased levels of subgenomic flavivirus RNA (sfRNA) relative to genomic RNA during replication. PR-2B sfRNA showed sequence-dependent binding to and prevention of tripartite motif 25 (TRIM25) deubiquitylation, which is critical for sustained and amplified retinoic acid–inducible gene 1 (RIG-I)–induced type I interferon expression. Our findings demonstrate a distinctive viral RNA–host protein interaction to evade the innate immune response for increased epidemiological fitness. PMID:26138103

  17. Dengue subgenomic RNA binds TRIM25 to inhibit interferon expression for epidemiological fitness.

    PubMed

    Manokaran, Gayathri; Finol, Esteban; Wang, Chunling; Gunaratne, Jayantha; Bahl, Justin; Ong, Eugenia Z; Tan, Hwee Cheng; Sessions, October M; Ward, Alex M; Gubler, Duane J; Harris, Eva; Garcia-Blanco, Mariano A; Ooi, Eng Eong

    2015-10-09

    The global spread of dengue virus (DENV) infections has increased viral genetic diversity, some of which appears associated with greater epidemic potential. The mechanisms governing viral fitness in epidemiological settings, however, remain poorly defined. We identified a determinant of fitness in a foreign dominant (PR-2B) DENV serotype 2 (DENV-2) clade, which emerged during the 1994 epidemic in Puerto Rico and replaced an endemic (PR-1) DENV-2 clade. The PR-2B DENV-2 produced increased levels of subgenomic flavivirus RNA (sfRNA) relative to genomic RNA during replication. PR-2B sfRNA showed sequence-dependent binding to and prevention of tripartite motif 25 (TRIM25) deubiquitylation, which is critical for sustained and amplified retinoic acid-inducible gene 1 (RIG-I)-induced type I interferon expression. Our findings demonstrate a distinctive viral RNA-host protein interaction to evade the innate immune response for increased epidemiological fitness. Copyright © 2015, American Association for the Advancement of Science.

  18. Mangiferin inhibits macrophage classical activation via downregulating interferon regulatory factor 5 expression.

    PubMed

    Wei, Zhiquan; Yan, Li; Chen, Yixin; Bao, Chuanhong; Deng, Jing; Deng, Jiagang

    2016-08-01

    Mangiferin is a natural polyphenol and the predominant effective component of Mangifera indica Linn. leaves. For hundreds of years, Mangifera indica Linn. leaf has been used as an ingredient in numerous traditional Chinese medicine preparations for the treatment of bronchitis. However, the pharmacological mechanism of mangiferin in the treatment of bronchitis remains to be elucidated. Macrophage classical activation is important role in the process of bronchial airway inflammation, and interferon regulatory factor 5 (IRF5) has been identified as a key regulatory factor for macrophage classical activation. The present study used the THP‑1 human monocyte cell line to investigate whether mangiferin inhibits macrophage classical activation via suppressing IRF5 expression in vitro. THP‑1 cells were differentiated to macrophages by phorbol 12‑myristate 13‑acetate. Macrophages were polarized to M1 macrophages following stimulation with lipopolysaccharide (LPS)/interferon‑γ (IFN‑γ). Flow cytometric analysis was conducted to detect the M1 macrophages. Reverse transcription‑quantitative polymerase chain reaction was used to investigate cellular IRF5 gene expression. Levels of proinflammatory cytokines and IRF5 were assessed following cell culture and cellular homogenization using enzyme‑linked immunosorbent assay. IRF5 protein and nuclei co‑localization was performed in macrophages with laser scanning confocal microscope immunofluorescence analysis. The results of the present study demonstrated that mangiferin significantly inhibits LPS/IFN‑γ stimulation‑induced classical activation of macrophages in vitro and markedly decreases proinflammatory cytokine release. In addition, cellular IRF5 expression was markedly downregulated. These results suggest that the inhibitory effect of mangiferin on classical activation of macrophages may be exerted via downregulation of cellular IRF5 expression levels.

  19. Interferons alpha and gamma induce p53-dependent and p53-independent apoptosis, respectively.

    PubMed

    Porta, Chiara; Hadj-Slimane, Reda; Nejmeddine, Mohamed; Pampin, Mathieu; Tovey, Michael G; Espert, Lucile; Alvarez, Sandra; Chelbi-Alix, Mounira K

    2005-01-20

    Type I interferon (IFN) enhances the transcription of the tumor suppressor gene p53. To elucidate the molecular mechanism mediating IFN-induced apoptosis, we analysed programmed cell death in response to type I (IFNalpha) or type II (IFNgamma) treatment in relation to p53 status. In two cell lines (MCF-7, SKNSH), IFNalpha, but not IFNgamma, enhanced apoptosis in a p53-dependent manner. Furthermore, only IFNalpha upregulated p53 as well as p53 target genes (Noxa, Mdm2 and CD95). The apoptotic response to IFNalpha decreased in the presence of ZB4, an anti-CD95 antibody, suggesting that CD95 is involved in this process. When p53 was inactivated by the E6 viral protein or the expression of a p53 mutant, IFNalpha-induced apoptosis and p53 target genes upregulation were abrogated. Altogether these results demonstrate that p53 plays a pivotal role in the IFNalpha-induced apoptotic response. IFNalpha-induced PML was unable to recruit p53 into nuclear bodies and its downregulation by siRNA did not alter CD95 expression. In contrast, IFNgamma-induced apoptosis is p53-independent. CD95 and IFN-regulatory factor 1 (IRF1) are directly upregulated by this cytokine. Apoptotic response to IFNgamma is decreased in the presence of ZB4 and strongly diminished by IRF1 siRNA, implicating both CD95 and IRF1 in IFNgamma-induced apoptotic response. Taken together, these results show that in two different cell lines, IFNalpha and IFNgamma, induce p53-dependent -independent apoptosis, respectively.

  20. Human Interferon Regulatory Factor 2 Gene Expression is Induced in Chronic Hepatitis C Virus Infection—A Possible Mode of Viral Persistence

    PubMed Central

    Mukherjee, Rathindra M; Bansode, Budhapriyavilas; Gangwal, Puja; Jakkampudi, Aparna; Reddy, Panyala B; Rao, Padaki N; Gupta, Rajesh; Reddy, D Nageshwar

    2012-01-01

    Background The interferon regulatory factors (IRFs) are a family of transcription factors known to be involved in the modulation of cellular responses to interferons (IFNs) and viral infection. While IRF-1 acts as a positive regulator, IRF-2 is known to repress IFN-mediated gene expression. The increase in the IRF-1/IRF-2 ratio is considered as an important event in the transcriptional activation of IFN-α gene toward development of the cellular antiviral response. Objective This study was performed to assess the expression of IRF mRNAs along with the expression level of IFN-α, its receptor (IFNAR-1), and the signal transduction factor (STAT-1) in treatment naive hepatitis C virus (HCV)-infected subjects. Materials Thirty-five chronically infected (CHC) patients and 39 voluntary blood donors as controls were included in the study. Quantification of HCV-RNA (ribonucleic acid) and genotyping were done by real-time polymerase chain reaction (PCR) and hybridization assays, respectively, using patient's serum/plasma. In both controls and patients, the serum level of IFN-α and IFN-α was measured by flow cytometry. Target gene expressions were studied by retro-transcription of respective mRNAs extracted from peripheral blood mononuclear cells (PBMCs) followed by PCR amplification and densitometry. Minus-strand HCV-RNA as a marker of viral replication in PBMCs was detected by an inhouse PCR assay. Results Both IRF-1 and IRF-2 genes were significantly enhanced in CHC than in control subjects (P < 0.001). A significant positive correlation (r2 = 0.386, P <0.01) was obtained between higher IRF-2 gene expression and increasing level of HCV-RNA. Chronically infected subjects (13%) harboring replicating HCV in PBMCs showed no significant differences in gene expressions than the subjects without HCV in PBMCs. Conclusion Our findings indicate that HCV modulates host immunity by inducing IRF-2 gene to counteract IRF-1-mediated IFN-α gene expression. Since the IRF-2 gene is

  1. MicroRNA-302a suppresses influenza A virus-stimulated interferon regulatory factor-5 expression and cytokine storm induction.

    PubMed

    Chen, Xueyuan; Zhou, Li; Peng, Nanfang; Yu, Haisheng; Li, Mengqi; Cao, Zhongying; Lin, Yong; Wang, Xueyu; Li, Qian; Wang, Jun; She, Yinglong; Zhu, Chengliang; Lu, Mengji; Zhu, Ying; Liu, Shi

    2017-12-29

    During influenza A virus (IAV) infection, cytokine storms play a vital and critical role in clinical outcomes. We have previously reported that microRNA (miR)-302c regulates IAV-induced IFN expression by targeting the 3'-UTR of nuclear factor κB (NF-κB)-inducing kinase. In the current study, we found that miR-302a, another member of the miR-302 cluster, controls the IAV-induced cytokine storm. According to results from cell-based and knockout mouse models, IAV induces a cytokine storm via interferon regulatory factor-5 (IRF-5). We also found that IAV infection up-regulates IRF-5 expression and that IRF-5 in turn promotes IAV replication. Furthermore, we observed that IRF-5 is a direct target of miR-302a, which down-regulated IRF-5 expression by binding its 3'-UTR. Moreover, IAV increased IRF-5 expression by down-regulating miR-302a expression. Interestingly, miR-302a inhibited IAV replication. In IAV-infected patients, miR-302a expression was down-regulated, whereas IRF-5 expression was up-regulated. Taken together, our work uncovers and defines a signaling pathway implicated in an IAV-induced cytokine storm. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  2. Induction of indolamine 2,3-dioxygenase and kynurenine 3-monooxygenase in rat brain following a systemic inflammatory challenge: a role for IFN-gamma?

    PubMed

    Connor, Thomas J; Starr, Neasa; O'Sullivan, Joan B; Harkin, Andrew

    2008-08-15

    Inflammation-mediated dysregulation of the kynurenine pathway has been implicated as a contributor to a number of major brain disorders. Consequently, we examined the impact of a systemic inflammatory challenge on kynurenine pathway enzyme expression in rat brain. Indoleamine 2,3-dioxygenase (IDO) expression was induced in cortex and hippocampus following systemic lipopolysaccharide (LPS) administration. Whilst IDO expression was paralleled by increased circulating interferon (IFN)-gamma concentrations, IFN-gamma expression in the brain was only modestly altered following LPS administration. In contrast, induction of IDO was associated with increased central tumour necrosis factor (TNF)-alpha and interleukin (IL)-6 expression. Similarly, in cultured glial cells LPS-induced IDO expression was accompanied by increased TNF-alpha and IL-6 expression, whereas IFN-gamma was not detectable. These findings indicate that IFN-gamma is not required for LPS-induced IDO expression in brain. A robust increase in kynurenine-3-monooxygenase (KMO) expression was observed in rat brain 24h post LPS, without any change in kynurenine aminotransferase II (KAT II) expression. In addition, we report that constitutive expression of KAT II is approximately 8-fold higher than KMO in cortex and 20-fold higher in hippocampus. Similarly, in glial cells constitutive expression of KAT II was approximately 16-fold higher than KMO, and expression of KMO but not KAT II was induced by LPS. These data are the first to demonstrate that a systemic inflammatory challenge stimulates KMO expression in brain; a situation that is likely to favour kynurenine metabolism in a neurotoxic direction. However, our observation that expression of KAT II is much higher than KMO in rat brain is likely to counteract potential neurotoxicity that could arise from KMO induction following an acute inflammation.

  3. Loss of the type I interferon pathway increases vulnerability of mice to genital herpes simplex virus 2 infection.

    PubMed

    Conrady, Christopher D; Halford, William P; Carr, Daniel J J

    2011-02-01

    The mouse model of genital herpes relies on medoxyprogesterone treatment of female mice to render the vaginal lumen susceptible to inoculation with herpes simplex virus 2 (HSV-2). In the present study, we report that mice deficient in the A1 chain of the type I interferon receptor (CD118(-/-)) are susceptible to HSV-2 in the absence of medroxyprogesterone preconditioning. In the absence of hormone pretreatment, 2,000 PFU of a clinical isolate of HSV-2 was sufficient to establish a productive infection in the vagina of 75% ± 17% and in the spinal cord of 71% ± 14% of CD118(-/-) mice, whereas the same dose of HSV-2 replicated to detectable levels in only 13% ± 13% of vaginal samples and 0% of spinal cord samples from wild-type mice, as determined at day 5 postinfection. The susceptibility to HSV-2 infection in the CD118(-/-) mice was associated with a significant reduction in the infiltration of HSV-specific cytotoxic T lymphocytes into the vaginal tissue, the local production of gamma interferon (IFN-γ), and the expression of T cell-recruiting chemokines CCL5, CXCL9, and CXCL10. Collectively, the results underscore the significant contribution of type I IFNs in resistance to genital HSV-2 infection.

  4. Transgenic Expression of Interferon-γ in Mouse Stomach Leads to Inflammation, Metaplasia, and Dysplasia

    PubMed Central

    Syu, Li-Jyun; El-Zaatari, Mohamad; Eaton, Kathryn A.; Liu, Zhiping; Tetarbe, Manas; Keeley, Theresa M.; Pero, Joanna; Ferris, Jennifer; Wilbert, Dawn; Kaatz, Ashley; Zheng, Xinlei; Qiao, Xiotan; Grachtchouk, Marina; Gumucio, Deborah L.; Merchant, Juanita L.; Samuelson, Linda C.; Dlugosz, Andrzej A.

    2013-01-01

    Gastric adenocarcinoma is one of the leading causes of cancer mortality worldwide. It arises through a stepwise process that includes prominent inflammation with expression of interferon-γ (IFN-γ) and multiple other pro-inflammatory cytokines. We engineered mice expressing IFN-γ under the control of the stomach-specific H+/K+ ATPase β promoter to test the potential role of this cytokine in gastric tumorigenesis. Stomachs of H/K-IFN-γ transgenic mice exhibited inflammation, expansion of myofibroblasts, loss of parietal and chief cells, spasmolytic polypeptide expressing metaplasia, and dysplasia. Proliferation was elevated in undifferentiated and metaplastic epithelial cells in H/K-IFN-γ transgenic mice, and there was increased apoptosis. H/K-IFN-γ mice had elevated levels of mRNA for IFN-γ target genes and the pro-inflammatory cytokines IL-6, IL-1β, and tumor necrosis factor-α. Intracellular mediators of IFN-γ and IL-6 signaling, pSTAT1 and pSTAT3, respectively, were detected in multiple cell types within stomach. H/K-IFN-γ mice developed dysplasia as early as 3 months of age, and 4 of 39 mice over 1 year of age developed antral polyps or tumors, including one adenoma and one adenocarcinoma, which expressed high levels of nuclear β-catenin. Our data identified IFN-γ as a pivotal secreted factor that orchestrates complex changes in inflammatory, epithelial, and mesenchymal cell populations to drive pre-neoplastic progression in stomach; however, additional alterations appear to be required for malignant conversion. PMID:23036899

  5. Assessment of Type I Interferon Signaling in Pediatric Inflammatory Disease.

    PubMed

    Rice, Gillian I; Melki, Isabelle; Frémond, Marie-Louise; Briggs, Tracy A; Rodero, Mathieu P; Kitabayashi, Naoki; Oojageer, Anthony; Bader-Meunier, Brigitte; Belot, Alexandre; Bodemer, Christine; Quartier, Pierre; Crow, Yanick J

    2017-02-01

    Increased type I interferon is considered relevant to the pathology of a number of monogenic and complex disorders spanning pediatric rheumatology, neurology, and dermatology. However, no test exists in routine clinical practice to identify enhanced interferon signaling, thus limiting the ability to diagnose and monitor treatment of these diseases. Here, we set out to investigate the use of an assay measuring the expression of a panel of interferon-stimulated genes (ISGs) in children affected by a range of inflammatory diseases. A cohort study was conducted between 2011 and 2016 at the University of Manchester, UK, and the Institut Imagine, Paris, France. RNA PAXgene blood samples and clinical data were collected from controls and symptomatic patients with a genetically confirmed or clinically well-defined inflammatory phenotype. The expression of six ISGs was measured by quantitative polymerase chain reaction, and the median fold change was used to calculate an interferon score (IS) for each subject compared to a previously derived panel of 29 controls (where +2 SD of the control data, an IS of >2.466, is considered as abnormal). Results were correlated with genetic and clinical data. Nine hundred ninety-two samples were analyzed from 630 individuals comprising symptomatic patients across 24 inflammatory genotypes/phenotypes, unaffected heterozygous carriers, and controls. A consistent upregulation of ISG expression was seen in 13 monogenic conditions (455 samples, 265 patients; median IS 10.73, interquartile range (IQR) 5.90-18.41), juvenile systemic lupus erythematosus (78 samples, 55 patients; median IS 10.60, IQR 3.99-17.27), and juvenile dermatomyositis (101 samples, 59 patients; median IS 9.02, IQR 2.51-21.73) compared to controls (78 samples, 65 subjects; median IS 0.688, IQR 0.427-1.196), heterozygous mutation carriers (89 samples, 76 subjects; median IS 0.862, IQR 0.493-1.942), and individuals with non-molecularly defined autoinflammation (89 samples, 69

  6. Differential chemokine, chemokine receptor and cytokine expression in Epstein-Barr virus-associated lymphoproliferative diseases.

    PubMed

    Ohshima, Koichi; Karube, Kennosuke; Hamasaki, Makoto; Tutiya, Takeshi; Yamaguchi, Takahiro; Suefuji, Hiroaki; Suzuki, Keiko; Suzumiya, Junji; Ohga, Shouichi; Kikuchi, Masahiro

    2003-08-01

    T cell immunity plays an important role in the clinicopathology of Epstein-Barr virus (EBV)-associated diseases. Acute EBV-induced infectious mononucleosis (IM) is a common self-limiting disease, however, other EBV-associated diseases, including chronic active EBV infection (CAEBV), NK cell lymphoma (NKL), and Hodgkin's lymphoma (HL), exhibit distinct clinical features. Chemokines are members of a family of small-secreted proteins. The relationships between chemokines and the chemokine receptor (R) are thought to be important for selectivity of local immunity. Some chemokines, chemokine R and cytokines closely associate with the T cell subtypes, Th1 and Th2 T cells and cytotoxic cells. To clarify the role of T cell immunity in EBV-associated diseases, we conducted gene expression profiling, using chemokine, chemokine R and cytokine DNA chips. Compared to EBV negative non-specific lymphadenitis, CAEBV and NKL exhibited diffuse down- and up-regulation, respectively, of these gene profiles. IM had a predominantly Th1-type profile, whereas HL had a mixed Th1/Th2-type profile. Reduction of the Th1-type cytokine interferon gamma (IFN-gamma) in CAEBV was confirmed by Reverse transcriptase-polymerase chain reaction, whereas IFN-gamma expression was markedly enhanced in NKL, and moderately enhanced in IM. Compared to IM, CAEBV showed slight elevation of "regulated upon activation, normal T expressed and secreted" (RANTES), but almost all other genes assayed were down-regulated. NKL exhibited elevated expression of numerous genes, particularly IFN-gamma-inducible-10 (IP-10) and monokine induced by IFN-gamma (MIG). HL showed variable elevated and reduced expression of various genes, with increased expression of IL-13 receptor and MIG. Our study demonstrated the enormous potential of gene expression profiling for clarifying the pathogenesis of EBV-associated diseases.

  7. Evaluation of pre- and posttransplantation serum interferon-gamma and soluble CD30 for predicting liver allograft rejection.

    PubMed

    Kim, K H; Oh, E-J; Jung, E-S; Park, Y-J; Choi, J Y; Kim, D-G; Lee, K Y; Kang, C S

    2006-06-01

    The aim of the present study was to identify whether the serum interferon-gamma (IFNgamma), a Th1 cytokine, or soluble CD30 (sCD30), a marker for activation of Th2 cytokine-producing T cells, predict acute cellular rejection episodes among liver graft patients. Pretransplant and posttransplant sera from 32 living donor liver transplant recipients obtained on days 1, 3, and 7 after surgery were tested for serum IFNgamma and sCD30 concentrations using commercial enzyme-linked immunosorbent assay kits. Recipients with an acute rejection episode (ARE) (n=14) displayed significantly higher IFNgamma concentrations pretransplant than did the patients with no ARE (n=18) (P<.05). The pretransplant serum levels of sCD30 were not different between the non-ARE and ARE groups. However, in comparison with the non-ARE group, who showed steadily decreasing serum sCD30 levels after transplantation, 12 among the 14 patients in the ARE group showed increasing sCD30 levels from day 1 to day 3 after transplantation (P<.05). These results suggest that the sCD30 increment during the early period after liver transplantation affects the immune response of rejection. This observation emphasizes the clinical relevance of serum sCD30, in addition to serum IFNgamma, as predictive markers for acute liver graft rejection.

  8. Contradictory results in interferon research

    NASA Technical Reports Server (NTRS)

    Sonnenfeld, G.

    1984-01-01

    Several reports on immunologically related interferon research, both in the areas of basic science and clinical research, are briefly reviewed, and it is noted that in many cases the results obtained are contradictory. It is argued, however, that the contradictory results are not surprising since interferon is a biological response modifier and has been known to produce opposite results even when the same interferon prepartion is used. It is emphasized that dosage, timing, route, and other experimental conditions are essential factors in planning immunological studies with interferon. Careful planning of future experiments with interferon should be required to prevent the possible generation of effects that are opposite to those expected.

  9. Expression of mouse Tla region class I genes in tissues enriched for gamma delta cells.

    PubMed

    Eghtesady, P; Brorson, K A; Cheroutre, H; Tigelaar, R E; Hood, L; Kronenberg, M

    1992-01-01

    The Tla region of the BALB/c mouse major histocompatibility complex contains at least 20 class I genes. The function of the products of these genes is unknown, but recent evidence demonstrates that some Tla region gene products could be involved in presentation of antigens to gamma delta T cells. We have generated a set of polymerase chain reaction (PCR) oligonucleotide primers and hybridization probes that permit us to specifically amplify and detect expression of 11 of the 20 BALB/c Tla region genes. cDNA prepared from 12 adult and fetal tissues and from seven cell lines was analyzed. In some cases, northern blot analysis or staining with monoclonal antibodies specific for the Tla-encoded thymus leukemia (TL) antigen were used to confirm the expression pattern of several of the genes as determined by PCR. Some Tla region genes, such as T24d and the members of the T10d/T22d gene pair, are expressed in a wide variety of tissues in a manner similar to the class I transplantation antigens. The members of the TL antigen encoding gene pair, T3d/T18d, are expressed in only a limited number of organs, including several sites enriched for gamma delta T cells. Other Tla region genes, including T1d, T2d, T16d, and T17d, are transcriptionally silent and transcripts from the T8d/T20d gene pair do not undergo proper splicing. In general, sites that contain gamma delta T lymphocytes have Tla region transcripts. The newly identified pattern of expression of the genes analyzed in sites containing gamma delta T cells further extends the list of potential candidates for antigen presentation to gamma delta T cells.

  10. Regulation of Production of Mucosal Antibody to Pneumococcal Protein Antigens by T-Cell-Derived Gamma Interferon and Interleukin-10 in Children

    PubMed Central

    Zhang, Qibo; Bernatoniene, Jolanta; Bagrade, Linda; Paton, James C.; Mitchell, Timothy J.; Hammerschmidt, Sven; Nunez, Desmond A.; Finn, Adam

    2006-01-01

    Nasopharyngeal tonsils (adenoids) are part of human nasopharynx-associated lymphoid tissue, which may play an important role in local defense against pneumococci. Recent studies with animals have suggested that several pneumococcal proteins, including CbpA and pneumolysin (Ply), may be vaccine candidates. Our recent data obtained with children suggest that antibodies to these proteins may protect against carriage. This study was performed to investigate the regulation of the T-cell-dependent antibody responses to CbpA and pneumolysin by cytokines in adenoidal immune cells from children. Adenoidal mononuclear cells (MNC) were cultured with pneumococcal concentrated culture supernatants (CCS) or recombinant proteins. Cytokine expression profiles in adenoidal MNC after antigen stimulation were analyzed by reverse transcription-PCR, protein array analysis, and an immunoassay, along with an antibody production analysis. The roles, interactions, and cellular sources of the main cytokines identified were evaluated further. Pneumococcal CCS induced production of CbpA- and Ply-specific antibodies in association with several chemokines and cytokines, including gamma interferon (IFN-γ) and interleukin-10 (IL-10) in MNC. The antibody production correlated well with the concentrations of these two cytokines. Addition of recombinant IFN-γ or IL-10 enhanced antibody production, and monoclonal antibodies to these two cytokines and T-cell depletion significantly reduced antibody production. Intracellular cytokine staining showed that T cells are a major source of IFN-γ and IL-10. Recombinant Ply and, to a lesser extent, recombinant CbpA induced significant production of IFN-γ and IL-10 in MNC. T-cell-derived IFN-γ and IL-10 may be key regulators of production of mucosal antibody to pneumococcal protein antigens in the nasopharynx and may play an important role in local protection against pneumococcal infection in children. PMID:16861661

  11. Co-expression of antioxidant enzymes with expression of p53, DNA repair, and heat shock protein genes in the gamma ray-irradiated hermaphroditic fish Kryptolebias marmoratus larvae.

    PubMed

    Rhee, Jae-Sung; Kim, Bo-Mi; Kim, Ryeo-Ok; Seo, Jung Soo; Kim, Il-Chan; Lee, Young-Mi; Lee, Jae-Seong

    2013-09-15

    To investigate effects of gamma ray irradiation in the hermaphroditic fish, Kryptolebias marmoratus larvae, we checked expression of p53, DNA repair, and heat shock protein genes with several antioxidant enzyme activities by quantitative real-time RT-PCR and biochemical methods in response to different doses of gamma radiation. As a result, the level of gamma radiation-induced DNA damage was initiated after 4Gy of radiation, and biochemical and molecular damage became substantial from 8Gy. In particular, several DNA repair mechanism-related genes were significantly modulated in the 6Gy gamma radiation-exposed fish larvae, suggesting that upregulation of such DNA repair genes was closely associated with cell survival after gamma irradiation. The mRNA expression of p53 and most hsps was also significantly upregulated at high doses of gamma radiation related to cellular damage. This finding indicates that gamma radiation can induce oxidative stress with associated antioxidant enzyme activities, and linked to modulation of the expression of DNA repair-related genes as one of the defense mechanisms against radiation damage. This study provides a better understanding of the molecular mode of action of defense mechanisms upon gamma radiation in fish larvae. Copyright © 2013 Elsevier B.V. All rights reserved.

  12. Interferon-λ restricts West Nile virus neuroinvasion by tightening the blood-brain barrier.

    PubMed

    Lazear, Helen M; Daniels, Brian P; Pinto, Amelia K; Huang, Albert C; Vick, Sarah C; Doyle, Sean E; Gale, Michael; Klein, Robyn S; Diamond, Michael S

    2015-04-22

    Although interferon-λ [also known as type III interferon or interleukin-28 (IL-28)/IL-29] restricts infection by several viruses, its inhibitory mechanism has remained uncertain. We used recombinant interferon-λ and mice lacking the interferon-λ receptor (IFNLR1) to evaluate the effect of interferon-λ on infection with West Nile virus, an encephalitic flavivirus. Cell culture studies in mouse keratinocytes and dendritic cells showed no direct antiviral effect of exogenous interferon-λ, even though expression of interferon-stimulated genes was induced. We observed no differences in West Nile virus burden between wild-type and Ifnlr1(-/-) mice in the draining lymph nodes, spleen, or blood. We detected increased West Nile virus infection in the brain and spinal cord of Ifnlr1(-/-) mice, yet this was not associated with a direct antiviral effect in mouse neurons. Instead, we observed an increase in blood-brain barrier permeability in Ifnlr1(-/-) mice. Treatment of mice with pegylated interferon-λ2 resulted in decreased blood-brain barrier permeability, reduced West Nile virus infection in the brain without affecting viremia, and improved survival against lethal virus challenge. An in vitro model of the blood-brain barrier showed that interferon-λ signaling in mouse brain microvascular endothelial cells increased transendothelial electrical resistance, decreased virus movement across the barrier, and modulated tight junction protein localization in a protein synthesis- and signal transducer and activator of transcription 1 (STAT1)-independent manner. Our data establish an indirect antiviral function of interferon-λ in which noncanonical signaling through IFNLR1 tightens the blood-brain barrier and restricts viral neuroinvasion and pathogenesis. Copyright © 2015, American Association for the Advancement of Science.

  13. Interferon Alfa-2b Injection

    MedlinePlus

    Interferon alfa-2b injection is used to treat a number of conditions.Interferon alfa-2b injection is used alone or in combination ... lymphoma (NHL; a slow-growing blood cancer). Interferon alfa-2b is in a class of medications called ...

  14. Myeloid interferon-γ receptor deficiency does not affect atherosclerosis in LDLR(-/-) mice.

    PubMed

    Boshuizen, Marieke C S; Neele, Annette E; Gijbels, Marion J J; van der Velden, Saskia; Hoeksema, Marten A; Forman, Ruth A; Muller, Werner; Van den Bossche, Jan; de Winther, Menno P J

    2016-03-01

    Atherosclerosis is a chronic lipid-driven inflammatory disease of the arterial wall. Interferon gamma (IFNγ) is an important immunomodulatory cytokine and a known pro-atherosclerotic mediator. However, cell-specific targeting of IFNγ or its signaling in atherosclerosis development has not been studied yet. As macrophages are important IFNγ targets, we here addressed the involvement of myeloid IFNγ signaling in murine atherosclerosis. Bone marrow was isolated from interferon gamma receptor 2 chain (IFNγR2) wildtype and myeloid IFNγR2 deficient mice and injected into lethally irradiated LDLR(-/-) mice. After recovery mice were put on a high fat diet for 10 weeks after which atherosclerotic lesion analysis was performed. In addition, the accompanying liver inflammation was assessed. Even though absence of myeloid IFNγ signaling attenuated the myeloid IFNγ response, no significant differences in atherosclerotic lesion size or phenotype were found. Also, when examining the liver inflammatory state no effects of IFNγR2 deficiency could be observed. Overall, our data argue against a role for myeloid IFNγR2 in atherosclerosis development. Since myeloid IFNγ signaling seems to be nonessential throughout atherogenesis, it is important to understand the mechanisms by which IFNγ acts in atherogenesis. In the future new studies should be performed considering other cell-specific targets. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  15. Frequency of indeterminate results from an interferon-gamma release assay among HIV-infected individuals

    PubMed Central

    de Oliveira, Sandra Maria do Valle Leone; Trajman, Anete; Paniago, Anamaria Mello Miranda; Motta-Castro, Ana Rita Coimbra; Ruffino-Netto, Antonio; Maciel, Ethel Leonor Noia; Croda, Julio; Bonecini-Almeida, Maria da Gloria

    2017-01-01

    ABSTRACT Objective: To evaluate the frequency of and factors associated with indeterminate interferon-gamma release assay (IGRA) results in people living with HIV/AIDS (PLWHA). Methods: We tested 81 PLWHA in the central-west region of Brazil, using the tuberculin skin test and an IGRA. Information on sociodemographic and clinical variables was gathered through the use of questionnaires and from medical records. The association of those variables with indeterminate results was analyzed by calculating the adjusted ORs in a multivariate logistic regression model. Concordance was evaluated by determining the kappa statistic. Results: Among the 81 patients evaluated, the tuberculin skin test results were positive in 18 (22.2%) of the patients, and the IGRA results were positive in 10 (12.3%), with a kappa of 0.62. The IGRA results were indeterminate in 22 (27.1%) of the patients (95% CI: 17.8-38.1%). The odds of obtaining indeterminate results were significantly higher in smokers (adjusted OR = 6.0; 95% CI: 1.4-26.7) and in samples stored for less than 35 days (adjusted OR = 14.0; 95% CI: 3.1-64.2). Patients with advanced immunosuppression (CD4+ T-cell count < 200 cells/mm3) were at a higher risk for indeterminate results (OR adjusted for smoking and inadequate duration of sample storage = 4.7; 95% CI: 0.91-24.0), although the difference was not significant. Conclusions: The high prevalence of indeterminate results can be a major limitation for the routine use of IGRAs in PLWHA. The need to repeat the test increases its costs and should be taken into account in cost-effectiveness studies. The processing of samples can significantly alter the results. PMID:28746533

  16. Molecular characterization and development of Sarcocystis speeri sarcocysts in gamma interferon gene knockout mice.

    PubMed

    Dubey, J P; Verma, S K; Dunams, D; Calero-Bernal, R; Rosenthal, B M

    2015-11-01

    The North American opossum (Didelphis virginiana) is the definitive host for at least three named species of Sarcocystis: Sarcocystis falcatula, Sarcocystis neurona and Sarcocystis speeri. The South American opossums (Didelphis albiventris, Didelphis marsupialis and Didelphis aurita) are definitive hosts for S. falcatula and S. lindsayi. The sporocysts of these Sarcocystis species are similar morphologically. They are also not easily distinguished genetically because of the difficulties of DNA extraction from sporocysts and availability of distinguishing genetic markers. Some of these species can be distinguished by bioassay; S. neurona and S. speeri are infective to gamma interferon gene knockout (KO) mice, but not to budgerigars (Melopsittacus undulatus); whereas S. falcatula and S. lindsayi are infective to budgerigars but not to KO mice. The natural intermediate host of S. speeri is unknown. In the present study, development of sarcocysts of S. speeri in the KO mice is described. Sarcocysts were first seen at 12 days post-inoculation (p.i.), and they became macroscopic (up to 4 mm long) by 25 days p.i. The structure of the sarcocyst wall did not change from the time bradyzoites had formed at 50-220 days p.i. Sarcocysts contained unique villar protrusions, 'type 38'. The polymerase chain reaction amplifications and sequences analysis of three nuclear loci (18S rRNA, 28S rRNA and ITS1) and two mitochondrial loci (cox1 and cytb) of S. speeri isolate from an Argentinean opossum (D. albiventris) confirmed its membership among species of Sarcocystis and indicated an especially close relationship to another parasite in this genus that employs opossums as its definitive host, S. neurona. These results should be useful in finding natural intermediate host of S. speeri.

  17. Overlapping gene expression profiles indicative of antigen processing and the interferon pathway characterize inflammatory fibrotic skin diseases.

    PubMed

    Limpers, Annelies; van Royen-Kerkhof, Annet; van Roon, Joel A G; Radstake, Timothy R D J; Broen, Jasper C A

    2014-02-01

    Inflammatory fibrotic disorders have been of high interest both for dermatologists and rheumatologists. Although the phenotypic end stage of this group of diseases is ultimately the same, namely fibrosis, patients present with different clinical features and are often treated with distinct therapeutic modalities. This review addresses whether there is evidence for different underlying molecular pathways in the various inflammatory fibrotic diseases such as localized scleroderma, pediatric lichen sclerosus, adult lichen sclerosus, eosinophilic fasciitis and systemic sclerosis. To investigate this, a large number of gene expression microarray studies performed on skin or fibroblasts from patients with these aforementioned diseases were described, (re-)analysed, and compared. As suspected by the heterogeneous phenotype, most diseases showed unique gene expression features. Intriguingly, a clear overlap was observed between adult and pediatric lichen sclerosus and localized scleroderma, in antigen processing and the interferon pathway. Delineating the cause and consequence of these pathways may generate novel tools to better characterize and more effectively treat these patients.

  18. Interferon regulatory factors: A key to tumour immunity.

    PubMed

    Chen, Yan-Jie; Li, Jing; Lu, Nan; Shen, Xi-Zhong

    2017-08-01

    Interferon regulatory factors (IRFs), which have 10 members, belong to the transcription factor family and were named because of the regulation of interferon expression. They play important roles in the immune regulation, cell differentiation, cell apoptosis, and cell cycle regulation. This article will review the functional characteristics and immune activity of the family members, especially in the role of cell differentiation and autoimmune diseases. Intensive studies will help uncover the pathogenesis of the disease in a more comprehensive view, and provide novel targets for disease treatment. But the most important problems yet to solve is IRFs function in the development processes of tumour, and whether IRFs can be an important regulator in tumour immune treatment. Copyright © 2017. Published by Elsevier B.V.

  19. Interferon-alpha receptor 1 mRNA expression in peripheral blood mononuclear cells is associated with response to interferon-alpha therapy of patients with chronic hepatitis C.

    PubMed

    Massirer, K B; Hirata, M H; Silva, A E B; Ferraz, M L G; Nguyen, N Y; Hirata, R D C

    2004-05-01

    Interferon (IFN)-alpha receptor mRNA expression in liver of patients with chronic hepatitis C has been shown to be a response to IFN-alpha therapy. The objective of the present study was to determine whether the expression of mRNA for subunit 1 of the IFN-alpha receptor (IFNAR1) in peripheral blood mononuclear cells (PBMC) is associated with the response to IFN-alpha in patients with chronic hepatitis C. Thirty patients with positive anti-HCV and HCV-RNA, and abnormal levels of alanine aminotransferase in serum were selected and treated with IFN-alpha 2b for one year. Those with HBV or HIV infection, or using alcohol were not included. Thirteen discontinued the treatment and were not evaluated. The IFN-alpha response was monitored on the basis of alanine aminotransferase level and positivity for HCV-RNA in serum. IFNAR1-mRNA expression in PBMC was measured by reverse transcription-polymerase chain reaction before and during the first three months of therapy. The results are reported as IFNAR1-mRNA/beta-actin-mRNA ratio (mean +/- SD). Before treatment, responder patients had significantly higher IFNAR1-mRNA expression in PBMC (0.67 +/- 0.15; N = 5; P < 0.05) compared to non-responders (0.35 +/- 0.17; N = 12) and controls (0.30 +/- 0.16; N = 9). Moreover, IFNAR1-mRNA levels were significantly reduced after 3 months of treatment in responders, whereas there were no differences in IFNAR1 expression in non-responders during IFN-alpha therapy. Basal IFNAR1-mRNA expression was not correlated with the serum level of alanine and aspartate aminotransferases or the presence of cirrhosis. The present results suggest that IFNAR1-mRNA expression in PBMC is associated with IFN-alpha response to hepatitis C and may be useful for monitoring therapy in patients with chronic hepatitis C.

  20. The Human Respiratory Syncytial Virus Nonstructural Protein 1 Regulates Type I and Type II Interferon Pathways*

    PubMed Central

    Hastie, Marcus L.; Headlam, Madeleine J.; Patel, Nirav B.; Bukreyev, Alexander A.; Buchholz, Ursula J.; Dave, Keyur A.; Norris, Emma L.; Wright, Cassandra L.; Spann, Kirsten M.; Collins, Peter L.; Gorman, Jeffrey J.

    2012-01-01

    Respiratory syncytial viruses encode a nonstructural protein (NS1) that interferes with type I and III interferon and other antiviral responses. Proteomic studies were conducted on human A549 type II alveolar epithelial cells and type I interferon-deficient Vero cells (African green monkey kidney cells) infected with wild-type and NS1-deficient clones of human respiratory syncytial virus to identify other potential pathway and molecular targets of NS1 interference. These analyses included two-dimensional differential gel electrophoresis and quantitative Western blotting. Surprisingly, NS1 was found to suppress the induction of manganese superoxide dismutase (SOD2) expression in A549 cells and to a much lesser degree Vero cells in response to infection. Because SOD2 is not directly inducible by type I interferons, it served as a marker to probe the impact of NS1 on signaling of other cytokines known to induce SOD2 expression and/or indirect effects of type I interferon signaling. Deductive analysis of results obtained from cell infection and cytokine stimulation studies indicated that interferon-γ signaling was a potential target of NS1, possibly as a result of modulation of STAT1 levels. However, this was not sufficient to explain the magnitude of the impact of NS1 on SOD2 induction in A549 cells. Vero cell infection experiments indicated that NS1 targeted a component of the type I interferon response that does not directly induce SOD2 expression but is required to induce another initiator of SOD2 expression. STAT2 was ruled out as a target of NS1 interference using quantitative Western blot analysis of infected A549 cells, but data were obtained to indicate that STAT1 was one of a number of potential targets of NS1. A label-free mass spectrometry-based quantitative approach is proposed as a means of more definitive identification of NS1 targets. PMID:22322095

  1. Molecular cloning, characterization and expression analysis of PPAR gamma in the orange-spotted grouper (Epinephelus coioides) after the Vibrio alginolyticus challenge.

    PubMed

    Luo, Shengwei; Huang, Youhua; Xie, Fuxing; Huang, Xiaohong; Liu, Yuan; Wang, Weina; Qin, Qiwei

    2015-04-01

    PPAR gamma was a key nuclear receptor, playing an important role in the immune defense and the anti-inflammatory mechanism. In this study, the full-length PPAR gamma (EcPPAR gamma) was obtained, containing a 5'UTR of 133 bp, an ORF of 1602 bp and a 3'UTR of 26 bp besides the poly (A) tail. The EcPPAR gamma gene encoded a protein of 533 amino acids with an estimated molecular mass of 60.02 KDa and a predicted isoelectric point (pI) of 6.26. The deduced amino acid sequence showed that EcPPAR gamma consisted of the conserved residues and the domains known to be critical for the PPAR gamma function. The quantitative real-time PCR analysis revealed that EcPPAR gamma transcript was expressed in all the examined tissue, while the strong expression was observed in intestine, followed by the expression in liver, gill, spleen heart, kidney and muscle. Vibrio challenge could stimulate the inflammatory response in grouper and induce a sharp increase of pro-inflammatory cytokines expression, lipid peroxidation and DNA damage, while the up-regulation of vibrio-induced inflammation could also increase the non-specific immune defense. The groupers challenged with Vibrio alginolyticus showed a sharp increase of EcPPAR gamma transcript in immune tissues. Subcellular localization analysis revealed that EcPPAR gamma was distributed in the nucleus. Furthermore, overexpression of EcPPAR gamma could down-regulated the expression of IL1b, IL6, TNF1 and TNF2. In addition, the administration of PPAR gamma antagonist, GW9662, could up-regulate the expression of pro-inflammatory genes, including IL1b, IL6, TNF1 and TNF2. Together, these results indicated that EcPPAR gamma serving as a negative regulator of pro-inflammatory cytokines may play an important role in the immune defense against vibrio-induced inflammation in grouper. Copyright © 2015 Elsevier Ltd. All rights reserved.

  2. Interferon-γ biphasically regulates angiotensinogen expression via a JAK-STAT pathway and suppressor of cytokine signaling 1 (SOCS1) in renal proximal tubular cells

    PubMed Central

    Satou, Ryousuke; Miyata, Kayoko; Gonzalez-Villalobos, Romer A.; Ingelfinger, Julie R.; Navar, L. Gabriel; Kobori, Hiroyuki

    2012-01-01

    Renal inflammation modulates angiotensinogen (AGT) production in renal proximal tubular cells (RPTCs) via inflammatory cytokines, including interleukin-6, tumor necrosis factor α, and interferon-γ (IFN-γ). Among these, the effects of IFN-γ on AGT regulation in RPTCs are incompletely delineated. This study aimed to elucidate mechanisms by which IFN-γ regulates AGT expression in RPTCs. RPTCs were incubated with or without IFN-γ up to 48 h. AGT expression, STAT1 and STAT3 activities, and SOCS1 expression were evaluated. RNA interference studies against STAT1, SOCS1, and STAT3 were performed to elucidate a signaling cascade. IFN-γ decreased AGT expression at 6 h (0.61±0.05, ratio to control) and 12 h (0.47±0.03). In contrast, longer exposure for 24 and 48 h increased AGT expression (1.76±0.18, EC50=3.4 ng/ml, and 1.45±0.08, respectively). IFN-γ treatment for 6 h strongly induced STAT1 phosphorylation and SOCS1 augmentation, and decreased STAT3 activity. However, STAT1 phosphorylation and SOCS1 augmentation waned at 24 h, while STAT3 activity increased. RNA interference studies revealed that activation of STAT1-SOCS1 axis decreased STAT3 activity. Thus, IFN-γ biphasically regulates AGT expression in RPTCs via STAT3 activity modulated by STAT1-SOCS1 axis, suggesting the STAT1-SOCS1 axis is important in IFN-γ-induced activation of the intrarenal renin-angiotensin system.—Satou, R., Miyata, K., Gonzalez-Villalobos, R. A., Ingelfinger, J. R., Navar, L. G., Kobori, H. Interferon-γ biphasically regulates angiotensinogen expression via a JAK-STAT pathway and suppressor of cytokine signaling 1 (SOCS1) in renal proximal tubular cells. PMID:22302831

  3. PPAR gamma is highly expressed in F4/80(hi) adipose tissue macrophages and dampens adipose-tissue inflammation.

    PubMed

    Bassaganya-Riera, Josep; Misyak, Sarah; Guri, Amir J; Hontecillas, Raquel

    2009-01-01

    Macrophage infiltration into adipose tissue is a hallmark of obesity. We recently reported two phenotypically distinct subsets of adipose tissue macrophages (ATM) based on the surface expression of the glycoprotein F4/80 and responsiveness to treatment with a peroxisome proliferator-activated receptor (PPAR) gamma agonist. Hence, we hypothesized that F4/80(hi) and F4/80(lo) ATM differentially express PPAR gamma. This study phenotypically and functionally characterizes F4/80(hi) and F4/80(lo) ATM subsets during obesity. Changes in gene expression were also examined on sorted F4/80(lo) and F4/80(hi) ATM by quantitative real-time RT-PCR. We show that while F4/80(lo) macrophages predominate in adipose tissue of lean mice, obesity causes accumulation of both F4/80(lo) and F4/80(hi) ATM. Moreover, accumulation of F4/80(hi) ATM in adipose tissue is associated with impaired glucose tolerance. Phenotypically, F4/80(hi) ATM express greater amounts of CD11c, MHC II, CD49b, and CX3CR1 and produce more TNF-alpha, MCP-1, and IL-10 than F4/80(lo) ATM. Gene expression analyses of the sorted populations revealed that only the F4/80(lo) population produced IL-4, whereas the F4/80(hi) ATM expressed greater amounts of PPAR gamma, delta, CD36 and toll-like receptor-4. In addition, the deficiency of PPAR gamma in immune cells favors expression of M1 and impairs M2 macrophage marker expression in adipose tissue. Thus, PPAR gamma is differentially expressed in F4/80(hi) versus F4/80(low) ATM subsets and its deficiency favors a predominance of M1 markers in WAT.

  4. Mycophenolic acid induces ATP-binding cassette transporter A1 (ABCA1) expression through the PPAR{gamma}-LXR{alpha}-ABCA1 pathway

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xu, Yanni; Lai, Fangfang; Xu, Yang

    2011-11-04

    Highlights: Black-Right-Pointing-Pointer Using an ABCA1p-LUC HepG2 cell line, we found that MPA upregulated ABCA1 expression. Black-Right-Pointing-Pointer MPA induced ABCA1 and LXR{alpha} protein expression in HepG2 cells. Black-Right-Pointing-Pointer PPAR{gamma} antagonist GW9662 markedly inhibited MPA-induced ABCA1 and LXR{alpha} protein expression. Black-Right-Pointing-Pointer The effect of MPA upregulating ABCA1 was due mainly to activation of the PPAR{gamma}-LXR{alpha}-ABCA1 pathway. -- Abstract: ATP-binding cassette transporter A1 (ABCA1) promotes cholesterol and phospholipid efflux from cells to lipid-poor apolipoprotein A-I and plays an important role in atherosclerosis. In a previous study, we developed a high-throughput screening method using an ABCA1p-LUC HepG2 cell line to find upregulators of ABCA1.more » Using this method in the present study, we found that mycophenolic acid (MPA) upregulated ABCA1 expression (EC50 = 0.09 {mu}M). MPA upregulation of ABCA1 expression was confirmed by real-time quantitative reverse transcription-PCR and Western blot analysis in HepG2 cells. Previous work has indicated that MPA is a potent agonist of peroxisome proliferator-activated receptor gamma (PPAR{gamma}; EC50 = 5.2-9.3 {mu}M). Liver X receptor {alpha} (LXR{alpha}) is a target gene of PPAR{gamma} and may directly regulate ABCA1 expression. Western blot analysis showed that MPA induced LXR{alpha} protein expression in HepG2 cells. Addition of PPAR{gamma} antagonist GW9662 markedly inhibited MPA-induced ABCA1 and LXR{alpha} protein expression. These data suggest that MPA increased ABCA1 expression mainly through activation of PPAR{gamma}. Thus, the effects of MPA on upregulation of ABCA1 expression were due mainly to activation of the PPAR{gamma}-LXR{alpha}-ABCA1 signaling pathway. This is the first report that the antiatherosclerosis activity of MPA is due to this mechanism.« less

  5. Cerebrospinal fluid interferon-gamma-inducible protein 10 (IP-10, CXCL10) in HIV-1 infection.

    PubMed

    Cinque, Paola; Bestetti, Arabella; Marenzi, Roberta; Sala, Serena; Gisslen, Magnus; Hagberg, Lars; Price, Richard W

    2005-11-01

    Interferon-gamma-inducible protein (IP-10 or CXCL10) is a potent chemoattractant and has been suggested to enhance retrovirus infection and mediate neuronal injury. In order to assess this chemokine in central nervous system (CNS) HIV infection, we measured the cerebrospinal fluid (CSF) and plasma concentrations of CXCL10 by immunoassay in samples derived from 97 HIV-infected subjects across a spectrum of immunological progression and CNS complications and from 16 HIV seronegative control subjects studied at three clinical centers between 1994 and 2001. We also examined changes in the CSF and plasma CXCL10 concentrations in 30 subjects starting and three stopping antiretroviral therapy. CSF CXCL10 concentrations: (1) correlated with CSF HIV RNA and white blood cell (WBC) counts, but not with blood CXCL10, HIV RNA, or CD4 counts; (2) were increased in subjects with primary and asymptomatic HIV infections and AIDS dementia complex, but less frequently in those with more advanced infection, with or without CNS opportunistic diseases except cytomegalovirus encephalitis; (3) decreased in subjects starting antiretroviral in association with decreases in CSF and plasma HIV RNA and CSF WBCs; and (4) conversely, increased in subjects stopping treatment in parallel with CSF HIV RNA and WBCs. These results confirm that CSF CXCL10 associates closely with both CSF HIV and WBCs and suggest that this chemokine may be both a response to and contributing determinant of local infection. High CSF levels may be useful in the diagnosis of ADC in subjects with advanced immunosuppression in whom CMV encephalitis has been ruled out, though this issue requires further study.

  6. Effects of interferon on antibody formation

    NASA Technical Reports Server (NTRS)

    Sonnenfeld, G.

    1984-01-01

    Studies of the effects of interferon on primary and secondary antibody responses and of the relationship of interferon to other cytokines, or cell products, are presented. Dosage- and timing-dependent immunoenhancing and immunosuppressive activities of interferon are documented for mouse spleen cell cultures and for mice infected with murine hepatitis virus (MHV-3). A possibility that altered interferon production might lead to immunopathological disorders, such as lupus erythematosus, AIDS, arthritis, etc., is discussed. Latest technological developments are presented that indicate that interferon does apparently play a major role in the regulation of antibody responses.

  7. Inhibition of interferon induction and action by the nairovirus Nairobi sheep disease virus/Ganjam virus.

    PubMed

    Holzer, Barbara; Bakshi, Siddharth; Bridgen, Anne; Baron, Michael D

    2011-01-01

    The Nairoviruses are an important group of tick-borne viruses that includes pathogens of man (Crimean Congo hemorrhagic fever virus) and livestock animals (Dugbe virus, Nairobi sheep disease virus (NSDV)). NSDV is found in large parts of East Africa and the Indian subcontinent (where it is known as Ganjam virus). We have investigated the ability of NSDV to antagonise the induction and actions of interferon. Both pathogenic and apathogenic isolates could actively inhibit the induction of type 1 interferon, and also blocked the signalling pathways of both type 1 and type 2 interferons. Using transient expression of viral proteins or sections of viral proteins, these activities all mapped to the ovarian tumour-like protease domain (OTU) found in the viral RNA polymerase. Virus infection, or expression of this OTU domain in transfected cells, led to a great reduction in the incorporation of ubiquitin or ISG15 protein into host cell proteins. Point mutations in the OTU that inhibited the protease activity also prevented it from antagonising interferon induction and action. Interestingly, a mutation at a peripheral site, which had little apparent effect on the ability of the OTU to inhibit ubiquitination and ISG15ylation, removed the ability of the OTU to block the induction of type 1 and the action of type 2 interferons, but had a lesser effect on the ability to block type 1 interferon action, suggesting that targets other than ubiquitin and ISG15 may be involved in the actions of the viral OTU.

  8. Inhibition of Interferon Induction and Action by the Nairovirus Nairobi Sheep Disease Virus/Ganjam Virus

    PubMed Central

    Holzer, Barbara; Bakshi, Siddharth; Bridgen, Anne; Baron, Michael D.

    2011-01-01

    The Nairoviruses are an important group of tick-borne viruses that includes pathogens of man (Crimean Congo hemorrhagic fever virus) and livestock animals (Dugbe virus, Nairobi sheep disease virus (NSDV)). NSDV is found in large parts of East Africa and the Indian subcontinent (where it is known as Ganjam virus). We have investigated the ability of NSDV to antagonise the induction and actions of interferon. Both pathogenic and apathogenic isolates could actively inhibit the induction of type 1 interferon, and also blocked the signalling pathways of both type 1 and type 2 interferons. Using transient expression of viral proteins or sections of viral proteins, these activities all mapped to the ovarian tumour-like protease domain (OTU) found in the viral RNA polymerase. Virus infection, or expression of this OTU domain in transfected cells, led to a great reduction in the incorporation of ubiquitin or ISG15 protein into host cell proteins. Point mutations in the OTU that inhibited the protease activity also prevented it from antagonising interferon induction and action. Interestingly, a mutation at a peripheral site, which had little apparent effect on the ability of the OTU to inhibit ubiquitination and ISG15ylation, removed the ability of the OTU to block the induction of type 1 and the action of type 2 interferons, but had a lesser effect on the ability to block type 1 interferon action, suggesting that targets other than ubiquitin and ISG15 may be involved in the actions of the viral OTU. PMID:22163042

  9. Disruption of transforming growth factor-beta signaling by curcumin induces gene expression of peroxisome proliferator-activated receptor-gamma in rat hepatic stellate cells.

    PubMed

    Zheng, Shizhong; Chen, Anping

    2007-01-01

    Activation of hepatic stellate cells (HSC), the major effectors of hepatic fibrogenesis, is coupled with sequential alterations in gene expression, including an increase in receptors for transforming growth factor-beta (TGF-beta) and a dramatic reduction in the peroxisome proliferator-activated receptor-gamma (PPAR-gamma). The relationship between them remains obscure. We previously demonstrated that curcumin induced gene expression of PPAR-gamma in activated HSC, leading to reducing cell proliferation, inducing apoptosis and suppressing expression of extracellular matrix genes. The underlying molecular mechanisms are largely unknown. We recently observed that stimulation of PPAR-gamma activation suppressed gene expression of TGF-beta receptors in activated HSC, leading to the interruption of TGF-beta signaling. This observation supported our assumption of an antagonistic relationship between PPAR-gamma activation and TGF-beta signaling in HSC. In this study, we further hypothesize that TGF-beta signaling might negatively regulate gene expression of PPAR-gamma in activated HSC. The present report demonstrates that exogenous TGF-beta1 inhibits gene expression of PPAR-gamma in activated HSC, which is eliminated by the pretreatment with curcumin likely by interrupting TGF-beta signaling. Transfection assays further indicate that blocking TGF-beta signaling by dominant negative type II TGF-beta receptor increases the promoter activity of PPAR-gamma gene. Promoter deletion assays, site-directed mutageneses, and gel shift assays localize two Smad binding elements (SBEs) in the PPAR-gamma gene promoter, acting as curcumin response elements and negatively regulating the promoter activity in passaged HSC. The Smad3/4 protein complex specifically binds to the SBEs. Overexpression of Smad4 dose dependently eliminates the inhibitory effects of curcumin on the PPAR-gamma gene promoter and TGF-beta signaling. Taken together, these results demonstrate that the interruption of TGF

  10. HLA-DRB1 and HLA-DQB1 Are Associated with Adult-Onset Immunodeficiency with Acquired Anti-Interferon-Gamma Autoantibodies

    PubMed Central

    Pithukpakorn, Manop; Roothumnong, Ekkapong; Angkasekwinai, Nasikarn; Suktitipat, Bhoom; Assawamakin, Anunchai; Luangwedchakarn, Voravich; Umrod, Pinklow; Thongnoppakhun, Wanna; Foongladda, Suporn; Suputtamongkol, Yupin

    2015-01-01

    Recently a newly identified clinical syndrome of disseminated non-tuberculous mycobacterial diseases (with or without other opportunistic infections in adult patients who were previously healthy, has been recognized in association with an acquired autoantibody to interferon-gamma. This syndrome is emerging as an important cause of morbidity and mortality, especially among people of Asian descent. Trigger for the production of this autoantibody remains unknown, but genetic factors are strongly suspected to be involved. We compared HLA genotyping between 32 patients with this clinical syndrome, and 38 controls. We found that this clinical syndrome was associated with very limited allele polymorphism, with HLA-DRB1 and DQB1 alleles, especially HLA-DRB1*15:01, DRB1*16:02, DQB1*05:01 and DQB1*05:02. Odds ratio of DRB1*15:01, DRB1*16:02, DQB1*05:01 and DQB1*05:02 were 7.03 (95% CI, 2.18–22.69, P<0.0001, 9.06 (95% CI, 2.79–29.46, P<0.0001), 6.68 (95% CI, 2.29–19.52, P = 0.0004), and 6.64 (95% CI, 2.30–19.20, P = 0.0004), respectively. Further investigation is warranted to provide better understanding on pathogenesis of this association. PMID:26011559

  11. Mink parvoviruses and interferons: in vitro studies.

    PubMed Central

    Wiedbrauk, D L; Bloom, M E; Lodmell, D L

    1986-01-01

    Although interferons can inhibit the replication of a number of viruses, little is known about their ability to inhibit parvovirus replication. Therefore, in vitro experiments were done to determine if Aleutian disease virus and mink enteritis virus, two autonomously replicating mink parvoviruses, induced interferon, were sensitive to the effects of interferon, or inhibited the production of interferon. The results indicated that these parvoviruses neither induced nor were sensitive to the effects of interferon. Furthermore, preexisting parvovirus infections did not inhibit poly(I).poly(C)-induced interferon production. This independence from the interferon system may, therefore, be a general property of the autonomously replicating parvoviruses. PMID:2431162

  12. Secretion of interferon gamma from human immune cells is altered by exposure to tributyltin and dibutyltin.

    PubMed

    Lawrence, Shanieek; Reid, Jacqueline; Whalen, Margaret

    2015-05-01

    Tributyltin (TBT) and dibutyltin (DBT) are widespread environmental contaminants found in food, beverages, and human blood samples. Both of these butyltins (BTs) interfere with the ability of human natural killer (NK) cells to lyse target cells and alter secretion of the pro-inflammatory cytokine tumor necrosis factor alpha (TNFα) from human immune cells in vitro. The capacity of BTs to interfere with secretion of other pro-inflammatory cytokines has not been examined. Interferon gamma (IFNγ) is a modulator of adaptive and innate immune responses, playing an important role in overall immune competence. This study shows that both TBT and DBT alter secretion of IFNγ from human immune cells. Peripheral blood cell preparations that were increasingly reconstituted were used to determine if exposures to either TBT or DBT affected IFNγ secretion and how the makeup of the cell preparation influenced that effect. IFNγ secretion was examined after 24 h, 48 h, and 6 day exposures to TBT (200 - 2.5 nM) and DBT (5 - 0.05 µM) in highly enriched human NK cells, a monocyte-depleted preparation of PBMCs, and monocyte-containing PBMCs. Both BTs altered IFNγ secretion from immune cells at most of the conditions tested (either increasing or decreasing secretion). However, there was significant variability among donors as to the concentrations and time points that showed changes as well as the baseline secretion of IFNγ. The majority of donors showed an increase in IFNγ secretion in response to at least one concentration of TBT or DBT at a minimum of one length of exposure. © 2013 Wiley Periodicals, Inc.

  13. The interferons.

    PubMed Central

    Toy, J L

    1983-01-01

    An overview of the interferons is presented. A description of something of what is known about them is given, including: their genes; their protein structures and characteristics; their mechanisms of actions; and their varied biological effects emphasising particularly their immunomodulatory actions. Finally, a brief summary is made of the current status of human clinical studies that have been conducted with interferons in the oncological and viral fields, mentioning also recent findings in patients who have the acquired immunodeficiency syndrome (AIDS). PMID:6193915

  14. Changes in serum hepatitis C virus RNA in interferon nonresponders retreated with interferon plus ribavirin: a preliminary report.

    PubMed

    Nyberg, L; Albrecht, J; Glue, P; Gianelli, G; Zambas, D; Elliot, M; Conrad, A; McHutchison, J

    1999-06-01

    Ribavirin, a nucleoside analogue, inhibits replication of RNA and DNA viruses and may control hepatitis C virus (HCV) infection through modulation of anti-inflammatory and antiviral actions. Ribavirin monotherapy has no effect on serum HCV RNA levels. In combination with interferon, this agent appears to enhance the efficacy of interferon. The aim of this study was to monitor serum HCV RNA levels early during therapy with interferon and ribavirin compared with that previously seen in the same patients during interferon monotherapy. Five patients who previously showed no response to therapy with interferon alfa 3 MU three times weekly for 6 months were retreated with the identical dose of interferon alfa 2b in combination with oral ribavirin 1,000 mg/day. Serum HCV RNA levels were monitored at baseline, week 4, week 8, and week 12 of therapy by a quantitative multicycle polymerase chain reaction assay. In the first 8 to 12 weeks, serum HCV RNA levels showed a greater decrease in all patients when retreated with combination therapy compared with interferon alone. Mean (+/- SEM) serum HCV RNA levels for interferon therapy alone were 3.3 +/- 0.95, 1.2 +/- 0.95, 1.6 +/- 1.2, and 2.3 +/- 1.2 x 10(6) copies/ml at week 0, 4, 8, and 12, respectively. This was compared with 3.3 +/- 0.83, 0.3 +/- 0.2, 0.03 +/- 0.02, and 0.15 +/- 0.14 x 10(6), respectively, for the interferon and ribavirin group (p < 0.07 at week 8). Two of five patients had undetectable serum HCV RNA during combination therapy. Combination therapy with interferon and ribavirin in prior interferon nonresponders reduces serum HCV RNA levels compared with interferon alone. This may suggest some additional antiviral effect of ribavirin when given with interferon.

  15. Human gingival fibroblasts express functional chemokine receptor CXCR6.

    PubMed

    Hosokawa, Y; Hosokawa, I; Ozaki, K; Nakae, H; Matsuo, T

    2009-06-01

    We have reported that CXCL16, a recently discovered transmembrane chemokine, is expressed in human gingival fibroblasts (HGF). However, it is not known whether HGF express CXCR6, the receptor for CXCL16, or CXCL16 affects HGF biology. We have shown that HGF expressed CXCR6 by reverse transcription-polymerase chain reaction and flow cytometric analysis. Moreover, we elucidated that tumour necrosis factor (TNF)-alpha and cytosine-guanine dinucleotide (CpG) DNA (Toll-like receptor-9 ligand) treatment enhanced CXCR6 expression by HGF. Interleukin (IL)-4, IL-13 and CpG DNA up-regulated CXCR6 expression by TNF-alpha-stimulated HGF. On the other hand, IL-1beta and interferon-gamma inhibited CXCR6 expression on TNF-alpha-treated HGF. CXCL16 treatment induced HGF proliferation and phosphorylation of extracellular regulated kinase (ERK) and protein kinase B (AKT) in HGF. In conclusion, HGF expressed CXCR6 functionally, because CXCL16 induced HGF proliferation and ERK and AKT phosphorylation in HGF. These results indicate that CXCL16 may play an important role in the pathogenesis and remodelling in periodontally diseased tissues.

  16. Interferon production and signaling pathways are antagonized during henipavirus infection of fruit bat cell lines.

    PubMed

    Virtue, Elena R; Marsh, Glenn A; Baker, Michelle L; Wang, Lin-Fa

    2011-01-01

    Bats are natural reservoirs for a spectrum of infectious zoonotic diseases including the recently emerged henipaviruses (Hendra and Nipah viruses). Henipaviruses have been observed both naturally and experimentally to cause serious and often fatal disease in many different mammal species, including humans. Interestingly, infection of the flying fox with henipaviruses occurs in the absence of clinical disease. The extreme variation in the disease pattern between humans and bats has led to an investigation into the effects of henipavirus infection on the innate immune response in bat cell lines. We report that henipavirus infection does not result in the induction of interferon expression, and the viruses also inhibit interferon signaling. We also confirm that the interferon production and signaling block in bat cells is not due to differing viral protein expression levels between human and bat hosts. This information, in addition to the known lack of clinical signs in bats following henipavirus infection, suggests that bats control henipavirus infection by an as yet unidentified mechanism, not via the interferon response. This is the first report of henipavirus infection in bat cells specifically investigating aspects of the innate immune system.

  17. Transforming growth factor-{beta} inhibits CCAAT/enhancer-binding protein expression and PPAR{gamma} activity in unloaded bone marrow stromal cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ahdjoudj, S.; Kaabeche, K.; Holy, X.

    2005-02-01

    The molecular mechanisms regulating the adipogenic differentiation of bone marrow stromal cells in vivo remain largely unknown. In this study, we investigated the regulatory effects of transforming growth factor beta-2 (TGF-{beta}2) on transcription factors involved in adipogenic differentiation induced by hind limb suspension in rat bone marrow stromal cells in vivo. Time course real-time quantitative reverse-transcription polymerase chain reaction (RT-PCR) analysis of gene expression showed that skeletal unloading progressively increases the expression of CCAAT/enhancer-binding protein (C/EBP){alpha} and C/EBP{beta} {alpha} at 5 days in bone marrow stromal cells resulting in increased peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}2) transcripts at 7 days. TGF-{beta}2more » administration in unloaded rats corrected the rise in C/EBP{alpha} and C/EBP{beta} transcripts induced by unloading in bone marrow stromal cells. This resulted in inhibition of PPAR{gamma}2 expression that was associated with increased Runx2 expression. Additionally, the inhibition of C/EBP{alpha} and C/EBP{beta} expression by TGF-{beta}2 was associated with increased PPAR{gamma} serine phosphorylation in bone marrow stromal cells, a mechanism that inhibits PPAR{gamma} transactivating activity. The sequential inhibitory effect of TGF-{beta}2 on C/EBP{alpha}, C/EBP{beta}, and PPAR{gamma}2 resulted in reduced LPL expression and abolition of bone marrow stromal cell adipogenic differentiation, which contributed to prevent bone loss induced by skeletal unloading. We conclude that TGF-{beta}2 inhibits the excessive adipogenic differentiation of bone marrow stromal cells induced by skeletal unloading by inhibiting C/EBP{alpha}, C/EBP{beta}, and PPAR{gamma} expression and activity, which provides a sequential mechanism by which TGF-{beta}2 regulates adipogenic differentiation of bone marrow stromal cells in vivo.« less

  18. Private sector tuberculosis prevention in the US: Characteristics associated with interferon-gamma release assay or tuberculin skin testing.

    PubMed

    Stockbridge, Erica L; Miller, Thaddeus L; Carlson, Erin K; Ho, Christine

    2018-01-01

    To determine whether latent tuberculosis infection risk factors are associated with an increased likelihood of latent tuberculosis infection testing in the US private healthcare sector. A national sample of medical and pharmacy claims representing services rendered January 2011 through December 2013 for 3,997,986 commercially insured individuals in the US who were 0 to 64 years of age. We used multivariable logistic regression models to determine whether TB/LTBI risk factors were associated with an increased likelihood of Interferon-Gamma Release Assay (IGRA) or Tuberculin Skin Test (TST) testing in the private sector. 4.31% (4.27-4.34%) received at least one TST/IGRA test between 2011 and 2013 while 1.69% (1.67-1.72%) received a TST/IGRA test in 2013. Clinical risk factors associated with a significantly increased likelihood of testing included HIV, immunosuppressive therapy, exposure to tuberculosis, a history of tuberculosis, diabetes, tobacco use, end stage renal disease, and alcohol use disorder. Other significant variables included gender, age, asthma, the state tuberculosis rate, population density, and percent of foreign-born persons in a county. Private sector TST/IGRA testing is not uncommon and testing varies with clinical risk indicators. Thus, the private sector can be a powerful resource in the fight against tuberculosis. Analyses of administrative data can inform how best to leverage private sector healthcare toward tuberculosis prevention activities.

  19. Differential expression of largemouth bass (Micropterus salmoides) estrogen receptor isotypes alpha, beta, and gamma by estradiol.

    PubMed

    Sabo-Attwood, Tara; Kroll, Kevin J; Denslow, Nancy D

    2004-04-15

    The expression levels of three estrogen receptor (ER) isotypes alpha, beta, and gamma were quantified in female largemouth bass (Micropterus salmoides) (LMB) liver, ovary, brain, and pituitary tissues. ER alpha and beta expression predominated in the liver, while ERs beta and gamma predominated in the other tissues. Temporally in females, ER alpha was highly up-regulated, ER gamma was slightly up-regulated, and ER beta levels remained unchanged in the liver when plasma 17-beta estradiol (E2) and vitellogenin (Vtg) levels were elevated in the spring. In ovarian tissue from these same fish, all three ERs were maximally expressed in the fall, during early oocyte development and prior to peak plasma E2 levels. When males were injected with E2, ER alpha was highly inducible, ER gamma was moderately up-regulated, and ER beta levels were not affected. None of the ER isotypes were induced by E2 in gonadal tissues. These results combined suggest that the ERs themselves are not regulated in the same manner by E2, and furthermore, do not contribute equally to the transcriptional regulation of genes involved in fish reproduction such as Vtg.

  20. Rhodiola sachalinesis induces the expression of inducible nitric oxide synthase gene by murine fetal hepatocytes (BNL CL.2).

    PubMed

    Pae, H O; Seo, W G; Oh, G S; Kim, N Y; Kim, Y M; Kwon, T O; Shin, M K; Chai, K Y; Chung, H T

    2001-02-01

    We have examined the effect of the aqueous extract of Rhodiola sachalinensis root (RSE), a traditional herbal medicine, on nitric oxide (NO) synthesis in murine fetal hepatocytes (BNL CL.2) by measuring the stable end-product nitrite and the mRNA of inducible NO synthase (iNOS). Interferon-gamma (IFN-gamma) by itself failed to induce NO synthesis in BNL CL.2 cells. RSE also did not elicit NO synthesis at concentrations up to 1,000 microg/ml, but dose- and time-dependently induced NO synthesis in the presence of IFN-gamma in BNL CL.2 cells. Whereas RSE or IFN-gamma failed to induce detectable levels of iNOS mRNA, a combination of RSE and IFN-gamma markedly induced iNOS mRNA in BNL CL.2 cells. Thus, we found that RSE triggered IFN-gamma-primed BNL CL.2 cells to synthesize NO by inducing iNOS gene expression. The capability of RSE to induce NO synthesis might be related to the therapeutic efficacy of RSE on the liver diseases.

  1. Enhanced expression of interferon-gamma-induced antigen-processing machinery components in a spontaneously occurring cancer.

    PubMed

    Cerruti, Fulvia; Martano, Marina; Petterino, Claudio; Bollo, Enrico; Morello, Emanuela; Bruno, Renato; Buracco, Paolo; Cascio, Paolo

    2007-11-01

    In human tumors, changes in the surface expression and/or function of major histocompatibility complex (MHC) class I antigens are frequently found and may provide malignant cells with a mechanism to escape control of the immune system. This altered human lymphocyte antigen (HLA) class I phenotype can be caused by either structural alterations or dysregulation of genes encoding subunits of HLA class I antigens and/or components of the MHC class I antigen-processing machinery (APM). Herein we analyze the expression of several proteins involved in the generation of MHC class I epitopes in feline injection site sarcoma, a spontaneously occurring tumor in cats that is an informative model for the study of tumor biology in other species, including humans. Eighteen surgically removed primary fibrosarcoma lesions were analyzed, and an enhanced expression of two catalytic subunits of immunoproteasomes, PA28 and leucine aminopeptidase, was found in tumors compared to matched normal tissues. As a functional counterpart of these changes in protein levels, proteasomal activities were increased in tissue extracts from fibrosarcomas. Taken together, these results suggest that alterations in the APM system may account for reduced processing of selected tumor antigens and may potentially provide neoplastic fibroblasts with a mechanism for escape from T-cell recognition and destruction.

  2. Interferon β induces clearance of mutant ataxin 7 and improves locomotion in SCA7 knock-in mice.

    PubMed

    Chort, Alice; Alves, Sandro; Marinello, Martina; Dufresnois, Béatrice; Dornbierer, Jean-Gabriel; Tesson, Christelle; Latouche, Morwena; Baker, Darren P; Barkats, Martine; El Hachimi, Khalid H; Ruberg, Merle; Janer, Alexandre; Stevanin, Giovanni; Brice, Alexis; Sittler, Annie

    2013-06-01

    We showed previously, in a cell model of spinocerebellar ataxia 7, that interferon beta induces the expression of PML protein and the formation of PML protein nuclear bodies that degrade mutant ataxin 7, suggesting that the cytokine, used to treat multiple sclerosis, might have therapeutic value in spinocerebellar ataxia 7. We now show that interferon beta also induces PML-dependent clearance of ataxin 7 in a preclinical model, SCA7(266Q/5Q) knock-in mice, and improves motor function. Interestingly, the presence of mutant ataxin 7 in the mice induces itself the expression of endogenous interferon beta and its receptor. Immunohistological studies in brains from two patients with spinocerebellar ataxia 7 confirmed that these modifications are also caused by the disease in humans. Interferon beta, administered intraperitoneally three times a week in the knock-in mice, was internalized with its receptor in Purkinje and other cells and translocated to the nucleus. The treatment induced PML protein expression and the formation of PML protein nuclear bodies and decreased mutant ataxin 7 in neuronal intranuclear inclusions, the hallmark of the disease. No reactive gliosis or other signs of toxicity were observed in the brain or internal organs. The performance of the SCA7(266Q/5Q) knock-in mice was significantly improved on two behavioural tests sensitive to cerebellar function: the Locotronic® Test of locomotor function and the Beam Walking Test of balance, motor coordination and fine movements, which are affected in patients with spinocerebellar ataxia 7. In addition to motor dysfunction, SCA7(266Q/5Q) mice present abnormalities in the retina as in patients: ataxin 7-positive neuronal intranuclear inclusions that were reduced by interferon beta treatment. Finally, since neuronal death does not occur in the cerebellum of SCA7(266Q/5Q) mice, we showed in primary cell cultures expressing mutant ataxin 7 that interferon beta treatment improves Purkinje cell survival.

  3. The importance of communication in promoting voluntary participation in an experimental trial: A qualitative study based on the assessment of the gamma-interferon test for the diagnosis of bovine tuberculosis in France

    PubMed Central

    Dufour, Barbara; Praud, Anne

    2017-01-01

    Understanding the factors leading each stakeholder to participate in an experimental trial is a key element for improving trial set-up and for identifying selection bias in statistical analyses. An experimental protocol, validated by the European Commission, was developed in France to assess the ability of the gamma-interferon test in terms of accuracy to replace the second intradermal skin test in cases of suspected bovine tuberculosis. Implemented between 2013 and 2015, this experimental trial was based on voluntary participation. To determine and understand the motivation or reluctance of farmers to take part in this trial, we carried out a sociological survey in France. Our study was based on semi-structured interviews with the farmers and other stakeholders involved. The analysis of findings demonstrated that shortening the lock-up period during tuberculosis suspicion, following the use of a gamma-interferon test, was an important aim and a genuine challenge for the animal health stakeholders. However, some farmers did not wish to continue the trial because it could potentially have drastic consequences for them. Moreover, misunderstandings and confusion concerning the objectives and consequences of the trial led stakeholders to reject it forcefully. Based on our results, we offer some recommendations: clear and appropriate communication tools should be prepared to explain the protocol and its aims. In addition, these types of animal health trials should be designed with the stakeholders’ interests in mind. This study provides a better understanding of farmer motivations and stakeholder influences on trial participation and outcomes. The findings can be used to help design trials so that they promote participation by farmers and by all animal health stakeholders in general. PMID:28973018

  4. MicroRNA Expression Changes during Interferon-Beta Treatment in the Peripheral Blood of Multiple Sclerosis Patients

    PubMed Central

    Hecker, Michael; Thamilarasan, Madhan; Koczan, Dirk; Schröder, Ina; Flechtner, Kristin; Freiesleben, Sherry; Füllen, Georg; Thiesen, Hans-Jürgen; Zettl, Uwe Klaus

    2013-01-01

    MicroRNAs (miRNAs) are small non-coding RNA molecules acting as post-transcriptional regulators of gene expression. They are involved in many biological processes, and their dysregulation is implicated in various diseases, including multiple sclerosis (MS). Interferon-beta (IFN-beta) is widely used as a first-line immunomodulatory treatment of MS patients. Here, we present the first longitudinal study on the miRNA expression changes in response to IFN-beta therapy. Peripheral blood mononuclear cells (PBMC) were obtained before treatment initiation as well as after two days, four days, and one month, from patients with clinically isolated syndrome (CIS) and patients with relapsing-remitting MS (RRMS). We measured the expression of 651 mature miRNAs and about 19,000 mRNAs in parallel using real-time PCR arrays and Affymetrix microarrays. We observed that the up-regulation of IFN-beta-responsive genes is accompanied by a down-regulation of several miRNAs, including members of the mir-29 family. These differentially expressed miRNAs were found to be associated with apoptotic processes and IFN feedback loops. A network of miRNA-mRNA target interactions was constructed by integrating the information from different databases. Our results suggest that miRNA-mediated regulation plays an important role in the mechanisms of action of IFN-beta, not only in the treatment of MS but also in normal immune responses. miRNA expression levels in the blood may serve as a biomarker of the biological effects of IFN-beta therapy that may predict individual disease activity and progression. PMID:23921681

  5. Interferon-alpha-induced changes in metallothionein expression in liver biopsies from patients with chronic hepatitis C.

    PubMed

    Nagamine, Takeaki; Suzuki, Keiji; Kondo, Toshihiko; Nakazato, Kyomi; Kakizaki, Satoru; Takagi, Hitoshi; Nakajima, Katuyuki

    2005-08-01

    An association between reactive oxygen species and liver damage has been postulated in the course of hepatitis C virus (HCV) infection. Metallothionein (MT), induced by HCV core protein and interferon (IFN), plays a role in scavenging free radicals. MT expression in liver biopsies obtained from 21 patients with chronic HCV infection before and after IFN-alpha therapy was investigated. Changes in Knodell histological activity index (HAI) scores, MT protein levels (immunohistochemistry), MT-I and MT-II messenger (m)RNA expression levels (in situ hybridization) and proliferating cell nuclear antigen (PCNA) labelling index were determined and compared in serial liver specimens. MT staining was clustered around the portal tracts with inflammatory cells and fibrosis. The pattern of MT protein before IFN-alpha therapy was similar in all patients, but was higher in IFN-sustained responders than in nonresponders after IFN-alpha therapy. HAI scores and PCNA labelling indexes were significantly reduced after IFN-alpha therapy. MT-II mRNA expression correlated positively with PCNA index before therapy and with HAI scores after therapy (P<0.05). No correlation was found between MT-I mRNA and HAI scores or PCNA index. The findings indicate that IFN-alpha-induced hepatic MT may participate in the therapeutic effects of IFN-alpha for HCV. In addition, MT-II mRNA expression may be involved in cell proliferation in the livers of patients with chronic HCV infection.

  6. Detection of bacterial pyrogens on the basis of their effects on gamma interferon-mediated formation of neopterin or nitrite in cultured monocyte cell lines.

    PubMed Central

    Werner-Felmayer, G; Baier-Bitterlich, G; Fuchs, D; Hausen, A; Murr, C; Reibnegger, G; Werner, E R; Wachter, H

    1995-01-01

    In a number of mammalian cell types, pteridine biosynthesis from guanosine 5'-triphosphate and formation of nitric oxide from L-arginine are induced by gamma interferon (IFN-gamma) and bacterial lipopolysaccharide (LPS). We assessed the possibility of using such metabolic alterations for the in vitro detection of pyrogens. Products from gram-negative and gram-positive bacteria and related synthetic compounds were tested for their potential to induce either of these pathways. Stimulation of pteridine biosynthesis was monitored as the formation of neopterin in the human myelomonocytic cell line THP-1. The formation of nitric oxide was determined as nitrite in murine J774A.1 macrophage cultures. The substances tested included toxic and detoxified parts of LPS and lipid A from Escherichia coli, Salmonella typhimurium, Salmonella minnesota, and Klebsiella pneumoniae as well as lipoteichoic acid and toxic shock syndrome toxin 1 from Staphylococcus aureus. Furthermore, two cell wall compounds from Mycobacterium tuberculosis, trehalose 6,6'-dimycolate and N-acetylmuramyl-L-alanyl-D-isoglutamine, which are active components of Freund's adjuvant, were used. When applied as a single stimulus, only the whole LPS molecule potently stimulated neopterin or nitrite formation. Lipid A and products from gram-positive bacteria were weakly active. For neopterin formation, lipid A required the presence of fetal calf serum. Besides detoxified LPS and independently from the presence of serum, all bacterial compounds tested strongly increased the effects mediated by IFN-gamma. Our results show that bacterial pyrogens can be detected by monitoring the formation of neopterin or nitrite. This may provide a basis for the development of an in vitro assay for the detection of pyrogenic contamination with the aim of replacing the currently used animal test. PMID:7664177

  7. [Association between Fok I vitamin D receptor (VDR) gene polymorphism and plasmatic concentrations of transforming growth factor-beta1 and interferon gamma in type 1 diabetes mellitus].

    PubMed

    López, Tatiana; García, Diego; Angel, Bárbara; Carrasco, Elena; Codner, Ethel; Ugarte, Francisca; Pérez-Bravo, Francisco

    2008-02-02

    In order to assess whether Fok I vitamin D receptor gene (VDR) polymorphism is involved in the genetic susceptibility of type 1 diabetes, a case-control study was conducted and VDR genotypes were related to serum concentrations of 25(OH) vitamin D and cytokines transforming growth factor beta1 (TGF-beta1) and interferon gamma (INF-gamma). 151 incident cases of type 1 diabetes and 182 non related healthy controls from Santiago were studied for VDR polymorphisms in peripheral blood DNA. Exon 2 (Fok I) segments were amplified by polimerase chain reaction and analyzed by means of restriction fragment length polymorphism to determine each corresponding genotype. Differences for allele, genotype and serological markers as 25(OH) vitamin D, TGF-beta1 and INF-gamma levels distribution between patients and controls were analyzed. Fok I polymorphism distribution analysis showed no differences between patients and controls. Among diabetics, higher levels of TGF-beta1 (median, 282.6 pg/ml; range, 131.8-3,031.4) were observed compared with healthy children (median, 232.2 pg/ml; range, 135.7-506.5) (p < 0.0038). Similar results were observed for INF-gamma concentrations (median, 121.1 pg/ml, and range, 5.3-228.8, in cases, and median, 89.6 pg/ml, and range, 10.9-117.2 in controls) (p < 0.0004). The diabetic carriers of the ff genotype showed low levels of 25(OH) vitamin D compared with the carriers of the F allele: mean (standard deviation), 23.1 (5.9) versus 27.9 (10.3) ng/ml (p < 0.03). A similar result was observed for TGF-beta1 concentrations in diabetic carriers of ff genotype and patients carriers of the F allele (298.5 versus 276.6; p < 0.05). Fok I polymorphism of VDR could have a marginal role in the immunologic disturbance in type 1 diabetes.

  8. Effects of positive results for Mycobacterium avium subsp paratuberculosis as determined by microbial culture of feces or antibody ELISA on results of caudal fold tuberculin test and interferon-gamma assay for tuberculosis in cattle.

    PubMed

    Dunn, John R; Kaneene, John B; Grooms, Daniel L; Bolin, Steven R; Bolin, Carole A; Bruning-Fann, Colleen S

    2005-02-01

    To determine whether cattle testing positive for Mycobacterium avium subsp paratuberculosis as determined by microbial culture of feces or antibody ELISA were more likely to have false-positive responses on the caudal fold tuberculin (CFT) test or interferon-gamma (IFN-gamma) assay for Mycobacterium bovis than cattle testing negative for M paratuberculosis. 1043 cattle from 10 herds in Michigan. Feces and blood samples for plasma were collected from cattle > or =24 months old on the day the CFT test was read. Fecal samples were submitted for microbial culture for M paratuberculosis. Plasma samples were tested for antibody against M paratuberculosis, and IFN-gamma after stimulation with purified protein derivative tuberculin from M bovis or M avium. Of 1043 cattle, 180 (17.3%) had positive CFT test results (suspects) and 8 (0.8%) had positive IFN-gamma assay results after stimulation with purified protein derivative tuberculin from M bovis. Forty-five (4.3%) and 115 (11.0%) cattle tested positive for M paratuberculosis as determined by microbial culture of feces and antibody ELISA, respectively. Cattle with positive responses for M paratuberculosis appeared to have an increased likelihood of false-positive results on the CFT test, although this association was not significant. No significant association was detected among cattle testing positive for M paratuberculosis as determined by microbial culture of feces and antibody ELISA and positive CFT test and IFN-gamma assay results for M bovis.

  9. Antiviral Activity of Lambda Interferon in Chickens

    PubMed Central

    Reuter, Antje; Soubies, Sebastien; Härtle, Sonja; Schusser, Benjamin; Kaspers, Bernd

    2014-01-01

    Interferons (IFNs) are essential components of the antiviral defense system of vertebrates. In mammals, functional receptors for type III IFN (lambda interferon [IFN-λ]) are found mainly on epithelial cells, and IFN-λ was demonstrated to play a crucial role in limiting viral infections of mucosal surfaces. To determine whether IFN-λ plays a similar role in birds, we produced recombinant chicken IFN-λ (chIFN-λ) and we used the replication-competent retroviral RCAS vector system to generate mosaic-transgenic chicken embryos that constitutively express chIFN-λ. We could demonstrate that chIFN-λ markedly inhibited replication of various virus strains, including highly pathogenic influenza A viruses, in ovo and in vivo, as well as in epithelium-rich tissue and cell culture systems. In contrast, chicken fibroblasts responded poorly to chIFN-λ. When applied in vivo to 3-week-old chickens, recombinant chIFN-λ strongly induced the IFN-responsive Mx gene in epithelium-rich organs, such as lungs, tracheas, and intestinal tracts. Correspondingly, these organs were found to express high transcript levels of the putative chIFN-λ receptor alpha chain (chIL28RA) gene. Transfection of chicken fibroblasts with a chIL28RA expression construct rendered these cells responsive to chIFN-λ treatment, indicating that receptor expression determines cell type specificity of IFN-λ action in chickens. Surprisingly, mosaic-transgenic chickens perished soon after hatching, demonstrating a detrimental effect of constitutive chIFN-λ expression. Our data highlight fundamental similarities between the IFN-λ systems of mammals and birds and suggest that type III IFN might play a role in defending mucosal surfaces against viral intruders in most if not all vertebrates. PMID:24371053

  10. Plasma interferon-gamma-inducible protein-10 (IP-10) levels during acute hepatitis C virus infection

    PubMed Central

    Grebely, Jason; Feld, Jordan J.; Applegate, Tanya; Matthews, Gail V.; Hellard, Margaret; Sherker, Alana; Petoumenos, Kathy; Zang, Geng; Shaw, Ineke; Yeung, Barbara; George, Jacob; Teutsch, Suzy; Kaldor, John M.; Cherepanov, Vera; Bruneau, Julie; Shoukry, Naglaa H.; Lloyd, Andrew R.; Dore, Gregory J.

    2013-01-01

    Systemic levels of interferon-gamma-inducible protein-10 (IP-10) are predictive of treatment-induced clearance in chronic HCV. In the present study, factors associated with plasma IP-10 levels at the time of acute HCV detection and the association between IP-10 levels and spontaneous clearance were assessed in three cohorts of acute HCV infection. Among 300 individuals, 245 (181 male, 47 HIV+) were HCV RNA+ at acute HCV detection. In adjusted analysis, factors independently associated with IP-10 levels ≥150 pg/mL (median level) included HCV RNA levels >6 log IU/mL, HIV co-infection and non-Aboriginal ethnicity. Among 245 HCV RNA+ at acute HCV detection, 214 were untreated (n=137) or had persistent infection (infection duration ≥26 weeks) at treatment initiation (n=77). Spontaneous clearance occurred in 14% (29 of 214). Individuals without spontaneous clearance had significantly higher mean plasma IP-10 levels at the time of acute HCV detection than those with clearance (248±32 vs. 142±22 pg/mL, P=0.008). The proportion of individuals with spontaneous clearance was 0% (0 of 22, P=0.048) and 16% (27 of 165) and in those in those with and without plasma IP-10 levels ≥380 pg/mL. In adjusted analyses, favourable IL28B genotype was associated with spontaneous clearance, while higher HCV RNA level was independently associated with lower odds of spontaneous clearance. Conclusion High IP-10 levels at acute HCV detection were associated with failure to spontaneously clear HCV. Patients with acute HCV and high baseline IP-10 levels, particularly >380 pg/mL, should be considered for early therapeutic intervention, and those with low levels should defer therapy for potential spontaneous clearance. PMID:23325615

  11. The mechanism of chromosome 7 inversion in human lymphocytes expressing chimeric gamma beta TCR.

    PubMed

    Retière, C; Halary, F; Peyrat, M A; Le Deist, F; Bonneville, M; Hallet, M M

    1999-01-15

    Functional chimeric TCR chains, encoded by V gamma J gamma C beta or V gamma J beta C beta hybrid gene TCR, are expressed at the surface of a small fraction of alpha beta T lymphocytes in healthy individuals. Their frequency is dramatically increased in patients with ataxia-telangiectasia, a syndrome associated with inherited genomic instability. As the TCR gamma and beta loci are in an inverted orientation on chromosome 7, the generation of such hybrid genes requires at least an inversion event. Until now, neither the sequences involved in this genetic mechanism nor the number of recombinations leading to the formation of functional transcriptional units have been characterized. In this manuscript, we demonstrate that at least two rearrangements, involving classical recombination signal sequence and the V(D)J recombinase complex, lead to the formation of productive hybrid genes. A primary inversion 7 event between D beta and J gamma genic segments generates C gamma V beta and C beta V gamma hybrid loci. Within the C gamma V beta locus, secondary rearrangements between V gamma and J gamma or V gamma and J beta elements generate functional genes. Besides, our results suggest that secondary rearrangements were blocked in the C beta V gamma locus of normal but not ataxia-telangiectasia T lymphocytes. We also provide formal evidence that the same D beta-3' recombination signal sequence can be used in successive rearrangements with J gamma and J beta genic segments, thus showing that a signal joint has been involved in a secondary recombination event.

  12. Production of an active feline interferon in the cocoon of transgenic silkworms using the fibroin H-chain expression system

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kurihara, H.; Sezutsu, H.; Tamura, T.

    2007-04-20

    We constructed the fibroin H-chain expression system to produce recombinant proteins in the cocoon of transgenic silkworms. Feline interferon (FeIFN) was used for production and to assess the quality of the product. Two types of FeIFN fusion protein, each with N- and C-terminal sequences of the fibroin H-chain, were designed to be secreted into the lumen of the posterior silk glands. The expression of the FeIFN/H-chain fusion gene was regulated by the fibroin H-chain promoter domain. The transgenic silkworms introduced these constructs with the piggyBac transposon-derived vector, which produced the normal sized cocoons containing each FeIFN/H-chain fusion protein. Although themore » native-protein produced by transgenic silkworms have almost no antiviral activity, the proteins after the treatment with PreScission protease to eliminate fibroin H-chain derived N- and C-terminal sequences from the products, had very high antiviral activity. This H-chain expression system, using transgenic silkworms, could be an alternative method to produce an active recombinant protein and silk-based biomaterials.« less

  13. Role of Local Cytokines in Increased Gastric Expression of the Secretory Component in Helicobacter pylori Infection

    PubMed Central

    Ahlstedt, Ingela; Lindholm, Catharina; Lönroth, Hans; Hamlet, Annika; Svennerholm, Ann-Mari; Quiding-Järbrink, Marianne

    1999-01-01

    Using immunohistochemical staining, we examined the presence of secretory component (SC) on epithelial cells in gastric and duodenal biopsy specimens collected from Helicobacter pylori-infected individuals and healthy controls. Gastric epithelial cells from healthy volunteers expressed low, but detectable, levels of SC. In contrast, significantly higher level of expression of SC (P < 0.001) was observed on epithelial cells in the antra of H. pylori-infected individuals. The antral SC expression correlated with staining for gamma interferon of intraepithelial and lamina propria lymphocytes (rs = 0.76 and 0.69, respectively, P < 0.001) and correlated weakly with production of tumor necrosis factor alpha (rs = 0.43, P < 0.05), but it did not correlate at all with interleukin-4 production. PMID:10456951

  14. Interferon-α Silencing by Small Interference RNA Increases Adenovirus Transduction and Transgene Expression in Huh7 Cells.

    PubMed

    Sobrevilla-Navarro, Ana Alondra; Sandoval-Rodríguez, Ana; García-Bañuelos, Jesús Javier; Armendariz-Borunda, Juan; Salazar-Montes, Adriana María

    2018-04-01

    Adenoviruses are the most common vectors used in clinical trials of gene therapy. In 2017, 21.2% of clinical trials used rAds as vectors. Systemic administration of rAds results in high tropism in the liver. Interferon types α and β are the major antiviral cytokines which orchestrate the host's immune response against rAd, limiting therapeutic gene expression and preventing subsequent vector administration. siRNA is small double-strand RNAs that temporally inhibit the expression of a specific gene. The aim is to evaluate the effect of IFN-α blocking by a specific siRNA on Ad-GFP transduction and on transgene expression in Huh7 cells in culture. Huh7 cells were cultured in DMEM and transfected with 70 nM of siRNA-IFN-α. Six hours later, the cells were exposed to 1 × 10 9  vp/ml of rAd-GFP for 24 h. Expression of IFN-α, TNF-α and the PKR gene was determined by RT-qPCR. Percentage of transduction was analyzed by flow cytometry and by qPCR. GFP expression was determined by western blot. 70 nM of siRNA-IFN-α inhibited 96% of IFN-α and 65% of TNF-α gene expression compared to an irrelevant siRNA. Percentage of transduction and transgene expression increased in these cells compared to an irrelevant siRNA. Inhibition of IFN-α expression by siRNA-IFN-α enabled a higher level of transduction and transgene expression GFP, highlighting the role of IFN-α in the elimination of adenovirus in transduced cells and thus suggesting that its inhibition could be an important strategy for gene therapy in clinical trials using adenovirus as a vector directed to liver diseases.

  15. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sakaeda, Yoshiichi; Hiroi, Miki; Shimojima, Takahiro

    Sulindac, a non-steroidal anti-inflammatory drug, has been shown to exert an anti-tumor effect on several types of cancer. To determine the effect of sulindac on intracellular signaling pathways in host immune cells such as macrophages, we investigated the effect of the drug on interferon gamma (IFN{gamma})-induced expression of signal transducer and activator of transcription 1 (STAT1) and other genes in mouse macrophage-like cell line RAW264.7 cells. Sulindac, but not aspirin or sodium salicylate, inhibited IFN{gamma}-induced expression of the CXC ligand 9 (CXCL9) mRNA, a chemokine for activated T cells, whereas the interferon-induced expression of CXCL10 or IFN regulatory factor-1 wasmore » not affected by sulindac. Luciferase reporter assay demonstrated that sulindac inhibited IFN{gamma}-induced promoter activity of the CXCL9 gene. Surprisingly, sulindac had no inhibitory effect on IFN{gamma}-induced STAT1 activation; however, constitutive nuclear factor {kappa}B activity was suppressed by the drug. These results indicate that sulindac selectively inhibited IFN{gamma}-inducible gene expression without inhibiting STAT1 activation.« less

  16. Loss of the Type I Interferon Pathway Increases Vulnerability of Mice to Genital Herpes Simplex Virus 2 Infection ▿

    PubMed Central

    Conrady, Christopher D.; Halford, William P.; Carr, Daniel J. J.

    2011-01-01

    The mouse model of genital herpes relies on medoxyprogesterone treatment of female mice to render the vaginal lumen susceptible to inoculation with herpes simplex virus 2 (HSV-2). In the present study, we report that mice deficient in the A1 chain of the type I interferon receptor (CD118−/−) are susceptible to HSV-2 in the absence of medroxyprogesterone preconditioning. In the absence of hormone pretreatment, 2,000 PFU of a clinical isolate of HSV-2 was sufficient to establish a productive infection in the vagina of 75% ± 17% and in the spinal cord of 71% ± 14% of CD118−/− mice, whereas the same dose of HSV-2 replicated to detectable levels in only 13% ± 13% of vaginal samples and 0% of spinal cord samples from wild-type mice, as determined at day 5 postinfection. The susceptibility to HSV-2 infection in the CD118−/− mice was associated with a significant reduction in the infiltration of HSV-specific cytotoxic T lymphocytes into the vaginal tissue, the local production of gamma interferon (IFN-γ), and the expression of T cell-recruiting chemokines CCL5, CXCL9, and CXCL10. Collectively, the results underscore the significant contribution of type I IFNs in resistance to genital HSV-2 infection. PMID:21147921

  17. DNA polymerase-α regulates type I interferon activation through cytosolic RNA:DNA synthesis

    PubMed Central

    Starokadomskyy, Petro; Gemelli, Terry; Rios, Jonathan J.; Xing, Chao; Wang, Richard C.; Li, Haiying; Pokatayev, Vladislav; Dozmorov, Igor; Khan, Shaheen; Miyata, Naoteru; Fraile, Guadalupe; Raj, Prithvi; Xu, Zhe; Xu, Zigang; Ma, Lin; Lin, Zhimiao; Wang, Huijun; Yang, Yong; Ben-Amitai, Dan; Orenstein, Naama; Mussaffi, Huda; Baselga, Eulalia; Tadini, Gianluca; Grunebaum, Eyal; Sarajlija, Adrijan; Krzewski, Konrad; Wakeland, Edward K.; Yan, Nan; de la Morena, Maria Teresa; Zinn, Andrew R.; Burstein, Ezra

    2016-01-01

    Aberrant nucleic acids generated during viral replication are the main trigger for antiviral immunity, and mutations disrupting nucleic acid metabolism can lead to autoinflammatory disorders. Here we investigated the etiology of X-linked reticulate pigmentary disorder (XLPDR), a primary immunodeficiency with autoinflammatory features. We discovered that XLPDR is caused by an intronic mutation that disrupts expression of POLA1, the gene encoding the catalytic subunit of DNA polymerase-α. Unexpectedly, POLA1 deficiency results in increased type I interferon production. This enzyme is necessary for RNA:DNA primer synthesis during DNA replication and strikingly, POLA1 is also required for the synthesis of cytosolic RNA:DNA, which directly modulates interferon activation. Altogether, this work identified POLA1 as a critical regulator of the type I interferon response. PMID:27019227

  18. IFN-gamma synergizes with LPS to induce nitric oxide biosynthesis through glycogen synthase kinase-3-inhibited IL-10.

    PubMed

    Lin, Chiou-Feng; Tsai, Cheng-Chieh; Huang, Wei-Ching; Wang, Chi-Yun; Tseng, Hsiang-Chi; Wang, Yi; Kai, Jui-In; Wang, Szu-Wen; Cheng, Yi-Lin

    2008-10-15

    Interferon-gamma (IFN-gamma) plays a crucial role in innate immunity and inflammation. It causes the synergistic effect on endotoxin lipopolysaccharide (LPS)-stimulated inducible nitric oxide synthase (iNOS)/NO biosynthesis; however, the mechanism remains unclear. In the present study, we investigated the effects of glycogen synthase kinase-3 (GSK-3)-mediated inhibition of anti-inflammatory interleukin-10 (IL-10). We found, in LPS-stimulated macrophages, that IFN-gamma increased iNOS expression and NO production in a time-dependent manner. In addition, ELISA analysis showed the upregulation of tumor necrosis factor-alpha and regulated on activation, normal T expressed and secreted, and the downregulation of IL-10. RT-PCR further showed changes in the IL-10 mRNA level as well. Treating cells with recombinant IL-10 showed a decrease in IFN-gamma/LPS-induced iNOS/NO biosynthesis, whereas anti-IL-10 neutralizing antibodies enhanced this effect, suggesting that IL-10 acts in an anti-inflammatory role. GSK-3-inhibitor treatment blocked IFN-gamma/LPS-induced iNOS/NO biosynthesis but upregulated IL-10 production. Inhibiting GSK-3 using short-interference RNA showed similar results. Additionally, treating cells with anti-IL-10 neutralizing antibodies blocked these effects. We further showed that inhibiting GSK-3 increased phosphorylation of transcription factor cyclic AMP response element binding protein. Inhibiting protein tyrosine kinase Pyk2, an upstream regulator of GSK-3beta, caused inhibition on IFN-gamma/LPS-induced GSK-3beta phosphorylation at tyrosine 216 and iNOS/NO biosynthesis. Taken together, these findings reveal the involvement of GSK-3-inhibited IL-10 on the induction of iNOS/NO biosynthesis by IFN-gamma synergized with LPS. (c) 2008 Wiley-Liss, Inc.

  19. Astrocytes express specific variants of CaM KII delta and gamma, but not alpha and beta, that determine their cellular localizations.

    PubMed

    Vallano, M L; Beaman-Hall, C M; Mathur, A; Chen, Q

    2000-04-01

    Multiple isoforms of type II Ca(2+)-calmodulin-dependent kinase (CaM KII) are composed of two major neuron-specific subunits, designated alpha and beta, and two less well-characterized subunits that are also expressed in non-neuronal tissues, designated delta and gamma. Regulated expression of these 4 gene products, and several variants produced by alternative splicing, shows temporal and regional specificity and influences intracellular targeting. We used immunoblotting and RT-PCR to analyze subunit and variant expression and distribution in cultured cerebellar astrocytes and neurons, and whole cerebellar cortex from rodent brain. The data indicate that: (i) astrocytes express a single splice variant of delta, namely delta(2); (ii) like neurons, astrocytes express two forms of CaM KII gamma; gamma(B) and gamma(A); (iii) these CaM KII variants are enriched in the supernate fraction in astrocytes, and the particulate fraction in neurons; (iv) unlike neurons, astrocytes do not express detectable levels of alpha or beta subunits or their respective splice variants. The results indicate that neurons and astrocytes express distinct CaM KII subunits and variants that localize to distinct subcellular compartments and, by inference, exert distinct cellular functions. Copyright 2000 Wiley-Liss, Inc.

  20. Chicken interferome: avian interferon-stimulated genes identified by microarray and RNA-seq of primary chick embryo fibroblasts treated with a chicken type I interferon (IFN-α).

    PubMed

    Giotis, Efstathios S; Robey, Rebecca C; Skinner, Natalie G; Tomlinson, Christopher D; Goodbourn, Stephen; Skinner, Michael A

    2016-08-05

    Viruses that infect birds pose major threats-to the global supply of chicken, the major, universally-acceptable meat, and as zoonotic agents (e.g. avian influenza viruses H5N1 and H7N9). Controlling these viruses in birds as well as understanding their emergence into, and transmission amongst, humans will require considerable ingenuity and understanding of how different species defend themselves. The type I interferon-coordinated response constitutes the major antiviral innate defence. Although interferon was discovered in chicken cells, details of the response, particularly the identity of hundreds of stimulated genes, are far better described in mammals. Viruses induce interferon-stimulated genes but they also regulate the expression of many hundreds of cellular metabolic and structural genes to facilitate their replication. This study focusses on the potentially anti-viral genes by identifying those induced just by interferon in primary chick embryo fibroblasts. Three transcriptomic technologies were exploited: RNA-seq, a classical 3'-biased chicken microarray and a high density, "sense target", whole transcriptome chicken microarray, with each recognising 120-150 regulated genes (curated for duplication and incorrect assignment of some microarray probesets). Overall, the results are considered robust because 128 of the compiled, curated list of 193 regulated genes were detected by two, or more, of the technologies.

  1. [Plasma levels of interferon gamma and interleukin 10 in patients with lymphonodular toxoplasmosis].

    PubMed

    Bielec, D; Patorska-Mach, E; Semczuk, G; Toruń, E

    1997-01-01

    The concentrations of IFN gamma and IL 10 in plasma of sixteen patients with toxoplasmic lymphadenopathy were measured. These examinations were carried out two times in the interval of a month. We found increased level of IFN gamma and normal concentrations of IL 10 in both of these terms.

  2. Roles of CD4+ T Cells and Gamma Interferon in Protective Immunity against Babesia microti Infection in Mice

    PubMed Central

    Igarashi, Ikuo; Suzuki, Reiko; Waki, Seiji; Tagawa, Yoh-Ichi; Seng, Seyha; Tum, Sothyra; Omata, Yoshitaka; Saito, Atsushi; Nagasawa, Hideyuki; Iwakura, Yohichiro; Suzuki, Naoyoshi; Mikami, Takeshi; Toyoda, Yutaka

    1999-01-01

    Babesia microti produces a self-limiting infection in mice, and recovered mice are resistant to reinfection. In the present study, the role of T cells in protective immunity against challenge infection was examined. BALB/c mice which recovered from primary infection showed strong protective immunity against challenge infection. In contrast, nude mice which failed to control the primary infection and were cured with an antibabesial drug did not show protection against challenge infection. Treatment of immune mice with anti-CD4 monoclonal antibody (MAb) diminished the protective immunity against challenge infection, but treatment with anti-CD8 MAb had no effect on the protection. Transfer of CD4+ T-cell-depleted spleen cells resulted in higher parasitemia than transfer of CD8+ T-cell-depleted spleen cells. A high level of gamma interferon (IFN-γ), which was produced by CD4+ T cells, was observed for the culture supernatant of spleen cells from immune mice, and treatment of immune mice with anti-IFN-γ MAb partially reduced the protection. Moreover, no protection against challenge infection was found in IFN-γ-deficient mice. On the other hand, treatment of immune mice with MAbs against interleukin-2 (IL-2), IL-4, or tumor necrosis factor alpha did not affect protective immunity. These results suggest essential requirements for CD4+ T cells and IFN-γ in protective immunity against challenge infection with B. microti. PMID:10417185

  3. The elephant interferon gamma assay: a contribution to diagnosis of tuberculosis in elephants.

    PubMed

    Angkawanish, T; Morar, D; van Kooten, P; Bontekoning, I; Schreuder, J; Maas, M; Wajjwalku, W; Sirimalaisuwan, A; Michel, A; Tijhaar, E; Rutten, V

    2013-11-01

    Mycobacterium tuberculosis (M. tb) has been shown to be the main causative agent of tuberculosis in elephants worldwide. M. tb may be transmitted from infected humans to other species including elephants and vice versa, in case of prolonged intensive contact. An accurate diagnostic approach covering all phases of the infection in elephants is required. As M. tb is an intracellular pathogen and cell-mediated immune (CMI) responses are elicited early after infection, the skin test is the CMI assay of choice in humans and cattle. However, this test is not applicable in elephants. The interferon gamma (IFN-γ) assay is considered a good alternative for the skin test in general, validated for use in cattle and humans. This study was aimed at development of an IFN-γ assay applicable for diagnosis of tuberculosis in elephants. Recombinant elephant IFN-γ (rEpIFN-γ) produced in eukaryotic cells was used to immunize mice and generate the monoclonal antibodies. Hybridomas were screened for IFN-γ-specific monoclonal antibody production and subcloned, and antibodies were isotyped and affinity purified. Western blot confirmed recognition of the rEpIFN-γ. The optimal combination of capture and detection antibodies selected was able to detect rEpIFN-γ in concentrations as low as 1 pg/ml. The assay was shown to be able to detect the native elephant IFN-γ, elicited in positive-control cultures (pokeweed mitogen (PWM), phorbol myristate acetate plus ionomycin (PMA/I)) of both Asian and African elephant whole-blood cultures (WBC). Preliminary data were generated using WBC from non-infected elephants, a M. tb infection-suspected elephant and a culture-confirmed M. tb-infected elephant. The latter showed measurable production of IFN-γ after stimulation with ESAT6/CFP10 PPDB and PPDA in concentration ranges as elicited in WBC by Mycobacterium tuberculosis complex (MTBC)-specific antigens in other species. Hence, the IFN-γ assay presented potential as a diagnostic tool for the

  4. [Fish interferon response and its molecular regulation: a review].

    PubMed

    Zhang, Yibing; Gui, Jianfang

    2011-05-01

    Interferon response is the first line of host defense against virus infection. Recent years have witnessed tremendous progress in understanding of fish innate response to virus infection, especially in fish interferon antiviral response. A line of fish genes involved in interferon antiviral response have been identified and functional studies further reveal that fish possess an IFN antiviral system similar to mammals. However, fish virus-induced interferon genes contain introns similar to mammalian type III interferon genes although they encode proteins similar to type I interferons, which makes it hard to understand the evolution of vertebrate interferon genes directly resulting in a debate on nomenclature of fish interferon genes. Actually, fish display some unique mechanisms underlying interferon antiviral response. This review documents the recent progress on fish interferon response and its molecular mechanism.

  5. Clearance of Virulent but Not Avirulent Rhodococcus equi from the Lungs of Adult Horses Is Associated with Intracytoplasmic Gamma Interferon Production by CD4+ and CD8+ T Lymphocytes

    PubMed Central

    Hines, Stephen A.; Stone, Diana M.; Hines, Melissa T.; Alperin, Debby C.; Knowles, Donald P.; Norton, Linda K.; Hamilton, Mary J.; Davis, William C.; McGuire, Travis C.

    2003-01-01

    Rhodococcus equi is a gram-positive bacterium that infects alveolar macrophages and causes rhodococcal pneumonia in horses and humans. The virulence plasmid of R. equi appears to be required for both pathogenicity in the horse and the induction of protective immunity. An understanding of the mechanisms by which virulent R. equi circumvents protective host responses and by which bacteria are ultimately cleared is important for development of an effective vaccine. Six adult horses were challenged with either virulent R. equi or an avirulent, plasmid-cured derivative. By using a flow cytometric method for intracytoplasmic detection of gamma interferon (IFN-γ) in equine bronchoalveolar lavage fluid (BALF) cells, clearance of the virulent strain was shown to be associated with increased numbers of pulmonary CD4+ and CD8+ T lymphocytes producing IFN-γ. There was no change in IFN-γ-positive cells in peripheral blood, suggesting that a type 1 recall response at the site of challenge was protective. The plasmid-cured strain of R. equi was cleared in horses without a significant increase in IFN-γ-producing T lymphocytes in BALF. In contrast to these data, a previous report in foals suggested an immunomodulating role for R. equi virulence plasmid-encoded products in downregulating IFN-γ expression by equine CD4+ T lymphocytes. Intracytoplasmic detection of IFN-γ provides a method to better determine whether modulation of macrophage-activating cytokines by virulent strains occurs uniquely in neonates and contributes to their susceptibility to rhodococcal pneumonia. PMID:12626444

  6. Langerhans' cell expression of the selectin ligand, sialyl Lewis x.

    PubMed Central

    Ross, E L; Barker, J N; Allen, M H; Chu, A C; Groves, R W; MacDonald, D M

    1994-01-01

    Cellular adhesion molecules play a central role in leucocyte migration through peripheral blood and tissues. A crucial stage in these events in selectin-mediated adhesion involving E-selectin expressed on activated endothelium interacting with a range of carbohydrate ligands expressed by specific subpopulations of leucocytes. As such mechanisms may be relevant to bone marrow-derived dendritic epidermal Langerhans' cell (LC) migration, expression of these carbohydrate ligands was assessed immunocytochemically in whole skin biopsies and in epidermal cell suspensions obtained from adult humans. Double-labelling experiments revealed that sialyl Lewis x, recognized by the monoclonal antibody CSLEX1, was expressed on epidermal LC (n = 9). Furthermore, expression was enhanced at 24 hr following epicutaneous application of antigen and in the inflammatory disorder psoriasis (n = 10). E-selectin was concomitantly strongly expressed on dermal endothelium in psoriasis and allergic contact dermatitis. Intradermal injection of the T-cell-derived cytokine interferon-gamma (IFN-gamma) led to increased LC expression of sialyl Lewis x. In epidermal cell suspensions, in contrast to keratinocytes, CD1a+ cells expressed sialyl Lewis x, intensity of which was enhanced after 4 days in culture. CSLEX1 staining could be abolished and CD15 (non-sialated Lewis x) expression induced by saponification and treatment with neuraminidase. Expression of other selectin ligands was also examined. While the cutaneous lymphocyte antigen defined by the monoclonal antibody HECA-452 reacted with a small minority of LC, sialyl Lewis a and sulphatide were not expressed under any experimental conditions. These studies indicate that E-selectin-sialyl Lewis x interactions are potentially important in LC migration, both into and out of skin. Images Figure 2 Figure 3 Figure 5 Figure 6 PMID:7512530

  7. The Synthetic Cannabinoid R(+)WIN55,212-2 Augments InterferonExpression via Peroxisome Proliferator-activated Receptor-α*

    PubMed Central

    Downer, Eric J.; Clifford, Eileen; Amu, Sylvie; Fallon, Padraic G.; Moynagh, Paul N.

    2012-01-01

    We have demonstrated that R(+)WIN55,212-2, a synthetic cannabinoid that possesses cannabimimetic properties, acts as a novel regulator of Toll-like receptor 3 (TLR3) signaling to interferon (IFN) regulatory factor 3 (IRF3) activation and IFN-β expression, and this is critical for manifesting its protective effects in a murine multiple sclerosis model. Here we investigated the role of peroxisome proliferator-activated receptor-α (PPARα) in mediating the effects of R(+)WIN55,212-2 on this pathway. Data herein demonstrate that the TLR3 agonist poly(I:C) promotes IFN-β expression and R(+)WIN55,212-2 enhances TLR3-induced IFN-β expression in a stereoselective manner via PPARα. R(+)WIN55,212-2 promotes increased transactivation and expression of PPARα. Using the PPARα antagonist GW6471, we demonstrate that R(+)WIN55,212-2 acts via PPARα to activate JNK, activator protein-1, and positive regulatory domain IV to transcriptionally regulate the IFN-β promoter. Furthermore, GW6471 ameliorated the protective effects of R(+)WIN55,212-2 during the initial phase of experimental autoimmune encephalomyelitis. Overall, these findings define PPARα as an important mediator in manifesting the effects of R(+)WIN55,212-2 on the signaling cascade regulating IFN-β expression. The study adds to our molecular appreciation of potential therapeutic effects of R(+)WIN55,212-2 in multiple sclerosis. PMID:22654113

  8. Chronic allograft nephropathy: expression and localization of PAI-1 and PPAR-gamma.

    PubMed

    Revelo, Monica P; Federspiel, Charles; Helderman, Harold; Fogo, Agnes B

    2005-12-01

    Chronic allograft nephropathy (CAN) is a major cause of loss of renal allografts. Mechanisms postulated to be involved include sequelae of rejection, warm ischaemia time, drug toxicity, ongoing hypertension and dyslipidaemia. Plasminogen activator inhibitor-1 (PAI-1) is implicated not only in thrombosis, but also in fibrosis, by inhibiting matrix degradation, and is expressed in renal parenchymal cells as well as in macrophages. Peroxisome proliferator-activated receptor-gamma (PPAR-gamma) is a member of the steroid receptor superfamily, and plays a major beneficial role in lipid regulation, insulin sensitivity and macrophage function, factors that may play a role in CAN. We therefore studied the expression of these molecules in CAN. All renal biopsy/nephrectomy files from Vanderbilt and Nashville VAMC from a 6 year period were reviewed to identify all renal transplant biopsies or nephrectomies more than 6 months after transplant with CAN. CAN was defined as fibrosis in the graft, vascular, interstitial or glomerular. All cases were scored for severity of fibrosis in vasculature (0-3 scale), glomeruli (% affected with either segmental and/or global sclerosis) and interstitial fibrosis (% of sample affected). PAI-1 and PPAR-gamma immunostaining was assessed on a 0-3 scale in glomeruli, vessels and tubules. Eighty-two patients with a total of 106 samples met entry criteria. The population consisted of 59 Caucasians and 23 African-Americans; 49 males, 33 females with average age 37.9+/-1.7 years. Average time after transplant at time of biopsy was 60.5+/-4.9 months (range 7-229). Glomerulosclerosis extent in CAN was on average 26.5+/-2.4% compared with 3.6+/-1.2% in normal control kidneys from native kidney cancer nephrectomies and 0% in transplanted kidney biopsies from patients obtained > or =6 months after transplantation without CAN. Native control kidneys showed mild interstitial fibrosis (8.0+/-1.2%), whereas transplant controls showed very minimal fibrosis (2

  9. Identification and characterization of TF1(phox), a DNA-binding protein that increases expression of gp91(phox) in PLB985 myeloid leukemia cells.

    PubMed

    Eklund, E A; Kakar, R

    1997-04-04

    The CYBB gene encodes gp91(phox), the heavy chain of the phagocyte-specific NADPH oxidase. CYBB is transcriptionally inactive until the promyelocyte stage of myelopoiesis, and in mature phagocytes, expression of gp91(phox) is further increased by interferon-gamma (IFN-gamma) and other inflammatory mediators. The CYBB promoter region contains several lineage-specific cis-elements involved in the IFN-gamma response. We screened a leukocyte cDNA expression library for proteins able to bind to one of these cis-elements (-214 to -262 base pairs) and identified TF1(phox), a protein with sequence-specific binding to the CYBB promoter. Electrophoretic mobility shift assay with nuclear proteins from a variety of cell lines demonstrated binding of a protein to the CYBB promoter that was cross-immunoreactive with TF1(phox). DNA binding of this protein was increased by IFN-gamma treatment in the myeloid cell line PLB985, but not in the non-myeloid cell line HeLa. Overexpression of recombinant TF1(phox) in PLB985 cells increased endogenous gp91(phox) message abundance, but did not lead to cellular differentiation. Overexpression of TF1(phox) in myeloid leukemia cell lines increased reporter gene expression from artificial promoter constructs containing CYBB promoter sequence. These data suggested that TF1(phox) increased expression of gp91(phox).

  10. IL-1 or TNF receptor gene deletion delays onset of encephalopathy and attenuates brain edema in experimental acute liver failure.

    PubMed

    Bémeur, Chantal; Qu, Hong; Desjardins, Paul; Butterworth, Roger F

    2010-01-01

    Previous reports suggested that brain-derived proinflammatory cytokines are involved in the pathogenesis of hepatic encephalopathy (HE) and brain edema in acute liver failure (ALF). To further address this issue, expression of interleukin-1beta (IL-1beta), tumor necrosis factor-alpha (TNF-alpha) and interferon-gamma (IFN-gamma) mRNAs were measured in the brains of mice with acute liver failure resulting from exposure to azoxymethane. In addition, time to severe encephalopathy (coma) was assessed in mice lacking genes coding for interferon-gamma, the tumor necrosis factor receptor-1 or the interleukin-1 type 1 receptor. Interleukin-1beta, tumor necrosis factor-alpha and interferon-gamma expression were quantified using RT-PCR. Significant increases in interleukin-1beta and tumor necrosis factor-alpha mRNA were observed in the frontal cortex of azoxymethane-treated wild-type mice at coma stages of encephalopathy. Interferon-gamma, however, could not be detected in the brains of these animals. Onset of severe encephalopathy (coma) and brain edema in ALF mice were significantly delayed in interleukin-1 type 1 receptor or tumor necrosis factor receptor-1 knockout mice. Deletion of the interferon-gamma gene, on the other hand, had no significative effect on the neurological status or brain water content of acute liver failure mice. These results demonstrate that toxic liver injury resulting from exposure to azoxymethane is associated with selective induction of proinflammatory cytokines in the brain and that deletion of tumor necrosis factor receptor-1 or interlukin-1 type 1 receptor delays the onset of coma and brain edema in this model of acute liver failure. These findings further support a role for selective brain-derived cytokines in the pathogenesis of the cerebral complications in acute liver failure and suggest that anti-inflammatory strategies could be beneficial in their prevention. Copyright 2009 Elsevier Ltd. All rights reserved.

  11. Differentially Expressed Genes Associated with Low-Dose Gamma Radiation

    NASA Astrophysics Data System (ADS)

    Hegyesi, Hargita; Sándor, Nikolett; Schilling, Boglárka; Kis, Enikő; Lumniczky, Katalin; Sáfrány, Géza

    We have studied low dose radiation induced gene expression alterations in a primary human fibroblast cell line using Agilent's whole human genome microarray. Cells were irradiated with 60Co γ-rays (0; 0.1; 0.5 Gy) and 2 hours later total cellular RNA was isolated. We observed differential regulation of approximately 300-500 genes represented on the microarray. Of these, 126 were differentially expressed at both doses, among them significant elevation of GDF-15 and KITLG was confirmed by qRT-PCR. Based on the transcriptional studies we selected GDF-15 to assess its role in radiation response, since GDF-15 is one of the p53 gene targets and is believed to participate in mediating p53 activities. First we confirmed gamma-radiation induced dose-dependent changes in GDF-15 expression by qRT-PCR. Next we determined the effect of GDF-15 silencing on radiosensitivity. Four GDF-15 targeting shRNA expressing lentiviral vectors were transfected into immortalized human fibroblast cells. We obtained efficient GDF-15 silencing in one of the four constructs. RNA interference inhibited GDF-15 gene expression and enhanced the radiosensitivity of the cells. Our studies proved that GDF-15 plays an essential role in radiation response and may serve as a promising target in radiation therapy.

  12. Controlling nuclear JAKs and STATs for specific gene activation by IFN{gamma}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Noon-Song, Ezra N.; Ahmed, Chulbul M.; Dabelic, Rea

    2011-07-08

    Highlights: {yields} Gamma interferon (IFN{gamma}) and its receptor subunit, IFNGR1, interact with the promoter region of IFN{gamma}-associated genes along with transcription factor STAT1{alpha}. {yields} We show that activated Janus kinases pJAK2 and pJAK1 also associate with IFNGR1 in the nucleus. {yields} The activated Janus kinases are responsible for phosphorylation of tyrosine 41 on histone H3, an important epigenetic event for specific gene activation. -- Abstract: We previously showed that gamma interferon (IFN{gamma}) and its receptor subunit, IFNGR1, interacted with the promoter region of IFN{gamma}-activated genes along with transcription factor STAT1{alpha}. Recent studies have suggested that activated Janus kinases pJAK2 andmore » pJAK1 also played a role in gene activation by phosphorylation of histone H3 on tyrosine 41. This study addresses the question of the role of activated JAKs in specific gene activation by IFN{gamma}. We carried out chromatin immunoprecipitation (ChIP) followed by PCR in IFN{gamma} treated WISH cells and showed association of pJAK1, pJAK2, IFNGR1, and STAT1 on the same DNA sequence of the IRF-1 gene promoter. The {beta}-actin gene, which is not activated by IFN{gamma}, did not show this association. The movement of activated JAK to the nucleus and the IRF-1 promoter was confirmed by the combination of nuclear fractionation, confocal microscopy and DNA precipitation analysis using the biotinylated GAS promoter. Activated JAKs in the nucleus was associated with phosphorylated tyrosine 41 on histone H3 in the region of the GAS promoter. Unphosphorylated JAK2 was found to be constitutively present in the nucleus and was capable of undergoing activation in IFN{gamma} treated cells, most likely via nuclear IFNGR1. Association of pJAK2 and IFNGR1 with histone H3 in IFN{gamma} treated cells was demonstrated by histone H3 immunoprecipitation. Unphosphorylated STAT1 protein was associated with histone H3 of untreated cells. IFN{gamma

  13. Combination alpha-interferon and lamivudine therapy for alpha-interferon-resistant chronic hepatitis B infection: results of a pilot study.

    PubMed

    Mutimer, D; Naoumov, N; Honkoop, P; Marinos, G; Ahmed, M; de Man, R; McPhillips, P; Johnson, M; Williams, R; Elias, E; Schalm, S

    1998-06-01

    Alpha-interferon achieves seroconversion in about one third of naive patients. Attempts to achieve seroconversion in patients who have previously failed alpha-interferon have proved disappointing. Combination chemotherapy (alpha-interferon with a nucleoside analogue) might provide a treatment alternative for these patients. We have undertaken a phase 2 study in 20 patients who had previously failed at least one course of alpha-interferon. The study was designed to assess the safety, tolerability and efficacy of the combination. All patients were treated for 16 weeks with alpha-interferon in combination with 12 or 16 weeks of Lamivudine (3'TC). Patients were followed for 16 weeks post-treatment. Pharmacokinetic studies were performed to identify/exclude significant pharmacokinetic drug interaction. The combination was well tolerated, and side-effects of the combination were indistinguishable from the recognised side-effects of alpha-interferon. Pharmacokinetic studies performed on days 1 and 29 did not show any significant interaction. All patients achieved HBV DNA clearance during treatment, but 19 relapsed at the end of treatment. HBeAg/anti-HBe seroconversion was observed for four patients, but was sustained for a single patient (who also had sustained DNA clearance). Combination therapy with alpha-interferon and lamivudine given for 16 weeks appears safe and is well tolerated. However, for this group of patients who had previously failed interferon monotherapy, the efficacy of combination interferon/lamivudine therapy appears disappointing, and other treatment strategies should be investigated.

  14. Oxidized LDL binding to LOX-1 upregulates VEGF expression in cultured bovine chondrocytes through activation of PPAR-{gamma}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kanata, Sohya; Akagi, Masao; Nishimura, Shunji

    It has been reported that vascular endothelial growth factor (VEGF) and its receptors play an important role in the destruction of articular cartilage in osteoarthritis through increased production of matrix metalloproteinases. We investigated whether the oxidized low-density lipoprotein (ox-LDL) binding to lectin-like ox-LDL receptor-1 (LOX-1) upregulates VEGF expression in cultured bovine articular chondrocytes (BACs). Ox-LDL markedly increased VEGF mRNA expression and protein release in time- and dose-dependent manners, which was significantly suppressed by anti-LOX-1 antibody pretreatment. Activation of peroxisome proliferator-activated receptor (PPAR)-{gamma} was evident in BACs with ox-LDL addition and was attenuated by anti-LOX-1 antibody. The specific PPAR-{gamma} inhibitor GW9662more » suppressed ox-LDL-induced VEGF expression. These results suggest that the ox-LDL/LOX-1 system upregulates VEGF expression in articular cartilage, at least in part, through activation of PPAR-{gamma} and supports the hypothesis that ox-LDL is involved in cartilage degradation via LOX-1.« less

  15. Constitutive Smad signaling and Smad-dependent collagen gene expression in mouse embryonic fibroblasts lacking peroxisome proliferator-activated receptor-{gamma}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ghosh, Asish K; Wei, Jun; Wu, Minghua

    2008-09-19

    Transforming growth factor-{beta} (TGF-{beta}), a potent inducer of collagen synthesis, is implicated in pathological fibrosis. Peroxisome proliferator-activated receptor-{gamma} (PPAR-{gamma}) is a nuclear hormone receptor that regulates adipogenesis and numerous other biological processes. Here, we demonstrate that collagen gene expression was markedly elevated in mouse embryonic fibroblasts (MEFs) lacking PPAR-{gamma} compared to heterozygous control MEFs. Treatment with the PPAR-{gamma} ligand 15d-PGJ{sub 2} failed to down-regulate collagen gene expression in PPAR-{gamma} null MEFs, whereas reconstitution of these cells with ectopic PPAR-{gamma} resulted in their normalization. Compared to control MEFs, PPAR-{gamma} null MEFs displayed elevated levels of the Type I TGF-{beta} receptor (T{beta}RI),more » and secreted more TGF-{beta}1 into the media. Furthermore, PPAR-{gamma} null MEFs showed constitutive phosphorylation of cellular Smad2 and Smad3, even in the absence of exogenous TGF-{beta}, which was abrogated by the ALK5 inhibitor SB431542. Constitutive Smad2/3 phosphorylation in PPAR-{gamma} null MEFs was associated with Smad3 binding to its cognate DNA recognition sequences, and interaction with coactivator p300 previously implicated in TGF-{beta} responses. Taken together, these results indicate that loss of PPAR-{gamma} in MEFs is associated with upregulation of collagen synthesis, and activation of intracellular Smad signal transduction, due, at least in part, to autocrine TGF-{beta} stimulation.« less

  16. PPAR{alpha} deficiency augments a ketogenic diet-induced circadian PAI-1 expression possibly through PPAR{gamma} activation in the liver

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Oishi, Katsutaka, E-mail: k-ooishi@aist.go.jp; Uchida, Daisuke; Graduate School of Life and Environmental Sciences, University of Tsukuba, Tsukuba, Ibaraki

    Research highlights: {yields} PPAR{alpha} deficiency augments a ketogenic diet-induced circadian PAI-1 expression. {yields} Hepatic expressions of PPAR{gamma} and PCG-1{alpha} are induced by a ketogenic diet. {yields} PPAR{gamma} antagonist attenuates a ketogenic diet-induced PAI-1 expression. {yields} Ketogenic diet advances the phase of circadian clock in a PPAR{alpha}-independent manner. -- Abstract: An increased level of plasminogen activator inhibitor-1 (PAI-1) is considered a risk factor for cardiovascular diseases, and PAI-1 gene expression is under the control of molecular circadian clocks in mammals. We recently showed that PAI-1 expression is augmented in a phase-advanced circadian manner in mice fed with a ketogenic diet (KD).more » To determine whether peroxisome proliferator-activated receptor {alpha} (PPAR{alpha}) is involved in hypofibrinolytic status induced by a KD, we examined the expression profiles of PAI-1 and circadian clock genes in PPAR{alpha}-null KD mice. Chronic administration of bezafibrate induced the PAI-1 gene expression in a PPAR{alpha}-dependent manner. Feeding with a KD augmented the circadian expression of PAI-1 mRNA in the hearts and livers of wild-type (WT) mice as previously described. The KD-induced mRNA expression of typical PPAR{alpha} target genes such as Cyp4A10 and FGF21 was damped in PPAR{alpha}-null mice. However, plasma PAI-1 concentrations were significantly more elevated in PPAR{alpha}-null KD mice in accordance with hepatic mRNA levels. These observations suggest that PPAR{alpha} activation is dispensable for KD-induced PAI-1 expression. We also found that hyperlipidemia, fatty liver, and the hepatic expressions of PPAR{gamma} and its coactivator PCG-1{alpha} were more effectively induced in PPAR{alpha}-null, than in WT mice on a KD. Furthermore, KD-induced hepatic PAI-1 expression was significantly suppressed by supplementation with bisphenol A diglycidyl ether, a PPAR{gamma} antagonist, in both WT and PPAR

  17. Pharmacokinetic and pharmacodynamic characterization of a new formulation containing synergistic proportions of interferons alpha-2b and gamma (HeberPAG®) in patients with mycosis fungoides: an open-label trial

    PubMed Central

    2012-01-01

    Background The synergistic combination of interferon (IFN) alpha-2b and IFN gamma results in more potent in vitro biological effects mediated by both IFNs. The aim of this investigation was to evaluate by first time the pharmacokinetics and pharmacodynamics of this combination in patients with mycosis fungoides. Methods An exploratory, prospective, open-label clinical trial was conducted. Twelve patients, both genders, 18 to 75 years-old, with mycosis fungoides at stages IB to III, were eligible for the study. All of them received intramuscularly a single high dose (23 × 106 IU) of a novel synergistic IFN mixture (HeberPAG®) for pharmacokinetic and pharmacodynamic studies. Serum IFN alpha-2b and IFN gamma concentrations were measured during 96 hours by commercial enzyme immunoassays (EIA) specific for each IFN. Other blood IFN-inducible markers and laboratory variables were used as pharmacodynamics and safety criteria. Results The pharmacokinetic evaluation by EIA yielded a similar pattern for both IFNs that are also in agreement with the well-known described profiles for these molecules when these are administered separately. The average values for main parameters were: Cmax: 263 and 9.3 pg/mL; Tmax: 9.5 and 6.9 h; AUC: 4483 and 87.5 pg.h/mL, half-life (t1/2): 4.9 and 13.4 h; mean residence time (MRT): 13.9 and 13.5 h, for serum IFN alpha-2b and IFN gamma, respectively. The pharmacodynamic variables were strongly stimulated by simultaneous administration of both IFNs: serum neopterin and beta-2 microglobulin levels (β2M), and stimulation of 2’-5’ oligoadenylate synthetase (OAS1) mRNA expression. The most encouraging data was the high increment of serum neopterin, 8.0 ng/mL at 48 h, not been described before for any unmodified or pegylated IFN. Additionally, β2M concentration doubled the pre-dose value at 24–48 hours. For both variables the values remained clearly upper baseline levels at 96 hours. Conclusions HeberPAG®possesses improved

  18. Identification and characterization of novel peroxisome proliferator-activated receptor-gamma (PPAR-gamma) transcriptional variants in pig and human.

    PubMed

    Omi, T; Brenig, B; Spilar Kramer, S; Iwamoto, S; Stranzinger, G; Neuenschwander, S

    2005-04-01

    The peroxisome proliferator-activated receptor-gamma (PPAR-gamma) is a member of the steroid/thyroid/retinoid receptor superfamily, and is primarily expressed in fat tissue. To date, two major PPAR-gamma isoforms have been identified in pig, PPAR-gamma1 and PPAR-gamma2. Porcine PPAR-gamma1a consists of two leader exons, designated A1 and A2, followed by six exons containing the open reading frame. Here, we report the isolation and characterization of three novel PPAR-gamma1 transcripts. PPAR-gamma1b is derived from exon A1, with exon A2 spliced out. PPAR-gamma1c and PPAR-gamma1d are derived from the new exon, A', containing exon A2 (gamma1c) or without exon A2 (gamma1d). Based on PCR analysis of PAC clones that included sequences from the 5'-untranslated region of the PPAR-gamma gene, the new A' exon is located between the known exons A1 and A2. We also isolated the human homologue to exon A', as well as the two new PPAR-gamma1c and -gamma1d splice variants, from human adipose tissue. Studies of the expression of porcine PPAR-gamma by real time reverse transcription-polymerase chain reaction analysis show that transcripts derived from exon A1 were not expressed at significantly different levels in visceral fat (lamina subserosa) or subcutaneous fat (back fat, inner and outer layer). In contrast, exon A'-derived transcripts were expressed at progressively higher levels in the inner and outer layers of subcutaneous fat than in visceral fat. The same expression pattern was also observed for PPAR-gamma2. We hypothesize that there are three promoters, which differentially regulate PPAR-gamma1 and PPAR-gamma2 gene expression, depending on the specific localization of the fat tissue.

  19. α-Synuclein Activates Innate Immunity but Suppresses InterferonExpression in Murine Astrocytes.

    PubMed

    Wang, Jintang; Chen, Zheng; Walston, Jeremy; Gao, Peisong; Gao, Maolong; Leng, Sean X

    2018-05-19

    Glial activation and neuroinflammation contribute to pathogenesis of neurodegenerative diseases, linked to neuron loss and dysfunction. α-Synuclein (α-syn), as a metabolite of neuron, can induce microglia activation to trigger innate immune response. However, whether α-syn, as well as its mutants (A53T, A30P and E46K), induces astrocyte activation and inflammatory response is not fully elucidated. In this study, we used A53T mutant and wildtype α-syns to stimulate primary astrocytes in dose- and time-dependent manners (0.5, 2, 8 and 20 μg/mL for 24 hour or 3, 12, 24 and 48 hour at 2 μg/mL), and evaluated activation of several canonical inflammatory pathway components. The results showed that A53T mutant or wildtype α-syn significantly upregulated mRNA expression of toll-like receptor (TLR)2, TLR3, nuclear factor-κB and interleukin (IL)-1β, displaying a pattern of positive dose-effect correlation or negative time-effect correlation. Such upregulation was confirmed at protein levels of TLR2 (at 20 μg/mL), TLR3 (at most doses) and IL-1β (at 3 hour) by western blotting. Blockage of TLR2 other than TLR4 inhibited TLR3 and IL-1β mRNA expressions. By contrast, interferon (IFN)-γ was significantly downregulated at mRNA, protein and protein release levels, especially at high concentrations of α-syns or early time-points. These findings indicate that α-syn was a TLRs-mediated immunogenic agent (A53T mutant stronger than wildtype α-syn). The stimulation patterns suggest that persistent release and accumulation of α-syn is required for maintenance of innate immunity activation, and IFN-γ expression inhibition by α-syn suggests a novel immune molecule interaction mechanism underlying pathogenesis of neurodegenerative diseases. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  20. Risk of tuberculosis among air passengers estimated by interferon gamma release assay: survey of contact investigations, Japan, 2012 to 2015

    PubMed Central

    Ota, Masaki; Kato, Seiya

    2017-01-01

    Although the World Health Organization recommends contact investigations around air travel-associated sputum smear-positive tuberculosis (TB) patients, evidence suggests that the information thus obtained may have overestimated the risk of TB infection because it involved some contacts born in countries with high TB burden who were likely to have been infected with TB in the past, or because tuberculin skin tests were used, which are less specific than the interferon gamma release assay (IGRA) particularly in areas where Bacillus Calmette-Guérin (BCG) vaccination coverage is high. We conducted a questionnaire survey on air travel-associated TB contact investigations in local health offices of Japan from 2012 to 2015, focusing on IGRA positivity. Among 651 air travel-associated TB contacts, average positivity was 3.8% (95% confidence interval (CI): 2.5–5.6) with a statistically significant increasing trend with older age (p < 0.0094). Positivity among 0–34 year-old contacts was 1.0% (95% CI: 0.12–3.5%), suggesting their risk of TB infection is as small as among Japanese young adults with low risk of TB infection (positivity: 0.85–0.90%). Limiting the contact investigation to fewer passengers (within two seats surrounding the index case, rather than two rows) seems reasonable in the case of aircraft with many seats per row. PMID:28367799

  1. Interferon Lambda: A New Sword in Cancer Immunotherapy

    PubMed Central

    Lasfar, Ahmed; Abushahba, Walid; Balan, Murugabaskar; Cohen-Solal, Karine A.

    2011-01-01

    The discovery of the interferon-lambda (IFN-λ) family has considerably contributed to our understanding of the role of interferon not only in viral infections but also in cancer. IFN-λ proteins belong to the new type III IFN group. Type III IFN is structurally similar to type II IFN (IFN-γ) but functionally identical to type I IFN (IFN-α/β). However, in contrast to type I or type II IFNs, the response to type III IFN is highly cell-type specific. Only epithelial-like cells and to a lesser extent some immune cells respond to IFN-λ. This particular pattern of response is controlled by the differential expression of the IFN-λ receptor, which, in contrast to IFN-α, should result in limited side effects in patients. Recently, we and other groups have shown in several animal models a potent antitumor role of IFN-λ that will open a new challenging era for the current IFN therapy. PMID:22190970

  2. Behavior of a cloned murine interferon alpha/beta receptor expressed in homospecific or heterospecific background.

    PubMed

    Uzé, G; Lutfalla, G; Bandu, M T; Proudhon, D; Mogensen, K E

    1992-05-15

    A murine interferon (IFN) alpha/beta receptor was cloned from the IFN-sensitive L1210 cell line on the basis of its homology with the human receptor. A combination of methods that includes the screening of random-primed and oligo(dT)-primed cDNA libraries and polymerase chain reactions with a single-side specificity was used. At the amino acid level, the murine IFN-alpha/beta shows 46% identity with its human counterpart. Both human WISH cells presenting a low sensitivity to mouse IFN and a murine L1210 mutant subline that does not express the receptor have been stably transfected with the murine IFN-alpha/beta receptor. Whereas transfected human cells became sensitive to a limited number of mouse IFN-alpha/beta subtypes, the transfected murine L1210 mutant was found to be fully complemented and became sensitive to all mouse IFN-alpha/beta subtypes tested, including those that were not active on transfected human cells. These results strongly suggest that the receptor described here is implicated in the mediation of the activities of all murine IFN-alpha/beta subtypes.

  3. Analyzing the Utilization of Interferon-Gamma Screening for Tuberculosis at Recruit Training Command, Great Lakes

    DTIC Science & Technology

    2006-05-31

    the project through a business case analysis conducted on this same subject. CAPT Monestersky, Preventive Medicine; LCDR Jacobs, Occupational Medicine...TB and LTBI (Taylor, Nolan, & Blumberg , Interferon-y screening for TB 8 2005). They are based on science founded in the 1 9 th century. The current...identify individuals who may not be suitable for service. For the majority who are suitable, the "P" days allow time to complete necessary business

  4. RNA editing is induced by type I interferon in esophageal squamous cell carcinoma.

    PubMed

    Zhang, Jinyao; Chen, Zhaoli; Tang, Zefang; Huang, Jianbing; Hu, Xueda; He, Jie

    2017-07-01

    In recent years, abnormal RNA editing has been shown to play an important role in the development of esophageal squamous cell carcinoma, as such abnormal editing is catalyzed by ADAR (adenosine deaminases acting on RNA). However, the regulatory mechanism of ADAR1 in esophageal squamous cell carcinomas remains largely unknown. In this study, we investigated ADAR1 expression and its association with RNA editing in esophageal squamous cell carcinomas. RNA sequencing applied to esophageal squamous cell carcinoma clinical samples showed that ADAR1 expression was correlated with the expression of STAT1, STAT2, and IRF9. In vitro experiments showed that the abundance of ADAR1 protein was associated with the induced activation of the JAK/STAT pathway by type I interferon. RNA sequencing results showed that treatment with type I interferon caused an increase in the number and degree of RNA editing in esophageal squamous cell carcinoma cell lines. In conclusion, the activation of the JAK/STAT pathway is a regulatory mechanism of ADAR1 expression and causes abnormal RNA editing profile in esophageal squamous cell carcinoma. This mechanism may serve as a new target for esophageal squamous cell carcinoma therapy.

  5. Essential Cell-Autonomous Role for Interferon (IFN) Regulatory Factor 1 in IFN-γ-Mediated Inhibition of Norovirus Replication in Macrophages

    PubMed Central

    Maloney, Nicole S.; Thackray, Larissa B.; Goel, Gautam; Hwang, Seungmin; Duan, Erning; Vachharajani, Punit; Xavier, Ramnik

    2012-01-01

    Noroviruses (NVs) cause the majority of cases of epidemic nonbacterial gastroenteritis worldwide and contribute to endemic enteric disease. However, the molecular mechanisms responsible for immune control of their replication are not completely understood. Here we report that the transcription factor interferon regulatory factor 1 (IRF-1) is required for control of murine NV (MNV) replication and pathogenesis in vivo. This led us to studies documenting a cell-autonomous role for IRF-1 in gamma interferon (IFN-γ)-mediated inhibition of MNV replication in primary macrophages. This role of IRF-1 in the inhibition of MNV replication by IFN-γ is independent of IFN-αβ signaling. While the signal transducer and activator of transcription STAT-1 was also required for IFN-γ-mediated inhibition of MNV replication in vitro, class II transactivator (CIITA), interferon regulatory factor 3 (IRF-3), and interferon regulatory factor 7 (IRF-7) were not required. We therefore hypothesized that there must be a subset of IFN-stimulated genes (ISGs) regulated by IFN-γ in a manner dependent only on STAT-1 and IRF-1. Analysis of transcriptional profiles of macrophages lacking various transcription factors confirmed this hypothesis. These studies identify a key role for IRF-1 in IFN-γ-dependent control of norovirus infection in mice and macrophages. PMID:22973039

  6. Rapid activation of the interferon system in vivo.

    PubMed Central

    Dianzani, F; Gullino, P; Baron, S

    1978-01-01

    Experiments were carried out to study the kinetics of local interferon production in the subcutaneous tissues of rats stimulated with Newcastle disease virus. Specifically, the interferon produced and released in the extracellular fluids was collected at various intervals of time in micropore chambers implanted into the subcutaneous tissue of rats. Interferon was detected at moderate titers 1 h after induction, and it was present at high titer at 2 h. The interferon levels remained remarkably high in the samples collected after 3, 5, and 24 h, and in some rats it was still detectable after 48 and 72 h. Since control experiments showed that it requires 2 to 3 h for interferon to penetrate the chambers, it may be concluded that high concentrations of interferon are present in the extracellular fluid within 1 h of induction. The evaluation of the kinetics of production and of the concentrations attained in the extracellular fluid suggests that in a solid tissue a cell infected by a potent interferon inducer may produce interferon early enough and in sufficient quantity to protect neighboring cells before the production of progeny virions. PMID:669799

  7. Different Expression of Interferon-Stimulated Genes in Response to HIV-1 Infection in Dendritic Cells Based on Their Maturation State

    PubMed Central

    Calonge, Esther; Bermejo, Mercedes; Diez-Fuertes, Francisco; Mangeot, Isabelle; González, Nuria; Coiras, Mayte; Jiménez Tormo, Laura; García-Perez, Javier; Dereuddre-Bosquet, Nathalie; Le Grand, Roger

    2017-01-01

    ABSTRACT Dendritic cells (DCs) are professional antigen-presenting cells whose functions are dependent on their degree of differentiation. In their immature state, DCs capture pathogens and migrate to the lymph nodes. During this process, DCs become resident mature cells specialized in antigen presentation. DCs are characterized by a highly limiting environment for human immunodeficiency virus type 1 (HIV-1) replication due to the expression of restriction factors such as SAMHD1 and APOBEC3G. However, uninfected DCs capture and transfer viral particles to CD4 lymphocytes through a trans-enhancement mechanism in which chemokines are involved. We analyzed changes in gene expression with whole-genome microarrays when immature DCs (IDCs) or mature DCs (MDCs) were productively infected using Vpx-loaded HIV-1 particles. Whereas productive HIV infection of IDCs induced expression of interferon-stimulated genes (ISGs), such induction was not produced in MDCs, in which a sharp decrease in ISG- and CXCR3-binding chemokines was observed, lessening trans-infection of CD4 lymphocytes. Similar patterns of gene expression were found when DCs were infected with HIV-2 that naturally expresses Vpx. Differences were also observed under conditions of restrictive HIV-1 infection, in the absence of Vpx. ISG expression was not modified in IDCs, whereas an increase of ISG- and CXCR3-binding chemokines was observed in MDCs. Overall these results suggest that sensing and restriction of HIV-1 infection are different in IDCs and MDCs. We propose that restrictive infection results in increased virulence through different mechanisms. In IDCs avoidance of sensing and induction of ISGs, whereas in MDCs increased production of CXCR3-binding chemokines, would result in lymphocyte attraction and enhanced infection at the immune synapse. IMPORTANCE In this work we describe for the first time the activation of a different genetic program during HIV-1 infection depending on the state of maturation of

  8. Interleukin-18, Interferon-γ, IP-10, and Mig Expression in Epstein-Barr Virus-Induced Infectious Mononucleosis and Posttransplant Lymphoproliferative Disease

    PubMed Central

    Setsuda, Joyce; Teruya-Feldstein, Julie; Harris, Nancy L.; Ferry, Judith A.; Sorbara, Lynn; Gupta, Ghanshyam; Jaffe, Elaine S.; Tosato, Giovanna

    1999-01-01

    T cell immunodeficiency plays an important role in the pathogenesis of posttransplant lymphoproliferative disease (PTLD) by permitting the unbridled expansion of Epstein-Barr virus (EBV)-infected B lymphocytes. However, factors other than T cell function may contribute to PTLD pathogenesis because PTLD infrequently develops even in the context of severe T cell immunodeficiency, and athymic mice that are T-cell-immunodeficient can reject EBV-immortalized cells. Here we report that PTLD tissues express significantly lower levels of IL-18, interferon-γ (IFN-γ), Mig, and RANTES compared to lymphoid tissues diagnosed with acute EBV-induced infectious mononucleosis, as assessed by semiquantitative RT-PCR analysis. Other cytokines and chemokines are expressed at similar levels. Immunohistochemistry confirmed that PTLD tissues contain less IL-18 and Mig protein than tissues with infectious mononucleosis. IL-18, primarily a monocyte product, promotes the secretion of IFN-γ, which stimulates Mig and RANTES expression. Both IL-18 and Mig display antitumor activity in mice involving inhibition of angiogenesis. These results document greater expression of IL-18, IFN-γ, Mig, and RANTES in lymphoid tissues with acute EBV-induced infectious mononucleosis compared to tissues with PTLD and raise the possibility that these mediators participate in critical host responses to EBV infection. PMID:10393857

  9. Measles virus C protein suppresses gamma-activated factor formation and virus-induced cell growth arrest

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yokota, Shin-ichi; Okabayashi, Tamaki; Fujii, Nobuhiro, E-mail: fujii@sapmed.ac.j

    2011-05-25

    Measles virus (MeV) produces two accessory proteins, V and C, from the P gene. These accessory proteins have been reported to contribute to efficient virus proliferation through the modulation of host cell events. Our previous paper described that Vero cell-adapted strains of MeV led host cells to growth arrest through the upregulation of interferon regulatory factor 1 (IRF-1), and wild strains did not. In the present study, we found that C protein expression levels varied among MeV strains in infected SiHa cells. C protein levels were inversely correlated with IRF-1 expression levels and with cell growth arrest. Forced expression ofmore » C protein released cells from growth arrest. C-deficient recombinant virus efficiently upregulated IRF-1 and caused growth arrest more efficiently than the wild-type virus. C protein preferentially bound to phosphorylated STAT1 and suppressed STAT1 dimer formation. We conclude that MeV C protein suppresses IFN-{gamma} signaling pathway via inhibition of phosphorylated STAT1 dimerization.« less

  10. Lymphocytes from wasted mice express enhanced spontaneous and {gamma}-ray-induced apoptosis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Woloschak, G.E.; Chang-Liu, Chin-Mei; Chung, Jen

    1993-09-01

    Mice bearing the autosomal recessive mutation wasted (wst/wst) display a disease pattern including faulty repair of DNA damage in lymphocytes after radiation exposure, neurologic abnormalities, and immunodeficiency. Many of the features of this mouse model have suggested a premature or increased spontaneous frequency of apoptosis in thymocytes; past work has shown an inability to establish cultured T cell lines, an abnormally high death rate of stimulated T cells in culture, and an increased sensitivity of T cells to the killing effects of ionizing radiations in wst/wst mice relative to controls. The experiments reported here were designed to examine splenic andmore » thymic lymphocytes from wasted and control mice for signs of early apoptosis. Our results revealed enhanced expression of Rp-8 mRNA (associated with apoptosis) in thymic lymphocytes and reduced expression in splenic lymphocytes of wst/wst mice relative to controls; expression of Rp-2 and Td-30 mRNA (induced during apoptosis) were not detectable in spleen or thymus. Higher spontaneous DNA fragmentation was observed in wasted mice than in controls; however, {gamma}-ray-induced DNA fragmentation peaked at a lower dose and occurred to a greater extent in wasted mice relative to controls. These results provide evidence for high spontaneous and {gamma}-ray-induced apoptosis in T cells of wasted mice as a mechanism underlying the observed lymphocyte and DNA repair abnormalities.« less

  11. PARP-1 regulates the expression of caspase-11

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yoo, Lang; Hong, Seokheon; Shin, Ki Soon

    2011-05-13

    Highlights: {yields} Knockdown of PARP-1 suppresses the LPS-induced expression of caspase-11. {yields} Knockdown of PARP-1 suppresses the caspase-11 promoter activity following LPS stimulation. {yields} PARP-1 is recruited to the caspase-11 promoter region containing NF-{kappa}B-binding sites following LPS stimulation. {yields} PARP-1 inhibitors cannot suppress the caspase-11 induction. {yields} PARP-1 does not suppress IFN-{gamma}-induced expression of caspase-11. -- Abstract: Poly(ADP-ribose) polymerase-1 (PARP-1) is a multifunctional enzyme that regulates DNA repair, cell death and transcription of inflammatory proteins. In the present study, we present evidence that PARP-1 regulates the expression of caspase-11 following lipopolysaccharide (LPS) stimulation. Knockdown of PARP-1 suppressed the LPS-induced expressionmore » of caspase-11 at both mRNA and protein levels as well as caspase-11 promoter activity. Importantly, PARP-1 was recruited to the caspase-11 promoter region containing predicted nuclear factor (NF)-{kappa}B-binding sites when examined by chromatin immunoprecipitation assay. However, knockdown of PARP-1 did not suppress the expression of caspase-11 induced by interferon-{gamma} that activates signal transducer and activator of transcription 1 but not NF-{kappa}B. PARP-1 enzymatic activity was not required for the caspase-11 upregulation since pharmacological inhibitors of PARP-1 did not suppress the induction of caspase-11. Our results suggest that PARP-1, as a transcriptional cofactor for NF-{kappa}B, regulates the induction of caspase-11 at a transcriptional level.« less

  12. Recombinant bovine S100A8 and A9 enhance IL-1β secretion of interferon-gamma primed monocytes.

    PubMed

    Koy, Mirja; Hambruch, Nina; Hussen, Jamal; Pfarrer, Christiane; Seyfert, Hans-Martin; Schuberth, Hans-Joachim

    2013-09-15

    Calgranulin A (S100A8) and B (S100A9) are found at high levels in inflamed tissue and have been associated with acute and chronic inflammatory disorders. Calgranulins are discussed as damage-associated molecular patterns (DAMPs). To analyze the role of calgranulins for inflammatory responses, bovine S100A8 and S100A9 were cloned, successfully expressed and FPLC-purified. Both molecules did not induce NF-κB activation in boTLR4-transfected HEK293 cells and stimulation of bovine monocytes with both proteins did not result in interleukin 1β (IL-1β) secretion or an upregulated mRNA expression of selected genes (IL1B, TNF, CXCL8, IL10, IL12). However, Interferon γ (IFN-γ) primed bovine monocytes released significantly higher amounts of IL-1β after stimulation with S100A8, S100A9, and co-stimulation with adenosine triphosphate (ATP). In IL-4/IL-13-primed monocytes, the IL-1β release was completely abrogated. The results imply that TLR4/MyD88/NF-κB-independent S100A8/A9-mediated activation of the inflammasome in cattle is favored in a Th1 environment and that S100A8 and S100A9 act as a DAMP in cattle. Copyright © 2013 Elsevier B.V. All rights reserved.

  13. [Effects of interferon-gamma on cytotoxicity of murine activated macrophages against murine glioma cells].

    PubMed

    Ohyama, K; Kikuchi, H; Oda, Y; Moritake, K; Yamasaki, T

    1993-06-01

    We studied the effects of mouse IFN-gamma on the cytotoxic activity of murine activated macrophages (M phi) against mouse VM-Glioma cells (H-2b). Activated M phi were obtained from peritoneal exudate cells of mice from four strains, C57BL/6 (H-2b), C3H/He(H-2k), DBA/2 (H-2d), and BALB/c (H-2d), following intraperitoneal injection of (1) LPS 200 micrograms, (2) BCG 200 micrograms, (3) C. parvum 200 micrograms, or (4) MDP 350 micrograms 7 days prior to 20-hr 51Cr release-assay. Of the various combination of mouse strains and activating agents tested, that of activated M phi of the C3H/He mouse with induction by LPS had the most tumoricidal effect against the glioma cells, which was not MHC restricted. Although LPS-activated M phi underwent marked loss of cytotoxicity following initiation of in vitro culture, this 24 hr pretreatment with IFN-gamma inhibited this reduction in tumoricidal effects in a dose-dependent fashion. On the other hand, 24 hr pretreatment of target cells with IFN-gamma did not increase their susceptibility to lysis by activated M phi. These findings suggest that IFN-gamma augments the in vitro tumoricidal activation of M phi; This effect appears to be unrelated to any influence of IFN-gamma on target sensitivity to lysis by macrophages.

  14. The neutron-gamma Feynman variance to mean approach: Gamma detection and total neutron-gamma detection (theory and practice)

    NASA Astrophysics Data System (ADS)

    Chernikova, Dina; Axell, Kåre; Avdic, Senada; Pázsit, Imre; Nordlund, Anders; Allard, Stefan

    2015-05-01

    Two versions of the neutron-gamma variance to mean (Feynman-alpha method or Feynman-Y function) formula for either gamma detection only or total neutron-gamma detection, respectively, are derived and compared in this paper. The new formulas have particular importance for detectors of either gamma photons or detectors sensitive to both neutron and gamma radiation. If applied to a plastic or liquid scintillation detector, the total neutron-gamma detection Feynman-Y expression corresponds to a situation where no discrimination is made between neutrons and gamma particles. The gamma variance to mean formulas are useful when a detector of only gamma radiation is used or when working with a combined neutron-gamma detector at high count rates. The theoretical derivation is based on the Chapman-Kolmogorov equation with the inclusion of general reactions and corresponding intensities for neutrons and gammas, but with the inclusion of prompt reactions only. A one energy group approximation is considered. The comparison of the two different theories is made by using reaction intensities obtained in MCNPX simulations with a simplified geometry for two scintillation detectors and a 252Cf-source. In addition, the variance to mean ratios, neutron, gamma and total neutron-gamma are evaluated experimentally for a weak 252Cf neutron-gamma source, a 137Cs random gamma source and a 22Na correlated gamma source. Due to the focus being on the possibility of using neutron-gamma variance to mean theories for both reactor and safeguards applications, we limited the present study to the general analytical expressions for Feynman-alpha formulas.

  15. The Third Intron of the Interferon Regulatory Factor-8 Is an Initiator of Repressed Chromatin Restricting Its Expression in Non-Immune Cells

    PubMed Central

    Barnea-Yizhar, Ofer; Ram, Sigal; Kovalev, Ekaterina; Azriel, Aviva; Rand, Ulfert; Nakayama, Manabu; Hauser, Hansjörg; Gepstein, Lior; Levi, Ben-Zion

    2016-01-01

    Interferon Regulatory Factor-8 (IRF-8) serves as a key factor in the hierarchical differentiation towards monocyte/dendritic cell lineages. While much insight has been accumulated into the mechanisms essential for its hematopoietic specific expression, the mode of restricting IRF-8 expression in non-hematopoietic cells is still unknown. Here we show that the repression of IRF-8 expression in restrictive cells is mediated by its 3rd intron. Removal of this intron alleviates the repression of Bacterial Artificial Chromosome (BAC) IRF-8 reporter gene in these cells. Fine deletion analysis points to conserved regions within this intron mediating its restricted expression. Further, the intron alone selectively initiates gene silencing only in expression-restrictive cells. Characterization of this intron’s properties points to its role as an initiator of sustainable gene silencing inducing chromatin condensation with suppressive histone modifications. This intronic element cannot silence episomal transgene expression underlining a strict chromatin-dependent silencing mechanism. We validated this chromatin-state specificity of IRF-8 intron upon in-vitro differentiation of induced pluripotent stem cells (iPSCs) into cardiomyocytes. Taken together, the IRF-8 3rd intron is sufficient and necessary to initiate gene silencing in non-hematopoietic cells, highlighting its role as a nucleation core for repressed chromatin during differentiation. PMID:27257682

  16. Prokaryotic Expression and Anti-IBDV Activity of Chicken Interleukin-18 and Interferon-γ.

    PubMed

    Song, Baifen; Li, Xiaoting; Ma, Jinzhu; Yu, Liquan; Feng, Zhenyue; Liu, Zhenhua; Cui, Yudong

    2017-01-01

    Interferon-γ (IFN-γ), a cytokine produced by activated natural killer cells and T lymphocytes, is an important regulator of innate and adaptive immunity. Interleukin (IL)-18, also known as IFN-γ-inducing factor, is a cytokine that induces T and natural killer cells to produce IFN-γ. In this study, the chicken IL-18 (ChIL-18) and chicken IFN-γ (ChIFN-γ) genes were inserted into the pET28a prokaryotic expression vector, resulting in pET28a-IL-18 and pET28a-IFN-γ, respectively. These plasmids were transformed into Escherichia coli strain BL21, and the ChIL-18 and ChIFN-γ proteins were expressed and purified. To determine their antiviral activities, 200 ng/mL of ChIL-18 and/or ChIFN-γ were inoculated into chicken embryonic fibroblast cells. After 24 h, one 50% tissue culture infective dose (TCID50) of infectious bursal disease virus (IBDV) was inoculated into the chicken embryonic fibroblast cells. The results showed that the antiviral effect of ChIL-18 and ChIFN-γ in combination was better than that of ChIL-18 or ChIFN-γ alone. Next, 14-day-old chicken were injected with 200 µg of ChIL-18 and/or ChIFN-γ and then were challenged with 103 TCID50 of IBDV via intraperitoneal injection. The results showed that the proliferation of IBDV was inhibited by the injection of the recombinant proteins, especially the combination of ChIL-18 and ChIFN-γ, as evidenced by cytokine detection, quantitative PCR, and pathology analyses. These results indicate that ChIL-18 and ChIFN-γ could inhibit IBDV infection and the combination of ChIL-18 and ChIFN-γ has a better inhibitory effect than either cytokine alone. © 2017 S. Karger AG, Basel.

  17. Antigen presentation under the influence of 'immune evasion' proteins and its modulation by interferon-gamma: implications for immunotherapy of cytomegalovirus infection with antiviral CD8 T cells.

    PubMed

    Fink, Annette; Lemmermann, Niels A W; Gillert-Marien, Dorothea; Thomas, Doris; Freitag, Kirsten; Böhm, Verena; Wilhelmi, Vanessa; Reifenberg, Kurt; Reddehase, Matthias J; Holtappels, Rafaela

    2012-11-01

    Cytomegalovirus (CMV) disease with multiple organ manifestations is the most feared viral complication limiting the success of hematopoietic cell transplantation as a therapy of hematopoietic malignancies. A timely endogenous reconstitution of CD8 T cells controls CMV infection, and adoptive transfer of antiviral CD8 T cells is a therapeutic option to prevent CMV disease by bridging the gap between an early CMV reactivation and delayed endogenous reconstitution of protective immunity. Preclinical research in murine models has provided 'proof of concept' for CD8 T-cell therapy of CMV disease. Protection by CD8 T cells appears to be in conflict with the finding that CMVs encode proteins that inhibit antigen presentation to CD8 T cells by interfering with the constitutive trafficking of peptide-loaded MHC class I molecules (pMHC-I complexes) to the cell surface. Here, we have systematically explored antigen presentation in the presence of the three currently noted immune evasion proteins of murine CMV in all possible combinations and its modulation by pre-treatment of cells with interferon-gamma (IFN-γ). The data reveal improvement in antigen processing by pre-treatment with IFN-γ can almost overrule the inhibitory function of immune evasion molecules in terms of pMHC-I expression levels capable of triggering most of the specific CD8 T cells, though the intensity of stimulation did not retrieve their full functional capacity. Notably, an in vivo conditioning of host tissue cells with IFN-γ in adoptive cell transfer recipients constitutively overexpressing IFN-γ (B6-SAP-IFN-γ mice) enhanced the antiviral efficiency of CD8 T cells in this transgenic cytoimmunotherapy model.

  18. C-Reactive Protein (CRP), Interferon Gamma-Inducible Protein 10 (IP-10), and Lipopolysaccharide (LPS) Are Associated with Risk of Tuberculosis after Initiation of Antiretroviral Therapy in Resource-Limited Settings

    PubMed Central

    Tenforde, Mark W.; Gupte, Nikhil; Dowdy, David W.; Asmuth, David M.; Balagopal, Ashwin; Pollard, Richard B.; Sugandhavesa, Patcharaphan; Lama, Javier R.; Pillay, Sandy; Cardoso, Sandra W.; Pawar, Jyoti; Santos, Breno; Riviere, Cynthia; Mwelase, Noluthando; Kanyama, Cecilia; Kumwenda, Johnstone; Hakim, James G.; Kumarasamy, Nagalingeswaran; Bollinger, Robert; Semba, Richard D.; Campbell, Thomas B.; Gupta, Amita

    2015-01-01

    Objective The association between pre-antiretroviral (ART) inflammation and immune activation and risk for incident tuberculosis (TB) after ART initiation among adults is uncertain. Design Nested case-control study (n = 332) within ACTG PEARLS trial of three ART regimens among 1571 HIV-infected, treatment-naïve adults in 9 countries. We compared cases (participants with incident TB diagnosed by 96 weeks) to a random sample of controls (participants who did not develop TB, stratified by country and treatment arm). Methods We measured pre-ART C-reactive protein (CRP), EndoCab IgM, ferritin, interferon gamma (IFN-γ), interleukin 6 (IL-6), interferon gamma-inducible protein 10 (IP-10), lipopolysaccharide (LPS), soluble CD14 (sCD14), tumor necrosis factor alpha (TNF-α), and CD4/DR+/38+ and CD8/DR+/38+ T cells. Markers were defined according to established cutoff definitions when available, 75th percentile of measured values when not, and detectable versus undetectable for LPS. Using logistic regression, we measured associations between biomarkers and incident TB, adjusting for age, sex, study site, treatment arm, baseline CD4 and log10 viral load. We assessed the discriminatory value of biomarkers using receiver operating characteristic (ROC) analysis. Results Seventy-seven persons (4.9%) developed incident TB during follow-up. Elevated baseline CRP (aOR 3.25, 95% CI: 1.55–6.81) and IP-10 (aOR 1.89, 95% CI: 1.05–3.39), detectable plasma LPS (aOR 2.39, 95% CI: 1.13–5.06), and the established TB risk factors anemia and hypoalbuminemia were independently associated with incident TB. In ROC analysis, CRP, albumin, and LPS improved discrimination only modestly for TB risk when added to baseline routine patient characteristics including CD4 count, body mass index, and prior TB. Conclusion Incident TB occurs commonly after ART initiation. Although associated with higher post-ART TB risk, baseline CRP, IP-10, and LPS add limited value to routine patient characteristics

  19. Antifibrotic mechanism of deferoxamine in concanavalin A induced-liver fibrosis: Impact on interferon therapy.

    PubMed

    Darwish, Samar F; El-Bakly, Wesam M; El-Naga, Reem N; Awad, Azza S; El-Demerdash, Ebtehal

    2015-11-01

    Iron-overload is a well-known factor of hepatotoxicity and liver fibrosis, which found to be a common finding among hepatitis C virus patients and related to interferon resistance. We aimed to elucidate the potential antifibrotic effect of deferoxamine; the main iron chelator, and its additional usefulness to interferon-based therapy in concanavalin A-induced immunological model of liver fibrosis. Rats were treated with deferoxamine and/or pegylated interferon-α for 6 weeks. Hepatotoxicity indices, oxidative stress, inflammatory and liver fibrosis markers were assessed. Concanavalin A induced a significant increase in hepatotoxicity indices and lipid peroxidation accompanied with a significant depletion of total antioxidant capacity, glutathione level and superoxide dismutase activity. Besides, it increased CD4(+) T-cells content and the downstream inflammatory cascades, including NF-κB, TNF-α, iNOS, COX-2, IL-6 and IFN-γ. Furthermore, α-SMA, TGF-β1 and hydroxyproline were increased markedly, which confirmed by histopathology. Treatment with either deferoxamine or pegylated interferon-α alone reduced liver fibrosis markers significantly and improved liver histology. However, some of the hepatotoxicity indices and oxidative stress markers did not improve upon pegylated interferon-α treatment alone, besides the remarkable increase in IL-6. Combination therapy of deferoxamine with pegylated interferon-α further improved all previous markers, ameliorated IL-6 elevation, as well as increased hepcidin expression. In conclusion, our study provides evidences for the potent antifibrotic effects of deferoxamine and the underlying mechanisms that involved attenuating oxidative stress and subsequent inflammatory cascade, as well as the production of profibrogenic factors. Addition of deferoxamine to interferon regimen for HCV patients may offer a promising adjuvant modality to enhance therapeutic response. Copyright © 2015 Elsevier Inc. All rights reserved.

  20. Crystallization and preliminary X-ray analysis of Ebola VP35 interferon inhibitory domain mutant proteins

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Leung, Daisy W.; Borek, Dominika; Farahbakhsh, Mina

    2010-06-21

    VP35 is one of seven structural proteins encoded by the Ebola viral genome and mediates viral replication, nucleocapsid formation and host immune suppression. The C-terminal interferon inhibitory domain (IID) of VP35 is critical for dsRNA binding and interferon inhibition. The wild-type VP35 IID structure revealed several conserved residues that are important for dsRNA binding and interferon antagonism. Here, the expression, purification and crystallization of recombinant Zaire Ebola VP35 IID mutants R312A, K319A/R322A and K339A in space groups P6{sub 1}22, P2{sub 1}2{sub 1}2{sub 1} and P2{sub 1}, respectively, are described. Diffraction data were collected using synchrotron sources at the Advanced Lightmore » Source and the Advanced Photon Source.« less

  1. Regulation by interferon alpha of immunoglobulin isotype selection and lymphokine production in mice

    PubMed Central

    1991-01-01

    Antigens and infectious agents that stimulate interferon alpha(IFN- alpha) production in mice induce antibody responses that are predominantly of the immunoglobulin (Ig)G2a isotype and contain little or no IgE. This suggested the possibility that IFN-alpha might have a role in directing Ig isotype selection. Consistent with this possibility, we have found that injection of mice with recombinant mouse IFN-alpha suppresses IgE secretion, enhances IgG2a secretion, and has no independent effect on IgG1 secretion in mice stimulated with a foreign anti-IgD antibody. Injection of mice with polyinosinic acid.polycytidylic acid (poly I.C), an inducer of macrophage IFN-alpha production, also suppresses the anti-IgD antibody-induced IgE response and stimulates the IgG2a response; these effects are blocked by a sheep antibody that neutralizes mouse IFN-alpha/beta. Both recombinant IFN- alpha and poly I.C have maximum IgE suppressive and IgG2a stimulatory effects when injected early in the anti-IgD antibody-induced immune response. Addition of IFN-alpha to mouse B cells cultured with lipopolysaccharide (LPS) + interleukin 4 (IL-4) suppresses both IgG1 and IgE production, but much less potently than IFN-gamma. IFN-alpha suppresses anti-IgD antibody-induced increases in the level of splenic IL-4 mRNA, but enhances the anti-IgD antibody-induced increase in the splenic level of IFN-gamma mRNA. These results are consistent with the effect of IFN-alpha on Ig isotype expression in mice, as IL-4 stimulates IgE and suppresses IgG2a secretion while IFN-gamma exerts opposite effects. These observations suggest that antigen presenting cells, by secreting IFN-alpha early in the course of an immune response, can influence the nature of that response both through direct effects on B cells and by influencing the differentiation of T cells. PMID:1940796

  2. Interferon-gamma +874 T/A and interleukin-10 -1082 A/G single nucleotide polymorphism in Egyptian children with tuberculosis.

    PubMed

    Mosaad, Y M; Soliman, O E; Tawhid, Z E; Sherif, D M

    2010-10-01

    The aim was to investigate the association of interferon-gamma (IFN-γ) +874 T/A and interleukin-10 (IL-10)-1082 A/G single nucleotide polymorphisms with tuberculous infection and post-BCG lymphadenitis in Egyptian children. IFN-γ +874 T/A and IL-10 -1082 A/G polymorphism detection by amplification refractory mutation system technique was carried out for 110 patients with TB, 40 patients with post-BCG lymphadenitis and 118 healthy controls. IFN-γ +874 A allele was higher in TB and post-BCG patients than those in healthy controls (Pc=0.006 and 0.002, respectively). IFN-γ +874 genotype AA was significantly higher in patients with TB than that in control (Pc=0.015), in extrapulmonary than patients with pulmonary TB (PTB) (Pc=0.009), and young children with TB below 5 years (Pc=0.024). No statistically significant differences were observed between patients with TB and controls for the frequency of IL-10(-1082) alleles or genotypes (P>0.05); however, a statistically significant difference in the frequency of IL-10 (-1082) GG genotype was found between patients with pulmonary and extrapulmonary TB (Pc=0.003). Low producer IFN-γ +874 A/A genotype is associated with post-BCG lymphadenitis and TB disease especially in younger children below 5 years. IL-10-1082 G/G genotype did not exhibit significant association except for increased GG frequency in PTB. Both cytokine polymorphisms have no relation to tuberculin reaction in patients with TB. © 2010 The Authors. Scandinavian Journal of Immunology © 2010 Blackwell Publishing Ltd.

  3. Secretion of Interferon gamma (IFNγ) from Human Immune Cells is Altered by Exposure to Tributyltin (TBT) and Dibutyltin (DBT)

    PubMed Central

    Lawrence, Shanieek; Reid, Jacqueline; Whalen, Margaret

    2013-01-01

    Tributyltin (TBT) and dibutyltin (DBT) are widespread environmental contaminants found in food, beverages, and human blood samples. Both of these butyltins (BTs) interfere with the ability of human natural killer (NK) cells to lyse target cells and also alter secretion of the pro-inflammatory cytokine tumor necrosis factor alpha (TNFα) from human immune cells in vitro. The capacity of BTs to interfere with secretion of other pro-inflammatory cytokines has not been examined. Interferon gamma (IFNγ) is a modulator of adaptive and innate immune responses, playing an important role in overall immune competence. This study shows that both TBT and DBT alter secretion of IFNγ from human immune cells. Peripheral blood cell preparations that were increasingly reconstituted were used to determine if exposures to either TBT or DBT affected IFNγ secretion and how the makeup of the cell preparation influenced that effect. IFNγ secretion was examined after 24 h, 48 h and 6 day exposures to TBT (200- 2.5 nM) and DBT (5- 0.05 μM) in highly enriched human NK cells, a monocyte-depleted preparation of PBMCs, and monocyte-containing PBMCs. Both BTs altered IFNγ secretion from NK cells at most of the conditions tested (either increasing or decreasing secretion). However, there was significant variability among donors as to the concentrations and time points that showed changes as well as the baseline secretion of IFNγ. The majority of donors showed an increase in IFNγ secretion in response to at least one concentration of TBT or DBT at a minimum of one length of exposure. PMID:24357260

  4. Immunobiologic effects of cytokine gene transfer of the B16-BL6 melanoma.

    PubMed

    Strome, S E; Krauss, J C; Cameron, M J; Forslund, K; Shu, S; Chang, A E

    1993-12-01

    The genetic modification of tumors offers an approach to modulate the host immune response to relatively weak native tumor antigens. We examined the immunobiologic effects of various cytokine genes transferred into the poorly immunogenic B16-BL6 murine melanoma. Retroviral expression vectors containing cDNAs for interleukin 2, interleukin 4, interferon gamma, or a neomycin-resistant control were electroporated into a B16-BL6 tumor clone. Selected transfected clones were examined for in vitro cytokine secretion and in vivo tumorigenicity. When cells from individual clones were injected intradermally into syngeneic mice, the interleukin 4-secreting clone grew significantly slower than did the neomycin-resistant transfected control, while the growth of the interleukin 2- and interferon gamma-expressing clones was not affected. Despite minimal cytokine secretion by interferon gamma-transfected cells, these cells expressed upregulated major histocompatibility class I antigen and were more susceptible to lysis by allosensitized cytotoxic T lymphocytes compared with parental or neomycin-resistant transfected tumor targets. We observed diverse immunobiologic effects associated with cytokine gene transfer into the B16-BL6 melanoma. Interleukin 4 transfection of tumor resulted in decreased in vivo tumorigenicity that may be related to a host immune response. Further studies to evaluate the host T-cell response to these gene-modified tumors are being investigated.

  5. Behavior of a cloned murine interferon alpha/beta receptor expressed in homospecific or heterospecific background.

    PubMed Central

    Uzé, G; Lutfalla, G; Bandu, M T; Proudhon, D; Mogensen, K E

    1992-01-01

    A murine interferon (IFN) alpha/beta receptor was cloned from the IFN-sensitive L1210 cell line on the basis of its homology with the human receptor. A combination of methods that includes the screening of random-primed and oligo(dT)-primed cDNA libraries and polymerase chain reactions with a single-side specificity was used. At the amino acid level, the murine IFN-alpha/beta shows 46% identity with its human counterpart. Both human WISH cells presenting a low sensitivity to mouse IFN and a murine L1210 mutant subline that does not express the receptor have been stably transfected with the murine IFN-alpha/beta receptor. Whereas transfected human cells became sensitive to a limited number of mouse IFN-alpha/beta subtypes, the transfected murine L1210 mutant was found to be fully complemented and became sensitive to all mouse IFN-alpha/beta subtypes tested, including those that were not active on transfected human cells. These results strongly suggest that the receptor described here is implicated in the mediation of the activities of all murine IFN-alpha/beta subtypes. Images PMID:1533935

  6. MicroRNA203a suppresses glioma tumorigenesis through an ATM-dependent interferon response pathway

    PubMed Central

    Yang, Chuan He; Wang, Yinan; Sims, Michelle; Cai, Chun; He, Ping; Häcker, Hans; Yue, Junming; Cheng, Jinjun; Boop, Frederick A.; Pfeffer, Lawrence M.

    2017-01-01

    Glioblastoma (GBM) is a deadly and incurable brain tumor. Although microRNAs (miRNAs) play critical roles in regulating the cancer cell phenotype, the underlying mechanisms of how they regulate tumorigenesis are incompletely understood. We previously showed that miR-203a is expressed at relatively low levels in GBM patients, and ectopic miR-203a expression in GBM cell lines inhibited cell proliferation and migration, increased sensitivity to apoptosis induced by interferon (IFN) or temozolomide in vitro, and inhibited GBM tumorigenesis in vivo. Here we show that ectopic expression of miR-203a in GBM cell lines promotes the IFN response pathway as evidenced by increased IFN production and IFN-stimulated gene (ISG) expression, and high basal tyrosine phosphorylation of multiple STAT proteins. Importantly, we identified that miR-203a directly suppressed the protein levels of ataxia-telangiectasia mutated (ATM) kinase that negatively regulates IFN production. We found that high ATM expression in GBM correlates with poor patient survival and that ATM expression is inversely correlated with miR-203a expression. Knockout of ATM expression and inhibition of ATM function in GBM cell lines inhibited cell proliferation and migration, increased sensitivity to apoptosis induced by therapeutic agents in vitro, and markedly suppressed GBM tumor growth and promoted animal survival. In contrast, restoring ATM levels in GBM cells ectopically expressing miR-203a increased tumorigenicity and decreased animal survival. Our study suggests that low miR-203a expression in GBM suppresses the interferon response through an ATM-dependent pathway. PMID:29348882

  7. MicroRNA203a suppresses glioma tumorigenesis through an ATM-dependent interferon response pathway.

    PubMed

    Yang, Chuan He; Wang, Yinan; Sims, Michelle; Cai, Chun; He, Ping; Häcker, Hans; Yue, Junming; Cheng, Jinjun; Boop, Frederick A; Pfeffer, Lawrence M

    2017-12-22

    Glioblastoma (GBM) is a deadly and incurable brain tumor. Although microRNAs (miRNAs) play critical roles in regulating the cancer cell phenotype, the underlying mechanisms of how they regulate tumorigenesis are incompletely understood. We previously showed that miR-203a is expressed at relatively low levels in GBM patients, and ectopic miR-203a expression in GBM cell lines inhibited cell proliferation and migration, increased sensitivity to apoptosis induced by interferon (IFN) or temozolomide in vitro , and inhibited GBM tumorigenesis in vivo . Here we show that ectopic expression of miR-203a in GBM cell lines promotes the IFN response pathway as evidenced by increased IFN production and IFN-stimulated gene (ISG) expression, and high basal tyrosine phosphorylation of multiple STAT proteins. Importantly, we identified that miR-203a directly suppressed the protein levels of ataxia-telangiectasia mutated (ATM) kinase that negatively regulates IFN production. We found that high ATM expression in GBM correlates with poor patient survival and that ATM expression is inversely correlated with miR-203a expression. Knockout of ATM expression and inhibition of ATM function in GBM cell lines inhibited cell proliferation and migration, increased sensitivity to apoptosis induced by therapeutic agents in vitro , and markedly suppressed GBM tumor growth and promoted animal survival. In contrast, restoring ATM levels in GBM cells ectopically expressing miR-203a increased tumorigenicity and decreased animal survival. Our study suggests that low miR-203a expression in GBM suppresses the interferon response through an ATM-dependent pathway.

  8. Transcriptional expression of type-I interferon response genes and stability of housekeeping genes in the human endometrium and endometriosis.

    PubMed

    Vestergaard, Anna L; Knudsen, Ulla B; Munk, Torben; Rosbach, Hanne; Martensen, Pia M

    2011-04-01

    Endometriosis is a painful chronic female disease defined by the presence of endometrial tissue implants in ectopic (Ec) locations. The pathogenesis is much debated, and type-I interferons (IFNs) could be involved. The expression of genes of the type-I IFN response were profiled by a specific PCR array of RNA obtained from Ec and eutopic (Eu) endometrium collected from nine endometriosis patients and nine healthy control women. Transcriptional expression levels of selected IFN-regulated and housekeeping genes (HKGs) were investigated by real-time quantitative reverse transcriptase PCR (qRT-PCR). Stably expressed HKGs for valid normalization of transcriptional studies of endometrium and endometriosis have not yet been published. Here, seven HKGs were evaluated for stability using the GeNorm and NormFinder software. A normalization factor based on HMBS, TBP and YWHAZ expression was suitable for normalization of qRT-PCR studies of Eu versus Ec endometrium. In the endometrial cell lines HEC1A, HEC1B, Ishikawa and RL95-2, HMBS and HPRT1 were the most stably expressed. The IFN-specific PCR array indicated significantly different expression of the genes BST2, COL16A1, HOXB2 and ISG20 between the endometrial tissue types. However, by correctly normalized qRT-PCR, levels of BST2, COL16A1 and the highly type-I IFN-stimulated genes ISG12A and 6-16 displayed insignificant variations. Conversely, HOXB2 and ISG20 transcriptions were significantly reduced in endometriosis lesions compared with endometrium from endometriosis patients and healthy controls. In conclusion, appropriate HKGs for normalization of qRT-PCR studies of endometrium and endometriosis have been identified here. Abolished expression of ISG20 and HOX genes could be important in endometriosis.

  9. Evasion of interferon responses by Ebola and Marburg viruses.

    PubMed

    Basler, Christopher F; Amarasinghe, Gaya K

    2009-09-01

    The filoviruses, Ebola virus (EBOV) and Marburg virus (MARV), cause frequently lethal viral hemorrhagic fever. These infections induce potent cytokine production, yet these host responses fail to prevent systemic virus replication. Consistent with this, filoviruses have been found to encode proteins VP35 and VP24 that block host interferon (IFN)-alpha/beta production and inhibit signaling downstream of the IFN-alpha/beta and the IFN-gamma receptors, respectively. VP35, which is a component of the viral nucleocapsid complex and plays an essential role in viral RNA synthesis, acts as a pseudosubstrate for the cellular kinases IKK-epsilon and TBK-1, which phosphorylate and activate interferon regulatory factor 3 (IRF-3) and interferon regulatory factor 7 (IRF-7). VP35 also promotes SUMOylation of IRF-7, repressing IFN gene transcription. In addition, VP35 is a dsRNA-binding protein, and mutations that disrupt dsRNA binding impair VP35 IFN-antagonist activity while leaving its RNA replication functions intact. The phenotypes of recombinant EBOV bearing mutant VP35s unable to inhibit IFN-alpha/beta demonstrate that VP35 IFN-antagonist activity is critical for full virulence of these lethal pathogens. The structure of the VP35 dsRNA-binding domain, which has recently become available, is expected to provide insight into how VP35 IFN-antagonist and dsRNA-binding functions are related. The EBOV VP24 protein inhibits IFN signaling through an interaction with select host cell karyopherin-alpha proteins, preventing the nuclear import of otherwise activated STAT1. It remains to be determined to what extent VP24 may also modulate the nuclear import of other host cell factors and to what extent this may influence the outcome of infection. Notably, the Marburg virus VP24 protein does not detectably block STAT1 nuclear import, and, unlike EBOV, MARV infection inhibits STAT1 and STAT2 phosphorylation. Thus, despite their similarities, there are fundamental differences by which

  10. [Interferon alpha-2b modified with polyethylene glycol].

    PubMed

    Wu, Yingxin; Zhai, Yanqin; Lei, Jiandu; Ma, Guanghui; Su, Zhiguo

    2008-09-01

    In order to obtain a more stable PEGylated interferon alpha-2b, and prolong its half life, interferon alpha-2b (IFN alpha-2b) was modified with monomethoxy polyethylene glycol propionaldehyde (mPEG-ALD) 20000. It was found that the optimized reaction condition for the maximum bioactivity and highest PEGylation degree of the mono PEGylated interferon alpha-2b was as follows: in 20 mmol/L, pH 6.5, citric acid and sodium dihydrogen phosphate buffer, the concentration of IFN alpha-2b was 4 mg/mL, and the molar ratio of PEG/IFN alpha-2b was 8:1, and the reaction time was 20 h at 4 degrees C. Under the optimized reaction condition, the mono PEGylation degree reached to 55%. Ion exchange chromatography was used to separate and purify mono PEGylated interferon alpha-2b from the reaction mixture. The purity of mono PEGylated interferon alpha-2b was higher than 97% characterized by HPLC. The bioactivity of the mono PEGylated interferon alpha-2b was 13.4% of the native IFN alpha-2b, while its half life in SD rat is much longer than the native IFN alpha-2b. The mono PEGylated interferon alpha-2b is also stable in aqueous.

  11. Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice

    PubMed Central

    Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.

    2001-01-01

    Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339

  12. Features of Postoperative Immune Suppression Are Reversible With Interferon Gamma and Independent of Interleukin-6 Pathways.

    PubMed

    Longbottom, E Rebecca; Torrance, Hew D T; Owen, Helen C; Fragkou, Paraskevi C; Hinds, Charles J; Pearse, Rupert M; O'Dwyer, Michael J

    2016-08-01

    The aim of this study was to evaluate the role of interleukin (IL)-6 pathways in postoperative immune suppression and to assess the reversibility of this phenomenon. The postoperative period is characterized by increased IL-6 production and features of immune suppression. In vitro, IL-6 mediates anti-inflammatory effects through inhibition of interferon gamma (IFN-γ) pathways. The significance of the immunomodulatory effects of IL-6 in the clinical setting of postoperative immune suppression remains unclear. Patients over 45 years old undergoing elective surgery, involving the gastrointestinal tract, were recruited. IL-6 levels were assayed using an enzyme linked immunosorbent assay preoperatively, and at 24 and 48 hours. Peripheral blood mononuclear cells from healthy volunteers were cultured in perioperative serum and CD14Human Leukocyte Antigen-DR (HLA-DR) [monocyte HLA-DR (mHLA-DR)] geometric mean florescent intensity was measured in the presence and absence of IL-6 neutralizing antibody and recombinant IFN-γ. Of the 108 patients, 41 developed a postoperative infection. The IL-6 levels increased 19-fold from the preoperative sample to 24 hours postoperatively (P < 0.0001). Higher IL-6 levels at 24 (P = 0.0002) and 48 hours (P = 0.003) were associated with subsequent postoperative infectious complications. mHLA-DR mean florescent intensity fell when healthy peripheral blood mononuclear cells were cultured with postoperative serum compared with preoperative serum (P = 0.008). This decrease was prevented by the presence of IFN-γ in the culture media, but not by the presence of IL-6-neutralizing antibody. IL-6 levels increase after a major surgery and are associated with an increased susceptibility to postoperative infections. Serum obtained from postoperative patients induces an immunosuppressive response, reflected in reduced mHLA-DR levels, mediated through IL-6 independent pathways and is reversible with IFN-γ. These data may have

  13. Continuous in vivo infusion of interferon-gamma (IFN-γ) enhances engraftment of syngeneic wild-type cells in Fanca–/– and Fancg–/– mice

    PubMed Central

    Si, Yue; Ciccone, Samantha; Yang, Feng-Chun; Yuan, Jin; Zeng, Daisy; Chen, Shi; van de Vrugt, Henri J.; Critser, John; Arwert, Fre; Haneline, Laura S.; Clapp, D. Wade

    2006-01-01

    Fanconi anemia (FA) is a heterogeneous genetic disorder characterized by bone marrow (BM) failure and cancer susceptibility. Identification of the cDNAs of FA complementation types allows the potential of using gene transfer technology to introduce functional cDNAs as transgenes into autologous stem cells and provide a cure for the BM failure in FA patients. However, strategies to enhance the mobilization, transduction, and engraftment of exogenous stem cells are required to optimize efficacy prior to widespread clinical use. Hypersensitivity of Fancc–/– cells to interferon-gamma (IFN-γ), a nongenotoxic immune-regulatory cytokine, enhances engraftment of syngeneic wild-type (WT) cells in Fancc–/– mice. However, whether this phenotype is of broad relevance in other FA complementation groups is unresolved. Here we show that primitive and mature myeloid progenitors in Fanca–/– and Fancg–/– mice are hypersensitive to IFN-γ and that in vivo infusion of IFN-γ at clinically relevant concentrations was sufficient to allow consistent long-term engraftment of isogenic WT repopulating stem cells. Given that FANCA, FANCC, and FANCG complementation groups account for more than 90% of all FA patients, these data provide evidence that IFN-γ conditioning may be a useful nongenotoxic strategy for myelopreparation in FA patients. PMID:16946306

  14. Expression of Ifnlr1 on Intestinal Epithelial Cells Is Critical to the Antiviral Effects of Interferon Lambda against Norovirus and Reovirus.

    PubMed

    Baldridge, Megan T; Lee, Sanghyun; Brown, Judy J; McAllister, Nicole; Urbanek, Kelly; Dermody, Terence S; Nice, Timothy J; Virgin, Herbert W

    2017-04-01

    Lambda interferon (IFN-λ) has potent antiviral effects against multiple enteric viral pathogens, including norovirus and rotavirus, in both preventing and curing infection. Because the intestine includes a diverse array of cell types, however, the cell(s) upon which IFN-λ acts to exert its antiviral effects is unclear. Here, we sought to identify IFN-λ-responsive cells by generation of mice with lineage-specific deletion of the receptor for IFN-λ, Ifnlr1 We found that expression of IFNLR1 on intestinal epithelial cells (IECs) in the small intestine and colon is required for enteric IFN-λ antiviral activity. IEC Ifnlr1 expression also determines the efficacy of IFN-λ in resolving persistent murine norovirus (MNoV) infection and regulates fecal shedding and viral titers in tissue. Thus, the expression of Ifnlr1 by IECs is necessary for the response to both endogenous and exogenous IFN-λ. We further demonstrate that IEC Ifnlr1 expression is required for the sterilizing innate immune effects of IFN-λ by extending these findings in Rag1 -deficient mice. Finally, we assessed whether our findings pertained to multiple viral pathogens by infecting mice specifically lacking IEC Ifnlr1 expression with reovirus. These mice phenocopied Ifnlr1 -null animals, exhibiting increased intestinal tissue titers and enhanced reovirus fecal shedding. Thus, IECs are the critical cell type responding to IFN-λ to control multiple enteric viruses. This is the first genetic evidence that supports an essential role for IECs in IFN-λ-mediated control of enteric viral infection, and these findings provide insight into the mechanism of IFN-λ-mediated antiviral activity. IMPORTANCE Human noroviruses (HNoVs) are the leading cause of epidemic gastroenteritis worldwide. Type III interferons (IFN-λ) control enteric viral infections in the gut and have been shown to cure mouse norovirus, a small-animal model for HNoVs. Using a genetic approach with conditional knockout mice, we identified

  15. Expression of Ifnlr1 on Intestinal Epithelial Cells Is Critical to the Antiviral Effects of Interferon Lambda against Norovirus and Reovirus

    PubMed Central

    Baldridge, Megan T.; Lee, Sanghyun; Brown, Judy J.; McAllister, Nicole; Urbanek, Kelly; Dermody, Terence S.

    2017-01-01

    ABSTRACT Lambda interferon (IFN-λ) has potent antiviral effects against multiple enteric viral pathogens, including norovirus and rotavirus, in both preventing and curing infection. Because the intestine includes a diverse array of cell types, however, the cell(s) upon which IFN-λ acts to exert its antiviral effects is unclear. Here, we sought to identify IFN-λ-responsive cells by generation of mice with lineage-specific deletion of the receptor for IFN-λ, Ifnlr1. We found that expression of IFNLR1 on intestinal epithelial cells (IECs) in the small intestine and colon is required for enteric IFN-λ antiviral activity. IEC Ifnlr1 expression also determines the efficacy of IFN-λ in resolving persistent murine norovirus (MNoV) infection and regulates fecal shedding and viral titers in tissue. Thus, the expression of Ifnlr1 by IECs is necessary for the response to both endogenous and exogenous IFN-λ. We further demonstrate that IEC Ifnlr1 expression is required for the sterilizing innate immune effects of IFN-λ by extending these findings in Rag1-deficient mice. Finally, we assessed whether our findings pertained to multiple viral pathogens by infecting mice specifically lacking IEC Ifnlr1 expression with reovirus. These mice phenocopied Ifnlr1-null animals, exhibiting increased intestinal tissue titers and enhanced reovirus fecal shedding. Thus, IECs are the critical cell type responding to IFN-λ to control multiple enteric viruses. This is the first genetic evidence that supports an essential role for IECs in IFN-λ-mediated control of enteric viral infection, and these findings provide insight into the mechanism of IFN-λ-mediated antiviral activity. IMPORTANCE Human noroviruses (HNoVs) are the leading cause of epidemic gastroenteritis worldwide. Type III interferons (IFN-λ) control enteric viral infections in the gut and have been shown to cure mouse norovirus, a small-animal model for HNoVs. Using a genetic approach with conditional knockout mice, we

  16. Interferon-based treatment of chronic hepatitis C.

    PubMed

    Souvignet, Claude; Lejeune, Olivier; Trepo, Christian

    2007-01-01

    The treatment of patients with chronic hepatitis C has rapidly evolved in the past 10 years centered on the use of interferon alpha 2 as an antiviral and immunomodulatory agent against hepatitis C virus. Firstly used as a monotherapy associated with a deceiving long-term efficacy, interferon alpha was then combined with ribavirin, a nucleoside analog with large antiviral properties. Combination of both drugs dramatically improved the efficacy of treatment with 50% of patients reaching a sustained viral response, characterized by the final eradication of the virus from the infected individual. Surprisingly, this synergistic effect remains greatly unexplained. The third step consisted in the use of pegylated interferon in order to adapt its pharmacokinetics and to allow a better efficacy with a more tolerable dosing schedule: once weekly subcutaneous injection instead of thrice weekly. Pegylated interferon combined with ribavirin during 24-48 weeks of treatment is the current standard of care with nearly 60% of sustained virologic response, overall. Development of new forms of interferon alpha are on the way with promising preliminary results.

  17. Stability of human interferon-beta 1: oligomeric human interferon-beta 1 is inactive but is reactivated by monomerization.

    PubMed

    Utsumi, J; Yamazaki, S; Kawaguchi, K; Kimura, S; Shimizu, H

    1989-10-05

    Human interferon-beta 1 is extremely stable is a low ionic strength solution of pH 2 such as 10 mM HCl at 37 degrees C. However, the presence of 0.15 M NaCl led to a remarkable loss of antiviral activity. The molecular-sieve high-performance liquid chromatography revealed that, whereas completely active human interferon-beta 1 eluted as a 25 kDa species (monomeric form), the inactivated preparation eluted primarily as a 90 kDa species (oligomeric form). The specific activity (units per mg protein) of the oligomeric form was approx. 10% of that of the monomeric form. This observation shows that oligomeric human interferon-beta 1 is apparently in an inactive form. When the oligomeric eluate was resolved by polyacrylamide gel containing sodium dodecyl sulphate (SDS), it appeared to be monomeric under non-reducing conditions. Monomerization of the oligomeric human interferon-beta 1 by treatment with 1% SDS, fully regenerated its antiviral activity. These results suggest that the inactivation of the human interferon-beta 1 preparation was caused by its oligomerization via hydrophobic interactions without the formation of intermolecular disulphide bonds. These oligomers can be dissociated by SDS to restore biological activity.

  18. Prenatal Dexamethasone and Postnatal High-Fat Diet Decrease Interferon Gamma Production through an Age-Dependent Histone Modification in Male Sprague-Dawley Rats

    PubMed Central

    Yu, Hong-Ren; Tain, You-Lin; Sheen, Jiunn-Ming; Tiao, Mao-Meng; Chen, Chih-Cheng; Kuo, Ho-Chang; Hung, Pi-Lien; Hsieh, Kai-Sheng; Huang, Li-Tung

    2016-01-01

    Overexposure to prenatal glucocorticoid (GC) disturbs hypothalamic-pituitary-adrenocortical axis-associated neuroendocrine metabolism and susceptibility to metabolic syndrome. A high-fat (HF) diet is a major environmental factor that can cause metabolic syndrome. We aimed to investigate whether prenatal GC plus a postnatal HF diet could alter immune programming in rat offspring. Pregnant Sprague-Dawley rats were given intraperitoneal injections of dexamethasone or saline at 14–21 days of gestation. Male offspring were then divided into four groups: vehicle, prenatal dexamethasone exposure, postnatal HF diet (VHF), and prenatal dexamethasone exposure plus a postnatal HF diet (DHF). The rats were sacrificed and adaptive immune function was evaluated. Compared to the vehicle, the DHF group had lower interferon gamma (IFN-γ) production by splenocytes at postnatal day 120. Decreases in H3K9 acetylation and H3K36me3 levels at the IFN-γ promoter correlated with decreased IFN-γ production. The impaired IFN-γ production and aberrant site-specific histone modification at the IFN-γ promoter by prenatal dexamethasone treatment plus a postnatal HF diet resulted in resilience at postnatal day 180. Prenatal dexamethasone and a postnatal HF diet decreased IFN-γ production through a site-specific and an age-dependent histone modification. These findings suggest a mechanism by which prenatal exposure to GC and a postnatal environment exert effects on fetal immunity programming. PMID:27669212

  19. Over-expression of bacterial gamma-glutamylcysteine synthetase (GSH1) in plastids affects photosynthesis, growth and sulphur metabolism in poplar (Populus tremula x Populus alba) dependent on the resulting gamma-glutamylcysteine and glutathione levels.

    PubMed

    Herschbach, Cornelia; Rizzini, Luca; Mult, Susanne; Hartmann, Tanja; Busch, Florian; Peuke, Andreas D; Kopriva, Stanislav; Ensminger, Ingo

    2010-07-01

    We compared three transgenic poplar lines over-expressing the bacterial gamma-glutamylcysteine synthetase (GSH1) targeted to plastids. Lines Lggs6 and Lggs12 have two copies, while line Lggs20 has three copies of the transgene. The three lines differ in their expression levels of the transgene and in the accumulation of gamma-glutamylcysteine (gamma-EC) and glutathione (GSH) in leaves, roots and phloem exudates. The lowest transgene expression level was observed in line Lggs6 which showed an increased growth, an enhanced rate of photosynthesis and a decreased excitation pressure (1-qP). The latter typically represents a lower reduction state of the plastoquinone pool, and thereby facilitates electron flow along the electron transport chain. Line Lggs12 showed the highest transgene expression level, highest gamma-EC accumulation in leaves and highest GSH enrichment in phloem exudates and roots. This line also exhibited a reduced growth, and after a prolonged growth of 4.5 months, symptoms of leaf injury. Decreased maximum quantum yield (F(v)/F(m)) indicated down-regulation of photosystem II reaction centre (PSII RC), which correlates with decreased PSII RC protein D1 (PsbA) and diminished light-harvesting complex (Lhcb1). Potential effects of changes in chloroplastic and cytosolic GSH contents on photosynthesis, growth and the whole-plant sulphur nutrition are discussed for each line.

  20. Interferon-targeted therapy in systemic lupus erythematosus: Is this an alternative to targeting B and T cells?

    PubMed

    Kalunian, K C

    2016-09-01

    Clinical trials of investigational agents in systemic lupus erythematosus (SLE) have focused on targeting dysregulated B and T cells; however, recent translational research findings of the importance of the dysregulation of the innate immune system in SLE have led to clinical trials that target interferon. Three biologics that target type I interferons have been tested for their efficacy and safety in active SLE patients; these phase II trials have tested the hypothesis that down-regulation of interferon-regulated gene expression (the interferon signature) lessen the clinical burden of SLE. Rontalizumab, an anti-interferon-α monoclonal antibody, was studied in patients who had discontinued immunosuppressants. This study failed to show efficacy as assessed by both two outcome assessments; however, in low interferon signature patients, response was higher and corticosteroid usage was less in rontalizumab-treated patients. Sifalimumab, another anti-interferon-α monoclonal antibody, was studied in patients who remained on standard of care therapy. This study showed significantly better efficacy in patients treated with two sifalimumab dosages; significant differences were seen in the high interferon signature group. In a similar design and in a similar population as the sifalimumab study, anifrolumab, a monoclonal antibody that binds to a type I interferon receptor, was studied in patients who remained on standard of care therapy. In this study, one dosage group demonstrated efficacy and statistically significant effects were achieved in both tested dosage groups with secondary end points. Oral corticosteroid reduction to ≤7.5 mg daily was achieved in one of the tested dosage groups and organ-specific outcomes were significantly improved in that same group. For all studies, no significant differences in serious adverse effects were seen; although, herpes zoster infections were increased in sifalimumab- and anifrolumab-treated patients and influenza rates were

  1. Association of IRF5 polymorphisms with activation of the interferon α pathway

    PubMed Central

    Rullo, Ornella J; Woo, Jennifer M P; Wu, Hui; Hoftman, Alice D C; Maranian, Paul; Brahn, Brittany A; McCurdy, Deborah; Cantor, Rita M; Tsao, Betty P

    2011-01-01

    Objective The genetic association of interferon regulatory factor 5 (IRF5) with systemic lupus erythematosus (SLE) susceptibility has been convincingly established. To gain understanding of the effect of IRF5 variation in individuals without SLE, a study was undertaken to examine whether such genetic variation predisposes to activation of the interferon α (IFNα) pathway. Methods Using a computer simulated approach, 14 single nucleotide polymorphisms (SNPs) and haplotypes of IRF5 were tested for association with mRNA expression levels of IRF5, IFNα and IFN-inducible genes and chemokines in lymphoblastoid cell lines (LCLs) from individuals of European (CEU), Han Chinese (CHB), Japanese (JPT) and Yoruba Nigerian (YRI) backgrounds. IFN-inducible gene expression was assessed in LCLs from children with SLE in the presence and absence of IFNα stimulation. Results The major alleles of IRF5 rs13242262 and rs2280714 were associated with increased IRF5 mRNA expression levels in the CEU, CHB+JPT and YRI samples. The minor allele of IRF5 rs10488631 was associated with increased IRF5, IFNα and IFN-inducible chemokine expression in CEU (pc=0.0005, 0.01 and 0.04, respectively). A haplotype containing these risk alleles of rs13242262, rs10488631 and rs2280714 was associated with increased IRF5, IFNα and IFN-inducible chemokine expression in CEU LCLs. In vitro studies showed specific activation of IFN-inducible genes in LCLs by IFNα. Conclusions SNPs of IRF5 in healthy individuals of a number of ethnic groups were associated with increased mRNA expression of IRF5. In European-derived individuals, an IRF5 haplotype was associated with increased IRF5, IFNα and IFN-inducible chemokine expression. Identifying individuals genetically predisposed to increased IFN-inducible gene and chemokine expression may allow early detection of risk for SLE. PMID:19854706

  2. Role of CD28/B7 costimulation in the dexamethasone-induced suppression of IFN-gamma.

    PubMed

    Agarwal, S K; Marshall, G D

    2000-11-01

    In vitro exposure of peripheral blood mononuclear cells (PBMC) to glucocorticoids (GC), at concentrations observed during psychologic stress, induces a shift in the human type 1/type 2 cytokine balance toward a type 2 cytokine response. The mechanisms involved in these cytokine alterations are unknown but likely include modulation of regulatory cytokines or the interaction between the antigen-presenting cell (APC) and T lymphocyte or both. The CD28/B7 costimulation pathway has been reported to modulate the type 1/type 2 cytokine balance and may contribute to the GC-associated cytokine alterations. Therefore, we sought to determine the effect of dexamethasone (Dex) on the expression and function of the human CD28/B7 costimulatory pathway and whether these alterations contribute to the Dex-induced type 1/type 2 cytokine alterations. Dex inhibited the expression of both CD80 and CD86 on THP-1 cells, a human acute monocytic leukemia cell line, as determined by flow cytometry. Dex also inhibited the expression of CD28 and CTLA-4 on phytohemagglutinin (PHA)-stimulated CD3+ T lymphocytes, which was attenuated by the addition of interleukin-12 (IL-12). Lastly, activation of CD28 with anti-CD28 antibody attenuated the Dex-induced decrease in interferon-gamma (IFN-gamma) production by anti-CD3 antibody-stimulated PBMC. These data suggest that Dex induces a modulation of the CD28/B7 costimulatory pathway that contributes to the shift in the type 1/type 2 cytokine balance toward a predominant type 2 cytokine response.

  3. Interferon in resistance to bacterial and protozoan infections

    NASA Technical Reports Server (NTRS)

    Sonnenfeld, Gerald; Gould, Cheryl L.; Kierszenbaum, Felipe; Degee, Antonie L. W.; Mansfield, John M.

    1986-01-01

    The effects of genetic differences in mouse strains on the modulation of protozoan infections by interferon (IFN) were investigated. In one set of experiments, three different strains of mice were injected with T. cruzi, and their sera were assayed at five time intervals for IFN titer. A greater quantity of IFN was produced by mouse strains that were susceptible to T. cruzi infection than by the more resistant strain. In another set of experiments, spleen cell cultures from inbred strains of mice were challenged with an antigen made from T.b. rhodesiense. The cells from mice resistant to infection, produced greater amounts of IFN-gamma than did cells from the susceptible mice. In a third set of experiments, it was found that mice injected with T.b. rhodesiense before being infected with a diabetogenic virus (EMC-D) were resistant to the effects of the virus and did not produce virus-specific antibody.

  4. Oral administration of pentachlorophenol induces interferon signaling mRNAs in C57BL/6 male mouse liver.

    PubMed

    Kanno, Jun; Aisaki, Ken-ichi; Igarashi, Katsuhide; Kitajima, Satoshi; Matsuda, Nae; Morita, Koichi; Tsuji, Masaki; Moriyama, Noriko; Furukawa, Yusuke; Otsuka, Maki; Tachihara, Erika; Nakatsu, Noriyuki; Kodama, Yukio

    2013-01-01

    Pentachlorophenol (PCP) was monitored for transcriptome responses in adult mouse liver at 2, 4, 8 and 24 hr after a single oral administration at four dose levels, 0, 10, 30 and 100 mg/kg. The expression data obtained using Affymetrix GeneChip MOE430 2.0 were absolutized by the Percellome method and expressed as three dimensional (3D) surface graphs with axes of time, dose and copy numbers of mRNA per cell. We developed the programs RSort, for comprehensive screening of the 3D surface data and PercellomeExploror for cross-referencing and confirmed the significant responses by visual inspection. In the first 8 hr, approximately 100 probe sets (PSs) related to PXR/SXR and Cyp2a4 and other metabolic enzymes were induced whereas Fos and JunB were suppressed. At 24 hr, about 1,200 PSs were strongly induced. We cross-referenced the Percellome database consisting of 111 chemicals on the liver transcriptome and found that about half of the PSs belonged to the metabolic pathways including Nrf2-mediated oxidative stress response networks shared with some of the 111 chemicals. The other half of the induced genes were interferon signaling network genes (ISG) and their induction was unique to PCP. Toll like receptors and other pattern recognition receptors, interferon regulatory factors and interferon alpha itself were included but inflammatory cytokines were not induced. In summary, these data indicated that functional symptoms of PCP treatment, such as hyperthermia and profuse sweating might be mediated by the ISG rather than the previously documented mitochondrial uncoupling mechanism. PCP might become a hint for developing low molecular weight orally available interferon mimetic drugs following imiquimod and RO4948191 as agonists of toll-like receptor and interferon receptor.

  5. Serum profile of cytokines interferon gamma and interleukin-10 in ewes subjected to artificial insemination by cervical retraction.

    PubMed

    Alvares, C T G; Cruz, J F; Romano, C C; Brandão, F Z

    2016-04-15

    This study evaluated the influence of artificial insemination (AI) by cervical retraction (CRI) on serum levels of interferon gamma (IFNγ) and interleukin-10 (IL-10) in ewes. Synchronized pluriparous Santa Inês ewes were subjected to natural mating (NM, n = 8) and AI, which was performed for a fixed time (55 ± 1 hour) by CRI (n = 8) or laparoscopy (n = 8). Ewes were classified as pregnant, with return to estrus (RE) or with embryonic loss (EL). Blood samples were collected on Day 0, Day 3, Day 5, Day 12, and Day 17 (Day 0 = AI/NM) for progesterone dosage and cytokines were quantified from Day 0 to Day 12. Progesterone levels were constant, except for a decrease in ewes with RE at Day 17 (P < 0.05). Regardless of the reproductive method used, there was no difference in the IFNγ and IL-10 levels at any time, with averages of 642.1, 713.2, and 741.2 pg/mL for IFNγ and 667.1, 616.8, and 721.1 pg/mL for IL-10 when using CRI, laproscopy, and NM, respectively. Regarding the physiological status, ewes with EL had lower serum levels of IFNγ and IL-10 than pregnant ewes and ewes with RE, regardless of the reproductive method used, with averages of 769.1, 714.9, and 555.7 pg/mL for IFNγ and 713.8, 699.3, and 578.7 pg/mL for IL-10 in pregnant ewes, ewes with RE and EL, respectively (P < 0.01). In conclusion, AI by CRI in Santa Inês ewes does not alter the profile of serum cytokines IFNγ and IL-10 and does not induce an inflammatory reaction that can compromise pregnancy. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. Parasite-mediated upregulation of NK cell-derived gamma interferon protects against severe highly pathogenic H5N1 influenza virus infection.

    PubMed

    O'Brien, Kevin B; Schultz-Cherry, Stacey; Knoll, Laura J

    2011-09-01

    Outbreaks of influenza A viruses are associated with significant human morbidity worldwide. Given the increasing resistance to the available influenza drugs, new therapies for the treatment of influenza virus infection are needed. An alternative approach is to identify products that enhance a protective immune response. In these studies, we demonstrate that infecting mice with the Th1-inducing parasite Toxoplasma gondii prior to highly pathogenic avian H5N1 influenza virus infection led to decreased lung viral titers and enhanced survival. A noninfectious fraction of T. gondii soluble antigens (STAg) elicited an immune response similar to that elicited by live parasites, and administration of STAg 2 days after H5N1 influenza virus infection enhanced survival, lowered viral titers, and reduced clinical disease. STAg administration protected H5N1 virus-infected mice lacking lymphocytes, suggesting that while the adaptive immune response was not required for enhanced survival, it was necessary for STAg-mediated viral clearance. Mechanistically, we found that administration of STAg led to increased production of gamma interferon (IFN-γ) from natural killer (NK) cells, which were both necessary and sufficient for survival. Further, administration of exogenous IFN-γ alone enhanced survival from H5N1 influenza virus infection, although not to the same level as STAg treatment. These studies demonstrate that a noninfectious T. gondii extract enhances the protective immune response against severe H5N1 influenza virus infections even when a single dose is administered 2 days postinfection.

  7. Hemozoin Regulates iNOS Expression by Modulating the Transcription Factor NF-κB in Macrophages.

    PubMed

    Ranjan, Ravi; Karpurapu, Manjula; Rani, Asha; Chishti, Athar H; Christman, John W

    2016-01-01

    Hemozoin (Hz) is released from ruptured erythrocytes during malaria infection caused by Plasmodium sp., in addition the malaria infected individuals are prone to bacterial sepsis. The molecular interactions between Hz, bacterial components and macrophages remains poorly investigated. In this report, we investigated the combinatorial immune-modulatory effects of phagocytosed Hz, Interferon gamma (IFNγ) or lipopolysaccharide (LPS) in macrophages. Macrophages were treated with various concentrations of commercial synthetic Hz, and surprisingly it did not result in inducible nitric oxide synthase (iNOS) expression. However, when macrophages were pretreated with Hz and then challenged with IFNγ or LPS, there was a differential impact on iNOS expression. There was an increase in iNOS expression when macrophages were pre-treated with Hz and subsequently treated with IFNγ when compared to IFNγ alone. Whereas iNOS expression was reduced when Hz phagocytosed macrophages were stimulated with LPS compared to LPS alone. Furthermore, there was an increased activation of NF-κB in Hz phagocytosed macrophages that were challenged with IFNγ. The interaction between Hz and macrophages has an impact on iNOS expression.

  8. Interferon-alpha in the treatment of multiple myeloma.

    PubMed

    Khoo, Teh Liane; Vangsted, Annette Juul; Joshua, Douglas; Gibson, John

    2011-03-01

    Interferons are soluble proteins produced naturally by cells in response to viruses. It has both anti-proliferative and immunomodulating properties and is one of the first examples of a biological response modifier use to treat the haematological malignancy multiple myeloma. Interferon has been used in this clinical practice for over thirty years. However, despite considerable efforts, numerous clinical trials and two large meta-analysis, its exact role in the management of multiple myeloma still remains unclear. Its role in the treatment of multiple myeloma has been as a single induction agent, a co-induction agent with other chemotherapy regimens, and as maintenance therapy after conventional chemotherapy or complete remission after autologous or allogeneic transplantation. Interferon as a single induction agent or co-induction agent with other chemotherapy agents appears only to have minimal benefit in myeloma. Its role as maintenance therapy in the plateau phase of myeloma also remains uncertain. More recently, the use of interferon must now compete with the "new drugs"--thalidomide, lenalidomide and bortezomib in myeloma treatment. Will there be a future role of interferon in the treatment of multiple myeloma or will interferon be resigned to the history books remains to be seen.

  9. Molecular cloning of ADIR, a novel interferon responsive gene encoding a protein related to the torsins.

    PubMed

    Dron, Michel; Meritet, Jean François; Dandoy-Dron, Françoise; Meyniel, Jean-Philippe; Maury, Chantal; Tovey, Michael G

    2002-03-01

    The expression of the previously uncharacterized gene Adir (for ATP dependent interferon responsive gene) was increased by 5- to 15-fold in tissue of the oral cavity or in spleen and liver of mice treated orally or intraperitoneally with IFN-alpha, and in mouse cells treated in vitro with IFN-alpha or IFN-gamma. The level of Adir mRNA was also increased 20- to 40-fold in the brains of animals infected with encephalomyocarditis virus. Adir is expressed ubiquitously in mouse tissues as 1.9-, 2.4-, and 3.5-kb mRNA transcripts encoding a 385-amino-acid protein with a conserved ATP binding domain containing typical nucleotide and Mg(2+) binding sites. We also characterized the human ortholog, ADIR, which is located on chromosome 1q25-q31 and contains six exons encoding a 397-amino-acid protein with 80% homology to the mouse protein. A single 2.3-kb mRNA was detected in all human tissues examined, except for placenta, which also contained a 1.25-kb tissue-specific transcript generated by alternative splicing and encoding a putative 336-amino-acid protein. Although ADIR exhibits low homology to DYT1 and TOR1B, the deduced ADIR protein sequences are highly homologous to torsin A and torsin B and more distantly related to members of the Clp/HSP100 family of proteins, suggesting that ADIR, like torsins, is related to the AAA chaperone-like family of ATPases. An ADIR-EGFP fusion protein expressed in HeLa cells was shown to be associated with the endoplasmic reticulum.

  10. Chloroplast-derived vaccine antigens and biopharmaceuticals: expression, folding, assembly and functionality.

    PubMed

    Chebolu, S; Daniell, H

    2009-01-01

    Chloroplast genetic engineering offers several advantages, including high levels of transgene expression, transgene containment via maternal inheritance, and multi-gene expression in a single transformation event. Oral delivery is facilitated by hyperexpression of vaccine antigens against cholera, tetanus, anthrax, plague, or canine parvovirus (4%-31% of total soluble protein, TSP) in transgenic chloroplasts (leaves) or non-green plastids (carrots, tomato) as well as the availability of antibiotic free selectable markers or the ability to excise selectable marker genes. Hyperexpression of several therapeutic proteins, including human serum albumin (11.1% TSP), somatotropin (7% TSP), interferon-alpha (19% TSP), interferon-gamma (6% TSP), and antimicrobial peptide (21.5% TSP), facilitates efficient and economic purification. Also, the presence of chaperones and enzymes in chloroplasts facilitates assembly of complex multisubunit proteins and correct folding of human blood proteins with proper disulfide bonds. Functionality of chloroplast-derived vaccine antigens and therapeutic proteins has been demonstrated by several assays, including the macrophage lysis assay, GM1-ganglioside binding assay, protection of HeLA cells or human lung carcinoma cells against encephalomyocarditis virus, systemic immune response, protection against pathogen challenge, and growth or inhibition of cell cultures. Purification of human proinsulin has been achieved using novel purification strategies (inverse temperature transition property) that do not require expensive column chromatography techniques. Thus, transgenic chloroplasts are ideal bio-reactors for production of functional human and animal therapeutic proteins in an environmentally friendly manner.

  11. Chloroplast-Derived Vaccine Antigens and Biopharmaceuticals: Expression, Folding, Assembly and Functionality

    PubMed Central

    Chebolu, S.; Daniell, H.

    2009-01-01

    Chloroplast genetic engineering offers several advantages, including high levels of transgene expression, transgene containment via maternal inheritance, and multi-gene expression in a single transformation event. Oral delivery is facilitated by hyperexpression of vaccine antigens against cholera, tetanus, anthrax, plague, or canine parvovirus (4%–31% of total soluble protein, TSP) in transgenic chloroplasts (leaves) or non-green plastids (carrots, tomato) as well as the availability of antibiotic free selectable markers or the ability to excise selectable marker genes. Hyperexpression of several therapeutic proteins, including human serum albumin (11.1% TSP), somatotropin (7% TSP), interferon-alpha (19% TSP), interferon-gamma (6% TSP), and antimicrobial peptide (21.5% TSP), facilitates efficient and economic purification. Also, the presence of chaperones and enzymes in chloroplasts facilitates assembly of complex multisubunit proteins and correct folding of human blood proteins with proper disulfide bonds. Functionality of chloroplast-derived vaccine antigens and therapeutic proteins has been demonstrated by several assays, including the macrophage lysis assay, GM1-ganglioside binding assay, protection of HeLA cells or human lung carcinoma cells against encephalomyocarditis virus, systemic immune response, protection against pathogen challenge, and growth or inhibition of cell cultures. Purification of human proinsulin has been achieved using novel purification strategies (inverse temperature transition property) that do not require expensive column chromatography techniques. Thus, transgenic chloroplasts are ideal bioreactors for production of functional human and animal therapeutic proteins in an environmentally friendly manner. PMID:19401820

  12. CD4+ T-cell clones obtained from cattle chronically infected with Fasciola hepatica and specific for adult worm antigen express both unrestricted and Th2 cytokine profiles.

    PubMed Central

    Brown, W C; Davis, W C; Dobbelaere, D A; Rice-Ficht, A C

    1994-01-01

    The well-established importance of helper T (Th)-cell subsets in immunity and immunoregulation of many experimental helminth infections prompted a detailed study of the cellular immune response against Fasciola hepatica in the natural bovine host. T-cell lines established from two cattle infected with F. hepatica were characterized for the expression of T-cell surface markers and proliferative responses against F. hepatica adult worm antigen. Parasite-specific T-cell lines contained a mixture of CD4+, CD8+, and gamma/delta T-cell-receptor-bearing T cells. However, cell lines containing either fewer than 10% CD8+ T cells or depleted of gamma/delta T cells proliferated vigorously against F. hepatica antigen, indicating that these T-cell subsets are not required for proliferative responses in vitro. Seventeen F. hepatica-specific CD4+ Th-cell clones were examined for cytokine expression following concanavalin A stimulation. Biological assays to measure interleukin-2 (IL-2) or IL-4, gamma interferon (IFN-gamma), and tumor necrosis factor and Northern (RNA) blot analysis to verify the expression of IL-2, IL-4, and IFN-gamma revealed that the Th-cell clones expressed a spectrum of cytokine profiles. Several Th-cell clones were identified as Th2 cells by the strong expression of IL-4 but little or no IL-2 or IFN-gamma mRNA. The majority of Th-cell clones were classified as Th0 cells by the expression of either all three cytokines or combinations of IL-2 and IL-4 or IL-4 and IFN-gamma. No Th1-cell clones were obtained. All of the Th-cell clones expressed a typical memory cell surface phenotype, characterized as CD45Rlow, and all expressed the lymph node homing receptor (L selectin). These results are the first to describe cytokine responses of F. hepatica-specific T cells obtained from infected cattle and extend our previous analysis of Th0 and Th1 cells from cattle immune to Babesia bovis (W. C. Brown, V. M. Woods, D. A. E. Dobbelaere, and K. S. Logan, Infect. Immun. 61

  13. Regulatory T cells and other lymphocyte subpopulations in patients with melanoma developing interferon-induced thyroiditis during high-dose interferon-α2b treatment.

    PubMed

    Soldevila, Berta; Alonso, Núria; Martínez-Arconada, Maria J; Granada, Maria L; Boada, Aram; Vallejos, Virginia; Fraile, Manuel; Fernández-Sanmartín, Marco A; Pujol-Borrell, Ricardo; Puig-Domingo, Manel; Sanmartí, Anna; Martínez-Cáceres, Eva M

    2013-04-01

    One of the side effects of interferon-alpha therapy is interferon-induced thyroiditis (IIT). The role of lymphocyte subpopulations in IIT melanoma patients remains to be defined. Our objective was to assess different peripheral blood lymphocyte subpopulations, mainly regulatory T cells (Tregs), in melanoma patients who developed IIT. From 30 melanoma patients receiving high-dose interferon (HDI)-alpha 2b (IFN-α2b) treatment, those who developed IIT (IIT patients) were selected and compared with patients who did not develop IIT (Co-MM) and healthy controls (Co-H). Peripheral blood mononuclear cells were obtained before treatment (BT), mid-treatment (MT), end of treatment (ET), 24 weeks post-treatment and at appearance of IIT (TT). Nine patients developed IIT (30%): four Hashimoto's thyroiditis and five destructive thyroiditis. An increase in Tregs was observed in both melanoma groups during HDI treatment. A decrease in CD3(+) , NKT lymphocyte subpopulations and Bcl2 expression on B cells was also observed in both groups. However, no changes were observed in the percentage of CD4(+) , CD8(+) , CD3(+) γδ(+) , CD19(+) , transitional B cells (CD24(high) CD38(high) CD19(+) CD27(-) ), natural killer (NK), invariant NKT (iNKT) lymphocytes and Th1/Th2 balance when BT was compared with ET. At TT, IIT patients had a higher Tregs percentage than Co-MM (P = 0·012) and Co-H (P = 0·004), a higher iNKT percentage than Co-MM (P = 0·011), a higher transitional B cells percentage than Co-H (P = 0·015), a lower CD3(+) percentage than Co-H (P = 0·001) and a lower Bcl2 expression on B cells than Co-H (P < 0·001). Our results point to the immunomodulatory effects of IFN-α on different lymphocyte subpopulations and a possible role of Tregs in melanoma patients who developed IIT. © 2012 Blackwell Publishing Ltd.

  14. Effect of carprofen administration during banding or burdizzo castration of bulls on plasma cortisol, in vitro interferon-gamma production, acute-phase proteins, feed intake, and growth.

    PubMed

    Pang, W Y; Earley, B; Sweeney, T; Crowe, M A

    2006-02-01

    The objective of this study was to determine the effect of carprofen (C) administration before banding or burdizzo castration of bulls on cortisol, in vitro interferon-gamma (IFN-gamma) production, acute-phase proteins, feed intake, and growth. Fifty Holstein Friesian bulls (5.5 mo old; 191 +/- 3.7 kg) were blocked by weight and assigned randomly to 1 of 5 treatments (n = 10/treatment): 1) untreated control (2) banding castration at 0 min (Band); 3) Band following an i.v. injection of 1.4 mg/kg of BW of C at -20 min (Band+C); 4) Burdizzo castration at 0 min (Burd); or 5) Burd following 1.4 mg/kg of BW of C at -20 min (Burd+C). Castration acutely increased plasma cortisol concentrations compared with control; no significant differences occurred in peak and interval to peak cortisol responses between Band and Band+C or Burd and Burd+C groups. The administration of C in Band+C reduced (P < 0.05) the cortisol concentration between 6 and 12 h postcastration compared with Band animals. Overall, the integrated cortisol response was greater (P < 0.05) in the castrates than in control, whereas C treatments tended to reduce this response compared with Band (P = 0.08) and Burd (P = 0.07), respectively. Plasma fibrinogen was elevated in Band animals on d 14 and in Burd animals on d 3 and 14. Carprofen administration reduced Band- and Burd-induced fibrinogen production on d 14 and 3, respectively. Plasma haptoglobin was elevated in Band animals on d 3 and 35 compared with control, and C administration was effective in reducing the haptoglobin elevation on d 35 in Band+C compared with Band. There were no differences among treatments in in vitro IFN-gamma production induced by concanavalin A and phytohemagglutinin on d 1 and 2. Overall from d -1 to 16, there were no DMI differences among treatments. From d -1 to 35, there were no ADG differences among treatments. In conclusion, banding and burdizzo castration increased plasma cortisol with no change in in vitro IFN-gamma

  15. Specificity, cross-talk and adaptation in Interferon signaling

    NASA Astrophysics Data System (ADS)

    Zilman, Anton

    Innate immune system is the first line of defense of higher organisms against pathogens. It coordinates the behavior of millions of cells of multiple types, achieved through numerous signaling molecules. This talk focuses on the signaling specificity of a major class of signaling molecules - Type I Interferons - which are also used therapeutically in the treatment of a number of diseases, such as Hepatitis C, multiple sclerosis and some cancers. Puzzlingly, different Interferons act through the same cell surface receptor but have different effects on the target cells. They also exhibit a strange pattern of temporal cross-talk resulting in a serious clinical problem - loss of response to Interferon therapy. We combined mathematical modeling with quantitative experiments to develop a quantitative model of specificity and adaptation in the Interferon signaling pathway. The model resolves several outstanding experimental puzzles and directly affects the clinical use of Type I Interferons in treatment of viral hepatitis and other diseases.

  16. ATL response to arsenic/interferon therapy is triggered by SUMO/PML/RNF4-dependent Tax degradation.

    PubMed

    Dassouki, Zeina; Sahin, Umut; El Hajj, Hiba; Jollivet, Florence; Kfoury, Youmna; Lallemand-Breitenbach, Valérie; Hermine, Olivier; de Thé, Hugues; Bazarbachi, Ali

    2015-01-15

    The human T-cell lymphotropic virus type I (HTLV-1) Tax transactivator initiates transformation in adult T-cell leukemia/lymphoma (ATL), a highly aggressive chemotherapy-resistant malignancy. The arsenic/interferon combination, which triggers degradation of the Tax oncoprotein, selectively induces apoptosis of ATL cell lines and has significant clinical activity in Tax-driven murine ATL or human patients. However, the role of Tax loss in ATL response is disputed, and the molecular mechanisms driving degradation remain elusive. Here we demonstrate that ATL-derived or HTLV-1-transformed cells are dependent on continuous Tax expression, suggesting that Tax degradation underlies clinical responses to the arsenic/interferon combination. The latter enforces promyelocytic leukemia protein (PML) nuclear body (NB) formation and partner protein recruitment. In arsenic/interferon-treated HTLV-1 transformed or ATL cells, Tax is recruited onto NBs and undergoes PML-dependent hyper-sumoylation by small ubiquitin-like modifier (SUMO)2/3 but not SUMO1, ubiquitination by RNF4, and proteasome-dependent degradation. Thus, the arsenic/interferon combination clears ATL through degradation of its Tax driver, and this regimen could have broader therapeutic value by promoting degradation of other pathogenic sumoylated proteins. © 2015 by The American Society of Hematology.

  17. Production of interferon-alpha in high cell density cultures of recombinant Escherichia coli and its single step purification from refolded inclusion body proteins.

    PubMed

    Babu, K R; Swaminathan, S; Marten, S; Khanna, N; Rinas, U

    2000-06-01

    Escherichia coli TG1 transformed with a temperature-regulated interferon-alpha expression vector was grown to high cell density in defined medium containing glucose as the sole carbon and energy source, utilizing a simple fed-batch process. Feeding was carried out to achieve an exponential increase in biomass at growth rates which minimized acetate production. Thermal induction of such high cell density cultures resulted in the production of approximately 4 g interferon-alpha/l culture broth. Interferon-alpha was produced exclusively in the form of insoluble inclusion bodies and was solubilized under denaturing conditions, refolded in the presence of arginine and purified to near homogeneity, utilizing single-step ion-exchange chromatography on Q-Sepharose. The yield of purified interferon-alpha was approximately 300 mg/l with respect to the original high cell density culture broth (overall yield of approximately 7.5% active interferon-alpha). The purified recombinant interferon-alpha was found by different criteria to be predominantly monomeric and possessed a specific bioactivity of approximately 2.5 x 10(8) IU/mg based on viral cytopathic assay.

  18. Transfer of interferon alfa into human breast milk.

    PubMed

    Kumar, A R; Hale, T W; Mock, R E

    2000-08-01

    Originally assumed to be antiviral substances, the efficacy of interferons in a number of pathologies, including malignancies, multiple sclerosis, and other immune syndromes, is increasingly recognized. This study provides data on the transfer of interferon alfa (2B) into human milk of a patient receiving massive intravenous doses for the treatment of malignant melanoma. Following an intravenous dose of 30 million IU, the amount of interferon transferred into human milk was only slightly elevated (1551 IU/mL) when compared to control milk (1249 IU/mL). These data suggest that even following enormous doses, interferon is probably too large in molecular weight to transfer into human milk in clinically relevant amounts.

  19. Sustained exogenous expression of therapeutic levels of IFN-gamma ameliorates atopic dermatitis in NC/Nga mice via Th1 polarization.

    PubMed

    Hattori, Kayoko; Nishikawa, Makiya; Watcharanurak, Kanitta; Ikoma, Akihiko; Kabashima, Kenji; Toyota, Hiroyasu; Takahashi, Yuki; Takahashi, Rei; Watanabe, Yoshihiko; Takakura, Yoshinobu

    2010-03-01

    The short in vivo half-life of IFN-gamma can prevent the cytokine from inducing immunological changes that are favorable for the treatment of Th2-dominant diseases, such as atopic dermatitis. To examine whether a sustained supply of IFN-gamma is effective in regulating the balance of Th lymphocyte subpopulations, plasmid vector encoding mouse IFN-gamma, pCpG-Mugamma, or pCMV-Mugamma was injected into the tail vein of NC/Nga mice, a model for human atopic dermatitis. A single hydrodynamic injection of a CpG motif reduced pCpG-Mugamma at a dose of 0.14 microg/mouse resulted in a sustained concentration of IFN-gamma in the serum, and the concentration was maintained at >300 pg/ml over 80 d. The pCpG-Mugamma-mediated IFN-gamma gene transfer was associated with an increase in the serum concentration of IL-12, reduced production of IgE, and inhibition of mRNA expression of IL-4, -5, -10, -13, and -17 and thymus and activation-regulated chemokine in the spleen. These immunological changes were not clearly observed in mice receiving two injections of 20 microg pCMV-Mugamma, a CpG-replete plasmid DNA, because of the transient nature of the expression from the vector. The mice receiving pCpG-Mugamma showed a significant reduction in the severity of skin lesions and in the intensity of their scratching behavior. Furthermore, high transepidermal water loss, epidermal thickening, and infiltration of lymphocytes and eosinophils, all of which were obvious in the untreated mice, were significantly inhibited. These results indicate that an extraordinary sustained IFN-gamma expression induces favorable immunological changes, leading to a Th1-dominant state in the atopic dermatitis model.

  20. Interferon antagonist NSs of La Crosse virus triggers a DNA damage response-like degradation of transcribing RNA polymerase II.

    PubMed

    Verbruggen, Paul; Ruf, Marius; Blakqori, Gjon; Överby, Anna K; Heidemann, Martin; Eick, Dirk; Weber, Friedemann

    2011-02-04

    La Crosse encephalitis virus (LACV) is a mosquito-borne member of the negative-strand RNA virus family Bunyaviridae. We have previously shown that the virulence factor NSs of LACV is an efficient inhibitor of the antiviral type I interferon system. A recombinant virus unable to express NSs (rLACVdelNSs) strongly induced interferon transcription, whereas the corresponding wt virus (rLACV) suppressed it. Here, we show that interferon induction by rLACVdelNSs mainly occurs through the signaling pathway leading from the pattern recognition receptor RIG-I to the transcription factor IRF-3. NSs expressed by rLACV, however, acts downstream of IRF-3 by specifically blocking RNA polymerase II-dependent transcription. Further investigations revealed that NSs induces proteasomal degradation of the mammalian RNA polymerase II subunit RPB1. NSs thereby selectively targets RPB1 molecules of elongating RNA polymerase II complexes, the so-called IIo form. This phenotype has similarities to the cellular DNA damage response, and NSs was indeed found to transactivate the DNA damage response gene pak6. Moreover, NSs expressed by rLACV boosted serine 139 phosphorylation of histone H2A.X, one of the earliest cellular reactions to damaged DNA. However, other DNA damage response markers such as up-regulation and serine 15 phosphorylation of p53 or serine 1524 phosphorylation of BRCA1 were not triggered by LACV infection. Collectively, our data indicate that the strong suppression of interferon induction by LACV NSs is based on a shutdown of RNA polymerase II transcription and that NSs achieves this by exploiting parts of the cellular DNA damage response pathway to degrade IIo-borne RPB1 subunits.

  1. Type I interferon induces necroptosis in macrophages during infection with Salmonella enterica serovar Typhimurium

    PubMed Central

    Robinson, Nirmal; McComb, Scott; Mulligan, Rebecca; Dudani, Renu; Krishnan, Lakshmi; Sad, Subash

    2014-01-01

    Salmonella enterica serovar Typhimurium (S. Typhimurium) is a virulent pathogen that induces rapid host death. Here we observed that host survival after infection with S. Typhimurium was enhanced in the absence of type I interferon signaling, with improved survival of mice deficient in the receptor for type I interferons (Ifnar1−/− mice) that was attributed to macrophages. Although there was no impairment in cytokine expression or inflammasome activation in Ifnar1−/− macrophages, they were highly resistant to S. Typhimurium–induced cell death. Specific inhibition of the kinase RIP1or knockdown of the gene encoding the kinase RIP3 prevented the death of wild-type macrophages, which indicated that necroptosis was a mechanism of cell death. Finally, RIP3-deficient macrophages, which cannot undergo necroptosis, had similarly less death and enhanced control of S. Typhimurium in vivo. Thus, we propose that S. Typhimurium induces the production of type I interferon, which drives necroptosis of macrophages and allows them to evade the immune response. PMID:22922364

  2. Type I and type II interferons upregulate functional type I interleukin-1 receptor in a human fibroblast cell line TIG-1.

    PubMed

    Takii, T; Niki, N; Yang, D; Kimura, H; Ito, A; Hayashi, H; Onozaki, K

    1995-12-01

    The regulation of type I interleukin-1 receptor (IL-1R) expression by type I, interferon (IFN)-alpha A/D, and type II IFN, IFN-gamma, in a human fibroblast cell line TIG-1 was investigated. After 2 h stimulation with human IFN-alpha A/D or IFN-gamma, the levels of type I IL-1R mRNA increased. We previously reported that IL-1 upregulates transcription and cell surface molecules of type I IL-1R in TIG-1 cells through induction of prostaglandin (PG) E2 and cAMP accumulation. However, indomethacin was unable to inhibit the effect of IFNs, indicating that IFNs augment IL-1R expression through a pathway distinct from that of IL-1. The augmentation was also observed in other fibroblast cell lines. Nuclear run-on assays and studies of the stability of mRNA suggested that the increase in IL-1R mRNA was a result of the enhanced transcription of IL-1R gene. Binding studies using 125I-IL-1 alpha revealed that the number of cell surface IL-1R increased with no change in binding affinity by treatment with these IFNs. Pretreatment of the cells with IFNs enhanced IL-1-induced IL-6 production, indicating that IFNs upregulate functional IL-1R. IL-1 and IFNs are produced by the same cell types, as well as by the adjacent different cell types, and are concomitantly present in lesions of immune and inflammatory reactions. These results therefore suggest that IFNs exhibit synergistic effects with IL-1 through upregulation of IL-1R. Augmented production of IL-6 may also contribute to the reactions.

  3. Leaf-Encapsulated Vaccines: Agroinfiltration and Transient Expression of the Antigen Staphylococcal Endotoxin B in Radish Leaves

    PubMed Central

    Liu, Pei-Feng; Wang, Yanhan; Ulrich, Robert G.; Simmons, Christopher W.; VanderGheynst, Jean S.; Gallo, Richard L.

    2018-01-01

    Transgene introgression is a major concern associated with transgenic plant-based vaccines. Agroinfiltration can be used to selectively transform nonreproductive organs and avoid introgression. Here, we introduce a new vaccine modality in which Staphylococcal enterotoxin B (SEB) genes are agroinfiltrated into radishes (Raphanw sativus L.), resulting in transient expression and accumulation of SEB in planta. This approach can simultaneously express multiple antigens in a single leaf. Furthermore, the potential of high-throughput vaccine production was demonstrated by simultaneously agroinfiltrating multiple radish leaves using a multichannel pipette. The expression of SEB was detectable in two leaf cell types (epidermal and guard cells) in agroinfiltrated leaves. ICR mice intranasally immunized with homogenized leaves agroinfiltrated with SEB elicited detectable antibody to SEB and displayed protection against SEB-induced interferon-gamma (IFN-γ) production. The concept of encapsulating antigens in leaves rather than purifying them for immunization may facilitate rapid vaccine production during an epidemic disease. PMID:29577048

  4. INF-gamma rearranges membrane topography of MHC-I and ICAM-1 in colon carcinoma cells.

    PubMed

    Bacsó, Zsolt; Bene, László; Damjanovich, László; Damjanovich, Sándor

    2002-01-18

    Flow-cytometric fluorescence energy transfer (FCET) measurements between fluorescently labeled cell surface MHC-I and ICAM-1 molecules indicated similar receptor patterns in the plasma membrane of interferon-gamma (INF-gamma)-treated colon carcinoma cells as those observed earlier at the surface of lymphoid cells. INF-gamma activation significantly increased the density of MHC-I and ICAM-1 proteins in the membrane. This increase in receptor density was accompanied by decreased proximity level of the homo-associated MHC-I receptors. Hetero-association of MHC-I and ICAM-1 molecules was increased by INF-gamma treatment. INF-gamma changed neither hetero- nor homo-association of transferrin receptors. By staining the sphingomyelin/cholesterol-enriched lipid microdomains with fluorescently labeled cholera toxin B subunit, we found an increase in the amount of lipid-raft associated G(M1)-gangliosides due to INF-gamma treatment. Confocal microscopic results and FCET measurements show that MHC-I and ICAM-1 are components of G(M1)-ganglioside containing lipid-rafts and also support an increase in the size of these lipid-rafts upon INF-gamma treatment.

  5. Effect of bacterial endotoxin LPS on expression of INF-gamma and IL-5 in T-lymphocytes from asthmatics.

    PubMed

    Koch, Andrea; Knobloch, Jürgen; Dammhayn, Cathrin; Raidl, Maria; Ruppert, Andrea; Hag, Haitham; Rottlaender, Dennis; Müller, Katja; Erdmann, Erland

    2007-11-01

    Epidemiological evidence, in vitro studies and animal models suggest that exposure to the bacterial endotoxin lipopolysaccharide (LPS) can influence the development and severity of asthma. Although it is known that signaling through Toll-like receptors (TLR) is required for adaptive T helper cell type 1 and 2 responses, it is unclear whether the LPS ligand TLR 4 is expressed on CD4(+) and CD8(+) T-lymphocytes and if so, whether LPS could modulate the T(H)1 or T(H)2 response in this context. The present authors have, therefore, examined the expression of TLR 4 on peripheral blood CD4(+) and CD8(+) T-lymphocytes using RT-PCR method and FACS analyses. Furthermore, the authors have studied the IL-12-induced expression of the T(H)1-associated cytokine INF-gamma and the IL-4-induced expression of the T(H)2-specific cytokine IL-5 in the presence of LPS using ELISA and compared nine atopic asthmatic subjects and eleven nonatopic normal volunteers. There was an increased anti-CD3/anti-CD28-induced IL-5 expression in T cells of asthmatics compared with normals (p<0.01). In the presence of IL-4 (10 ng/ml), there was an additional increase in IL-5 expression and this additional increase was greater in T cells of normals compared with asthmatics (p<0.05). There was an expression of INF-gamma in anti-CD3/anti-CD28-induced T-lymphocytes without differences between both groups (NS). In the presence of IL-12 (10 ng/ml), there was an increase in INF-gamma release without differences between normals and asthmatics (NS). In the presence of different concentrations of LPS (10 ng/ml, 1 mug/ml), there was a decrease in IL-4-induced IL-5 expression without differences in both groups, indicating an intact T(H)2 response to bacterial endotoxin LPS in asthma. Interestingly, LPS increased the IL-12-induced INF-gamma release in a concentration-dependent manner in T-lymphocytes of normals but this could not be found in T cells of asthmatics, indicating an impaired T(H)1 response to bacterial

  6. Effects of the estrous cycle, pregnancy and interferon tau on expression of cyclooxygenase two (COX-2) in ovine endometrium

    PubMed Central

    Kim, Seokwoon; Choi, Youngsok; Spencer, Thomas E; Bazer, Fuller W

    2003-01-01

    In sheep, the uterus produces luteolytic pulses of prostaglandin F2α (PGF) on Days 15 to 16 of estrous cycle to regress the corpus luteum (CL). These PGF pulses are produced by the endometrial lumenal epithelium (LE) and superficial ductal glandular epithelium (sGE) in response to binding of pituitary and/or luteal oxytocin to oxytocin receptors (OTR) and liberation of arachidonic acid, the precursor of PGF. Cyclooxygenase-one (COX-1) and COX-2 are rate-limiting enzymes in PGF synthesis, and COX-2 is the major form expressed in ovine endometrium. During pregnancy recognition, interferon tau (IFNτ), produced by the conceptus trophectoderm, acts in a paracrine manner to suppress development of the endometrial epithelial luteolytic mechanism by inhibiting transcription of estrogen receptor α (ERα) (directly) and OTR (indirectly) genes. Conflicting studies indicate that IFNτ increases, decreases or has no effect on COX-2 expression in bovine and ovine endometrial cells. In Study One, COX-2 mRNA and protein were detected solely in endometrial LE and sGE of both cyclic and pregnant ewes. During the estrous cycle, COX-2 expression increased from Days 10 to 12 and then decreased to Day 16. During early pregnancy, COX-2 expression increased from Days 10 to 12 and remained higher than in cyclic ewes. In Study Two, intrauterine infusion of recombinant ovine IFNτ in cyclic ewes from Days 11 to 16 post-estrus did not affect COX-2 expression in the endometrial epithelium. These results clearly indicate that IFNτ has no effect on expression of the COX-2 gene in the ovine endometrium. Therefore, antiluteolytic effects of IFNτ are to inhibit ERα and OTR gene transcription, thereby preventing endometrial production of luteolytic pulses of PGF. Indeed, expression of COX-2 in the endometrial epithelia as well as conceptus is likely to have a beneficial regulatory role in implantation and development of the conceptus. PMID:12956885

  7. Altered expression and activation of signal transducers and activators of transcription (STATs) in hepatitis C virus infection: in vivo and in vitro studies.

    PubMed

    Larrea, E; Aldabe, R; Molano, E; Fernandez-Rodriguez, C M; Ametzazurra, A; Civeira, M P; Prieto, J

    2006-08-01

    Signal transducers and activators of transcription (STATs) play a critical role in antiviral defence. STAT3 is also important in cell protection against inflammatory damage. STAT proteins are activated by interferons and by hepatoprotective cytokines of the interleukin 6 superfamily, including cardiotrophin 1. We analysed the status of STATs in hepatitis C virus (HCV) infected livers and the relationship between expression and activation of STATs and HCV replication in Huh7 cells transfected with HCV genomic replicon. STAT3alpha expression was reduced in HCV infected livers showing an inverse correlation with serum alanine aminotransferase. In patients with HCV infection, nuclear staining for phosphorylated STAT3 was faint in parenchymal cells (although conspicuous in infiltrating leucocytes), in contrast with strong nuclear staining in hepatocytes from control livers. Expression and activation of STAT1 (a factor activated by both interferon (IFN)-alpha and IFN-gamma) were increased in HCV infected livers, particularly in those with high inflammatory activity. Conversely, phosphorylated STAT2 (a factor selectively activated by IFN-alpha) was undetectable in livers with HCV infection, a finding that was associated with marked downregulation of the two functional subunits of the IFN-alpha receptor. HCV replication in Huh7 cells caused STAT3alpha downregulation and blocked STAT3 phosphorylation by either IFN-alpha or cardiotrophin 1. HCV replication in Huh7 cells also inhibited STAT1 and STAT2 activation by IFN-alpha while there was no impairment of STAT1 phosphorylation by the proinflammatory cytokine IFN-gamma. STAT3 is downregulated in HCV infected livers and in Huh7 cells bearing the full length HCV replicon. HCV replication is associated with impaired Jak-STAT signalling by antiviral and cytoprotective cytokines. These effects may favour viral replication while facilitating the progression of liver disease.

  8. Enhanced production of human influenza virus in PBS-12SF cells with a reduced interferon response.

    PubMed

    Carvajal-Yepes, Monica; Sporer, Kelly R B; Carter, Jenna L; Colvin, Christopher J; Coussens, Paul M

    2015-01-01

    Influenza is one of the most important infectious diseases in humans. The best way to prevent severe illness caused by influenza infection is vaccination. Cell culture-derived influenza vaccines are being considered in addition to the widely used egg-based system in order to support the increasing seasonal demand and to be prepared in case of a pandemic. Cell culture based systems offer increased safety, capacity, and flexibility with reduced downstream processing relative to embryonated eggs. We have previously reported a chick embryo cell line, termed PBS-12SF, that supports replication of human and avian influenza A viruses to high titers (>10(7) PFU/ml) without the need for exogenous proteases or serum proteins. Viral infections in cells are limited by the Interferon (IFN) response typified by production of type I IFNs that bind to the IFNα/β receptor and activate an antiviral state. In this study, we investigated how neutralizing the interferon (IFN) response in PBS-12SF cells, via shRNA-mediated knock-down of IFNAR1 mRNA expression, affects influenza virus production. We were successful in knocking down ∼90% of IFNAR1 protein expression by this method, resulting in a significant decrease in the response to recombinant chIFNα stimulation in PBS-12SF cells as shown by a reduction in expression of interferon-responsive genes when compared to control cells. Additionally; IFNAR1-knock-down cells displayed enhanced viral HA production and released more virus into cell culture supernatants than parental PBS-12SF cells.

  9. Interferon sensitivity-determining region of hepatitis C virus influences virus production and interferon signaling

    PubMed Central

    Sugiyama, Ryuichi; Murayama, Asako; Nitta, Sayuri; Yamada, Norie; Tasaka-Fujita, Megumi; Masaki, Takahiro; Aly, Hussein Hassan; Shiina, Masaaki; Ryo, Akihide; Ishii, Koji; Wakita, Takaji; Kato, Takanobu

    2018-01-01

    The number of amino acid substitutions in the interferon (IFN) sensitivity-determining region (ISDR) of hepatitis C virus (HCV) NS5A is a strong predictor for the outcome of IFN-based treatment. To assess the involvement of ISDR in the HCV life cycle and to clarify the molecular mechanisms influencing IFN susceptibility, we used recombinant JFH-1 viruses with NS5A of the genotype 1b Con1 strain (JFH1/5ACon1) and with NS5A ISDR containing 7 amino acid substitutions (JFH1/5ACon1/i-7mut), and compared the virus propagation and the induction of interferon-stimulated genes (ISGs). By transfecting RNAs of these strains into HuH-7-derived cells, we found that the efficiency of infectious virus production of JFH1/5ACon1/i-7mut was attenuated compared with JFH1/5ACon1. After transfecting full-length HCV RNA into HepaRG cells, the mRNA expression of ISGs was sufficiently induced by IFN treatment in JFH1/5ACon1/i-7mut-transfected but not in JFH1/5ACon1-transfected cells. These data suggested that the NS5A-mediated inhibition of ISG induction was deteriorated by amino acid substitutions in the ISDR. In conclusion, using recombinant JFH-1 viruses, we demonstrated that HCV NS5A is associated with infectious virus production and the inhibition of IFN signaling, and amino acid substitutions in the NS5A ISDR deteriorate these functions. These observations explain the strain-specific evasion of IFN signaling by HCV. PMID:29464023

  10. Regulation of the steady state level of Fc gamma RI mRNA by IFN-gamma and dexamethasone in human monocytes, neutrophils, and U-937 cells.

    PubMed

    Pan, L Y; Mendel, D B; Zurlo, J; Guyre, P M

    1990-07-01

    The high affinity IgG FcR Fc gamma RI, CD64, plays important roles in the immune response. Fc gamma RI is predominantly expressed on monocytes and macrophages, and barely detectable on neutrophils. rIFN-gamma markedly increases the expression of Fc gamma RI on neutrophils, monocytes, macrophages and myeloid cell lines such as U-937, HL-60, and THP-1. Glucocorticoids inhibit the augmentation of Fc gamma RI expression by rIFN-gamma on neutrophils and myeloid cell lines, but enhance the augmentation of Fc gamma RI expression by rIFN-gamma on monocytes. In this study, we examined the effect of rIFN-gamma and dexamethasone (Dex) on the steady state level of Fc gamma RI mRNA in U-937 cells, neutrophils, and monocytes by hybridizing total RNA with the Fc gamma RI cDNA probe, p135. We found that the amount of Fc gamma RI mRNA increased within 1 h of treatment with rIFN-gamma in all three cell types. This initial induction of Fc gamma RI mRNA by rIFN-gamma was completely blocked by an inhibitor of RNA synthesis, actinomycin D, suggesting that the rIFN-gamma-mediated induction of Fc gamma RI mRNA is dependent on gene transcription. Dex, used in combination with rIFN-gamma, partially blocked the induction of Fc gamma RI mRNA by rIFN-gamma in U-937 cells and neutrophils, but caused a synergistic increase in Fc gamma RI mRNA levels in monocytes. The inhibitory effect of Dex on the steady state level of Fc gamma RI mRNA in U-937 cells was blocked by an inhibitor of protein synthesis, cycloheximide, suggesting that Dex-induced proteins were involved in the regulation of Fc gamma RI expression. This study indicates that the regulation of Fc gamma RI expression on U-937 cells, neutrophils, and monocytes by rIFN-gamma and Dex occurs, at least in part, at the mRNA level. rIFN-gamma increases the steady state level of Fc gamma RI mRNA through a common pathway among U-937 cells, neutrophils, and monocytes, whereas the effect of Dex on rIFN-gamma-induced Fc gamma RI mRNA is cell

  11. Interferon Induced Transfer of Viral Resistance

    DTIC Science & Technology

    1981-02-01

    necseeary and Identify by block number) - Interferon, Cell Communication, Resistance Transfer, Viruses , Antibody Production, Polypeptide Hormones...lymphocytes and the foreign cells, but not mycoplasmas or endogenous viruses , appears to be required for induction. The kinetics of production of leukocyte...interferon by nonsensitized lymphocytes in response to foreign cells is similar to that induced by viruses . We have shown that a component probably of Vie

  12. Interferon Induced Transfer of Viral Resistance

    DTIC Science & Technology

    1982-02-01

    released from the cell membrane. We have also shown that CM’s activity is removed by a gelatin /sepharose affinity column which selectively binds...interferon preparation adsorbing to the WISH cells, interferon was subjected to gelatin /sepharose affinity chromatography to remove endogenous...caused an increase in the amount of H-.amnino acids incorporated into a gelatin binding protein, presumably fibronectin. This suggests that in addition to

  13. [Interferons--its method of administration and adverse effect related to pharmacokinetics ].

    PubMed

    Furue, H

    1984-02-01

    The potential role of interferons in the treatment of malignant diseases is currently being evaluated. This paper reviews experimental and clinical findings regarding pharmacokinetics, method of administration, and side reactions of interferons. Interferon in the blood is rapidly cleared from the circulation. Intramuscular injection of alpha-interferon causes low but stable interferon levels in the blood. However, in the case of beta-interferon, interferon is never detected consistently in the blood after intramuscular or subcutaneous administration. The studies with animal models suggest that doses higher than those given in current clinical trials will be necessary to obtain clearly beneficial effects in human. The maximum safely tolerated daily dose is appreciably higher than that used in most previous studies, although even at this level, considerable toxicity may be encountered. Adequate method of administration, route, dose and interval are not yet established at all. Exact mechanism of anticancer activity is not yet well defined. The most frequent side reaction is fever. However, the exact mechanism to cause these side reactions is also not yet clarified. Dose limiting central nervous system toxicities, hypotension, hypocalcaemia etc. are occasionally encountered in some instances. Antibody to interferon is demonstrated in some cases. Purification of interferon does not always causes reduction of side reactions. The treatment of cancer cases with interferon has just started and there are many problems to be solved. However, therapeutic beneficial may be achieved in the treatment of malignant tumors by appropriate combinations of interferon with conventional treatment. More laboratory studies as well as carefully controlled clinical observations are warranted.

  14. Fc gamma RII/III and CD2 expression mark distinct subpopulations of immature CD4-CD8- murine thymocytes: in vivo developmental kinetics and T cell receptor beta chain rearrangement status.

    PubMed

    Rodewald, H R; Awad, K; Moingeon, P; D'Adamio, L; Rabinowitz, D; Shinkai, Y; Alt, F W; Reinherz, E L

    1993-04-01

    We have recently identified a dominant wave of CD4-CD8- (double-negative [DN]) thymocytes in early murine fetal development that express low affinity Fc gamma receptors (Fc gamma RII/III) and contain precursors for Ti alpha/beta lineage T cells. Here we show that Fc gamma RII/III is expressed in very immature CD4low single-positive (SP) thymocytes and that Fc gamma RII/III expression is downregulated within the DN subpopulation and before the CD3-CD8low SP stage in T cell receptor (TCR)-alpha/beta lineage-committed thymocytes. DN Fc gamma RII/III+ thymocytes also contain a small fraction of TCR-gamma/delta lineage cells in addition to TCR-alpha/beta progenitors. Fetal day 15.5 DN TCR-alpha/beta lineage progenitors can be subdivided into three major subpopulations as characterized by cell surface expression of Fc gamma RII/III vs. CD2 (Fc gamma RII/III+CD2-, Fc gamma RII/III+CD2+, Fc gamma RII/III-CD2+). Phenotypic analysis during fetal development as well as adoptive transfer of isolated fetal thymocyte subpopulations derived from C57B1/6 (Ly5.1) mice into normal, nonirradiated Ly5.2 congenic recipient mice identifies one early differentiation sequence (Fc gamma RII/III+CD2(-)-->Fc gamma RII/III+CD2(+)-->Fc gamma RII/III-CD2+) that precedes the entry of DN thymocytes into the CD4+CD8+ double-positive (DP) TCRlow/- stage. Unseparated day 15.5 fetal thymocytes develop into DP thymocytes within 2.5 d and remain at the DP stage for > 48 h before being selected into either CD4+ or CD8+ SP thymocytes. In contrast, Fc gamma RII/III+CD2- DN thymocytes follow this same developmental pathway but are delayed by approximately 24 h before entering the DP compartment, while Fc gamma RII/III-CD2+ display accelerated development by approximately 24 h compared with total day 15.5 thymocytes. Fc gamma RII/III-CD2+ are also more developmentally advanced than Fc gamma RII/III+CD2- fetal thymocytes with respect to their TCR beta chain V(D)J rearrangement. At day 15.5 in gestation, beta

  15. Foot-and-mouth disease virus leader proteinase inhibits dsRNA-induced type I interferon transcription by decreasing interferon regulatory factor 3/7 in protein levels

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Dang; Fang, Liurong; Luo, Rui

    2010-08-13

    Research highlights: {yields} FMDV L{sup pro} inhibits poly(I:C)-induced IFN-{alpha}1/{beta} mRNA expression. {yields} L{sup pro} inhibits MDA5-mediated activation of the IFN-{alpha}1/{beta} promoter. {yields} L{sup pro} significantly reduced the transcription of multiple IRF-responsive genes. {yields} L{sup pro} inhibits IFN-{alpha}1/{beta} promoter activation by decreasing IRF-3/7 in protein levels. {yields} The ability to process eIF-4G of L{sup pro} is not necessary to inhibit IFN-{alpha}1/{beta} activation. -- Abstract: The leader proteinase (L{sup pro}) of foot-and-mouth disease virus (FMDV) has been identified as an interferon-{beta} (IFN-{beta}) antagonist that disrupts the integrity of transcription factor nuclear factor {kappa}B (NF-{kappa}B). In this study, we showed that the reductionmore » of double stranded RNA (dsRNA)-induced IFN-{alpha}1/{beta} expression caused by L{sup pro} was also associated with a decrease of interferon regulatory factor 3/7 (IRF-3/7) in protein levels, two critical transcription factors for activation of IFN-{alpha}/{beta}. Furthermore, overexpression of L{sup pro} significantly reduced the transcription of multiple IRF-responsive genes including 2',5'-OAS, ISG54, IP-10, and RANTES. Screening L{sup pro} mutants indicated that the ability to process eIF-4G of L{sup pro} is not required for suppressing dsRNA-induced activation of the IFN-{alpha}1/{beta} promoter and decreasing IRF-3/7 expression. Taken together, our results demonstrate that, in addition to disrupting NF-{kappa}B, L{sup pro} also decreases IRF-3/7 expression to suppress dsRNA-induced type I IFN production, suggesting multiple strategies used by FMDV to counteract the immune response to viral infection.« less

  16. Identification and Expression Analysis of the Interferon-Induced Protein with Tetratricopeptide Repeats 5 (IFIT5) Gene in Duck (Anas platyrhynchos domesticus)

    PubMed Central

    Mu, Chunyu; Su, Yanhui; Liu, Ran; Huang, Zhengyang; Li, Yang; Yu, Qingming; Chang, Guobin; Xu, Qi; Chen, Guohong

    2015-01-01

    The interferon-induced proteins with tetratricopeptide repeats (IFITs) protein family mediates antiviral effects by inhibiting translation initiation, cell proliferation, and migration in the interferon (IFN) dependent innate immune system. Several members of this family, including IFIT1, IFIT2, IFIT3 and IFIT5, have been heavily studied in mammals. Avian species contain only one family member, IFIT5, and little is known about the role of this protein in birds. In this study, duck IFIT5 (duIFIT5) full-length mRNA was cloned by reverse transcription polymerase chain reaction (RT-PCR) and rapid amplification of the cDNA ends (RACE). Based on the sequence obtained, we performed a series of bioinformatics analyses, and found that duIFIT5 was most similar to homologs in other avian species. Also, duIFIT5 contained eight conserved TPR motifs and two conserved multi-domains (TPR_11 and TPR_12). Finally, we used duck hepatitis virus type 1 (DHV-1) and polyriboinosinicpolyribocytidylic acid (poly (I:C)) as a pathogen or a pathogen-associated molecular pattern induction to infect three-day-old domestic ducklings. The liver and spleen were collected to detect the change in duIFIT5 transcript level upon infection by quantitative real-time PCR (qRT-PCR). DuIFIT5 expression rapidly increased after DHV-1 infection and maintained a high level, while the transcripts of duIFIT5 peaked at 8h after poly (I:C) infection and then returned to normal. Taken together, these results provide a greater understanding of avian IFIT5. PMID:25816333

  17. FOXL2 is regulated during the bovine estrous cycle and its expression in the endometrium is independent of conceptus-derived interferon tau.

    PubMed

    Eozenou, Caroline; Vitorino Carvalho, Anaïs; Carvalho, Anaïs Vitorino; Forde, Niamh; Giraud-Delville, Corinne; Gall, Laurence; Lonergan, Pat; Auguste, Aurélie; Charpigny, Gilles; Richard, Christophe; Pannetier, Maëlle; Sandra, Olivier

    2012-08-01

    FOXL2, a winged-helix/forkhead domain transcription factor, is a key gene involved in the differentiation and biological functions of the ovary. In a recent transcriptomic analysis, we found that FOXL2 expression in bovine caruncular endometrium was different from that in intercaruncular endometrium. In order to gain new insights into FOXL2 in this tissue, we determined the expression of this transcription factor during the estrous cycle and the establishment of pregnancy in cattle. The endometrial expression of FOXL2 did not vary during maternal recognition of pregnancy (Days 16-20). Using an in vivo bovine model and primary cell cultures, we showed that FOXL2 was not an interferon-tau target gene. Both FOXL2 transcript and protein were expressed from Day 5 to Day 20 of the estrous cycle, and their levels showed a significant increase during the luteolytic phase. A 2-day progesterone supplementation in heifers led to a clear down-regulation of FOXL2 protein levels, suggesting the negative impact of progesterone on FOXL2 expression. Immunohistochemistry data revealed the localization of FOXL2 in endometrial stromal and glandular cells. FOXL2 subcellular distribution was shown to be nuclear in endometrial samples collected during the luteolytic period, while it was not detected in nuclei during the luteal phase and at implantation. Collectively, our findings provide the first evidence that FOXL2 is involved in the regulation of endometrial tissue physiology.

  18. Beta-interferon inhibits cell infection by Trypanosoma cruzi

    NASA Technical Reports Server (NTRS)

    Kierszenbaum, F.; Sonnenfeld, G.

    1984-01-01

    Beta interferon has been shown to inhibit the capacity of bloodstream forms of the flagellate Trypanosoma cruzi, the causative agent of Chagas' disease, to associate with and infect mouse peritoneal macrophages and rat heart myoblasts. The inhibitory effect was abrogated in the presence of specific antibodies to the interferon. Pretreatment of the parasites with interferon reduced their infectivity for untreated host cells, whereas pretreament of either type of host cell did not affect the interaction. The effect of interferon on the trypanosomes was reversible; the extent of the inhibitory effect was significantly reduced afer 20 min, and was undetectable after 60 min when macrophages were used as host cells. For the myoblasts, 60 min elapsed before the inhibitory effect began to subside and 120 min elapsed before it became insignificant or undetectable.

  19. Knockdown of hTERT and concurrent treatment with interferon-gamma inhibited proliferation and invasion of human glioblastoma cell lines

    PubMed Central

    George, Joseph; Banik, Naren L.; Ray, Swapan K.

    2011-01-01

    Human telomerase reverse transcriptase (hTERT) is the catalytic component of telomerase that facilitates tumor cell invasion and proliferation. Telomerase and hTERT are remarkably upregulated in majority of cancers including glioblastoma. Interferon-gamma (IFN-γ) modulates several cellular activities including cell cycle and multiplication through transcriptional regulation. The present investigation was designed to unravel the molecular mechanisms of the inhibition of cell proliferation, migration, and invasion of human glioblastoma SNB-19 and LN-18 cell lines after knockdown of hTERT using a plasmid vector based siRNA and concurrent treatment with IFN-γ. We observed more than 80% inhibition of cell proliferation, migration, and invasion of both cell lines after the treatment with combination of hTERT siRNA and IFN-γ. Our studies also showed accumulation of apoptotic cells in subG1 phase and an increase in cell population in G0/G1 with a reduction in G2/M phase indicating cell cycle arrest in G0/G1 phase for apoptosis. Semiquantitative and real-time RT-PCR analyses demonstrated significant downregulation of c- Myc and upregulation of p21 Waf1 and p27 Kip1. Western blotting confirmed the downregulation of the molecules involved in cell proliferation, migration, and invasion and also showed upregulation of cell cycle inhibitors. In conclusion, our study demonstrated that knockdown of hTERT siRNA and concurrent treatment with IFN-γ effectively inhibited cell proliferation, migration, and invasion in glioblastoma cells through downregulation of the molecules involved in these processes and cell cycle inhibition. Therefore, the combination of hTERT siRNA and IFN-γ offers a potential therapeutic strategy for controlling growth of human glioblastoma cells. PMID:20394835

  20. How Methodologic Differences Affect Results of Economic Analyses: A Systematic Review of Interferon Gamma Release Assays for the Diagnosis of LTBI

    PubMed Central

    Oxlade, Olivia; Pinto, Marcia; Trajman, Anete; Menzies, Dick

    2013-01-01

    Introduction Cost effectiveness analyses (CEA) can provide useful information on how to invest limited funds, however they are less useful if different analysis of the same intervention provide unclear or contradictory results. The objective of our study was to conduct a systematic review of methodologic aspects of CEA that evaluate Interferon Gamma Release Assays (IGRA) for the detection of Latent Tuberculosis Infection (LTBI), in order to understand how differences affect study results. Methods A systematic review of studies was conducted with particular focus on study quality and the variability in inputs used in models used to assess cost-effectiveness. A common decision analysis model of the IGRA versus Tuberculin Skin Test (TST) screening strategy was developed and used to quantify the impact on predicted results of observed differences of model inputs taken from the studies identified. Results Thirteen studies were ultimately included in the review. Several specific methodologic issues were identified across studies, including how study inputs were selected, inconsistencies in the costing approach, the utility of the QALY (Quality Adjusted Life Year) as the effectiveness outcome, and how authors choose to present and interpret study results. When the IGRA versus TST test strategies were compared using our common decision analysis model predicted effectiveness largely overlapped. Implications Many methodologic issues that contribute to inconsistent results and reduced study quality were identified in studies that assessed the cost-effectiveness of the IGRA test. More specific and relevant guidelines are needed in order to help authors standardize modelling approaches, inputs, assumptions and how results are presented and interpreted. PMID:23505412

  1. Role of T Cells and Gamma Interferon during Induction of Hypersensitivity to Lipopolysaccharide by Toxic Shock Syndrome Toxin 1 in Mice

    PubMed Central

    Dinges, Martin M.; Schlievert, Patrick M.

    2001-01-01

    The superantigenic function of toxic shock syndrome toxin 1 (TSST-1) is generally regarded as an important determinant of its lethal effects in humans or experimental animals. This study examined the role of superantigenicity in a BALB/c mouse model of lethal TSST-1-induced hypersensitivity to lipopolysaccharide (LPS). In this model, TSST-1 greatly potentiated both LPS-induced lethality, as well as LPS-induced serum tumor necrosis factor alpha (TNF-α) activity. Although BALB/c-SCID mice were resistant to these LPS enhancement effects of TSST-1, BALB/c-SCID mice reconstituted with T cells were completely susceptible to the enhancement effect of TSST-1 on LPS-induced serum TNF-α. Mice pretreated with cyclosporine (Cs) or neutralizing antibodies against gamma interferon (IFN-γ) did not develop lethal LPS hypersensitivity when injected with TSST-1, and these agents reduced the enhancement effect of TSST-1 on LPS-induced serum TNF-α by 99 and 85%, respectively. Cs pretreatment also completely inhibited the known capacity of TSST-1 to amplify LPS-induced levels of IFN-γ in serum. In contrast, mice given Cs after a priming injection of TSST-1, but before LPS, still exhibited lethal hypersensitivity to LPS. Cs given after TSST-1 also did not inhibit enhancement of LPS-induced serum TNF-α by TSST-1 but inhibited the enhancement effect of TSST-1 on LPS-induced serum IFN-γ by 50%. These experiments support the theory that TSST-1-induced hypersensitivity to LPS is mediated primarily by IFN-γ derived from superantigen-activated T cells. PMID:11179286

  2. Differential induction of Toll-like receptors & type 1 interferons by Sabin attenuated & wild type 1 polioviruses in human neuronal cells.

    PubMed

    Mohanty, Madhu C; Deshpande, Jagadish M

    2013-01-01

    Polioviruses are the causative agent of paralytic poliomyelitis. Attenuated polioviruses (Sabin oral poliovirus vaccine strains) do not replicate efficiently in neurons as compared to the wild type polioviruses and therefore do not cause disease. This study was aimed to investigate the differential host immune response to wild type 1 poliovirus (wild PV) and Sabin attenuated type 1 poliovirus (Sabin PV) in cultured human neuronal cells. By using flow cytometry and real time PCR methods we examined host innate immune responses and compared the role of toll like receptors (TLRs) and cytoplasmic RNA helicases in cultured human neuronal cells (SK-N-SH) infected with Sabin PV and wild PV. Human neuronal cells expressed very low levels of TLRs constitutively. Sabin PV infection induced significantly higher expression of TLR3, TLR7 and melanoma differentiation-associated protein-5 (MDA-5) m-RNA in neuronal cells at the beginning of infection (up to 4 h) as compared to wild PV. Further, Sabin PV also induced the expression of interferon α/β at early time point of infection. The induced expression of IFN α/β gene by Sabin PV in neuronal cells could be suppressed by inhibiting TLR7. Neuronal cell innate immune response to Sabin and wild polioviruses differ significantly for TLR3, TLR7, MDA5 and type 1 interferons. Effects of TLR7 activation and interferon production and Sabin virus replication in neuronal cells need to be actively investigated in future studies.

  3. Transglutaminase 2 expression is enhanced synergistically by interferon-γ and tumour necrosis factor-α in human small intestine

    PubMed Central

    Bayardo, M; Punzi, F; Bondar, C; Chopita, N; Chirdo, F

    2012-01-01

    Transglutaminase 2 (TG2) is expressed ubiquitously, has multiple physiological functions and has also been associated with inflammatory diseases, neurodegenerative disorders, autoimmunity and cancer. In particular, TG2 is expressed in small intestine mucosa where it is up-regulated in active coeliac disease (CD). The aim of this work was to investigate the induction of TG2 expression by proinflammatory cytokines [interleukin (IL)-1, IL-6, tumour necrosis factor (TNF)-α, interferon (IFN)-γ and IL-15] and the signalling pathways involved, in human epithelial and monocytic cells and in intestinal tissue from controls and untreated CD patients. Here we report that IFN-γ was the most potent inducer of TG2 expression in the small intestinal mucosa and in four [Caco-2, HT-29, Calu-6 and human acute monocytic leukaemia cell line (THP-1)] of five cell lines tested. The combination of TNF-α and IFN-γ produced a strong synergistic effect. The use of selective inhibitors of signalling pathways revealed that induction of TG2 by IFN-γ was mediated by phosphoinositide 3-kinase (PI3K), while c-Jun N-terminal kinase (JNK) and p38 mitogen-activated protein kinase (MAPK) were required for TNF-α activation. Quantitative polymerase chain reaction (PCR), flow cytometry and Western blot analysis showed that TG2 expression was blocked completely when stimulation by either TNF-α or IFN-γ was performed in the presence of nuclear factor (NF)-κB inhibitors (sulphasalazine and BAY-117082). TG2 was up-regulated substantially by TNF-α and IFN-γ in intestinal mucosa in untreated CD compared with controls. This study shows that IFN-γ, a dominant cytokine in intestinal mucosa in active CD, is the most potent inducer of TG2, and synergism with TNF-α may contribute to exacerbate the pathogenic mechanism of CD. Selective inhibition of signalling pathways may be of therapeutic benefit. PMID:22385244

  4. Transglutaminase 2 expression is enhanced synergistically by interferon-γ and tumour necrosis factor-α in human small intestine.

    PubMed

    Bayardo, M; Punzi, F; Bondar, C; Chopita, N; Chirdo, F

    2012-04-01

    Transglutaminase 2 (TG2) is expressed ubiquitously, has multiple physiological functions and has also been associated with inflammatory diseases, neurodegenerative disorders, autoimmunity and cancer. In particular, TG2 is expressed in small intestine mucosa where it is up-regulated in active coeliac disease (CD). The aim of this work was to investigate the induction of TG2 expression by proinflammatory cytokines [interleukin (IL)-1, IL-6, tumour necrosis factor (TNF)-α, interferon (IFN)-γ and IL-15] and the signalling pathways involved, in human epithelial and monocytic cells and in intestinal tissue from controls and untreated CD patients. Here we report that IFN-γ was the most potent inducer of TG2 expression in the small intestinal mucosa and in four [Caco-2, HT-29, Calu-6 and human acute monocytic leukaemia cell line (THP-1)] of five cell lines tested. The combination of TNF-α and IFN-γ produced a strong synergistic effect. The use of selective inhibitors of signalling pathways revealed that induction of TG2 by IFN-γ was mediated by phosphoinositide 3-kinase (PI3K), while c-Jun N-terminal kinase (JNK) and p38 mitogen-activated protein kinase (MAPK) were required for TNF-α activation. Quantitative polymerase chain reaction (PCR), flow cytometry and Western blot analysis showed that TG2 expression was blocked completely when stimulation by either TNF-α or IFN-γ was performed in the presence of nuclear factor (NF)-κB inhibitors (sulphasalazine and BAY-117082). TG2 was up-regulated substantially by TNF-α and IFN-γ in intestinal mucosa in untreated CD compared with controls. This study shows that IFN-γ, a dominant cytokine in intestinal mucosa in active CD, is the most potent inducer of TG2, and synergism with TNF-α may contribute to exacerbate the pathogenic mechanism of CD. Selective inhibition of signalling pathways may be of therapeutic benefit. © 2011 The Authors. Clinical and Experimental Immunology © 2011 British Society for Immunology.

  5. Interferon lambda inhibits dengue virus replication in epithelial cells.

    PubMed

    Palma-Ocampo, Helen K; Flores-Alonso, Juan C; Vallejo-Ruiz, Verónica; Reyes-Leyva, Julio; Flores-Mendoza, Lilian; Herrera-Camacho, Irma; Rosas-Murrieta, Nora H; Santos-López, Gerardo

    2015-09-28

    In viral disease, infection is controlled at the cellular level by type I interferon (IFN-I), but dengue virus (DENV) has the ability to inhibit this response. Type III interferon, also known as lambda IFN (IFN-III or IFN-λ), is a complementary pathway to the antiviral response by IFN-I. This work analyzed the IFN-λ (IFN-III) mediated antiviral response against DENV serotype 2 (DENV-2) infection. Dengue fever patients were sampled to determine their IFN-λ levels by ELISA. To study the IFN-λ response during DENV infection we selected the epithelial cell line C33-A, and we demonstrated that it is permissive to DENV-2 infection. The effect of IFN-λ on virus replication was determined in these cells, in parallel to the expression of IFN-stimulated genes (ISGs), and Suppressor of Cytokine Signaling (SOCS), genes measured by RT-qPCR. We found increased (~1.8 times) serological IFN-λ in dengue fever patients compared to healthy blood donors. IFN-λ inhibited DENV-2 replication in a dose-dependent manner in vitro. The reduction of viral titer corresponded with increased ISG mRNA levels (MX1 and OAS1), with the highest inhibition occurring at ISG's peak expression. Presence of IFN-negative regulators, SOCS1 and SOCS3, during DENV-2 infection was associated with reduced IFN-λ1 expression. Evidence described here suggests that IFN-λ is a good candidate inhibitor of viral replication in dengue infection. Mechanisms for the cellular and organismal interplay between DENV and IFN- λ need to be further studied as they could provide insights into strategies to treat this disease. Furthermore, we report a novel epithelial model to study dengue infection in vitro.

  6. Clinical efficacy of gamma knife and surgery treatment of mesial temporal lobe epilepsy and their effects on EF-Tumt and EF-Tsmt expression.

    PubMed

    Wang, X-Q; Zhang, X-D; Han, Y-M; Shi, X-F; Lan, Z-B; Men, X-X; Pan, Y-W

    2017-04-01

    To study the clinical efficacy of gamma knife and surgery treatment of mesial temporal lobe epilepsy (MTLE) and their effects on EF-Tumt and EF-Tsmt expression. The data of 78 cases of MTLE patients treated in our hospital from April 2011 to March 2013 were retrospectively analyzed. The patients were divided into two groups according to the treatment methods: the surgery group (including 41 cases) and the gamma knife group (including 37 cases). The clinical efficacy, the occurrence and recurrence of complications were evaluated, respectively; meanwhile, the expression of the EF-Tumt protein and EF-Tsmt protein in brain tissue were analyzed. The difference between the efficacy rate of the two groups showed no statistical significance (χ2=0.960, p>0.05). The complication rate of the gamma knife group was significantly lower than that of the control group (χ2=6.430, p<0.05). The recurrence rate of the patients in the gamma knife group was significantly lower than that of the patients in the surgery group (p>0.05). Within the two groups, the positive expression granum of EF-Tsmt protein and EF-Tumt protein of the two groups after treatment were significantly lower than that before treatment (p<0.05). After treatment, the positive expression granum of EF-Tsmt protein of the patients in the gamma knife group was obviously more than that of the patients in the surgery group (p<0.05). The difference between the positive expression granum of EF-Tumt protein of the two groups showed no statistical significance (p>0.05). Before and after treatment within the group, the positive cell of EF-Tsmt protein and EF-Tumt protein of the two groups of patients after treatment were significantly lower than that before treatment (p<0.05). After treatment, the difference between the EF-Tsmt protein positive cell and the EF-Tumt protein positive cell of the two groups of patients showed no statistical significance (p>0.05). Both surgery and gamma knife could treat MTLE effectively, and

  7. Arthritis is inhibited in Borrelia-primed and infected interleukin-17A-deficient mice after administration of anti-gamma-interferon, anti-tumor necrosis factor alpha and anti-interleukin-6 antibodies.

    PubMed

    Kuo, Joseph; Warner, Thomas F; Schell, Ronald F

    2017-08-31

    The role that cytokines play in the induction of Lyme arthritis is gradually being delineated. We showed previously that severe arthritis developed in a T-cell-driven murine model, even in mice lacking interleukin-17A (IL-17A) and administered anti-gamma-interferon (IFN-γ) antibody. Increased levels of tumor necrosis factor alpha (TNF-α) and interleukin-6 (IL-6), two pro-inflammatory cytokines, were detected in cultures of popliteal lymph node cells obtained from these mice. We hypothesized that concomitantly administered anti-IL-6, anti-TNF-α and anti-IFN-γ antibodies would inhibit the development of arthritis in IL-17A-deficient mice. Our results showed that swelling of the hind paws and histopathological changes consistent with arthritis were significantly reduced in IL-17A-deficient mice that administered the three anti-cytokine antibodies. These results suggest that treatment with multiple anti-cytokine antibodies can abrogate the induction of Lyme arthritis in mice. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  8. Improved Innate and Adaptive Immunostimulation by Genetically Modified HIV-1 Protein Expressing NYVAC Vectors

    PubMed Central

    Quakkelaar, Esther D.; Redeker, Anke; Haddad, Elias K.; Harari, Alexandre; McCaughey, Stella Mayo; Duhen, Thomas; Filali-Mouhim, Abdelali; Goulet, Jean-Philippe; Loof, Nikki M.; Ossendorp, Ferry; Perdiguero, Beatriz; Heinen, Paul; Gomez, Carmen E.; Kibler, Karen V.; Koelle, David M.; Sékaly, Rafick P.; Sallusto, Federica; Lanzavecchia, Antonio; Pantaleo, Giuseppe; Esteban, Mariano; Tartaglia, Jim; Jacobs, Bertram L.; Melief, Cornelis J. M.

    2011-01-01

    Attenuated poxviruses are safe and capable of expressing foreign antigens. Poxviruses are applied in veterinary vaccination and explored as candidate vaccines for humans. However, poxviruses express multiple genes encoding proteins that interfere with components of the innate and adaptive immune response. This manuscript describes two strategies aimed to improve the immunogenicity of the highly attenuated, host-range restricted poxvirus NYVAC: deletion of the viral gene encoding type-I interferon-binding protein and development of attenuated replication-competent NYVAC. We evaluated these newly generated NYVAC mutants, encoding HIV-1 env, gag, pol and nef, for their ability to stimulate HIV-specific CD8 T-cell responses in vitro from blood mononuclear cells of HIV-infected subjects. The new vectors were evaluated and compared to the parental NYVAC vector in dendritic cells (DCs), RNA expression arrays, HIV gag expression and cross-presentation assays in vitro. Deletion of type-I interferon-binding protein enhanced expression of interferon and interferon-induced genes in DCs, and increased maturation of infected DCs. Restoration of replication competence induced activation of pathways involving antigen processing and presentation. Also, replication-competent NYVAC showed increased Gag expression in infected cells, permitting enhanced cross-presentation to HIV-specific CD8 T cells and proliferation of HIV-specific memory CD8 T-cells in vitro. The recombinant NYVAC combining both modifications induced interferon-induced genes and genes involved in antigen processing and presentation, as well as increased Gag expression. This combined replication-competent NYVAC is a promising candidate for the next generation of HIV vaccines. PMID:21347234

  9. Host Defense against Viral Infection Involves Interferon Mediated Down-Regulation of Sterol Biosynthesis

    PubMed Central

    Blanc, Mathieu; Hsieh, Wei Yuan; Robertson, Kevin A.; Watterson, Steven; Shui, Guanghou; Lacaze, Paul; Khondoker, Mizanur; Dickinson, Paul; Sing, Garwin; Rodríguez-Martín, Sara; Phelan, Peter; Forster, Thorsten; Strobl, Birgit; Müller, Matthias; Riemersma, Rudolph; Osborne, Timothy; Wenk, Markus R.; Angulo, Ana; Ghazal, Peter

    2011-01-01

    Little is known about the protective role of inflammatory processes in modulating lipid metabolism in infection. Here we report an intimate link between the innate immune response to infection and regulation of the sterol metabolic network characterized by down-regulation of sterol biosynthesis by an interferon regulatory loop mechanism. In time-series experiments profiling genome-wide lipid-associated gene expression of macrophages, we show a selective and coordinated negative regulation of the complete sterol pathway upon viral infection or cytokine treatment with IFNγ or β but not TNF, IL1β, or IL6. Quantitative analysis at the protein level of selected sterol metabolic enzymes upon infection shows a similar level of suppression. Experimental testing of sterol metabolite levels using lipidomic-based measurements shows a reduction in metabolic output. On the basis of pharmacologic and RNAi inhibition of the sterol pathway we show augmented protection against viral infection, and in combination with metabolite rescue experiments, we identify the requirement of the mevalonate-isoprenoid branch of the sterol metabolic network in the protective response upon statin or IFNβ treatment. Conditioned media experiments from infected cells support an involvement of secreted type 1 interferon(s) to be sufficient for reducing the sterol pathway upon infection. Moreover, we show that infection of primary macrophages containing a genetic knockout of the major type I interferon, IFNβ, leads to only a partial suppression of the sterol pathway, while genetic knockout of the receptor for all type I interferon family members, ifnar1, or associated signaling component, tyk2, completely abolishes the reduction of the sterol biosynthetic activity upon infection. Levels of the proteolytically cleaved nuclear forms of SREBP2, a key transcriptional regulator of sterol biosynthesis, are reduced upon infection and IFNβ treatment at both the protein and de novo transcription level. The

  10. Stimulatory role of interleukin 10 in CD8+ T cells through STATs in gastric cancer.

    PubMed

    Xi, Jianjun; Xu, Mingzheng; Song, Zongchang; Li, Hongqiang; Xu, Shumin; Wang, Chunmei; Song, Haihan; Bai, Jianwen

    2017-05-01

    CD8 + T cells are considered to be critical in tumor surveillance and elimination. Increased CD8 + T cell frequency and function is associated with better prognosis in cancer patients. Interleukin 10 is a cytokine with controversial roles in CD8 + T cell-mediated anti-tumor immunity. We therefore examined the interleukin 10 expression and consumption in CD8 + T cells harvested from the peripheral blood and resected tumors of gastric cancer patients of stages II-IV. We found that the gastric cancer patients presented significantly elevated frequencies of interleukin 10-expressing cells in both CD4 + and CD8 + T cells compared to healthy controls. But distinctive from the interleukin 10-expressing CD4 + T cells, which increased in frequency in advanced cancer, the interleukin 10-expressing CD8 + T cells did not increase with cancer stage in the peripheral blood and actually decreased with cancer stage in resected tumor. Interleukin 10 and interleukin 10 receptor expression was also enriched in interferon gamma-expressing activated CD8 + T cells. Compared to interleukin 10-nonexpressing CD8 + T cells, interleukin 10 receptor-expressing CD8 + T cells secreted significantly elevated interferon gamma levels. Treatment of anti-CD3/CD28-stimulated, purified CD8 + T cells with interleukin 10 alone could significantly enhance CD8 + T cell survival, an effect dependent on interleukin 10 receptor expression. Interleukin 10 also increased CD8 + T cell proliferation synergistically with interferon gamma but not alone. Analysis of downstream signal transducer and activator of transcription molecules showed that interleukin 10 treatment significantly increased the phosphorylation of signal transducer and activator of transcription 3 and signal transducer and activator of transcription 1 to lesser extent. Together, these results demonstrate that interleukin 10 possessed stimulatory roles in activated CD8 + T cells from gastric cancer patients.

  11. Interferon for the treatment of genital warts: a systematic review

    PubMed Central

    2009-01-01

    Background Interferon has been widely used in the treatment of genital warts for its immunomodulatory, antiproliferative and antiviral properties. Currently, no evidence that interferon improves the complete response rate or reduces the recurrence rate of genital warts has been generally provided. The aim of this review is to assess, from randomized control trials (RCTs), the efficacy and safety of interferon in curing genital warts. Methods We searched Cochrane Sexually Transmitted Diseases Group's Trials Register (January, 2009), Cochrane Central Register of Controlled Trials (2009, issue 1), PubMed (1950-2009), EMBASE (1974-2009), Chinese Biomedical Literature Database (CBM) (1975-2009), China National Knowledge Infrastructure (CNKI) (1979-2009), VIP database (1989-2009), as well as reference lists of relevant studies. Two reviewers independently screened searched studies, extracted data and evaluated their methodological qualities. RevMan 4.2.8 software was used for meta-analysis Results 12 RCTs involving 1445 people were included. Among them, 7 studies demonstrated the complete response rate of locally-used interferon as compared to placebo for treating genital warts. Based on meta-analysis, the rate of Complete response of the two interventions differed significantly (locally-used interferon:44.4%; placebo:16.1%). The difference between the two groups had statistical significance (RR 2.68, 95% CI 1.79 to 4.02, P < 0.00001). 5 studies demonstrated the complete response rate of systemically-used interferon as compared to placebo for treating genital warts. Based on meta-analysis, the rate of Complete response of the two interventions had no perceivable discrepancy (systemically-used interferon:27.4%; placebo:26.4%). The difference between the two groups had no statistical significance (RR1.25, 95% CI 0.80 to 1.95, P > 0.05). 7 studies demonstrated the recurrence rate of interferon as compared to placebo for treating genital warts. Based on meta-analysis, the

  12. Interferon for the treatment of genital warts: a systematic review.

    PubMed

    Yang, Jin; Pu, Yu-Guo; Zeng, Zhong-Ming; Yu, Zhi-Jian; Huang, Na; Deng, Qi-Wen

    2009-09-21

    Interferon has been widely used in the treatment of genital warts for its immunomodulatory, antiproliferative and antiviral properties. Currently, no evidence that interferon improves the complete response rate or reduces the recurrence rate of genital warts has been generally provided. The aim of this review is to assess, from randomized control trials (RCTs), the efficacy and safety of interferon in curing genital warts. We searched Cochrane Sexually Transmitted Diseases Group's Trials Register (January, 2009), Cochrane Central Register of Controlled Trials (2009, issue 1), PubMed (1950-2009), EMBASE (1974-2009), Chinese Biomedical Literature Database (CBM) (1975-2009), China National Knowledge Infrastructure (CNKI) (1979-2009), VIP database (1989-2009), as well as reference lists of relevant studies. Two reviewers independently screened searched studies, extracted data and evaluated their methodological qualities. RevMan 4.2.8 software was used for meta-analysis 12 RCTs involving 1445 people were included. Among them, 7 studies demonstrated the complete response rate of locally-used interferon as compared to placebo for treating genital warts. Based on meta-analysis, the rate of Complete response of the two interventions differed significantly (locally-used interferon:44.4%; placebo:16.1%). The difference between the two groups had statistical significance (RR 2.68, 95% CI 1.79 to 4.02, P < 0.00001). 5 studies demonstrated the complete response rate of systemically-used interferon as compared to placebo for treating genital warts. Based on meta-analysis, the rate of Complete response of the two interventions had no perceivable discrepancy (systemically-used interferon:27.4%; placebo:26.4%). The difference between the two groups had no statistical significance (RR1.25, 95% CI 0.80 to 1.95, P > 0.05). 7 studies demonstrated the recurrence rate of interferon as compared to placebo for treating genital warts. Based on meta-analysis, the recurrence rate of the two

  13. Over-expression of C/EBP-{alpha} induces apoptosis in cultured rat hepatic stellate cells depending on p53 and peroxisome proliferator-activated receptor-{gamma}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang Xueqing; Huang Guangcun; Mei Shuang

    2009-03-06

    Hepatic stellate cells (HSCs) play a key role in the pathogenesis of hepatic fibrosis. In our previous studies, CCAAT enhancer binding protein-{alpha} (C/EBP-{alpha}) has been shown to be involved in the activation of HSCs and to have a repression effect on hepatic fibrosis in vivo. However, the mechanisms are largely unknown. In this study, we show that the infection of adenovirus vector expressing C/EBP-{alpha} gene (Ad-C/EBP-{alpha}) could induce HSCs apoptosis in a dose- and time-dependent manner by Annexin V/PI staining, caspase-3 activation assay, and flow cytometry. Also, over-expression of C/EBP-{alpha} resulted in the up-regulation of peroxisome proliferator-activated receptor-{gamma} (PPAR-{gamma}) andmore » P53, while P53 expression was regulated by PPAR-{gamma}. In addition, Fas, FasL, DR4, DR5, and TRAIL were studied. The results indicated that the death receptor pathway was mainly involved and regulated by PPAR-{gamma} and p53 in the process of apoptosis triggered by C/EBP-{alpha} in HSCs.« less

  14. Comparison of the interferon-tau expression from primary trophectoderm outgrowths derived from IVP, NT, and parthenogenote bovine blastocysts.

    PubMed

    Talbot, Neil C; Powell, Anne M; Ocón, Olga M; Caperna, Thomas J; Camp, Mary; Garrett, Wesley M; Ealy, Alan D

    2008-02-01

    The expression of interferon-tau (IFN-tau) is essential for bovine embryo survival in the uterus. An evaluation of IFN-tau production from somatic cell nuclear transfer (NT)-embryo-derived primary trophectoderm cultures in comparison to trophectoderm cultured from parthenogenote (P) and in vitro matured, fertilized, and cultured (IVP) bovine embryos was performed. In Experiment 1, the success/failure ratio for primary trophectoderm colony formation was similar for IVP and NT blastocysts [IVP = 155/29 (84%); NT 104/25 (81%)], but was decreased (P = .05) for P blastocysts [54/43 (56%)]. Most trophectoderm colonies reached diameters of at least 1 cm within 3-4 weeks, and at this time, 72 hr conditioned cell culture medium was measured for IFN-tau concentration by antiviral activity assay. The amount of IFN-tau produced by IVP-outgrowths [4311 IU/mL (n = 155)] was greater (P < .05) than that from NT- [626 IU/mL (n = 104)] and P - [1595 IU/mL (n = 54)] derived trophectoderm. Differential expression of IFN-tau was confirmed by immunoblotting. In Experiment 2, colony formation was again similar for IVP and NT blastocysts [IVP = 70/5 (93%); NT 67/1 (99%)] and less (P < .05) for P blastocysts [65/27 (70%)]. Analysis of trophectoderm colony size after 23 days in culture showed a similar relationship with P-derived colonies being significantly smaller in comparison to IVP and NT colonies. A differential expression of IFN-tau was also observed again, but this time as measured over time in culture. Maximal IFN-tau production was found at day-14 of primary culture and diminished to a minimum by the 23rd day. 2007 Wiley-Liss, Inc

  15. [Alpha-interferon and mental disorders].

    PubMed

    Debien, C; De Chouly De Lenclave, M B; Foutrein, P; Bailly, D

    2001-01-01

    The interferon alpha stands as a reference both in oncology and virology. But its efficiency is limited by frequent somatic as well as neuropsychic side effects. As a matter of fact, the reduction or the ending of a chemotherapy treatment come chiefly from the psychiatric complications caused by the use of interferon. For about 30% of patients, various psychic disorders are noticed: personality disorders, mood disorders, anxiety states, suicidal tendencies, manic and psychotic symptoms. We thus propose a review which shall be completed by a discussion on wether the interferon is responsible or not of the appearance of the described mental disorders. We shall conclude with a synthesis of the proposed practical management when confronted with such disorders. Psychiatric complications under interferon-Alpha. The appearance of psychiatric complications caused by interferon has been the subject of many publications. They have also raised the question of the toxicity mechanism which is still misunderstood today. This toxicity appears to be dose-dependent with variations depending on the daily dose given, the mode of administration, the combination with other chemotherapy treatments, the concomitance with a cerebral radiotherapy or a medical history of psychiatric disorders. Most of these effects occur after three weeks of treatment but non specific neuropsychic symptoms can be observed earlier. Non specific symptoms. They appear early but are difficult to detect, though they bring together a whole lot of clinical signs: asthenia, irritability, psychomotor slowdown, depressive mood or even a real "subsyndromic" depressive syndrome, anorexia, decline of the libido, concentration and attention problems, dizzy spells and headaches. Some authors have described intense and fluctuating of personality, mixing anxiety, irritability and disorder of drive control. Depression. Depression is the most frequently found psychiatric pathology in studies but the real frequency of clear

  16. Periplasmic expression of human interferon-alpha 2c in Escherichia coli results in a correctly folded molecule.

    PubMed Central

    Voss, T; Falkner, E; Ahorn, H; Krystek, E; Maurer-Fogy, I; Bodo, G; Hauptmann, R

    1994-01-01

    Human interferon-alpha 2c (IFN-alpha 2c) was produced in Escherichia coli under the control of the alkaline phosphatase promoter using a periplasmic expression system. Compared with other leader sequences, the heat-stable enterotoxin II leader of E. coli (STII) resulted in the highest rate of correct processing as judged by Western-blot analysis. The fermentation was designed as a batch-fed process in order to obtain a high yield of biomass. The processing rate of IFN-alpha 2c could be increased from 25% to more than 50% by shifting the fermentation pH from 7.0 to 6.7. IFN-alpha 2c extracted from the periplasm was purified by a new four-step chromatographic procedure. Whereas cytoplasmically produced IFN-alpha 2c does not have its full native structure, IFN-alpha 2c extracted from the periplasm was found to be correctly folded, as shown by c.d. spectroscopy. Peptide-map analysis in combination with m.s. revealed the correct formation of disulphide bridges. N-terminal sequence analysis showed complete removal of the leader sequence, creating the authentic N-terminus starting with cysteine. Images Figure 3 Figure 4 Figure 6 PMID:8141788

  17. Type I interferon and pattern recognition receptor signaling following particulate matter inhalation

    PubMed Central

    2012-01-01

    Background Welding, a process that generates an aerosol containing gases and metal-rich particulates, induces adverse physiological effects including inflammation, immunosuppression and cardiovascular dysfunction. This study utilized microarray technology and subsequent pathway analysis as an exploratory search for markers/mechanisms of in vivo systemic effects following inhalation. Mice were exposed by inhalation to gas metal arc – stainless steel (GMA-SS) welding fume at 40 mg/m3 for 3 hr/d for 10 d and sacrificed 4 hr, 14 d and 28 d post-exposure. Whole blood cells, aorta and lung were harvested for global gene expression analysis with subsequent Ingenuity Pathway Analysis and confirmatory qRT-PCR. Serum was collected for protein profiling. Results The novel finding was a dominant type I interferon signaling network with the transcription factor Irf7 as a central component maintained through 28 d. Remarkably, these effects showed consistency across all tissues indicating a systemic type I interferon response that was complemented by changes in serum proteins (decreased MMP-9, CRP and increased VCAM1, oncostatin M, IP-10). In addition, pulmonary expression of interferon α and β and Irf7 specific pattern recognition receptors (PRR) and signaling molecules (Ddx58, Ifih1, Dhx58, ISGF3) were induced, an effect that showed specificity when compared to other inflammatory exposures. Also, a canonical pathway indicated a coordinated response of multiple PRR and associated signaling molecules (Tlr7, Tlr2, Clec7a, Nlrp3, Myd88) to inhalation of GMA-SS. Conclusion This methodological approach has the potential to identify consistent, prominent and/or novel pathways and provides insight into mechanisms that contribute to pulmonary and systemic effects following toxicant exposure. PMID:22776377

  18. Type I interferon and pattern recognition receptor signaling following particulate matter inhalation.

    PubMed

    Erdely, Aaron; Antonini, James M; Salmen-Muniz, Rebecca; Liston, Angie; Hulderman, Tracy; Simeonova, Petia P; Kashon, Michael L; Li, Shengqiao; Gu, Ja K; Stone, Samuel; Chen, Bean T; Frazer, David G; Zeidler-Erdely, Patti C

    2012-07-09

    Welding, a process that generates an aerosol containing gases and metal-rich particulates, induces adverse physiological effects including inflammation, immunosuppression and cardiovascular dysfunction. This study utilized microarray technology and subsequent pathway analysis as an exploratory search for markers/mechanisms of in vivo systemic effects following inhalation. Mice were exposed by inhalation to gas metal arc - stainless steel (GMA-SS) welding fume at 40 mg/m3 for 3 hr/d for 10 d and sacrificed 4 hr, 14 d and 28 d post-exposure. Whole blood cells, aorta and lung were harvested for global gene expression analysis with subsequent Ingenuity Pathway Analysis and confirmatory qRT-PCR. Serum was collected for protein profiling. The novel finding was a dominant type I interferon signaling network with the transcription factor Irf7 as a central component maintained through 28 d. Remarkably, these effects showed consistency across all tissues indicating a systemic type I interferon response that was complemented by changes in serum proteins (decreased MMP-9, CRP and increased VCAM1, oncostatin M, IP-10). In addition, pulmonary expression of interferon α and β and Irf7 specific pattern recognition receptors (PRR) and signaling molecules (Ddx58, Ifih1, Dhx58, ISGF3) were induced, an effect that showed specificity when compared to other inflammatory exposures. Also, a canonical pathway indicated a coordinated response of multiple PRR and associated signaling molecules (Tlr7, Tlr2, Clec7a, Nlrp3, Myd88) to inhalation of GMA-SS. This methodological approach has the potential to identify consistent, prominent and/or novel pathways and provides insight into mechanisms that contribute to pulmonary and systemic effects following toxicant exposure.

  19. Interactions of the interferon system with cellular metabolism

    NASA Technical Reports Server (NTRS)

    Sonnenfeld, Gerald

    1986-01-01

    The results of studies concerning the interaction of the interferon (Inf) system with the activities of carcinogens, tumor promoters, and cytochrome P-450 are presented. The results show that the addition of a tumor promoter (TPA or 4-O-methyl-TPA) to a tissue culture enhances virus-induced Inf-gamma production, suggesting a potential value of tumor promoters in the biosynthesis of commercial Inf. On the other hand, the carcinogens were reported to inhibit the induction of Inf-alpha/beta in cultured cells and in intact animals (with no effect on the administered or preformed Inf). The demonstration of a correlation between the carcinogenic potential of a compound and its inhibitive effect on Inf production suggests a possible use of the Inf production assay in the evaluation of the carcinogenicity of chemicals. In addition, it was shown that the induction of Inf-alpha/beta as well as the administration of this Inf depresses the levels of rat liver cytochrome P-450 which is responsible for binding lipophilic drugs, steroids, and carcinogens, thus increasing the toxicity of the respective chemical.

  20. Type I interferon signature in systemic lupus erythematosus.

    PubMed

    Bezalel, Shira; Guri, Keren Mahlab; Elbirt, Daniel; Asher, Ilan; Sthoeger, Zev Moshe

    2014-04-01

    Type I interferons (IFN) are primarily regarded as an inhibitor of viral replication. However, type I IFN, mainly IFNalpha, plays a major role in activation of both the innate and adaptive immune systems. Systemic lupus erythematosus (SLE) is a chronic, multi-systemic, inflammatory autoimmune disease with undefined etiology. SLE is characterized by dysregulation of both the innate and the adaptive immune systems. An increased expression of type I IFN-regulated genes, termed IFN signature, has been reported in patients with SLE. We review here the role of IFNalpha in the pathogenesis and course of SLE and the possible role of IFNalpha inhibition as a novel treatment for lupus patients.