USDA-ARS?s Scientific Manuscript database
Gamma interferon (IFN-gamma)-induced protein 10 (IP-10) has recently shown promise as a diagnostic biomarker of Mycobacterium tuberculosis infection of humans. The aim of the current study was to compare IP-10 and IFN-gamma responses upon Mycobacterium bovis infection in cattle using archived sample...
Morar, D; Tijhaar, E; Negrea, A; Hendriks, J; van Haarlem, D; Godfroid, J; Michel, A L; Rutten, V P M G
2007-01-15
Bovine tuberculosis (BTB) is endemic in African buffalo (Syncerus caffer) in the Kruger National Park (KNP). In addition to buffalo, Mycobacterium bovis has been found in at least 14 other mammalian species in South Africa, including kudu (Tragelaphus strepsiceros), Chacma baboon (Papio ursinus) and lion (Panthera leo). This has raised concern about the spillover into other potentially susceptible species like rhinoceros, thus jeopardising breeding and relocation projects aiming at the conservation of biodiversity. Hence, procedures to screen for and diagnose BTB in black rhinoceros (Diceros bicornis) and white rhinoceros (Ceratotherium simum) need to be in place. The Interferon-gamma (IFN-gamma) assay is used as a routine diagnostic tool to determine infection of cattle and recently African buffalo, with M. bovis and other mycobacteria. The aim of the present work was to develop reagents to set up a rhinoceros IFN-gamma (RhIFN-gamma) assay. The white rhinoceros IFN-gamma gene was cloned, sequenced and expressed as a mature protein. Amino acid (aa) sequence analysis revealed that RhIFN-gamma shares a homology of 90% with equine IFN-gamma. Monoclonal antibodies, as well as polyclonal chicken antibodies (Yolk Immunoglobulin-IgY) with specificity for recombinant RhIFN-gamma were produced. Using the monoclonals as capture antibodies and the polyclonal IgY for detection, it was shown that recombinant as well as native white rhinoceros IFN-gamma was recognised. This preliminary IFN-gamma enzyme-linked immunosorbent assay (ELISA), has the potential to be developed into a diagnostic assay for M. bovis infection in rhinoceros.
Yoo, J C; Pae, H O; Choi, B M; Kim, W I; Kim, J D; Kim, Y M; Chung, H T
2000-02-01
The effects of ionizing irradiation on the nitric oxide (NO) production in murine embryonic liver cell line, BNL CL.2 cells, were investigated. Various doses (5-40 Gy) of radiation made BNL CL.2 cells responsive to interferon-gamma alone for the production of NO in a dose-dependent manner. Small amounts of lipopolysaccharide (LPS) or tumor necrosis factor-alpha (TNF-alpha) synergized with IFN-gamma in the production of NO from irradiated BNL CL.2 cells, even though LPS or TNF-alpha alone did not induce NO production from the same cells. Immunoblots showed parallel induction of inducible nitric oxide synthase (iNOS). NO production in irradiated BNL CL.2 cells by IFN-gamma or IFN-gamma plus LPS was decreased by the addition of catalase, suggesting that H(2)O(2) produced by ionizing irradiation primed the cells to trigger NO production in response to IFN-gamma or IFN-gamma plus LPS. Furthermore, the treatment of nongamma-irradiated BNL CL.2 cells with H(2)O(2) made the cells responsive to IFN-gamma or IFN-gamma plus LPS for the production of NO. This study shows that ionizing irradiation has the ability to induce iNOS gene expression in responsive to IFN-gamma via the formation of H(2)O(2) in BNL CL.2 murine embryonic liver cells.
Si, Yue; Ciccone, Samantha; Yang, Feng-Chun; Yuan, Jin; Zeng, Daisy; Chen, Shi; van de Vrugt, Henri J; Critser, John; Arwert, Fre; Haneline, Laura S; Clapp, D Wade
2006-12-15
Fanconi anemia (FA) is a heterogeneous genetic disorder characterized by bone marrow (BM) failure and cancer susceptibility. Identification of the cDNAs of FA complementation types allows the potential of using gene transfer technology to introduce functional cDNAs as transgenes into autologous stem cells and provide a cure for the BM failure in FA patients. However, strategies to enhance the mobilization, transduction, and engraftment of exogenous stem cells are required to optimize efficacy prior to widespread clinical use. Hypersensitivity of Fancc-/- cells to interferon-gamma (IFN-gamma), a nongenotoxic immune-regulatory cytokine, enhances engraftment of syngeneic wild-type (WT) cells in Fancc-/- mice. However, whether this phenotype is of broad relevance in other FA complementation groups is unresolved. Here we show that primitive and mature myeloid progenitors in Fanca-/- and Fancg-/- mice are hypersensitive to IFN-gamma and that in vivo infusion of IFN-gamma at clinically relevant concentrations was sufficient to allow consistent long-term engraftment of isogenic WT repopulating stem cells. Given that FANCA, FANCC, and FANCG complementation groups account for more than 90% of all FA patients, these data provide evidence that IFN-gamma conditioning may be a useful nongenotoxic strategy for myelopreparation in FA patients.
Asea, A; Hansson, M; Czerkinsky, C; Houze, T; Hermodsson, S; Strannegård, O; Hellstrand, K
1996-08-01
Monocytes, recovered from human peripheral blood by counter-current centrifugal elutriation, effectively inhibit the production of IFN-gamma by CD3-/56+ NK cells in response to IL-2. This study aimed at defining the nature of the inhibitory signal, particularly the importance of monocyte-derived reactive metabolites of oxygen. It was found that monocytes recovered from patients with chronic granulomatous disease (CGD), a condition characterized by deficient NADPH-oxidase activity of phagocytes, did not inhibit IFN-gamma production by NK cells. Further, catalase, a scavenger of hydrogen peroxide, completely reversed the inhibitory signal whereas scavengers of the superoxide anion, hypohalous acids, the hydroxyl radical, or nitric oxide synthesis inhibitors such as L-NMMA were ineffective. Inhibition of IFN-gamma production was operating on a pretranslational level, as indicated by the inability of enriched NK cells to accumulate IFN-gamma mRNA in the presence of elutriated monocytes. Hydrogen peroxide, at micromolar concentrations, reconstituted the inhibition of IFN-gamma production when added to enriched NK cells. Histamine, a biogenic amine which inhibits the generation of reactive oxygen metabolites in monocytes, abrogated the inhibition of IFN-gamma production in NK cells; by this mechanism, histamine strongly synergized with IL-2 to induce IFN-gamma in mixtures of NK cells and monocytes. The synergizing effect of histamine was specifically mediated by H2-type histamine receptors. We conclude that: (i) the induction of IFN-gamma mRNA in NK cells is effectively down-regulated by products of the oxidative metabolism of monocytes; and (ii) histamine effectively enhances IFN-gamma production by preventing monocyte-induced oxidative damage to NK cells.
Maloney, Nicole S.; Thackray, Larissa B.; Goel, Gautam; Hwang, Seungmin; Duan, Erning; Vachharajani, Punit; Xavier, Ramnik
2012-01-01
Noroviruses (NVs) cause the majority of cases of epidemic nonbacterial gastroenteritis worldwide and contribute to endemic enteric disease. However, the molecular mechanisms responsible for immune control of their replication are not completely understood. Here we report that the transcription factor interferon regulatory factor 1 (IRF-1) is required for control of murine NV (MNV) replication and pathogenesis in vivo. This led us to studies documenting a cell-autonomous role for IRF-1 in gamma interferon (IFN-γ)-mediated inhibition of MNV replication in primary macrophages. This role of IRF-1 in the inhibition of MNV replication by IFN-γ is independent of IFN-αβ signaling. While the signal transducer and activator of transcription STAT-1 was also required for IFN-γ-mediated inhibition of MNV replication in vitro, class II transactivator (CIITA), interferon regulatory factor 3 (IRF-3), and interferon regulatory factor 7 (IRF-7) were not required. We therefore hypothesized that there must be a subset of IFN-stimulated genes (ISGs) regulated by IFN-γ in a manner dependent only on STAT-1 and IRF-1. Analysis of transcriptional profiles of macrophages lacking various transcription factors confirmed this hypothesis. These studies identify a key role for IRF-1 in IFN-γ-dependent control of norovirus infection in mice and macrophages. PMID:22973039
Effect of gamma interferon on resolution of murine chlamydial genital infection.
Rank, R G; Ramsey, K H; Pack, E A; Williams, D M
1992-01-01
Mice infected in the genital tract with the Chlamydia trachomatis agent of mouse pneumonitis were treated with monoclonal rat anti-gamma interferon (anti-IFN-gamma) antibody to determine whether IFN-gamma participated in the resolution of the infection. In two experiments, anti-IFN-gamma antibody treatment resulted in significantly prolonged infections. In support of these data, passive administration of recombinant IFN-gamma to chronically infected nu/nu mice was able to bring about resolution of the infection in some animals. PMID:1398955
Interferon-alpha and interferon-gamma sensitize human tenon fibroblasts to mitomycin-C.
Wang, Xiao Yang; Crowston, Jonathan G; Zoellner, Hans; Healey, Paul R
2007-08-01
To investigate the effect of interferon (IFN)-alpha and IFN-gamma pretreatment on mitomycin C (MMC)-induced cell death in human Tenon fibroblasts (HTFs) and the mechanisms by which IFN-alpha and IFN-gamma modulate the susceptibility of HTFs to MMC. HTFs were pretreated with IFN-alpha and IFN-gamma for 48 hours before 5-minute application of 0.4 mg/mL MMC. Cell death after 48 hours was determined by Annexin V/propidium iodide (PI) staining and lactate dehydrogenase (LDH) release assay. Fas, Fas-ligand, and Bcl-2 expression were determined by flow cytometry. Fas associated death domain (FADD), Bax, cytochrome c, and caspase expression were determined by Western blot analysis and immunofluorescence staining. MMC treatment increased cell death and upregulated Fas and FADD expression, but had no effect on Fas-Ligand, Bax, Bcl-2, or cytochrome c. Neither IFN-alpha nor IFN-gamma alone induced HTF death, but each increased cell death 2 days after MMC treatment in a dose-dependent fashion. Combination IFN-alpha and IFN-gamma had a synergistic effect. IFN-alpha and IFN-gamma pretreatment increased Fas expression. Fas upregulation was associated with increased sensitivity to MMC. IFN pretreatment increased procaspase-8, procaspase-9, and procaspase-3 expression, and caspase-3 activation. Caspase-8, caspase-3, and broad caspase inhibitors, but not caspase-9 inhibitor, inhibited MMC-induced cell death in nonpretreated and IFN-pretreated cells. IFN-alpha and IFN-gamma enhance the susceptibility of HTFs to MMC-induced cell death through a Fas-mediated and a caspase-3-dependent pathway. Pretreatment with IFN primed HTFs to MMC, providing a potential means for initially slowing the healing response with IFN and subsequently terminating fibroblast activity through MMC-induced cell death.
Anti-interferon-gamma antibodies in the treatment of autoimmune diseases.
Skurkovich, Boris; Skurkovich, Simon
2003-02-01
Interferon (IFN)-gamma is an important immune regulator in normal immunity. When IFN gamma production is disturbed, various autoimmune diseases (ADs) can develop, in which we suggest that anti-IFN gamma could have a beneficial effect. Depending on the cell type in which IFN gamma synthesis is disturbed, different clinical manifestations may result. We have also proposed to remove tumor necrosis factor (TNF)-alpha, together with certain types of IFNs, to treat various ADs and AIDS, also an autoimmune condition. Anti-IFN gamma has been tested in several T-helper cell (Th1) ADs, including rheumatoid arthritis (RA), multiple sclerosis (MS), corneal transplant rejection, uveitis, Type I diabetes, schizophrenia (anti-IFN gamma and anti-TNF alpha), and various autoimmune skin diseases (alopecia areata, psoriasis vulgaris, vitiligo, pemphigus vulgaris and epidermolysis bullosa). A strong, sometimes striking, therapeutic response followed administration of anti-IFN gamma, indicating that it may be a promising therapy for Th1 ADs.
Reproducibility of Interferon Gamma (IFN-γ) Release Assays. A Systematic Review
Tagmouti, Saloua; Slater, Madeline; Benedetti, Andrea; Kik, Sandra V.; Banaei, Niaz; Cattamanchi, Adithya; Metcalfe, John; Dowdy, David; van Zyl Smit, Richard; Dendukuri, Nandini
2014-01-01
Rationale: Interferon gamma (IFN-γ) release assays for latent tuberculosis infection result in a larger-than-expected number of conversions and reversions in occupational screening programs, and reproducibility of test results is a concern. Objectives: Knowledge of the relative contribution and extent of the individual sources of variability (immunological, preanalytical, or analytical) could help optimize testing protocols. Methods: We performed a systematic review of studies published by October 2013 on all potential sources of variability of commercial IFN-γ release assays (QuantiFERON-TB Gold In-Tube and T-SPOT.TB). The included studies assessed test variability under identical conditions and under different conditions (the latter both overall and stratified by individual sources of variability). Linear mixed effects models were used to estimate within-subject SD. Measurements and Main Results: We identified a total of 26 articles, including 7 studies analyzing variability under the same conditions, 10 studies analyzing variability with repeat testing over time under different conditions, and 19 studies reporting individual sources of variability. Most data were on QuantiFERON (only three studies on T-SPOT.TB). A considerable number of conversions and reversions were seen around the manufacturer-recommended cut-point. The estimated range of variability of IFN-γ response in QuantiFERON under identical conditions was ±0.47 IU/ml (coefficient of variation, 13%) and ±0.26 IU/ml (30%) for individuals with an initial IFN-γ response in the borderline range (0.25–0.80 IU/ml). The estimated range of variability in noncontrolled settings was substantially larger (±1.4 IU/ml; 60%). Blood volume inoculated into QuantiFERON tubes and preanalytic delay were identified as key sources of variability. Conclusions: This systematic review shows substantial variability with repeat IFN-γ release assays testing even under identical conditions, suggesting that reversions
[Interferon. An overview of the state of basic research with special regard to interferon-gamma].
Günther, G; Otto, B
1993-02-01
Interferons / An overview on the state of basic research with special regard to interferon-gamma Interferons are multifunctional glycoproteins with a broad range of antiviral, antiproliferative and immunoregulatory effects on the target cell. This review deals with the basics as well as with more recent developments in interferon research. A historic overview of 35 years of interferon research since the discovery of interferons by Isaacs and Lindenmann in 1957 introduces the most important milestones in this field and appreciates the work of the participating researchers. A brief description of the classification of interferons based on different tissue sources, different antigenic properties and different induction behaviour is made. The main part of this review focuses on human interferon-gamma. We discuss recent work on the structure-function relationship of interferon-gamma. The interferon-gamma receptor and its role in signal transduction is another part of this paper. The structure and length of the C-terminal region of interferon-gamma seems to be important for receptor binding and expression of biological activities. A conservative estimate is that the family of IFN-activated genes numbers 15-20 in most cells.
Lion (Panthera leo) and cheetah (Acinonyx jubatus) IFN-gamma sequences.
Maas, Miriam; Van Rhijn, Ildiko; Allsopp, Maria T E P; Rutten, Victor P M G
2010-04-15
Cloning and sequencing of the full length lion and cheetah interferon-gamma (IFN-gamma) transcript will enable the expression of the recombinant cytokine, to be used for production of monoclonal antibodies and to set up lion and cheetah-specific IFN-gamma ELISAs. These are relevant in blood-based diagnosis of bovine tuberculosis, an important threat to lions in the Kruger National Park. Alignment of nucleotide and amino acid sequences of lion and cheetah and that of domestic cats showed homologies of 97-100%. Copyright 2009 Elsevier B.V. All rights reserved.
Controlling nuclear JAKs and STATs for specific gene activation by IFN{gamma}
DOE Office of Scientific and Technical Information (OSTI.GOV)
Noon-Song, Ezra N.; Ahmed, Chulbul M.; Dabelic, Rea
2011-07-08
Highlights: {yields} Gamma interferon (IFN{gamma}) and its receptor subunit, IFNGR1, interact with the promoter region of IFN{gamma}-associated genes along with transcription factor STAT1{alpha}. {yields} We show that activated Janus kinases pJAK2 and pJAK1 also associate with IFNGR1 in the nucleus. {yields} The activated Janus kinases are responsible for phosphorylation of tyrosine 41 on histone H3, an important epigenetic event for specific gene activation. -- Abstract: We previously showed that gamma interferon (IFN{gamma}) and its receptor subunit, IFNGR1, interacted with the promoter region of IFN{gamma}-activated genes along with transcription factor STAT1{alpha}. Recent studies have suggested that activated Janus kinases pJAK2 andmore » pJAK1 also played a role in gene activation by phosphorylation of histone H3 on tyrosine 41. This study addresses the question of the role of activated JAKs in specific gene activation by IFN{gamma}. We carried out chromatin immunoprecipitation (ChIP) followed by PCR in IFN{gamma} treated WISH cells and showed association of pJAK1, pJAK2, IFNGR1, and STAT1 on the same DNA sequence of the IRF-1 gene promoter. The {beta}-actin gene, which is not activated by IFN{gamma}, did not show this association. The movement of activated JAK to the nucleus and the IRF-1 promoter was confirmed by the combination of nuclear fractionation, confocal microscopy and DNA precipitation analysis using the biotinylated GAS promoter. Activated JAKs in the nucleus was associated with phosphorylated tyrosine 41 on histone H3 in the region of the GAS promoter. Unphosphorylated JAK2 was found to be constitutively present in the nucleus and was capable of undergoing activation in IFN{gamma} treated cells, most likely via nuclear IFNGR1. Association of pJAK2 and IFNGR1 with histone H3 in IFN{gamma} treated cells was demonstrated by histone H3 immunoprecipitation. Unphosphorylated STAT1 protein was associated with histone H3 of untreated cells. IFN{gamma
Goulding, N J; Knight, S M; Godolphin, J L; Guyre, P M
1992-01-01
The therapeutic potential of interferon gamma (IFN gamma) in a number of disease states is still being explored, but progress is hampered by the lack of a suitable measure of in vivo biological activity. To assess the in vivo biological effects of recombinant human IFN gamma (rhIFN gamma), 14 patients were studied in a randomised, prospective, double blind, placebo controlled trial of this cytokine for the treatment of rheumatoid arthritis. The levels of Fc gamma receptors on peripheral blood neutrophils were measured at baseline and after 21 days of once daily, subcutaneous injections of rhIFN gamma or placebo. An induction of neutrophil Fc gamma receptor type I (Fc gamma RI) was seen in the group of patients receiving recombinant human rhIFN gamma but not in those receiving placebo. No change in the expression of Fc gamma RII or Fc gamma RIII was detected. The amount of induction of Fc gamma RI detected on the neutrophils of patients receiving rhIFN gamma did not correlate with clinical measures of response at either 21 days or at the end of the study (24 weeks). No significant clinical responses were observed in the rhIFN gamma group at these times. These data confirm that the reported in vitro effect of IFN gamma on human neutrophil Fc receptor expression can be reproduced in vivo. PMID:1534001
Goulding, N J; Knight, S M; Godolphin, J L; Guyre, P M
1992-04-01
The therapeutic potential of interferon gamma (IFN gamma) in a number of disease states is still being explored, but progress is hampered by the lack of a suitable measure of in vivo biological activity. To assess the in vivo biological effects of recombinant human IFN gamma (rhIFN gamma), 14 patients were studied in a randomised, prospective, double blind, placebo controlled trial of this cytokine for the treatment of rheumatoid arthritis. The levels of Fc gamma receptors on peripheral blood neutrophils were measured at baseline and after 21 days of once daily, subcutaneous injections of rhIFN gamma or placebo. An induction of neutrophil Fc gamma receptor type I (Fc gamma RI) was seen in the group of patients receiving recombinant human rhIFN gamma but not in those receiving placebo. No change in the expression of Fc gamma RII or Fc gamma RIII was detected. The amount of induction of Fc gamma RI detected on the neutrophils of patients receiving rhIFN gamma did not correlate with clinical measures of response at either 21 days or at the end of the study (24 weeks). No significant clinical responses were observed in the rhIFN gamma group at these times. These data confirm that the reported in vitro effect of IFN gamma on human neutrophil Fc receptor expression can be reproduced in vivo.
Effects of chicken interferon Gamma on Newcastle disease virus vaccine immunogenicity
USDA-ARS?s Scientific Manuscript database
More effective vaccines are needed to control avian diseases. The use of chicken interferon gamma (chIFN') during vaccination is a potentially important but controversial approach that may improve the immune response to antigens. In the present study, three different systems to co-deliver chIFN' wit...
Role of gamma interferon in a neonatal mouse model of group B streptococcal disease.
Cusumano, V; Mancuso, G; Genovese, F; Delfino, D; Beninati, C; Losi, E; Teti, G
1996-01-01
The aim of this study was to assess the role of gamma interferon (IFN-gamma) in a neonatal mouse model of group B streptococcal (GBS) sepsis. IFN-gamma was produced by spleen cells at 24, 48, and 72 h after GBS challenge. Treatment with anti-IFN-gamma at 6 h before challenge totally abrogated the IFN-gamma response but did not affect survival. Subcutaneous administration of recombinant IFN-gamma (2,500 IU per pup) at 18 h after challenge resulted in increased survival time and reduced blood colony counts at 48 and 72 h. In vitro preincubation of neonatal whole blood with IFN-gamma before the addition of GBS resulted in significant restriction of bacterial growth. These data indicate that administration of recombinant IFN-gamma can partially restore impaired host defenses against GBS in neonatal mice. This cytokine may be useful for the treatment of neonatal infections. PMID:8757817
Interferon (IFN)-λ Takes the Helm: Immunomodulatory Roles of Type III IFNs
Zanoni, Ivan; Granucci, Francesca; Broggi, Achille
2017-01-01
Type III interferons (IFNs) (or IFN-λ) are the latest addition to the IFN family. Even though they share little protein homology with type I IFN, both exhibit remarkable functional similarities: each can be induced in response to viral infections, and both lead to Janus kinases (JAK) and signal transducer and activator of transcription (STAT) activation. The JAK/STAT pathway induces antiviral responses and IFN-stimulated gene transcription. However, despite the similarities in their effector functions with type I IFNs, IFN-λ also has a non-redundant role in protecting barrier organs: epithelial cells preferentially produce IFN-λ rather than type I IFNs; and interferon lambda receptor 1 (IFNLR1), the specific receptor for IFN-λ, is highly expressed on cells of epithelial lineage. Thus far, IFN-λ has been considered mainly as an epithelial cytokine, which restricts viral replication in epithelial cells and constitutes an added layer of protection at mucosal sites. However, it is now increasingly recognized that IFNLR1 is expressed broadly, and that immune cells such as neutrophils and dendritic cells also respond to IFN-λ. Moreover, in many in vivo models, IFN-λ modulates immune cell functions and thereby configures itself less as a cytokine that is only specific to the epithelium, and more as a cytokine that directly controls the inflammatory response at mucosal sites. Here, we critically review the recent literature on immune modulatory roles for IFN-λ, and distinguish between the direct and indirect effects of this IFN on immune cell functions in different inflammatory settings. PMID:29234323
Interferon (IFN)-λ Takes the Helm: Immunomodulatory Roles of Type III IFNs.
Zanoni, Ivan; Granucci, Francesca; Broggi, Achille
2017-01-01
Type III interferons (IFNs) (or IFN-λ) are the latest addition to the IFN family. Even though they share little protein homology with type I IFN, both exhibit remarkable functional similarities: each can be induced in response to viral infections, and both lead to Janus kinases (JAK) and signal transducer and activator of transcription (STAT) activation. The JAK/STAT pathway induces antiviral responses and IFN-stimulated gene transcription. However, despite the similarities in their effector functions with type I IFNs, IFN-λ also has a non-redundant role in protecting barrier organs: epithelial cells preferentially produce IFN-λ rather than type I IFNs; and interferon lambda receptor 1 (IFNLR1), the specific receptor for IFN-λ, is highly expressed on cells of epithelial lineage. Thus far, IFN-λ has been considered mainly as an epithelial cytokine, which restricts viral replication in epithelial cells and constitutes an added layer of protection at mucosal sites. However, it is now increasingly recognized that IFNLR1 is expressed broadly, and that immune cells such as neutrophils and dendritic cells also respond to IFN-λ. Moreover, in many in vivo models, IFN-λ modulates immune cell functions and thereby configures itself less as a cytokine that is only specific to the epithelium, and more as a cytokine that directly controls the inflammatory response at mucosal sites. Here, we critically review the recent literature on immune modulatory roles for IFN-λ, and distinguish between the direct and indirect effects of this IFN on immune cell functions in different inflammatory settings.
The immunomodulatory effects of interferon-gamma on mature B-lymphocyte responses.
Jurado, A; Carballido, J; Griffel, H; Hochkeppel, H K; Wetzel, G D
1989-06-15
Interferon-gamma (IFN-gamma) exerts a broad spectrum of activities which affect the responses of mature B-cells. It strongly inhibits B-cell activation, acts as a B-cell growth factor (BCGF), and also induces final differentiation to immunoglobulin (Ig) production. IFN-gamma is deeply involved in the differential control of isotype expression, as it enhances IgG2a production and suppresses both IgG1 and IgE production. Although it is now possible to draw a general scheme of the effects of IFN-gamma on B-cells, a number of paradoxical results still exist in the field. In this manuscript, different experimental systems are analyzed in an attempt to explain these apparent paradoxes.
Zhang, Kao; Jin, Huijun; Zhong, Fei; Li, Xiujin; Neng, Changai; Chen, Huihui; Li, Wenyan; Wen, Jiexia
2012-11-04
To construct recombinant adenovirus containing canine interferon-gamma (cIFN-gamma) gene and to investigate its antiviral activity against canine parvovirus in Madin-Darby canine kidney cells (MDCK). [Methods] The cIFN-gamma gene was inserted into adenovirus shuttle plasmid to construct pShuttle3-cIFN-gamma expression vector, from which the cIFN-gamma expression cassette was transferred into the adenovirus genomic plasmid pAdeno-X by specific restriction sites to generate recombinant adenovirus genomic plasmid pAd-cIFN-gamma. The pAd-cIFN-gamma plasmid was linearized by digestion and transfected into human embryonic kidney (HEK) 293T cells to generate the replication-defective cIFN-gamma recombinant adenovirus (Ad-cIFN-gamma). To analyze its anti-canine parvovirus activity, the MDCK cells were pre-infected by Ad-cIFN-gamma recombinant adenovirus, and then infected by canine parvovirus. The antiviral activity of the Ad-cIFN-gamma recombinant adenovirus against parvovirus was analyzed. The recombinant adenovirus containing cIFN-gamma gene was constructed by the ligation method. The recombinant adenovirus could mediates recombinant cIFN-gamma secretory expression in MDCK cells. The Ad-cIFN-gamma recombinant adenovirus could significantly inhibit canine parvovirus replication in MDCK cells pre-infected with the recombinant adenovirus. These results indicate that the Ad-cIFN-gamma recombinant adenovirus has the potent antiviral activity against canine parvovirus. The Ad-cIFN-gamma recombinant adenovirus was successfully constructed by the ligation method and possessed a powerful antiviral activity against canine parvovirus.
Tao, Yaqiong; Zeng, Bo; Xu, Liu; Yue, Bisong; Yang, Dong; Zou, Fangdong
2010-01-01
Interferon-gamma (IFN-gamma) is the only member of type II IFN and is vital in the regulation of immune and inflammatory responses. Herein we report the cloning, expression, and sequence analysis of IFN-gamma from the giant panda (Ailuropoda melanoleuca). The open reading frame of this gene is 501 base pair in length and encodes a polypeptide consisting of 166 amino acids. All conserved N-linked glycosylation sites and cysteine residues among carnivores were found in the predicted amino acid sequence of the giant panda. Recombinant giant panda IFN-gamma with a V5 epitope and polyhistidine tag was expressed in HEK293 host cells and confirmed by Western blotting. Phylogenetic analysis of mammalian IFN-gamma-coding sequences indicated that the giant panda IFN-gamma was closest to that of carnivores, then to ungulates and dolphin, and shared a distant relationship with mouse and human. These results represent a first step into the study of IFN-gamma in giant panda.
Cannon, Grant W; Pincus, Seth H; Emkey, Ronald D; Denes, Alex; Cohen, Selwyn A; Wolfe, Frederick; Saway, P Anthony; Jaffer, Adrian M; Weaver, Arthur L; Cogen, Lewis; Schindler, John D
2008-02-01
One hundred five patients were enrolled in a 12-week, randomized, prospective, double-blind, placebo-controlled trial of recombinant human gamma-interferon (rHu gamma-IFN) for the treatment of rheumatoid arthritis. Fifty-four patients received rHu gamma-IFN and 51 received placebo. Forty-two patients in each group completed the 12-week trial. Some clinical improvement occurred in both groups of patients. Although the improvement with rHu gamma-IFN was greater than that with placebo, the differences were generally not statistically significant.
Sonoda, Junichiro; Laganière, Josée; Mehl, Isaac R; Barish, Grant D; Chong, Ling-Wa; Li, Xiangli; Scheffler, Immo E; Mock, Dennis C; Bataille, Alain R; Robert, Francois; Lee, Chih-Hao; Giguère, Vincent; Evans, Ronald M
2007-08-01
Macrophage activation by the proinflammatory cytokine interferon-gamma (IFN-gamma) is a critical component of the host innate response to bacterial pathogenesis. However, the precise nature of the IFN-gamma-induced activation pathway is not known. Here we show using genome-wide expression and chromatin-binding profiling that IFN-gamma induces the expression of many nuclear genes encoding mitochondrial respiratory chain machinery via activation of the nuclear receptor ERR alpha (estrogen-related receptor alpha, NR3B1). Studies with macrophages lacking ERR alpha demonstrate that it is required for induction of mitochondrial reactive oxygen species (ROS) production and efficient clearance of Listeria monocytogenes (LM) in response to IFN-gamma. As a result, mice lacking ERR alpha are susceptible to LM infection, a phenotype that is localized to bone marrow-derived cells. Furthermore, we found that IFN-gamma-induced activation of ERR alpha depends on coactivator PGC-1 beta (peroxisome proliferator-activated receptor gamma coactivator-1 beta), which appears to be a direct target for the IFN-gamma/STAT-1 signaling cascade. Thus, ERR alpha and PGC-1 beta act together as a key effector of IFN-gamma-induced mitochondrial ROS production and host defense.
Interferon-gamma inhibits HIV-induced invasiveness of monocytes.
Dhawan, S; Wahl, L M; Heredia, A; Zhang, Y; Epstein, J S; Meltzer, M S; Hewlett, I K
1995-12-01
HIV-infected monocytes form highly invasive network on basement membrane matrix and secrete high levels of 92-kd metalloproteinase (MMP-9), an enzyme that degrades basement membrane proteins. In the present study, using matrigel as a model basement membrane system, we demonstrate that treatment of human immunodeficiency virus (HIV)-infected monocytes with interferon-gamma at 50 U/ml inhibited the ability of infected monocytes to form an invasive network on matrigel and their invasion through the matrigel matrix. These effects were associated with a significant reduction in the levels of MMP-9 produced by HIV-infected monocytes treated with interferon-gamma 1 day prior to infection with HIV as compared with that of untreated HIV-infected monocytes. Monocytes treated with interferon-gamma 1 day after HIV infection showed the presence of integrated HIV sequences; however, the levels of MMP-9 were substantially lower than those produced by monocytes inoculated with live HIV, heat-inactivated HIV, or even the control uninfected monocytes. Exposure of monocytes to heat-inactivated HIV did not result in increased invasiveness or high MMP-9 production, suggesting that regulation of metalloproteinase by monocytes was independent of CD4-gp120 interactions and required active virus infection. Furthermore, addition of interferon-gamma to monocytes on day 10 after infection inhibited MMP-9 production by more than threefold with no significant reduction of virus replication. These results indicate that the mechanism of interferon-gamma-induced down-regulation of MMP-9 levels and reduced monocyte invasiveness may be mediated by a mechanism independent of antiviral activity of IFN-gamma in monocytes. Down-regulation of MMP-9 in HIV-infected monocytes by interferon-gamma may play an important role in the control of HIV pathogenesis.
Gao, Y; Chenping; Lin, X P
1997-10-01
In order to determine whether interferon-gamma (IFN-gamma) inhibits eosinphil infiltration in the trachea of asthmatic guinea pigs induced by Rhizopus nigricans. We had administered aerosolized rIFN-gamma in the tracheas of 30 sensitized guinea pigs which had been divided into six groups, then teated animal inhaled rIFN-gamma of 5 x 10(4), 20 x 10(4), and 40 x 10(4) concentration, BDP and normal saline respectively at 24 h, 12 h, 2 h before being challenged. (1) Provocation positive rates decreased in 40 x 10(4) rIFN-gamma and BDP group compared with that in normal saline group and before intervention (P < 0.05), airway resistence decreased (P < 0.01). (2) The administration of aerosolized rIFN-gamma (40 x 10(4)) and BDP also decreased fungus-induced eosnophils but not other cells infiltration in the trachea. (3) In BALF, Eos count and ECP level were obviously lower than those in other groups. However, eosinophil numbers did not show significant change in the peripheral blood. Local administration of rIFN-gamma (40 x 10(4)) may reduce airway inflammation and intervene asthmatic attack by inhibition of Eos, ECP infiltration in airways.
Interferon Gamma as a Biomarker of Exposure to Enteric Viruses
Interferon gamma (IFN-γ) was selected as a biomarker for viral exposure. Twelve-week-old BALB/c mice were intraperitoneally injected with Coxsackievirus B3 or B4 diluted in phosphate-buffered saline (PBS). Control mice were injected with PBS only. Four months after viral infectio...
IFN-gamma induction by SCG, 1,3-beta-D-glucan from Sparassis crispa, in DBA/2 mice in vitro.
Harada, Toshie; Miura, Noriko N; Adachi, Yoshiyuki; Nakajima, Mitsuhiro; Yadomae, Toshiro; Ohno, Naohito
2002-12-01
Sparassis crispa Fr. in an edible mushroom recently cultivable in Japan. A branched beta-glucan from S. crispa (SCG) is a major 6-branched 1,3-beta-D-glucan showing antitumor activity. In this study, we examined interferon-gamma (IFN-gamma) induction by SCG from splenocytes in DBA/2 mice in vitro. In the splenocytes derived from almost all inbred strains of mice except for DBA/1 and DBA/2 mice, IFN-gamma production was not induced by SCG. The breeder and genders of DBA/2 mice showed no influence on IFN-gamma induction by SCG. On the other hand, the magnitude of IFN-gamma induction was lower in young mice than in their older counterparts. IFN-gamma was induced by SCG in adherent splenocytes, but IFN-gamma production was most significantly increased by SCG in instances involving coexistence of adherent and nonadherent splenocytes. In fact, inhibition of cell-cell contact reduced IFN-gamma induction by SCG. In addition, interleukin-12 p70 (IL-12p70) was induced by SCG in DBA/2 mice. It was suggested that soluble factors and cell-cell contact mediate synergistic effects on SCG-induced IFN-gamma production.
Jeevan, A; McFarland, C T; Yoshimura, T; Skwor, T; Cho, H; Lasco, T; McMurray, D N
2006-01-01
Gamma interferon (IFN-gamma) plays a critical role in the protective immune responses against mycobacteria. We previously cloned a cDNA coding for guinea pig IFN-gamma (gpIFN-gamma) and reported that BCG vaccination induced a significant increase in the IFN-gamma mRNA expression in guinea pig cells in response to living mycobacteria and that the virulent H37Rv strain of Mycobacterium tuberculosis stimulated less IFN-gamma mRNA than did the attenuated H37Ra strain. In this study, we successfully expressed and characterized recombinant gpIFN-gamma with a histidine tag at the N terminus (His-tagged rgpIFN-gamma) in Escherichia coli. rgpIFN-gamma was identified as an 18-kDa band in the insoluble fraction; therefore, the protein was purified under denaturing conditions and renatured. N-terminal amino acid sequencing of the recombinant protein yielded the sequence corresponding to the N terminus of His-tagged gpIFN-gamma. The recombinant protein upregulated major histocompatibility complex class II expression in peritoneal macrophages. The antiviral activity of rgpIFN-gamma was demonstrated with a guinea pig fibroblast cell line (104C1) infected with encephalomyocarditis virus. Interestingly, peritoneal macrophages treated with rgpIFN-gamma did not produce any nitric oxide but did produce hydrogen peroxide and suppressed the intracellular growth of mycobacteria. Furthermore, rgpIFN-gamma induced morphological alterations in cultured macrophages. Thus, biologically active rgpIFN-gamma has been successfully produced and characterized in our laboratory. The study of rgpIFN-gamma will further increase our understanding of the cellular and molecular responses induced by BCG vaccination in the guinea pig model of pulmonary tuberculosis.
Badie, B; Schartner, J; Vorpahl, J; Preston, K
2000-04-01
Activation of microglia by interferon-gamma (IFN-gamma) has been implicated in a number of central nervous system (CNS) inflammatory disease processes. Because IFN-gamma has also been shown to play a role in programmed cell death, we investigated its cytotoxicity and its effect on the Fas apoptotic pathway in microglia. Flow cytometry was used to quantify the IFN-gamma-mediated apoptotic response and Fas and Fas ligand (FasL) expression in two well-characterized murine microglia cell lines (BV-2 and N9). Nuclear fragmentation, suggestive of apoptosis, was noted within 24 h of incubation of microglia with IFN-gamma (10 U/ml). After a 72-h incubation, almost every BV-2 and N9 microglia, but not GL261 glioma cells, underwent cell death and detached from the culture plates. This cytotoxicity occurred even at low IFN-gamma concentrations (1 U/ml) and was inhibited by BAF, a pan-caspase inhibitor. Incubation of BV-2 and N9 microglia, but not GL261 glioma cells, with IFN-gamma also potentiated the expression of Fas and FasL in a similar dose-response and time-course manner, as seen for the apoptotic response. Whereas Fas expression increased by 100% in both microglia cells, FasL upregulation was more pronounced and increased by as much as 200% in the N9 cells. These findings suggest that in addition to its role as a microglia activator, IFN-gamma may also induce apoptosis of microglia, possibly through simultaneous upregulation of Fas and FasL. Interferon-gamma modulation of the Fas pathway and apoptosis in microglia may be important in the pathogenesis of inflammatory CNS disease processes. Copyright 2000 Academic Press.
Development of an aptamer beacon for detection of interferon-gamma.
Tuleuova, Nazgul; Jones, Caroline N; Yan, Jun; Ramanculov, Erlan; Yokobayashi, Yohei; Revzin, Alexander
2010-03-01
Traditional antibody-based affinity sensing strategies employ multiple reagents and washing steps and are unsuitable for real-time detection of analyte binding. Aptamers, on the other hand, may be designed to monitor binding events directly, in real-time, without the need for secondary labels. The goal of the present study was to design an aptamer beacon for fluorescence resonance energy transfer (FRET)-based detection of interferon-gamma (IFN-gamma)--an important inflammatory cytokine. Variants of DNA aptamer modified with biotin moieties and spacers were immobilized on avidin-coated surfaces and characterized by surface plasmon resonance (SPR). The SPR studies showed that immobilization of aptamer via the 3' end resulted in the best binding IFN-gamma (K(d) = 3.44 nM). This optimal aptamer variant was then used to construct a beacon by hybridizing fluorophore-labeled aptamer with an antisense oligonucleotide strand carrying a quencher. SPR studies revealed that IFN-gamma binding with an aptamer beacon occurred within 15 min of analyte introduction--suggesting dynamic replacement of the quencher-complementary strand by IFN-gamma molecules. To further highlight biosensing applications, aptamer beacon molecules were immobilized inside microfluidic channels and challenged with varying concentration of analyte. Fluorescence microscopy revealed low fluorescence in the absence of analyte and high fluorescence after introduction of IFN-gamma. Importantly, unlike traditional antibody-based immunoassays, the signal was observed directly upon binding of analyte without the need for multiple washing steps. The surface immobilized aptamer beacon had a linear range from 5 to 100 nM and a lower limit of detection of 5 nM IFN-gamma. In conclusion, we designed a FRET-based aptamer beacon for monitoring of an inflammatory cytokine-IFN-gamma. In the future, this biosensing strategy will be employed to monitor dynamics of cytokine production by the immune cells.
Yanagida, M; Fukamachi, H; Takei, M; Hagiwara, T; Uzumaki, H; Tokiwa, T; Saito, H; Iikura, Y; Nakahata, T
1996-01-01
We examined the effects of interferon-gamma (IFN-gamma) on 100% pure human mast cells generated in suspension cultures of umbilical cord blood mononuclear cells in the presence of stem cell factor (SCF) and interleukin-6 (IL-6). When mast cells were suspended in serum-free medium without any cytokine after the withdrawal of SCF and IL-6, they died over a period of 5 days because of apoptosis. IFN-gamma in the cultures suppressed apoptosis and prolonged their survival in a dose-dependent manner. This survival-promoting effect of IFN-gamma was blocked by neutralizing antibodies to IFN-gamma or to IFN-gamma receptor (IFN-gamma R). When mast cells were incubated with IFN-gamma in serum-free medium for more than 4 hr during sensitization, immunoglobulin E (IgE)/anti-IgE antibody-induced histamine release was effectively enhanced. Polymerase chain reaction (PCR) amplification of the alpha-chain of IFN-gamma R (IFN-gamma R alpha) yielded products of the correct size predicted from the sequence of the receptor. In addition, flow cytometry using anti-IFN-gamma R monoclonal antibodies (mAbs) indicated that these mast cells bear IFN-gamma R on their surface. These findings suggested that IFN-gamma activates human mast cells via specific receptors in certain aspects of inflammatory reactions. Images Figure 2 Figure 4 PMID:9014819
Evidence for a gamma-interferon receptor that regulates macrophage tumoricidal activity
1984-01-01
Gamma-interferon (IFN-gamma) is the macrophage-activating factor (MAF) produced by normal murine splenic cells and the murine T cell hybridoma 24/G1 that induces nonspecific tumoricidal activity in macrophages. Incubation of 24/G1 supernatants diluted to 8.3 IRU IFN-gamma/ml with 6 X 10(6) elicited peritoneal macrophages or bone marrow-derived macrophages for 4 h at 37 degrees C, resulted in removal of 80% of the MAF activity from the lymphokine preparation. Loss of activity appeared to result from absorption and not consumption because (a) 40% of the activity was removed after exposure to macrophage for 30 min at 4 degrees C, (b) no reduction of MAF activity was detected when the 24/G1 supernatant was incubated with macrophage culture supernatants, and (c) macrophage-treated supernatants showed a selective loss of MAF activity but not interleukin 2 (IL-2) activity. Absorption was dependent on the input of either IFN-gamma or macrophages and was time dependent at 37 degrees C but not at 4 degrees C. With four rodent species tested, absorption of murine IFN-gamma displayed species specificity. However, cultured human peripheral blood monocytes and the human histiocytic lymphoma cell line U937 were able to absorb the murine lymphokine. Although the majority of murine cell lines tested absorbed 24/G1 MAF activity, two murine macrophage cell lines, P388D1 and J774, were identified which absorbed significantly reduced amounts of natural IFN- gamma. Purified murine recombinant IFN-gamma was absorbed by elicited macrophages but not by P388D1. Normal macrophages but not P388D1 bound fluoresceinated microspheres coated with recombinant IFN-gamma and binding was inhibited by pretreatment of the normal cells with 24/G1 supernatants. Scatchard plot analysis showed that 12,000 molecules of soluble 125I-recombinant IFN-gamma bound per bone marrow macrophage with a Ka of 0.9 X 10(8) M-1. Binding was quantitatively inhibitable by natural IFN-gamma but not by murine IFN alpha. IFN
Effects of interferon-gamma and tumor necrosis factor-alpha on macrophage enzyme levels
NASA Technical Reports Server (NTRS)
Pierangeli, Silvia S.; Sonnenfeld, Gerald
1989-01-01
Murine peritoneal macrophages were treated with interferon-gamma (IFN-gamma) or tumor necrosis factor-alpha (TNF). Measurements of changes in acid phosphatase and beta-glucuronidase levels were made as an indication of activation by cytokine treatment. IFN-gamma or TNF-gamma treatment resulted in a significant increase in the activities of both enzymes measured in the cell lysates. This increase was observable after 6 h of incubation, but reached its maximum level after 24 h of incubation. The effect of the treatment of the cell with both cytokines together was additive. No synergistic effect of addition of both cytokines on the enzyme levels was observed.
Paillot, R; Daly, J M; Juillard, V; Minke, J M; Hannant, D; Kydd, J H
2005-08-22
Equine cytotoxic T lymphocyte (CTL) responses to equine herpesvirus-1 (EHV-1) are well characterised but little is known about the cytokine response after infection or vaccination. EHV-1 is common in horses and infects lymphocytes in vivo. This virus was used as a model to measure the synthesis of interferon gamma (IFN-gamma) by equine peripheral blood mononuclear cells (PBMC) after in vivo infection and/or in vitro stimulation with EHV-1. Both flow cytometry and ELISPOT assays were used to quantify equine IFN-gamma using a mouse anti-bovine IFN-gamma monoclonal antibody (clone CC302; shown to cross-react with recombinant equine IFN-gamma) and a rabbit anti-canine IFN-gamma polyclonal antibody. The percentage of PBMC synthesising IFN-gamma after in vitro stimulation with EHV-1 increased with age. In yearlings infected experimentally with EHV-1, PBMC showed two peaks of IFN-gamma synthesis, 11 and 56 days after infection. The IFN-gamma synthesis was principally associated with CD8(+) cells. The patterns of IFN-gamma synthesis detected by intracellular IFN-gamma staining or ELISPOT were compared with CTL data and shown to be similar. These methods were also applied successfully to frozen samples of PBMC. Measurement of equine IFN-gamma using these simple techniques can now be applied to future studies on protective cellular immune responses following virus infection and/or vaccination of horses.
COULD INTERFERON-GAMMA BE A THERAPEUTIC TARGET FOR TREATING HEART FAILURE?
Levick, Scott P.; Goldspink, Paul H.
2013-01-01
The cytokine interferon-gamma (IFN-γ), is the only known member of the type II family of interferons, and as such, binds to its own distinct receptor. It is important in host defense against infection, as well as adaptive immune responses. Whilst a wide array of cytokines are known to be involved in adverse remodeling of the heart and the progression to heart failure, the role of IFN-γ is unclear. Recent evidence from clinical studies, animal models of myocarditis and hypertension, as well as isolated cell studies, provide conflicting data as to whether IFN-γ is pathological or protective in the heart. Thus, it is important to highlight these discrepant findings so that areas of future investigation can be identified to more clearly determine the precise role of IFN-γ in the heart. Accordingly, this review will: 1) discuss the source of IFN-γ in the diseased heart; 2) summarize the data from animal studies; 3) discuss the effects of IFN-γ on isolated cardiac fibroblasts and cardiomyocytes; 4) identify signaling mechanisms that may be invoked by IFN-γ in the heart; and 5) present the clinical evidence supporting a role for IFN-γ in heart failure. PMID:23589353
Interferon Gamma in African Trypanosome Infections: Friends or Foes?
Wu, Hui; Liu, Gongguan; Shi, Meiqing
2017-01-01
African trypanosomes cause fatal infections in both humans and livestock. Interferon gamma (IFN-γ) plays an essential role in resistance to African trypanosomes. However, increasing evidence suggests that IFN-γ, when excessively synthesized, also induces immunopathology, enhancing susceptibility to the infection. Thus, production of IFN-γ must be tightly regulated during infections with African trypanosomes to ensure that a robust immune response is elicited without tissue destruction. Early studies have shown that secretion of IFN-γ is downregulated by interleukin 10 (IL-10). More recently, IL-27 has been identified as a negative regulator of IFN-γ production during African trypanosome infections. In this review, we discuss the current state of our understanding of the role of IFN-γ in African trypanosome infections. We have focused on the cellular source of IFN-γ, its beneficial and detrimental effects, and mechanisms involved in regulation of its production, highlighting some recent advances and offering some perspectives on future directions.
Delisle, Jean-Sébastien; Gaboury, Louis; Bélanger, Marie-Pier; Tassé, Eliane; Yagita, Hideo; Perreault, Claude
2008-09-01
The immunopathologic condition known as graft-versus-host disease (GVHD) results from a type I T-cell process. However, a prototypical type I cytokine, interferon-gamma (IFN-gamma), can protect against several manifestations of GVHD in recipients of major histocompatibility complex (MHC)-mismatched hematopoietic cells. We transplanted hematopoietic cells from C3H.SW donors in wild-type (wt) and IFN-gamma-receptor-deficient (IFN-gammaRKO) MHC-matched C57BL/6 recipients. In IFN-gammaRKO recipients, host cells were unresponsive to IFN-gamma, whereas wt donor cells were exposed to exceptionally high levels of IFN-gamma. From an IFN-gamma perspective, we could therefore evaluate the impact of a loss-of-function on host cells and gain-of-function on donor cells. We found that lack of IFN-gammaR prevented up-regulation of MHC proteins on host cells but did not mitigate damage to most target organs. Two salient phenotypes in IFN-gammaRKO recipients involved donor cells: lymphoid hypoplasia and hematopoietic failure. Lymphopenia was due to FasL-induced apoptosis and decreased cell proliferation. Bone marrow aplasia resulted from a decreased proliferation of hematopoietic stem/progenitor cells that was associated with down-regulation of 2 genes negatively regulated by IFN-gamma: Ccnd1 and Myc. We conclude that IFN-gamma produced by alloreactive T cells may entail a severe graft-versus-graft reaction and could be responsible for cytopenias that are frequently observed in subjects with GVHD.
Kawai, K; Enomoto, T; Fornasier, V; Resetkova, E; Volpé, R
1997-03-01
We have studied the in vivo effects of human interferon alpha (IFN-alpha) and interferon gamma (IFN-gamma) administration on human thyroid tissue xenografted into two mouse strains: severe combined immunodeficient (SCID) mice and nude mice. Human lymphocytes survive in SCID mice but are lysed in nude mice. Thyroid tissues from Graves' disease or Hashimoto's thyroiditis, or paranodular [normal, (N)] tissue was xenografted into SCID mice (0.8 g/mouse) pretreated with anti-asialo GM-1 antiserum and radiation and also into nude mice. One week after xenografting, SCID and nude mice were divided into three groups. Group A was treated with IFN-alpha intraperitoneally (2,000 units/mouse) three times weekly; group B was treated with IFN-gamma similarly; group C was treated with phosphate buffered saline (PBS) only (control). Autologous human peripheral blood mononuclear cells (PBMCs) were added to mice receiving N xenografts. Blood was taken every 2 weeks for levels of IgG and thyroid antibodies (TAb). After 6 weeks of treatment, mice were sacrificed, and xenograft thyrocyte histocompatibility leukocyte antigen (HLA-DR) and intercellular adhesion molecule (ICAM-1) expression were measured. In addition, thyrocyte cultures were stimulated in vitro with 200 units/ml of either IFN-alpha or IFN-gamma or PBS (control). SCID mice xenografted with autoimmune thyroid disease (AITD) in group A showed a significantly higher TAb production than group C, whereas in group B, TAb production was not statistically increased compared to control (group C). SCID mice xenografted with N did not produce TAb in any group, nor did nude mice xenografted with AITD. Thyrocyte HLA-DR expression was markedly increased in group A and B in SCID mice xenografted with Graves' disease, Hashimoto's thyroiditis, and N tissue compared to group C. In contrast, only group B (IFN-gamma) showed an increase in thyrocyte HLA-DR in nude mice. In the in vitro studies, only IFN-gamma (not IFN-alpha) stimulated
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bursuker, I.; Pearce, M.T.
1990-02-01
The state of active immunity to Meth A fibrosarcoma in mice immunized with an admixture of Meth A cells and Propionibacterium acnes is associated with possession by the host of spleen cells capable of producing interferon-gamma (IFN-gamma) upon in vitro restimulation with irradiated tumor cells. The ability of spleen cells from immunized mice to produce IFN-gamma in response to irradiated Meth A cells decays as active antitumor immunity is replaced by a state of immunological memory. The IFN-producing cells are L3T4+Ly2+, cyclophosphamide-sensitive and radiosensitive T cells, as determined by their sensitivity to corresponding monoclonal antibodies and complement. The induction ofmore » IFN-gamma production by in vivo tumor-sensitized T cells is tumor specific, in that spleen cells from mice immunized against Meth A fibrosarcoma can produce IFN in response to irradiated Meth A cells but not in response to another syngeneic tumor M109 lung carcinoma.« less
USDA-ARS?s Scientific Manuscript database
Currently the Bovigam assay is used as an official supplemental test within the bovine tuberculosis eradication program. This assay measures interferon-gamma (IFN-gamma) produced by lymphocytes in response to specific antigens. The objectives of the present study were to evaluate two Mycobacterium ...
Brar, Kanwaljit; Leung, Donald Y M
2016-01-01
Atopic dermatitis (AD) is the most common inflammatory skin disease in the general population. There are different endophenotypes of AD that likely have a unique immune and molecular basis, such as those who are predisposed to eczema herpeticum, or Staphylococcus aureus infections. In this review, we highlight the endophenotypes of AD where reduced interferon gamma expression may be playing a role. Additionally, we review the potential role of recombinant interferon gamma therapy in the treatment of atopic dermatitis and the particular phenotypes that may benefit from this treatment. Recombinant interferon gamma treatment will likely benefit the pediatric population with AD, as well as those with susceptibilities for skin infections. Future studies are needed to elucidate whether IFN-γ may reduce the prevalence of skin infection in AD.
Wong, L H; Hatzinisiriou, I; Devenish, R J; Ralph, S J
1998-06-01
IFN-stimulated gene factor 3 (ISGF3) mediates transcriptional activation of IFN-sensitive genes (ISGs). The component subunits of ISGF3, STAT1alphabeta, STAT2, and p48-ISGF3gamma, are tyrosine phosphorylated before their assembly into a complex. Subsequently, the ISGF3 complex is translocated to the nucleus. We have recently established that the responsiveness of human melanoma cell lines to type I IFNs correlates directly with their intracellular levels of ISGF3 components, particularly STAT1. In the present study, we show that pretreating IFN-resistant melanoma cell lines with IFN-gamma (IFN-gamma priming) before stimulation with type I IFN also results in increased levels of ISGF3 components and enhanced DNA-binding activation of ISGF3. In addition, IFN-gamma priming of IFN-resistant melanoma cell lines increased expression of type I IFN-induced ISG products, including ISG54, 2'-5'-oligoadenylate synthase, HLA class I, B7-1, and ICAM-1 Ags. Furthermore, IFN-gamma priming enhanced the antiviral effect of IFN-beta on the IFN-resistant melanoma cell line, MM96. These results support a role for IFN-gamma priming in up-regulating ISGF3, thereby augmenting the responsiveness of IFN-resistant melanoma cell lines to type I IFN and providing a molecular basis and justification for using sequential IFN therapy, as proposed by others, to enhance the use of IFNs in the treatment of melanoma.
[Experimental study of IFN-alpha and IFN-gamma on reversing ATRA-resistance in MR2 cell line].
He, Peng-Cheng; Zhang, Mei; Li, Jing; Cao, Yun-Xin; Cai, Rui-Bo; Liu, Ya-Lin
2007-03-01
To explore the possibility and the possible mechanism of reversing ATRA-resistance in MR2 cells by using IFN-alpha and IFN-gamma in combination with all-trans retinoic acid (ATRA). After MR2 cells(ATRA-resistance cell line) were treated with IFN-alpha, IFN-gamma and ATRA alone or IFN-alpha and IFN-gamma in combination with ATRA respectively, the cell proliferation was tested by MTT colorimetry, the cell differentiation was tested through light microscope, by NBT test and flow cytometry (FCM). The expression of promyelocytic leukemia (PML) protein was observed by indirect immunofluorescence staining. Both IFN-alpha and IFN-gamma could inhibit the proliferation of MR2 cells. The effects were more obviously in both IFN-alpha+ATRA group and IFN-gamma+ATRA group. But there were no significant difference between either IFN-alpha group and IFN-gamma group or IFN-alpha+ATRA group and IFN-gamma+ATRA group (P>0.05). Both IFN could also induce the differentiation of MR2 cells. The effects of IFN-alpha+ATRA group and IFN-gamma+ATRA group were more obvious. However, the differentiation of MR2 cells induced by IFN-gamma+ATRA group was more higher than that by IFN-alpha+ATRA group (P<0.05). Both IFN could induce the expression of PML protein. The reversing effcet of IFN-gamma+ATRA group on ATRA-resistence in MR2 cells are more powerful than that of IFN-alpha+ATRA group, which may be related to the different signal transduction pathway of IFN-alpha and IFN-gamma.
Breckler, L A; Hale, J; Taylor, A; Dunstan, J A; Thornton, C A; Prescott, S L
2008-11-01
During pregnancy, variations in maternal-foetal cellular interactions may influence immune programming. This study was carried out to determine if maternal responses to foetal alloantigens are altered by maternal allergic disease and/or previous pregnancies. For this cohort study, peripheral blood was collected from allergic (n = 69) and nonallergic (n = 63) pregnant women at 20, 30, 36-week gestation and 6-week postpartum (pp). Cord blood was collected at delivery. Mixed lymphocyte reactions were used to measure maternal cytokine responses [interleukin-6 (IL-6), IL-10, IL-13 and (interferon-gamma) IFN-gamma] at each time point towards foetal mononuclear cells. Maternal cytokine responses during pregnancy (20, 30 and 36 weeks) were suppressed compared to the responses at 6-week pp. The ratio of maternal IFN-gamma/IL-13 and IFN-gamma/IL-10 responses were lower during pregnancy. Allergic mothers had lower IFN-gamma responses at each time-point during pregnancy with the greatest difference in responses observed at 36-week gestation. When allergic and nonallergic women were further stratified by gravidity group, IFN-gamma responses of allergic multigravid mothers were significantly lower than nonallergic multigravid mothers during pregnancy. During normal pregnancy, peripheral T-cell cytokine responses to foetal alloantigens may be altered by both allergic status of the mother and previous pregnancies. These factors could influence the cytokine milieu experienced by the foetus and will be further explored in the development of allergic disease during early life.
Si, Yue; Ciccone, Samantha; Yang, Feng-Chun; Yuan, Jin; Zeng, Daisy; Chen, Shi; van de Vrugt, Henri J.; Critser, John; Arwert, Fre; Haneline, Laura S.; Clapp, D. Wade
2006-01-01
Fanconi anemia (FA) is a heterogeneous genetic disorder characterized by bone marrow (BM) failure and cancer susceptibility. Identification of the cDNAs of FA complementation types allows the potential of using gene transfer technology to introduce functional cDNAs as transgenes into autologous stem cells and provide a cure for the BM failure in FA patients. However, strategies to enhance the mobilization, transduction, and engraftment of exogenous stem cells are required to optimize efficacy prior to widespread clinical use. Hypersensitivity of Fancc–/– cells to interferon-gamma (IFN-γ), a nongenotoxic immune-regulatory cytokine, enhances engraftment of syngeneic wild-type (WT) cells in Fancc–/– mice. However, whether this phenotype is of broad relevance in other FA complementation groups is unresolved. Here we show that primitive and mature myeloid progenitors in Fanca–/– and Fancg–/– mice are hypersensitive to IFN-γ and that in vivo infusion of IFN-γ at clinically relevant concentrations was sufficient to allow consistent long-term engraftment of isogenic WT repopulating stem cells. Given that FANCA, FANCC, and FANCG complementation groups account for more than 90% of all FA patients, these data provide evidence that IFN-γ conditioning may be a useful nongenotoxic strategy for myelopreparation in FA patients. PMID:16946306
Electrochemical impedance spectroscopy based-on interferon-gamma detection
NASA Astrophysics Data System (ADS)
Li, Guan-Wei; Kuo, Yi-Ching; Tsai, Pei-I.; Lee, Chih-Kung
2014-03-01
Tuberculosis (TB) is an ancient disease constituted a long-term menace to public health. According to World Health Organization (WHO), mycobacterium tuberculosis (MTB) infected nearly a third of people of the world. There is about one new TB occurrence every second. Interferon-gamma (IFN-γ) is associated with susceptibility to TB, and interferongamma release assays (IGRA) is considered to be the best alternative of tuberculin skin test (TST) for diagnosis of latent tuberculosis infection (LTBI). Although significant progress has been made with regard to the design of enzyme immunoassays for IFN-γ, adopting this assay is still labor-intensive and time-consuming. To alleviate these drawbacks, we used IFN-γ antibody to facilitate the detection of IFN-γ. An experimental verification on the performance of IGRA was done in this research. We developed two biosensor configurations, both of which possess high sensitivity, specificity, and rapid IFN-γ diagnoses. The first is the electrochemical method. The second is a circular polarization interferometry configuration, which incorporates two light beams with p-polarization and s-polarization states individually along a common path, a four photo-detector quadrature configuration to arrive at a phase modulated ellipsometer. With these two methods, interaction between IFN-γ antibody and IFN-γ were explored and presented in detail.
Yuminamochi, Eri; Koike, Taisuke; Takeda, Kazuyoshi; Horiuchi, Isao; Okumura, Ko
2007-06-01
Dried fruiting bodies of Agaricus blazei Murill (A. blazei) and its extracts have generally used as complementary and alternative medicines (CAMs). Here, we report that the oral administration of A. blazei augmented cytotoxicity of natural killer (NK) cells in wild-type (WT) C57BL/6, C3H/HeJ, and BALB/c mice. Augmented cytotoxicity was demonstrated by purified NK cells from treated wild-type (WT) and RAG-2-deficient mice, but not from interferon-gamma (IFN-gamma) deficient mice. NK cell activation and IFN-gamma production was also observed in vitro when dendritic cell (DC)-rich splenocytes of WT mice were coincubation with an extract of A. blazei. Both parameters were largely inhibited by neutralizing anti-interleukin-12 (IL-12) monoclonal antibody (mAb) and completely inhibited when anti-IL-12 mAb and anti-IL-18 mAb were used in combination. An aqueous extract of the hemicellulase-digested compound of A. blazei particle; (ABPC) induced IFN-gamma production more effectively, and this was completely inhibited by anti-IL-12 mAb alone. NK cell cytotoxicty was augmented with the same extracts, again in an IL-12 and IFN-gamma-dependent manner. These results clearly demonstrated that A. blazei and ABPC augmented NK cell activation through IL-12-mediated IFN-gamma production.
Mycobacterium avium Complex Empyema in a Patient with Interferon Gamma Autoantibodies
Chung, Heath H; Opal, Steven M; Dworkin, Jonathan D
2014-01-01
Interferon gamma (IFN-γ) autoantibodies are a relatively recently discovered clinical entity, which have been shown to be associated with disseminated non-tuberculous mycobacterial (NTM) infections and other opportunistic infections. Interestingly, isolated NTM infections (without disseminated NTM infection) have not been shown to be a good predictor of the presence of IFN-γ autoantibodies. This case describes an isolated NTM empyema in a patient with IFN-γ autoantibodies and makes the argument that the development of an NTM empyema in a patient with no known immunodeficiency should prompt consideration for IFN-γ testing. Additionally, this case underscores the importance for clinicians to recognize that an unusual infection without the typical cause of impairment in immunity should prompt a more thorough investigation of the patient's immune system. PMID:25285250
Development of a lion-specific interferon-gamma assay.
Maas, M; van Kooten, P J S; Schreuder, J; Morar, D; Tijhaar, E; Michel, A L; Rutten, V P M G
2012-10-15
The ongoing spread of bovine tuberculosis (BTB) in African free-ranging lion populations, for example in the Kruger National Park, raises the need for diagnostic assays for BTB in lions. These, in addition, would be highly relevant for zoological gardens worldwide that want to determine the BTB status of their lions, e.g. for translocations. The present study concerns the development of a lion-specific IFN-γ assay, following the production and characterization of monoclonal antibodies specific for lion interferon-gamma (IFN-γ). Recombinant lion IFN-γ (rLIFN-γ) was produced in mammalian cells and used to immunize mice to establish hybridoma cell lines producing monoclonal antibodies. These were used to develop a sensitive, lion IFN-γ-specific capture ELISA, able to detect rLIFN-γ to the level of 160 pg/ml. Recognition of native lion IFN-γ was shown in an initial assessment of supernatants of mitogen stimulated whole blood cultures of 11 known BTB-negative lions. In conclusion, the capture ELISA shows potential as a diagnostic assay for bovine tuberculosis in lions. Preliminary results also indicate the possible use of the test for other (feline) species. Copyright © 2012 Elsevier B.V. All rights reserved.
Qin, Xin-Tian; Lu, Yue; Tan, Yin-Duo; Chen, Xiao-Qin; Gen, Qi-Rong
2008-01-01
We have constructed plasmid "pTre-IFN-gamma" and proved that the Tet-off system could regulate the expression of human interferon-gamma (IFN-gamma) gene in murine marrow stromal cells in vitro. This study was to investigate the regulatory reversibility of Tet-off system and its effect on the expression of human IFN-gamma gene in murine marrow stromal cells in mice. Plasmids pTet-off and pTre-IFN-gamma were co-transfected into murine marrow stromal cells. The expression of IFN-gamma in marrow stromal cells was detected with ELISA. The marrow stromal cells were transfused into BABL/c naked mice after co-transfection. The expression of IFN-gamma mRNA in the spleen was detected by real-time fluorescent quantitative reverse transcription-polymerase chain reaction (RT-PCR). IFN-gamma protein was detected in the culture solution of marrow stromal cells after co-transfection. The secretion peak appeared within the first 72 h. The protein level of IFN-gamma was significantly lower in 300 ng/ml tetracycline hydrochloride-treated marrow stroma cells than in untreated cells [(67.11+/-22.14) pg/1 x 10(7) cells vs. (319.96+/-29.04) pg/1 x 10(7) cells, P<0.001]; its expression was increased when removed tetracycline hydrochloride (P=0.032). The expression of human IFN-gamma mRNA was detected in the spleen. The mRNA level of IFN-gamma was significantly higher in untreated group than in continuous tetracycline hydrochloride-treated group [(1.5+/-0.7)x10(5) copies . (100 mg)(-1) vs. (6.9+/-5.3)x10(2) copies . (100 mg)(-1), P<0.001]; its expression in the mice received tetracycline hydrochloride for one single time lay between the above two groups with significant difference. In mice, Tet-off system could rapidly, efficiently and reversibly regulate the expression of human IFN-gamma gene in marrow stromal cells in vitro and in vivo.
Pae, H O; Yoo, J C; Choi, B M; Paik, S G; Kim, Y H; Jin, H S; Chung, H T
1999-01-01
A previous study has demonstrated that both interferon-gamma (IFN-gamma) and lipopolysaccharide (LPS) were needed to induce the production of nitric oxide (NO) in BNL CL.2 cells, murine embryonic liver cells. We here demonstrate that when BNL CL.2 cells were cultured with serum-free medium, they were induced to produce NO by the stimulation of IFN-gamma alone. BNL CL.2 cells were cultured with serum-free or serum-containing medium for 1-3 days and then stimulated to synthesize NO by IFN-gamma. Surprisingly, only serum-starved cells showed significant amount of nitrite accumulation and iNOS protein expression in response to IFN-gamma in dose- and time-dependent manners, but serum-supplied cells did not. When the cells were stimulated with IFN-gamma, tumor necrosis factor-alpha (TNF-alpha), or LPS in combinations, only the combination of IFN-gamma and LPS produced more NO than that produced by IFN-gamma alone. The production of NO by the cells stimulated with IFN-gamma or IFN-gamma plus LPS was blocked by the addition of N(G)-monomethyl-L-arginine (N(G)MMA), a NO synthesis inhibitor. To address the intracellular signal pathway responsible for the production of NO by the cells stimulated with IFN-gamma aloneor IFN-gamma plus LPS, we examined the effects of several protein kinase inhibitors on the production of NO from the cells. The production of NO was significantly inhibited by protein tyrosine kinase (PTK) inhibitors, genistein and herbimycin A, but not by protein kinase A or C inhibitors. These results suggest that the deprivation of serum from BNL CL.2 cell culture medium might prime the cells to induce NO synthesis when the cells are triggered by IFN-gamma and the involvement of PTK signal transduction pathway in the expression of inducible NO synthase gene in murine hepatoma cells.
Inhibition of interferon-gamma expression by osmotic shrinkage of peripheral blood lymphocytes.
Lang, K S; Weigert, C; Braedel, S; Fillon, S; Palmada, M; Schleicher, E; Rammensee, H-G; Lang, F
2003-01-01
A hypertonic environment, as it prevails in renal medulla or in hyperosmolar states such as hyperglycemia of diabetes mellitus, has been shown to impair the immune response, thus facilitating the development of infection. The present experiments were performed to test whether hypertonicity influences activation of T lymphocytes. To this end, peripheral blood lymphocytes (PBL) of cytomegalovirus (CMV)-positive donors were stimulated by human leukocyte antigen (HLA)-A2-restricted CMV epitope NLVPMVATV to produce interferon (IFN)-gamma at varying extracellular osmolarity. As a result, increasing extracellular osmolarity during exposure to the CMV antigen indeed decreased IFN-gamma formation. Addition of NaCl was more effective than urea. A 50% inhibition was observed at 350 mosM by addition of NaCl. The combined application of the Ca(2+) ionophore ionomycin (1 microg/ml) and the phorbol ester phorbol 12-myristate 13-acetate (PMA; 5 microg/ml) stimulated IFN-gamma production, an effect again reversed by hyperosmolarity. Moreover, hyperosmolarity abrogated the stimulating effect of ionomycin (1 microg/ml) and PMA (5 microg/ml) on the transcription factors activator protein (AP)-1, nuclear factor of activated T cells (NFAT), and NF-kappaB but not Sp1. In conclusion, osmotic cell shrinkage blunts the stimulatory action of antigen exposure on IFN-gamma production, an effect explained at least partially by suppression of transcription factor activation.
Reiners, J J; Cantu, A; Thai, G; Pavone, A
1993-03-01
SENCAR mice develop more papillomas in two-stage skin carcinogenesis protocols if gamma interferon (IFN-gamma) is co-administered with 12-O-tetradecanoylphorbol-13-acetate (TPA) during the promotion phase. In the current study preparations of murine alpha, beta and gamma IFNs were surveyed for their abilities to modulate TPA-dependent promotion and induction of epidermal hyperplasia, inflammation and ornithine decarboxylase activity (ODC). Single or multiple i.p. administrations of IFN-alpha, -beta or -gamma (< or = 2500 units) did not induce epidermal hyperplasia, inflammation or ODC activity. Single or multiple i.p. administrations of IFN-alpha, -beta or -gamma (2500 units) to mice being topically promoted with 0.1 or 1 microgram of TPA did not alter the epidermal hyperplasia induced by the phorbol ester. The vascular permeability of the skin, as evaluated by the extravasation of Evans blue dye, was increased in a dose-dependent fashion by TPA over the range of 0.1-1 microgram. Treatment of mice promoted with 0.1 microgram of TPA with IFN-gamma (> or = 2500 units) significantly increased the skin's vascular permeability. Comparable effects were not obtained with IFN-beta (IFN-alpha not tested). Treatment of TPA-promoted mice with IFN-gamma, and to a lesser extent IFN-beta, weakly potentiated the TPA-dependent induction of epidermal ODC activity. Under conditions in which IFN-gamma had co-promoting activities in an initiation-promotion protocol, co-treatment of initiated mice with 1 microgram of TPA and IFN-alpha or -beta (100-5000 units) did not reproducibly alter tumor latency., or papilloma and carcinoma multiplicities. These findings suggest that the co-promoting activities of IFNs are restricted to the gamma class, and are not uniformly reflected by parameters commonly employed as short-term markers of tumor promotion.
Gamma Interferon-Induced T-Cell Loss in Virulent Mycobacterium avium Infection
Flórido, Manuela; Pearl, John E.; Solache, Alejandra; Borges, Margarida; Haynes, Laura; Cooper, Andrea M.; Appelberg, Rui
2005-01-01
Infection by virulent Mycobacterium avium caused progressive severe lymphopenia in C57BL/6 mice due to increased apoptosis rates. T-cell depletion did not occur in gamma interferon (IFN-γ)-deficient mice which showed increased T-cell numbers and proliferation; in contrast, deficiency in nitric oxide synthase 2 did not prevent T-cell loss. Although T-cell loss was IFN-γ dependent, expression of the IFN-γ receptor on T cells was not required for depletion. Similarly, while T-cell loss was optimal if the T cells expressed IFN-γ, CD8+ T-cell depletion could occur in the absence of T-cell-derived IFN-γ. Depletion did not require that the T cells be specific for mycobacterial antigen and was not affected by deficiencies in the tumor necrosis factor receptors p55 or p75, the Fas receptor (CD95), or the respiratory burst enzymes or by forced expression of bcl-2 in hematopoietic cells. PMID:15908387
NASA Technical Reports Server (NTRS)
Degee, Antonie L. W.; Mansfield, John M.; Sonnenfeld, Gerald
1986-01-01
Earlier studies have demonstrated that mice resistant to Trypanosoma brucei rhodesiense (the B10.BR/SgSnJ strain) produces, upon infection by this parasite, two peaks of serum interferon (IFN), while the susceptible mice (C3HeB/FeJ) produces no IFN. In the present study, survival times were compared for B10.BR/SgSnJ, C3HeB/FeJ, and CBA/J (an intermediately resistant strain) mice that were injected, prior to infection with the parasite, with either of the following three preparations (1) IFN-gamma, (2) an antibody to IFN-gamma and (3) polyriboinosinic-polyribocytidylic acid (to induce IFN-alpha/beta). No effect on the survival times of mice by any of these preparations could be demonstrated, contrary to some previous reports.
Hirota, Ryuichiro; Tajima, Sadao; Yoneda, Yukio; Tamayama, Takumi; Watanabe, Masahito; Ueda, Kouichi; Kubota, Takahiro; Yoshida, Ryotaro
2002-09-01
Interferon-gamma(-/-) (IFN-gamma(-/-)) and IFN-gamma(+/+) C57BL/6 mice (3 weeks of age) completed the production of morphogenesis-derived hair. Around 6 weeks of age, however, most of the IFN-gamma(-/-) but none of the IFN-gamma(+/+) mice began to lose hairs in the dorsal and occipital areas in the absence of inflammatory reactions, and the alopecia was sustained for at least several 10-week periods of observation. A single subcutaneous injection of IFN-gamma to IFN-gamma(-/-) mice at 3, but not 4, 5, or 8 weeks of age could protect all the mice from alopecia, revealing that the lack of IFN-gamma around 3 weeks of age is directly responsible for the alopecia. Histologic features showed that the hair follicles of the IFN-gamma(+/+) mice passed through the anagen (4-5 weeks of age) and catagen/telogen ( approximately 6 weeks of age) phases, whereas those of IFN-gamma(-/-) mice (5 weeks of age or older) stayed in the anagen phase. TUNEL and bromodeoxyuridine experiments suggested that an arrest with unlimited DNA synthesis of the hair cycle in the anagen phase by the lack of IFN-gamma-dependent apoptosis in the midfollicle region and diffuse shedding of previously formed hair induced alopecia in IFN-gamma(-/-) mice.
Connell, Tom G; Davies, Mary-Ann; Johannisen, Christine; Wood, Kathryn; Pienaar, Sandy; Wilkinson, Katalin A; Wilkinson, Robert J; Zar, Heather J; Beatty, David; Nicol, Mark P; Curtis, Nigel; Eley, Brian
2010-05-27
Recent interest has focused on the potential use of serial interferon gamma (IFN-gamma) release assay (IGRA) measurements to assess the response to anti-tuberculous (TB) treatment. The kinetics of IFN-gamma responses to Mycobacterium tuberculosis (MTB) antigens in HIV-infected children during treatment have not however been previously investigated. IFN-gamma responses to the MTB antigens, ESAT-6, CFP-10 and PPD were measured by an enzyme-linked immunospot assay (IFN-gamma ELISpot) at presentation and at one, two and six months after starting anti-tuberculous treatment in HIV-infected children with definite or probable TB. Responses at different time points were compared using a Mann-Whitney U test with paired data analysed using the Wilcoxon signed rank test. A Fisher's exact or Chi-squared test was used to compare proportions when test results were analysed as dichotomous outcomes. Of 102 children with suspected TB, 22 (21%) had definite TB and 24 (23%) probable TB. At least one follow up IFN-gamma ELISpot assay result was available for 31 (67%) of the 46 children. In children with definite or probable TB in whom the IFN-gamma ELISpot assay result was positive at presentation, anti-tuberculous treatment was accompanied by a significant decrease in both the magnitude of the IFN-gamma response to individual or combined MTB-specific antigens (ESAT-6 median 110 SFCs/106 PBMC (IQR 65-305) at presentation vs. 15 (10-115) at six months, p = 0.04; CFP-10 177 (48-508) vs. 20 (5-165), p = 0.004, ESAT-6 or CFP-10 median 250 SFCs/106 PBMC (IQR 94-508) vs. 25 (10-165), p = 0.004) and in the proportion of children with a positive IFN-gamma ELISpot assay (Fisher's exact test: ESAT-6 15/0 vs 5/11, p = 0.0002, CFP-10 22/0 vs 8/17, p = 0.0001, ESAT-6 or CFP-10 22/0 vs. 9/17, p= 0.002). However almost half of the children had a positive IFN-gamma ELISpot assay after six months of anti-tuberculous treatment. In addition, there was conversion of the IFN-gamma ELISpot assay result
Morris, L; Troutt, A B; McLeod, K S; Kelso, A; Handman, E; Aebischer, T
1993-01-01
For murine cutaneous leishmaniasis, data to date suggest a correlation between the presence of gamma interferon (IFN-gamma) and resistance in C57BL/6 mice and the presence of interleukin-4 (IL-4) and disease in BALB/c mice. In this study, 13 inbred strains of mice covering the range of susceptibility to disease were infected with Leishmania major to determine whether the subsequent expression of IFN-gamma or IL-4 is a reliable indicator of cure or progressive disease. The presence of IL-4 and IFN-gamma mRNAs in the draining lymph nodes was examined 9 weeks after infection, when differences in disease severity became obvious. There were large differences in the levels of IL-4 mRNA among the different strains, whereas IFN-gamma mRNA was detected at similar levels in all strains. The levels of IL-4 mRNA correlated with lesion score, with susceptible and intermediate strains containing up to 100-fold more than any of the resistant strains. Differences in the levels of IFN-gamma mRNA were within only a fourfold range, with significant overlap among susceptible, intermediate, and resistant strains. Similarly, the levels of IFN-gamma secreted in vitro by lymph node cells from infected mice in response to L. major antigens were within a 10-fold range for most strains, and there was no correlation with lesion score. Analysis of Leishmania-specific antibody levels revealed a correlation between immunoglobulin G1 (IgG1) titers and lesion score, consistent with the role of IL-4 as a switch factor for IgG1. In contrast, there was no correlation between IgG2a titers and lesion score, supporting the notion that IFN-gamma synthesis (which promotes IgG2a production) is not correlated with disease state. These data suggest that along the spectrum of murine cutaneous leishmaniasis, IL-4 is a reliable indicator of disease, but IFN-gamma is not prognostic for resistance. Images PMID:8335376
NASA Technical Reports Server (NTRS)
Gould, Cheryl L.; Sonnenfeld, Gerald
1987-01-01
The effect of pretreatment of mice with 34 units/day, for five days, of interferon-gamma (IFN-gamma) on the course of infection with LD50 of Salmonella typhimurium strain LT-2 was assessed, using two IFN preparations: (1) a hybridoma supernatant fluid containing concanavalin-A-induced IFN-gamma activity and (2) pure murine IFN-gamma produced by recombinant DNA technology. The hybridoma supernatant-treated Salmonella-infected mice were found to die faster than mice treated only with Salmonella. Pure murine IFN-gamma was found to protect infected mice significantly, with 95 percent of mice surviving LD50 infection. In contrast, the Salmonella-infected mice treated with hybridoma supernatant were found to die faster than the Salmonella-infected untreated controls. Mice treated with concanavalin A alone prior to infection with S. typhimurium died more quickly than the untreated infected controls, suggesting that contamination with concanavalin A had a detrimental effect on mice survival.
Leaphart, Cynthia L; Qureshi, Faisal; Cetin, Selma; Li, Jun; Dubowski, Theresa; Baty, Catherine; Batey, Catherine; Beer-Stolz, Donna; Guo, Fengli; Murray, Sandra A; Hackam, David J
2007-06-01
Necrotizing enterocolitis (NEC) is characterized by interferon-gamma (IFN-gamma) release and inadequate intestinal restitution. Because enterocytes migrate together, mucosal healing may require interenterocyte communication via connexin 43-mediated gap junctions. We hypothesize that enterocyte migration requires interenterocyte communication, that IFN impairs migration by impairing connexin 43, and that impaired healing during NEC is associated with reduced gap junctions. NEC was induced in Swiss-Webster or IFN(-/-) mice, and restitution was determined in the presence of the gap junction inhibitor oleamide, or via time-lapse microscopy of IEC-6 cells. Connexin 43 expression, trafficking, and localization were detected in cultured or primary enterocytes or mouse or human intestine by confocal microscopy and (35)S-labeling, and gap junction communication was assessed using live microscopy with oleamide or connexin 43 siRNA. Enterocytes expressed connexin 43 in vitro and in vivo, and exchanged fluorescent dye via gap junctions. Gap junction inhibition significantly reduced enterocyte migration in vitro and in vivo. NEC was associated with IFN release and loss of enterocyte connexin 43 expression. IFN inhibited enterocyte migration by reducing gap junction communication through the dephosphorylation and internalization of connexin 43. Gap junction inhibition significantly increased NEC severity, whereas reversal of the inhibitory effects of IFN on gap junction communication restored enterocyte migration after IFN exposure. Strikingly, IFN(-/-) mice were protected from the development of NEC, and showed restored connexin 43 expression and intestinal restitution. IFN inhibits enterocyte migration by preventing interenterocyte gap junction communication. Connexin 43 loss may provide insights into the development of NEC, in which restitution is impaired.
NASA Technical Reports Server (NTRS)
Lah, T. T.; Hawley, M.; Rock, K. L.; Goldberg, A. L.
1995-01-01
Previous studies have indicated that acid-optimal cysteine proteinase(s) in the endosomal-lysosomal compartments, cathepsins, play a critical role in the proteolytic processing of endocytosed proteins to generate the antigenic peptides presented to the immune system on major histocompatibility complex (MHC) class II molecules. The presentation of these peptides and the expression of MHC class II molecules by macrophages and lymphocytes are stimulated by gamma-interferon (gamma-IFN). We found that treatment of human U-937 monocytes with gamma-IFN increased the activities and the content of the two major lysosomal cysteine proteinases, cathepsins B and L. Assays of protease activity, enzyme-linked immunosorbant assays (ELISA) and immunoblotting showed that this cytokine increased the amount of cathepsin B 5-fold and cathepsin L 3-fold in the lysosomal fraction. By contrast, the aspartic proteinase, cathepsin D, in this fraction was not significantly altered by gamma-IFN treatment. An induction of cathepsins B and L was also observed in mouse macrophages, but not in HeLa cells. These results suggest coordinate regulation in monocytes of the expression of cathepsins B and L and MHC class II molecules. Presumably, this induction of cysteine proteases contributes to the enhancement of antigen presentation by gamma-IFN.
Lin, Chiou-Feng; Tsai, Cheng-Chieh; Huang, Wei-Ching; Wang, Chi-Yun; Tseng, Hsiang-Chi; Wang, Yi; Kai, Jui-In; Wang, Szu-Wen; Cheng, Yi-Lin
2008-10-15
Interferon-gamma (IFN-gamma) plays a crucial role in innate immunity and inflammation. It causes the synergistic effect on endotoxin lipopolysaccharide (LPS)-stimulated inducible nitric oxide synthase (iNOS)/NO biosynthesis; however, the mechanism remains unclear. In the present study, we investigated the effects of glycogen synthase kinase-3 (GSK-3)-mediated inhibition of anti-inflammatory interleukin-10 (IL-10). We found, in LPS-stimulated macrophages, that IFN-gamma increased iNOS expression and NO production in a time-dependent manner. In addition, ELISA analysis showed the upregulation of tumor necrosis factor-alpha and regulated on activation, normal T expressed and secreted, and the downregulation of IL-10. RT-PCR further showed changes in the IL-10 mRNA level as well. Treating cells with recombinant IL-10 showed a decrease in IFN-gamma/LPS-induced iNOS/NO biosynthesis, whereas anti-IL-10 neutralizing antibodies enhanced this effect, suggesting that IL-10 acts in an anti-inflammatory role. GSK-3-inhibitor treatment blocked IFN-gamma/LPS-induced iNOS/NO biosynthesis but upregulated IL-10 production. Inhibiting GSK-3 using short-interference RNA showed similar results. Additionally, treating cells with anti-IL-10 neutralizing antibodies blocked these effects. We further showed that inhibiting GSK-3 increased phosphorylation of transcription factor cyclic AMP response element binding protein. Inhibiting protein tyrosine kinase Pyk2, an upstream regulator of GSK-3beta, caused inhibition on IFN-gamma/LPS-induced GSK-3beta phosphorylation at tyrosine 216 and iNOS/NO biosynthesis. Taken together, these findings reveal the involvement of GSK-3-inhibited IL-10 on the induction of iNOS/NO biosynthesis by IFN-gamma synergized with LPS. (c) 2008 Wiley-Liss, Inc.
Interferon-gamma: biologic functions and HCV therapy (type I/II) (1 of 2 parts).
Gattoni, A; Parlato, A; Vangieri, B; Bresciani, M; Derna, R
2006-01-01
This review is aimed at exhaustively presenting and discussing the interferon-gamma (IFN-gamma), a cytokine that plays an important role in inducing and modulating an array of immune responses. A review of the most significant and recent clinical trials was performed. Although IFN-gamma has some antiviral activity, it is much less active in this regard than type I IFNs. IFN-gamma is involved in the regulation of nearly all phases of the immune and inflammatory responses, including the activation and differentiation of T cells, B cells, NK cells, macrophages, and others. It is therefore best regarded as a distint immunoregulatory cytokine. IFN-gamma secretion is a hallmark of Th1 lymphocytes. It is also secreted by nearly all CD8 T cells, by some Th0 cells, and by NK cells. Each of these cell types secretes IFN-gamma only when activated, usually as part of immune response and especially in response to IL-2 and IL-12. IFN-gamma production is inhibited by IL-4, IL-10, TGFbeta, glucocorticoids, cyclosporin A and FK506. Nearly all cell types express the heterodimeric receptor for IFN-beta and respond to this cytokine by increasing the surface expression of class I MHC proteins. As a result, virtually any cell in the vicinity of an IFN-beta-secreting cell becomes more efficient at presenting endogenous antigens and hence a better target for cytotoxic killing if it harbors an intracellular pathogen. Unlike the type I IFNs, IFN-gamma also increases the expression of class II MHC proteins on professional APCs, and so promotes antigen presentation to helper T cells as well. It also induces de novo expression of class II MHC proteins on venular endothelial cells and on some other epithelial and connective tissue cells that do not otherwise express them, thus enabling these cell types to function as temporary APCs at sites of intense immune reactions. The effector functions of NK cells are to lyse virus-infected cells and to secrete IFN-gamma, which activates macrofages to
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cheon, Soyoung; Song, Seok Bean; Jung, Minkyung
2008-09-12
Natural killer (NK) cells play an important role in the innate immune response. Interleukin-18 (IL-18) is a well-known interferon-gamma (IFN-{gamma} inducing factor, which stimulates immune response in NK and T cells. Sphingosine kinase (SPHK) catalyzes the formation of sphingosine 1-phosphate (S1P), which acts as a second messenger to function as an anti-apoptotic factor and proliferation stimulator of immune cells. In this study, to elucidate whether SPHK is involved in IL-18-induced IFN-{gamma} production, we measured IL-18-induced IFN-{gamma} production after pre-treatment with SPHK inhibitor (SKI) in NK-92MI cells. We found that IL-18-induced IFN-{gamma} expression was blocked by SKI pre-treatment in both mRNAmore » and protein levels. In addition, the increased IFN-{gamma} production by stimulation with IL-18 is mediated through both SPHK and p38 MAPK. To determine the upstream signals of SKI and p38 MAPK in IL-18-induced IFN-{gamma} production, phosphorylation levels of p38 MAPK was measured after SKI pre-treatment. As a result, inhibition of SPHK by SKI blocked phosphorylation of p38 MAPK, showing that SPHK activation by IL-18 is an upstream signal of p38 MAPK activation. Inhibition of SPHK by SKI also inhibited IL-18-induced IFN-{gamma} production in human primary NK cells. In conclusion, SPHK activation is an essential factor for IL-18-induced IFN-{gamma} production via p38 MAPK.« less
Müller, M; Laxton, C; Briscoe, J; Schindler, C; Improta, T; Darnell, J E; Stark, G R; Kerr, I M
1993-01-01
Mutants in complementation group U3, completely defective in the response of all genes tested to interferons (IFNs) alpha and gamma, do not express the 91 and 84 kDa polypeptide components of interferon-stimulated gene factor 3 (ISGF3), a transcription factor known to play a primary role in the IFN-alpha response pathway. The 91 and 84 kDa polypeptides are products of a single gene. They result from differential splicing and differ only in a 38 amino acid extension at the C-terminus of the 91 kDa polypeptide. Complementation of U3 mutants with cDNA constructs expressing the 91 kDa product at levels comparable to those observed in induced wild-type cells completely restored the response to both IFN-alpha and -gamma and the ability to form ISGF3. Complementation with the 84 kDa component similarly restored the ability to form ISGF3 and, albeit to a lower level, the IFN-alpha response of all genes tested so far. It failed, however, to restore the IFN-gamma response of any gene analysed. The precise nature of the DNA motifs and combination of factors required for the transcriptional response of all genes inducible by IFN-alpha and -gamma remains to be established. The results presented here, however, emphasize the apparent general requirement of the 91 kDa polypeptide in the primary transcriptional response to both types of IFN. Images PMID:7693454
Higashi, Kiyoshi; Inagaki, Yutaka; Fujimori, Ko; Nakao, Atsuhito; Kaneko, Hideo; Nakatsuka, Iwao
2003-10-31
Transforming growth factor-beta (TGF-beta) and interferon-gamma (IFN-gamma) exert antagonistic effects on collagen synthesis in human dermal fibroblasts. We have recently shown that Y box-binding protein YB-1 mediates the inhibitory effects of IFN-gamma on alpha2(I) procollagen gene (COL1A2) transcription through the IFN-gamma response element located between -161 and -150. Here we report that YB-1 counter-represses TGF-beta-stimulated COL1A2 transcription by interfering with Smad3 bound to the upstream sequence around -265 and subsequently by interrupting the Smad3-p300 interaction. Western blot and immunofluorescence analyses using inhibitors for Janus kinases or casein kinase II suggested that the casein kinase II-dependent signaling pathway mediates IFN-gamma-induced nuclear translocation of YB-1. Down-regulation of endogenous YB-1 expression by double-stranded YB-1-specific RNA abrogated the transcriptional repression of COL1A2 by IFN-gamma in the absence and presence of TGF-beta. In transient transfection assays, overexpression of YB-1 in human dermal fibroblasts exhibited antagonistic actions against TGF-beta and Smad3. Physical interaction between Smad3 and YB-1 was demonstrated by immunoprecipitation-Western blot analyses, and electrophoretic mobility shift assays using the recombinant Smad3 and YB-1 proteins indicated that YB-1 forms a complex with Smad3 bound to the Smad-binding element. Glutathione S-transferase pull-down assays showed that YB-1 binds to the MH1 domain of Smad3, whereas the central and carboxyl-terminal regions of YB-1 were required for its interaction with Smad3. YB-1 also interferes with the Smad3-p300 interaction by its preferential binding to p300. Altogether, the results provide a novel insight into the mechanism by which IFN-gamma/YB-1 counteracts TGF-beta/Smad3. They also indicate that IFN-gamma/YB-1 inhibits COL1A2 transcription by dual actions: via the IFN-gamma response element and through a cross-talk with the TGF
Potential mechanisms of cytosolic calcium modulation in interferon-gamma treated U937 cells
NASA Technical Reports Server (NTRS)
Klein, Jon B.; Mcleish, Kenneth R.; Sonnenfeld, Gerald; Dean, William L.
1987-01-01
The ability of interferon-gamma (IFN-gamma) to alter cytoplasmic Ca(2+) content in the monocytelike cell line U937 was investigated, using a slow Ca-channel blocker, diltiazem. In addition, the Ca-ATPase and the Ca-uptake activities were measured in isolated U937 membranes, together with the effect of inositol trisphosphate (IP3) upon the Ca(2+) release from Ca-loaded membranes. The addition of 50 U/ml INF-gamma to U937 cultures was found to increase internal Ca(2+) by about 100 percent within 3 min. The increase was significantly reduced by incubation in Ca-free buffer or by the addition of diltiazem. A crude membrane preparation from U937 cells was found to contain significant amounts of Ca-ATPase activity and to sequester Ca(2+) to a level of 8 nmol/mg in 30 sec; the addition of IP3 induced release of a portion of the sequestered Ca(2+) which was then resequestered. The results suggest that IFN-gamma causes an increase of cytoplasmic Ca(2+), in part, by the IP3-induced release from the internal storage sites and, in part, from the entry of extracellular Ca through slow channels.
Titze-de-Almeida, Simoneide S; Lustosa, Cátia Faria; Horst, Camila Hillesheim; Bel, Elaine Del; Titze-de-Almeida, Ricardo
2014-12-01
This study examined whether the cytokine interferon (IFN) gamma plays a role in the injury of SH-SY5Y cells caused by MPP(+) (1-methyl-4-phenylpyridinium). First of all, IFN-gamma sensitized cells to the neurotoxin MPP(+), as determined by MTT (3-(4,5-dimethylthiazol-2-y1)-2,5-diphenyltetrazolium bromide) assay. MPP(+)-injured cells showed higher reactive oxygen species (ROS) levels, which was reinforced by IFN-gamma. The injury triggered a marked expression of the neuronal NOS (nNOS) enzyme. L-NAME [N(ω)-nitro-L-arginine methyl ester, a non-specific NOS inhibitor] reestablished the cell viability after IFN-gamma challenging, and recovered cells from MPP(+) injury (95.0 vs. 84.7 %; P < 0.05). Seven-NI (7-nitroindazole, a nNOS inhibitor) protected cells against the injury by MPP(+) co-administered with IFN-gamma. Both inhibitors restrained the apoptosis of SH-SY5Y cells caused by MPP(+)/IFN-gamma. Regarding oxidative stress, L-NAME and 7-NI attenuated the increase in ROS levels caused by MPP(+) (45.3 or 48.4 vs. 87.9 %, P < 0.05). Indeed, L-NAME was more effective than 7-NI for reducing oxidative stress caused by MPP(+) under IFN-gamma exposition. The nNOS gene silencing by small-interfering RNAs recovered cells challenged by IFN-gamma (24 h), or MPP(+) (8 h). In conclusion, IFN-gamma sensitizes cells to MPP(+)-induced injury, also causing an increase in ROS levels. Pretreating cells with L-NAME or 7-NI reverts both the oxidative stress and apoptosis triggered by the neurotoxin MPP(+). Taking together, our data reinforce that IFN-gamma and NOS enzymes play a role in oxidative stress and dopaminergic cell death triggered by MPP(+).
Sareneva, T; Mørtz, E; Tölö, H; Roepstorff, P; Julkunen, I
1996-12-01
Interferon-gamma (IFN-gamma) is a secretory glycoprotein produced by T cells in response to antigenic or mitogenic stimuli. We studied the kinetics of the synthesis, N-glycosylation, and secretion of IFN-gamma in human CD8+ T lymphocytes stimulated via T-cell receptor. Highly elevated IFN-gamma mRNA levels were found as early as 1 h after stimulation. Maximal IFN-gamma protein synthesis was observed 2-4 h after induction and appeared to correlate to steady-state IFN-gamma mRNA levels. As analyzed by pulse/chase experiments, the secretion of IFN-gamma from T cells was very rapid, the secretion half-time being approximately 20-25 min. Inhibition of N-glycosylation by tunicamycin dramatically reduced the expression of IFN-gamma, but did not block its secretion. Natural IFN-gamma is heterogeneously glycosylated and doubly, singly, and unglycosylated forms exist. Experiments performed in a cell-free translation/glycosylation system with mutated IFN-gamma constructs lacking either one of the potential glycosylation sites suggested that Asn25 is more efficiently glycosylated than Asn97. Site-specific oligosaccharide analysis of natural IFN-gamma by glycosidase treatment followed by matrix-assisted-laser-desorption-ionization mass spectrometry revealed considerable variation in the carbohydrate structures, with more than 30 different forms. The glycans at Asn25 consisted of fucosylated, mainly complex-type oligosaccharides, whereas the glycans at Asn97 were more heterogeneous, with hybrid and high-mannose structures. Our results emphasize the essential role of N-linked glycans in the biology of IFN-gamma and show that there is a considerable heterogeneity in the individual sugar chains of this important human cytokine.
Designing of interferon-gamma inducing MHC class-II binders
2013-01-01
Background The generation of interferon-gamma (IFN-γ) by MHC class II activated CD4+ T helper cells play a substantial contribution in the control of infections such as caused by Mycobacterium tuberculosis. In the past, numerous methods have been developed for predicting MHC class II binders that can activate T-helper cells. Best of author’s knowledge, no method has been developed so far that can predict the type of cytokine will be secreted by these MHC Class II binders or T-helper epitopes. In this study, an attempt has been made to predict the IFN-γ inducing peptides. The main dataset used in this study contains 3705 IFN-γ inducing and 6728 non-IFN-γ inducing MHC class II binders. Another dataset called IFNgOnly contains 4483 IFN-γ inducing epitopes and 2160 epitopes that induce other cytokine except IFN-γ. In addition we have alternate dataset that contains IFN-γ inducing and equal number of random peptides. Results It was observed that the peptide length, positional conservation of residues and amino acid composition affects IFN-γ inducing capabilities of these peptides. We identified the motifs in IFN-γ inducing binders/peptides using MERCI software. Our analysis indicates that IFN-γ inducing and non-inducing peptides can be discriminated using above features. We developed models for predicting IFN-γ inducing peptides using various approaches like machine learning technique, motifs-based search, and hybrid approach. Our best model based on the hybrid approach achieved maximum prediction accuracy of 82.10% with MCC of 0.62 on main dataset. We also developed hybrid model on IFNgOnly dataset and achieved maximum accuracy of 81.39% with 0.57 MCC. Conclusion Based on this study, we have developed a webserver for predicting i) IFN-γ inducing peptides, ii) virtual screening of peptide libraries and iii) identification of IFN-γ inducing regions in antigen (http://crdd.osdd.net/raghava/ifnepitope/). Reviewers This article was reviewed by Prof Kurt
Chen, Jianzhou; Markelc, Bostjan; Kaeppler, Jakob; Ogundipe, Vivian M L; Cao, Yunhong; McKenna, W Gillies; Muschel, Ruth J
2018-05-01
To investigate the induction of type III interferons (IFNs) in human cancer cells by gamma-rays. Type III IFN expression in human cancer cell lines after gamma-ray irradiation in vitro was assessed by reverse transcription-quantitative polymerase chain reaction and enzyme-linked immunosorbent assay. Signaling pathways mediating type III IFN induction were examined by a variety of means, including immunoblotting, flow cytometry, confocal imaging, and reverse transcription-quantitative polymerase chain reaction. Key mediators in these pathways were further explored and validated using gene CRISPR knockout or short hairpin RNA knockdown. Exposure to gamma-rays directly induced type III IFNs (mainly IFNL1) in human cancer cell lines in dose- and time-dependent fashions. The induction of IFNL1 was primarily mediated by the cytosolic DNA sensors-STING-TBK1-IRF1 signaling axis, with a lesser contribution from the nuclear factor kappa b signaling in HT29 cells. In addition, type III IFN signaling through its receptors serves as a positive feedback loop, further enhancing IFN expression via up-regulation of the kinases in the STING-TBK1 signaling axis. Our results suggest that IFNL1 can be up-regulated in human cancer cell lines after gamma-ray treatment. In HT29 cells this induction occurs via the STING pathway, adding another layer of complexity to the understanding of radiation-induced antitumor immunity, and may provide novel insights into IFN-based cancer treatment. Copyright © 2018 Elsevier Inc. All rights reserved.
Coppen, S R; Newsam, R; Bull, A T; Baines, A J
1995-04-20
The Chinese hamster ovary (CHO) cell line has great commercial importance in the production of recombinant human proteins, especially those for therapeutic use. Much attention has been paid to CHO cell population physiology in order to define factors affecting product fidelity and yield. Such studies have revealed that recombinant proteins, including human interferon-gamma (IFN-gamma), can be heterogeneous both in glycosylation and in proteolytic processing. The type of heterogeneity observed depends on the growth physiology of the cell population, although the relationship between them is complex. In this article we report results of a cytological study of the CHO320 line which expresses recombinant human IFN-gamma. When grown in suspension culture, this cell line exhibited three types of heterogeneity: (1) heterogeneity of the production of IFN-gamma within the cell population, (2) heterogeneity of the number of nuclei and mitotic spindles in dividing cells, and (3) heterogeneity of cellular environment. The last of these arises from cell aggregates which form in suspension culture: Some cells are exposed to the culture medium; others are fully enclosed within the mass with little or no direct access to the medium. Thus, live cells producing IFN-gamma are heterogeneous in their environment, with variable access to O(2) and nutrients. Within the aggregates, it appears that live cells proliferate on a dead cell mass. The layer of live cells can be several cells deep. Specific cell-cell attachments are observed between the living cells in these aggregates. Two proteins, known to be required for the formation of certain types of intercellular junctions, spectrin and vinculin, have been localized to the regions of cell-cell contact. The aggregation of the cells appears to be an active process requiring protein synthesis. (c) 1995 John Wiley & Sons, Inc.
Yoon, Wonsuck; Park, Yoo Chang; Kim, Jinseok; Chae, Yang Seok; Byeon, Jung Hye; Min, Sang-Hyun; Park, Sungha; Yoo, Young; Park, Yong Keun; Kim, Byeong Mo
2017-01-01
Salmonella have been experimentally used as anti-cancer agents, because they show selective growth in tumours. In this study, we genetically modified attenuated Salmonella typhimurium to express and secrete interferon-gamma (IFN-γ) as a tumouricidal agent to enhance the therapeutic efficacy of Salmonella. IFN-γ was fused to the N-terminal region (residues 1-160) of SipB (SipB160) for secretion from bacterial cells. Attenuated S. typhimurium expressing recombinant IFN-γ (S. typhimurium (IFN-γ)) invaded the melanoma cells and induced cytotoxicity. Subcutaneous administration of S. typhimurium (IFN-γ) also efficiently inhibited tumour growth and prolonged the survival of C57BL/6 mice bearing B16F10 melanoma compared with administration of phosphate-buffered saline (PBS), unmodified S. typhimurium or S. typhimurium expressing empty vector (S. typhimurium [Vec]) in a natural killer (NK) cell-dependent manner. Moreover, genetically modified Salmonella, including S. typhimurium (IFN-γ), showed little toxicity to normal tissues with no observable adverse effects. However, S. typhimurium (IFN-γ)-mediated tumour suppression was attributed to direct killing of tumour cells rather than to stable anti-tumour immunity. Collectively, these results suggest that tumour-targeted therapy using S. typhimurium (IFN-γ) has potential for melanoma treatment. Copyright © 2016 Elsevier Ltd. All rights reserved.
Interferon effects on protozoan infections
NASA Technical Reports Server (NTRS)
Sonnenfeld, G.; Wirth, J.; Kierszenbaum, F.; Degee, A. L. W.; Mansfield, J. M.
1985-01-01
The effects of interferon (IFN) on mice infected with two different parasitic protozoans, Trypanosoma cruzi and Trypanosoma brucei rhodesiense, are investigated experimentally. The preparation of the cell cultures, IFN and assays, antibody, and the experimental procedures are described. It is observed that in cells treated with IFN-gamma there is an increased association of T. cruzi with murine macrophages and an increase in the killing of T. cruzi by IFN-gamma-treated murine macrophages. For spleen cells infected with T.b. rhodesiense in vitro, it is detected that live trypanosomes cannot induce IFN in cells from normal mice, but can in cells from immunized mice; and that trypanosome-lysates induce IFN in vitro in cells from normal mice. The data suggest that there is a two-step mechanism for mice against T. cruzi and T.b. rhodesiense.
Komohara, Yoshihiro; Takemura, Kenichi; Lei, Xiao Feng; Sakashita, Naomi; Harada, Mamoru; Suzuki, Hiroshi; Kodama, Tatsuhiko; Takeya, Motohiro
2009-11-01
Class A scavenger receptors (SR-A, CD204) are highly expressed in tumor-associated macrophages (TAM). To investigate the function of SR-A in TAM, wild-type and SR-A-deficient (SR-A(-/-)) mice were injected with EL4 cells. Although these groups of mice did not differ in the numbers of infiltrating macrophages and lymphocytes and in neovascularization, SR-A(-/-) mice had delayed growth of EL4 tumors. Expression of inducible nitric oxide (NO) synthase and interferon (IFN)-gamma mRNA increased significantly in tumor tissues from SR-A(-/-) mice. Engulfment of necrotic EL4 cells induced upregulation of NO and IFN-gamma production by cultured macrophages, and production of NO and IFN-gamma increased in SR-A(-/-) macrophages in vitro. IFN-beta production by cultured macrophages was also elevated in SR-A(-/-) macrophages in vitro. These results suggested that the antitumor activity of macrophages increased in SR-A(-/-) mice because of upregulation of NO and IFN-gamma production. These data indicate an important role of SR-A in regulating TAM function by inhibiting toll-like receptor (TLR)4-IFN-beta signaling.
Shaw, Patrick J; Ditewig, Amy C; Waring, Jeffrey F; Liguori, Michael J; Blomme, Eric A; Ganey, Patricia E; Roth, Robert A
2009-01-01
The antibiotic trovafloxacin (TVX) has caused severe idiosyncratic hepatotoxicity in people, whereas levofloxacin (LVX) has not. Mice cotreated with TVX and lipopolysaccharide (LPS), but not with LVX and LPS, develop severe hepatocellular necrosis. Mice were treated with TVX and/or LPS, and hepatic gene expression changes were measured before liver injury using gene array. Hepatic gene expression profiles from mice treated with TVX/LPS clustered differently from those treated with LPS or TVX alone. Several of the probe sets expressed differently in TVX/LPS-treated mice were involved in interferon (IFN) signaling and the janus kinase/signal transducers and activators of transcription (JAK/STAT) pathway. A time course of plasma concentrations of IFN-gamma and interleukin (IL)-18, which directly induces IFN-gamma production, revealed that both cytokines were selectively increased in TVX/LPS-treated mice. Both IL-18(-/-) and IFN-gamma(-/-) mice were significantly protected from TVX/LPS-induced liver injury. In addition, IFN-gamma(-/-) mice had decreased plasma concentrations of tumor necrosis factor-alpha, IL-18, and IL-1beta when compared to wild-type mice. In conclusion, the altered expression of genes involved in IFN signaling in TVX/LPS-treated mice led to the finding that IL-18 and IFN-gamma play a critical role in TVX/LPS-induced liver injury.
Ruiz-Ruiz, Carmen; López-Rivas, Abelardo
2002-01-01
Tumour necrosis factor-related apoptosis-inducing ligand (TRAIL/APO-2L) induces apoptosis in a variety of tumour cells upon binding to death receptors TRAIL-R1 and TRAIL-R2. Here we describe the sensitization by interferon (IFN)-gamma to TRAIL-induced apoptosis in the breast tumour cell lines MCF-7 and MDA-MB231. IFN-gamma promoted TRAIL-mediated activation of caspase-8, Bcl-2 interacting domain death agonist (Bid) degradation, Bcl-2-associated X protein (Bax) translocation to mitochondria, cytochrome c release to the cytosol and activation of caspase-9 in these cell lines. No changes in the expression of TRAIL receptors were observed upon IFN-gamma treatment. Overexpression of Bcl-2 in MCF-7 cells completely inhibited IFN-gamma-induced sensitization to TRAIL-mediated cell death. Interestingly, TRAIL-induced apoptosis was also clearly enhanced by IFN-gamma in caspase-3-overexpressing MCF-7 cells, in the absence of Bax translocation to mitochondria and cytochrome c release to the cytosol. In summary, our results suggest that IFN-gamma facilitates TRAIL-induced activation of mitochondria-regulated as well as mitochondria-independent apoptotic pathways in breast tumour cells. PMID:11936954
Segura, S.; Gamazo, C.; Irache, J. M.; Espuelas, S.
2007-01-01
The aim of this study was to evaluate the activity of gamma interferon (IFN-γ) when it was either adsorbed onto or loaded into albumin nanoparticles. Brucella abortus-infected macrophages and infected BALB/c mice were selected as the models for testing of the therapeutic potentials of these cytokine delivery systems, in view of the well-established role of IFN-γ-activated macrophages for the control of Brucella sp. infections. Whereas the encapsulation of IFN-γ inside the matrix of nanoparticles completely abrogated its activity, adsorbed IFN-γ increased by 0.75 log unit the bactericidal effect induced by RAW macrophages activated with free IFN-γ, along with a higher level of production of nitric oxide. In infected BALB/c-mice, IFN-γ adsorbed onto nanoparticles was also more active than free cytokine in reducing the number of bacteria in the spleens, and the effect was mediated by an increased ratio of IFN-γ-secreting (Th1) to interleukin-4-secreting (Th2) cells. Overall, albumin nanoparticles would be suitable as carriers that target IFN-γ to macrophages and, thus, potentiate their therapeutic activity. PMID:17220401
Xia, Chuan; Vijayan, Madhuvanthi; Pritzl, Curtis J; Fuchs, Serge Y; McDermott, Adrian B; Hahm, Bumsuk
2015-12-16
Influenza A virus (IAV) employs diverse strategies to circumvent type I interferon (IFN) responses, particularly by inhibiting the synthesis of type I IFNs. However, it is poorly understood if and how IAV regulates the type I IFN receptor (IFNAR)-mediated signaling mode. In this study, we demonstrate that IAV induces the degradation of IFNAR subunit 1 (IFNAR1) to attenuate the type I IFN-induced antiviral signaling pathway. Following infection, the level of IFNAR1 protein, but not mRNA, decreased. Indeed, IFNAR1 was phosphorylated and ubiquitinated by IAV infection, which resulted in IFNAR1 elimination. The transiently overexpressed IFNAR1 displayed antiviral activity by inhibiting virus replication. Importantly, the hemagglutinin (HA) protein of IAV was proved to trigger the ubiquitination of IFNAR1, diminishing the levels of IFNAR1. Further, influenza A viral HA1 subunit, but not HA2 subunit, downregulated IFNAR1. However, viral HA-mediated degradation of IFNAR1 was not caused by the endoplasmic reticulum (ER) stress response. IAV HA robustly reduced cellular sensitivity to type I IFNs, suppressing the activation of STAT1/STAT2 and induction of IFN-stimulated antiviral proteins. Taken together, our findings suggest that IAV HA causes IFNAR1 degradation, which in turn helps the virus escape the powerful innate immune system. Thus, the research elucidated an influenza viral mechanism for eluding the IFNAR signaling pathway, which could provide new insights into the interplay between influenza virus and host innate immunity. Influenza A virus (IAV) infection causes significant morbidity and mortality worldwide and remains a major health concern. When triggered by influenza viral infection, host cells produce type I interferon (IFN) to block viral replication. Although IAV was shown to have diverse strategies to evade this powerful, IFN-mediated antiviral response, it is not well-defined if IAV manipulates the IFN receptor-mediated signaling pathway. Here, we
Zhu, Hui; Wang, Wen-Xiu; Wang, Bao-Qin; Zhu, Xiao-Fu; Wu, Xu-Jin; Ma, Qing-Yi; Chen, De-Kun
2012-06-29
The giant panda (Ailuropoda melanoleuca) is an endangered species and indigenous to China. Interferon-gamma (IFN-γ) is the only member of type □ IFN and is vital for the regulation of host adapted immunity and inflammatory response. Little is known aboutthe FN-γ gene and its roles in giant panda.In this study, IFN-γ gene of Qinling giant panda was amplified from total blood RNA by RT-CPR, cloned, sequenced and analysed. The open reading frame (ORF) of Qinling giant panda IFN-γ encodes 152 amino acidsand is highly similar to Sichuan giant panda with an identity of 99.3% in cDNA sequence. The IFN-γ cDNA sequence was ligated to the pET32a vector and transformed into E. coli BL21 competent cells. Expression of recombinant IFN-γ protein of Qinling giant panda in E. coli was confirmed by SDS-PAGE and Western blot analysis. Biological activity assay indicated that the recombinant IFN-γ protein at the concentration of 4-10 µg/ml activated the giant panda peripheral blood lymphocytes,while at 12 µg/mlinhibited. the activation of the lymphocytes.These findings provide insights into the evolution of giant panda IFN-γ and information regarding amino acid residues essential for their biological activity.
Soler, Concepció; Felipe, Antonio; García-Manteiga, José; Serra, Maria; Guillén-Gómez, Elena; Casado, F Javier; MacLeod, Carol; Modolell, Manuel; Pastor-Anglada, Marçal; Celada, Antonio
2003-01-01
The expressions of CNT and ENT (concentrative and equilibrative nucleoside transporters) in macrophages are differentially regulated by IFN-gamma (interferon-gamma). This cytokine controls gene expression through STAT1-dependent and/or -independent pathways (where STAT1 stands for signal transduction and activator of transcription 1). In the present study, the role of STAT1 in the response of nucleoside transporters to IFN-gamma was studied using macrophages from STAT1 knockout mice. IFN-gamma triggered an inhibition of ENT1-related nucleoside transport activity through STAT1-dependent mechanisms. Such inhibition of macrophage growth and ENT1 activity by IFN-gamma is required for DNA synthesis. Interestingly, IFN-gamma led to an induction of the CNT1- and CNT2-related nucleoside transport activities independent of STAT1, thus ensuring the supply of extracellular nucleosides for the STAT1-independent RNA synthesis. IFN-gamma up-regulated CNT2 mRNA and CNT1 protein levels and down-regulated ENT1 mRNA in both wild-type and STAT1 knockout macrophages. This is consistent with a STAT1-independent, long-term-mediated, probably transcription-dependent, regulation of nucleoside transporter genes. Moreover, STAT1-dependent post-transcriptional mechanisms are implicated in the regulation of ENT1 activity. Although nitric oxide is involved in the regulation of ENT1 activity in B-cells at a post-transcriptional level, our results show that STAT1-dependent induction of nitric oxide by IFN-gamma is not implicated in the regulation of ENT1 activity in macrophages. Our results indicate that both STAT1-dependent and -independent pathways are involved in the regulation of nucleoside transporters by IFN-gamma in macrophages. PMID:12868960
Berri, Fatma; Haffar, Ghina; Lê, Vuong Ba; Sadewasser, Anne; Paki, Katharina; Lina, Bruno; Wolff, Thorsten
2014-01-01
ABSTRACT During the budding process, influenza A viruses (IAVs) incorporate multiple host cell membrane proteins. However, for most of them, their significance in viral morphogenesis and infectivity remains unknown. We demonstrate here that the expression of annexin V (A5) is upregulated at the cell surface upon IAV infection and that a substantial proportion of the protein is present in lipid rafts, the site of virus budding. Western blotting and immunogold analysis of highly purified IAV particles showed the presence of A5 in the virion. Significantly, gamma interferon (IFN-γ)-induced Stat phosphorylation and IFN-γ-induced 10-kDa protein (IP-10) production in macrophage-derived THP-1 cells was inhibited by purified IAV particles. Disruption of the IFN-γ signaling pathway was A5 dependent since downregulation of its expression or its blockage reversed the inhibition and resulted in decreased viral replication in vitro. The functional significance of these results was also observed in vivo. Thus, IAVs can subvert the IFN-γ antiviral immune response by incorporating A5 into their envelope during the budding process. IMPORTANCE Many enveloped viruses, including influenza A viruses, bud from the plasma membrane of their host cells and incorporate cellular surface proteins into viral particles. However, for the vast majority of these proteins, only the observation of their incorporation has been reported. We demonstrate here that the host protein annexin V is specifically incorporated into influenza virus particles during the budding process. Importantly, we showed that packaged annexin V counteracted the antiviral activity of gamma interferon in vitro and in vivo. Thus, these results showed that annexin V incorporated in the viral envelope of influenza viruses allow viral escape from immune surveillance. Understanding the role of host incorporated protein into virions may reveal how enveloped RNA viruses hijack the host cell machinery for their own purposes. PMID
Induction of ceruloplasmin synthesis by IFN-gamma in human monocytic cells
NASA Technical Reports Server (NTRS)
Mazumder, B.; Mukhopadhyay, C. K.; Prok, A.; Cathcart, M. K.; Fox, P. L.
1997-01-01
Ceruloplasmin is a 132-kDa glycoprotein abundant in human plasma. It has multiple in vitro activities, including copper transport, lipid pro- and antioxidant activity, and oxidation of ferrous ion and aromatic amines; however, its physiologic role is uncertain. Although ceruloplasmin is synthesized primarily by the liver in adult humans, production by cells of monocytic origin has been reported. We here show that IFN-gamma is a potent inducer of ceruloplasmin synthesis by monocytic cells. Activation of human monoblastic leukemia U937 cells with IFN-gamma increased the production of ceruloplasmin by at least 20-fold. The identity of the protein was confirmed by plasmin fingerprinting. IFN-gamma also increased ceruloplasmin mRNA. Induction followed a 2- to 4-h lag and was partially blocked by cycloheximide, indicating a requirement for newly synthesized factors. Ceruloplasmin induction in monocytic cells was agonist specific, as IL-1, IL-4, IL-6, IFN-alpha, IFN-beta, TNF-alpha, and LPS were completely ineffective. The induction was also cell type specific, as IFN-gamma did not induce ceruloplasmin synthesis in endothelial or smooth muscle cells. In contrast, IFN-gamma was stimulatory in other monocytic cells, including THP-1 cells and human peripheral blood monocytes, and also in HepG2 cells. Ceruloplasmin secreted by IFN-gamma-stimulated U937 cells had ferroxidase activity and was, in fact, the only secreted protein with this activity. Monocytic cell-derived ceruloplasmin may contribute to defense responses via its ferroxidase activity, which may drive iron homeostasis in a direction unfavorable to invasive organisms.
Lewis, C E; McCarthy, S P; Lorenzen, J; McGee, J O
1990-01-01
Human mononuclear phagocytes can be activated to perform a variety of complex functions by exposure to the immunomodulators, lipopolysaccharide (LPS), interferon-gamma (IFN-gamma) and tumour necrosis factor alpha (TNF alpha). Although such activation often involves the release of various cytokines by monocytes and macrophages, little is known of the effects of such signals on their secretion of lysozyme (LZM). In this study, a reverse haemolytic plaque assay for LZM secretion is coupled with immunocytochemistry for the pan macrophage (CD68) marker, EBM/11. This enabled the direct effects of LPS, IFN-gamma and TNF alpha on the secretion of LZM by individual, immunoidentified human mononuclear phagocytes to be investigated. The overall secretion of this peptide by populations of freshly isolated or 3-day cultured monocytes was augmented by exposure for 6 hr to bacterial LPS, recombinant human IFN-gamma or recombinant human TNF alpha. Extension of the culture period for monocytes from 3 to 7 days prior to use in the assay resulted in higher levels of LZM secretion, which could be further increased by TNF alpha but not by LPS or IFN-gamma. Individual peritoneal macrophages activated by inflammation in vivo were uniform in their augmented LZM responses to TNF alpha, but a small subpopulation of human peritoneal macrophages, which may represent younger 'inflammatory' exudate macrophages, was seen to be preferentially responsive to the LZM-stimulating effects of LPS and IFN-gamma. These studies suggest that (i) secretion of LZM by human mononuclear phagocytes can be regulated by LPS and IFN-gamma, although the effects of these agents may be dependent upon the state of maturation and/or differentiation of the cells, and (ii) TNF alpha is a potent stimulant of LZM secretion by monocytes and macrophages irrespective of cell maturity. Images Figure 1 Figure 1 PMID:2107146
Pai, Madhukar; Gokhale, Kaustubh; Joshi, Rajnish; Dogra, Sandeep; Kalantri, Shriprakash; Mendiratta, Deepak K; Narang, Pratibha; Daley, Charles L; Granich, Reuben M; Mazurek, Gerald H; Reingold, Arthur L; Riley, Lee W; Colford, John M
2005-06-08
Mycobacterium tuberculosis infection in health care workers has not been adequately studied in developing countries using newer diagnostic tests. To estimate latent tuberculosis infection prevalence in health care workers using the tuberculin skin test (TST) and a whole-blood interferon gamma (IFN-gamma) assay; to determine agreement between the tests; and to compare their correlation with risk factors. A cross-sectional comparison study of 726 health care workers aged 18 to 61 years (median age, 22 years) with no history of active tuberculosis conducted from January to May 2004, at a rural medical school in India. A total of 493 (68%) of the health care workers had direct contact with patients with tuberculosis and 514 (71%) had BCG vaccine scars. Tuberculin skin testing was performed using 1-TU dose of purified protein derivative RT23, and the IFN-gamma assay was performed by measuring IFN-gamma response to early secreted antigenic target 6, culture filtrate protein 10, and a portion of tuberculosis antigen TB7.7. Agreement between TST and the IFN-gamma assay, and comparison of the tests with respect to their association with risk factors. A large proportion of the health care workers were latently infected; 360 (50%) were positive by either TST or IFN-gamma assay, and 226 (31%) were positive by both tests. The prevalence estimates of TST and IFN-gamma assay positivity were comparable (41%; 95% confidence interval [CI], 38%-45% and 40%; 95% CI, 37%-43%, respectively). Agreement between the tests was high (81.4%; kappa = 0.61; 95% CI, 0.56-0.67). Increasing age and years in the health profession were significant risk factors for both IFN-gamma assay and TST positivity. BCG vaccination had little impact on TST and IFN-gamma assay results. Our study showed high latent tuberculosis infection prevalence in Indian health care workers, high agreement between TST and IFN-gamma assay, and similar association between positive test results and risk factors. Although TST and
Murray, Paul D; McGavern, Dorian B; Pease, Larry R; Rodriguez, Moses
2002-03-01
IFN-gamma is an anti-viral and immunomodulatory cytokine critical for resistance to multiple pathogens. Using mice with targeted disruption of the gene for IFN-gamma, we previously demonstrated that this cytokine is critical for resistance to viral persistence and demyelination in the Theiler's virus model of multiple sclerosis. During viral infections, IFN-gamma is produced by natural killer (NK) cells, CD4(+) and CD8(+) T cells; however, the proportions of lymphocyte subsets responding to virus infection influences the contributions to IFN-gamma-mediated protection. To determine the lymphocyte subsets that produce IFN-gamma to maintain resistance, we used adoptive transfer strategies to generate mice with lymphocyte-specific deficiencies in IFN-gamma-production. We demonstrate that IFN-gamma production by both CD4(+) and CD8(+) T cell subsets is critical for resistance to Theiler's murine encephalomyelitis virus (TMEV)-induced demyelination and neurological disease, and that CD4(+) T cells make a greater contribution to IFN-gamma-mediated protection. To determine the cellular targets of IFN-gamma-mediated responses, we used adoptive transfer studies and bone marrow chimerism to generate mice in which either hematopoietic or somatic cells lacked the ability to express IFN-gamma receptor. We demonstrate that IFN-gamma receptor must be present on central nervous system glia, but not bone marrow-derived lymphocytes, in order to maintain resistance to TMEV-induced demyelination.
Wang, Xiao Yang; Crowston, Jonathan G; White, Andrew J R; Zoellner, Hans; Healey, Paul R
2014-08-01
The aim of the study was to investigate, using a native mitomycin-C-resistant human Tenon's fibroblast cell line, the possibility that interferon-alpha and gamma could be used with Fas agonists as an alternative anti-fibrotic strategy to mitomycin-C in trabeculectomy. A clinically resistant and in vitro verified mitomycin-C-resistant human Tenon's fibroblast cell line was pretreated with interferon-alpha and interferon-gamma for 48 h before stimulation with an agonistic Fas antibody (CH11) for 2 days to induce cell death. Cell death assays were undertaken. Changes in apoptosis-related proteins were determined by flow cytometry and Western blot. Pretreatment with interferon-alpha or interferon-gamma for 48 h increased Fas, Fas-associated protein with death domain and caspase-8 expression. Protein expression was further increased by combined exposure to interferon-alpha and gamma. Pretreatment with cytokines had no effect on Fas-L and Bcl-2. Interferon-alpha alone did not change the rate of induced cell death. A combination of interferon-alpha and gamma synergistically increased the sensitivity of mitomycin-C-resistant human Tenon's fibroblast cell line to induced cell death. An antagonistic anti-Fas antibody (ZB4) completely blocked induced cell death. Broad caspase inhibitors specific for caspases-8 and -3 reduced induced deaths in interferon pretreated mitomycin-C-resistant human Tenon's fibroblast cell line in a dose-dependent manner. Interferon-alpha and interferon-gamma render mitomycin-C-resistant human Tenon's fibroblast cell line sensitive to Fas-mediated apoptosis. The mechanism involves increased death-inducing signalling complex formation by upregulation of Fas, Fas-associated protein with death domain and caspase-8 expression. © 2013 Royal Australian and New Zealand College of Ophthalmologists.
Protective Role of Gamma Interferon during the Recall Response to Influenza Virus
Bot, Adrian; Bot, Simona; Bona, Constantin A.
1998-01-01
During secondary immune responses to influenza virus, virus-specific T memory cells are a major source of gamma interferon (IFN-γ). We assessed the contribution of IFN-γ to heterologous protection against the A/WSN/33 (H1N1) virus of wild-type and IFN-γ−/− mice previously immunized with the A/HK/68 (H3N2) virus. The IFN-γ−/− mice displayed significantly reduced survival rates subsequent to a challenge with various doses of the A/WSN/33 virus. This was associated with an impaired ability of the IFN-γ−/− mice to completely clear the pulmonary virus by day 7 after the challenge, although significant reduction of the virus titers was noted. However, the IFN-γ−/− mice developed type A influenza virus cross-reactive cytotoxic T lymphocytes (CTLs) similar to the wild-type mice, as demonstrated by both cytotoxicity and a limiting-dilution assay for the estimation of CTL precursor frequency. The pulmonary recruitment of T cells in IFN-γ−/− mice was not dramatically affected, and the percentage of CD4+ and CD8+ T cells was similar to that of wild-type mice. The T cells from IFN-γ−/− mice did not display a significant switch toward a Th2 profile. Furthermore, the IFN-γ−/− mice retained the ability to mount significant titers of WSN and HK virus-specific hemagglutination-inhibiting antibodies. Together, these results are consistent with a protective role of IFN-γ during the heterologous response against influenza virus independently of the generation and local recruitment of cross-reactive CTLs. PMID:9658110
Evaluation of Gamma Interferon and Antibody Tuberculosis Tests in Alpacas
Holder, Tom; Clifford, Derek; Dexter, Ian; Brewer, Jacky; Smith, Noel; Waring, Laura; Crawshaw, Tim; Gillgan, Steve; Lyashchenko, Konstantin; Lawrence, John; Clarke, John; de la Rua-Domenech, Ricardo; Vordermeier, Martin
2012-01-01
We describe the performance of cell-based and antibody blood tests for the antemortem diagnosis of tuberculosis (TB) in South American camelids (SAC). The sensitivity and specificity of the gamma interferon (IFN-γ) release assay, two lateral flow rapid antibody tests (Stat-Pak and Dual Path Platform [DPP]), and two enzyme-linked immunosorbent assay (ELISA)-based antibody tests (Idexx and Enferplex) were determined using diseased alpacas from Mycobacterium bovis culture-confirmed breakdown herds and TB-free alpacas from geographical areas with no history of bovine TB, respectively. Our results show that while the sensitivities of the IFN-γ and antibody tests were similar (range of 57.7% to 66.7%), the specificity of the IFN-γ test (89.1%) was lower than those of any of the antibody tests (range of 96.4% to 97.4%). This lower specificity of the IFN-γ test was at least in part due to undisclosed Mycobacterium microti infection in the TB-free cohort, which stimulates a positive purified protein derivative (PPD) response. The sensitivity of infection detection could be increased by combining two antibody tests, but even the use of all four antibody tests failed to detect all diseased alpacas. These antibody-negative alpacas were IFN-γ positive. We found that the maximum sensitivity could be achieved only by the combination of the IFN-γ test with two antibody tests in a “test package,” although this resulted in decreased specificity. The data from this evaluation of tests with defined sensitivity and specificity provide potential options for antemortem screening of SAC for TB in herd breakdown situations and could also find application in movement testing and tracing investigations. PMID:22914362
Evaluation of gamma interferon and antibody tuberculosis tests in alpacas.
Rhodes, Shelley; Holder, Tom; Clifford, Derek; Dexter, Ian; Brewer, Jacky; Smith, Noel; Waring, Laura; Crawshaw, Tim; Gillgan, Steve; Lyashchenko, Konstantin; Lawrence, John; Clarke, John; de la Rua-Domenech, Ricardo; Vordermeier, Martin
2012-10-01
We describe the performance of cell-based and antibody blood tests for the antemortem diagnosis of tuberculosis (TB) in South American camelids (SAC). The sensitivity and specificity of the gamma interferon (IFN-γ) release assay, two lateral flow rapid antibody tests (Stat-Pak and Dual Path Platform [DPP]), and two enzyme-linked immunosorbent assay (ELISA)-based antibody tests (Idexx and Enferplex) were determined using diseased alpacas from Mycobacterium bovis culture-confirmed breakdown herds and TB-free alpacas from geographical areas with no history of bovine TB, respectively. Our results show that while the sensitivities of the IFN-γ and antibody tests were similar (range of 57.7% to 66.7%), the specificity of the IFN-γ test (89.1%) was lower than those of any of the antibody tests (range of 96.4% to 97.4%). This lower specificity of the IFN-γ test was at least in part due to undisclosed Mycobacterium microti infection in the TB-free cohort, which stimulates a positive purified protein derivative (PPD) response. The sensitivity of infection detection could be increased by combining two antibody tests, but even the use of all four antibody tests failed to detect all diseased alpacas. These antibody-negative alpacas were IFN-γ positive. We found that the maximum sensitivity could be achieved only by the combination of the IFN-γ test with two antibody tests in a "test package," although this resulted in decreased specificity. The data from this evaluation of tests with defined sensitivity and specificity provide potential options for antemortem screening of SAC for TB in herd breakdown situations and could also find application in movement testing and tracing investigations.
Interferon-gamma response to the treatment of active pulmonary and extra-pulmonary tuberculosis.
Liang, L; Shi, R; Liu, X; Yuan, X; Zheng, S; Zhang, G; Wang, W; Wang, J; England, K; Via, L E; Cai, Y; Goldfeder, L C; Dodd, L E; Barry, C E; Chen, R Y
2017-10-01
Interferon-gamma (IFN-γ) release assays (IGRAs) are used to diagnose tuberculosis (TB) but not to measure treatment response. To measure IFN-γ response to active anti-tuberculosis treatment. Patients from the Henan Provincial Chest Hospital, Henan, China, with TB symptoms and/or signs were enrolled into this prospective, observational cohort study and followed for 6 months of treatment, with blood and sputum samples collected at 0, 2, 4, 6, 8, 16 and 24 weeks. The QuantiFERON® TB-Gold assay was run on collected blood samples. Participants received a follow-up telephone call at 24 months to determine relapse status. Of the 152 TB patients enrolled, 135 were eligible for this analysis: 118 pulmonary (PTB) and 17 extra-pulmonary TB (EPTB) patients. IFN-γ levels declined significantly over time among all patients (P = 0.002), with this decline driven by PTB patients (P = 0.001), largely during the initial 8 weeks of treatment (P = 0.019). IFN-γ levels did not change among EPTB patients over time or against baseline culture or drug resistance status. After 6 months of effective anti-tuberculosis treatment, IFN-γ levels decreased significantly in PTB patients, largely over the initial 8 weeks of treatment. IFN-γ concentrations may offer some value for monitoring anti-tuberculosis treatment response among PTB patients.
Interferon lambda (IFN-λ) efficiently blocks norovirus transmission in a mouse model.
Rocha-Pereira, Joana; Jacobs, Sophie; Noppen, Sam; Verbeken, Eric; Michiels, Thomas; Neyts, Johan
2018-01-01
Human noroviruses are highly efficient in person to person transmission thus associated with explosive outbreaks of acute gastroenteritis. Outbreak control is limited to disinfection and isolation measures. Strategies to control the spread of noroviruses should be developed and models to study norovirus transmission will greatly facilitate this. Here, a mouse-to-mouse transmission model, in which mice develop acute murine norovirus (MNV)-induced diarrhea, was used to explore the role of interferon lambda (IFN-λ) in the control of a norovirus infection. Sentinel AG129 mice [deficient in IFN-α/β and IFN-γ receptors] that were co-housed with MNV-infected mice shedding high amounts of virus in their stool, developed a MNV-infection with associated diarrhea. Inoculation of such sentinel mice with an IFN-λ expression plasmid resulted in the production of circulating IFN-λ and upregulation of the expression of IFN-stimulated genes (ISGs) of the gut. Injection of the IFN-λ-expressing plasmid to sentinels prevents MNV-induced disease upon exposure to MNV-infected mice, as well as MNV replication in the small intestine, the associated signs of inflammation and the mounting of a specific IgG-based immune response. This demonstrates that IFN-λ can alone mediate protection against transmission of norovirus. The development of a simple delivery method for IFN-λ could be explored as a strategy to control norovirus outbreaks and protect vulnerable populations such as the elderly and immunocompromised. Copyright © 2017. Published by Elsevier B.V.
Solis, B; Nova, E; Gómez, S; Samartín, S; Mouane, N; Lemtouni, A; Belaoui, H; Marcos, A
2002-12-01
For several years cytokine production has been associated with infections but it was not suspected that some types of food could also induce cytokines, even in a state of non-infection. Lactic bacteria can induce interferon (IFN) production in human healthy subjects, thus, a better protection against infections would be expected. Therefore, we planned to evaluate the effect of two diets including yoghurt or milk on IFN-gamma production during nutritional recovery in two different situations of malnutrition: (1) children with diarrhoea; and (2) patients with anorexia nervosa (AN). Both the diet including yoghurt of that including milk seemed to increase IFN-gamma production at the end of nutritional recovery in the malnourished children with diarrhoea. The significance of interferon production and the lymphocyte subset increase should be explored to know if a better resistance against pathogens is related to them. Regulation of intestinal absorption and moderate stimulation of interferon production make the yoghurt-based diet a good choice in the nutritional care of children. In the same way, an increase in the IFN-gamma production was observed in AN patients consuming yoghurt. This increase of IFN-gamma production could be considered a biological marker to detect the effect of probiotics on the immune response, especially in the improvement of a deficient nutritional status.
Ballez, J S; Mols, J; Burteau, C; Agathos, S N; Schneider, Y J
2004-03-01
We have recently developed a protein-free medium (PFS) able to support the growth of Chinese hamster ovary (CHO) cells in suspension. Upon further supplementation with some plant protein hydrolysates, medium performances reached what could be observed in serum-containing media [Burteau et al. In Vitro Cell. Dev. Biol.-Anim. 39 (2003) 291]. Now, we describe the use of rice and wheat protein hydrolysates, as non-nutritional additives to the culture medium to support productivity and cell growth in suspension or in microcarriers. When CHO-320 cells secreting recombinant interferon-gamma (IFN-gamma) were cultivated in suspension in a bioreactor with our PFS supplemented with wheat hydrolysates, the maximum cell density increased by 25% and the IFN-gamma secretion by 60% compared to the control PFS. A small-scale perfusion system consisting of CHO-320 cells growing on and inside fibrous microcarriers under discontinuous operation was first developed. Under these conditions, rice protein hydrolysates stimulated recombinant IFN-gamma secretion by 30% compared to the control PFS. At the bioreactorscale, similar results were obtained but when compared to shake-flasks studies, nutrients, oxygen or toxic by-products gradients inside the microcarriers seemed to be the main limitation of the system. An increase of the perfusion rate to maintain glucose concentration over 5.5 mM and dissolved oxygen (DO) at 60% was able to stimulate the production of IFN-gamma to a level of 6.6 mug h(-1) g(-1) of microcarriers after 160 h when a cellular density of about 4 x 10(8) cell g(-1) of carriers was reached.
Hao, Junli; Jin, Wensong; Li, Xinghui; Wang, Saifeng; Zhang, Xiaojun; Fan, Hongxia; Li, Changfei; Chen, Lizhao; Gao, Bin; Liu, Guangze; Meng, Songdong
2013-01-01
Alpha interferon (IFN-α)-based therapy can effectively treat chronic hepatitis B virus (HBV) infection, which causes life-threatening complications. Responses to IFN-α therapy vary greatly in chronic hepatitis B (CHB) patients, but underlying mechanisms are almost unknown. In this study, we found that IFN-α treatment induced a marked decrease of microRNA-122 (miR-122) expression in hepatocytes. We next showed that IFN-α-induced miR-122 downregulation was only partly due to transcriptional suppression. One IFN-stimulated gene (ISG), NT5C3, which was identified as a miR-122 target, efficiently inhibited miR-122 by binding and sequestering miR-122 with its mRNA 3'-untranslated region (3'-UTR), indicating that this ISG is involved in IFN-α-mediated miR-122 suppression. Notably, the inhibitory effect of IFN-α on miR-122 was completely abolished by blocking IFN-α-induced upregulation of NT5C3 mRNA expression by RNA interference (RNAi). Meanwhile, we observed that miR-122 dramatically inhibited HBV expression and replication. Finally, we showed that IFN-α-mediated HBV-inhibitory effects could be enhanced significantly by blocking IFN-α-induced downregulation of miR-122. We therefore concluded that IFN-α-induced inhibition of miR-122 may negatively affect the anti-HBV function of IFN-α. These data provide valuable insights for a better understanding of the antiviral mechanism of IFN-α and raise further potential interest in enhancing its anti-HBV efficacy.
Hao, Junli; Jin, Wensong; Li, Xinghui; Wang, Saifeng; Zhang, Xiaojun; Fan, Hongxia; Li, Changfei; Chen, Lizhao; Gao, Bin
2013-01-01
Alpha interferon (IFN-α)-based therapy can effectively treat chronic hepatitis B virus (HBV) infection, which causes life-threatening complications. Responses to IFN-α therapy vary greatly in chronic hepatitis B (CHB) patients, but underlying mechanisms are almost unknown. In this study, we found that IFN-α treatment induced a marked decrease of microRNA-122 (miR-122) expression in hepatocytes. We next showed that IFN-α-induced miR-122 downregulation was only partly due to transcriptional suppression. One IFN-stimulated gene (ISG), NT5C3, which was identified as a miR-122 target, efficiently inhibited miR-122 by binding and sequestering miR-122 with its mRNA 3′-untranslated region (3′-UTR), indicating that this ISG is involved in IFN-α-mediated miR-122 suppression. Notably, the inhibitory effect of IFN-α on miR-122 was completely abolished by blocking IFN-α-induced upregulation of NT5C3 mRNA expression by RNA interference (RNAi). Meanwhile, we observed that miR-122 dramatically inhibited HBV expression and replication. Finally, we showed that IFN-α-mediated HBV-inhibitory effects could be enhanced significantly by blocking IFN-α-induced downregulation of miR-122. We therefore concluded that IFN-α-induced inhibition of miR-122 may negatively affect the anti-HBV function of IFN-α. These data provide valuable insights for a better understanding of the antiviral mechanism of IFN-α and raise further potential interest in enhancing its anti-HBV efficacy. PMID:23055569
Peng, X M; Lei, R X; Gu, L; Ma, H H; Xie, Q F; Gao, Z L
2007-10-01
The influence of human genetics on the natural history of hepatitis B virus (HBV) infection may be diminished in endemic areas because infection at a young age predisposes to chronic HBV infection. The present study aimed to address this issue through the determination of the influences of single nucleotide polymorphisms (SNPs) of myxovirus resistence-1 (MxA) -88 G/T and interferon (IFN)-gamma +874 A/T on the natural history of HBV infection in endemic regions. One hundred adult patients with self-limiting HBV infection (positive for both anti-HBs and anti-HBc) and 340 adult patients with persistent HBV infection were recruited from southern China, an endemic area with an HBsAg carrier rate of 17.8%. SNPs of MxA -88 G/T and interferon (IFN)-gamma +874 A/T were typed using a protocol based on competitively differentiated polymerase chain reaction. A highly significant difference in the distribution of MxA -88 G/T was observed between those with persistent and self-limiting HBV infections. The latter displayed a lower frequency of the GG genotype (41.0% vs. 52.9%, P = 0.036) and a higher frequency of the TT genotype (16.0% vs. 2.4%, P = 0.000), compared to patients with persistent infection. These differences were not gender- or age-specific. However, a significant distribution difference of IFN-gamma +874 A/T was not observed. Between two groups of patients, respectively, the distribution frequencies of the AA genotype (65.0% vs. 72.8%, P = 0.139) and the TT genotype (2.0% vs. 1.2%, P = 0.894) were found. These results suggest that MxA gene -88 G/T and IFN-gamma +874 A/T behave differently in endemic HBV infections. Further study is necessary to clarify the influences of human genetics on endemic HBV infections.
Critical role of IFN-gamma in CFA-mediated protection of NOD mice from diabetes development.
Mori, Yoshiko; Kodaka, Tetsuro; Kato, Takako; Kanagawa, Edith M; Kanagawa, Osami
2009-11-01
IFN-gamma signaling-deficient non-obese diabetic (NOD) mice develop diabetes with similar kinetics to those of wild-type NOD mice. However, the immunization of IFN-gamma signaling-deficient NOD mice with CFA failed to induce long-term protection, whereas wild-type NOD mice receiving CFA remained diabetes-free. CFA also failed to protect IFN-gamma receptor-deficient (IFN-gammaR(-/-)) NOD mice from the autoimmune rejection of transplanted islets, as it does in diabetic NOD mice, and from disease transfer by spleen cells from diabetic NOD mice. These data clearly show that the pro-inflammatory cytokine IFN-gamma is necessary for the CFA-mediated protection of NOD mice from diabetes. There is no difference in the T(h)1/T(h)17 balance between IFN-gammaR(-/-) NOD and wild-type NOD mice. There is also no difference in the total numbers and percentages of regulatory T (Treg) cells in the lymph node CD4(+) T-cell populations between IFN-gammaR(-/-) NOD and wild-type NOD mice. However, pathogenic T cells lacking IFN-gammaR are resistant to the suppressive effect of Treg cells, both in vivo and in vitro. Therefore, it is likely that CFA-mediated protection against diabetes development depends on a change in the balance between Treg cells and pathogenic T cells, and IFN-gamma signaling seems to control the susceptibility of pathogenic T cells to the inhibitory activity of Treg cells.
Watanuki, Hironobu; Chakraborty, Gunimala; Korenaga, Hiroki; Kono, Tomoya; Shivappa, R B; Sakai, Masahiro
2009-10-15
Human interferon-alpha (huIFN-alpha) is an important immunomodulatory substance used in the treatment and prevention of numerous infectious and immune-related diseases in animals. However, the immunostimulatory effects of huIFN-alpha in fish remain to be investigated. In the current study, the immune responses of the carp species Cyprinus carpio L. to treatment with huIFN-alpha were analyzed via measurement of superoxide anion production, phagocytic activity and the expression of cytokine genes including interleukin-1beta, tumor necrosis factor-alpha and interleukin 10. Low doses of huIFN-alpha were administered orally once a day for 3 days, and sampling was carried out at 1, 3 and 5 days post-treatment. Our results indicate that a low dose of huIFN-alpha significantly increased phagocytic activity and superoxide anion production in the carp kidney. The huIFN-alpha-treated fish also displayed a significant upregulation in cytokine gene expression. The current study demonstrates the stimulatory effects of huIFN-alpha on the carp immune system and highlights the immunomodulatory role of huIFN-alpha in fish.
Bacterial DNA-induced NK cell IFN-gamma production is dependent on macrophage secretion of IL-12.
Chace, J H; Hooker, N A; Mildenstein, K L; Krieg, A M; Cowdery, J S
1997-08-01
Bacterial DNA (bDNA) activates B cells and macrophages and can augment inflammatory responses by inducing release of proinflammatory cytokines. We found that bDNA stimulation of mouse spleen cells induced NK cell IFN-gamma production that was dependent upon the presence of unmethylated CpG motifs, and oligonucleotides with internal CpG motifs could also induce splenocytes to secrete IFN-gamma. The bDNA-induced IFN-gamma response was strictly macrophages dependent. While splenocytes from SCID mice secreted IFN-gamma in response to bDNA, depletion of macrophages eliminated this response. Additionally, purified NK cells did not respond to bDNA; however, addition of macrophages restored the NK cell IFN-gamma response. Coculture of NK cells with preactivated macrophages further increased bDNA-induced NK cell IFN-gamma production. Anti-IL-12 or IL-10 inhibited bDNA-induced IFN-gamma response. Treatment of purified macrophages with bDNA resulted in IL-12 secretion accompanied by an increase in IL-12 p40 mRNA level. Although isolated NK cells did not make IFN-gamma in response to bDNA, NK cells costimulated with IL-12 gained the ability to respond to bDNA. These experiments show that bDNA induces macrophage IL-12 production which, in turn, stimulates NK cell IFN-gamma production. Macrophage-derived IL-12 renders NK cells responsive to bDNA permitting an even greater IFN-gamma response to bDNA.
Yuk, Seong-Su; Lee, Dong-Hun; Park, Jae-Keun; Tseren-Ochir, Erdene-Ochir; Kwon, Jung-Hoon; Noh, Jin-Yong; Lee, Joong-Bok; Park, Seung-Yong; Choi, In-Soo; Song, Chang-Seon
2016-04-27
Interferon gamma (IFN-γ), an immunoregulatory cytokine, is known to control many microbial infections. In a previous study, chicken interferon gamma (chIFN-γ) was found to be up-regulated following avian influenza virus (AIV) infection in specific pathogen-free chickens. We aimed to investigate whether the pre-immune state induced by chIFN-γ could generate an antiviral response against influenza virus. We generated a chIFN-γ-expressing plasmid and transfected it into chicken embryo fibroblasts (CEFs) and then infected the cells with human origin H1N1 or avian origin H9N2 influenza viruses. Viral titers of culture medium were evaluated in MDCK cell and the viral RNA and IFN-stimulated genes (ISGs) were then quantified by real-time reverse transcriptase polymerase. To further evaluate the role of the antiviral effect of chIFN-γ by using a backward approach, synthetic small interfering RNAs (siRNA) targeting chIFN-γ were used to suppress chIFN-γ. The chIFN-γ-stimulated CEFs inhibited the replication of viral RNA (vRNA) and showed a mild decrease in the infectious virus load released in the culture medium. Compared to the mock-transfected control, the messenger RNA (mRNA) levels of type I IFNs and IFN-stimulated genes were up-regulated in the cells expressing chIFN-γ. After treatment with the siRNA, we detected a higher expression of viral genes than that observed in the mock-transfected control. Our results suggest that apart from the important role played by chIFN-γ in the antiviral state generated against influenza virus infection, the pre-immune state induced by chIFN-γ can be helpful in mitigating the propagation of influenza virus.
The effect of centaurein on interferon-{gamma} expression and Listeria infection in mice
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chang, S.-L.; Department of Biological Science and Technology, National Chiao Tung University, 1001, Ta Hsueh Road, Hsinchu 300, Taiwan; Yeh, H.-H.
2007-02-15
We previously found that centaurein enhanced IFN-{gamma} transcription in T cells. Here, we demonstrate that centaurein increased the IFN-{gamma} expression in T and NK cells and the serum IFN-{gamma} level in mice. Centaurein elevated the transcription of T-bet but not GATA-3, which is consistent with its effect on that of IFN-{gamma} but not IL-4. Additionally, centaurein effectively protected mice against Listeria infection. Moreover, centaurein per se or in combination with antibiotics could treat Listeria infection. Our mechanistic studies suggest that centaurein augments IFN-{gamma} expression via a transcriptional up-regulation of T-bet and that centaurein protects against or treats Listeria infection viamore » a modulation of IFN-{gamma} expression.« less
Tanabe, Y; Dan, K; Kuriya, S; Nomura, T
1989-10-01
The effects of recombinant human interferon (IFN) alpha-2b and gamma on the bone marrow megakaryocyte progenitors (CFU-Meg) were compared between eight patients in the chronic phase of Ph1-positive chronic myelocytic leukemia (CML) and five hematologically normal patients. CFU-Meg was assayed in plasma clot culture added with phytohemagglutinin-stimulated leukocyte-conditioned medium as a source of colony stimulating activity. The average count of CFU-Meg colonies formed from the bone marrow of CML patients was 5.5 times that of normal controls. Spontaneous CFU-Meg colonies were grown in seven of eight CML patients, but in none of five controls. Colony formation by CFU-Meg in CML as well as normal bone marrow was suppressed by the two preparations of IFN in a dose dependent fashion. Their suppressive influence on colonies from CFU-Meg was comparable between CML and normal bone marrow at lower concentrations, but was less marked for CML than normal bone marrow at higher concentrations. The formation of CFU-Meg colonies from CML bone marrow was more severely suppressed by IFN-gamma than IFN-alpha-2b. Depletion of either T lymphocytes or adherent cells from the CML bone marrow cells diminished the suppressive effects of IFN-gamma, but had no influence on the effects of IFN-alpha-2b.
NASA Astrophysics Data System (ADS)
Daulay, R. S.; Daulay, R. M.
2018-03-01
Cellular immunity was mediated the host immune response against Mycobacterium tuberculosis, in which cytokine and T-helper (Th) 1 cells play an important role. Interferon-gamma (IFN-γ) is a leading cytokine involved in the immune response of tuberculosis (TB).The primary function of IFN-γ is to activate macrophages in opposition Mycobacterium tuberculosis. Contrast from IFN-γ, interleukin-10 (IL-10) is considered inhibitory cytokine, important to an adequate balance between inflammatory responses. To analyze cytokine profile, particularly IFN-γ and IL-10 of the children with TB in Indonesia, a cross-sectional study was conducted at two general hospitals and seven primary health care located in Medan and Batubara, North Sumatera, Indonesia. Among 51 children with TB disease and 51 healthy children, found that IFN-γ and IL-10 levels were lower in TB patients compared to healthy children. Statistically significant decreased production of the IFN-γ levels (p=0.042) were found in TB patients 9.41 (1.10-28.06) pg/ml contrast to healthy children 6.30 (1.30-89.76) pg/ml. Homologue finding of the IL-10 levels were also found in TB patients 4.93 (0.22-48.01) pg/ml and 4.93 (0.07-81.60) pg/ml in healthy children, but not statistically significant (p=0.784). High levels of IL-10 were not proven to suppress the levels production of IFN-γ in TB patients.
Household food insecurity is associated with low interferon-gamma levels in pregnant Indian women.
Vaidya, A; Bhosale, R; Sambarey, P; Suryavanshi, N; Young, S; Mave, V; Kanade, S; Kulkarni, V; Deshpande, P; Balasubramanian, U; Elf, J; Gupte, N; Gupta, A; Mathad, J S
2017-07-01
Over 20% of tuberculosis (TB) cases during pregnancy occur in India. To determine the association between household food insecurity and interferon-gamma (IFN-γ) levels in pregnancy. Pregnant women in India were administered the Household Food Insecurity Access Scale (HFIAS) questionnaire and underwent an IFN-γ release assay. Logistic regression was used to identify factors associated with food insecurity. Of 538 women, 60 (11%) had household food insecurity, 47 (78%) of which were moderate or severe food insecure. After mitogen stimulation, moderate or severe food insecure women had a median IFN-γ concentration of 4.2 IU/ml (IQR 2.2-9.8) vs. 8.4 IU/ml (IQR 3.0-10) in women with no or mild food insecurity (P = 0.03). In multivariate analysis, higher IFN-γ concentrations were associated with human immunodeficiency virus infection (OR 1.3, 95%CI 0.51-2.1, P = 0.001), and inversely associated with moderate or severe food insecurity (OR -1.6, 95%CI -2.9 to -0.27, P = 0.02) and the number of adults in the household (OR -0.08, 95%CI -0.16 to -0.01, P = 0.03). There was no association between food insecurity and IFN-γ response to Mycobacterium tuberculosis antigen. Food insecurity in pregnancy is associated with low IFN-γ levels. There was no association between food insecurity and IFN-γ response to M. tuberculosis antigen, but our study was underpowered to detect this outcome.
Tuo, Wenbin; Fetterer, Raymond; Jenkins, Mark; Dubey, J. P.
2005-01-01
Gamma interferon (IFN-γ) response is essential to the development of a host protective immunity in response to infections by intracellular parasites. Neosporosis, an infection caused by the intracellular protozoan parasite Neospora caninum, is fatal when there is a complete lack of IFN-γ in the infected host. However, the mechanism by which IFN-γ is elicited by the invading parasite is unclear. This study has identified a microbial protein in the N. caninum tachyzoite N. caninum cyclophilin (NcCyP) as a major component of the parasite responsible for the induction of IFN-γ production by bovine peripheral blood mononuclear cells (PBMC) and antigen-specific CD4+ T cells. NcCyP has high sequence homology (86%) with Toxoplasma gondii 18-kDa CyP with a calculated molecular mass of 19.4 kDa. NcCyP is a secretory protein with a predicted signal peptide of 17 amino acids. Abundant NcCyP was detected in whole-cell N. caninum tachyzoite lysate antigen (NcAg) and N. caninum tachyzoite culture supernatant. In N. caninum tachyzoite culture supernatant, three NcCyP bands of 19, 22, and 24 kDa were identified. NcAg stimulated high levels of IFN-γ production by PBMC and CD4+ T cells. The IFN-γ-inducing effect of NcAg was blocked by cyclosporine, a specific ligand for CyP, in a dose-dependent manner. Furthermore, cyclosporine abolished IFN-γ production by PBMC from naïve cows as well as PBMC and CD4+ T cells from infected/immunized cows. These results indicate that the N. caninum tachyzoite naturally produces a potent IFN-γ-inducing protein, NcCyP, which may be important for parasite survival as well as host protection. PMID:16041025
Effect of interferon-gamma on complement gene expression in different cell types.
Lappin, D F; Guc, D; Hill, A; McShane, T; Whaley, K
1992-01-15
We have studied the expression of the complement components C2, C3, factor B, C1 inhibitor (C1-inh), C4-binding protein (C4-bp) and factor H in human peripheral blood monocytes, skin fibroblasts, umbilical vein endothelial cells (HUVEC) and the human hepatoma cell line G2 (Hep G2) in the absence and the presence of interferon-gamma (IFN-gamma). E.l.i.s.a. performed on culture fluids, run-on transcription assays, Northern blot and double-dilution dot-blot techniques confirmed that monocytes expressed all six components, whereas fibroblasts, HUVEC and HepG2 each expressed five of the six components. Fibroblasts and HUVEC did not synthesize C4-bp, and Hep G2 did not produce factor H. In addition to these differences, the synthesis rates of C3, C1-inh and factor H were not the same in all cell types. However, the synthesis rates of C2 and factor B were similar in all four cell types. The half-lives of the mRNAs were shorter in monocytes than in other cell types. Monocyte factor H mRNA had a half-life of 12 min in monocytes, compared with over 3 h in fibroblasts and HUVEC. The instability of factor H mRNA in monocytes may contribute to their low factor H secretion rate. IFN-gamma produced dose-dependent stimulation of C2, factor B, C1-inh, C4-bp and factor H synthesis by all cell types expressing these proteins, but decreased C3 synthesis in all four cell types. Cell-specific differences in the response to IFN-gamma were observed. The increased rates of transcription of the C1-inh and factor H genes in HUVEC were greater than in other cell types, while the increased rate of transcription of the C2, factor B and C1-inh genes in Hep G2 cells was less than in other cell types. IFN-gamma did not affect the stability of C3, factor H or C4 bp mRNAs, but increased the stability of factor B and C1-inh mRNAs and decreased the stability of C2 mRNA. Although these changes occurred in all four cell types studied, the half-life of C1-inh mRNA in monocytes was increased almost 4-fold
Pan, L Y; Mendel, D B; Zurlo, J; Guyre, P M
1990-07-01
The high affinity IgG FcR Fc gamma RI, CD64, plays important roles in the immune response. Fc gamma RI is predominantly expressed on monocytes and macrophages, and barely detectable on neutrophils. rIFN-gamma markedly increases the expression of Fc gamma RI on neutrophils, monocytes, macrophages and myeloid cell lines such as U-937, HL-60, and THP-1. Glucocorticoids inhibit the augmentation of Fc gamma RI expression by rIFN-gamma on neutrophils and myeloid cell lines, but enhance the augmentation of Fc gamma RI expression by rIFN-gamma on monocytes. In this study, we examined the effect of rIFN-gamma and dexamethasone (Dex) on the steady state level of Fc gamma RI mRNA in U-937 cells, neutrophils, and monocytes by hybridizing total RNA with the Fc gamma RI cDNA probe, p135. We found that the amount of Fc gamma RI mRNA increased within 1 h of treatment with rIFN-gamma in all three cell types. This initial induction of Fc gamma RI mRNA by rIFN-gamma was completely blocked by an inhibitor of RNA synthesis, actinomycin D, suggesting that the rIFN-gamma-mediated induction of Fc gamma RI mRNA is dependent on gene transcription. Dex, used in combination with rIFN-gamma, partially blocked the induction of Fc gamma RI mRNA by rIFN-gamma in U-937 cells and neutrophils, but caused a synergistic increase in Fc gamma RI mRNA levels in monocytes. The inhibitory effect of Dex on the steady state level of Fc gamma RI mRNA in U-937 cells was blocked by an inhibitor of protein synthesis, cycloheximide, suggesting that Dex-induced proteins were involved in the regulation of Fc gamma RI expression. This study indicates that the regulation of Fc gamma RI expression on U-937 cells, neutrophils, and monocytes by rIFN-gamma and Dex occurs, at least in part, at the mRNA level. rIFN-gamma increases the steady state level of Fc gamma RI mRNA through a common pathway among U-937 cells, neutrophils, and monocytes, whereas the effect of Dex on rIFN-gamma-induced Fc gamma RI mRNA is cell
NASA Astrophysics Data System (ADS)
Priwahyuningtyas, N. B.; Sinaga, B. Y. M.; Pandia, P.; Eyanoer, P. C.
2018-03-01
Tuberculosis is an infectious disease which caused by Mycobacterium tuberculosis (M. tuberculosis) that infected numerous organ especially the lung. A person’s immunity is very affecting for a person exposed to pulmonary tuberculosis. T-helper-1 cell (Th1) is very influential in the immune system especially in interfering intracellular bacterial infection. One of the cytokines known produced by Th1 cell is interferon gamma (IFN-γ) which is in eliminating M. tuberculosis. The study aims to identify the association between level of IFN-γ and AFB positivity in pulmonary tuberculosis patients in Medan. It is a case-control study. The subjects of the study were 60 new cases of pulmonary tuberculosis with AFB sputum smear- positive that never received ATT consisting 20 cases AFB (+1), 20 cases AFB (+2) and 20 cases AFB (+3).Samples were plasma collected from the venous blood of pulmonary tuberculosis patients. The plasma then underwent laboratory assay with ELISA techniques. Independent t-test was p<0.05 considered significant. Level of IFN-γ in TB AFB (+1) is higher than TB AFB (+2) and (+3), with thesignificant statistical result (p=0.001).
Browne, Sarah K; Roesser, James R; Zhu, Sheng Zu; Ginder, Gordon D
2006-12-15
IFNs regulate most MHC class I genes by stimulating transcription initiation. As shown previously, IFN-gamma controls HLA-A expression primarily at the posttranscriptional level. We have defined two 8-base sequences in a 39-nucleotide region in the 3'-transcribed region of the HLA-A gene that are required for the posttranscriptional response to IFN-gamma. Stimulation of HLA-A expression by IFN-gamma requires nuclear export of HLA-A mRNA by chromosome maintenance region 1 (CRM-1). Treatment of cells with leptomycin B, a specific inhibitor of CRM-1, completely inhibited IFN-gamma induction of HLA-A. Expression of a truncated, dominant-negative form of the nucleoporin NUP214/CAN, DeltaCAN, that specifically interacts with CRM-1, also prevented IFN-gamma stimulation of HLA-A, providing confirmation of the role of CRM-1. Increased expression of HLA-A induced by IFN-gamma also requires protein methylation, as shown by the fact that treatment of SK-N-MC cells or HeLa cells with the PRMT1 inhibitor 5'-methyl-5'-thioadenosine abolished the cellular response to IFN-gamma. In contrast with HLA-A, IFN-gamma-induced expression of the HLA class Ib gene, HLA-E, was not affected by either 5'-methyl-5'-thioadenosine or leptomycin B. These results provide proof of principle that it is possible to differentially modulate the IFN-gamma-induced expression of the HLA-E and HLA-A genes, whose products often mediate opposing effects on cellular immunity to tumor cells, pathogens, and autoantigens.
Schijns, V E; Haagmans, B L; Rijke, E O; Huang, S; Aguet, M; Horzinek, M C
1994-09-01
The lymphokine IFN-gamma is a pleiotropic immunomodulator and possesses intrinsic antiviral activity. We studied its significance in the development of antiviral immune responses by using IFN-gamma receptor-deficient (IFN-gamma R-/-) mice. After inoculation with live attenuated pseudorabies virus (PRV), the mutant mice showed no infectivity titers in various tissues, and transient viral Ag expression only in the spleen, similar as in wild-type mice. However, the absence of the IFN-gamma R resulted in increased proliferative splenocyte responses. The PRV-immune animals showed a normal IFN-gamma and IL-2 production, without detectable IL-4, and with decreased IL-10 secretion in response to viral Ag or Con A. Immunohistochemically, an increased ratio of IFN-gamma:IL-4-producing spleen cells was found. After immunization with either live attenuated or inactivated PRV, IFN-gamma R-/- mice produced significantly less antiviral Ab, and more succumbed to challenge infection than the intact control animals. The reduction in Ab titers in the mutant mice correlated with lower protection by their sera in transfer experiments. Our data demonstrate that ablation of the IFN-gamma receptor surprisingly does not inhibit the generation of antiviral Th1-type and increase Th2-type cytokine responses. However, it profoundly impairs the generation of protective antiviral Ab.
T-Cell Mineralocorticoid Receptor Controls Blood Pressure by Regulating Interferon-Gamma.
Sun, Xue-Nan; Li, Chao; Liu, Yuan; Du, Lin-Juan; Zeng, Meng-Ru; Zheng, Xiao-Jun; Zhang, Wu-Chang; Liu, Yan; Zhu, Mingjiang; Kong, Deping; Zhou, Li; Lu, Limin; Shen, Zhu-Xia; Yi, Yi; Du, Lili; Qin, Mu; Liu, Xu; Hua, Zichun; Sun, Shuyang; Yin, Huiyong; Zhou, Bin; Yu, Ying; Zhang, Zhiyuan; Duan, Sheng-Zhong
2017-05-12
Hypertension remains to be a global public health burden and demands novel intervention strategies such as targeting T cells and T-cell-derived cytokines. Mineralocorticoid receptor (MR) antagonists have been clinically used to treat hypertension. However, the function of T-cell MR in blood pressure (BP) regulation has not been elucidated. We aim to determine the role of T-cell MR in BP regulation and to explore the mechanism. Using T-cell MR knockout mouse in combination with angiotensin II-induced hypertensive mouse model, we demonstrated that MR deficiency in T cells strikingly decreased both systolic and diastolic BP and attenuated renal and vascular damage. Flow cytometric analysis showed that T-cell MR knockout mitigated angiotensin II-induced accumulation of interferon-gamma (IFN-γ)-producing T cells, particularly CD8 + population, in both kidneys and aortas. Similarly, eplerenone attenuated angiotensin II-induced elevation of BP and accumulation of IFN-γ-producing T cells in wild-type mice. In cultured CD8 + T cells, T-cell MR knockout suppressed IFN-γ expression whereas T-cell MR overexpression and aldosterone both enhanced IFN-γ expression. At the molecular level, MR interacted with NFAT1 (nuclear factor of activated T-cells 1) and activator protein-1 in T cells. Finally, T-cell MR overexpressing mice manifested more elevated BP compared with control mice after angiotensin II infusion and such difference was abolished by IFN-γ-neutralizing antibodies. MR may interact with NFAT1 and activator protein-1 to control IFN-γ in T cells and to regulate target organ damage and ultimately BP. Targeting MR in T cells specifically may be an effective novel approach for hypertension treatment. © 2017 American Heart Association, Inc.
Kuo, Joseph; Warner, Thomas F; Schell, Ronald F
2017-03-01
The immune mechanisms responsible for development of Lyme arthritis are partially understood with interleukin-17 (IL-17) and gamma-interferon (IFN-γ) playing a generally accepted role. Elevated levels of IL-17 and/or IFN-γ have been reported in samples from human Lyme arthritis patients and experimental mice. In addition, IL-17 and IFN-γ have been implicated in the onset of arthritis in Borrelia-primed and -infected C57BL/6 mice. Recently, we showed that IL-17-deficient mice developed swelling and histopathological changes consistent with arthritis in the presence of high levels of IFN-γ. We hypothesized that neutralization of IFN-γ in IL-17-deficient mice would inhibit Borrelia-induced arthritis. Our results, however, showed that swelling of the hind paws and histopathological changes of arthritis did not differ between Borrelia-primed and -infected IL-17-deficient and wild-type mice with or without neutralization of IFN-γ. We also found higher levels of tumor necrosis factor alpha (TNF-α) and IL-6 in the popliteal lymph node cells of Borrelia-primed and -infected IL-17-deficient mice after neutralization of IFN-γ. These results suggest that multiple cytokines interact in the development of Borrelia-induced arthritis. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
... in people with severe, malignant osteopetrosis (an inherited bone disease). Interferon gamma-1b is in a class of ... you may have flu-like symptoms such as headache, fever, chills, muscle aches, and tiredness after your ...
Scorneaux, B; Ouadrhiri, Y; Anzalone, G; Tulkens, P M
1996-01-01
Listeria monocytogenes is a facultative intracellular pathogen which enters cells by endocytosis and reaches phagolysosomes from where it escapes and multiplies in the cytosol of untreated cells. Exposure of macrophages to gamma interferon (IFN-gamma) restricts L. monocytogenes to phagosomes and prevents its intracellular multiplication. We have tested whether IFN-gamma also modulates the susceptibility of L. monocytogenes to antibiotics. We selected drugs from three different classes displaying marked properties concerning their cellular accumulation and subcellular distribution, namely, ampicillin (not accumulated by cells but present in cytosol), azithromycin (largely accumulated by cells but mostly restricted to lysosomes), and sparfloxacin (accumulated to a fair extent but detected only in cytosol). We used a continuous line of myelomonocytic cells (THP-1 macrophages), which display specific surface receptors for IFN-gamma, and examined the activity of these antibiotics against L. monocytogenes Hly+ (virulent variant) and L. monocytogenes Hly- (a nonvirulent variant defective in hemolysin production). Untreated THP-1 and phorbol myristate acetate-differentiated THP-1 were permissive for infection and multiplication of intracellular L. monocytogenes Hly+ (virulent variant). All three antibiotics tested were bactericidal against this Listeria strain when added to an extracellular concentration of 10x their MIC. After preexposure of THP-1 to IFN-gamma, L. monocytogenes Hly+ was still phagocytosed but no longer grew intracellularly. The activity of ampicillin became almost undetectable (antagonistic effect), and that of azithromycin was unchanged (additive effect with that of IFN-gamma), whereas that of sparfloxacin was markedly enhanced (synergy). A similar behavior (lack of bacterial growth, associated with a loss of activity of ampicillin, an enhanced activity of sparfloxacin, and unchanged activity of azithromycin) was observed in cells infected with L
La Flamme, Anne Camille; Patton, Elisabeth A.; Pearce, Edward J.
2001-01-01
In the absence of interleukin-4 (IL-4), infection with Schistosoma mansoni leads to a severe fatal disease rather than the chronic survivable condition that occurs in wild-type (WT) mice. Because the sustained production of NO most closely correlates to weight loss and fatality in infected IL-4−/− mice and because gamma interferon (IFN-γ) is an important inducer of inducible NO synthase, infected IL-4−/− mice were treated with anti-IFN-γ antibodies to determine the role of IFN-γ during schistosomiasis in WT and IL-4−/− animals. When IFN-γ was neutralized, Th2 responses were enhanced and NO production was reduced in both WT and IL-4−/− mice. The decreased NO production correlated with a rescue of proliferation in splenocytes from infected IL-4−/− mice. Furthermore, the neutralization of IFN-γ in vivo improved the gross appearance of the liver and led to a reduction in granuloma size in infected IL-4−/− but not WT mice. However, the neutralization of IFN-γ in vivo did not affect the development of severe disease in infected IL-4−/− mice. These results suggest that while the increased production of IFN-γ does lead to some of the pathology observed in infected IL-4−/− mice, it is not ultimately responsible for cachexia and death. PMID:11705919
Jouanguy, E; Lamhamedi-Cherradi, S; Altare, F; Fondanèche, M C; Tuerlinckx, D; Blanche, S; Emile, J F; Gaillard, J L; Schreiber, R; Levin, M; Fischer, A; Hivroz, C; Casanova, J L
1997-01-01
Complete interferon-gamma receptor 1 (IFNgammaR1) deficiency has been identified previously as a cause of fatal bacillus Calmette-Guérin (BCG) infection with lepromatoid granulomas, and of disseminated nontuberculous mycobacterial (NTM) infection in children who had not been inoculated with BCG. We report here a kindred with partial IFNgammaR1 deficiency: one child afflicted by disseminated BCG infection with tuberculoid granulomas, and a sibling, who had not been inoculated previously with BCG, with clinical tuberculosis. Both responded to antimicrobials and are currently well without prophylactic therapy. Impaired response to IFN-gamma was documented in B cells by signal transducer and activator of transcription 1 nuclear translocation, in fibroblasts by cell surface HLA class II induction, and in monocytes by cell surface CD64 induction and TNF-alpha secretion. Whereas cells from healthy children responded to even low IFN-gamma concentrations (10 IU/ml), and cells from a child with complete IFNgammaR1 deficiency did not respond to even high IFN-gamma concentrations (10,000 IU/ml), cells from the two siblings did not respond to low or intermediate concentrations, yet responded to high IFN-gamma concentrations. A homozygous missense IFNgR1 mutation was identified, and its pathogenic role was ascertained by molecular complementation. Thus, whereas complete IFNgammaR1 deficiency in previously identified kindreds caused fatal lepromatoid BCG infection and disseminated NTM infection, partial IFNgammaR1 deficiency in this kindred caused curable tuberculoid BCG infection and clinical tuberculosis. PMID:9389728
Deckert-Schlüter, M; Rang, A; Weiner, D; Huang, S; Wiestler, O D; Hof, H; Schlüter, D
1996-12-01
Toxoplasma gondii may cause severe infections in immunocompromised patients including fetuses and those with AIDS. Among the factors mediating protection against T. gondii, IFN-gamma has gained special attention. To analyze the role of IFN-gamma in the early phase of toxoplasmosis, IFN-gamma receptor-deficient (IFN-gamma R0/0) mice were orally infected with low-virulent toxoplasms. IFN-gamma R0/0 mice died of the disease up to day 10 postinfection, whereas immunocompetent wild-type (WT) mice developed a chronic toxoplasmosis. Histopathology revealed that in IFN-gamma R0/0 mice, the parasite multiplied unrestrictedly in the small intestine, the intestinal lymphatic tissue, the liver, and the spleen. Ultimately, animals died of a necrotizing hepatitis. In WT mice, the same organs were effected, but multiplication of the parasite was effectively limited. Compared with WT mice, immunohistochemistry and flow cytometry demonstrated that in IFN-gamma R0/0 mice, macrophages were only marginally activated in response to the infection, as evidenced by a reduced expression of major histocompatability complex class II antigens. In addition, immunohistochemistry and RT-PCR showed a reduced production of the macrophage-derived cytokines tumor necrosis factor-alpha, inducible nitric oxide synthase, and IL-1 beta in the liver of IFN-gamma R0/0 mice. In contrast, activation of T cells, recruitment of immune cells to inflammatory foci, and anti-T. gondii IgM antibody production were unaffected by the mutation of the IFN-gamma R. Moreover, induction of IL-2, IL-4, and IL-10 mRNA transcripts in the liver was normal in IFN-gamma R0/0 mice. Adoptive transfer experiments revealed that the immune T cells of WT animals did not protect IFN-gamma R0/0 mice from lethal infection with highly virulent toxoplasms, whereas WT mice were significantly protected by the adoptive transfer. Based on these studies, we conclude that IFN-gamma is absolutely required for an efficient activation of
Thyroid epithelial cell hyperplasia in IFN-gamma deficient NOD.H-2h4 mice.
Yu, Shiguang; Sharp, Gordon C; Braley-Mullen, Helen
2006-01-01
The role of inflammatory cells in thyroid epithelial cell (thyrocyte) hyperplasia is unknown. Here, we demonstrate that thyrocyte hyperplasia in IFN-gamma-/- NOD.H-2h4 mice has an autoimmune basis. After chronic exposure to increased dietary iodine, 60% of IFN-gamma-/- mice had severe thyrocyte hyperplasia with minimal or moderate lymphocyte infiltration, and thyroid dysfunction with reduced serum T4. All mice produced anti-thyroglobulin autoantibody. Some wild-type NOD.H-2h4 mice had isolated areas of thyrocyte hyperplasia with predominantly lymphocytic infiltration, whereas IL-4-/- and 50% of wild-type NOD.H-2h4 mice developed lymphocytic thyroiditis but no thyrocyte hyperplasia. Both thyroid infiltrating inflammatory cells and environmental factors (iodine) were required to induce thyrocyte hyperplasia. Splenocytes from IFN-gamma-/- mice with thyrocyte hyperplasia, but not splenocytes from naïve IFN-gamma-/- mice, induced hyperplasia in IFN-gamma-/- NOD.H-2h4.SCID mice. These results may provide clues for understanding the mechanisms underlying development of epithelial cell hyperplasia not only in thyroids but also in other tissues and organs.
Histaminergic regulation of interferon-gamma (IFN-γ) production by human natural killer (NK) cells
ASEA, A; HANSSON, M; CZERKINSKY, C; HOUZE, T; HERMODSSON, S; STRANNEGÅRD, Ö; HELLSTRAND, K
1996-01-01
Monocytes, recovered from human peripheral blood by counter-current centrifugal elutriation, effectively inhibit the production of IFN-γ by CD3−/56+ NK cells in response to IL-2. This study aimed at defining the nature of the inhibitory signal, particularly the importance of monocyte-derived reactive metabolites of oxygen. It was found that monocytes recovered from patients with chronic granulomatous disease (CGD), a condition characterized by deficient NADPH-oxidase activity of phagocytes, did not inhibit IFN-γ production by NK cells. Further, catalase, a scavenger of hydrogen peroxide, completely reversed the inhibitory signal, whereas scavengers of the superoxide anion, hypohalous acids, the hydroxyl radical, or nitric oxide synthesis inhibitors such as L-NMMA were ineffective. Inhibition of IFN-γ production was operating on a pre-translational level, as indicated by the inability of enriched NK cells to accumulate IFN-γ mRNA in the presence of elutriated monocytes. Hydrogen peroxide, at micromolar concentrations, reconstituted the inhibition of IFN-γ production when added to enriched NK cells. Histamine, a biogenic amine which inhibits the generation of reactive oxygen metabolites in monocytes, abrogated the inhibition of IFN-γ production in NK cells; by this mechanism, histamine strongly synergized with IL-2 to induce IFN-γ in mixtures of NK cells and monocytes. The synergizing effect of histamine was specifically mediated by H2-type histamine receptors. We conclude that: (i) the induction of IFN-γ mRNA in NK cells is effectively down-regulated by products of the oxidative metabolism of monocytes; and (ii) histamine effectively enhances IFN-γ production by preventing monocyte-induced oxidative damage to NK cells. PMID:8706348
Compartmentalized bronchoalveolar IFN-gamma and IL-12 response in human pulmonary tuberculosis.
Herrera, Maria Teresa; Torres, Martha; Nevels, Denarra; Perez-Redondo, Carlos Núñez; Ellner, Jerrold J; Sada, Eduardo; Schwander, Stephan K
2009-01-01
Human tuberculosis (TB) principally involves the lungs, where local immunity impacts on the load of Mycobacterium tuberculosis (M.tb). Because concomitants of local Th1 immunity are still under-explored in humans, we characterized immune responses in bronchoalveolar cells (BACs) and systemically in peripheral blood mononuclear cells (PBMCs) in persons with active pulmonary TB and in healthy community controls. PPD- and live M.tb-induced IFN-gamma-production were observed in CD4(+), CD8(+), gammadeltaTCR(+), and CD56(+) alveolar T cell subpopulations and NK cells (CD3(-)CD56(+)). IFN-gamma-producing CD4(+) T cells (mostly CD45RO(+)) were more abundant (p<0.05). M.tb-induced IL-12p70, but interestingly also IL-4, was increased (p<0.05) in BACs from TB patients. Constitutive expression of IL-12Rbeta1 and IL-12Rbeta2 mRNA in BACs and PBMCs and IFN-gammaR1 in BACs was similar in both study groups. Data were normalized to account for differences in proportions of alveolar T cells and macrophages in the study groups. IFN-gamma-production and its induction by IL-12R engagement occur virtually unimpaired in the bronchoalveolar spaces of patients with pulmonary TB. The reasons for the apparent failure to control M. tuberculosis growth during active pulmonary TB disease is unknown but could be the expression of locally acting immunosuppressive mechanisms that subvert the antimycobacterial effects of IFN-gamma.
Woolard, Matthew D; Hensley, Lucinda L; Kawula, Thomas H; Frelinger, Jeffrey A
2008-06-01
Two key routes of Francisella tularensis infection are through the skin and airway. We wished to understand how the route of inoculation influenced the primary acute adaptive immune response. We show that an intranasal inoculation of the F. tularensis live vaccine strain (LVS) with a 1,000-fold-smaller dose than an intradermal dose results in similar growth kinetics and peak bacterial burdens. In spite of similar bacterial burdens, we demonstrate a difference in the quality, magnitude, and kinetics of the primary acute T-cell response depending on the route of inoculation. Further, we show that prostaglandin E(2) secretion in the lung is responsible for the difference in the gamma interferon (IFN-gamma) response. Intradermal inoculation led to a large number of IFN-gamma(+) T cells 7 days after infection in both the spleen and the lung. In contrast, intranasal inoculation induced a lower number of IFN-gamma(+) T cells in the spleen and lung but an increased number of Th17 cells in the lung. Intranasal infection also led to a significant increase of prostaglandin E(2) (PGE(2)) in the bronchoalveolar lavage fluid. Inhibition of PGE(2) production with indomethacin treatment resulted in increased numbers of IFN-gamma(+) T cells and decreased bacteremia in the lungs of intranasally inoculated mice. This research illuminates critical differences in acute adaptive immune responses between inhalational and dermal infection with F. tularensis LVS mediated by the innate immune system and PGE(2).
Evaluating pleural ADA, ADA2, IFN-γ and IGRA for diagnosing tuberculous pleurisy.
Keng, Li-Ta; Shu, Chin-Chung; Chen, Jason Yao-Ping; Liang, Sheng-Kai; Lin, Ching-Kai; Chang, Lih-Yu; Chang, Chia-Hao; Wang, Jann-Yuan; Yu, Chong-Jen; Lee, Li-Na
2013-10-01
Conventional methods for diagnosing tuberculous pleurisy (TB pleurisy) are either invasive or have a long turn-around-time. Performances of pleural adenosine deaminase (ADA), ADA2, interferon-gamma (IFN-γ), and interferon-gamma release assays (IGRA) as diagnostic tools for TB pleurisy were evaluated. Eighty-eight patients with lymphocyte-predominant pleural exudates between June 2010 and March 2011, including 31 with clinically diagnosed TB pleurisy, were prospectively studied. Pleural ADA and ADA2 activity were measured by colorimetric method, IFN-γ levels by enzyme-linked immuno-sorbent assay, and IGRA by enzyme-linked immuno-spot (T-SPOT.TB) assay. Pleural ADA, ADA2, and IFN-γ levels, but not the proportion of positive T-SPOT.TB assay, were significantly higher in patients with TB pleurisy than in those without TB pleurisy. The area under the receiver-operating-characteristic (ROC) curve was 0.920, 0.893, 0.875, and 0.544 for IFN-γ, ADA2, ADA, and T-SPOT.TB assay, respectively. The combination of ADA ≥ 40 IU/L and IFN-γ ≥ 75 pg/mL yielded a specificity of 100%. Pleural ADA, ADA2 and IFN-γ, but not T-SPOT.TB assay, are all sensitive and specific for TB pleurisy. In patients with lymphocyte-predominant pleural exudates, ADA ≥ 40 IU/L and IFN-γ ≥ 75 pg/mL in pleural effusion imply a very high probability of TB pleurisy. Copyright © 2013 The British Infection Association. Published by Elsevier Ltd. All rights reserved.
The Jak-STAT pathway stimulated by interferon alpha or interferon beta.
Horvath, Curt M
2004-11-23
Type I interferons, such as interferon alpha and interferon beta (IFN-alpha and beta), signal through a Janus kinase (Jak) to signal transduction and activator of transcription (STAT) pathway to stimulate gene expression. In response to ligand binding, the receptors dimerize, Jaks phosphorylate STAT1 and STAT2, which then dimerize and interact with a third transcriptional regulator IFN regulatory factor 9 (IRF9) to stimulate gene expression. IFN-alpha is the main innate antiviral cytokine and is essential for effective immune response to viral infection. The animation shows activation of STAT-responsive gene expression in response to type I IFNs.
Jans, Jop; Unger, Wendy W J; Vissers, Marloes; Ahout, Inge M L; Schreurs, Inge; Wickenhagen, Arthur; de Groot, Ronald; de Jonge, Marien I; Ferwerda, Gerben
2018-04-01
Interferon gamma (IFN-γ) plays an important role in the antiviral immune response during respiratory syncytial virus (RSV) infections. Monocytes and T cells are recruited to the site of RSV infection, but it is unclear whether cell-cell interactions between monocytes and T cells regulate IFN-γ production. In this study, micro-array data identified the upregulation of sialic acid-binding immunoglobulin-type lectin 1 (Siglec-1) in human RSV-infected infants. In vitro, RSV increased expression of Siglec-1 on healthy newborn and adult monocytes. RSV-induced Siglec-1 on monocytes inhibited IFN-γ production by adult CD4 + T cells. In contrast, IFN-γ production by RSV in newborns was not affected by Siglec-1. The ligand for Siglec-1, CD43, is highly expressed on adult CD4 + T cells compared to newborns. Our data show that Siglec-1 reduces IFN-γ release by adult T cells possibly by binding to the highly expressed CD43. The Siglec-1-dependent inhibition of IFN-γ in adults and the low expression of CD43 on newborn T cells provides a better understanding of the immune response against RSV in early life and adulthood. © 2017 The Authors. European Journal of Immunology published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Silva, J S; Vespa, G N; Cardoso, M A; Aliberti, J C; Cunha, F Q
1995-01-01
Cell invasion by Trypanosoma cruzi and its intracellular replication are essential for continuation of the parasite life cycle and for production of Chagas' disease. T. cruzi is able to replicate in nucleated cells and can be killed by activated macrophages. Gamma interferon (IFN-gamma) is one of the major stimuli for the activation of macrophages and has been shown to be a key activation factor for the killing of intracellular parasites through a mechanism dependent upon nitric oxide (NO) biosynthesis. We show that although the addition of exogenous tumor necrosis factor alpha (TNF-alpha) does not potentiate the trypanocidal activity of IFN-gamma in vitro, treatment of resistant C57BI/6 mice with an anti-TNF-alpha monoclonal antibody increased parasitemia and mortality. In addition, the anti-TNF-alpha-treated animals had decreased NO production, both in vivo and in vitro, suggesting an important role for TNF-alpha in controlling infection. In order to better understand the role of TNF-alpha in the macrophage-mediating killing of parasites, cultures of T. cruzi-infected macrophages were treated with an anti-TNF-alpha monoclonal antibody. IFN-gamma-activated macrophages failed to kill intracellular parasites following treatment with 100 micrograms of anti-TNF-alpha. In these cultures, the number of parasites released at various time points after infection was significantly increased while NO production was significantly reduced. We conclude that IFN-gamma-activated macrophages produce TNF-alpha after infection by T. cruzi and suggest that this cytokine plays a role in amplifying NO production and parasite killing. PMID:7591147
Keck, Nicolas; Boschiroli, Maria-Laura; Smyej, Florence; Vogler, Valérie; Moyen, Jean-Louis; Desvaux, Stéphanie
2018-01-01
In the French Camargue region, where bovine tuberculosis had been enzootic for several years in bullfighting cattle herds, the gamma-interferon (IFN) assay was used since 2003 in parallel with the intradermal test in order to increase overall disease detection sensitivity in infected herds. This study presents the results of a field-evaluation of the assay during a 10-year period (2004-2014) of disease control and surveillance program and explores the particular pattern of IFN assay results in bullfight herds in comparison to cattle from other regions of France. The low sensitivity [59.2% (50.6; 67.3)] of IFN assay using the tuberculin stimulation could be related to the poor gamma-IFN production from bullfight cattle blood cells which is significantly lower than in animals of conventional breeds. The characteristics of the assay were progressively adapted to the epidemiological situation and the desired strategic applications. Data analysis with a receiver operating characteristic curve based on a simple S/P value algorithm allowed for the determination of a new cutoff adapted for a global screening, giving a high specificity of 99.9% results and a high accuracy of the assay. Having regularly risen to above 5% since 2005, with a peak around 10% in 2010, the annual incidence dropped to under 1% in 2014. The positive predictive value relative to the bacteriological confirmation evolved during the years, from 33% in 2009 to 12% during the last screening period, a normal trend in a context of decreasing prevalence. The estimated rate of false-positive reactions during screening campaigns was 0.67%, confirming the high specificity of the test, measured in bTB negative herds, in this epidemiological context. The proportion of false-positive reactions decreased with the age and was higher in males than in females. Although these results indicate that the IFN assay is accurate in the field, it also emphasizes great differences between interferon quantities produced by
Gamma Interferon-Induced Guanylate Binding Protein 1 Is a Novel Actin Cytoskeleton Remodeling Factor
Ostler, Nicole; Britzen-Laurent, Nathalie; Liebl, Andrea; Naschberger, Elisabeth; Lochnit, Günter; Ostler, Markus; Forster, Florian; Kunzelmann, Peter; Ince, Semra; Supper, Verena; Praefcke, Gerrit J. K.; Schubert, Dirk W.; Stockinger, Hannes; Herrmann, Christian
2014-01-01
Gamma interferon (IFN-γ) regulates immune defenses against viruses, intracellular pathogens, and tumors by modulating cell proliferation, migration, invasion, and vesicle trafficking processes. The large GTPase guanylate binding protein 1 (GBP-1) is among the cellular proteins that is the most abundantly induced by IFN-γ and mediates its cell biologic effects. As yet, the molecular mechanisms of action of GBP-1 remain unknown. Applying an interaction proteomics approach, we identified actin as a strong and specific binding partner of GBP-1. Furthermore, GBP-1 colocalized with actin at the subcellular level and was both necessary and sufficient for the extensive remodeling of the fibrous actin structure observed in IFN-γ-exposed cells. These effects were dependent on the oligomerization and the GTPase activity of GBP-1. Purified GBP-1 and actin bound to each other, and this interaction was sufficient to impair the formation of actin filaments in vitro, as demonstrated by atomic force microscopy, dynamic light scattering, and fluorescence-monitored polymerization. Cosedimentation and band shift analyses demonstrated that GBP-1 binds robustly to globular actin and slightly to filamentous actin. This indicated that GBP-1 may induce actin remodeling via globular actin sequestering and/or filament capping. These results establish GBP-1 as a novel member within the family of actin-remodeling proteins specifically mediating IFN-γ-dependent defense strategies. PMID:24190970
Ostler, Nicole; Britzen-Laurent, Nathalie; Liebl, Andrea; Naschberger, Elisabeth; Lochnit, Günter; Ostler, Markus; Forster, Florian; Kunzelmann, Peter; Ince, Semra; Supper, Verena; Praefcke, Gerrit J K; Schubert, Dirk W; Stockinger, Hannes; Herrmann, Christian; Stürzl, Michael
2014-01-01
Gamma interferon (IFN-γ) regulates immune defenses against viruses, intracellular pathogens, and tumors by modulating cell proliferation, migration, invasion, and vesicle trafficking processes. The large GTPase guanylate binding protein 1 (GBP-1) is among the cellular proteins that is the most abundantly induced by IFN-γ and mediates its cell biologic effects. As yet, the molecular mechanisms of action of GBP-1 remain unknown. Applying an interaction proteomics approach, we identified actin as a strong and specific binding partner of GBP-1. Furthermore, GBP-1 colocalized with actin at the subcellular level and was both necessary and sufficient for the extensive remodeling of the fibrous actin structure observed in IFN-γ-exposed cells. These effects were dependent on the oligomerization and the GTPase activity of GBP-1. Purified GBP-1 and actin bound to each other, and this interaction was sufficient to impair the formation of actin filaments in vitro, as demonstrated by atomic force microscopy, dynamic light scattering, and fluorescence-monitored polymerization. Cosedimentation and band shift analyses demonstrated that GBP-1 binds robustly to globular actin and slightly to filamentous actin. This indicated that GBP-1 may induce actin remodeling via globular actin sequestering and/or filament capping. These results establish GBP-1 as a novel member within the family of actin-remodeling proteins specifically mediating IFN-γ-dependent defense strategies.
Hsieh, Ming Kun; Wu, Ching Ching; Lin, Tsang Long
2006-11-17
The purpose of the present study was to determine whether DNA vaccination by co-administration of DNA coding for chicken interferon-gamma (IFN-gamma) gene and DNA encoding for the VP243 gene of IBDV could enhance immune response and protection efficacy of chickens against challenge by IBDV. Plasmids carrying VP243 gene of IBDV strain variant E (VE) (P/VP243/E) and chicken IFN-gamma gene (P/cIFN-gamma) were constructed, respectively. One-day-old chickens were intramuscularly injected with P/VP243/E, or P/cIFN-gamma, or both once, twice, or three times into the thigh muscle of one leg or the thigh muscles of two separate legs at weekly intervals. Chickens were orally challenged with IBDV strain VE at 3 weeks of age and observed for 10 days. Chickens receiving two plasmids in the same site two times had significantly higher (P<0.05) bursal lesion scores and significantly lower (P<0.05) bursa weight/body weight ratios than those that only received P/VP243/E two or three times. Chickens inoculated with two plasmids separately in the thigh muscles of different legs or P/VP243/E two times had 33-50% protection and those receiving two plasmids in the same sites did not have any protection against IBD. The enzyme-linked immunosorbent assay (ELISA) and virus neutralization (VN) titers to IBDV of chickens in the groups with three doses of P/VP243/E were significantly higher (P<0.05) than those in groups receiving two doses of P/VP243/E or P/VP243/E and P/cIFN-gamma. Chickens protected by DNA vaccination did not have detectable IBDV antigen in the bursae as determined by immunofluorescent antibody assay (IFA). The results indicated that co-administration of plasmid encoding chicken IFN-gamma gene with plasmid encoding a large segment gene of the IBDV did not enhance immune response and protection against challenge by IBDV.
Estes, D M; Tuo, W; Brown, W C; Goin, J
1998-12-01
In this report, we sought to determine the role of selected type I interferons [interferon-alpha (IFN-alpha) and interferon-tau (IFN-tau)], IFN-gamma and transforming growth factor-beta (TGF-beta) in the regulation of bovine antibody responses. B cells were stimulated via CD40 in the presence or absence of B-cell receptor (BCR) cross-linking. IFN-alpha enhanced IgM, IgG2 and IgA responses but did not enhance IgG1 responses. BCR signalling alone was more effective at inducing IgG2 responses with IFN-alpha than dual cross-linking with CD40. Recombinant ovine IFN-tau was less effective at inducing IgG2 responses when compared with IFN-alpha, though IgA responses were similar in magnitude following BCR cross-linking. At higher concentrations, IFN-tau enhanced IgA responses greater than twofold over the levels observed with IFN-alpha. Previous studies have shown that addition of IFN-gamma to BCR or pokeweed mitogen-activated bovine B cells stimulates IgG2 production. However, following CD40 stimulation alone, IFN-gamma was relatively ineffective at stimulating high-rate synthesis of any non-IgM isotype. Dual cross-linking via CD40 and the BCR resulted in decreased synthesis of IgM with a concomitant increase in IgA and similar levels of IgG2 production to those obtained via the BCR alone. We also assessed the effects of endogenous and exogenous TGF-beta on immunoglobulin synthesis by bovine B cells. Exogenous TGF-beta stimulates both IgG2 and IgA production following CD40 and BCR cross-linking in the presence of IL-2. Blocking endogenous TGF-beta did not inhibit the up-regulation of IgG2 or IgA by interferons.
Distinct regulatory functions of SLP-76 and MIST in NK cell cytotoxicity and IFN-gamma production.
Hidano, Shinya; Sasanuma, Hiroki; Ohshima, Keiko; Seino, Ken-ichiro; Kumar, Lalit; Hayashi, Katsuhiko; Hikida, Masaki; Kurosaki, Tomohiro; Taniguchi, Masaru; Geha, Raif S; Kitamura, Daisuke; Goitsuka, Ryo
2008-03-01
Activation of NK cells is triggered by multiple receptors. We demonstrate here that SLP-76 is required for CD16- and NKG2D-mediated NK cell cytotoxicity, while MIST negatively regulates these responses in an SLP-76-dependent manner. Exceptionally, MIST acts as a positive regulator of cytotoxicity against YAC-1 cells, although SLP-76 plays a more key role. SLP-76 acts as a dominant positive regulator for both NKG2D-mediated and YAC-1 cell-triggered IFN-gamma production. Although NKG2D-mediated IFN-gamma production depends on phospholipase C (PLC) gamma 2, YAC-1 cell-triggered IFN-gamma production is PLC gamma 2- and Syk/ZAP-70 independent and nuclear factor-kappa B mediated. SLP-76 is required for this process in the presence of MIST but is dispensable in the absence of MIST. Thus, YAC-1 cell-triggered NKG2D-independent IFN-gamma production appears to be regulated by SLP-76-dependent and -independent pathways, in which the latter is negatively regulated by MIST. Taken together, these results suggest that SLP-76 and MIST distinctly but interactively regulate NK cell cytotoxicity and IFN-gamma production.
Three-dimensional crystal structure of recombinant murine interferon-beta.
Senda, T; Shimazu, T; Matsuda, S; Kawano, G; Shimizu, H; Nakamura, K T; Mitsui, Y
1992-01-01
The crystal structure of recombinant murine interferon-beta (IFN-beta) has been solved by the multiple isomorphous replacement method and refined to an R-factor of 20.5% against 2.6 A X-ray diffraction data. The structure shows a variant of the alpha-helix bundle with a new chain-folding topology, which seems to represent a basic structural framework of all the IFN-alpha and IFN-beta molecules belonging to the type I family. Functionally important segments of the polypeptide chain, as implied through numerous gene manipulation studies carried out so far, are spatially clustered indicating the binding site(s) to the receptor(s). Comparison of the present structure with those of other alpha-helical cytokine proteins, including porcine growth hormone, interleukin 2 and interferon gamma, indicated either a topological similarity in chain folding or a similar spatial arrangement of the alpha-helices. Images PMID:1505514
Connor, Thomas J; Starr, Neasa; O'Sullivan, Joan B; Harkin, Andrew
2008-08-15
Inflammation-mediated dysregulation of the kynurenine pathway has been implicated as a contributor to a number of major brain disorders. Consequently, we examined the impact of a systemic inflammatory challenge on kynurenine pathway enzyme expression in rat brain. Indoleamine 2,3-dioxygenase (IDO) expression was induced in cortex and hippocampus following systemic lipopolysaccharide (LPS) administration. Whilst IDO expression was paralleled by increased circulating interferon (IFN)-gamma concentrations, IFN-gamma expression in the brain was only modestly altered following LPS administration. In contrast, induction of IDO was associated with increased central tumour necrosis factor (TNF)-alpha and interleukin (IL)-6 expression. Similarly, in cultured glial cells LPS-induced IDO expression was accompanied by increased TNF-alpha and IL-6 expression, whereas IFN-gamma was not detectable. These findings indicate that IFN-gamma is not required for LPS-induced IDO expression in brain. A robust increase in kynurenine-3-monooxygenase (KMO) expression was observed in rat brain 24h post LPS, without any change in kynurenine aminotransferase II (KAT II) expression. In addition, we report that constitutive expression of KAT II is approximately 8-fold higher than KMO in cortex and 20-fold higher in hippocampus. Similarly, in glial cells constitutive expression of KAT II was approximately 16-fold higher than KMO, and expression of KMO but not KAT II was induced by LPS. These data are the first to demonstrate that a systemic inflammatory challenge stimulates KMO expression in brain; a situation that is likely to favour kynurenine metabolism in a neurotoxic direction. However, our observation that expression of KAT II is much higher than KMO in rat brain is likely to counteract potential neurotoxicity that could arise from KMO induction following an acute inflammation.
ERIC Educational Resources Information Center
Gilli, Francesca; Bertolotto, Antonio; Sala, Arianna; Hoffmann, Francine; Capobianco, Marco; Malucchi, Simona; Glass, Tracy; Kappos, Ludwig; Lindberg, Raija L. P.; Leppert, David
2004-01-01
Neutralizing antibodies (NAb) against interferon-[Beta] (IFN-Beta) develop in about a third of treated multiple sclerosis patients and are believed to reduce therapeutic efficacy of IFN-[Beta] on clinical and MRI measures. The expression of the interferon acute-response protein, myxovirus resistance protein A (MxA) is a sensitive measure of the…
Alvarez, Guillermo Cabrera; Madrid-Marina, Vicente; Jimenez-Mendez, Ricardo; Buitimea, Angel Leon; Román, Margarita Bahena; Cortez-Gomez, Rudyard; Esparza, Jorge Reyes; Rodríguez-Fragoso, Lourdes
2007-01-01
The aim of this study was to investigate the effects of combinations of pegilated-interferon (PEG-IFN), ribavirin, and danazol on thrombocytopenia and liver injury in rats with fibrosis. Male adult Wistar rats were treated with either mineral oil, danazol (0.83 mg/kg per day), PEG-interferon alpha-2a (PEG-IFN, 0.3 microg/ week) + ribavirin (12 mg/kg per day), PEG-IFN + ribavirin + danazol, CCl(4) (4 g/kg for eight weeks), CCl(4) + PEG-IFN + ribavirin, or CCl(4) + PEG-IFN + ribavirin+ danazol. The following assays were conducted: hematology, clinical chemistry, liver function, liver fibrosis, lymphocyte cytokine mRNA expression, and bone-marrow DNA content. Platelet counts were low in sham-treated animals and animals treated with PEG- IFN + ribavirin (30% and 25% respectively; P < 0.05). PEG-IFN + ribavirin + danazol reduced platelet counts of fibrotic animals by only 9% (P < 0.05). PEG- IFN + ribavirin reduced hepatic collagen content by 50%, whereas danazol + PEG-IFN + ribavirin reduced hepatic collagen content by 60% (P < 0.05). PEG-IFN + ribavirin reduced the total bilirubin concentration by 27%, alanine amino transferase (ALT) activity by 75% and gamma-glutamyl transpeptidase (gamma-GTP) activity by 74% (P < 0.05). In contrast, danazol + PEG-IFN + ribavirin reduced total bilirubin levels by 61%, alkaline phosphatase activity by 45%, ALT activity by 76%, and gamma-GTP activity by 74% (P < 0.05). The only treatment that increased interleukin 10 (IL-10) mRNA in fibrotic rats was PEG-IFN + ribavirin. However, danazol + PEG-IFN + ribavirin reduced the expression of IL-6, IL-10, tumor necrosis factor alpha and transforming growth factor ss. Bone-marrow DNA content was not altered by any treatment. In conclusion, PEG-IFN + ribavirin + danazol could be a new therapeutic option for patients with liver injury, fibrosis, and thrombocytopenia.
Vercelli, D; Jabara, H H; Lauener, R P; Geha, R S
1990-01-15
The T cell-derived lymphokine IL-4 is essential for the induction of IgE synthesis by human lymphocytes. The IgE-inducing effect of IL-4 is antagonized by IFN-gamma. The secretion of IFN-gamma is vigorously triggered in MLC. Thus, IL-4-stimulated MLC represent a suitable model to characterize the functional antagonism between IL-4 and IFN-gamma. In this report, we show that rIL-4 consistently induced IgE synthesis when added to human primary MLC. IL-4-dependent IgE production required cognate T/B cell recognition, because it was inhibited by antibodies to CD3 and MHC class II (HlA-DR) Ag. A neutralizing anti-IFN-gamma mAb dramatically enhanced IL-4-dependent IgE synthesis by MLC, indicating that endogenous IFN-gamma is a major inhibitor of IgE production. More importantly, addition of rIL-4 markedly inhibited the release of IFN-gamma in supernatants of MLC and Con A-activated PBMC. The decrease in IFN-gamma protein was accompanied by a decreased expression of IFN-gamma mRNA transcripts. The downregulation of IFN-gamma by IL-4 is likely to play an important role in the IL-4-dependent induction of IgE synthesis.
Dempoya, Junichi; Imaizumi, Tadaatsu; Hayakari, Ryo; Xing, Fei; Yoshida, Hidemi; Okumura, Ken; Satoh, Kei
2012-01-01
Upon viral infection, pattern recognition receptors sense viral nucleic acids, leading to the production of type I interferons (IFNs), which initiate antiviral activities. Type I IFNs bind to their cognate receptor, IFNAR, resulting in the activation of signal-transducing activators of transcription 1 (STAT1). Thus, it has long been thought that double-stranded RNA (dsRNA)-induced STAT1 phosphorylation is mediated by the transactivation of type I IFN signaling. Foreign RNA, such as viral RNA, in cells is sensed by the cytoplasmic sensors retinoic acid-inducible gene I (RIG-I) and melanoma differentiation-associated gene 5 (MDA-5). In this study, we explored the molecular mechanism responsible for STAT1 phosphorylation in response to the sensing of dsRNA by cytosolic RNA sensors. Polyinosinic-poly(C) [poly(I:C)], a synthetic dsRNA that is sensed by both RIG-I and MDA-5, induces STAT1 phosphorylation. We found that the poly(I:C)-induced initial phosphorylation of STAT1 is dependent on the RIG-I pathway and that MDA-5 is not involved in STAT1 phosphorylation. Furthermore, pretreatment of the cells with neutralizing antibody targeting the IFN receptor suppressed the initial STAT1 phosphorylation in response to poly(I:C), suggesting that this initial phosphorylation event is predominantly type I IFN dependent. In contrast, neither the known RIG-I pathway nor type I IFN is involved in the late phosphorylation of STAT1. In addition, poly(I:C) stimulated STAT1 phosphorylation in type I IFN receptor-deficient U5A cells with delayed kinetics. Collectively, our study provides evidence of a comprehensive regulatory mechanism in which dsRNA induces STAT1 phosphorylation, indicating the importance of STAT1 in maintaining very tight regulation of the innate immune system. PMID:22973045
Park, Jong-Hyeon; Lee, Kwang-Nyeong; Kim, Se-Kyung; You, Su-Hwa; Kim, Taeseong; Tark, Dongseob; Lee, Hyang-Sim; Seo, Min-Goo; Kim, Byounghan
2015-01-01
ABSTRACT Because the currently available vaccines against foot-and-mouth disease (FMD) provide no protection until 4 to 7 days postvaccination, the only alternative method to halt the spread of the FMD virus (FMDV) during outbreaks is the application of antiviral agents. Combination treatment strategies have been used to enhance the efficacy of antiviral agents, and such strategies may be advantageous in overcoming viral mechanisms of resistance to antiviral treatments. We have developed recombinant adenoviruses (Ads) for the simultaneous expression of porcine alpha and gamma interferons (Ad-porcine IFN-αγ) as well as 3 small interfering RNAs (Ad-3siRNA) targeting FMDV mRNAs encoding nonstructural proteins. The antiviral effects of Ad-porcine IFN-αγ and Ad-3siRNA expression were tested in combination in porcine cells, suckling mice, and swine. We observed enhanced antiviral effects in porcine cells and mice as well as robust protection against the highly pathogenic strain O/Andong/SKR/2010 and increased expression of cytokines in swine following combination treatment. In addition, we showed that combination treatment was effective against all serotypes of FMDV. Therefore, we suggest that the combined treatment with Ad-porcine IFN-αγ and Ad-3siRNA may offer fast-acting antiviral protection and be used with a vaccine during the period that the vaccine does not provide protection against FMD. IMPORTANCE The use of current foot-and-mouth disease (FMD) vaccines to induce rapid protection provides limited effectiveness because the protection does not become effective until a minimum of 4 days after vaccination. Therefore, during outbreaks antiviral agents remain the only available treatment to confer rapid protection and reduce the spread of foot-and-mouth disease virus (FMDV) in livestock until vaccine-induced protective immunity can become effective. Interferons (IFNs) and small interfering RNAs (siRNAs) have been reported to be effective antiviral agents against
Takahashi, Yuki; Vikman, Elin; Nishikawa, Makiya; Ando, Mitsuru; Watanabe, Yoshihiko; Takakura, Yoshinobu
2010-09-01
The in vivo half-life of interferons (IFNs) is very short, and its extension would produce a better therapeutic outcome in IFN-based therapy. Delivery of IFN genes is one solution for providing a sustained supply. IFNs have a variety of functions, including the suppression of transgene expression, through interaction with IFN receptors (IFNRs). This suppression could prevent IFNs from being expressed from vectors delivered. Silencing the expression of IFNAR and IFNGR, the receptors for type I and II IFNs, respectively, in cells expressing IFNs may prolong transgene expression of IFNs. Mouse melanoma B16-BL6 cells or mouse liver were selected as a site expressing IFNs (not a target for IFN gene therapy) and IFN-expressing plasmid DNA was delivered with or without small interfering RNA (siRNA) targeting IFNRs. Transfection of B16-BL6 cells with siRNA targeting IFNAR1 subunit (IFNAR1) resulted in the reduced expression of IFNAR on the cell surface. This silencing significantly increased the IFN-beta production in cells that were transfected with IFN-beta-expressing plasmid DNA. Similar results were obtained with the combination of IFN-gamma and IFNGR. Co-injection of IFN-beta-expressing plasmid DNA with siRNA targeting IFNAR1 into mice resulted in sustained plasma concentration of IFN-beta. These results provide experimental evidence that the RNAi-mediated silencing of IFNRs in cells expressing IFN, such as hepatocytes, is an effective approach for improving transgene expression of IFNs when their therapeutic target comprises cells other than those expressing IFNs.
The elephant interferon gamma assay: a contribution to diagnosis of tuberculosis in elephants.
Angkawanish, T; Morar, D; van Kooten, P; Bontekoning, I; Schreuder, J; Maas, M; Wajjwalku, W; Sirimalaisuwan, A; Michel, A; Tijhaar, E; Rutten, V
2013-11-01
Mycobacterium tuberculosis (M. tb) has been shown to be the main causative agent of tuberculosis in elephants worldwide. M. tb may be transmitted from infected humans to other species including elephants and vice versa, in case of prolonged intensive contact. An accurate diagnostic approach covering all phases of the infection in elephants is required. As M. tb is an intracellular pathogen and cell-mediated immune (CMI) responses are elicited early after infection, the skin test is the CMI assay of choice in humans and cattle. However, this test is not applicable in elephants. The interferon gamma (IFN-γ) assay is considered a good alternative for the skin test in general, validated for use in cattle and humans. This study was aimed at development of an IFN-γ assay applicable for diagnosis of tuberculosis in elephants. Recombinant elephant IFN-γ (rEpIFN-γ) produced in eukaryotic cells was used to immunize mice and generate the monoclonal antibodies. Hybridomas were screened for IFN-γ-specific monoclonal antibody production and subcloned, and antibodies were isotyped and affinity purified. Western blot confirmed recognition of the rEpIFN-γ. The optimal combination of capture and detection antibodies selected was able to detect rEpIFN-γ in concentrations as low as 1 pg/ml. The assay was shown to be able to detect the native elephant IFN-γ, elicited in positive-control cultures (pokeweed mitogen (PWM), phorbol myristate acetate plus ionomycin (PMA/I)) of both Asian and African elephant whole-blood cultures (WBC). Preliminary data were generated using WBC from non-infected elephants, a M. tb infection-suspected elephant and a culture-confirmed M. tb-infected elephant. The latter showed measurable production of IFN-γ after stimulation with ESAT6/CFP10 PPDB and PPDA in concentration ranges as elicited in WBC by Mycobacterium tuberculosis complex (MTBC)-specific antigens in other species. Hence, the IFN-γ assay presented potential as a diagnostic tool for the
Ma, C G; Zhang, G X; Xiao, B G; Wang, Z Y; Link, J; Olsson, T; Link, H
1996-02-13
Oral and nasal administration of nicotinic acetylcholine receptor (AChR) to Lewis rats prior to myasthenogenic immunization with AChR and complete Freund's adjuvant (CFA) resulted in prevention or marked decrease of the severity of experimental autoimmune myasthenia gravis (EAMG) and suppression of AChR-specific B-cell responses and of AChR-reactive T-cell function. To examine the involvement of immunoregulatory cytokines and the underlying mechanisms involved in tolerance induction, in situ hybridization with radiolabeled cDNA oligonucleotide proves was adopted to enumerate mononuclear cells (MNC) expressing mRNA for the proinflammatory cytokine interferon-gamma (IFN-gamma), the B cell-stimulating interleukin-4 (IL-4), and the immunosuppressive transforming growth factor-beta (TGF-beta). Popliteal and inguinal lymph nodes from EAMG rats contained elevated numbers of AChR-reactive IFN-gamma, IL-4, and TGF-beta mRNA-expressing cells, compared to control rats receiving PBS orally or nasally and injected with CFA only. Oral and nasal tolerance was accompanied by decreased numbers of AChR-reactive IFN-gamma and IL-4 mRNA-expressing cells and strong up-regulation of TGF-beta mRNA-positive cells in lymphoid organs when compared to nontolerized EAMG control rats. The results suggest that IFN-gamma and IL-4 are central effector molecules in the development of EAMG and that TGF-beta plays an important role in tolerance induction to EAMG.
Coers, Jörn; Bernstein-Hanley, Isaac; Grotsky, David; Parvanova, Iana; Howard, Jonathan C; Taylor, Gregory A; Dietrich, William F; Starnbach, Michael N
2008-05-01
Chlamydiae are obligate intracellular bacterial pathogens that exhibit a broad range of host tropism. Differences in host tropism between Chlamydia species have been linked to host variations in IFN-gamma-mediated immune responses. In mouse cells, IFN-gamma can effectively restrict growth of the human pathogen Chlamydia trachomatis but fails to control growth of the closely related mouse pathogen Chlamydia muridarum. The ability of mouse cells to resist C. trachomatis replication is largely dependent on the induction of a family of IFN-gamma-inducible GTPases called immunity-related GTPases or IRGs. In this study we demonstrate that C. muridarum can specifically evade IRG-mediated host resistance. It has previously been suggested that C. muridarum inactivates the IRG protein Irga6 (Iigp1) to dampen the murine immune response. However, we show that Irga6 is dispensable for the control of C. trachomatis replication. Instead, an effective IFN-gamma response to C. trachomatis requires the IRG proteins Irgm1 (Lrg47), Irgm3 (Igtp), and Irgb10. Ectopic expression of Irgb10 in the absence of IFN-gamma is sufficient to reduce intracellular growth of C. trachomatis but fails to restrict growth of C. muridarum, indicating that C. muridarum can specifically evade Irgb10-driven host responses. Importantly, we find that Irgb10 protein intimately associates with inclusions harboring C. trachomatis but is absent from inclusions formed by C. muridarum. These data suggest that C. muridarum has evolved a mechanism to escape the murine IFN-gamma response by restricting access of Irgb10 and possibly other IRG proteins to the inclusion.
Hunsicker, A; Kullich, W; Weissenhofer, W; Lorenz, D; Petermann, J; Rokos, H; Schwesinger, G
1997-05-01
To establish a standardised reproducible animal model of intraperitoneal sepsis, and to investigate early immunoserological responses to find a mediator-based system for evaluation and grading of diffuse peritonitis in patients Prospective experimental study 4 Teaching hospitals, Germany and Austria 42 LEW. 1W rats, 12 of which acted as controls Gram negative sepsis was induced by intraperitoneal injection of 6 ml of a mixture of Escherichia coli (K1:H+) 10(10) organisms/ml, autogenous haemoglobin 2.9 ml (haemoglobin concentration 3%), 0.9% sodium chloride 3 ml, and suspension 0.1 ml. Control rats were given physiological saline 6 ml alone. Concentrations of endotoxin, interferon gamma (IFN-gamma), and biopterin, and serum phospholipase A2 (PLA2) activity. There were significant differences between the septic and control rats in concentrations of endotoxin (EU/ml) (median (interquartile range) 21.85 (2.02-159.5) compared with 0, p < 0.0001; IFN-gamma (pg/ml) 1263.0 (271.0-7575.0) compared with 101.0 (89.0-141.0), p < 0.0001; biopterin (nmol/L) 111.0 (66.4-156.3) compared with 53.7 (38.3-67.6), p < 0.001; and PLA2 (U/L) 163.0 (125.8-209.0) compared with 112.5 (88.5-126.5) p < 0.01. Measurements of concentrations of endotoxin, IFN-gamma, pteridines, and PLA2 activity may well be adequate markers for early recognition of sepsis, and perhaps for grading it during the first 6 hours after induction. The allow a clear distinction to be made between septic and non-septic disorders in 87% of cases.
NASA Technical Reports Server (NTRS)
Mazumder, B.; Fox, P. L.
1999-01-01
Ceruloplasmin (Cp) is an acute-phase protein with ferroxidase, amine oxidase, and pro- and antioxidant activities. The primary site of Cp synthesis in human adults is the liver, but it is also synthesized by cells of monocytic origin. We have shown that gamma interferon (IFN-gamma) induces the synthesis of Cp mRNA and protein in monocytic cells. We now report that the induced synthesis of Cp is terminated by a mechanism involving transcript-specific translational repression. Cp protein synthesis in U937 cells ceased after 16 h even in the presence of abundant Cp mRNA. RNA isolated from cells treated with IFN-gamma for 24 h exhibited a high in vitro translation rate, suggesting that the transcript was not defective. Ribosomal association of Cp mRNA was examined by sucrose centrifugation. When Cp synthesis was high, i.e., after 8 h of IFN-gamma treatment, Cp mRNA was primarily associated with polyribosomes. However, after 24 h, when Cp synthesis was low, Cp mRNA was primarily in the nonpolyribosomal fraction. Cytosolic extracts from cells treated with IFN-gamma for 24 h, but not for 8 h, contained a factor which blocked in vitro Cp translation. Inhibitor expression was cell type specific and present in extracts of human cells of myeloid origin, but not in several nonmyeloid cells. The inhibitory factor bound to the 3' untranslated region (3'-UTR) of Cp mRNA, as shown by restoration of in vitro translation by synthetic 3'-UTR added as a "decoy" and detection of a binding complex by RNA gel shift analysis. Deletion mapping of the Cp 3'-UTR indicated an internal 100-nucleotide region of the Cp 3'-UTR that was required for complex formation as well as for silencing of translation. Although transcript-specific translational control is common during development and differentiation and global translational control occurs during responses to cytokines and stress, to our knowledge, this is the first report of translational silencing of a specific transcript following cytokine
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pulit-Penaloza, Joanna A.; Scherbik, Svetlana V.; Brinton, Margo A., E-mail: mbrinton@gsu.edu
2012-04-10
Although infection of mouse embryofibroblasts (MEFs) with WNV Eg101 induced interferon (IFN) beta production and STAT1 and STAT2 phosphorylation, these transcription factors (TFs) were not detected in the nucleus or on the promoters of four IRF-3-independent interferon stimulated genes (ISGs): Oas1a and Irf7 (previously characterized as IFN/ISGF3-dependent), Oas1b and Irf1. These ISGs were upregulated in WNV Eg101-infected STAT1-/-, STAT2-/-, and IFN alpha/beta receptor -/- MEFs. Although either IRF-3 or IRF-7 could amplify/sustain Oas1a and Oas1b upregulation at later times after infection, these factors were not required for the initial gene activation. The lack of upregulation of these ISGs in WNVmore » Eg101-infected IRF-3/9-/- MEFs suggested the involvement of IRF-9. Activation of Irf1 in infected MEFs did not depend on any of these IRFs. The data indicate that additional alternative activation mechanisms exist for subsets of ISGs when a virus infection has blocked ISG activation by the canonical IFN-mediated pathway.« less
[Expression of gamma interferon during HPV and Chlamydia trachomatis infection in cervical samples].
Colín-Ferreyra, María Del Carmen; Mendieta-Zerón, Hugo; Romero-Figueroa, María Del Socorro; Martínez-Madrigal, Migdania; Martínez-Pérez, Sergio; Domínguez-García, María Victoria
2015-02-01
The aim of this study was to mesure the expression of gamma interferon in HPV and Chlamydia trachomatis infection in squamous intraepithelial lesions. Samples from 100 patients diagnosed by colposcopy with or without squamous intraepithelial lesions were used in the present study. Each patient was found to be infected by HPV and C.trachomatis. Relative gamma interferon mRNA expression was assessed using a real-time reverse transcriptase PCR assay (RT-PCR). The relative units of expression of gamma interferon mRNA were 13, 1.8 and 0.3, for HPV and C.trachomatis co-infection, or HPV or C.trachomatis infection, respectively. HPV and C.trachomatis could overstimulate the expression of gamma interferon. Copyright © 2014 Elsevier España, S.L.U. y Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.
Interferon-gamma, macrophages, and virus spread after HSV-1 injection.
Cathcart, Heather M; Zheng, Mei; Covar, Jason J; Liu, Yi; Podolsky, Robert; Atherton, Sally S
2011-06-07
After uniocular anterior chamber (AC) injection of HSV-1, the anterior segment of BALB/c mice becomes inflamed and infected; however, virus does not spread from the anterior segment to cause retinitis in the injected eye. The purpose of these studies was to determine whether interferon (IFN-)-γ and Mac-1(+) cells play a role in preventing direct anterior-to-posterior spread of HSV-1 in the injected eye. One AC of adult female BALB/c mice was injected with HSV-1 (KOS). The location of IFN-α, IFN-β, and IFN-γ in the injected eye was determined by immunofluorescence, and mRNA expression was quantified by qPCR. Injected eyes of IFN-γ knockout or clodronate-treated macrophage-depleted mice were examined to determine whether the absence of IFN-γ or Mac-1(+) macrophages affected the sites or timing of virus spread. IFN-α, IFN-β, and IFN-γ were observed in the anterior segment of injected eyes through 72 hours and mRNA levels of IFN-β and IFN-γ were increased in virus-infected eyes 48 to 120 hours after infection. However, the absence of IFN-γ or macrophages did not affect either the sites or the timing of HSV-1 infection in injected eyes. Protection of the retina of the injected eye does not depend on a single cell type or cytokine. In addition, in the eye, as in other sites of the body, there are redundancies in the innate response to virus infection.
Targeting IFN-λ: therapeutic implications.
Eslam, Mohammed; George, Jacob
2016-12-01
Type-III interferons (IFN-λ), the most recently discovered family of IFNs, shares common features with other family members, but also has many distinctive activities. IFN-λ uniquely has a different receptor complex, and a more focused pattern of tissue expression and signaling effects, from other classes of IFNs. Multiple genome-wide association studies (GWAS) and subsequent validation reports suggest a pivotal role for polymorphisms near the IFNL3 gene in hepatitis C clearance and control, as also for several other epithelial cell tropic viruses. Apart from its antiviral activity, IFN-λ possesses anti-tumor, immune-inflammatory and homeostatic functions. The overlapping effects of IFN-λ with type I IFN, with a restricted tissue expression pattern renders IFN-λ an attractive therapeutic target for viral infection, cancer and autoimmune diseases, with limited side effects. Areas covered: This review will summarize the current and future therapeutic opportunities offered by this most recently discovered family of interferons. Expert opinion: Our knowledge on IFN-λ is rapidly expanding. Though there are many remaining questions and challenges that require elucidation, the unique characteristics of IFN-λ increases enthusiasm that multiple therapeutic options will emerge.
Zhou, Qin; Zhang, Wei; Chen, Shun; Wang, Anqi; Sun, Lipei; Wang, Mingshu; Jia, Renyong; Zhu, Dekang; Liu, Mafeng; Sun, Kunfeng; Yang, Qiao; Wu, Ying; Chen, Xiaoyue; Cheng, Anchun
2017-06-01
Type III interferons (IFN-λ1/λ2/λ3, also known as IL-29/28A/28B, and IFN-λ4) are a recently discovered interferon group. In this study, we first identified the Chinese goose IFN-λ (goIFN-λ). The full-length sequence of goIFN-λ was found to be 823 bp. There was only one open reading frame that contained 570 bp, and, encoded 189 amino acids. The predicted goIFN-λ protein showed 78%, 67%, and 40% amino acid identity with duIFN-λ, chIFN-λ, and hIFN-λ3, respectively. The tissue distribution of goIFN-λ existed as a parallel distribution with goIFNLR1 as its functional receptor, which was mainly expressed in epithelium-rich tissues, such as lung, gizzard, proventriculus, skin and pancreas, and immune tissues, such as harderian gland and thymus. Furthermore, the immunological characteristics studies of goIFN-λ showed that there was a significant increase in the mRNA at the transcriptional level of goIFN-λ after the peripheral blood mononuclear cells were stimulated with ploy (I:C) and ODN2006, and infected with Gosling plague virus (GPV). In vivo, the mRNA transcriptional level of goIFN-λ increased nearly 20 times in the lung tissue and nearly 40 times in the pancreatic tissue after being artificially infected with H9N2 AIV. It is suggested that goIFN-λ might play a pivotal role in the mucosal immune protection and antiviral defense.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kim, Hun Sik; Kim, Sunshin; Lee, Myung-Shik
2005-10-28
Although X-linked inhibitor of apoptosis protein (XIAP) is an important intracellular suppressor of apoptosis in a variety of cell types, its role in cytokine-induced pancreatic {beta}-cell apoptosis remains unclear. Here, we found that: (i) XIAP level was inversely correlated with tumor necrosis factor (TNF)-{alpha}-induced apoptosis in MIN6N8 insulinoma cells; (ii) adenoviral XIAP overexpression abrogated the TNF-{alpha}-induced apoptosis through inhibition of caspase activity; (iii) downregulation of XIAP by antisense oligonucleotide or Smac peptide sensitized MIN6N8 cells to TNF-{alpha}-induced apoptosis; (iv) XIAP expression was induced by TNF-{alpha} through a nuclear factor-{kappa}B (NF-{kappa}B)-dependent pathway, and interferon (IFN)-{gamma} prevented such an induction in amore » manner independent of NF-{kappa}B, which presents a potential mechanism underlying cytotoxic IFN-{gamma}/TNF-{alpha} synergism. Taken together, our results suggest that XIAP is an important modulator of TNF-{alpha}-induced apoptosis of MIN6N8 cells, and XIAP regulation in pancreatic {beta}-cells might play an important role in pancreatic {beta}-cell apoptosis and in the pathogenesis of type 1 diabetes.« less
Evasion of interferon responses by Ebola and Marburg viruses.
Basler, Christopher F; Amarasinghe, Gaya K
2009-09-01
The filoviruses, Ebola virus (EBOV) and Marburg virus (MARV), cause frequently lethal viral hemorrhagic fever. These infections induce potent cytokine production, yet these host responses fail to prevent systemic virus replication. Consistent with this, filoviruses have been found to encode proteins VP35 and VP24 that block host interferon (IFN)-alpha/beta production and inhibit signaling downstream of the IFN-alpha/beta and the IFN-gamma receptors, respectively. VP35, which is a component of the viral nucleocapsid complex and plays an essential role in viral RNA synthesis, acts as a pseudosubstrate for the cellular kinases IKK-epsilon and TBK-1, which phosphorylate and activate interferon regulatory factor 3 (IRF-3) and interferon regulatory factor 7 (IRF-7). VP35 also promotes SUMOylation of IRF-7, repressing IFN gene transcription. In addition, VP35 is a dsRNA-binding protein, and mutations that disrupt dsRNA binding impair VP35 IFN-antagonist activity while leaving its RNA replication functions intact. The phenotypes of recombinant EBOV bearing mutant VP35s unable to inhibit IFN-alpha/beta demonstrate that VP35 IFN-antagonist activity is critical for full virulence of these lethal pathogens. The structure of the VP35 dsRNA-binding domain, which has recently become available, is expected to provide insight into how VP35 IFN-antagonist and dsRNA-binding functions are related. The EBOV VP24 protein inhibits IFN signaling through an interaction with select host cell karyopherin-alpha proteins, preventing the nuclear import of otherwise activated STAT1. It remains to be determined to what extent VP24 may also modulate the nuclear import of other host cell factors and to what extent this may influence the outcome of infection. Notably, the Marburg virus VP24 protein does not detectably block STAT1 nuclear import, and, unlike EBOV, MARV infection inhibits STAT1 and STAT2 phosphorylation. Thus, despite their similarities, there are fundamental differences by which
[Plasma levels of interferon gamma and interleukin 10 in patients with lymphonodular toxoplasmosis].
Bielec, D; Patorska-Mach, E; Semczuk, G; Toruń, E
1997-01-01
The concentrations of IFN gamma and IL 10 in plasma of sixteen patients with toxoplasmic lymphadenopathy were measured. These examinations were carried out two times in the interval of a month. We found increased level of IFN gamma and normal concentrations of IL 10 in both of these terms.
Bernitz, Netanya; Clarke, Charlene; Roos, Eduard O; Goosen, Wynand J; Cooper, David; van Helden, Paul D; Parsons, Sven D C; Miller, Michele A
2018-02-01
African buffaloes (Syncerus caffer) are wildlife maintenance hosts of Mycobacterium bovis, the cause of bovine tuberculosis. Consequently, M. bovis infected buffaloes pose a transmission risk for cattle and other wildlife species. Previously, a modification to the Qiagen QuantiFERON ® -TB Gold (QFT) system, using QFT tubes and an in-house bovine interferon-gamma (IFN-γ) ELISA, was evaluated for the detection of M. bovis infection in buffaloes. Subsequently, Qiagen has developed a commercially available cattletype ® IFN-gamma ELISA for the detection of antigen-specific IFN-γ release in ruminants. The aim of this study was to investigate the use of QFT tubes and the cattletype ® IFN-gamma ELISA, in a cattletype IFN-γ release assay (IGRA), to detect M. bovis infection in African buffaloes. The test agreements between the cattletype IGRA, single comparative intradermal skin test (SCITT) and Bovigam ® 1G IGRA in two M. bovis-exposed buffalo populations (n = 134 and n = 92) were calculated and κ coefficients ranged from 0.65 (95% CI 0.48-0.82) to 0.86 (95% CI 0.72-0.99). Increasing the QFT incubation time in one M. bovis-exposed buffalo cohort (n = 92), from 20 to 40 h, had no effect on the cattletype IGRA test results. Inter-assay and intra-assay reproducibility determination for the cattletype IGRA produced coefficient of variations (CV) <9.1% and <1.7%, respectively. A total of 21/21 known M. bovis-unexposed buffaloes tested negative in the cattletype IGRA. Moreover, the cattletype IGRA test result values were significantly greater for 13 M. bovis culture-positive buffaloes compared with 14 M. bovis-exposed culture-negative (P < .01) and 21 M. bovis-unexposed (P < .001) buffaloes, respectively. These findings suggest that the combination of QFT tubes and the cattletype ® IFN-gamma ELISA is a promising new diagnostic assay for the detection of M. bovis infection in African buffaloes. However, further research is needed to evaluate the
Koizumi, Yusuke; Sakagami, Takuro; Nishiyama, Naoya; Hirai, Jun; Hayashi, Yuta; Asai, Nobuhiro; Yamagishi, Yuka; Kato, Hideo; Hagihara, Mao; Sakanashi, Daisuke; Suematsu, Hiroyuki; Ogawa, Kenji; Mikamo, Hiroshige
2017-10-01
A 67-year-old Japanese female with back pain and severe cachexia visited our hospital. The diagnosis was disseminated Mycobacterium avium complex infection (dMAC) with multiple bone involvement. Anti-mycobacterial chemotherapy was started, but fever persisted and dislocation of cervical vertebrae has made her bedridden. Because anti-interferon (IFN)-γ autoantibody was positive, four doses of rituximab 375 mg/m 2 , every 7 day, were administered. Soon after treatment, progression of osteolytic lesions and wasting has stopped. We proved that rituximab has recovered IFN-γ signaling as shown by IFN-γ-induced STAT1 phosphorylation. It can be a promising option for dMAC cases with anti-IFN-γ autoantibody.
Role of IL-10 -1082, IFN-gamma +874, and TNF-alpha -308 genes polymorphisms in suicidal behavior.
Omrani, Mir Davood; Bushehri, Behzad; Bagheri, Morteza; Salari-Lak, Shaker; Alipour, Azize; Anoshae, Mohamad-Reza; Massomi, Reza
2009-01-01
In this study, it was determined whether the IL-10 -1082, IFN-gamma +874, and TNF-alpha -308 polymorphisms were associated with suicidal behavior. One hundred forty five patients with suicidal behavior and 160 normal individuals were genotyped for IL-10 -1082, IFN-gamma +874, and TNF-alpha -308 polymorphisms using ASO-PCR method. TNF-alpha -308 G/G genotype has been increased in males with completed suicide behavior versus control group (p value = 0.017). IL-10 -1082 A/A genotype is higher in both male and female suicide completed groups (p value = 0.017). IFN-gamma (+874) A/A genotype was significantly higher in males with completed suicide behavior versus normal male control (p value = 0.027). It can be concluded that IL-10, IFN-gamma, and TNF-alpha polymorphisms may play a role in suicidal behavior.
Agosti, J M; Coombs, R W; Collier, A C; Paradise, M A; Benedetti, J K; Jaffe, H S; Corey, L
1992-05-01
To determine safety and efficacy of tumor necrosis factor (TNF) and interferon-gamma (IFN gamma) in the treatment of patients with acquired immunodeficiency syndrome (AIDS)-related complex, a randomized, double-blind study was conducted. Twenty-five patients with AIDS-related complex and CD4 lymphocytes less than or equal to 500 x 10(6)/L attended an AIDS Clinical Trials Unit of a tertiary referral center. Patients were administered tumor necrosis factor (TNF) (10 micrograms/m2) or IFN gamma (10 micrograms/m2), or both intramuscularly three times weekly for 16 weeks. Side effects from all three preparations included fever, constitutional symptoms, and local reactions. No significant hematologic, hepatic, renal, or coagulation abnormalities were observed. CD4 lymphocyte counts, beta 2-microglobulin, p24 antigen levels, and anti-p24 antibody did not change significantly during therapy. Similarly, no significant change was noted in rates of HIV isolation from peripheral blood mononuclear cells or plasma. TNF and IFN gamma were tolerable after premedication with acetaminophen; however, no significant change in markers of human immunodeficiency virus infection was demonstrated. These cytokines alone do not appear to be of benefit, nor do they appear to hasten the progression of HIV infection.
[Interleukin 8 and interferon gamma in ocular toxoplasmosis].
Czepiel, Jacek; Biesiada, Grazyna; Sobczyk-Krupiarz, Iwona; Miklasszewska, Grazyna; Fedak, Danuta; Solnica, Bogdan; Mach, Tomasz; Garlicki, Aleksander
2011-01-01
Toxoplasmosis is one of the most common parasitic infections in the world, it is caused by Toxoplasma gondii. The infection is typically asymptomatic or the symptoms are very mild. Approximately 10% patients have limphadenopathy, involvement of the others organs, like eyes, nervous system, liver, heart, are observed more rarely. The aim of our study was to assess the level of selected cytokines in blood among patients with ocular toxoplasmosis. We have enrolled in the study 30 patients, 19-42 years old, treated for ocular toxoplasmosis, and 20 healthy volunteers, 20-48 years old, to the control group. Tests for blood morphology, C-reactive protein, the level of IL-8 and IFN-gamma were performed in all patients. The blood parameters in toxoplasmosis group were performed before antiparasitic treatment was given. The level of IFN-gamma in blood was lower among patients with ocular toxoplasmosis comparing with control group (1.52 vs. 4.18 pg/ml; p = 0.002). The level of IL-8 in blood was lower among patients with ocular toxoplasmosis comparing with control group (22.96 vs. 94.3 pg/ml; p = 0,007). There were no correlations between analyzed cytokines and blood morphology or CRP. The low level of IFN-gamma and IL-8 in blood is important factor leading to reactivation of the ocular toxoplasmosis.
Bjerre, Anna; Brusletto, Berit; Høiby, Ernst Arne; Kierulf, Peter; Brandtzaeg, Petter
2004-02-01
To analyze plasma interferon-gamma and interleukin-10 concentrations in patients with systemic meningococcal disease and patients with severe Gram-positive septic shock caused by Streptococcus pneumoniae or Staphylococcus aureus. To study the in vitro cytokine (interferon-gamma and interleukin-10) responses in a whole blood model boosted with heat-killed Neisseria meningitidis, S. pneumoniae, and S. aureus before and after treatment with recombinant interleukin-10 or recombinant interferon-gamma. Experimental study. Laboratory. Plasma samples were collected from patients with systemic meningococcal disease (n = 66) and patients with severe Gram-positive septic shock caused by S. pneumoniae (n = 4) or S. aureus (n = 3). Whole blood was boosted with heat-killed N. meningitidis, S. pneumoniae, and S. aureus (1 x 106 colony forming units/mL), and plasmas were analyzed for interleukin-10 or interferon-gamma at 0, 5, 12, and 24 hrs. Furthermore, recombinant interleukin-10 or recombinant interferon-gamma was added before bacteria, and the effect on the secretion of interferon-gamma and interleukin-10, respectively, was analyzed after 24 hrs. The median concentration of interferon-gamma was 15 pg/mL and of interleukin-10 was 10,269 pg/mL in patients with meningococcal septic shock (n = 24) compared with median interferon-gamma concentration of 3400 pg/mL and interleukin-10 concentration of 465 pg/mL in patients with severe Gram-positive shock (p =.001). Increased interferon-gamma concentrations were associated with case fatality (p =.011). In a whole blood model we demonstrated that 1 x 106 colony forming units/mL of N. meningitidis induced more interleukin-10 but less interferon-gamma than S. pneumoniae. S. aureus induced minimal secretion of both cytokines. Recombinant interleukin-10 efficiently down-regulated the secretion of interferon-gamma, and vice versa, as shown in a whole blood model. We speculate whether high concentrations of interleukin-10 contribute to the
Pan, L Y; Guyre, P M
1988-02-01
We investigated the influence of glucocorticoids on two effects of interferons (IFNs) which are thought to relate to their antitumor actions: cytotoxic activity and induction of HLA antigen expression. We treated human myeloid cell lines (U-937, HL-60, THP-1, K-562, and KG-1a), and T-(MOLT-4) and B- (Daudi) lymphoblastic cell lines with concentrations of IFN-alpha, IFN-gamma, and dexamethasone (Dex) which are commonly achieved in the circulation following therapeutic administration. The results show that for every cell line except Daudi, the greatest inhibition of cell growth occurred when IFN-gamma and Dex treatments were combined. The advantage of combined IFN-gamma and Dex treatment over treatment with either agent alone was most dramatic for the three cell lines (U-937, HL-60, and THP-1) which have monocytoid characteristics. There was also more growth inhibition by the combination of IFN-alpha and Dex than by either agent alone for all seven cell lines tested. The induction of HLA antigen expression by IFN-alpha and IFN-gamma, an effect which could increase recognition of the tumor cells by the immune system, was as great or greater in the presence of Dex as in its absence. These results demonstrate that glucocorticoids do not inhibit, and in some cases enhance, two effects of IFNs that appear to be related to their antitumor actions: inhibition of tumor cell proliferation and enhancement of HLA antigen expression.
Bausero, Maria A; Gastpar, Robert; Multhoff, Gabriele; Asea, Alexzander
2005-09-01
IFN-gamma exhibits differential effects depending on the target and can induce cellular activation and enhance survival or mediate cell death via activation of apoptotic pathways. In this study, we demonstrate an alternative mechanism by which IFN-gamma enhances tumor recognition, mediated by the active release of Hsp72. We demonstrate that stimulation of 4T1 breast adenocarcinoma cells and K562 erythroleukemic cells with IFN-gamma triggers the cellular stress response, which results in the enhanced expression of total Hsp72 expression without a significant increase in cell death. Intracellular expression of Hsp72 was abrogated in cells stably transfected with a mutant hsf-1 gene. IFN-gamma-induced Hsp72 expression correlated with enhanced surface expression and consequent release of Hsp72 into the culture medium. Pretreatment of tumors with compounds known to the block the classical protein transport pathway, including monensin, brefeldin A, tunicamycin, and thapsigargin, did not significantly block Hsp72 release. However, pretreatment with intracellular calcium chelator BAPTA-AM or disruption of lipid rafts using methyl beta-cyclodextrin completely abrogated IFN-gamma-induced Hsp72 release. Biochemical characterization revealed that Hsp72 is released within exosomes and has the ability to up-regulate CD83 expression and stimulate IL-12 release by naive dendritic cells. Pretreatment with neutralizing mAb or depletion of Hsp72 completely abrogated its chaperokine function. Taken together, these findings are indicative of an additional previously unknown mechanism by which IFN-gamma promotes tumor surveillance and furthers our understanding of the central role of extracellular Hsp72 as an endogenous adjuvant and danger signal.
Gharesi-Fard, Behrouz; Zolghadri, Jaleh; Kamali-Sarvestani, Eskandar
2008-03-01
Considering the deleterious role of T helper1 (Th1) cells in pregnancy outcome, a successful treatment for recurrent spontaneous abortion (RSA) should be able to make a significant shift away from Th1 responses. Although paternal leukocyte immunization has been used for treatment of RSA for years, because of methodological differences there is no consensus on the mechanism of action and effectiveness of this method. Twenty-five Iranian non-pregnant women with RSA and 16 non-pregnant control women with at least two successful pregnancies were included in this study. All cases were followed up after leukocyte therapy for pregnancy outcome. Mononuclear cells from women were co-cultured with the husband's mononuclear cells before and after immunotherapy. The levels of tumor necrosis factor-alpha (TNF-alpha) and interferon-gamma (IFN-gamma) were checked on culture supernatant by enzyme-linked immunosorbent assay method. The mean concentration of TNF-alpha was significantly higher in patients compared with that in normal controls (P=0.0001). After immunotherapy, the TNF-alpha level was only significantly decreased in women with successful outcome (P=0.0001). Immunotherapy also induced a significant reduction in the IFN-gamma level (P=0.009). The results of this investigation confirm the role of TNF-alpha in RSA and propose the assessment of TNF-alpha production as a valuable prognostic parameter for the prediction of abortion after leukocyte therapy.
Inflammation activates the interferon signaling pathways in taste bud cells.
Wang, Hong; Zhou, Minliang; Brand, Joseph; Huang, Liquan
2007-10-03
Patients with viral and bacterial infections or other inflammatory illnesses often experience taste dysfunctions. The agents responsible for these taste disorders are thought to be related to infection-induced inflammation, but the mechanisms are not known. As a first step in characterizing the possible role of inflammation in taste disorders, we report here evidence for the presence of interferon (IFN)-mediated signaling pathways in taste bud cells. IFN receptors, particularly the IFN-gamma receptor IFNGR1, are coexpressed with the taste cell-type markers neuronal cell adhesion molecule and alpha-gustducin, suggesting that both the taste receptor cells and synapse-forming cells in the taste bud can be stimulated by IFN. Incubation of taste bud-containing lingual epithelia with recombinant IFN-alpha and IFN-gamma triggered the IFN-mediated signaling cascades, resulting in the phosphorylation of the downstream STAT1 (signal transducer and activator of transcription protein 1) transcription factor. Intraperitoneal injection of lipopolysaccharide or polyinosinic:polycytidylic acid into mice, mimicking bacterial and viral infections, respectively, altered gene expression patterns in taste bud cells. Furthermore, the systemic administration of either IFN-alpha or IFN-gamma significantly increased the number of taste bud cells undergoing programmed cell death. These findings suggest that bacterial and viral infection-induced IFNs can act directly on taste bud cells, affecting their cellular function in taste transduction, and that IFN-induced apoptosis in taste buds may cause abnormal cell turnover and skew the representation of different taste bud cell types, leading to the development of taste disorders. To our knowledge, this is the first study providing direct evidence that inflammation can affect taste buds through cytokine signaling pathways.
Qi, Guoyan; Liu, Peng; Gu, Shanshan; Yang, Hongxia; Dong, Huimin; Xue, Yinping
2018-04-01
Our study is aimed to explore the underlying genetic basis of myasthenia gravis. We collected a Chinese pedigree with myasthenia gravis, and whole-exome sequencing was performed on the two affected siblings and their parents. The candidate pathogenic gene was identified by bioinformatics filtering, which was further verified by Sanger sequencing. The homozygous mutation c.G40A (p.V14M) in interferon gamma receptor 1was identified. Moreover, the mutation was also detected in 3 cases of 44 sporadic myasthenia gravis patients. The p.V14M substitution in interferon gamma receptor 1 may affect the signal peptide function and the translocation on cell membrane, which could disrupt the binding of the ligand of interferon gamma and antibody production, contributing to myasthenia gravis susceptibility. We discovered that a rare variant c.G40A in interferon gamma receptor 1 potentially contributes to the myasthenia gravis pathogenesis. Further functional studies are needed to confirm the effect of the interferon gamma receptor 1 on the myasthenia gravis phenotype.
Schwaab, T; Heaney, J A; Schned, A R; Harris, R D; Cole, B F; Noelle, R J; Phillips, D M; Stempkowski, L; Ernstoff, M S
2000-04-01
The clinical observation of spontaneous regression in patients with renal cell carcinoma (RCC) and the response to various immunotherapeutic therapies strongly suggest a role for the host immune system in this disease. Prior studies showed that sequential administration of interferon (IFN) gamma and IFN alpha to RCC patients was safe. Clinical responses as well as immune changes in the peripheral blood mononuclear cell compartment were observed. Autologous tumor cell vaccines (AV) have also demonstrated activity in renal cell carcinoma. We hypothesize that the addition of AV to sequential IFN gamma and a therapy might improve the tumor-specific immune response by providing an appropriate source of antigen in the appropriate cytokine environment. To our knowledge, this is the first trial using AV combined with IFN alpha and IFN gamma. The purpose of this study was to evaluate the feasibility of manufacturing and administering (AV) from resected tumor samples, and administration of AV with combination IFN gamma and IFN alpha therapy. Finally, the impact on immunological parameters of these treatment options was assessed. Patients with metastatic RCC were randomly assigned to receive AV plus bCG along with a sequential administration of IFN gamma and a either together or after initiation of vaccine. Toxicity and clinical responses were evaluated. Modulations of the immune system were investigated by analyzing phenotype, cytokine mRNA expression, T cell proliferation and cytotoxicity in the peripheral blood mononuclear cell compartment. Fourteen patients with metastatic renal cell carcinoma were enrolled in this study; 9 were available for response evaluation. In a 70 day period, 3 (33%) showed mixed responses, 5 (56%) stable disease and 1 (11%) progression of disease. Toxicities were consistent with previous clinical reports. In the flow-cytometry phenotype analysis, stimulation of distinct subsets of circulating T-lymphocytes and a decrease of CD8+ T cell subsets was
Interferon-gamma enhances radiation-induced cell death via downregulation of Chk1
Kim, Kwang Seok; Choi, Kyu Jin; Bae, Sangwoo
2012-01-01
Interferon-gamma (IFNγ) is a cytokine with roles in immune responses as well as in tumor control. Interferon is often used in cancer treatment together with other therapies. Here we report a novel approach to enhancement of cancer cell killing by combined treatment of IFNγ with ionizing radiation. We found that IFNγ treatment alone in HeLa cells induced phosphorylation of Chk1 in a time- and dose-dependent manner, and resulted in cell arrest. Moreover IFNγ treatment was correlated with attenuation of Chk1 as the treatment shortened protein half-life of Chk1. As Chk1 is an essential cell cycle regulator for viability after DNA damage, attenuation of Chk1 by IFNγ pre-treatment in HeLa cells resulted in increased cell death following ionizing radiation about 2-folds than ionizing radiation treatment alone whereas IFNγ treatment alone had little effect on cell death. X-linked inhibitor of apoptosis-associated factor 1 (XAF1), an IFN-induced gene, seems to partly regulate IFNγ-induced Chk1 destabilization and radiation sensitivity because transient depletion of XAF1 by siRNA prevented IFNγ-induced Chk1 attenuation and partly protected cells from IFNγ-enhanced radiation cell killing. Therefore the results provide a novel rationale to combine IFNγ pretreatment and DNA-damaging anti-cancer drugs such as ionizing radiation to enhance cancer cell killing. PMID:22825336
Takahashi, Yuki; Kaneda, Haruka; Takasuka, Nana; Hattori, Kayoko; Nishikawa, Makiya; Watanabe, Yoshihiko; Takakura, Yoshinobu
2008-08-01
The suppressor of cytokine signaling (SOCS) proteins, negative regulators of interferon (IFN)-induced signaling pathways, is involved in IFN resistance of tumor cells. To improve the growth inhibitory effect of IFN-beta and IFN-gamma on a murine melanoma cell line, B16-BL6, and a murine colon carcinoma cell line, Colon26 cells, SOCS-1 and SOCS-3 gene expression in tumor cells was downregulated by transfection of plasmid DNA expressing short hairpin RNA targeting one of these genes (pshSOCS-1 and pshSOCS-3, respectively). Transfection of pshSOCS-1 significantly increased the antiproliferative effect of IFN-gamma on B16-BL6 cells. However, any other combinations of plasmids and IFN had little effect on the growth of B16-BL6 cells. In addition, transfection of pshSOCS-1 and pshSOCS-3 produced little improvement in the effect of IFN on Colon26 cells. To understand the mechanism underlining these findings, the level of SOCS gene expression was measured by real time polymerase chain reaction. Addition of IFN-gamma greatly increased the SOCS-1 mRNA expression in B16-BL6 cells. Taking into account the synergistic effect of pshSOCS-1 and IFN-gamma on the growth of B16-BL6 cells, these findings suggest that IFN-gamma-induced high SOCS-1 gene expression in B16-BL6 cells significantly interferes with the antiproliferative effect of IFN-gamma. These results indicate that silencing SOCS gene expression can be an effective strategy to enhance the antitumor effect of IFN under conditions in which the SOCS gene expression is upregulated by IFN.
(PCG) Protein Crystal Growth Gamma-Interferon
NASA Technical Reports Server (NTRS)
1989-01-01
(PCG) Protein Crystal Growth Gamma-Interferon. Stimulates the body's immune system and is used clinically in the treatment of cancer. Potential as an anti-tumor agent against solid tumors as well as leukemia's and lymphomas. It has additional utility as an anti-ineffective agent, including antiviral, anti-bacterial, and anti-parasitic activities. Principal Investigator on STS-26 was Charles Bugg.
Seo, Kwang Won; Ahn, Jong-Joon; Ra, Seung Won; Kwon, Woon-Jung; Jegal, Yangjin
2014-06-01
The interferon gamma (IFN-γ) release assays (IGRAs) are the best method of detecting Mycobacterium tuberculosis infection. However, reports on IGRAs results obtained during and right after the treatment of tuberculosis (TB) have presented differing results. Some studies have shown declining responses, whereas other reports described persistent, fluctuating, or increasing responses. We postulated that the IGRA-positivity will decrease or revert long time after treatment of TB, and thus, evaluated the response of IGRA in subjects with a history of pulmonary TB. Seventy subjects (M:F = 51:19; age = 53.2 ± 11.8 years) underwent tuberculin skin tests (TSTs) and IGRA. The interval of time elapsed after the completion of anti-TB treatment was < 10 years for 16 subjects, 10-20 years for 13 subjects, 20-30 years for 16 subjects, and ≥ 30 years for 25 subjects. The TST was positive in 49 subjects (74%) and negative in 17 subjects (26%). The IGRA was positive in 52 subjects (74%) and negative in 18 subjects (26%). The IFN-γ level and the size of induration showed good correlation (r = 0.525, P < 0.001). However, the correlation between time elapsed after the completion of anti-TB treatment and the size of induration or that between time and the IFN-γ level was not significant. The TST and IGRA were positive in 72.7% and 68.0% of subjects ≥ 30 years after the treatment of pulmonary TB. In conclusion, majority of subjects with a history of pulmonary TB are IGRA-positive, even a few decades after the completion of anti-TB treatment.
Yang, Y F; Tomura, M; Ono, S; Hamaoka, T; Fujiwara, H
2000-12-01
Two cytokines IL-4 and IL-12 are known to determine the balance between T(h)1 and T(h)2 development. In addition to IL-4 production of V(alpha)14(+) NKT cells, they have recently been demonstrated to have the capacity to stimulate IL-12 production by antigen-presenting cells (APC). This study demonstrates that IFN-gamma is absolutely required for the NKT cell-stimulated IL-12 production. Culture of B cell-depleted spleen cells from C57BL/6 mice with alpha-galactosylceramide (alpha-GalCer) capable of selectively stimulating V(alpha)14/J(alpha)281(+) NKT cells resulted in the production of IL-12 together with IL-4. Whereas IL-4 production occurred in culture of IFN-gamma(-/-) C57BL/6 splenocytes, the same culture failed to generate IL-12 production. While IL-12 production induced during culture of V(alpha)14(+) NKT cells and APC depended on the interaction between CD40 ligand on NKT cells and CD40 on APC, the expression levels of these key molecules were comparable in cells from wild-type and IFN-gamma(-/-) mice. Addition of rIFN-gamma to alpha-GalCer stimulated IFN-gamma(-/-) splenocyte culture, and administration of rIFN-gamma to alpha-GalCer-injected IFN-gamma(-/-) mice resulted in the restoration of IL-12 production in vitro and in vivo. These results illustrate a mandatory role for IFN-gamma in V(alpha)14(+) NKT cell-stimulated IL-12 production by APC.
de Alencar, Bruna C G; Persechini, Pedro M; Haolla, Filipe A; de Oliveira, Gabriel; Silverio, Jaline C; Lannes-Vieira, Joseli; Machado, Alexandre V; Gazzinelli, Ricardo T; Bruna-Romero, Oscar; Rodrigues, Mauricio M
2009-10-01
A heterologous prime-boost strategy using plasmid DNA, followed by replication-defective recombinant adenovirus 5, is being proposed as a powerful way to elicit CD4(+) and CD8(+) T-cell-mediated protective immunity against intracellular pathogens. We confirmed this concept and furthered existing research by providing evidence that the heterologous prime-boost regimen using the gene encoding amastigote surface protein 2 elicited CD4(+) and CD8(+) T-cell-mediated protective immunity (reduction of acute parasitemia and prolonged survival) against experimental infection with Trypanosoma cruzi. Protective immunity correlated with the presence of in vivo antigen-specific cytotoxic activity prior to challenge. Based on this, our second goal was to determine the outcome of infection after heterologous prime-boost immunization of perforin-deficient mice. These mice were highly susceptible to infection. A detailed analysis of the cell-mediated immune responses in immunized perforin-deficient mice showed an impaired gamma interferon (IFN-gamma) secretion by immune spleen cells upon restimulation in vitro with soluble recombinant antigen. In spite of a normal numeric expansion, specific CD8(+) T cells presented several functional defects detected in vivo (cytotoxicity) and in vitro (simultaneous expression of CD107a/IFN-gamma or IFN-gamma/tumor necrosis factor alpha) paralleled by a decreased expression of CD44 and KLRG-1. Our final goal was to determine the importance of IFN-gamma in the presence of highly cytotoxic T cells. Vaccinated IFN-gamma-deficient mice developed highly cytotoxic cells but failed to develop any protective immunity. Our study thus demonstrated a role for perforin and IFN-gamma in a number of T-cell-mediated effector functions and in the antiparasitic immunity generated by a heterologous plasmid DNA prime-adenovirus boost vaccination strategy.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Badger, A.M.; Swift, B.; Sung, C.P.
1986-03-05
Recombinant murine gamma interferon (IFN-..gamma..) activates oil elicited C57BL/6 peritoneal macrophages to inhibit the growth of Listeria. Maximum activity is obtained with 10-20 units/ml, can be demonstrated in the absence of antibiotics and is not due to LPS contamination. Studies of the kinetics of this phenomenon demonstrate that a 30 minute incubation with IFN-..gamma.. is sufficient to initiate the antiproliferative state and full activity can be obtained with a 4 hour incubation. Alpha/beta interferon (IFN-..cap alpha../..beta..) is also active but requires 100X more units to obtain equivalent activity. The evaluation of a number of other BRMS demonstrated that MDP andmore » LPS could stimulate phagocytosis of Listeria but could not inhibit their growth. Bestatin, tuftsin, Con A, A23187 and Poly I:C did not stimulate either phagocytosis or growth inhibitory activity. These compounds were also tested for their ability to enhance the release of superoxide anion from PMA stimulated macrophages. With the exception of tuftsin and bestatin all of the BRMS tested were able to enhance the production of oxidative burst products confirming the findings of others of the dissociation between the two functions.« less
Kim, S; Ponka, P
2000-03-03
Iron regulatory proteins (IRP-1 and IRP-2) control the synthesis of transferrin receptors (TfR) and ferritin by binding to iron-responsive elements, which are located in the 3'-untranslated region and the 5'-untranslated region of their respective mRNAs. Cellular iron levels affect binding of IRPs to iron-responsive elements and consequently expression of TfR and ferritin. Moreover, NO(*), a redox species of nitric oxide that interacts primarily with iron, can activate IRP-1 RNA binding activity resulting in an increase in TfR mRNA levels. Recently we found that treatment of RAW 264.7 cells (a murine macrophage cell line) with NO(+) (nitrosonium ion, which causes S-nitrosylation of thiol groups) resulted in a rapid decrease in RNA binding of IRP-2 followed by IRP-2 degradation, and these changes were associated with a decrease in TfR mRNA levels (Kim, S., and Ponka, P. (1999) J. Biol. Chem. 274, 33035-33042). In this study, we demonstrated that stimulation of RAW 264.7 cells with lipopolysaccharide (LPS) and interferon-gamma (IFN-gamma) increased IRP-1 binding activity, whereas RNA binding of IRP-2 decreased and was followed by a degradation of this protein. Moreover, the decrease of IRP-2 binding/protein levels was associated with a decrease in TfR mRNA levels in LPS/IFN-gamma-treated cells, and these changes were prevented by inhibitors of inducible nitric oxide synthase. Furthermore, LPS/IFN-gamma-stimulated RAW 264.7 cells showed increased rates of ferritin synthesis. These results suggest that NO(+)-mediated degradation of IRP-2 plays a major role in iron metabolism during inflammation.
IFN-λ suppresses intestinal inflammation by non-translational regulation of neutrophil function.
Broggi, Achille; Tan, Yunhao; Granucci, Francesca; Zanoni, Ivan
2017-10-01
Interferon-λ (IFN-λ) is a central regulator of mucosal immunity; however, its signaling specificity relative to that of type I interferons is poorly defined. IFN-λ can induce antiviral interferon-stimulated genes (ISGs) in epithelia, while the effect of IFN-λ in non-epithelial cells remains unclear. Here we report that neutrophils responded to IFN-λ. We found that in addition to inducing ISG transcription, IFN-λ (but not IFN-β) specifically activated a translation-independent signaling pathway that diminished the production of reactive oxygen species and degranulation in neutrophils. In mice, IFN-λ was elicited by enteric viruses and acted on neutrophils to decrease oxidative stress and intestinal damage. Thus, IFN-λ acted as a unique immunomodulatory agent by modifying transcriptional and non-translational neutrophil responses, which might permit a controlled development of the inflammatory process.
Yu, Hong-Ren; Tain, You-Lin; Sheen, Jiunn-Ming; Tiao, Mao-Meng; Chen, Chih-Cheng; Kuo, Ho-Chang; Hung, Pi-Lien; Hsieh, Kai-Sheng; Huang, Li-Tung
2016-01-01
Overexposure to prenatal glucocorticoid (GC) disturbs hypothalamic-pituitary-adrenocortical axis-associated neuroendocrine metabolism and susceptibility to metabolic syndrome. A high-fat (HF) diet is a major environmental factor that can cause metabolic syndrome. We aimed to investigate whether prenatal GC plus a postnatal HF diet could alter immune programming in rat offspring. Pregnant Sprague-Dawley rats were given intraperitoneal injections of dexamethasone or saline at 14–21 days of gestation. Male offspring were then divided into four groups: vehicle, prenatal dexamethasone exposure, postnatal HF diet (VHF), and prenatal dexamethasone exposure plus a postnatal HF diet (DHF). The rats were sacrificed and adaptive immune function was evaluated. Compared to the vehicle, the DHF group had lower interferon gamma (IFN-γ) production by splenocytes at postnatal day 120. Decreases in H3K9 acetylation and H3K36me3 levels at the IFN-γ promoter correlated with decreased IFN-γ production. The impaired IFN-γ production and aberrant site-specific histone modification at the IFN-γ promoter by prenatal dexamethasone treatment plus a postnatal HF diet resulted in resilience at postnatal day 180. Prenatal dexamethasone and a postnatal HF diet decreased IFN-γ production through a site-specific and an age-dependent histone modification. These findings suggest a mechanism by which prenatal exposure to GC and a postnatal environment exert effects on fetal immunity programming. PMID:27669212
[Peptide Ala-Glu-Asp-Gly and interferon gamma: their role in immune response during aging].
Lin'kova, N S; Kuznik, B I; Khavinson, V Kh
2012-01-01
The decrease of lymphocyte interferon gamma expression during aging is one of the main mechanisms leading to the immunodeficiency state in the elderly. Cell penetrating geroprotective peptide Ala-Glu-Asp-Gly has the capability to activate the proliferation of lymphocytes in thymus during its aging. The nucleotide sequence which is complementary contacted with peptide Ala-Glu-Asp-Gly was found in promoter region of interferon gamma gene. Thus, the immune protection of this peptide can be explained by its activation of the interferon gamma production in T-cells.
The Role of the Interferon-Gamma-Jak/STAT Pathway in Rheumatoid Arthritis
2017-09-01
AWARD NUMBER: W81XWH-16-1-0537 TITLE: The Role of the Interferon-Gamma-Jak/STAT Pathway in Rheumatoid Arthritis PRINCIPAL INVESTIGATOR: Stanley...Sep 2016 - 31 Aug 2017 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER The Role of the Interferon-Gamma-Jak/STAT Pathway in Rheumatoid Arthritis 5b...subsets that likely counteracts IL-2 regulator activity and contribute to the pathogenesis of RA. 15. SUBJECT TERMS Rheumatoid arthritis ; Autoimmunity; T
Ohyama, K; Kikuchi, H; Oda, Y; Moritake, K; Yamasaki, T
1993-06-01
We studied the effects of mouse IFN-gamma on the cytotoxic activity of murine activated macrophages (M phi) against mouse VM-Glioma cells (H-2b). Activated M phi were obtained from peritoneal exudate cells of mice from four strains, C57BL/6 (H-2b), C3H/He(H-2k), DBA/2 (H-2d), and BALB/c (H-2d), following intraperitoneal injection of (1) LPS 200 micrograms, (2) BCG 200 micrograms, (3) C. parvum 200 micrograms, or (4) MDP 350 micrograms 7 days prior to 20-hr 51Cr release-assay. Of the various combination of mouse strains and activating agents tested, that of activated M phi of the C3H/He mouse with induction by LPS had the most tumoricidal effect against the glioma cells, which was not MHC restricted. Although LPS-activated M phi underwent marked loss of cytotoxicity following initiation of in vitro culture, this 24 hr pretreatment with IFN-gamma inhibited this reduction in tumoricidal effects in a dose-dependent fashion. On the other hand, 24 hr pretreatment of target cells with IFN-gamma did not increase their susceptibility to lysis by activated M phi. These findings suggest that IFN-gamma augments the in vitro tumoricidal activation of M phi; This effect appears to be unrelated to any influence of IFN-gamma on target sensitivity to lysis by macrophages.
Human B cells fail to secrete type I interferons upon cytoplasmic DNA exposure.
Gram, Anna M; Sun, Chenglong; Landman, Sanne L; Oosenbrug, Timo; Koppejan, Hester J; Kwakkenbos, Mark J; Hoeben, Rob C; Paludan, Søren R; Ressing, Maaike E
2017-11-01
Most cells are believed to be capable of producing type I interferons (IFN I) as part of an innate immune response against, for instance, viral infections. In macrophages, IFN I is potently induced upon cytoplasmic exposure to foreign nucleic acids. Infection of these cells with herpesviruses leads to triggering of the DNA sensors interferon-inducible protein 16 (IFI16) and cyclic GMP-AMP (cGAMP) synthase (cGAS). Thereby, the stimulator of interferon genes (STING) and the downstream molecules TANK-binding kinase 1 (TBK1) and interferon regulatory factor 3 (IRF3) are sequentially activated culminating in IFN I secretion. Human gamma-herpesviruses, such as Epstein-Barr virus (EBV), exploit B cells as a reservoir for persistent infection. In this study, we investigated whether human B cells, similar to macrophages, engage the cytoplasmic DNA sensing pathway to induce an innate immune response. We found that the B cells fail to secrete IFN I upon cytoplasmic DNA exposure, although they express the DNA sensors cGAS and IFI16 and the signaling components TBK1 and IRF3. In primary human B lymphocytes and EBV-negative B cell lines, this deficiency is explained by a lack of detectable levels of the central adaptor protein STING. In contrast, EBV-transformed B cell lines did express STING, yet both these lines as well as STING-reconstituted EBV-negative B cells did not produce IFN I upon dsDNA or cGAMP stimulation. Our combined data show that the cytoplasmic DNA sensing pathway is dysfunctional in human B cells. This exemplifies that certain cell types cannot induce IFN I in response to cytoplasmic DNA exposure providing a potential niche for viral persistence. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
Gamma Interferon Release Assays for Detection of Mycobacterium tuberculosis Infection
Denkinger, Claudia M.; Kik, Sandra V.; Rangaka, Molebogeng X.; Zwerling, Alice; Oxlade, Olivia; Metcalfe, John Z.; Cattamanchi, Adithya; Dowdy, David W.; Dheda, Keertan; Banaei, Niaz
2014-01-01
SUMMARY Identification and treatment of latent tuberculosis infection (LTBI) can substantially reduce the risk of developing active disease. However, there is no diagnostic gold standard for LTBI. Two tests are available for identification of LTBI: the tuberculin skin test (TST) and the gamma interferon (IFN-γ) release assay (IGRA). Evidence suggests that both TST and IGRA are acceptable but imperfect tests. They represent indirect markers of Mycobacterium tuberculosis exposure and indicate a cellular immune response to M. tuberculosis. Neither test can accurately differentiate between LTBI and active TB, distinguish reactivation from reinfection, or resolve the various stages within the spectrum of M. tuberculosis infection. Both TST and IGRA have reduced sensitivity in immunocompromised patients and have low predictive value for progression to active TB. To maximize the positive predictive value of existing tests, LTBI screening should be reserved for those who are at sufficiently high risk of progressing to disease. Such high-risk individuals may be identifiable by using multivariable risk prediction models that incorporate test results with risk factors and using serial testing to resolve underlying phenotypes. In the longer term, basic research is necessary to identify highly predictive biomarkers. PMID:24396134
Müller, J-M V; Wissemann, J; Meli, M L; Dasen, G; Lutz, H; Heinzerling, L; Feige, K
2011-11-01
Whole blood pharmacokinetics of intratumourally injected naked plasmid DNA coding for equine Interleukin 12 (IL-12) was assessed as a means of in vivo gene transfer in the treatment of melanoma in grey horses. The expression of induced interferon gamma (IFN-g) was evaluated in order to determine the pharmacodynamic properties of in vivo gene transduction. Seven grey horses bearing melanoma were injected intratumourally with 250 µg naked plasmid DNA coding for IL-12. Peripheral blood and biopsies from the injection site were taken at 13 time points until day 14 post injection (p.i.). Samples were analysed using quantitative real-time PCR. Plasmid DNA was quantified in blood samples and mRNA expression for IFN-g in tissue samples. Plasmid DNA showed fast elimination kinetics with more than 99 % of the plasmid disappearing within 36 hours. IFN-g expression increased quickly after IL-12 plasmid injection, but varied between individual horses. Intratumoural injection of plasmid DNA is a feasible method for inducing transgene expression in vivo. Biological activity of the transgene IL-12 was confirmed by measuring expression of IFN-g.
How Does Vaccinia Virus Interfere With Interferon?
Smith, Geoffrey L; Talbot-Cooper, Callum; Lu, Yongxu
2018-01-01
Interferons (IFNs) are secreted glycoproteins that are produced by cells in response to virus infection and other stimuli and induce an antiviral state in cells bearing IFN receptors. In this way, IFNs restrict virus replication and spread before an adaptive immune response is developed. Viruses are very sensitive to the effects of IFNs and consequently have evolved many strategies to interfere with interferon. This is particularly well illustrated by poxviruses, which have large dsDNA genomes and encode hundreds of proteins. Vaccinia virus is the prototypic poxvirus and expresses many proteins that interfere with IFN and are considered in this review. These proteins act either inside or outside the cell and within the cytoplasm or nucleus. They function by restricting the production of IFN by blocking the signaling pathways leading to transcription of IFN genes, stopping IFNs binding to their receptors, blocking IFN-induced signal transduction leading to expression of interferon-stimulated genes (ISGs), or inhibiting the antiviral activity of ISG products. © 2018 Elsevier Inc. All rights reserved.
[Interferon alpha-2b modified with polyethylene glycol].
Wu, Yingxin; Zhai, Yanqin; Lei, Jiandu; Ma, Guanghui; Su, Zhiguo
2008-09-01
In order to obtain a more stable PEGylated interferon alpha-2b, and prolong its half life, interferon alpha-2b (IFN alpha-2b) was modified with monomethoxy polyethylene glycol propionaldehyde (mPEG-ALD) 20000. It was found that the optimized reaction condition for the maximum bioactivity and highest PEGylation degree of the mono PEGylated interferon alpha-2b was as follows: in 20 mmol/L, pH 6.5, citric acid and sodium dihydrogen phosphate buffer, the concentration of IFN alpha-2b was 4 mg/mL, and the molar ratio of PEG/IFN alpha-2b was 8:1, and the reaction time was 20 h at 4 degrees C. Under the optimized reaction condition, the mono PEGylation degree reached to 55%. Ion exchange chromatography was used to separate and purify mono PEGylated interferon alpha-2b from the reaction mixture. The purity of mono PEGylated interferon alpha-2b was higher than 97% characterized by HPLC. The bioactivity of the mono PEGylated interferon alpha-2b was 13.4% of the native IFN alpha-2b, while its half life in SD rat is much longer than the native IFN alpha-2b. The mono PEGylated interferon alpha-2b is also stable in aqueous.
Dunn, John R; Kaneene, John B; Grooms, Daniel L; Bolin, Steven R; Bolin, Carole A; Bruning-Fann, Colleen S
2005-02-01
To determine whether cattle testing positive for Mycobacterium avium subsp paratuberculosis as determined by microbial culture of feces or antibody ELISA were more likely to have false-positive responses on the caudal fold tuberculin (CFT) test or interferon-gamma (IFN-gamma) assay for Mycobacterium bovis than cattle testing negative for M paratuberculosis. 1043 cattle from 10 herds in Michigan. Feces and blood samples for plasma were collected from cattle > or =24 months old on the day the CFT test was read. Fecal samples were submitted for microbial culture for M paratuberculosis. Plasma samples were tested for antibody against M paratuberculosis, and IFN-gamma after stimulation with purified protein derivative tuberculin from M bovis or M avium. Of 1043 cattle, 180 (17.3%) had positive CFT test results (suspects) and 8 (0.8%) had positive IFN-gamma assay results after stimulation with purified protein derivative tuberculin from M bovis. Forty-five (4.3%) and 115 (11.0%) cattle tested positive for M paratuberculosis as determined by microbial culture of feces and antibody ELISA, respectively. Cattle with positive responses for M paratuberculosis appeared to have an increased likelihood of false-positive results on the CFT test, although this association was not significant. No significant association was detected among cattle testing positive for M paratuberculosis as determined by microbial culture of feces and antibody ELISA and positive CFT test and IFN-gamma assay results for M bovis.
Pérez de Val, Bernat; Vidal, Enric; López-Soria, Sergio; Marco, Alberto; Cervera, Zoraida; Martín, Maite; Mercader, Irene; Singh, Mahavir; Raeber, Alex; Domingo, Mariano
2016-02-10
Vaccination of domestic animals has emerged as an alternative long-term strategy for the control of tuberculosis (TB). A trial under field conditions was conducted in a TB-free goat herd to assess the safety of the Mycobacterium bovis BCG vaccine. Eleven kids and 10 milking goats were vaccinated with BCG. Bacterial shedding and interferon gamma (IFN-γ) responses were monitored throughout the study. Comprehensive pathological examination and mycobacterial culture of target tissues were performed. BCG vaccine strain was only isolated from the draining lymph node of the injection site of a kid euthanized at week 8 post-vaccination. The remaining animals were euthanized at week 24. Six out of 20 showed small granulomas at the injection site. BCG shedding was not detected in either faeces or in milk throughout the study. All vaccinated kids showed BCG-induced IFN-γ responses at week 8 post-vaccination. BCG vaccination of goats showed no lack of biological safety for the animals, environment and public health, and local adverse reactions were negligible. Copyright © 2016 Elsevier Ltd. All rights reserved.
Inter-operator variation in ELISPOT analysis of measles virus-specific IFN-gamma-secreting T cells.
Ryan, J E; Ovsyannikova, I G; Dhiman, N; Pinsky, N A; Vierkant, R A; Jacobson, R M; Poland, G A
2005-01-01
The ELISPOT assay is a highly sensitive technique used for the detection of individual cytokine releasing cells. We have developed an IFN-gamma ELISPOT assay utilizing unfractionated frozen peripheral blood mononuclear cells (PBMC) to quantify the frequency of measles virus (MV)-specific IFN-gamma-secreting T cells in 117 healthy children who had been previously immunized with two doses of the measles-mumps-rubella vaccine. We have also estimated the variability associated with the quantification of ELISPOT plates and compared the number of MV-specific IFN-gamma-secreting T cells for each subject as determined by two different operators of an ELISPOT reader. The median frequency of MV-specific IFN-gamma-producing memory T cells detected by this assay was 0.005 % and 0.01 % as determined by an in-house and commercial operator, respectively. Although we found a significant correlation (r = 0.83, p<0.0001) between the number of spots counted by the commercial and in-house operators of an ELISPOT reader, the median number of spots counted by the commercial operator was twice the number of spots counted by an in-house operator (p<0.001). This demonstrates the importance of using a common ELISPOT reader and operator, among other parameters, to quantify the number of spots when a large volume of plates are being scanned and analyzed.
Igarashi, Ikuo; Suzuki, Reiko; Waki, Seiji; Tagawa, Yoh-Ichi; Seng, Seyha; Tum, Sothyra; Omata, Yoshitaka; Saito, Atsushi; Nagasawa, Hideyuki; Iwakura, Yohichiro; Suzuki, Naoyoshi; Mikami, Takeshi; Toyoda, Yutaka
1999-01-01
Babesia microti produces a self-limiting infection in mice, and recovered mice are resistant to reinfection. In the present study, the role of T cells in protective immunity against challenge infection was examined. BALB/c mice which recovered from primary infection showed strong protective immunity against challenge infection. In contrast, nude mice which failed to control the primary infection and were cured with an antibabesial drug did not show protection against challenge infection. Treatment of immune mice with anti-CD4 monoclonal antibody (MAb) diminished the protective immunity against challenge infection, but treatment with anti-CD8 MAb had no effect on the protection. Transfer of CD4+ T-cell-depleted spleen cells resulted in higher parasitemia than transfer of CD8+ T-cell-depleted spleen cells. A high level of gamma interferon (IFN-γ), which was produced by CD4+ T cells, was observed for the culture supernatant of spleen cells from immune mice, and treatment of immune mice with anti-IFN-γ MAb partially reduced the protection. Moreover, no protection against challenge infection was found in IFN-γ-deficient mice. On the other hand, treatment of immune mice with MAbs against interleukin-2 (IL-2), IL-4, or tumor necrosis factor alpha did not affect protective immunity. These results suggest essential requirements for CD4+ T cells and IFN-γ in protective immunity against challenge infection with B. microti. PMID:10417185
Byleveld, P M; Pang, G T; Clancy, R L; Roberts, D C
1999-02-01
Ingestion of fish oil can suppress the inflammatory response to injury and may impair host resistance to infection. To investigate the effect of a diet containing fish oil on immunity to viral infection, 148 BALB/c mice were fed diets containing 3 g/100 g of sunflower oil with either 17 g/100 g of fish oil or beef tallow for 14 d before intranasal challenge with live influenza virus. At d 1 and d 5 after infection, the mice fed fish oil had higher lung viral load and lower body weight (P < 0.05). In addition to the greater viral load and weight loss at d 5 after infection, the fish oil group consumed less food (P < 0.05) while the beef tallow group was clearing the virus, had regained their preinfection weights and was returning to their preinfection food consumption. The fish oil group had impaired production of lung interferon-gamma (IFN-gamma), serum immunoglobulin (Ig) G and lung IgA-specific antibodies (all P < 0. 05) although lung IFN-alpha/beta and the relative proportions of bronchial lymph node CD4+ and CD8+ T lymphocytes did not differ between groups after infection. The present study demonstrates a delay in virus clearance in mice fed fish oil associated with reduced IFN-gamma and antibody production and a greater weight loss and suppression of appetite following influenza virus infection. However, differences observed during the course of infection did not affect the ultimate outcome as both groups cleared the virus and returned to preinfection food consumption and body weight by d 7.
Sonoda, Soichiro; Yamaza, Haruyoshi; Ma, Lan; Tanaka, Yosuke; Tomoda, Erika; Aijima, Reona; Nonaka, Kazuaki; Kukita, Toshio; Shi, Songtao; Nishimura, Fusanori; Yamaza, Takayoshi
2016-01-01
Clinically, irreversible pulpitis is treated by the complete removal of pulp tissue followed by replacement with artificial materials. There is considered to be a high potential for autologous transplantation of human dental pulp stem cells (DPSCs) in endodontic treatment. The usefulness of DPSCs isolated from healthy teeth is limited. However, DPSCs isolated from diseased teeth with irreversible pulpitis (IP-DPSCs) are considered to be suitable for dentin/pulp regeneration. In this study, we examined the stem cell potency of IP-DPSCs. In comparison with healthy DPSCs, IP-DPSCs expressed lower colony-forming capacity, population-doubling rate, cell proliferation, multipotency, in vivo dentin regeneration, and immunosuppressive activity, suggesting that intact IP-DPSCs may be inadequate for dentin/pulp regeneration. Therefore, we attempted to improve the impaired in vivo dentin regeneration and in vitro immunosuppressive functions of IP-DPSCs to enable dentin/pulp regeneration. Interferon gamma (IFN-γ) treatment enhanced in vivo dentin regeneration and in vitro T cell suppression of IP-DPSCs, whereas treatment with tumor necrosis factor alpha did not. Therefore, these findings suggest that IFN-γ may be a feasible modulator to improve the functions of impaired IP-DPSCs, suggesting that autologous transplantation of IFN-γ-accelerated IP-DPSCs might be a promising new therapeutic strategy for dentin/pulp tissue engineering in future endodontic treatment. PMID:26775677
So, H S; Jung, B H; Yeum, S S; Park, J S; Kim, M S; Lee, J H; Chung, S Y; Choi, S; Chae, H J; Kim, H R; Ko, C B; Chung, H T; Park, R
2000-11-01
Although it has been well known that the role of LPS on liver damage is mediated through TNF-alpha, the mechanism by which LPS modulates the cytotoxicity of IFN-gamma on hepatocytes has not yet been clearly demonstrated. Here, we demonstrate that IFN-gamma mediated apoptosis in murine embryonic hepatocyte BNL CL2 cells is potentiated by the addition of LPS (0.5 microg/ml). Consistently, LPS markedly increases the catalytic activity of caspase 3-like protease but not caspase 1-like protease in IFN-gamma treated cells. In addition, TNF-alpha alone does not affect cell viability but rather it potentiates the cytotoxic effect of IFN-gamma on BNL CL2 cells. However, the cell viability of IFN-gamma/LPS treated cells is affected by the addition of polymyxin B but not by TNF binding protein I (TNF-BPI). These data suggest that the lipid moiety of LPS may mediate direct cytotoxicity of BNL CL2 cells in a TNF-alpha independent manner.
Interferon in resistance to bacterial and protozoan infections
NASA Technical Reports Server (NTRS)
Sonnenfeld, Gerald; Gould, Cheryl L.; Kierszenbaum, Felipe; Degee, Antonie L. W.; Mansfield, John M.
1986-01-01
The effects of genetic differences in mouse strains on the modulation of protozoan infections by interferon (IFN) were investigated. In one set of experiments, three different strains of mice were injected with T. cruzi, and their sera were assayed at five time intervals for IFN titer. A greater quantity of IFN was produced by mouse strains that were susceptible to T. cruzi infection than by the more resistant strain. In another set of experiments, spleen cell cultures from inbred strains of mice were challenged with an antigen made from T.b. rhodesiense. The cells from mice resistant to infection, produced greater amounts of IFN-gamma than did cells from the susceptible mice. In a third set of experiments, it was found that mice injected with T.b. rhodesiense before being infected with a diabetogenic virus (EMC-D) were resistant to the effects of the virus and did not produce virus-specific antibody.
USDA-ARS?s Scientific Manuscript database
Interferons (IFNs) are key cytokines identified in vertebrates, and evolutionary dominance of intronless IFN genes in amniotes is a signature event in IFN evolution. For the first time, we show that the emergence and expansion of intronless IFN genes is evident in amphibians, shown by 24-37 intronle...
Young, A M; Marsden, J; Goodman, A; Burton, A; Dunn, J A
2001-01-01
Dacarbazine (DTIC) has been the mainstay of chemotherapy for metastatic melanoma for over two decades, but only 15%-20% of patients respond and benefit is usually transient. Randomized studies combining DTIC with interferon-alpha (IFN-alpha) in advanced disease have so far been inconclusive in terms of response and survival. We report a randomized prospective pilot Phase III trial of DTIC +IFN-alpha in patients with metastatic melanoma. The primary endpoint was death. A total of 61 patients were randomized between April 1995 and April 1998. Differences in survival between groups were assessed using log-rank analysis. Quality of life was measured using the European Organization for Research on Treatment of Cancer QLQ C30 (+3) questionnaire. Fifty-seven patients died during the study. The median survival for patients receiving DTIC was 7.2 months (95% confidence interval (CI) 4.4-9.0); it was 4.8 months for DTIC + IFN-alpha (95% CI 2.0-8.0). There was no significant difference in survival between the two treatment arms (chi2 unadjusted = 0.15, P = 0.70; chi2 adjusted = 0.01, P = 0.91). The 6-month survival of those patients randomized to DTIC alone was 58% compared with 40% for those patients randomized to DTIC + IFN-alpha. There were no differences in quality of life between treatment groups. This study failed to demonstrate a survival benefit for patients receiving IFN-alpha in combination with DTIC. These results are inconclusive primarily owing to the small size of the trial. A meta-analysis is required to determine whether there is a role for the addition of IFN-alpha to DTIC in the treatment of this disease.
Cross-talk between interferon-gamma and interleukin-18 in melanogenesis.
Zhou, Jia; Ling, Jingjing; Wang, Yong; Shang, Jing; Ping, Fengfeng
2016-10-01
Skin is the largest organ in our body and strategically placed to provide a metabolically active biological barrier against a range of noxious stressors. A lot of inflammatory cytokines, which are increased after ultraviolet (UV) irradiation produced by keratinocytes or other immunocytes, are closely related to pigmentary changes, including interleukin-18 (IL-18) and interferon-γ (IFN-γ). In this study, the effect of cross-talk between IL-18 and IFN-γ on melanogenesis was investigated. Treatment with IL-18 resulted in a dose-dependent increase of melanogenesis, while IFN-γ made an opposite effect. This influence of IL-18 and IFN-γ was mediated by regulations of microphthalmia-associated transcription factor (MITF) and its downstream enzymatic cascade expressions. Furthermore, IFN-γ inhibited basal and IL-18-induced melanogenesis. IFN-γ increased signal transducer and activator of transcription-1 (STAT-1) phosphorylation to play its position in regulating melanin pigmentation, and its inhibitory effect could be prevented by Janus Kinase 1 (JAK 1) inhibitor. IFN-γ could inhibit melanogenesis by decreasing melanocyte dendrite formation. In addition, IFN-γ inhibited the expressions of Rab Pases to suppress the mature and transport of melanosomes. IL-18 could rapidly induce Akt and PTEN phosphorylation and p65 expression in B16F10 cells. When treatment with IL-18 and IFN-γ together, the phosphorylation level of Protein Kinase B (Akt) and phosphatase and tensin homolog deleted on chromosome ten (PTEN) and expression of p65 NF-κB were inhibited, compared with treated with IL-18 only. Our studies indicated that IFN-γ could directly induce B16F10 cells apoptosis in vitro. Furthermore, we demonstrated that IFN-γ markedly up-regulated IL-18 binding protein (BP) production in normal human foreskin-derived epidermal keratinocytes in dose-dependent manner. UVB irradiation induced protease-activated receptor-2 (PAR-2) expression in NHEK, IFN-γ could inhibit this
Lahuerta-Marin, Angela; Gallagher, Martin; McBride, Stewart; Skuce, Robin; Menzies, Fraser; McNair, Jim; McDowell, Stanley W J; Byrne, Andrew W
2015-09-04
Bovine tuberculosis (bTB), caused by Mycobacterium bovis, is a serious infectious disease that remains an ongoing concern for cattle farming worldwide. Tuberculin skin-tests are often used to identify infected animals (reactors) during test-and-cull programs, however, due to relatively poor sensitivity, additional tests can be implemented in parallel. For example, in Northern Ireland interferon-gamma (IFN-g) testing is used in high-risk herds. However, skin-test negative animals which are positive to the IFN-g test are not required by law to be slaughtered - therefore the final choice for these animals' fate is left with the owner. During this study we investigated whether these animals represented a greater risk of becoming a skin reactor, relative to IFN-g test negative animals from the same herds. Our study population included 1107 IFN-g positive animals from 239 herds. A Cox-proportional hazard model indicated that animals which tested IFN-g positive were 2.31 times (95% CI: 1.92-2.79; P < 0.001) more likely to become a reactor compared with IFN-g negative animals. Animals from dairy herds, and from herds in the south-east, were of higher risk than animals from beef herds and other regions, respectively. Our findings suggest that IFN-g positive animals represent a higher risk of failing a skin-test in the future, indicating the value of IFN-g testing for identifying early-stage infected animals. These IFN-g positive animals are not under any disease restriction, and may move freely (trade), which may put recipient herds at increased risk. Our findings provide important evidence for stakeholders engaged in bTB eradication programs.
Mosaad, Y M; Soliman, O E; Tawhid, Z E; Sherif, D M
2010-10-01
The aim was to investigate the association of interferon-gamma (IFN-γ) +874 T/A and interleukin-10 (IL-10)-1082 A/G single nucleotide polymorphisms with tuberculous infection and post-BCG lymphadenitis in Egyptian children. IFN-γ +874 T/A and IL-10 -1082 A/G polymorphism detection by amplification refractory mutation system technique was carried out for 110 patients with TB, 40 patients with post-BCG lymphadenitis and 118 healthy controls. IFN-γ +874 A allele was higher in TB and post-BCG patients than those in healthy controls (Pc=0.006 and 0.002, respectively). IFN-γ +874 genotype AA was significantly higher in patients with TB than that in control (Pc=0.015), in extrapulmonary than patients with pulmonary TB (PTB) (Pc=0.009), and young children with TB below 5 years (Pc=0.024). No statistically significant differences were observed between patients with TB and controls for the frequency of IL-10(-1082) alleles or genotypes (P>0.05); however, a statistically significant difference in the frequency of IL-10 (-1082) GG genotype was found between patients with pulmonary and extrapulmonary TB (Pc=0.003). Low producer IFN-γ +874 A/A genotype is associated with post-BCG lymphadenitis and TB disease especially in younger children below 5 years. IL-10-1082 G/G genotype did not exhibit significant association except for increased GG frequency in PTB. Both cytokine polymorphisms have no relation to tuberculin reaction in patients with TB. © 2010 The Authors. Scandinavian Journal of Immunology © 2010 Blackwell Publishing Ltd.
PM-17INTRACEREBRAL IFN-γ DOES NOT ENHANCE THE RESPONSE TO VACCINE IMMUNOTHERAPY FOR CANINE GLIOMA
Pluhar, Liz; Olin, Michael; Goulart, Michelle; Andersen, Brian; Hunt, Matt; Ohlfest, John
2014-01-01
Due to the complexity of human tumor environment and host immune interactions, the majority of successful brain cancer therapies in rodent models fail to show the same efficacy when translated to human patients. Pet dogs with spontaneous glioma recapitulate important features of human disease and we have used this more representative model to assess the response to vaccine immunotherapy with and without interferon gamma (IFN-γ) gene therapy after surgery. Dogs with newly diagnosed glioma underwent surgical tumor debulking and were randomized to receive 1) autologous tumor lysate vaccines with CpG ODN as an adjuvant (n = 12) or 2) Ad-mediated interferon gamma (IFN-γ) gene therapy injected around the resection cavity followed by vaccine immunotherapy (n = 12). A grade IV IFN-γ dose-related toxicity (severe encephalitis and lymphocytic perivascular cuffing) resulted in death of one dog. No further adverse events were seen at a lower IFN-γ dose supporting the safety of the treatment. This immunotherapy activated a humoral response with specific tumor-reactive IgG antibodies detected after vaccination in all dogs. Addition of IFN-γ gene therapy did not affect the median overall survival time of 204 days versus 211 days with vaccine alone. As expected, there were significant differences (P = 0.036) in survival between dogs with low-grade (369 days) versus high-grade (204 days) tumors. During postmortem analysis, no dog with a low-grade tumor had recurrence, whereas all dogs with grade III/IV tumors died from progression. We hoped that forced IFN-γ expression would sensitize residual tumor cells to CTL recognition and recruit NK cells to kill MHC Ilow/- cells, thereby enhancing the effects of vaccine immunotherapy. Our data failed to support this theory, however the lack of difference could be due to the small number of dogs in each group (type II error) or to insufficient in situ expression of IFN-γ to elicit the desired effect.
Interferon-Gamma Promotes UV-Induced Melanoma in Mice | Center for Cancer Research
Scientists have made an unanticipated discovery in mice that interferon-gamma, a type of protein primarily used by the immune system for intercellular communication, acts as a promoter for the deadly form of skin cancer known as melanoma. This finding resulted from a series of experiments designed to understand how solar ultraviolet (UV) radiation causes melanoma. This study suggests that interferon-gamma, which has been thought to contribute to an innate defense system against cancer, under some circumstances, may instead promote melanoma and incite the development of tumors.
Paul-Samojedny, Monika; Owczarek, Aleksander; Suchanek, Renata; Kowalczyk, Malgorzata; Fila-Danilow, Anna; Borkowska, Paulina; Kucia, Krzysztof; Kowalski, Jan
2011-03-01
Schizophrenia is a multifactorial disease with changes affecting the immune system. Dysregulation of the cytokine network in schizophrenia has been well documented. Such changes may occur due to disturbances in cytokine levels that are linked to polymorphisms of cytokine genes. However, research in the role of cytokine gene polymorphisms in schizophrenia has been surprisingly scanty. The aim of this study was to identify, in a case control study, whether polymorphism of IFN-γ gene is a risk factor for the development of paranoid schizophrenia. To the best of our knowledge, this is the first study that examines the association between the IFN-γ gene polymorphism and psychopathological symptoms in patients with paranoid schizophrenia. Polymorphism of IFN-γ (+874T/A, rs 62559044) in schizophrenic patients (n=179), as well as healthy individuals (n=196), both Polish residents, was genotyped using AS-PCR method. Of note, when analyzing the results, we took into consideration the gender of studied individuals. Surprisingly, a single-nucleotide polymorphism in the first intron of the IFN-γ gene was found to be associated with paranoid schizophrenia in males, but not in females. The presence of allele A at position +874 in the IFN-γ gene correlates with 1.66-fold higher risk of paranoid schizophrenia development in males. Differences in the genotypes may have an important role in determining the level of I gene transcription. Because other polymorphisms have been demonstrated to influence IFN-γ transcription, further analysis is necessary to clarify the role of this gene in the pathogenesis of paranoid schizophrenia.
Zibara, Kazem; Zeidan, Asad; Bjeije, Hassan; Kassem, Nouhad; Badran, Bassam; El-Zein, Nabil
2017-03-01
Interferon gamma (IFN-ɣ) is a pleiotropic cytokine which plays dual contrasting roles in cancer. Although IFN-ɣ has been clinically used to treat various malignancies, it was recently shown to have protumorigenic activities. Reactive oxygen species (ROS) are overproduced in cancer cells, mainly due to NADPH oxidase activity, which results into several changes in signaling pathways. In this study, we examined IFN-ɣ effect on the phosphorylation levels of key signaling proteins, through ROS production, in the human breast cancer cell line MCF-7. After treatment by IFN-ɣ, results showed a significant increase in the phosphorylation of STAT1, Src, raf, AKT, ERK1/2 and p38 signaling molecules, in a time specific manner. Src and Raf were found to be involved in early stages of IFN-ɣ signaling since their phosphorylation increased very rapidly. Selective inhibition of Src-family kinases resulted in an immediate significant decrease in the phosphorylation status of Raf and ERK1/2, but not p38 and AKT. On the other hand, IFN-ɣ resulted in ROS generation, through H 2 O 2 production, whereas pre-treatment with the ROS inhibitor NAC caused ROS inhibition and a significant decrease in the phosphorylation levels of AKT, ERK1/2, p38 and STAT1. Moreover, pretreatment with a selective NOX1 inhibitor resulted in a significant decrease of AKT phosphorylation. Finally, no direct relationship was found between ROS production and calcium mobilization. In summary, IFN-ɣ signaling in MCF-7 cell line is ROS-dependent and follows the Src/Raf/ERK pathway whereas its signaling through the AKT pathway is highly dependent on NOX1.
Tálas, M; Bátkai, L; Stöger, I; Nagy, K; Hiros, L; Konstantinova, I; Kozharinov, V
1983-01-01
The influence of spaceflight conditions on the biological activity of HuIFN-alpha preparations (lyophilized, in solution and in ointment) and interferon inducers was studied. In antiviral activity no difference was observed between the samples kept aboard the spaceship and the controls kept under ground conditions. The interferon inducers poly I:C, poly G:C and gossipol placed in the space laboratory for 7 days maintained their interferon-inducing capacity. The circulating interferon level in mice was the same irrespective of the induction being performed with flight or ground-control samples of inducers.
Razaghi, Ali; Owens, Leigh; Heimann, Kirsten
2016-12-20
Human interferon gamma is a cytokine belonging to a diverse group of interferons which have a crucial immunological function against mycobacteria and a wide variety of viral infections. To date, it has been approved for treatment of chronic granulomatous disease and malignant osteopetrosis, and its application as an immunotherapeutic agent against cancer is an increasing prospect. Recombinant human interferon gamma, as a lucrative biopharmaceutical, has been engineered in different expression systems including prokaryotic, protozoan, fungal (yeasts), plant, insect and mammalian cells. Human interferon gamma is commonly expressed in Escherichia coli, marketed as ACTIMMUNE ® , however, the resulting product of the prokaryotic expression system is unglycosylated with a short half-life in the bloodstream; the purification process is tedious and makes the product costlier. Other expression systems also did not show satisfactory results in terms of yields, the biological activity of the protein or economic viability. Thus, the review aims to synthesise available information from previous studies on the production of human interferon gamma and its glycosylation patterns in different expression systems, to provide direction to future research in this field. Copyright © 2016 Elsevier B.V. All rights reserved.
2012-01-01
Background The synergistic combination of interferon (IFN) alpha-2b and IFN gamma results in more potent in vitro biological effects mediated by both IFNs. The aim of this investigation was to evaluate by first time the pharmacokinetics and pharmacodynamics of this combination in patients with mycosis fungoides. Methods An exploratory, prospective, open-label clinical trial was conducted. Twelve patients, both genders, 18 to 75 years-old, with mycosis fungoides at stages IB to III, were eligible for the study. All of them received intramuscularly a single high dose (23 × 106 IU) of a novel synergistic IFN mixture (HeberPAG®) for pharmacokinetic and pharmacodynamic studies. Serum IFN alpha-2b and IFN gamma concentrations were measured during 96 hours by commercial enzyme immunoassays (EIA) specific for each IFN. Other blood IFN-inducible markers and laboratory variables were used as pharmacodynamics and safety criteria. Results The pharmacokinetic evaluation by EIA yielded a similar pattern for both IFNs that are also in agreement with the well-known described profiles for these molecules when these are administered separately. The average values for main parameters were: Cmax: 263 and 9.3 pg/mL; Tmax: 9.5 and 6.9 h; AUC: 4483 and 87.5 pg.h/mL, half-life (t1/2): 4.9 and 13.4 h; mean residence time (MRT): 13.9 and 13.5 h, for serum IFN alpha-2b and IFN gamma, respectively. The pharmacodynamic variables were strongly stimulated by simultaneous administration of both IFNs: serum neopterin and beta-2 microglobulin levels (β2M), and stimulation of 2’-5’ oligoadenylate synthetase (OAS1) mRNA expression. The most encouraging data was the high increment of serum neopterin, 8.0 ng/mL at 48 h, not been described before for any unmodified or pegylated IFN. Additionally, β2M concentration doubled the pre-dose value at 24–48 hours. For both variables the values remained clearly upper baseline levels at 96 hours. Conclusions HeberPAG®possesses improved
Interferon Lambda: A New Sword in Cancer Immunotherapy
Lasfar, Ahmed; Abushahba, Walid; Balan, Murugabaskar; Cohen-Solal, Karine A.
2011-01-01
The discovery of the interferon-lambda (IFN-λ) family has considerably contributed to our understanding of the role of interferon not only in viral infections but also in cancer. IFN-λ proteins belong to the new type III IFN group. Type III IFN is structurally similar to type II IFN (IFN-γ) but functionally identical to type I IFN (IFN-α/β). However, in contrast to type I or type II IFNs, the response to type III IFN is highly cell-type specific. Only epithelial-like cells and to a lesser extent some immune cells respond to IFN-λ. This particular pattern of response is controlled by the differential expression of the IFN-λ receptor, which, in contrast to IFN-α, should result in limited side effects in patients. Recently, we and other groups have shown in several animal models a potent antitumor role of IFN-λ that will open a new challenging era for the current IFN therapy. PMID:22190970
Inada, Takefumi; Kubo, Kozue; Shingu, Koh
2010-10-01
Propofol is an intravenous anesthetic, widely used for general anesthesia during surgery, which inevitably involves tissue trauma with inflammation. At sites of inflammation, prostanoids, especially prostaglandin E₂ (PGE₂), are abundant. This study addresses the effect of propofol on macrophage PGE₂ production. Using thioglycollate-elicited murine peritoneal macrophages, propofol (7.5-30 μM) suppressed lipopolysaccharide-induced PGE₂ production. The suppression was via the direct inhibition of cyclooxygenase (COX) enzyme activity and due neither to the downregulation of COX expression nor the inhibition of arachidonic acid release from plasma membranes. In macrophage:natural killer (NK) cell co-culture, propofol dramatically increased interferon-gamma (IFN-γ) production, and the actions of propofol were mimicked by a selective COX-2 inhibitor, NS-398, as well as the selective EP4 receptor antagonist L-161,982, suggesting a role of PGE₂ suppression in the upregulation of IFN-γ production. Furthermore, in purified NK cell culture, PGE₂ directly suppressed the production of IFN-γ by activated NK cells, which was reversed by selective inhibition of EP4 activity. Taken together, our results show that, in macrophage:NK cell co-culture, propofol, through the suppression of macrophage PGE₂ production, upregulates NK cell IFN-γ production by alleviating EP4 receptor-mediated suppression of IFN-γ production. Propofol may potentially exert considerable influence on inflammation and immunity by suppressing PGE₂ synthesis. Copyright © 2010 Elsevier B.V. All rights reserved.
Yuan, Yitong; Liu, Shunqi; Zhao, Yue; Lian, Ling; Lian, Zhengxing
2018-01-01
Interferon-γ (IFN-γ) is critical for innate and adaptive immunity against viral and bacterial infections. IFN-γ reportedly affects the phagocytic ability of monocytes and macrophages as well as regulates pituitary function in humans and mice. The present study analyzed the impact of IFN-γ on monocyte and macrophage phagocytosis, production performance, and pituitary function in vivo and in vitro (in dwarf chickens). IFN-γ was injected into dwarf chickens through a vein, and then, the laying rate, average egg weight, and levels of follicle-stimulating hormone (FSH) and IFN-γ were measured in treatment and control groups. For the in vitro experiment, the pituitary tissues were supplemented with IFN-γ, and the mRNA expression levels of follicle-stimulating hormone beta subunit ( FSH-β ), interferon gamma receptor 1 ( IFNGR 1), and interferon gamma receptor 2 ( IFNGR 2) in the pituitary were assessed. Monocyte and macrophage phagocytosis product (PP) was decreased by IFN-γ treatment in a dose-dependent manner in vitro. In the in vivo experiment, the level of IFN-γ in the treatment group was higher than that in the control group at 7 d ( P < 0.05), 14 d ( P < 0.01), and 21 d ( P < 0.01) post-injection. Compared with the control group, monocyte and macrophage PP was lower in the treatment group after injection ( P < 0.01). The laying rate was higher in the treatment group than in the control group at 2 and 3 wk post-injection ( P < 0.05). There was a significant difference between the treatment and control groups in the levels of FSH at 1, 3, 7, and 14 d post-injection ( P < 0.01). In the in vitro experiment, increased mRNA expression levels of FSH-β , IFNGR 1, and IFNGR 2 were observed in the treatment group after stimulation with 100 U/mL IFN-γ for 24 h compared to those in the control group ( P < 0.05). IFN-γ inhibited the phagocytosis of monocytes and macrophages; up-regulated the mRNA expression levels of the FSH
Gri, Giorgia; Chiodoni, Claudia; Gallo, Elena; Stoppacciaro, Antonella; Liew, Foo Y; Colombo, Mario P
2002-08-01
IFN-gamma knockout mice (GKO) rejected C26 colon carcinoma cells transduced to secrete interleukin(IL)-12 but do not reject similarly transduced TSA mammary adenocarcinoma (C26/12 and TSA/12 cells, respectively). To determine whether such difference could be because of a different tumor response to IFN-gamma, we injected BALB/c mice with TSA, C26, and their IL-12-transduced counterparts rendered unresponsive to IFN-gamma by stable transduction of a dominant negative (DN), truncated IFN-gamma receptor alpha chain. TSA/DN and C26/DN showed the same in vivo growth kinetics as parental cells, whereas coexpression of IL-12 induced rejection independent of tumor-cell responsiveness to IFN-gamma. This suggests that the role of IFN-gamma is primarily in activating the host immune response, which appears to depend on the intrinsic immunogenicity of the target tumor. C26 and TSA share a common tumor-associated antigen, yet C26 cells are more immunogenic than TSA. C26/12 expressed 10-fold higher levels of class I MHC molecules and induced higher CTL activity compared with TSA/12 cells in GKO mice. Moreover, whereas in GKO mice the TSA/12 tumor was associated with a greater number of infiltrating T cells, only those infiltrating C26/12 tumor expressed the activation marker OX40. The search for cytokine(s) that might contribute in determining the different T-cell response to these IL-12-transduced tumors in GKO mice revealed a role of IL-15. In situ hybridization showed IL-15 expression in C26/12 but not in TSA/12 tumors. In addition, injection of GKO mice with soluble IL-15 receptor-alpha to block IL-15 expression prevented rejection of C26/12 cells. Together, the results suggest that in the absence of IFN-gamma, IL-12 can exert antitumor activity through alternative mechanisms, depending on the tumor cell type and the availability of cytokines that can replace IFN-gamma in sustaining T-cell functions.
CCR6 and NK1.1 distinguish between IL-17A and IFN-gamma-producing gammadelta effector T cells.
Haas, Jan D; González, Frano H Malinarich; Schmitz, Susanne; Chennupati, Vijaykumar; Föhse, Lisa; Kremmer, Elisabeth; Förster, Reinhold; Prinz, Immo
2009-12-01
Gammadelta T cells are a potent source of innate IL-17A and IFN-gamma, and they acquire the capacity to produce these cytokines within the thymus. However, the precise stages and required signals that guide this differentiation are unclear. Here we show that the CD24(low) CD44(high) effector gammadelta T cells of the adult thymus are segregated into two lineages by the mutually exclusive expression of CCR6 and NK1.1. Only CCR6+ gammadelta T cells produced IL-17A, while NK1.1+ gammadelta T cells were efficient producers of IFN-gamma but not of IL-17A. Their effector phenotype correlated with loss of CCR9 expression, particularly among the NK1.1+ gammadelta T cells. Accordingly, both gammadelta T-cell subsets were rare in gut-associated lymphoid tissues, but abundant in peripheral lymphoid tissues. There, they provided IL-17A and IFN-gamma in response to TCR-specific and TCR-independent stimuli. IL-12 and IL-18 induced IFN-gamma and IL-23 induced IL-17A production by NK1.1+ or CCR6+ gammadelta T cells, respectively. Importantly, we show that CCR6+ gammadelta T cells are more responsive to TCR stimulation than their NK1.1+ counterparts. In conclusion, our findings support the hypothesis that CCR6+ IL-17A-producing gammadelta T cells derive from less TCR-dependent selection events than IFN-gamma-producing NK1.1+ gammadelta T cells.
Zhang, Xiaobo; De Paiva, Cintia S; Su, Zhitao; Volpe, Eugene A; Li, De-Quan; Pflugfelder, Stephen C
2014-01-01
Evidence suggests that the cytokine interferon (IFN)-γ released by natural killer and CD4(+) T cells contributes to the conjunctival goblet cell (GC) loss in dry eye. The purpose of this study was to investigate if topical neutralization of IFN-γ prevents or alleviates GC loss in an experimental desiccating stress (DS) model of dry eye. In this study, we found that topical IFN-γ neutralization significantly decreased DS-induced conjunctival GC loss. This was accompanied by decreased epithelial apoptosis, and increased IL-13 and decreased FoxA2 expression in the forniceal conjunctiva. To establish that IFN-γ produced by pathogenic CD4(+) T cells contributes to DS-induced GC loss, adoptive transfer of CD4(+) T cells isolated from DS exposed donors to naïve RAG-1(-/-) recipient mice was performed. Similar to the donor mice, topical IFN-γ neutralization decreased conjunctival GC loss, suppressed apoptosis and increased IL-13 expression in adoptive transfer recipients. In summary, this study demonstrated that topical neutralization of IFN-γ prevents GC loss via modulating apoptosis and maintaining IL-13 signaling. Copyright © 2013 Elsevier Ltd. All rights reserved.
Bielecka, Teresa; Komorowska-Piotrowska, Anna; Krenke, Katarzyna; Feleszko, Wojciech; Kulus, Marek
2018-02-01
To assess whether children ≤5 years of age, produce sufficient amounts of interferon gamma (IFN-ɣ) in response to phytohaemagglutinin (mitogen), and Mycobacterium tuberculosis antigens (TB antigens) in the QuantiFERON-TB Gold in-Tube test (QFT-GIT), (Cellestis Ltd., Australia). Is TB-antigen-induced IFN-ɣ response in children ≤5 years sufficient to consider QFT-GIT a possible tool for TB diagnostics? Study design, patient-subject selection, and methods: We recruited children 0-17 years old suspected of TB infection to this cross-sectional study, in whom QFT-GIT and TST were performed. We analyzed the median IFN-ɣ levels in mitogen and TB antigen tubes in children ≤5 years and >5 years, and the correlation between IFN-ɣ level in both tubes and age. A total of 153 children were enrolled, age median was 7.8 (IQR:8), 45 (29.4%) aged ≤5 years (median 3.4, IQR:1.7), 108 > 5 years (median 10.55, IQR:5.93). In the mitogen tubes, the median IFN-ɣ level was higher in children >5 years (median 17.87, IQR:2.1 vs 16.77, IQR:7.6), but surprisingly in the TB antigen tubes it was higher in the younger group (median 0.12, IQR:0.21vs 0.06, IQR:0.09, P = 0.04). We proved a positive correlation between IFN-ɣ level and age in mitogen tubes (r = 0.18, P = 0.03) and a negative correlation in TB antigen tubes (r = -0.17, P = 0.04). In latent tuberculosis infection patients, the latter correlation was found to be even stronger (r = -0.39, P = 0.01). The youngest children release sufficient amount of IFN-ɣ in response to TB antigens thus QFT-GIT might be a useful tool for TB diagnostics in this age group. © 2017 Wiley Periodicals, Inc.
Kelly, Aoife; Robinson, Mark W; Roche, Gerard; Biron, Christine A; O'Farrelly, Cliona; Ryan, Elizabeth J
2016-12-01
The interferon lambda (IFN-λ) cytokines have well-known antiviral properties, yet their contribution to immune regulation is not well understood. Epithelial cells represent the major target cell of IFN-λ; peripheral blood mononuclear cells are generally considered nonresponsive, with the exception of plasmacytoid dendritic cells (pDCs). In this study we aimed to define the potential for discrete subpopulations of cells to directly respond to IFN-λ. Analysis of peripheral blood leukocytes reveals that, while pDCs uniformly express the highest levels of IFN-λ receptor, a small proportion of B cells and monocytes also express the receptor. Nevertheless, B cells and monocytes respond poorly to IFN-λ stimulation in vitro, with minimal STAT phosphorylation and interferon-stimulated gene (ISG) induction observed. We confirm that pDCs respond to IFN-λ in vitro, upregulating their expression of pSTAT1, pSTAT3, and pSTAT5. However, we found that pDCs do not upregulate pSTAT6 in response to IFN-λ treatment. Our results highlight unique aspects of the response to IFN-λ and confirm that while the IFN-λ receptor is expressed by a small proportion of several different circulating immune cell lineages, under normal conditions only pDCs respond to IFN-λ stimulation with robust STAT phosphorylation and ISG induction. The difference in STAT6 responsiveness of pDCs to type I and type III interferons may help explain the divergence in their biological activities.
Regulation by interferon alpha of immunoglobulin isotype selection and lymphokine production in mice
1991-01-01
Antigens and infectious agents that stimulate interferon alpha(IFN- alpha) production in mice induce antibody responses that are predominantly of the immunoglobulin (Ig)G2a isotype and contain little or no IgE. This suggested the possibility that IFN-alpha might have a role in directing Ig isotype selection. Consistent with this possibility, we have found that injection of mice with recombinant mouse IFN-alpha suppresses IgE secretion, enhances IgG2a secretion, and has no independent effect on IgG1 secretion in mice stimulated with a foreign anti-IgD antibody. Injection of mice with polyinosinic acid.polycytidylic acid (poly I.C), an inducer of macrophage IFN-alpha production, also suppresses the anti-IgD antibody-induced IgE response and stimulates the IgG2a response; these effects are blocked by a sheep antibody that neutralizes mouse IFN-alpha/beta. Both recombinant IFN- alpha and poly I.C have maximum IgE suppressive and IgG2a stimulatory effects when injected early in the anti-IgD antibody-induced immune response. Addition of IFN-alpha to mouse B cells cultured with lipopolysaccharide (LPS) + interleukin 4 (IL-4) suppresses both IgG1 and IgE production, but much less potently than IFN-gamma. IFN-alpha suppresses anti-IgD antibody-induced increases in the level of splenic IL-4 mRNA, but enhances the anti-IgD antibody-induced increase in the splenic level of IFN-gamma mRNA. These results are consistent with the effect of IFN-alpha on Ig isotype expression in mice, as IL-4 stimulates IgE and suppresses IgG2a secretion while IFN-gamma exerts opposite effects. These observations suggest that antigen presenting cells, by secreting IFN-alpha early in the course of an immune response, can influence the nature of that response both through direct effects on B cells and by influencing the differentiation of T cells. PMID:1940796
Adjuvant immunotherapy of feline fibrosarcoma with recombinant feline interferon-omega.
Hampel, Verena; Schwarz, Bianca; Kempf, Christine; Köstlin, Roberto; Schillinger, Ulrike; Küchenhoff, Helmut; Fenske, Nora; Brill, Thomas; Hirschberger, Johannes
2007-01-01
Recombinant feline interferon-omega (rFeIFN-omega) was tested as a treatment option for cats with fibrosarcoma to assess safety and feasibility. Treatment with rFeIFN-omega in cats with fibrosarcoma is safe and feasible. Twenty domestic cats. In an open-labeled uncontrolled clinical trial 12 injections of 1 x 10(6) U/kg rFeIFN-omega were administered over a 5-week period: the 1st through 4th injections were given intratumorally, and the 5th through 12th injections were administered subcutaneously at the tumor excision site. Wide surgical excision of the tumors was carried out after the 4th injection and before the 5th injection of rFeIFN-omega. A Common Terminology Criteria for Adverse Events (CTCAE) analysis was conducted. Flow cytometry of fibrosarcoma cells after incubation with rFeIFN-omega and recombinant feline interferon-gamma was performed to assess the biological effect of rFeIFN-omega. Changes in blood cell count, increases in serum aspartate-amino-transferase activity, serum bilirubin concentration, serum creatinine and serum electrolyte concentrations, weight loss, anorexia, increased body temperature, and reduced general condition were observed but were mostly minor (grade 1 and 2) and self limiting. Eosinophilia (P = .025), neutropenia (P = .021), and weight loss (P < .001) were statistically correlated with rFeIFN-omega-treatment (analysis of parameters before treatment and after 3 injections of rFeIFN-omega). Flow cytometry of 5 unrelated feline fibrosarcoma cell lines showed increased expression of major histocompatibility complex (MHC) class I molecules (P = .026) in response to in vitro incubation with rFeIFN-omega, whereas expression of MHC class II molecules was not affected significantly. RFeIFN-omega for the treatment of feline fibrosarcoma is safe, well tolerated, and can be easily performed in practice. To assess the efficacy of the treatment, it should be tested in a placebo-controlled trial.
Meager, A; Wadhwa, M; Dilger, P; Bird, C; Thorpe, R; Newsom-Davis, J; Willcox, N
2003-04-01
We have screened for spontaneous anticytokine autoantibodies in patients with infections, neoplasms and autoimmune diseases, because of their increasingly reported co-occurrence. We tested for both binding and neutralizing autoantibodies to a range of human cytokines, including interleukin-1alpha (IL-1alpha), IL-1beta, IL-2, IL-4, IL-6, IL-8, IL-10, IL-12, IL-18, interferon-alpha2 (IFN-alpha2), IFN-omega, IFN-beta, IFN-gamma, tumour necrosis factor alpha (TNF-alpha), transforming growth factor beta-1 (TGF-beta1) and granulocyte-macrophage colony stimulating factor (GM-CSF), in plasmas or sera. With two notable exceptions described below, we found only occasional, mostly low-titre, non-neutralizing antibodies, mainly to GM-CSF; also to IL-10 in pemphigoid. Strikingly, however, high-titre, mainly IgG, autoantibodies to IFN-alpha2, IFN-omega and IL-12 were common at diagnosis in patients with late-onset myasthenia gravis (LOMG+), thymoma (T) but no MG (TMG-) and especially with both thymoma and MG together (TMG+). The antibodies recognized other closely related type I IFN-alpha subtypes, but rarely the distantly related type I IFN-beta, and never (detectably) the unrelated type II IFN-gamma. Antibodies to IL-12 showed a similar distribution to those against IFN-alpha2, although prevalences were slightly lower; correlations between individual titres against each were so modest that they appear to be entirely different specificities. Neither showed any obvious correlations with clinical parameters including thymoma histology and HLA type, but they did increase sharply if the tumours recurred. These antibodies neutralized their respective cytokine in bioassays in vitro; although they persisted for years severe infections were surprisingly uncommon, despite the immunosuppressive therapy also used in most cases. These findings must hold valuable clues to autoimmunizing mechanisms in paraneoplastic autoimmunity.
Hattori, Kayoko; Nishikawa, Makiya; Watcharanurak, Kanitta; Ikoma, Akihiko; Kabashima, Kenji; Toyota, Hiroyasu; Takahashi, Yuki; Takahashi, Rei; Watanabe, Yoshihiko; Takakura, Yoshinobu
2010-03-01
The short in vivo half-life of IFN-gamma can prevent the cytokine from inducing immunological changes that are favorable for the treatment of Th2-dominant diseases, such as atopic dermatitis. To examine whether a sustained supply of IFN-gamma is effective in regulating the balance of Th lymphocyte subpopulations, plasmid vector encoding mouse IFN-gamma, pCpG-Mugamma, or pCMV-Mugamma was injected into the tail vein of NC/Nga mice, a model for human atopic dermatitis. A single hydrodynamic injection of a CpG motif reduced pCpG-Mugamma at a dose of 0.14 microg/mouse resulted in a sustained concentration of IFN-gamma in the serum, and the concentration was maintained at >300 pg/ml over 80 d. The pCpG-Mugamma-mediated IFN-gamma gene transfer was associated with an increase in the serum concentration of IL-12, reduced production of IgE, and inhibition of mRNA expression of IL-4, -5, -10, -13, and -17 and thymus and activation-regulated chemokine in the spleen. These immunological changes were not clearly observed in mice receiving two injections of 20 microg pCMV-Mugamma, a CpG-replete plasmid DNA, because of the transient nature of the expression from the vector. The mice receiving pCpG-Mugamma showed a significant reduction in the severity of skin lesions and in the intensity of their scratching behavior. Furthermore, high transepidermal water loss, epidermal thickening, and infiltration of lymphocytes and eosinophils, all of which were obvious in the untreated mice, were significantly inhibited. These results indicate that an extraordinary sustained IFN-gamma expression induces favorable immunological changes, leading to a Th1-dominant state in the atopic dermatitis model.
β-Glucan from Saccharomyces cerevisiae Induces IFN-γ Production In Vivo in BALB/c Mice.
Javmen, Artur; Nemeikaitė-Čėnienė, Aušra; Bratchikov, Maksim; Grigiškis, Saulius; Grigas, Fortūnatas; Jonauskienė, Irena; Zabulytė, Danguolė; Mauricas, Mykolas
2015-01-01
β-Glucan is one of the most abundant polymers in nature and has been established as an immunomodulator. This compound has notable physiological effects on mammalian immune systems, including anti-tumor and anti-infective activities and can activate the immune response. It is considered that the immune-stimulating activities of β-glucan can depend on physicochemical parameters, such as molecular size. Saccharomyces cerevisiae, also known as baker's yeast, is a frequently used source of β-glucan. The aim of the experiments was to investigate how different Saccharomyces cerevisiae β-glucan preparations with different molecular size affect interferon-gamma (IFN-γ) production in BALB/c mice. In vivo and in vitro BALB/c mouse models were used for the investigations. Different β-glucan preparations were orally administrated in the in vivo experiments. IFN-γ production in BALB/c mice was analyzed by enzyme-linked immunosorbent assay and measuring interferon-γ RNA concentration. The results showed that orally-administered β-glucan from S. cerevisiae enhanced IFN-γ production in BALB/c mice in the in vivo model, but not by mouse leukocytes in vitro. Moreover, water-soluble β-glucan enhanced IFN-γ production more effectively than did particulate β-glucan. IFN-γ plays an important role in immunity against viral and bacterial infections. Our experiments have shown that β-glucan preparations enhance IFN-γ production in BALB/c mice and can be potentially used for immune system stimulation in mammals. Current results may be used to develop soluble β-glucan nutritional supplements. Copyright © 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
Sahiratmadja, Edhyana; Alisjahbana, Bachti; de Boer, Tjitske; Adnan, Iskandar; Maya, Anugrah; Danusantoso, Halim; Nelwan, Ronald H. H.; Marzuki, Sangkot; van der Meer, Jos W. M.; van Crevel, Reinout; van de Vosse, Esther; Ottenhoff, Tom H. M.
2007-01-01
Pro- and anti-inflammatory cytokines and their signaling pathways play key roles in protection from and pathogenesis of mycobacterial infection, and their balance and dynamic changes may control or predict clinical outcome. Peripheral blood cells' capacity to produce proinflammatory (tumor necrosis factor alpha [TNF-α], interleukin-12/23p40 [IL-12/23p40], and gamma interferon [IFN-γ]) and anti-inflammatory (IL-10) cytokines in response to Mycobacterium tuberculosis or unrelated stimuli (lipopolysaccharide, phytohemagglutinin) was studied in 93 pulmonary tuberculosis (TB) patients and 127 healthy controls from Indonesia. Their cells' ability to respond to IFN-γ was examined to investigate whether M. tuberculosis infection can also inhibit IFN-γ receptor (IFN-γR) signaling. Although there was interindividual variability in the observed responses, the overall results revealed that M. tuberculosis-induced TNF-α and IFN-γ levels showed opposite trends. Whereas TNF-α production was higher in active-TB patients than in controls, IFN-γ production was strongly depressed during active TB, correlated inversely with TB disease severity, and increased during therapy. By contrast, mitogen-induced IFN-γ production, although lower in patients than in controls, did not change during treatment, suggesting an M. tuberculosis-specific and reversible component in the depression of IFN-γ. Depressed IFN-γ production was not due to decreased IL-12/IL-23 production. Importantly, IFN-γ-inducible responses were also significantly depressed during active TB and normalized during treatment, revealing disease activity-related and reversible impairment in IFN-γR signaling in TB. Finally, IFN-γ/IL-10 ratios significantly correlated with TB cure. Taken together, these results show that M. tuberculosis-specific stimulation of IFN-γ (but not TNF-α) production and IFN-γR signaling are significantly depressed in active TB, correlate with TB disease severity and activity, and
Kidane, Fana Alem; Mitra, Taniya; Wernsdorf, Patricia; Hess, Michael; Liebhart, Dieter
2018-01-01
Histomonosis is a parasitic disease of gallinaceous birds characterized by necrotic lesions in cacum and liver that usually turns fatal in turkeys while it is less severe in chickens. Vaccination using in vitro attenuated Histomonas meleagridis has been experimentally shown to confer protection against histomonosis. The protective mechanisms that underpin the vaccine-induced immune response are not resolved so far. Therefore, the actual study aimed to evaluate the location and quantitative distribution patterns of signature cytokines of type 1 [interferon gamma (IFN-γ)] or type 2 [interleukin (IL)-13] immune responses in vaccinated or infected hosts. An intergroup and interspecies difference in the spatial and temporal distribution patterns of cytokine mRNA positive cells was evident. Quantification of cells showed a significantly decreased percentage of IFN-γ mRNA positive cells at 4 days post-inoculation (DPI) in caeca of turkeys inoculated exclusively with the attenuated or the virulent inocula, compared to control birds. The decrement was followed by a surge of cells expressing mRNA for IFN-γ or IL-13, reaching a peak of increment at 10 DPI. By contrast, turkeys challenged following vaccination showed a slight increment of cecal IFN-γ mRNA positive cells at 4 DPI after which positive cell counts became comparable to control birds. The increase in infected birds was accompanied by an extensive distribution of positively stained cells up to the muscularis layer of cecal tissue whereas the vaccine group maintained an intact mucosal structure. In chickens, the level of changes of positive cells was generally lower compared to turkeys. However, control chickens were found with a higher percentage of IFN-γ mRNA positive cells in cecum compared to their turkey counterparts indicating a higher resistance to histomonosis, similar to the observation in immunized turkeys. In chickens, it could be shown that the changes of cytokine-positive cells were related to
Jegaskanda, S.; Ahn, S. H.; Skinner, N.; Thompson, A. J.; Ngyuen, T.; Holmes, J.; De Rose, R.; Navis, M.; Winnall, W. R.; Kramski, M.; Bernardi, G.; Bayliss, J.; Colledge, D.; Sozzi, V.; Visvanathan, K.; Locarnini, S. A.; Kent, S. J.
2014-01-01
ABSTRACT The mechanisms by which hepatitis B virus (HBV) establishes and maintains chronic hepatitis B infection (CHB) are poorly defined. Innate immune responses play an important role in reducing HBV replication and pathogenesis. HBV has developed numerous mechanisms to escape these responses, including the production of the secreted hepatitis B e antigen (HBeAg), which has been shown to regulate antiviral toll-like receptor (TLR) and interleukin-1 (IL-1) signaling. IL-18 is a related cytokine that inhibits HBV replication in hepatoma cell lines and in the liver through the induction of gamma interferon (IFN-γ) by NK cells and T cells. We hypothesized that HBV or HBV proteins inhibit IFN-γ expression by NK cells as an accessory immunomodulatory function. We show that HBeAg protein inhibits the NF-κB pathway and thereby downregulates NK cell IFN-γ expression. Additionally, IFN-γ expression was significantly inhibited by exposure to serum from individuals with HBeAg-positive but not HBeAg-negative chronic HBV infection. Further, we show that the HBeAg protein suppresses IL-18-mediated NF-κB signaling in NK and hepatoma cells via modulation of the NF-κB pathway. Together, these findings show that the HBeAg inhibits IL-18 signaling and IFN-γ expression, which may play an important role in the establishment and/or maintenance of persistent HBV infection. IMPORTANCE It is becoming increasingly apparent that NK cells play a role in the establishment and/or maintenance of chronic hepatitis B infection. The secreted HBeAg is an important regulator of innate and adaptive immune responses. We now show that the HBeAg downregulates NK cell-mediated IFN-γ production and IL-18 signaling, which may contribute to the establishment of infection and/or viral persistence. Our findings build on previous studies showing that the HBeAg also suppresses the TLR and IL-1 signaling pathways, suggesting that this viral protein is a key regulator of antiviral innate immune responses
Yun, Cheol H.; Lundgren, Anna; Azem, Josef; Sjöling, Åsa; Holmgren, Jan; Svennerholm, Ann-Mari; Lundin, B. Samuel
2005-01-01
Helicobacter pylori is known to induce a local immune response, which is characterized by activation of lymphocytes and the production of IFN-γ in the stomach mucosa. Since not only T cells, but also natural killer (NK) cells, are potent producers of gamma interferon (IFN-γ), we investigated whether NK cells play a role in the immune response to H. pylori infection. Our results showed that NK cells were present in both the gastric and duodenal mucosae but that H. pylori infection did not affect the infiltration of NK cells into the gastrointestinal area. Furthermore, we could show that NK cells could be activated directly by H. pylori antigens, as H. pylori bacteria, as well as lysate from H. pylori, induced the secretion of IFN-γ by NK cells. NK cells were also activated without direct contact when separated from the bacteria by an epithelial cell layer, indicating that the activation of NK cells by H. pylori can also occur in vivo, in the infected stomach mucosa. Moreover, the production of IFN-γ by NK cells was greatly enhanced when a small amount of interleukin-12 (IL-12) was added, and this synergistic effect was associated with increased expression of the IL-12 receptor β2. It was further evident that bacterial lysate alone was sufficient to induce the activation of cytotoxicity-related molecules. In conclusion, we demonstrated that NK cells are present in the gastroduodenal mucosa of humans and that NK cells produce high levels of IFN-γ when stimulated with a combination of H. pylori antigen and IL-12. We propose that NK cells play an active role in the local immune response to H. pylori infection. PMID:15731046
Durward-Diioia, Marina; Harms, Jerome; Khan, Mike; Hall, Cherisse; Smith, Judith A.
2015-01-01
Brucella melitensis is a well-adapted zoonotic pathogen considered a scourge of mankind since recorded history. In some cases, initial infection leads to chronic and reactivating brucellosis, incurring significant morbidity and economic loss. The mechanism by which B. melitensis subverts adaptive immunological memory is poorly understood. Previous work has shown that Brucella-specific CD8+ T cells express gamma interferon (IFN-γ) and can transition to long-lived memory cells but are not polyfunctional. In this study, chronic infection of mice with B. melitensis led to CD8+ T cell exhaustion, manifested by programmed cell death 1 (PD-1) and lymphocyte activation gene 3 (LAG-3) expression and a lack of IFN-γ production. The B. melitensis-specific CD8+ T cells that produced IFN-γ expressed less IFN-γ per cell than did CD8+ cells from uninfected mice. Both memory precursor (CD8+ LFA1HI CD127HI KLRG1LO) and long-lived memory (CD8+ CD27HI CD127HI KLRG1LO) cells were identified during chronic infection. Interestingly, after adoptive transfer, mice receiving cells from chronically infected animals were able to contain infection more rapidly than recipients of cells from acutely infected or uninfected donors, although the proportions of exhausted CD8+ T cells increased after adoptive transfer in both challenged and unchallenged recipients. CD8+ T cells of challenged recipients initially retained the stunted IFN-γ production found prior to transfer, and cells from acutely infected mice were never seen to transition to either memory subset at all time points tested, up to 30 days post-primary infection, suggesting a delay in the generation of memory. Here we have identified defects in Brucella-responsive CD8+ T cells that allow chronic persistence of infection. PMID:26416901
George, Joseph; Banik, Naren L.; Ray, Swapan K.
2011-01-01
Human telomerase reverse transcriptase (hTERT) is the catalytic component of telomerase that facilitates tumor cell invasion and proliferation. Telomerase and hTERT are remarkably upregulated in majority of cancers including glioblastoma. Interferon-gamma (IFN-γ) modulates several cellular activities including cell cycle and multiplication through transcriptional regulation. The present investigation was designed to unravel the molecular mechanisms of the inhibition of cell proliferation, migration, and invasion of human glioblastoma SNB-19 and LN-18 cell lines after knockdown of hTERT using a plasmid vector based siRNA and concurrent treatment with IFN-γ. We observed more than 80% inhibition of cell proliferation, migration, and invasion of both cell lines after the treatment with combination of hTERT siRNA and IFN-γ. Our studies also showed accumulation of apoptotic cells in subG1 phase and an increase in cell population in G0/G1 with a reduction in G2/M phase indicating cell cycle arrest in G0/G1 phase for apoptosis. Semiquantitative and real-time RT-PCR analyses demonstrated significant downregulation of c- Myc and upregulation of p21 Waf1 and p27 Kip1. Western blotting confirmed the downregulation of the molecules involved in cell proliferation, migration, and invasion and also showed upregulation of cell cycle inhibitors. In conclusion, our study demonstrated that knockdown of hTERT siRNA and concurrent treatment with IFN-γ effectively inhibited cell proliferation, migration, and invasion in glioblastoma cells through downregulation of the molecules involved in these processes and cell cycle inhibition. Therefore, the combination of hTERT siRNA and IFN-γ offers a potential therapeutic strategy for controlling growth of human glioblastoma cells. PMID:20394835
Park, Sookyoung; Nozaki, Kenkichi; Smith, Joshua A.; Krause, James S.; Banik, Naren L.
2014-01-01
Insulin-like growth factor-1 (IGF-1) is a neuroprotective growth factor that promotes neuronal survival by inhibition of apoptosis. In order to examine whether IGF-1 exerts cytoprotective effects against extracellular inflammatory stimulation, ventral spinal cord 4.1 (VSC4.1) motoneuron cells were treated with interferon-gamma (IFN-γ). Our data demonstrated apoptotic changes, increased calpain:calpastatin and Bax:Bcl-2 ratios, and expression of apoptosis related proteases (caspase-3 and −12) in motoneurons rendered by IFN-γ in a dose-dependent manner. Post-treatment with IGF-1 attenuated these changes. In addition, IGF-1 treatment of motoneurons exposed to IFN-γ decreased expression of inflammatory markers (cyclooxygenase-2 and nuclear factor-kappa B:inhibitor of kappa B ratio). Furthermore, IGF-1 attenuated the loss of expression of IGF-1 receptors (IGF-1Rα and IGF-1Rβ) and estrogen receptors (ERα and ERβ) induced by IFN-γ. To determine whether the protective effects of IGF-1 are associated with ERs, ERs antagonist ICI and selective siRNA targeted against ERα and ERβ were used in VSC4.1 motoneurons. Distinctive morphological changes were observed following siRNA knockdown of ERα and ERβ. In particular, apoptotic cell death assessed by TUNEL assay was enhanced in both ERα and ERβ-silenced VSC4.1 motoneurons following IFN-γ and IGF-1 exposure. These results suggest that IGF-1 protects motoneurons from inflammatory insult by a mechanism involving pivotal interactions with ERα and ERβ. PMID:24188094
Franssila, R; Auramo, J; Modrow, S; Möbs, M; Oker-Blom, C; Käpylä, P; Söderlund-Venermo, M; Hedman, K
2005-01-01
Human parvovirus B19 is a small non-enveloped DNA virus with an icosahedral capsid consisting of proteins of only two species, the major protein VP2 and the minor protein VP1. VP2 is contained within VP1, which has an additional unique portion (VP1u) of 227 amino acids. We determined the ability of eukaryotically expressed parvovirus B19 virus-like particles consisting of VP1 and VP2 in the ratio recommended for vaccine use, or of VP2 alone, to stimulate, in an HLA class II restricted manner, peripheral blood mononuclear cells (PBMC) to proliferate and to secrete interferon gamma (IFN-γ) and interleukin (IL)-10 cytokines among recently and remotely B19 infected subjects. PBMC reactivity with VP1u was determined specifically with a prokaryotically expressed VP1u antigen. In general, B19-specific IFN-γ responses were stronger than IL-10 responses in both recent and remote infection; however, IL-10 responses were readily detectable among both groups, with the exception of patients with relapsed or persisting symptoms who showed strikingly low IL-10 responses. Whereas VP1u-specific IFN-γ responses were very strong among the recently infected subjects, the VP1u-specific IFN-γ and IL-10 responses were virtually absent among the remotely infected subjects. The disappearance of VP1u-specific IFN-γ expression is surprising, as B-cell immunity against VP1u is well maintained. PMID:16178856
Inhibited interferon-gamma but normal interleukin-3 production from rats flown on the Space Shuttle
NASA Technical Reports Server (NTRS)
Gould, Cheryl L.; Lyte, Mark; Williams, Joann; Mandel, Adrian D.; Sonnenfeld, Gerald
1987-01-01
Rats were flown on Space Shuttle SL-3 for one week. When spleen cells were removed from these rats and challenged with concanavalin-A, interferon-gamma production was severely inhibited, while interleukin-3 production was unaffected compared to ground-based control rats. These data indicate that there is a defect in interferon-gamma production in rats that have been exposed to spaceflight. This defect could contribute to, and be one reason for, immunosuppression observed after spaceflight.
2013-01-01
Background Human T-cell leukemia virus type-1 (HTLV-1) is the causative retrovirus of adult T-cell leukemia/lymphoma (ATL) and HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP). HTLV-1 gene expression is maintained at low levels in vivo by unknown mechanisms. A combination therapy of interferon-α (IFN-α) and zidovudin (AZT) shows therapeutic effects in ATL patients, although its mechanism is also obscure. We previously found that viral gene expression in IL-2-dependent HTLV-1-infected T-cells (ILTs) derived from ATL patients was markedly suppressed by stromal cells through a type I IFN response. Here, we investigated the effects of IFN-α with or without AZT on viral gene expression and cell growth in ILTs. Results ILTs expressed variable but lower amounts of HTLV-1 Tax protein than HTLV-1-transformed HUT102 cells. Following the addition of IFN-α, the amounts of HTLV-1 p19 in the supernatants of these cells decreased in three days, while HTLV-1 gene expression decreased only in ILTs but not HUT102 cells. IFN-α also suppressed the spontaneous HTLV-1 induction in primary ATL cells cultured for 24 h. A time course study using ILTs revealed that the levels of intracellular Tax proteins decreased in the first 24 h after addition of IFN-α, before the reduction in HTLV-1 mRNA levels. The initial decreases of Tax protein following IFN-α treatment were observed in 6 of 7 ILT lines tested, although the reduction rates varied among ILT lines. An RNA-dependent protein kinase (PKR)-inhibitor reversed IFN-mediated suppression of Tax in ILTs. IFN-α also induced cell cycle arrest at the G0/G1 phase and suppressed NF-κB activities in these cells. AZT alone did not affect HTLV-1 gene expression, cell viability or NF-κB activities. AZT combined with IFN-α markedly induced cell apoptosis associated with phosphorylation of p53 and induction of p53-responsive genes in ILTs. Conclusions IFN-α suppressed HTLV-1 gene expression at least through a PKR
Day, Yuan-Ji; Huang, Liping; Ye, Hong; Li, Li; Linden, Joel; Okusa, Mark D
2006-03-01
A(2A) adenosine receptor (A(2A)R)-expressing bone marrow (BM)-derived cells contribute to the renal protective effect of A(2A) agonists in renal ischemia-reperfusion injury (IRI). We performed IRI in mice lacking T and B cells to determine whether A(2A)R expressed in CD4+ cells mediate protection from IRI. Rag-1 knockout (KO) mice were protected in comparison to wild-type (WT) mice when subjected to IRI. ATL146e, a selective A(2A) agonist, did not confer additional protection. IFN-gamma is an important early signal in IRI and is thought to contribute to reperfusion injury. Because IFN-gamma is produced by kidney cells and T cells we performed IRI in BM chimeras in which the BM of WT mice was reconstituted with BM from IFN-gamma KO mice (IFN-gamma KO-->WT chimera). We observed marked reduction in IRI in comparison to WT-->WT chimeras providing additional indirect support for the role of T cells. To confirm the role of CD4+ A(2A)R in mediating protection from IRI, Rag-1 KO mice were subjected to ischemia-reperfusion. The protection observed in Rag-1 KO mice was reversed in Rag-1 KO mice that were adoptively transferred WT CD4+ cells (WT CD4+-->Rag-1 KO) or A(2A) KO CD4+ cells (A(2A) KO CD4+-->Rag-1 KO). ATL146e reduced injury in WT CD4+-->Rag-1 KO mice but not in A(2A) KO CD4+-->Rag-1 KO mice. Rag-1 KO mice reconstituted with CD4+ cells derived from IFN-gamma KO mice (IFN-gamma CD4+-->Rag-1 KO) were protected from IRI; ATL146e conferred no additional protection. These studies demonstrate that CD4+ IFN-gamma contributes to IRI and that A(2A) agonists mediate protection from IRI through action on CD4+ cells.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Jeeyun; Im, Young-Hyuck; Jung, Hae Hyun
2005-08-26
The A549 cells, non-small cell lung cancer cell line from human, were resistant to interferon (IFN)-{alpha} treatment. The IFN-{alpha}-treated A549 cells showed increase in protein expression levels of NF-{kappa}B and COX-2. IFN-{alpha} induced NF-{kappa}B binding activity within 30 min and this increased binding activity was markedly suppressed with inclusion of curcumin. Curcumin also inhibited IFN-{alpha}-induced COX-2 expression in A549 cells. Within 10 min, IFN-{alpha} rapidly induced the binding activity of a {gamma}-{sup 32}P-labeled consensus GAS oligonucleotide probe, which was profoundly reversed by curcumin. Taken together, IFN-{alpha}-induced activations of NF-{kappa}B and COX-2 were inhibited by the addition of curcumin in A549more » cells.« less
Smirnova, Natalia P; Webb, Brett T; McGill, Jodi L; Schaut, Robert G; Bielefeldt-Ohmann, Helle; Van Campen, Hana; Sacco, Randy E; Hansen, Thomas R
2014-04-01
Development of transplacental infection depends on the ability of the virus to cross the placenta and replicate within the fetus while counteracting maternal and fetal immune responses. Unfortunately, little is known about this complex process. Non-cytopathic (ncp) strains of bovine viral diarrhea virus (BVDV), a pestivirus in the Flaviviridae family, cause persistent infection in early gestational fetuses (<150 days; persistently infected, PI), but are cleared by immunocompetent animals and late gestational fetuses (>150 days; transiently infected, TI). Evasion of innate immune response and development of immunotolerance to ncp BVDV have been suggested as possible mechanisms for the establishment of the persistent infection. Previously we have observed a robust temporal induction of interferon (IFN) type I (innate immune response) and upregulation of IFN stimulated genes (ISGs) in BVDV TI fetuses. Modest chronic upregulation of ISGs in PI fetuses and calves reflects a stimulated innate immune response during persistent BVDV infection. We hypothesized that establishing persistent fetal BVDV infection is also accompanied by the induction of IFN-gamma (IFN-γ). The aims of the present study were to determine IFN-γ concentration in blood and amniotic fluid from control, TI and PI fetuses during BVDV infection and analyze induction of the IFN-γ downstream pathways in fetal lymphoid tissues. Two experiments with in vivo BVDV infections were completed. In Experiment 1, pregnant heifers were infected with ncp BVDV type 2 on day 75 or 175 of gestation or kept naïve to generate PI, TI and control fetuses, respectively. Fetuses were collected by Cesarean section on day 190. In Experiment 2, fetuses were collected on days 82, 89, 97, 192 and 245 following infection of pregnant heifers on day 75 of gestation. The results were consistent with the hypothesis that ncp BVDV infection induces IFN-γ secretion during acute infection in both TI and PI fetuses and that lymphoid
D'Ombrain, Marthe C; Voss, Till S; Maier, Alexander G; Pearce, J Andrew; Hansen, Diana S; Cowman, Alan F; Schofield, Louis
2007-08-16
Plasmodium falciparum erythrocyte membrane protein-1 (PfEMP-1) is a variable antigen expressed by P. falciparum, the malarial parasite. PfEMP-1, present on the surface of infected host erythrocytes, mediates erythrocyte binding to vascular endothelium, enabling the parasite to avoid splenic clearance. In addition, PfEMP-1 is proposed to regulate host immune responses via interactions with the CD36 receptor on antigen-presenting cells. We investigated the immunoregulatory function of PfEMP-1 by comparing host cell responses to erythrocytes infected with either wild-type parasites or transgenic parasites lacking PfEMP-1. We showed that PfEMP-1 suppresses the production of the cytokine interferon-gamma by human peripheral blood mononuclear cells early after exposure to P. falciparum. Suppression of this rapid proinflammatory response was CD36 independent and specific to interferon-gamma production by gammadelta-T, NK, and alphabeta-T cells. These data demonstrate a parasite strategy for downregulating the proinflammatory interferon-gamma response and further establish transgenic parasites lacking PfEMP-1 as powerful tools for elucidating PfEMP-1 functions.
Role of CD28/B7 costimulation in the dexamethasone-induced suppression of IFN-gamma.
Agarwal, S K; Marshall, G D
2000-11-01
In vitro exposure of peripheral blood mononuclear cells (PBMC) to glucocorticoids (GC), at concentrations observed during psychologic stress, induces a shift in the human type 1/type 2 cytokine balance toward a type 2 cytokine response. The mechanisms involved in these cytokine alterations are unknown but likely include modulation of regulatory cytokines or the interaction between the antigen-presenting cell (APC) and T lymphocyte or both. The CD28/B7 costimulation pathway has been reported to modulate the type 1/type 2 cytokine balance and may contribute to the GC-associated cytokine alterations. Therefore, we sought to determine the effect of dexamethasone (Dex) on the expression and function of the human CD28/B7 costimulatory pathway and whether these alterations contribute to the Dex-induced type 1/type 2 cytokine alterations. Dex inhibited the expression of both CD80 and CD86 on THP-1 cells, a human acute monocytic leukemia cell line, as determined by flow cytometry. Dex also inhibited the expression of CD28 and CTLA-4 on phytohemagglutinin (PHA)-stimulated CD3+ T lymphocytes, which was attenuated by the addition of interleukin-12 (IL-12). Lastly, activation of CD28 with anti-CD28 antibody attenuated the Dex-induced decrease in interferon-gamma (IFN-gamma) production by anti-CD3 antibody-stimulated PBMC. These data suggest that Dex induces a modulation of the CD28/B7 costimulatory pathway that contributes to the shift in the type 1/type 2 cytokine balance toward a predominant type 2 cytokine response.
Gupta, Kanupriya; Ogendi, Brian M. O.; Bakshi, Rakesh K.; Kapil, Richa; Press, Christen G.; Sabbaj, Steffanie; Lee, Jeannette Y.
2017-01-01
ABSTRACT Chlamydia trachomatis infection is the most prevalent bacterial sexually transmitted infection and can cause significant reproductive morbidity in women. There is insufficient knowledge of C. trachomatis-specific immune responses in humans, which could be important in guiding vaccine development efforts. In contrast, murine models have clearly demonstrated the essential role of T helper type 1 (Th1) cells, especially interferon gamma (IFN-γ)-producing CD4+ T cells, in protective immunity to chlamydia. To determine the frequency and magnitude of Th1 cytokine responses elicited to C. trachomatis infection in humans, we stimulated peripheral blood mononuclear cells from 90 chlamydia-infected women with C. trachomatis elementary bodies, Pgp3, and major outer membrane protein and measured IFN-γ-, tumor necrosis factor alpha (TNF-α)-, and interleukin-2 (IL-2)-producing CD4+ and CD8+ T-cell responses using intracellular cytokine staining. The majority of chlamydia-infected women elicited CD4+ TNF-α responses, with frequency and magnitude varying significantly depending on the C. trachomatis antigen used. CD4+ IFN-γ and IL-2 responses occurred infrequently, as did production of any of the three cytokines by CD8+ T cells. About one-third of TNF-α-producing CD4+ T cells coproduced IFN-γ or IL-2. In summary, the predominant Th1 cytokine response elicited to C. trachomatis infection in women was a CD4+ TNF-α response, not CD4+ IFN-γ, and a subset of the CD4+ TNF-α-positive cells produced a second Th1 cytokine. PMID:28100498
DOE Office of Scientific and Technical Information (OSTI.GOV)
Preble, O.T.; Rothko, K.; Klippel, J.H.
1983-06-01
The interferon (IFN)-induced enzyme 2-5A synthetase was elevated in mononuclear cells from both serum IFN-positive and -negative systemic lupus erythematosus (SLE) patients. This suggests that a much higher percentage of patients than previously thought produce endogenous IFN. These results may partly explain findings that mononuclear cells from SLE patients are deficient in IFN production in vitro in response to certain IFN inducers. Although normal lymphocytes can produce an acid-labile alpha IFN after stimulation with C. parvum in vitro, the reason for endogenous production of this unusual alpha IFN by SLE patients remains unknown.
Dinges, Martin M.; Schlievert, Patrick M.
2001-01-01
The superantigenic function of toxic shock syndrome toxin 1 (TSST-1) is generally regarded as an important determinant of its lethal effects in humans or experimental animals. This study examined the role of superantigenicity in a BALB/c mouse model of lethal TSST-1-induced hypersensitivity to lipopolysaccharide (LPS). In this model, TSST-1 greatly potentiated both LPS-induced lethality, as well as LPS-induced serum tumor necrosis factor alpha (TNF-α) activity. Although BALB/c-SCID mice were resistant to these LPS enhancement effects of TSST-1, BALB/c-SCID mice reconstituted with T cells were completely susceptible to the enhancement effect of TSST-1 on LPS-induced serum TNF-α. Mice pretreated with cyclosporine (Cs) or neutralizing antibodies against gamma interferon (IFN-γ) did not develop lethal LPS hypersensitivity when injected with TSST-1, and these agents reduced the enhancement effect of TSST-1 on LPS-induced serum TNF-α by 99 and 85%, respectively. Cs pretreatment also completely inhibited the known capacity of TSST-1 to amplify LPS-induced levels of IFN-γ in serum. In contrast, mice given Cs after a priming injection of TSST-1, but before LPS, still exhibited lethal hypersensitivity to LPS. Cs given after TSST-1 also did not inhibit enhancement of LPS-induced serum TNF-α by TSST-1 but inhibited the enhancement effect of TSST-1 on LPS-induced serum IFN-γ by 50%. These experiments support the theory that TSST-1-induced hypersensitivity to LPS is mediated primarily by IFN-γ derived from superantigen-activated T cells. PMID:11179286
Interferon-γ Inhibits Ebola Virus Infection.
Rhein, Bethany A; Powers, Linda S; Rogers, Kai; Anantpadma, Manu; Singh, Brajesh K; Sakurai, Yasuteru; Bair, Thomas; Miller-Hunt, Catherine; Sinn, Patrick; Davey, Robert A; Monick, Martha M; Maury, Wendy
2015-01-01
Ebola virus outbreaks, such as the 2014 Makona epidemic in West Africa, are episodic and deadly. Filovirus antivirals are currently not clinically available. Our findings suggest interferon gamma, an FDA-approved drug, may serve as a novel and effective prophylactic or treatment option. Using mouse-adapted Ebola virus, we found that murine interferon gamma administered 24 hours before or after infection robustly protects lethally-challenged mice and reduces morbidity and serum viral titers. Furthermore, we demonstrated that interferon gamma profoundly inhibits Ebola virus infection of macrophages, an early cellular target of infection. As early as six hours following in vitro infection, Ebola virus RNA levels in interferon gamma-treated macrophages were lower than in infected, untreated cells. Addition of the protein synthesis inhibitor, cycloheximide, to interferon gamma-treated macrophages did not further reduce viral RNA levels, suggesting that interferon gamma blocks life cycle events that require protein synthesis such as virus replication. Microarray studies with interferon gamma-treated human macrophages identified more than 160 interferon-stimulated genes. Ectopic expression of a select group of these genes inhibited Ebola virus infection. These studies provide new potential avenues for antiviral targeting as these genes that have not previously appreciated to inhibit negative strand RNA viruses and specifically Ebola virus infection. As treatment of interferon gamma robustly protects mice from lethal Ebola virus infection, we propose that interferon gamma should be further evaluated for its efficacy as a prophylactic and/or therapeutic strategy against filoviruses. Use of this FDA-approved drug could rapidly be deployed during future outbreaks.
Longbottom, E Rebecca; Torrance, Hew D T; Owen, Helen C; Fragkou, Paraskevi C; Hinds, Charles J; Pearse, Rupert M; O'Dwyer, Michael J
2016-08-01
The aim of this study was to evaluate the role of interleukin (IL)-6 pathways in postoperative immune suppression and to assess the reversibility of this phenomenon. The postoperative period is characterized by increased IL-6 production and features of immune suppression. In vitro, IL-6 mediates anti-inflammatory effects through inhibition of interferon gamma (IFN-γ) pathways. The significance of the immunomodulatory effects of IL-6 in the clinical setting of postoperative immune suppression remains unclear. Patients over 45 years old undergoing elective surgery, involving the gastrointestinal tract, were recruited. IL-6 levels were assayed using an enzyme linked immunosorbent assay preoperatively, and at 24 and 48 hours. Peripheral blood mononuclear cells from healthy volunteers were cultured in perioperative serum and CD14Human Leukocyte Antigen-DR (HLA-DR) [monocyte HLA-DR (mHLA-DR)] geometric mean florescent intensity was measured in the presence and absence of IL-6 neutralizing antibody and recombinant IFN-γ. Of the 108 patients, 41 developed a postoperative infection. The IL-6 levels increased 19-fold from the preoperative sample to 24 hours postoperatively (P < 0.0001). Higher IL-6 levels at 24 (P = 0.0002) and 48 hours (P = 0.003) were associated with subsequent postoperative infectious complications. mHLA-DR mean florescent intensity fell when healthy peripheral blood mononuclear cells were cultured with postoperative serum compared with preoperative serum (P = 0.008). This decrease was prevented by the presence of IFN-γ in the culture media, but not by the presence of IL-6-neutralizing antibody. IL-6 levels increase after a major surgery and are associated with an increased susceptibility to postoperative infections. Serum obtained from postoperative patients induces an immunosuppressive response, reflected in reduced mHLA-DR levels, mediated through IL-6 independent pathways and is reversible with IFN-γ. These data may have
A new assay system for guinea pig interferon biological activity.
Yamamoto, Toshiko; Jeevan, Amminikutty; Ohishi, Kazue; Nojima, Yasuhiro; Umemori, Kiyoko; Yamamoto, Saburo; McMurray, David N
2002-07-01
We have developed an assay system for guinea pig interferon (IFN) based on reduction of viral cytopathic effect (CPE) in various cell lines. CPE inhibition was detected optimally in the guinea pig fibroblast cell line 104C1 infected with encephalomyocarditis virus (EMCV). The amount of biologically active guinea pig IFN was quantified by estimating viable cell numbers colorimetrically by means of a tetrazolium compound, 2-(4-iodophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium monosodium salt (WST-1) and 1-methoxy-5-methylphenazinium methylsulfate (PMS). WST-1 color developed until stopped by the addition of sulfuric acid. This had no effect on the colorimetric assay, and the color was stable for at least 24 h. The acid also inactivated the EMCV and, thus, eliminated the viral hazard. Inhibition of CPE activity was highly correlated with the concentration of culture supernatants from BCG-vaccinated guinea pig splenocytes stimulated in vitro with tuberculin or an immunostimulatory oligoDNA. This assay detected guinea pig IFN and human IFN-alpha, but not IFN-gamma from human, mouse, rat, pig, or dog. This assay system has proved useful for the titration of guinea pig IFN, being easy to perform, free from viral hazard, relatively species specific, highly reproducible, and inexpensive.
Park, Sookyoung; Nozaki, Kenkichi; Smith, Joshua A; Krause, James S; Banik, Naren L
2014-03-01
Insulin-like growth factor-1 (IGF-1) is a neuroprotective growth factor that promotes neuronal survival by inhibition of apoptosis. To examine whether IGF-1 exerts cytoprotective effects against extracellular inflammatory stimulation, ventral spinal cord 4.1 (VSC4.1) motoneuron cells were treated with interferon-gamma (IFN-γ). Our data demonstrated apoptotic changes, increased calpain:calpastatin and Bax:Bcl-2 ratios, and expression of apoptosis-related proteases (caspase-3 and -12) in motoneurons rendered by IFN-γ in a dose-dependent manner. Post-treatment with IGF-1 attenuated these changes. In addition, IGF-1 treatment of motoneurons exposed to IFN-γ decreased expression of inflammatory markers (cyclooxygenase-2 and nuclear factor-kappa B:inhibitor of kappa B ratio). Furthermore, IGF-1 attenuated the loss of expression of IGF-1 receptors (IGF-1Rα and IGF-1Rβ) and estrogen receptors (ERα and ERβ) induced by IFN-γ. To determine whether the protective effects of IGF-1 are associated with ERs, ERs antagonist ICI and selective siRNA targeted against ERα and ERβ were used in VSC4.1 motoneurons. Distinctive morphological changes were observed following siRNA knockdown of ERα and ERβ. In particular, apoptotic cell death assessed by TUNEL assay was enhanced in both ERα and ERβ-silenced VSC4.1 motoneurons following IFN-γ and IGF-1 exposure. These results suggest that IGF-1 protects motoneurons from inflammatory insult by a mechanism involving pivotal interactions with ERα and ERβ. © 2013 International Society for Neurochemistry.
A phase II trial on alpha-interferon (alpha IFN) effect in patients with monoclonal IgM gammopathy.
Rotoli, B; De Renzo, A; Frigeri, F; Buffardi, S; Marcenò, R; Cavallaro, A M; Ruggeri, P; Liso, V; Musto, P; Andriani, A
1994-05-01
Waldenström's macroglobulinemia (WM) is an incurable disorder of B cells. Following occasional reports of response to alpha interferon (IFN) and in view of its effectiveness in hairy cell leukemia, we tested this agent in a relatively large group (n = 88) of patients who had an IgM monoclonal component (MC) greater than 10 g/l. Thirty eight patients had a MC > 30 g/l and were classified as Waldenström's macroglobulinemia (WM), while fifty had either WM in an early stage or an IgM monoclonal gammopathy of undeterminated significance (all of them operationally classified as IgM-MGUS). All patients received IFN 3 MU/day for one month and then 3 times/week. Response to treatment was mainly based on MC reduction in two consecutive determinations (> 50%: major response; 25-50%: minor response). Of 36 evaluable WM patients, 12 had a major and 6 a minor response; of 41 evaluable IgM-MGUS patients, 2 had a major and 6 a minor response. In WM patients with a major response, MC reduction was associated with disappearance of hyperviscosity symptoms, raised Hb level and reduced bone marrow lymphoplasmacytosis. At the dose used, tolerance was excellent in the majority of patients; only 15% withdrew from the study due to side effects. Although single cases and very small series have already been reported, no large study collecting quantitative data on the effects of alpha IFN in WM has been published so far. Our results suggest that IFN treatment is not indicated for patients with a low monoclonal component, while it is of clinical benefit in about 50% of patients with IgM > 30 g/l.
Zhang, Qibo; Bernatoniene, Jolanta; Bagrade, Linda; Paton, James C.; Mitchell, Timothy J.; Hammerschmidt, Sven; Nunez, Desmond A.; Finn, Adam
2006-01-01
Nasopharyngeal tonsils (adenoids) are part of human nasopharynx-associated lymphoid tissue, which may play an important role in local defense against pneumococci. Recent studies with animals have suggested that several pneumococcal proteins, including CbpA and pneumolysin (Ply), may be vaccine candidates. Our recent data obtained with children suggest that antibodies to these proteins may protect against carriage. This study was performed to investigate the regulation of the T-cell-dependent antibody responses to CbpA and pneumolysin by cytokines in adenoidal immune cells from children. Adenoidal mononuclear cells (MNC) were cultured with pneumococcal concentrated culture supernatants (CCS) or recombinant proteins. Cytokine expression profiles in adenoidal MNC after antigen stimulation were analyzed by reverse transcription-PCR, protein array analysis, and an immunoassay, along with an antibody production analysis. The roles, interactions, and cellular sources of the main cytokines identified were evaluated further. Pneumococcal CCS induced production of CbpA- and Ply-specific antibodies in association with several chemokines and cytokines, including gamma interferon (IFN-γ) and interleukin-10 (IL-10) in MNC. The antibody production correlated well with the concentrations of these two cytokines. Addition of recombinant IFN-γ or IL-10 enhanced antibody production, and monoclonal antibodies to these two cytokines and T-cell depletion significantly reduced antibody production. Intracellular cytokine staining showed that T cells are a major source of IFN-γ and IL-10. Recombinant Ply and, to a lesser extent, recombinant CbpA induced significant production of IFN-γ and IL-10 in MNC. T-cell-derived IFN-γ and IL-10 may be key regulators of production of mucosal antibody to pneumococcal protein antigens in the nasopharynx and may play an important role in local protection against pneumococcal infection in children. PMID:16861661
Faulkner, C B; Simecka, J W; Davidson, M K; Davis, J K; Schoeb, T R; Lindsey, J R; Everson, M P
1995-01-01
Studies were conducted to determine whether the production of various cytokines is associated with Mycoplasma pulmonis disease expression. Susceptible C3H/HeN and resistant C57BL/6N mice were inoculated intranasally with 10(7) CFU of virulent M. pulmonis UAB CT or avirulent M. pulmonis UAB T. Expression of genes for tumor necrosis factor alpha (TNF-alpha), interleukin 1 alpha (IL-1 alpha), IL-1 beta, IL-6, and gamma interferon (IFN-gamma) in whole lung tissue and TNF-alpha gene expression in bronchoalveolar lavage (BAL) cells was determined by reverse transcription-PCR using specific cytokine primers at various times postinoculation. In addition, concentrations of TNF-alpha, IL-1, IL-6, and IFN-gamma were determined in BAL fluid and serum samples at various times postinoculation. Our results showed that there was a sequential appearance of cytokines in the lungs of infected mice: TNF-alpha, produced primarily by BAL cells, appeared first, followed by IL-1 and IL-6, which were followed by IFN-gamma. Susceptible C3H/HeN mice had higher and more persistent concentrations of TNF-alpha and IL-6 in BAL fluid than did resistant C57BL/6N mice, indicating that TNF-alpha and possibly IL-6 are important factors in pathogenesis of acute M. pulmonis disease in mice. Serum concentrations of IL-6 were elevated in C3H/HeN mice, but not C57BL/6N mice, following infection with M. pulmonis, suggesting that IL-6 has both local and systemic effects in M. pulmonis disease. PMID:7558323
Immunogenicity of an interferon-beta1a product.
Kauffman, M A; Sterin-Prync, A; Papouchado, M; González, E; Vidal, A J; Grossberg, S E; Chuppa, S; Odoriz, B; Vrech, C; Diez, R A; Ferro, H H
2011-01-01
In order to determine whether Blastoferon®, a biosimilar interferon (IFN)- beta 1a formulation, shares epitopes with other known IFN-beta products, a series of neutralization bioassays were performed with a set of well-characterized anti-IFN- beta monoclonal antibodies and human sera (World Health Organization Reference Reagents). The bioassay was the interferon-induced inhibition of virus cytopathic effect on human cells in culture (EMC virus and A-549 cells). Computer-calculated results were reported as Tenfold Reduction Units (TRU)/ml. To further assess Blastoferon® immunogenicity, in vivo production of anti-IFN beta antibodies was determined in sera of patients included in the pharmacovigilance plan of Blastoferon® by the level of IFN- beta 1a binding antibodies (by enzyme immunoassay -EIA) and neutralizing antibodies (in the Wish-VSV system). The highly characterized neutralizing monoclonal antibodies A1 and A5 that bind to specific regions of the IFN- beta molecule reacted positively with the three beta 1a IFNs: Blastoferon®, Rebif®, and the IFN- beta WHO Second International Standard 00/572. As expected, the non-neutralizing monoclonal antibodies B4 and B7 did not neutralize any of the IFN- beta preparations. The commercially available monoclonal antibody B-02 reacted essentially equally with Rebif® and Blastoferon®. The WHO Reference Reagent human serum anti-IFN- beta polyclonal antibody neutralized all the IFN- beta products, whereas the WHO Reference Reagent human serum anti-IFN-alpha polyclonal antibody G037-501-572 appropriately failed to react with any of the IFN- beta products. On the basis of in vitro reactivity with known, well-characterized monoclonal and polyclonal antibody preparations, Blastoferon® shares immunological determinants with other human interferon- beta products, especially IFN- beta 1a. In vivo antibodies were detected by EIA in 72.9% of 37 chronically treated multiple sclerosis patients, whereas neutralizing antibodies were
Cauvi, David M; Cauvi, Gabrielle; Toomey, Christopher B; Jacquinet, Eric; Pollard, Kenneth Michael
2017-07-01
IFN-γ has been found to be robustly important to disease pathogenesis in both idiopathic and induced models of murine lupus. In transgenic mice, over production of IFN-γ in the skin results in an inflammatory response and autoimmunity. This suggests that localized exposure to environmental factors that induce autoimmunity may be associated with expression of an IFN-γ-dependent inflammatory response. Using murine mercury-induced autoimmunity (mHgIA), the severity of inflammation and proinflammatory cytokine expression, including the cellular source of IFN-γ, were assessed at the site of subcutaneous exposure and in secondary lymphoid organs. Exposure induced a localized chronic inflammation comprising both innate and adaptive immune cells but only CD8+ T and NK cells were reduced in the absence of IFN-γ. IFN-γ+ cells began to appear as early as day 1 and comprised both resident (γδ T) and infiltrating cells (CD8+ T, NKT, CD11c+). The requirements for inflammation were examined in mice deficient in genes required (Ifng, Il6) or not required (Casp1) for mHgIA. None of these genes were essential for induction of inflammation, however IFN-γ and IL-6 were required for exacerbation of other proinflammatory cytokines. Additionally, lack of IFN-γ or IL-6 impacted expression of genes regulated by either IFN-γ or type I IFN. Significantly, both IFN-γ and IL-6 were required for increased expression of IRF-1 which regulates IFN stimulated genes and is required for mHgIA. Thus IRF-1 may be at the nexus of the interplay between IFN-γ and IL-6 in exacerbating a xenobiotic-induced inflammatory response, regulation of interferon responsive genes and autoimmunity. © The Author 2017. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Hines, Stephen A.; Stone, Diana M.; Hines, Melissa T.; Alperin, Debby C.; Knowles, Donald P.; Norton, Linda K.; Hamilton, Mary J.; Davis, William C.; McGuire, Travis C.
2003-01-01
Rhodococcus equi is a gram-positive bacterium that infects alveolar macrophages and causes rhodococcal pneumonia in horses and humans. The virulence plasmid of R. equi appears to be required for both pathogenicity in the horse and the induction of protective immunity. An understanding of the mechanisms by which virulent R. equi circumvents protective host responses and by which bacteria are ultimately cleared is important for development of an effective vaccine. Six adult horses were challenged with either virulent R. equi or an avirulent, plasmid-cured derivative. By using a flow cytometric method for intracytoplasmic detection of gamma interferon (IFN-γ) in equine bronchoalveolar lavage fluid (BALF) cells, clearance of the virulent strain was shown to be associated with increased numbers of pulmonary CD4+ and CD8+ T lymphocytes producing IFN-γ. There was no change in IFN-γ-positive cells in peripheral blood, suggesting that a type 1 recall response at the site of challenge was protective. The plasmid-cured strain of R. equi was cleared in horses without a significant increase in IFN-γ-producing T lymphocytes in BALF. In contrast to these data, a previous report in foals suggested an immunomodulating role for R. equi virulence plasmid-encoded products in downregulating IFN-γ expression by equine CD4+ T lymphocytes. Intracytoplasmic detection of IFN-γ provides a method to better determine whether modulation of macrophage-activating cytokines by virulent strains occurs uniquely in neonates and contributes to their susceptibility to rhodococcal pneumonia. PMID:12626444
IFN-λ cancer immunotherapy: new kid on the block
Lasfar, Ahmed; Gogas, Helen; Zloza, Andrew; Kaufman, Howard L; Kirkwood, John M
2016-01-01
Interferon-lambda (IFN-λ) is a new IFN type, related to IFN-α, that is commonly used in the clinic. However, significant side effects accompanying IFN-α treatment limit enthusiasm for IFN-α. In this review, we discuss the current landscape of IFN-α use in oncology and describe the biologic characteristics of IFN-λ. IFN-λ offers unique advantages, including a more tumor cell selective targeting, lower off-target binding and an ability to generate both innate and adaptive immune responses. IFN-λ has also demonstrated therapeutic benefit in murine cancer models. IFN-λ may be used in clinic as a single agent or in combination with other immunotherapy agents, such as immune checkpoint inhibitors. Further clinical trials will be needed to fully elucidate the potential of this novel agent in oncology. PMID:27381684
IFN-λ cancer immunotherapy: new kid on the block.
Lasfar, Ahmed; Gogas, Helen; Zloza, Andrew; Kaufman, Howard L; Kirkwood, John M
2016-07-01
Interferon-lambda (IFN-λ) is a new IFN type, related to IFN-α, that is commonly used in the clinic. However, significant side effects accompanying IFN-α treatment limit enthusiasm for IFN-α. In this review, we discuss the current landscape of IFN-α use in oncology and describe the biologic characteristics of IFN-λ. IFN-λ offers unique advantages, including a more tumor cell selective targeting, lower off-target binding and an ability to generate both innate and adaptive immune responses. IFN-λ has also demonstrated therapeutic benefit in murine cancer models. IFN-λ may be used in clinic as a single agent or in combination with other immunotherapy agents, such as immune checkpoint inhibitors. Further clinical trials will be needed to fully elucidate the potential of this novel agent in oncology.
Interferon-gamma (INF-gamma) release test can detect cutaneous adverse effects to statins.
Goldberg, Ilan; Isman, Gila; Shirazi, Idit; Brenner, Sarah
2009-12-01
An increasing number of cutaneous adverse effects are being reported as use of statins becomes more widespread. A study was undertaken to establish the relationship between statin and a cutaneous reaction by the in vitro interferon-gamma (INF-gamma) release test. The lymphocytes of 20 patients with suspected drug-induced skin reaction were incubated with and without the drug. The level of INF-gamma from the supernatant was measured by enzyme-linked immunosorbent assay (ELISA), and the increase calculated. Response was positive in 27 (21.43%) of the 126 drugs. Statin was the only drug with a positive response in 80% of those cases. Nine of 20 patients (45.0%) had complete resolution after discontinuation of the drug; 6 (30.0%) who replaced one drug by another statin had partial or no resolution; and 5 (20.0%) had no resolution despite cessation of statins of all kinds. A positive INF-gamma release test was found in patients who developed skin reactions while taking statins; the test's reliability was strengthened by prompt improvement following elimination of the suspected drug in the majority of patients.
Ng, Cherie T; Sullivan, Brian M; Teijaro, John R; Lee, Andrew M; Welch, Megan; Rice, Stephanie; Sheehan, Kathleen C F; Schreiber, Robert D; Oldstone, Michael B A
2015-05-13
Although type I interferon (IFN-I) is thought to be beneficial against microbial infections, persistent viral infections are characterized by high interferon signatures suggesting that IFN-I signaling may promote disease pathogenesis. During persistent lymphocytic choriomeningitis virus (LCMV) infection, IFNα and IFNβ are highly induced early after infection, and blocking IFN-I receptor (IFNAR) signaling promotes virus clearance. We assessed the specific roles of IFNβ versus IFNα in controlling LCMV infection. While blockade of IFNβ alone does not alter early viral dissemination, it is important in determining lymphoid structure, lymphocyte migration, and anti-viral T cell responses that lead to accelerated virus clearance, approximating what occurs during attenuation of IFNAR signaling. Comparatively, blockade of IFNα was not associated with improved viral control, but with early dissemination of virus. Thus, despite their use of the same receptor, IFNβ and IFNα have unique and distinguishable biologic functions, with IFNβ being mainly responsible for promoting viral persistence. Copyright © 2015 Elsevier Inc. All rights reserved.
Hansel, Trevor T; Tunstall, Tanushree; Trujillo-Torralbo, Maria-Belen; Shamji, Betty; Del-Rosario, Ajerico; Dhariwal, Jaideep; Kirk, Paul D W; Stumpf, Michael P H; Koopmann, Jens; Telcian, Aurica; Aniscenko, Julia; Gogsadze, Leila; Bakhsoliani, Eteri; Stanciu, Luminita; Bartlett, Nathan; Edwards, Michael; Walton, Ross; Mallia, Patrick; Hunt, Toby M; Hunt, Trevor L; Hunt, Duncan G; Westwick, John; Edwards, Matthew; Kon, Onn Min; Jackson, David J; Johnston, Sebastian L
2017-05-01
Rhinovirus infection is a major cause of asthma exacerbations. We studied nasal and bronchial mucosal inflammatory responses during experimental rhinovirus-induced asthma exacerbations. We used nasosorption on days 0, 2-5 and 7 and bronchosorption at baseline and day 4 to sample mucosal lining fluid to investigate airway mucosal responses to rhinovirus infection in patients with allergic asthma (n=28) and healthy non-atopic controls (n=11), by using a synthetic absorptive matrix and measuring levels of 34 cytokines and chemokines using a sensitive multiplex assay. Following rhinovirus infection asthmatics developed more upper and lower respiratory symptoms and lower peak expiratory flows compared to controls (all P<0.05). Asthmatics also developed higher nasal lining fluid levels of an anti-viral pathway (including IFN-γ, IFN-λ/IL-29, CXCL11/ITAC, CXCL10/IP10 and IL-15) and a type 2 inflammatory pathway (IL-4, IL-5, IL-13, CCL17/TARC, CCL11/eotaxin, CCL26/eotaxin-3) (area under curve day 0-7, all P<0.05). Nasal IL-5 and IL-13 were higher in asthmatics at day 0 (P<0.01) and levels increased by days 3 and 4 (P<0.01). A hierarchical correlation matrix of 24 nasal lining fluid cytokine and chemokine levels over 7days demonstrated expression of distinct interferon-related and type 2 pathways in asthmatics. In asthmatics IFN-γ, CXCL10/IP10, CXCL11/ITAC, IL-15 and IL-5 increased in bronchial lining fluid following viral infection (all P<0.05). Precision sampling of mucosal lining fluid identifies robust interferon and type 2 responses in the upper and lower airways of asthmatics during an asthma exacerbation. Nasosorption and bronchosorption have potential to define asthma endotypes in stable disease and at exacerbation. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.
Martins, Marcia Valéria B S; Lima, Mônica Cristina B S; Duppre, Nadia C; Matos, Haroldo J; Spencer, John S; Brennan, Patrick J; Sarno, Euzenir N; Fonseca, Leila; Pereira, Geraldo M B; Pessolani, Maria Cristina V
2007-05-01
There are no reliable means for detecting subclinical mycobacterial infections. The recent sequencing of several mycobacterial genomes has now afforded new opportunities for the development of pathogen-specific diagnostic tests, critical in the context of leprosy and tuberculosis control. In the present study, we applied a multi-parametric flow cytometric analysis that allowed the investigation of T-cell functions in order to define immunological markers that measure previous exposure to mycobacteria. We compared the in vivo response to PPD, the gold standard skin test reagent for measuring previous exposure to Mycobacterium tuberculosis, with in vitro parameters of leukocyte activation in five PPD positive and five PPD negative healthy volunteers. PPD-stimulated peripheral leukocytes expressing CD4, CD69, cutaneous lymphocyte-associated antigen (CLA) and intracellular IFN-gamma were enumerated in whole blood and compared with the size of in vivo PPD-induced induration and IFN-gamma production levels as measured by ELISA in supernatants of PPD-stimulated peripheral blood mononuclear cells. The reactivity to the tuberculin skin test (TST) was associated with markedly increased frequencies of PPD-responsive activated (CD69+) and IFN-gamma-producing CD4+T cells. Detection of PPD-specific IFN-gamma producing leukocytes was restricted to CD4+T cells and a subset of these cells was shown to express the skin homing molecule CLA. Multiple linear regression modeling of responses to PPD showed the highest association between skin test indurations and frequencies of PPD-responsive IFN-gamma-producing CD4+CD69+ T cells. Our data show that the in vitro enumeration of antigen-specific IFN-gamma-producing CD4+ T cells can provide an alternative to the in vivo tuberculin test for the detection of latent Mycobacterium tuberculosis infection. Moreover, the measurement of these immunological parameters can be useful for the screening of new specific antigens defined by the genome
Cappelli, G; Volpe, P; Sanduzzi, A; Sacchi, A; Colizzi, V; Mariani, F
2001-12-01
Mycobacterium tuberculosis is an intracellular pathogen that readily survives and replicates in human macrophages (MPhi). Host cells have developed different mycobactericidal mechanisms, including the production of inflammatory cytokines. The aim of this study was to compare the MPhi response, in terms of cytokine gene expression, to infection with the M. tuberculosis laboratory strain H37Rv and the clinical M. tuberculosis isolate CMT97. Both strains induce the production of interleukin-12 (IL-12) and IL-16 at comparable levels. However, the clinical isolate induces a significantly higher and more prolonged MPhi activation, as shown by reverse transcription-PCR analysis of IL-1beta, IL-6, IL-10, transforming growth factor beta, tumor necrosis factor alpha, and gamma interferon (IFN-gamma) transcripts. Interestingly, when IFN-gamma transcription is high, the number of M. tuberculosis genes expressed decreases and vice versa, whereas no mycobactericidal effect was observed in terms of bacterial growth. Expression of 11 genes was also studied in the two M. tuberculosis strains by infecting resting or activated MPhi and compared to bacterial intracellular survival. In both cases, a peculiar inverse correlation between expression of these genes and multiplication was observed. The number and type of genes expressed by the two strains differed significantly.
Lam, L K Metthew; Watson, Alan M; Ryman, Kate D; Klimstra, William B
2018-01-01
Live attenuated viruses are historically among the most effective viral vaccines. Development of a safe vaccine requires the virus to be less virulent, a phenotype that is historically arrived by empirical evaluation often leaving the mechanisms of attenuation unknown. The yellow fever virus 17D live attenuated vaccine strain has been developed as a delivery vector for heterologous antigens; however, the mechanisms of attenuation remain elusive. The successful and safe progress of 17D as a vaccine vector and the development of live attenuated vaccines (LAVs) to related flaviviruses requires an understanding of the molecular mechanisms leading to attenuation. Using subcutaneous infection of interferon-deficient mouse models of wild type yellow fever virus (WT YFV) pathogenesis and 17D-mediated immunity, we found that, in the absence of type I IFN (IFN-α/β), type II interferon (IFN-γ) restricted 17D replication, but not that of WT YFV, by 1-2 days post-infection. In this context, IFN-γ responses protected 17D-infected animals from mortality, largely restricted the virus to lymphoid organs, and eliminated viscerotropic disease signs such as steatosis in the liver and inflammatory cell infiltration into the spleen. However, WT YFV caused a disseminated infection, gross liver pathology, and rapid death of the animals. In vitro, IFN-γ treatment of myeloid cells suppressed the replication of 17D significantly more than that of WT YFV, suggesting a direct differential effect on 17D virus replication. Together these data indicate that an important mechanism of 17D attenuation in vivo is increased sensitivity to IFN-γ stimulated responses elicited early after infection.
Molecular cloning, expression and characterization of Pekin duck interferon-λ.
Yao, Qingxia; Fischer, Karl P; Arnesen, Karina; Tyrrell, D Lorne; Gutfreund, Klaus S
2014-09-10
Interferons (IFNs) are the first line of defense against viral infections in vertebrates. Type III interferon (IFN-λ) is recognized for its key role in innate immunity of tissues of epithelial origin. Here we describe the identification of the Pekin duck IFN-λ ortholog (duIFN-λ). The predicted duIFN-λ protein has an amino acid identity of 63%, 38%, 37% and 33% with chicken IFN-λ and human IFN-λ3, IFN-λ2 and IFN-λ1, respectively. The duck genome contains a single IFN-λ gene that is comprised of five exons and four introns. Recombinant duIFN-λ up-regulated OASL and Mx-1 mRNA in primary duck hepatocytes. Our observations suggest evolutionary conservation of genomic organization and structural features implicated in receptor binding and antiviral activity. The identification and expression of duIFN-λ will facilitate further study of the role of type III IFN in antiviral defense and inflammatory responses of the Pekin duck, a non-mammalian vertebrate and pathogen host with relevance for human and animal health. Copyright © 2014 Elsevier B.V. All rights reserved.
OK-432 synergizes with IFN-γ to confer dendritic cells with enhanced antitumor immunity.
Pan, Ke; Lv, Lin; Zheng, Hai-xia; Zhao, Jing-jing; Pan, Qiu-zhong; Li, Jian-jun; Weng, De-sheng; Wang, Dan-dan; Jiang, Shan-shan; Chang, Alfred E; Li, Qiao; Xia, Jian-chuan
2014-03-01
Generation of functional dendritic cells (DCs) with boosted immunity after the withdrawal of initial activation/maturation conditions remains a significant challenge. In this study, we investigated the impact of a newly developed maturation cocktail consisting of OK-432 and interferon-gamma (IFN-γ) on the function of human monocyte-derived DCs (MoDCs). We found that OK-432 plus IFN-γ stimulation could induce significantly stronger expression of surface molecules, production of cytokines, as well as migration of DCs compared with OK-432 stimulation alone. Most importantly, DCs matured with OK-432 plus IFN-γ-induced maintained secretion of interleukin-12 (IL-12)p70 in secondary culture after stimulus withdrawal. Functionally, OK-432 plus IFN-γ-conditioned DCs induce remarkable Th1 and Tc1 responses more effectively than OK-432 alone, even more than the use of α-type-1 cytokine cocktail. As a result, DCs matured with OK-432 plus IFN-γ can prime stronger cytotoxic lymphocyte (CTL) and natural killer (NK) cell response against tumor cells in vitro. Peripheral blood mononuclear cells activated by DCs matured with OK-432 plus IFN-γ also showed greater tumor growth inhibition in vivo in null mice. Molecular mechanistic analysis showed that DC maturation using IFN-γ in concert with OK-432 involves the activation of p38 and nuclear factor-kappa B (NF-κB) pathways. This study provided a novel strategy to generate more potent immune segments in DC vaccine.
Martín, V; Pascual, E; Avia, M; Rangel, G; de Molina, A; Alejo, A; Sevilla, N
2016-01-06
Ovine interferon tau (IFN-τ) is a unique type I interferon with low toxicity and a broad host range in vivo. We report the generation of a nonreplicative recombinant adenovirus expressing biologically active IFN-τ. Using the B6.A2G-Mx1 mouse model, we showed that single-dose intranasal administration of recombinant Ad5-IFN-τ can effectively prevent lethality and disease induced by highly virulent hv-PR8 influenza virus by activating the interferon response and preventing viral replication. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
IFN-γ regulates human dental pulp stem cells behavior via NF-κB and MAPK signaling
He, Xinyao; Jiang, Wenkai; Luo, Zhirong; Qu, Tiejun; Wang, Zhihua; Liu, Ningning; Zhang, Yaqing; Cooper, Paul R.; He, Wenxi
2017-01-01
During caries, dental pulp expresses a range of pro-inflammatory cytokines in response to the infectious challenge. Interferon gamma (IFN-γ) is a dimerized soluble cytokine, which is critical for immune responses. Previous study has demonstrated that IFN-γ at relative high concentration (100 ng/mL) treatment improved the impaired dentinogenic and immunosuppressive regulatory functions of disease-derived dental pulp stem cells (DPSCs). However, little is known about the regulatory effects of IFN-γ at relative low concentration on healthy DPSC behavior (including proliferation, migration, and multiple-potential differentiation). Here we demonstrate that IFN-γ at relatively low concentrations (0.5 ng/mL) promoted the proliferation and migration of DPSCs, but abrogated odonto/osteogenic differentiation. Additionally, we identified that NF-κB and MAPK signaling pathways are both involved in the process of IFN-γ-regulated odonto/osteogenic differentiation of DPSCs. DPSCs treated with IFN-γ and supplemented with pyrrolidine dithiocarbamate (PDTC, an NF-κB inhibitor) or SB203580 (a MAPK inhibitor) showed significantly improved potential for odonto/osteogenic differentiation of DPSCs both in vivo and in vitro. These data provide important insight into the regulatory effects of IFN-γ on the biological behavior of DPSCs and indicate a promising therapeutic strategy for dentin/pulp tissue engineering in future endodontic treatment. PMID:28098169
Prevention of SHIV transmission by topical IFN-β treatment.
Veazey, R S; Pilch-Cooper, H A; Hope, T J; Alter, G; Carias, A M; Sips, M; Wang, X; Rodriguez, B; Sieg, S F; Reich, A; Wilkinson, P; Cameron, M J; Lederman, M M
2016-11-01
Understanding vaginal and rectal HIV transmission and protective cellular and molecular mechanisms is critical for designing new prevention strategies, including those required for an effective vaccine. The determinants of protection against HIV infection are, however, poorly understood. Increasing evidence suggest that innate immune defenses may help protect mucosal surfaces from HIV transmission in highly exposed, uninfected subjects. More recent studies suggest that systemically administered type 1 interferon protects against simian immunodeficiency virus infection of macaques. Here we hypothesized that topically applied type 1 interferons might stimulate vaginal innate responses that could protect against HIV transmission. We therefore applied a recombinant human type 1 interferon (IFN-β) to the vagina of rhesus macaques and vaginally challenged them with pathogenic simian/human immunodeficiency virus (SHIV). Vaginal administration of IFN-β resulted in marked local changes in immune cell phenotype, increasing immune activation and HIV co-receptor expression, yet provided significant protection from SHIV acquisition as interferon response genes were also upregulated. These data suggest that protection from vaginal HIV acquisition may be achieved by activating innate mucosal defenses.
Ren, Hongyu; Li, Yuhong; Jiang, Han; Du, Minquan
2016-11-01
A number of studies recently revealed a link between periodontal disease and preterm birth (PTB). PTB can be induced by dental infection with Porphyromonas gingivalis (Pg), a periodontopathic bacterium. This study aims to investigate responses of human extravillous trophoblast-derived HTR8/SVneo cells to Pg infection. Cell apoptosis, cell viability, protein expression, and cytokine production in HTR8 cells were measured via: 1) flow cytometry, 2) CCK-8 assay, 3) western blot, and 4) enzyme-linked immunosorbent assay methods, respectively. Pg decreased cell viability and increased cell apoptosis, active caspase-3 and Fas expression, and interferon-gamma (IFN-γ) secretion in HTR8 cells. Extracellular signal-regulated kinase (ERK) 1/2 inhibitor U0126 and FasL neutralizing antibody NOK1 that blocks FasL/Fas interaction both significantly suppressed Pg-induced apoptosis. U0126 also inhibited IFN-γ secretion and Fas expression close to control levels. Moreover, treatment with recombinant IFN-γ also significantly decreased number of viable HTR8 cells and increased Fas expression, suggesting IFN-γ may play an important role in Pg-induced apoptosis of HTR8 cells, at least partially through regulation of Fas expression. To the best of the authors' knowledge, this is the first study to demonstrate Pg induces IFN-γ secretion, Fas expression, and apoptosis in human extravillous trophoblast-derived HTR8/SVneo cells in an ERK1/2-dependent manner, and IFN-γ (explored by recombinant IFN-γ) and Fas are involved in Pg-induced apoptosis. The finding that Pg infection abnormally regulates inflammation and apoptosis of human trophoblasts may give new insights into the possible link of PTB with maternal periodontal disease and periodontal pathogens.
Laouar, Yasmina; Sutterwala, Fayyaz S; Gorelik, Leonid; Flavell, Richard A
2005-06-01
Interferon-gamma and interleukin 12 produced by the innate arm of the immune system are important regulators of T helper type 1 (T(H)1) cell development, but signals that negatively regulate their expression remain controversial. Here we show that transforming growth factor-beta (TGF-beta) controlled T(H)1 differentiation through the regulation of interferon-gamma produced by natural killer (NK) cells. Blockade of TGF-beta signaling in NK cells caused the accumulation of a large pool of NK cells secreting copious interferon-gamma, responsible for T(H)1 differentiation and protection from leishmania infection. In contrast, blockade of TGF-beta signaling in dendritic cells did not affect dendritic cell homeostasis or interleukin 12 production, thus indicating a previously undescribed demarcation of the function of TGF-beta in NK cells versus dendritic cells.
Kim, Su-Mi; Kim, Se-Kyung; Park, Jong-Hyeon; Lee, Kwang-Nyeong; Ko, Young-Joon; Lee, Hyang-Sim; Seo, Min-Goo; Shin, Yeun-Kyung; Kim, Byounghan
2014-04-01
Foot-and-mouth disease (FMD) is a virulent and economically costly disease in domestic livestock. Since the current vaccine available against FMD provides no protection until 7days postvaccination, the only alternative method to halt the spread of the FMD virus (FMDV) during outbreaks is by the application of anti-viral agents. The combination of recombinant adenovirus expressing type I interferon (IFN-α) and adenovirus expressing type II IFN (IFN-γ) has been reported to be an effective anti-viral treatment strategy against FMDV. Nevertheless, the recombinant adenovirus mixture may be inefficient because of the low anti-viral efficiency of IFN-γ compared to that of IFN-α. In this study, we generated a recombinant adenovirus co-expressing porcine IFN-α and IFN-γ in tandem using an FMDV 2A sequence to mediate effective cleavage of the two proteins (referred to as Ad-porcine IFN-αγ). We demonstrated that both recombinant porcine IFN-α and IFN-γ were expressed and interferon stimulated gene (ISG)s related with IFN-α and IFN-γ were induced in porcine kidney (IBRS-2) cells infected with Ad-porcine IFN-αγ. Additionally, the anti-viral effects of Ad-porcine IFN-αγ against FMDV were enhanced both in IBRS-2 cells and in CD-1 (ICR) suckling mice compared to that of adenovirus expressing only a single protein. We propose that Ad-porcine IFN-αγ could be a rapid, highly efficient, convenient anti-viral agent against FMDV. Copyright © 2014 Elsevier B.V. All rights reserved.
Antiviral Activity of Lambda Interferon in Chickens
Reuter, Antje; Soubies, Sebastien; Härtle, Sonja; Schusser, Benjamin; Kaspers, Bernd
2014-01-01
Interferons (IFNs) are essential components of the antiviral defense system of vertebrates. In mammals, functional receptors for type III IFN (lambda interferon [IFN-λ]) are found mainly on epithelial cells, and IFN-λ was demonstrated to play a crucial role in limiting viral infections of mucosal surfaces. To determine whether IFN-λ plays a similar role in birds, we produced recombinant chicken IFN-λ (chIFN-λ) and we used the replication-competent retroviral RCAS vector system to generate mosaic-transgenic chicken embryos that constitutively express chIFN-λ. We could demonstrate that chIFN-λ markedly inhibited replication of various virus strains, including highly pathogenic influenza A viruses, in ovo and in vivo, as well as in epithelium-rich tissue and cell culture systems. In contrast, chicken fibroblasts responded poorly to chIFN-λ. When applied in vivo to 3-week-old chickens, recombinant chIFN-λ strongly induced the IFN-responsive Mx gene in epithelium-rich organs, such as lungs, tracheas, and intestinal tracts. Correspondingly, these organs were found to express high transcript levels of the putative chIFN-λ receptor alpha chain (chIL28RA) gene. Transfection of chicken fibroblasts with a chIL28RA expression construct rendered these cells responsive to chIFN-λ treatment, indicating that receptor expression determines cell type specificity of IFN-λ action in chickens. Surprisingly, mosaic-transgenic chickens perished soon after hatching, demonstrating a detrimental effect of constitutive chIFN-λ expression. Our data highlight fundamental similarities between the IFN-λ systems of mammals and birds and suggest that type III IFN might play a role in defending mucosal surfaces against viral intruders in most if not all vertebrates. PMID:24371053
Tilahun, Ashenafi Y; Holz, Marah; Wu, Tsung-Teh; David, Chella S; Rajagopalan, Govindarajan
2011-02-03
Toxic shock syndrome (TSS) caused by the superantigen exotoxins of Staphylococcus aureus and Streptococcus pyogenes is characterized by robust T cell activation, profound elevation in systemic levels of multiple cytokines, including interferon-γ (IFN-γ), followed by multiple organ dysfunction and often death. As IFN-γ possesses pro- as well as anti-inflammatory properties, we delineated its role in the pathogenesis of TSS. Antibody-mediated in vivo neutralization of IFN-γ or targeted disruption of IFN-γ gene conferred significant protection from lethal TSS in HLA-DR3 transgenic mice. Following systemic high dose SEB challenge, whereas the HLA-DR3.IFN-γ(+/+) mice became sick and succumbed to TSS, HLA-DR3.IFN-γ(-/-) mice appeared healthy and were significantly protected from SEB-induced lethality. SEB-induced systemic cytokine storm was significantly blunted in HLA-DR3.IFN-γ(-/-) transgenic mice. Serum concentrations of several cytokines (IL-4, IL-10, IL-12p40 and IL-17) and chemokines (KC, rantes, eotaxin and MCP-1) were significantly lower in HLA-DR3.IFN-γ(-/-) transgenic mice. However, SEB-induced T cell expansion in the spleens was unaffected and expansion of SEB-reactive TCR Vβ8(+) CD4(+) and CD8(+) T cells was even more pronounced in HLA-DR3.IFN-γ(-/-) transgenic mice when compared to HLA-DR3.IFN-γ(+/+) mice. A systematic histopathological examination of several vital organs revealed that both HLA-DR3.IFN-γ(+/+) and HLA-DR3.IFN-γ(-/-) transgenic mice displayed comparable severe inflammatory changes in lungs, and liver during TSS. Remarkably, whereas the small intestines from HLA-DR3.IFN-γ(+/+) transgenic mice displayed significant pathological changes during TSS, the architecture of small intestines in HLA-DR3.IFN-γ(-/-) transgenic mice was preserved. In concordance with these histopathological changes, the gut permeability to macromolecules was dramatically increased in HLA-DR3.IFN-γ(+/+) but not HLA-DR3.IFN-γ(-/-) mice during TSS. Overall
Tilahun, Ashenafi Y.; Holz, Marah; Wu, Tsung-Teh; David, Chella S.; Rajagopalan, Govindarajan
2011-01-01
Toxic shock syndrome (TSS) caused by the superantigen exotoxins of Staphylococcus aureus and Streptococcus pyogenes is characterized by robust T cell activation, profound elevation in systemic levels of multiple cytokines, including interferon-γ (IFN-γ), followed by multiple organ dysfunction and often death. As IFN-γ possesses pro- as well as anti-inflammatory properties, we delineated its role in the pathogenesis of TSS. Antibody-mediated in vivo neutralization of IFN-γ or targeted disruption of IFN-γ gene conferred significant protection from lethal TSS in HLA-DR3 transgenic mice. Following systemic high dose SEB challenge, whereas the HLA-DR3.IFN-γ+/+ mice became sick and succumbed to TSS, HLA-DR3.IFN-γ−/− mice appeared healthy and were significantly protected from SEB-induced lethality. SEB-induced systemic cytokine storm was significantly blunted in HLA-DR3.IFN-γ−/− transgenic mice. Serum concentrations of several cytokines (IL-4, IL-10, IL-12p40 and IL-17) and chemokines (KC, rantes, eotaxin and MCP-1) were significantly lower in HLA-DR3.IFN-γ−/− transgenic mice. However, SEB-induced T cell expansion in the spleens was unaffected and expansion of SEB-reactive TCR Vβ8+ CD4+ and CD8+ T cells was even more pronounced in HLA-DR3.IFN-γ−/− transgenic mice when compared to HLA-DR3.IFN-γ+/+ mice. A systematic histopathological examination of several vital organs revealed that both HLA-DR3.IFN-γ+/+ and HLA-DR3.IFN-γ−/− transgenic mice displayed comparable severe inflammatory changes in lungs, and liver during TSS. Remarkably, whereas the small intestines from HLA-DR3.IFN-γ+/+ transgenic mice displayed significant pathological changes during TSS, the architecture of small intestines in HLA-DR3.IFN-γ−/− transgenic mice was preserved. In concordance with these histopathological changes, the gut permeability to macromolecules was dramatically increased in HLA-DR3.IFN-γ+/+ but not HLA-DR3.IFN-γ−/− mice during TSS. Overall, IFN
A cyclometalated iridium(III) complex used as a conductor for the electrochemical sensing of IFN-γ
NASA Astrophysics Data System (ADS)
Miao, Xiangmin; Ko, Chung-Nga; Vellaisamy, Kasipandi; Li, Zongbing; Yang, Guanjun; Leung, Chung-Hang; Ma, Dik-Lung
2017-02-01
A novel iridium(III) complex was prepared and used as a conductor for sensitive and enzyme-free electrochemical detection of interferon gamma (IFN-γ). This assay is based on a dual signal amplification mechanism involving positively charged gold nanoparticles ((+)AuNPs) and hybridization chain reaction (HCR). To construct the sensor, nafion (Nf) and (+)AuNPs composite membrane was first immobilized onto the electrode surface. Subsequently, a loop-stem structured capture probe (CP) containing a special IFN-γ interact strand was modified onto the (+)AuNP surface via the formation of Au-S bonds. Upon addition of IFN-γ, the loop-stem structure of CP was opened, and the newly exposed “sticky” region of CP then hybridized with DNA hairpin-1 (H1), which in turn opened its hairpin structure for hybridizing with DNA hairpin-2 (H2). Happen of HCR between H1 and H2 thus generated a polymeric duplex DNA (dsDNA) chain. Meanwhile, the iridium(III) complex could interact with the grooves of the dsDNA polymer, producing a strong current signal that was proportional to IFN-γ concentration. Thus, sensitive detection of IFN-γ could be realized with a detection limit down to 16.3 fM. Moreover, satisfied results were achieved by using this method for the detection of IFN-γ in human serum samples.
Shaik, Junaid; Pillay, Manormoney; Jeena, Prakash
2014-09-01
Successful control of childhood TB requires early diagnosis, effective chemotherapy and a method of evaluating the response to therapy. Identification of suitable biomarkers that predict the response to anti-TB therapy may allow the duration of treatment to be shortened. The majority of biomarker studies in paediatric TB have focused on the role of T cell-based interferon-gamma (IFN-γ) release assays (IGRAs) in the diagnosis of either latent or active disease. Little has been published on the role of IGRAs in the monitoring response to therapy in children. We reviewed the available literature to ascertain the value of IGRAs in the monitoring of response to anti-TB therapy in children. We explored the results of the few studies that have investigated the role of IGRAs as markers of response to anti-TB treatment in children. We conclude that the role of IGRAs as surrogate markers appears promising. Robust clinical trials are, however, needed to entrench the value of IGRAs as surrogate biomarkers of response to anti-TB therapy in children. Copyright © 2013 Elsevier Ltd. All rights reserved.
USDA-ARS?s Scientific Manuscript database
While T cell contribution to IAV immunity is appreciated, data comparing methods to evaluate IFN-gamma production by IAV-specific T cells elicited following vaccination is limited. To understand the differential immunogenicity between live-attenuated influenza virus (LAIV) and whole-inactivated viru...
Yoneto, Toshihiko; Yoshimoto, Takayuki; Wang, Chrong-Reen; Takahama, Yasuhiro; Tsuji, Moriya; Waki, Seiji; Nariuchi, Hideo
1999-01-01
We have examined the roles of gamma interferon (IFN-γ), nitric oxide (NO), and natural killer (NK) cells in the host resistance to infection with the blood-stage malarial parasite Plasmodium berghei XAT, an irradiation-induced attenuated variant of the lethal strain P. berghei NK65. Although the infection with P. berghei XAT enhanced NK cell lytic activity of splenocytes, depletion of NK1.1+ cells caused by the treatment of mice with anti-NK1.1 antibody affected neither parasitemia nor IFN-γ production by their splenocytes. The P. berghei XAT infection induced a large amount of NO production by splenocytes during the first peak of parasitemia, while P. berghei NK65 infection induced a small amount. Unexpectedly, however, mice deficient in inducible nitric oxide synthase (iNOS−/−) cleared P. berghei XAT after two peaks of parasitemia were observed, as occurred for wild-type control mice. Although the infected iNOS−/− mouse splenocytes did not produce a detectable level of NO, they produced an amount of IFN-γ comparable to that produced by wild-type control mouse splenocytes, and treatment of these mice with neutralizing anti-IFN-γ antibody led to the progression of parasitemia and fatal outcome. CD4−/− mice infected with P. berghei XAT could not clear the parasite, and all these mice died with apparently reduced IFN-γ production. Furthermore, treatment with carrageenan increased the susceptibility of mice to P. berghei XAT infection. These results suggest that neither NO production nor NK cell activation is critical for the resistance to P. berghei XAT infection and that IFN-γ plays an important role in the elimination of malarial parasites, possibly by the enhancement of phagocytic activity of macrophages. PMID:10225894
We Can Still Be Friends: IFN-γ Breaks Up Macrophage Enhancers.
Novakovic, Boris; Wang, Cheng; Logie, Colin
2017-08-15
Interferon (IFN)-γ can prime macrophages for inflammatory responses by several mechanisms, including enhancer establishment and gene activation. In this issue of Immunity, Kang et al. (2017) provide insight into the mechanisms of IFN-γ-mediated gene repression as they show that IFN-γ promotes the disassembly of select active enhancers by interfering with enhancer-binding transcription factor MAF. Copyright © 2017 Elsevier Inc. All rights reserved.
Antiviral activity of ovine interferon tau 4 against foot-and-mouth disease virus.
Usharani, Jayaramaiah; Park, Sun Young; Cho, Eun-Ju; Kim, Chungsu; Ko, Young-Joon; Tark, Dongseob; Kim, Su-Mi; Park, Jong-Hyeon; Lee, Kwang-Nyeong; Lee, Myoung-Heon; Lee, Hyang-Sim
2017-07-01
Foot-and-mouth disease (FMD) is an economically important disease in most parts of the world and new therapeutic agents are needed to protect the animals before vaccination can trigger the host immune response. Although several interferons have been used for their antiviral activities against Foot-and-mouth disease virus (FMDV), ovine interferon tau 4 (OvIFN-τ4), with a broad-spectrum of action, cross-species antiviral activity, and lower incidence of toxicity in comparison to other type І interferons, has not yet been evaluated for this indication. This is the first study to evaluate the antiviral activity of OvIFN-τ4 against various strains of FMDV. The effective anti-cytopathic concentration of OvIFN-τ4 and its effectiveness pre- and post-infection with FMDV were tested in vitro in LFBK cells. In vivo activity of OvIFN-τ4 was then confirmed in a mouse model of infection. OvIFN-τ4 at a concentration of 500 ng, protected mice until 5days post-FMDV challenge and provided 90% protection for 10 days following FMDV challenge. These results suggest that OvIFN-τ4 could be used as an alternative to other interferons or antiviral agents at the time of FMD outbreak. Copyright © 2017. Published by Elsevier B.V.
The nucleocapsid protein of measles virus blocks host interferon response
DOE Office of Scientific and Technical Information (OSTI.GOV)
Takayama, Ikuyo; Sato, Hiroki; Watanabe, Akira
2012-03-01
Measles virus (MV) belongs to the genus Morbillivirus of the family Paramyxoviridae. A number of paramyxoviruses inhibit host interferon (IFN) signaling pathways in host immune systems by various mechanisms. Inhibition mechanisms have been described for many paramyxoviruses. Although there are inconsistencies among previous reports concerning MV, it appears that P/V/C proteins interfere with the pathways. In this study, we confirmed the effects of MV P gene products of a wild MV strain on IFN pathways and examined that of other viral proteins on it. Interestingly, we found that N protein acts as an IFN-{alpha}/{beta} and {gamma}-antagonist as strong as Pmore » gene products. We further investigated the mechanisms of MV-N inhibition, and revealed that MV-N blocks the nuclear import of activated STAT without preventing STAT and Jak activation or STAT degradation, and that the nuclear translocation of MV-N is important for the inhibition. The inhibitory effect of the N protein was observed as a common feature of other morbilliviruses. The results presented in this report suggest that N protein of MV as well as P/V/C proteins is involved in the inhibition of host IFN signaling pathways.« less
Cossetti, Chiara; Iraci, Nunzio; Mercer, Tim R.; Leonardi, Tommaso; Alpi, Emanuele; Drago, Denise; Alfaro-Cervello, Clara; Saini, Harpreet K.; Davis, Matthew P.; Schaeffer, Julia; Vega, Beatriz; Stefanini, Matilde; Zhao, CongJian; Muller, Werner; Garcia-Verdugo, Jose Manuel; Mathivanan, Suresh; Bachi, Angela; Enright, Anton J.; Mattick, John S.; Pluchino, Stefano
2015-01-01
SUMMARY The idea that stem cell therapies work only via cell replacement is challenged by the observation of consistent intercellular molecule exchange between the graft and the host. Here we defined a mechanism of cellular signaling by which neural stem/precursor cells (NPCs) communicate with the microenvironment via extracellular vesicles (EVs), and we elucidated its molecular signature and function. We observed cytokine-regulated pathways that sort proteins and mRNAs into EVs. We described induction of interferon gamma (IFN-γ) pathway in NPCs exposed to proinflammatory cytokines that is mirrored in EVs. We showed that IFN-γ bound to EVs through Ifngr1 activates Stat1 in target cells. Finally, we demonstrated that endogenous Stat1 and Ifngr1 in target cells are indispensable to sustain the activation of Stat1 signaling by EV-associated IFN-γ/Ifngr1 complexes. Our study identifies a mechanism of cellular signaling regulated by EV-associated IFN-γ/Ifngr1 complexes, which grafted stem cells may use to communicate with the host immune system. PMID:25242146
Takii, T; Niki, N; Yang, D; Kimura, H; Ito, A; Hayashi, H; Onozaki, K
1995-12-01
The regulation of type I interleukin-1 receptor (IL-1R) expression by type I, interferon (IFN)-alpha A/D, and type II IFN, IFN-gamma, in a human fibroblast cell line TIG-1 was investigated. After 2 h stimulation with human IFN-alpha A/D or IFN-gamma, the levels of type I IL-1R mRNA increased. We previously reported that IL-1 upregulates transcription and cell surface molecules of type I IL-1R in TIG-1 cells through induction of prostaglandin (PG) E2 and cAMP accumulation. However, indomethacin was unable to inhibit the effect of IFNs, indicating that IFNs augment IL-1R expression through a pathway distinct from that of IL-1. The augmentation was also observed in other fibroblast cell lines. Nuclear run-on assays and studies of the stability of mRNA suggested that the increase in IL-1R mRNA was a result of the enhanced transcription of IL-1R gene. Binding studies using 125I-IL-1 alpha revealed that the number of cell surface IL-1R increased with no change in binding affinity by treatment with these IFNs. Pretreatment of the cells with IFNs enhanced IL-1-induced IL-6 production, indicating that IFNs upregulate functional IL-1R. IL-1 and IFNs are produced by the same cell types, as well as by the adjacent different cell types, and are concomitantly present in lesions of immune and inflammatory reactions. These results therefore suggest that IFNs exhibit synergistic effects with IL-1 through upregulation of IL-1R. Augmented production of IL-6 may also contribute to the reactions.
Towards molecular modeling of the impact of heparin-derived oligosaccharides on hIFN-γ binding
NASA Astrophysics Data System (ADS)
Lilkova, E.; Petkov, P.; Ilieva, N.; Litov, L.
2015-10-01
Human interferon gamma (hIFN-γ) is an important signalling molecule, which plays a key role in the formation and modulation of immune response. The role of the cytokine C-termini in the formation of a complex with the extracellular receptor is still controversial due to the lack of structural information about this domain. Moreover, the C-termini are also responsible for the high affinity interaction of hIFN-γ with the glycosaminoglicans heparan sulfate and heparin. This interaction can drastically change the properties and behaviour of the protein. We performed molecular dynamics simulations in order to model the structure of the hIFN-γ C-terminal part and the interaction of the cytokine with heparin-derived oligosaccharides. For this purpose we reconstructed the missing C-terminal amino acid residues and performed folding simulations to determine their conformation. In order to simulate the interaction with heparin-like fragments, we developed CHARMM 36 compatible force field for the sulfamate anion group that is present in the glucosamine sugar to complete the heparin and heparan sulfate force field. The new topology and parameters reproduce the available experimental structural properties of heparin-like fragments. The simulations show that the oligosaccharides quickly bind the IFN-γ C-termini and reduce their solvent accessible surface area.
Muramatsu, Matthew K.; Brothwell, Julie A.; Stein, Barry D.; Putman, Timothy E.; Rockey, Daniel D.
2016-01-01
Chlamydia trachomatis can enter a viable but nonculturable state in vitro termed persistence. A common feature of C. trachomatis persistence models is that reticulate bodies fail to divide and make few infectious progeny until the persistence-inducing stressor is removed. One model of persistence that has relevance to human disease involves tryptophan limitation mediated by the host enzyme indoleamine 2,3-dioxygenase, which converts l-tryptophan to N-formylkynurenine. Genital C. trachomatis strains can counter tryptophan limitation because they encode a tryptophan-synthesizing enzyme. Tryptophan synthase is the only enzyme that has been confirmed to play a role in interferon gamma (IFN-γ)-induced persistence, although profound changes in chlamydial physiology and gene expression occur in the presence of persistence-inducing stressors. Thus, we screened a population of mutagenized C. trachomatis strains for mutants that failed to reactivate from IFN-γ-induced persistence. Six mutants were identified, and the mutations linked to the persistence phenotype in three of these were successfully mapped. One mutant had a missense mutation in tryptophan synthase; however, this mutant behaved differently from previously described synthase null mutants. Two hypothetical genes of unknown function, ctl0225 and ctl0694, were also identified and may be involved in amino acid transport and DNA damage repair, respectively. Our results indicate that C. trachomatis utilizes functionally diverse genes to mediate survival during and reactivation from persistence in HeLa cells. PMID:27430273
Werner-Felmayer, G; Baier-Bitterlich, G; Fuchs, D; Hausen, A; Murr, C; Reibnegger, G; Werner, E R; Wachter, H
1995-01-01
In a number of mammalian cell types, pteridine biosynthesis from guanosine 5'-triphosphate and formation of nitric oxide from L-arginine are induced by gamma interferon (IFN-gamma) and bacterial lipopolysaccharide (LPS). We assessed the possibility of using such metabolic alterations for the in vitro detection of pyrogens. Products from gram-negative and gram-positive bacteria and related synthetic compounds were tested for their potential to induce either of these pathways. Stimulation of pteridine biosynthesis was monitored as the formation of neopterin in the human myelomonocytic cell line THP-1. The formation of nitric oxide was determined as nitrite in murine J774A.1 macrophage cultures. The substances tested included toxic and detoxified parts of LPS and lipid A from Escherichia coli, Salmonella typhimurium, Salmonella minnesota, and Klebsiella pneumoniae as well as lipoteichoic acid and toxic shock syndrome toxin 1 from Staphylococcus aureus. Furthermore, two cell wall compounds from Mycobacterium tuberculosis, trehalose 6,6'-dimycolate and N-acetylmuramyl-L-alanyl-D-isoglutamine, which are active components of Freund's adjuvant, were used. When applied as a single stimulus, only the whole LPS molecule potently stimulated neopterin or nitrite formation. Lipid A and products from gram-positive bacteria were weakly active. For neopterin formation, lipid A required the presence of fetal calf serum. Besides detoxified LPS and independently from the presence of serum, all bacterial compounds tested strongly increased the effects mediated by IFN-gamma. Our results show that bacterial pyrogens can be detected by monitoring the formation of neopterin or nitrite. This may provide a basis for the development of an in vitro assay for the detection of pyrogenic contamination with the aim of replacing the currently used animal test. PMID:7664177
Fisher, P B; Prignoli, D R; Hermo, H; Weinstein, I B; Pestka, S
1985-01-01
We have analyzed the effects of various human interferons produced in bacteria and the antileukemic compound mezerein (MEZ) on growth and melanogenesis in human melanoma cells. In four human melanoma cell lines, recombinant human fibroblast interferon (IFN-beta) was more active than recombinant human leukocyte interferons (IFN-alpha A, IFN-alpha D, or IFN-alpha A/D (Bgl] in inhibiting cellular proliferation. When monolayer cultures were exposed to 1000 IU/ml IFN-beta for four days the degree of growth inhibition in the different melanoma cell lines varied between 94 and 26%. Similarly, four days growth in medium containing 10 ng/ml MEZ resulted in either no inhibition of growth or as much as 53% inhibition of growth, depending on the specific melanoma cell line tested. MEZ induced dendrite-like processes, cytoplasmic projections morphologically similar to those normally found in neurons and melanocytes, in all four melanoma cell lines, whereas none of the interferons tested had this effect. The combination of interferon and MEZ resulted in a dramatic inhibition in cellular proliferation in all four melanoma cell lines. When cell extracts were assayed for melanin content, a marker of melanoma cell differentiation, the combination of IFN-beta and MEZ resulted in higher levels of melanin than with either agent alone. Dendrite-like formation was also prominent in the cultures treated with this combination. These results indicate that the antiproliferative effect of interferon toward human melanoma dells can be enhanced by treatment with MEZ and that this effect is associated with an enhancement of terminal differentiation.
Pierkes, M; Bellinghausen, I; Hultsch, T; Metz, G; Knop, J; Saloga, J
1999-02-01
Recent studies provide evidence that venom immunotherapy (VIT) alters the pattern of cytokine production by inducing an allergen-specific T-cell shift in cytokine expression from TH2 (IL-4, IL-5) to TH1 (IFN-gamma) cytokines and also inducing the production of IL-10. This study was carried out to analyze whether these changes in cytokine production of T cells already observed 1 week after the initiation of VIT in subjects with wasp venom allergy also influence the reactivity of effector cells, such as mast cells and basophils. All subjects included in this study had a history of severe systemic allergic reactions to wasp stings and positive skin test responses with venom and venom-specific IgE in the sera. Peripheral blood leukocytes were isolated before and after the initiation of VIT (rush therapy reaching a maintenance dose of 100 microg venom injected subcutaneously within 1 week) and preincubated with or without addition of IL-10, IFN-gamma, IL-10 + IFN-gamma, anti-IL-10, or anti-IFN-gamma. After stimulation with wasp venom, histamine and sulfidoleukotriene release were assessed by ELISA and compared with spontaneous release and total histamine content. After the induction of VIT, venom-induced absolute and relative histamine and sulfidoleukotriene release were reduced. This was at least partially due to the induction of IFN-gamma and IL-10 production, because (1) neutralization of IL-10 and IFN-gamma by mAbs partially restored the release after the initiation of VIT and (2) the addition of exogenous IFN-gamma and IL-10 caused a statistically significant diminution of the venom-induced histamine and sulfidoleukotriene release before VIT. Depletion of CD2(+) T cells also restored the releasability after VIT. These data indicate that T cells (producing IL-10 and IFN-gamma after VIT) play a key role for the inhibition of histamine and sulfidoleukotriene release of effector cells.
USDA-ARS?s Scientific Manuscript database
Type I interferons, such as interferon (IFN) alpha, contribute to innate antiviral immunity by promoting production of antiviral mediators and also play a role in the adaptive immune response. Porcine reproductive and respiratory syndrome (PRRS) has been shown to induce a meager IFN-alpha response. ...
Interferon-Gamma Promotes UV-Induced Melanoma in Mice | Center for Cancer Research
Scientists have made an unanticipated discovery in mice that interferon-gamma, a type of protein primarily used by the immune system for intercellular communication, acts as a promoter for the deadly form of skin cancer known as melanoma. This finding resulted from a series of experiments designed to understand how solar ultraviolet (UV) radiation causes melanoma. This study
Heathcote, E J; James, S; Mullen, K D; Hauser, S C; Rosenblate, H; Albert, D G
1999-08-01
Patients with chronic hepatitis C who have not had a sustained hepatitis C virus (HCV)-RNA response or serum alanine transaminase (ALT) response to a 6-month course of interferon (IFN) may respond to higher dose retreatment with consensus interferon (CIFN). Some nonresponders to initial IFN treatment have a transient response defined as undetectable HCV RNA or normalization of ALT during treatment, but subsequently have a "breakthrough" while still on treatment. The aim of this study was to determine if nonresponders who had breakthroughs responded differently to CIFN retreatment than nonresponders without breakthroughs using data from a large, multicenter trial. ALT and HCV RNA were monitored frequently during initial IFN therapy (either 9 mcg CIFN or 3 MU IFN-alpha2b 3 times per week). HCV-RNA breakthroughs were observed in 86 of 467 (18%) of all treated patients, and ALT breakthroughs were observed in 90 of 467 (19%) of all treated patients. There was no association between breakthroughs and the presence of either binding or neutralizing anti-IFN antibodies. When the patients who were nonresponders to initial IFN treatment were retreated with CIFN (15 mcg) for 12 months, 27% of those with viral breakthroughs had a sustained viral response compared with 8% in prior nonresponders without breakthroughs (P =.102). Sustained ALT responses were observed in 39% with breakthroughs compared with 10% in those without breakthroughs (P =.014). The data suggest that prior nonresponders with breakthroughs have a greater chance of responding to retreatment than do nonresponders without breakthroughs. However, most breakthrough patients would be missed unless repeated HCV-RNA testing were conducted during therapy.
Fink, Annette; Lemmermann, Niels A W; Gillert-Marien, Dorothea; Thomas, Doris; Freitag, Kirsten; Böhm, Verena; Wilhelmi, Vanessa; Reifenberg, Kurt; Reddehase, Matthias J; Holtappels, Rafaela
2012-11-01
Cytomegalovirus (CMV) disease with multiple organ manifestations is the most feared viral complication limiting the success of hematopoietic cell transplantation as a therapy of hematopoietic malignancies. A timely endogenous reconstitution of CD8 T cells controls CMV infection, and adoptive transfer of antiviral CD8 T cells is a therapeutic option to prevent CMV disease by bridging the gap between an early CMV reactivation and delayed endogenous reconstitution of protective immunity. Preclinical research in murine models has provided 'proof of concept' for CD8 T-cell therapy of CMV disease. Protection by CD8 T cells appears to be in conflict with the finding that CMVs encode proteins that inhibit antigen presentation to CD8 T cells by interfering with the constitutive trafficking of peptide-loaded MHC class I molecules (pMHC-I complexes) to the cell surface. Here, we have systematically explored antigen presentation in the presence of the three currently noted immune evasion proteins of murine CMV in all possible combinations and its modulation by pre-treatment of cells with interferon-gamma (IFN-γ). The data reveal improvement in antigen processing by pre-treatment with IFN-γ can almost overrule the inhibitory function of immune evasion molecules in terms of pMHC-I expression levels capable of triggering most of the specific CD8 T cells, though the intensity of stimulation did not retrieve their full functional capacity. Notably, an in vivo conditioning of host tissue cells with IFN-γ in adoptive cell transfer recipients constitutively overexpressing IFN-γ (B6-SAP-IFN-γ mice) enhanced the antiviral efficiency of CD8 T cells in this transgenic cytoimmunotherapy model.
Kuo, Joseph; Warner, Thomas F; Schell, Ronald F
2017-08-31
The role that cytokines play in the induction of Lyme arthritis is gradually being delineated. We showed previously that severe arthritis developed in a T-cell-driven murine model, even in mice lacking interleukin-17A (IL-17A) and administered anti-gamma-interferon (IFN-γ) antibody. Increased levels of tumor necrosis factor alpha (TNF-α) and interleukin-6 (IL-6), two pro-inflammatory cytokines, were detected in cultures of popliteal lymph node cells obtained from these mice. We hypothesized that concomitantly administered anti-IL-6, anti-TNF-α and anti-IFN-γ antibodies would inhibit the development of arthritis in IL-17A-deficient mice. Our results showed that swelling of the hind paws and histopathological changes consistent with arthritis were significantly reduced in IL-17A-deficient mice that administered the three anti-cytokine antibodies. These results suggest that treatment with multiple anti-cytokine antibodies can abrogate the induction of Lyme arthritis in mice. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Montoya, Carlos Julio; Velilla, Paula Andrea; Chougnet, Claire; Landay, Alan L; Rugeles, Maria Teresa
2006-08-01
The mechanisms involved in controlling the establishment of HIV-1 infection are not fully understood. In particular, the role of innate immunity in natural resistance exhibited by individuals who are continuously exposed to HIV-1 but remain seronegative (ESN) has not been thoroughly evaluated. We determined the frequency and function of peripheral blood innate immune cells (plasmacytoid and myeloid dendritic cells, monocytes, NK cells, CD3+/CD56+ cells and invariant NKT cells) in ESN, chronically HIV-1-infected and low-risk HIV-1 seronegative individuals. ESN demonstrated a similar frequency of innate immune cells in comparison to controls and a higher frequency of dendritic cells, NK and invariant NKT cells compared to HIV-1-infected subjects. Incubation of mononuclear cells with stimulatory CpG ODN induced CD86 and CD69 up-regulation to a similar degree on innate cells from the three study groups. CpG ODN-stimulated secretion of cytokines was also similar between ESN and controls, while secretion of IFN-alpha was significantly decreased in HIV-1+ individuals. Importantly, expression of IFN-gamma by PMA/Ionomycin-activated CD56(bright) NK cells and CD3+/CD56+ cells was significantly higher in ESN when compared with controls. The anti-viral effects of IFN-gamma are well established, and so our results suggest that IFN-gamma production by innate immune cells might be one of the multiple factors involved in controlling the establishment of sexually transmitted HIV-1 infection.
Maroufi, Yahya; Ghaffarifar, Fatemeh; Dalimi, Abdolhosein; Sharifi, Zohreh
2014-06-01
Cutaneous leishmaniasis is a health problem in the world. Lesions should be treated on cosmetically or functionally important sites, such as the face and hands. Cantharidin is a terpenoid compound produced naturally by beetles of Meloidae and Oedemeridae families. The current study aimed to investigate the effect of cantharidin on Cutaneous Leishmaniasis (CL) lesions and IFN-γ and IL-4 patterns in infected BALB/c mice. INFECTED BALB/C MICE WERE DIVIDED INTO FIVE GROUPS AS: untreated (control group), eucerin-treated and 0.05%, 0.1% and 0.5% cantharidin-treated. Lesions diameter was measured by Vernier caliper every three days for four weeks. Cytokines levels were measured by enzyme-linked immunosorbent assay (ELISA) using U-CyTech kit. The results indicated that treatment with cantharidin exacerbates lesions compared with the controls, except for 0.05% cantharidin dose that restrained lesion growth significantly. Interferon gamma level in cantharidin-treated groups was significantly less than that of the control group. But interlukin-4 level was similar among the groups. The current study results indicated that high doses of cantharidin exacerbates leishmaniasis lesion, but low dose of cantharidin inhibits lesion growth.
Maroufi, Yahya; Ghaffarifar, Fatemeh; Dalimi, Abdolhosein; Sharifi, Zohreh
2014-01-01
Background: Cutaneous leishmaniasis is a health problem in the world. Lesions should be treated on cosmetically or functionally important sites, such as the face and hands. Cantharidin is a terpenoid compound produced naturally by beetles of Meloidae and Oedemeridae families. Objectives: The current study aimed to investigate the effect of cantharidin on Cutaneous Leishmaniasis (CL) lesions and IFN-γ and IL-4 patterns in infected BALB/c mice. Materials and Methods: Infected BALB/c mice were divided into five groups as: untreated (control group), eucerin-treated and 0.05%, 0.1% and 0.5% cantharidin-treated. Lesions diameter was measured by Vernier caliper every three days for four weeks. Cytokines levels were measured by enzyme-linked immunosorbent assay (ELISA) using U-CyTech kit. Results: The results indicated that treatment with cantharidin exacerbates lesions compared with the controls, except for 0.05% cantharidin dose that restrained lesion growth significantly. Interferon gamma level in cantharidin-treated groups was significantly less than that of the control group. But interlukin-4 level was similar among the groups. Conclusions: The current study results indicated that high doses of cantharidin exacerbates leishmaniasis lesion, but low dose of cantharidin inhibits lesion growth. PMID:25371808
Williams, C M; Coleman, J W
1995-10-01
We examined the capacity of purified rat peritoneal connective tissue-type mast cells (PMC) to express mRNA for several cytokines. Stimulation of PMC with anti-IgE for 4 hr induced the expression of mRNA encoding interleukin-5 (IL-5), IL-6, tumour necrosis factor-alpha (TNF-alpha), macrophage inflammatory protein-2 (MIP-2) and interferon-gamma (IFN-gamma). Unstimulated PMC expressed detectable mRNA for TNF-alpha but not for the other four cytokines. Incubation of PMC with cyclosporin A (CsA) or dexamethasone (DEX), each at 10(-6) M for 24 hr, significantly inhibited the induced expression of mRNA for each of the five cytokines, and also inhibited release of biologically active TNF-alpha. Throughout these experiments mRNA levels of the housekeeping gene G3PDH were not altered by stimulation with anti-IgE or incubation with CsA or DEX. We conclude that immunological activation of rat PMC induces gene expression of several cytokines and that expression of these genes can be inhibited by immunosuppressive drugs.
Williams, C M; Coleman, J W
1995-01-01
We examined the capacity of purified rat peritoneal connective tissue-type mast cells (PMC) to express mRNA for several cytokines. Stimulation of PMC with anti-IgE for 4 hr induced the expression of mRNA encoding interleukin-5 (IL-5), IL-6, tumour necrosis factor-alpha (TNF-alpha), macrophage inflammatory protein-2 (MIP-2) and interferon-gamma (IFN-gamma). Unstimulated PMC expressed detectable mRNA for TNF-alpha but not for the other four cytokines. Incubation of PMC with cyclosporin A (CsA) or dexamethasone (DEX), each at 10(-6) M for 24 hr, significantly inhibited the induced expression of mRNA for each of the five cytokines, and also inhibited release of biologically active TNF-alpha. Throughout these experiments mRNA levels of the housekeeping gene G3PDH were not altered by stimulation with anti-IgE or incubation with CsA or DEX. We conclude that immunological activation of rat PMC induces gene expression of several cytokines and that expression of these genes can be inhibited by immunosuppressive drugs. Images Figure 1 Figure 2 Figure 3 PMID:7490125
Hecker, M.; Preiss, C.; Klemm, P.; Busse, R.
1996-01-01
1. In view of the potential deleterious effects of high amounts of nitric oxide (NO) produced by the inducible isoform of NO synthase (iNOS) in inflammation, the prevention of the expression of this enzyme represents an important therapeutic goal. In cytokine-stimulated cells, activation of nuclear factor kappa B (NF-kappa B) is crucial for the increase in iNOS gene expression. Since NF-kappa B activation appears to involve a redox-sensitive step, we have investigated whether three structurally unrelated antioxidants, 5,7-dihydroxyflavone (chrysin), 3,4-dichloroisocoumarin (DCI) and N-acetyl 5-hydroxytryptamine (N-acetylserotonin, NAS), affect iNOS expression in cultured RAW 264.7 monocyte/macrophages stimulated with bacterial lipopolysaccharide (LPS, 140 ng ml-1) and interferon-gamma (IFN gamma, 5 u ml-1). 2. During a 6 h incubation period neither LPS nor IFN gamma alone exerted a significant effect but when combined, caused a prominent increase in nitrite formation, iNOS mRNA and protein abundance. Co-incubation with chrysin (50 microM), DCI (50 microM) or NAS (1 mM) markedly attenuated this increase in iNOS gene expression. 3. DCI, but not chrysin or NAS, prevented the activation of NF-kappa B in cells exposed to LPS plus IFN gamma for 30 min. In contrast, all three antioxidants significantly blunted the DNA-binding activity of interferon regulatory factor 1 (IRF-1), which mediates the synergistic effect of IFN gamma on iNOS gene expression in cells treated for 2 h with LPS plus IFN gamma. 4. DCI thus appears to inhibit iNOS gene expression at the transcriptional level by preventing the activation of both NF-kappa B and IRF-1. The inhibitory effect of DCI on NF-kappa B activation, however, does not seem to be related to its antioxidative properties, since DCI, unlike chrysin or NAS, is a potent serine protease inhibitor which stabilizes the inactive NF-kappa B complex by protecting the inhibitory I kappa B-alpha subunit from proteolytic degradation. 5. The
Gil, Olga; Vilaplana, Cristina; Guirado, Evelyn; Díaz, Jorge; Cáceres, Neus; Singh, Mahavir; Cardona, Pere-Joan
2008-11-01
Gamma interferon responses of spleen cells in mice were examined during postchemotherapy relapse of intraperitoneally induced latent tuberculous infection. The mycobacterial extract RUTI, which prevented the relapse, significantly enhanced the immune responses to secreted and structural recombinant mycobacterial antigens, suggesting that RUTI-mediated protection was mediated by activated T cells.
The regulation of inflammation by interferons and their STATs.
Rauch, Isabella; Müller, Mathias; Decker, Thomas
2013-01-01
Interferons (IFN) are subdivided into type I IFN (IFN-I, here synonymous with IFN-α/β), type II (IFN-γ) and type III IFN (IFN-III/IFN-λ) that reprogram nuclear gene expression through STATs 1 and 2 by forming STAT1 dimers (mainly IFN-γ) or the ISGF3 complex, a STAT1-STAT2-IRF9 heterotrimer (IFN-I and IFN-III). Dominant IFN activities in the immune system are to protect cells from viral replication and to activate macrophages for enhanced effector function. However, the impact of IFN and their STATs on the immune system stretches far beyond these activities and includes the control of inflammation. The goal of this review is to give an overview of the different facets of the inflammatory process that show regulatory input by IFN/STAT.
Haldar, Arun K; Piro, Anthony S; Finethy, Ryan; Espenschied, Scott T; Brown, Hannah E; Giebel, Amanda M; Frickel, Eva-Maria; Nelson, David E; Coers, Jörn
2016-12-13
The cytokine gamma interferon (IFN-γ) induces cell-autonomous immunity to combat infections with intracellular pathogens, such as the bacterium Chlamydia trachomatis The present study demonstrates that IFN-γ-primed human cells ubiquitinate and eliminate intracellular Chlamydia-containing vacuoles, so-called inclusions. We previously described how IFN-γ-inducible immunity-related GTPases (IRGs) employ ubiquitin systems to mark inclusions for destruction in mouse cells and, furthermore, showed that the rodent pathogen Chlamydia muridarum blocks ubiquitination of its inclusions by interfering with mouse IRG function. Here, we report that ubiquitination of inclusions in human cells is independent of IRG and thus distinct from the murine pathway. We show that C. muridarum is susceptible to inclusion ubiquitination in human cells, while the closely related human pathogen C. trachomatis is resistant. C. muridarum, but not C. trachomatis, inclusions attract several markers of cell-autonomous immunity, including the ubiquitin-binding protein p62, the ubiquitin-like protein LC3, and guanylate-binding protein 1. Consequently, we find that IFN-γ priming of human epithelial cells triggers the elimination of C. muridarum, but not C. trachomatis, inclusions. This newly described defense pathway is independent of indole-2,3-dioxygenase, a known IFN-γ-inducible anti-Chlamydia resistance factor. Collectively, our observations indicate that C. trachomatis evolved mechanisms to avoid a human-specific, ubiquitin-mediated response as part of its unique adaptation to its human host. Chlamydia trachomatis is the leading cause of sexually transmitted bacterial infections and responsible for significant morbidity, including pelvic inflammatory disease, infertility, and ectopic pregnancies in women. As an obligate intracellular pathogen, C. trachomatis is in perpetual conflict with cell-intrinsic defense programs executed by its human host. Our study defines a novel anti
Duran, Maria Carolina; Willenbrock, Saskia; Müller, Jessika-M V; Nolte, Ingo; Feige, Karsten; Murua Escobar, Hugo
2013-04-01
Interleukin-12 (IL-12) and interferon gamma (IFN-γ) are key cytokines in immunemediated equine melanoma therapy. Currently, a method for accurate simultaneous quantification of these equine cytokines is lacking. Therefore, we sought to establish an assay that allows for accurate and simultaneous quantification of equine IL-12 (eIL-12) and IFN-γ (eIFN-γ). Several antibodies were evaluated for cross-reactivity to eIL-12 and eIFN-γ and were used to establish a bead-based Luminex assay, which was subsequently applied to quantify cytokine concentrations in biological samples. Cytokine detection ranged from 31.5-5,000 pg/ml and 15-10,000 pg/ml for eIL-12 and eIFN-γ, respectively. eIL-12 was detected in supernatants of stimulated peripheral blood mononuclear cells (PBMCs) and supernatants/cell lysates of eIL-12 expression plasmid-transfected cells. Low or undetectable cytokine concentrations were measured in negative controls. In equine serum samples, the mean measured eIL-12 concentration was 1,374 ± 8 pg/ml. The bead-based assay and ELISA for eIFN-γ used to measure eIFN-γ concentrations, showed similar concentrations. Results demonstrate, to our knowledge for the first time, that cross-reactive antibody pairs to eIL-12 and eIFN-γ and Luminex bead-based technology allow for accurate, simultaneous and multiplexed quantification of these key cytokines in biological samples.
Sugiyama, Ryuichi; Murayama, Asako; Nitta, Sayuri; Yamada, Norie; Tasaka-Fujita, Megumi; Masaki, Takahiro; Aly, Hussein Hassan; Shiina, Masaaki; Ryo, Akihide; Ishii, Koji; Wakita, Takaji; Kato, Takanobu
2018-01-01
The number of amino acid substitutions in the interferon (IFN) sensitivity-determining region (ISDR) of hepatitis C virus (HCV) NS5A is a strong predictor for the outcome of IFN-based treatment. To assess the involvement of ISDR in the HCV life cycle and to clarify the molecular mechanisms influencing IFN susceptibility, we used recombinant JFH-1 viruses with NS5A of the genotype 1b Con1 strain (JFH1/5ACon1) and with NS5A ISDR containing 7 amino acid substitutions (JFH1/5ACon1/i-7mut), and compared the virus propagation and the induction of interferon-stimulated genes (ISGs). By transfecting RNAs of these strains into HuH-7-derived cells, we found that the efficiency of infectious virus production of JFH1/5ACon1/i-7mut was attenuated compared with JFH1/5ACon1. After transfecting full-length HCV RNA into HepaRG cells, the mRNA expression of ISGs was sufficiently induced by IFN treatment in JFH1/5ACon1/i-7mut-transfected but not in JFH1/5ACon1-transfected cells. These data suggested that the NS5A-mediated inhibition of ISG induction was deteriorated by amino acid substitutions in the ISDR. In conclusion, using recombinant JFH-1 viruses, we demonstrated that HCV NS5A is associated with infectious virus production and the inhibition of IFN signaling, and amino acid substitutions in the NS5A ISDR deteriorate these functions. These observations explain the strain-specific evasion of IFN signaling by HCV. PMID:29464023
Interferon lambda inhibits dengue virus replication in epithelial cells.
Palma-Ocampo, Helen K; Flores-Alonso, Juan C; Vallejo-Ruiz, Verónica; Reyes-Leyva, Julio; Flores-Mendoza, Lilian; Herrera-Camacho, Irma; Rosas-Murrieta, Nora H; Santos-López, Gerardo
2015-09-28
In viral disease, infection is controlled at the cellular level by type I interferon (IFN-I), but dengue virus (DENV) has the ability to inhibit this response. Type III interferon, also known as lambda IFN (IFN-III or IFN-λ), is a complementary pathway to the antiviral response by IFN-I. This work analyzed the IFN-λ (IFN-III) mediated antiviral response against DENV serotype 2 (DENV-2) infection. Dengue fever patients were sampled to determine their IFN-λ levels by ELISA. To study the IFN-λ response during DENV infection we selected the epithelial cell line C33-A, and we demonstrated that it is permissive to DENV-2 infection. The effect of IFN-λ on virus replication was determined in these cells, in parallel to the expression of IFN-stimulated genes (ISGs), and Suppressor of Cytokine Signaling (SOCS), genes measured by RT-qPCR. We found increased (~1.8 times) serological IFN-λ in dengue fever patients compared to healthy blood donors. IFN-λ inhibited DENV-2 replication in a dose-dependent manner in vitro. The reduction of viral titer corresponded with increased ISG mRNA levels (MX1 and OAS1), with the highest inhibition occurring at ISG's peak expression. Presence of IFN-negative regulators, SOCS1 and SOCS3, during DENV-2 infection was associated with reduced IFN-λ1 expression. Evidence described here suggests that IFN-λ is a good candidate inhibitor of viral replication in dengue infection. Mechanisms for the cellular and organismal interplay between DENV and IFN- λ need to be further studied as they could provide insights into strategies to treat this disease. Furthermore, we report a novel epithelial model to study dengue infection in vitro.
Identification of Interferon-Stimulated Gene Proteins That Inhibit Human Parainfluenza Virus Type 3
Rabbani, M. A. G.; Ribaudo, Michael; Guo, Ju-Tao
2016-01-01
ABSTRACT A major arm of cellular innate immunity is type I interferon (IFN), represented by IFN-α and IFN-β. Type I IFN transcriptionally induces a large number of cellular genes, collectively known as IFN-stimulated gene (ISG) proteins, which act as antivirals. The IFIT (interferon-induced proteins with tetratricopeptide repeats) family proteins constitute a major subclass of ISG proteins and are characterized by multiple tetratricopeptide repeats (TPRs). In this study, we have interrogated IFIT proteins for the ability to inhibit the growth of human parainfluenza virus type 3 (PIV3), a nonsegmented negative-strand RNA virus of the Paramyxoviridae family and a major cause of respiratory disease in children. We found that IFIT1 significantly inhibited PIV3, whereas IFIT2, IFIT3, and IFIT5 were less effective or not at all. In further screening a set of ISG proteins we discovered that several other such proteins also inhibited PIV3, including IFITM1, IDO (indoleamine 2,3-dioxygenase), PKR (protein kinase, RNA activated), and viperin (virus inhibitory protein, endoplasmic reticulum associated, interferon inducible)/Cig5. The antiviral effect of IDO, the enzyme that catalyzes the first step of tryptophan degradation, could be counteracted by tryptophan. These results advance our knowledge of diverse ISG proteins functioning as antivirals and may provide novel approaches against PIV3. IMPORTANCE The innate immunity of the host, typified by interferon (IFN), is a major antiviral defense. IFN inhibits virus growth by inducing a large number of IFN-stimulated gene (ISG) proteins, several of which have been shown to have specific antiviral functions. Parainfluenza virus type 3 (PIV3) is major pathogen of children, and no reliable vaccine or specific antiviral against it currently exists. In this article, we report several ISG proteins that strongly inhibit PIV3 growth, the use of which may allow a better antiviral regimen targeting PIV3. PMID:27707917
Antiviral activity of bovine type III interferon against foot-and-mouth disease virus
USDA-ARS?s Scientific Manuscript database
Interferons (IFN) are the first line of defense against viral infections. Recently a new family of IFNs, type III, has been identified in humans, mice, swine and chickens. Here we report the identification and characterization of a member of the bovine type III IFN family, boIFN-lambda3, also known...
Antitumor activity of type I and type III interferons in BNL hepatoma model.
Abushahba, Walid; Balan, Murugabaskar; Castaneda, Ismael; Yuan, Yao; Reuhl, Kenneth; Raveche, Elizabeth; de la Torre, Andrew; Lasfar, Ahmed; Kotenko, Sergei V
2010-07-01
Hepatocellular carcinoma (HCC) occurs most commonly secondary to cirrhosis due to chronic hepatitis C or B virus (HCV/HBV) infections. Type I interferon (IFN-alpha) treatment of chronic HCV/HBV infections reduces the incidence of HCC in cirrhotic patients. However, IFN-alpha toxicity limits its tolerability and efficacy highlighting a need for better therapeutic treatments. A recently discovered type III IFN (IFN-lambda) has been shown to possess antiviral properties against HCV and HBV in vitro. In phase I clinical trials, IFN-lambda treatment did not cause significant adverse reactions. Using a gene therapy approach, we compared the antitumor properties of IFN-alpha and IFN-lambda in a transplantable hepatoma model of HCC. BALB/c mice were inoculated with syngeneic BNL hepatoma cells, or BNL cells expressing IFN-lambda (BNL.IFN-lambda cells) or IFN-alpha (BNL.IFN-alpha cells). Despite the lack of antiproliferative activity of IFNs on BNL cells, both BNL.IFN-lambda and BNL.IFN-alpha cells displayed retarded growth kinetics in vivo. Depletion of NK cells from splenocytes inhibited splenocyte-mediated cytotoxicity, demonstrating that NK cells play a role in IFN-induced antitumor responses. However, isolated NK cells did not respond directly to IFN-lambda. There was also a marked NK cell infiltration in IFN-lambda producing tumors. In addition, IFN-lambda and, to a lesser extent, IFN-alpha enhanced immunocytotoxicity of splenocytes primed with irradiated BNL cells. Splenocyte cytotoxicity against BNL cells was dependent on IL-12 and IFN-gamma, and mediated by dendritic cells. In contrast to NK cells, isolated from spleen CD11c+ and mPDCA+ dendritic cells responded directly to IFN-lambda. The antitumor activities of IFN-lambda against hepatoma, in combination with HCV and HBV antiviral activities warrant further investigation into the clinical use of IFN-lambda to prevent HCC in HCV/HBV-infected cirrhotic patients, as well as to treat liver cancer.
Karachaliou, Niki; Gonzalez-Cao, Maria; Crespo, Guillermo; Drozdowskyj, Ana; Aldeguer, Erika; Gimenez-Capitan, Ana; Teixido, Cristina; Molina-Vila, Miguel Angel; Viteri, Santiago; De Los Llanos Gil, Maria; Algarra, Salvador Martin; Perez-Ruiz, Elisabeth; Marquez-Rodas, Ivan; Rodriguez-Abreu, Delvys; Blanco, Remedios; Puertolas, Teresa; Royo, Maria Angeles; Rosell, Rafael
2018-01-01
Background: Programmed death-ligand 1 (PD-L1) may be induced by oncogenic signals or can be upregulated via interferon gamma (IFN-γ). We have explored whether the expression of IFNG, the gene encoding IFN-γ, is associated with clinical response to the immune checkpoint blockade in non-small cell lung cancer (NSCLC) and melanoma patients. The role of inflammation-associated transcription factors STAT3, IKBKE, STAT1 and other associated genes has also been examined. Methods: Total RNA from 17 NSCLC and 21 melanoma patients was analyzed by quantitative reverse transcription PCR. STAT3 and Rantes, YAP1 and CXCL5, DNMT1, RIG1 and TET1, EOMES, IFNG, PD-L1 and CTLA4, IKBKE and NFATC1 mRNA were examined. PD-L1 protein expression in tumor and immune cells and stromal infiltration of CD8+ T-cells were also evaluated. Progression-free survival and overall survival were estimated. Results: A total of 17 NSCLC patients received nivolumab and 21 melanoma patients received pembrolizumab. Progression-free survival with nivolumab was significantly longer in NSCLC patients with high versus low IFNG expression (5.1 months versus 2 months, p = 0.0124). Progression-free survival with pembrolizumab was significantly longer in melanoma patients with high versus low IFNG expression (5.0 months versus 1.9 months, p = 0.0099). Significantly longer overall survival was observed for melanoma patients with high versus low IFNG expression (not reached versus 10.2 months p = 0.0183). There was a trend for longer overall survival for NSCLC patients with high versus low IFNG expression. Conclusions: IFN-γ is an important marker for prediction of response to immune checkpoint blockade. Further research is warranted in order to validate whether IFNG is more accurate than PD-L1. PMID:29383037
Clancy, R L; Gleeson, M; Cox, A; Callister, R; Dorrington, M; D'Este, C; Pang, G; Pyne, D; Fricker, P; Henriksson, A
2006-04-01
Fatigue and impaired performance in athletes is well recognised and has been loosely linked to "overtraining". Reduced concentration of IgA in the saliva and increased shedding of Epstein Barr virus (EBV) have been associated with intense training in elite athletes. To determine whether athletes presenting with fatigue and impaired performance had an immune defect relevant to defective containment of EBV infection, and whether a probiotic preparation (Lactobacillus acidophilus) shown to enhance mucosal immunity in animal models could reverse any detected abnormality. The fatigued athletes had clinical characteristics consistent with re-activation of EBV infection and significantly (p = 0.02) less secretion of interferon (IFN) gamma from blood CD4 positive T cells. After one month of daily capsules containing 2 x 10(10) colony forming units of L acidophilus, secretion of IFNgamma from T cells had increased significantly (p = 0.01) to levels found in healthy control athletes. A significant (p = 0.03) increase in salivary IFNgamma concentrations in healthy control athletes after the one month course of L acidophilus demonstrated in man the capacity for this probiotic to enhance the mucosal IFNgamma concentration. This is the first evidence of a T cell defect in fatigued athletes, and of its reversal following probiotic therapy.
Rodriguez, Jason J.; Parisien, Jean-Patrick; Horvath, Curt M.
2002-01-01
Characterization of recent outbreaks of fatal encephalitis in southeast Asia identified the causative agent to be a previously unrecognized enveloped negative-strand RNA virus of the Paramyxoviridae family, Nipah virus. One feature linking Nipah virus to this family is a conserved cysteine-rich domain that is the hallmark of paramyxovirus V proteins. The V proteins of other paramyxovirus species have been linked with evasion of host cell interferon (IFN) signal transduction and subsequent antiviral responses by inducing proteasomal degradation of the IFN-responsive transcription factors, STAT1 or STAT2. Here we demonstrate that Nipah virus V protein escapes IFN by a distinct mechanism involving direct inhibition of STAT protein function. Nipah virus V protein differs from other paramyxovirus V proteins in its subcellular distribution but not in its ability to inhibit cellular IFN responses. Nipah virus V protein does not induce STAT degradation but instead inhibits IFN responses by forming high-molecular-weight complexes with both STAT1 and STAT2. We demonstrate that Nipah virus V protein accumulates in the cytoplasm by a Crm1-dependent mechanism, alters the STAT protein subcellular distribution in the steady state, and prevents IFN-stimulated STAT redistribution. Consistent with the formation of complexes, STAT protein tyrosine phosphorylation is inhibited in cells expressing the Nipah virus V protein. As a result, Nipah virus V protein efficiently prevents STAT1 and STAT2 nuclear translocation in response to IFN, inhibiting cellular responses to both IFN-α and IFN-γ. PMID:12388709
Cloning, sequencing, and expression of interferon-γ from elk in North America
Sweeney, Steven J.; Emerson, Carlene; Eriks, Inge S.
2001-01-01
Eradication of Mycobacterium bovis relies on accurate detection of infected animals, including potential domestic and wildlife reservoirs. Available diagnostic tests lack the sensitivity and specificity necessary for accurate detection, particularly in infected wildlife populations. Recently, an in vitro diagnostic test for cattle which measures plasma interferon-gamma (IFN-γ) levels in blood following in vitro incubation with M. bovis purified protein derivative has been enveloped. This test appears to have increased sensitivity over traditional testing. Unfortunately, it does not detect IFN-γ from Cervidae. To begin to address this problem, the IFN-γ gene from elk (Cervus elaphus) was cloned, sequenced, expressed, and characterized. cDNA was cloned from mitogen stimulated peripheral blood mononuclear cells. The predicted amino acid (aa) sequence was compared to known sequences from cattle, sheep, goats, red deer (Cervus elaphus), humans, and mice. Biological activity of the recombinant elk IFN-γ (rElkIFN-γ) was confirmed in a vesicular stomatitis virus cytopathic effect reduction assay. Production of monoclonal antibodies to IFN-γ epitopes conserved between ruminant species could provide an important tool for the development of reliable, practical diagnostic assays for detection of a delayed type hypersensitivity response to a variety of persistent infectious agents in ruminants, including M. bovis and Brucella abortus. Moreover, development of these reagents will aid investigators in studies to explore immunological responses of elk that are associated with resistance to infectious diseases.
The regulation of inflammation by interferons and their STATs
Rauch, Isabella; Müller, Mathias; Decker, Thomas
2013-01-01
Interferons (IFN) are subdivided into type I IFN (IFN-I, here synonymous with IFN-α/β), type II (IFN-γ) and type III IFN (IFN-III/IFN-λ) that reprogram nuclear gene expression through STATs 1 and 2 by forming STAT1 dimers (mainly IFN-γ) or the ISGF3 complex, a STAT1-STAT2-IRF9 heterotrimer (IFN-I and IFN-III). Dominant IFN activities in the immune system are to protect cells from viral replication and to activate macrophages for enhanced effector function. However, the impact of IFN and their STATs on the immune system stretches far beyond these activities and includes the control of inflammation. The goal of this review is to give an overview of the different facets of the inflammatory process that show regulatory input by IFN/STAT. PMID:24058799
Cortese, Victor S; Woolums, Amelia; Hurley, David J; Berghaus, Roy; Bernard, John K; Short, Thomas H
2017-05-01
Thirty-two Holstein cows were allocated to receive intranasal vaccination with modified live bovine herpesvirus-1 (BHV-1), bovine respiratory syncytial virus (BRSV) and parainfluenza type 3 virus (PI3V) vaccine either two weeks prior to their projected calving date, or within 24h after calving. Nasal secretions were collected twice at a 12-h interval on the day prior to vaccination (day 0) and at 2, 4, 7, 10 and 14days post vaccination to measure interferon (IFN) alpha, IFN-beta, IFN-gamma, and BHV-1-specific IgA by ELISA. Serum neutralizing antibody titers to BHV-1 and BRSV were measured on days 0, 7, and 14. There was a significant treatment effect (p<0.0004) and interaction (p<0.05) on nasal BHV-1 IgA levels, with higher IgA levels in cows vaccinated within 24h after calving. There was a significant treatment effect on nasal IFN-gamma concentration (p<0.05) and on nasal total IFN concentration (p<0.05), with higher IFN-gamma and total IFN concentrations seen in cows vaccinated within 24h after calving. There was no significant treatment or interaction effect on nasal IFN-alpha or IFN-beta concentrations, or on serum neutralizing titers to BRSV. In spite of prior viral vaccination during the previous lactation, cows vaccinated on the day of calving responded to an intranasal viral vaccination with increased concentrations of IFN-gamma and increased titers of IgA following vaccination which was significantly higher than cows vaccinated precalving. This study is the first to examine respiratory mucosal responses in immunologically mature dairy cattle vaccinated intranasally before and after calving. Copyright © 2017. Published by Elsevier B.V.
Grau, G E; Heremans, H; Piguet, P F; Pointaire, P; Lambert, P H; Billiau, A; Vassalli, P
1989-01-01
Experimental cerebral malaria (ECM), a lethal hyperacute neurological syndrome associated with high blood levels of tumor necrosis factor, develops in genetically susceptible (CBA/Ca) mice 7 days after infection with Plasmodium berghei ANKA strain. Injections of neutralizing monoclonal antibody against recombinant murine interferon gamma, not later than 4 days after infection, markedly reduced the incidence of ECM and the elevation in serum levels of tumor necrosis factor. This treatment prevented the cerebral lesions (plugging of brain vessels by monocytes, lymphocytes, and parasitized erythrocytes). In contrast, the extent of macrophage infiltration in lymphoid organs (which is a characteristic feature of mice developing ECM), as well as the course of infection, remained unaffected by the antibody treatment. Protected mice died at a later time of severe anemia and overwhelming parasitemia, the usual outcome of P. berghei infection in mice that are not susceptible to ECM. The present data indicate that interferon gamma constitutes an important link in the cytokine network that leads to brain vessel inflammation in experimental malaria. It is proposed that interferon gamma released by activated CD4+ T cells acts by augmenting both production and action of tumor necrosis factor. PMID:2501793
Moroda, Masataka; Takamoto, Masaya; Iwakura, Yoichiro; Nakayama, Jun; Aosai, Fumie
2017-12-01
Interleukin17A (IL-17A) is known to be involved in the host defense against pathogens and the pathogenesis of autoimmune diseases. Previously, we showed that excessive amounts of interferon gamma (IFN-γ) play an important role in the pathogenesis of the lethal effects of Toxoplasma gondii by inducing anaphylactic responses. In the study described in this report, we examined the effects of IL-17A deficiency on murine host defense against oral T. gondii infection. IL-17A-deficient C57BL/6 (B6) mice exhibited higher rates of mortality than wild-type (WT) mice during the acute phase of T. gondii infection. CD4 + T cells in the mesenteric lymph nodes (mLNs) and ileum of T. gondii -infected IL-17A-deficient mice produced higher levels of IFN-γ than did those of WT mice. In addition, the level of T. gondii HSP70 ( T.g HSP70) expression was also significantly increased in the ileum, mLNs, liver, and spleen of infected IL-17A-deficient mice compared with that in WT mice. These elevated levels of expression of T.g HSP70 and IFN-γ in infected IL-17A-deficient mice were presumably linked to the IL-17A defect since they decreased to WT levels after treatment with recombinant IL-17A. Furthermore, IL-17A-deficient mice were highly susceptible to the anaphylactic effect of T.g HSP70, and the survival of IL-17A-deficient mice during the acute phase was improved by treatment with an anti- T.g HSP70 monoclonal antibody. These results suggest that IL-17A plays an important role in host survival against T. gondii infection by protecting the host from an anaphylactic reaction via the downregulation of T.g HSP70 and IFN-γ production. Copyright © 2017 American Society for Microbiology.
Inhibition of IFN-γ-dependent antiviral airway epithelial defense by cigarette smoke
2010-01-01
Background Although individuals exposed to cigarette smoke are more susceptible to respiratory infection, the effects of cigarette smoke on lung defense are incompletely understood. Because airway epithelial cell responses to type II interferon (IFN) are critical in regulation of defense against many respiratory viral infections, we hypothesized that cigarette smoke has inhibitory effects on IFN-γ-dependent antiviral mechanisms in epithelial cells in the airway. Methods Primary human tracheobronchial epithelial cells were first treated with cigarette smoke extract (CSE) followed by exposure to both CSE and IFN-γ. Epithelial cell cytotoxicity and IFN-γ-induced signaling, gene expression, and antiviral effects against respiratory syncytial virus (RSV) were tested without and with CSE exposure. Results CSE inhibited IFN-γ-dependent gene expression in airway epithelial cells, and these effects were not due to cell loss or cytotoxicity. CSE markedly inhibited IFN-γ-induced Stat1 phosphorylation, indicating that CSE altered type II interferon signal transduction and providing a mechanism for CSE effects. A period of CSE exposure combined with an interval of epithelial cell exposure to both CSE and IFN-γ was required to inhibit IFN-γ-induced cell signaling. CSE also decreased the inhibitory effect of IFN-γ on RSV mRNA and protein expression, confirming effects on viral infection. CSE effects on IFN-γ-induced Stat1 activation, antiviral protein expression, and inhibition of RSV infection were decreased by glutathione augmentation of epithelial cells using N-acetylcysteine or glutathione monoethyl ester, providing one strategy to alter cigarette smoke effects. Conclusions The results indicate that CSE inhibits the antiviral effects of IFN-γ, thereby presenting one explanation for increased susceptibility to respiratory viral infection in individuals exposed to cigarette smoke. PMID:20504369
Xie, Yan-Hui; Chen, Qin-Fen; Xie, Yi; Xie, Hong
2002-12-01
To observe the proliferation of T lymphocytes stimulated by CML and AML cells which were induced by rhGM-CSF and rhIL-4, and the secretion of IFN-gamma from proliferated T lymphocytes, the expression of CD80, CD86 and HLA-DR on CML and AML cells induced by GM-CSF and IL-4 was assayed by flow cytometry in vitro. Then one-way mixed lymphocyte reaction was carried out, with induced leukemia cells as stimulating cells and auto-T lymphocytes as reactive cells. The secretion of IFN-gamma from T lymphocytes was determined by double antibody sandwich ELISA. The results showed that GM-CSF and IL-4 significantly upregulated the expression of CD80, CD86 and HLA-DR on CML cells and CD80 and CD86 on AML cells, which could stimulate the T lymphocyte proliferation and high secretion of IFN-gamma (in CML group) of autologous T lymphocytes. It is concluded that the CML and AML cells induced by GM-CSF and IL-4 have the ability to present tumor specific antigen to auto-T lymphocyte.
Chang, Ruey-Yi; Hsu, Ta-Wen; Chen, Yen-Lin; Liu, Shu-Fan; Tsai, Yi-Jer; Lin, Yun-Tong; Chen, Yi-Shiuan; Fan, Yi-Hsin
2013-09-27
Noncoding RNA (ncRNA) plays a critical role in modulating a broad range of diseases. All arthropod-borne flaviviruses produce short fragment ncRNA (sfRNA) collinear with highly conserved regions of the 3'-untranslated region (UTR) in the viral genome. We show that the molar ratio of sfRNA to genomic RNA in Japanese encephalitis virus (JEV) persistently infected cells is greater than that in acutely infected cells, indicating an sfRNA role in establishing persistent infection. Transfecting excess quantities of sfRNA into JEV-infected cells reduced interferon-β (IFN-β) promoter activity by 57% and IFN-β mRNA levels by 52%, compared to mock-transfected cells. Transfection of sfRNA into JEV-infected cells also reduced phosphorylation of interferon regulatory factor-3 (IRF-3), the IFN-β upstream regulator, and blocked roughly 30% of IRF-3 nuclear localization. Furthermore, JEV-infected sfRNA transfected cells produced 23% less IFN-β-stimulated apoptosis than mock-transfected groups did. Taken together, these results suggest that sfRNA plays a role against host-cell antiviral responses, prevents cells from undergoing apoptosis, and thus contributes to viral persistence. Copyright © 2013 Elsevier B.V. All rights reserved.
O'Brien, Kevin B; Schultz-Cherry, Stacey; Knoll, Laura J
2011-09-01
Outbreaks of influenza A viruses are associated with significant human morbidity worldwide. Given the increasing resistance to the available influenza drugs, new therapies for the treatment of influenza virus infection are needed. An alternative approach is to identify products that enhance a protective immune response. In these studies, we demonstrate that infecting mice with the Th1-inducing parasite Toxoplasma gondii prior to highly pathogenic avian H5N1 influenza virus infection led to decreased lung viral titers and enhanced survival. A noninfectious fraction of T. gondii soluble antigens (STAg) elicited an immune response similar to that elicited by live parasites, and administration of STAg 2 days after H5N1 influenza virus infection enhanced survival, lowered viral titers, and reduced clinical disease. STAg administration protected H5N1 virus-infected mice lacking lymphocytes, suggesting that while the adaptive immune response was not required for enhanced survival, it was necessary for STAg-mediated viral clearance. Mechanistically, we found that administration of STAg led to increased production of gamma interferon (IFN-γ) from natural killer (NK) cells, which were both necessary and sufficient for survival. Further, administration of exogenous IFN-γ alone enhanced survival from H5N1 influenza virus infection, although not to the same level as STAg treatment. These studies demonstrate that a noninfectious T. gondii extract enhances the protective immune response against severe H5N1 influenza virus infections even when a single dose is administered 2 days postinfection.
[Fish interferon response and its molecular regulation: a review].
Zhang, Yibing; Gui, Jianfang
2011-05-01
Interferon response is the first line of host defense against virus infection. Recent years have witnessed tremendous progress in understanding of fish innate response to virus infection, especially in fish interferon antiviral response. A line of fish genes involved in interferon antiviral response have been identified and functional studies further reveal that fish possess an IFN antiviral system similar to mammals. However, fish virus-induced interferon genes contain introns similar to mammalian type III interferon genes although they encode proteins similar to type I interferons, which makes it hard to understand the evolution of vertebrate interferon genes directly resulting in a debate on nomenclature of fish interferon genes. Actually, fish display some unique mechanisms underlying interferon antiviral response. This review documents the recent progress on fish interferon response and its molecular mechanism.
A strong interferon response correlates with a milder dengue clinical condition.
De La Cruz Hernández, Sergio Isaac; Puerta-Guardo, Henry; Flores-Aguilar, Hilario; González-Mateos, Silvia; López-Martinez, Irma; Ortiz-Navarrete, Vianney; Ludert, Juan E; Del Angel, Rosa María
2014-07-01
Type 1 interferon (IFNα/β) has a significant role in establishing protection against virus infections. It has been well documented by in vitro studies that dengue virus (DENV) activates a robust IFNα/β response. However, DENV also induces a down-regulation of the JAK/STAT pathway, inhibiting the induction of interferon regulated genes. As a consequence, the role played by the IFN type 1 response in the protection of dengue patients is not fully understood. To compare IFN-α levels in dengue patients with dengue fever (DF) or dengue hemorrhagic fever (DHF) undergoing primary or secondary infections. Two hundred and four serum samples were analyzed for IFN-α level by cytometric bead array. Patients' clinical condition was assigned following the WHO 1997 criteria and specific IgG and IgM antibodies were measured using commercial assays to determine primary and secondary infections. The infecting serotype was determined by qRT-PCR. The IFN-α levels were found significantly higher in DF than DHF patients irrespective of the infecting serotype (DENV1 or 2), and were found to decline rapidly at day 3 after fever onset. For DENV2 infections, higher IFN-α level was found during primary than secondary infections. These results suggest that an early strong interferon response correlates with a better clinical condition. Copyright © 2014 Elsevier B.V. All rights reserved.
Pang, W Y; Earley, B; Sweeney, T; Crowe, M A
2006-02-01
The objective of this study was to determine the effect of carprofen (C) administration before banding or burdizzo castration of bulls on cortisol, in vitro interferon-gamma (IFN-gamma) production, acute-phase proteins, feed intake, and growth. Fifty Holstein Friesian bulls (5.5 mo old; 191 +/- 3.7 kg) were blocked by weight and assigned randomly to 1 of 5 treatments (n = 10/treatment): 1) untreated control (2) banding castration at 0 min (Band); 3) Band following an i.v. injection of 1.4 mg/kg of BW of C at -20 min (Band+C); 4) Burdizzo castration at 0 min (Burd); or 5) Burd following 1.4 mg/kg of BW of C at -20 min (Burd+C). Castration acutely increased plasma cortisol concentrations compared with control; no significant differences occurred in peak and interval to peak cortisol responses between Band and Band+C or Burd and Burd+C groups. The administration of C in Band+C reduced (P < 0.05) the cortisol concentration between 6 and 12 h postcastration compared with Band animals. Overall, the integrated cortisol response was greater (P < 0.05) in the castrates than in control, whereas C treatments tended to reduce this response compared with Band (P = 0.08) and Burd (P = 0.07), respectively. Plasma fibrinogen was elevated in Band animals on d 14 and in Burd animals on d 3 and 14. Carprofen administration reduced Band- and Burd-induced fibrinogen production on d 14 and 3, respectively. Plasma haptoglobin was elevated in Band animals on d 3 and 35 compared with control, and C administration was effective in reducing the haptoglobin elevation on d 35 in Band+C compared with Band. There were no differences among treatments in in vitro IFN-gamma production induced by concanavalin A and phytohemagglutinin on d 1 and 2. Overall from d -1 to 16, there were no DMI differences among treatments. From d -1 to 35, there were no ADG differences among treatments. In conclusion, banding and burdizzo castration increased plasma cortisol with no change in in vitro IFN-gamma
DOE Office of Scientific and Technical Information (OSTI.GOV)
Andersson, G.; Lundgren, E.; Ekre, H.P.
Four different mouse monoclonal antibodies to human interferon-alpha (IFN-alpha) were evaluated for application in quantitative and comparative analysis of natural IFN-alpha mixtures. Binding to IFN-alpha subtypes in solution revealed individual reactivity patterns. These patterns changed if the IFN-alpha molecules were immobilized either passively to a surface or bound by another antibody. Also, substitution of a single amino acid in IFN-alpha 2 affected the binding, apparently by altering the conformation. Isoelectric focusing of three natural IFN-alpha preparations from different sources, followed by immunoblotting, resulted in individual patterns with each of the four mAbs and also demonstrated variation in the composition ofmore » the IFN-alpha preparations. None of the mAbs was subtype specific, but by combining the different mAbs, and also applying polyclonal anti-human IFN-alpha antibodies, it was possible to design sensitive sandwich ELISAs with broad or more limited IFN-alpha subtype specificity.« less
The POU Transcription Factor Oct-1 Represses Virus-Induced Interferon A Gene Expression
Mesplède, Thibault; Island, Marie-Laure; Christeff, Nicolas; Petek, Fahrettin; Doly, Janine; Navarro, Sébastien
2005-01-01
Alpha interferon (IFN-α) and IFN-β are able to interfere with viral infection. They exert a vast array of biologic functions, including growth arrest, cell differentiation, and immune system regulation. This regulation extends from innate immunity to cellular and humoral adaptive immune responses. A strict control of expression is needed to prevent detrimental effects of unregulated IFN. Multiple IFN-A subtypes are coordinately induced in human and mouse cells infected by virus and exhibit differences in expression of their individual mRNAs. We demonstrated that the weakly expressed IFN-A11 gene is negatively regulated after viral infection, due to a distal negative regulatory element, binding homeoprotein pituitary homeobox 1 (Pitx1). Here we show that the POU protein Oct-1 binds in vitro and in vivo to the IFN-A11 promoter and represses IFN-A expression upon interferon regulatory factor overexpression. Furthermore, we show that Oct-1-deficient MEFs exhibit increased in vivo IFN-A gene expression and increased antiviral activity. Finally, the IFN-A expression pattern is modified in Oct-1-deficient MEFs. The broad representation of effective and potent octamer-like sequences within IFN-A promoters suggests an important role for Oct-1 in IFN-A regulation. PMID:16166650
Montanuy, Imma; Alejo, Ali; Alcami, Antonio
2011-01-01
Eradication of smallpox was accomplished 30 yr ago, but poxviral infections still represent a public health concern due to the potential release of variola virus or the emergence of zoonotic poxviruses, such as monkeypox virus. A critical determinant of poxvirus virulence is the inhibition of interferons (IFNs) by the virus-encoded type I IFN-binding protein (IFNα/βBP). This immunomodulatory protein is secreted and has the unique property of interacting with the cell surface in order to prevent IFN-mediated antiviral responses. However, the mechanism of its attachment to the cell surface remains unknown. Using surface plasmon resonance and cell-binding assays, we report that the IFNα/βBP from vaccinia virus, the smallpox vaccine, interacts with cell surface glycosaminoglycans (GAGs). Analysis of the contribution of different regions of the protein to cell surface binding demonstrated that clusters of basic residues in the first immunoglobulin domain mediate GAG interactions. Furthermore, mutation of the GAG-interaction motifs does not affect its IFN-binding and -blocking capacity. Functional conservation of GAG-binding sites is demonstrated for the IFNα/βBP from variola and monkeypox viruses, extending our understanding of immune modulation by the most virulent human poxviruses. These results are relevant for the design of improved vaccines and intervention strategies.—Montanuy, I., Alejo, A., Alcami, A. Glycosaminoglycans mediate retention of the poxvirus type I interferon binding protein at the cell surface to locally block interferon antiviral responses. PMID:21372110
Targeting interferons in systemic lupus erythematosus: current and future prospects.
Mathian, Alexis; Hie, Miguel; Cohen-Aubart, Fleur; Amoura, Zahir
2015-05-01
Systemic lupus erythematosus (SLE) is a chronic autoimmune disease of unknown aetiology that can be debilitating and life threatening. As new insights are gained into the underlying pathology of SLE, there have been an unprecedented number of new agents under development to treat the disease via a diverse range of targets. One such class of emerging agents target interferon (IFN) signalling. In this article, we review the preclinical evidence that the inhibition of the secretion and downstream effectors of both IFN-α and IFN-γ may be effective for the treatment of SLE. The primary agents that are currently in clinical development to treat SLE via the targeting of interferon pathways are monoclonal neutralising antibodies (Mab) that bind to and neutralise IFN-γ (AMG 811), IFN-α (sifalimumab, rontalizumab and AGS-009) or its receptor (anifrolumab), and IFN-α kinoid, which is a drug composed of inactivated IFN-α molecules coupled to the keyhole limpet haemocyanin protein. Phase I and II trials have demonstrated acceptable short-term safety with no increase in severe viral infections or reactivation, favourable pharmacokinetic profiles and an inhibition of IFN-associated gene overexpression; however, the impact of these drugs on disease activity must still be assessed in phase III clinical trials. This review concludes with a summary of the challenges that are inherent to this approach to managing SLE.
Interferon in chronic myeloid leukaemia: past and future.
Guilhot, François; Roy, Lydia; Saulnier, Pierre-Jean; Guilhot, Joëlle
2009-09-01
Imatinib has revolutionized the therapy of chronic myeloid leukaemia. However the complete eradication of leukaemic stem cells is still a matter of discussion. Interferon (IFN) has been used in the past with success. However the proportion of patients who achieved sustained complete cytogenetic response was small. Recently, in addition to its direct antineoplastic effect and immunomodulatory activity, IFN has been shown to stimulate the quiescent leukaemic stem cells. Thus there is now a rational for combining Imatinib and IFN. Large prospective phase III trials are in good progress to demonstrate in humans the usefullness of a combination therapy using Imatinib and IFN.
Chronic inflammatory demyelinating polyneuropathy after treatment with interferon-alpha.
Hirotani, Makoto; Nakano, Hitoshi; Ura, Shigehisa; Yoshida, Kazuto; Niino, Masaaki; Yabe, Ichiro; Sasaki, Hidenao
2009-01-01
Interferon-alpha (IFN-alpha), though widely used for the treatment of chronic viral hepatitis, may be associated with the occurrence of autoimmune disorders. In this case report, a patient with chronic hepatitis C virus infection had chronic inflammatory demyelinating polyneuropathy (CIDP) after the initiation of IFN-alpha therapy. The neurological symptoms of this patient continued to progress even though the treatment with IFN-alpha had been withdrawn; the symptoms improved dramatically following treatment with intravenous immunoglobulin. This case may therefore provide an important clue to understand the immune mechanism of CIDP and IFN-alpha.
Paglino, Justin C; Andres, Wells; van den Pol, Anthony N
2014-05-01
Members of the genus Parvovirus are small, nonenveloped single-stranded DNA viruses that are nonpathogenic in humans but have potential utility as cancer therapeutics. Because the innate immune response to parvoviruses has received relatively little attention, we compared the response to parvoviruses to that of several other types of viruses in human cells. In normal human glia, fibroblasts, or melanocytes, vesicular stomatitis virus evoked robust beta interferon (IFN-β) responses. Cytomegalovirus, pseudorabies virus, and Sindbis virus all evoked a 2-log-unit or greater upregulation of IFN-β in glia; in contrast, LuIII and MVMp parvoviruses did not evoke a detectable IFN-β or interferon-stimulated gene (ISG; MX1, oligoadenylate synthetase [OAS], IFIT-1) response in the same cell types. The lack of response raised the question of whether parvoviral infection can be attenuated by IFN; interestingly, we found that IFN did not decrease parvovirus (MVMp, LuIII, and H-1) infectivity in normal human glia, fibroblasts, or melanocytes. The same was true in human cancers, including glioma, sarcoma, and melanoma. Similarly, IFN failed to attenuate transduction by the dependovirus vector adeno-associated virus type 2. Progeny production of parvoviruses was also unimpaired by IFN in both glioma and melanoma, whereas vesicular stomatitis virus replication was blocked. Sarcoma cells with upregulated IFN signaling that show high levels of resistance to other viruses showed strong infection by LuIII. Unlike many other oncolytic viruses, we found no evidence that impairment of innate immunity in cancer cells plays a role in the oncoselectivity of parvoviruses in human cells. Parvoviral resistance to the effects of IFN in cancer cells may constitute an advantage in the virotherapy of some tumors. Understanding the interactions between oncolytic viruses and the innate immune system will facilitate employing these viruses as therapeutic agents in cancer patients. The cancer
Paglino, Justin C.; Andres, Wells
2014-01-01
ABSTRACT Members of the genus Parvovirus are small, nonenveloped single-stranded DNA viruses that are nonpathogenic in humans but have potential utility as cancer therapeutics. Because the innate immune response to parvoviruses has received relatively little attention, we compared the response to parvoviruses to that of several other types of viruses in human cells. In normal human glia, fibroblasts, or melanocytes, vesicular stomatitis virus evoked robust beta interferon (IFN-β) responses. Cytomegalovirus, pseudorabies virus, and Sindbis virus all evoked a 2-log-unit or greater upregulation of IFN-β in glia; in contrast, LuIII and MVMp parvoviruses did not evoke a detectable IFN-β or interferon-stimulated gene (ISG; MX1, oligoadenylate synthetase [OAS], IFIT-1) response in the same cell types. The lack of response raised the question of whether parvoviral infection can be attenuated by IFN; interestingly, we found that IFN did not decrease parvovirus (MVMp, LuIII, and H-1) infectivity in normal human glia, fibroblasts, or melanocytes. The same was true in human cancers, including glioma, sarcoma, and melanoma. Similarly, IFN failed to attenuate transduction by the dependovirus vector adeno-associated virus type 2. Progeny production of parvoviruses was also unimpaired by IFN in both glioma and melanoma, whereas vesicular stomatitis virus replication was blocked. Sarcoma cells with upregulated IFN signaling that show high levels of resistance to other viruses showed strong infection by LuIII. Unlike many other oncolytic viruses, we found no evidence that impairment of innate immunity in cancer cells plays a role in the oncoselectivity of parvoviruses in human cells. Parvoviral resistance to the effects of IFN in cancer cells may constitute an advantage in the virotherapy of some tumors. IMPORTANCE Understanding the interactions between oncolytic viruses and the innate immune system will facilitate employing these viruses as therapeutic agents in cancer patients
Skums, Pavel; Campo, David S; Dimitrova, Zoya; Vaughan, Gilberto; Lau, Daryl T; Khudyakov, Yury
Hepatitis C virus (HCV) is a major cause of liver disease world-wide. Current interferon and ribavirin (IFN/RBV) therapy is effective in 50%-60% of patients. HCV exists in infected patients as a large viral population of intra-host variants (quasispecies), which may be differentially resistant to interferon treatment. We present a method for measuring differential interferon resistance of HCV quasispecies based on mathematical modeling and analysis of HCV population dynamics during the first hours of interferon therapy. The mathematical models showed that individual intra-host HCV variants have a wide range of resistance to IFN treatment in each patient. Analysis of differential IFN resistance among intra-host HCV variants allows for accurate prediction of response to IFN therapy. The models strongly suggest that resistance to interferon may vary broadly among closely related variants in infected hosts and therapy outcome may be defined by a single or a few variants irrespective of their frequency in the intra-host HCV population before treatment.
Albuquerque, Maíra Cavalcanti de; Aleixo, Ana Luisa Quintella do Couto; Benchimol, Eliezer Israel; Leandro, Ana Cristina Câmara S; das Neves, Leandro Batista; Vicente, Regiane Trigueiro; Bonecini-Almeida, Maria da Glória; Amendoeira, Maria Regina Reis
2009-05-01
Toxoplasmosis is a worldwide zoonosis that generally produces an asymptomatic infection. In some cases, however, toxoplasmosis infection can lead to ocular damage. The immune system has a crucial role in both the course of the infection and in the evolution of toxoplasmosis disease. In particular, IFN-gamma plays an important role in resistance to toxoplasmosis. Polymorphisms in genes encoding cytokines have been shown to have an association with susceptibility to parasitic diseases. The aim of this work was to analyse the occurrence of polymorphisms in the gene encoding IFN-gamma (+874T/A) among Toxoplasma gondii seropositive individuals, including those with ocular lesions caused by the parasite, from a rural population of Santa Rita de Cássia, Barra Mansa, state of Rio de Janeiro, Brazil. Further, we verified which of these polymorphisms could be related to susceptibility to the development of ocular toxoplasmosis. This study included 34 individuals with ocular toxoplasmosis (ocular group) and 134 without ocular lesions (control group). The differences between A and T allele distributions were not statistically significant between the two groups. However, we observed that a higher frequency of individuals from the ocular group possessed the A/A genotype, when compared with the control group, suggesting that homozygocity for the A allele could enhance susceptibility to ocular toxoplasmosis in T. gondii infection.
Interferon-Inducible CD169/Siglec1 Attenuates Anti-HIV-1 Effects of Alpha Interferon
Akiyama, Hisashi; Ramirez, Nora-Guadalupe Pina; Gibson, Gregory; Kline, Christopher; Watkins, Simon; Ambrose, Zandrea
2017-01-01
ABSTRACT A hallmark of human immunodeficiency virus type 1 (HIV-1) infection in vivo is chronic immune activation concomitant with type I interferon (IFN) production. Although type I IFN induces an antiviral state in many cell types, HIV-1 can replicate in vivo via mechanisms that have remained unclear. We have recently identified a type I IFN-inducible protein, CD169, as the HIV-1 attachment factor on dendritic cells (DCs) that can mediate robust infection of CD4+ T cells in trans. Since CD169 expression on macrophages is also induced by type I IFN, we hypothesized that type I IFN-inducible CD169 could facilitate productive HIV-1 infection in myeloid cells in cis and CD4+ T cells in trans and thus offset antiviral effects of type I IFN. In support of this hypothesis, infection of HIV-1 or murine leukemia virus Env (MLV-Env)-pseudotyped HIV-1 particles was enhanced in IFN-α-treated THP-1 monocytoid cells, and this enhancement was primarily dependent on CD169-mediated enhancement at the virus entry step, a phenomenon phenocopied in HIV-1 infections of IFN-α-treated primary monocyte-derived macrophages (MDMs). Furthermore, expression of CD169, a marker of type I IFN-induced immune activation in vivo, was enhanced in lymph nodes from pigtailed macaques infected with simian immunodeficiency virus (SIV) carrying HIV-1 reverse transcriptase (RT-SHIV), compared to uninfected macaques, and interestingly, there was extensive colocalization of p27gag and CD169, suggesting productive infection of CD169+ myeloid cells in vivo. While cell-free HIV-1 infection of IFN-α-treated CD4+ T cells was robustly decreased, initiation of infection in trans via coculture with CD169+ IFN-α-treated DCs restored infection, suggesting that HIV-1 exploits CD169 in cis and in trans to attenuate a type I IFN-induced antiviral state. IMPORTANCE HIV-1 infection in humans causes immune activation characterized by elevated levels of proinflammatory cytokines, including type I interferons (IFN
A Promising IFN-Deficient System to Manufacture IFN-Sensitive Influenza Vaccine Virus.
Chen, Can; Fan, Wenhui; Li, Jing; Zheng, Weinan; Zhang, Shuang; Yang, Limin; Liu, Di; Liu, Wenjun; Sun, Lei
2018-01-01
Interferon (IFN)-sensitive and replication-incompetent influenza viruses are likely to be the alternatives to inactivated and attenuated virus vaccines. Some IFN-sensitive influenza vaccine candidates with modified non-structural protein 1 (NS1) are highly attenuated in IFN-competent hosts but induce robust antiviral immune responses. However, little research has been done on the manufacturability of these IFN-sensitive vaccine viruses. Here, RIG-I-knockout 293T cells were used to package the IFN-sensitive influenza A/WSN/33 (H1N1) virus expressing the mutant NS1 R38A/K41A. We found that the packaging efficiency of the NS1 R38A/K41A virus in RIG-I-knockout 293T cells was much higher than that in 293T cells. Moreover, the NS1 R38A/K41A virus almost lost its IFN antagonist activity and could no longer replicate in A549, MDCK, and Vero cells after 3-6 passages. This indicated that the replication of NS1 R38A/K41A virus is limited in conventional cells. Therefore, we further established a stable Vero cell line expressing the wild-type (WT) NS1 of the WSN virus, based on the Tet-On 3G system. The NS1 R38A/K41A virus was able to steadily propagate in this IFN-deficient cell line for at least 20 passages. In a mouse model, the NS1 R38A/K41A virus showed more than a 4-log reduction in lung virus titers compared to the WT virus at 3 and 5 days post infection. Furthermore, we observed that the NS1 R38A/K41A virus triggered high-level of IFN-α/β production in lung tissues and was eliminated from the host in a relatively short period of time. Additionally, this virus induced high-titer neutralizing antibodies against the WT WSN, A/Puerto Rico/8/1934 (PR8), or A/California/04/2009 (CA04) viruses and provided 100% protection against the WT WSN virus. Thus, we found that the replication of the NS1 R38A/K41A virus was limited in IFN-competent cells and mice. We also presented a promising IFN-deficient system, involving a RIG-I-knockout 293T cell line to package the IFN
Tang, Bone Siu-Fai; Chan, Jasper Fuk-Woo; Chen, Min; Tsang, Owen Tak-Yin; Mok, M. Y.; Lai, Raymond Wai-Man; Lee, Rodney; Que, Tak-Lun; Tse, Herman; Li, Iris Wai-Sum; To, Kelvin Kai-Wang; Cheng, Vincent Chi-Chung; Chan, Eric Yuk-Tat; Zheng, Bojian; Yuen, Kwok-Yung
2010-01-01
Acquired immunodeficiency due to autoantibody against gamma interferon has recently been associated with opportunistic nontuberculous mycobacteriosis, especially among Southeast Asians. We report another 8 cases, all except one apparently immunocompetent hosts who suffered from concomitant or sequential infections by other intracellular pathogens causing penicilliosis, extraintestinal nontyphoidal salmonellosis, and burkholderiosis. The only case with an underlying immunodeficiency syndrome had systemic lupus erythematosus that was quiescent throughout the multiple infective episodes. Eight out of 10 (80.0%) patients with serological evidence of penicilliosis, 5 out of 7 (71.4%) with culture-positive extraintestinal nontyphoidal salmonellosis, 5 out of 28 (17.9%) with serological evidence of melioidosis, and 7 out of 13 (53.8%) with culture-positive nontuberculous mycobacteriosis possessed autoantibody against gamma interferon, whereas only 1 out of 100 patients with systemic lupus erythematosus did. Our study represents the first and largest case series linking this emerging immunodeficiency syndrome with these atypical infections in apparently immunocompetent hosts. Thus, we advocate that any patient with unexplained recurrent or polymicrobial infections due to these intracellular pathogens should be screened for acquired immunodeficiency due to autoantibody against gamma interferon. PMID:20445006
Identification of Interferon-Stimulated Gene Proteins That Inhibit Human Parainfluenza Virus Type 3.
Rabbani, M A G; Ribaudo, Michael; Guo, Ju-Tao; Barik, Sailen
2016-12-15
A major arm of cellular innate immunity is type I interferon (IFN), represented by IFN-α and IFN-β. Type I IFN transcriptionally induces a large number of cellular genes, collectively known as IFN-stimulated gene (ISG) proteins, which act as antivirals. The IFIT (interferon-induced proteins with tetratricopeptide repeats) family proteins constitute a major subclass of ISG proteins and are characterized by multiple tetratricopeptide repeats (TPRs). In this study, we have interrogated IFIT proteins for the ability to inhibit the growth of human parainfluenza virus type 3 (PIV3), a nonsegmented negative-strand RNA virus of the Paramyxoviridae family and a major cause of respiratory disease in children. We found that IFIT1 significantly inhibited PIV3, whereas IFIT2, IFIT3, and IFIT5 were less effective or not at all. In further screening a set of ISG proteins we discovered that several other such proteins also inhibited PIV3, including IFITM1, IDO (indoleamine 2,3-dioxygenase), PKR (protein kinase, RNA activated), and viperin (virus inhibitory protein, endoplasmic reticulum associated, interferon inducible)/Cig5. The antiviral effect of IDO, the enzyme that catalyzes the first step of tryptophan degradation, could be counteracted by tryptophan. These results advance our knowledge of diverse ISG proteins functioning as antivirals and may provide novel approaches against PIV3. The innate immunity of the host, typified by interferon (IFN), is a major antiviral defense. IFN inhibits virus growth by inducing a large number of IFN-stimulated gene (ISG) proteins, several of which have been shown to have specific antiviral functions. Parainfluenza virus type 3 (PIV3) is major pathogen of children, and no reliable vaccine or specific antiviral against it currently exists. In this article, we report several ISG proteins that strongly inhibit PIV3 growth, the use of which may allow a better antiviral regimen targeting PIV3. Copyright © 2016, American Society for Microbiology
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hatano, Ryo; Yamada, Kiyoshi; Iwamoto, Taku
2013-06-14
Highlights: •Small intestinal epithelial cells (sIECs). •sIECs are able to induce antigen specific proliferation of CD4{sup +} IELs. •sIECs induce markedly enhanced IFN-γ secretion by CD4{sup +} IELs. •Induction of enhanced IFN-γ secretion by sIECs is uniquely observed in CD4{sup +} IELs. -- Abstract: Small intestinal epithelial cells (sIECs) express major histocompatibility complex class II molecules even in a normal condition, and are known to function as antigen presenting cells (APCs) at least in vitro. These findings raised the possibility that sIECs play an important role in inducing immune responses against luminal antigens, especially those of intestinal intraepithelial lymphocytes (IELs)more » and lamina propria lymphocytes (LPLs). We herein showed that antigenic stimulation with sIECs induced markedly greater secretion of interferon-gamma (IFN-γ) by CD4{sup +} IELs, but not interleukin (IL)-4, IL-10 and IL-17 although the proliferative response was prominently lower than that with T cell-depleted splenic APCs. In contrast, no enhanced IFN-γ secretion by CD4{sup +} LPLs and primed splenic CD4{sup +} T cells was observed when stimulated with sIECs. Taken together, these results suggest that sIECs uniquely activate CD4{sup +} IELs and induce remarkable IFN-γ secretion upon antigenic stimulation in vivo.« less
Goodfellow, Alfred; Keeling, Douglas N; Hayes, Robert C; Webster, Duncan
2009-01-01
With increasing use of immunosuppressive therapy, including tumor necrosis factor alpha inhibitors, there is concern about infectious complications, including reactivation of latent Mycobacterium tuberculosis infection. Routine testing prior to administration of systemic immunosuppression includes the tuberculin skin test, which lacks sensitivity and specificity and may be difficult to interpret in the presence of extensive cutaneous disease. Treatment of individuals with latent tuberculosis infection is recommended when immunosuppressive medications are to be employed. We report a case in which a diagnosis of latent tuberculosis infection in a patient with extensive bullous pemphigoid was clarified by the use of an interferon-gamma release assay after equivocal tuberculin skin test results. Interferon-gamma release assays are useful adjuncts to the tuberculin skin test in the diagnosis of latent tuberculosis infection in the setting of extensive cutaneous disease.
Cachat, Anne; Chevalier, Sébastien Alain; Alais, Sandrine; Ko, Nga Ling; Ratner, Lee; Journo, Chloé; Dutartre, Hélène
2013-01-01
Type I interferon (IFN-I) inhibits the replication of different viruses. However, the effect of IFN-I on the human T-lymphotropic virus type 1 (HTLV-1) viral cycle is controversial. Here, we investigated the consequences of IFN-α addition for different steps of HTLV-1 and HTLV-2 infection. We first show that alpha interferon (IFN-α) efficiently impairs HTLV-1 and HTLV-2 de novo infection in a T cell line and in primary lymphocytes. Using pseudotyped viruses expressing HTLV-1 envelope, we then show that cell-free infection is insensitive to IFN-α, demonstrating that the cytokine does not affect the early stages of the viral cycle. In contrast, intracellular levels of Gag, Env, or Tax protein are affected by IFN-α treatment in T cells, primary lymphocytes, or 293T cells transfected with HTLV-1 or HTLV-2 molecular clones, demonstrating that IFN-α acts during the late stages of infection. We show that IFN-α does not affect Tax-mediated transcription and acts at a posttranscriptional level. Using either small interfering RNA (siRNA) directed against PKR or a PKR inhibitor, we demonstrate that PKR, whose expression is induced by interferon, plays a major role in IFN-α-induced HTLV-1/2 inhibition. These results indicate that IFN-α has a strong repressive effect on the HTLV-1 and HTLV-2 viral cycle during de novo infection of cells that are natural targets of the viruses. PMID:24089560
Antiproliferative Properties of Type I and Type II Interferon
Bekisz, Joseph; Baron, Samuel; Balinsky, Corey; Morrow, Angel; Zoon, Kathryn C.
2010-01-01
The clinical possibilities of interferon (IFN) became apparent with early studies demonstrating that it was capable of inhibiting tumor cells in culture and in vivo using animal models. IFN gained the distinction of being the first recombinant cytokine to be licensed in the USA for the treatment of a malignancy in 1986, with the approval of IFN-α2a (Hoffman-La Roche) and IFN-α2b (Schering-Plough) for the treatment of Hairy Cell Leukemia. In addition to this application, other approved antitumor applications for IFN-α2a are AIDS-related Kaposi’s Sarcoma and Chronic Myelogenous Leukemia (CML) and other approved antitumor applications for IFN-α2b are Malignant Melanoma, Follicular Lymphoma, and AIDS-related Kapoisi’s Sarcoma. In the ensuing years, a considerable number of studies have been conducted to establish the mechanisms of the induction and action of IFN’s anti-tumor activity. These include identifying the role of Interferon Regulatory Factor 9 (IRF9) as a key factor in eliciting the antiproliferative effects of IFN-α as well as identifying genes induced by IFN that are involved in recognition of tumor cells. Recent studies also show that IFN-activated human monocytes can be used to achieve >95% eradication of select tumor cells. The signaling pathways by which IFN induces apoptosis can vary. IFN treatment induces the tumor suppressor gene p53, which plays a role in apoptosis for some tumors, but it is not essential for the apoptotic response. IFN-α also activates phosphatidylinositol 3-kinase (PI3K), which is associated with cell survival. Downstream of PI3K is the mammalian target of rapamycin (mTOR) which, in conjunction with PI3K, may act in signaling induced by growth factors after IFN treatment. This paper will explore the mechanisms by which IFN acts to elicit its antiproliferative effects and more closely examine the clinical applications for the anti-tumor potential of IFN. PMID:20664817
Yamaguchi, Mayu; Kitagawa, Yoshinori; Zhou, Min; Itoh, Masae; Gotoh, Bin
2014-01-03
Paramyxovirus C protein targets the host interferon (IFN) system for virus immune evasion. To identify its unknown anti-IFN activity, we examined the effect of Sendai virus C protein on activation of the IFN-α promoter via various signaling pathways. This study uncovers a novel ability of C protein to block Toll-like receptor (TLR) 7- and TLR9-dependent IFN-α induction, which is specific to plasmacytoid dendritic cells. C protein interacts with a serine/threonine kinase IKKα and inhibits phosphorylation of IRF7. This anti-IFN activity of C protein is shared across genera of the Paramyxovirinae, and thus appears to play an important role in paramyxovirus immune evasion. Copyright © 2013 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
Onabajo, Olusegun O.; Porter-Gill, Patricia; Paquin, Ashley; Rao, Nina; Liu, Luyang; Tang, Wei; Brand, Nathan
2015-01-01
Interferon lambda 4 (IFN-λ4) is a novel type-III interferon that can be generated only in individuals carrying a ΔG frame-shift allele of an exonic genetic variant (rs368234815-ΔG/TT). The rs368234815-ΔG allele is strongly associated with decreased clearance of hepatitis C virus (HCV) infection. Here, we further explored the biological function of IFN-λ4 expressed in human hepatic cells—a hepatoma cell line HepG2 and fresh primary human hepatocytes (PHHs). We performed live confocal imaging, cell death and proliferation assays, mRNA expression profiling, protein detection, and antibody blocking assays using transient and inducible stable in vitro systems. Not only did we observe significant intracellular retention of IFN-λ4 but also detected secreted IFN-λ4 in the culture media of expressing cells. Secreted IFN-λ4 induced strong activation of the interferon-stimulated genes (ISGs) in IFN-λ4-expressing and surrounding cells in transwell assays. Specifically, in PHHs, secreted IFN-λ4 induced expression of the CXCL10 transcript and a corresponding pro-inflammatory chemokine, IP-10. In IFN-λ4-expressing HepG2 cells, we also observed decreased proliferation and increased cell death. All IFN-λ4-induced phenotypes—activation of ISGs, decreased proliferation, and increased cell death—could be inhibited by an anti-IFN-λ4-specific antibody. Our study offers new insights into biology of IFN-λ4 and its possible role in HCV clearance. PMID:26134097
Effect of gamma interferon on lung function of mustard gas exposed patients, after 15 years.
Ghanei, Mostafa; Panahi, Yoones; Mojtahedzadeh, Mojtaba; Khalili, Ali Reza Hosseini; Aslani, Jafar
2006-01-01
Bronchiolitis has been known to be among the main the pathological features of lung lesions in Mustard Gas (MG) exposed patients. The purpose of this research was to evaluate the efficacy of interferon gamma-1b on the lung function in MG exposed patients with bronchiolitis. Thirty-six bronchiolitis patients, whose lung lesion had been diagnosed through High Resolution Computerized Tomography (HRCT) of the chest and also pathological study, were divided into two 18-member case and control groups. Both groups were receiving their conventional treatment (inhaled Felixotide and Servent). The case group were treated for 6 months with a combination of 200 microg of interferon gamma-1b (given three times per week subcutaneously) plus 7.5 mg of prednisolone (given once a day), while the control group received their previous conventional medications. Lung function was measured at base line and after 1, 3 and 6 months of treatment. In case and control groups, Forced Expiratory Volume in first second (FEV1) did not have statistical differences at the base line (49.3 +/- 2.9 and 48.7 +/- 4.1, respectively = 0.6), whereas a significant increase was seen in the case group (66.3 +/- 5.4) compared control group (57.3 +/- 8.6) at the subsequent months (P = 0.001 for the difference between the groups). Similar pattern of increase was observed in Forced Vital Capacity (FVC). The findings of this study indicate that a 6-month treatment with interferon gamma-1b plus a low-dose prednisolone is associated with an improvement in the lung function in mustard-gas exposed patients with bronchiolitis.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sakaeda, Yoshiichi; Hiroi, Miki; Shimojima, Takahiro
Sulindac, a non-steroidal anti-inflammatory drug, has been shown to exert an anti-tumor effect on several types of cancer. To determine the effect of sulindac on intracellular signaling pathways in host immune cells such as macrophages, we investigated the effect of the drug on interferon gamma (IFN{gamma})-induced expression of signal transducer and activator of transcription 1 (STAT1) and other genes in mouse macrophage-like cell line RAW264.7 cells. Sulindac, but not aspirin or sodium salicylate, inhibited IFN{gamma}-induced expression of the CXC ligand 9 (CXCL9) mRNA, a chemokine for activated T cells, whereas the interferon-induced expression of CXCL10 or IFN regulatory factor-1 wasmore » not affected by sulindac. Luciferase reporter assay demonstrated that sulindac inhibited IFN{gamma}-induced promoter activity of the CXCL9 gene. Surprisingly, sulindac had no inhibitory effect on IFN{gamma}-induced STAT1 activation; however, constitutive nuclear factor {kappa}B activity was suppressed by the drug. These results indicate that sulindac selectively inhibited IFN{gamma}-inducible gene expression without inhibiting STAT1 activation.« less
Type I interferon signature in systemic lupus erythematosus.
Bezalel, Shira; Guri, Keren Mahlab; Elbirt, Daniel; Asher, Ilan; Sthoeger, Zev Moshe
2014-04-01
Type I interferons (IFN) are primarily regarded as an inhibitor of viral replication. However, type I IFN, mainly IFNalpha, plays a major role in activation of both the innate and adaptive immune systems. Systemic lupus erythematosus (SLE) is a chronic, multi-systemic, inflammatory autoimmune disease with undefined etiology. SLE is characterized by dysregulation of both the innate and the adaptive immune systems. An increased expression of type I IFN-regulated genes, termed IFN signature, has been reported in patients with SLE. We review here the role of IFNalpha in the pathogenesis and course of SLE and the possible role of IFNalpha inhibition as a novel treatment for lupus patients.
Wei, Fang; Liu, Junying; Liu, Fen; Hu, Huaidong; Ren, Hong; Hu, Peng
2014-01-01
Hepatitis C virus (HCV) infection is highly prevalent in renal transplant (RT) recipients. Currently, interferon-based (IFN-based) antiviral therapies are the standard approach to control HCV infection. In a post-transplantation setting, however, IFN-based therapies appear to have limited efficacy and their use remains controversial. The present study aimed to evaluate the efficacy and safety of IFN-based therapies for HCV infection post RT. We searched Pubmed, Embase, Web of Knowledge, and The Cochrane Library (1997-2013) for clinical trials in which transplant patients were given Interferon (IFN), pegylated interferon (PEG), interferon plus ribavirin (IFN-RIB), or pegylated interferon plus ribavirin (PEG-RIB). The Sustained Virological Response (SVR) and/or drop-out rates were the primary outcomes. Summary estimates were calculated using the random-effects model of DerSimonian and Laird, with heterogeneity and sensitivity analysis. We identified 12 clinical trials (140 patients in total). The summary estimate for SVR rate, drop-out rate and graft rejection rate was 26.6% (95%CI, 15.0-38.1%), 21.1% (95% CI, 10.9-31.2%) and 4% (95%CI: 0.8%-7.1%), respectively. The overall SVR rate in PEG-based and standard IFN-based therapy was 40.6% (24/59) and 20.9% (17/81), respectively. The most frequent side-effect requiring discontinuation of treatment was graft dysfunction (14 cases, 45.1%). Meta-regression analysis showed the covariates included contribute to the heterogeneity in the SVR logit rate, but not in the drop-out logit rate. The sensitivity analyses by the random model yielded very similar results to the fixed-effects model. IFN-based therapy for HCV infection post RT has poor efficacy and limited safety. PEG-based therapy is a more effective approach for treating HCV infection post-RT than standard IFN-based therapy. Future research is required to develop novel strategies to improve therapeutic efficacy and tolerability, and reduce the liver-related morbidity and
Liao, Zhiwei; Wan, Quanyuan; Su, Jianguo
2016-08-01
Interferons (IFNs) play crucial roles in the immune response of defense against viral infection and bacteria invasion. In the present study, we systematically identified and characterized the IFNs, their regulatory factors (Interferon Regulatory Factors, IRFs) and receptors (Cytokine Receptor Family B, CRFBs) in grass carp (Ctenopharyngodon idella). Grass carp IFNs can be classified into type I IFN (IFN-I) and type II IFN (IFN-II) like other teleosts. IFN-I consist of two groups with two (group I) or four (group II) cysteines in the mature peptide and can be further divided into three subgroups (IFN-a, -c and -d), containing four members: IFN1, IFN2, IFN3, IFN4 in grass carp. IFN-II contain two members, IFNγ2 with the similarity to mammalian IFNγ and a cyprinid specific IFNγ1 (IFNγ-rel) molecule. mRNA expression analyses of IFNs discovered that IFN1 and IFN-II were sustainably expressed in many tissues, while other IFN members were transiently expressed in specific tissues and time points. In the immune response, IFN transcriptions are primarily regulated through multiple IRFs after grass carp reovirus (GCRV) challenge. IRF family possess thirteen members in grass carp, which can be further divided into four subfamilies (IRF-1, -3, -4 and -5 subfamily), each of them plays different roles in the innate and adaptive immunity via various signaling pathways to interact with IFNs (mainly IFN-I). IFNs have to bind receptors (CRFBs) to perform their functions. CRFBs as IFN receptors contain six members in grass carp. The structure and expression characterizations of IFNs, IRFs and CRFBs were analyzed using bioinformatics tools. These results might provide basic data for the further functional research of IFN system, and deeply understand fish immune mechanisms against virus infection. Copyright © 2016 Elsevier Ltd. All rights reserved.
Treatment of Hepatitis C Infections with Interferon: A Historical Perspective
2010-01-01
infected AKR cells: a novel effect of interferon,” Proceedings of the National Academy of Sciences of the United States of America, vol. 71, no. 9, pp...Treatment of Hepatitis C Infections with Interferon: A Historical Perspective Robert M. Friedman and Sara Contente Department of Pathology, Uniformed...involve new anti-HCV agents that are currently under development. The antiviral activity of interferon (IFN), first described in 1957, was in a chick cell
[Complication of pernicious anemia during interferon-β treatment for type C chronic hepatitis].
Ichihara, Hiroyoshi; Koh, Shiro; Aoyama, Yasutaka; Kumura, Takeo; Ohta, Tadanobu; Furukawa, Yoshio; Terada, Yoshiki; Yamane, Takahisa; Hino, Masayuki; Mugitani, Atsuko
2012-03-01
A 62-year-old man with chronic hepatitis C underwent interferon (IFN)-β therapy. After treatment for a period comprising 29 months and 2 weeks, hematological results showed a decrease in white blood cell, hemoglobin, and platelet counts (WBC 2,300/µl, Hb 7.2 g/dl, PLT 4.7×10(4)/µl), and IFN therapy was stopped. Despite therapy discontinuation, the pancytopenia continued to progress with elevation of LDH (LDH 4,898 IU/l), and the patient was admitted to our hospital with suspected hematological disease. The patient underwent clinical screening, and pernicious anemia caused by vitamin B12 deficiency was diagnosed. The anemia rapidly improved with vitamin B12 treatment. Interferon is the mainstay of treatment for patients with viral hepatitis. While the adverse effects of interferon therapy are widely recognized, only a few reports have documented pernicious anemia developing during IFN-therapy. We recommend that particular attention be paid to such clinical and laboratory conditions as megaloblastic anemia when administering IFN. We also recommend checking the vitamin B12 level, as a deficiency of this vitamin may lead to the development of megaloblastic anemia.
Laurent-Rolle, Maudry; Morrison, Juliet; Rajsbaum, Ricardo; Macleod, Jesica M Levingston; Pisanelli, Giuseppe; Pham, Alissa; Ayllon, Juan; Miorin, Lisa; Martinez, Carles; tenOever, Benjamin R; García-Sastre, Adolfo
2014-09-10
To successfully establish infection, flaviviruses have to overcome the antiviral state induced by type I interferon (IFN-I). The nonstructural NS5 proteins of several flaviviruses antagonize IFN-I signaling. Here we show that yellow fever virus (YFV) inhibits IFN-I signaling through a unique mechanism that involves binding of YFV NS5 to the IFN-activated transcription factor STAT2 only in cells that have been stimulated with IFN-I. This NS5-STAT2 interaction requires IFN-I-induced tyrosine phosphorylation of STAT1 and the K63-linked polyubiquitination at a lysine in the N-terminal region of YFV NS5. We identified TRIM23 as the E3 ligase that interacts with and polyubiquitinates YFV NS5 to promote its binding to STAT2 and trigger IFN-I signaling inhibition. Our results demonstrate the importance of YFV NS5 in overcoming the antiviral action of IFN-I and offer a unique example of a viral protein that is activated by the same host pathway that it inhibits. Copyright © 2014 Elsevier Inc. All rights reserved.
Rajsbaum, Ricardo; Macleod, Jesica M. Levingston; Pisanelli, Giuseppe; Pham, Alissa; Ayllon, Juan; Miorin, Lisa; Martinez, Carles; tenOever, Benjamin R; García-Sastre, Adolfo
2014-01-01
Summary To successfully establish infection Flaviviruses have to overcome the antiviral state induced by type I interferon (IFN-I). The nonstructural NS5 proteins of several flaviviruses antagonize IFN-I signaling. Here we show that yellow fever virus (YFV) inhibits IFN-I signaling through a unique mechanism that involves binding of YFV NS5 to the IFN-activated transcription factor STAT2 only in cells that have been stimulated with IFN-I. This NS5-STAT2 interaction requires IFN-I-induced tyrosine phosphorylation of STAT1 and the K63-linked polyubiquitination at a lysine in the N-terminal region of YFV NS5. We identified TRIM23 as the E3 ligase that interacts with and polyubiquitinates YFV NS5 to promote its binding to STAT2 and trigger IFN-I signaling inhibition. Our results demonstrate the importance of YFV NS5 in overcoming the antiviral action of IFN-I and offer a unique example of a viral protein that is activated by the same host pathway that it inhibits. PMID:25211074
Development and evaluation of an interferon-γ release assay in Asian elephants (Elephas maximus).
Paudel, Sarad; Villanueva, Marvin A; Mikota, Susan K; Nakajima, Chie; Gairhe, Kamal P; Subedi, Suraj; Rayamajhi, Nabin; Sashika, Mariko; Shimozuru, Michito; Matsuba, Takashi; Suzuki, Yasuhiko; Tsubota, Toshio
2016-08-01
We developed an interferon-γ release assay (IGRA) specific for Asian elephants (Elephas maximus). Whole blood collected from forty captive Asian elephants was stimulated with three different mitogens i.e., phytohemagglutinin (PHA), pokweed mitogen (PWM) and phorbol myristate aceteate/ionomycin (PMA/I). A sandwich ELISA that was able to recognize the recombinant elephant interferon-γ (rEIFN-γ) as well as native interferon-γ from the Asian elephants was performed using anti-elephant IFN-γ rabbit polyclonal antibodies as capture antibodies and biotinylated anti-elephant IFN-γ rabbit polyclonal antibodies as detection antibodies. PMA/I was the best mitogen to use as a positive control for an Asian elephant IGRA. The development of an Asian elephant-specific IGRA that detects native IFN-γ in elephant whole blood provides promising results for its application as a potential diagnostic tool for diseases, such as tuberculosis (TB) in Asian elephants.
Effect of Type-I Interferon on Retroviruses
Gómez-Lucía, Esperanza; Collado, Victorio M.; Miró, Guadalupe; Doménech, Ana
2009-01-01
Type-I interferons (IFN-I) play an important role in the innate immune response to several retroviruses. They seem to be effective in controlling the in vivo infection, though many of the clinical signs of retroviral infection may be due to their continual presence which over-stimulates the immune system and activates apoptosis. IFN-I not only affect the immune system, but also operate directly on virus replication. Most data suggest that the in vitro treatment with IFN-I of retrovirus infected cells inhibits the final stages of virogenesis, avoiding the correct assembly of viral particles and their budding, even though the mechanism is not well understood. However, in some retroviruses IFN-I may also act at a previous stage as some retroviral LTRs posses sequences homologous to the IFN-stimulated response element (ISRE). When stimulated, ISREs control viral transcription. HIV-1 displays several mechanisms for evading IFN-I, such as through Tat and Nef. Besides IFN-α and IFN-β, some other type I IFN, such as IFN-τ and IFN-ω, have potent antiviral activity and are promising treatment drugs. PMID:21994560
Effects of isolation on interferon production and hematological and immunological parameters
NASA Technical Reports Server (NTRS)
Sonnenfeld, G.; Measel, J.; Loken, M. R.; Degioanni, J.; Follini, S.; Galvagno, A.; Montalbini, M.
1992-01-01
A 27-year-old woman was maintained in an isolated state for 131 days in Carlsbad Caverns, New Mexico. Her diet was vitamin D-depleted. Determinations on the effects of such isolation on levels and activities of peripheral blood cells that are important for hematological homeostasis and immunological function were carried out. Throughout the duration of the study, the percentage of lymphoid cells that expressed CD3, CD4, CD8, CD19, Leu 8, and other markers remained relatively constant although the absolute numbers of these cells varied. Although the percentage of natural killer (NK) cells did not vary, the activity of these cells did change. NK cell activity became elevated as the isolation study progressed. Production of interferon-gamma (IFN-gamma) in response to mitogen stimulation was higher than expected throughout the isolation periods, but returned to the normal range after termination of the isolation. Red and white cell counts dropped significantly upon entering isolation, but soon returned to normal.
Kim, Dong-Young; Jung, Jung-A; Kim, Tae-Ho; Seo, Sang-Wan; Jung, Sung-Ki; Park, Cheung-Seog
2009-04-21
Uncariae rhynchophylla (UR) is an herb which has blood pressure lowering and anti-inflammatory effects and has been prescribed traditionally to treat stroke and vascular dementia. In the present study, we examined whether UR suppress Atopic dermatitis (AD)-like skin lesions in NC/Nga mice treated with 2, 4-dinitrofluorobenzene (DNFB) under SPF conditions. The effect of UR in DNFB- treated NC/Nga mice was determined by measuring the skin symptom severity, levels of serum IgE, and of the amounts of IL-4 and IFN-gamma secreted by activated T cells in draining lymph nodes. Oral administration of UR to DNFB-treated NC/Nga mice was found to inhibit ear thickness increases and the skin lesions induced by DNFB. IFN-gamma production by CD4+ T cells from the lymph nodes of DNFB-treated NC/Nga mice was significantly inhibited by UR treatment, although levels of IL-4 and total IgE in serum were not. UR may suppress the development of AD-like dermatitis in DNFB-treated NC/Nga mice by reducing IFN-gamma production.
Screening of a ScFv Antibody With High Affinity for Application in Human IFN-γ Immunoassay
Yang, Hang; Zhong, Yanfang; Wang, Juncheng; Zhang, Qinghong; Li, Xiulan; Ling, Sumei; Wang, Shihua; Wang, Rongzhi
2018-01-01
Interferon gamma (IFN-γ), a signal proinflammatory cytokine secreted by immune cell, and plays a critical role in the pathogenesis and progression of many diseases. It has been regarded as an important marker for determination of disease-specific immune responses. Therefore, it is urgent to develop a feasible and accurate method to detect IFN-γ in clinic real blood samples. Until now, the immunoassay based on singe chain variable fragment (scFv) antibody for human IFN-γ is still not reported. In the present study, an scFv antibody named scFv-A8 with high specificity was obtained by phage display and biopanning, with the affinity 2.6 × 109 L/mol. Maltose binding protein (MBP) was used to improve the solubility of scFv by inserting an linker DNA between scFv and MBP tag, and the resulted fusion protein (MBP-LK-scFv) has high solubility and antigen biding activity. The expressed and purified MBP-LK-scFv antibody was used to develop the indirect competitive enzyme-linked immunosorbent assay (ELISA) (ic-ELISA) for detection of human IFN-γ, and the result indicated that the linear range to detect IFN-γ was 6–60 pg/mL with IC50 of 25 pg/mL. The limit of detection was 2 pg/mL (1.3 fm), and the average recovery was 85.05%, further demonstrating that the detection method based on scFv has higher recovery and accuracy. Hence, the developed ic-ELISA can be used to detect IFN-γ in real samples, and it may be further provided a scientific basis for disease diagnosis. PMID:29563896
USDA-ARS?s Scientific Manuscript database
Paramyxoviruses are known to inhibit type I interferon (IFN) production, however there is a lack of information regarding the type III IFN response during infection. Type III IFNs signal through a unique heterodimeric receptor, the IFN-'R1/IL-10R2, which is primarily expressed by epithelial cells. ...
Nomura, Masaru; Hodgkinson, Suzanne J; Tran, Giang T; Verma, Nirupama D; Robinson, Catherine; Plain, Karren M; Boyd, Rochelle; Hall, Bruce M
2017-06-01
CD4 + T cells that transfer alloantigen-specific transplant tolerance are short lived in culture unless stimulated with specific-donor alloantigen and lymphocyte derived cytokines. Here, we examined if IFN-γ maintained survival of tolerance transferring CD4 + T cells. Alloantigen-specific transplant tolerance was induced in DA rats with heterotopic adult PVG heart allografts by a short course of immunosuppression and these grafts functioned for >100days with no further immunosuppression. In previous studies, we found the CD4 + T cells from tolerant rats that transfer tolerance to an irradiated DA host grafted with a PVG heart, lose their tolerance transferring ability after 3days of culture, either with or without donor alloantigen, and effect rejection of specific-donor grafts. If cultures with specific-donor alloantigen are supplemented by supernatant from ConA activated lymphocytes the tolerance transferring cells survive, suggesting these cells depend on cytokines for their survival. In this study, we found addition of rIFN-γ to MLC with specific-donor alloantigen maintained the capacity of tolerant CD4 + T cells to transfer alloantigen-specific tolerance and their ability to suppress PVG allograft rejection mediated by co-administered naïve CD4 + T cells. IFN-γ suppressed the in vitro proliferation of tolerant CD4 + T cells. Tolerant CD4 + CD25 + T cells did not proliferate in MLC to PVG stimulator cells with no cytokine added, but did when IFN-γ was present. IFN-γ did not alter proliferation of tolerant CD4 + CD25 + T cells to third-party Lewis. Tolerant CD4 + CD25 + T cells' expression of IFN-γ receptor (IFNGR) was maintained in culture when IFN-γ was present. This study suggested that IFN-γ maintained tolerance mediating alloantigen-specific CD4 + CD25 + T cells. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.
Callister, Steven M; Jobe, Dean A; Stuparic-Stancic, Aleksandra; Miyamasu, Misato; Boyle, Jeff; Dattwyler, Raymond J; Arnaboldi, Paul M
2016-05-15
Current serodiagnostics for Lyme disease lack sensitivity during early disease, and cannot determine treatment response. We evaluated an assay based on QuantiFERON technology utilizing peptide antigens derived from Borrelia burgdorferi to stimulate interferon-gamma (IFN-γ) release as an alternative to serodiagnosis for the laboratory detection of Lyme disease. Blood was obtained from patients with erythema migrans before (n = 29) and 2 months after (n = 27) antibiotic therapy. IFN-γ release was measured by enzyme-linked immunosorbent assay (ELISA) following overnight stimulation of whole blood with the peptide antigens, and compared to the results of standard serological assays (C6, ELISA, and Western blot). IFN-γ release was observed in pretreatment blood of 20 of 29 (69%) patients with Lyme disease. Following antibiotic treatment, IFN-γ was significantly reduced (P = .0002), and was detectable in only 4 of 20 (20%) initially positive patients. By contrast, anti-C6 antibodies were detected in pretreatment sera from 17 of 29 (59%) subjects, whereas only 5 of 29 (17%) patients had positive Western blot seroreactivity. Antibody responses persisted and expanded following treatment. Our findings suggest that measurement of IFN-γ after incubating blood with Borrelia antigens could be useful in the laboratory diagnosis of early Lyme disease. Also, after antibiotic treatment, this response appears to be short lived. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.
IFN-β: A Contentious Player in Host–Pathogen Interaction in Tuberculosis
Sabir, Naveed; Hussain, Tariq; Shah, Syed Zahid Ali; Zhao, Deming; Zhou, Xiangmei
2017-01-01
Tuberculosis (TB) is a major health threat to the human population worldwide. The etiology of the disease is Mycobacterium tuberculosis (Mtb), a highly successful intracellular pathogen. It has the ability to manipulate the host immune response and to make the intracellular environment suitable for its survival. Many studies have addressed the interactions between the bacteria and the host immune cells as involving many immune mediators and other cellular players. Interferon-β (IFN-β) signaling is crucial for inducing the host innate immune response and it is an important determinant in the fate of mycobacterial infection. The role of IFN-β in protection against viral infections is well established and has been studied for decades, but its role in mycobacterial infections remains much more complicated and debatable. The involvement of IFN-β in immune evasion mechanisms adopted by Mtb has been an important area of investigation in recent years. These advances have widened our understanding of the pro-bacterial role of IFN-β in host–pathogen interactions. This pro-bacterial activity of IFN-β appears to be correlated with its anti-inflammatory characteristics, primarily by antagonizing the production and function of interleukin 1β (IL-1β) and interleukin 18 (IL-18) through increased interleukin 10 (IL-10) production and by inhibiting the nucleotide-binding domain and leucine-rich repeat protein-3 (NLRP3) inflammasome. Furthermore, it also fails to provoke a proper T helper 1 (Th1) response and reduces the expression of major histocompatibility complex II (MHC-II) and interferon-γ receptors (IFNGRs). Here we will review some studies to provide a paradigm for the induction, regulation, and role of IFN-β in mycobacterial infection. Indeed, recent studies suggest that IFN-β plays a role in Mtb survival in host cells and its downregulation may be a useful therapeutic strategy to control Mtb infection. PMID:29258190
IFN-β: A Contentious Player in Host-Pathogen Interaction in Tuberculosis.
Sabir, Naveed; Hussain, Tariq; Shah, Syed Zahid Ali; Zhao, Deming; Zhou, Xiangmei
2017-12-16
Tuberculosis (TB) is a major health threat to the human population worldwide. The etiology of the disease is Mycobacterium tuberculosis (Mtb), a highly successful intracellular pathogen. It has the ability to manipulate the host immune response and to make the intracellular environment suitable for its survival. Many studies have addressed the interactions between the bacteria and the host immune cells as involving many immune mediators and other cellular players. Interferon-β (IFN-β) signaling is crucial for inducing the host innate immune response and it is an important determinant in the fate of mycobacterial infection. The role of IFN-β in protection against viral infections is well established and has been studied for decades, but its role in mycobacterial infections remains much more complicated and debatable. The involvement of IFN-β in immune evasion mechanisms adopted by Mtb has been an important area of investigation in recent years. These advances have widened our understanding of the pro-bacterial role of IFN-β in host-pathogen interactions. This pro-bacterial activity of IFN-β appears to be correlated with its anti-inflammatory characteristics, primarily by antagonizing the production and function of interleukin 1β (IL-1β) and interleukin 18 (IL-18) through increased interleukin 10 (IL-10) production and by inhibiting the nucleotide-binding domain and leucine-rich repeat protein-3 (NLRP3) inflammasome. Furthermore, it also fails to provoke a proper T helper 1 (Th1) response and reduces the expression of major histocompatibility complex II (MHC-II) and interferon-γ receptors (IFNGRs). Here we will review some studies to provide a paradigm for the induction, regulation, and role of IFN-β in mycobacterial infection. Indeed, recent studies suggest that IFN-β plays a role in Mtb survival in host cells and its downregulation may be a useful therapeutic strategy to control Mtb infection.
Fan, Y-H; Lin, Y-L; Hwang, Y-C; Yang, H-C; Chiu, H-C; Chiou, S-H; Jong, M-H; Chow, K-C; Lin, C-C
2016-10-01
The effect of co-administration of interferon (IFN)-γ in pigs undergoing vaccination with an attenuated strain (LPC) of classical swine fever virus (CSFV) was investigated. Unvaccinated pigs demonstrated pyrexia and died 7-9 days after challenge with virulent CSFV. Pigs receiving the attenuated vaccine remained healthy after virus challenge, except for mild, transient pyrexia, whereas pigs receiving IFN-γ simultaneously with the vaccine demonstrated normal body temperatures after virus challenge. Examination by nested RT-PCR revealed greater viral load in the spleens of the pigs vaccinated with the attenuated CSFV, compared with those that had additionally received IFN-γ. Expression of major histocompatibility complex (MHC) class I and MHC class II molecules was upregulated in the spleens of the IFN-γ treated vaccinated pigs, demonstrated by immunohistochemistry. Based on Western blot analysis, anti-CSFV IgG2 antibodies were elevated in vaccinated pigs by co-administration of IFN-γ (IFN-γ(Hi): P < 0.01; IFN-γ(Lo): P <0.05). By employing the suppression subtractive hybridization technique, RT-PCR, in situ hybridization, and immunohistochemistry, T-cell factor-4 (Tcf-4) mRNA and protein expression were found to be upregulated in the spleens of vaccinated pigs that had received IFN-γ. This study suggests involvement of Tcf-4 in IFN-γ-mediated immune regulation following CSFV vaccination. Copyright © 2016 Elsevier Ltd. All rights reserved.
Shiba, Masahiro; Nonomura, Norio; Nakai, Yasutomo; Nakayama, Masashi; Takayama, Hitoshi; Inoue, Hitoshi; Tsujimura, Akira; Nishimura, Kazuo; Okuyama, Akihiko
2009-04-01
To investigate the regulation of interferon-alpha (IFN-alpha) receptor expression in metastatic renal cell carcinoma (RCC) after IFN-alpha administration. Blood sampling was carried out in eight patients with metastatic RCC and six healthy volunteers. Flow-cytometric analysis using a monoclonal antibody against the active subunit of the type-I IFN-alpha receptor (IFNAR2) was carried out to examine the circadian rhythm of IFNAR2 expression in peripheral blood mononuclear cells (PBMC) as well as its downregulation after IFN-alpha administration. According to its circadian rhythm IFNAR2 in PBMC had a peak expression at night. Once IFN-alpha is administered, IFNAR2 levels in PBMC showed downregulation within 48 h and recovered within another 48 h. Our findings might support the establishment of an optimal schedule for IFN-alpha administration.
Nguyen, S; Beziat, V; Dhedin, N; Kuentz, M; Vernant, J P; Debre, P; Vieillard, V
2009-05-01
Natural killer (NK) cells generated after haploidentical hematopoietic SCT in patients with AML are characterized by specific phenotypic features and impaired functioning that may affect transplantation outcome. We show that IFN-gamma produced by immature CD56(bright) NK cells upregulates cell surface expression of HLA-E on AML blasts and that this upregulation protects leukemic cells from NK-mediated cell lysis through the mediation of CD94/NKG2A, an inhibitory receptor overexpressed on NK cells after haploidentical SCT. Two years after transplantation, however, maturing NK cells were functionally active, as evidenced by high cytotoxicity and poor IFN-gamma production. This implies that maturation of NK cells is the key to improved immune responses and transplantation outcome.
Ontiveros, N; Tye-Din, J A; Hardy, M Y; Anderson, R P
2014-01-01
T cell cytokine release assays are used to diagnose infectious diseases, but not autoimmune or allergic disease. Coeliac disease (CD) is a common T cell-mediated disease diagnosed by the presence of gluten-dependent intestinal inflammation and serology. Many patients cannot be diagnosed with CD because they reduce dietary gluten before medical workup. Oral gluten challenge in CD patients treated with gluten-free diet (GFD) mobilizes gluten-reactive T cells measurable by interferon (IFN)-γ enzyme-linked immunospot (ELISPOT) or major histocompatibility complex (MHC) class II tetramers. Immunodominant peptides are quite consistent in the 90% of patients who possess HLA-DQ2·5. We aimed to develop whole blood assays to detect gluten-specific T cells. Blood was collected before and after gluten challenge from GFD donors confirmed to have CD (n = 27, all HLA-DQ2·5+), GFD donors confirmed not to have CD (n = 6 HLA-DQ2·5+, 11 HLA-DQ2·5−) and donors with CD not following GFD (n = 4, all HLA-DQ2·5+). Plasma IFN-γ and IFN-γ inducible protein-10 (IP-10) were measured by enzyme-linked immunosorbent assay (ELISA) after whole blood incubation with peptides or gliadin, and correlated with IFN-γ ELISPOT. No T cell assay could distinguish between CD patients and controls prior to gluten challenge, but after gluten challenge the whole blood IFN-γ ELISA and the ELISPOT were both 85% sensitive and 100% specific for HLA-DQ2·5+ CD patients; the whole blood IP-10 ELISA was 94% sensitive and 100% specific. We conclude that whole blood cytokine release assays are sensitive and specific for detection of gluten-reactive T cells in CD; further clinical studies addressing the utility of these tests in patients with an uncertain diagnosis of CD is warranted. PMID:24192268
Yokota, Shin-ichi; Okabayashi, Tamaki; Yokosawa, Noriko; Fujii, Nobuhiro
2004-01-01
Natural infection with measles virus (MeV) is initiated when the virus reaches epithelial cells in the respiratory tract, oropharynx, or conjunctivae. Human epithelial cells infected with MeV frequently show growth suppression. In this study, we investigated the possible mechanisms for this suppression. The bronchiolar epithelial cell A549 showed growth arrest in G0/G1 following MeV infection or treatment with gamma interferon (IFN-γ). IFN regulatory factor-1 (IRF-1) was upregulated during MeV infection, although A549 did not produce IFN-γ. Cells of the cervical squamous cell line SiHa persistently infected with various strains of MeV displayed slower growth than uninfected SiHa cells, although the growth rates varied depending on the MeV strain. Transfection of antisense-oriented IRF-1 cDNA released the MeV-infected SiHa cells from growth suppression. Although these infected cells did not produce IFN-γ and suppressed IFN-α/β-induced Jak1 phosphorylation, Jak1 was constitutively phosphorylated. The growth rates negatively correlated with levels of both IRF-1 expression and constitutively phosphorylated Jak1. These results indicate that MeV upregulates IRF-1 in a manner that is independent of IFN but dependent on the JAK/STAT pathway. This induction of IRF-1 appears to suppress cell growth, although the extent seems to vary among MeV strains. PMID:15078941
Frau, Aldo; Sgarbanti, Marco; Orsatti, Roberto
2018-01-01
The interferon (IFN) system is the first line of defense against viral infections. Evasion of IFN signaling by Ebola viral protein 24 (VP24) is a critical event in the pathogenesis of the infection and, hence, VP24 is a potential target for drug development. Since no drugs target VP24, the identification of molecules able to inhibit VP24, restoring and possibly enhancing the IFN response, is a goal of concern. Accordingly, we developed a dual signal firefly and Renilla luciferase cell-based drug screening assay able to quantify IFN-mediated induction of Interferon Stimulated Genes (ISGs) and its inhibition by VP24. Human Embryonic Kidney 293T (HEK293T) cells were transiently transfected with a luciferase reporter gene construct driven by the promoter of ISGs, Interferon-Stimulated Response Element (ISRE). Stimulation of cells with IFN-α activated the IFN cascade leading to the expression of ISRE. Cotransfection of cells with a plasmid expressing VP24 cloned from a virus isolated during the last 2014 outbreak led to the inhibition of ISRE transcription, quantified by a luminescent signal. To adapt this system to test a large number of compounds, we performed it in 96-well plates; optimized the assay analyzing different parameters; and validated the system by calculating the Z′- and Z-factor, which showed values of 0.62 and 0.53 for IFN-α stimulation assay and VP24 inhibition assay, respectively, indicative of robust assay performance. PMID:29495311
Fanunza, Elisa; Frau, Aldo; Sgarbanti, Marco; Orsatti, Roberto; Corona, Angela; Tramontano, Enzo
2018-02-24
The interferon (IFN) system is the first line of defense against viral infections. Evasion of IFN signaling by Ebola viral protein 24 (VP24) is a critical event in the pathogenesis of the infection and, hence, VP24 is a potential target for drug development. Since no drugs target VP24, the identification of molecules able to inhibit VP24, restoring and possibly enhancing the IFN response, is a goal of concern. Accordingly, we developed a dual signal firefly and Renilla luciferase cell-based drug screening assay able to quantify IFN-mediated induction of Interferon Stimulated Genes (ISGs) and its inhibition by VP24. Human Embryonic Kidney 293T (HEK293T) cells were transiently transfected with a luciferase reporter gene construct driven by the promoter of ISGs, Interferon-Stimulated Response Element (ISRE). Stimulation of cells with IFN-α activated the IFN cascade leading to the expression of ISRE. Cotransfection of cells with a plasmid expressing VP24 cloned from a virus isolated during the last 2014 outbreak led to the inhibition of ISRE transcription, quantified by a luminescent signal. To adapt this system to test a large number of compounds, we performed it in 96-well plates; optimized the assay analyzing different parameters; and validated the system by calculating the Z'- and Z-factor, which showed values of 0.62 and 0.53 for IFN-α stimulation assay and VP24 inhibition assay, respectively, indicative of robust assay performance.
Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.
2001-01-01
Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339
Molecular cloning and characterization of a novel bovine IFN-ε.
Guo, Yongli; Gao, Mingchun; Bao, Jun; Luo, Xiuxin; Liu, Ying; An, Dong; Zhang, Haili; Ma, Bo; Wang, Junwei
2015-03-01
A bovine IFN-ε (BoIFN-ε) gene was amplified from bovine liver genomic DNA consisting of a 463bp partial 5'UTR, 582bp complete ORF and 171bp partial 3'UTR, which encodes a protein of 193 amino acids with a 21-amino acid signal peptide and shares 61 to 87% identity with other species IFN-ε. Then BoIFN-ε gene was characterized, and it can be transcribed in EBK cells at a high level after being infected by VSV. Recombinant proteins were expressed in Escherichia coli and the antiviral activity was determined in vitro, which revealed that bovine IFN-ε has less antiviral activity than bovine IFN-α. In addition, an immunofluorescence assay indicated that BoIFN-ε expressed in MDBK cells could be detected by polyclonal antibody against BoIFN-ε. Furthermore, the BoIFN-ε gene can be constitutively expressed in the liver, thymus, kidney, small intestine and testis, but not in the heart. This study revealed that BoIFN-ε has the typical characteristics of type I interferon and can be expressed constitutively in certain tissue, which not only can be a likely candidate for a novel, effective therapeutic agent, but also facilitate further research on the role of bovine IFN system. Copyright © 2014 Elsevier B.V. All rights reserved.
The antiviral innate immune response in fish: evolution and conservation of the IFN system.
Langevin, Christelle; Aleksejeva, Elina; Passoni, Gabriella; Palha, Nuno; Levraud, Jean-Pierre; Boudinot, Pierre
2013-12-13
Innate immunity constitutes the first line of the host defense after pathogen invasion. Viruses trigger the expression of interferons (IFNs). These master antiviral cytokines induce in turn a large number of interferon-stimulated genes, which possess diverse effector and regulatory functions. The IFN system is conserved in all tetrapods as well as in fishes, but not in tunicates or in the lancelet, suggesting that it originated in early vertebrates. Viral diseases are an important concern of fish aquaculture, which is why fish viruses and antiviral responses have been studied mostly in species of commercial value, such as salmonids. More recently, there has been an interest in the use of more tractable model fish species, notably the zebrafish. Progress in genomics now makes it possible to get a relatively complete image of the genes involved in innate antiviral responses in fish. In this review, by comparing the IFN system between teleosts and mammals, we will focus on its evolution in vertebrates. © 2013 Elsevier Ltd. All rights reserved.
El Azbaoui, S; Alaoui Mrani, N; Sabri, A; Jouhadi, Z; Ailal, F; Bousfiha, A A; Najib, J; El Hafidi, N; Deswarte, C; Schurr, E; Bustamante, J; Boisson-Dupuis, S; Casanova, J-L; Abel, L; El Baghdadi, J
2015-12-01
Tuberculosis spondylodiscitis (TS), or Pott's disease, an extra-pulmonary form of tuberculosis (TB), is rare and difficult to diagnose in children. Some cases of severe TB in children were recently explained by inborn errors of immunity affecting the interleukin-12/interferon-gamma (IL-12/IFN-γ) axis. To analyse clinical data on Moroccan children with TS, and to perform immunological and genetic explorations of the IL-12/IFN-γ axis. We studied nine children with TS diagnosed between 2012 and 2014. We investigated the IL-12/IFN-γ circuit by both whole-blood assays and sequencing of the coding regions of 14 core genes of this pathway. A diagnosis of TS was based on a combination of clinical, biological, histological and radiological data. QuantiFERON(®)-TB Gold In-Tube results were positive in 75% of patients. Whole-blood assays showed normal IL-12 and IFN-γ production in all but one patient, who displayed impaired decreased response to IL-12. No candidate disease-causing mutations were detected in the exonic regions of the 14 genes. TS diagnosis in children remains challenging, and is based largely on imaging. Further investigations of TS in children are required to determine the role of genetic defects in pathways that may or may not be related to the IL-12/IFN-γ axis.
Toscana Virus NSs Protein Inhibits the Induction of Type I Interferon by Interacting with RIG-I
Gori-Savellini, Gianni; Valentini, Melissa
2013-01-01
Toscana virus (TOSV) is a phlebovirus, of the Bunyaviridae family, that is responsible for central nervous system (CNS) injury in humans. Previous data have shown that the TOSV NSs protein is a gamma interferon (IFN-β) antagonist when transiently overexpressed in mammalian cells, inhibiting IRF-3 induction (G. Gori Savellini, F. Weber, C. Terrosi, M. Habjan, B. Martorelli, and M. G. Cusi, J. Gen. Virol. 92:71–79, 2011). In this study, we investigated whether an upstream sensor, which has a role in the signaling cascade leading to the production of type I IFN, was involved. We found a significant decrease in RIG-I protein levels in cells overexpressing TOSV NSs, suggesting that the nonstructural protein interacts with RIG-I and targets it for proteasomal degradation. In fact, the MG-132 proteasome inhibitor was able to restore IFN-β promoter activation in cells expressing NSs, demonstrating the existence of an evasion mechanism based on inhibition of the RIG-I sensor. Furthermore, a C-terminal truncated NSs protein (ΔNSs), although able to interact with RIG-I, did not affect the RIG-I-mediated IFN-β promoter activation, suggesting that the NSs domains responsible for RIG-I-mediated signaling and interaction with RIG-I are mapped on different regions. These results contribute to identify a novel mechanism for bunyaviruses by which TOSV NSs counteracts the early IFN response. PMID:23552410
Toscana virus NSs protein inhibits the induction of type I interferon by interacting with RIG-I.
Gori-Savellini, Gianni; Valentini, Melissa; Cusi, Maria Grazia
2013-06-01
Toscana virus (TOSV) is a phlebovirus, of the Bunyaviridae family, that is responsible for central nervous system (CNS) injury in humans. Previous data have shown that the TOSV NSs protein is a gamma interferon (IFN-β) antagonist when transiently overexpressed in mammalian cells, inhibiting IRF-3 induction (G. Gori Savellini, F. Weber, C. Terrosi, M. Habjan, B. Martorelli, and M. G. Cusi, J. Gen. Virol. 92:71-79, 2011). In this study, we investigated whether an upstream sensor, which has a role in the signaling cascade leading to the production of type I IFN, was involved. We found a significant decrease in RIG-I protein levels in cells overexpressing TOSV NSs, suggesting that the nonstructural protein interacts with RIG-I and targets it for proteasomal degradation. In fact, the MG-132 proteasome inhibitor was able to restore IFN-β promoter activation in cells expressing NSs, demonstrating the existence of an evasion mechanism based on inhibition of the RIG-I sensor. Furthermore, a C-terminal truncated NSs protein (ΔNSs), although able to interact with RIG-I, did not affect the RIG-I-mediated IFN-β promoter activation, suggesting that the NSs domains responsible for RIG-I-mediated signaling and interaction with RIG-I are mapped on different regions. These results contribute to identify a novel mechanism for bunyaviruses by which TOSV NSs counteracts the early IFN response.
Viral Replication Complexes Are Targeted by LC3-Guided Interferon-Inducible GTPases.
Biering, Scott B; Choi, Jayoung; Halstrom, Rachel A; Brown, Hailey M; Beatty, Wandy L; Lee, Sanghyun; McCune, Broc T; Dominici, Erin; Williams, Lelia E; Orchard, Robert C; Wilen, Craig B; Yamamoto, Masahiro; Coers, Jörn; Taylor, Gregory A; Hwang, Seungmin
2017-07-12
All viruses with positive-sense RNA genomes replicate on membranous structures in the cytoplasm called replication complexes (RCs). RCs provide an advantageous microenvironment for viral replication, but it is unknown how the host immune system counteracts these structures. Here we show that interferon-gamma (IFNG) disrupts the RC of murine norovirus (MNV) via evolutionarily conserved autophagy proteins and the induction of IFN-inducible GTPases, which are known to destroy the membrane of vacuoles containing bacteria, protists, or fungi. The MNV RC was marked by the microtubule-associated-protein-1-light-chain-3 (LC3) conjugation system of autophagy and then targeted by immunity-related GTPases (IRGs) and guanylate-binding proteins (GBPs) upon their induction by IFNG. Further, the LC3 conjugation system and the IFN-inducible GTPases were necessary to inhibit MNV replication in mice and human cells. These data suggest that viral RCs can be marked and antagonized by a universal immune defense mechanism targeting diverse pathogens replicating in cytosolic membrane structures. Copyright © 2017 Elsevier Inc. All rights reserved.
USDA-ARS?s Scientific Manuscript database
Porcine reproductive and respiratory syndrome virus (PRRSV) inhibits synthesis of type I interferons (IFNs) in infected pigs and in cultured cells. Here we report that one PRRSV mutant A2MC2 induces type I IFNs in cultured cells and has no effect on IFN downstream signaling. The mutant isolate was p...
Kotla, Swathi; Gustin, Kurt E
2015-10-06
The type I interferon (IFN) response is a critical component of the innate immune response to infection by RNA viruses and is initiated via recognition of viral nucleic acids by RIG-like receptors (RLR). Engagement of these receptors in the cytoplasm initiates a signal transduction pathway leading to activation of the transcription factors NF-κB, ATF-2 and IRF-3 that coordinately upregulate transcription of type I IFN genes, such as that encoding IFN-β. In this study the impact of poliovirus infection on the type I interferon response has been examined. The type I IFN response was assessed by measuring IFN-β mRNA levels using qRT-PCR and normalizing to levels of β-actin mRNA. The status of host factors involved in activation of the type I IFN response was examined by immunoblot, immunofluorescence microcopy and qRT-PCR. The results show that poliovirus infection results in induction of very low levels of IFN-β mRNA despite clear activation of NF-κB and ATF-2. In contrast, analysis of IRF-3 revealed no transcriptional induction of an IRF-3-responsive promoter or homodimerization of IRF-3 indicating it is not activated in poliovirus-infected cells. Exposure of poliovirus-infected cells to poly(I:C) results in lower levels of IFN-β mRNA synthesis and IRF-3 activation compared to mock-infected cells. Analysis of MDA-5 and IPS-1 revealed that these components of the RLR pathway were largely intact at times when the type I IFN response was suppressed. Collectively, these results demonstrate that poliovirus infection actively suppresses the host type I interferon response by blocking activation of IRF-3 and suggests that this is not mediated by cleavage of MDA-5 or IPS-1.
Biesold, Susanne E.; Ritz, Daniel; Gloza-Rausch, Florian; Wollny, Robert; Drexler, Jan Felix; Corman, Victor M.; Kalko, Elisabeth K. V.; Oppong, Samuel; Drosten, Christian; Müller, Marcel A.
2011-01-01
Bats harbor several highly pathogenic zoonotic viruses including Rabies, Marburg, and henipaviruses, without overt clinical symptoms in the animals. It has been suspected that bats might have evolved particularly effective mechanisms to suppress viral replication. Here, we investigated interferon (IFN) response, -induction, -secretion and -signaling in epithelial-like cells of the relevant and abundant African fruit bat species, Eidolon helvum (E. helvum). Immortalized cell lines were generated; their potential to induce and react on IFN was confirmed, and biological assays were adapted to application in bat cell cultures, enabling comparison of landmark IFN properties with that of common mammalian cell lines. E. helvum cells were fully capable of reacting to viral and artificial IFN stimuli. E. helvum cells showed highest IFN mRNA induction, highly productive IFN protein secretion, and evidence of efficient IFN stimulated gene induction. In an Alphavirus infection model, O'nyong-nyong virus exhibited strong IFN induction but evaded the IFN response by translational rather than transcriptional shutoff, similar to other Alphavirus infections. These novel IFN-competent cell lines will allow comparative research on zoonotic, bat-borne viruses in order to model mechanisms of viral maintenance and emergence in bat reservoirs. PMID:22140523
Biesold, Susanne E; Ritz, Daniel; Gloza-Rausch, Florian; Wollny, Robert; Drexler, Jan Felix; Corman, Victor M; Kalko, Elisabeth K V; Oppong, Samuel; Drosten, Christian; Müller, Marcel A
2011-01-01
Bats harbor several highly pathogenic zoonotic viruses including Rabies, Marburg, and henipaviruses, without overt clinical symptoms in the animals. It has been suspected that bats might have evolved particularly effective mechanisms to suppress viral replication. Here, we investigated interferon (IFN) response, -induction, -secretion and -signaling in epithelial-like cells of the relevant and abundant African fruit bat species, Eidolon helvum (E. helvum). Immortalized cell lines were generated; their potential to induce and react on IFN was confirmed, and biological assays were adapted to application in bat cell cultures, enabling comparison of landmark IFN properties with that of common mammalian cell lines. E. helvum cells were fully capable of reacting to viral and artificial IFN stimuli. E. helvum cells showed highest IFN mRNA induction, highly productive IFN protein secretion, and evidence of efficient IFN stimulated gene induction. In an Alphavirus infection model, O'nyong-nyong virus exhibited strong IFN induction but evaded the IFN response by translational rather than transcriptional shutoff, similar to other Alphavirus infections. These novel IFN-competent cell lines will allow comparative research on zoonotic, bat-borne viruses in order to model mechanisms of viral maintenance and emergence in bat reservoirs.
Disruption of Type I Interferon Induction by HIV Infection of T Cells
Sanchez, David Jesse; Miranda, Daniel; Marsden, Matthew D.; Dizon, Thomas Michael A.; Bontemps, Johnny R.; Davila, Sergio J.; Del Mundo, Lara E.; Ha, Thai; Senaati, Ashkon; Zack, Jerome A.; Cheng, Genhong
2015-01-01
Our main objective of this study was to determine how Human Immunodeficiency Virus (HIV) avoids induction of the antiviral Type I Interferon (IFN) system. To limit viral infection, the innate immune system produces important antiviral cytokines such as the IFN. IFN set up a critical roadblock to virus infection by limiting further replication of a virus. Usually, IFN production is induced by the recognition of viral nucleic acids by innate immune receptors and subsequent downstream signaling. However, the importance of IFN in the defense against viruses has lead most pathogenic viruses to evolve strategies to inhibit host IFN induction or responses allowing for increased pathogenicity and persistence of the virus. While the adaptive immune responses to HIV infection have been extensively studied, less is known about the balance between induction and inhibition of innate immune defenses, including the antiviral IFN response, by HIV infection. Here we show that HIV infection of T cells does not induce significant IFN production even IFN I Interferon production. To explain this paradox, we screened HIV proteins and found that two HIV encoded proteins, Vpu and Nef, strongly antagonize IFN induction, with expression of these proteins leading to loss of expression of the innate immune viral RNA sensing adaptor protein, IPS-1 (IFN-β promoter stimulator-1). We hypothesize that with lower levels of IPS-1 present, infected cells are defective in mounting antiviral responses allowing HIV to replicate without the normal antiviral actions of the host IFN response. Using cell lines as well as primary human derived cells, we show that HIV targeting of IPS-1 is key to limiting IFN induction. These findings describe how HIV infection modulates IFN induction providing insight into the mechanisms by which HIV establishes infection and persistence in a host. PMID:26375588
Disruption of Type I Interferon Induction by HIV Infection of T Cells.
Sanchez, David Jesse; Miranda, Daniel; Marsden, Matthew D; Dizon, Thomas Michael A; Bontemps, Johnny R; Davila, Sergio J; Del Mundo, Lara E; Ha, Thai; Senaati, Ashkon; Zack, Jerome A; Cheng, Genhong
2015-01-01
Our main objective of this study was to determine how Human Immunodeficiency Virus (HIV) avoids induction of the antiviral Type I Interferon (IFN) system. To limit viral infection, the innate immune system produces important antiviral cytokines such as the IFN. IFN set up a critical roadblock to virus infection by limiting further replication of a virus. Usually, IFN production is induced by the recognition of viral nucleic acids by innate immune receptors and subsequent downstream signaling. However, the importance of IFN in the defense against viruses has lead most pathogenic viruses to evolve strategies to inhibit host IFN induction or responses allowing for increased pathogenicity and persistence of the virus. While the adaptive immune responses to HIV infection have been extensively studied, less is known about the balance between induction and inhibition of innate immune defenses, including the antiviral IFN response, by HIV infection. Here we show that HIV infection of T cells does not induce significant IFN production even IFN I Interferon production. To explain this paradox, we screened HIV proteins and found that two HIV encoded proteins, Vpu and Nef, strongly antagonize IFN induction, with expression of these proteins leading to loss of expression of the innate immune viral RNA sensing adaptor protein, IPS-1 (IFN-β promoter stimulator-1). We hypothesize that with lower levels of IPS-1 present, infected cells are defective in mounting antiviral responses allowing HIV to replicate without the normal antiviral actions of the host IFN response. Using cell lines as well as primary human derived cells, we show that HIV targeting of IPS-1 is key to limiting IFN induction. These findings describe how HIV infection modulates IFN induction providing insight into the mechanisms by which HIV establishes infection and persistence in a host.
Interferons alpha and gamma induce p53-dependent and p53-independent apoptosis, respectively.
Porta, Chiara; Hadj-Slimane, Reda; Nejmeddine, Mohamed; Pampin, Mathieu; Tovey, Michael G; Espert, Lucile; Alvarez, Sandra; Chelbi-Alix, Mounira K
2005-01-20
Type I interferon (IFN) enhances the transcription of the tumor suppressor gene p53. To elucidate the molecular mechanism mediating IFN-induced apoptosis, we analysed programmed cell death in response to type I (IFNalpha) or type II (IFNgamma) treatment in relation to p53 status. In two cell lines (MCF-7, SKNSH), IFNalpha, but not IFNgamma, enhanced apoptosis in a p53-dependent manner. Furthermore, only IFNalpha upregulated p53 as well as p53 target genes (Noxa, Mdm2 and CD95). The apoptotic response to IFNalpha decreased in the presence of ZB4, an anti-CD95 antibody, suggesting that CD95 is involved in this process. When p53 was inactivated by the E6 viral protein or the expression of a p53 mutant, IFNalpha-induced apoptosis and p53 target genes upregulation were abrogated. Altogether these results demonstrate that p53 plays a pivotal role in the IFNalpha-induced apoptotic response. IFNalpha-induced PML was unable to recruit p53 into nuclear bodies and its downregulation by siRNA did not alter CD95 expression. In contrast, IFNgamma-induced apoptosis is p53-independent. CD95 and IFN-regulatory factor 1 (IRF1) are directly upregulated by this cytokine. Apoptotic response to IFNgamma is decreased in the presence of ZB4 and strongly diminished by IRF1 siRNA, implicating both CD95 and IRF1 in IFNgamma-induced apoptotic response. Taken together, these results show that in two different cell lines, IFNalpha and IFNgamma, induce p53-dependent -independent apoptosis, respectively.
Conrady, Christopher D; Halford, William P; Carr, Daniel J J
2011-02-01
The mouse model of genital herpes relies on medoxyprogesterone treatment of female mice to render the vaginal lumen susceptible to inoculation with herpes simplex virus 2 (HSV-2). In the present study, we report that mice deficient in the A1 chain of the type I interferon receptor (CD118(-/-)) are susceptible to HSV-2 in the absence of medroxyprogesterone preconditioning. In the absence of hormone pretreatment, 2,000 PFU of a clinical isolate of HSV-2 was sufficient to establish a productive infection in the vagina of 75% ± 17% and in the spinal cord of 71% ± 14% of CD118(-/-) mice, whereas the same dose of HSV-2 replicated to detectable levels in only 13% ± 13% of vaginal samples and 0% of spinal cord samples from wild-type mice, as determined at day 5 postinfection. The susceptibility to HSV-2 infection in the CD118(-/-) mice was associated with a significant reduction in the infiltration of HSV-specific cytotoxic T lymphocytes into the vaginal tissue, the local production of gamma interferon (IFN-γ), and the expression of T cell-recruiting chemokines CCL5, CXCL9, and CXCL10. Collectively, the results underscore the significant contribution of type I IFNs in resistance to genital HSV-2 infection.
USDA-ARS?s Scientific Manuscript database
Type I interferons (IFNs) are critical in animal antiviral regulation. IFN-mediated signaling regulates hundreds of genes that are directly associated with antiviral, immune and other physiological responses. The signaling pathway mediated by mechanistic target of rapamycin (mTOR), a serine/threonin...
de Alencar, Bruna C. G.; Persechini, Pedro M.; Haolla, Filipe A.; de Oliveira, Gabriel; Silverio, Jaline C.; Lannes-Vieira, Joseli; Machado, Alexandre V.; Gazzinelli, Ricardo T.; Bruna-Romero, Oscar; Rodrigues, Mauricio M.
2009-01-01
A heterologous prime-boost strategy using plasmid DNA, followed by replication-defective recombinant adenovirus 5, is being proposed as a powerful way to elicit CD4+ and CD8+ T-cell-mediated protective immunity against intracellular pathogens. We confirmed this concept and furthered existing research by providing evidence that the heterologous prime-boost regimen using the gene encoding amastigote surface protein 2 elicited CD4+ and CD8+ T-cell-mediated protective immunity (reduction of acute parasitemia and prolonged survival) against experimental infection with Trypanosoma cruzi. Protective immunity correlated with the presence of in vivo antigen-specific cytotoxic activity prior to challenge. Based on this, our second goal was to determine the outcome of infection after heterologous prime-boost immunization of perforin-deficient mice. These mice were highly susceptible to infection. A detailed analysis of the cell-mediated immune responses in immunized perforin-deficient mice showed an impaired gamma interferon (IFN-γ) secretion by immune spleen cells upon restimulation in vitro with soluble recombinant antigen. In spite of a normal numeric expansion, specific CD8+ T cells presented several functional defects detected in vivo (cytotoxicity) and in vitro (simultaneous expression of CD107a/IFN-γ or IFN-γ/tumor necrosis factor alpha) paralleled by a decreased expression of CD44 and KLRG-1. Our final goal was to determine the importance of IFN-γ in the presence of highly cytotoxic T cells. Vaccinated IFN-γ-deficient mice developed highly cytotoxic cells but failed to develop any protective immunity. Our study thus demonstrated a role for perforin and IFN-γ in a number of T-cell-mediated effector functions and in the antiparasitic immunity generated by a heterologous plasmid DNA prime-adenovirus boost vaccination strategy. PMID:19651871
Leal, Rodolfo Oliveira; Gil, Solange
2016-10-27
Type I interferons (IFNs) are well-known cytokines that, among their main functions, are key components of the host immune response against viral infections. Due to its immune modulation properties, they are commonly used in the therapeutic approach of various retroviral infections, namely human immunodeficiency virus (HIV) and feline immunodeficiency virus (FIV). In HIV infection, it has been shown that IFN therapy limits early viral replication, particularly useful on post-exposure prophylaxis. In veterinary medicine, recombinant feline interferon omega (rFeIFN-ω) was the first interferon licensed for use in cats. Several studies have recently shown that this compound seems to stimulate the innate immunity, decreasing clinical signs and co-infections in naturally FIV-infected cats. More than summarizing the main conclusions about rFeIFN-ω in cats, this review emphasizes the immune-modulation properties of IFN therapy, opening new perspectives for its use in retroviral infections. Either in FIV-infected cats or in HIV individuals, type I IFNs seem to induce an innate immune-modulation and should not be overlooked as a therapeutic option in retroviral infections.
Interferon-λ: immune functions at barrier surfaces and beyond
Lazear, Helen M.; Nice, Timothy J.; Diamond, Michael S.
2015-01-01
SUMMARY When type III interferon (IFN-λ; also known as interleukin-28 (IL-28) and IL-29) was discovered in 2003, its antiviral function was expected to be analogous to the type I IFNs (IFN-α and IFN-β), via the induction of IFN-stimulated genes (ISGs). While IFN-λ stimulates expression of antiviral ISGs preferentially in cells of epithelial origin, recent studies have defined additional antiviral mechanisms in other cell types and tissues. Models of viral infection using mice lacking IFN-λ signaling and single nucleotide polymorphism (SNP) associations with human disease have expanded our understanding of the contribution of IFN-λ to the antiviral response at anatomic barriers and the immune response beyond these barriers. In this review, we highlight recent insights into the functions of IFN-λ, including its ability to restrict virus spread into the brain and to clear chronic viral infections in the gastrointestinal tract. We also discuss how IFN-λ modulates innate and adaptive immunity, autoimmunity, and tumor progression and its possible therapeutic applications in human disease. PMID:26200010
Kavanagh, David; Jury, Alexa; Williams, Jac; Scolding, Neil; Bellamy, Chris; Gunther, Claudia; Ritchie, Diane; Gale, Daniel P.; Kanwar, Yashpal S.; Challis, Rachel; Buist, Holly; Overell, James; Weller, Belinda; Flossmann, Oliver; Blunden, Mark; Meyer, Eric P.; Krucker, Thomas; Evans, Stephen J. W.; Campbell, Iain L.; Jackson, Andrew P.; Chandran, Siddharthan
2016-01-01
Many drugs have been reported to cause thrombotic microangiopathy (TMA), yet evidence supporting a direct association is often weak. In particular, TMA has been reported in association with recombinant type I interferon (IFN) therapies, with recent concern regarding the use of IFN in multiple sclerosis patients. However, a causal association has yet to be demonstrated. Here, we adopt a combined clinical and experimental approach to provide evidence of such an association between type I IFN and TMA. We show that the clinical phenotype of cases referred to a national center is uniformly consistent with a direct dose-dependent drug-induced TMA. We then show that dose-dependent microvascular disease is seen in a transgenic mouse model of IFN toxicity. This includes specific microvascular pathological changes seen in patient biopsies and is dependent on transcriptional activation of the IFN response through the type I interferon α/β receptor (IFNAR). Together our clinical and experimental findings provide evidence of a causal link between type I IFN and TMA. As such, recombinant type I IFN therapies should be stopped at the earliest stage in patients who develop this complication, with implications for risk mitigation. PMID:27663672
Strain differences in the somnogenic effects of interferon inducers in mice.
Toth, L A
1996-12-01
Increased slow-wave sleep accompanies influenza infection in C57BL/6 mice but not BALB/c mice. These strains of mice possess different alleles of the genetic lucus If-1, which codes for high (If-1h; C57BL/6) and low (If-1(1); BALB/c) production of interferon (IFN), a putative sleep-inducing cytokine. To evaluate the contribution of the If-1 gene to differences in murine sleep propensity, sleep patterns were evaluated in mice treated with the IFN inducers polyinosinic:polycytidilic acid (pIC) or Newcastle disease virus (NDV), with influenza virus, or with murine interferon (IFN-alpha) or IFN-alpha/beta. As compared with baseline values, C57BL/6 mice exhibited increased slow-wave sleep after all three challenges, but BALB/c mice did not. Congenic B6.C-H28c mice, which bear the BALB/c allele for low IFN production on the C57BL/6 genetic background, showed enhanced slow-wave sleep after influenza infection but not after NDV. Exogenous IFN did not enhance slow-wave sleep in either C57BL/6 or BALB/c mice. These data suggest that the If-1 allele may influence the somnogenic responsiveness of mice under some conditions but that additional mechanisms may contribute to sleep enhancement during infectious disease.
Ahn, H J; Tomura, M; Yu, W G; Iwasaki, M; Park, W R; Hamaoka, T; Fujiwara, H
1998-12-01
While IL-12 is known to activate JAK2 and TYK2 and induce the phosphorylation of STAT4 and STAT3, little is known regarding how the activation of these signaling molecules is related to the biologic effects of IL-12. Using an IL-12-responsive T cell clone (2D6), we investigated their requirements for proliferation and IFN-gamma production of 2D6 cells. 2D6 cells could be maintained with either IL-12 or IL-2. 2D6 lines maintained with IL-12 (2D6(IL-12)) or IL-2 (2D6(IL-2)) exhibited comparable levels of proliferation, but produced large or only small amounts of IFN-gamma, respectively, when restimulated with IL-12 after starvation of either cytokine. 2D6(IL-12) induced TYK2 and STAT4 phosphorylation. In contrast, their phosphorylation was marginally induced in 2D6(IL-2). The reduced STAT4 phosphorylation was due to a progressive decrease in the amount of STAT4 protein along with the passages in IL-2-containing medium. 2D6(IL-12) and 2D6(IL-2) similarly proliferating in response to IL-12 induced comparable levels of JAK2 activation and STAT5 phosphorylation. JAK2 was associated with STAT5, and IL-12-induced STAT5 phosphorylation was elicited in the absence of JAK3 activation. These results indicate that IL-12 has the capacity to induce/maintain STAT4 and STAT5 proteins, and that TYK2 and JAK2 activation correlate with STAT4 phosphorylation/IFN-gamma induction and STAT5 phosphorylation/cellular proliferation, respectively.
Kim, Bu Kyung; Choi, Young Sik; Park, Yo Han; Lee, Sang Uk
2011-12-01
Interferon-induced thyroiditis (IIT) is a major clinical problem for patients receiving interferon-alpha (IFN-α) therapy. But, destructive thyroiditis followed by Graves' disease associated with IFN-α therapy is very rarely reported. Herein, we report a rare case of pegylated IFN-α (pegIFN-α) induced destructive thyroiditis followed by Graves' disease in a patient with HCV infection. A 31-yr-old woman suffered from chronic active hepatitis C and was treated with pegIFN-α and ribavirin for 12 months. Results of a thyroid function test and autoantibody levels were normal before IFN-α therapy was initiated. Destructive thyrotoxicosis appeared seven months after the initiation of IFN-α therapy, followed by Graves' thyrotoxicosis two months after the cessation of therapy. The diagnoses of destructive thyroiditis and Graves' disease were confirmed by the presence of TSH receptor antibodies in addition to Tc-99m scintigraphy findings. The patient's antithyroglobulin antibody titer increased gradually during IFN-α therapy and remained weakly positive after IFN-α therapy was discontinued.
Penski, Nicola; Härtle, Sonja; Rubbenstroth, Dennis; Krohmann, Carsten; Ruggli, Nicolas; Schusser, Benjamin; Pfann, Michael; Reuter, Antje; Gohrbandt, Sandra; Hundt, Jana; Veits, Jutta; Breithaupt, Angele; Kochs, Georg; Stech, Jürgen; Summerfield, Artur; Vahlenkamp, Thomas; Kaspers, Bernd; Staeheli, Peter
2011-01-01
From infection studies with cultured chicken cells and experimental mammalian hosts, it is well known that influenza viruses use the nonstructural protein 1 (NS1) to suppress the synthesis of interferon (IFN). However, our current knowledge regarding the in vivo role of virus-encoded NS1 in chickens is much more limited. Here, we report that highly pathogenic avian influenza viruses of subtypes H5N1 and H7N7 lacking fully functional NS1 genes were attenuated in 5-week-old chickens. Surprisingly, in diseased birds infected with NS1 mutants, the IFN levels were not higher than in diseased birds infected with wild-type virus, suggesting that NS1 cannot suppress IFN gene expression in at least one cell population of infected chickens that produces large amounts of the cytokine in vivo. To address the question of why influenza viruses are highly pathogenic in chickens although they strongly activate the innate immune system, we determined whether recombinant chicken alpha interferon (IFN-α) can inhibit the growth of highly pathogenic avian influenza viruses in cultured chicken cells and whether it can ameliorate virus-induced disease in 5-week-old birds. We found that IFN treatment failed to confer substantial protection against challenge with highly pathogenic viruses, although it was effective against viruses with low pathogenic potential. Taken together, our data demonstrate that preventing the synthesis of IFN is not the primary role of the viral NS1 protein during infection of chickens. Our results further suggest that virus-induced IFN does not contribute substantially to resistance of chickens against highly pathogenic influenza viruses. PMID:21613402
Johnson, Chase L.; Zoon, Kathryn C.
2015-01-01
Interferons (IFNs) play an important role in immune surveillance of tumors; however, their efficacy in the treatment of malignancies has been limited. Monocytes are mononuclear phagocytes that are critical to the generation of an innate immune response to tumors. The authors and others have shown that treatment of tumor cell lines in vitro and in vivo with human monocytes primed with type I and type II IFNs results in killing. We now expand on this work, in an extended panel of ovarian cancer cell lines. In this study, we hypothesized that there would be variable sensitivity amongst cell lines to the killing properties of monocytes and IFNs. To this end, we explored the interactions of IFN primed monocytes in conjunction with the standard of therapy for ovarian cancer, taxane, and platinum-based chemotherapeutics. Using 6 ovarian cancer cell lines, we demonstrated that there is variation from cell line to cell line in the ability of IFN-α2a and IFN-γ primed monocytes to synergistically kill target tumor cells, and further, there is an additive killing effect when target cells are treated with both IFN primed monocytes and chemotherapy. PMID:25068849
Dhar, Jayeeta; Barik, Sailen
2016-12-01
Pneumonia Virus of Mice (PVM) is the only virus that shares the Pneumovirus genus of the Paramyxoviridae family with Respiratory Syncytial Virus (RSV). A deadly mouse pathogen, PVM has the potential to serve as a robust animal model of RSV infection, since human RSV does not fully replicate the human pathology in mice. Like RSV, PVM also encodes two nonstructural proteins that have been implicated to suppress the IFN pathway, but surprisingly, they exhibit no sequence similarity with their RSV equivalents. The molecular mechanism of PVM NS function, therefore, remains unknown. Here, we show that recombinant PVM NS proteins degrade the mouse counterparts of the IFN pathway components. Proteasomal degradation appears to be mediated by ubiquitination promoted by PVM NS proteins. Interestingly, NS proteins of PVM lowered the levels of several ISG (IFN-stimulated gene) proteins as well. These results provide a molecular foundation for the mechanisms by which PVM efficiently subverts the IFN response of the murine cell. They also reveal that in spite of their high sequence dissimilarity, the two pneumoviral NS proteins are functionally and mechanistically similar.
Control of HIV infection by IFN-α: implications for latency and a cure.
Bourke, Nollaig M; Napoletano, Silvia; Bannan, Ciaran; Ahmed, Suaad; Bergin, Colm; McKnight, Áine; Stevenson, Nigel J
2018-03-01
Viral infections, including HIV, trigger the production of type I interferons (IFNs), which in turn, activate a signalling cascade that ultimately culminates with the expression of anti-viral proteins. Mounting evidence suggests that type I IFNs, in particular IFN-α, play a pivotal role in limiting acute HIV infection. Highly active anti-retroviral treatment reduces viral load and increases life expectancy in HIV positive patients; however, it fails to fully eliminate latent HIV reservoirs. To revisit HIV as a curable disease, this article reviews a body of literature that highlights type I IFNs as mediators in the control of HIV infection, with particular focus on the anti-HIV restriction factors induced and/or activated by IFN-α. In addition, we discuss the relevance of type I IFN treatment in the context of HIV latency reversal, novel therapeutic intervention strategies and the potential for full HIV clearance.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Dang; Fang, Liurong; Luo, Rui
2010-08-13
Research highlights: {yields} FMDV L{sup pro} inhibits poly(I:C)-induced IFN-{alpha}1/{beta} mRNA expression. {yields} L{sup pro} inhibits MDA5-mediated activation of the IFN-{alpha}1/{beta} promoter. {yields} L{sup pro} significantly reduced the transcription of multiple IRF-responsive genes. {yields} L{sup pro} inhibits IFN-{alpha}1/{beta} promoter activation by decreasing IRF-3/7 in protein levels. {yields} The ability to process eIF-4G of L{sup pro} is not necessary to inhibit IFN-{alpha}1/{beta} activation. -- Abstract: The leader proteinase (L{sup pro}) of foot-and-mouth disease virus (FMDV) has been identified as an interferon-{beta} (IFN-{beta}) antagonist that disrupts the integrity of transcription factor nuclear factor {kappa}B (NF-{kappa}B). In this study, we showed that the reductionmore » of double stranded RNA (dsRNA)-induced IFN-{alpha}1/{beta} expression caused by L{sup pro} was also associated with a decrease of interferon regulatory factor 3/7 (IRF-3/7) in protein levels, two critical transcription factors for activation of IFN-{alpha}/{beta}. Furthermore, overexpression of L{sup pro} significantly reduced the transcription of multiple IRF-responsive genes including 2',5'-OAS, ISG54, IP-10, and RANTES. Screening L{sup pro} mutants indicated that the ability to process eIF-4G of L{sup pro} is not required for suppressing dsRNA-induced activation of the IFN-{alpha}1/{beta} promoter and decreasing IRF-3/7 expression. Taken together, our results demonstrate that, in addition to disrupting NF-{kappa}B, L{sup pro} also decreases IRF-3/7 expression to suppress dsRNA-induced type I IFN production, suggesting multiple strategies used by FMDV to counteract the immune response to viral infection.« less
Functional Characterization of Canine Interferon-Lambda
Fan, Wenhui; Xu, Lei; Ren, Liqian; Qu, Hongren; Li, Jing; Liang, Jingjing; Liu, Wenjun
2014-01-01
In this study, we provide the first comprehensive annotation of canine interferon-λ (CaIFN-λ, type III IFN). Phylogenetic analysis based on genomic sequences indicated that CaIFN-λ is located in the same branch with Swine IFN-λ1 (SwIFN-λ), Bat IFN-λ1 (BaIFN-λ), and human IFN-λ1 (HuIFN-λ1). CaIFN-λ was cloned, expressed in Escherichia coli, and purified to further investigate the biological activity in vitro. The recombinant CaIFN-λ (rCaIFN-λ) displayed potent antiviral activity on both homologous and heterologous animal cells in terms of inhibiting the replication of the New Jersey serotype of vesicular stomatitis virus (VSV), canine parvovirus, and influenza virus A/WSN/33 (H1N1), respectively. In addition, we also found that rCaIFN-λ exhibits a significant antiproliferative response against A72 canine tumor cells and MDCK cells in a dose-dependent manner. Furthermore, CaIFN-λ activated the JAK-STAT signaling pathway. To evaluate the expression of CaIFN-λ induced by virus and the expression of IFN-stimulated genes (ISGs) induced by rCaIFN-λ in the MDCK cells, we measured the relative mRNA level of CaIFN-λ and ISGs (ISG15, Mx1, and 2′5′-OAS) by quantitative real-time PCR and found that the mRNA level of CaIFN-λ and the ISGs significantly increased after treating the MDCK cells with viruses and rCaIFN-λ protein, respectively. Finally, to evaluate the binding activity of rCaIFN-λ to its receptor, we expressed the extracellular domain of the canine IFN-λ receptor 1 (CaIFN-λR1-EC) and determined the binding activity via ELISA. Our results demonstrated that rCaIFN-λ bound tightly to recombinant CaIFN-λR1-EC (rCaIFN-λR1-EC). PMID:24950142
Yamauchi, Shota; Takeuchi, Kenji; Chihara, Kazuyasu; Honjoh, Chisato; Kato, Yuji; Yoshiki, Hatsumi; Hotta, Hak; Sada, Kiyonao
2016-12-08
Interferon-α (IFN-α) and IFN-λ are structurally distinct cytokines that bind to different receptors, but induce expression of similar sets of genes through Janus kinase (JAK)-signal transducers and activators of transcription (STAT) pathways. The difference between IFN-α and IFN-λ signaling remains poorly understood. Here, using the CRISPR/Cas9 system, we examine the role of STAT1 and STAT2 in the inhibition of hepatitis C virus (HCV) replication by IFN-α and IFN-λ. Treatment with IFN-α increases expression of IFN-stimulated genes (ISGs) such as double-stranded RNA-activated protein kinase (PKR) and decreases viral RNA and protein levels in HCV-infected Huh-7.5 human hepatoma cells. These responses are only partially attenuated by knockout of STAT1 but are abolished by knockout of STAT2. In contrast, the inhibition of HCV replication by IFN-λ is abolished by knockout of STAT1 or STAT2. Microarray analysis reveals that IFN-α but not IFN-λ can induce expression of the majority of ISGs in STAT1 knockout cells. These findings suggest that IFN-α can inhibit HCV replication through a STAT2-dependent but STAT1-independent pathway, whereas IFN-λ induces ISG expression and inhibits HCV replication exclusively through a STAT1- and STAT2-dependent pathway.
Yamauchi, Shota; Takeuchi, Kenji; Chihara, Kazuyasu; Honjoh, Chisato; Kato, Yuji; Yoshiki, Hatsumi; Hotta, Hak; Sada, Kiyonao
2016-01-01
Interferon-α (IFN-α) and IFN-λ are structurally distinct cytokines that bind to different receptors, but induce expression of similar sets of genes through Janus kinase (JAK)-signal transducers and activators of transcription (STAT) pathways. The difference between IFN-α and IFN-λ signaling remains poorly understood. Here, using the CRISPR/Cas9 system, we examine the role of STAT1 and STAT2 in the inhibition of hepatitis C virus (HCV) replication by IFN-α and IFN-λ. Treatment with IFN-α increases expression of IFN-stimulated genes (ISGs) such as double-stranded RNA-activated protein kinase (PKR) and decreases viral RNA and protein levels in HCV-infected Huh-7.5 human hepatoma cells. These responses are only partially attenuated by knockout of STAT1 but are abolished by knockout of STAT2. In contrast, the inhibition of HCV replication by IFN-λ is abolished by knockout of STAT1 or STAT2. Microarray analysis reveals that IFN-α but not IFN-λ can induce expression of the majority of ISGs in STAT1 knockout cells. These findings suggest that IFN-α can inhibit HCV replication through a STAT2-dependent but STAT1-independent pathway, whereas IFN-λ induces ISG expression and inhibits HCV replication exclusively through a STAT1- and STAT2-dependent pathway. PMID:27929099
Ziegler, Susanne M; Beisel, Claudia; Sutter, Kathrin; Griesbeck, Morgane; Hildebrandt, Heike; Hagen, Sven H; Dittmer, Ulf; Altfeld, Marcus
2017-02-01
The outcomes of many diseases differ between women and men, with women experiencing a higher incidence and more severe pathogenesis of autoimmune and some infectious diseases. It has been suggested that this is partially due to activation of plasmacytoid dendritic cells (pDCs), the main producers of interferon (IFN)-α, in response to toll-like receptor (TLR)7 stimulation. We investigated the induction of type I IFN (IFN-I) subtypes upon TLR7 stimulation on isolated pDCs. Our data revealed a sex-specific differential expression of IFN-Is, with pDCs from females showing a significantly higher mRNA expression of all 13 IFN-α subtypes. In addition, pDCs from females had higher levels of IFN-β mRNA after stimulation, indicating that sex differences in IFN-I production by pDCs were mediated by a signaling event upstream of the first loop of IFN-I mRNA transcription. Furthermore, the surface expression levels of the common IFN-α/β receptor subunit 2 were significantly higher on pDCs from females in comparison to males. These data indicate that higher IFN-α production is already established at the mRNA level and propose a contribution of higher IFN-α/β receptor 2 expression on pDCs to the immunological differences in IFN-I production observed between females and males. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Interferon-Lambda: A Potent Regulator of Intestinal Viral Infections.
Lee, Sanghyun; Baldridge, Megan T
2017-01-01
Interferon-lambda (IFN-λ) is a recently described cytokine found to be of critical importance in innate immune regulation of intestinal viruses. Endogenous IFN-λ has potent antiviral effects and has been shown to control multiple intestinal viruses and may represent a factor that contributes to human variability in response to infection. Importantly, recombinant IFN-λ has therapeutic potential against enteric viral infections, many of which lack other effective treatments. In this mini-review, we describe recent advances regarding IFN-λ-mediated regulation of enteric viruses with important clinical relevance including rotavirus, reovirus, and norovirus. We also briefly discuss IFN-λ interactions with other cytokines important in the intestine, and how IFN-λ may play a role in regulation of intestinal viruses by the commensal microbiome. Finally, we indicate currently outstanding questions regarding IFN-λ control of enteric infections that remain to be explored to enhance our understanding of this important immune molecule.
Interferon-Lambda: A Potent Regulator of Intestinal Viral Infections
Lee, Sanghyun; Baldridge, Megan T.
2017-01-01
Interferon-lambda (IFN-λ) is a recently described cytokine found to be of critical importance in innate immune regulation of intestinal viruses. Endogenous IFN-λ has potent antiviral effects and has been shown to control multiple intestinal viruses and may represent a factor that contributes to human variability in response to infection. Importantly, recombinant IFN-λ has therapeutic potential against enteric viral infections, many of which lack other effective treatments. In this mini-review, we describe recent advances regarding IFN-λ-mediated regulation of enteric viruses with important clinical relevance including rotavirus, reovirus, and norovirus. We also briefly discuss IFN-λ interactions with other cytokines important in the intestine, and how IFN-λ may play a role in regulation of intestinal viruses by the commensal microbiome. Finally, we indicate currently outstanding questions regarding IFN-λ control of enteric infections that remain to be explored to enhance our understanding of this important immune molecule. PMID:28713375
Plasmacytoid predendritic cells initiate psoriasis through interferon-α production
Nestle, Frank O.; Conrad, Curdin; Tun-Kyi, Adrian; Homey, Bernhard; Gombert, Michael; Boyman, Onur; Burg, Günter; Liu, Yong-Jun; Gilliet, Michel
2005-01-01
Psoriasis is one of the most common T cell–mediated autoimmune diseases in humans. Although a role for the innate immune system in driving the autoimmune T cell cascade has been proposed, its nature remains elusive. We show that plasmacytoid predendritic cells (PDCs), the natural interferon (IFN)-α–producing cells, infiltrate the skin of psoriatic patients and become activated to produce IFN-α early during disease formation. In a xenograft model of human psoriasis, we demonstrate that blocking IFN-α signaling or inhibiting the ability of PDCs to produce IFN-α prevented the T cell–dependent development of psoriasis. Furthermore, IFN-α reconstitution experiments demonstrated that PDC-derived IFN-α is essential to drive the development of psoriasis in vivo. These findings uncover a novel innate immune pathway for triggering a common human autoimmune disease and suggest that PDCs and PDC-derived IFN-α represent potential early targets for the treatment of psoriasis. PMID:15998792
Evidence for the involvement of type I interferon in pulmonary arterial hypertension.
George, Peter M; Oliver, Eduardo; Dorfmuller, Peter; Dubois, Olivier D; Reed, Daniel M; Kirkby, Nicholas S; Mohamed, Nura A; Perros, Frederic; Antigny, Fabrice; Fadel, Elie; Schreiber, Benjamin E; Holmes, Alan M; Southwood, Mark; Hagan, Guy; Wort, Stephen J; Bartlett, Nathan; Morrell, Nicholas W; Coghlan, John G; Humbert, Marc; Zhao, Lan; Mitchell, Jane A
2014-02-14
Evidence is increasing of a link between interferon (IFN) and pulmonary arterial hypertension (PAH). Conditions with chronically elevated endogenous IFNs such as systemic sclerosis are strongly associated with PAH. Furthermore, therapeutic use of type I IFN is associated with PAH. This was recognized at the 2013 World Symposium on Pulmonary Hypertension where the urgent need for research into this was highlighted. To explore the role of type I IFN in PAH. Cells were cultured using standard approaches. Cytokines were measured by ELISA. Gene and protein expression were measured using reverse transcriptase polymerase chain reaction, Western blotting, and immunohistochemistry. The role of type I IFN in PAH in vivo was determined using type I IFN receptor knockout (IFNAR1(-/-)) mice. Human lung cells responded to types I and II but not III IFN correlating with relevant receptor expression. Type I, II, and III IFN levels were elevated in serum of patients with systemic sclerosis associated PAH. Serum interferon γ inducible protein 10 (IP10; CXCL10) and endothelin 1 were raised and strongly correlated together. IP10 correlated positively with pulmonary hemodynamics and serum brain natriuretic peptide and negatively with 6-minute walk test and cardiac index. Endothelial cells grown out of the blood of PAH patients were more sensitive to the effects of type I IFN than cells from healthy donors. PAH lung demonstrated increased IFNAR1 protein levels. IFNAR1(-/-) mice were protected from the effects of hypoxia on the right heart, vascular remodeling, and raised serum endothelin 1 levels. These data indicate that type I IFN, via an action of IFNAR1, mediates PAH.
El Eit, Rabab M; Iskandarani, Ahmad N; Saliba, Jessica L; Jabbour, Mark N; Mahfouz, Rami A; Bitar, Nizar M A; Ayoubi, Hanadi R El; Zaatari, Ghazi S; Mahon, Francois-Xavier; De Thé, Hugues B; Bazarbachi, Ali A; Nasr, Rihab R
2014-02-15
Imatinib is the standard of care in chronic meloid leukemia (CML) therapy. However, imatinib is not curative since most patients who discontinue therapy relapse indicating that leukemia initiating cells (LIC) are resistant. Interferon alpha (IFN) induces hematologic and cytogenetic remissions and interestingly, improved outcome was reported with the combination of interferon and imatinib. Arsenic trioxide was suggested to decrease CML LIC. We investigated the effects of arsenic and IFN on human CML cell lines or primary cells and the bone marrow retroviral transduction/transplantation murine CML model. In vitro, the combination of arsenic and IFN inhibited proliferation and activated apoptosis. Importantly, arsenic and IFN synergistically reduced the clonogenic activity of primary bone marrow cells derived from CML patients. Finally, in vivo, combined interferon and arsenic treatment, but not single agents, prolonged the survival of primary CML mice. Importantly, the combination severely impaired engraftment into untreated secondary recipients, with some recipients never developing the disease, demonstrating a dramatic decrease in CML LIC activity. Arsenic/IFN effect on CML LIC activity was significantly superior to that of imatinib. These results support further exploration of this combination, alone or with imatinib aiming at achieving CML eradication rather than long-term disease control. © 2013 UICC.
Interferons and viruses: an evolutionary arms race of molecular interactions.
Hoffmann, Hans-Heinrich; Schneider, William M; Rice, Charles M
2015-03-01
Over half a century has passed since interferons (IFNs) were discovered and shown to inhibit virus infection in cultured cells. Since then, researchers have steadily brought to light the molecular details of IFN signaling, catalogued their pleiotropic effects on cells, and harnessed their therapeutic potential for a variety of maladies. While advances have been plentiful, several fundamental questions have yet to be answered and much complexity remains to be unraveled. We explore the current knowledge surrounding four main questions: are type I IFN subtypes differentially produced in response to distinct pathogens? How are IFN subtypes distinguished by cells? What are the mechanisms and consequences of viral antagonism? Lastly, how can the IFN response be harnessed to improve vaccine efficacy? Copyright © 2015 Elsevier Ltd. All rights reserved.
Interferons and viruses: an evolutionary arms race of molecular interactions
Hoffmann, Hans-Heinrich; Schneider, William M.; Rice, Charles M.
2015-01-01
Over half a century has passed since interferons (IFNs) were discovered and shown to inhibit virus infection in cultured cells. Since then, researchers have steadily brought to light the molecular details of IFN signaling, catalogued their pleiotropic effects on cells, and harnessed their therapeutic potential for a variety of maladies. While advances have been plentiful, several fundamental questions have yet to be answered and much complexity remains to be unraveled. We explore the current knowledge surrounding four main questions: are type I IFN subtypes differentially produced in response to distinct pathogens? How are IFN subtypes distinguished by cells? What are the mechanisms and consequences of viral antagonism? Lastly, how can the IFN response be harnessed to improve vaccine efficacy? PMID:25704559
Interferon system in women with genital papillomavirus infection receiving immunomodulatory therapy.
Rogovskaya, S I; Zhdanov, A V; Loginova, N S; Faizullin, L Z; Prilepskaya, V N; Van'ko, L V; Sukhikh, G T
2002-11-01
The interferon system was studied in women with genital papillomavirus infection. In most patients the interferon system was activated, while the ability of lymphocytes to respond to inductors decreased. Laserotherapy and immunomodulatory therapy with larifan, ridostin, and viferon for 1 month normalized blood interferon concentration (39.4% patients) and interferon-gamma production by lymphocytes in response to inductors (87.9% patients). After laser monotherapy these parameters returned to normal only in 13.2 and 7.6% patients, respectively. Correlation and regression analyses showed that changes in the interferon system were synchronized after immunomodulatory therapy. These data indicate that immunomodulatory therapy produces a complex effect on the interferon system. Measurements of blood interferon level can be used to predict the effect of further treatment with interferon-gamma inductors.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lowe, Xiu R.; Marchetti, Francesco; Lu, Xiaochen
2009-03-03
We previously showed that the expression of troponin T1 (Tnnt 1) was induced in the central nervous system (CNS) of adultmice 30 min after treatment with ketamine, a glutamate N-methyl-D-aspartic acid (NMDA) receptor antagonist. We hypothesized that Tnnt 1 expression may be an early molecular biomarker of stress response in the CNS of mice. To further evaluate this hypothesis, we investigated the regional expression of Tnnt 1 in the mouse brain using RNA in situ hybridization 4 h after systemic exposure to interferon-a (IFN-a) and gamma ionizing radiation, both of which have be associated with wide ranges of neuropsychiatric complications.more » Adult B6C3F1 male mice were treated with either human IFN-a (a single i.p. injection at 1 x 105 IU/kg) or whole body gamma-radiation (10 cGy or 2 Gy). Patterns of Tnnt 1 transcript expression were compared in various CNS regions after IFN-a, radiation and ketamine treatments (previous study). Tnnt 1 expression was consistently induced in pyramidal neurons of cerebral cortex and hippocampus after all treatment regimens including 10 cGy of ionizing radiation. Regional expression of Tnnt 1 was induced in Purkinje cells of cerebellum after ionizing radiation and ketamine treatment; but not after IFN-a treatment. None of the three treatments induced Tnnt 1 expression in glial cells. The patterns of Tnnt 1 expression in pyramidal neurons of cerebral cortex andhippocampus, which are both known to play important roles in cognitive function, memory and emotion, suggest that the expression of Tnnt 1 may be an early molecular biomarker of induced CNS stress.« less
Gonçales, Fernando L; Moma, Camila A; Vigani, Aline G; Angerami, Adriana F C F; Gonçales, Eduardo S L; Tozzo, Raquel; Pavan, Maria H P; Gonçales, Neiva S L
2010-07-20
More than 50% of hepatitis C viruses (HCV)-infected patients do not respond to the classical Interferon (IFN)/Ribavirin (RBV) combination therapy. The aim of this study was to evaluate the efficacy of retreatment with Peg-Interferon alpha-2b (PEG-IFN alpha-2b) plus RBV, in patients with HCV, genotypes 1 or 3, who were non-responders to the previous standard treatment with IFN/RBV. In the period 2005-2007, a total of 238 HCV chronic patients were non-responders to previous treatment with IFN plus RBV. Of these 130 agreed to be retreated with PEG-IFN alpha-2b and participated in this evaluation (90 with genotype 1 HCV and 40 with genotype 3 HCV). Patients were retreated at assisted IFN application hubs in compliance with the country's public health system rules. They received subcutaneous PEG-IFN alpha-2b, 1.5 microg, once weekly, associated with RBV, through the oral route, with doses determined according to weight (1,000 mg if weight
2010-01-01
Background More than 50% of hepatitis C viruses (HCV)-infected patients do not respond to the classical Interferon (IFN)/Ribavirin (RBV) combination therapy. The aim of this study was to evaluate the efficacy of retreatment with Peg-Interferon alpha-2b (PEG-IFN alpha-2b) plus RBV, in patients with HCV, genotypes 1 or 3, who were non-responders to the previous standard treatment with IFN/RBV. Methods In the period 2005-2007, a total of 238 HCV chronic patients were non-responders to previous treatment with IFN plus RBV. Of these 130 agreed to be retreated with PEG-IFN alpha-2b and participated in this evaluation (90 with genotype 1 HCV and 40 with genotype 3 HCV). Patients were retreated at assisted IFN application hubs in compliance with the country's public health system rules. They received subcutaneous PEG-IFN alpha-2b, 1.5 μg, once weekly, associated with RBV, through the oral route, with doses determined according to weight (1,000 mg if weight ≤ 75 kg and 1,250 mg if > 75 kg). Patients with genotype 1 HCV were retreated for over 48 weeks and patients with genotype 3 HCV for over 24 weeks. HCV-RNA was tested by polymerase chain reaction (PCR) at baseline, at week 12, at the end of the treatment, and 6 months thereafter. The predictiveness of week 12 in the development of a sustained virologic response (SVR) was also evaluated. Patients with negative HCV-RNA at week 12 were considered as early virologic responders (EVR). Results EVR was observed in 25% of the patients with genotype 1 HCV and in 64% of the patients genotype 3 HCV (risk = 2.075 and p-value = 0.0414). SVR was observed in 22.2% of the patients with genotype 1 HCV and in 40% with genotype 3 HCV (intention-to-treat analysis). The positive predictive value (PPV) of the HCV-RNA testing at week 12, in order to obtain the SVR, was 65% for genotype 1 and 56% for genotype 3, and the negative predictive value (NPV) was 88% for genotype 1 and 89% for genotype 3. Conclusions PEG-IFN alpha-2b plus weight
Lachance, Claude; Gottschalk, Marcelo; Gerber, Pehuén P; Lemire, Paul; Xu, Jianguo; Segura, Mariela
2013-06-01
Streptococcus suis, a major porcine pathogen, can be transmitted to humans and cause severe symptoms. A large human outbreak associated with an unusual streptococcal toxic shock-like syndrome (STSLS) was described in China. Albeit an early burst of proinflammatory cytokines following Chinese S. suis infection was suggested to be responsible for STSLS case severity, the mechanisms involved are still poorly understood. Using a mouse model, the host response to S. suis infection with a North American intermediately pathogenic strain, a European highly pathogenic strain, and the Chinese epidemic strain was investigated by a whole-genome microarray approach. Proinflammatory genes were expressed at higher levels in mice infected with the Chinese strain than those infected with the European strain. The Chinese strain induced a fast and strong gamma interferon (IFN-γ) response by natural killer (NK) cells. In fact, IFN-γ-knockout mice infected with the Chinese strain showed significantly better survival than wild-type mice. Conversely, infection with the less virulent North American strain resulted in an IFN-β-subjugated, low inflammatory response that might be beneficial for the host to clear the infection. Overall, our data suggest that a highly virulent epidemic strain has evolved to massively activate IFN-γ production, mainly by NK cells, leading to a rapid and lethal STSLS.
Type I Interferon in the Pathogenesis of Lupus
Crow, Mary K.
2014-01-01
Investigations of patients with systemic lupus erythematosus (SLE) have applied insights from studies of the innate immune response to define type I interferon (IFN-I), with IFN-α the dominant mediator, as central to the pathogenesis of this prototype systemic autoimmune disease. Genetic association data identify regulators of nucleic acid degradation and components of TLR-independent, endosomal TLR-dependent, and IFN-I signaling pathways as contributors to lupus disease susceptibility. Together with a gene expression signature characterized by IFNI-induced gene transcripts in lupus blood and tissue, those data support the conclusion that many of the immunologic and pathologic features of this disease are a consequence of a persistent self-directed immune reaction driven by IFN-I and mimicking a sustained anti-virus response. This expanding knowledge of the role of IFN-I and the innate immune response suggests candidate therapeutic targets that are being tested in lupus patients. PMID:24907379
Type I IFN gene delivery suppresses regulatory T cells within tumors.
Hashimoto, H; Ueda, R; Narumi, K; Heike, Y; Yoshida, T; Aoki, K
2014-12-01
Type I interferon (IFN) is a pleiotropic cytokine regulating the cancer cell death and immune response. IFN-α can, as we have also reported, effectively induce an antitumor immunity by the activation of tumor-specific T cells and maturation of dendritic cells in various animal models. Unknown, however, is how the type I IFN alters the immunotolerant microenvironment in the tumors. Here, we found that intratumoral IFN-α gene transfer significantly decreased the frequency of regulatory T cells (Tregs) per CD4(+) T cells in tumors. The concentration of a Treg-inhibitory cytokine, interleukin (IL)-6, was correlated with the IFN-α expression level in tumors, and intratumoral CD11c(+) cells produced IL-6 in response to IFN-α stimulation. To confirm the role of IL-6 in the suppression of Tregs in tumors, an anti-IL-6 receptor antibody was administered in IFN-α-treated mice. The antibody increased the frequency of Tregs in the tumors, and attenuated systemic tumor-specific immunity induced by IFN-α. Furthermore, the IFN-α-mediated IL-6 production increased the frequency of Th17 cells in the tumors, which may be one of the mechanisms for the reduction of Tregs. The study demonstrated that IFN-α gene delivery creates an environment strongly supporting the enhancement of antitumor immunity through the suppression of Tregs.
Duez, C; Gras-Masse, H; Hammad, H; Akoum, H; Didierlaurent, A; André, C; Tonnel, A B; Pestel, J
2001-01-01
We have previously established a model to study the in vivo human IgE response using humanized SCID mice. Allergic SCID mice were obtained following intraperitoneal injection with mononuclear cells from Dermatophagoides pteronyssinus (Dpt)-sensitive patients, and sensitization by Dpt allergen intraperitoneal injection (immunization) or Dpt aerosol (inhalation). Human serum IgE was measured in allergic SCID mice after administration of human recombinant IFN-gamma or the lipopeptide LP 52-71 (derived from peptide p52-71 from Der p 1, Dpt major allergen, coupled to a lipophilic moiety), during the immunization or the inhalation phase. IFN-gamma inhibited human IgE production when given at the time of immunization, but not during inhalation. This effect was long-lasting as Dpt aerosol, given one month after immunization and IFN-gamma administration, failed to increase IgE levels. Unlike Dpt or p52-71, LP 52-71 failed to induce human IgE production at day 14 and 21 after its injection, but did inhibit the development of the IgE response after a secondary Dpt-challenge. Moreover, LP 52-71 administration 14 days after Dpt inhalation decreased IgE levels, in contrast to peptide 52-71, which increased IgE levels. Thus, taken together these results indicate that the development of the human IgE response in allergic SCID mice can be modulated by modified allergen and a Th1 cytokine.
Huang, T J; MacAry, P A; Eynott, P; Moussavi, A; Daniel, K C; Askenase, P W; Kemeny, D M; Chung, K F
2001-01-01
Th2 T cell immune-driven inflammation plays an important role in allergic asthma. We studied the effect of counterbalancing Th1 T cells in an asthma model in Brown Norway rats that favors Th2 responses. Rats received i.v. transfers of syngeneic allergen-specific Th1 or Th2 cells, 24 h before aerosol exposure to allergen, and were studied 18-24 h later. Adoptive transfer of OVA-specific Th2 cells, but not Th1 cells, and OVA, but not BSA exposure, induced bronchial hyperresponsiveness (BHR) to acetylcholine and eosinophilia in a cell number-dependent manner. Importantly, cotransfer of OVA-specific Th1 cells dose-dependently reversed BHR and bronchoalveolar lavage (BAL) eosinophilia, but not mucosal eosinophilia. OVA-specific Th1 cells transferred alone induced mucosal eosinophilia, but neither BHR nor BAL eosinophilia. Th1 suppression of BHR and BAL eosinophilia was allergen specific, since cotransfer of BSA-specific Th1 cells with the OVA-specific Th2 cells was not inhibitory when OVA aerosol alone was used, but was suppressive with OVA and BSA challenge. Furthermore, recipients of Th1 cells alone had increased gene expression for IFN-gamma in the lungs, while those receiving Th2 cells alone showed increased IL-4 mRNA. Importantly, induction of these Th2 cytokines was inhibited in recipients of combined Th1 and Th2 cells. Anti-IFN-gamma treatment attenuated the down-regulatory effect of Th1 cells. Allergen-specific Th1 cells down-regulate efferent Th2 cytokine-dependent BHR and BAL eosinophilia in an asthma model via mechanisms that depend on IFN-gamma. Therapy designed to control the efferent phase of established asthma by augmenting down-regulatory Th1 counterbalancing mechanisms should be effective.
Hung, Chiung-Yu; Castro-Lopez, Natalia; Cole, Garry T
2016-04-01
Coccidioidomycosis is a potentially life-threatening respiratory disease which is endemic to the southwestern United States and arid regions of Central and South America. It is responsible for approximately 150,000 infections annually in the United States alone. Almost every human organ has been reported to harbor parasitic cells of Coccidioides spp. in collective cases of the disseminated form of this mycosis. Current understanding of the mechanisms of protective immunity against lung infection has been largely derived from murine models of pulmonary coccidioidomycosis. However, little is known about the nature of the host response to Coccidioides in extrapulmonary tissue. Primary subcutaneous coccidioidal infection is rare but has been reported to result in disseminated disease. Here, we show that activation of MyD88 and Card9 signal pathways are required for resistance to Coccidioides infection following subcutaneous challenge of C57BL/6 mice, which correlates with earlier findings of the protective response to pulmonary infection. MyD88(-/-) andCard9(-/-) mice recruited reduced numbers of T cells, B cells, and neutrophils to the Coccidioides-infected hypodermis com pared to wild-type mice; however, neutrophils were dispensable for resistance to skin infection. Further studies have shown that gamma interferon (IFN-γ) production and activation of Th1 cells characterize resistance to subcutaneous infection. Furthermore, activation of a phagosomal enzyme, inducible nitric oxide synthase, which is necessary for NO production, is a requisite for fungal clearance in the hypodermis. Collectively, our data demonstrate that MyD88- and Card9-mediated IFN-γ and nitric oxide production is essential for protection against subcutaneous Coccidioides infection. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Efficacy of HCV treatment in Poland at the turn of the interferon era - the EpiTer study.
Flisiak, Robert; Pogorzelska, Joanna; Berak, Hanna; Horban, Andrzej; Orłowska, Iwona; Simon, Krzysztof; Tuchendler, Ewelina; Madej, Grzegorz; Piekarska, Anna; Jabłkowski, Maciej; Deroń, Zbigniew; Mazur, Włodzimierz; Kaczmarczyk, Marcin; Janczewska, Ewa; Pisula, Arkadiusz; Smykał, Jacek; Nowak, Krzysztof; Matukiewicz, Marek; Halota, Waldemar; Wernik, Joanna; Sikorska, Katarzyna; Mozer-Lisewska, Iwona; Rozpłochowski, Błażej; Garlicki, Aleksander; Tomasiewicz, Krzysztof; Krzowska-Firych, Joanna; Baka-Ćwierz, Barbara; Kryczka, Wiesław; Zarębska-Michaluk, Dorota; Olszok, Iwona; Boroń-Kaczmarska, Anna; Sobala-Szczygieł, Barbara; Szlauer, Bronisława; Korcz-Ondrzejek, Bogumiła; Sieklucki, Jerzy; Pleśniak, Robert; Ruszała, Agata; Postawa-Kłosińska, Barbara; Citko, Jolanta; Lachowicz-Wawrzyniak, Anna; Musialik, Joanna; Jezierska, Edyta; Dobracki, Witold; Dobracka, Beata; Hałubiec, Jan; Krygier, Rafał; Strokowska, Anna; Chomczyk, Wojciech; Witczak-Malinowska, Krystyna
2016-12-01
Was to analyze the efficacy achieved with regimens available for chronic hepatitis C (CHC) in Poland between 2013 and 2016. Data were collected from 29 centers and included 6786 patients with available sustained virologic response (SVR) data between 1 January 2013 and 31 March 2016. The sustained virologic response rate for genotypes (G) 1a, 1b, 2, 3 and 4 was 62%, 56%, 92%, 67% and 56% respectively; 71% patients ( n = 4832) were treated with pegylated interferon α (Peg-IFNα) and ribavirin (RBV), with SVR rates of 58%, 49%, 92%, 67% and 55% respectively. The sustained virologic response among 5646 G1 infected patients was the lowest with natural interferon α (7%, n = 70) or PegIFN (50%, n = 3779) with RBV, and improved in those receiving triple regimens of Peg-IFN + RBV combined with boceprevir (47%, n = 485), telaprevir (64%, n = 805), simeprevir (73%, n = 132) or sofosbuvir (70%, n = 23). The sustained virologic response with interferon-free regimens of sofosbuvir and RBV ( n = 7), sofosbuvir and simeprevir ( n = 53), and ledipasvir and sofosbuvir ( n = 64) achieved 86%, 89% and 94% respectively. The highest SVR of 98% was observed with ombitasvir/paritaprevir combined with dasabuvir ( n = 227). Patients infected with G3 ( n = 896) and G4 ( n = 220) received mostly Peg-IFN + RBV with SVR of 67% and 56% respectively. Interferon-free regimens were administered in 18 G3/G4 patients and all achieved an SVR. Sofosbuvir combined with Peg-IFN and RBV was administered to 33 patients with an SVR rate of 94%, and a similar rate was achieved among 13 G2 patients treated with interferon and RBV. We observed significant differences in efficacy of HCV regimens available in Poland at the turn of the interferon era. The data will be useful as a comparison for therapeutic options expected in the next few years.
Tisserand, Johan; Khetchoumian, Konstantin; Thibault, Christelle; Dembélé, Doulaye; Chambon, Pierre; Losson, Régine
2011-01-01
Recent genetic studies in mice have established that the nuclear receptor coregulator Trim24/Tif1α suppresses hepatocarcinogenesis by inhibiting retinoic acid receptor α (Rara)-dependent transcription and cell proliferation. However, Rara targets regulated by Trim24 remain unknown. We report that the loss of Trim24 resulted in interferon (IFN)/STAT pathway overactivation soon after birth (week 5). Despite a transient attenuation of this pathway by the induction of several IFN/STAT pathway repressors later in the disease, this phenomenon became more pronounced in tumors. Remarkably, Rara haplodeficiency, which suppresses tumorigenesis in Trim24−/− mice, prevented IFN/STAT overactivation. Moreover, together with Rara, Trim24 bound to the retinoic acid-responsive element of the Stat1 promoter and repressed its retinoic acid-induced transcription. Altogether, these results identify Trim24 as a novel negative regulator of the IFN/STAT pathway and suggest that this repression through Rara inhibition may prevent liver cancer. PMID:21768647
Cheng, Jinbo; Liao, Yajin; Zhou, Lujun; Peng, Shengyi; Chen, Hong; Yuan, Zengqiang
2016-01-01
Type I interferon (IFN-I) is critical for a host against viral and bacterial infections via induction of hundreds of interferon-stimulated genes (ISGs), but the mechanism underlying the regulation of IFN-I remains largely unknown. In this study, we first demonstrate that ISG expression is required for optimal IFN-β levels, an effect that is further enhanced by endoplasmic reticulum (ER) stress. Furthermore, we identify mitochondrial calcium uniporter protein (MCU) as a mitochondrial antiviral signaling protein (MAVS)-interacting protein that is important for ER stress induction and amplified MAVS signaling activation. In addition, by performing an ectopic expression assay to screen a library of 117 human ISGs for effects on IFN-β levels, we found that tumor necrosis factor receptor 1 (TNFR1) significantly increases IFN-β levels independent of ER stress. Altogether, our findings suggest that MCU and TNFR1 are involved in the regulation of RIG-I-like receptors (RLR) signaling. PMID:26892273
Zhou, Qin; Chen, Shun; Qi, Yulin; Zhou, Hao; Wang, Mingshu; Jia, Renyong; Zhu, Dekang; Liu, Mafeng; Liu, Fei; Chen, Xiaoyue; Zhou, Xue; Cheng, Anchun
2015-01-01
Interferons, as the first line of defense against the viral infection, play an important role in innate immune responses. Type III interferon (IFN-λ) was a newly identified member of IFN family, which plays IFN-like antiviral activity. Towards a better understanding of the type III interferon system in birds, type III interferon lambda receptor (IFNLR1) was first identified in the Chinese goose. In this paper, we had cloned 1952 bp for goose IFNLR1 (goIFNLR1), including an ORF of 1539 bp, encoding a 512-amino acid protein with a 20 aa predict signal peptide at its N terminal and a 23 aa transmembrane region. The predicted amino acid sequence of goIFNLR1 has 90%, 73%, and 34% identity with duck IFNLR1 (predicted sequence), chicken IFNLR1, and human IFNLR1, respectively. And the age-related tissue distribution of goIFNLR1 was identified by Real Time quantitative PCR (RT-qPCR), we found that the goIFNLR1 has a mainly expression in epithelium-rich tissues similar to other species', such as small intestinal, lung, liver, and stomach. Moreover, a relatively high expression of goIFNLR1 was also observed in the secondary immune tissues (harderian gland and cecal tonsil). The identification and tissue distribution of goIFNLR1 will facilitate further study of the role of IFN-λ in goose antiviral defense. PMID:26064884
Interferon lambda: opportunities, risks, and uncertainties in the fight against HCV.
Laidlaw, Stephen M; Dustin, Lynn B
2014-01-01
Innate immunity is key to the fight against the daily onslaught from viruses that our bodies are subjected to. Essential to this response are the interferons (IFNs) that prime our cells to block viral pathogens. Recent evidence suggests that the Type III (λ) IFNs are intimately associated with the immune response to hepatitis C virus (HCV) infection. Genome-wide association studies have identified polymorphisms within the IFN-λ gene locus that correlate with response to IFNα-based antiviral therapy and with spontaneous clearance of HCV infection. The mechanisms for these correlations are incompletely understood. Restricted expression of the IFN-λ receptor, and the ability of IFN-λ to induce IFN-stimulated genes in HCV-infected cells, suggest potential roles for IFN-λ in HCV therapy even in this era of directly acting antivirals. This review summarizes our current understanding of the IFN-λ family and the role of λ IFNs in the natural history of HCV infection.
Critical review: assessment of interferon-β immunogenicity in multiple sclerosis.
Bendtzen, Klaus
2010-10-01
This review discusses type I interferon (IFN) immunogenicity with focus on methods of detection of anti-IFN antibodies in patients treated with human recombinant IFN-β. Pitfalls involved in the clinical use of various types of assays for binding antibodies and neutralizing antibodies against IFN-β are presented, and the widely held distinction between binding antibodies and neutralizing antibodies is questioned both in terms of detection and clinical importance. The article also addresses important bioavailability and pharmacokinetic issues occurring with prolonged use of protein drugs. The rationale for individualized or personalized medicine, ie, optimizing therapies according to individual needs rather than using standardized trial-and-error regimens to all patients, is highlighted.
Devane, John G; Martin, Mary L; Matson, Mark A
2014-06-01
Flu-like symptoms (FLS) are commonly experienced by patients receiving interferon gamma-1b which may cause discontinuation or disruption of dosing during initial therapy or on re-initiation following a break in therapy. In contrast to Type I interferons, the impact of dose-titration on FLS has not been reported and is not a practice described or included in the approved prescribing information for interferon gamma-1b.The objective of this study was to assess the effect of a 2 week titration regimen on the severity of FLS during the initial 3 weeks of therapy with three times weekly subcutaneous injections of interferon gamma-1b. Healthy men and women were randomized into a double-blind, two-period, crossover study. Each study period was 3 weeks in duration and there was a minimum 15 day washout between treatment periods. Two treatment regimens were compared: No Titration dosing (full 50 mcg/m(2) subcutaneously [s.c.] three times weekly for 3 weeks) and Titration (15 mcg/m(2) s.c. three times weekly during week 1, 30 mcg/m(2) s.c. three times weekly during week 2 followed by the full dose of 50 mcg/m(2) s.c. three times weekly during week 3). Subjects remained in the clinic for at least 12 hours following each injection. FLS was based on a composite score for fever, chills, tiredness and muscle aches assessed at baseline and 4, 8 and 12 hours following each injection. Acetaminophen was allowed at the discretion of the PI. The primary endpoint was the change from baseline in FLS severity at 8 hours averaged over the 3 weeks of treatment. Additional endpoints included FLS at 4 and 12 hours, individual flu-like symptoms, rates of discontinuation, incidence of FLS and acetaminophen use. NCT 01929382. Of the 40 subjects randomized, there were 15 (37.5%) discontinuations. Titration resulted in a significant reduction in FLS severity at 8 hours (p = 0.023) averaged over the 3 week treatment period. The difference in 3 week FLS severity reflects differences
VISA is an adapter protein required for virus-triggered IFN-beta signaling.
Xu, Liang-Guo; Wang, Yan-Yi; Han, Ke-Jun; Li, Lian-Yun; Zhai, Zhonghe; Shu, Hong-Bing
2005-09-16
Viral infection or stimulation of TLR3 triggers signaling cascades, leading to activation of the transcription factors IRF-3 and NF-kappaB, which collaborate to induce transcription of type I interferon (IFN) genes. In this study, we identified a protein termed VISA (for virus-induced signaling adaptor) as a critical component in the IFN-beta signaling pathways. VISA recruits IRF-3 to the cytoplasmic viral dsRNA sensor RIG-I. Depletion of VISA inhibits virus-triggered and RIG-I-mediated activation of IRF-3, NF-kappaB, and the IFN-beta promoter, suggesting that VISA plays a central role in virus-triggered TLR3-independent IFN-beta signaling. Our data also indicate that VISA interacts with TRIF and TRAF6 and mediates bifurcation of the TLR3-triggered NF-kappaB and IRF-3 activation pathways. These findings suggest that VISA is critically involved in both virus-triggered TLR3-independent and TLR3-mediated antiviral IFN signaling.
Interferon-inducible effector mechanisms in cell-autonomous immunity
MacMicking, John D.
2014-01-01
Interferons (IFNs) induce the expression of hundreds of genes as part of an elaborate antimicrobial programme designed to combat infection in all nucleated cells — a process termed cell-autonomous immunity. As described in this Review, recent genomic and subgenomic analyses have begun to assign functional properties to novel IFN-inducible effector proteins that restrict bacteria, protozoa and viruses in different subcellular compartments and at different stages of the pathogen life cycle. Several newly described host defence factors also participate in canonical oxidative and autophagic pathways by spatially coordinating their activities to enhance microbial killing. Together, these IFN-induced effector networks help to confer vertebrate host resistance to a vast and complex microbial world. PMID:22531325
Zhao, Rong; Chen, Ni-Nan; Zhou, Xiao-Wei; Miao, Ping; Hu, Chao-Ying; Qian, Liu; Yu, Qi-Wen; Zhang, Ji-Ying; Nie, Hong; Chen, Xue-hua; Li, Pu; Xu, Rong; Xiao, Lian-Bo; Zhang, Xin; Liu, Jian-Ren; Zhang, Dong-Qing
2014-12-10
Although a variety of drugs have been used to treat the symptoms of rheumatoid arthritis (RA), none of them are able to cure the disease. Interferon β (IFN-β) has pleiotropic effects on RA, but whether it can be used to treat RA remains globally controversial. Thus, in this study we tested the effects of IFN-β on RA patients and on collagen antibody-induced arthritis (CAIA) model mice. The cytokine and auto-antibody expression profiles in the serum and synovial fluid (SF) from RA patients were assessed using enzyme-linked immunosorbent assay (ELISA) and compared with the results from osteoarthritis (OA) patients. Exogenous IFN-β was administered to RA patients and CAIA model mice, and the therapeutic effects were evaluated. Endogenous IFN-β expression in the joint bones of CAIA model mice was evaluated by quantitative real-time PCR (qRT-PCR). The effects of exogenous IFN-β on CAIA model mice were assessed using a clinical scoring system, hematoxylin eosin and safranin-O with fast green counterstain histology, molybdenum target X-ray, and tartrate-resistant acid phosphatase (TRAP) staining. The RANKL-RANK signaling pathway was analyzed using qRT-PCR. The RAW 264.7 cell line was differentiated into osteoclasts with RANKL stimulation and then treated with exogenous IFN-β. The expression of inflammatory cytokines (IFN-γ, IL-17, MMP-3, and RANKL) and auto-antibodies (CII antibodies, RF-IgM, and anti-CCP/GPI) were significantly higher in RA compared with OA patients. After IFN-β intervention, some clinical symptoms in RA patients were partially alleviated, and the expression of IFN-γ, IL-17, MMP-3, and OPG) returned to normal levels. In the CAIA model, the expression of endogenous IFN-β in the joint bones was decreased. After IFN-β administration, the arthritis scores were decreased; synovial inflammation, cartilage, and bone destruction were clearly attenuated; and the expression of c-Fos and NFATc1 were reduced, while RANKL and TRAF6 expression was
ElAlfy, Mohsen Saleh; Adly, Amira Abdel Moneam; Ebeid, Fatma Soliman ElSayed; Eissa, Deena Samir; Ismail, Eman Abdel Rahman; Mohammed, Yasser Hassan; Ahmed, Manar Elsayed; Saad, Aya Sayed
2018-06-20
Sickle cell disease (SCD) is associated with alterations in immune phenotypes. CD4 + CD28 null T lymphocytes have pro-inflammatory functions and are linked to vascular diseases. To assess the percentage of CD4 + CD28 null T lymphocytes, natural killer cells (NK), and IFN-gamma levels, we compared 40 children and adolescents with SCD with 40 healthy controls and evaluated their relation to disease severity and response to therapy. Patients with SCD steady state were studied, focusing on history of frequent vaso-occlusive crisis, hydroxyurea therapy, and IFN-gamma levels. Analysis of CD4 + CD28 null T lymphocytes and NK cells was done by flow cytometry. Liver and cardiac iron overload were assessed. CD4 + CD28 null T lymphocytes, NK cells, and IFN-gamma levels were significantly higher in patients than controls. Patients with history of frequent vaso-occlusive crisis and those with vascular complications had higher percentage of CD4 + CD28 null T lymphocytes and IFN-gamma while levels were significantly lower among hydroxyurea-treated patients. CD4 + CD28 null T lymphocytes were positively correlated to transfusional iron input while these cells and IFN-gamma were negatively correlated to cardiac T2* and duration of hydroxyurea therapy. NK cells were correlated to HbS and indirect bilirubin. Increased expression of CD4 + CD28 null T lymphocytes highlights their role in immune dysfunction and pathophysiology of SCD complications.
Intracystic interferon-α treatment leads to neurotoxicity in craniopharyngioma: case report.
Sharma, Julia; Bonfield, Christopher M; Singhal, Ash; Hukin, Juliette; Steinbok, Paul
2015-09-01
Craniopharyngioma is a benign, cystic suprasellar tumor that can be treated with intracystic chemotherapy. Interferon-α (IFN-α) has been gaining popularity as an intracystic treatment for craniopharyngioma because of its efficacy and supposed benign neurotoxicity profile. In this case report the authors describe a patient who, while receiving intracystic IFN-α, suffered a neurological event, which was believed to be related to drug leakage outside the cyst. This is the first report of a focal neurological deficit potentially attributable to intracystic IFN-α therapy, highlighting the fact that IFN-α may have neurotoxic effects on the central nervous system. Given this case and the results of a literature review, the authors suggest that a positive leak test is a relative contraindication to intracystic IFN-α treatment.
Santin, Miguel; García-García, José-María; Rigau, David; Altet, Neus; Anibarro, Luis; Casas, Irma; Díez, Nuria; García-Gasalla, Mercedes; Martínez-Lacasa, Xavier; Penas, Antón; Pérez-Escolano, Elvira; Sánchez, Francisca; Domínguez, José
2016-09-01
Interferon-gamma release assays are widely used for the diagnosis of tuberculosis infection in Spain. However, there is no consensus on their application in specific clinical scenarios. To develop a guide-line for their use, a panel of experts comprising specialists in infectious diseases, respiratory diseases, microbiology, pediatrics and preventive medicine, together with a methodologist, conducted a systematic literature search, summarized the findings, rated the quality of the evidence, and formulated recommendations following the Grading of Recommendations of Assessment Development and Evaluations methodology. This document provides evidence-based guidance on the use of interferon-gamma release assays for the diagnosis of tuberculosis infection in patients at risk of tuberculosis or suspected of having active disease. The guidelines will be applicable to specialist and primary care, and public health. Copyright © 2016 SEPAR. Publicado por Elsevier España, S.L.U. All rights reserved.
RIOK3 Is an Adaptor Protein Required for IRF3-Mediated Antiviral Type I Interferon Production
Feng, Jun; De Jesus, Paul D.; Su, Victoria; Han, Stephanie; Gong, Danyang; Wu, Nicholas C.; Tian, Yuan; Li, Xudong; Wu, Ting-Ting; Chanda, Sumit K.
2014-01-01
ABSTRACT Detection of cytosolic nucleic acids by pattern recognition receptors leads to the induction of type I interferons (IFNs) and elicits the innate immune response. We report here the identification of RIOK3 as a novel adaptor protein that is essential for the cytosolic nucleic acid-induced type I IFN production and for the antiviral response to gammaherpesvirus through two independent kinome-wide RNA interference screens. RIOK3 knockdown blocks both cytosolic double-stranded B-form DNA and double-stranded RNA-induced IRF3 activation and IFN-β production. In contrast, the overexpression of RIOK3 activates IRF3 and induces IFN-β. RIOK3 functions downstream of TBK1 and upstream of IRF3 activation. Furthermore, RIOK3 physically interacts with both IRF3 and TBK1 and is necessary for the interaction between TBK1 and IRF3. In addition, global transcriptome analysis shows that the expression of many gene involved antiviral responses is dependent on RIOK3. Thus, knockdown of RIOK3 inhibits cellular antiviral responses against both DNA and RNA viruses (herpesvirus and influenza A virus). Our data suggest that RIOK3 plays a critical role in the antiviral type I IFN pathway by bridging TBK1 and IRF3. IMPORTANCE The innate immune response, such as the production of type I interferons, acts as the first line of defense, limiting infectious pathogens directly and shaping the adaptive immune response. In this study, we identified RIOK3 as a novel regulator of the antiviral type I interferon pathway. Specifically, we found that RIOK3 physically interacts with TBK1 and IRF3 and bridges the functions between TBK1 and IRF3 in the activation of type I interferon pathway. The identification of a cellular kinase that plays a role the type I interferon pathway adds another level of complexity in the regulation of innate immunity and will have implications for developing novel strategies to combat viral infection. PMID:24807708
Noh, G; Jang, E H
2014-01-01
Specific oral tolerance induction (SOTI) for IgE-mediated food allergy (IFA) can be successfully achieved using interfero gamma (classic SOTI). In this study, a tolerable dose was introduced during tolerance induction with interferon gamma (dual SOTI), and its effectiveness was evaluated. The study population comprised 25 IFA patients. Blood samples were taken for analysis, including complete blood count with differential counts of eosinophils, serum total IgE levels, and specific IgE for allergenic foods. Skin prick tests were conducted with the allergens. Oral food challenges were performed to diagnose IFA. Ten patients received dual SOTI, 5 received classic SOTI, 5 received SOTI without interferon gamma (original SOTI), and 5 were not treated (controls). Patients treated with dual SOTI and classic SOTI using interferon gamma became tolerant to the allergenic food. The tolerable dose was introduced successfully in dual SOTI. It was difficult to proceed with the same dosing protocol used for classic SOTI in cases treated with original SOTI. Following dual SOTI, the systemic reaction to oral intake subsided, but the local skin reaction to contact with the allergenic food persisted. Dual SOTI is an improved protocol for SOTI using interferon gamma for IFA.The local skin reaction and systemic reaction to oral intake were dissociated following dual SOTI. In cases of food allergy, tolerance appears to result from desensitization to allergens.
The interferon response circuit in antiviral host defense.
Haller, O; Weber, F
2009-01-01
Viruses have learned to multiply in the face of a powerful innate and adaptive immune response of the host. They have evolved multiple strategies to evade the interferon (IFN) system which would otherwise limit virus growth at an early stage of infection. IFNs induce the synthesis of a range of antiviral proteins which serve as cell-autonomous intrinsic restriction factors. For example, the dynamin-like MxA GTPase inhibits the multiplication of influenza and bunyaviruses (such as La Crosse virus, Hantaan virus, Rift Valley Fever virus, and Crimean-Congo hemorrhagic fever virus) by binding and sequestering the nucleocapsid protein into large perinuclear complexes. To overcome such intracellular restrictions, virulent viruses either inhibit IFN synthesis, bind and inactivate secreted IFN molecules, block IFN-activated signaling, or disturb the action of IFN-induced antiviral proteins. Many viruses produce specialized proteins to disarm the danger signal or express virulence genes that target members of the IFN regulatory factor family (IRFs) or components of the JAK-STAT signaling pathway. An alternative evasion strategy is based on extreme viral replication speed which out-competes the IFN response. The identification of viral proteins with IFN antagonistic functions has great implications for disease prevention and therapy. Virus mutants lacking IFN antagonistic properties represent safe yet highly immunogenic candidate vaccines. Furthermore, novel drugs intercepting viral IFN-antagonists could be used to disarm the viral intruders.
Dynamic control of type I IFN signalling by an integrated network of negative regulators.
Porritt, Rebecca A; Hertzog, Paul J
2015-03-01
Whereas type I interferons (IFNs) have critical roles in protection from pathogens, excessive IFN responses contribute to pathology in both acute and chronic settings, pointing to the importance of balancing activating signals with regulatory mechanisms that appropriately tune the response. Here we review evidence for an integrated network of negative regulators of IFN production and action, which function at all levels of the activating and effector signalling pathways. We propose that the aim of this extensive network is to limit tissue damage while enabling an IFN response that is temporally appropriate and of sufficient magnitude. Understanding the architecture and dynamics of this network, and how it differs in distinct tissues, will provide new insights into IFN biology and aid the design of more effective therapeutics. Crown Copyright © 2015. Published by Elsevier Ltd. All rights reserved.
Mantegazza, R; Gebbia, M; Mora, M; Barresi, R; Bernasconi, P; Baggi, F; Cornelio, F
1996-08-01
Major histocompatibility complex (MHC) class II molecules are expressed on myoblasts after interferon-gamma (IFN-gamma) treatment, suggesting a muscle cell involvement in antigen presentation in inflammatory myopathies. However, they were not observed on normal or pathological myofibers. This discrepancy might be related to different responsiveness of developmentally differentiated muscle cells to IFN-gamma. Myoblasts expressed class II transcripts and proteins after IFN-gamma, while myotubes and innervated contracting muscle cells did not show staining for class II molecules. At all cell stages no loss of IFN-gamma receptor was detected indicating that myofiber maturation blocks their capacity to express MHC class II molecules. This suggests that completely differentiated myofibers cannot participate in class II restricted immunological reactions.
Tumor-suppressive effects of natural-type interferon-β through CXCL10 in melanoma
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kobayashi, Hikaru; Nobeyama, Yoshimasa, E-mail: nobederm@jikei.ac.jp; Nakagawa, Hidemi
2015-08-21
Introduction: Type 1 interferon is in widespread use as adjuvant therapy to inhibit melanoma progression. Considering the tumor-suppressive effects of local administration of interferon-β (IFN-β) on lymphatic metastasis, the present study was conducted to identify melanoma-suppressive molecules that are up-regulated by IFN-β treatment of lymphatic endothelial cells. Materials and methods: Lymphatic endothelial cells, fibroblasts, and melanoma cells were treated with natural-type IFN-β, and melanoma cells were treated with CXCL10. Genome-wide oligonucleotide microarray analysis was performed using lymphatic endothelial cells with or without IFN-β treatment. Quantitative real-time reverse transcription-PCR and an enzyme-linked immunosorbent assay were performed to examine CXCL10 expression. Amore » proliferation assay was performed to examine the effects of IFN-β and CXCL10 in melanoma cells. Results: Genome-wide microarray analyses detected CXCL10 as a gene encoding a secretory protein that was up-regulated by IFN-β in lymphatic endothelial cells. IFN-β treatment significantly induced CXCL10 in dermal lymphatic endothelial cells and melanoma cells that are highly sensitive to IFN-β. CXCL10 reduced melanoma cell proliferation in IFN-β-sensitive cells as well as resistant cells. Melanoma cells in which CXCL10 was knocked down were sensitive to IFN-β. CXCR3-B, which encodes the CXCL10 receptor, was up-regulated in melanoma cells with high sensitivity to IFN-β and down-regulated in melanoma cells with medium to low sensitivity. Conclusions: Our data suggest that IFN-β suppresses proliferation and metastasis from the local lymphatic system and melanoma cells via CXCL10. Down-regulation of CXCR3-B by IFN-β may be associated with resistance to IFN-β. - Highlights: • We search melanoma-suppressive molecules induced by IFN-β. • IFN-β induces a high amount of CXCL10 from lymphatic endothelial cells. • CXCL10 induction level in melanoma cells is
BID is a critical factor controlling cell viability regulated by IFN-α.
Tsuno, Takaya; Mejido, Josef; Zhao, Tongmao; Phillips, Terry; Myers, Timothy G; Bekisz, Joseph; Zoon, Kathryn C
2012-01-01
Clinical applications of human interferon (IFN)-α have met with varying degrees of success. Nevertheless, key molecules in cell viability regulated by IFN-α have not been clearly identified. Our previous study indicated that IFN (α, β, and ω) receptor (IFNAR) 1/2- and IFN regulatory factor 9-RNA interference (RNAi) completely restored cell viability after IFN-α treatment in human ovarian adenocarcinoma OVCAR3 cells sensitive to IFN-α. In this study, IFNAR1/2- and IFN regulatory factor 9-RNAi inhibited the gene expression of tumor necrosis factor-related apoptosis-inducing ligand (TRAIL), but not of Fas ligand, after IFN-α treatment. In fact, TRAIL but not Fas ligand inhibited the viability of OVCAR3 cells. IFN-α notably upregulated the levels of TRAIL protein in the supernatant and on the membrane of OVCAR3 cells. After TRAIL signaling, caspase 8 inhibitor and BH3 interacting domain death agonist (BID)-RNAi significantly restored cell viability in response to IFN-α and TRAIL in OVCAR3 cells. Furthermore, BID-RNAi prevented both IFN-α and TRAIL from collapsing the mitochondrial membrane potential (ΔΨm). Finally, we provided important evidence that BID overexpression led to significant inhibition of cell viability after IFN-α or TRAIL treatments in human lung carcinoma A549 cells resistant to IFN-α. Thus, this study suggests that BID is crucial for cell viability regulated by IFN-α which can induce mitochondria-mediated apoptosis, indicating a notable potential to be a targeted therapy for IFN-α resistant tumors.
USDA-ARS?s Scientific Manuscript database
Type I interferons, such as interferon alpha (IFN-alpha), contribute to innate antiviral immunity by promoting production of antiviral mediators and also play a role in the adaptive immune response. Porcine reproductive and respiratory syndrome (PRRS) is one of the most devastating and costly diseas...
Ultrasound-mediated interferon {beta} gene transfection inhibits growth of malignant melanoma
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yamaguchi, Kazuki; Department of Anatomy, Fukuoka University School of Medicine, 7-45-1 Nanakuma, Jonan-ku, Fukuoka City 814-0180; Feril, Loreto B., E-mail: ferilism@yahoo.com
2011-07-22
Highlights: {yields} Successful ultrasound-mediated transfection of melanoma (C32) cells with IFN-{beta} genes both in vitro and in vivo. {yields} Ultrasound-mediated IFN-{beta} transfection inhibited proliferation of melanoma cells in vitro. {yields} Ultrasound-mediated IFN-{beta} transfection inhibited melanoma tumor growth in vivo. -- Abstract: We investigated the effects of ultrasound-mediated transfection (sonotransfection) of interferon {beta} (IFN-{beta}) gene on melanoma (C32) both in vitro and in vivo. C32 cells were sonotransfected with IFN-{beta} in vitro. Subcutaneous C32 tumors in mice were sonicated weekly immediately after intra-tumor injection with IFN-{beta} genes mixed with microbubbles. Successful sonotransfection with IFN-{beta} gene in vitro was confirmed by ELISA,more » which resulted in C32 growth inhibition. In vivo, the growth ratio of tumors transfected with IFN-{beta} gene was significantly lower than the other experimental groups. These results may lead to a new method of treatment against melanoma and other hard-to-treat cancers.« less
Christophi, George P.; Christophi, Jennifer A.; Gruber, Ross C.; Mihai, Cornelia; Mejico, Luis J.; Massa, Paul T.; Jubelt, Burk
2012-01-01
Interferon-β (IFN-β) is a current effective treatment for multiple sclerosis (MS) and exerts its therapeutic effects by down-modulating the systemic immune response and cytokine signaling. In clinical practice there are several formulations of interferon including a low dose of IFN-β 1a formulation of 30μg IM once weekly (Avonex) and a high dose formulation of 44 μg SC three times weekly (Rebif). Recent studies suggest that Rebif is more efficacious compared to Avonex in preventing relapses and decreasing MRI activity in relapsing remitting MS (RRMS) patients. This study examines whether there are quantitative gene expression changes in interferon-treated RRMS patients that can explain the difference in efficacy and side effects between Rebif and Avonex. Herein, RRMS patients were treated for three months with IFN-β 1a and the levels of plasma cytokines and gene expression in peripheral blood mononuclear cells were examined. Thirty-two normal subjects were compared to thirty-two RRMS patients, of which ten were treated with Rebif and ten with Avonex. Rebif and Avonex both significantly and equally suppressed plasma TNF-α and IL-6 levels. Rebif suppressed IL-13 significantly more than Avonex. Rebif also significantly suppressed the levels of the chemokines CCL17 and RANTES, the protease ADAM8, and COX-2 at a higher degree compared to Avonex. The STAT1-inducible genes IP-10 and caspase 1 were significantly increased with Rebif compared to Avonex. In conclusion, the higher dosed, more frequently administered IFN-β 1a Rebif when compared to IFN β-1a Avonex has more potent immunomodulatory effects. These quantitative results might relate to efficacy and side-effect profile of the two IFN-β 1a formulations and provide prospective practical clinical tools to monitor treatment and adjust dosage. PMID:21658727
van Gorkom, T; Sankatsing, S U C; Voet, W; Ismail, D M; Muilwijk, R H; Salomons, M; Vlaminckx, B J M; Bossink, A W J; Notermans, D W; Bouwman, J J M; Kremer, K; Thijsen, S F T
2018-04-01
Two-tier serology testing is most frequently used for the diagnosis of Lyme borreliosis (LB); however, a positive result is no proof of active disease. To establish a diagnosis of active LB, better diagnostics are needed. Tests investigating the cellular immune system are available, but studies evaluating the utility of these tests on well-defined patient populations are lacking. Therefore, we investigated the utility of an enzyme-linked immunosorbent spot (ELISpot) assay to diagnose active Lyme neuroborreliosis. Peripheral blood mononuclear cells (PBMCs) of various study groups were stimulated by using Borrelia burgdorferi strain B31 and various recombinant antigens, and subsequently, the number of Borrelia -specific interferon gamma (IFN-γ)-secreting T cells was measured. We included 33 active and 37 treated Lyme neuroborreliosis patients, 28 healthy individuals treated for an early manifestation of LB in the past, and 145 untreated healthy individuals. The median numbers of B. burgdorferi B31-specific IFN-γ-secreting T cells/2.5 × 10 5 PBMCs did not differ between active Lyme neuroborreliosis patients (6.0; interquartile range [IQR], 0.5 to 14.0), treated Lyme neuroborreliosis patients (4.5; IQR, 2.0 to 18.6), and treated healthy individuals (7.4; IQR, 2.3 to 14.9) ( P = 1.000); however, the median number of B. burgdorferi B31-specific IFN-γ-secreting T cells/2.5 × 10 5 PBMCs among untreated healthy individuals was lower (2.0; IQR, 0.5 to 3.9) ( P ≤ 0.016). We conclude that the Borrelia ELISpot assay, measuring the number of B. burgdorferi B31-specific IFN-γ-secreting T cells/2.5 × 10 5 PBMCs, correlates with exposure to the Borrelia bacterium but cannot be used for the diagnosis of active Lyme neuroborreliosis. Copyright © 2018 van Gorkom et al.
van Gorkom, T.; Sankatsing, S. U. C.; Voet, W.; Ismail, D. M.; Muilwijk, R. H.; Salomons, M.; Vlaminckx, B. J. M.; Bossink, A. W. J.; Notermans, D. W.; Bouwman, J. J. M.; Kremer, K.
2018-01-01
ABSTRACT Two-tier serology testing is most frequently used for the diagnosis of Lyme borreliosis (LB); however, a positive result is no proof of active disease. To establish a diagnosis of active LB, better diagnostics are needed. Tests investigating the cellular immune system are available, but studies evaluating the utility of these tests on well-defined patient populations are lacking. Therefore, we investigated the utility of an enzyme-linked immunosorbent spot (ELISpot) assay to diagnose active Lyme neuroborreliosis. Peripheral blood mononuclear cells (PBMCs) of various study groups were stimulated by using Borrelia burgdorferi strain B31 and various recombinant antigens, and subsequently, the number of Borrelia-specific interferon gamma (IFN-γ)-secreting T cells was measured. We included 33 active and 37 treated Lyme neuroborreliosis patients, 28 healthy individuals treated for an early manifestation of LB in the past, and 145 untreated healthy individuals. The median numbers of B. burgdorferi B31-specific IFN-γ-secreting T cells/2.5 × 105 PBMCs did not differ between active Lyme neuroborreliosis patients (6.0; interquartile range [IQR], 0.5 to 14.0), treated Lyme neuroborreliosis patients (4.5; IQR, 2.0 to 18.6), and treated healthy individuals (7.4; IQR, 2.3 to 14.9) (P = 1.000); however, the median number of B. burgdorferi B31-specific IFN-γ-secreting T cells/2.5 × 105 PBMCs among untreated healthy individuals was lower (2.0; IQR, 0.5 to 3.9) (P ≤ 0.016). We conclude that the Borrelia ELISpot assay, measuring the number of B. burgdorferi B31-specific IFN-γ-secreting T cells/2.5 × 105 PBMCs, correlates with exposure to the Borrelia bacterium but cannot be used for the diagnosis of active Lyme neuroborreliosis. PMID:29367297
Ekerfelt, C; Forsberg, P; Svenvik, M; Roberg, M; Bergström, S; Ernerudh, J
1999-01-01
Lyme disease is a complex disorder that sometimes becomes chronic. There are contradictory reports of experimental Borrelia infections regarding which type of T cell cytokine responses, i.e. Th1 or Th2, are needed to eradicate the Borrelia spirochaetes. In human borreliosis a predominance of Borrelia-specific Th1-like responses has been shown. In this study, spontaneous, as well as Borrelia-specific, secretion of IFN-γ (Th1) and IL-4 (Th2) in Borrelia-seropositive healthy asymptomatic individuals (n = 17) was investigated in peripheral blood by a sensitive ELISPOT assay, and compared with previously reported responses in patients with clinical Borrelia infection (n = 25). The seropositive asymptomatic individuals displayed the same predominance of Borrelia-specific IFN-γ-secreting cells as the patients with clinical Borrelia infection. Interestingly, the proportion of spontaneously IL-4-secreting cells, reflecting the unstimulated in vivo secretion, was lower in the seropositive asymptomatic individuals compared with patients with chronic Borrelia infections (n = 13, P = 0.02), whereas no such difference was found compared with subacute Borrelia infections (n = 12). These findings indicate that IFN-γ secretion alone is not sufficient to eliminate Borrelia spirochaetes in humans, although IFN-γ may still have a beneficial role in borreliosis acting in concert with other mechanisms. PMID:10193424
Al-Tawfiq, Jaffar A; Al-Abdely, Hail M
2010-05-01
We report a case of invasive aspergillosis due to Aspergillus fumigatus involving the cervical and thoracic vertebrae and upper mediastinum of a 17 year-old Saudi male with chronic granulomatous disease (CGD). The patient did not respond to a long course of liposomal amphotericin B but did to surgical drainage and a combination of caspofungin and itraconazole with subsequent suppression with oral voriconazole. Fourteen months after the start of therapy, the patient had anterior dislocation of T2 thoracic vertebra with cord transection and quadriplegia. He was then treated intravenously with liquid itraconazole and interferon-gamma. The patient made a remarkable recovery over a 2-year period and was eventually able to walk independently. Thus, a combination of antifungals and interferon-gamma may have resulted in the positive outcome in this case.
Saldan, Alda; Mengoli, Carlo; Fiscon, Marta; Silvestre, Cristina; Fallico, Loredana; Peracchi, Marta; Furian, Lucrezia; Cusinato, Riccardo; Bonfante, Luciana; Rossi, Barbara; Marchini, Francesco; Sgarabotto, Dino; Rigotti, Paolo; Palù, Giorgio
2013-01-01
Assessing cytomegalovirus (CMV)-specific cell-mediated immunity (CMI) represents an appealing strategy for identifying transplant recipients at risk of infection. In this study, we compared two gamma interferon-releasing assays (IGRAs), Quantiferon-CMV and CMV enzyme-linked immunosorbent spot (ELISPOT), to determine the ability of each test to predict protective CMV-specific T-cell responses. Two hundred twenty-one Quantiferon-CMV and ELISPOT tests were conducted on 120 adult kidney transplant recipients (KTRs), including 100 CMV-seropositive transplant recipients (R+) and 20 CMV-seronegative transplant recipients of a CMV-positive donor (D+/R−). As a control cohort, 39 healthy adult subjects (including 33 CMV-seropositive and 6 CMV-seronegative subjects) were enrolled. CMV IgG serology was used as a reference for both tests. In the CMV-seropositive individuals, the ELISPOT and Quantiferon-CMV assays provided 46% concordance with the serology, 12% discordance, 18% disagreement between ELISPOT or Quantiferon-CMV and the serology, and 24% gray areas when one or both tests resulted in weak positives. None of the CMV-seronegative subjects showed detectable responses in the ELISPOT or the Quantiferon-CMV test. In transplant recipients, both the ELISPOT and Quantiferon-CMV assays positively correlated with each other and negatively correlated with CMV DNAemia in a significant way (P < 0.05). During the antiviral prophylaxis, all 20 D+/R− KTRs we examined displayed undetectable Quantiferon-CMV and ELISPOT results, and there was no evidence of CMV seroconversion. The receiving operator curve (ROC) statistical analysis revealed similar specificities and sensitivities in predicting detectable viremia (areas under the curve [AUC], 0.66 and 0.62 for Quantiferon-CMV and ELISPOT, respectively). ELISPOT and Quantiferon-CMV values of >150 spots/200,000 peripheral blood mononuclear cells (PBMCs) and >1 to 6 IU gamma interferon (IFN-γ) were associated with protection from CMV
Leung, Donald YM; Gao, Pei-Song; Grigoryev, Dmitry N; Rafaels, Nicholas M; Streib, Joanne E; Howell, Michael D; Taylor, Patricia A; Boguniewicz, Mark; Canniff, Jennifer; Armstrong, Brian; Zaccaro, Daniel J; Schneider, Lynda C; Hata, Tissa R; Hanifin, Jon M; Beck, Lisa A; Weinberg, Adriana; Barnes, Kathleen C
2011-01-01
Background The basis for increased susceptibility of atopic dermatitis (AD) patients to develop disseminated viral skin infections such as eczema herpeticum (ADEH+) is poorly understood. Objective We sought to determine whether atopic dermatitis subjects prone to disseminated viral skin infections have defects in their interferon responses. Methods GeneChip profiling was used to identify differences in gene expression of peripheral blood mononuclear cells (PBMC) from patients with a history of ADEH+ as compared to ADEH− and non-atopic controls. Key differences in protein expression were verified by ELISPOT and/or ELISA. Clinical relevance was further demonstrated by a mouse model of disseminated viral skin infection and genetic association analysis for genetic variants in IFNG and IFNGR1 and ADEH among 435 cases and controls. Results We demonstrate by global gene expression analysis selective transcriptomic changes within the interferon (IFN) superfamily of PBMCs from ADEH+ subjects reflecting low IFNγ and IFNγ receptor gene expression. IFNγ protein production was also significantly lower in ADEH+ (N=24) compared to ADEH− (N=20) and non-atopic (NA; N=20) controls. IFNγ receptor knockout (KO) mice developed disseminated viral skin infection after epicutaneous challenge with vaccinia virus (VV). Genetic variants in IFNG and IFNGR1 SNPs were significantly associated with ADEH (112 cases, 166 controls) and IFNγ production: a 2-SNP (A–G) IFNGR1 haplotype (rs10457655 and rs7749390) showed the strongest association with a reduced risk of ADEH+ ((13.2% ADEH+ vs 25.5% ADEH−, P = 0.00057). Conclusions ADEH+ patients have reduced IFNγ production, and IFNG and IFNGR1 SNPs are significantly associated with ADEH+ and may contribute to an impaired immune response to herpes simplex virus (HSV). Clinical Implications Atopic dermatitis subjects prone to disseminated viral skin infections have defects in their interferon responses. Capsule summary Using genomic
Corn, Radiah A; Aronica, Mark A; Zhang, Fuping; Tong, Yingkai; Stanley, Sarah A; Kim, Se Ryoung Agnes; Stephenson, Linda; Enerson, Ben; McCarthy, Susan; Mora, Ana; Boothby, Mark
2003-08-15
NF-kappaB/Rel transcription factors are linked to innate immune responses and APC activation. Whether and how the induction of NF-kappaB signaling in normal CD4(+) T cells regulates effector function are not well-understood. The liberation of NF-kappaB dimers from inhibitors of kappaB (IkappaBs) constitutes a central checkpoint for physiologic regulation of most forms of NF-kappaB. To investigate the role of NF-kappaB induction in effector T cell responses, we targeted inhibition of the NF-kappaB/Rel pathway specifically to T cells. The Th1 response in vivo is dramatically weakened when T cells defective in their NF-kappaB induction (referred to as IkappaBalpha(DeltaN) transgenic cells) are activated by a normal APC population. Analyses in vivo, and IL-12-supplemented T cell cultures in vitro, reveal that the mechanism underlying this T cell-intrinsic requirement for NF-kappaB involves activation of the IFN-gamma gene in addition to clonal expansion efficiency. The role of NF-kappaB in IFN-gamma gene expression includes a modest decrease in Stat4 activation, T box expressed in T cell levels, and differentiation efficiency along with a more prominent postdifferentiation step. Further, induced expression of Bcl-3, a trans-activating IkappaB-like protein, is decreased in T cells as a consequence of NF-kappaB inhibition. Together, these findings indicate that NF-kappaB induction in T cells regulates efficient clonal expansion, Th1 differentiation, and IFN-gamma production by Th1 lymphocytes at a control point downstream from differentiation.
Conrady, Christopher D.; Halford, William P.; Carr, Daniel J. J.
2011-01-01
The mouse model of genital herpes relies on medoxyprogesterone treatment of female mice to render the vaginal lumen susceptible to inoculation with herpes simplex virus 2 (HSV-2). In the present study, we report that mice deficient in the A1 chain of the type I interferon receptor (CD118−/−) are susceptible to HSV-2 in the absence of medroxyprogesterone preconditioning. In the absence of hormone pretreatment, 2,000 PFU of a clinical isolate of HSV-2 was sufficient to establish a productive infection in the vagina of 75% ± 17% and in the spinal cord of 71% ± 14% of CD118−/− mice, whereas the same dose of HSV-2 replicated to detectable levels in only 13% ± 13% of vaginal samples and 0% of spinal cord samples from wild-type mice, as determined at day 5 postinfection. The susceptibility to HSV-2 infection in the CD118−/− mice was associated with a significant reduction in the infiltration of HSV-specific cytotoxic T lymphocytes into the vaginal tissue, the local production of gamma interferon (IFN-γ), and the expression of T cell-recruiting chemokines CCL5, CXCL9, and CXCL10. Collectively, the results underscore the significant contribution of type I IFNs in resistance to genital HSV-2 infection. PMID:21147921
Skorokhod, Oleksii A; Schwarzer, Evelin; Ceretto, Monica; Arese, Paolo
2007-01-01
Background Enhanced production of nitric oxide (NO) following upmodulation of the inducible isoform of NO synthase (iNOS) by haemozoin (HZ), inflammatory cytokines and LPS may provide protection against Plasmodium falciparum malaria by killing hepatic and blood forms of parasites and inhibiting the cytoadherence of parasitized erythrocytes (RBC) to endothelial cells. Monocytes and macrophages are considered to contribute importantly to protective upregulation of iNOS and production of NO. Data obtained with murine phagocytes fed with human HZ and synthetic HZ (sHZ) indicate that supplemental treatment of those cells with IFN-gamma elicited significant increases in protein and mRNA expression of iNOS and NO production, providing a potential mechanism linking HZ phagocytosis and increased production of NO. Purpose of this study was to analyse the effect of P. falciparum HZ and sHZ supplemental to treatment with IFN-gamma and/or a stimulatory cytokine-LPS mix on iNOS protein and mRNA expression in immuno-purified human monocytes. Methods Adherent immunopurified human monocytes (purity >85%), and murine phagocytic cell lines RAW 264.7, N11 and ANA1 were fed or not with P. falciparum HZ or sHZ and treated or not with IFN-gamma or a stimulatory cytokine-LPS mix. Production of NO was quantified in supernatants, iNOS protein and mRNA expression were measured after immunoprecipitation and Western blotting and quantitative RT-PCT, respectively. Results Phagocytosis of HZ/sHZ by human monocytes did not increase iNOS protein and mRNA expression and NO production either after stimulation by IFN-gamma or the cytokine-LPS mix. By contrast, in HZ/sHZ-laden murine macrophages, identical treatment with IFN-gamma and the cytokine-LPS mix elicited significant increases in protein and mRNA expression of iNOS and NOS metabolites production, in agreement with literature data. Conclusion Results indicate that human monocytes fed or not with HZ/sHZ were constantly unable to express i
Carlin, Aaron F; Plummer, Emily M; Vizcarra, Edward A; Sheets, Nicholas; Joo, Yunichel; Tang, William; Day, Jeremy; Greenbaum, Jay; Glass, Christopher K; Diamond, Michael S; Shresta, Sujan
2017-11-07
Interferon-regulatory factors (IRFs) are a family of transcription factors (TFs) that translate viral recognition into antiviral responses, including type I interferon (IFN) production. Dengue virus (DENV) and other clinically important flaviviruses are suppressed by type I IFN. While mice lacking the type I IFN receptor (Ifnar1 -/- ) succumb to DENV infection, we found that mice deficient in three transcription factors controlling type I IFN production (Irf3 -/- Irf5 -/- Irf7 -/- triple knockout [TKO]) survive DENV challenge. DENV infection of TKO mice resulted in minimal type I IFN production but a robust type II IFN (IFN-γ) response. Using loss-of-function approaches for various molecules, we demonstrate that the IRF-3-, IRF-5-, IRF-7-independent pathway predominantly utilizes IFN-γ and, to a lesser degree, type I IFNs. This pathway signals via IRF-1 to stimulate interleukin-12 (IL-12) production and IFN-γ response. These results reveal a key antiviral role for IRF-1 by activating both type I and II IFN responses during DENV infection. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Sauerhering, Lucie; Müller, Helena; Behner, Laura; Elvert, Mareike; Fehling, Sarah Katharina; Strecker, Thomas; Maisner, Andrea
2017-10-01
Highly pathogenic Nipah virus (NiV) generally causes severe encephalitis in humans. Respiratory symptoms are infrequently observed, likely reflecting variations in infection kinetics in human airways. Supporting this idea, we recently identified individual differences in NiV replication kinetics in cultured airway epithelia from different human donors. As type III interferons (IFN-λ) represent major players in the defence mechanism against viral infection of the respiratory mucosa, we studied IFN-λ induction and antiviral activity in NiV-infected primary differentiated human bronchial epithelial cells (HBEpCs) cultured under air-liquid interface conditions. Our studies revealed that IFN-λ was upregulated in airway epithelia upon NiV infection. We also show that IFN-λ pretreatment efficiently inhibited NiV replication. Interestingly, the antiviral activity of IFN-λ varied in HBEpCs from two different donors. Increased sensitivity to IFN-λ was associated with higher expression levels of IFN-λ receptors, enhanced phosphorylation of STAT1, as well as enhanced induction of interferon-stimulated gene expression. These findings suggest that individual variations in IFN-λ receptor expression affecting IFN responsiveness can play a functional role for NiV replication kinetics in human respiratory epithelial cells of different donors.
A CpG oligonucleotide can protect mice from a low aerosol challenge dose of Burkholderia mallei.
Waag, David M; McCluskie, Michael J; Zhang, Ningli; Krieg, Arthur M
2006-03-01
Treatment with an oligodeoxynucleotide (ODN) containing CPG motifs (CpG ODN 7909) was found to protect BALB/c mice from lung infection or death after aerosol challenge with Burkholderia mallei. Protection was associated with enhanced levels of gamma interferon (IFN-gamma)-inducible protein 10, interleukin-12 (IL-12), IFN-gamma, and IL-6. Preexposure therapy with CpG ODNs may protect victims of a biological attack from glanders.
ATM supports gammaherpesvirus replication by attenuating type I interferon pathway.
Darrah, Eric J; Stoltz, Kyle P; Ledwith, Mitchell; Tarakanova, Vera L
2017-10-01
Ataxia-Telangiectasia mutated (ATM) kinase participates in multiple networks, including DNA damage response, oxidative stress, and mitophagy. ATM also supports replication of diverse DNA and RNA viruses. Gammaherpesviruses are prevalent cancer-associated viruses that benefit from ATM expression during replication. This proviral role of ATM had been ascribed to its signaling within the DNA damage response network; other functions of ATM have not been considered. In this study increased type I interferon (IFN) responses were observed in ATM deficient gammaherpesvirus-infected macrophages. Using a mouse model that combines ATM and type I IFN receptor deficiencies we show that increased type I IFN response in the absence of ATM fully accounts for the proviral role of ATM during gammaherpesvirus replication. Further, increased type I IFN response rendered ATM deficient macrophages more susceptible to antiviral effects of type II IFN. This study identifies attenuation of type I IFN responses as the primary mechanism underlying proviral function of ATM during gammaherpesvirus infection. Copyright © 2017 Elsevier Inc. All rights reserved.
Zhao, Hongjing; Ma, Jian; Wang, Yu; Liu, Juanjuan; Shao, Yizhi; Li, Jinglun; Jiang, Guangshun; Xing, Mingwei
2017-12-01
Interferon has a broad-spectrum of antiviral effects and represents an ideal choice for the development of antiviral drugs. Nonetheless, information about alpha interferon (IFN-α) is vacant in Amur tiger (Panthera tigris altaica), an endangered species and indigenous to northeast Asia. Herein, 11 PtIFN-αs genes, which encoded proteins of 164-165 amino acids, were amplified. Afterwards, expression and purification were conducted in Escherichia coli. In physicochemical analysis, PtIFN-αs were shown to be highly sensitive to trypsin and remained stable despite changes in pH and temperature. In feline kidney cells (F81)/vesicular stomatitis virus (VSV)/canine distemper virus (CDV)/avian influenza virus (AIV) systems, PtIFN-αs were demonstrated to have distinct antiviral activities, some of them (PtIFN-α and PtIFN-α9) inhibited viral transcription levels more effectively than the other subtypes including Felis catus IFN-α, an effective therapeutic agent used for viral infections clinically. Additionally, PtIFN-α and PtIFN-α9 can up-regulate the transcription and expression of p53, a tumor suppressor factor, which could promote apoptosis of virus-infected cells. In conclusion, we cloned and expressed 11 subtypes of PtIFN-α for the first time. Furthermore, PtIFN-α and PtIFN-α9 were likely to be more efficient against both chronic viral infections and neoplastic diseases that affect the Amur tiger population. It will be of significant importance for further studies to protect this endangered species. Copyright © 2017. Published by Elsevier Ltd.
Li, Ping; Shi, Ming-Lei; Shen, Wen-Long; Zhang, Zhang; Xie, De-Jian; Zhang, Xiang-Yuan; He, Chao; Zhang, Yan; Zhao, Zhi-Hu
2017-08-01
Interferon-induced transmembrane protein (IFITM) 1, 2 and 3 genes encode a family of interferon (IFN)-induced transmembrane proteins that block entry of a broad spectrum of pathogens. However, the transcriptional regulation of these genes, especially whether there exist any enhancers and their roles during the IFN induction process remain elusive. Here, through public data mining, episomal luciferase reporter assay and in vivo CRISPR-Cas9 genome editing, we identified an IFN-responsive enhancer located 35kb upstream of IFITM3 gene promoter upregulating the IFN-induced expression of IFITM1, 2 and 3 genes. Chromatin immunoprecipitation (ChIP), electrophoretic mobility shift assay (EMSA) and luciferase reporter assay demonstrated that signal transducers and activators of transcription (STAT) 1 bound to the enhancer with the treatment of IFN and was indispensable for the enhancer activity. Furthermore, using chromosome conformation capture technique, we revealed that the IFITM1, 2 and 3 genes physically clustered together and constitutively looped to the distal enhancer through long-range interactions in both HEK293 and A549 cells, providing structural basis for coordinated regulation of IFITM1, 2 and 3 by the enhancer. Finally, we showed that in vivo truncation of the enhancer impaired IFN-induced resistance to influenza A virus (IAV) infection. These findings expand our understanding of the mechanisms underlying the transcriptional regulation of IFITM1, 2 and 3 expression and its ability to mediate IFN signaling. Copyright © 2017 Elsevier B.V. All rights reserved.
Type III IFNs are produced by and stimulate human plasmacytoid dendritic cells1
Yin, Zhiwei; Dai, Jihong; Deng, Jing; Sheikh, Faruk; Natalia, Mahwish; Shih, Tiffany; Lewis-Antes, Anita; Amrute, Sheela B.; Garrigues, Ursula; Doyle, Sean; Donnelly, Raymond P; Kotenko, Sergei V; Fitzgerald-Bocarsly, Patricia
2012-01-01
Plasmacytoid dendritic cells (pDC) are rare cells found in peripheral blood and lymphoid tissues. pDC are considered to be “professional” type I interferon (IFN) producing cells and produce 10–100-fold more IFN-α than other cell types in response to enveloped viruses or synthetic TLR-7 and -9 agonists. In this study, purified pDC were found to express high levels of IFN-λ receptor mRNA as well as cell-surface IFN-λ receptor. We have developed intracellular flow cytometry assays using antibodies to IFN-λ1/3 or -λ2 to assess the expression of IFN-λ proteins by pDC. We observed that a subset of human pDC expresses only intracellular IFN-α while another subset produces both IFN-α and IFN-λ after stimulation with virus or the TLR9 agonist, CpGA; the cells that co-expressed IFN-α and IFN-λ were the cells with the highest levels of IFN-α expression. Antibody cross-linking of CD4 or BDCA-2 molecules on pDC inhibited both HSV-induced IFN-λ and IFN-α production. Like the production of IFN-α, the HSV-induced IFN-λ production in pDC was mediated through TLR9 and independent of virus replication. Exogenous IFN-λ treatment of pDC resulted in increased virus-induced expression of both IFN-α and IFN-λ. In addition, both exogenous IFN-λ and –α inhibited dexamethasone-induced apoptosis of pDC. We conclude that pDC are major producers of IFN-λ1 and –λ2 in response to viral stimulation and also express functional receptors for this cytokine. Thus, IFN-λ can serve as an autocrine signal to strengthen the antiviral response of pDC by increasing IFN-α and IFN-λ production, resulting in prolonged pDC survival. PMID:22891284
Dickensheets, Harold; Sheikh, Faruk; Park, Ogyi; Gao, Bin; Donnelly, Raymond P.
2013-01-01
This study compared the ability of IFN-α and IFN-λ to induce signal transduction and gene expression in primary human hepatocytes, PBLs, and monocytes. IFN-α drug products are widely used to treat chronic HCV infection; however, IFN-α therapy often induces hematologic toxicities as a result of the broad expression of IFNARs on many cell types, including most leukocytes. rIFN-λ1 is currently being tested as a potential alternative to IFN-α for treating chronic HCV. Although IFN-λ has been shown to be active on hepatoma cell lines, such as HepG2 and Huh-7, its ability to induce responses in primary human hepatocytes or leukocytes has not been examined. We found that IFN-λ induces activation of Jak/STAT signaling in mouse and human hepatocytes, and the ability of IFN-λ to induce STAT activation correlates with induction of numerous ISGs. Although the magnitude of ISG expression induced by IFN-λ in hepatocytes was generally lower than that induced by IFN-α, the repertoire of regulated genes was quite similar. Our findings demonstrate that although IFN-α and IFN-λ signal through distinct receptors, they induce expression of a common set of ISGs in hepatocytes. However, unlike IFN-α, IFN-λ did not induce STAT activation or ISG expression by purified lymphocytes or monocytes. This important functional difference may provide a clinical advantage for IFN-λ as a treatment for chronic HCV infection, as it is less likely to induce the leukopenias that are often associated with IFN-α therapy. PMID:23258595
Silvestre, Ricardo; Cordeiro-Da-Silva, Anabela; Santarém, Nuno; Vergnes, Baptiste; Sereno, Denis; Ouaissi, Ali
2007-09-01
The ability to manipulate the Leishmania genome to create genetically modified parasites by introducing or eliminating genes is considered a powerful alternative for developing a new generation vaccine against leishmaniasis. Previously, we showed that the deletion of one allele of the Leishmania infantum silent information regulatory 2 (LiSIR2) locus was sufficient to dramatically affect amastigote axenic proliferation. Furthermore, LiSIR2 single knockout (LiSIR2(+/-)) amastigotes were unable to replicate in vitro inside macrophages. Because this L. infantum mutant persisted in BALB/c mice for up to 6 wk but failed to establish an infection, we tested its ability to provide protection toward a virulent L. infantum challenge. Strikingly, vaccination with a single i.p. injection of LiSIR2(+/-) single knockout elicits complete protection. Thus, vaccinated BALB/c mice showed a reversal of T cell anergy with specific anti-Leishmania cytotoxic activity and high levels of NO production. Moreover, vaccinated mice simultaneously generated specific anti-Leishmania IgG Ab subclasses suggestive of both type 1 and type 2 responses. A strong correlation was found between the elimination of the parasites and an increased Leishmania-specific IFN-gamma/IL-10 ratio. Therefore, we propose that the polarization to a high IFN-gamma/low IL-10 ratio after challenge is a clear indicator of vaccine success. Furthermore these mutants, which presented attenuated virulence, represent a good model to understand the correlatives of protection in visceral leishmaniasis.
Salim, Taha; Sershen, Cheryl L; May, Elebeoba E
2016-01-01
Macrophage produced inducible nitric oxide synthase (iNOS) is known to play a critical role in the proinflammatory response against intracellular pathogens by promoting the generation of bactericidal reactive nitrogen species. Robust and timely production of nitric oxide (NO) by iNOS and analogous production of reactive oxygen species are critical components of an effective immune response. In addition to pathogen associated lipopolysaccharides (LPS), iNOS gene expression is dependent on numerous proinflammatory cytokines in the cellular microenvironment of the macrophage, two of which include interferon gamma (IFN-γ) and tumor necrosis factor alpha (TNF-α). To understand the synergistic effect of IFN-γ and TNF-α activation, and LPS stimulation on iNOS expression dynamics and NO production, we developed a systems biology based mathematical model. Using our model, we investigated the impact of pre-infection cytokine exposure, or priming, on the system. We explored the essentiality of IFN-γ priming to the robustness of initial proinflammatory response with respect to the ability of macrophages to produce reactive species needed for pathogen clearance. Results from our theoretical studies indicated that IFN-γ and subsequent activation of IRF1 are essential in consequential production of iNOS upon LPS stimulation. We showed that IFN-γ priming at low concentrations greatly increases the effector response of macrophages against intracellular pathogens. Ultimately the model demonstrated that although TNF-α contributed towards a more rapid response time, measured as time to reach maximum iNOS production, IFN-γ stimulation was significantly more significant in terms of the maximum expression of iNOS and the concentration of NO produced.
Type I interferons in tuberculosis: Foe and occasionally friend.
Moreira-Teixeira, Lúcia; Mayer-Barber, Katrin; Sher, Alan; O'Garra, Anne
2018-05-07
Tuberculosis remains one of the leading causes of mortality worldwide, and, despite its clinical significance, there are still significant gaps in our understanding of pathogenic and protective mechanisms triggered by Mycobacterium tuberculosis infection. Type I interferons (IFN) regulate a broad family of genes that either stimulate or inhibit immune function, having both host-protective and detrimental effects, and exhibit well-characterized antiviral activity. Transcriptional studies have uncovered a potential deleterious role for type I IFN in active tuberculosis. Since then, additional studies in human tuberculosis and experimental mouse models of M. tuberculosis infection support the concept that type I IFN promotes both bacterial expansion and disease pathogenesis. More recently, studies in a different setting have suggested a putative protective role for type I IFN. In this study, we discuss the mechanistic and contextual factors that determine the detrimental versus beneficial outcomes of type I IFN induction during M. tuberculosis infection, from human disease to experimental mouse models of tuberculosis. © 2018 Moreira-Teixeira et al.
Vaillier, D; Daculsi, R; Gualde, N
1992-01-01
Splenocytes cultured for 24 h in the presence of interleukin-2 (IL-2), lipopolysaccharide (LPS) or both together expressed a cytotoxic activity against the YAC-1 lymphoma cell line and to a lesser extent against P815 mastocytoma cells. The association of IL-2 and LPS had an additive effect on induction of cytotoxicity. The IL-2-induced cytotoxic activity lasted for the whole of the culture; however, the addition of LPS at the initiation of the culture increased the cytotoxic activity during its the early phase, the increment being followed by a fall of lytic activity after 72 h of culture. Assessment of interferon (IFN) in the culture supernatants showed (a) a production of IFN gamma by IL-2-supplemented cultures, (b) a more potent IFN production by cultures treated with IL-2 plus LPS (including 20% IFN alpha/beta, (c) and that indomethacin (1 microM) potentiated the effect of either IL-2 or LPS used alone but did not significantly increase the cytotoxic activity of cultures treated with IL-2 plus LPS (the one that produced a high level of IFN). When cultures were treated by an anti-IFN gamma antibody we observed no change in the cytotoxic activity; however, in the presence of anti-IFN alpha/beta serum the cytotoxic activity of cultures treated with IL-2 plus LPS was inhibited after 24 h but stimulated after 72 h. When cultures treated with IL-2 plus LPS were supplemented with both indomethacin and anti-IFN alpha/beta the cytotoxic activity assessed after 72 h of culture was maintained at the same level as that of IL-2-treated cultures, hence the fall after 72 h of the cytotoxicity of cultures initiated in the presence of LPS alone was affected by both the immune serum and the cyclooxygenase inhibitor. Altogether these data show that when splenocytes are cultured for more than 72 h in the presence of IL-2 and LPS their cytotoxic activity decreases, and it is likely that this diminution is linked to the endogenous production of prostaglandin E2 and INF alpha/beta.
Kiyota, Tsuyoshi; Takahashi, Yuki; Watcharanurak, Kanitta; Nishikawa, Makiya; Ohara, Saori; Ando, Mitsuru; Watanabe, Yoshihiko; Takakura, Yoshinobu
2014-05-05
Tumor-associated macrophages (TAMs) negatively affect the therapeutic effects of anticancer agents. To examine the role of TAMs in interferon (IFN)-γ gene therapy, we selected two types of solid tumors, which varied in the number of TAMs, and investigated the effects of IFN-γ gene transfer on tumor growth. Many TAMs were detected in the solid tumors of murine adenocarcinoma colon-26 cells, whereas few TAMs were detected in murine melanoma B16-BL6 cells. IFN-γ gene transfer hardly suppressed the growth of colon-26 tumors, whereas it was effective in suppressing the growth of B16-BL6 tumors. The antiproliferative effects of IFN-γ on cultured colon-26 cells were similar to those on cultured B16-BL6 cells. To evaluate the role of TAMs, we injected clodronate liposomes (CLs) modified with poly(ethylene glycol) (PEG) to functionally deplete TAMs in tumor-bearing mice. Repeated injections of PEG-CLs significantly retarded the growth of colon-26 tumors and combination with IFN-γ gene transfer further inhibited the growth. In contrast, PEG-CLs hardly retarded the growth of B16-BL6 tumors. These results clearly indicate that TAM depletion is effective in enhancing the therapeutic effect of IFN-γ in TAM-repleted and IFN-γ-resistant tumors.
Smart, Joanne M; Horak, Elisabeth; Kemp, Andrew S; Robertson, Colin F; Tang, Mimi L K
2002-09-01
Atopic disease is associated with skewing of immune responses away from a T(H)1 toward a T(H)2 profile. Previous studies have implicated this cytokine imbalance in the development of disease. However, it is not known whether normalization of this imbalance is conversely associated with disease resolution. To further delineate the role of reduced T(H)1 and increased T(H)2 cytokine production in the pathogenesis of atopic disease and to determine whether disease resolution is associated with alteration of cytokine profiles, we investigated cytokine responses in a cohort of adult patients with asthma followed from childhood. A cohort of wheezy children and control subjects aged 7 to 10 years were recruited from 1964 to 1967. Subjects were reevaluated every 7 years to monitor the outcome of childhood asthma. At the 42-year follow-up, 89 subjects from this cohort were evaluated for mitogen and house dust mite (HDM)-induced T(H)1 (IFN-gamma) and T(H)2 (IL-4, IL-5, and IL-13) cytokine responses. Cytokine responses were compared in patients with ongoing asthma, patients with resolved asthma, and control subjects. Patients with severe ongoing asthma had significantly reduced HDM-induced IFN-gamma production compared with that of control subjects and patients with resolved asthma. In contrast, HDM-induced IFN-gamma production in patients with resolved asthma was equivalent to that seen in control subjects. Patients with ongoing and resolved asthma produced significantly higher levels of IL-5 in response to HDM compared with that seen in control subjects, with levels being equivalent in patients with active and resolved asthma. HDM-induced IL-13 production was significantly increased in the patients with resolved asthma when compared with that seen in the control subjects. PHA-induced cytokine responses did not parallel HDM-induced responses. Patients with persistent and severe atopic asthma have a reduced HDM-induced T(H)1 response, whereas those with resolved asthma do not
Type I Interferon Controls Propagation of Long Interspersed Element-1*
Yu, Qiujing; Carbone, Christopher J.; Katlinskaya, Yuliya V.; Zheng, Hui; Zheng, Ke; Luo, Mengcheng; Wang, P. Jeremy; Greenberg, Roger A.; Fuchs, Serge Y.
2015-01-01
Type I interferons (IFN) including IFNα and IFNβ are critical for the cellular defense against viruses. Here we report that increased levels of IFNβ were found in testes from mice deficient in MOV10L1, a germ cell-specific RNA helicase that plays a key role in limiting the propagation of retrotransposons including Long Interspersed Element-1 (LINE-1). Additional experiments revealed that activation of LINE-1 retrotransposons increases the expression of IFNβ and of IFN-stimulated genes. Conversely, pretreatment of cells with IFN suppressed the replication of LINE-1. Furthermore, the efficacy of LINE-1 replication was increased in isogenic cell lines harboring inactivating mutations in diverse elements of the IFN signaling pathway. Knockdown of the IFN receptor chain IFNAR1 also stimulated LINE-1 propagation in vitro. Finally, a greater accumulation of LINE-1 was found in mice that lack IFNAR1 compared with wild type mice. We propose that LINE-1-induced IFN plays an important role in restricting LINE-1 propagation and discuss the putative role of IFN in preserving the genome stability. PMID:25716322
LAGIER, B; LEBEL, B; BOUSQUET, J; PÈNE, J
1997-01-01
Histamine, an important inflammatory mediator in allergic diseases and asthma, has been reported to have modulator effects on T cells, suggesting that the bronchial microenvironment may regulate the function of resident T cells. We examined the effect of histamine on the release of the Th2-associated cytokines IL-4 and IL-5 and the Th1-associated cytokine IFN-γ by 30 CD4+ T cell clones from peripheral blood or bronchial biopsy of one atopic subject. Based on the IL-4/IFN-γ ratio, the clones were ascribed to the Th2 (ratio >1), Th0 (ratio ⩾ 0.1 and ⩽1) or Th1 (ratio <0.1) phenotype. Histamine inhibited IFN-γ production by Th1-like cells (P<0.02, Kruskall–Wallis), especially from bronchial biopsy, but had no effect on IL-4 release. Regarding Th0 clones, histamine inhibited IL-4 production (P<0.02) in a dose-dependent manner and slightly inhibited IFN-γ production, but had no effect on Th2-like cells. Histamine had a heterogeneous and insignificant effect on IL-5 production. The H2-receptor antagonist ranitidine completely reversed the inhibition of IL-4 and IFN-γ production, whereas the agonist dimaprit mimicked this effect. In contrast, H1- and H3-receptor agonists and antagonists had no significant effect. These data demonstrate that histamine has different effects on IL-4 and IFN-γ release by T helper cells according to their phenotype via H2-receptors. This study extends the immunomodulatory effects of histamine which may contribute to the perpetuation of airway inflammation in asthma. PMID:9182905
Type I Interferon Responses by HIV-1 Infection: Association with Disease Progression and Control.
Soper, Andrew; Kimura, Izumi; Nagaoka, Shumpei; Konno, Yoriyuki; Yamamoto, Keisuke; Koyanagi, Yoshio; Sato, Kei
2017-01-01
Human immunodeficiency virus type 1 (HIV-1) is the causative agent of acquired immunodeficiency syndrome and its infection leads to the onset of several disorders such as the depletion of peripheral CD4 + T cells and immune activation. HIV-1 is recognized by innate immune sensors that then trigger the production of type I interferons (IFN-Is). IFN-Is are well-known cytokines eliciting broad anti-viral effects by inducing the expression of anti-viral genes called interferon-stimulated genes (ISGs). Extensive in vitro studies using cell culture systems have elucidated that certain ISGs such as APOBEC3G, tetherin, SAM domain and HD domain-containing protein 1, MX dynamin-like GTPase 2, guanylate-binding protein 5, and schlafen 11 exert robust anti-HIV-1 activity, suggesting that IFN-I responses triggered by HIV-1 infection are detrimental for viral replication and spread. However, recent studies using animal models have demonstrated that at both the acute and chronic phase of infection, the role of IFN-Is produced by HIV or SIV infection in viral replication, spread, and pathogenesis, may not be that straightforward. In this review, we describe the pluses and minuses of HIV-1 infection stimulated IFN-I responses on viral replication and pathogenesis, and further discuss the possibility for therapeutic approaches.
Pig but not Human Interferon-γ Initiates Human Cell-Mediated Rejection of Pig Tissue in vivo
NASA Astrophysics Data System (ADS)
Sultan, Parvez; Murray, Allan G.; McNiff, Jennifer M.; Lorber, Marc I.; Askenase, Philip W.; Bothwell, Alfred L. M.; Pober, Jordan S.
1997-08-01
Split-thickness pig skin was transplanted on severe combined immunodeficient mice so that pig dermal microvessels spontaneously inosculated with mouse microvessels and functioned to perfuse the grafts. Pig endothelial cells in the healed grafts constitutively expressed class I and class II major histocompatibility complex molecules. Major histocompatibility complex molecule expression could be further increased by intradermal injection of pig interferon-γ (IFN-γ ) but not human IFN-γ or tumor necrosis factor. Grafts injected with pig IFN-γ also developed a sparse infiltrate of mouse neutrophils and eosinophils without evidence of injury. Introduction of human peripheral blood mononuclear cells into the animals by intraperitoneal inoculation resulted in sparse perivascular mononuclear cell infiltrates in the grafts confined to the pig dermis. Injection of pig skin grafts on mice that received human peripheral blood mononuclear cells with pig IFN-γ (but not human IFN-γ or heat-inactivated pig IFN-γ ) induced human CD4+ and CD8+ T cells and macrophages to more extensively infiltrate the pig skin grafts and injure pig dermal microvessels. These findings suggest that human T cell-mediated rejection of xenotransplanted pig organs may be prevented if cellular sources of pig interferon (e.g., passenger lymphocytes) are eliminated from the graft.
Zinc is a potent and specific inhibitor of IFN-λ3 signalling
Read, Scott A.; O'Connor, Kate S.; Suppiah, Vijay; Ahlenstiel, Chantelle L. E.; Obeid, Stephanie; Cook, Kristina M.; Cunningham, Anthony; Douglas, Mark W.; Hogg, Philip J.; Booth, David; George, Jacob; Ahlenstiel, Golo
2017-01-01
Lambda interferons (IFNL, IFN-λ) are pro-inflammatory cytokines important in acute and chronic viral infection. Single-nucleotide polymorphisms rs12979860 and rs8099917 within the IFNL gene locus predict hepatitis C virus (HCV) clearance, as well as inflammation and fibrosis progression in viral and non-viral liver disease. The underlying mechanism, however, is not defined. Here we show that the rs12979860 CC genotype correlates with increased hepatic metallothionein expression through increased systemic zinc levels. Zinc interferes with IFN-λ3 binding to IFNL receptor 1 (IFNLR1), resulting in decreased antiviral activity and increased viral replication (HCV, influenza) in vitro. HCV patients with high zinc levels have low hepatocyte antiviral and inflammatory gene expression and high viral loads, confirming the inhibitory role of zinc in vivo. We provide the first evidence that zinc can act as a potent and specific inhibitor of IFN-λ3 signalling and highlight its potential as a target of therapeutic intervention for IFN-λ3-mediated chronic disease. PMID:28513591
Flores, Jose; DuPont, Herbert L; Paredes-Paredes, Mercedes; Aguirre-Garcia, M Magdalena; Rojas, Araceli; Gonzalez, Alexei; Okhuysen, Pablo C
2010-05-01
Enterotoxigenic Escherichia coli (ETEC), which produces heat-labile toxin (LT), is a common cause of travelers' diarrhea (TD). The B subunit of ETEC LT is immunologically related to the B subunit of Vibrio cholerae toxin (CT). In this pilot study we evaluated the whole-blood gamma interferon response to CT B in 17 U.S. adults traveling to Mexico. Only one of nine subjects who demonstrated a cellular immune response as determined by whole-blood gamma interferon production to CT B on arrival to Mexico developed diarrhea, whereas five of eight without a cellular response developed diarrhea. Markers of the cellular immune response to ETEC LT could help in identifying individuals immune to ETEC LT, and these markers deserve additional study.
Interferon-alpha, immune activation and immune dysfunction in treated HIV infection
Cha, Lilian; Berry, Cassandra M; Nolan, David; Castley, Allison; Fernandez, Sonia; French, Martyn A
2014-01-01
Type I interferons (IFNs) exert anti-viral effects through the induction of numerous IFN-stimulated genes and an immunomodulatory effect on innate and adaptive immune responses. This is beneficial in controlling virus infections but prolonged IFN-α activity in persistent virus infections, such as HIV infection, may contribute to immune activation and have a detrimental effect on the function of monocytes and T and B lymphocytes. Activation of monocytes, associated with increased IFN-α activity, contributes to atherosclerotic vascular disease, brain disease and other ‘age-related diseases' in HIV patients treated with long-term antiretroviral therapy (ART). In HIV patients receiving ART, the anti-viral effects of IFN-α therapy have the potential to contribute to eradication of HIV infection while IFN-α inhibitor therapy is under investigation for the treatment of immune activation. The management of HIV patients receiving ART will be improved by understanding more about the opposing effects of IFN-α on HIV infection and disease and by developing methods to assess IFN-α activity in clinical practice. PMID:25505958
How Ebola virus counters the interferon system.
Kühl, A; Pöhlmann, S
2012-09-01
Zoonotic transmission of Ebola virus (EBOV) to humans causes a severe haemorrhagic fever in afflicted individuals with high case-fatality rates. Neither vaccines nor therapeutics are at present available to combat EBOV infection, making the virus a potential threat to public health. To devise antiviral strategies, it is important to understand which components of the immune system could be effective against EBOV infection. The interferon (IFN) system constitutes a key innate defence against viral infections and prevents development of lethal disease in mice infected with EBOV strains not adapted to this host. Recent research revealed that expression of the host cell IFN-inducible transmembrane proteins 1-3 (IFITM1-3) and tetherin is induced by IFN and restricts EBOV infection, at least in cell culture model systems. IFITMs, tetherin and other effector molecules of the IFN system could thus pose a potent barrier against EBOV spread in humans. However, EBOV interferes with signalling events required for human cells to express these proteins. Here, we will review the strategies employed by EBOV to fight the IFN system, and we will discuss how IFITM proteins and tetherin inhibit EBOV infection. © 2012 Blackwell Verlag GmbH.
Update on PEG-interferon α-2b as adjuvant therapy in melanoma.
Di Trolio, Rossella; Simeone, Ester; Di Lorenzo, Giuseppe; Grimaldi, Antonio Maria; Romano, Anna; Ayala, Fabrizio; Caracò, Corrado; Mozzillo, Nicola; Ascierto, Paolo A
2012-09-01
Based on the results of European Organization for Research and Treatment of Cancer (EORTC) 18991 trial, the US Food and Drug Administration (FDA) approved PEG-interferon α-2b (PEG-IFN) (Sylatron) as adjuvant therapy for high-risk melanoma. The EORTC 18991 trial was an open-label study of resectable stage III melanoma with 1,256 patients who were randomized to observation-alone or to treatment with PEG-IFN for up to 5 years. The median recurrence-free survival of the treatment groups was significantly longer, while overall survival, a secondary endpoint, was not significantly different between the two groups. This review, after a short summary of interferon α-2b trials, critically analyzes the EORTC18991 trial, as well as the subgroup results and future perspectives for this stage of disease.
Palesch, David; Bosinger, Steven E; Mavigner, Maud; Billingsley, James M; Mattingly, Cameron; Carnathan, Diane; Paiardini, Mirko; Chahroudi, Ann; Vanderford, Thomas; Silvestri, Guido
2018-05-02
The major obstacle to HIV-1 eradication is a reservoir of latently infected cells that persists despite long-term antiretroviral therapy (ART) and causes rapid viral rebound if treatment is interrupted. Type I interferons are immunomodulatory cytokines that induce antiviral factors and have been evaluated for the treatment of HIV-infected individuals, resulting in moderate reduction of viremia and inconclusive data about their effect on reservoir size. Here, we assessed the potential of pegylated IFN-α2a (pIFN-α2a) to reduce the viral reservoir in SIV-infected, ART-treated rhesus macaques (RMs). We found that pIFN-α2a treatment of animals in which virus replication is effectively suppressed with ART is safe and well-tolerated as no major clinical side effects were observed. By monitoring the cellular immune response during this intervention, we established that pIFN-α2a administration is not associated with either CD4 + T cell depletion or increased immune activation. Importantly, we found that Interferon Stimulated Genes (ISGs) were significantly up-regulated in IFN-treated RMs when compared to control animals, confirming that pIFN-α2a is bioactive in vivo. To evaluate the effect of pIFN-α2a administration on the viral reservoir in CD4 + T cells, we performed cell-associated proviral SIV DNA measurements in multiple tissues and assessed levels of replication-competent virus by a quantitative viral outgrowth assay (QVOA). These analyses failed to reveal any significant difference in reservoir size between IFN-treated and control animals. In summary, our data suggest that short-term type I interferon treatment in combination with suppressive ART is not sufficient to induce a significant reduction of the viral reservoir in SIV-infected RMs. IMPORTANCE The potential of type I interferons to reduce the viral reservoir has been recently studied in clinical trials in HIV-infected humans. However, given the lack of mechanistic data and the potential for safety
Visser, J; Blauw, B; Hinloopen, B; Brommer, E; de Kloet, E R; Kluft, C; Nagelkerken, L
1998-02-01
A disturbed hypothalamus-pituitary-adrenal gland axis and alterations at the immune system level have been observed in patients with chronic fatigue syndrome (CFS). Glucocorticoids are known to modulate T cell responses; therefore, purified CD4 T cells from CFS patients were studied to determine whether they have an altered sensitivity to dexamethasone (DEX). CD4 T cells from CFS patients produced less interferon-gamma than did cells from controls; by contrast, interleukin-4 production and cell proliferation were comparable. With CD4 T cells from CFS patients (compared with cells from controls), a 10- to 20-fold lower DEX concentration was needed to achieve 50% inhibition of interleukin-4 production and proliferation, indicating an increased sensitivity to DEX in CFS patients. Surprisingly, interferon-gamma production in patients and controls was equally sensitive to DEX. A differential sensitivity of cytokines or CD4 T cell subsets to glucocorticoids might explain an altered immunologic function in CFS patients.
Systemic production of IFN-alpha by garlic (Allium sativum) in humans.
Bhattacharyya, Mau; Girish, G V; Karmohapatra, Soumendra K; Samad, S A; Sinha, Asru K
2007-05-01
The effect of foods on the production of interferon-alpha (IFN-alpha) is currently unknown. Garlic (Allium sativum) used as a folk medicine is reported to stimulate nitric oxide (NO) production. We investigated the systemic increase of NO due to the ingestion of garlic on the plasma IFN-alpha level in normal volunteers. Normal volunteers (10 groups, 10 in each group) ate 2 g fresh garlic, and plasma NO and IFN-alpha levels were determined after 2 and 4 h. The participants were also asked to eat garlic for various periods of time, and plasma NO and IFN-alpha were similarly assayed. Ingestion of 2 g fresh, but not boiled, garlic was found to increase the basal plasma level of NO from 2.7 +/- 0.1 microM to 8.76 +/- 0.21 microM at 2 and 4 h, respectively. The basal plasma IFN-alpha level increased from 9.51 +/- 0.26 nM to 46.3 +/- 1.2 nM in normal volunteers (n = 10) at the same time. The chronic eating of garlic was found to maintain IFN-alpha at high levels for at least 7 days. The exposure of neutrophils to garlic in vivo or in vitro, which also stimulated synthesis of NO in these cells, was found to stimulate IFN-alpha synthesis as measured by the stimulation of IFN-alpha mRNA synthesis. Thus, consumption of garlic resulted in stimulated synthesis of NO and, in turn, IFN-alpha in humans, which could be beneficial in viral or proliferative diseases.
Hepatitis D virus replication is sensed by MDA5 and induces IFN-β/λ responses in hepatocytes.
Zhang, Zhenfeng; Filzmayer, Christina; Ni, Yi; Sültmann, Holger; Mutz, Pascal; Hiet, Marie-Sophie; Vondran, Florian W R; Bartenschlager, Ralf; Urban, Stephan
2018-07-01
Hepatitis B virus (HBV) and D virus (HDV) co-infections cause the most severe form of viral hepatitis. HDV induces an innate immune response, but it is unknown how the host cell senses HDV and if this defense affects HDV replication. We aim to characterize interferon (IFN) activation by HDV, identify the responsible sensor and evaluate the effect of IFN on HDV replication. HDV and HBV susceptible hepatoma cell lines and primary human hepatocytes (PHH) were used for infection studies. Viral markers and cellular gene expression were analyzed at different time points after infection. Pattern recognition receptors (PRRs) required for HDV-mediated IFN activation and the impact on HDV replication were studied using stable knock-down or overexpression of the PRRs. Microarray analysis revealed that HDV but not HBV infection activated a broad range of interferon stimulated genes (ISGs) in HepG2 NTCP cells. HDV strongly activated IFN-β and IFN-λ in cell lines and PHH. HDV induced IFN levels remained unaltered upon RIG-I (DDX58) or TLR3 knock-down, but were almost completely abolished upon MDA5 (IFIH1) depletion. Conversely, overexpression of MDA5 but not RIG-I and TLR3 in HuH7.5 NTCP cells partially restored ISG induction. During long-term infection, IFN levels gradually diminished in both HepG2 NTCP and HepaRG NTCP cell lines. MDA5 depletion had little effect on HDV replication despite dampening HDV-induced IFN response. Moreover, treatment with type I or type III IFNs did not abolish HDV replication. Active replication of HDV induces an IFN-β/λ response, which is predominantly mediated by MDA5. This IFN response and exogenous IFN treatment have only a moderate effect on HDV replication in vitro indicating the adaption of HDV replication to an IFN-activated state. In contrast to hepatitis B virus, infection with hepatitis D virus induces a strong IFN-β/λ response in innate immune competent cell lines. MDA5 is the key sensor for the recognition of hepatitis D virus
Barlow, Sally; Fahey, Briana; Smith, Kimberley J; Passecker, Johannes; Della-Chiesa, Andrea; Hok, Vincent; Day, Jennifer S; Callaghan, Charlotte K; O'Mara, Shane M
2018-05-18
Patients receiving cytokine immunotherapy with IFN-α frequently present with neuropsychiatric consequences and cognitive impairments, including a profound depressive-like symptomatology. While the neurobiological substrates of the dysfunction that leads to adverse events in IFN-α-treated patients remains ill-defined, dysfunctions of the hippocampus and prefrontal cortex (PFC) are strong possibilities. To date, hippocampal deficits have been well-characterised; there does however remain a lack of insight into the nature of prefrontal participation. Here, we used a PFC-supported temporal order memory paradigm to examine if IFN-α treatment induced deficits in performance; additionally, we used an object recognition task to assess the integrity of the perirhinal cortex (PRH). Finally, the utility of exercise as an ameliorative strategy to recover temporal order deficits in rats was also explored. We found that IFN-α-treatment impaired temporal order memory discriminations, whereas recognition memory remained intact, reflecting a possible dissociation between recognition and temporal order memory processing. Further characterisation of temporal order memory impairments using a longitudinal design revealed that deficits persisted for 10 weeks following cessation of IFN-α-treatment. Finally, a 6 week forced exercise regime reversed IFN-α-induced deficits in temporal order memory. These data provide further insight into the circuitry involved in cognitive impairments arising from IFN-α-treatment. Here we suggest that PFC (or the hippocampo-prefrontal pathway) may be compromised whilst the function of the PRH is preserved. Deficits may persist after cessation of IFN-α-treatment which suggests that extended patient monitoring is required. Aerobic exercise may be restorative and could prove beneficial for patients treated with IFN-α. Copyright © 2018 Elsevier Inc. All rights reserved.
Bolen, Christopher R; Ding, Siyuan; Robek, Michael D; Kleinstein, Steven H
2014-04-01
Despite activating similar signaling cascades, the type I and type III interferons (IFNs) differ in their ability to antagonize virus replication. However, it is not clear whether these cytokines induce unique antiviral states, particularly in the liver, where the clinically important hepatitis B and C viruses cause persistent infection. Here, clustering and promoter analyses of microarray-based gene expression profiling were combined with mechanistic studies of signaling pathways to dynamically characterize the transcriptional responses induced by these cytokines in Huh7 hepatoma cells and primary human hepatocytes. Type I and III IFNs differed greatly in their level of interferon-stimulated gene (ISG) induction with a clearly detectable hierarchy (IFN-β > IFN-α > IFN-λ3 > IFN-λ1 > IFN-λ2). Notably, although the hierarchy identified varying numbers of differentially expressed genes when quantified using common statistical thresholds, further analysis of gene expression over multiple timepoints indicated that the individual IFNs do not in fact regulate unique sets of genes. The kinetic profiles of IFN-induced gene expression were also qualitatively similar with the important exception of IFN-α. While stimulation with either IFN-β or IFN-λs resulted in a similar long-lasting ISG induction, IFN-α signaling peaked early after stimulation then declined due to a negative feedback mechanism. The quantitative expression hierarchy and unique kinetics of IFN-α reveal potential specific roles for individual IFNs in the immune response, and elucidate the mechanism behind previously observed differences in IFN antiviral activity. While current clinical trials are focused on IFN-λ1 as a potential antiviral therapy, the finding that IFN-λ3 invariably possesses the highest activity among type III IFNs suggests that this cytokine may have superior clinical activity. © 2014 by the American Association for the Study of Liver Diseases.
Thymoquinone Suppresses IRF-3-Mediated Expression of Type I Interferons via Suppression of TBK1
Cho, Jae Youl
2018-01-01
Interferon regulatory factor (IRF)-3 is known to have a critical role in viral and bacterial innate immune responses by regulating the production of type I interferon (IFN). Thymoquinone (TQ) is a compound derived from black cumin (Nigella sativa L.) and is known to regulate immune responses by affecting transcription factors associated with inflammation, including nuclear factor-κB (NF-κB) and activator protein-1 (AP-1). However, the role of TQ in the IRF-3 signaling pathway has not been elucidated. In this study, we explored the molecular mechanism of TQ-dependent regulation of enzymes in IRF-3 signaling pathways using the lipopolysaccharide (LPS)-stimulated murine macrophage-like RAW264.7 cell line. TQ decreased mRNA expression of the interferon genes IFN-α and IFN-β in these cells. This inhibition was due to its suppression of the transcriptional activation of IRF-3, as shown by inhibition of IRF-3 PRD (III-I) luciferase activity as well as the phosphorylation pattern of IRF-3 in the immunoblotting experiment. Moreover, TQ targeted the autophosphorylation of TANK-binding kinase 1 (TBK1), an upstream key enzyme responsible for IRF-3 activation. Taken together, these findings suggest that TQ can downregulate IRF-3 activation via inhibition of TBK1, which would subsequently decrease the production of type I IFN. TQ also regulated IRF-3, one of the inflammatory transcription factors, providing a novel insight into its anti-inflammatory activities. PMID:29751576
Li, Lian-Feng; Yu, Jiahui; Zhang, Yuexiu; Yang, Qian; Li, Yongfeng; Zhang, Lingkai; Wang, Jinghan; Li, Su; Luo, Yuzi; Sun, Yuan; Qiu, Hua-Ji
2017-06-01
Classical swine fever virus (CSFV) is the causative agent of classical swine fever (CSF), which poses a serious threat to the global pig industry. Interferons (IFNs) and IFN-stimulated genes (ISGs) play a key role in host antiviral defense. We have previously screened the porcine 2'-5'-oligoadenylate synthetase-like protein (pOASL) as a potential anti-CSFV ISG using a reporter CSFV. This study aimed to clarify the underlying antiviral mechanism of pOASL against CSFV. We confirmed that CSFV replication was significantly suppressed in lentivirus-delivered, pOASL-overexpressing PK-15 cells, whereas silencing the expression of endogenous pOASL by small interfering RNAs markedly enhanced CSFV growth. In addition, the transcriptional level of pOASL was upregulated both in vitro and in vivo upon CSFV infection. Interestingly, the anti-CSFV effects of pOASL are independent of the canonical RNase L pathway but depend on the activation of the type I IFN response. Glutathione S -transferase pulldown and coimmunoprecipitation assays revealed that pOASL interacts with MDA5, a double-stranded RNA sensor, and further enhances MDA5-mediated type I IFN signaling. Moreover, we showed that pOASL exerts anti-CSFV effects in an MDA5-dependent manner. In conclusion, pOASL suppresses CSFV replication via the MDA5-mediated type I IFN-signaling pathway. IMPORTANCE The host innate immune response plays an important role in mounting the initial resistance to viral infection. Here, we identify the porcine 2'-5'-oligoadenylate synthetase-like protein (pOASL) as an interferon (IFN)-stimulated gene (ISG) against classical swine fever virus (CSFV). We demonstrate that the anti-CSFV effects of pOASL depend on the activation of type I IFN response. In addition, we show that pOASL, as an MDA5-interacting protein, is a coactivator of MDA5-mediated IFN induction to exert anti-CSFV actions. This work will be beneficial to the development of novel anti-CSFV strategies by targeting pOASL. Copyright
Liu, Ruikang; Moss, Bernard
2018-05-01
Type I interferons (IFNs) induce expression of more than 300 cellular genes that provide protection against viruses and other pathogens. For survival, viruses evolved defenses to prevent the IFN response or counteract the IFN-induced antiviral state. However, because viruses and cells coevolved, the dynamic relationship between virus and host is difficult to discern. In the present study, we demonstrated that vaccinia virus with a large deletion near the left end of the genome had a diminished ability to replicate in cells that had been pretreated with beta interferon (IFN-β), suggesting that one or more of the missing 17 open reading frames (ORFs) encode an antagonist of the IFN-induced antiviral state. By systematically deleting groups of ORFs and then individual ORFs, the C9L gene was shown to be required for IFN resistance. Replication of the C9L deletion mutant (vΔC9) was impaired in human cells that had been pretreated with IFN-β. Expression of viral early genes occurred, but subsequent events, including genome uncoating, genome replication, and postreplicative gene expression, were inhibited. Expression of the C9 protein occurred prior to genome replication, consistent with an early role in counteracting the IFN-induced antiviral state. C9 contains six ankyrin repeat motifs and a near C-terminal F-box. Mass spectrometry and immunoblotting identified host proteins that copurified with a functional epitope-tagged C9. The most abundant proteins were components of the SCF (CUL1, SKP1, F-box) and signalosome/deneddylation complexes, which interact with each other, suggesting a possible role in proteolysis of one or more interferon-induced proteins. IMPORTANCE Poxviruses comprise a family of large DNA viruses that replicate in the cytoplasm of vertebrate and insect hosts and cause human and zoonotic diseases. In most cases the primary infection is moderated by innate immune defenses. Vertebrates, including fish, amphibians, reptiles, birds, and mammals, all
Toscana virus induces interferon although its NSs protein reveals antagonistic activity.
Gori Savellini, Gianni; Weber, Friedemann; Terrosi, Chiara; Habjan, Matthias; Martorelli, Barbara; Cusi, Maria Grazia
2011-01-01
Toscana virus (TOSV) is a phlebotomus-transmitted virus that belongs to the family Bunyaviridae and causes widespread infections in humans; about 30 % of these cases result in aseptic meningitis. In the present study, it was shown that TOSV is an inducer of beta interferon (IFN-β), although its non-structural protein (NSs) could inhibit the induction of IFN-β if expressed in a heterologous context. A recombinant Rift Valley fever virus expressing the TOSV NSs could suppress IFN-β expression in infected cells. Moreover, in cells expressing NSs protein from a cDNA plasmid, IFN-β transcripts were not inducible by poly(I : C). Unlike other members of the family Bunyaviridae, TOSV appears to express an NSs protein that is a weak antagonist of IFN induction. Characterization of the interaction of TOSV with the IFN system will help our understanding of virus-host cell interactions and may explain why the pathogenesis of this disease is mostly mild in humans.
Efficacy of HCV treatment in Poland at the turn of the interferon era – the EpiTer study
Pogorzelska, Joanna; Berak, Hanna; Horban, Andrzej; Orłowska, Iwona; Simon, Krzysztof; Tuchendler, Ewelina; Madej, Grzegorz; Piekarska, Anna; Jabłkowski, Maciej; Deroń, Zbigniew; Mazur, Włodzimierz; Kaczmarczyk, Marcin; Janczewska, Ewa; Pisula, Arkadiusz; Smykał, Jacek; Nowak, Krzysztof; Matukiewicz, Marek; Halota, Waldemar; Wernik, Joanna; Sikorska, Katarzyna; Mozer-Lisewska, Iwona; Rozpłochowski, Błażej; Garlicki, Aleksander; Tomasiewicz, Krzysztof; Krzowska-Firych, Joanna; Baka-Ćwierz, Barbara; Kryczka, Wiesław; Zarębska-Michaluk, Dorota; Olszok, Iwona; Boroń-Kaczmarska, Anna; Sobala-Szczygieł, Barbara; Szlauer, Bronisława; Korcz-Ondrzejek, Bogumiła; Sieklucki, Jerzy; Pleśniak, Robert; Ruszała, Agata; Postawa-Kłosińska, Barbara; Citko, Jolanta; Lachowicz-Wawrzyniak, Anna; Musialik, Joanna; Jezierska, Edyta; Dobracki, Witold; Dobracka, Beata; Hałubiec, Jan; Krygier, Rafał; Strokowska, Anna; Chomczyk, Wojciech; Witczak-Malinowska, Krystyna
2016-01-01
The aim of the study Was to analyze the efficacy achieved with regimens available for chronic hepatitis C (CHC) in Poland between 2013 and 2016. Material and methods Data were collected from 29 centers and included 6786 patients with available sustained virologic response (SVR) data between 1 January 2013 and 31 March 2016. Results The sustained virologic response rate for genotypes (G) 1a, 1b, 2, 3 and 4 was 62%, 56%, 92%, 67% and 56% respectively; 71% patients (n = 4832) were treated with pegylated interferon α (Peg-IFNα) and ribavirin (RBV), with SVR rates of 58%, 49%, 92%, 67% and 55% respectively. The sustained virologic response among 5646 G1 infected patients was the lowest with natural interferon α (7%, n = 70) or PegIFN (50%, n = 3779) with RBV, and improved in those receiving triple regimens of Peg-IFN + RBV combined with boceprevir (47%, n = 485), telaprevir (64%, n = 805), simeprevir (73%, n = 132) or sofosbuvir (70%, n = 23). The sustained virologic response with interferon-free regimens of sofosbuvir and RBV (n = 7), sofosbuvir and simeprevir (n = 53), and ledipasvir and sofosbuvir (n = 64) achieved 86%, 89% and 94% respectively. The highest SVR of 98% was observed with ombitasvir/paritaprevir combined with dasabuvir (n = 227). Patients infected with G3 (n = 896) and G4 (n = 220) received mostly Peg-IFN + RBV with SVR of 67% and 56% respectively. Interferon-free regimens were administered in 18 G3/G4 patients and all achieved an SVR. Sofosbuvir combined with Peg-IFN and RBV was administered to 33 patients with an SVR rate of 94%, and a similar rate was achieved among 13 G2 patients treated with interferon and RBV. Conclusions We observed significant differences in efficacy of HCV regimens available in Poland at the turn of the interferon era. The data will be useful as a comparison for therapeutic options expected in the next few years. PMID:28856278
Pegylated Interferon α Therapy in Chronic Delta Hepatitis: A One-Center Experience.
Bahcecioglu, Ibrahim Halil; Ispiroglu, Murat; Demirel, Ulvi; Yalniz, Mehmet
2015-03-01
The only established therapy for chronic viral delta hepatitis, the most severe form of viral hepatitis is treatment with pegylated-interferon α (Peg IFN α). In this study, we aimed to determine the efficacy of pegylated-interferon α 2a (Peg-IFN α 2a) and 2b (Peg IFN α 2b) in the treatment of patients infected with chronic delta hepatitis virus. The sample size was based on available patients potentially to be recruited. Data of 63 patients receiving either Peg IFN alpha 2a or Peg IFN alpha 2b were retrospectively assessed in the present cohort study performed in Turkey. Of 56 patients completed the study, 41 received Peg IFN α 2a and 15 received Peg IFN α 2b for 12 months. Patients were evaluated for biochemical and virological responses at the end of given treatment and six months after the treatment. Stage of fibrosis was found high in both groups (85.4% vs. 86.7%), while cirrhosis was higher in the group of Peg IFN α 2b (53.3% vs. 34.1%). At the end of treatment, either hepatitis delta virus RNA (HDV RNA) alone or both HDV RNA and hepatitis b virus DNA (HBV DNA) had negative results in 32% of patients. Although HDV RNA negativity was sustained in 30.3% of patients, negativity of both HDV RNA and HBV DNA was decreased to 19.6% six months after completion of the treatment. HBV DNA became positive in one third of patients with response at six months after completion of the treatment (10.7% of all patients). HDV RNA negativity at month six was found as a predictor of positive response. No significant difference was found between Peg IFN α 2a and Peg IFN α 2b for virological response rate. Treatment with Peg IFN α achieved a sustained negativity of HDV RNA in about one third of patients. Duration of Peg IFN α therapy might be prolonged to at least 24 months or more to prevent the occurrence of Hepatitis B virus (HBV) relapse encountered six months after completion of the treatment.
Charoenvit, Yupin; Majam, Victoria Fallarme; Corradin, Giampietro; Sacci, John B.; Wang, Ruobing; Doolan, Denise L.; Jones, Trevor R.; Abot, Esteban; Patarroyo, Manuel E.; Guzman, Fanny; Hoffman, Stephen L.
1999-01-01
Most work on protective immunity against the pre-erythrocytic stages of malaria has focused on induction of antibodies that prevent sporozoite invasion of hepatocytes, and CD8+ T-cell responses that eliminate infected hepatocytes. We recently reported that immunization of A/J mice with an 18-amino-acid synthetic linear peptide from Plasmodium yoelii sporozoite surface protein 2 (SSP2) in TiterMax adjuvant induces sterile protection that is dependent on CD4+ T cells and gamma interferon (IFN-γ). We now report that immunization of inbred A/J mice and outbred CD1 mice with each of two linear synthetic peptides from the 17-kDa P. yoelii hepatocyte erythrocyte protein (HEP17) in the same adjuvant also induces protection against sporozoite challenge that is dependent on CD4+ T cells and IFN-γ. The SSP2 peptide and the two HEP17 peptides are recognized by B cells as well as T cells, and the protection induced by these peptides appears to be directed against the infected hepatocytes. In contrast to the peptide-induced protection, immunization of eight different strains of mice with radiation-attenuated sporozoites induces protection that is absolutely dependent on CD8+ T cells. Data represented here demonstrate that CD4+ T-cell-dependent protection can be induced by immunization with linear synthetic peptides. These studies therefore provide the foundation for an approach to pre-erythrocytic-stage malaria vaccine development, based on the induction of protective CD4+ T-cell responses, which will complement efforts to induce protective antibody and CD8+ T-cell responses. PMID:10531206
NASA Technical Reports Server (NTRS)
Shearer, William T.; Lee, Bang-Ning; Cron, Stanley G.; Rosenblatt, Howard M.; Smith, E. O'Brian; Lugg, Desmond J.; Nickolls, Peter M.; Sharp, Robert M.; Rollings, Karl; Reuben, James M.
2002-01-01
Cellular immune function has been shown to be decreased and latent virus shedding to be increased in human beings isolated during the Antarctic winter, a model used for assessing some effects of space flight. However, the balance of proinflammatory (IFN-gamma) and anti-inflammatory (IL-10 and IL-1RA) cytokines has not previously been evaluated. We therefore sought to determine whether isolation during the Antarctic winter would alter the proinflammatory and anti-inflammatory cytokine balance. Cytokine levels were measured with ELISA in monthly plasma samples from January through September 1999 in 21 study subjects in the Antarctic and 7 control subjects on Macquarie Island. There was a significant time-dependent increase in plasma IFN-gamma (P =.039) as well as decreases in IL-10 (P =.042) and IL-1RA (P =.053) in the study subjects compared with the control subjects. The study subjects also had significantly increased plasma IFN-gamma levels (P < or =.045) but decreased IL-10 and IL-1RA levels (P < or =.036) at individual time points of isolation. Isolation of human beings in the Antarctic appears to shift the plasma cytokine balance toward a proinflammatory profile. These observations are consistent with T-cell activation that might be due to activation of latent viruses, and they could hold importance for determining the risks of space flight.
Stuart, Jennifer H; Sumner, Rebecca P; Lu, Yongxu; Snowden, Joseph S; Smith, Geoffrey L
2016-12-01
The type I interferon (IFN) response is a crucial innate immune signalling pathway required for defense against viral infection. Accordingly, the great majority of mammalian viruses possess means to inhibit this important host immune response. Here we show that vaccinia virus (VACV) strain Western Reserve protein C6, is a dual function protein that inhibits the cellular response to type I IFNs in addition to its published function as an inhibitor of IRF-3 activation, thereby restricting type I IFN production from infected cells. Ectopic expression of C6 inhibits the induction of interferon stimulated genes (ISGs) in response to IFNα treatment at both the mRNA and protein level. C6 inhibits the IFNα-induced Janus kinase/signal transducer and activator of transcription (JAK/STAT) signalling pathway at a late stage, downstream of STAT1 and STAT2 phosphorylation, nuclear translocation and binding of the interferon stimulated gene factor 3 (ISGF3) complex to the interferon stimulated response element (ISRE). Mechanistically, C6 associates with the transactivation domain of STAT2 and this might explain how C6 inhibits the type I IFN signalling very late in the pathway. During virus infection C6 reduces ISRE-dependent gene expression despite the presence of the viral protein phosphatase VH1 that dephosphorylates STAT1 and STAT2. The ability of a cytoplasmic replicating virus to dampen the immune response within the nucleus, and the ability of viral immunomodulators such as C6 to inhibit multiple stages of the innate immune response by distinct mechanisms, emphasizes the intricacies of host-pathogen interactions and viral immune evasion.
Local expression of interferon-alpha and interferon receptors in cervical intraepithelial neoplasia.
Tirone, Nelson R; Peghini, Bethanea C; Barcelos, Ana Cristina M; Murta, Eddie F C; Michelin, Marcia A
2009-12-01
The present study evaluated mRNA expression of interferon-alpha (IFN-alpha), IFN-alpha receptor subunits (IFNAR-1 and IFNAR-2) and an IFN-stimulated gene encoding the enzyme 2',5'-oligoadenylate synthetase (2'5'OAS) in biopsies on patients with varying grades of cervical intraepithelial neoplasia (CIN I, II and III). Uterine cervix biopsies were collected from women with CIN I, II and III (n = 28) and controls without CIN lesions or human papilloma virus (HPV) infection (n = 17). The presence of high and low-risk HPV DNA was determined using hybrid capture. The mRNA levels of IFNAR-1, IFNAR-2, IFN-alpha and 2'5'OAS were determined by RT-PCR with specific primers. The control group exhibited a greater frequency of IFNAR-1 expression (10/17; 58.3%) than the CIN samples (4/28; 14.2%) (P = 0.0018), while, the expression of IFNAR-2 was also greater in the control samples (11/17; 64.7%) than in the patients with lesions (2/28; 7.1%) (P = 0.0018). Importantly, simultaneous expression of both receptors was observed only in the control group (8/17; 47.0%) (P = 0.0001). Among the CIN samples, there was one case of low expression of mRNA of IFNAR-1 and IFNAR-2. IFN-alpha was present in 14.2% (4/28) of the CIN samples but was not expressed in the control group. mRNA 2'5'OAS were expressed in 28.5% (8/28) of the CIN samples and 11.7% (2/17) of the control samples (not statistically significant). Fifty percent (14/28) of the CIN samples were positive for HPV DNA. Cervical biopsy samples from control women or those without neoplasia or HPV infection displayed higher IFN-alpha receptor expression than those with CIN, while simultaneous expression of both IFN-alpha receptor subunits was found only in the control group. There was no significant difference in mRNA expression of IFN-alpha and 2'5'OAS between the control and CIN groups. Then we concluded that the samples obtained from patients with CIN present low levels of the IFN-alpha receptor mRNA.
Interferon Independent Non-Canonical STAT Activation and Virus Induced Inflammation
Wu, Chunyan
2018-01-01
Interferons (IFNs) are a group of secreted proteins that play critical roles in antiviral immunity, antitumor activity, activation of cytotoxic T cells, and modulation of host immune responses. IFNs are cytokines, and bind receptors on cell surfaces to trigger signal transduction. The major signaling pathway activated by IFNs is the JAK/STAT (Janus kinase/signal transducer and activator of transcription) pathway, a complex pathway involved in both viral and host survival strategies. On the one hand, viruses have evolved strategies to escape from antiviral host defenses evoked by IFN-activated JAK/STAT signaling. On the other hand, viruses have also evolved to exploit the JAK/STAT pathway to evoke activation of certain STATs that somehow promote viral pathogenesis. In this review, recent progress in our understanding of the virus-induced IFN-independent STAT signaling and its potential roles in viral induced inflammation and pathogenesis are summarized in detail, and perspectives are provided. PMID:29662014
Distinct Effects of Type I and III Interferons on Enteric Viruses
Peterson, Stefan T.
2018-01-01
Interferons (IFNs) are key host cytokines in the innate immune response to viral infection, and recent work has identified unique roles for IFN subtypes in regulating different aspects of infection. Currently emerging is a common theme that type III IFNs are critical in localized control of infection at mucosal barrier sites, while type I IFNs are important for broad systemic control of infections. The intestine is a particular site of interest for exploring these effects, as in addition to being the port of entry for a multitude of pathogens, it is a complex tissue with a variety of cell types as well as the presence of the intestinal microbiota. Here we focus on the roles of type I and III IFNs in control of enteric viruses, discussing what is known about signaling downstream from these cytokines, including induction of specific IFN-stimulated genes. We review viral strategies to evade IFN responses, effects of IFNs on the intestine, interactions between IFNs and the microbiota, and briefly discuss the role of IFNs in controlling viral infections at other barrier sites. Enhanced understanding of the coordinate roles of IFNs in control of viral infections may facilitate development of antiviral therapeutic strategies; here we highlight potential avenues for future exploration. PMID:29361691
Younossi, Zobair M; Limongi, Dolores; Stepanova, Maria; Pierobon, Mariaelena; Afendy, Arian; Mehta, Rohini; Baranova, Ancha; Liotta, Lance; Petricoin, Emanuel
2011-02-04
Only half of chronic hepatitis C (CH-C) patients treated with pegylated interferon and ribavirin (PEG-IFN+RBV) achieve sustained virologic response) SVR. In addition to known factors, we postulated that activation of key protein signaling networks in the peripheral blood mononuclear cells (PBMCs) may contribute to SVR due to inherent patient-specific basal immune cell signaling architecture. In this study, we included 92 patients with CH-C. PBMCs were collected while patients were not receiving treatment and used for phosphoprotein-based network profiling. Patients received a full course of PEG-IFN+RBV with overall SVR of 55%. From PBMC, protein lysates were extracted and then used for Reverse Phase Protein Microarray (RPMA) analysis, which quantitatively measured the levels of cytokines and activation levels of 25 key protein signaling molecules involved in immune cell regulation and interferon alpha signaling. Regression models for predicting SVR were generated by stepwise bidirectional selection. Both clinical-laboratory and RPMA parameters were used as predictor variables. Model accuracies were estimated using 10-fold cross-validation. Our results show that by comparing patients who achieved SVR to those who did not, phosphorylation levels of 6 proteins [AKT(T308), JAK1(Y1022/1023), p70 S6 Kinase (S371), PKC zeta/lambda(T410/403), TYK2(Y1054/1055), ZAP-70(Y319)/Syk(Y352)] and overall levels of 6 unmodified proteins [IL2, IL10, IL4, IL5, TNF-alpha, CD5L] were significantly different (P < 0.05). For SVR, the model based on a combination of clinical and proteome parameters was developed, with an AUC = 0.914, sensitivity of 92.16%, and specificity of 85.0%. This model included the following parameters: viral genotype, previous treatment status, BMI, phosphorylated states of STAT2, AKT, LCK, and TYK2 kinases as well as steady state levels of IL4, IL5, and TNF-alpha. In conclusion, SVR could be predicted by a combination of clinical, cytokine, and protein signaling
Respiratory syncytial virus mechanisms to interfere with type 1 interferons.
Barik, Sailen
2013-01-01
Respiratory syncytial virus (RSV) is a member of the Paramyxoviridae family that consists of viruses with nonsegmented negative-strand RNA genome. Infection by these viruses triggers the innate antiviral response of the host, mainly type I interferon (IFN). Essentially all other viruses of this family produce IFN suppressor functions by co-transcriptional RNA editing. In contrast, RSV has evolved two unique nonstructural proteins, NS1 and NS2, to effectively serve this purpose. Together, NS1 and NS2 degrade or sequester multiple signaling proteins that affect both IFN induction and IFN effector functions. While the mechanism of action of NS1 and NS2 is a subject of active research, their effect on adaptive immunity is also being recognized. In this review, we discuss various aspects of NS1 and NS2 function with implications for vaccine design.
Spratte, Julia; Oemus, Anne; Zygmunt, Marek; Fluhr, Herbert
2015-09-01
The pro-inflammatory T helper (Th)-1 cytokines, tumor necrosis factor-α (TNF-α) and interferon-γ (IFN-γ), are immunological factors relevant at the feto-maternal interface and involved in the pathophysiology of implantation disorders. The synergistic action of the two cytokines has been described with regard to apoptotic cell death and inflammatory responses in different cell types, but little is known regarding the human endometrium. Therefore, we examined the interaction of TNF-α and IFN-γ in human endometrial stromal cells (ESCs). ESCs were isolated from specimens obtained during hysterectomy and decidualized in vitro. Cells were incubated with TNF-α, IFN-γ or signaling-inhibitor. Insulin-like growth factor binding protein (IGFBP)-1, prolactin (PRL), leukemia inhibitory factor (LIF), interleukin (IL)-6, IL-8, regulated on activation normal T-cell expressed and secreted protein (RANTES) and monocyte chemotactic protein (MCP)-1 were measured using ELISA and real-time RT-PCR. Nuclear factor of transcription (NF)-κB and its inhibitor (IκBα) were analyzed by in-cell western assay and transcription factor assay. TNF-α inhibited and IFN-γ did not affect the decidualization of ESCs. In contrast, IFN-gamma differentially modulated the stimulating effect of TNF-alpha on cytokines by enhancing IL-6, RANTES and MCP-1 and attenuating LIF mRNA expression. These effects were time- and dose-dependent. IFN-γ had no impact on the initial activation of NF-κB signaling. Histone-deacetylase activity was involved in the modulating effect of IFN-γ on RANTES secretion. These observations showed a distinct pattern of interaction of the Th-1 cytokines, TNF-α and IFN-γ in the human endometrium, which could play an important role in the pathophysiology of implantation disorders. Copyright © 2015 Society for Biology of Reproduction & the Institute of Animal Reproduction and Food Research of Polish Academy of Sciences in Olsztyn. Published by Elsevier Urban & Partner Sp. z
Type I interferon-mediated autoimmune diseases: pathogenesis, diagnosis and targeted therapy.
Psarras, Antonios; Emery, Paul; Vital, Edward M
2017-10-01
Type I interferons (IFN-Is) are a group of molecules with pleiotropic effects on the immune system forming a crucial link between innate and adaptive immune responses. Apart from their important role in antiviral immunity, IFN-Is are increasingly recognized as key players in autoimmune CTDs such as SLE. Novel therapies that target IFN-I appear effective in SLE in early trials, but effectiveness is related to the presence of IFN-I biomarkers. IFN-I biomarkers may also act as positive or negative predictors of response to other biologics. Despite the high failure rate of clinical trials in SLE, subgroups of patients often respond better. Fully optimizing the potential of these agents is therefore likely to require stratification of patients using IFN-I and other biomarkers. This suggests the unified concept of type I IFN-mediated autoimmune diseases as a grouping including patients with a variety of different traditional diagnoses. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Rheumatology. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Modiano, Nir; Lu, Yanping E; Cresswell, Peter
2005-06-14
Human guanylate-binding protein-1 (hGBP-1) is a large GTPase, similar in structure to the dynamins. Like many smaller GTPases of the Ras/Rab family, it is farnesylated, suggesting it may dock into membranes and perhaps play a role in intracellular trafficking. To date, however, hGBP-1 has never been associated with a specific intracellular compartment. Here we present evidence that hGBP-1 can associate with the Golgi apparatus. Redistribution from the cytosol to the Golgi was observed by immunofluorescence and subcellular fractionation after aluminum fluoride treatment, suggesting that it occurs when hGBP-1 is in its GTP-bound state. Relocalization was blocked by a farnesyl transferase inhibitor. The C589S mutant of hGBP-1, which cannot be farnesylated, and the previously uncharacterized R48P mutant, which cannot bind GTP, both failed to localize to the Golgi. These two mutants had a dominant-negative effect, preventing endogenous wild-type hGBP-1 from efficiently redistributing after aluminum fluoride treatment. Furthermore, hGBP-1 requires another IFN-gamma-induced factor to be targeted to the Golgi, because constitutively expressed hGBP-1 remained cytosolic in cells treated with aluminum fluoride unless the cells were preincubated with IFN-gamma. Finally, two nonhydrolyzing mutants of hGBP-1, corresponding to active mutants of Ras family proteins, failed to constitutively associate with the Golgi; we propose three possible explanations for this surprising result.
Recurrence of depressive disorders after interferon-induced depression
Chiu, W-C; Su, Y-P; Su, K-P; Chen, P-C
2017-01-01
Interferon alpha (IFN-α)-treated patients commonly develop depression during the therapy period. Although most IFN-α-induced depressive disorders achieve remission after IFN-α therapy, no studies have examined the long-term mood effects of IFN-α treatment. We conducted a 12-year population-based cohort study of hepatitis C virus (HCV)-infected patients who were older than 20 years and had received IFN-α therapy. The sample was obtained from the Taiwan National Health Insurance Research Database. The cohort included patients with and without IFN-α-induced depression, matched randomly by age, sex and depression history, at a ratio of 1:10. The follow-up started after the last administration of IFN-α and was designed to determine the incidence of recurrent depressive disorder after IFN-α therapy. A total of 156 subjects were identified as having IFN-α-induced depression and achieving full remission after IFN-α therapy. The overall incidence of recurrent depressive disorders among patients with and without IFN-α-induced depression was 56.8 (95% confidence interval (CI), 42.4–76.1) and 4.1 (95% CI, 2.9–5.8) cases, respectively, per 100 000 person-years, P<0.001. The adjusted hazard ratios for recurrent depressive disorder were 13.5 (95% CI, 9.9–18.3) in the IFN-α-treated cohort and 22.2 (95% CI, 11.2–44.2) in the matched cohort for IFN-α-induced depression patients after adjusting for age, sex, income, urbanization and comorbid diseases. IFN-α-induced depression was associated with a high risk of recurrent depression. It was not a transient disease and might be considered an episode of depressive disorder. Continuation therapy might be considered, and further research is needed. PMID:28170005
Association of IRF5 polymorphisms with activation of the interferon α pathway
Rullo, Ornella J; Woo, Jennifer M P; Wu, Hui; Hoftman, Alice D C; Maranian, Paul; Brahn, Brittany A; McCurdy, Deborah; Cantor, Rita M; Tsao, Betty P
2011-01-01
Objective The genetic association of interferon regulatory factor 5 (IRF5) with systemic lupus erythematosus (SLE) susceptibility has been convincingly established. To gain understanding of the effect of IRF5 variation in individuals without SLE, a study was undertaken to examine whether such genetic variation predisposes to activation of the interferon α (IFNα) pathway. Methods Using a computer simulated approach, 14 single nucleotide polymorphisms (SNPs) and haplotypes of IRF5 were tested for association with mRNA expression levels of IRF5, IFNα and IFN-inducible genes and chemokines in lymphoblastoid cell lines (LCLs) from individuals of European (CEU), Han Chinese (CHB), Japanese (JPT) and Yoruba Nigerian (YRI) backgrounds. IFN-inducible gene expression was assessed in LCLs from children with SLE in the presence and absence of IFNα stimulation. Results The major alleles of IRF5 rs13242262 and rs2280714 were associated with increased IRF5 mRNA expression levels in the CEU, CHB+JPT and YRI samples. The minor allele of IRF5 rs10488631 was associated with increased IRF5, IFNα and IFN-inducible chemokine expression in CEU (pc=0.0005, 0.01 and 0.04, respectively). A haplotype containing these risk alleles of rs13242262, rs10488631 and rs2280714 was associated with increased IRF5, IFNα and IFN-inducible chemokine expression in CEU LCLs. In vitro studies showed specific activation of IFN-inducible genes in LCLs by IFNα. Conclusions SNPs of IRF5 in healthy individuals of a number of ethnic groups were associated with increased mRNA expression of IRF5. In European-derived individuals, an IRF5 haplotype was associated with increased IRF5, IFNα and IFN-inducible chemokine expression. Identifying individuals genetically predisposed to increased IFN-inducible gene and chemokine expression may allow early detection of risk for SLE. PMID:19854706
Collaborative study for the validation of an improved HPLC assay for recombinant IFN-alfa-2.
Jönsson, K H; Daas, A; Buchheit, K H; Terao, E
2016-01-01
The current European Pharmacopoeia (Ph. Eur.) texts for Interferon (IFN)-alfa-2 include a nonspecific photometric protein assay using albumin as calibrator and a highly variable cell-based assay for the potency determination of the protective effects. A request was expressed by the Official Medicines Control Laboratories (OMCLs) for improved methods for the batch control of recombinant interferon alfa-2 bulk and market surveillance testing of finished products, including those formulated with Human Serum Albumin (HSA). A HPLC method was developed at the Medical Products Agency (MPA, Sweden) for the testing of IFN-alfa-2 products. An initial collaborative study run under the Biological Standardisation Programme (BSP; study code BSP039) revealed the need for minor changes to improve linearity of the calibration curves, assay reproducibility and robustness. The goal of the collaborative study, coded BSP071, was to transfer and further validate this improved HPLC method. Ten laboratories participated in the study. Four marketed IFN-alfa-2 preparations (one containing HSA) together with the Ph. Eur. Chemical Reference Substance (CRS) for IFN-alfa-2a and IFN-alfa-2b, and in-house reference standards from two manufacturers were used for the quantitative assay. The modified method was successfully transferred to all laboratories despite local variation in equipment. The resolution between the main and the oxidised forms of IFN-alfa-2 was improved compared to the results from the BSP039 study. The improved method even allowed partial resolution of an extra peak after the principal peak. Symmetry of the main IFN peak was acceptable for all samples in all laboratories. Calibration curves established with the Ph. Eur. IFN-alfa-2a and IFN-alfa-2b CRSs showed excellent linearity with intercepts close to the origin and coefficients of determination greater than 0.9995. Assay repeatability, intermediate precision and reproducibility varied with the tested sample within acceptable
ERIC Educational Resources Information Center
Birch, Samantha J.; Golbeck, Amanda L.
2015-01-01
Objective: This analysis examined the effectiveness of utilizing interferon-gamma release assay (IGRA) technology in a TB (TB) screening program at a university. Participants: Participants were 2299 students at a Montana university who had presented to the university health center for TB screening during 2012 and 2013. Methods: A retrospective…
Aboulnasr, Fatma; Hazari, Sidhartha; Nayak, Satyam; Chandra, Partha K.; Panigrahi, Rajesh; Ferraris, Pauline; Chava, Srinivas; Kurt, Ramazan; Song, Kyongsub; Dash, Asha; Balart, Luis A.; Garry, Robert F.; Wu, Tong; Dash, Srikanta
2015-01-01
Background HCV replication in persistently infected cell culture remains resistant to IFN-α/RBV combination treatment, whereas IFN-λ1 induces viral clearance. The antiviral mechanisms by which IFN-λ1 induces sustained HCV clearance have not been determined. Aim To investigate the mechanisms by which IFN-λ clears HCV replication in an HCV cell culture model. Methods IFN-α sensitive (S3-GFP) and resistant (R4-GFP) cells were treated with equivalent concentrations of either IFN-α or IFN-λ. The relative antiviral effects of IFN-α and IFN-λ1 were compared by measuring the HCV replication, quantification of HCV-GFP expression by flow cytometry, and viral RNA levels by real time RT-PCR. Activation of Jak-Stat signaling, interferon stimulated gene (ISG) expression, and miRNA-122 transcription in S3-GFP and R4-GFP cells were examined. Results We have shown that IFN-λ1 induces HCV clearance in IFN-α resistant and sensitive replicon cell lines in a dose dependent manner through Jak-Stat signaling, and induces STAT 1 and STAT 2 activation, ISRE-luciferase promoter activation and ISG expression. Stat 3 activation is also involved in IFN-λ1 induced antiviral activity in HCV cell culture. IFN-λ1 induced Stat 3 phosphorylation reduces the expression of hepatocyte nuclear factor 4 alpha (HNF4α) through miR-24 in R4-GFP cells. Reduced expression of HNF4α is associated with decreased expression of miR-122 resulting in an anti-HCV effect. Northern blot analysis confirms that IFN-λ1 reduces miR-122 levels in R4-GFP cells. Our results indicate that IFN-λ1 activates the Stat 3-HNF4α feedback inflammatory loop to inhibit miR-122 transcription in HCV cell culture. Conclusions In addition to the classical Jak–Stat antiviral signaling pathway, IFN-λ1 inhibits HCV replication through the suppression of miRNA-122 transcription via an inflammatory Stat 3–HNF4α feedback loop. Inflammatory feedback circuits activated by IFNs during chronic inflammation expose non
Toki, S; Hiromatsu, K; Aoki, Y; Makino, M; Yoshikai, Y
1997-10-01
Mice with retrovirus-induced murine acquired immunodeficiency syndrome (MAIDS) were hypersensitive to lipopolysaccharide (LPS)-induced lethal shock accompanied by marked elevations of systematic interleukin 1beta (IL-beta) and interferon gamma (IFN-gamma) after LPS challenge. Pretreatment with 10 microg of recombinant human granulocyte colony-stimulating factor (rhG-CSF) protected MAIDS mice from hypersensitivity to LPS-induced lethal shock and this protection was concomitant with suppression of IFN-gamma production. Copyright 1997 Academic Press Limited.
Rodriguez, Marisela R.; Monte, Kristen; Thackray, Larissa B.
2014-01-01
ABSTRACT Human noroviruses (HuNoV) are the leading cause of nonbacterial gastroenteritis worldwide. Similar to HuNoV, murine noroviruses (MNV) are enteric pathogens spread via the fecal-oral route and have been isolated from numerous mouse facilities worldwide. Type I and type II interferons (IFN) restrict MNV-1 replication; however, the antiviral effectors impacting MNV-1 downstream of IFN signaling are largely unknown. Studies using dendritic cells, macrophages, and mice deficient in free and conjugated forms of interferon-stimulated gene 15 (ISG15) revealed that ISG15 conjugation contributes to protection against MNV-1 both in vitro and in vivo. ISG15 inhibited a step early in the viral life cycle upstream of viral genome transcription. Directly transfecting MNV-1 RNA into IFN-stimulated mouse embryonic fibroblasts (MEFs) and bone marrow-derived dendritic cells (BMDC) lacking ISG15 conjugates bypassed the antiviral activity of ISG15, further suggesting that ISG15 conjugates restrict the MNV-1 life cycle at the viral entry/uncoating step. These results identify ISG15 as the first type I IFN effector regulating MNV-1 infection both in vitro and in vivo and for the first time implicate the ISG15 pathway in the regulation of early stages of MNV-1 replication. IMPORTANCE Type I IFNs are important in controlling murine norovirus 1 (MNV-1) infections; however, the proteins induced by IFNs that restrict viral growth are largely unknown. This report reveals that interferon-stimulated gene 15 (ISG15) mitigates MNV-1 replication both in vitro and in vivo. In addition, it shows that ISG15 inhibits MNV-1 replication by targeting an early step in the viral life cycle, MNV-1 entry and/or uncoating. These results identify ISG15 as the first type I IFN effector regulating MNV-1 infection both in vitro and in vivo and for the first time implicate the ISG15 pathway in the regulation of viral entry/uncoating. PMID:24899198
Pène, Jérôme; Guglielmi, Laurence; Gauchat, Jean-François; Harrer, Nathalie; Woisetschläger, Maximilian; Boulay, Vera; Fabre, Jean-Michel; Demoly, Pascal; Yssel, Hans
2006-10-15
IL-21 is a cytokine produced by CD4+ T cells that has been reported to regulate human, as well as, mouse T and NK cell function and to inhibit Ag-induced IgE production by mouse B cells. In the present study, we show that human rIL-21 strongly enhances IgE production by both CD19+ CD27- naive, and CD19+ CD27+ memory B cells, stimulated with anti-CD40 mAb and rIL-4 and that it promotes the proliferative responses of these cells. However, rIL-21 does not significantly affect anti-CD40 mAb and rIL-4-induced Cepsilon promoter activation in a gene reporter assay, nor germline Cepsilon mRNA expression in purified human spleen or peripheral blood B cells. In contrast, rIL-21 inhibits rIL-4-induced IgE production in cultures of PBMC or total splenocytes by an IFN-gamma-dependent mechanism. The presence of a polymorphism (T-83C), in donors heterozygous for this mutation was found to be associated not only with lower rIL-21-induced IFN-gamma production levels, but also with a lower sensitivity to the inhibitory effects of IL-21 on the production of IgE, compared with those in donors expressing the wild-type IL-21R. Taken together, these results show that IL-21 differentially regulates IL-4-induced human IgE production, via its growth- and differentiation-promoting capacities on isotype-, including IgE-, committed B cells, as well as via its ability to induce IFN-gamma production, most likely by T and NK cells, whereas the outcome of these IL-21-mediated effects is dependent on the presence of a polymorphism in the IL-21R.
Soluble expression and one-step purification of recombinant mouse interferon-λ3 in Escherichia coli.
Wang, Y Q; Zhou, M; Zeng, L M; Gao, Q Y; Yuan, X L; Li, Y; Li, M C
2015-02-01
Interferon (IFN)-λ3, a member of the type III IFN family, is a pleiotropic cytokine that exhibits potent antiproliferative, antiviral, and immunoregulatory activities. For further functional study of IFN-λ3, we developed an efficient procedure that includes cloning, expression, and purification to obtain relatively large quantity of mouse IFN-λ3 fusion protein. The mature IFN-λ3 protein-coding region was cloned into the prokaryotic expression vector pET-44. IFN-λ3 contains a hexahistidine tag at its C-terminus. We used Ni(2+)-nitrilotriacetic acid agarose-affinity chromatography to purify the expressed soluble protein. The purified IFN-λ3 inhibited significantly IL-13 production in stimulated RAW264.7 macrophages. Our findings show that the production of soluble IFN-λ3 proteins by the pET-44 vector in Escherichia coli is a good alternative for the production of native IFN-λ3 and could be useful for the production of other IFN proteins.
Interferon Response Factors 3 and 7 Protect against Chikungunya Virus Hemorrhagic Fever and Shock
Rudd, Penny A.; Wilson, Jane; Gardner, Joy; Larcher, Thibaut; Babarit, Candice; Le, Thuy T.; Anraku, Itaru; Kumagai, Yutaro; Loo, Yueh-Ming; Gale, Michael; Akira, Shizuo; Khromykh, Alexander A.
2012-01-01
Chikungunya virus (CHIKV) infections can produce severe disease and mortality. Here we show that CHIKV infection of adult mice deficient in interferon response factors 3 and 7 (IRF3/7−/−) is lethal. Mortality was associated with undetectable levels of alpha/beta interferon (IFN-α/β) in serum, ∼50- and ∼10-fold increases in levels of IFN-γ and tumor necrosis factor (TNF), respectively, increased virus replication, edema, vasculitis, hemorrhage, fever followed by hypothermia, oliguria, thrombocytopenia, and raised hematocrits. These features are consistent with hemorrhagic shock and were also evident in infected IFN-α/β receptor-deficient mice. In situ hybridization suggested CHIKV infection of endothelium, fibroblasts, skeletal muscle, mononuclear cells, chondrocytes, and keratinocytes in IRF3/7−/− mice; all but the latter two stained positive in wild-type mice. Vaccination protected IRF3/7−/− mice, suggesting that defective antibody responses were not responsible for mortality. IPS-1- and TRIF-dependent pathways were primarily responsible for IFN-α/β induction, with IRF7 being upregulated >100-fold in infected wild-type mice. These studies suggest that inadequate IFN-α/β responses following virus infection can be sufficient to induce hemorrhagic fever and shock, a finding with implications for understanding severe CHIKV disease and dengue hemorrhagic fever/dengue shock syndrome. PMID:22761364
Axonal interferon responses and alphaherpesvirus neuroinvasion
NASA Astrophysics Data System (ADS)
Song, Ren
Infection by alphaherpesviruses, including herpes simplex virus (HSV) and pseudorabies virus (PRV), typically begins at a peripheral epithelial surface and continues into the peripheral nervous system (PNS) that innervates this tissue. Inflammatory responses are induced at the infected peripheral site prior to viral invasion of the PNS. PNS neurons are highly polarized cells with long axonal processes that connect to distant targets. When the peripheral tissue is first infected, only the innervating axons are exposed to this inflammatory milieu, which include type I interferon (e.g. IFNbeta) and type II interferon (i.e. IFNgamma). IFNbeta can be produced by all types of cells, while IFNgamma is secreted by some specific types of immune cells. And both types of IFN induce antiviral responses in surrounding cells that express the IFN receptors. The fundamental question is how do PNS neurons respond to the inflammatory milieu experienced only by their axons. Axons must act as potential front-line barriers to prevent PNS infection and damage. Using compartmented cultures that physically separate neuron axons from cell bodies, I found that pretreating isolated axons with IFNbeta or IFNgamma significantly diminished the number of HSV-1 and PRV particles moving from axons to the cell bodies in an IFN receptor-dependent manner. Furthermore, I found the responses in axons are activated differentially by the two types of IFNs. The response to IFNbeta is a rapid, axon-only response, while the response to IFNgamma involves long distance signaling to the PNS cell body. For example, exposing axons to IFNbeta induced STAT1 phosphorylation (p-STAT1) only in axons, while exposure of axons to IFNgamma induced p-STAT1 accumulation in distant cell body nuclei. Blocking transcription in cell bodies eliminated IFNgamma-, but not IFNbeta-mediated antiviral effects. Proteomic analysis of IFNbeta- or IFNgamma-treated axons identified several differentially regulated proteins. Therefore
Kremers, Marjolein N. T.; Hodemaekers, Hennie M.; Hagenaars, Julia C. J. P.; Koning, Olivier H. J.; Renders, Nicole H. M.; Hermans, Mirjam H. A.; de Klerk, Arja; Notermans, Daan W.; Wever, Peter C.; Janssen, Riny
2015-01-01
A large community outbreak of Q fever occurred in the Netherlands in the period 2007 to 2010. Some of the infected patients developed chronic Q fever, which typically includes pathogen dissemination to predisposed cardiovascular sites, with potentially fatal consequences. To identify the immune mechanisms responsible for ineffective clearance of Coxiella burnetii in patients who developed chronic Q fever, we compared serum concentrations of 47 inflammation-associated markers among patients with acute Q fever, vascular chronic Q fever, and past resolved Q fever. Serum levels of gamma interferon were strongly increased in acute but not in vascular chronic Q fever patients, compared to past resolved Q fever patients. Interleukin-18 levels showed a comparable increase in acute as well as vascular chronic Q fever patients. Additionally, vascular chronic Q fever patients had lower serum levels of gamma interferon-inducible protein 10 (IP-10) and transforming growth factor β (TGF-β) than did acute Q fever patients. Serum responses for these and other markers indicate that type I immune responses to C. burnetii are affected in chronic Q fever patients. This may be attributed to an affected immune system in cardiovascular patients, which enables local C. burnetii replication at affected cardiovascular sites. PMID:25924761
Jin, Shouheng; Tian, Shuo; Luo, Man; Xie, Weihong; Liu, Tao; Duan, Tianhao; Wu, Yaoxing; Cui, Jun
2017-10-19
Tetherin (BST2/CD317) is an interferon-inducible antiviral factor known for its ability to block the release of enveloped viruses from infected cells. Yet its role in type I interferon (IFN) signaling remains poorly defined. Here, we demonstrate that Tetherin is a negative regulator of RIG-I like receptor (RLR)-mediated type I IFN signaling by targeting MAVS. The induction of Tetherin by type I IFN accelerates MAVS degradation via ubiquitin-dependent selective autophagy in human cells. Moreover, Tetherin recruits E3 ubiquitin ligase MARCH8 to catalyze K27-linked ubiquitin chains on MAVS at lysine 7, which serves as a recognition signal for NDP52-dependent autophagic degradation. Taken together, our findings reveal a negative feedback loop of RLR signaling generated by Tetherin-MARCH8-MAVS-NDP52 axis and provide insights into a better understanding of the crosstalk between selective autophagy and optimal deactivation of type I IFN signaling. Copyright © 2017 Elsevier Inc. All rights reserved.
Arsenic enhances the apoptosis induced by interferon gamma: key role of IRF-1.
El Bougrini, J; Pampin, M; Chelbi-Alix, M K
2006-05-15
Interferons (IFNs) and arsenic trioxide (As2O3) are known inhibitors of cell proliferation and have been used in the treatment of certain forms of malignancy. IFNgamma treatment of cells leads to tyrosine phosphorylation of STAT1 followed by dimerization that accumulates in the nucleus. This is followed by DNA binding, activation of target gene transcription, dephosphorylation, and return to the cytoplasm. We have shown earlier that IFNgamma and As2O3 act synergistically in acute promyelocytic leukemia cells to upregulate IRF-1 expression and to induce apoptosis. Here, we show that in the human fibrosarcoma cell line 2fTGH, As2O3 prolongs IFNgamma-induced STAT1 phosphorylation resulting in persistent binding of STAT1 to GAS motif leading to an increase in IRF-1 expression which correlated with both higher anti-proliferative effect and increased apoptosis. These biological responses induced by IFNgamma alone or in combination with As2O3 were abolished when IRF-1 expression was down-regulated by RNA interference, thus demonstrating the key role of IRF-1.