USDA-ARS?s Scientific Manuscript database
Gamma interferon (IFN-gamma)-induced protein 10 (IP-10) has recently shown promise as a diagnostic biomarker of Mycobacterium tuberculosis infection of humans. The aim of the current study was to compare IP-10 and IFN-gamma responses upon Mycobacterium bovis infection in cattle using archived sample...
Morar, D; Tijhaar, E; Negrea, A; Hendriks, J; van Haarlem, D; Godfroid, J; Michel, A L; Rutten, V P M G
2007-01-15
Bovine tuberculosis (BTB) is endemic in African buffalo (Syncerus caffer) in the Kruger National Park (KNP). In addition to buffalo, Mycobacterium bovis has been found in at least 14 other mammalian species in South Africa, including kudu (Tragelaphus strepsiceros), Chacma baboon (Papio ursinus) and lion (Panthera leo). This has raised concern about the spillover into other potentially susceptible species like rhinoceros, thus jeopardising breeding and relocation projects aiming at the conservation of biodiversity. Hence, procedures to screen for and diagnose BTB in black rhinoceros (Diceros bicornis) and white rhinoceros (Ceratotherium simum) need to be in place. The Interferon-gamma (IFN-gamma) assay is used as a routine diagnostic tool to determine infection of cattle and recently African buffalo, with M. bovis and other mycobacteria. The aim of the present work was to develop reagents to set up a rhinoceros IFN-gamma (RhIFN-gamma) assay. The white rhinoceros IFN-gamma gene was cloned, sequenced and expressed as a mature protein. Amino acid (aa) sequence analysis revealed that RhIFN-gamma shares a homology of 90% with equine IFN-gamma. Monoclonal antibodies, as well as polyclonal chicken antibodies (Yolk Immunoglobulin-IgY) with specificity for recombinant RhIFN-gamma were produced. Using the monoclonals as capture antibodies and the polyclonal IgY for detection, it was shown that recombinant as well as native white rhinoceros IFN-gamma was recognised. This preliminary IFN-gamma enzyme-linked immunosorbent assay (ELISA), has the potential to be developed into a diagnostic assay for M. bovis infection in rhinoceros.
Yoo, J C; Pae, H O; Choi, B M; Kim, W I; Kim, J D; Kim, Y M; Chung, H T
2000-02-01
The effects of ionizing irradiation on the nitric oxide (NO) production in murine embryonic liver cell line, BNL CL.2 cells, were investigated. Various doses (5-40 Gy) of radiation made BNL CL.2 cells responsive to interferon-gamma alone for the production of NO in a dose-dependent manner. Small amounts of lipopolysaccharide (LPS) or tumor necrosis factor-alpha (TNF-alpha) synergized with IFN-gamma in the production of NO from irradiated BNL CL.2 cells, even though LPS or TNF-alpha alone did not induce NO production from the same cells. Immunoblots showed parallel induction of inducible nitric oxide synthase (iNOS). NO production in irradiated BNL CL.2 cells by IFN-gamma or IFN-gamma plus LPS was decreased by the addition of catalase, suggesting that H(2)O(2) produced by ionizing irradiation primed the cells to trigger NO production in response to IFN-gamma or IFN-gamma plus LPS. Furthermore, the treatment of nongamma-irradiated BNL CL.2 cells with H(2)O(2) made the cells responsive to IFN-gamma or IFN-gamma plus LPS for the production of NO. This study shows that ionizing irradiation has the ability to induce iNOS gene expression in responsive to IFN-gamma via the formation of H(2)O(2) in BNL CL.2 murine embryonic liver cells.
Asea, A; Hansson, M; Czerkinsky, C; Houze, T; Hermodsson, S; Strannegård, O; Hellstrand, K
1996-08-01
Monocytes, recovered from human peripheral blood by counter-current centrifugal elutriation, effectively inhibit the production of IFN-gamma by CD3-/56+ NK cells in response to IL-2. This study aimed at defining the nature of the inhibitory signal, particularly the importance of monocyte-derived reactive metabolites of oxygen. It was found that monocytes recovered from patients with chronic granulomatous disease (CGD), a condition characterized by deficient NADPH-oxidase activity of phagocytes, did not inhibit IFN-gamma production by NK cells. Further, catalase, a scavenger of hydrogen peroxide, completely reversed the inhibitory signal whereas scavengers of the superoxide anion, hypohalous acids, the hydroxyl radical, or nitric oxide synthesis inhibitors such as L-NMMA were ineffective. Inhibition of IFN-gamma production was operating on a pretranslational level, as indicated by the inability of enriched NK cells to accumulate IFN-gamma mRNA in the presence of elutriated monocytes. Hydrogen peroxide, at micromolar concentrations, reconstituted the inhibition of IFN-gamma production when added to enriched NK cells. Histamine, a biogenic amine which inhibits the generation of reactive oxygen metabolites in monocytes, abrogated the inhibition of IFN-gamma production in NK cells; by this mechanism, histamine strongly synergized with IL-2 to induce IFN-gamma in mixtures of NK cells and monocytes. The synergizing effect of histamine was specifically mediated by H2-type histamine receptors. We conclude that: (i) the induction of IFN-gamma mRNA in NK cells is effectively down-regulated by products of the oxidative metabolism of monocytes; and (ii) histamine effectively enhances IFN-gamma production by preventing monocyte-induced oxidative damage to NK cells.
Si, Yue; Ciccone, Samantha; Yang, Feng-Chun; Yuan, Jin; Zeng, Daisy; Chen, Shi; van de Vrugt, Henri J; Critser, John; Arwert, Fre; Haneline, Laura S; Clapp, D Wade
2006-12-15
Fanconi anemia (FA) is a heterogeneous genetic disorder characterized by bone marrow (BM) failure and cancer susceptibility. Identification of the cDNAs of FA complementation types allows the potential of using gene transfer technology to introduce functional cDNAs as transgenes into autologous stem cells and provide a cure for the BM failure in FA patients. However, strategies to enhance the mobilization, transduction, and engraftment of exogenous stem cells are required to optimize efficacy prior to widespread clinical use. Hypersensitivity of Fancc-/- cells to interferon-gamma (IFN-gamma), a nongenotoxic immune-regulatory cytokine, enhances engraftment of syngeneic wild-type (WT) cells in Fancc-/- mice. However, whether this phenotype is of broad relevance in other FA complementation groups is unresolved. Here we show that primitive and mature myeloid progenitors in Fanca-/- and Fancg-/- mice are hypersensitive to IFN-gamma and that in vivo infusion of IFN-gamma at clinically relevant concentrations was sufficient to allow consistent long-term engraftment of isogenic WT repopulating stem cells. Given that FANCA, FANCC, and FANCG complementation groups account for more than 90% of all FA patients, these data provide evidence that IFN-gamma conditioning may be a useful nongenotoxic strategy for myelopreparation in FA patients.
Goulding, N J; Knight, S M; Godolphin, J L; Guyre, P M
1992-01-01
The therapeutic potential of interferon gamma (IFN gamma) in a number of disease states is still being explored, but progress is hampered by the lack of a suitable measure of in vivo biological activity. To assess the in vivo biological effects of recombinant human IFN gamma (rhIFN gamma), 14 patients were studied in a randomised, prospective, double blind, placebo controlled trial of this cytokine for the treatment of rheumatoid arthritis. The levels of Fc gamma receptors on peripheral blood neutrophils were measured at baseline and after 21 days of once daily, subcutaneous injections of rhIFN gamma or placebo. An induction of neutrophil Fc gamma receptor type I (Fc gamma RI) was seen in the group of patients receiving recombinant human rhIFN gamma but not in those receiving placebo. No change in the expression of Fc gamma RII or Fc gamma RIII was detected. The amount of induction of Fc gamma RI detected on the neutrophils of patients receiving rhIFN gamma did not correlate with clinical measures of response at either 21 days or at the end of the study (24 weeks). No significant clinical responses were observed in the rhIFN gamma group at these times. These data confirm that the reported in vitro effect of IFN gamma on human neutrophil Fc receptor expression can be reproduced in vivo. PMID:1534001
Goulding, N J; Knight, S M; Godolphin, J L; Guyre, P M
1992-04-01
The therapeutic potential of interferon gamma (IFN gamma) in a number of disease states is still being explored, but progress is hampered by the lack of a suitable measure of in vivo biological activity. To assess the in vivo biological effects of recombinant human IFN gamma (rhIFN gamma), 14 patients were studied in a randomised, prospective, double blind, placebo controlled trial of this cytokine for the treatment of rheumatoid arthritis. The levels of Fc gamma receptors on peripheral blood neutrophils were measured at baseline and after 21 days of once daily, subcutaneous injections of rhIFN gamma or placebo. An induction of neutrophil Fc gamma receptor type I (Fc gamma RI) was seen in the group of patients receiving recombinant human rhIFN gamma but not in those receiving placebo. No change in the expression of Fc gamma RII or Fc gamma RIII was detected. The amount of induction of Fc gamma RI detected on the neutrophils of patients receiving rhIFN gamma did not correlate with clinical measures of response at either 21 days or at the end of the study (24 weeks). No significant clinical responses were observed in the rhIFN gamma group at these times. These data confirm that the reported in vitro effect of IFN gamma on human neutrophil Fc receptor expression can be reproduced in vivo.
Effect of gamma interferon on resolution of murine chlamydial genital infection.
Rank, R G; Ramsey, K H; Pack, E A; Williams, D M
1992-01-01
Mice infected in the genital tract with the Chlamydia trachomatis agent of mouse pneumonitis were treated with monoclonal rat anti-gamma interferon (anti-IFN-gamma) antibody to determine whether IFN-gamma participated in the resolution of the infection. In two experiments, anti-IFN-gamma antibody treatment resulted in significantly prolonged infections. In support of these data, passive administration of recombinant IFN-gamma to chronically infected nu/nu mice was able to bring about resolution of the infection in some animals. PMID:1398955
Anti-interferon-gamma antibodies in the treatment of autoimmune diseases.
Skurkovich, Boris; Skurkovich, Simon
2003-02-01
Interferon (IFN)-gamma is an important immune regulator in normal immunity. When IFN gamma production is disturbed, various autoimmune diseases (ADs) can develop, in which we suggest that anti-IFN gamma could have a beneficial effect. Depending on the cell type in which IFN gamma synthesis is disturbed, different clinical manifestations may result. We have also proposed to remove tumor necrosis factor (TNF)-alpha, together with certain types of IFNs, to treat various ADs and AIDS, also an autoimmune condition. Anti-IFN gamma has been tested in several T-helper cell (Th1) ADs, including rheumatoid arthritis (RA), multiple sclerosis (MS), corneal transplant rejection, uveitis, Type I diabetes, schizophrenia (anti-IFN gamma and anti-TNF alpha), and various autoimmune skin diseases (alopecia areata, psoriasis vulgaris, vitiligo, pemphigus vulgaris and epidermolysis bullosa). A strong, sometimes striking, therapeutic response followed administration of anti-IFN gamma, indicating that it may be a promising therapy for Th1 ADs.
Controlling nuclear JAKs and STATs for specific gene activation by IFN{gamma}
DOE Office of Scientific and Technical Information (OSTI.GOV)
Noon-Song, Ezra N.; Ahmed, Chulbul M.; Dabelic, Rea
2011-07-08
Highlights: {yields} Gamma interferon (IFN{gamma}) and its receptor subunit, IFNGR1, interact with the promoter region of IFN{gamma}-associated genes along with transcription factor STAT1{alpha}. {yields} We show that activated Janus kinases pJAK2 and pJAK1 also associate with IFNGR1 in the nucleus. {yields} The activated Janus kinases are responsible for phosphorylation of tyrosine 41 on histone H3, an important epigenetic event for specific gene activation. -- Abstract: We previously showed that gamma interferon (IFN{gamma}) and its receptor subunit, IFNGR1, interacted with the promoter region of IFN{gamma}-activated genes along with transcription factor STAT1{alpha}. Recent studies have suggested that activated Janus kinases pJAK2 andmore » pJAK1 also played a role in gene activation by phosphorylation of histone H3 on tyrosine 41. This study addresses the question of the role of activated JAKs in specific gene activation by IFN{gamma}. We carried out chromatin immunoprecipitation (ChIP) followed by PCR in IFN{gamma} treated WISH cells and showed association of pJAK1, pJAK2, IFNGR1, and STAT1 on the same DNA sequence of the IRF-1 gene promoter. The {beta}-actin gene, which is not activated by IFN{gamma}, did not show this association. The movement of activated JAK to the nucleus and the IRF-1 promoter was confirmed by the combination of nuclear fractionation, confocal microscopy and DNA precipitation analysis using the biotinylated GAS promoter. Activated JAKs in the nucleus was associated with phosphorylated tyrosine 41 on histone H3 in the region of the GAS promoter. Unphosphorylated JAK2 was found to be constitutively present in the nucleus and was capable of undergoing activation in IFN{gamma} treated cells, most likely via nuclear IFNGR1. Association of pJAK2 and IFNGR1 with histone H3 in IFN{gamma} treated cells was demonstrated by histone H3 immunoprecipitation. Unphosphorylated STAT1 protein was associated with histone H3 of untreated cells. IFN{gamma
Lion (Panthera leo) and cheetah (Acinonyx jubatus) IFN-gamma sequences.
Maas, Miriam; Van Rhijn, Ildiko; Allsopp, Maria T E P; Rutten, Victor P M G
2010-04-15
Cloning and sequencing of the full length lion and cheetah interferon-gamma (IFN-gamma) transcript will enable the expression of the recombinant cytokine, to be used for production of monoclonal antibodies and to set up lion and cheetah-specific IFN-gamma ELISAs. These are relevant in blood-based diagnosis of bovine tuberculosis, an important threat to lions in the Kruger National Park. Alignment of nucleotide and amino acid sequences of lion and cheetah and that of domestic cats showed homologies of 97-100%. Copyright 2009 Elsevier B.V. All rights reserved.
Interferon-alpha and interferon-gamma sensitize human tenon fibroblasts to mitomycin-C.
Wang, Xiao Yang; Crowston, Jonathan G; Zoellner, Hans; Healey, Paul R
2007-08-01
To investigate the effect of interferon (IFN)-alpha and IFN-gamma pretreatment on mitomycin C (MMC)-induced cell death in human Tenon fibroblasts (HTFs) and the mechanisms by which IFN-alpha and IFN-gamma modulate the susceptibility of HTFs to MMC. HTFs were pretreated with IFN-alpha and IFN-gamma for 48 hours before 5-minute application of 0.4 mg/mL MMC. Cell death after 48 hours was determined by Annexin V/propidium iodide (PI) staining and lactate dehydrogenase (LDH) release assay. Fas, Fas-ligand, and Bcl-2 expression were determined by flow cytometry. Fas associated death domain (FADD), Bax, cytochrome c, and caspase expression were determined by Western blot analysis and immunofluorescence staining. MMC treatment increased cell death and upregulated Fas and FADD expression, but had no effect on Fas-Ligand, Bax, Bcl-2, or cytochrome c. Neither IFN-alpha nor IFN-gamma alone induced HTF death, but each increased cell death 2 days after MMC treatment in a dose-dependent fashion. Combination IFN-alpha and IFN-gamma had a synergistic effect. IFN-alpha and IFN-gamma pretreatment increased Fas expression. Fas upregulation was associated with increased sensitivity to MMC. IFN pretreatment increased procaspase-8, procaspase-9, and procaspase-3 expression, and caspase-3 activation. Caspase-8, caspase-3, and broad caspase inhibitors, but not caspase-9 inhibitor, inhibited MMC-induced cell death in nonpretreated and IFN-pretreated cells. IFN-alpha and IFN-gamma enhance the susceptibility of HTFs to MMC-induced cell death through a Fas-mediated and a caspase-3-dependent pathway. Pretreatment with IFN primed HTFs to MMC, providing a potential means for initially slowing the healing response with IFN and subsequently terminating fibroblast activity through MMC-induced cell death.
[Interferon. An overview of the state of basic research with special regard to interferon-gamma].
Günther, G; Otto, B
1993-02-01
Interferons / An overview on the state of basic research with special regard to interferon-gamma Interferons are multifunctional glycoproteins with a broad range of antiviral, antiproliferative and immunoregulatory effects on the target cell. This review deals with the basics as well as with more recent developments in interferon research. A historic overview of 35 years of interferon research since the discovery of interferons by Isaacs and Lindenmann in 1957 introduces the most important milestones in this field and appreciates the work of the participating researchers. A brief description of the classification of interferons based on different tissue sources, different antigenic properties and different induction behaviour is made. The main part of this review focuses on human interferon-gamma. We discuss recent work on the structure-function relationship of interferon-gamma. The interferon-gamma receptor and its role in signal transduction is another part of this paper. The structure and length of the C-terminal region of interferon-gamma seems to be important for receptor binding and expression of biological activities. A conservative estimate is that the family of IFN-activated genes numbers 15-20 in most cells.
Zhang, Kao; Jin, Huijun; Zhong, Fei; Li, Xiujin; Neng, Changai; Chen, Huihui; Li, Wenyan; Wen, Jiexia
2012-11-04
To construct recombinant adenovirus containing canine interferon-gamma (cIFN-gamma) gene and to investigate its antiviral activity against canine parvovirus in Madin-Darby canine kidney cells (MDCK). [Methods] The cIFN-gamma gene was inserted into adenovirus shuttle plasmid to construct pShuttle3-cIFN-gamma expression vector, from which the cIFN-gamma expression cassette was transferred into the adenovirus genomic plasmid pAdeno-X by specific restriction sites to generate recombinant adenovirus genomic plasmid pAd-cIFN-gamma. The pAd-cIFN-gamma plasmid was linearized by digestion and transfected into human embryonic kidney (HEK) 293T cells to generate the replication-defective cIFN-gamma recombinant adenovirus (Ad-cIFN-gamma). To analyze its anti-canine parvovirus activity, the MDCK cells were pre-infected by Ad-cIFN-gamma recombinant adenovirus, and then infected by canine parvovirus. The antiviral activity of the Ad-cIFN-gamma recombinant adenovirus against parvovirus was analyzed. The recombinant adenovirus containing cIFN-gamma gene was constructed by the ligation method. The recombinant adenovirus could mediates recombinant cIFN-gamma secretory expression in MDCK cells. The Ad-cIFN-gamma recombinant adenovirus could significantly inhibit canine parvovirus replication in MDCK cells pre-infected with the recombinant adenovirus. These results indicate that the Ad-cIFN-gamma recombinant adenovirus has the potent antiviral activity against canine parvovirus. The Ad-cIFN-gamma recombinant adenovirus was successfully constructed by the ligation method and possessed a powerful antiviral activity against canine parvovirus.
Role of gamma interferon in a neonatal mouse model of group B streptococcal disease.
Cusumano, V; Mancuso, G; Genovese, F; Delfino, D; Beninati, C; Losi, E; Teti, G
1996-01-01
The aim of this study was to assess the role of gamma interferon (IFN-gamma) in a neonatal mouse model of group B streptococcal (GBS) sepsis. IFN-gamma was produced by spleen cells at 24, 48, and 72 h after GBS challenge. Treatment with anti-IFN-gamma at 6 h before challenge totally abrogated the IFN-gamma response but did not affect survival. Subcutaneous administration of recombinant IFN-gamma (2,500 IU per pup) at 18 h after challenge resulted in increased survival time and reduced blood colony counts at 48 and 72 h. In vitro preincubation of neonatal whole blood with IFN-gamma before the addition of GBS resulted in significant restriction of bacterial growth. These data indicate that administration of recombinant IFN-gamma can partially restore impaired host defenses against GBS in neonatal mice. This cytokine may be useful for the treatment of neonatal infections. PMID:8757817
The immunomodulatory effects of interferon-gamma on mature B-lymphocyte responses.
Jurado, A; Carballido, J; Griffel, H; Hochkeppel, H K; Wetzel, G D
1989-06-15
Interferon-gamma (IFN-gamma) exerts a broad spectrum of activities which affect the responses of mature B-cells. It strongly inhibits B-cell activation, acts as a B-cell growth factor (BCGF), and also induces final differentiation to immunoglobulin (Ig) production. IFN-gamma is deeply involved in the differential control of isotype expression, as it enhances IgG2a production and suppresses both IgG1 and IgE production. Although it is now possible to draw a general scheme of the effects of IFN-gamma on B-cells, a number of paradoxical results still exist in the field. In this manuscript, different experimental systems are analyzed in an attempt to explain these apparent paradoxes.
Interferon-gamma inhibits HIV-induced invasiveness of monocytes.
Dhawan, S; Wahl, L M; Heredia, A; Zhang, Y; Epstein, J S; Meltzer, M S; Hewlett, I K
1995-12-01
HIV-infected monocytes form highly invasive network on basement membrane matrix and secrete high levels of 92-kd metalloproteinase (MMP-9), an enzyme that degrades basement membrane proteins. In the present study, using matrigel as a model basement membrane system, we demonstrate that treatment of human immunodeficiency virus (HIV)-infected monocytes with interferon-gamma at 50 U/ml inhibited the ability of infected monocytes to form an invasive network on matrigel and their invasion through the matrigel matrix. These effects were associated with a significant reduction in the levels of MMP-9 produced by HIV-infected monocytes treated with interferon-gamma 1 day prior to infection with HIV as compared with that of untreated HIV-infected monocytes. Monocytes treated with interferon-gamma 1 day after HIV infection showed the presence of integrated HIV sequences; however, the levels of MMP-9 were substantially lower than those produced by monocytes inoculated with live HIV, heat-inactivated HIV, or even the control uninfected monocytes. Exposure of monocytes to heat-inactivated HIV did not result in increased invasiveness or high MMP-9 production, suggesting that regulation of metalloproteinase by monocytes was independent of CD4-gp120 interactions and required active virus infection. Furthermore, addition of interferon-gamma to monocytes on day 10 after infection inhibited MMP-9 production by more than threefold with no significant reduction of virus replication. These results indicate that the mechanism of interferon-gamma-induced down-regulation of MMP-9 levels and reduced monocyte invasiveness may be mediated by a mechanism independent of antiviral activity of IFN-gamma in monocytes. Down-regulation of MMP-9 in HIV-infected monocytes by interferon-gamma may play an important role in the control of HIV pathogenesis.
Tao, Yaqiong; Zeng, Bo; Xu, Liu; Yue, Bisong; Yang, Dong; Zou, Fangdong
2010-01-01
Interferon-gamma (IFN-gamma) is the only member of type II IFN and is vital in the regulation of immune and inflammatory responses. Herein we report the cloning, expression, and sequence analysis of IFN-gamma from the giant panda (Ailuropoda melanoleuca). The open reading frame of this gene is 501 base pair in length and encodes a polypeptide consisting of 166 amino acids. All conserved N-linked glycosylation sites and cysteine residues among carnivores were found in the predicted amino acid sequence of the giant panda. Recombinant giant panda IFN-gamma with a V5 epitope and polyhistidine tag was expressed in HEK293 host cells and confirmed by Western blotting. Phylogenetic analysis of mammalian IFN-gamma-coding sequences indicated that the giant panda IFN-gamma was closest to that of carnivores, then to ungulates and dolphin, and shared a distant relationship with mouse and human. These results represent a first step into the study of IFN-gamma in giant panda.
Gao, Y; Chenping; Lin, X P
1997-10-01
In order to determine whether interferon-gamma (IFN-gamma) inhibits eosinphil infiltration in the trachea of asthmatic guinea pigs induced by Rhizopus nigricans. We had administered aerosolized rIFN-gamma in the tracheas of 30 sensitized guinea pigs which had been divided into six groups, then teated animal inhaled rIFN-gamma of 5 x 10(4), 20 x 10(4), and 40 x 10(4) concentration, BDP and normal saline respectively at 24 h, 12 h, 2 h before being challenged. (1) Provocation positive rates decreased in 40 x 10(4) rIFN-gamma and BDP group compared with that in normal saline group and before intervention (P < 0.05), airway resistence decreased (P < 0.01). (2) The administration of aerosolized rIFN-gamma (40 x 10(4)) and BDP also decreased fungus-induced eosnophils but not other cells infiltration in the trachea. (3) In BALF, Eos count and ECP level were obviously lower than those in other groups. However, eosinophil numbers did not show significant change in the peripheral blood. Local administration of rIFN-gamma (40 x 10(4)) may reduce airway inflammation and intervene asthmatic attack by inhibition of Eos, ECP infiltration in airways.
Evidence for a gamma-interferon receptor that regulates macrophage tumoricidal activity
1984-01-01
Gamma-interferon (IFN-gamma) is the macrophage-activating factor (MAF) produced by normal murine splenic cells and the murine T cell hybridoma 24/G1 that induces nonspecific tumoricidal activity in macrophages. Incubation of 24/G1 supernatants diluted to 8.3 IRU IFN-gamma/ml with 6 X 10(6) elicited peritoneal macrophages or bone marrow-derived macrophages for 4 h at 37 degrees C, resulted in removal of 80% of the MAF activity from the lymphokine preparation. Loss of activity appeared to result from absorption and not consumption because (a) 40% of the activity was removed after exposure to macrophage for 30 min at 4 degrees C, (b) no reduction of MAF activity was detected when the 24/G1 supernatant was incubated with macrophage culture supernatants, and (c) macrophage-treated supernatants showed a selective loss of MAF activity but not interleukin 2 (IL-2) activity. Absorption was dependent on the input of either IFN-gamma or macrophages and was time dependent at 37 degrees C but not at 4 degrees C. With four rodent species tested, absorption of murine IFN-gamma displayed species specificity. However, cultured human peripheral blood monocytes and the human histiocytic lymphoma cell line U937 were able to absorb the murine lymphokine. Although the majority of murine cell lines tested absorbed 24/G1 MAF activity, two murine macrophage cell lines, P388D1 and J774, were identified which absorbed significantly reduced amounts of natural IFN- gamma. Purified murine recombinant IFN-gamma was absorbed by elicited macrophages but not by P388D1. Normal macrophages but not P388D1 bound fluoresceinated microspheres coated with recombinant IFN-gamma and binding was inhibited by pretreatment of the normal cells with 24/G1 supernatants. Scatchard plot analysis showed that 12,000 molecules of soluble 125I-recombinant IFN-gamma bound per bone marrow macrophage with a Ka of 0.9 X 10(8) M-1. Binding was quantitatively inhibitable by natural IFN-gamma but not by murine IFN alpha. IFN
Development of an aptamer beacon for detection of interferon-gamma.
Tuleuova, Nazgul; Jones, Caroline N; Yan, Jun; Ramanculov, Erlan; Yokobayashi, Yohei; Revzin, Alexander
2010-03-01
Traditional antibody-based affinity sensing strategies employ multiple reagents and washing steps and are unsuitable for real-time detection of analyte binding. Aptamers, on the other hand, may be designed to monitor binding events directly, in real-time, without the need for secondary labels. The goal of the present study was to design an aptamer beacon for fluorescence resonance energy transfer (FRET)-based detection of interferon-gamma (IFN-gamma)--an important inflammatory cytokine. Variants of DNA aptamer modified with biotin moieties and spacers were immobilized on avidin-coated surfaces and characterized by surface plasmon resonance (SPR). The SPR studies showed that immobilization of aptamer via the 3' end resulted in the best binding IFN-gamma (K(d) = 3.44 nM). This optimal aptamer variant was then used to construct a beacon by hybridizing fluorophore-labeled aptamer with an antisense oligonucleotide strand carrying a quencher. SPR studies revealed that IFN-gamma binding with an aptamer beacon occurred within 15 min of analyte introduction--suggesting dynamic replacement of the quencher-complementary strand by IFN-gamma molecules. To further highlight biosensing applications, aptamer beacon molecules were immobilized inside microfluidic channels and challenged with varying concentration of analyte. Fluorescence microscopy revealed low fluorescence in the absence of analyte and high fluorescence after introduction of IFN-gamma. Importantly, unlike traditional antibody-based immunoassays, the signal was observed directly upon binding of analyte without the need for multiple washing steps. The surface immobilized aptamer beacon had a linear range from 5 to 100 nM and a lower limit of detection of 5 nM IFN-gamma. In conclusion, we designed a FRET-based aptamer beacon for monitoring of an inflammatory cytokine-IFN-gamma. In the future, this biosensing strategy will be employed to monitor dynamics of cytokine production by the immune cells.
Jeevan, A; McFarland, C T; Yoshimura, T; Skwor, T; Cho, H; Lasco, T; McMurray, D N
2006-01-01
Gamma interferon (IFN-gamma) plays a critical role in the protective immune responses against mycobacteria. We previously cloned a cDNA coding for guinea pig IFN-gamma (gpIFN-gamma) and reported that BCG vaccination induced a significant increase in the IFN-gamma mRNA expression in guinea pig cells in response to living mycobacteria and that the virulent H37Rv strain of Mycobacterium tuberculosis stimulated less IFN-gamma mRNA than did the attenuated H37Ra strain. In this study, we successfully expressed and characterized recombinant gpIFN-gamma with a histidine tag at the N terminus (His-tagged rgpIFN-gamma) in Escherichia coli. rgpIFN-gamma was identified as an 18-kDa band in the insoluble fraction; therefore, the protein was purified under denaturing conditions and renatured. N-terminal amino acid sequencing of the recombinant protein yielded the sequence corresponding to the N terminus of His-tagged gpIFN-gamma. The recombinant protein upregulated major histocompatibility complex class II expression in peritoneal macrophages. The antiviral activity of rgpIFN-gamma was demonstrated with a guinea pig fibroblast cell line (104C1) infected with encephalomyocarditis virus. Interestingly, peritoneal macrophages treated with rgpIFN-gamma did not produce any nitric oxide but did produce hydrogen peroxide and suppressed the intracellular growth of mycobacteria. Furthermore, rgpIFN-gamma induced morphological alterations in cultured macrophages. Thus, biologically active rgpIFN-gamma has been successfully produced and characterized in our laboratory. The study of rgpIFN-gamma will further increase our understanding of the cellular and molecular responses induced by BCG vaccination in the guinea pig model of pulmonary tuberculosis.
Sonoda, Junichiro; Laganière, Josée; Mehl, Isaac R; Barish, Grant D; Chong, Ling-Wa; Li, Xiangli; Scheffler, Immo E; Mock, Dennis C; Bataille, Alain R; Robert, Francois; Lee, Chih-Hao; Giguère, Vincent; Evans, Ronald M
2007-08-01
Macrophage activation by the proinflammatory cytokine interferon-gamma (IFN-gamma) is a critical component of the host innate response to bacterial pathogenesis. However, the precise nature of the IFN-gamma-induced activation pathway is not known. Here we show using genome-wide expression and chromatin-binding profiling that IFN-gamma induces the expression of many nuclear genes encoding mitochondrial respiratory chain machinery via activation of the nuclear receptor ERR alpha (estrogen-related receptor alpha, NR3B1). Studies with macrophages lacking ERR alpha demonstrate that it is required for induction of mitochondrial reactive oxygen species (ROS) production and efficient clearance of Listeria monocytogenes (LM) in response to IFN-gamma. As a result, mice lacking ERR alpha are susceptible to LM infection, a phenotype that is localized to bone marrow-derived cells. Furthermore, we found that IFN-gamma-induced activation of ERR alpha depends on coactivator PGC-1 beta (peroxisome proliferator-activated receptor gamma coactivator-1 beta), which appears to be a direct target for the IFN-gamma/STAT-1 signaling cascade. Thus, ERR alpha and PGC-1 beta act together as a key effector of IFN-gamma-induced mitochondrial ROS production and host defense.
Cannon, Grant W; Pincus, Seth H; Emkey, Ronald D; Denes, Alex; Cohen, Selwyn A; Wolfe, Frederick; Saway, P Anthony; Jaffer, Adrian M; Weaver, Arthur L; Cogen, Lewis; Schindler, John D
2008-02-01
One hundred five patients were enrolled in a 12-week, randomized, prospective, double-blind, placebo-controlled trial of recombinant human gamma-interferon (rHu gamma-IFN) for the treatment of rheumatoid arthritis. Fifty-four patients received rHu gamma-IFN and 51 received placebo. Forty-two patients in each group completed the 12-week trial. Some clinical improvement occurred in both groups of patients. Although the improvement with rHu gamma-IFN was greater than that with placebo, the differences were generally not statistically significant.
Effects of chicken interferon Gamma on Newcastle disease virus vaccine immunogenicity
USDA-ARS?s Scientific Manuscript database
More effective vaccines are needed to control avian diseases. The use of chicken interferon gamma (chIFN') during vaccination is a potentially important but controversial approach that may improve the immune response to antigens. In the present study, three different systems to co-deliver chIFN' wit...
Yanagida, M; Fukamachi, H; Takei, M; Hagiwara, T; Uzumaki, H; Tokiwa, T; Saito, H; Iikura, Y; Nakahata, T
1996-01-01
We examined the effects of interferon-gamma (IFN-gamma) on 100% pure human mast cells generated in suspension cultures of umbilical cord blood mononuclear cells in the presence of stem cell factor (SCF) and interleukin-6 (IL-6). When mast cells were suspended in serum-free medium without any cytokine after the withdrawal of SCF and IL-6, they died over a period of 5 days because of apoptosis. IFN-gamma in the cultures suppressed apoptosis and prolonged their survival in a dose-dependent manner. This survival-promoting effect of IFN-gamma was blocked by neutralizing antibodies to IFN-gamma or to IFN-gamma receptor (IFN-gamma R). When mast cells were incubated with IFN-gamma in serum-free medium for more than 4 hr during sensitization, immunoglobulin E (IgE)/anti-IgE antibody-induced histamine release was effectively enhanced. Polymerase chain reaction (PCR) amplification of the alpha-chain of IFN-gamma R (IFN-gamma R alpha) yielded products of the correct size predicted from the sequence of the receptor. In addition, flow cytometry using anti-IFN-gamma R monoclonal antibodies (mAbs) indicated that these mast cells bear IFN-gamma R on their surface. These findings suggested that IFN-gamma activates human mast cells via specific receptors in certain aspects of inflammatory reactions. Images Figure 2 Figure 4 PMID:9014819
Effects of interferon-gamma and tumor necrosis factor-alpha on macrophage enzyme levels
NASA Technical Reports Server (NTRS)
Pierangeli, Silvia S.; Sonnenfeld, Gerald
1989-01-01
Murine peritoneal macrophages were treated with interferon-gamma (IFN-gamma) or tumor necrosis factor-alpha (TNF). Measurements of changes in acid phosphatase and beta-glucuronidase levels were made as an indication of activation by cytokine treatment. IFN-gamma or TNF-gamma treatment resulted in a significant increase in the activities of both enzymes measured in the cell lysates. This increase was observable after 6 h of incubation, but reached its maximum level after 24 h of incubation. The effect of the treatment of the cell with both cytokines together was additive. No synergistic effect of addition of both cytokines on the enzyme levels was observed.
Paillot, R; Daly, J M; Juillard, V; Minke, J M; Hannant, D; Kydd, J H
2005-08-22
Equine cytotoxic T lymphocyte (CTL) responses to equine herpesvirus-1 (EHV-1) are well characterised but little is known about the cytokine response after infection or vaccination. EHV-1 is common in horses and infects lymphocytes in vivo. This virus was used as a model to measure the synthesis of interferon gamma (IFN-gamma) by equine peripheral blood mononuclear cells (PBMC) after in vivo infection and/or in vitro stimulation with EHV-1. Both flow cytometry and ELISPOT assays were used to quantify equine IFN-gamma using a mouse anti-bovine IFN-gamma monoclonal antibody (clone CC302; shown to cross-react with recombinant equine IFN-gamma) and a rabbit anti-canine IFN-gamma polyclonal antibody. The percentage of PBMC synthesising IFN-gamma after in vitro stimulation with EHV-1 increased with age. In yearlings infected experimentally with EHV-1, PBMC showed two peaks of IFN-gamma synthesis, 11 and 56 days after infection. The IFN-gamma synthesis was principally associated with CD8(+) cells. The patterns of IFN-gamma synthesis detected by intracellular IFN-gamma staining or ELISPOT were compared with CTL data and shown to be similar. These methods were also applied successfully to frozen samples of PBMC. Measurement of equine IFN-gamma using these simple techniques can now be applied to future studies on protective cellular immune responses following virus infection and/or vaccination of horses.
IFN-gamma induction by SCG, 1,3-beta-D-glucan from Sparassis crispa, in DBA/2 mice in vitro.
Harada, Toshie; Miura, Noriko N; Adachi, Yoshiyuki; Nakajima, Mitsuhiro; Yadomae, Toshiro; Ohno, Naohito
2002-12-01
Sparassis crispa Fr. in an edible mushroom recently cultivable in Japan. A branched beta-glucan from S. crispa (SCG) is a major 6-branched 1,3-beta-D-glucan showing antitumor activity. In this study, we examined interferon-gamma (IFN-gamma) induction by SCG from splenocytes in DBA/2 mice in vitro. In the splenocytes derived from almost all inbred strains of mice except for DBA/1 and DBA/2 mice, IFN-gamma production was not induced by SCG. The breeder and genders of DBA/2 mice showed no influence on IFN-gamma induction by SCG. On the other hand, the magnitude of IFN-gamma induction was lower in young mice than in their older counterparts. IFN-gamma was induced by SCG in adherent splenocytes, but IFN-gamma production was most significantly increased by SCG in instances involving coexistence of adherent and nonadherent splenocytes. In fact, inhibition of cell-cell contact reduced IFN-gamma induction by SCG. In addition, interleukin-12 p70 (IL-12p70) was induced by SCG in DBA/2 mice. It was suggested that soluble factors and cell-cell contact mediate synergistic effects on SCG-induced IFN-gamma production.
Badie, B; Schartner, J; Vorpahl, J; Preston, K
2000-04-01
Activation of microglia by interferon-gamma (IFN-gamma) has been implicated in a number of central nervous system (CNS) inflammatory disease processes. Because IFN-gamma has also been shown to play a role in programmed cell death, we investigated its cytotoxicity and its effect on the Fas apoptotic pathway in microglia. Flow cytometry was used to quantify the IFN-gamma-mediated apoptotic response and Fas and Fas ligand (FasL) expression in two well-characterized murine microglia cell lines (BV-2 and N9). Nuclear fragmentation, suggestive of apoptosis, was noted within 24 h of incubation of microglia with IFN-gamma (10 U/ml). After a 72-h incubation, almost every BV-2 and N9 microglia, but not GL261 glioma cells, underwent cell death and detached from the culture plates. This cytotoxicity occurred even at low IFN-gamma concentrations (1 U/ml) and was inhibited by BAF, a pan-caspase inhibitor. Incubation of BV-2 and N9 microglia, but not GL261 glioma cells, with IFN-gamma also potentiated the expression of Fas and FasL in a similar dose-response and time-course manner, as seen for the apoptotic response. Whereas Fas expression increased by 100% in both microglia cells, FasL upregulation was more pronounced and increased by as much as 200% in the N9 cells. These findings suggest that in addition to its role as a microglia activator, IFN-gamma may also induce apoptosis of microglia, possibly through simultaneous upregulation of Fas and FasL. Interferon-gamma modulation of the Fas pathway and apoptosis in microglia may be important in the pathogenesis of inflammatory CNS disease processes. Copyright 2000 Academic Press.
Delisle, Jean-Sébastien; Gaboury, Louis; Bélanger, Marie-Pier; Tassé, Eliane; Yagita, Hideo; Perreault, Claude
2008-09-01
The immunopathologic condition known as graft-versus-host disease (GVHD) results from a type I T-cell process. However, a prototypical type I cytokine, interferon-gamma (IFN-gamma), can protect against several manifestations of GVHD in recipients of major histocompatibility complex (MHC)-mismatched hematopoietic cells. We transplanted hematopoietic cells from C3H.SW donors in wild-type (wt) and IFN-gamma-receptor-deficient (IFN-gammaRKO) MHC-matched C57BL/6 recipients. In IFN-gammaRKO recipients, host cells were unresponsive to IFN-gamma, whereas wt donor cells were exposed to exceptionally high levels of IFN-gamma. From an IFN-gamma perspective, we could therefore evaluate the impact of a loss-of-function on host cells and gain-of-function on donor cells. We found that lack of IFN-gammaR prevented up-regulation of MHC proteins on host cells but did not mitigate damage to most target organs. Two salient phenotypes in IFN-gammaRKO recipients involved donor cells: lymphoid hypoplasia and hematopoietic failure. Lymphopenia was due to FasL-induced apoptosis and decreased cell proliferation. Bone marrow aplasia resulted from a decreased proliferation of hematopoietic stem/progenitor cells that was associated with down-regulation of 2 genes negatively regulated by IFN-gamma: Ccnd1 and Myc. We conclude that IFN-gamma produced by alloreactive T cells may entail a severe graft-versus-graft reaction and could be responsible for cytopenias that are frequently observed in subjects with GVHD.
Interferon Gamma as a Biomarker of Exposure to Enteric Viruses
Interferon gamma (IFN-γ) was selected as a biomarker for viral exposure. Twelve-week-old BALB/c mice were intraperitoneally injected with Coxsackievirus B3 or B4 diluted in phosphate-buffered saline (PBS). Control mice were injected with PBS only. Four months after viral infectio...
[Experimental study of IFN-alpha and IFN-gamma on reversing ATRA-resistance in MR2 cell line].
He, Peng-Cheng; Zhang, Mei; Li, Jing; Cao, Yun-Xin; Cai, Rui-Bo; Liu, Ya-Lin
2007-03-01
To explore the possibility and the possible mechanism of reversing ATRA-resistance in MR2 cells by using IFN-alpha and IFN-gamma in combination with all-trans retinoic acid (ATRA). After MR2 cells(ATRA-resistance cell line) were treated with IFN-alpha, IFN-gamma and ATRA alone or IFN-alpha and IFN-gamma in combination with ATRA respectively, the cell proliferation was tested by MTT colorimetry, the cell differentiation was tested through light microscope, by NBT test and flow cytometry (FCM). The expression of promyelocytic leukemia (PML) protein was observed by indirect immunofluorescence staining. Both IFN-alpha and IFN-gamma could inhibit the proliferation of MR2 cells. The effects were more obviously in both IFN-alpha+ATRA group and IFN-gamma+ATRA group. But there were no significant difference between either IFN-alpha group and IFN-gamma group or IFN-alpha+ATRA group and IFN-gamma+ATRA group (P>0.05). Both IFN could also induce the differentiation of MR2 cells. The effects of IFN-alpha+ATRA group and IFN-gamma+ATRA group were more obvious. However, the differentiation of MR2 cells induced by IFN-gamma+ATRA group was more higher than that by IFN-alpha+ATRA group (P<0.05). Both IFN could induce the expression of PML protein. The reversing effcet of IFN-gamma+ATRA group on ATRA-resistence in MR2 cells are more powerful than that of IFN-alpha+ATRA group, which may be related to the different signal transduction pathway of IFN-alpha and IFN-gamma.
Reproducibility of Interferon Gamma (IFN-γ) Release Assays. A Systematic Review
Tagmouti, Saloua; Slater, Madeline; Benedetti, Andrea; Kik, Sandra V.; Banaei, Niaz; Cattamanchi, Adithya; Metcalfe, John; Dowdy, David; van Zyl Smit, Richard; Dendukuri, Nandini
2014-01-01
Rationale: Interferon gamma (IFN-γ) release assays for latent tuberculosis infection result in a larger-than-expected number of conversions and reversions in occupational screening programs, and reproducibility of test results is a concern. Objectives: Knowledge of the relative contribution and extent of the individual sources of variability (immunological, preanalytical, or analytical) could help optimize testing protocols. Methods: We performed a systematic review of studies published by October 2013 on all potential sources of variability of commercial IFN-γ release assays (QuantiFERON-TB Gold In-Tube and T-SPOT.TB). The included studies assessed test variability under identical conditions and under different conditions (the latter both overall and stratified by individual sources of variability). Linear mixed effects models were used to estimate within-subject SD. Measurements and Main Results: We identified a total of 26 articles, including 7 studies analyzing variability under the same conditions, 10 studies analyzing variability with repeat testing over time under different conditions, and 19 studies reporting individual sources of variability. Most data were on QuantiFERON (only three studies on T-SPOT.TB). A considerable number of conversions and reversions were seen around the manufacturer-recommended cut-point. The estimated range of variability of IFN-γ response in QuantiFERON under identical conditions was ±0.47 IU/ml (coefficient of variation, 13%) and ±0.26 IU/ml (30%) for individuals with an initial IFN-γ response in the borderline range (0.25–0.80 IU/ml). The estimated range of variability in noncontrolled settings was substantially larger (±1.4 IU/ml; 60%). Blood volume inoculated into QuantiFERON tubes and preanalytic delay were identified as key sources of variability. Conclusions: This systematic review shows substantial variability with repeat IFN-γ release assays testing even under identical conditions, suggesting that reversions
Breckler, L A; Hale, J; Taylor, A; Dunstan, J A; Thornton, C A; Prescott, S L
2008-11-01
During pregnancy, variations in maternal-foetal cellular interactions may influence immune programming. This study was carried out to determine if maternal responses to foetal alloantigens are altered by maternal allergic disease and/or previous pregnancies. For this cohort study, peripheral blood was collected from allergic (n = 69) and nonallergic (n = 63) pregnant women at 20, 30, 36-week gestation and 6-week postpartum (pp). Cord blood was collected at delivery. Mixed lymphocyte reactions were used to measure maternal cytokine responses [interleukin-6 (IL-6), IL-10, IL-13 and (interferon-gamma) IFN-gamma] at each time point towards foetal mononuclear cells. Maternal cytokine responses during pregnancy (20, 30 and 36 weeks) were suppressed compared to the responses at 6-week pp. The ratio of maternal IFN-gamma/IL-13 and IFN-gamma/IL-10 responses were lower during pregnancy. Allergic mothers had lower IFN-gamma responses at each time-point during pregnancy with the greatest difference in responses observed at 36-week gestation. When allergic and nonallergic women were further stratified by gravidity group, IFN-gamma responses of allergic multigravid mothers were significantly lower than nonallergic multigravid mothers during pregnancy. During normal pregnancy, peripheral T-cell cytokine responses to foetal alloantigens may be altered by both allergic status of the mother and previous pregnancies. These factors could influence the cytokine milieu experienced by the foetus and will be further explored in the development of allergic disease during early life.
Qin, Xin-Tian; Lu, Yue; Tan, Yin-Duo; Chen, Xiao-Qin; Gen, Qi-Rong
2008-01-01
We have constructed plasmid "pTre-IFN-gamma" and proved that the Tet-off system could regulate the expression of human interferon-gamma (IFN-gamma) gene in murine marrow stromal cells in vitro. This study was to investigate the regulatory reversibility of Tet-off system and its effect on the expression of human IFN-gamma gene in murine marrow stromal cells in mice. Plasmids pTet-off and pTre-IFN-gamma were co-transfected into murine marrow stromal cells. The expression of IFN-gamma in marrow stromal cells was detected with ELISA. The marrow stromal cells were transfused into BABL/c naked mice after co-transfection. The expression of IFN-gamma mRNA in the spleen was detected by real-time fluorescent quantitative reverse transcription-polymerase chain reaction (RT-PCR). IFN-gamma protein was detected in the culture solution of marrow stromal cells after co-transfection. The secretion peak appeared within the first 72 h. The protein level of IFN-gamma was significantly lower in 300 ng/ml tetracycline hydrochloride-treated marrow stroma cells than in untreated cells [(67.11+/-22.14) pg/1 x 10(7) cells vs. (319.96+/-29.04) pg/1 x 10(7) cells, P<0.001]; its expression was increased when removed tetracycline hydrochloride (P=0.032). The expression of human IFN-gamma mRNA was detected in the spleen. The mRNA level of IFN-gamma was significantly higher in untreated group than in continuous tetracycline hydrochloride-treated group [(1.5+/-0.7)x10(5) copies . (100 mg)(-1) vs. (6.9+/-5.3)x10(2) copies . (100 mg)(-1), P<0.001]; its expression in the mice received tetracycline hydrochloride for one single time lay between the above two groups with significant difference. In mice, Tet-off system could rapidly, efficiently and reversibly regulate the expression of human IFN-gamma gene in marrow stromal cells in vitro and in vivo.
Yuminamochi, Eri; Koike, Taisuke; Takeda, Kazuyoshi; Horiuchi, Isao; Okumura, Ko
2007-06-01
Dried fruiting bodies of Agaricus blazei Murill (A. blazei) and its extracts have generally used as complementary and alternative medicines (CAMs). Here, we report that the oral administration of A. blazei augmented cytotoxicity of natural killer (NK) cells in wild-type (WT) C57BL/6, C3H/HeJ, and BALB/c mice. Augmented cytotoxicity was demonstrated by purified NK cells from treated wild-type (WT) and RAG-2-deficient mice, but not from interferon-gamma (IFN-gamma) deficient mice. NK cell activation and IFN-gamma production was also observed in vitro when dendritic cell (DC)-rich splenocytes of WT mice were coincubation with an extract of A. blazei. Both parameters were largely inhibited by neutralizing anti-interleukin-12 (IL-12) monoclonal antibody (mAb) and completely inhibited when anti-IL-12 mAb and anti-IL-18 mAb were used in combination. An aqueous extract of the hemicellulase-digested compound of A. blazei particle; (ABPC) induced IFN-gamma production more effectively, and this was completely inhibited by anti-IL-12 mAb alone. NK cell cytotoxicty was augmented with the same extracts, again in an IL-12 and IFN-gamma-dependent manner. These results clearly demonstrated that A. blazei and ABPC augmented NK cell activation through IL-12-mediated IFN-gamma production.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bursuker, I.; Pearce, M.T.
1990-02-01
The state of active immunity to Meth A fibrosarcoma in mice immunized with an admixture of Meth A cells and Propionibacterium acnes is associated with possession by the host of spleen cells capable of producing interferon-gamma (IFN-gamma) upon in vitro restimulation with irradiated tumor cells. The ability of spleen cells from immunized mice to produce IFN-gamma in response to irradiated Meth A cells decays as active antitumor immunity is replaced by a state of immunological memory. The IFN-producing cells are L3T4+Ly2+, cyclophosphamide-sensitive and radiosensitive T cells, as determined by their sensitivity to corresponding monoclonal antibodies and complement. The induction ofmore » IFN-gamma production by in vivo tumor-sensitized T cells is tumor specific, in that spleen cells from mice immunized against Meth A fibrosarcoma can produce IFN in response to irradiated Meth A cells but not in response to another syngeneic tumor M109 lung carcinoma.« less
USDA-ARS?s Scientific Manuscript database
Currently the Bovigam assay is used as an official supplemental test within the bovine tuberculosis eradication program. This assay measures interferon-gamma (IFN-gamma) produced by lymphocytes in response to specific antigens. The objectives of the present study were to evaluate two Mycobacterium ...
Brar, Kanwaljit; Leung, Donald Y M
2016-01-01
Atopic dermatitis (AD) is the most common inflammatory skin disease in the general population. There are different endophenotypes of AD that likely have a unique immune and molecular basis, such as those who are predisposed to eczema herpeticum, or Staphylococcus aureus infections. In this review, we highlight the endophenotypes of AD where reduced interferon gamma expression may be playing a role. Additionally, we review the potential role of recombinant interferon gamma therapy in the treatment of atopic dermatitis and the particular phenotypes that may benefit from this treatment. Recombinant interferon gamma treatment will likely benefit the pediatric population with AD, as well as those with susceptibilities for skin infections. Future studies are needed to elucidate whether IFN-γ may reduce the prevalence of skin infection in AD.
Pae, H O; Yoo, J C; Choi, B M; Paik, S G; Kim, Y H; Jin, H S; Chung, H T
1999-01-01
A previous study has demonstrated that both interferon-gamma (IFN-gamma) and lipopolysaccharide (LPS) were needed to induce the production of nitric oxide (NO) in BNL CL.2 cells, murine embryonic liver cells. We here demonstrate that when BNL CL.2 cells were cultured with serum-free medium, they were induced to produce NO by the stimulation of IFN-gamma alone. BNL CL.2 cells were cultured with serum-free or serum-containing medium for 1-3 days and then stimulated to synthesize NO by IFN-gamma. Surprisingly, only serum-starved cells showed significant amount of nitrite accumulation and iNOS protein expression in response to IFN-gamma in dose- and time-dependent manners, but serum-supplied cells did not. When the cells were stimulated with IFN-gamma, tumor necrosis factor-alpha (TNF-alpha), or LPS in combinations, only the combination of IFN-gamma and LPS produced more NO than that produced by IFN-gamma alone. The production of NO by the cells stimulated with IFN-gamma or IFN-gamma plus LPS was blocked by the addition of N(G)-monomethyl-L-arginine (N(G)MMA), a NO synthesis inhibitor. To address the intracellular signal pathway responsible for the production of NO by the cells stimulated with IFN-gamma aloneor IFN-gamma plus LPS, we examined the effects of several protein kinase inhibitors on the production of NO from the cells. The production of NO was significantly inhibited by protein tyrosine kinase (PTK) inhibitors, genistein and herbimycin A, but not by protein kinase A or C inhibitors. These results suggest that the deprivation of serum from BNL CL.2 cell culture medium might prime the cells to induce NO synthesis when the cells are triggered by IFN-gamma and the involvement of PTK signal transduction pathway in the expression of inducible NO synthase gene in murine hepatoma cells.
Kawai, K; Enomoto, T; Fornasier, V; Resetkova, E; Volpé, R
1997-03-01
We have studied the in vivo effects of human interferon alpha (IFN-alpha) and interferon gamma (IFN-gamma) administration on human thyroid tissue xenografted into two mouse strains: severe combined immunodeficient (SCID) mice and nude mice. Human lymphocytes survive in SCID mice but are lysed in nude mice. Thyroid tissues from Graves' disease or Hashimoto's thyroiditis, or paranodular [normal, (N)] tissue was xenografted into SCID mice (0.8 g/mouse) pretreated with anti-asialo GM-1 antiserum and radiation and also into nude mice. One week after xenografting, SCID and nude mice were divided into three groups. Group A was treated with IFN-alpha intraperitoneally (2,000 units/mouse) three times weekly; group B was treated with IFN-gamma similarly; group C was treated with phosphate buffered saline (PBS) only (control). Autologous human peripheral blood mononuclear cells (PBMCs) were added to mice receiving N xenografts. Blood was taken every 2 weeks for levels of IgG and thyroid antibodies (TAb). After 6 weeks of treatment, mice were sacrificed, and xenograft thyrocyte histocompatibility leukocyte antigen (HLA-DR) and intercellular adhesion molecule (ICAM-1) expression were measured. In addition, thyrocyte cultures were stimulated in vitro with 200 units/ml of either IFN-alpha or IFN-gamma or PBS (control). SCID mice xenografted with autoimmune thyroid disease (AITD) in group A showed a significantly higher TAb production than group C, whereas in group B, TAb production was not statistically increased compared to control (group C). SCID mice xenografted with N did not produce TAb in any group, nor did nude mice xenografted with AITD. Thyrocyte HLA-DR expression was markedly increased in group A and B in SCID mice xenografted with Graves' disease, Hashimoto's thyroiditis, and N tissue compared to group C. In contrast, only group B (IFN-gamma) showed an increase in thyrocyte HLA-DR in nude mice. In the in vitro studies, only IFN-gamma (not IFN-alpha) stimulated
Inhibition of interferon-gamma expression by osmotic shrinkage of peripheral blood lymphocytes.
Lang, K S; Weigert, C; Braedel, S; Fillon, S; Palmada, M; Schleicher, E; Rammensee, H-G; Lang, F
2003-01-01
A hypertonic environment, as it prevails in renal medulla or in hyperosmolar states such as hyperglycemia of diabetes mellitus, has been shown to impair the immune response, thus facilitating the development of infection. The present experiments were performed to test whether hypertonicity influences activation of T lymphocytes. To this end, peripheral blood lymphocytes (PBL) of cytomegalovirus (CMV)-positive donors were stimulated by human leukocyte antigen (HLA)-A2-restricted CMV epitope NLVPMVATV to produce interferon (IFN)-gamma at varying extracellular osmolarity. As a result, increasing extracellular osmolarity during exposure to the CMV antigen indeed decreased IFN-gamma formation. Addition of NaCl was more effective than urea. A 50% inhibition was observed at 350 mosM by addition of NaCl. The combined application of the Ca(2+) ionophore ionomycin (1 microg/ml) and the phorbol ester phorbol 12-myristate 13-acetate (PMA; 5 microg/ml) stimulated IFN-gamma production, an effect again reversed by hyperosmolarity. Moreover, hyperosmolarity abrogated the stimulating effect of ionomycin (1 microg/ml) and PMA (5 microg/ml) on the transcription factors activator protein (AP)-1, nuclear factor of activated T cells (NFAT), and NF-kappaB but not Sp1. In conclusion, osmotic cell shrinkage blunts the stimulatory action of antigen exposure on IFN-gamma production, an effect explained at least partially by suppression of transcription factor activation.
Morris, L; Troutt, A B; McLeod, K S; Kelso, A; Handman, E; Aebischer, T
1993-01-01
For murine cutaneous leishmaniasis, data to date suggest a correlation between the presence of gamma interferon (IFN-gamma) and resistance in C57BL/6 mice and the presence of interleukin-4 (IL-4) and disease in BALB/c mice. In this study, 13 inbred strains of mice covering the range of susceptibility to disease were infected with Leishmania major to determine whether the subsequent expression of IFN-gamma or IL-4 is a reliable indicator of cure or progressive disease. The presence of IL-4 and IFN-gamma mRNAs in the draining lymph nodes was examined 9 weeks after infection, when differences in disease severity became obvious. There were large differences in the levels of IL-4 mRNA among the different strains, whereas IFN-gamma mRNA was detected at similar levels in all strains. The levels of IL-4 mRNA correlated with lesion score, with susceptible and intermediate strains containing up to 100-fold more than any of the resistant strains. Differences in the levels of IFN-gamma mRNA were within only a fourfold range, with significant overlap among susceptible, intermediate, and resistant strains. Similarly, the levels of IFN-gamma secreted in vitro by lymph node cells from infected mice in response to L. major antigens were within a 10-fold range for most strains, and there was no correlation with lesion score. Analysis of Leishmania-specific antibody levels revealed a correlation between immunoglobulin G1 (IgG1) titers and lesion score, consistent with the role of IL-4 as a switch factor for IgG1. In contrast, there was no correlation between IgG2a titers and lesion score, supporting the notion that IFN-gamma synthesis (which promotes IgG2a production) is not correlated with disease state. These data suggest that along the spectrum of murine cutaneous leishmaniasis, IL-4 is a reliable indicator of disease, but IFN-gamma is not prognostic for resistance. Images PMID:8335376
Reiners, J J; Cantu, A; Thai, G; Pavone, A
1993-03-01
SENCAR mice develop more papillomas in two-stage skin carcinogenesis protocols if gamma interferon (IFN-gamma) is co-administered with 12-O-tetradecanoylphorbol-13-acetate (TPA) during the promotion phase. In the current study preparations of murine alpha, beta and gamma IFNs were surveyed for their abilities to modulate TPA-dependent promotion and induction of epidermal hyperplasia, inflammation and ornithine decarboxylase activity (ODC). Single or multiple i.p. administrations of IFN-alpha, -beta or -gamma (< or = 2500 units) did not induce epidermal hyperplasia, inflammation or ODC activity. Single or multiple i.p. administrations of IFN-alpha, -beta or -gamma (2500 units) to mice being topically promoted with 0.1 or 1 microgram of TPA did not alter the epidermal hyperplasia induced by the phorbol ester. The vascular permeability of the skin, as evaluated by the extravasation of Evans blue dye, was increased in a dose-dependent fashion by TPA over the range of 0.1-1 microgram. Treatment of mice promoted with 0.1 microgram of TPA with IFN-gamma (> or = 2500 units) significantly increased the skin's vascular permeability. Comparable effects were not obtained with IFN-beta (IFN-alpha not tested). Treatment of TPA-promoted mice with IFN-gamma, and to a lesser extent IFN-beta, weakly potentiated the TPA-dependent induction of epidermal ODC activity. Under conditions in which IFN-gamma had co-promoting activities in an initiation-promotion protocol, co-treatment of initiated mice with 1 microgram of TPA and IFN-alpha or -beta (100-5000 units) did not reproducibly alter tumor latency., or papilloma and carcinoma multiplicities. These findings suggest that the co-promoting activities of IFNs are restricted to the gamma class, and are not uniformly reflected by parameters commonly employed as short-term markers of tumor promotion.
Connell, Tom G; Davies, Mary-Ann; Johannisen, Christine; Wood, Kathryn; Pienaar, Sandy; Wilkinson, Katalin A; Wilkinson, Robert J; Zar, Heather J; Beatty, David; Nicol, Mark P; Curtis, Nigel; Eley, Brian
2010-05-27
Recent interest has focused on the potential use of serial interferon gamma (IFN-gamma) release assay (IGRA) measurements to assess the response to anti-tuberculous (TB) treatment. The kinetics of IFN-gamma responses to Mycobacterium tuberculosis (MTB) antigens in HIV-infected children during treatment have not however been previously investigated. IFN-gamma responses to the MTB antigens, ESAT-6, CFP-10 and PPD were measured by an enzyme-linked immunospot assay (IFN-gamma ELISpot) at presentation and at one, two and six months after starting anti-tuberculous treatment in HIV-infected children with definite or probable TB. Responses at different time points were compared using a Mann-Whitney U test with paired data analysed using the Wilcoxon signed rank test. A Fisher's exact or Chi-squared test was used to compare proportions when test results were analysed as dichotomous outcomes. Of 102 children with suspected TB, 22 (21%) had definite TB and 24 (23%) probable TB. At least one follow up IFN-gamma ELISpot assay result was available for 31 (67%) of the 46 children. In children with definite or probable TB in whom the IFN-gamma ELISpot assay result was positive at presentation, anti-tuberculous treatment was accompanied by a significant decrease in both the magnitude of the IFN-gamma response to individual or combined MTB-specific antigens (ESAT-6 median 110 SFCs/106 PBMC (IQR 65-305) at presentation vs. 15 (10-115) at six months, p = 0.04; CFP-10 177 (48-508) vs. 20 (5-165), p = 0.004, ESAT-6 or CFP-10 median 250 SFCs/106 PBMC (IQR 94-508) vs. 25 (10-165), p = 0.004) and in the proportion of children with a positive IFN-gamma ELISpot assay (Fisher's exact test: ESAT-6 15/0 vs 5/11, p = 0.0002, CFP-10 22/0 vs 8/17, p = 0.0001, ESAT-6 or CFP-10 22/0 vs. 9/17, p= 0.002). However almost half of the children had a positive IFN-gamma ELISpot assay after six months of anti-tuberculous treatment. In addition, there was conversion of the IFN-gamma ELISpot assay result
Interferon-gamma: biologic functions and HCV therapy (type I/II) (1 of 2 parts).
Gattoni, A; Parlato, A; Vangieri, B; Bresciani, M; Derna, R
2006-01-01
This review is aimed at exhaustively presenting and discussing the interferon-gamma (IFN-gamma), a cytokine that plays an important role in inducing and modulating an array of immune responses. A review of the most significant and recent clinical trials was performed. Although IFN-gamma has some antiviral activity, it is much less active in this regard than type I IFNs. IFN-gamma is involved in the regulation of nearly all phases of the immune and inflammatory responses, including the activation and differentiation of T cells, B cells, NK cells, macrophages, and others. It is therefore best regarded as a distint immunoregulatory cytokine. IFN-gamma secretion is a hallmark of Th1 lymphocytes. It is also secreted by nearly all CD8 T cells, by some Th0 cells, and by NK cells. Each of these cell types secretes IFN-gamma only when activated, usually as part of immune response and especially in response to IL-2 and IL-12. IFN-gamma production is inhibited by IL-4, IL-10, TGFbeta, glucocorticoids, cyclosporin A and FK506. Nearly all cell types express the heterodimeric receptor for IFN-beta and respond to this cytokine by increasing the surface expression of class I MHC proteins. As a result, virtually any cell in the vicinity of an IFN-beta-secreting cell becomes more efficient at presenting endogenous antigens and hence a better target for cytotoxic killing if it harbors an intracellular pathogen. Unlike the type I IFNs, IFN-gamma also increases the expression of class II MHC proteins on professional APCs, and so promotes antigen presentation to helper T cells as well. It also induces de novo expression of class II MHC proteins on venular endothelial cells and on some other epithelial and connective tissue cells that do not otherwise express them, thus enabling these cell types to function as temporary APCs at sites of intense immune reactions. The effector functions of NK cells are to lyse virus-infected cells and to secrete IFN-gamma, which activates macrofages to
Wong, L H; Hatzinisiriou, I; Devenish, R J; Ralph, S J
1998-06-01
IFN-stimulated gene factor 3 (ISGF3) mediates transcriptional activation of IFN-sensitive genes (ISGs). The component subunits of ISGF3, STAT1alphabeta, STAT2, and p48-ISGF3gamma, are tyrosine phosphorylated before their assembly into a complex. Subsequently, the ISGF3 complex is translocated to the nucleus. We have recently established that the responsiveness of human melanoma cell lines to type I IFNs correlates directly with their intracellular levels of ISGF3 components, particularly STAT1. In the present study, we show that pretreating IFN-resistant melanoma cell lines with IFN-gamma (IFN-gamma priming) before stimulation with type I IFN also results in increased levels of ISGF3 components and enhanced DNA-binding activation of ISGF3. In addition, IFN-gamma priming of IFN-resistant melanoma cell lines increased expression of type I IFN-induced ISG products, including ISG54, 2'-5'-oligoadenylate synthase, HLA class I, B7-1, and ICAM-1 Ags. Furthermore, IFN-gamma priming enhanced the antiviral effect of IFN-beta on the IFN-resistant melanoma cell line, MM96. These results support a role for IFN-gamma priming in up-regulating ISGF3, thereby augmenting the responsiveness of IFN-resistant melanoma cell lines to type I IFN and providing a molecular basis and justification for using sequential IFN therapy, as proposed by others, to enhance the use of IFNs in the treatment of melanoma.
Interferon Gamma in African Trypanosome Infections: Friends or Foes?
Wu, Hui; Liu, Gongguan; Shi, Meiqing
2017-01-01
African trypanosomes cause fatal infections in both humans and livestock. Interferon gamma (IFN-γ) plays an essential role in resistance to African trypanosomes. However, increasing evidence suggests that IFN-γ, when excessively synthesized, also induces immunopathology, enhancing susceptibility to the infection. Thus, production of IFN-γ must be tightly regulated during infections with African trypanosomes to ensure that a robust immune response is elicited without tissue destruction. Early studies have shown that secretion of IFN-γ is downregulated by interleukin 10 (IL-10). More recently, IL-27 has been identified as a negative regulator of IFN-γ production during African trypanosome infections. In this review, we discuss the current state of our understanding of the role of IFN-γ in African trypanosome infections. We have focused on the cellular source of IFN-γ, its beneficial and detrimental effects, and mechanisms involved in regulation of its production, highlighting some recent advances and offering some perspectives on future directions.
Hirota, Ryuichiro; Tajima, Sadao; Yoneda, Yukio; Tamayama, Takumi; Watanabe, Masahito; Ueda, Kouichi; Kubota, Takahiro; Yoshida, Ryotaro
2002-09-01
Interferon-gamma(-/-) (IFN-gamma(-/-)) and IFN-gamma(+/+) C57BL/6 mice (3 weeks of age) completed the production of morphogenesis-derived hair. Around 6 weeks of age, however, most of the IFN-gamma(-/-) but none of the IFN-gamma(+/+) mice began to lose hairs in the dorsal and occipital areas in the absence of inflammatory reactions, and the alopecia was sustained for at least several 10-week periods of observation. A single subcutaneous injection of IFN-gamma to IFN-gamma(-/-) mice at 3, but not 4, 5, or 8 weeks of age could protect all the mice from alopecia, revealing that the lack of IFN-gamma around 3 weeks of age is directly responsible for the alopecia. Histologic features showed that the hair follicles of the IFN-gamma(+/+) mice passed through the anagen (4-5 weeks of age) and catagen/telogen ( approximately 6 weeks of age) phases, whereas those of IFN-gamma(-/-) mice (5 weeks of age or older) stayed in the anagen phase. TUNEL and bromodeoxyuridine experiments suggested that an arrest with unlimited DNA synthesis of the hair cycle in the anagen phase by the lack of IFN-gamma-dependent apoptosis in the midfollicle region and diffuse shedding of previously formed hair induced alopecia in IFN-gamma(-/-) mice.
NASA Technical Reports Server (NTRS)
Lah, T. T.; Hawley, M.; Rock, K. L.; Goldberg, A. L.
1995-01-01
Previous studies have indicated that acid-optimal cysteine proteinase(s) in the endosomal-lysosomal compartments, cathepsins, play a critical role in the proteolytic processing of endocytosed proteins to generate the antigenic peptides presented to the immune system on major histocompatibility complex (MHC) class II molecules. The presentation of these peptides and the expression of MHC class II molecules by macrophages and lymphocytes are stimulated by gamma-interferon (gamma-IFN). We found that treatment of human U-937 monocytes with gamma-IFN increased the activities and the content of the two major lysosomal cysteine proteinases, cathepsins B and L. Assays of protease activity, enzyme-linked immunosorbant assays (ELISA) and immunoblotting showed that this cytokine increased the amount of cathepsin B 5-fold and cathepsin L 3-fold in the lysosomal fraction. By contrast, the aspartic proteinase, cathepsin D, in this fraction was not significantly altered by gamma-IFN treatment. An induction of cathepsins B and L was also observed in mouse macrophages, but not in HeLa cells. These results suggest coordinate regulation in monocytes of the expression of cathepsins B and L and MHC class II molecules. Presumably, this induction of cysteine proteases contributes to the enhancement of antigen presentation by gamma-IFN.
NASA Technical Reports Server (NTRS)
Gould, Cheryl L.; Sonnenfeld, Gerald
1987-01-01
The effect of pretreatment of mice with 34 units/day, for five days, of interferon-gamma (IFN-gamma) on the course of infection with LD50 of Salmonella typhimurium strain LT-2 was assessed, using two IFN preparations: (1) a hybridoma supernatant fluid containing concanavalin-A-induced IFN-gamma activity and (2) pure murine IFN-gamma produced by recombinant DNA technology. The hybridoma supernatant-treated Salmonella-infected mice were found to die faster than mice treated only with Salmonella. Pure murine IFN-gamma was found to protect infected mice significantly, with 95 percent of mice surviving LD50 infection. In contrast, the Salmonella-infected mice treated with hybridoma supernatant were found to die faster than the Salmonella-infected untreated controls. Mice treated with concanavalin A alone prior to infection with S. typhimurium died more quickly than the untreated infected controls, suggesting that contamination with concanavalin A had a detrimental effect on mice survival.
Pan, L Y; Mendel, D B; Zurlo, J; Guyre, P M
1990-07-01
The high affinity IgG FcR Fc gamma RI, CD64, plays important roles in the immune response. Fc gamma RI is predominantly expressed on monocytes and macrophages, and barely detectable on neutrophils. rIFN-gamma markedly increases the expression of Fc gamma RI on neutrophils, monocytes, macrophages and myeloid cell lines such as U-937, HL-60, and THP-1. Glucocorticoids inhibit the augmentation of Fc gamma RI expression by rIFN-gamma on neutrophils and myeloid cell lines, but enhance the augmentation of Fc gamma RI expression by rIFN-gamma on monocytes. In this study, we examined the effect of rIFN-gamma and dexamethasone (Dex) on the steady state level of Fc gamma RI mRNA in U-937 cells, neutrophils, and monocytes by hybridizing total RNA with the Fc gamma RI cDNA probe, p135. We found that the amount of Fc gamma RI mRNA increased within 1 h of treatment with rIFN-gamma in all three cell types. This initial induction of Fc gamma RI mRNA by rIFN-gamma was completely blocked by an inhibitor of RNA synthesis, actinomycin D, suggesting that the rIFN-gamma-mediated induction of Fc gamma RI mRNA is dependent on gene transcription. Dex, used in combination with rIFN-gamma, partially blocked the induction of Fc gamma RI mRNA by rIFN-gamma in U-937 cells and neutrophils, but caused a synergistic increase in Fc gamma RI mRNA levels in monocytes. The inhibitory effect of Dex on the steady state level of Fc gamma RI mRNA in U-937 cells was blocked by an inhibitor of protein synthesis, cycloheximide, suggesting that Dex-induced proteins were involved in the regulation of Fc gamma RI expression. This study indicates that the regulation of Fc gamma RI expression on U-937 cells, neutrophils, and monocytes by rIFN-gamma and Dex occurs, at least in part, at the mRNA level. rIFN-gamma increases the steady state level of Fc gamma RI mRNA through a common pathway among U-937 cells, neutrophils, and monocytes, whereas the effect of Dex on rIFN-gamma-induced Fc gamma RI mRNA is cell
Lin, Chiou-Feng; Tsai, Cheng-Chieh; Huang, Wei-Ching; Wang, Chi-Yun; Tseng, Hsiang-Chi; Wang, Yi; Kai, Jui-In; Wang, Szu-Wen; Cheng, Yi-Lin
2008-10-15
Interferon-gamma (IFN-gamma) plays a crucial role in innate immunity and inflammation. It causes the synergistic effect on endotoxin lipopolysaccharide (LPS)-stimulated inducible nitric oxide synthase (iNOS)/NO biosynthesis; however, the mechanism remains unclear. In the present study, we investigated the effects of glycogen synthase kinase-3 (GSK-3)-mediated inhibition of anti-inflammatory interleukin-10 (IL-10). We found, in LPS-stimulated macrophages, that IFN-gamma increased iNOS expression and NO production in a time-dependent manner. In addition, ELISA analysis showed the upregulation of tumor necrosis factor-alpha and regulated on activation, normal T expressed and secreted, and the downregulation of IL-10. RT-PCR further showed changes in the IL-10 mRNA level as well. Treating cells with recombinant IL-10 showed a decrease in IFN-gamma/LPS-induced iNOS/NO biosynthesis, whereas anti-IL-10 neutralizing antibodies enhanced this effect, suggesting that IL-10 acts in an anti-inflammatory role. GSK-3-inhibitor treatment blocked IFN-gamma/LPS-induced iNOS/NO biosynthesis but upregulated IL-10 production. Inhibiting GSK-3 using short-interference RNA showed similar results. Additionally, treating cells with anti-IL-10 neutralizing antibodies blocked these effects. We further showed that inhibiting GSK-3 increased phosphorylation of transcription factor cyclic AMP response element binding protein. Inhibiting protein tyrosine kinase Pyk2, an upstream regulator of GSK-3beta, caused inhibition on IFN-gamma/LPS-induced GSK-3beta phosphorylation at tyrosine 216 and iNOS/NO biosynthesis. Taken together, these findings reveal the involvement of GSK-3-inhibited IL-10 on the induction of iNOS/NO biosynthesis by IFN-gamma synergized with LPS. (c) 2008 Wiley-Liss, Inc.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cheon, Soyoung; Song, Seok Bean; Jung, Minkyung
2008-09-12
Natural killer (NK) cells play an important role in the innate immune response. Interleukin-18 (IL-18) is a well-known interferon-gamma (IFN-{gamma} inducing factor, which stimulates immune response in NK and T cells. Sphingosine kinase (SPHK) catalyzes the formation of sphingosine 1-phosphate (S1P), which acts as a second messenger to function as an anti-apoptotic factor and proliferation stimulator of immune cells. In this study, to elucidate whether SPHK is involved in IL-18-induced IFN-{gamma} production, we measured IL-18-induced IFN-{gamma} production after pre-treatment with SPHK inhibitor (SKI) in NK-92MI cells. We found that IL-18-induced IFN-{gamma} expression was blocked by SKI pre-treatment in both mRNAmore » and protein levels. In addition, the increased IFN-{gamma} production by stimulation with IL-18 is mediated through both SPHK and p38 MAPK. To determine the upstream signals of SKI and p38 MAPK in IL-18-induced IFN-{gamma} production, phosphorylation levels of p38 MAPK was measured after SKI pre-treatment. As a result, inhibition of SPHK by SKI blocked phosphorylation of p38 MAPK, showing that SPHK activation by IL-18 is an upstream signal of p38 MAPK activation. Inhibition of SPHK by SKI also inhibited IL-18-induced IFN-{gamma} production in human primary NK cells. In conclusion, SPHK activation is an essential factor for IL-18-induced IFN-{gamma} production via p38 MAPK.« less
COULD INTERFERON-GAMMA BE A THERAPEUTIC TARGET FOR TREATING HEART FAILURE?
Levick, Scott P.; Goldspink, Paul H.
2013-01-01
The cytokine interferon-gamma (IFN-γ), is the only known member of the type II family of interferons, and as such, binds to its own distinct receptor. It is important in host defense against infection, as well as adaptive immune responses. Whilst a wide array of cytokines are known to be involved in adverse remodeling of the heart and the progression to heart failure, the role of IFN-γ is unclear. Recent evidence from clinical studies, animal models of myocarditis and hypertension, as well as isolated cell studies, provide conflicting data as to whether IFN-γ is pathological or protective in the heart. Thus, it is important to highlight these discrepant findings so that areas of future investigation can be identified to more clearly determine the precise role of IFN-γ in the heart. Accordingly, this review will: 1) discuss the source of IFN-γ in the diseased heart; 2) summarize the data from animal studies; 3) discuss the effects of IFN-γ on isolated cardiac fibroblasts and cardiomyocytes; 4) identify signaling mechanisms that may be invoked by IFN-γ in the heart; and 5) present the clinical evidence supporting a role for IFN-γ in heart failure. PMID:23589353
Potential mechanisms of cytosolic calcium modulation in interferon-gamma treated U937 cells
NASA Technical Reports Server (NTRS)
Klein, Jon B.; Mcleish, Kenneth R.; Sonnenfeld, Gerald; Dean, William L.
1987-01-01
The ability of interferon-gamma (IFN-gamma) to alter cytoplasmic Ca(2+) content in the monocytelike cell line U937 was investigated, using a slow Ca-channel blocker, diltiazem. In addition, the Ca-ATPase and the Ca-uptake activities were measured in isolated U937 membranes, together with the effect of inositol trisphosphate (IP3) upon the Ca(2+) release from Ca-loaded membranes. The addition of 50 U/ml INF-gamma to U937 cultures was found to increase internal Ca(2+) by about 100 percent within 3 min. The increase was significantly reduced by incubation in Ca-free buffer or by the addition of diltiazem. A crude membrane preparation from U937 cells was found to contain significant amounts of Ca-ATPase activity and to sequester Ca(2+) to a level of 8 nmol/mg in 30 sec; the addition of IP3 induced release of a portion of the sequestered Ca(2+) which was then resequestered. The results suggest that IFN-gamma causes an increase of cytoplasmic Ca(2+), in part, by the IP3-induced release from the internal storage sites and, in part, from the entry of extracellular Ca through slow channels.
Murray, Paul D; McGavern, Dorian B; Pease, Larry R; Rodriguez, Moses
2002-03-01
IFN-gamma is an anti-viral and immunomodulatory cytokine critical for resistance to multiple pathogens. Using mice with targeted disruption of the gene for IFN-gamma, we previously demonstrated that this cytokine is critical for resistance to viral persistence and demyelination in the Theiler's virus model of multiple sclerosis. During viral infections, IFN-gamma is produced by natural killer (NK) cells, CD4(+) and CD8(+) T cells; however, the proportions of lymphocyte subsets responding to virus infection influences the contributions to IFN-gamma-mediated protection. To determine the lymphocyte subsets that produce IFN-gamma to maintain resistance, we used adoptive transfer strategies to generate mice with lymphocyte-specific deficiencies in IFN-gamma-production. We demonstrate that IFN-gamma production by both CD4(+) and CD8(+) T cell subsets is critical for resistance to Theiler's murine encephalomyelitis virus (TMEV)-induced demyelination and neurological disease, and that CD4(+) T cells make a greater contribution to IFN-gamma-mediated protection. To determine the cellular targets of IFN-gamma-mediated responses, we used adoptive transfer studies and bone marrow chimerism to generate mice in which either hematopoietic or somatic cells lacked the ability to express IFN-gamma receptor. We demonstrate that IFN-gamma receptor must be present on central nervous system glia, but not bone marrow-derived lymphocytes, in order to maintain resistance to TMEV-induced demyelination.
Higashi, Kiyoshi; Inagaki, Yutaka; Fujimori, Ko; Nakao, Atsuhito; Kaneko, Hideo; Nakatsuka, Iwao
2003-10-31
Transforming growth factor-beta (TGF-beta) and interferon-gamma (IFN-gamma) exert antagonistic effects on collagen synthesis in human dermal fibroblasts. We have recently shown that Y box-binding protein YB-1 mediates the inhibitory effects of IFN-gamma on alpha2(I) procollagen gene (COL1A2) transcription through the IFN-gamma response element located between -161 and -150. Here we report that YB-1 counter-represses TGF-beta-stimulated COL1A2 transcription by interfering with Smad3 bound to the upstream sequence around -265 and subsequently by interrupting the Smad3-p300 interaction. Western blot and immunofluorescence analyses using inhibitors for Janus kinases or casein kinase II suggested that the casein kinase II-dependent signaling pathway mediates IFN-gamma-induced nuclear translocation of YB-1. Down-regulation of endogenous YB-1 expression by double-stranded YB-1-specific RNA abrogated the transcriptional repression of COL1A2 by IFN-gamma in the absence and presence of TGF-beta. In transient transfection assays, overexpression of YB-1 in human dermal fibroblasts exhibited antagonistic actions against TGF-beta and Smad3. Physical interaction between Smad3 and YB-1 was demonstrated by immunoprecipitation-Western blot analyses, and electrophoretic mobility shift assays using the recombinant Smad3 and YB-1 proteins indicated that YB-1 forms a complex with Smad3 bound to the Smad-binding element. Glutathione S-transferase pull-down assays showed that YB-1 binds to the MH1 domain of Smad3, whereas the central and carboxyl-terminal regions of YB-1 were required for its interaction with Smad3. YB-1 also interferes with the Smad3-p300 interaction by its preferential binding to p300. Altogether, the results provide a novel insight into the mechanism by which IFN-gamma/YB-1 counteracts TGF-beta/Smad3. They also indicate that IFN-gamma/YB-1 inhibits COL1A2 transcription by dual actions: via the IFN-gamma response element and through a cross-talk with the TGF
Induction of ceruloplasmin synthesis by IFN-gamma in human monocytic cells
NASA Technical Reports Server (NTRS)
Mazumder, B.; Mukhopadhyay, C. K.; Prok, A.; Cathcart, M. K.; Fox, P. L.
1997-01-01
Ceruloplasmin is a 132-kDa glycoprotein abundant in human plasma. It has multiple in vitro activities, including copper transport, lipid pro- and antioxidant activity, and oxidation of ferrous ion and aromatic amines; however, its physiologic role is uncertain. Although ceruloplasmin is synthesized primarily by the liver in adult humans, production by cells of monocytic origin has been reported. We here show that IFN-gamma is a potent inducer of ceruloplasmin synthesis by monocytic cells. Activation of human monoblastic leukemia U937 cells with IFN-gamma increased the production of ceruloplasmin by at least 20-fold. The identity of the protein was confirmed by plasmin fingerprinting. IFN-gamma also increased ceruloplasmin mRNA. Induction followed a 2- to 4-h lag and was partially blocked by cycloheximide, indicating a requirement for newly synthesized factors. Ceruloplasmin induction in monocytic cells was agonist specific, as IL-1, IL-4, IL-6, IFN-alpha, IFN-beta, TNF-alpha, and LPS were completely ineffective. The induction was also cell type specific, as IFN-gamma did not induce ceruloplasmin synthesis in endothelial or smooth muscle cells. In contrast, IFN-gamma was stimulatory in other monocytic cells, including THP-1 cells and human peripheral blood monocytes, and also in HepG2 cells. Ceruloplasmin secreted by IFN-gamma-stimulated U937 cells had ferroxidase activity and was, in fact, the only secreted protein with this activity. Monocytic cell-derived ceruloplasmin may contribute to defense responses via its ferroxidase activity, which may drive iron homeostasis in a direction unfavorable to invasive organisms.
Mycobacterium avium Complex Empyema in a Patient with Interferon Gamma Autoantibodies
Chung, Heath H; Opal, Steven M; Dworkin, Jonathan D
2014-01-01
Interferon gamma (IFN-γ) autoantibodies are a relatively recently discovered clinical entity, which have been shown to be associated with disseminated non-tuberculous mycobacterial (NTM) infections and other opportunistic infections. Interestingly, isolated NTM infections (without disseminated NTM infection) have not been shown to be a good predictor of the presence of IFN-γ autoantibodies. This case describes an isolated NTM empyema in a patient with IFN-γ autoantibodies and makes the argument that the development of an NTM empyema in a patient with no known immunodeficiency should prompt consideration for IFN-γ testing. Additionally, this case underscores the importance for clinicians to recognize that an unusual infection without the typical cause of impairment in immunity should prompt a more thorough investigation of the patient's immune system. PMID:25285250
Electrochemical impedance spectroscopy based-on interferon-gamma detection
NASA Astrophysics Data System (ADS)
Li, Guan-Wei; Kuo, Yi-Ching; Tsai, Pei-I.; Lee, Chih-Kung
2014-03-01
Tuberculosis (TB) is an ancient disease constituted a long-term menace to public health. According to World Health Organization (WHO), mycobacterium tuberculosis (MTB) infected nearly a third of people of the world. There is about one new TB occurrence every second. Interferon-gamma (IFN-γ) is associated with susceptibility to TB, and interferongamma release assays (IGRA) is considered to be the best alternative of tuberculin skin test (TST) for diagnosis of latent tuberculosis infection (LTBI). Although significant progress has been made with regard to the design of enzyme immunoassays for IFN-γ, adopting this assay is still labor-intensive and time-consuming. To alleviate these drawbacks, we used IFN-γ antibody to facilitate the detection of IFN-γ. An experimental verification on the performance of IGRA was done in this research. We developed two biosensor configurations, both of which possess high sensitivity, specificity, and rapid IFN-γ diagnoses. The first is the electrochemical method. The second is a circular polarization interferometry configuration, which incorporates two light beams with p-polarization and s-polarization states individually along a common path, a four photo-detector quadrature configuration to arrive at a phase modulated ellipsometer. With these two methods, interaction between IFN-γ antibody and IFN-γ were explored and presented in detail.
Development of a lion-specific interferon-gamma assay.
Maas, M; van Kooten, P J S; Schreuder, J; Morar, D; Tijhaar, E; Michel, A L; Rutten, V P M G
2012-10-15
The ongoing spread of bovine tuberculosis (BTB) in African free-ranging lion populations, for example in the Kruger National Park, raises the need for diagnostic assays for BTB in lions. These, in addition, would be highly relevant for zoological gardens worldwide that want to determine the BTB status of their lions, e.g. for translocations. The present study concerns the development of a lion-specific IFN-γ assay, following the production and characterization of monoclonal antibodies specific for lion interferon-gamma (IFN-γ). Recombinant lion IFN-γ (rLIFN-γ) was produced in mammalian cells and used to immunize mice to establish hybridoma cell lines producing monoclonal antibodies. These were used to develop a sensitive, lion IFN-γ-specific capture ELISA, able to detect rLIFN-γ to the level of 160 pg/ml. Recognition of native lion IFN-γ was shown in an initial assessment of supernatants of mitogen stimulated whole blood cultures of 11 known BTB-negative lions. In conclusion, the capture ELISA shows potential as a diagnostic assay for bovine tuberculosis in lions. Preliminary results also indicate the possible use of the test for other (feline) species. Copyright © 2012 Elsevier B.V. All rights reserved.
Coppen, S R; Newsam, R; Bull, A T; Baines, A J
1995-04-20
The Chinese hamster ovary (CHO) cell line has great commercial importance in the production of recombinant human proteins, especially those for therapeutic use. Much attention has been paid to CHO cell population physiology in order to define factors affecting product fidelity and yield. Such studies have revealed that recombinant proteins, including human interferon-gamma (IFN-gamma), can be heterogeneous both in glycosylation and in proteolytic processing. The type of heterogeneity observed depends on the growth physiology of the cell population, although the relationship between them is complex. In this article we report results of a cytological study of the CHO320 line which expresses recombinant human IFN-gamma. When grown in suspension culture, this cell line exhibited three types of heterogeneity: (1) heterogeneity of the production of IFN-gamma within the cell population, (2) heterogeneity of the number of nuclei and mitotic spindles in dividing cells, and (3) heterogeneity of cellular environment. The last of these arises from cell aggregates which form in suspension culture: Some cells are exposed to the culture medium; others are fully enclosed within the mass with little or no direct access to the medium. Thus, live cells producing IFN-gamma are heterogeneous in their environment, with variable access to O(2) and nutrients. Within the aggregates, it appears that live cells proliferate on a dead cell mass. The layer of live cells can be several cells deep. Specific cell-cell attachments are observed between the living cells in these aggregates. Two proteins, known to be required for the formation of certain types of intercellular junctions, spectrin and vinculin, have been localized to the regions of cell-cell contact. The aggregation of the cells appears to be an active process requiring protein synthesis. (c) 1995 John Wiley & Sons, Inc.
Titze-de-Almeida, Simoneide S; Lustosa, Cátia Faria; Horst, Camila Hillesheim; Bel, Elaine Del; Titze-de-Almeida, Ricardo
2014-12-01
This study examined whether the cytokine interferon (IFN) gamma plays a role in the injury of SH-SY5Y cells caused by MPP(+) (1-methyl-4-phenylpyridinium). First of all, IFN-gamma sensitized cells to the neurotoxin MPP(+), as determined by MTT (3-(4,5-dimethylthiazol-2-y1)-2,5-diphenyltetrazolium bromide) assay. MPP(+)-injured cells showed higher reactive oxygen species (ROS) levels, which was reinforced by IFN-gamma. The injury triggered a marked expression of the neuronal NOS (nNOS) enzyme. L-NAME [N(ω)-nitro-L-arginine methyl ester, a non-specific NOS inhibitor] reestablished the cell viability after IFN-gamma challenging, and recovered cells from MPP(+) injury (95.0 vs. 84.7 %; P < 0.05). Seven-NI (7-nitroindazole, a nNOS inhibitor) protected cells against the injury by MPP(+) co-administered with IFN-gamma. Both inhibitors restrained the apoptosis of SH-SY5Y cells caused by MPP(+)/IFN-gamma. Regarding oxidative stress, L-NAME and 7-NI attenuated the increase in ROS levels caused by MPP(+) (45.3 or 48.4 vs. 87.9 %, P < 0.05). Indeed, L-NAME was more effective than 7-NI for reducing oxidative stress caused by MPP(+) under IFN-gamma exposition. The nNOS gene silencing by small-interfering RNAs recovered cells challenged by IFN-gamma (24 h), or MPP(+) (8 h). In conclusion, IFN-gamma sensitizes cells to MPP(+)-induced injury, also causing an increase in ROS levels. Pretreating cells with L-NAME or 7-NI reverts both the oxidative stress and apoptosis triggered by the neurotoxin MPP(+). Taking together, our data reinforce that IFN-gamma and NOS enzymes play a role in oxidative stress and dopaminergic cell death triggered by MPP(+).
Sareneva, T; Mørtz, E; Tölö, H; Roepstorff, P; Julkunen, I
1996-12-01
Interferon-gamma (IFN-gamma) is a secretory glycoprotein produced by T cells in response to antigenic or mitogenic stimuli. We studied the kinetics of the synthesis, N-glycosylation, and secretion of IFN-gamma in human CD8+ T lymphocytes stimulated via T-cell receptor. Highly elevated IFN-gamma mRNA levels were found as early as 1 h after stimulation. Maximal IFN-gamma protein synthesis was observed 2-4 h after induction and appeared to correlate to steady-state IFN-gamma mRNA levels. As analyzed by pulse/chase experiments, the secretion of IFN-gamma from T cells was very rapid, the secretion half-time being approximately 20-25 min. Inhibition of N-glycosylation by tunicamycin dramatically reduced the expression of IFN-gamma, but did not block its secretion. Natural IFN-gamma is heterogeneously glycosylated and doubly, singly, and unglycosylated forms exist. Experiments performed in a cell-free translation/glycosylation system with mutated IFN-gamma constructs lacking either one of the potential glycosylation sites suggested that Asn25 is more efficiently glycosylated than Asn97. Site-specific oligosaccharide analysis of natural IFN-gamma by glycosidase treatment followed by matrix-assisted-laser-desorption-ionization mass spectrometry revealed considerable variation in the carbohydrate structures, with more than 30 different forms. The glycans at Asn25 consisted of fucosylated, mainly complex-type oligosaccharides, whereas the glycans at Asn97 were more heterogeneous, with hybrid and high-mannose structures. Our results emphasize the essential role of N-linked glycans in the biology of IFN-gamma and show that there is a considerable heterogeneity in the individual sugar chains of this important human cytokine.
The effect of centaurein on interferon-{gamma} expression and Listeria infection in mice
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chang, S.-L.; Department of Biological Science and Technology, National Chiao Tung University, 1001, Ta Hsueh Road, Hsinchu 300, Taiwan; Yeh, H.-H.
2007-02-15
We previously found that centaurein enhanced IFN-{gamma} transcription in T cells. Here, we demonstrate that centaurein increased the IFN-{gamma} expression in T and NK cells and the serum IFN-{gamma} level in mice. Centaurein elevated the transcription of T-bet but not GATA-3, which is consistent with its effect on that of IFN-{gamma} but not IL-4. Additionally, centaurein effectively protected mice against Listeria infection. Moreover, centaurein per se or in combination with antibiotics could treat Listeria infection. Our mechanistic studies suggest that centaurein augments IFN-{gamma} expression via a transcriptional up-regulation of T-bet and that centaurein protects against or treats Listeria infection viamore » a modulation of IFN-{gamma} expression.« less
Leaphart, Cynthia L; Qureshi, Faisal; Cetin, Selma; Li, Jun; Dubowski, Theresa; Baty, Catherine; Batey, Catherine; Beer-Stolz, Donna; Guo, Fengli; Murray, Sandra A; Hackam, David J
2007-06-01
Necrotizing enterocolitis (NEC) is characterized by interferon-gamma (IFN-gamma) release and inadequate intestinal restitution. Because enterocytes migrate together, mucosal healing may require interenterocyte communication via connexin 43-mediated gap junctions. We hypothesize that enterocyte migration requires interenterocyte communication, that IFN impairs migration by impairing connexin 43, and that impaired healing during NEC is associated with reduced gap junctions. NEC was induced in Swiss-Webster or IFN(-/-) mice, and restitution was determined in the presence of the gap junction inhibitor oleamide, or via time-lapse microscopy of IEC-6 cells. Connexin 43 expression, trafficking, and localization were detected in cultured or primary enterocytes or mouse or human intestine by confocal microscopy and (35)S-labeling, and gap junction communication was assessed using live microscopy with oleamide or connexin 43 siRNA. Enterocytes expressed connexin 43 in vitro and in vivo, and exchanged fluorescent dye via gap junctions. Gap junction inhibition significantly reduced enterocyte migration in vitro and in vivo. NEC was associated with IFN release and loss of enterocyte connexin 43 expression. IFN inhibited enterocyte migration by reducing gap junction communication through the dephosphorylation and internalization of connexin 43. Gap junction inhibition significantly increased NEC severity, whereas reversal of the inhibitory effects of IFN on gap junction communication restored enterocyte migration after IFN exposure. Strikingly, IFN(-/-) mice were protected from the development of NEC, and showed restored connexin 43 expression and intestinal restitution. IFN inhibits enterocyte migration by preventing interenterocyte gap junction communication. Connexin 43 loss may provide insights into the development of NEC, in which restitution is impaired.
Critical role of IFN-gamma in CFA-mediated protection of NOD mice from diabetes development.
Mori, Yoshiko; Kodaka, Tetsuro; Kato, Takako; Kanagawa, Edith M; Kanagawa, Osami
2009-11-01
IFN-gamma signaling-deficient non-obese diabetic (NOD) mice develop diabetes with similar kinetics to those of wild-type NOD mice. However, the immunization of IFN-gamma signaling-deficient NOD mice with CFA failed to induce long-term protection, whereas wild-type NOD mice receiving CFA remained diabetes-free. CFA also failed to protect IFN-gamma receptor-deficient (IFN-gammaR(-/-)) NOD mice from the autoimmune rejection of transplanted islets, as it does in diabetic NOD mice, and from disease transfer by spleen cells from diabetic NOD mice. These data clearly show that the pro-inflammatory cytokine IFN-gamma is necessary for the CFA-mediated protection of NOD mice from diabetes. There is no difference in the T(h)1/T(h)17 balance between IFN-gammaR(-/-) NOD and wild-type NOD mice. There is also no difference in the total numbers and percentages of regulatory T (Treg) cells in the lymph node CD4(+) T-cell populations between IFN-gammaR(-/-) NOD and wild-type NOD mice. However, pathogenic T cells lacking IFN-gammaR are resistant to the suppressive effect of Treg cells, both in vivo and in vitro. Therefore, it is likely that CFA-mediated protection against diabetes development depends on a change in the balance between Treg cells and pathogenic T cells, and IFN-gamma signaling seems to control the susceptibility of pathogenic T cells to the inhibitory activity of Treg cells.
Gamma Interferon-Induced T-Cell Loss in Virulent Mycobacterium avium Infection
Flórido, Manuela; Pearl, John E.; Solache, Alejandra; Borges, Margarida; Haynes, Laura; Cooper, Andrea M.; Appelberg, Rui
2005-01-01
Infection by virulent Mycobacterium avium caused progressive severe lymphopenia in C57BL/6 mice due to increased apoptosis rates. T-cell depletion did not occur in gamma interferon (IFN-γ)-deficient mice which showed increased T-cell numbers and proliferation; in contrast, deficiency in nitric oxide synthase 2 did not prevent T-cell loss. Although T-cell loss was IFN-γ dependent, expression of the IFN-γ receptor on T cells was not required for depletion. Similarly, while T-cell loss was optimal if the T cells expressed IFN-γ, CD8+ T-cell depletion could occur in the absence of T-cell-derived IFN-γ. Depletion did not require that the T cells be specific for mycobacterial antigen and was not affected by deficiencies in the tumor necrosis factor receptors p55 or p75, the Fas receptor (CD95), or the respiratory burst enzymes or by forced expression of bcl-2 in hematopoietic cells. PMID:15908387
Bacterial DNA-induced NK cell IFN-gamma production is dependent on macrophage secretion of IL-12.
Chace, J H; Hooker, N A; Mildenstein, K L; Krieg, A M; Cowdery, J S
1997-08-01
Bacterial DNA (bDNA) activates B cells and macrophages and can augment inflammatory responses by inducing release of proinflammatory cytokines. We found that bDNA stimulation of mouse spleen cells induced NK cell IFN-gamma production that was dependent upon the presence of unmethylated CpG motifs, and oligonucleotides with internal CpG motifs could also induce splenocytes to secrete IFN-gamma. The bDNA-induced IFN-gamma response was strictly macrophages dependent. While splenocytes from SCID mice secreted IFN-gamma in response to bDNA, depletion of macrophages eliminated this response. Additionally, purified NK cells did not respond to bDNA; however, addition of macrophages restored the NK cell IFN-gamma response. Coculture of NK cells with preactivated macrophages further increased bDNA-induced NK cell IFN-gamma production. Anti-IL-12 or IL-10 inhibited bDNA-induced IFN-gamma response. Treatment of purified macrophages with bDNA resulted in IL-12 secretion accompanied by an increase in IL-12 p40 mRNA level. Although isolated NK cells did not make IFN-gamma in response to bDNA, NK cells costimulated with IL-12 gained the ability to respond to bDNA. These experiments show that bDNA induces macrophage IL-12 production which, in turn, stimulates NK cell IFN-gamma production. Macrophage-derived IL-12 renders NK cells responsive to bDNA permitting an even greater IFN-gamma response to bDNA.
... in people with severe, malignant osteopetrosis (an inherited bone disease). Interferon gamma-1b is in a class of ... you may have flu-like symptoms such as headache, fever, chills, muscle aches, and tiredness after your ...
Soler, Concepció; Felipe, Antonio; García-Manteiga, José; Serra, Maria; Guillén-Gómez, Elena; Casado, F Javier; MacLeod, Carol; Modolell, Manuel; Pastor-Anglada, Marçal; Celada, Antonio
2003-01-01
The expressions of CNT and ENT (concentrative and equilibrative nucleoside transporters) in macrophages are differentially regulated by IFN-gamma (interferon-gamma). This cytokine controls gene expression through STAT1-dependent and/or -independent pathways (where STAT1 stands for signal transduction and activator of transcription 1). In the present study, the role of STAT1 in the response of nucleoside transporters to IFN-gamma was studied using macrophages from STAT1 knockout mice. IFN-gamma triggered an inhibition of ENT1-related nucleoside transport activity through STAT1-dependent mechanisms. Such inhibition of macrophage growth and ENT1 activity by IFN-gamma is required for DNA synthesis. Interestingly, IFN-gamma led to an induction of the CNT1- and CNT2-related nucleoside transport activities independent of STAT1, thus ensuring the supply of extracellular nucleosides for the STAT1-independent RNA synthesis. IFN-gamma up-regulated CNT2 mRNA and CNT1 protein levels and down-regulated ENT1 mRNA in both wild-type and STAT1 knockout macrophages. This is consistent with a STAT1-independent, long-term-mediated, probably transcription-dependent, regulation of nucleoside transporter genes. Moreover, STAT1-dependent post-transcriptional mechanisms are implicated in the regulation of ENT1 activity. Although nitric oxide is involved in the regulation of ENT1 activity in B-cells at a post-transcriptional level, our results show that STAT1-dependent induction of nitric oxide by IFN-gamma is not implicated in the regulation of ENT1 activity in macrophages. Our results indicate that both STAT1-dependent and -independent pathways are involved in the regulation of nucleoside transporters by IFN-gamma in macrophages. PMID:12868960
Pai, Madhukar; Gokhale, Kaustubh; Joshi, Rajnish; Dogra, Sandeep; Kalantri, Shriprakash; Mendiratta, Deepak K; Narang, Pratibha; Daley, Charles L; Granich, Reuben M; Mazurek, Gerald H; Reingold, Arthur L; Riley, Lee W; Colford, John M
2005-06-08
Mycobacterium tuberculosis infection in health care workers has not been adequately studied in developing countries using newer diagnostic tests. To estimate latent tuberculosis infection prevalence in health care workers using the tuberculin skin test (TST) and a whole-blood interferon gamma (IFN-gamma) assay; to determine agreement between the tests; and to compare their correlation with risk factors. A cross-sectional comparison study of 726 health care workers aged 18 to 61 years (median age, 22 years) with no history of active tuberculosis conducted from January to May 2004, at a rural medical school in India. A total of 493 (68%) of the health care workers had direct contact with patients with tuberculosis and 514 (71%) had BCG vaccine scars. Tuberculin skin testing was performed using 1-TU dose of purified protein derivative RT23, and the IFN-gamma assay was performed by measuring IFN-gamma response to early secreted antigenic target 6, culture filtrate protein 10, and a portion of tuberculosis antigen TB7.7. Agreement between TST and the IFN-gamma assay, and comparison of the tests with respect to their association with risk factors. A large proportion of the health care workers were latently infected; 360 (50%) were positive by either TST or IFN-gamma assay, and 226 (31%) were positive by both tests. The prevalence estimates of TST and IFN-gamma assay positivity were comparable (41%; 95% confidence interval [CI], 38%-45% and 40%; 95% CI, 37%-43%, respectively). Agreement between the tests was high (81.4%; kappa = 0.61; 95% CI, 0.56-0.67). Increasing age and years in the health profession were significant risk factors for both IFN-gamma assay and TST positivity. BCG vaccination had little impact on TST and IFN-gamma assay results. Our study showed high latent tuberculosis infection prevalence in Indian health care workers, high agreement between TST and IFN-gamma assay, and similar association between positive test results and risk factors. Although TST and
Wang, Xiao Yang; Crowston, Jonathan G; White, Andrew J R; Zoellner, Hans; Healey, Paul R
2014-08-01
The aim of the study was to investigate, using a native mitomycin-C-resistant human Tenon's fibroblast cell line, the possibility that interferon-alpha and gamma could be used with Fas agonists as an alternative anti-fibrotic strategy to mitomycin-C in trabeculectomy. A clinically resistant and in vitro verified mitomycin-C-resistant human Tenon's fibroblast cell line was pretreated with interferon-alpha and interferon-gamma for 48 h before stimulation with an agonistic Fas antibody (CH11) for 2 days to induce cell death. Cell death assays were undertaken. Changes in apoptosis-related proteins were determined by flow cytometry and Western blot. Pretreatment with interferon-alpha or interferon-gamma for 48 h increased Fas, Fas-associated protein with death domain and caspase-8 expression. Protein expression was further increased by combined exposure to interferon-alpha and gamma. Pretreatment with cytokines had no effect on Fas-L and Bcl-2. Interferon-alpha alone did not change the rate of induced cell death. A combination of interferon-alpha and gamma synergistically increased the sensitivity of mitomycin-C-resistant human Tenon's fibroblast cell line to induced cell death. An antagonistic anti-Fas antibody (ZB4) completely blocked induced cell death. Broad caspase inhibitors specific for caspases-8 and -3 reduced induced deaths in interferon pretreated mitomycin-C-resistant human Tenon's fibroblast cell line in a dose-dependent manner. Interferon-alpha and interferon-gamma render mitomycin-C-resistant human Tenon's fibroblast cell line sensitive to Fas-mediated apoptosis. The mechanism involves increased death-inducing signalling complex formation by upregulation of Fas, Fas-associated protein with death domain and caspase-8 expression. © 2013 Royal Australian and New Zealand College of Ophthalmologists.
Deckert-Schlüter, M; Rang, A; Weiner, D; Huang, S; Wiestler, O D; Hof, H; Schlüter, D
1996-12-01
Toxoplasma gondii may cause severe infections in immunocompromised patients including fetuses and those with AIDS. Among the factors mediating protection against T. gondii, IFN-gamma has gained special attention. To analyze the role of IFN-gamma in the early phase of toxoplasmosis, IFN-gamma receptor-deficient (IFN-gamma R0/0) mice were orally infected with low-virulent toxoplasms. IFN-gamma R0/0 mice died of the disease up to day 10 postinfection, whereas immunocompetent wild-type (WT) mice developed a chronic toxoplasmosis. Histopathology revealed that in IFN-gamma R0/0 mice, the parasite multiplied unrestrictedly in the small intestine, the intestinal lymphatic tissue, the liver, and the spleen. Ultimately, animals died of a necrotizing hepatitis. In WT mice, the same organs were effected, but multiplication of the parasite was effectively limited. Compared with WT mice, immunohistochemistry and flow cytometry demonstrated that in IFN-gamma R0/0 mice, macrophages were only marginally activated in response to the infection, as evidenced by a reduced expression of major histocompatability complex class II antigens. In addition, immunohistochemistry and RT-PCR showed a reduced production of the macrophage-derived cytokines tumor necrosis factor-alpha, inducible nitric oxide synthase, and IL-1 beta in the liver of IFN-gamma R0/0 mice. In contrast, activation of T cells, recruitment of immune cells to inflammatory foci, and anti-T. gondii IgM antibody production were unaffected by the mutation of the IFN-gamma R. Moreover, induction of IL-2, IL-4, and IL-10 mRNA transcripts in the liver was normal in IFN-gamma R0/0 mice. Adoptive transfer experiments revealed that the immune T cells of WT animals did not protect IFN-gamma R0/0 mice from lethal infection with highly virulent toxoplasms, whereas WT mice were significantly protected by the adoptive transfer. Based on these studies, we conclude that IFN-gamma is absolutely required for an efficient activation of
Chen, Jianzhou; Markelc, Bostjan; Kaeppler, Jakob; Ogundipe, Vivian M L; Cao, Yunhong; McKenna, W Gillies; Muschel, Ruth J
2018-05-01
To investigate the induction of type III interferons (IFNs) in human cancer cells by gamma-rays. Type III IFN expression in human cancer cell lines after gamma-ray irradiation in vitro was assessed by reverse transcription-quantitative polymerase chain reaction and enzyme-linked immunosorbent assay. Signaling pathways mediating type III IFN induction were examined by a variety of means, including immunoblotting, flow cytometry, confocal imaging, and reverse transcription-quantitative polymerase chain reaction. Key mediators in these pathways were further explored and validated using gene CRISPR knockout or short hairpin RNA knockdown. Exposure to gamma-rays directly induced type III IFNs (mainly IFNL1) in human cancer cell lines in dose- and time-dependent fashions. The induction of IFNL1 was primarily mediated by the cytosolic DNA sensors-STING-TBK1-IRF1 signaling axis, with a lesser contribution from the nuclear factor kappa b signaling in HT29 cells. In addition, type III IFN signaling through its receptors serves as a positive feedback loop, further enhancing IFN expression via up-regulation of the kinases in the STING-TBK1 signaling axis. Our results suggest that IFNL1 can be up-regulated in human cancer cell lines after gamma-ray treatment. In HT29 cells this induction occurs via the STING pathway, adding another layer of complexity to the understanding of radiation-induced antitumor immunity, and may provide novel insights into IFN-based cancer treatment. Copyright © 2018 Elsevier Inc. All rights reserved.
Schijns, V E; Haagmans, B L; Rijke, E O; Huang, S; Aguet, M; Horzinek, M C
1994-09-01
The lymphokine IFN-gamma is a pleiotropic immunomodulator and possesses intrinsic antiviral activity. We studied its significance in the development of antiviral immune responses by using IFN-gamma receptor-deficient (IFN-gamma R-/-) mice. After inoculation with live attenuated pseudorabies virus (PRV), the mutant mice showed no infectivity titers in various tissues, and transient viral Ag expression only in the spleen, similar as in wild-type mice. However, the absence of the IFN-gamma R resulted in increased proliferative splenocyte responses. The PRV-immune animals showed a normal IFN-gamma and IL-2 production, without detectable IL-4, and with decreased IL-10 secretion in response to viral Ag or Con A. Immunohistochemically, an increased ratio of IFN-gamma:IL-4-producing spleen cells was found. After immunization with either live attenuated or inactivated PRV, IFN-gamma R-/- mice produced significantly less antiviral Ab, and more succumbed to challenge infection than the intact control animals. The reduction in Ab titers in the mutant mice correlated with lower protection by their sera in transfer experiments. Our data demonstrate that ablation of the IFN-gamma receptor surprisingly does not inhibit the generation of antiviral Th1-type and increase Th2-type cytokine responses. However, it profoundly impairs the generation of protective antiviral Ab.
Müller, M; Laxton, C; Briscoe, J; Schindler, C; Improta, T; Darnell, J E; Stark, G R; Kerr, I M
1993-01-01
Mutants in complementation group U3, completely defective in the response of all genes tested to interferons (IFNs) alpha and gamma, do not express the 91 and 84 kDa polypeptide components of interferon-stimulated gene factor 3 (ISGF3), a transcription factor known to play a primary role in the IFN-alpha response pathway. The 91 and 84 kDa polypeptides are products of a single gene. They result from differential splicing and differ only in a 38 amino acid extension at the C-terminus of the 91 kDa polypeptide. Complementation of U3 mutants with cDNA constructs expressing the 91 kDa product at levels comparable to those observed in induced wild-type cells completely restored the response to both IFN-alpha and -gamma and the ability to form ISGF3. Complementation with the 84 kDa component similarly restored the ability to form ISGF3 and, albeit to a lower level, the IFN-alpha response of all genes tested so far. It failed, however, to restore the IFN-gamma response of any gene analysed. The precise nature of the DNA motifs and combination of factors required for the transcriptional response of all genes inducible by IFN-alpha and -gamma remains to be established. The results presented here, however, emphasize the apparent general requirement of the 91 kDa polypeptide in the primary transcriptional response to both types of IFN. Images PMID:7693454
Browne, Sarah K; Roesser, James R; Zhu, Sheng Zu; Ginder, Gordon D
2006-12-15
IFNs regulate most MHC class I genes by stimulating transcription initiation. As shown previously, IFN-gamma controls HLA-A expression primarily at the posttranscriptional level. We have defined two 8-base sequences in a 39-nucleotide region in the 3'-transcribed region of the HLA-A gene that are required for the posttranscriptional response to IFN-gamma. Stimulation of HLA-A expression by IFN-gamma requires nuclear export of HLA-A mRNA by chromosome maintenance region 1 (CRM-1). Treatment of cells with leptomycin B, a specific inhibitor of CRM-1, completely inhibited IFN-gamma induction of HLA-A. Expression of a truncated, dominant-negative form of the nucleoporin NUP214/CAN, DeltaCAN, that specifically interacts with CRM-1, also prevented IFN-gamma stimulation of HLA-A, providing confirmation of the role of CRM-1. Increased expression of HLA-A induced by IFN-gamma also requires protein methylation, as shown by the fact that treatment of SK-N-MC cells or HeLa cells with the PRMT1 inhibitor 5'-methyl-5'-thioadenosine abolished the cellular response to IFN-gamma. In contrast with HLA-A, IFN-gamma-induced expression of the HLA class Ib gene, HLA-E, was not affected by either 5'-methyl-5'-thioadenosine or leptomycin B. These results provide proof of principle that it is possible to differentially modulate the IFN-gamma-induced expression of the HLA-E and HLA-A genes, whose products often mediate opposing effects on cellular immunity to tumor cells, pathogens, and autoantigens.
Ruiz-Ruiz, Carmen; López-Rivas, Abelardo
2002-01-01
Tumour necrosis factor-related apoptosis-inducing ligand (TRAIL/APO-2L) induces apoptosis in a variety of tumour cells upon binding to death receptors TRAIL-R1 and TRAIL-R2. Here we describe the sensitization by interferon (IFN)-gamma to TRAIL-induced apoptosis in the breast tumour cell lines MCF-7 and MDA-MB231. IFN-gamma promoted TRAIL-mediated activation of caspase-8, Bcl-2 interacting domain death agonist (Bid) degradation, Bcl-2-associated X protein (Bax) translocation to mitochondria, cytochrome c release to the cytosol and activation of caspase-9 in these cell lines. No changes in the expression of TRAIL receptors were observed upon IFN-gamma treatment. Overexpression of Bcl-2 in MCF-7 cells completely inhibited IFN-gamma-induced sensitization to TRAIL-mediated cell death. Interestingly, TRAIL-induced apoptosis was also clearly enhanced by IFN-gamma in caspase-3-overexpressing MCF-7 cells, in the absence of Bax translocation to mitochondria and cytochrome c release to the cytosol. In summary, our results suggest that IFN-gamma facilitates TRAIL-induced activation of mitochondria-regulated as well as mitochondria-independent apoptotic pathways in breast tumour cells. PMID:11936954
Maloney, Nicole S.; Thackray, Larissa B.; Goel, Gautam; Hwang, Seungmin; Duan, Erning; Vachharajani, Punit; Xavier, Ramnik
2012-01-01
Noroviruses (NVs) cause the majority of cases of epidemic nonbacterial gastroenteritis worldwide and contribute to endemic enteric disease. However, the molecular mechanisms responsible for immune control of their replication are not completely understood. Here we report that the transcription factor interferon regulatory factor 1 (IRF-1) is required for control of murine NV (MNV) replication and pathogenesis in vivo. This led us to studies documenting a cell-autonomous role for IRF-1 in gamma interferon (IFN-γ)-mediated inhibition of MNV replication in primary macrophages. This role of IRF-1 in the inhibition of MNV replication by IFN-γ is independent of IFN-αβ signaling. While the signal transducer and activator of transcription STAT-1 was also required for IFN-γ-mediated inhibition of MNV replication in vitro, class II transactivator (CIITA), interferon regulatory factor 3 (IRF-3), and interferon regulatory factor 7 (IRF-7) were not required. We therefore hypothesized that there must be a subset of IFN-stimulated genes (ISGs) regulated by IFN-γ in a manner dependent only on STAT-1 and IRF-1. Analysis of transcriptional profiles of macrophages lacking various transcription factors confirmed this hypothesis. These studies identify a key role for IRF-1 in IFN-γ-dependent control of norovirus infection in mice and macrophages. PMID:22973039
Shaw, Patrick J; Ditewig, Amy C; Waring, Jeffrey F; Liguori, Michael J; Blomme, Eric A; Ganey, Patricia E; Roth, Robert A
2009-01-01
The antibiotic trovafloxacin (TVX) has caused severe idiosyncratic hepatotoxicity in people, whereas levofloxacin (LVX) has not. Mice cotreated with TVX and lipopolysaccharide (LPS), but not with LVX and LPS, develop severe hepatocellular necrosis. Mice were treated with TVX and/or LPS, and hepatic gene expression changes were measured before liver injury using gene array. Hepatic gene expression profiles from mice treated with TVX/LPS clustered differently from those treated with LPS or TVX alone. Several of the probe sets expressed differently in TVX/LPS-treated mice were involved in interferon (IFN) signaling and the janus kinase/signal transducers and activators of transcription (JAK/STAT) pathway. A time course of plasma concentrations of IFN-gamma and interleukin (IL)-18, which directly induces IFN-gamma production, revealed that both cytokines were selectively increased in TVX/LPS-treated mice. Both IL-18(-/-) and IFN-gamma(-/-) mice were significantly protected from TVX/LPS-induced liver injury. In addition, IFN-gamma(-/-) mice had decreased plasma concentrations of tumor necrosis factor-alpha, IL-18, and IL-1beta when compared to wild-type mice. In conclusion, the altered expression of genes involved in IFN signaling in TVX/LPS-treated mice led to the finding that IL-18 and IFN-gamma play a critical role in TVX/LPS-induced liver injury.
Lewis, C E; McCarthy, S P; Lorenzen, J; McGee, J O
1990-01-01
Human mononuclear phagocytes can be activated to perform a variety of complex functions by exposure to the immunomodulators, lipopolysaccharide (LPS), interferon-gamma (IFN-gamma) and tumour necrosis factor alpha (TNF alpha). Although such activation often involves the release of various cytokines by monocytes and macrophages, little is known of the effects of such signals on their secretion of lysozyme (LZM). In this study, a reverse haemolytic plaque assay for LZM secretion is coupled with immunocytochemistry for the pan macrophage (CD68) marker, EBM/11. This enabled the direct effects of LPS, IFN-gamma and TNF alpha on the secretion of LZM by individual, immunoidentified human mononuclear phagocytes to be investigated. The overall secretion of this peptide by populations of freshly isolated or 3-day cultured monocytes was augmented by exposure for 6 hr to bacterial LPS, recombinant human IFN-gamma or recombinant human TNF alpha. Extension of the culture period for monocytes from 3 to 7 days prior to use in the assay resulted in higher levels of LZM secretion, which could be further increased by TNF alpha but not by LPS or IFN-gamma. Individual peritoneal macrophages activated by inflammation in vivo were uniform in their augmented LZM responses to TNF alpha, but a small subpopulation of human peritoneal macrophages, which may represent younger 'inflammatory' exudate macrophages, was seen to be preferentially responsive to the LZM-stimulating effects of LPS and IFN-gamma. These studies suggest that (i) secretion of LZM by human mononuclear phagocytes can be regulated by LPS and IFN-gamma, although the effects of these agents may be dependent upon the state of maturation and/or differentiation of the cells, and (ii) TNF alpha is a potent stimulant of LZM secretion by monocytes and macrophages irrespective of cell maturity. Images Figure 1 Figure 1 PMID:2107146
Komohara, Yoshihiro; Takemura, Kenichi; Lei, Xiao Feng; Sakashita, Naomi; Harada, Mamoru; Suzuki, Hiroshi; Kodama, Tatsuhiko; Takeya, Motohiro
2009-11-01
Class A scavenger receptors (SR-A, CD204) are highly expressed in tumor-associated macrophages (TAM). To investigate the function of SR-A in TAM, wild-type and SR-A-deficient (SR-A(-/-)) mice were injected with EL4 cells. Although these groups of mice did not differ in the numbers of infiltrating macrophages and lymphocytes and in neovascularization, SR-A(-/-) mice had delayed growth of EL4 tumors. Expression of inducible nitric oxide (NO) synthase and interferon (IFN)-gamma mRNA increased significantly in tumor tissues from SR-A(-/-) mice. Engulfment of necrotic EL4 cells induced upregulation of NO and IFN-gamma production by cultured macrophages, and production of NO and IFN-gamma increased in SR-A(-/-) macrophages in vitro. IFN-beta production by cultured macrophages was also elevated in SR-A(-/-) macrophages in vitro. These results suggested that the antitumor activity of macrophages increased in SR-A(-/-) mice because of upregulation of NO and IFN-gamma production. These data indicate an important role of SR-A in regulating TAM function by inhibiting toll-like receptor (TLR)4-IFN-beta signaling.
Thyroid epithelial cell hyperplasia in IFN-gamma deficient NOD.H-2h4 mice.
Yu, Shiguang; Sharp, Gordon C; Braley-Mullen, Helen
2006-01-01
The role of inflammatory cells in thyroid epithelial cell (thyrocyte) hyperplasia is unknown. Here, we demonstrate that thyrocyte hyperplasia in IFN-gamma-/- NOD.H-2h4 mice has an autoimmune basis. After chronic exposure to increased dietary iodine, 60% of IFN-gamma-/- mice had severe thyrocyte hyperplasia with minimal or moderate lymphocyte infiltration, and thyroid dysfunction with reduced serum T4. All mice produced anti-thyroglobulin autoantibody. Some wild-type NOD.H-2h4 mice had isolated areas of thyrocyte hyperplasia with predominantly lymphocytic infiltration, whereas IL-4-/- and 50% of wild-type NOD.H-2h4 mice developed lymphocytic thyroiditis but no thyrocyte hyperplasia. Both thyroid infiltrating inflammatory cells and environmental factors (iodine) were required to induce thyrocyte hyperplasia. Splenocytes from IFN-gamma-/- mice with thyrocyte hyperplasia, but not splenocytes from naïve IFN-gamma-/- mice, induced hyperplasia in IFN-gamma-/- NOD.H-2h4.SCID mice. These results may provide clues for understanding the mechanisms underlying development of epithelial cell hyperplasia not only in thyroids but also in other tissues and organs.
Compartmentalized bronchoalveolar IFN-gamma and IL-12 response in human pulmonary tuberculosis.
Herrera, Maria Teresa; Torres, Martha; Nevels, Denarra; Perez-Redondo, Carlos Núñez; Ellner, Jerrold J; Sada, Eduardo; Schwander, Stephan K
2009-01-01
Human tuberculosis (TB) principally involves the lungs, where local immunity impacts on the load of Mycobacterium tuberculosis (M.tb). Because concomitants of local Th1 immunity are still under-explored in humans, we characterized immune responses in bronchoalveolar cells (BACs) and systemically in peripheral blood mononuclear cells (PBMCs) in persons with active pulmonary TB and in healthy community controls. PPD- and live M.tb-induced IFN-gamma-production were observed in CD4(+), CD8(+), gammadeltaTCR(+), and CD56(+) alveolar T cell subpopulations and NK cells (CD3(-)CD56(+)). IFN-gamma-producing CD4(+) T cells (mostly CD45RO(+)) were more abundant (p<0.05). M.tb-induced IL-12p70, but interestingly also IL-4, was increased (p<0.05) in BACs from TB patients. Constitutive expression of IL-12Rbeta1 and IL-12Rbeta2 mRNA in BACs and PBMCs and IFN-gammaR1 in BACs was similar in both study groups. Data were normalized to account for differences in proportions of alveolar T cells and macrophages in the study groups. IFN-gamma-production and its induction by IL-12R engagement occur virtually unimpaired in the bronchoalveolar spaces of patients with pulmonary TB. The reasons for the apparent failure to control M. tuberculosis growth during active pulmonary TB disease is unknown but could be the expression of locally acting immunosuppressive mechanisms that subvert the antimycobacterial effects of IFN-gamma.
Effect of interferon-gamma on complement gene expression in different cell types.
Lappin, D F; Guc, D; Hill, A; McShane, T; Whaley, K
1992-01-15
We have studied the expression of the complement components C2, C3, factor B, C1 inhibitor (C1-inh), C4-binding protein (C4-bp) and factor H in human peripheral blood monocytes, skin fibroblasts, umbilical vein endothelial cells (HUVEC) and the human hepatoma cell line G2 (Hep G2) in the absence and the presence of interferon-gamma (IFN-gamma). E.l.i.s.a. performed on culture fluids, run-on transcription assays, Northern blot and double-dilution dot-blot techniques confirmed that monocytes expressed all six components, whereas fibroblasts, HUVEC and HepG2 each expressed five of the six components. Fibroblasts and HUVEC did not synthesize C4-bp, and Hep G2 did not produce factor H. In addition to these differences, the synthesis rates of C3, C1-inh and factor H were not the same in all cell types. However, the synthesis rates of C2 and factor B were similar in all four cell types. The half-lives of the mRNAs were shorter in monocytes than in other cell types. Monocyte factor H mRNA had a half-life of 12 min in monocytes, compared with over 3 h in fibroblasts and HUVEC. The instability of factor H mRNA in monocytes may contribute to their low factor H secretion rate. IFN-gamma produced dose-dependent stimulation of C2, factor B, C1-inh, C4-bp and factor H synthesis by all cell types expressing these proteins, but decreased C3 synthesis in all four cell types. Cell-specific differences in the response to IFN-gamma were observed. The increased rates of transcription of the C1-inh and factor H genes in HUVEC were greater than in other cell types, while the increased rate of transcription of the C2, factor B and C1-inh genes in Hep G2 cells was less than in other cell types. IFN-gamma did not affect the stability of C3, factor H or C4 bp mRNAs, but increased the stability of factor B and C1-inh mRNAs and decreased the stability of C2 mRNA. Although these changes occurred in all four cell types studied, the half-life of C1-inh mRNA in monocytes was increased almost 4-fold
Distinct regulatory functions of SLP-76 and MIST in NK cell cytotoxicity and IFN-gamma production.
Hidano, Shinya; Sasanuma, Hiroki; Ohshima, Keiko; Seino, Ken-ichiro; Kumar, Lalit; Hayashi, Katsuhiko; Hikida, Masaki; Kurosaki, Tomohiro; Taniguchi, Masaru; Geha, Raif S; Kitamura, Daisuke; Goitsuka, Ryo
2008-03-01
Activation of NK cells is triggered by multiple receptors. We demonstrate here that SLP-76 is required for CD16- and NKG2D-mediated NK cell cytotoxicity, while MIST negatively regulates these responses in an SLP-76-dependent manner. Exceptionally, MIST acts as a positive regulator of cytotoxicity against YAC-1 cells, although SLP-76 plays a more key role. SLP-76 acts as a dominant positive regulator for both NKG2D-mediated and YAC-1 cell-triggered IFN-gamma production. Although NKG2D-mediated IFN-gamma production depends on phospholipase C (PLC) gamma 2, YAC-1 cell-triggered IFN-gamma production is PLC gamma 2- and Syk/ZAP-70 independent and nuclear factor-kappa B mediated. SLP-76 is required for this process in the presence of MIST but is dispensable in the absence of MIST. Thus, YAC-1 cell-triggered NKG2D-independent IFN-gamma production appears to be regulated by SLP-76-dependent and -independent pathways, in which the latter is negatively regulated by MIST. Taken together, these results suggest that SLP-76 and MIST distinctly but interactively regulate NK cell cytotoxicity and IFN-gamma production.
Si, Yue; Ciccone, Samantha; Yang, Feng-Chun; Yuan, Jin; Zeng, Daisy; Chen, Shi; van de Vrugt, Henri J.; Critser, John; Arwert, Fre; Haneline, Laura S.; Clapp, D. Wade
2006-01-01
Fanconi anemia (FA) is a heterogeneous genetic disorder characterized by bone marrow (BM) failure and cancer susceptibility. Identification of the cDNAs of FA complementation types allows the potential of using gene transfer technology to introduce functional cDNAs as transgenes into autologous stem cells and provide a cure for the BM failure in FA patients. However, strategies to enhance the mobilization, transduction, and engraftment of exogenous stem cells are required to optimize efficacy prior to widespread clinical use. Hypersensitivity of Fancc–/– cells to interferon-gamma (IFN-γ), a nongenotoxic immune-regulatory cytokine, enhances engraftment of syngeneic wild-type (WT) cells in Fancc–/– mice. However, whether this phenotype is of broad relevance in other FA complementation groups is unresolved. Here we show that primitive and mature myeloid progenitors in Fanca–/– and Fancg–/– mice are hypersensitive to IFN-γ and that in vivo infusion of IFN-γ at clinically relevant concentrations was sufficient to allow consistent long-term engraftment of isogenic WT repopulating stem cells. Given that FANCA, FANCC, and FANCG complementation groups account for more than 90% of all FA patients, these data provide evidence that IFN-γ conditioning may be a useful nongenotoxic strategy for myelopreparation in FA patients. PMID:16946306
Ballez, J S; Mols, J; Burteau, C; Agathos, S N; Schneider, Y J
2004-03-01
We have recently developed a protein-free medium (PFS) able to support the growth of Chinese hamster ovary (CHO) cells in suspension. Upon further supplementation with some plant protein hydrolysates, medium performances reached what could be observed in serum-containing media [Burteau et al. In Vitro Cell. Dev. Biol.-Anim. 39 (2003) 291]. Now, we describe the use of rice and wheat protein hydrolysates, as non-nutritional additives to the culture medium to support productivity and cell growth in suspension or in microcarriers. When CHO-320 cells secreting recombinant interferon-gamma (IFN-gamma) were cultivated in suspension in a bioreactor with our PFS supplemented with wheat hydrolysates, the maximum cell density increased by 25% and the IFN-gamma secretion by 60% compared to the control PFS. A small-scale perfusion system consisting of CHO-320 cells growing on and inside fibrous microcarriers under discontinuous operation was first developed. Under these conditions, rice protein hydrolysates stimulated recombinant IFN-gamma secretion by 30% compared to the control PFS. At the bioreactorscale, similar results were obtained but when compared to shake-flasks studies, nutrients, oxygen or toxic by-products gradients inside the microcarriers seemed to be the main limitation of the system. An increase of the perfusion rate to maintain glucose concentration over 5.5 mM and dissolved oxygen (DO) at 60% was able to stimulate the production of IFN-gamma to a level of 6.6 mug h(-1) g(-1) of microcarriers after 160 h when a cellular density of about 4 x 10(8) cell g(-1) of carriers was reached.
Vercelli, D; Jabara, H H; Lauener, R P; Geha, R S
1990-01-15
The T cell-derived lymphokine IL-4 is essential for the induction of IgE synthesis by human lymphocytes. The IgE-inducing effect of IL-4 is antagonized by IFN-gamma. The secretion of IFN-gamma is vigorously triggered in MLC. Thus, IL-4-stimulated MLC represent a suitable model to characterize the functional antagonism between IL-4 and IFN-gamma. In this report, we show that rIL-4 consistently induced IgE synthesis when added to human primary MLC. IL-4-dependent IgE production required cognate T/B cell recognition, because it was inhibited by antibodies to CD3 and MHC class II (HlA-DR) Ag. A neutralizing anti-IFN-gamma mAb dramatically enhanced IL-4-dependent IgE synthesis by MLC, indicating that endogenous IFN-gamma is a major inhibitor of IgE production. More importantly, addition of rIL-4 markedly inhibited the release of IFN-gamma in supernatants of MLC and Con A-activated PBMC. The decrease in IFN-gamma protein was accompanied by a decreased expression of IFN-gamma mRNA transcripts. The downregulation of IFN-gamma by IL-4 is likely to play an important role in the IL-4-dependent induction of IgE synthesis.
[Expression of gamma interferon during HPV and Chlamydia trachomatis infection in cervical samples].
Colín-Ferreyra, María Del Carmen; Mendieta-Zerón, Hugo; Romero-Figueroa, María Del Socorro; Martínez-Madrigal, Migdania; Martínez-Pérez, Sergio; Domínguez-García, María Victoria
2015-02-01
The aim of this study was to mesure the expression of gamma interferon in HPV and Chlamydia trachomatis infection in squamous intraepithelial lesions. Samples from 100 patients diagnosed by colposcopy with or without squamous intraepithelial lesions were used in the present study. Each patient was found to be infected by HPV and C.trachomatis. Relative gamma interferon mRNA expression was assessed using a real-time reverse transcriptase PCR assay (RT-PCR). The relative units of expression of gamma interferon mRNA were 13, 1.8 and 0.3, for HPV and C.trachomatis co-infection, or HPV or C.trachomatis infection, respectively. HPV and C.trachomatis could overstimulate the expression of gamma interferon. Copyright © 2014 Elsevier España, S.L.U. y Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.
Scorneaux, B; Ouadrhiri, Y; Anzalone, G; Tulkens, P M
1996-01-01
Listeria monocytogenes is a facultative intracellular pathogen which enters cells by endocytosis and reaches phagolysosomes from where it escapes and multiplies in the cytosol of untreated cells. Exposure of macrophages to gamma interferon (IFN-gamma) restricts L. monocytogenes to phagosomes and prevents its intracellular multiplication. We have tested whether IFN-gamma also modulates the susceptibility of L. monocytogenes to antibiotics. We selected drugs from three different classes displaying marked properties concerning their cellular accumulation and subcellular distribution, namely, ampicillin (not accumulated by cells but present in cytosol), azithromycin (largely accumulated by cells but mostly restricted to lysosomes), and sparfloxacin (accumulated to a fair extent but detected only in cytosol). We used a continuous line of myelomonocytic cells (THP-1 macrophages), which display specific surface receptors for IFN-gamma, and examined the activity of these antibiotics against L. monocytogenes Hly+ (virulent variant) and L. monocytogenes Hly- (a nonvirulent variant defective in hemolysin production). Untreated THP-1 and phorbol myristate acetate-differentiated THP-1 were permissive for infection and multiplication of intracellular L. monocytogenes Hly+ (virulent variant). All three antibiotics tested were bactericidal against this Listeria strain when added to an extracellular concentration of 10x their MIC. After preexposure of THP-1 to IFN-gamma, L. monocytogenes Hly+ was still phagocytosed but no longer grew intracellularly. The activity of ampicillin became almost undetectable (antagonistic effect), and that of azithromycin was unchanged (additive effect with that of IFN-gamma), whereas that of sparfloxacin was markedly enhanced (synergy). A similar behavior (lack of bacterial growth, associated with a loss of activity of ampicillin, an enhanced activity of sparfloxacin, and unchanged activity of azithromycin) was observed in cells infected with L
Coers, Jörn; Bernstein-Hanley, Isaac; Grotsky, David; Parvanova, Iana; Howard, Jonathan C; Taylor, Gregory A; Dietrich, William F; Starnbach, Michael N
2008-05-01
Chlamydiae are obligate intracellular bacterial pathogens that exhibit a broad range of host tropism. Differences in host tropism between Chlamydia species have been linked to host variations in IFN-gamma-mediated immune responses. In mouse cells, IFN-gamma can effectively restrict growth of the human pathogen Chlamydia trachomatis but fails to control growth of the closely related mouse pathogen Chlamydia muridarum. The ability of mouse cells to resist C. trachomatis replication is largely dependent on the induction of a family of IFN-gamma-inducible GTPases called immunity-related GTPases or IRGs. In this study we demonstrate that C. muridarum can specifically evade IRG-mediated host resistance. It has previously been suggested that C. muridarum inactivates the IRG protein Irga6 (Iigp1) to dampen the murine immune response. However, we show that Irga6 is dispensable for the control of C. trachomatis replication. Instead, an effective IFN-gamma response to C. trachomatis requires the IRG proteins Irgm1 (Lrg47), Irgm3 (Igtp), and Irgb10. Ectopic expression of Irgb10 in the absence of IFN-gamma is sufficient to reduce intracellular growth of C. trachomatis but fails to restrict growth of C. muridarum, indicating that C. muridarum can specifically evade Irgb10-driven host responses. Importantly, we find that Irgb10 protein intimately associates with inclusions harboring C. trachomatis but is absent from inclusions formed by C. muridarum. These data suggest that C. muridarum has evolved a mechanism to escape the murine IFN-gamma response by restricting access of Irgb10 and possibly other IRG proteins to the inclusion.
Berri, Fatma; Haffar, Ghina; Lê, Vuong Ba; Sadewasser, Anne; Paki, Katharina; Lina, Bruno; Wolff, Thorsten
2014-01-01
ABSTRACT During the budding process, influenza A viruses (IAVs) incorporate multiple host cell membrane proteins. However, for most of them, their significance in viral morphogenesis and infectivity remains unknown. We demonstrate here that the expression of annexin V (A5) is upregulated at the cell surface upon IAV infection and that a substantial proportion of the protein is present in lipid rafts, the site of virus budding. Western blotting and immunogold analysis of highly purified IAV particles showed the presence of A5 in the virion. Significantly, gamma interferon (IFN-γ)-induced Stat phosphorylation and IFN-γ-induced 10-kDa protein (IP-10) production in macrophage-derived THP-1 cells was inhibited by purified IAV particles. Disruption of the IFN-γ signaling pathway was A5 dependent since downregulation of its expression or its blockage reversed the inhibition and resulted in decreased viral replication in vitro. The functional significance of these results was also observed in vivo. Thus, IAVs can subvert the IFN-γ antiviral immune response by incorporating A5 into their envelope during the budding process. IMPORTANCE Many enveloped viruses, including influenza A viruses, bud from the plasma membrane of their host cells and incorporate cellular surface proteins into viral particles. However, for the vast majority of these proteins, only the observation of their incorporation has been reported. We demonstrate here that the host protein annexin V is specifically incorporated into influenza virus particles during the budding process. Importantly, we showed that packaged annexin V counteracted the antiviral activity of gamma interferon in vitro and in vivo. Thus, these results showed that annexin V incorporated in the viral envelope of influenza viruses allow viral escape from immune surveillance. Understanding the role of host incorporated protein into virions may reveal how enveloped RNA viruses hijack the host cell machinery for their own purposes. PMID
Jouanguy, E; Lamhamedi-Cherradi, S; Altare, F; Fondanèche, M C; Tuerlinckx, D; Blanche, S; Emile, J F; Gaillard, J L; Schreiber, R; Levin, M; Fischer, A; Hivroz, C; Casanova, J L
1997-01-01
Complete interferon-gamma receptor 1 (IFNgammaR1) deficiency has been identified previously as a cause of fatal bacillus Calmette-Guérin (BCG) infection with lepromatoid granulomas, and of disseminated nontuberculous mycobacterial (NTM) infection in children who had not been inoculated with BCG. We report here a kindred with partial IFNgammaR1 deficiency: one child afflicted by disseminated BCG infection with tuberculoid granulomas, and a sibling, who had not been inoculated previously with BCG, with clinical tuberculosis. Both responded to antimicrobials and are currently well without prophylactic therapy. Impaired response to IFN-gamma was documented in B cells by signal transducer and activator of transcription 1 nuclear translocation, in fibroblasts by cell surface HLA class II induction, and in monocytes by cell surface CD64 induction and TNF-alpha secretion. Whereas cells from healthy children responded to even low IFN-gamma concentrations (10 IU/ml), and cells from a child with complete IFNgammaR1 deficiency did not respond to even high IFN-gamma concentrations (10,000 IU/ml), cells from the two siblings did not respond to low or intermediate concentrations, yet responded to high IFN-gamma concentrations. A homozygous missense IFNgR1 mutation was identified, and its pathogenic role was ascertained by molecular complementation. Thus, whereas complete IFNgammaR1 deficiency in previously identified kindreds caused fatal lepromatoid BCG infection and disseminated NTM infection, partial IFNgammaR1 deficiency in this kindred caused curable tuberculoid BCG infection and clinical tuberculosis. PMID:9389728
[Plasma levels of interferon gamma and interleukin 10 in patients with lymphonodular toxoplasmosis].
Bielec, D; Patorska-Mach, E; Semczuk, G; Toruń, E
1997-01-01
The concentrations of IFN gamma and IL 10 in plasma of sixteen patients with toxoplasmic lymphadenopathy were measured. These examinations were carried out two times in the interval of a month. We found increased level of IFN gamma and normal concentrations of IL 10 in both of these terms.
[Interleukin 8 and interferon gamma in ocular toxoplasmosis].
Czepiel, Jacek; Biesiada, Grazyna; Sobczyk-Krupiarz, Iwona; Miklasszewska, Grazyna; Fedak, Danuta; Solnica, Bogdan; Mach, Tomasz; Garlicki, Aleksander
2011-01-01
Toxoplasmosis is one of the most common parasitic infections in the world, it is caused by Toxoplasma gondii. The infection is typically asymptomatic or the symptoms are very mild. Approximately 10% patients have limphadenopathy, involvement of the others organs, like eyes, nervous system, liver, heart, are observed more rarely. The aim of our study was to assess the level of selected cytokines in blood among patients with ocular toxoplasmosis. We have enrolled in the study 30 patients, 19-42 years old, treated for ocular toxoplasmosis, and 20 healthy volunteers, 20-48 years old, to the control group. Tests for blood morphology, C-reactive protein, the level of IL-8 and IFN-gamma were performed in all patients. The blood parameters in toxoplasmosis group were performed before antiparasitic treatment was given. The level of IFN-gamma in blood was lower among patients with ocular toxoplasmosis comparing with control group (1.52 vs. 4.18 pg/ml; p = 0.002). The level of IL-8 in blood was lower among patients with ocular toxoplasmosis comparing with control group (22.96 vs. 94.3 pg/ml; p = 0,007). There were no correlations between analyzed cytokines and blood morphology or CRP. The low level of IFN-gamma and IL-8 in blood is important factor leading to reactivation of the ocular toxoplasmosis.
Yoon, Wonsuck; Park, Yoo Chang; Kim, Jinseok; Chae, Yang Seok; Byeon, Jung Hye; Min, Sang-Hyun; Park, Sungha; Yoo, Young; Park, Yong Keun; Kim, Byeong Mo
2017-01-01
Salmonella have been experimentally used as anti-cancer agents, because they show selective growth in tumours. In this study, we genetically modified attenuated Salmonella typhimurium to express and secrete interferon-gamma (IFN-γ) as a tumouricidal agent to enhance the therapeutic efficacy of Salmonella. IFN-γ was fused to the N-terminal region (residues 1-160) of SipB (SipB160) for secretion from bacterial cells. Attenuated S. typhimurium expressing recombinant IFN-γ (S. typhimurium (IFN-γ)) invaded the melanoma cells and induced cytotoxicity. Subcutaneous administration of S. typhimurium (IFN-γ) also efficiently inhibited tumour growth and prolonged the survival of C57BL/6 mice bearing B16F10 melanoma compared with administration of phosphate-buffered saline (PBS), unmodified S. typhimurium or S. typhimurium expressing empty vector (S. typhimurium [Vec]) in a natural killer (NK) cell-dependent manner. Moreover, genetically modified Salmonella, including S. typhimurium (IFN-γ), showed little toxicity to normal tissues with no observable adverse effects. However, S. typhimurium (IFN-γ)-mediated tumour suppression was attributed to direct killing of tumour cells rather than to stable anti-tumour immunity. Collectively, these results suggest that tumour-targeted therapy using S. typhimurium (IFN-γ) has potential for melanoma treatment. Copyright © 2016 Elsevier Ltd. All rights reserved.
Designing of interferon-gamma inducing MHC class-II binders
2013-01-01
Background The generation of interferon-gamma (IFN-γ) by MHC class II activated CD4+ T helper cells play a substantial contribution in the control of infections such as caused by Mycobacterium tuberculosis. In the past, numerous methods have been developed for predicting MHC class II binders that can activate T-helper cells. Best of author’s knowledge, no method has been developed so far that can predict the type of cytokine will be secreted by these MHC Class II binders or T-helper epitopes. In this study, an attempt has been made to predict the IFN-γ inducing peptides. The main dataset used in this study contains 3705 IFN-γ inducing and 6728 non-IFN-γ inducing MHC class II binders. Another dataset called IFNgOnly contains 4483 IFN-γ inducing epitopes and 2160 epitopes that induce other cytokine except IFN-γ. In addition we have alternate dataset that contains IFN-γ inducing and equal number of random peptides. Results It was observed that the peptide length, positional conservation of residues and amino acid composition affects IFN-γ inducing capabilities of these peptides. We identified the motifs in IFN-γ inducing binders/peptides using MERCI software. Our analysis indicates that IFN-γ inducing and non-inducing peptides can be discriminated using above features. We developed models for predicting IFN-γ inducing peptides using various approaches like machine learning technique, motifs-based search, and hybrid approach. Our best model based on the hybrid approach achieved maximum prediction accuracy of 82.10% with MCC of 0.62 on main dataset. We also developed hybrid model on IFNgOnly dataset and achieved maximum accuracy of 81.39% with 0.57 MCC. Conclusion Based on this study, we have developed a webserver for predicting i) IFN-γ inducing peptides, ii) virtual screening of peptide libraries and iii) identification of IFN-γ inducing regions in antigen (http://crdd.osdd.net/raghava/ifnepitope/). Reviewers This article was reviewed by Prof Kurt
Bjerre, Anna; Brusletto, Berit; Høiby, Ernst Arne; Kierulf, Peter; Brandtzaeg, Petter
2004-02-01
To analyze plasma interferon-gamma and interleukin-10 concentrations in patients with systemic meningococcal disease and patients with severe Gram-positive septic shock caused by Streptococcus pneumoniae or Staphylococcus aureus. To study the in vitro cytokine (interferon-gamma and interleukin-10) responses in a whole blood model boosted with heat-killed Neisseria meningitidis, S. pneumoniae, and S. aureus before and after treatment with recombinant interleukin-10 or recombinant interferon-gamma. Experimental study. Laboratory. Plasma samples were collected from patients with systemic meningococcal disease (n = 66) and patients with severe Gram-positive septic shock caused by S. pneumoniae (n = 4) or S. aureus (n = 3). Whole blood was boosted with heat-killed N. meningitidis, S. pneumoniae, and S. aureus (1 x 106 colony forming units/mL), and plasmas were analyzed for interleukin-10 or interferon-gamma at 0, 5, 12, and 24 hrs. Furthermore, recombinant interleukin-10 or recombinant interferon-gamma was added before bacteria, and the effect on the secretion of interferon-gamma and interleukin-10, respectively, was analyzed after 24 hrs. The median concentration of interferon-gamma was 15 pg/mL and of interleukin-10 was 10,269 pg/mL in patients with meningococcal septic shock (n = 24) compared with median interferon-gamma concentration of 3400 pg/mL and interleukin-10 concentration of 465 pg/mL in patients with severe Gram-positive shock (p =.001). Increased interferon-gamma concentrations were associated with case fatality (p =.011). In a whole blood model we demonstrated that 1 x 106 colony forming units/mL of N. meningitidis induced more interleukin-10 but less interferon-gamma than S. pneumoniae. S. aureus induced minimal secretion of both cytokines. Recombinant interleukin-10 efficiently down-regulated the secretion of interferon-gamma, and vice versa, as shown in a whole blood model. We speculate whether high concentrations of interleukin-10 contribute to the
Qi, Guoyan; Liu, Peng; Gu, Shanshan; Yang, Hongxia; Dong, Huimin; Xue, Yinping
2018-04-01
Our study is aimed to explore the underlying genetic basis of myasthenia gravis. We collected a Chinese pedigree with myasthenia gravis, and whole-exome sequencing was performed on the two affected siblings and their parents. The candidate pathogenic gene was identified by bioinformatics filtering, which was further verified by Sanger sequencing. The homozygous mutation c.G40A (p.V14M) in interferon gamma receptor 1was identified. Moreover, the mutation was also detected in 3 cases of 44 sporadic myasthenia gravis patients. The p.V14M substitution in interferon gamma receptor 1 may affect the signal peptide function and the translocation on cell membrane, which could disrupt the binding of the ligand of interferon gamma and antibody production, contributing to myasthenia gravis susceptibility. We discovered that a rare variant c.G40A in interferon gamma receptor 1 potentially contributes to the myasthenia gravis pathogenesis. Further functional studies are needed to confirm the effect of the interferon gamma receptor 1 on the myasthenia gravis phenotype.
Woolard, Matthew D; Hensley, Lucinda L; Kawula, Thomas H; Frelinger, Jeffrey A
2008-06-01
Two key routes of Francisella tularensis infection are through the skin and airway. We wished to understand how the route of inoculation influenced the primary acute adaptive immune response. We show that an intranasal inoculation of the F. tularensis live vaccine strain (LVS) with a 1,000-fold-smaller dose than an intradermal dose results in similar growth kinetics and peak bacterial burdens. In spite of similar bacterial burdens, we demonstrate a difference in the quality, magnitude, and kinetics of the primary acute T-cell response depending on the route of inoculation. Further, we show that prostaglandin E(2) secretion in the lung is responsible for the difference in the gamma interferon (IFN-gamma) response. Intradermal inoculation led to a large number of IFN-gamma(+) T cells 7 days after infection in both the spleen and the lung. In contrast, intranasal inoculation induced a lower number of IFN-gamma(+) T cells in the spleen and lung but an increased number of Th17 cells in the lung. Intranasal infection also led to a significant increase of prostaglandin E(2) (PGE(2)) in the bronchoalveolar lavage fluid. Inhibition of PGE(2) production with indomethacin treatment resulted in increased numbers of IFN-gamma(+) T cells and decreased bacteremia in the lungs of intranasally inoculated mice. This research illuminates critical differences in acute adaptive immune responses between inhalational and dermal infection with F. tularensis LVS mediated by the innate immune system and PGE(2).
Hsieh, Ming Kun; Wu, Ching Ching; Lin, Tsang Long
2006-11-17
The purpose of the present study was to determine whether DNA vaccination by co-administration of DNA coding for chicken interferon-gamma (IFN-gamma) gene and DNA encoding for the VP243 gene of IBDV could enhance immune response and protection efficacy of chickens against challenge by IBDV. Plasmids carrying VP243 gene of IBDV strain variant E (VE) (P/VP243/E) and chicken IFN-gamma gene (P/cIFN-gamma) were constructed, respectively. One-day-old chickens were intramuscularly injected with P/VP243/E, or P/cIFN-gamma, or both once, twice, or three times into the thigh muscle of one leg or the thigh muscles of two separate legs at weekly intervals. Chickens were orally challenged with IBDV strain VE at 3 weeks of age and observed for 10 days. Chickens receiving two plasmids in the same site two times had significantly higher (P<0.05) bursal lesion scores and significantly lower (P<0.05) bursa weight/body weight ratios than those that only received P/VP243/E two or three times. Chickens inoculated with two plasmids separately in the thigh muscles of different legs or P/VP243/E two times had 33-50% protection and those receiving two plasmids in the same sites did not have any protection against IBD. The enzyme-linked immunosorbent assay (ELISA) and virus neutralization (VN) titers to IBDV of chickens in the groups with three doses of P/VP243/E were significantly higher (P<0.05) than those in groups receiving two doses of P/VP243/E or P/VP243/E and P/cIFN-gamma. Chickens protected by DNA vaccination did not have detectable IBDV antigen in the bursae as determined by immunofluorescent antibody assay (IFA). The results indicated that co-administration of plasmid encoding chicken IFN-gamma gene with plasmid encoding a large segment gene of the IBDV did not enhance immune response and protection against challenge by IBDV.
(PCG) Protein Crystal Growth Gamma-Interferon
NASA Technical Reports Server (NTRS)
1989-01-01
(PCG) Protein Crystal Growth Gamma-Interferon. Stimulates the body's immune system and is used clinically in the treatment of cancer. Potential as an anti-tumor agent against solid tumors as well as leukemia's and lymphomas. It has additional utility as an anti-ineffective agent, including antiviral, anti-bacterial, and anti-parasitic activities. Principal Investigator on STS-26 was Charles Bugg.
Tanabe, Y; Dan, K; Kuriya, S; Nomura, T
1989-10-01
The effects of recombinant human interferon (IFN) alpha-2b and gamma on the bone marrow megakaryocyte progenitors (CFU-Meg) were compared between eight patients in the chronic phase of Ph1-positive chronic myelocytic leukemia (CML) and five hematologically normal patients. CFU-Meg was assayed in plasma clot culture added with phytohemagglutinin-stimulated leukocyte-conditioned medium as a source of colony stimulating activity. The average count of CFU-Meg colonies formed from the bone marrow of CML patients was 5.5 times that of normal controls. Spontaneous CFU-Meg colonies were grown in seven of eight CML patients, but in none of five controls. Colony formation by CFU-Meg in CML as well as normal bone marrow was suppressed by the two preparations of IFN in a dose dependent fashion. Their suppressive influence on colonies from CFU-Meg was comparable between CML and normal bone marrow at lower concentrations, but was less marked for CML than normal bone marrow at higher concentrations. The formation of CFU-Meg colonies from CML bone marrow was more severely suppressed by IFN-gamma than IFN-alpha-2b. Depletion of either T lymphocytes or adherent cells from the CML bone marrow cells diminished the suppressive effects of IFN-gamma, but had no influence on the effects of IFN-alpha-2b.
Peng, X M; Lei, R X; Gu, L; Ma, H H; Xie, Q F; Gao, Z L
2007-10-01
The influence of human genetics on the natural history of hepatitis B virus (HBV) infection may be diminished in endemic areas because infection at a young age predisposes to chronic HBV infection. The present study aimed to address this issue through the determination of the influences of single nucleotide polymorphisms (SNPs) of myxovirus resistence-1 (MxA) -88 G/T and interferon (IFN)-gamma +874 A/T on the natural history of HBV infection in endemic regions. One hundred adult patients with self-limiting HBV infection (positive for both anti-HBs and anti-HBc) and 340 adult patients with persistent HBV infection were recruited from southern China, an endemic area with an HBsAg carrier rate of 17.8%. SNPs of MxA -88 G/T and interferon (IFN)-gamma +874 A/T were typed using a protocol based on competitively differentiated polymerase chain reaction. A highly significant difference in the distribution of MxA -88 G/T was observed between those with persistent and self-limiting HBV infections. The latter displayed a lower frequency of the GG genotype (41.0% vs. 52.9%, P = 0.036) and a higher frequency of the TT genotype (16.0% vs. 2.4%, P = 0.000), compared to patients with persistent infection. These differences were not gender- or age-specific. However, a significant distribution difference of IFN-gamma +874 A/T was not observed. Between two groups of patients, respectively, the distribution frequencies of the AA genotype (65.0% vs. 72.8%, P = 0.139) and the TT genotype (2.0% vs. 1.2%, P = 0.894) were found. These results suggest that MxA gene -88 G/T and IFN-gamma +874 A/T behave differently in endemic HBV infections. Further study is necessary to clarify the influences of human genetics on endemic HBV infections.
Interferon-gamma (INF-gamma) release test can detect cutaneous adverse effects to statins.
Goldberg, Ilan; Isman, Gila; Shirazi, Idit; Brenner, Sarah
2009-12-01
An increasing number of cutaneous adverse effects are being reported as use of statins becomes more widespread. A study was undertaken to establish the relationship between statin and a cutaneous reaction by the in vitro interferon-gamma (INF-gamma) release test. The lymphocytes of 20 patients with suspected drug-induced skin reaction were incubated with and without the drug. The level of INF-gamma from the supernatant was measured by enzyme-linked immunosorbent assay (ELISA), and the increase calculated. Response was positive in 27 (21.43%) of the 126 drugs. Statin was the only drug with a positive response in 80% of those cases. Nine of 20 patients (45.0%) had complete resolution after discontinuation of the drug; 6 (30.0%) who replaced one drug by another statin had partial or no resolution; and 5 (20.0%) had no resolution despite cessation of statins of all kinds. A positive INF-gamma release test was found in patients who developed skin reactions while taking statins; the test's reliability was strengthened by prompt improvement following elimination of the suspected drug in the majority of patients.
Silva, J S; Vespa, G N; Cardoso, M A; Aliberti, J C; Cunha, F Q
1995-01-01
Cell invasion by Trypanosoma cruzi and its intracellular replication are essential for continuation of the parasite life cycle and for production of Chagas' disease. T. cruzi is able to replicate in nucleated cells and can be killed by activated macrophages. Gamma interferon (IFN-gamma) is one of the major stimuli for the activation of macrophages and has been shown to be a key activation factor for the killing of intracellular parasites through a mechanism dependent upon nitric oxide (NO) biosynthesis. We show that although the addition of exogenous tumor necrosis factor alpha (TNF-alpha) does not potentiate the trypanocidal activity of IFN-gamma in vitro, treatment of resistant C57BI/6 mice with an anti-TNF-alpha monoclonal antibody increased parasitemia and mortality. In addition, the anti-TNF-alpha-treated animals had decreased NO production, both in vivo and in vitro, suggesting an important role for TNF-alpha in controlling infection. In order to better understand the role of TNF-alpha in the macrophage-mediating killing of parasites, cultures of T. cruzi-infected macrophages were treated with an anti-TNF-alpha monoclonal antibody. IFN-gamma-activated macrophages failed to kill intracellular parasites following treatment with 100 micrograms of anti-TNF-alpha. In these cultures, the number of parasites released at various time points after infection was significantly increased while NO production was significantly reduced. We conclude that IFN-gamma-activated macrophages produce TNF-alpha after infection by T. cruzi and suggest that this cytokine plays a role in amplifying NO production and parasite killing. PMID:7591147
Role of IL-10 -1082, IFN-gamma +874, and TNF-alpha -308 genes polymorphisms in suicidal behavior.
Omrani, Mir Davood; Bushehri, Behzad; Bagheri, Morteza; Salari-Lak, Shaker; Alipour, Azize; Anoshae, Mohamad-Reza; Massomi, Reza
2009-01-01
In this study, it was determined whether the IL-10 -1082, IFN-gamma +874, and TNF-alpha -308 polymorphisms were associated with suicidal behavior. One hundred forty five patients with suicidal behavior and 160 normal individuals were genotyped for IL-10 -1082, IFN-gamma +874, and TNF-alpha -308 polymorphisms using ASO-PCR method. TNF-alpha -308 G/G genotype has been increased in males with completed suicide behavior versus control group (p value = 0.017). IL-10 -1082 A/A genotype is higher in both male and female suicide completed groups (p value = 0.017). IFN-gamma (+874) A/A genotype was significantly higher in males with completed suicide behavior versus normal male control (p value = 0.027). It can be concluded that IL-10, IFN-gamma, and TNF-alpha polymorphisms may play a role in suicidal behavior.
Segura, S.; Gamazo, C.; Irache, J. M.; Espuelas, S.
2007-01-01
The aim of this study was to evaluate the activity of gamma interferon (IFN-γ) when it was either adsorbed onto or loaded into albumin nanoparticles. Brucella abortus-infected macrophages and infected BALB/c mice were selected as the models for testing of the therapeutic potentials of these cytokine delivery systems, in view of the well-established role of IFN-γ-activated macrophages for the control of Brucella sp. infections. Whereas the encapsulation of IFN-γ inside the matrix of nanoparticles completely abrogated its activity, adsorbed IFN-γ increased by 0.75 log unit the bactericidal effect induced by RAW macrophages activated with free IFN-γ, along with a higher level of production of nitric oxide. In infected BALB/c-mice, IFN-γ adsorbed onto nanoparticles was also more active than free cytokine in reducing the number of bacteria in the spleens, and the effect was mediated by an increased ratio of IFN-γ-secreting (Th1) to interleukin-4-secreting (Th2) cells. Overall, albumin nanoparticles would be suitable as carriers that target IFN-γ to macrophages and, thus, potentiate their therapeutic activity. PMID:17220401
Bausero, Maria A; Gastpar, Robert; Multhoff, Gabriele; Asea, Alexzander
2005-09-01
IFN-gamma exhibits differential effects depending on the target and can induce cellular activation and enhance survival or mediate cell death via activation of apoptotic pathways. In this study, we demonstrate an alternative mechanism by which IFN-gamma enhances tumor recognition, mediated by the active release of Hsp72. We demonstrate that stimulation of 4T1 breast adenocarcinoma cells and K562 erythroleukemic cells with IFN-gamma triggers the cellular stress response, which results in the enhanced expression of total Hsp72 expression without a significant increase in cell death. Intracellular expression of Hsp72 was abrogated in cells stably transfected with a mutant hsf-1 gene. IFN-gamma-induced Hsp72 expression correlated with enhanced surface expression and consequent release of Hsp72 into the culture medium. Pretreatment of tumors with compounds known to the block the classical protein transport pathway, including monensin, brefeldin A, tunicamycin, and thapsigargin, did not significantly block Hsp72 release. However, pretreatment with intracellular calcium chelator BAPTA-AM or disruption of lipid rafts using methyl beta-cyclodextrin completely abrogated IFN-gamma-induced Hsp72 release. Biochemical characterization revealed that Hsp72 is released within exosomes and has the ability to up-regulate CD83 expression and stimulate IL-12 release by naive dendritic cells. Pretreatment with neutralizing mAb or depletion of Hsp72 completely abrogated its chaperokine function. Taken together, these findings are indicative of an additional previously unknown mechanism by which IFN-gamma promotes tumor surveillance and furthers our understanding of the central role of extracellular Hsp72 as an endogenous adjuvant and danger signal.
Zhu, Hui; Wang, Wen-Xiu; Wang, Bao-Qin; Zhu, Xiao-Fu; Wu, Xu-Jin; Ma, Qing-Yi; Chen, De-Kun
2012-06-29
The giant panda (Ailuropoda melanoleuca) is an endangered species and indigenous to China. Interferon-gamma (IFN-γ) is the only member of type □ IFN and is vital for the regulation of host adapted immunity and inflammatory response. Little is known aboutthe FN-γ gene and its roles in giant panda.In this study, IFN-γ gene of Qinling giant panda was amplified from total blood RNA by RT-CPR, cloned, sequenced and analysed. The open reading frame (ORF) of Qinling giant panda IFN-γ encodes 152 amino acidsand is highly similar to Sichuan giant panda with an identity of 99.3% in cDNA sequence. The IFN-γ cDNA sequence was ligated to the pET32a vector and transformed into E. coli BL21 competent cells. Expression of recombinant IFN-γ protein of Qinling giant panda in E. coli was confirmed by SDS-PAGE and Western blot analysis. Biological activity assay indicated that the recombinant IFN-γ protein at the concentration of 4-10 µg/ml activated the giant panda peripheral blood lymphocytes,while at 12 µg/mlinhibited. the activation of the lymphocytes.These findings provide insights into the evolution of giant panda IFN-γ and information regarding amino acid residues essential for their biological activity.
The Role of the Interferon-Gamma-Jak/STAT Pathway in Rheumatoid Arthritis
2017-09-01
AWARD NUMBER: W81XWH-16-1-0537 TITLE: The Role of the Interferon-Gamma-Jak/STAT Pathway in Rheumatoid Arthritis PRINCIPAL INVESTIGATOR: Stanley...Sep 2016 - 31 Aug 2017 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER The Role of the Interferon-Gamma-Jak/STAT Pathway in Rheumatoid Arthritis 5b...subsets that likely counteracts IL-2 regulator activity and contribute to the pathogenesis of RA. 15. SUBJECT TERMS Rheumatoid arthritis ; Autoimmunity; T
[Peptide Ala-Glu-Asp-Gly and interferon gamma: their role in immune response during aging].
Lin'kova, N S; Kuznik, B I; Khavinson, V Kh
2012-01-01
The decrease of lymphocyte interferon gamma expression during aging is one of the main mechanisms leading to the immunodeficiency state in the elderly. Cell penetrating geroprotective peptide Ala-Glu-Asp-Gly has the capability to activate the proliferation of lymphocytes in thymus during its aging. The nucleotide sequence which is complementary contacted with peptide Ala-Glu-Asp-Gly was found in promoter region of interferon gamma gene. Thus, the immune protection of this peptide can be explained by its activation of the interferon gamma production in T-cells.
Ohyama, K; Kikuchi, H; Oda, Y; Moritake, K; Yamasaki, T
1993-06-01
We studied the effects of mouse IFN-gamma on the cytotoxic activity of murine activated macrophages (M phi) against mouse VM-Glioma cells (H-2b). Activated M phi were obtained from peritoneal exudate cells of mice from four strains, C57BL/6 (H-2b), C3H/He(H-2k), DBA/2 (H-2d), and BALB/c (H-2d), following intraperitoneal injection of (1) LPS 200 micrograms, (2) BCG 200 micrograms, (3) C. parvum 200 micrograms, or (4) MDP 350 micrograms 7 days prior to 20-hr 51Cr release-assay. Of the various combination of mouse strains and activating agents tested, that of activated M phi of the C3H/He mouse with induction by LPS had the most tumoricidal effect against the glioma cells, which was not MHC restricted. Although LPS-activated M phi underwent marked loss of cytotoxicity following initiation of in vitro culture, this 24 hr pretreatment with IFN-gamma inhibited this reduction in tumoricidal effects in a dose-dependent fashion. On the other hand, 24 hr pretreatment of target cells with IFN-gamma did not increase their susceptibility to lysis by activated M phi. These findings suggest that IFN-gamma augments the in vitro tumoricidal activation of M phi; This effect appears to be unrelated to any influence of IFN-gamma on target sensitivity to lysis by macrophages.
Yang, Y F; Tomura, M; Ono, S; Hamaoka, T; Fujiwara, H
2000-12-01
Two cytokines IL-4 and IL-12 are known to determine the balance between T(h)1 and T(h)2 development. In addition to IL-4 production of V(alpha)14(+) NKT cells, they have recently been demonstrated to have the capacity to stimulate IL-12 production by antigen-presenting cells (APC). This study demonstrates that IFN-gamma is absolutely required for the NKT cell-stimulated IL-12 production. Culture of B cell-depleted spleen cells from C57BL/6 mice with alpha-galactosylceramide (alpha-GalCer) capable of selectively stimulating V(alpha)14/J(alpha)281(+) NKT cells resulted in the production of IL-12 together with IL-4. Whereas IL-4 production occurred in culture of IFN-gamma(-/-) C57BL/6 splenocytes, the same culture failed to generate IL-12 production. While IL-12 production induced during culture of V(alpha)14(+) NKT cells and APC depended on the interaction between CD40 ligand on NKT cells and CD40 on APC, the expression levels of these key molecules were comparable in cells from wild-type and IFN-gamma(-/-) mice. Addition of rIFN-gamma to alpha-GalCer stimulated IFN-gamma(-/-) splenocyte culture, and administration of rIFN-gamma to alpha-GalCer-injected IFN-gamma(-/-) mice resulted in the restoration of IL-12 production in vitro and in vivo. These results illustrate a mandatory role for IFN-gamma in V(alpha)14(+) NKT cell-stimulated IL-12 production by APC.
Evaluation of Gamma Interferon and Antibody Tuberculosis Tests in Alpacas
Holder, Tom; Clifford, Derek; Dexter, Ian; Brewer, Jacky; Smith, Noel; Waring, Laura; Crawshaw, Tim; Gillgan, Steve; Lyashchenko, Konstantin; Lawrence, John; Clarke, John; de la Rua-Domenech, Ricardo; Vordermeier, Martin
2012-01-01
We describe the performance of cell-based and antibody blood tests for the antemortem diagnosis of tuberculosis (TB) in South American camelids (SAC). The sensitivity and specificity of the gamma interferon (IFN-γ) release assay, two lateral flow rapid antibody tests (Stat-Pak and Dual Path Platform [DPP]), and two enzyme-linked immunosorbent assay (ELISA)-based antibody tests (Idexx and Enferplex) were determined using diseased alpacas from Mycobacterium bovis culture-confirmed breakdown herds and TB-free alpacas from geographical areas with no history of bovine TB, respectively. Our results show that while the sensitivities of the IFN-γ and antibody tests were similar (range of 57.7% to 66.7%), the specificity of the IFN-γ test (89.1%) was lower than those of any of the antibody tests (range of 96.4% to 97.4%). This lower specificity of the IFN-γ test was at least in part due to undisclosed Mycobacterium microti infection in the TB-free cohort, which stimulates a positive purified protein derivative (PPD) response. The sensitivity of infection detection could be increased by combining two antibody tests, but even the use of all four antibody tests failed to detect all diseased alpacas. These antibody-negative alpacas were IFN-γ positive. We found that the maximum sensitivity could be achieved only by the combination of the IFN-γ test with two antibody tests in a “test package,” although this resulted in decreased specificity. The data from this evaluation of tests with defined sensitivity and specificity provide potential options for antemortem screening of SAC for TB in herd breakdown situations and could also find application in movement testing and tracing investigations. PMID:22914362
Evaluation of gamma interferon and antibody tuberculosis tests in alpacas.
Rhodes, Shelley; Holder, Tom; Clifford, Derek; Dexter, Ian; Brewer, Jacky; Smith, Noel; Waring, Laura; Crawshaw, Tim; Gillgan, Steve; Lyashchenko, Konstantin; Lawrence, John; Clarke, John; de la Rua-Domenech, Ricardo; Vordermeier, Martin
2012-10-01
We describe the performance of cell-based and antibody blood tests for the antemortem diagnosis of tuberculosis (TB) in South American camelids (SAC). The sensitivity and specificity of the gamma interferon (IFN-γ) release assay, two lateral flow rapid antibody tests (Stat-Pak and Dual Path Platform [DPP]), and two enzyme-linked immunosorbent assay (ELISA)-based antibody tests (Idexx and Enferplex) were determined using diseased alpacas from Mycobacterium bovis culture-confirmed breakdown herds and TB-free alpacas from geographical areas with no history of bovine TB, respectively. Our results show that while the sensitivities of the IFN-γ and antibody tests were similar (range of 57.7% to 66.7%), the specificity of the IFN-γ test (89.1%) was lower than those of any of the antibody tests (range of 96.4% to 97.4%). This lower specificity of the IFN-γ test was at least in part due to undisclosed Mycobacterium microti infection in the TB-free cohort, which stimulates a positive purified protein derivative (PPD) response. The sensitivity of infection detection could be increased by combining two antibody tests, but even the use of all four antibody tests failed to detect all diseased alpacas. These antibody-negative alpacas were IFN-γ positive. We found that the maximum sensitivity could be achieved only by the combination of the IFN-γ test with two antibody tests in a "test package," although this resulted in decreased specificity. The data from this evaluation of tests with defined sensitivity and specificity provide potential options for antemortem screening of SAC for TB in herd breakdown situations and could also find application in movement testing and tracing investigations.
Hunsicker, A; Kullich, W; Weissenhofer, W; Lorenz, D; Petermann, J; Rokos, H; Schwesinger, G
1997-05-01
To establish a standardised reproducible animal model of intraperitoneal sepsis, and to investigate early immunoserological responses to find a mediator-based system for evaluation and grading of diffuse peritonitis in patients Prospective experimental study 4 Teaching hospitals, Germany and Austria 42 LEW. 1W rats, 12 of which acted as controls Gram negative sepsis was induced by intraperitoneal injection of 6 ml of a mixture of Escherichia coli (K1:H+) 10(10) organisms/ml, autogenous haemoglobin 2.9 ml (haemoglobin concentration 3%), 0.9% sodium chloride 3 ml, and suspension 0.1 ml. Control rats were given physiological saline 6 ml alone. Concentrations of endotoxin, interferon gamma (IFN-gamma), and biopterin, and serum phospholipase A2 (PLA2) activity. There were significant differences between the septic and control rats in concentrations of endotoxin (EU/ml) (median (interquartile range) 21.85 (2.02-159.5) compared with 0, p < 0.0001; IFN-gamma (pg/ml) 1263.0 (271.0-7575.0) compared with 101.0 (89.0-141.0), p < 0.0001; biopterin (nmol/L) 111.0 (66.4-156.3) compared with 53.7 (38.3-67.6), p < 0.001; and PLA2 (U/L) 163.0 (125.8-209.0) compared with 112.5 (88.5-126.5) p < 0.01. Measurements of concentrations of endotoxin, IFN-gamma, pteridines, and PLA2 activity may well be adequate markers for early recognition of sepsis, and perhaps for grading it during the first 6 hours after induction. The allow a clear distinction to be made between septic and non-septic disorders in 87% of cases.
Interferon-gamma response to the treatment of active pulmonary and extra-pulmonary tuberculosis.
Liang, L; Shi, R; Liu, X; Yuan, X; Zheng, S; Zhang, G; Wang, W; Wang, J; England, K; Via, L E; Cai, Y; Goldfeder, L C; Dodd, L E; Barry, C E; Chen, R Y
2017-10-01
Interferon-gamma (IFN-γ) release assays (IGRAs) are used to diagnose tuberculosis (TB) but not to measure treatment response. To measure IFN-γ response to active anti-tuberculosis treatment. Patients from the Henan Provincial Chest Hospital, Henan, China, with TB symptoms and/or signs were enrolled into this prospective, observational cohort study and followed for 6 months of treatment, with blood and sputum samples collected at 0, 2, 4, 6, 8, 16 and 24 weeks. The QuantiFERON® TB-Gold assay was run on collected blood samples. Participants received a follow-up telephone call at 24 months to determine relapse status. Of the 152 TB patients enrolled, 135 were eligible for this analysis: 118 pulmonary (PTB) and 17 extra-pulmonary TB (EPTB) patients. IFN-γ levels declined significantly over time among all patients (P = 0.002), with this decline driven by PTB patients (P = 0.001), largely during the initial 8 weeks of treatment (P = 0.019). IFN-γ levels did not change among EPTB patients over time or against baseline culture or drug resistance status. After 6 months of effective anti-tuberculosis treatment, IFN-γ levels decreased significantly in PTB patients, largely over the initial 8 weeks of treatment. IFN-γ concentrations may offer some value for monitoring anti-tuberculosis treatment response among PTB patients.
NASA Technical Reports Server (NTRS)
Mazumder, B.; Fox, P. L.
1999-01-01
Ceruloplasmin (Cp) is an acute-phase protein with ferroxidase, amine oxidase, and pro- and antioxidant activities. The primary site of Cp synthesis in human adults is the liver, but it is also synthesized by cells of monocytic origin. We have shown that gamma interferon (IFN-gamma) induces the synthesis of Cp mRNA and protein in monocytic cells. We now report that the induced synthesis of Cp is terminated by a mechanism involving transcript-specific translational repression. Cp protein synthesis in U937 cells ceased after 16 h even in the presence of abundant Cp mRNA. RNA isolated from cells treated with IFN-gamma for 24 h exhibited a high in vitro translation rate, suggesting that the transcript was not defective. Ribosomal association of Cp mRNA was examined by sucrose centrifugation. When Cp synthesis was high, i.e., after 8 h of IFN-gamma treatment, Cp mRNA was primarily associated with polyribosomes. However, after 24 h, when Cp synthesis was low, Cp mRNA was primarily in the nonpolyribosomal fraction. Cytosolic extracts from cells treated with IFN-gamma for 24 h, but not for 8 h, contained a factor which blocked in vitro Cp translation. Inhibitor expression was cell type specific and present in extracts of human cells of myeloid origin, but not in several nonmyeloid cells. The inhibitory factor bound to the 3' untranslated region (3'-UTR) of Cp mRNA, as shown by restoration of in vitro translation by synthetic 3'-UTR added as a "decoy" and detection of a binding complex by RNA gel shift analysis. Deletion mapping of the Cp 3'-UTR indicated an internal 100-nucleotide region of the Cp 3'-UTR that was required for complex formation as well as for silencing of translation. Although transcript-specific translational control is common during development and differentiation and global translational control occurs during responses to cytokines and stress, to our knowledge, this is the first report of translational silencing of a specific transcript following cytokine
Protective Role of Gamma Interferon during the Recall Response to Influenza Virus
Bot, Adrian; Bot, Simona; Bona, Constantin A.
1998-01-01
During secondary immune responses to influenza virus, virus-specific T memory cells are a major source of gamma interferon (IFN-γ). We assessed the contribution of IFN-γ to heterologous protection against the A/WSN/33 (H1N1) virus of wild-type and IFN-γ−/− mice previously immunized with the A/HK/68 (H3N2) virus. The IFN-γ−/− mice displayed significantly reduced survival rates subsequent to a challenge with various doses of the A/WSN/33 virus. This was associated with an impaired ability of the IFN-γ−/− mice to completely clear the pulmonary virus by day 7 after the challenge, although significant reduction of the virus titers was noted. However, the IFN-γ−/− mice developed type A influenza virus cross-reactive cytotoxic T lymphocytes (CTLs) similar to the wild-type mice, as demonstrated by both cytotoxicity and a limiting-dilution assay for the estimation of CTL precursor frequency. The pulmonary recruitment of T cells in IFN-γ−/− mice was not dramatically affected, and the percentage of CD4+ and CD8+ T cells was similar to that of wild-type mice. The T cells from IFN-γ−/− mice did not display a significant switch toward a Th2 profile. Furthermore, the IFN-γ−/− mice retained the ability to mount significant titers of WSN and HK virus-specific hemagglutination-inhibiting antibodies. Together, these results are consistent with a protective role of IFN-γ during the heterologous response against influenza virus independently of the generation and local recruitment of cross-reactive CTLs. PMID:9658110
Interferon-Gamma Promotes UV-Induced Melanoma in Mice | Center for Cancer Research
Scientists have made an unanticipated discovery in mice that interferon-gamma, a type of protein primarily used by the immune system for intercellular communication, acts as a promoter for the deadly form of skin cancer known as melanoma. This finding resulted from a series of experiments designed to understand how solar ultraviolet (UV) radiation causes melanoma. This study suggests that interferon-gamma, which has been thought to contribute to an innate defense system against cancer, under some circumstances, may instead promote melanoma and incite the development of tumors.
Connor, Thomas J; Starr, Neasa; O'Sullivan, Joan B; Harkin, Andrew
2008-08-15
Inflammation-mediated dysregulation of the kynurenine pathway has been implicated as a contributor to a number of major brain disorders. Consequently, we examined the impact of a systemic inflammatory challenge on kynurenine pathway enzyme expression in rat brain. Indoleamine 2,3-dioxygenase (IDO) expression was induced in cortex and hippocampus following systemic lipopolysaccharide (LPS) administration. Whilst IDO expression was paralleled by increased circulating interferon (IFN)-gamma concentrations, IFN-gamma expression in the brain was only modestly altered following LPS administration. In contrast, induction of IDO was associated with increased central tumour necrosis factor (TNF)-alpha and interleukin (IL)-6 expression. Similarly, in cultured glial cells LPS-induced IDO expression was accompanied by increased TNF-alpha and IL-6 expression, whereas IFN-gamma was not detectable. These findings indicate that IFN-gamma is not required for LPS-induced IDO expression in brain. A robust increase in kynurenine-3-monooxygenase (KMO) expression was observed in rat brain 24h post LPS, without any change in kynurenine aminotransferase II (KAT II) expression. In addition, we report that constitutive expression of KAT II is approximately 8-fold higher than KMO in cortex and 20-fold higher in hippocampus. Similarly, in glial cells constitutive expression of KAT II was approximately 16-fold higher than KMO, and expression of KMO but not KAT II was induced by LPS. These data are the first to demonstrate that a systemic inflammatory challenge stimulates KMO expression in brain; a situation that is likely to favour kynurenine metabolism in a neurotoxic direction. However, our observation that expression of KAT II is much higher than KMO in rat brain is likely to counteract potential neurotoxicity that could arise from KMO induction following an acute inflammation.
Inter-operator variation in ELISPOT analysis of measles virus-specific IFN-gamma-secreting T cells.
Ryan, J E; Ovsyannikova, I G; Dhiman, N; Pinsky, N A; Vierkant, R A; Jacobson, R M; Poland, G A
2005-01-01
The ELISPOT assay is a highly sensitive technique used for the detection of individual cytokine releasing cells. We have developed an IFN-gamma ELISPOT assay utilizing unfractionated frozen peripheral blood mononuclear cells (PBMC) to quantify the frequency of measles virus (MV)-specific IFN-gamma-secreting T cells in 117 healthy children who had been previously immunized with two doses of the measles-mumps-rubella vaccine. We have also estimated the variability associated with the quantification of ELISPOT plates and compared the number of MV-specific IFN-gamma-secreting T cells for each subject as determined by two different operators of an ELISPOT reader. The median frequency of MV-specific IFN-gamma-producing memory T cells detected by this assay was 0.005 % and 0.01 % as determined by an in-house and commercial operator, respectively. Although we found a significant correlation (r = 0.83, p<0.0001) between the number of spots counted by the commercial and in-house operators of an ELISPOT reader, the median number of spots counted by the commercial operator was twice the number of spots counted by an in-house operator (p<0.001). This demonstrates the importance of using a common ELISPOT reader and operator, among other parameters, to quantify the number of spots when a large volume of plates are being scanned and analyzed.
So, H S; Jung, B H; Yeum, S S; Park, J S; Kim, M S; Lee, J H; Chung, S Y; Choi, S; Chae, H J; Kim, H R; Ko, C B; Chung, H T; Park, R
2000-11-01
Although it has been well known that the role of LPS on liver damage is mediated through TNF-alpha, the mechanism by which LPS modulates the cytotoxicity of IFN-gamma on hepatocytes has not yet been clearly demonstrated. Here, we demonstrate that IFN-gamma mediated apoptosis in murine embryonic hepatocyte BNL CL2 cells is potentiated by the addition of LPS (0.5 microg/ml). Consistently, LPS markedly increases the catalytic activity of caspase 3-like protease but not caspase 1-like protease in IFN-gamma treated cells. In addition, TNF-alpha alone does not affect cell viability but rather it potentiates the cytotoxic effect of IFN-gamma on BNL CL2 cells. However, the cell viability of IFN-gamma/LPS treated cells is affected by the addition of polymyxin B but not by TNF binding protein I (TNF-BPI). These data suggest that the lipid moiety of LPS may mediate direct cytotoxicity of BNL CL2 cells in a TNF-alpha independent manner.
NASA Astrophysics Data System (ADS)
Priwahyuningtyas, N. B.; Sinaga, B. Y. M.; Pandia, P.; Eyanoer, P. C.
2018-03-01
Tuberculosis is an infectious disease which caused by Mycobacterium tuberculosis (M. tuberculosis) that infected numerous organ especially the lung. A person’s immunity is very affecting for a person exposed to pulmonary tuberculosis. T-helper-1 cell (Th1) is very influential in the immune system especially in interfering intracellular bacterial infection. One of the cytokines known produced by Th1 cell is interferon gamma (IFN-γ) which is in eliminating M. tuberculosis. The study aims to identify the association between level of IFN-γ and AFB positivity in pulmonary tuberculosis patients in Medan. It is a case-control study. The subjects of the study were 60 new cases of pulmonary tuberculosis with AFB sputum smear- positive that never received ATT consisting 20 cases AFB (+1), 20 cases AFB (+2) and 20 cases AFB (+3).Samples were plasma collected from the venous blood of pulmonary tuberculosis patients. The plasma then underwent laboratory assay with ELISA techniques. Independent t-test was p<0.05 considered significant. Level of IFN-γ in TB AFB (+1) is higher than TB AFB (+2) and (+3), with thesignificant statistical result (p=0.001).
Ma, C G; Zhang, G X; Xiao, B G; Wang, Z Y; Link, J; Olsson, T; Link, H
1996-02-13
Oral and nasal administration of nicotinic acetylcholine receptor (AChR) to Lewis rats prior to myasthenogenic immunization with AChR and complete Freund's adjuvant (CFA) resulted in prevention or marked decrease of the severity of experimental autoimmune myasthenia gravis (EAMG) and suppression of AChR-specific B-cell responses and of AChR-reactive T-cell function. To examine the involvement of immunoregulatory cytokines and the underlying mechanisms involved in tolerance induction, in situ hybridization with radiolabeled cDNA oligonucleotide proves was adopted to enumerate mononuclear cells (MNC) expressing mRNA for the proinflammatory cytokine interferon-gamma (IFN-gamma), the B cell-stimulating interleukin-4 (IL-4), and the immunosuppressive transforming growth factor-beta (TGF-beta). Popliteal and inguinal lymph nodes from EAMG rats contained elevated numbers of AChR-reactive IFN-gamma, IL-4, and TGF-beta mRNA-expressing cells, compared to control rats receiving PBS orally or nasally and injected with CFA only. Oral and nasal tolerance was accompanied by decreased numbers of AChR-reactive IFN-gamma and IL-4 mRNA-expressing cells and strong up-regulation of TGF-beta mRNA-positive cells in lymphoid organs when compared to nontolerized EAMG control rats. The results suggest that IFN-gamma and IL-4 are central effector molecules in the development of EAMG and that TGF-beta plays an important role in tolerance induction to EAMG.
Razaghi, Ali; Owens, Leigh; Heimann, Kirsten
2016-12-20
Human interferon gamma is a cytokine belonging to a diverse group of interferons which have a crucial immunological function against mycobacteria and a wide variety of viral infections. To date, it has been approved for treatment of chronic granulomatous disease and malignant osteopetrosis, and its application as an immunotherapeutic agent against cancer is an increasing prospect. Recombinant human interferon gamma, as a lucrative biopharmaceutical, has been engineered in different expression systems including prokaryotic, protozoan, fungal (yeasts), plant, insect and mammalian cells. Human interferon gamma is commonly expressed in Escherichia coli, marketed as ACTIMMUNE ® , however, the resulting product of the prokaryotic expression system is unglycosylated with a short half-life in the bloodstream; the purification process is tedious and makes the product costlier. Other expression systems also did not show satisfactory results in terms of yields, the biological activity of the protein or economic viability. Thus, the review aims to synthesise available information from previous studies on the production of human interferon gamma and its glycosylation patterns in different expression systems, to provide direction to future research in this field. Copyright © 2016 Elsevier B.V. All rights reserved.
NASA Technical Reports Server (NTRS)
Degee, Antonie L. W.; Mansfield, John M.; Sonnenfeld, Gerald
1986-01-01
Earlier studies have demonstrated that mice resistant to Trypanosoma brucei rhodesiense (the B10.BR/SgSnJ strain) produces, upon infection by this parasite, two peaks of serum interferon (IFN), while the susceptible mice (C3HeB/FeJ) produces no IFN. In the present study, survival times were compared for B10.BR/SgSnJ, C3HeB/FeJ, and CBA/J (an intermediately resistant strain) mice that were injected, prior to infection with the parasite, with either of the following three preparations (1) IFN-gamma, (2) an antibody to IFN-gamma and (3) polyriboinosinic-polyribocytidylic acid (to induce IFN-alpha/beta). No effect on the survival times of mice by any of these preparations could be demonstrated, contrary to some previous reports.
Gharesi-Fard, Behrouz; Zolghadri, Jaleh; Kamali-Sarvestani, Eskandar
2008-03-01
Considering the deleterious role of T helper1 (Th1) cells in pregnancy outcome, a successful treatment for recurrent spontaneous abortion (RSA) should be able to make a significant shift away from Th1 responses. Although paternal leukocyte immunization has been used for treatment of RSA for years, because of methodological differences there is no consensus on the mechanism of action and effectiveness of this method. Twenty-five Iranian non-pregnant women with RSA and 16 non-pregnant control women with at least two successful pregnancies were included in this study. All cases were followed up after leukocyte therapy for pregnancy outcome. Mononuclear cells from women were co-cultured with the husband's mononuclear cells before and after immunotherapy. The levels of tumor necrosis factor-alpha (TNF-alpha) and interferon-gamma (IFN-gamma) were checked on culture supernatant by enzyme-linked immunosorbent assay method. The mean concentration of TNF-alpha was significantly higher in patients compared with that in normal controls (P=0.0001). After immunotherapy, the TNF-alpha level was only significantly decreased in women with successful outcome (P=0.0001). Immunotherapy also induced a significant reduction in the IFN-gamma level (P=0.009). The results of this investigation confirm the role of TNF-alpha in RSA and propose the assessment of TNF-alpha production as a valuable prognostic parameter for the prediction of abortion after leukocyte therapy.
NASA Astrophysics Data System (ADS)
Daulay, R. S.; Daulay, R. M.
2018-03-01
Cellular immunity was mediated the host immune response against Mycobacterium tuberculosis, in which cytokine and T-helper (Th) 1 cells play an important role. Interferon-gamma (IFN-γ) is a leading cytokine involved in the immune response of tuberculosis (TB).The primary function of IFN-γ is to activate macrophages in opposition Mycobacterium tuberculosis. Contrast from IFN-γ, interleukin-10 (IL-10) is considered inhibitory cytokine, important to an adequate balance between inflammatory responses. To analyze cytokine profile, particularly IFN-γ and IL-10 of the children with TB in Indonesia, a cross-sectional study was conducted at two general hospitals and seven primary health care located in Medan and Batubara, North Sumatera, Indonesia. Among 51 children with TB disease and 51 healthy children, found that IFN-γ and IL-10 levels were lower in TB patients compared to healthy children. Statistically significant decreased production of the IFN-γ levels (p=0.042) were found in TB patients 9.41 (1.10-28.06) pg/ml contrast to healthy children 6.30 (1.30-89.76) pg/ml. Homologue finding of the IL-10 levels were also found in TB patients 4.93 (0.22-48.01) pg/ml and 4.93 (0.07-81.60) pg/ml in healthy children, but not statistically significant (p=0.784). High levels of IL-10 were not proven to suppress the levels production of IFN-γ in TB patients.
Household food insecurity is associated with low interferon-gamma levels in pregnant Indian women.
Vaidya, A; Bhosale, R; Sambarey, P; Suryavanshi, N; Young, S; Mave, V; Kanade, S; Kulkarni, V; Deshpande, P; Balasubramanian, U; Elf, J; Gupte, N; Gupta, A; Mathad, J S
2017-07-01
Over 20% of tuberculosis (TB) cases during pregnancy occur in India. To determine the association between household food insecurity and interferon-gamma (IFN-γ) levels in pregnancy. Pregnant women in India were administered the Household Food Insecurity Access Scale (HFIAS) questionnaire and underwent an IFN-γ release assay. Logistic regression was used to identify factors associated with food insecurity. Of 538 women, 60 (11%) had household food insecurity, 47 (78%) of which were moderate or severe food insecure. After mitogen stimulation, moderate or severe food insecure women had a median IFN-γ concentration of 4.2 IU/ml (IQR 2.2-9.8) vs. 8.4 IU/ml (IQR 3.0-10) in women with no or mild food insecurity (P = 0.03). In multivariate analysis, higher IFN-γ concentrations were associated with human immunodeficiency virus infection (OR 1.3, 95%CI 0.51-2.1, P = 0.001), and inversely associated with moderate or severe food insecurity (OR -1.6, 95%CI -2.9 to -0.27, P = 0.02) and the number of adults in the household (OR -0.08, 95%CI -0.16 to -0.01, P = 0.03). There was no association between food insecurity and IFN-γ response to Mycobacterium tuberculosis antigen. Food insecurity in pregnancy is associated with low IFN-γ levels. There was no association between food insecurity and IFN-γ response to M. tuberculosis antigen, but our study was underpowered to detect this outcome.
T-Cell Mineralocorticoid Receptor Controls Blood Pressure by Regulating Interferon-Gamma.
Sun, Xue-Nan; Li, Chao; Liu, Yuan; Du, Lin-Juan; Zeng, Meng-Ru; Zheng, Xiao-Jun; Zhang, Wu-Chang; Liu, Yan; Zhu, Mingjiang; Kong, Deping; Zhou, Li; Lu, Limin; Shen, Zhu-Xia; Yi, Yi; Du, Lili; Qin, Mu; Liu, Xu; Hua, Zichun; Sun, Shuyang; Yin, Huiyong; Zhou, Bin; Yu, Ying; Zhang, Zhiyuan; Duan, Sheng-Zhong
2017-05-12
Hypertension remains to be a global public health burden and demands novel intervention strategies such as targeting T cells and T-cell-derived cytokines. Mineralocorticoid receptor (MR) antagonists have been clinically used to treat hypertension. However, the function of T-cell MR in blood pressure (BP) regulation has not been elucidated. We aim to determine the role of T-cell MR in BP regulation and to explore the mechanism. Using T-cell MR knockout mouse in combination with angiotensin II-induced hypertensive mouse model, we demonstrated that MR deficiency in T cells strikingly decreased both systolic and diastolic BP and attenuated renal and vascular damage. Flow cytometric analysis showed that T-cell MR knockout mitigated angiotensin II-induced accumulation of interferon-gamma (IFN-γ)-producing T cells, particularly CD8 + population, in both kidneys and aortas. Similarly, eplerenone attenuated angiotensin II-induced elevation of BP and accumulation of IFN-γ-producing T cells in wild-type mice. In cultured CD8 + T cells, T-cell MR knockout suppressed IFN-γ expression whereas T-cell MR overexpression and aldosterone both enhanced IFN-γ expression. At the molecular level, MR interacted with NFAT1 (nuclear factor of activated T-cells 1) and activator protein-1 in T cells. Finally, T-cell MR overexpressing mice manifested more elevated BP compared with control mice after angiotensin II infusion and such difference was abolished by IFN-γ-neutralizing antibodies. MR may interact with NFAT1 and activator protein-1 to control IFN-γ in T cells and to regulate target organ damage and ultimately BP. Targeting MR in T cells specifically may be an effective novel approach for hypertension treatment. © 2017 American Heart Association, Inc.
Tuo, Wenbin; Fetterer, Raymond; Jenkins, Mark; Dubey, J. P.
2005-01-01
Gamma interferon (IFN-γ) response is essential to the development of a host protective immunity in response to infections by intracellular parasites. Neosporosis, an infection caused by the intracellular protozoan parasite Neospora caninum, is fatal when there is a complete lack of IFN-γ in the infected host. However, the mechanism by which IFN-γ is elicited by the invading parasite is unclear. This study has identified a microbial protein in the N. caninum tachyzoite N. caninum cyclophilin (NcCyP) as a major component of the parasite responsible for the induction of IFN-γ production by bovine peripheral blood mononuclear cells (PBMC) and antigen-specific CD4+ T cells. NcCyP has high sequence homology (86%) with Toxoplasma gondii 18-kDa CyP with a calculated molecular mass of 19.4 kDa. NcCyP is a secretory protein with a predicted signal peptide of 17 amino acids. Abundant NcCyP was detected in whole-cell N. caninum tachyzoite lysate antigen (NcAg) and N. caninum tachyzoite culture supernatant. In N. caninum tachyzoite culture supernatant, three NcCyP bands of 19, 22, and 24 kDa were identified. NcAg stimulated high levels of IFN-γ production by PBMC and CD4+ T cells. The IFN-γ-inducing effect of NcAg was blocked by cyclosporine, a specific ligand for CyP, in a dose-dependent manner. Furthermore, cyclosporine abolished IFN-γ production by PBMC from naïve cows as well as PBMC and CD4+ T cells from infected/immunized cows. These results indicate that the N. caninum tachyzoite naturally produces a potent IFN-γ-inducing protein, NcCyP, which may be important for parasite survival as well as host protection. PMID:16041025
Agosti, J M; Coombs, R W; Collier, A C; Paradise, M A; Benedetti, J K; Jaffe, H S; Corey, L
1992-05-01
To determine safety and efficacy of tumor necrosis factor (TNF) and interferon-gamma (IFN gamma) in the treatment of patients with acquired immunodeficiency syndrome (AIDS)-related complex, a randomized, double-blind study was conducted. Twenty-five patients with AIDS-related complex and CD4 lymphocytes less than or equal to 500 x 10(6)/L attended an AIDS Clinical Trials Unit of a tertiary referral center. Patients were administered tumor necrosis factor (TNF) (10 micrograms/m2) or IFN gamma (10 micrograms/m2), or both intramuscularly three times weekly for 16 weeks. Side effects from all three preparations included fever, constitutional symptoms, and local reactions. No significant hematologic, hepatic, renal, or coagulation abnormalities were observed. CD4 lymphocyte counts, beta 2-microglobulin, p24 antigen levels, and anti-p24 antibody did not change significantly during therapy. Similarly, no significant change was noted in rates of HIV isolation from peripheral blood mononuclear cells or plasma. TNF and IFN gamma were tolerable after premedication with acetaminophen; however, no significant change in markers of human immunodeficiency virus infection was demonstrated. These cytokines alone do not appear to be of benefit, nor do they appear to hasten the progression of HIV infection.
Kim, S; Ponka, P
2000-03-03
Iron regulatory proteins (IRP-1 and IRP-2) control the synthesis of transferrin receptors (TfR) and ferritin by binding to iron-responsive elements, which are located in the 3'-untranslated region and the 5'-untranslated region of their respective mRNAs. Cellular iron levels affect binding of IRPs to iron-responsive elements and consequently expression of TfR and ferritin. Moreover, NO(*), a redox species of nitric oxide that interacts primarily with iron, can activate IRP-1 RNA binding activity resulting in an increase in TfR mRNA levels. Recently we found that treatment of RAW 264.7 cells (a murine macrophage cell line) with NO(+) (nitrosonium ion, which causes S-nitrosylation of thiol groups) resulted in a rapid decrease in RNA binding of IRP-2 followed by IRP-2 degradation, and these changes were associated with a decrease in TfR mRNA levels (Kim, S., and Ponka, P. (1999) J. Biol. Chem. 274, 33035-33042). In this study, we demonstrated that stimulation of RAW 264.7 cells with lipopolysaccharide (LPS) and interferon-gamma (IFN-gamma) increased IRP-1 binding activity, whereas RNA binding of IRP-2 decreased and was followed by a degradation of this protein. Moreover, the decrease of IRP-2 binding/protein levels was associated with a decrease in TfR mRNA levels in LPS/IFN-gamma-treated cells, and these changes were prevented by inhibitors of inducible nitric oxide synthase. Furthermore, LPS/IFN-gamma-stimulated RAW 264.7 cells showed increased rates of ferritin synthesis. These results suggest that NO(+)-mediated degradation of IRP-2 plays a major role in iron metabolism during inflammation.
Yuk, Seong-Su; Lee, Dong-Hun; Park, Jae-Keun; Tseren-Ochir, Erdene-Ochir; Kwon, Jung-Hoon; Noh, Jin-Yong; Lee, Joong-Bok; Park, Seung-Yong; Choi, In-Soo; Song, Chang-Seon
2016-04-27
Interferon gamma (IFN-γ), an immunoregulatory cytokine, is known to control many microbial infections. In a previous study, chicken interferon gamma (chIFN-γ) was found to be up-regulated following avian influenza virus (AIV) infection in specific pathogen-free chickens. We aimed to investigate whether the pre-immune state induced by chIFN-γ could generate an antiviral response against influenza virus. We generated a chIFN-γ-expressing plasmid and transfected it into chicken embryo fibroblasts (CEFs) and then infected the cells with human origin H1N1 or avian origin H9N2 influenza viruses. Viral titers of culture medium were evaluated in MDCK cell and the viral RNA and IFN-stimulated genes (ISGs) were then quantified by real-time reverse transcriptase polymerase. To further evaluate the role of the antiviral effect of chIFN-γ by using a backward approach, synthetic small interfering RNAs (siRNA) targeting chIFN-γ were used to suppress chIFN-γ. The chIFN-γ-stimulated CEFs inhibited the replication of viral RNA (vRNA) and showed a mild decrease in the infectious virus load released in the culture medium. Compared to the mock-transfected control, the messenger RNA (mRNA) levels of type I IFNs and IFN-stimulated genes were up-regulated in the cells expressing chIFN-γ. After treatment with the siRNA, we detected a higher expression of viral genes than that observed in the mock-transfected control. Our results suggest that apart from the important role played by chIFN-γ in the antiviral state generated against influenza virus infection, the pre-immune state induced by chIFN-γ can be helpful in mitigating the propagation of influenza virus.
Gri, Giorgia; Chiodoni, Claudia; Gallo, Elena; Stoppacciaro, Antonella; Liew, Foo Y; Colombo, Mario P
2002-08-01
IFN-gamma knockout mice (GKO) rejected C26 colon carcinoma cells transduced to secrete interleukin(IL)-12 but do not reject similarly transduced TSA mammary adenocarcinoma (C26/12 and TSA/12 cells, respectively). To determine whether such difference could be because of a different tumor response to IFN-gamma, we injected BALB/c mice with TSA, C26, and their IL-12-transduced counterparts rendered unresponsive to IFN-gamma by stable transduction of a dominant negative (DN), truncated IFN-gamma receptor alpha chain. TSA/DN and C26/DN showed the same in vivo growth kinetics as parental cells, whereas coexpression of IL-12 induced rejection independent of tumor-cell responsiveness to IFN-gamma. This suggests that the role of IFN-gamma is primarily in activating the host immune response, which appears to depend on the intrinsic immunogenicity of the target tumor. C26 and TSA share a common tumor-associated antigen, yet C26 cells are more immunogenic than TSA. C26/12 expressed 10-fold higher levels of class I MHC molecules and induced higher CTL activity compared with TSA/12 cells in GKO mice. Moreover, whereas in GKO mice the TSA/12 tumor was associated with a greater number of infiltrating T cells, only those infiltrating C26/12 tumor expressed the activation marker OX40. The search for cytokine(s) that might contribute in determining the different T-cell response to these IL-12-transduced tumors in GKO mice revealed a role of IL-15. In situ hybridization showed IL-15 expression in C26/12 but not in TSA/12 tumors. In addition, injection of GKO mice with soluble IL-15 receptor-alpha to block IL-15 expression prevented rejection of C26/12 cells. Together, the results suggest that in the absence of IFN-gamma, IL-12 can exert antitumor activity through alternative mechanisms, depending on the tumor cell type and the availability of cytokines that can replace IFN-gamma in sustaining T-cell functions.
CCR6 and NK1.1 distinguish between IL-17A and IFN-gamma-producing gammadelta effector T cells.
Haas, Jan D; González, Frano H Malinarich; Schmitz, Susanne; Chennupati, Vijaykumar; Föhse, Lisa; Kremmer, Elisabeth; Förster, Reinhold; Prinz, Immo
2009-12-01
Gammadelta T cells are a potent source of innate IL-17A and IFN-gamma, and they acquire the capacity to produce these cytokines within the thymus. However, the precise stages and required signals that guide this differentiation are unclear. Here we show that the CD24(low) CD44(high) effector gammadelta T cells of the adult thymus are segregated into two lineages by the mutually exclusive expression of CCR6 and NK1.1. Only CCR6+ gammadelta T cells produced IL-17A, while NK1.1+ gammadelta T cells were efficient producers of IFN-gamma but not of IL-17A. Their effector phenotype correlated with loss of CCR9 expression, particularly among the NK1.1+ gammadelta T cells. Accordingly, both gammadelta T-cell subsets were rare in gut-associated lymphoid tissues, but abundant in peripheral lymphoid tissues. There, they provided IL-17A and IFN-gamma in response to TCR-specific and TCR-independent stimuli. IL-12 and IL-18 induced IFN-gamma and IL-23 induced IL-17A production by NK1.1+ or CCR6+ gammadelta T cells, respectively. Importantly, we show that CCR6+ gammadelta T cells are more responsive to TCR stimulation than their NK1.1+ counterparts. In conclusion, our findings support the hypothesis that CCR6+ IL-17A-producing gammadelta T cells derive from less TCR-dependent selection events than IFN-gamma-producing NK1.1+ gammadelta T cells.
de Alencar, Bruna C G; Persechini, Pedro M; Haolla, Filipe A; de Oliveira, Gabriel; Silverio, Jaline C; Lannes-Vieira, Joseli; Machado, Alexandre V; Gazzinelli, Ricardo T; Bruna-Romero, Oscar; Rodrigues, Mauricio M
2009-10-01
A heterologous prime-boost strategy using plasmid DNA, followed by replication-defective recombinant adenovirus 5, is being proposed as a powerful way to elicit CD4(+) and CD8(+) T-cell-mediated protective immunity against intracellular pathogens. We confirmed this concept and furthered existing research by providing evidence that the heterologous prime-boost regimen using the gene encoding amastigote surface protein 2 elicited CD4(+) and CD8(+) T-cell-mediated protective immunity (reduction of acute parasitemia and prolonged survival) against experimental infection with Trypanosoma cruzi. Protective immunity correlated with the presence of in vivo antigen-specific cytotoxic activity prior to challenge. Based on this, our second goal was to determine the outcome of infection after heterologous prime-boost immunization of perforin-deficient mice. These mice were highly susceptible to infection. A detailed analysis of the cell-mediated immune responses in immunized perforin-deficient mice showed an impaired gamma interferon (IFN-gamma) secretion by immune spleen cells upon restimulation in vitro with soluble recombinant antigen. In spite of a normal numeric expansion, specific CD8(+) T cells presented several functional defects detected in vivo (cytotoxicity) and in vitro (simultaneous expression of CD107a/IFN-gamma or IFN-gamma/tumor necrosis factor alpha) paralleled by a decreased expression of CD44 and KLRG-1. Our final goal was to determine the importance of IFN-gamma in the presence of highly cytotoxic T cells. Vaccinated IFN-gamma-deficient mice developed highly cytotoxic cells but failed to develop any protective immunity. Our study thus demonstrated a role for perforin and IFN-gamma in a number of T-cell-mediated effector functions and in the antiparasitic immunity generated by a heterologous plasmid DNA prime-adenovirus boost vaccination strategy.
Kuo, Joseph; Warner, Thomas F; Schell, Ronald F
2017-03-01
The immune mechanisms responsible for development of Lyme arthritis are partially understood with interleukin-17 (IL-17) and gamma-interferon (IFN-γ) playing a generally accepted role. Elevated levels of IL-17 and/or IFN-γ have been reported in samples from human Lyme arthritis patients and experimental mice. In addition, IL-17 and IFN-γ have been implicated in the onset of arthritis in Borrelia-primed and -infected C57BL/6 mice. Recently, we showed that IL-17-deficient mice developed swelling and histopathological changes consistent with arthritis in the presence of high levels of IFN-γ. We hypothesized that neutralization of IFN-γ in IL-17-deficient mice would inhibit Borrelia-induced arthritis. Our results, however, showed that swelling of the hind paws and histopathological changes of arthritis did not differ between Borrelia-primed and -infected IL-17-deficient and wild-type mice with or without neutralization of IFN-γ. We also found higher levels of tumor necrosis factor alpha (TNF-α) and IL-6 in the popliteal lymph node cells of Borrelia-primed and -infected IL-17-deficient mice after neutralization of IFN-γ. These results suggest that multiple cytokines interact in the development of Borrelia-induced arthritis. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Inhibited interferon-gamma but normal interleukin-3 production from rats flown on the Space Shuttle
NASA Technical Reports Server (NTRS)
Gould, Cheryl L.; Lyte, Mark; Williams, Joann; Mandel, Adrian D.; Sonnenfeld, Gerald
1987-01-01
Rats were flown on Space Shuttle SL-3 for one week. When spleen cells were removed from these rats and challenged with concanavalin-A, interferon-gamma production was severely inhibited, while interleukin-3 production was unaffected compared to ground-based control rats. These data indicate that there is a defect in interferon-gamma production in rats that have been exposed to spaceflight. This defect could contribute to, and be one reason for, immunosuppression observed after spaceflight.
Keck, Nicolas; Boschiroli, Maria-Laura; Smyej, Florence; Vogler, Valérie; Moyen, Jean-Louis; Desvaux, Stéphanie
2018-01-01
In the French Camargue region, where bovine tuberculosis had been enzootic for several years in bullfighting cattle herds, the gamma-interferon (IFN) assay was used since 2003 in parallel with the intradermal test in order to increase overall disease detection sensitivity in infected herds. This study presents the results of a field-evaluation of the assay during a 10-year period (2004-2014) of disease control and surveillance program and explores the particular pattern of IFN assay results in bullfight herds in comparison to cattle from other regions of France. The low sensitivity [59.2% (50.6; 67.3)] of IFN assay using the tuberculin stimulation could be related to the poor gamma-IFN production from bullfight cattle blood cells which is significantly lower than in animals of conventional breeds. The characteristics of the assay were progressively adapted to the epidemiological situation and the desired strategic applications. Data analysis with a receiver operating characteristic curve based on a simple S/P value algorithm allowed for the determination of a new cutoff adapted for a global screening, giving a high specificity of 99.9% results and a high accuracy of the assay. Having regularly risen to above 5% since 2005, with a peak around 10% in 2010, the annual incidence dropped to under 1% in 2014. The positive predictive value relative to the bacteriological confirmation evolved during the years, from 33% in 2009 to 12% during the last screening period, a normal trend in a context of decreasing prevalence. The estimated rate of false-positive reactions during screening campaigns was 0.67%, confirming the high specificity of the test, measured in bTB negative herds, in this epidemiological context. The proportion of false-positive reactions decreased with the age and was higher in males than in females. Although these results indicate that the IFN assay is accurate in the field, it also emphasizes great differences between interferon quantities produced by
La Flamme, Anne Camille; Patton, Elisabeth A.; Pearce, Edward J.
2001-01-01
In the absence of interleukin-4 (IL-4), infection with Schistosoma mansoni leads to a severe fatal disease rather than the chronic survivable condition that occurs in wild-type (WT) mice. Because the sustained production of NO most closely correlates to weight loss and fatality in infected IL-4−/− mice and because gamma interferon (IFN-γ) is an important inducer of inducible NO synthase, infected IL-4−/− mice were treated with anti-IFN-γ antibodies to determine the role of IFN-γ during schistosomiasis in WT and IL-4−/− animals. When IFN-γ was neutralized, Th2 responses were enhanced and NO production was reduced in both WT and IL-4−/− mice. The decreased NO production correlated with a rescue of proliferation in splenocytes from infected IL-4−/− mice. Furthermore, the neutralization of IFN-γ in vivo improved the gross appearance of the liver and led to a reduction in granuloma size in infected IL-4−/− but not WT mice. However, the neutralization of IFN-γ in vivo did not affect the development of severe disease in infected IL-4−/− mice. These results suggest that while the increased production of IFN-γ does lead to some of the pathology observed in infected IL-4−/− mice, it is not ultimately responsible for cachexia and death. PMID:11705919
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kim, Hun Sik; Kim, Sunshin; Lee, Myung-Shik
2005-10-28
Although X-linked inhibitor of apoptosis protein (XIAP) is an important intracellular suppressor of apoptosis in a variety of cell types, its role in cytokine-induced pancreatic {beta}-cell apoptosis remains unclear. Here, we found that: (i) XIAP level was inversely correlated with tumor necrosis factor (TNF)-{alpha}-induced apoptosis in MIN6N8 insulinoma cells; (ii) adenoviral XIAP overexpression abrogated the TNF-{alpha}-induced apoptosis through inhibition of caspase activity; (iii) downregulation of XIAP by antisense oligonucleotide or Smac peptide sensitized MIN6N8 cells to TNF-{alpha}-induced apoptosis; (iv) XIAP expression was induced by TNF-{alpha} through a nuclear factor-{kappa}B (NF-{kappa}B)-dependent pathway, and interferon (IFN)-{gamma} prevented such an induction in amore » manner independent of NF-{kappa}B, which presents a potential mechanism underlying cytotoxic IFN-{gamma}/TNF-{alpha} synergism. Taken together, our results suggest that XIAP is an important modulator of TNF-{alpha}-induced apoptosis of MIN6N8 cells, and XIAP regulation in pancreatic {beta}-cells might play an important role in pancreatic {beta}-cell apoptosis and in the pathogenesis of type 1 diabetes.« less
Hattori, Kayoko; Nishikawa, Makiya; Watcharanurak, Kanitta; Ikoma, Akihiko; Kabashima, Kenji; Toyota, Hiroyasu; Takahashi, Yuki; Takahashi, Rei; Watanabe, Yoshihiko; Takakura, Yoshinobu
2010-03-01
The short in vivo half-life of IFN-gamma can prevent the cytokine from inducing immunological changes that are favorable for the treatment of Th2-dominant diseases, such as atopic dermatitis. To examine whether a sustained supply of IFN-gamma is effective in regulating the balance of Th lymphocyte subpopulations, plasmid vector encoding mouse IFN-gamma, pCpG-Mugamma, or pCMV-Mugamma was injected into the tail vein of NC/Nga mice, a model for human atopic dermatitis. A single hydrodynamic injection of a CpG motif reduced pCpG-Mugamma at a dose of 0.14 microg/mouse resulted in a sustained concentration of IFN-gamma in the serum, and the concentration was maintained at >300 pg/ml over 80 d. The pCpG-Mugamma-mediated IFN-gamma gene transfer was associated with an increase in the serum concentration of IL-12, reduced production of IgE, and inhibition of mRNA expression of IL-4, -5, -10, -13, and -17 and thymus and activation-regulated chemokine in the spleen. These immunological changes were not clearly observed in mice receiving two injections of 20 microg pCMV-Mugamma, a CpG-replete plasmid DNA, because of the transient nature of the expression from the vector. The mice receiving pCpG-Mugamma showed a significant reduction in the severity of skin lesions and in the intensity of their scratching behavior. Furthermore, high transepidermal water loss, epidermal thickening, and infiltration of lymphocytes and eosinophils, all of which were obvious in the untreated mice, were significantly inhibited. These results indicate that an extraordinary sustained IFN-gamma expression induces favorable immunological changes, leading to a Th1-dominant state in the atopic dermatitis model.
Gamma Interferon-Induced Guanylate Binding Protein 1 Is a Novel Actin Cytoskeleton Remodeling Factor
Ostler, Nicole; Britzen-Laurent, Nathalie; Liebl, Andrea; Naschberger, Elisabeth; Lochnit, Günter; Ostler, Markus; Forster, Florian; Kunzelmann, Peter; Ince, Semra; Supper, Verena; Praefcke, Gerrit J. K.; Schubert, Dirk W.; Stockinger, Hannes; Herrmann, Christian
2014-01-01
Gamma interferon (IFN-γ) regulates immune defenses against viruses, intracellular pathogens, and tumors by modulating cell proliferation, migration, invasion, and vesicle trafficking processes. The large GTPase guanylate binding protein 1 (GBP-1) is among the cellular proteins that is the most abundantly induced by IFN-γ and mediates its cell biologic effects. As yet, the molecular mechanisms of action of GBP-1 remain unknown. Applying an interaction proteomics approach, we identified actin as a strong and specific binding partner of GBP-1. Furthermore, GBP-1 colocalized with actin at the subcellular level and was both necessary and sufficient for the extensive remodeling of the fibrous actin structure observed in IFN-γ-exposed cells. These effects were dependent on the oligomerization and the GTPase activity of GBP-1. Purified GBP-1 and actin bound to each other, and this interaction was sufficient to impair the formation of actin filaments in vitro, as demonstrated by atomic force microscopy, dynamic light scattering, and fluorescence-monitored polymerization. Cosedimentation and band shift analyses demonstrated that GBP-1 binds robustly to globular actin and slightly to filamentous actin. This indicated that GBP-1 may induce actin remodeling via globular actin sequestering and/or filament capping. These results establish GBP-1 as a novel member within the family of actin-remodeling proteins specifically mediating IFN-γ-dependent defense strategies. PMID:24190970
Ostler, Nicole; Britzen-Laurent, Nathalie; Liebl, Andrea; Naschberger, Elisabeth; Lochnit, Günter; Ostler, Markus; Forster, Florian; Kunzelmann, Peter; Ince, Semra; Supper, Verena; Praefcke, Gerrit J K; Schubert, Dirk W; Stockinger, Hannes; Herrmann, Christian; Stürzl, Michael
2014-01-01
Gamma interferon (IFN-γ) regulates immune defenses against viruses, intracellular pathogens, and tumors by modulating cell proliferation, migration, invasion, and vesicle trafficking processes. The large GTPase guanylate binding protein 1 (GBP-1) is among the cellular proteins that is the most abundantly induced by IFN-γ and mediates its cell biologic effects. As yet, the molecular mechanisms of action of GBP-1 remain unknown. Applying an interaction proteomics approach, we identified actin as a strong and specific binding partner of GBP-1. Furthermore, GBP-1 colocalized with actin at the subcellular level and was both necessary and sufficient for the extensive remodeling of the fibrous actin structure observed in IFN-γ-exposed cells. These effects were dependent on the oligomerization and the GTPase activity of GBP-1. Purified GBP-1 and actin bound to each other, and this interaction was sufficient to impair the formation of actin filaments in vitro, as demonstrated by atomic force microscopy, dynamic light scattering, and fluorescence-monitored polymerization. Cosedimentation and band shift analyses demonstrated that GBP-1 binds robustly to globular actin and slightly to filamentous actin. This indicated that GBP-1 may induce actin remodeling via globular actin sequestering and/or filament capping. These results establish GBP-1 as a novel member within the family of actin-remodeling proteins specifically mediating IFN-γ-dependent defense strategies.
D'Ombrain, Marthe C; Voss, Till S; Maier, Alexander G; Pearce, J Andrew; Hansen, Diana S; Cowman, Alan F; Schofield, Louis
2007-08-16
Plasmodium falciparum erythrocyte membrane protein-1 (PfEMP-1) is a variable antigen expressed by P. falciparum, the malarial parasite. PfEMP-1, present on the surface of infected host erythrocytes, mediates erythrocyte binding to vascular endothelium, enabling the parasite to avoid splenic clearance. In addition, PfEMP-1 is proposed to regulate host immune responses via interactions with the CD36 receptor on antigen-presenting cells. We investigated the immunoregulatory function of PfEMP-1 by comparing host cell responses to erythrocytes infected with either wild-type parasites or transgenic parasites lacking PfEMP-1. We showed that PfEMP-1 suppresses the production of the cytokine interferon-gamma by human peripheral blood mononuclear cells early after exposure to P. falciparum. Suppression of this rapid proinflammatory response was CD36 independent and specific to interferon-gamma production by gammadelta-T, NK, and alphabeta-T cells. These data demonstrate a parasite strategy for downregulating the proinflammatory interferon-gamma response and further establish transgenic parasites lacking PfEMP-1 as powerful tools for elucidating PfEMP-1 functions.
Bernitz, Netanya; Clarke, Charlene; Roos, Eduard O; Goosen, Wynand J; Cooper, David; van Helden, Paul D; Parsons, Sven D C; Miller, Michele A
2018-02-01
African buffaloes (Syncerus caffer) are wildlife maintenance hosts of Mycobacterium bovis, the cause of bovine tuberculosis. Consequently, M. bovis infected buffaloes pose a transmission risk for cattle and other wildlife species. Previously, a modification to the Qiagen QuantiFERON ® -TB Gold (QFT) system, using QFT tubes and an in-house bovine interferon-gamma (IFN-γ) ELISA, was evaluated for the detection of M. bovis infection in buffaloes. Subsequently, Qiagen has developed a commercially available cattletype ® IFN-gamma ELISA for the detection of antigen-specific IFN-γ release in ruminants. The aim of this study was to investigate the use of QFT tubes and the cattletype ® IFN-gamma ELISA, in a cattletype IFN-γ release assay (IGRA), to detect M. bovis infection in African buffaloes. The test agreements between the cattletype IGRA, single comparative intradermal skin test (SCITT) and Bovigam ® 1G IGRA in two M. bovis-exposed buffalo populations (n = 134 and n = 92) were calculated and κ coefficients ranged from 0.65 (95% CI 0.48-0.82) to 0.86 (95% CI 0.72-0.99). Increasing the QFT incubation time in one M. bovis-exposed buffalo cohort (n = 92), from 20 to 40 h, had no effect on the cattletype IGRA test results. Inter-assay and intra-assay reproducibility determination for the cattletype IGRA produced coefficient of variations (CV) <9.1% and <1.7%, respectively. A total of 21/21 known M. bovis-unexposed buffaloes tested negative in the cattletype IGRA. Moreover, the cattletype IGRA test result values were significantly greater for 13 M. bovis culture-positive buffaloes compared with 14 M. bovis-exposed culture-negative (P < .01) and 21 M. bovis-unexposed (P < .001) buffaloes, respectively. These findings suggest that the combination of QFT tubes and the cattletype ® IFN-gamma ELISA is a promising new diagnostic assay for the detection of M. bovis infection in African buffaloes. However, further research is needed to evaluate the
Dunn, John R; Kaneene, John B; Grooms, Daniel L; Bolin, Steven R; Bolin, Carole A; Bruning-Fann, Colleen S
2005-02-01
To determine whether cattle testing positive for Mycobacterium avium subsp paratuberculosis as determined by microbial culture of feces or antibody ELISA were more likely to have false-positive responses on the caudal fold tuberculin (CFT) test or interferon-gamma (IFN-gamma) assay for Mycobacterium bovis than cattle testing negative for M paratuberculosis. 1043 cattle from 10 herds in Michigan. Feces and blood samples for plasma were collected from cattle > or =24 months old on the day the CFT test was read. Fecal samples were submitted for microbial culture for M paratuberculosis. Plasma samples were tested for antibody against M paratuberculosis, and IFN-gamma after stimulation with purified protein derivative tuberculin from M bovis or M avium. Of 1043 cattle, 180 (17.3%) had positive CFT test results (suspects) and 8 (0.8%) had positive IFN-gamma assay results after stimulation with purified protein derivative tuberculin from M bovis. Forty-five (4.3%) and 115 (11.0%) cattle tested positive for M paratuberculosis as determined by microbial culture of feces and antibody ELISA, respectively. Cattle with positive responses for M paratuberculosis appeared to have an increased likelihood of false-positive results on the CFT test, although this association was not significant. No significant association was detected among cattle testing positive for M paratuberculosis as determined by microbial culture of feces and antibody ELISA and positive CFT test and IFN-gamma assay results for M bovis.
Jans, Jop; Unger, Wendy W J; Vissers, Marloes; Ahout, Inge M L; Schreurs, Inge; Wickenhagen, Arthur; de Groot, Ronald; de Jonge, Marien I; Ferwerda, Gerben
2018-04-01
Interferon gamma (IFN-γ) plays an important role in the antiviral immune response during respiratory syncytial virus (RSV) infections. Monocytes and T cells are recruited to the site of RSV infection, but it is unclear whether cell-cell interactions between monocytes and T cells regulate IFN-γ production. In this study, micro-array data identified the upregulation of sialic acid-binding immunoglobulin-type lectin 1 (Siglec-1) in human RSV-infected infants. In vitro, RSV increased expression of Siglec-1 on healthy newborn and adult monocytes. RSV-induced Siglec-1 on monocytes inhibited IFN-γ production by adult CD4 + T cells. In contrast, IFN-γ production by RSV in newborns was not affected by Siglec-1. The ligand for Siglec-1, CD43, is highly expressed on adult CD4 + T cells compared to newborns. Our data show that Siglec-1 reduces IFN-γ release by adult T cells possibly by binding to the highly expressed CD43. The Siglec-1-dependent inhibition of IFN-γ in adults and the low expression of CD43 on newborn T cells provides a better understanding of the immune response against RSV in early life and adulthood. © 2017 The Authors. European Journal of Immunology published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Day, Yuan-Ji; Huang, Liping; Ye, Hong; Li, Li; Linden, Joel; Okusa, Mark D
2006-03-01
A(2A) adenosine receptor (A(2A)R)-expressing bone marrow (BM)-derived cells contribute to the renal protective effect of A(2A) agonists in renal ischemia-reperfusion injury (IRI). We performed IRI in mice lacking T and B cells to determine whether A(2A)R expressed in CD4+ cells mediate protection from IRI. Rag-1 knockout (KO) mice were protected in comparison to wild-type (WT) mice when subjected to IRI. ATL146e, a selective A(2A) agonist, did not confer additional protection. IFN-gamma is an important early signal in IRI and is thought to contribute to reperfusion injury. Because IFN-gamma is produced by kidney cells and T cells we performed IRI in BM chimeras in which the BM of WT mice was reconstituted with BM from IFN-gamma KO mice (IFN-gamma KO-->WT chimera). We observed marked reduction in IRI in comparison to WT-->WT chimeras providing additional indirect support for the role of T cells. To confirm the role of CD4+ A(2A)R in mediating protection from IRI, Rag-1 KO mice were subjected to ischemia-reperfusion. The protection observed in Rag-1 KO mice was reversed in Rag-1 KO mice that were adoptively transferred WT CD4+ cells (WT CD4+-->Rag-1 KO) or A(2A) KO CD4+ cells (A(2A) KO CD4+-->Rag-1 KO). ATL146e reduced injury in WT CD4+-->Rag-1 KO mice but not in A(2A) KO CD4+-->Rag-1 KO mice. Rag-1 KO mice reconstituted with CD4+ cells derived from IFN-gamma KO mice (IFN-gamma CD4+-->Rag-1 KO) were protected from IRI; ATL146e conferred no additional protection. These studies demonstrate that CD4+ IFN-gamma contributes to IRI and that A(2A) agonists mediate protection from IRI through action on CD4+ cells.
Gamma Interferon Release Assays for Detection of Mycobacterium tuberculosis Infection
Denkinger, Claudia M.; Kik, Sandra V.; Rangaka, Molebogeng X.; Zwerling, Alice; Oxlade, Olivia; Metcalfe, John Z.; Cattamanchi, Adithya; Dowdy, David W.; Dheda, Keertan; Banaei, Niaz
2014-01-01
SUMMARY Identification and treatment of latent tuberculosis infection (LTBI) can substantially reduce the risk of developing active disease. However, there is no diagnostic gold standard for LTBI. Two tests are available for identification of LTBI: the tuberculin skin test (TST) and the gamma interferon (IFN-γ) release assay (IGRA). Evidence suggests that both TST and IGRA are acceptable but imperfect tests. They represent indirect markers of Mycobacterium tuberculosis exposure and indicate a cellular immune response to M. tuberculosis. Neither test can accurately differentiate between LTBI and active TB, distinguish reactivation from reinfection, or resolve the various stages within the spectrum of M. tuberculosis infection. Both TST and IGRA have reduced sensitivity in immunocompromised patients and have low predictive value for progression to active TB. To maximize the positive predictive value of existing tests, LTBI screening should be reserved for those who are at sufficiently high risk of progressing to disease. Such high-risk individuals may be identifiable by using multivariable risk prediction models that incorporate test results with risk factors and using serial testing to resolve underlying phenotypes. In the longer term, basic research is necessary to identify highly predictive biomarkers. PMID:24396134
Byleveld, P M; Pang, G T; Clancy, R L; Roberts, D C
1999-02-01
Ingestion of fish oil can suppress the inflammatory response to injury and may impair host resistance to infection. To investigate the effect of a diet containing fish oil on immunity to viral infection, 148 BALB/c mice were fed diets containing 3 g/100 g of sunflower oil with either 17 g/100 g of fish oil or beef tallow for 14 d before intranasal challenge with live influenza virus. At d 1 and d 5 after infection, the mice fed fish oil had higher lung viral load and lower body weight (P < 0.05). In addition to the greater viral load and weight loss at d 5 after infection, the fish oil group consumed less food (P < 0.05) while the beef tallow group was clearing the virus, had regained their preinfection weights and was returning to their preinfection food consumption. The fish oil group had impaired production of lung interferon-gamma (IFN-gamma), serum immunoglobulin (Ig) G and lung IgA-specific antibodies (all P < 0. 05) although lung IFN-alpha/beta and the relative proportions of bronchial lymph node CD4+ and CD8+ T lymphocytes did not differ between groups after infection. The present study demonstrates a delay in virus clearance in mice fed fish oil associated with reduced IFN-gamma and antibody production and a greater weight loss and suppression of appetite following influenza virus infection. However, differences observed during the course of infection did not affect the ultimate outcome as both groups cleared the virus and returned to preinfection food consumption and body weight by d 7.
Interferon effects on protozoan infections
NASA Technical Reports Server (NTRS)
Sonnenfeld, G.; Wirth, J.; Kierszenbaum, F.; Degee, A. L. W.; Mansfield, J. M.
1985-01-01
The effects of interferon (IFN) on mice infected with two different parasitic protozoans, Trypanosoma cruzi and Trypanosoma brucei rhodesiense, are investigated experimentally. The preparation of the cell cultures, IFN and assays, antibody, and the experimental procedures are described. It is observed that in cells treated with IFN-gamma there is an increased association of T. cruzi with murine macrophages and an increase in the killing of T. cruzi by IFN-gamma-treated murine macrophages. For spleen cells infected with T.b. rhodesiense in vitro, it is detected that live trypanosomes cannot induce IFN in cells from normal mice, but can in cells from immunized mice; and that trypanosome-lysates induce IFN in vitro in cells from normal mice. The data suggest that there is a two-step mechanism for mice against T. cruzi and T.b. rhodesiense.
Interferon-gamma enhances radiation-induced cell death via downregulation of Chk1
Kim, Kwang Seok; Choi, Kyu Jin; Bae, Sangwoo
2012-01-01
Interferon-gamma (IFNγ) is a cytokine with roles in immune responses as well as in tumor control. Interferon is often used in cancer treatment together with other therapies. Here we report a novel approach to enhancement of cancer cell killing by combined treatment of IFNγ with ionizing radiation. We found that IFNγ treatment alone in HeLa cells induced phosphorylation of Chk1 in a time- and dose-dependent manner, and resulted in cell arrest. Moreover IFNγ treatment was correlated with attenuation of Chk1 as the treatment shortened protein half-life of Chk1. As Chk1 is an essential cell cycle regulator for viability after DNA damage, attenuation of Chk1 by IFNγ pre-treatment in HeLa cells resulted in increased cell death following ionizing radiation about 2-folds than ionizing radiation treatment alone whereas IFNγ treatment alone had little effect on cell death. X-linked inhibitor of apoptosis-associated factor 1 (XAF1), an IFN-induced gene, seems to partly regulate IFNγ-induced Chk1 destabilization and radiation sensitivity because transient depletion of XAF1 by siRNA prevented IFNγ-induced Chk1 attenuation and partly protected cells from IFNγ-enhanced radiation cell killing. Therefore the results provide a novel rationale to combine IFNγ pretreatment and DNA-damaging anti-cancer drugs such as ionizing radiation to enhance cancer cell killing. PMID:22825336
Schwaab, T; Heaney, J A; Schned, A R; Harris, R D; Cole, B F; Noelle, R J; Phillips, D M; Stempkowski, L; Ernstoff, M S
2000-04-01
The clinical observation of spontaneous regression in patients with renal cell carcinoma (RCC) and the response to various immunotherapeutic therapies strongly suggest a role for the host immune system in this disease. Prior studies showed that sequential administration of interferon (IFN) gamma and IFN alpha to RCC patients was safe. Clinical responses as well as immune changes in the peripheral blood mononuclear cell compartment were observed. Autologous tumor cell vaccines (AV) have also demonstrated activity in renal cell carcinoma. We hypothesize that the addition of AV to sequential IFN gamma and a therapy might improve the tumor-specific immune response by providing an appropriate source of antigen in the appropriate cytokine environment. To our knowledge, this is the first trial using AV combined with IFN alpha and IFN gamma. The purpose of this study was to evaluate the feasibility of manufacturing and administering (AV) from resected tumor samples, and administration of AV with combination IFN gamma and IFN alpha therapy. Finally, the impact on immunological parameters of these treatment options was assessed. Patients with metastatic RCC were randomly assigned to receive AV plus bCG along with a sequential administration of IFN gamma and a either together or after initiation of vaccine. Toxicity and clinical responses were evaluated. Modulations of the immune system were investigated by analyzing phenotype, cytokine mRNA expression, T cell proliferation and cytotoxicity in the peripheral blood mononuclear cell compartment. Fourteen patients with metastatic renal cell carcinoma were enrolled in this study; 9 were available for response evaluation. In a 70 day period, 3 (33%) showed mixed responses, 5 (56%) stable disease and 1 (11%) progression of disease. Toxicities were consistent with previous clinical reports. In the flow-cytometry phenotype analysis, stimulation of distinct subsets of circulating T-lymphocytes and a decrease of CD8+ T cell subsets was
Laouar, Yasmina; Sutterwala, Fayyaz S; Gorelik, Leonid; Flavell, Richard A
2005-06-01
Interferon-gamma and interleukin 12 produced by the innate arm of the immune system are important regulators of T helper type 1 (T(H)1) cell development, but signals that negatively regulate their expression remain controversial. Here we show that transforming growth factor-beta (TGF-beta) controlled T(H)1 differentiation through the regulation of interferon-gamma produced by natural killer (NK) cells. Blockade of TGF-beta signaling in NK cells caused the accumulation of a large pool of NK cells secreting copious interferon-gamma, responsible for T(H)1 differentiation and protection from leishmania infection. In contrast, blockade of TGF-beta signaling in dendritic cells did not affect dendritic cell homeostasis or interleukin 12 production, thus indicating a previously undescribed demarcation of the function of TGF-beta in NK cells versus dendritic cells.
Solis, B; Nova, E; Gómez, S; Samartín, S; Mouane, N; Lemtouni, A; Belaoui, H; Marcos, A
2002-12-01
For several years cytokine production has been associated with infections but it was not suspected that some types of food could also induce cytokines, even in a state of non-infection. Lactic bacteria can induce interferon (IFN) production in human healthy subjects, thus, a better protection against infections would be expected. Therefore, we planned to evaluate the effect of two diets including yoghurt or milk on IFN-gamma production during nutritional recovery in two different situations of malnutrition: (1) children with diarrhoea; and (2) patients with anorexia nervosa (AN). Both the diet including yoghurt of that including milk seemed to increase IFN-gamma production at the end of nutritional recovery in the malnourished children with diarrhoea. The significance of interferon production and the lymphocyte subset increase should be explored to know if a better resistance against pathogens is related to them. Regulation of intestinal absorption and moderate stimulation of interferon production make the yoghurt-based diet a good choice in the nutritional care of children. In the same way, an increase in the IFN-gamma production was observed in AN patients consuming yoghurt. This increase of IFN-gamma production could be considered a biological marker to detect the effect of probiotics on the immune response, especially in the improvement of a deficient nutritional status.
The elephant interferon gamma assay: a contribution to diagnosis of tuberculosis in elephants.
Angkawanish, T; Morar, D; van Kooten, P; Bontekoning, I; Schreuder, J; Maas, M; Wajjwalku, W; Sirimalaisuwan, A; Michel, A; Tijhaar, E; Rutten, V
2013-11-01
Mycobacterium tuberculosis (M. tb) has been shown to be the main causative agent of tuberculosis in elephants worldwide. M. tb may be transmitted from infected humans to other species including elephants and vice versa, in case of prolonged intensive contact. An accurate diagnostic approach covering all phases of the infection in elephants is required. As M. tb is an intracellular pathogen and cell-mediated immune (CMI) responses are elicited early after infection, the skin test is the CMI assay of choice in humans and cattle. However, this test is not applicable in elephants. The interferon gamma (IFN-γ) assay is considered a good alternative for the skin test in general, validated for use in cattle and humans. This study was aimed at development of an IFN-γ assay applicable for diagnosis of tuberculosis in elephants. Recombinant elephant IFN-γ (rEpIFN-γ) produced in eukaryotic cells was used to immunize mice and generate the monoclonal antibodies. Hybridomas were screened for IFN-γ-specific monoclonal antibody production and subcloned, and antibodies were isotyped and affinity purified. Western blot confirmed recognition of the rEpIFN-γ. The optimal combination of capture and detection antibodies selected was able to detect rEpIFN-γ in concentrations as low as 1 pg/ml. The assay was shown to be able to detect the native elephant IFN-γ, elicited in positive-control cultures (pokeweed mitogen (PWM), phorbol myristate acetate plus ionomycin (PMA/I)) of both Asian and African elephant whole-blood cultures (WBC). Preliminary data were generated using WBC from non-infected elephants, a M. tb infection-suspected elephant and a culture-confirmed M. tb-infected elephant. The latter showed measurable production of IFN-γ after stimulation with ESAT6/CFP10 PPDB and PPDA in concentration ranges as elicited in WBC by Mycobacterium tuberculosis complex (MTBC)-specific antigens in other species. Hence, the IFN-γ assay presented potential as a diagnostic tool for the
Martins, Marcia Valéria B S; Lima, Mônica Cristina B S; Duppre, Nadia C; Matos, Haroldo J; Spencer, John S; Brennan, Patrick J; Sarno, Euzenir N; Fonseca, Leila; Pereira, Geraldo M B; Pessolani, Maria Cristina V
2007-05-01
There are no reliable means for detecting subclinical mycobacterial infections. The recent sequencing of several mycobacterial genomes has now afforded new opportunities for the development of pathogen-specific diagnostic tests, critical in the context of leprosy and tuberculosis control. In the present study, we applied a multi-parametric flow cytometric analysis that allowed the investigation of T-cell functions in order to define immunological markers that measure previous exposure to mycobacteria. We compared the in vivo response to PPD, the gold standard skin test reagent for measuring previous exposure to Mycobacterium tuberculosis, with in vitro parameters of leukocyte activation in five PPD positive and five PPD negative healthy volunteers. PPD-stimulated peripheral leukocytes expressing CD4, CD69, cutaneous lymphocyte-associated antigen (CLA) and intracellular IFN-gamma were enumerated in whole blood and compared with the size of in vivo PPD-induced induration and IFN-gamma production levels as measured by ELISA in supernatants of PPD-stimulated peripheral blood mononuclear cells. The reactivity to the tuberculin skin test (TST) was associated with markedly increased frequencies of PPD-responsive activated (CD69+) and IFN-gamma-producing CD4+T cells. Detection of PPD-specific IFN-gamma producing leukocytes was restricted to CD4+T cells and a subset of these cells was shown to express the skin homing molecule CLA. Multiple linear regression modeling of responses to PPD showed the highest association between skin test indurations and frequencies of PPD-responsive IFN-gamma-producing CD4+CD69+ T cells. Our data show that the in vitro enumeration of antigen-specific IFN-gamma-producing CD4+ T cells can provide an alternative to the in vivo tuberculin test for the detection of latent Mycobacterium tuberculosis infection. Moreover, the measurement of these immunological parameters can be useful for the screening of new specific antigens defined by the genome
Seo, Kwang Won; Ahn, Jong-Joon; Ra, Seung Won; Kwon, Woon-Jung; Jegal, Yangjin
2014-06-01
The interferon gamma (IFN-γ) release assays (IGRAs) are the best method of detecting Mycobacterium tuberculosis infection. However, reports on IGRAs results obtained during and right after the treatment of tuberculosis (TB) have presented differing results. Some studies have shown declining responses, whereas other reports described persistent, fluctuating, or increasing responses. We postulated that the IGRA-positivity will decrease or revert long time after treatment of TB, and thus, evaluated the response of IGRA in subjects with a history of pulmonary TB. Seventy subjects (M:F = 51:19; age = 53.2 ± 11.8 years) underwent tuberculin skin tests (TSTs) and IGRA. The interval of time elapsed after the completion of anti-TB treatment was < 10 years for 16 subjects, 10-20 years for 13 subjects, 20-30 years for 16 subjects, and ≥ 30 years for 25 subjects. The TST was positive in 49 subjects (74%) and negative in 17 subjects (26%). The IGRA was positive in 52 subjects (74%) and negative in 18 subjects (26%). The IFN-γ level and the size of induration showed good correlation (r = 0.525, P < 0.001). However, the correlation between time elapsed after the completion of anti-TB treatment and the size of induration or that between time and the IFN-γ level was not significant. The TST and IGRA were positive in 72.7% and 68.0% of subjects ≥ 30 years after the treatment of pulmonary TB. In conclusion, majority of subjects with a history of pulmonary TB are IGRA-positive, even a few decades after the completion of anti-TB treatment.
Park, Jong-Hyeon; Lee, Kwang-Nyeong; Kim, Se-Kyung; You, Su-Hwa; Kim, Taeseong; Tark, Dongseob; Lee, Hyang-Sim; Seo, Min-Goo; Kim, Byounghan
2015-01-01
ABSTRACT Because the currently available vaccines against foot-and-mouth disease (FMD) provide no protection until 4 to 7 days postvaccination, the only alternative method to halt the spread of the FMD virus (FMDV) during outbreaks is the application of antiviral agents. Combination treatment strategies have been used to enhance the efficacy of antiviral agents, and such strategies may be advantageous in overcoming viral mechanisms of resistance to antiviral treatments. We have developed recombinant adenoviruses (Ads) for the simultaneous expression of porcine alpha and gamma interferons (Ad-porcine IFN-αγ) as well as 3 small interfering RNAs (Ad-3siRNA) targeting FMDV mRNAs encoding nonstructural proteins. The antiviral effects of Ad-porcine IFN-αγ and Ad-3siRNA expression were tested in combination in porcine cells, suckling mice, and swine. We observed enhanced antiviral effects in porcine cells and mice as well as robust protection against the highly pathogenic strain O/Andong/SKR/2010 and increased expression of cytokines in swine following combination treatment. In addition, we showed that combination treatment was effective against all serotypes of FMDV. Therefore, we suggest that the combined treatment with Ad-porcine IFN-αγ and Ad-3siRNA may offer fast-acting antiviral protection and be used with a vaccine during the period that the vaccine does not provide protection against FMD. IMPORTANCE The use of current foot-and-mouth disease (FMD) vaccines to induce rapid protection provides limited effectiveness because the protection does not become effective until a minimum of 4 days after vaccination. Therefore, during outbreaks antiviral agents remain the only available treatment to confer rapid protection and reduce the spread of foot-and-mouth disease virus (FMDV) in livestock until vaccine-induced protective immunity can become effective. Interferons (IFNs) and small interfering RNAs (siRNAs) have been reported to be effective antiviral agents against
Role of CD28/B7 costimulation in the dexamethasone-induced suppression of IFN-gamma.
Agarwal, S K; Marshall, G D
2000-11-01
In vitro exposure of peripheral blood mononuclear cells (PBMC) to glucocorticoids (GC), at concentrations observed during psychologic stress, induces a shift in the human type 1/type 2 cytokine balance toward a type 2 cytokine response. The mechanisms involved in these cytokine alterations are unknown but likely include modulation of regulatory cytokines or the interaction between the antigen-presenting cell (APC) and T lymphocyte or both. The CD28/B7 costimulation pathway has been reported to modulate the type 1/type 2 cytokine balance and may contribute to the GC-associated cytokine alterations. Therefore, we sought to determine the effect of dexamethasone (Dex) on the expression and function of the human CD28/B7 costimulatory pathway and whether these alterations contribute to the Dex-induced type 1/type 2 cytokine alterations. Dex inhibited the expression of both CD80 and CD86 on THP-1 cells, a human acute monocytic leukemia cell line, as determined by flow cytometry. Dex also inhibited the expression of CD28 and CTLA-4 on phytohemagglutinin (PHA)-stimulated CD3+ T lymphocytes, which was attenuated by the addition of interleukin-12 (IL-12). Lastly, activation of CD28 with anti-CD28 antibody attenuated the Dex-induced decrease in interferon-gamma (IFN-gamma) production by anti-CD3 antibody-stimulated PBMC. These data suggest that Dex induces a modulation of the CD28/B7 costimulatory pathway that contributes to the shift in the type 1/type 2 cytokine balance toward a predominant type 2 cytokine response.
Pérez de Val, Bernat; Vidal, Enric; López-Soria, Sergio; Marco, Alberto; Cervera, Zoraida; Martín, Maite; Mercader, Irene; Singh, Mahavir; Raeber, Alex; Domingo, Mariano
2016-02-10
Vaccination of domestic animals has emerged as an alternative long-term strategy for the control of tuberculosis (TB). A trial under field conditions was conducted in a TB-free goat herd to assess the safety of the Mycobacterium bovis BCG vaccine. Eleven kids and 10 milking goats were vaccinated with BCG. Bacterial shedding and interferon gamma (IFN-γ) responses were monitored throughout the study. Comprehensive pathological examination and mycobacterial culture of target tissues were performed. BCG vaccine strain was only isolated from the draining lymph node of the injection site of a kid euthanized at week 8 post-vaccination. The remaining animals were euthanized at week 24. Six out of 20 showed small granulomas at the injection site. BCG shedding was not detected in either faeces or in milk throughout the study. All vaccinated kids showed BCG-induced IFN-γ responses at week 8 post-vaccination. BCG vaccination of goats showed no lack of biological safety for the animals, environment and public health, and local adverse reactions were negligible. Copyright © 2016 Elsevier Ltd. All rights reserved.
Interferon-Gamma Promotes UV-Induced Melanoma in Mice | Center for Cancer Research
Scientists have made an unanticipated discovery in mice that interferon-gamma, a type of protein primarily used by the immune system for intercellular communication, acts as a promoter for the deadly form of skin cancer known as melanoma. This finding resulted from a series of experiments designed to understand how solar ultraviolet (UV) radiation causes melanoma. This study
USDA-ARS?s Scientific Manuscript database
While T cell contribution to IAV immunity is appreciated, data comparing methods to evaluate IFN-gamma production by IAV-specific T cells elicited following vaccination is limited. To understand the differential immunogenicity between live-attenuated influenza virus (LAIV) and whole-inactivated viru...
Gil, Olga; Vilaplana, Cristina; Guirado, Evelyn; Díaz, Jorge; Cáceres, Neus; Singh, Mahavir; Cardona, Pere-Joan
2008-11-01
Gamma interferon responses of spleen cells in mice were examined during postchemotherapy relapse of intraperitoneally induced latent tuberculous infection. The mycobacterial extract RUTI, which prevented the relapse, significantly enhanced the immune responses to secreted and structural recombinant mycobacterial antigens, suggesting that RUTI-mediated protection was mediated by activated T cells.
Pierkes, M; Bellinghausen, I; Hultsch, T; Metz, G; Knop, J; Saloga, J
1999-02-01
Recent studies provide evidence that venom immunotherapy (VIT) alters the pattern of cytokine production by inducing an allergen-specific T-cell shift in cytokine expression from TH2 (IL-4, IL-5) to TH1 (IFN-gamma) cytokines and also inducing the production of IL-10. This study was carried out to analyze whether these changes in cytokine production of T cells already observed 1 week after the initiation of VIT in subjects with wasp venom allergy also influence the reactivity of effector cells, such as mast cells and basophils. All subjects included in this study had a history of severe systemic allergic reactions to wasp stings and positive skin test responses with venom and venom-specific IgE in the sera. Peripheral blood leukocytes were isolated before and after the initiation of VIT (rush therapy reaching a maintenance dose of 100 microg venom injected subcutaneously within 1 week) and preincubated with or without addition of IL-10, IFN-gamma, IL-10 + IFN-gamma, anti-IL-10, or anti-IFN-gamma. After stimulation with wasp venom, histamine and sulfidoleukotriene release were assessed by ELISA and compared with spontaneous release and total histamine content. After the induction of VIT, venom-induced absolute and relative histamine and sulfidoleukotriene release were reduced. This was at least partially due to the induction of IFN-gamma and IL-10 production, because (1) neutralization of IL-10 and IFN-gamma by mAbs partially restored the release after the initiation of VIT and (2) the addition of exogenous IFN-gamma and IL-10 caused a statistically significant diminution of the venom-induced histamine and sulfidoleukotriene release before VIT. Depletion of CD2(+) T cells also restored the releasability after VIT. These data indicate that T cells (producing IL-10 and IFN-gamma after VIT) play a key role for the inhibition of histamine and sulfidoleukotriene release of effector cells.
Sonoda, Soichiro; Yamaza, Haruyoshi; Ma, Lan; Tanaka, Yosuke; Tomoda, Erika; Aijima, Reona; Nonaka, Kazuaki; Kukita, Toshio; Shi, Songtao; Nishimura, Fusanori; Yamaza, Takayoshi
2016-01-01
Clinically, irreversible pulpitis is treated by the complete removal of pulp tissue followed by replacement with artificial materials. There is considered to be a high potential for autologous transplantation of human dental pulp stem cells (DPSCs) in endodontic treatment. The usefulness of DPSCs isolated from healthy teeth is limited. However, DPSCs isolated from diseased teeth with irreversible pulpitis (IP-DPSCs) are considered to be suitable for dentin/pulp regeneration. In this study, we examined the stem cell potency of IP-DPSCs. In comparison with healthy DPSCs, IP-DPSCs expressed lower colony-forming capacity, population-doubling rate, cell proliferation, multipotency, in vivo dentin regeneration, and immunosuppressive activity, suggesting that intact IP-DPSCs may be inadequate for dentin/pulp regeneration. Therefore, we attempted to improve the impaired in vivo dentin regeneration and in vitro immunosuppressive functions of IP-DPSCs to enable dentin/pulp regeneration. Interferon gamma (IFN-γ) treatment enhanced in vivo dentin regeneration and in vitro T cell suppression of IP-DPSCs, whereas treatment with tumor necrosis factor alpha did not. Therefore, these findings suggest that IFN-γ may be a feasible modulator to improve the functions of impaired IP-DPSCs, suggesting that autologous transplantation of IFN-γ-accelerated IP-DPSCs might be a promising new therapeutic strategy for dentin/pulp tissue engineering in future endodontic treatment. PMID:26775677
Grau, G E; Heremans, H; Piguet, P F; Pointaire, P; Lambert, P H; Billiau, A; Vassalli, P
1989-01-01
Experimental cerebral malaria (ECM), a lethal hyperacute neurological syndrome associated with high blood levels of tumor necrosis factor, develops in genetically susceptible (CBA/Ca) mice 7 days after infection with Plasmodium berghei ANKA strain. Injections of neutralizing monoclonal antibody against recombinant murine interferon gamma, not later than 4 days after infection, markedly reduced the incidence of ECM and the elevation in serum levels of tumor necrosis factor. This treatment prevented the cerebral lesions (plugging of brain vessels by monocytes, lymphocytes, and parasitized erythrocytes). In contrast, the extent of macrophage infiltration in lymphoid organs (which is a characteristic feature of mice developing ECM), as well as the course of infection, remained unaffected by the antibody treatment. Protected mice died at a later time of severe anemia and overwhelming parasitemia, the usual outcome of P. berghei infection in mice that are not susceptible to ECM. The present data indicate that interferon gamma constitutes an important link in the cytokine network that leads to brain vessel inflammation in experimental malaria. It is proposed that interferon gamma released by activated CD4+ T cells acts by augmenting both production and action of tumor necrosis factor. PMID:2501793
Interferon (IFN)-λ Takes the Helm: Immunomodulatory Roles of Type III IFNs
Zanoni, Ivan; Granucci, Francesca; Broggi, Achille
2017-01-01
Type III interferons (IFNs) (or IFN-λ) are the latest addition to the IFN family. Even though they share little protein homology with type I IFN, both exhibit remarkable functional similarities: each can be induced in response to viral infections, and both lead to Janus kinases (JAK) and signal transducer and activator of transcription (STAT) activation. The JAK/STAT pathway induces antiviral responses and IFN-stimulated gene transcription. However, despite the similarities in their effector functions with type I IFNs, IFN-λ also has a non-redundant role in protecting barrier organs: epithelial cells preferentially produce IFN-λ rather than type I IFNs; and interferon lambda receptor 1 (IFNLR1), the specific receptor for IFN-λ, is highly expressed on cells of epithelial lineage. Thus far, IFN-λ has been considered mainly as an epithelial cytokine, which restricts viral replication in epithelial cells and constitutes an added layer of protection at mucosal sites. However, it is now increasingly recognized that IFNLR1 is expressed broadly, and that immune cells such as neutrophils and dendritic cells also respond to IFN-λ. Moreover, in many in vivo models, IFN-λ modulates immune cell functions and thereby configures itself less as a cytokine that is only specific to the epithelium, and more as a cytokine that directly controls the inflammatory response at mucosal sites. Here, we critically review the recent literature on immune modulatory roles for IFN-λ, and distinguish between the direct and indirect effects of this IFN on immune cell functions in different inflammatory settings. PMID:29234323
Interferon (IFN)-λ Takes the Helm: Immunomodulatory Roles of Type III IFNs.
Zanoni, Ivan; Granucci, Francesca; Broggi, Achille
2017-01-01
Type III interferons (IFNs) (or IFN-λ) are the latest addition to the IFN family. Even though they share little protein homology with type I IFN, both exhibit remarkable functional similarities: each can be induced in response to viral infections, and both lead to Janus kinases (JAK) and signal transducer and activator of transcription (STAT) activation. The JAK/STAT pathway induces antiviral responses and IFN-stimulated gene transcription. However, despite the similarities in their effector functions with type I IFNs, IFN-λ also has a non-redundant role in protecting barrier organs: epithelial cells preferentially produce IFN-λ rather than type I IFNs; and interferon lambda receptor 1 (IFNLR1), the specific receptor for IFN-λ, is highly expressed on cells of epithelial lineage. Thus far, IFN-λ has been considered mainly as an epithelial cytokine, which restricts viral replication in epithelial cells and constitutes an added layer of protection at mucosal sites. However, it is now increasingly recognized that IFNLR1 is expressed broadly, and that immune cells such as neutrophils and dendritic cells also respond to IFN-λ. Moreover, in many in vivo models, IFN-λ modulates immune cell functions and thereby configures itself less as a cytokine that is only specific to the epithelium, and more as a cytokine that directly controls the inflammatory response at mucosal sites. Here, we critically review the recent literature on immune modulatory roles for IFN-λ, and distinguish between the direct and indirect effects of this IFN on immune cell functions in different inflammatory settings.
Faulkner, C B; Simecka, J W; Davidson, M K; Davis, J K; Schoeb, T R; Lindsey, J R; Everson, M P
1995-01-01
Studies were conducted to determine whether the production of various cytokines is associated with Mycoplasma pulmonis disease expression. Susceptible C3H/HeN and resistant C57BL/6N mice were inoculated intranasally with 10(7) CFU of virulent M. pulmonis UAB CT or avirulent M. pulmonis UAB T. Expression of genes for tumor necrosis factor alpha (TNF-alpha), interleukin 1 alpha (IL-1 alpha), IL-1 beta, IL-6, and gamma interferon (IFN-gamma) in whole lung tissue and TNF-alpha gene expression in bronchoalveolar lavage (BAL) cells was determined by reverse transcription-PCR using specific cytokine primers at various times postinoculation. In addition, concentrations of TNF-alpha, IL-1, IL-6, and IFN-gamma were determined in BAL fluid and serum samples at various times postinoculation. Our results showed that there was a sequential appearance of cytokines in the lungs of infected mice: TNF-alpha, produced primarily by BAL cells, appeared first, followed by IL-1 and IL-6, which were followed by IFN-gamma. Susceptible C3H/HeN mice had higher and more persistent concentrations of TNF-alpha and IL-6 in BAL fluid than did resistant C57BL/6N mice, indicating that TNF-alpha and possibly IL-6 are important factors in pathogenesis of acute M. pulmonis disease in mice. Serum concentrations of IL-6 were elevated in C3H/HeN mice, but not C57BL/6N mice, following infection with M. pulmonis, suggesting that IL-6 has both local and systemic effects in M. pulmonis disease. PMID:7558323
2012-01-01
Background The synergistic combination of interferon (IFN) alpha-2b and IFN gamma results in more potent in vitro biological effects mediated by both IFNs. The aim of this investigation was to evaluate by first time the pharmacokinetics and pharmacodynamics of this combination in patients with mycosis fungoides. Methods An exploratory, prospective, open-label clinical trial was conducted. Twelve patients, both genders, 18 to 75 years-old, with mycosis fungoides at stages IB to III, were eligible for the study. All of them received intramuscularly a single high dose (23 × 106 IU) of a novel synergistic IFN mixture (HeberPAG®) for pharmacokinetic and pharmacodynamic studies. Serum IFN alpha-2b and IFN gamma concentrations were measured during 96 hours by commercial enzyme immunoassays (EIA) specific for each IFN. Other blood IFN-inducible markers and laboratory variables were used as pharmacodynamics and safety criteria. Results The pharmacokinetic evaluation by EIA yielded a similar pattern for both IFNs that are also in agreement with the well-known described profiles for these molecules when these are administered separately. The average values for main parameters were: Cmax: 263 and 9.3 pg/mL; Tmax: 9.5 and 6.9 h; AUC: 4483 and 87.5 pg.h/mL, half-life (t1/2): 4.9 and 13.4 h; mean residence time (MRT): 13.9 and 13.5 h, for serum IFN alpha-2b and IFN gamma, respectively. The pharmacodynamic variables were strongly stimulated by simultaneous administration of both IFNs: serum neopterin and beta-2 microglobulin levels (β2M), and stimulation of 2’-5’ oligoadenylate synthetase (OAS1) mRNA expression. The most encouraging data was the high increment of serum neopterin, 8.0 ng/mL at 48 h, not been described before for any unmodified or pegylated IFN. Additionally, β2M concentration doubled the pre-dose value at 24–48 hours. For both variables the values remained clearly upper baseline levels at 96 hours. Conclusions HeberPAG®possesses improved
Müller, J-M V; Wissemann, J; Meli, M L; Dasen, G; Lutz, H; Heinzerling, L; Feige, K
2011-11-01
Whole blood pharmacokinetics of intratumourally injected naked plasmid DNA coding for equine Interleukin 12 (IL-12) was assessed as a means of in vivo gene transfer in the treatment of melanoma in grey horses. The expression of induced interferon gamma (IFN-g) was evaluated in order to determine the pharmacodynamic properties of in vivo gene transduction. Seven grey horses bearing melanoma were injected intratumourally with 250 µg naked plasmid DNA coding for IL-12. Peripheral blood and biopsies from the injection site were taken at 13 time points until day 14 post injection (p.i.). Samples were analysed using quantitative real-time PCR. Plasmid DNA was quantified in blood samples and mRNA expression for IFN-g in tissue samples. Plasmid DNA showed fast elimination kinetics with more than 99 % of the plasmid disappearing within 36 hours. IFN-g expression increased quickly after IL-12 plasmid injection, but varied between individual horses. Intratumoural injection of plasmid DNA is a feasible method for inducing transgene expression in vivo. Biological activity of the transgene IL-12 was confirmed by measuring expression of IFN-g.
Igarashi, Ikuo; Suzuki, Reiko; Waki, Seiji; Tagawa, Yoh-Ichi; Seng, Seyha; Tum, Sothyra; Omata, Yoshitaka; Saito, Atsushi; Nagasawa, Hideyuki; Iwakura, Yohichiro; Suzuki, Naoyoshi; Mikami, Takeshi; Toyoda, Yutaka
1999-01-01
Babesia microti produces a self-limiting infection in mice, and recovered mice are resistant to reinfection. In the present study, the role of T cells in protective immunity against challenge infection was examined. BALB/c mice which recovered from primary infection showed strong protective immunity against challenge infection. In contrast, nude mice which failed to control the primary infection and were cured with an antibabesial drug did not show protection against challenge infection. Treatment of immune mice with anti-CD4 monoclonal antibody (MAb) diminished the protective immunity against challenge infection, but treatment with anti-CD8 MAb had no effect on the protection. Transfer of CD4+ T-cell-depleted spleen cells resulted in higher parasitemia than transfer of CD8+ T-cell-depleted spleen cells. A high level of gamma interferon (IFN-γ), which was produced by CD4+ T cells, was observed for the culture supernatant of spleen cells from immune mice, and treatment of immune mice with anti-IFN-γ MAb partially reduced the protection. Moreover, no protection against challenge infection was found in IFN-γ-deficient mice. On the other hand, treatment of immune mice with MAbs against interleukin-2 (IL-2), IL-4, or tumor necrosis factor alpha did not affect protective immunity. These results suggest essential requirements for CD4+ T cells and IFN-γ in protective immunity against challenge infection with B. microti. PMID:10417185
Yu, Hong-Ren; Tain, You-Lin; Sheen, Jiunn-Ming; Tiao, Mao-Meng; Chen, Chih-Cheng; Kuo, Ho-Chang; Hung, Pi-Lien; Hsieh, Kai-Sheng; Huang, Li-Tung
2016-01-01
Overexposure to prenatal glucocorticoid (GC) disturbs hypothalamic-pituitary-adrenocortical axis-associated neuroendocrine metabolism and susceptibility to metabolic syndrome. A high-fat (HF) diet is a major environmental factor that can cause metabolic syndrome. We aimed to investigate whether prenatal GC plus a postnatal HF diet could alter immune programming in rat offspring. Pregnant Sprague-Dawley rats were given intraperitoneal injections of dexamethasone or saline at 14–21 days of gestation. Male offspring were then divided into four groups: vehicle, prenatal dexamethasone exposure, postnatal HF diet (VHF), and prenatal dexamethasone exposure plus a postnatal HF diet (DHF). The rats were sacrificed and adaptive immune function was evaluated. Compared to the vehicle, the DHF group had lower interferon gamma (IFN-γ) production by splenocytes at postnatal day 120. Decreases in H3K9 acetylation and H3K36me3 levels at the IFN-γ promoter correlated with decreased IFN-γ production. The impaired IFN-γ production and aberrant site-specific histone modification at the IFN-γ promoter by prenatal dexamethasone treatment plus a postnatal HF diet resulted in resilience at postnatal day 180. Prenatal dexamethasone and a postnatal HF diet decreased IFN-γ production through a site-specific and an age-dependent histone modification. These findings suggest a mechanism by which prenatal exposure to GC and a postnatal environment exert effects on fetal immunity programming. PMID:27669212
Montoya, Carlos Julio; Velilla, Paula Andrea; Chougnet, Claire; Landay, Alan L; Rugeles, Maria Teresa
2006-08-01
The mechanisms involved in controlling the establishment of HIV-1 infection are not fully understood. In particular, the role of innate immunity in natural resistance exhibited by individuals who are continuously exposed to HIV-1 but remain seronegative (ESN) has not been thoroughly evaluated. We determined the frequency and function of peripheral blood innate immune cells (plasmacytoid and myeloid dendritic cells, monocytes, NK cells, CD3+/CD56+ cells and invariant NKT cells) in ESN, chronically HIV-1-infected and low-risk HIV-1 seronegative individuals. ESN demonstrated a similar frequency of innate immune cells in comparison to controls and a higher frequency of dendritic cells, NK and invariant NKT cells compared to HIV-1-infected subjects. Incubation of mononuclear cells with stimulatory CpG ODN induced CD86 and CD69 up-regulation to a similar degree on innate cells from the three study groups. CpG ODN-stimulated secretion of cytokines was also similar between ESN and controls, while secretion of IFN-alpha was significantly decreased in HIV-1+ individuals. Importantly, expression of IFN-gamma by PMA/Ionomycin-activated CD56(bright) NK cells and CD3+/CD56+ cells was significantly higher in ESN when compared with controls. The anti-viral effects of IFN-gamma are well established, and so our results suggest that IFN-gamma production by innate immune cells might be one of the multiple factors involved in controlling the establishment of sexually transmitted HIV-1 infection.
Tang, Bone Siu-Fai; Chan, Jasper Fuk-Woo; Chen, Min; Tsang, Owen Tak-Yin; Mok, M. Y.; Lai, Raymond Wai-Man; Lee, Rodney; Que, Tak-Lun; Tse, Herman; Li, Iris Wai-Sum; To, Kelvin Kai-Wang; Cheng, Vincent Chi-Chung; Chan, Eric Yuk-Tat; Zheng, Bojian; Yuen, Kwok-Yung
2010-01-01
Acquired immunodeficiency due to autoantibody against gamma interferon has recently been associated with opportunistic nontuberculous mycobacteriosis, especially among Southeast Asians. We report another 8 cases, all except one apparently immunocompetent hosts who suffered from concomitant or sequential infections by other intracellular pathogens causing penicilliosis, extraintestinal nontyphoidal salmonellosis, and burkholderiosis. The only case with an underlying immunodeficiency syndrome had systemic lupus erythematosus that was quiescent throughout the multiple infective episodes. Eight out of 10 (80.0%) patients with serological evidence of penicilliosis, 5 out of 7 (71.4%) with culture-positive extraintestinal nontyphoidal salmonellosis, 5 out of 28 (17.9%) with serological evidence of melioidosis, and 7 out of 13 (53.8%) with culture-positive nontuberculous mycobacteriosis possessed autoantibody against gamma interferon, whereas only 1 out of 100 patients with systemic lupus erythematosus did. Our study represents the first and largest case series linking this emerging immunodeficiency syndrome with these atypical infections in apparently immunocompetent hosts. Thus, we advocate that any patient with unexplained recurrent or polymicrobial infections due to these intracellular pathogens should be screened for acquired immunodeficiency due to autoantibody against gamma interferon. PMID:20445006
Cappelli, G; Volpe, P; Sanduzzi, A; Sacchi, A; Colizzi, V; Mariani, F
2001-12-01
Mycobacterium tuberculosis is an intracellular pathogen that readily survives and replicates in human macrophages (MPhi). Host cells have developed different mycobactericidal mechanisms, including the production of inflammatory cytokines. The aim of this study was to compare the MPhi response, in terms of cytokine gene expression, to infection with the M. tuberculosis laboratory strain H37Rv and the clinical M. tuberculosis isolate CMT97. Both strains induce the production of interleukin-12 (IL-12) and IL-16 at comparable levels. However, the clinical isolate induces a significantly higher and more prolonged MPhi activation, as shown by reverse transcription-PCR analysis of IL-1beta, IL-6, IL-10, transforming growth factor beta, tumor necrosis factor alpha, and gamma interferon (IFN-gamma) transcripts. Interestingly, when IFN-gamma transcription is high, the number of M. tuberculosis genes expressed decreases and vice versa, whereas no mycobactericidal effect was observed in terms of bacterial growth. Expression of 11 genes was also studied in the two M. tuberculosis strains by infecting resting or activated MPhi and compared to bacterial intracellular survival. In both cases, a peculiar inverse correlation between expression of these genes and multiplication was observed. The number and type of genes expressed by the two strains differed significantly.
Xie, Yan-Hui; Chen, Qin-Fen; Xie, Yi; Xie, Hong
2002-12-01
To observe the proliferation of T lymphocytes stimulated by CML and AML cells which were induced by rhGM-CSF and rhIL-4, and the secretion of IFN-gamma from proliferated T lymphocytes, the expression of CD80, CD86 and HLA-DR on CML and AML cells induced by GM-CSF and IL-4 was assayed by flow cytometry in vitro. Then one-way mixed lymphocyte reaction was carried out, with induced leukemia cells as stimulating cells and auto-T lymphocytes as reactive cells. The secretion of IFN-gamma from T lymphocytes was determined by double antibody sandwich ELISA. The results showed that GM-CSF and IL-4 significantly upregulated the expression of CD80, CD86 and HLA-DR on CML cells and CD80 and CD86 on AML cells, which could stimulate the T lymphocyte proliferation and high secretion of IFN-gamma (in CML group) of autologous T lymphocytes. It is concluded that the CML and AML cells induced by GM-CSF and IL-4 have the ability to present tumor specific antigen to auto-T lymphocyte.
Mosaad, Y M; Soliman, O E; Tawhid, Z E; Sherif, D M
2010-10-01
The aim was to investigate the association of interferon-gamma (IFN-γ) +874 T/A and interleukin-10 (IL-10)-1082 A/G single nucleotide polymorphisms with tuberculous infection and post-BCG lymphadenitis in Egyptian children. IFN-γ +874 T/A and IL-10 -1082 A/G polymorphism detection by amplification refractory mutation system technique was carried out for 110 patients with TB, 40 patients with post-BCG lymphadenitis and 118 healthy controls. IFN-γ +874 A allele was higher in TB and post-BCG patients than those in healthy controls (Pc=0.006 and 0.002, respectively). IFN-γ +874 genotype AA was significantly higher in patients with TB than that in control (Pc=0.015), in extrapulmonary than patients with pulmonary TB (PTB) (Pc=0.009), and young children with TB below 5 years (Pc=0.024). No statistically significant differences were observed between patients with TB and controls for the frequency of IL-10(-1082) alleles or genotypes (P>0.05); however, a statistically significant difference in the frequency of IL-10 (-1082) GG genotype was found between patients with pulmonary and extrapulmonary TB (Pc=0.003). Low producer IFN-γ +874 A/A genotype is associated with post-BCG lymphadenitis and TB disease especially in younger children below 5 years. IL-10-1082 G/G genotype did not exhibit significant association except for increased GG frequency in PTB. Both cytokine polymorphisms have no relation to tuberculin reaction in patients with TB. © 2010 The Authors. Scandinavian Journal of Immunology © 2010 Blackwell Publishing Ltd.
Goodfellow, Alfred; Keeling, Douglas N; Hayes, Robert C; Webster, Duncan
2009-01-01
With increasing use of immunosuppressive therapy, including tumor necrosis factor alpha inhibitors, there is concern about infectious complications, including reactivation of latent Mycobacterium tuberculosis infection. Routine testing prior to administration of systemic immunosuppression includes the tuberculin skin test, which lacks sensitivity and specificity and may be difficult to interpret in the presence of extensive cutaneous disease. Treatment of individuals with latent tuberculosis infection is recommended when immunosuppressive medications are to be employed. We report a case in which a diagnosis of latent tuberculosis infection in a patient with extensive bullous pemphigoid was clarified by the use of an interferon-gamma release assay after equivocal tuberculin skin test results. Interferon-gamma release assays are useful adjuncts to the tuberculin skin test in the diagnosis of latent tuberculosis infection in the setting of extensive cutaneous disease.
Effect of gamma interferon on lung function of mustard gas exposed patients, after 15 years.
Ghanei, Mostafa; Panahi, Yoones; Mojtahedzadeh, Mojtaba; Khalili, Ali Reza Hosseini; Aslani, Jafar
2006-01-01
Bronchiolitis has been known to be among the main the pathological features of lung lesions in Mustard Gas (MG) exposed patients. The purpose of this research was to evaluate the efficacy of interferon gamma-1b on the lung function in MG exposed patients with bronchiolitis. Thirty-six bronchiolitis patients, whose lung lesion had been diagnosed through High Resolution Computerized Tomography (HRCT) of the chest and also pathological study, were divided into two 18-member case and control groups. Both groups were receiving their conventional treatment (inhaled Felixotide and Servent). The case group were treated for 6 months with a combination of 200 microg of interferon gamma-1b (given three times per week subcutaneously) plus 7.5 mg of prednisolone (given once a day), while the control group received their previous conventional medications. Lung function was measured at base line and after 1, 3 and 6 months of treatment. In case and control groups, Forced Expiratory Volume in first second (FEV1) did not have statistical differences at the base line (49.3 +/- 2.9 and 48.7 +/- 4.1, respectively = 0.6), whereas a significant increase was seen in the case group (66.3 +/- 5.4) compared control group (57.3 +/- 8.6) at the subsequent months (P = 0.001 for the difference between the groups). Similar pattern of increase was observed in Forced Vital Capacity (FVC). The findings of this study indicate that a 6-month treatment with interferon gamma-1b plus a low-dose prednisolone is associated with an improvement in the lung function in mustard-gas exposed patients with bronchiolitis.
Albuquerque, Maíra Cavalcanti de; Aleixo, Ana Luisa Quintella do Couto; Benchimol, Eliezer Israel; Leandro, Ana Cristina Câmara S; das Neves, Leandro Batista; Vicente, Regiane Trigueiro; Bonecini-Almeida, Maria da Glória; Amendoeira, Maria Regina Reis
2009-05-01
Toxoplasmosis is a worldwide zoonosis that generally produces an asymptomatic infection. In some cases, however, toxoplasmosis infection can lead to ocular damage. The immune system has a crucial role in both the course of the infection and in the evolution of toxoplasmosis disease. In particular, IFN-gamma plays an important role in resistance to toxoplasmosis. Polymorphisms in genes encoding cytokines have been shown to have an association with susceptibility to parasitic diseases. The aim of this work was to analyse the occurrence of polymorphisms in the gene encoding IFN-gamma (+874T/A) among Toxoplasma gondii seropositive individuals, including those with ocular lesions caused by the parasite, from a rural population of Santa Rita de Cássia, Barra Mansa, state of Rio de Janeiro, Brazil. Further, we verified which of these polymorphisms could be related to susceptibility to the development of ocular toxoplasmosis. This study included 34 individuals with ocular toxoplasmosis (ocular group) and 134 without ocular lesions (control group). The differences between A and T allele distributions were not statistically significant between the two groups. However, we observed that a higher frequency of individuals from the ocular group possessed the A/A genotype, when compared with the control group, suggesting that homozygocity for the A allele could enhance susceptibility to ocular toxoplasmosis in T. gondii infection.
Takahashi, Yuki; Kaneda, Haruka; Takasuka, Nana; Hattori, Kayoko; Nishikawa, Makiya; Watanabe, Yoshihiko; Takakura, Yoshinobu
2008-08-01
The suppressor of cytokine signaling (SOCS) proteins, negative regulators of interferon (IFN)-induced signaling pathways, is involved in IFN resistance of tumor cells. To improve the growth inhibitory effect of IFN-beta and IFN-gamma on a murine melanoma cell line, B16-BL6, and a murine colon carcinoma cell line, Colon26 cells, SOCS-1 and SOCS-3 gene expression in tumor cells was downregulated by transfection of plasmid DNA expressing short hairpin RNA targeting one of these genes (pshSOCS-1 and pshSOCS-3, respectively). Transfection of pshSOCS-1 significantly increased the antiproliferative effect of IFN-gamma on B16-BL6 cells. However, any other combinations of plasmids and IFN had little effect on the growth of B16-BL6 cells. In addition, transfection of pshSOCS-1 and pshSOCS-3 produced little improvement in the effect of IFN on Colon26 cells. To understand the mechanism underlining these findings, the level of SOCS gene expression was measured by real time polymerase chain reaction. Addition of IFN-gamma greatly increased the SOCS-1 mRNA expression in B16-BL6 cells. Taking into account the synergistic effect of pshSOCS-1 and IFN-gamma on the growth of B16-BL6 cells, these findings suggest that IFN-gamma-induced high SOCS-1 gene expression in B16-BL6 cells significantly interferes with the antiproliferative effect of IFN-gamma. These results indicate that silencing SOCS gene expression can be an effective strategy to enhance the antitumor effect of IFN under conditions in which the SOCS gene expression is upregulated by IFN.
Lahuerta-Marin, Angela; Gallagher, Martin; McBride, Stewart; Skuce, Robin; Menzies, Fraser; McNair, Jim; McDowell, Stanley W J; Byrne, Andrew W
2015-09-04
Bovine tuberculosis (bTB), caused by Mycobacterium bovis, is a serious infectious disease that remains an ongoing concern for cattle farming worldwide. Tuberculin skin-tests are often used to identify infected animals (reactors) during test-and-cull programs, however, due to relatively poor sensitivity, additional tests can be implemented in parallel. For example, in Northern Ireland interferon-gamma (IFN-g) testing is used in high-risk herds. However, skin-test negative animals which are positive to the IFN-g test are not required by law to be slaughtered - therefore the final choice for these animals' fate is left with the owner. During this study we investigated whether these animals represented a greater risk of becoming a skin reactor, relative to IFN-g test negative animals from the same herds. Our study population included 1107 IFN-g positive animals from 239 herds. A Cox-proportional hazard model indicated that animals which tested IFN-g positive were 2.31 times (95% CI: 1.92-2.79; P < 0.001) more likely to become a reactor compared with IFN-g negative animals. Animals from dairy herds, and from herds in the south-east, were of higher risk than animals from beef herds and other regions, respectively. Our findings suggest that IFN-g positive animals represent a higher risk of failing a skin-test in the future, indicating the value of IFN-g testing for identifying early-stage infected animals. These IFN-g positive animals are not under any disease restriction, and may move freely (trade), which may put recipient herds at increased risk. Our findings provide important evidence for stakeholders engaged in bTB eradication programs.
Werner-Felmayer, G; Baier-Bitterlich, G; Fuchs, D; Hausen, A; Murr, C; Reibnegger, G; Werner, E R; Wachter, H
1995-01-01
In a number of mammalian cell types, pteridine biosynthesis from guanosine 5'-triphosphate and formation of nitric oxide from L-arginine are induced by gamma interferon (IFN-gamma) and bacterial lipopolysaccharide (LPS). We assessed the possibility of using such metabolic alterations for the in vitro detection of pyrogens. Products from gram-negative and gram-positive bacteria and related synthetic compounds were tested for their potential to induce either of these pathways. Stimulation of pteridine biosynthesis was monitored as the formation of neopterin in the human myelomonocytic cell line THP-1. The formation of nitric oxide was determined as nitrite in murine J774A.1 macrophage cultures. The substances tested included toxic and detoxified parts of LPS and lipid A from Escherichia coli, Salmonella typhimurium, Salmonella minnesota, and Klebsiella pneumoniae as well as lipoteichoic acid and toxic shock syndrome toxin 1 from Staphylococcus aureus. Furthermore, two cell wall compounds from Mycobacterium tuberculosis, trehalose 6,6'-dimycolate and N-acetylmuramyl-L-alanyl-D-isoglutamine, which are active components of Freund's adjuvant, were used. When applied as a single stimulus, only the whole LPS molecule potently stimulated neopterin or nitrite formation. Lipid A and products from gram-positive bacteria were weakly active. For neopterin formation, lipid A required the presence of fetal calf serum. Besides detoxified LPS and independently from the presence of serum, all bacterial compounds tested strongly increased the effects mediated by IFN-gamma. Our results show that bacterial pyrogens can be detected by monitoring the formation of neopterin or nitrite. This may provide a basis for the development of an in vitro assay for the detection of pyrogenic contamination with the aim of replacing the currently used animal test. PMID:7664177
Zibara, Kazem; Zeidan, Asad; Bjeije, Hassan; Kassem, Nouhad; Badran, Bassam; El-Zein, Nabil
2017-03-01
Interferon gamma (IFN-ɣ) is a pleiotropic cytokine which plays dual contrasting roles in cancer. Although IFN-ɣ has been clinically used to treat various malignancies, it was recently shown to have protumorigenic activities. Reactive oxygen species (ROS) are overproduced in cancer cells, mainly due to NADPH oxidase activity, which results into several changes in signaling pathways. In this study, we examined IFN-ɣ effect on the phosphorylation levels of key signaling proteins, through ROS production, in the human breast cancer cell line MCF-7. After treatment by IFN-ɣ, results showed a significant increase in the phosphorylation of STAT1, Src, raf, AKT, ERK1/2 and p38 signaling molecules, in a time specific manner. Src and Raf were found to be involved in early stages of IFN-ɣ signaling since their phosphorylation increased very rapidly. Selective inhibition of Src-family kinases resulted in an immediate significant decrease in the phosphorylation status of Raf and ERK1/2, but not p38 and AKT. On the other hand, IFN-ɣ resulted in ROS generation, through H 2 O 2 production, whereas pre-treatment with the ROS inhibitor NAC caused ROS inhibition and a significant decrease in the phosphorylation levels of AKT, ERK1/2, p38 and STAT1. Moreover, pretreatment with a selective NOX1 inhibitor resulted in a significant decrease of AKT phosphorylation. Finally, no direct relationship was found between ROS production and calcium mobilization. In summary, IFN-ɣ signaling in MCF-7 cell line is ROS-dependent and follows the Src/Raf/ERK pathway whereas its signaling through the AKT pathway is highly dependent on NOX1.
Inada, Takefumi; Kubo, Kozue; Shingu, Koh
2010-10-01
Propofol is an intravenous anesthetic, widely used for general anesthesia during surgery, which inevitably involves tissue trauma with inflammation. At sites of inflammation, prostanoids, especially prostaglandin E₂ (PGE₂), are abundant. This study addresses the effect of propofol on macrophage PGE₂ production. Using thioglycollate-elicited murine peritoneal macrophages, propofol (7.5-30 μM) suppressed lipopolysaccharide-induced PGE₂ production. The suppression was via the direct inhibition of cyclooxygenase (COX) enzyme activity and due neither to the downregulation of COX expression nor the inhibition of arachidonic acid release from plasma membranes. In macrophage:natural killer (NK) cell co-culture, propofol dramatically increased interferon-gamma (IFN-γ) production, and the actions of propofol were mimicked by a selective COX-2 inhibitor, NS-398, as well as the selective EP4 receptor antagonist L-161,982, suggesting a role of PGE₂ suppression in the upregulation of IFN-γ production. Furthermore, in purified NK cell culture, PGE₂ directly suppressed the production of IFN-γ by activated NK cells, which was reversed by selective inhibition of EP4 activity. Taken together, our results show that, in macrophage:NK cell co-culture, propofol, through the suppression of macrophage PGE₂ production, upregulates NK cell IFN-γ production by alleviating EP4 receptor-mediated suppression of IFN-γ production. Propofol may potentially exert considerable influence on inflammation and immunity by suppressing PGE₂ synthesis. Copyright © 2010 Elsevier B.V. All rights reserved.
Kim, Dong-Young; Jung, Jung-A; Kim, Tae-Ho; Seo, Sang-Wan; Jung, Sung-Ki; Park, Cheung-Seog
2009-04-21
Uncariae rhynchophylla (UR) is an herb which has blood pressure lowering and anti-inflammatory effects and has been prescribed traditionally to treat stroke and vascular dementia. In the present study, we examined whether UR suppress Atopic dermatitis (AD)-like skin lesions in NC/Nga mice treated with 2, 4-dinitrofluorobenzene (DNFB) under SPF conditions. The effect of UR in DNFB- treated NC/Nga mice was determined by measuring the skin symptom severity, levels of serum IgE, and of the amounts of IL-4 and IFN-gamma secreted by activated T cells in draining lymph nodes. Oral administration of UR to DNFB-treated NC/Nga mice was found to inhibit ear thickness increases and the skin lesions induced by DNFB. IFN-gamma production by CD4+ T cells from the lymph nodes of DNFB-treated NC/Nga mice was significantly inhibited by UR treatment, although levels of IL-4 and total IgE in serum were not. UR may suppress the development of AD-like dermatitis in DNFB-treated NC/Nga mice by reducing IFN-gamma production.
Pan, L Y; Guyre, P M
1988-02-01
We investigated the influence of glucocorticoids on two effects of interferons (IFNs) which are thought to relate to their antitumor actions: cytotoxic activity and induction of HLA antigen expression. We treated human myeloid cell lines (U-937, HL-60, THP-1, K-562, and KG-1a), and T-(MOLT-4) and B- (Daudi) lymphoblastic cell lines with concentrations of IFN-alpha, IFN-gamma, and dexamethasone (Dex) which are commonly achieved in the circulation following therapeutic administration. The results show that for every cell line except Daudi, the greatest inhibition of cell growth occurred when IFN-gamma and Dex treatments were combined. The advantage of combined IFN-gamma and Dex treatment over treatment with either agent alone was most dramatic for the three cell lines (U-937, HL-60, and THP-1) which have monocytoid characteristics. There was also more growth inhibition by the combination of IFN-alpha and Dex than by either agent alone for all seven cell lines tested. The induction of HLA antigen expression by IFN-alpha and IFN-gamma, an effect which could increase recognition of the tumor cells by the immune system, was as great or greater in the presence of Dex as in its absence. These results demonstrate that glucocorticoids do not inhibit, and in some cases enhance, two effects of IFNs that appear to be related to their antitumor actions: inhibition of tumor cell proliferation and enhancement of HLA antigen expression.
Estes, D M; Tuo, W; Brown, W C; Goin, J
1998-12-01
In this report, we sought to determine the role of selected type I interferons [interferon-alpha (IFN-alpha) and interferon-tau (IFN-tau)], IFN-gamma and transforming growth factor-beta (TGF-beta) in the regulation of bovine antibody responses. B cells were stimulated via CD40 in the presence or absence of B-cell receptor (BCR) cross-linking. IFN-alpha enhanced IgM, IgG2 and IgA responses but did not enhance IgG1 responses. BCR signalling alone was more effective at inducing IgG2 responses with IFN-alpha than dual cross-linking with CD40. Recombinant ovine IFN-tau was less effective at inducing IgG2 responses when compared with IFN-alpha, though IgA responses were similar in magnitude following BCR cross-linking. At higher concentrations, IFN-tau enhanced IgA responses greater than twofold over the levels observed with IFN-alpha. Previous studies have shown that addition of IFN-gamma to BCR or pokeweed mitogen-activated bovine B cells stimulates IgG2 production. However, following CD40 stimulation alone, IFN-gamma was relatively ineffective at stimulating high-rate synthesis of any non-IgM isotype. Dual cross-linking via CD40 and the BCR resulted in decreased synthesis of IgM with a concomitant increase in IgA and similar levels of IgG2 production to those obtained via the BCR alone. We also assessed the effects of endogenous and exogenous TGF-beta on immunoglobulin synthesis by bovine B cells. Exogenous TGF-beta stimulates both IgG2 and IgA production following CD40 and BCR cross-linking in the presence of IL-2. Blocking endogenous TGF-beta did not inhibit the up-regulation of IgG2 or IgA by interferons.
Nguyen, S; Beziat, V; Dhedin, N; Kuentz, M; Vernant, J P; Debre, P; Vieillard, V
2009-05-01
Natural killer (NK) cells generated after haploidentical hematopoietic SCT in patients with AML are characterized by specific phenotypic features and impaired functioning that may affect transplantation outcome. We show that IFN-gamma produced by immature CD56(bright) NK cells upregulates cell surface expression of HLA-E on AML blasts and that this upregulation protects leukemic cells from NK-mediated cell lysis through the mediation of CD94/NKG2A, an inhibitory receptor overexpressed on NK cells after haploidentical SCT. Two years after transplantation, however, maturing NK cells were functionally active, as evidenced by high cytotoxicity and poor IFN-gamma production. This implies that maturation of NK cells is the key to improved immune responses and transplantation outcome.
Histaminergic regulation of interferon-gamma (IFN-γ) production by human natural killer (NK) cells
ASEA, A; HANSSON, M; CZERKINSKY, C; HOUZE, T; HERMODSSON, S; STRANNEGÅRD, Ö; HELLSTRAND, K
1996-01-01
Monocytes, recovered from human peripheral blood by counter-current centrifugal elutriation, effectively inhibit the production of IFN-γ by CD3−/56+ NK cells in response to IL-2. This study aimed at defining the nature of the inhibitory signal, particularly the importance of monocyte-derived reactive metabolites of oxygen. It was found that monocytes recovered from patients with chronic granulomatous disease (CGD), a condition characterized by deficient NADPH-oxidase activity of phagocytes, did not inhibit IFN-γ production by NK cells. Further, catalase, a scavenger of hydrogen peroxide, completely reversed the inhibitory signal, whereas scavengers of the superoxide anion, hypohalous acids, the hydroxyl radical, or nitric oxide synthesis inhibitors such as L-NMMA were ineffective. Inhibition of IFN-γ production was operating on a pre-translational level, as indicated by the inability of enriched NK cells to accumulate IFN-γ mRNA in the presence of elutriated monocytes. Hydrogen peroxide, at micromolar concentrations, reconstituted the inhibition of IFN-γ production when added to enriched NK cells. Histamine, a biogenic amine which inhibits the generation of reactive oxygen metabolites in monocytes, abrogated the inhibition of IFN-γ production in NK cells; by this mechanism, histamine strongly synergized with IL-2 to induce IFN-γ in mixtures of NK cells and monocytes. The synergizing effect of histamine was specifically mediated by H2-type histamine receptors. We conclude that: (i) the induction of IFN-γ mRNA in NK cells is effectively down-regulated by products of the oxidative metabolism of monocytes; and (ii) histamine effectively enhances IFN-γ production by preventing monocyte-induced oxidative damage to NK cells. PMID:8706348
Alvarez, Guillermo Cabrera; Madrid-Marina, Vicente; Jimenez-Mendez, Ricardo; Buitimea, Angel Leon; Román, Margarita Bahena; Cortez-Gomez, Rudyard; Esparza, Jorge Reyes; Rodríguez-Fragoso, Lourdes
2007-01-01
The aim of this study was to investigate the effects of combinations of pegilated-interferon (PEG-IFN), ribavirin, and danazol on thrombocytopenia and liver injury in rats with fibrosis. Male adult Wistar rats were treated with either mineral oil, danazol (0.83 mg/kg per day), PEG-interferon alpha-2a (PEG-IFN, 0.3 microg/ week) + ribavirin (12 mg/kg per day), PEG-IFN + ribavirin + danazol, CCl(4) (4 g/kg for eight weeks), CCl(4) + PEG-IFN + ribavirin, or CCl(4) + PEG-IFN + ribavirin+ danazol. The following assays were conducted: hematology, clinical chemistry, liver function, liver fibrosis, lymphocyte cytokine mRNA expression, and bone-marrow DNA content. Platelet counts were low in sham-treated animals and animals treated with PEG- IFN + ribavirin (30% and 25% respectively; P < 0.05). PEG-IFN + ribavirin + danazol reduced platelet counts of fibrotic animals by only 9% (P < 0.05). PEG- IFN + ribavirin reduced hepatic collagen content by 50%, whereas danazol + PEG-IFN + ribavirin reduced hepatic collagen content by 60% (P < 0.05). PEG-IFN + ribavirin reduced the total bilirubin concentration by 27%, alanine amino transferase (ALT) activity by 75% and gamma-glutamyl transpeptidase (gamma-GTP) activity by 74% (P < 0.05). In contrast, danazol + PEG-IFN + ribavirin reduced total bilirubin levels by 61%, alkaline phosphatase activity by 45%, ALT activity by 76%, and gamma-GTP activity by 74% (P < 0.05). The only treatment that increased interleukin 10 (IL-10) mRNA in fibrotic rats was PEG-IFN + ribavirin. However, danazol + PEG-IFN + ribavirin reduced the expression of IL-6, IL-10, tumor necrosis factor alpha and transforming growth factor ss. Bone-marrow DNA content was not altered by any treatment. In conclusion, PEG-IFN + ribavirin + danazol could be a new therapeutic option for patients with liver injury, fibrosis, and thrombocytopenia.
Kidane, Fana Alem; Mitra, Taniya; Wernsdorf, Patricia; Hess, Michael; Liebhart, Dieter
2018-01-01
Histomonosis is a parasitic disease of gallinaceous birds characterized by necrotic lesions in cacum and liver that usually turns fatal in turkeys while it is less severe in chickens. Vaccination using in vitro attenuated Histomonas meleagridis has been experimentally shown to confer protection against histomonosis. The protective mechanisms that underpin the vaccine-induced immune response are not resolved so far. Therefore, the actual study aimed to evaluate the location and quantitative distribution patterns of signature cytokines of type 1 [interferon gamma (IFN-γ)] or type 2 [interleukin (IL)-13] immune responses in vaccinated or infected hosts. An intergroup and interspecies difference in the spatial and temporal distribution patterns of cytokine mRNA positive cells was evident. Quantification of cells showed a significantly decreased percentage of IFN-γ mRNA positive cells at 4 days post-inoculation (DPI) in caeca of turkeys inoculated exclusively with the attenuated or the virulent inocula, compared to control birds. The decrement was followed by a surge of cells expressing mRNA for IFN-γ or IL-13, reaching a peak of increment at 10 DPI. By contrast, turkeys challenged following vaccination showed a slight increment of cecal IFN-γ mRNA positive cells at 4 DPI after which positive cell counts became comparable to control birds. The increase in infected birds was accompanied by an extensive distribution of positively stained cells up to the muscularis layer of cecal tissue whereas the vaccine group maintained an intact mucosal structure. In chickens, the level of changes of positive cells was generally lower compared to turkeys. However, control chickens were found with a higher percentage of IFN-γ mRNA positive cells in cecum compared to their turkey counterparts indicating a higher resistance to histomonosis, similar to the observation in immunized turkeys. In chickens, it could be shown that the changes of cytokine-positive cells were related to
Wang, C Q; Udupa, K B; Lipschitz, D A
1995-01-01
Interferon-gamma (INF-gamma) has been shown to suppress erythropoiesis and perhaps to contribute to the anemia of chronic disease. In this study we demonstrated that the concentration of INF gamma required to suppress murine burst forming unit-erythroid (BFU-E) growth was significantly less than that required to suppress colony forming unit-erythroid (CFU-E) growth. INF gamma acted at the most primitive step in erythroid progenitor cell differentiation and proliferation, as inhibition was maximal when added at the time of BFU-E culture initiation. Inhibition was progressively less if INF gamma addition was delayed after culture initiation. The effects of INF gamma on BFU-E did not require the presence of interleukin-1 alpha (IL-1 alpha), tumor necrosis factor-alpha (TNF alpha), or granulocyte macrophage colony stimulating factor (GM-CSF), as its effects were not neutralized by monoclonal antibodies against IL-1 alpha, TNF alpha, or GM-CSF. This applied whether INF gamma was added to culture with individual antibodies or with a combination of all three antibodies. INF gamma was not required for IL-1 alpha- or TNF alpha-induced suppression of BFU-E, as their effects were not neutralized by a monoclonal anti-INF gamma antibody. In contrast, GM-CSF-induced suppression of BFU-E was negated by the simultaneous addition of anti-INF gamma. We have previously shown that the addition of TNF alpha does not suppress BFU-E growth in cultures from marrow depleted of macrophages. Suppression did occur, however, if a small concentration of INF gamma that does not inhibit and increasing concentration of TNF alpha were added to culture, suggesting a synergistic effect between INF-gamma and TNF alpha. These observations suggest that INF gamma is a potent direct inhibitor of erythroid colony growth in vitro. It exerts its negative regulatory effect primarily on the earliest stages of erythroid progenitor cell differentiation and proliferation, as much higher doses are required to
Yun, Cheol H.; Lundgren, Anna; Azem, Josef; Sjöling, Åsa; Holmgren, Jan; Svennerholm, Ann-Mari; Lundin, B. Samuel
2005-01-01
Helicobacter pylori is known to induce a local immune response, which is characterized by activation of lymphocytes and the production of IFN-γ in the stomach mucosa. Since not only T cells, but also natural killer (NK) cells, are potent producers of gamma interferon (IFN-γ), we investigated whether NK cells play a role in the immune response to H. pylori infection. Our results showed that NK cells were present in both the gastric and duodenal mucosae but that H. pylori infection did not affect the infiltration of NK cells into the gastrointestinal area. Furthermore, we could show that NK cells could be activated directly by H. pylori antigens, as H. pylori bacteria, as well as lysate from H. pylori, induced the secretion of IFN-γ by NK cells. NK cells were also activated without direct contact when separated from the bacteria by an epithelial cell layer, indicating that the activation of NK cells by H. pylori can also occur in vivo, in the infected stomach mucosa. Moreover, the production of IFN-γ by NK cells was greatly enhanced when a small amount of interleukin-12 (IL-12) was added, and this synergistic effect was associated with increased expression of the IL-12 receptor β2. It was further evident that bacterial lysate alone was sufficient to induce the activation of cytotoxicity-related molecules. In conclusion, we demonstrated that NK cells are present in the gastroduodenal mucosa of humans and that NK cells produce high levels of IFN-γ when stimulated with a combination of H. pylori antigen and IL-12. We propose that NK cells play an active role in the local immune response to H. pylori infection. PMID:15731046
Durward-Diioia, Marina; Harms, Jerome; Khan, Mike; Hall, Cherisse; Smith, Judith A.
2015-01-01
Brucella melitensis is a well-adapted zoonotic pathogen considered a scourge of mankind since recorded history. In some cases, initial infection leads to chronic and reactivating brucellosis, incurring significant morbidity and economic loss. The mechanism by which B. melitensis subverts adaptive immunological memory is poorly understood. Previous work has shown that Brucella-specific CD8+ T cells express gamma interferon (IFN-γ) and can transition to long-lived memory cells but are not polyfunctional. In this study, chronic infection of mice with B. melitensis led to CD8+ T cell exhaustion, manifested by programmed cell death 1 (PD-1) and lymphocyte activation gene 3 (LAG-3) expression and a lack of IFN-γ production. The B. melitensis-specific CD8+ T cells that produced IFN-γ expressed less IFN-γ per cell than did CD8+ cells from uninfected mice. Both memory precursor (CD8+ LFA1HI CD127HI KLRG1LO) and long-lived memory (CD8+ CD27HI CD127HI KLRG1LO) cells were identified during chronic infection. Interestingly, after adoptive transfer, mice receiving cells from chronically infected animals were able to contain infection more rapidly than recipients of cells from acutely infected or uninfected donors, although the proportions of exhausted CD8+ T cells increased after adoptive transfer in both challenged and unchallenged recipients. CD8+ T cells of challenged recipients initially retained the stunted IFN-γ production found prior to transfer, and cells from acutely infected mice were never seen to transition to either memory subset at all time points tested, up to 30 days post-primary infection, suggesting a delay in the generation of memory. Here we have identified defects in Brucella-responsive CD8+ T cells that allow chronic persistence of infection. PMID:26416901
George, Joseph; Banik, Naren L.; Ray, Swapan K.
2011-01-01
Human telomerase reverse transcriptase (hTERT) is the catalytic component of telomerase that facilitates tumor cell invasion and proliferation. Telomerase and hTERT are remarkably upregulated in majority of cancers including glioblastoma. Interferon-gamma (IFN-γ) modulates several cellular activities including cell cycle and multiplication through transcriptional regulation. The present investigation was designed to unravel the molecular mechanisms of the inhibition of cell proliferation, migration, and invasion of human glioblastoma SNB-19 and LN-18 cell lines after knockdown of hTERT using a plasmid vector based siRNA and concurrent treatment with IFN-γ. We observed more than 80% inhibition of cell proliferation, migration, and invasion of both cell lines after the treatment with combination of hTERT siRNA and IFN-γ. Our studies also showed accumulation of apoptotic cells in subG1 phase and an increase in cell population in G0/G1 with a reduction in G2/M phase indicating cell cycle arrest in G0/G1 phase for apoptosis. Semiquantitative and real-time RT-PCR analyses demonstrated significant downregulation of c- Myc and upregulation of p21 Waf1 and p27 Kip1. Western blotting confirmed the downregulation of the molecules involved in cell proliferation, migration, and invasion and also showed upregulation of cell cycle inhibitors. In conclusion, our study demonstrated that knockdown of hTERT siRNA and concurrent treatment with IFN-γ effectively inhibited cell proliferation, migration, and invasion in glioblastoma cells through downregulation of the molecules involved in these processes and cell cycle inhibition. Therefore, the combination of hTERT siRNA and IFN-γ offers a potential therapeutic strategy for controlling growth of human glioblastoma cells. PMID:20394835
Evaluating pleural ADA, ADA2, IFN-γ and IGRA for diagnosing tuberculous pleurisy.
Keng, Li-Ta; Shu, Chin-Chung; Chen, Jason Yao-Ping; Liang, Sheng-Kai; Lin, Ching-Kai; Chang, Lih-Yu; Chang, Chia-Hao; Wang, Jann-Yuan; Yu, Chong-Jen; Lee, Li-Na
2013-10-01
Conventional methods for diagnosing tuberculous pleurisy (TB pleurisy) are either invasive or have a long turn-around-time. Performances of pleural adenosine deaminase (ADA), ADA2, interferon-gamma (IFN-γ), and interferon-gamma release assays (IGRA) as diagnostic tools for TB pleurisy were evaluated. Eighty-eight patients with lymphocyte-predominant pleural exudates between June 2010 and March 2011, including 31 with clinically diagnosed TB pleurisy, were prospectively studied. Pleural ADA and ADA2 activity were measured by colorimetric method, IFN-γ levels by enzyme-linked immuno-sorbent assay, and IGRA by enzyme-linked immuno-spot (T-SPOT.TB) assay. Pleural ADA, ADA2, and IFN-γ levels, but not the proportion of positive T-SPOT.TB assay, were significantly higher in patients with TB pleurisy than in those without TB pleurisy. The area under the receiver-operating-characteristic (ROC) curve was 0.920, 0.893, 0.875, and 0.544 for IFN-γ, ADA2, ADA, and T-SPOT.TB assay, respectively. The combination of ADA ≥ 40 IU/L and IFN-γ ≥ 75 pg/mL yielded a specificity of 100%. Pleural ADA, ADA2 and IFN-γ, but not T-SPOT.TB assay, are all sensitive and specific for TB pleurisy. In patients with lymphocyte-predominant pleural exudates, ADA ≥ 40 IU/L and IFN-γ ≥ 75 pg/mL in pleural effusion imply a very high probability of TB pleurisy. Copyright © 2013 The British Infection Association. Published by Elsevier Ltd. All rights reserved.
Jegaskanda, S.; Ahn, S. H.; Skinner, N.; Thompson, A. J.; Ngyuen, T.; Holmes, J.; De Rose, R.; Navis, M.; Winnall, W. R.; Kramski, M.; Bernardi, G.; Bayliss, J.; Colledge, D.; Sozzi, V.; Visvanathan, K.; Locarnini, S. A.; Kent, S. J.
2014-01-01
ABSTRACT The mechanisms by which hepatitis B virus (HBV) establishes and maintains chronic hepatitis B infection (CHB) are poorly defined. Innate immune responses play an important role in reducing HBV replication and pathogenesis. HBV has developed numerous mechanisms to escape these responses, including the production of the secreted hepatitis B e antigen (HBeAg), which has been shown to regulate antiviral toll-like receptor (TLR) and interleukin-1 (IL-1) signaling. IL-18 is a related cytokine that inhibits HBV replication in hepatoma cell lines and in the liver through the induction of gamma interferon (IFN-γ) by NK cells and T cells. We hypothesized that HBV or HBV proteins inhibit IFN-γ expression by NK cells as an accessory immunomodulatory function. We show that HBeAg protein inhibits the NF-κB pathway and thereby downregulates NK cell IFN-γ expression. Additionally, IFN-γ expression was significantly inhibited by exposure to serum from individuals with HBeAg-positive but not HBeAg-negative chronic HBV infection. Further, we show that the HBeAg protein suppresses IL-18-mediated NF-κB signaling in NK and hepatoma cells via modulation of the NF-κB pathway. Together, these findings show that the HBeAg inhibits IL-18 signaling and IFN-γ expression, which may play an important role in the establishment and/or maintenance of persistent HBV infection. IMPORTANCE It is becoming increasingly apparent that NK cells play a role in the establishment and/or maintenance of chronic hepatitis B infection. The secreted HBeAg is an important regulator of innate and adaptive immune responses. We now show that the HBeAg downregulates NK cell-mediated IFN-γ production and IL-18 signaling, which may contribute to the establishment of infection and/or viral persistence. Our findings build on previous studies showing that the HBeAg also suppresses the TLR and IL-1 signaling pathways, suggesting that this viral protein is a key regulator of antiviral innate immune responses
Williams, C M; Coleman, J W
1995-10-01
We examined the capacity of purified rat peritoneal connective tissue-type mast cells (PMC) to express mRNA for several cytokines. Stimulation of PMC with anti-IgE for 4 hr induced the expression of mRNA encoding interleukin-5 (IL-5), IL-6, tumour necrosis factor-alpha (TNF-alpha), macrophage inflammatory protein-2 (MIP-2) and interferon-gamma (IFN-gamma). Unstimulated PMC expressed detectable mRNA for TNF-alpha but not for the other four cytokines. Incubation of PMC with cyclosporin A (CsA) or dexamethasone (DEX), each at 10(-6) M for 24 hr, significantly inhibited the induced expression of mRNA for each of the five cytokines, and also inhibited release of biologically active TNF-alpha. Throughout these experiments mRNA levels of the housekeeping gene G3PDH were not altered by stimulation with anti-IgE or incubation with CsA or DEX. We conclude that immunological activation of rat PMC induces gene expression of several cytokines and that expression of these genes can be inhibited by immunosuppressive drugs.
Williams, C M; Coleman, J W
1995-01-01
We examined the capacity of purified rat peritoneal connective tissue-type mast cells (PMC) to express mRNA for several cytokines. Stimulation of PMC with anti-IgE for 4 hr induced the expression of mRNA encoding interleukin-5 (IL-5), IL-6, tumour necrosis factor-alpha (TNF-alpha), macrophage inflammatory protein-2 (MIP-2) and interferon-gamma (IFN-gamma). Unstimulated PMC expressed detectable mRNA for TNF-alpha but not for the other four cytokines. Incubation of PMC with cyclosporin A (CsA) or dexamethasone (DEX), each at 10(-6) M for 24 hr, significantly inhibited the induced expression of mRNA for each of the five cytokines, and also inhibited release of biologically active TNF-alpha. Throughout these experiments mRNA levels of the housekeeping gene G3PDH were not altered by stimulation with anti-IgE or incubation with CsA or DEX. We conclude that immunological activation of rat PMC induces gene expression of several cytokines and that expression of these genes can be inhibited by immunosuppressive drugs. Images Figure 1 Figure 2 Figure 3 PMID:7490125
Pang, W Y; Earley, B; Sweeney, T; Crowe, M A
2006-02-01
The objective of this study was to determine the effect of carprofen (C) administration before banding or burdizzo castration of bulls on cortisol, in vitro interferon-gamma (IFN-gamma) production, acute-phase proteins, feed intake, and growth. Fifty Holstein Friesian bulls (5.5 mo old; 191 +/- 3.7 kg) were blocked by weight and assigned randomly to 1 of 5 treatments (n = 10/treatment): 1) untreated control (2) banding castration at 0 min (Band); 3) Band following an i.v. injection of 1.4 mg/kg of BW of C at -20 min (Band+C); 4) Burdizzo castration at 0 min (Burd); or 5) Burd following 1.4 mg/kg of BW of C at -20 min (Burd+C). Castration acutely increased plasma cortisol concentrations compared with control; no significant differences occurred in peak and interval to peak cortisol responses between Band and Band+C or Burd and Burd+C groups. The administration of C in Band+C reduced (P < 0.05) the cortisol concentration between 6 and 12 h postcastration compared with Band animals. Overall, the integrated cortisol response was greater (P < 0.05) in the castrates than in control, whereas C treatments tended to reduce this response compared with Band (P = 0.08) and Burd (P = 0.07), respectively. Plasma fibrinogen was elevated in Band animals on d 14 and in Burd animals on d 3 and 14. Carprofen administration reduced Band- and Burd-induced fibrinogen production on d 14 and 3, respectively. Plasma haptoglobin was elevated in Band animals on d 3 and 35 compared with control, and C administration was effective in reducing the haptoglobin elevation on d 35 in Band+C compared with Band. There were no differences among treatments in in vitro IFN-gamma production induced by concanavalin A and phytohemagglutinin on d 1 and 2. Overall from d -1 to 16, there were no DMI differences among treatments. From d -1 to 35, there were no ADG differences among treatments. In conclusion, banding and burdizzo castration increased plasma cortisol with no change in in vitro IFN-gamma
Interferon-gamma, macrophages, and virus spread after HSV-1 injection.
Cathcart, Heather M; Zheng, Mei; Covar, Jason J; Liu, Yi; Podolsky, Robert; Atherton, Sally S
2011-06-07
After uniocular anterior chamber (AC) injection of HSV-1, the anterior segment of BALB/c mice becomes inflamed and infected; however, virus does not spread from the anterior segment to cause retinitis in the injected eye. The purpose of these studies was to determine whether interferon (IFN-)-γ and Mac-1(+) cells play a role in preventing direct anterior-to-posterior spread of HSV-1 in the injected eye. One AC of adult female BALB/c mice was injected with HSV-1 (KOS). The location of IFN-α, IFN-β, and IFN-γ in the injected eye was determined by immunofluorescence, and mRNA expression was quantified by qPCR. Injected eyes of IFN-γ knockout or clodronate-treated macrophage-depleted mice were examined to determine whether the absence of IFN-γ or Mac-1(+) macrophages affected the sites or timing of virus spread. IFN-α, IFN-β, and IFN-γ were observed in the anterior segment of injected eyes through 72 hours and mRNA levels of IFN-β and IFN-γ were increased in virus-infected eyes 48 to 120 hours after infection. However, the absence of IFN-γ or macrophages did not affect either the sites or the timing of HSV-1 infection in injected eyes. Protection of the retina of the injected eye does not depend on a single cell type or cytokine. In addition, in the eye, as in other sites of the body, there are redundancies in the innate response to virus infection.
Shaik, Junaid; Pillay, Manormoney; Jeena, Prakash
2014-09-01
Successful control of childhood TB requires early diagnosis, effective chemotherapy and a method of evaluating the response to therapy. Identification of suitable biomarkers that predict the response to anti-TB therapy may allow the duration of treatment to be shortened. The majority of biomarker studies in paediatric TB have focused on the role of T cell-based interferon-gamma (IFN-γ) release assays (IGRAs) in the diagnosis of either latent or active disease. Little has been published on the role of IGRAs in the monitoring response to therapy in children. We reviewed the available literature to ascertain the value of IGRAs in the monitoring of response to anti-TB therapy in children. We explored the results of the few studies that have investigated the role of IGRAs as markers of response to anti-TB treatment in children. We conclude that the role of IGRAs as surrogate markers appears promising. Robust clinical trials are, however, needed to entrench the value of IGRAs as surrogate biomarkers of response to anti-TB therapy in children. Copyright © 2013 Elsevier Ltd. All rights reserved.
Longbottom, E Rebecca; Torrance, Hew D T; Owen, Helen C; Fragkou, Paraskevi C; Hinds, Charles J; Pearse, Rupert M; O'Dwyer, Michael J
2016-08-01
The aim of this study was to evaluate the role of interleukin (IL)-6 pathways in postoperative immune suppression and to assess the reversibility of this phenomenon. The postoperative period is characterized by increased IL-6 production and features of immune suppression. In vitro, IL-6 mediates anti-inflammatory effects through inhibition of interferon gamma (IFN-γ) pathways. The significance of the immunomodulatory effects of IL-6 in the clinical setting of postoperative immune suppression remains unclear. Patients over 45 years old undergoing elective surgery, involving the gastrointestinal tract, were recruited. IL-6 levels were assayed using an enzyme linked immunosorbent assay preoperatively, and at 24 and 48 hours. Peripheral blood mononuclear cells from healthy volunteers were cultured in perioperative serum and CD14Human Leukocyte Antigen-DR (HLA-DR) [monocyte HLA-DR (mHLA-DR)] geometric mean florescent intensity was measured in the presence and absence of IL-6 neutralizing antibody and recombinant IFN-γ. Of the 108 patients, 41 developed a postoperative infection. The IL-6 levels increased 19-fold from the preoperative sample to 24 hours postoperatively (P < 0.0001). Higher IL-6 levels at 24 (P = 0.0002) and 48 hours (P = 0.003) were associated with subsequent postoperative infectious complications. mHLA-DR mean florescent intensity fell when healthy peripheral blood mononuclear cells were cultured with postoperative serum compared with preoperative serum (P = 0.008). This decrease was prevented by the presence of IFN-γ in the culture media, but not by the presence of IL-6-neutralizing antibody. IL-6 levels increase after a major surgery and are associated with an increased susceptibility to postoperative infections. Serum obtained from postoperative patients induces an immunosuppressive response, reflected in reduced mHLA-DR levels, mediated through IL-6 independent pathways and is reversible with IFN-γ. These data may have
Park, Sookyoung; Nozaki, Kenkichi; Smith, Joshua A.; Krause, James S.; Banik, Naren L.
2014-01-01
Insulin-like growth factor-1 (IGF-1) is a neuroprotective growth factor that promotes neuronal survival by inhibition of apoptosis. In order to examine whether IGF-1 exerts cytoprotective effects against extracellular inflammatory stimulation, ventral spinal cord 4.1 (VSC4.1) motoneuron cells were treated with interferon-gamma (IFN-γ). Our data demonstrated apoptotic changes, increased calpain:calpastatin and Bax:Bcl-2 ratios, and expression of apoptosis related proteases (caspase-3 and −12) in motoneurons rendered by IFN-γ in a dose-dependent manner. Post-treatment with IGF-1 attenuated these changes. In addition, IGF-1 treatment of motoneurons exposed to IFN-γ decreased expression of inflammatory markers (cyclooxygenase-2 and nuclear factor-kappa B:inhibitor of kappa B ratio). Furthermore, IGF-1 attenuated the loss of expression of IGF-1 receptors (IGF-1Rα and IGF-1Rβ) and estrogen receptors (ERα and ERβ) induced by IFN-γ. To determine whether the protective effects of IGF-1 are associated with ERs, ERs antagonist ICI and selective siRNA targeted against ERα and ERβ were used in VSC4.1 motoneurons. Distinctive morphological changes were observed following siRNA knockdown of ERα and ERβ. In particular, apoptotic cell death assessed by TUNEL assay was enhanced in both ERα and ERβ-silenced VSC4.1 motoneurons following IFN-γ and IGF-1 exposure. These results suggest that IGF-1 protects motoneurons from inflammatory insult by a mechanism involving pivotal interactions with ERα and ERβ. PMID:24188094
Franssila, R; Auramo, J; Modrow, S; Möbs, M; Oker-Blom, C; Käpylä, P; Söderlund-Venermo, M; Hedman, K
2005-01-01
Human parvovirus B19 is a small non-enveloped DNA virus with an icosahedral capsid consisting of proteins of only two species, the major protein VP2 and the minor protein VP1. VP2 is contained within VP1, which has an additional unique portion (VP1u) of 227 amino acids. We determined the ability of eukaryotically expressed parvovirus B19 virus-like particles consisting of VP1 and VP2 in the ratio recommended for vaccine use, or of VP2 alone, to stimulate, in an HLA class II restricted manner, peripheral blood mononuclear cells (PBMC) to proliferate and to secrete interferon gamma (IFN-γ) and interleukin (IL)-10 cytokines among recently and remotely B19 infected subjects. PBMC reactivity with VP1u was determined specifically with a prokaryotically expressed VP1u antigen. In general, B19-specific IFN-γ responses were stronger than IL-10 responses in both recent and remote infection; however, IL-10 responses were readily detectable among both groups, with the exception of patients with relapsed or persisting symptoms who showed strikingly low IL-10 responses. Whereas VP1u-specific IFN-γ responses were very strong among the recently infected subjects, the VP1u-specific IFN-γ and IL-10 responses were virtually absent among the remotely infected subjects. The disappearance of VP1u-specific IFN-γ expression is surprising, as B-cell immunity against VP1u is well maintained. PMID:16178856
Noh, G; Jang, E H
2014-01-01
Specific oral tolerance induction (SOTI) for IgE-mediated food allergy (IFA) can be successfully achieved using interfero gamma (classic SOTI). In this study, a tolerable dose was introduced during tolerance induction with interferon gamma (dual SOTI), and its effectiveness was evaluated. The study population comprised 25 IFA patients. Blood samples were taken for analysis, including complete blood count with differential counts of eosinophils, serum total IgE levels, and specific IgE for allergenic foods. Skin prick tests were conducted with the allergens. Oral food challenges were performed to diagnose IFA. Ten patients received dual SOTI, 5 received classic SOTI, 5 received SOTI without interferon gamma (original SOTI), and 5 were not treated (controls). Patients treated with dual SOTI and classic SOTI using interferon gamma became tolerant to the allergenic food. The tolerable dose was introduced successfully in dual SOTI. It was difficult to proceed with the same dosing protocol used for classic SOTI in cases treated with original SOTI. Following dual SOTI, the systemic reaction to oral intake subsided, but the local skin reaction to contact with the allergenic food persisted. Dual SOTI is an improved protocol for SOTI using interferon gamma for IFA.The local skin reaction and systemic reaction to oral intake were dissociated following dual SOTI. In cases of food allergy, tolerance appears to result from desensitization to allergens.
Ahn, H J; Tomura, M; Yu, W G; Iwasaki, M; Park, W R; Hamaoka, T; Fujiwara, H
1998-12-01
While IL-12 is known to activate JAK2 and TYK2 and induce the phosphorylation of STAT4 and STAT3, little is known regarding how the activation of these signaling molecules is related to the biologic effects of IL-12. Using an IL-12-responsive T cell clone (2D6), we investigated their requirements for proliferation and IFN-gamma production of 2D6 cells. 2D6 cells could be maintained with either IL-12 or IL-2. 2D6 lines maintained with IL-12 (2D6(IL-12)) or IL-2 (2D6(IL-2)) exhibited comparable levels of proliferation, but produced large or only small amounts of IFN-gamma, respectively, when restimulated with IL-12 after starvation of either cytokine. 2D6(IL-12) induced TYK2 and STAT4 phosphorylation. In contrast, their phosphorylation was marginally induced in 2D6(IL-2). The reduced STAT4 phosphorylation was due to a progressive decrease in the amount of STAT4 protein along with the passages in IL-2-containing medium. 2D6(IL-12) and 2D6(IL-2) similarly proliferating in response to IL-12 induced comparable levels of JAK2 activation and STAT5 phosphorylation. JAK2 was associated with STAT5, and IL-12-induced STAT5 phosphorylation was elicited in the absence of JAK3 activation. These results indicate that IL-12 has the capacity to induce/maintain STAT4 and STAT5 proteins, and that TYK2 and JAK2 activation correlate with STAT4 phosphorylation/IFN-gamma induction and STAT5 phosphorylation/cellular proliferation, respectively.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Badger, A.M.; Swift, B.; Sung, C.P.
1986-03-05
Recombinant murine gamma interferon (IFN-..gamma..) activates oil elicited C57BL/6 peritoneal macrophages to inhibit the growth of Listeria. Maximum activity is obtained with 10-20 units/ml, can be demonstrated in the absence of antibiotics and is not due to LPS contamination. Studies of the kinetics of this phenomenon demonstrate that a 30 minute incubation with IFN-..gamma.. is sufficient to initiate the antiproliferative state and full activity can be obtained with a 4 hour incubation. Alpha/beta interferon (IFN-..cap alpha../..beta..) is also active but requires 100X more units to obtain equivalent activity. The evaluation of a number of other BRMS demonstrated that MDP andmore » LPS could stimulate phagocytosis of Listeria but could not inhibit their growth. Bestatin, tuftsin, Con A, A23187 and Poly I:C did not stimulate either phagocytosis or growth inhibitory activity. These compounds were also tested for their ability to enhance the release of superoxide anion from PMA stimulated macrophages. With the exception of tuftsin and bestatin all of the BRMS tested were able to enhance the production of oxidative burst products confirming the findings of others of the dissociation between the two functions.« less
Bielecka, Teresa; Komorowska-Piotrowska, Anna; Krenke, Katarzyna; Feleszko, Wojciech; Kulus, Marek
2018-02-01
To assess whether children ≤5 years of age, produce sufficient amounts of interferon gamma (IFN-ɣ) in response to phytohaemagglutinin (mitogen), and Mycobacterium tuberculosis antigens (TB antigens) in the QuantiFERON-TB Gold in-Tube test (QFT-GIT), (Cellestis Ltd., Australia). Is TB-antigen-induced IFN-ɣ response in children ≤5 years sufficient to consider QFT-GIT a possible tool for TB diagnostics? Study design, patient-subject selection, and methods: We recruited children 0-17 years old suspected of TB infection to this cross-sectional study, in whom QFT-GIT and TST were performed. We analyzed the median IFN-ɣ levels in mitogen and TB antigen tubes in children ≤5 years and >5 years, and the correlation between IFN-ɣ level in both tubes and age. A total of 153 children were enrolled, age median was 7.8 (IQR:8), 45 (29.4%) aged ≤5 years (median 3.4, IQR:1.7), 108 > 5 years (median 10.55, IQR:5.93). In the mitogen tubes, the median IFN-ɣ level was higher in children >5 years (median 17.87, IQR:2.1 vs 16.77, IQR:7.6), but surprisingly in the TB antigen tubes it was higher in the younger group (median 0.12, IQR:0.21vs 0.06, IQR:0.09, P = 0.04). We proved a positive correlation between IFN-ɣ level and age in mitogen tubes (r = 0.18, P = 0.03) and a negative correlation in TB antigen tubes (r = -0.17, P = 0.04). In latent tuberculosis infection patients, the latter correlation was found to be even stronger (r = -0.39, P = 0.01). The youngest children release sufficient amount of IFN-ɣ in response to TB antigens thus QFT-GIT might be a useful tool for TB diagnostics in this age group. © 2017 Wiley Periodicals, Inc.
Dinges, Martin M.; Schlievert, Patrick M.
2001-01-01
The superantigenic function of toxic shock syndrome toxin 1 (TSST-1) is generally regarded as an important determinant of its lethal effects in humans or experimental animals. This study examined the role of superantigenicity in a BALB/c mouse model of lethal TSST-1-induced hypersensitivity to lipopolysaccharide (LPS). In this model, TSST-1 greatly potentiated both LPS-induced lethality, as well as LPS-induced serum tumor necrosis factor alpha (TNF-α) activity. Although BALB/c-SCID mice were resistant to these LPS enhancement effects of TSST-1, BALB/c-SCID mice reconstituted with T cells were completely susceptible to the enhancement effect of TSST-1 on LPS-induced serum TNF-α. Mice pretreated with cyclosporine (Cs) or neutralizing antibodies against gamma interferon (IFN-γ) did not develop lethal LPS hypersensitivity when injected with TSST-1, and these agents reduced the enhancement effect of TSST-1 on LPS-induced serum TNF-α by 99 and 85%, respectively. Cs pretreatment also completely inhibited the known capacity of TSST-1 to amplify LPS-induced levels of IFN-γ in serum. In contrast, mice given Cs after a priming injection of TSST-1, but before LPS, still exhibited lethal hypersensitivity to LPS. Cs given after TSST-1 also did not inhibit enhancement of LPS-induced serum TNF-α by TSST-1 but inhibited the enhancement effect of TSST-1 on LPS-induced serum IFN-γ by 50%. These experiments support the theory that TSST-1-induced hypersensitivity to LPS is mediated primarily by IFN-γ derived from superantigen-activated T cells. PMID:11179286
Santin, Miguel; García-García, José-María; Rigau, David; Altet, Neus; Anibarro, Luis; Casas, Irma; Díez, Nuria; García-Gasalla, Mercedes; Martínez-Lacasa, Xavier; Penas, Antón; Pérez-Escolano, Elvira; Sánchez, Francisca; Domínguez, José
2016-09-01
Interferon-gamma release assays are widely used for the diagnosis of tuberculosis infection in Spain. However, there is no consensus on their application in specific clinical scenarios. To develop a guide-line for their use, a panel of experts comprising specialists in infectious diseases, respiratory diseases, microbiology, pediatrics and preventive medicine, together with a methodologist, conducted a systematic literature search, summarized the findings, rated the quality of the evidence, and formulated recommendations following the Grading of Recommendations of Assessment Development and Evaluations methodology. This document provides evidence-based guidance on the use of interferon-gamma release assays for the diagnosis of tuberculosis infection in patients at risk of tuberculosis or suspected of having active disease. The guidelines will be applicable to specialist and primary care, and public health. Copyright © 2016 SEPAR. Publicado por Elsevier España, S.L.U. All rights reserved.
Gupta, Kanupriya; Ogendi, Brian M. O.; Bakshi, Rakesh K.; Kapil, Richa; Press, Christen G.; Sabbaj, Steffanie; Lee, Jeannette Y.
2017-01-01
ABSTRACT Chlamydia trachomatis infection is the most prevalent bacterial sexually transmitted infection and can cause significant reproductive morbidity in women. There is insufficient knowledge of C. trachomatis-specific immune responses in humans, which could be important in guiding vaccine development efforts. In contrast, murine models have clearly demonstrated the essential role of T helper type 1 (Th1) cells, especially interferon gamma (IFN-γ)-producing CD4+ T cells, in protective immunity to chlamydia. To determine the frequency and magnitude of Th1 cytokine responses elicited to C. trachomatis infection in humans, we stimulated peripheral blood mononuclear cells from 90 chlamydia-infected women with C. trachomatis elementary bodies, Pgp3, and major outer membrane protein and measured IFN-γ-, tumor necrosis factor alpha (TNF-α)-, and interleukin-2 (IL-2)-producing CD4+ and CD8+ T-cell responses using intracellular cytokine staining. The majority of chlamydia-infected women elicited CD4+ TNF-α responses, with frequency and magnitude varying significantly depending on the C. trachomatis antigen used. CD4+ IFN-γ and IL-2 responses occurred infrequently, as did production of any of the three cytokines by CD8+ T cells. About one-third of TNF-α-producing CD4+ T cells coproduced IFN-γ or IL-2. In summary, the predominant Th1 cytokine response elicited to C. trachomatis infection in women was a CD4+ TNF-α response, not CD4+ IFN-γ, and a subset of the CD4+ TNF-α-positive cells produced a second Th1 cytokine. PMID:28100498
ElAlfy, Mohsen Saleh; Adly, Amira Abdel Moneam; Ebeid, Fatma Soliman ElSayed; Eissa, Deena Samir; Ismail, Eman Abdel Rahman; Mohammed, Yasser Hassan; Ahmed, Manar Elsayed; Saad, Aya Sayed
2018-06-20
Sickle cell disease (SCD) is associated with alterations in immune phenotypes. CD4 + CD28 null T lymphocytes have pro-inflammatory functions and are linked to vascular diseases. To assess the percentage of CD4 + CD28 null T lymphocytes, natural killer cells (NK), and IFN-gamma levels, we compared 40 children and adolescents with SCD with 40 healthy controls and evaluated their relation to disease severity and response to therapy. Patients with SCD steady state were studied, focusing on history of frequent vaso-occlusive crisis, hydroxyurea therapy, and IFN-gamma levels. Analysis of CD4 + CD28 null T lymphocytes and NK cells was done by flow cytometry. Liver and cardiac iron overload were assessed. CD4 + CD28 null T lymphocytes, NK cells, and IFN-gamma levels were significantly higher in patients than controls. Patients with history of frequent vaso-occlusive crisis and those with vascular complications had higher percentage of CD4 + CD28 null T lymphocytes and IFN-gamma while levels were significantly lower among hydroxyurea-treated patients. CD4 + CD28 null T lymphocytes were positively correlated to transfusional iron input while these cells and IFN-gamma were negatively correlated to cardiac T2* and duration of hydroxyurea therapy. NK cells were correlated to HbS and indirect bilirubin. Increased expression of CD4 + CD28 null T lymphocytes highlights their role in immune dysfunction and pathophysiology of SCD complications.
Interferon-γ Inhibits Ebola Virus Infection.
Rhein, Bethany A; Powers, Linda S; Rogers, Kai; Anantpadma, Manu; Singh, Brajesh K; Sakurai, Yasuteru; Bair, Thomas; Miller-Hunt, Catherine; Sinn, Patrick; Davey, Robert A; Monick, Martha M; Maury, Wendy
2015-01-01
Ebola virus outbreaks, such as the 2014 Makona epidemic in West Africa, are episodic and deadly. Filovirus antivirals are currently not clinically available. Our findings suggest interferon gamma, an FDA-approved drug, may serve as a novel and effective prophylactic or treatment option. Using mouse-adapted Ebola virus, we found that murine interferon gamma administered 24 hours before or after infection robustly protects lethally-challenged mice and reduces morbidity and serum viral titers. Furthermore, we demonstrated that interferon gamma profoundly inhibits Ebola virus infection of macrophages, an early cellular target of infection. As early as six hours following in vitro infection, Ebola virus RNA levels in interferon gamma-treated macrophages were lower than in infected, untreated cells. Addition of the protein synthesis inhibitor, cycloheximide, to interferon gamma-treated macrophages did not further reduce viral RNA levels, suggesting that interferon gamma blocks life cycle events that require protein synthesis such as virus replication. Microarray studies with interferon gamma-treated human macrophages identified more than 160 interferon-stimulated genes. Ectopic expression of a select group of these genes inhibited Ebola virus infection. These studies provide new potential avenues for antiviral targeting as these genes that have not previously appreciated to inhibit negative strand RNA viruses and specifically Ebola virus infection. As treatment of interferon gamma robustly protects mice from lethal Ebola virus infection, we propose that interferon gamma should be further evaluated for its efficacy as a prophylactic and/or therapeutic strategy against filoviruses. Use of this FDA-approved drug could rapidly be deployed during future outbreaks.
Maroufi, Yahya; Ghaffarifar, Fatemeh; Dalimi, Abdolhosein; Sharifi, Zohreh
2014-06-01
Cutaneous leishmaniasis is a health problem in the world. Lesions should be treated on cosmetically or functionally important sites, such as the face and hands. Cantharidin is a terpenoid compound produced naturally by beetles of Meloidae and Oedemeridae families. The current study aimed to investigate the effect of cantharidin on Cutaneous Leishmaniasis (CL) lesions and IFN-γ and IL-4 patterns in infected BALB/c mice. INFECTED BALB/C MICE WERE DIVIDED INTO FIVE GROUPS AS: untreated (control group), eucerin-treated and 0.05%, 0.1% and 0.5% cantharidin-treated. Lesions diameter was measured by Vernier caliper every three days for four weeks. Cytokines levels were measured by enzyme-linked immunosorbent assay (ELISA) using U-CyTech kit. The results indicated that treatment with cantharidin exacerbates lesions compared with the controls, except for 0.05% cantharidin dose that restrained lesion growth significantly. Interferon gamma level in cantharidin-treated groups was significantly less than that of the control group. But interlukin-4 level was similar among the groups. The current study results indicated that high doses of cantharidin exacerbates leishmaniasis lesion, but low dose of cantharidin inhibits lesion growth.
Maroufi, Yahya; Ghaffarifar, Fatemeh; Dalimi, Abdolhosein; Sharifi, Zohreh
2014-01-01
Background: Cutaneous leishmaniasis is a health problem in the world. Lesions should be treated on cosmetically or functionally important sites, such as the face and hands. Cantharidin is a terpenoid compound produced naturally by beetles of Meloidae and Oedemeridae families. Objectives: The current study aimed to investigate the effect of cantharidin on Cutaneous Leishmaniasis (CL) lesions and IFN-γ and IL-4 patterns in infected BALB/c mice. Materials and Methods: Infected BALB/c mice were divided into five groups as: untreated (control group), eucerin-treated and 0.05%, 0.1% and 0.5% cantharidin-treated. Lesions diameter was measured by Vernier caliper every three days for four weeks. Cytokines levels were measured by enzyme-linked immunosorbent assay (ELISA) using U-CyTech kit. Results: The results indicated that treatment with cantharidin exacerbates lesions compared with the controls, except for 0.05% cantharidin dose that restrained lesion growth significantly. Interferon gamma level in cantharidin-treated groups was significantly less than that of the control group. But interlukin-4 level was similar among the groups. Conclusions: The current study results indicated that high doses of cantharidin exacerbates leishmaniasis lesion, but low dose of cantharidin inhibits lesion growth. PMID:25371808
Inflammation activates the interferon signaling pathways in taste bud cells.
Wang, Hong; Zhou, Minliang; Brand, Joseph; Huang, Liquan
2007-10-03
Patients with viral and bacterial infections or other inflammatory illnesses often experience taste dysfunctions. The agents responsible for these taste disorders are thought to be related to infection-induced inflammation, but the mechanisms are not known. As a first step in characterizing the possible role of inflammation in taste disorders, we report here evidence for the presence of interferon (IFN)-mediated signaling pathways in taste bud cells. IFN receptors, particularly the IFN-gamma receptor IFNGR1, are coexpressed with the taste cell-type markers neuronal cell adhesion molecule and alpha-gustducin, suggesting that both the taste receptor cells and synapse-forming cells in the taste bud can be stimulated by IFN. Incubation of taste bud-containing lingual epithelia with recombinant IFN-alpha and IFN-gamma triggered the IFN-mediated signaling cascades, resulting in the phosphorylation of the downstream STAT1 (signal transducer and activator of transcription protein 1) transcription factor. Intraperitoneal injection of lipopolysaccharide or polyinosinic:polycytidylic acid into mice, mimicking bacterial and viral infections, respectively, altered gene expression patterns in taste bud cells. Furthermore, the systemic administration of either IFN-alpha or IFN-gamma significantly increased the number of taste bud cells undergoing programmed cell death. These findings suggest that bacterial and viral infection-induced IFNs can act directly on taste bud cells, affecting their cellular function in taste transduction, and that IFN-induced apoptosis in taste buds may cause abnormal cell turnover and skew the representation of different taste bud cell types, leading to the development of taste disorders. To our knowledge, this is the first study providing direct evidence that inflammation can affect taste buds through cytokine signaling pathways.
Devane, John G; Martin, Mary L; Matson, Mark A
2014-06-01
Flu-like symptoms (FLS) are commonly experienced by patients receiving interferon gamma-1b which may cause discontinuation or disruption of dosing during initial therapy or on re-initiation following a break in therapy. In contrast to Type I interferons, the impact of dose-titration on FLS has not been reported and is not a practice described or included in the approved prescribing information for interferon gamma-1b.The objective of this study was to assess the effect of a 2 week titration regimen on the severity of FLS during the initial 3 weeks of therapy with three times weekly subcutaneous injections of interferon gamma-1b. Healthy men and women were randomized into a double-blind, two-period, crossover study. Each study period was 3 weeks in duration and there was a minimum 15 day washout between treatment periods. Two treatment regimens were compared: No Titration dosing (full 50 mcg/m(2) subcutaneously [s.c.] three times weekly for 3 weeks) and Titration (15 mcg/m(2) s.c. three times weekly during week 1, 30 mcg/m(2) s.c. three times weekly during week 2 followed by the full dose of 50 mcg/m(2) s.c. three times weekly during week 3). Subjects remained in the clinic for at least 12 hours following each injection. FLS was based on a composite score for fever, chills, tiredness and muscle aches assessed at baseline and 4, 8 and 12 hours following each injection. Acetaminophen was allowed at the discretion of the PI. The primary endpoint was the change from baseline in FLS severity at 8 hours averaged over the 3 weeks of treatment. Additional endpoints included FLS at 4 and 12 hours, individual flu-like symptoms, rates of discontinuation, incidence of FLS and acetaminophen use. NCT 01929382. Of the 40 subjects randomized, there were 15 (37.5%) discontinuations. Titration resulted in a significant reduction in FLS severity at 8 hours (p = 0.023) averaged over the 3 week treatment period. The difference in 3 week FLS severity reflects differences
Smirnova, Natalia P; Webb, Brett T; McGill, Jodi L; Schaut, Robert G; Bielefeldt-Ohmann, Helle; Van Campen, Hana; Sacco, Randy E; Hansen, Thomas R
2014-04-01
Development of transplacental infection depends on the ability of the virus to cross the placenta and replicate within the fetus while counteracting maternal and fetal immune responses. Unfortunately, little is known about this complex process. Non-cytopathic (ncp) strains of bovine viral diarrhea virus (BVDV), a pestivirus in the Flaviviridae family, cause persistent infection in early gestational fetuses (<150 days; persistently infected, PI), but are cleared by immunocompetent animals and late gestational fetuses (>150 days; transiently infected, TI). Evasion of innate immune response and development of immunotolerance to ncp BVDV have been suggested as possible mechanisms for the establishment of the persistent infection. Previously we have observed a robust temporal induction of interferon (IFN) type I (innate immune response) and upregulation of IFN stimulated genes (ISGs) in BVDV TI fetuses. Modest chronic upregulation of ISGs in PI fetuses and calves reflects a stimulated innate immune response during persistent BVDV infection. We hypothesized that establishing persistent fetal BVDV infection is also accompanied by the induction of IFN-gamma (IFN-γ). The aims of the present study were to determine IFN-γ concentration in blood and amniotic fluid from control, TI and PI fetuses during BVDV infection and analyze induction of the IFN-γ downstream pathways in fetal lymphoid tissues. Two experiments with in vivo BVDV infections were completed. In Experiment 1, pregnant heifers were infected with ncp BVDV type 2 on day 75 or 175 of gestation or kept naïve to generate PI, TI and control fetuses, respectively. Fetuses were collected by Cesarean section on day 190. In Experiment 2, fetuses were collected on days 82, 89, 97, 192 and 245 following infection of pregnant heifers on day 75 of gestation. The results were consistent with the hypothesis that ncp BVDV infection induces IFN-γ secretion during acute infection in both TI and PI fetuses and that lymphoid
Duez, C; Gras-Masse, H; Hammad, H; Akoum, H; Didierlaurent, A; André, C; Tonnel, A B; Pestel, J
2001-01-01
We have previously established a model to study the in vivo human IgE response using humanized SCID mice. Allergic SCID mice were obtained following intraperitoneal injection with mononuclear cells from Dermatophagoides pteronyssinus (Dpt)-sensitive patients, and sensitization by Dpt allergen intraperitoneal injection (immunization) or Dpt aerosol (inhalation). Human serum IgE was measured in allergic SCID mice after administration of human recombinant IFN-gamma or the lipopeptide LP 52-71 (derived from peptide p52-71 from Der p 1, Dpt major allergen, coupled to a lipophilic moiety), during the immunization or the inhalation phase. IFN-gamma inhibited human IgE production when given at the time of immunization, but not during inhalation. This effect was long-lasting as Dpt aerosol, given one month after immunization and IFN-gamma administration, failed to increase IgE levels. Unlike Dpt or p52-71, LP 52-71 failed to induce human IgE production at day 14 and 21 after its injection, but did inhibit the development of the IgE response after a secondary Dpt-challenge. Moreover, LP 52-71 administration 14 days after Dpt inhalation decreased IgE levels, in contrast to peptide 52-71, which increased IgE levels. Thus, taken together these results indicate that the development of the human IgE response in allergic SCID mice can be modulated by modified allergen and a Th1 cytokine.
Al-Tawfiq, Jaffar A; Al-Abdely, Hail M
2010-05-01
We report a case of invasive aspergillosis due to Aspergillus fumigatus involving the cervical and thoracic vertebrae and upper mediastinum of a 17 year-old Saudi male with chronic granulomatous disease (CGD). The patient did not respond to a long course of liposomal amphotericin B but did to surgical drainage and a combination of caspofungin and itraconazole with subsequent suppression with oral voriconazole. Fourteen months after the start of therapy, the patient had anterior dislocation of T2 thoracic vertebra with cord transection and quadriplegia. He was then treated intravenously with liquid itraconazole and interferon-gamma. The patient made a remarkable recovery over a 2-year period and was eventually able to walk independently. Thus, a combination of antifungals and interferon-gamma may have resulted in the positive outcome in this case.
Huang, T J; MacAry, P A; Eynott, P; Moussavi, A; Daniel, K C; Askenase, P W; Kemeny, D M; Chung, K F
2001-01-01
Th2 T cell immune-driven inflammation plays an important role in allergic asthma. We studied the effect of counterbalancing Th1 T cells in an asthma model in Brown Norway rats that favors Th2 responses. Rats received i.v. transfers of syngeneic allergen-specific Th1 or Th2 cells, 24 h before aerosol exposure to allergen, and were studied 18-24 h later. Adoptive transfer of OVA-specific Th2 cells, but not Th1 cells, and OVA, but not BSA exposure, induced bronchial hyperresponsiveness (BHR) to acetylcholine and eosinophilia in a cell number-dependent manner. Importantly, cotransfer of OVA-specific Th1 cells dose-dependently reversed BHR and bronchoalveolar lavage (BAL) eosinophilia, but not mucosal eosinophilia. OVA-specific Th1 cells transferred alone induced mucosal eosinophilia, but neither BHR nor BAL eosinophilia. Th1 suppression of BHR and BAL eosinophilia was allergen specific, since cotransfer of BSA-specific Th1 cells with the OVA-specific Th2 cells was not inhibitory when OVA aerosol alone was used, but was suppressive with OVA and BSA challenge. Furthermore, recipients of Th1 cells alone had increased gene expression for IFN-gamma in the lungs, while those receiving Th2 cells alone showed increased IL-4 mRNA. Importantly, induction of these Th2 cytokines was inhibited in recipients of combined Th1 and Th2 cells. Anti-IFN-gamma treatment attenuated the down-regulatory effect of Th1 cells. Allergen-specific Th1 cells down-regulate efferent Th2 cytokine-dependent BHR and BAL eosinophilia in an asthma model via mechanisms that depend on IFN-gamma. Therapy designed to control the efferent phase of established asthma by augmenting down-regulatory Th1 counterbalancing mechanisms should be effective.
Clancy, R L; Gleeson, M; Cox, A; Callister, R; Dorrington, M; D'Este, C; Pang, G; Pyne, D; Fricker, P; Henriksson, A
2006-04-01
Fatigue and impaired performance in athletes is well recognised and has been loosely linked to "overtraining". Reduced concentration of IgA in the saliva and increased shedding of Epstein Barr virus (EBV) have been associated with intense training in elite athletes. To determine whether athletes presenting with fatigue and impaired performance had an immune defect relevant to defective containment of EBV infection, and whether a probiotic preparation (Lactobacillus acidophilus) shown to enhance mucosal immunity in animal models could reverse any detected abnormality. The fatigued athletes had clinical characteristics consistent with re-activation of EBV infection and significantly (p = 0.02) less secretion of interferon (IFN) gamma from blood CD4 positive T cells. After one month of daily capsules containing 2 x 10(10) colony forming units of L acidophilus, secretion of IFNgamma from T cells had increased significantly (p = 0.01) to levels found in healthy control athletes. A significant (p = 0.03) increase in salivary IFNgamma concentrations in healthy control athletes after the one month course of L acidophilus demonstrated in man the capacity for this probiotic to enhance the mucosal IFNgamma concentration. This is the first evidence of a T cell defect in fatigued athletes, and of its reversal following probiotic therapy.
Sahiratmadja, Edhyana; Alisjahbana, Bachti; de Boer, Tjitske; Adnan, Iskandar; Maya, Anugrah; Danusantoso, Halim; Nelwan, Ronald H. H.; Marzuki, Sangkot; van der Meer, Jos W. M.; van Crevel, Reinout; van de Vosse, Esther; Ottenhoff, Tom H. M.
2007-01-01
Pro- and anti-inflammatory cytokines and their signaling pathways play key roles in protection from and pathogenesis of mycobacterial infection, and their balance and dynamic changes may control or predict clinical outcome. Peripheral blood cells' capacity to produce proinflammatory (tumor necrosis factor alpha [TNF-α], interleukin-12/23p40 [IL-12/23p40], and gamma interferon [IFN-γ]) and anti-inflammatory (IL-10) cytokines in response to Mycobacterium tuberculosis or unrelated stimuli (lipopolysaccharide, phytohemagglutinin) was studied in 93 pulmonary tuberculosis (TB) patients and 127 healthy controls from Indonesia. Their cells' ability to respond to IFN-γ was examined to investigate whether M. tuberculosis infection can also inhibit IFN-γ receptor (IFN-γR) signaling. Although there was interindividual variability in the observed responses, the overall results revealed that M. tuberculosis-induced TNF-α and IFN-γ levels showed opposite trends. Whereas TNF-α production was higher in active-TB patients than in controls, IFN-γ production was strongly depressed during active TB, correlated inversely with TB disease severity, and increased during therapy. By contrast, mitogen-induced IFN-γ production, although lower in patients than in controls, did not change during treatment, suggesting an M. tuberculosis-specific and reversible component in the depression of IFN-γ. Depressed IFN-γ production was not due to decreased IL-12/IL-23 production. Importantly, IFN-γ-inducible responses were also significantly depressed during active TB and normalized during treatment, revealing disease activity-related and reversible impairment in IFN-γR signaling in TB. Finally, IFN-γ/IL-10 ratios significantly correlated with TB cure. Taken together, these results show that M. tuberculosis-specific stimulation of IFN-γ (but not TNF-α) production and IFN-γR signaling are significantly depressed in active TB, correlate with TB disease severity and activity, and
Zhang, Qibo; Bernatoniene, Jolanta; Bagrade, Linda; Paton, James C.; Mitchell, Timothy J.; Hammerschmidt, Sven; Nunez, Desmond A.; Finn, Adam
2006-01-01
Nasopharyngeal tonsils (adenoids) are part of human nasopharynx-associated lymphoid tissue, which may play an important role in local defense against pneumococci. Recent studies with animals have suggested that several pneumococcal proteins, including CbpA and pneumolysin (Ply), may be vaccine candidates. Our recent data obtained with children suggest that antibodies to these proteins may protect against carriage. This study was performed to investigate the regulation of the T-cell-dependent antibody responses to CbpA and pneumolysin by cytokines in adenoidal immune cells from children. Adenoidal mononuclear cells (MNC) were cultured with pneumococcal concentrated culture supernatants (CCS) or recombinant proteins. Cytokine expression profiles in adenoidal MNC after antigen stimulation were analyzed by reverse transcription-PCR, protein array analysis, and an immunoassay, along with an antibody production analysis. The roles, interactions, and cellular sources of the main cytokines identified were evaluated further. Pneumococcal CCS induced production of CbpA- and Ply-specific antibodies in association with several chemokines and cytokines, including gamma interferon (IFN-γ) and interleukin-10 (IL-10) in MNC. The antibody production correlated well with the concentrations of these two cytokines. Addition of recombinant IFN-γ or IL-10 enhanced antibody production, and monoclonal antibodies to these two cytokines and T-cell depletion significantly reduced antibody production. Intracellular cytokine staining showed that T cells are a major source of IFN-γ and IL-10. Recombinant Ply and, to a lesser extent, recombinant CbpA induced significant production of IFN-γ and IL-10 in MNC. T-cell-derived IFN-γ and IL-10 may be key regulators of production of mucosal antibody to pneumococcal protein antigens in the nasopharynx and may play an important role in local protection against pneumococcal infection in children. PMID:16861661
Park, Sookyoung; Nozaki, Kenkichi; Smith, Joshua A; Krause, James S; Banik, Naren L
2014-03-01
Insulin-like growth factor-1 (IGF-1) is a neuroprotective growth factor that promotes neuronal survival by inhibition of apoptosis. To examine whether IGF-1 exerts cytoprotective effects against extracellular inflammatory stimulation, ventral spinal cord 4.1 (VSC4.1) motoneuron cells were treated with interferon-gamma (IFN-γ). Our data demonstrated apoptotic changes, increased calpain:calpastatin and Bax:Bcl-2 ratios, and expression of apoptosis-related proteases (caspase-3 and -12) in motoneurons rendered by IFN-γ in a dose-dependent manner. Post-treatment with IGF-1 attenuated these changes. In addition, IGF-1 treatment of motoneurons exposed to IFN-γ decreased expression of inflammatory markers (cyclooxygenase-2 and nuclear factor-kappa B:inhibitor of kappa B ratio). Furthermore, IGF-1 attenuated the loss of expression of IGF-1 receptors (IGF-1Rα and IGF-1Rβ) and estrogen receptors (ERα and ERβ) induced by IFN-γ. To determine whether the protective effects of IGF-1 are associated with ERs, ERs antagonist ICI and selective siRNA targeted against ERα and ERβ were used in VSC4.1 motoneurons. Distinctive morphological changes were observed following siRNA knockdown of ERα and ERβ. In particular, apoptotic cell death assessed by TUNEL assay was enhanced in both ERα and ERβ-silenced VSC4.1 motoneurons following IFN-γ and IGF-1 exposure. These results suggest that IGF-1 protects motoneurons from inflammatory insult by a mechanism involving pivotal interactions with ERα and ERβ. © 2013 International Society for Neurochemistry.
Repeated irradiations with gamma-rays at a Dose of 0.5 Gy may exacerbate asthma.
Fang, Su-ping; Tago, Fumitoshi; Tanaka, Takashi; Simura, Noriko; Muto, Yasuko; Goto, Resuke; Kojima, Shuji
2005-06-01
We previously showed that 0.5 Gy whole-body gamma-ray irradiation with a single or small number of repeated exposures inhibits tumor growth in mice, via elevation of the IFN-gamma/IL-4 ratio concomitantly with a decrease in the percentage of B cells. Here we examined whether repeated 0.5 Gy gamma-rays irradiation can improve asthma in an OVA-induced asthmatic mouse model. We found that repeated irradiation (10 times) with 0.5 Gy of gamma-rays significantly increased total IgE in comparison with the disease-control group. The levels of IL-4 and IL-5 were also significantly higher in the gamma-ray-irradiated group, while that of IFN-gamma was significantly lower, resulting in a further decrease of the IFN-gamma/IL-4 ratio from the normal value. These results indicate that the repeated irradiation with gamma-rays may exacerbate asthma, and may have opposite effects on different immune reactions unlike the irradiation with a single or small number of repeated exposures.
Flores, Jose; DuPont, Herbert L; Paredes-Paredes, Mercedes; Aguirre-Garcia, M Magdalena; Rojas, Araceli; Gonzalez, Alexei; Okhuysen, Pablo C
2010-05-01
Enterotoxigenic Escherichia coli (ETEC), which produces heat-labile toxin (LT), is a common cause of travelers' diarrhea (TD). The B subunit of ETEC LT is immunologically related to the B subunit of Vibrio cholerae toxin (CT). In this pilot study we evaluated the whole-blood gamma interferon response to CT B in 17 U.S. adults traveling to Mexico. Only one of nine subjects who demonstrated a cellular immune response as determined by whole-blood gamma interferon production to CT B on arrival to Mexico developed diarrhea, whereas five of eight without a cellular response developed diarrhea. Markers of the cellular immune response to ETEC LT could help in identifying individuals immune to ETEC LT, and these markers deserve additional study.
Muramatsu, Matthew K.; Brothwell, Julie A.; Stein, Barry D.; Putman, Timothy E.; Rockey, Daniel D.
2016-01-01
Chlamydia trachomatis can enter a viable but nonculturable state in vitro termed persistence. A common feature of C. trachomatis persistence models is that reticulate bodies fail to divide and make few infectious progeny until the persistence-inducing stressor is removed. One model of persistence that has relevance to human disease involves tryptophan limitation mediated by the host enzyme indoleamine 2,3-dioxygenase, which converts l-tryptophan to N-formylkynurenine. Genital C. trachomatis strains can counter tryptophan limitation because they encode a tryptophan-synthesizing enzyme. Tryptophan synthase is the only enzyme that has been confirmed to play a role in interferon gamma (IFN-γ)-induced persistence, although profound changes in chlamydial physiology and gene expression occur in the presence of persistence-inducing stressors. Thus, we screened a population of mutagenized C. trachomatis strains for mutants that failed to reactivate from IFN-γ-induced persistence. Six mutants were identified, and the mutations linked to the persistence phenotype in three of these were successfully mapped. One mutant had a missense mutation in tryptophan synthase; however, this mutant behaved differently from previously described synthase null mutants. Two hypothetical genes of unknown function, ctl0225 and ctl0694, were also identified and may be involved in amino acid transport and DNA damage repair, respectively. Our results indicate that C. trachomatis utilizes functionally diverse genes to mediate survival during and reactivation from persistence in HeLa cells. PMID:27430273
Corn, Radiah A; Aronica, Mark A; Zhang, Fuping; Tong, Yingkai; Stanley, Sarah A; Kim, Se Ryoung Agnes; Stephenson, Linda; Enerson, Ben; McCarthy, Susan; Mora, Ana; Boothby, Mark
2003-08-15
NF-kappaB/Rel transcription factors are linked to innate immune responses and APC activation. Whether and how the induction of NF-kappaB signaling in normal CD4(+) T cells regulates effector function are not well-understood. The liberation of NF-kappaB dimers from inhibitors of kappaB (IkappaBs) constitutes a central checkpoint for physiologic regulation of most forms of NF-kappaB. To investigate the role of NF-kappaB induction in effector T cell responses, we targeted inhibition of the NF-kappaB/Rel pathway specifically to T cells. The Th1 response in vivo is dramatically weakened when T cells defective in their NF-kappaB induction (referred to as IkappaBalpha(DeltaN) transgenic cells) are activated by a normal APC population. Analyses in vivo, and IL-12-supplemented T cell cultures in vitro, reveal that the mechanism underlying this T cell-intrinsic requirement for NF-kappaB involves activation of the IFN-gamma gene in addition to clonal expansion efficiency. The role of NF-kappaB in IFN-gamma gene expression includes a modest decrease in Stat4 activation, T box expressed in T cell levels, and differentiation efficiency along with a more prominent postdifferentiation step. Further, induced expression of Bcl-3, a trans-activating IkappaB-like protein, is decreased in T cells as a consequence of NF-kappaB inhibition. Together, these findings indicate that NF-kappaB induction in T cells regulates efficient clonal expansion, Th1 differentiation, and IFN-gamma production by Th1 lymphocytes at a control point downstream from differentiation.
Skorokhod, Oleksii A; Schwarzer, Evelin; Ceretto, Monica; Arese, Paolo
2007-01-01
Background Enhanced production of nitric oxide (NO) following upmodulation of the inducible isoform of NO synthase (iNOS) by haemozoin (HZ), inflammatory cytokines and LPS may provide protection against Plasmodium falciparum malaria by killing hepatic and blood forms of parasites and inhibiting the cytoadherence of parasitized erythrocytes (RBC) to endothelial cells. Monocytes and macrophages are considered to contribute importantly to protective upregulation of iNOS and production of NO. Data obtained with murine phagocytes fed with human HZ and synthetic HZ (sHZ) indicate that supplemental treatment of those cells with IFN-gamma elicited significant increases in protein and mRNA expression of iNOS and NO production, providing a potential mechanism linking HZ phagocytosis and increased production of NO. Purpose of this study was to analyse the effect of P. falciparum HZ and sHZ supplemental to treatment with IFN-gamma and/or a stimulatory cytokine-LPS mix on iNOS protein and mRNA expression in immuno-purified human monocytes. Methods Adherent immunopurified human monocytes (purity >85%), and murine phagocytic cell lines RAW 264.7, N11 and ANA1 were fed or not with P. falciparum HZ or sHZ and treated or not with IFN-gamma or a stimulatory cytokine-LPS mix. Production of NO was quantified in supernatants, iNOS protein and mRNA expression were measured after immunoprecipitation and Western blotting and quantitative RT-PCT, respectively. Results Phagocytosis of HZ/sHZ by human monocytes did not increase iNOS protein and mRNA expression and NO production either after stimulation by IFN-gamma or the cytokine-LPS mix. By contrast, in HZ/sHZ-laden murine macrophages, identical treatment with IFN-gamma and the cytokine-LPS mix elicited significant increases in protein and mRNA expression of iNOS and NOS metabolites production, in agreement with literature data. Conclusion Results indicate that human monocytes fed or not with HZ/sHZ were constantly unable to express i
Visser, J; Blauw, B; Hinloopen, B; Brommer, E; de Kloet, E R; Kluft, C; Nagelkerken, L
1998-02-01
A disturbed hypothalamus-pituitary-adrenal gland axis and alterations at the immune system level have been observed in patients with chronic fatigue syndrome (CFS). Glucocorticoids are known to modulate T cell responses; therefore, purified CD4 T cells from CFS patients were studied to determine whether they have an altered sensitivity to dexamethasone (DEX). CD4 T cells from CFS patients produced less interferon-gamma than did cells from controls; by contrast, interleukin-4 production and cell proliferation were comparable. With CD4 T cells from CFS patients (compared with cells from controls), a 10- to 20-fold lower DEX concentration was needed to achieve 50% inhibition of interleukin-4 production and proliferation, indicating an increased sensitivity to DEX in CFS patients. Surprisingly, interferon-gamma production in patients and controls was equally sensitive to DEX. A differential sensitivity of cytokines or CD4 T cell subsets to glucocorticoids might explain an altered immunologic function in CFS patients.
Three-dimensional crystal structure of recombinant murine interferon-beta.
Senda, T; Shimazu, T; Matsuda, S; Kawano, G; Shimizu, H; Nakamura, K T; Mitsui, Y
1992-01-01
The crystal structure of recombinant murine interferon-beta (IFN-beta) has been solved by the multiple isomorphous replacement method and refined to an R-factor of 20.5% against 2.6 A X-ray diffraction data. The structure shows a variant of the alpha-helix bundle with a new chain-folding topology, which seems to represent a basic structural framework of all the IFN-alpha and IFN-beta molecules belonging to the type I family. Functionally important segments of the polypeptide chain, as implied through numerous gene manipulation studies carried out so far, are spatially clustered indicating the binding site(s) to the receptor(s). Comparison of the present structure with those of other alpha-helical cytokine proteins, including porcine growth hormone, interleukin 2 and interferon gamma, indicated either a topological similarity in chain folding or a similar spatial arrangement of the alpha-helices. Images PMID:1505514
Cross-talk between interferon-gamma and interleukin-18 in melanogenesis.
Zhou, Jia; Ling, Jingjing; Wang, Yong; Shang, Jing; Ping, Fengfeng
2016-10-01
Skin is the largest organ in our body and strategically placed to provide a metabolically active biological barrier against a range of noxious stressors. A lot of inflammatory cytokines, which are increased after ultraviolet (UV) irradiation produced by keratinocytes or other immunocytes, are closely related to pigmentary changes, including interleukin-18 (IL-18) and interferon-γ (IFN-γ). In this study, the effect of cross-talk between IL-18 and IFN-γ on melanogenesis was investigated. Treatment with IL-18 resulted in a dose-dependent increase of melanogenesis, while IFN-γ made an opposite effect. This influence of IL-18 and IFN-γ was mediated by regulations of microphthalmia-associated transcription factor (MITF) and its downstream enzymatic cascade expressions. Furthermore, IFN-γ inhibited basal and IL-18-induced melanogenesis. IFN-γ increased signal transducer and activator of transcription-1 (STAT-1) phosphorylation to play its position in regulating melanin pigmentation, and its inhibitory effect could be prevented by Janus Kinase 1 (JAK 1) inhibitor. IFN-γ could inhibit melanogenesis by decreasing melanocyte dendrite formation. In addition, IFN-γ inhibited the expressions of Rab Pases to suppress the mature and transport of melanosomes. IL-18 could rapidly induce Akt and PTEN phosphorylation and p65 expression in B16F10 cells. When treatment with IL-18 and IFN-γ together, the phosphorylation level of Protein Kinase B (Akt) and phosphatase and tensin homolog deleted on chromosome ten (PTEN) and expression of p65 NF-κB were inhibited, compared with treated with IL-18 only. Our studies indicated that IFN-γ could directly induce B16F10 cells apoptosis in vitro. Furthermore, we demonstrated that IFN-γ markedly up-regulated IL-18 binding protein (BP) production in normal human foreskin-derived epidermal keratinocytes in dose-dependent manner. UVB irradiation induced protease-activated receptor-2 (PAR-2) expression in NHEK, IFN-γ could inhibit this
Hines, Stephen A.; Stone, Diana M.; Hines, Melissa T.; Alperin, Debby C.; Knowles, Donald P.; Norton, Linda K.; Hamilton, Mary J.; Davis, William C.; McGuire, Travis C.
2003-01-01
Rhodococcus equi is a gram-positive bacterium that infects alveolar macrophages and causes rhodococcal pneumonia in horses and humans. The virulence plasmid of R. equi appears to be required for both pathogenicity in the horse and the induction of protective immunity. An understanding of the mechanisms by which virulent R. equi circumvents protective host responses and by which bacteria are ultimately cleared is important for development of an effective vaccine. Six adult horses were challenged with either virulent R. equi or an avirulent, plasmid-cured derivative. By using a flow cytometric method for intracytoplasmic detection of gamma interferon (IFN-γ) in equine bronchoalveolar lavage fluid (BALF) cells, clearance of the virulent strain was shown to be associated with increased numbers of pulmonary CD4+ and CD8+ T lymphocytes producing IFN-γ. There was no change in IFN-γ-positive cells in peripheral blood, suggesting that a type 1 recall response at the site of challenge was protective. The plasmid-cured strain of R. equi was cleared in horses without a significant increase in IFN-γ-producing T lymphocytes in BALF. In contrast to these data, a previous report in foals suggested an immunomodulating role for R. equi virulence plasmid-encoded products in downregulating IFN-γ expression by equine CD4+ T lymphocytes. Intracytoplasmic detection of IFN-γ provides a method to better determine whether modulation of macrophage-activating cytokines by virulent strains occurs uniquely in neonates and contributes to their susceptibility to rhodococcal pneumonia. PMID:12626444
Silvestre, Ricardo; Cordeiro-Da-Silva, Anabela; Santarém, Nuno; Vergnes, Baptiste; Sereno, Denis; Ouaissi, Ali
2007-09-01
The ability to manipulate the Leishmania genome to create genetically modified parasites by introducing or eliminating genes is considered a powerful alternative for developing a new generation vaccine against leishmaniasis. Previously, we showed that the deletion of one allele of the Leishmania infantum silent information regulatory 2 (LiSIR2) locus was sufficient to dramatically affect amastigote axenic proliferation. Furthermore, LiSIR2 single knockout (LiSIR2(+/-)) amastigotes were unable to replicate in vitro inside macrophages. Because this L. infantum mutant persisted in BALB/c mice for up to 6 wk but failed to establish an infection, we tested its ability to provide protection toward a virulent L. infantum challenge. Strikingly, vaccination with a single i.p. injection of LiSIR2(+/-) single knockout elicits complete protection. Thus, vaccinated BALB/c mice showed a reversal of T cell anergy with specific anti-Leishmania cytotoxic activity and high levels of NO production. Moreover, vaccinated mice simultaneously generated specific anti-Leishmania IgG Ab subclasses suggestive of both type 1 and type 2 responses. A strong correlation was found between the elimination of the parasites and an increased Leishmania-specific IFN-gamma/IL-10 ratio. Therefore, we propose that the polarization to a high IFN-gamma/low IL-10 ratio after challenge is a clear indicator of vaccine success. Furthermore these mutants, which presented attenuated virulence, represent a good model to understand the correlatives of protection in visceral leishmaniasis.
Smart, Joanne M; Horak, Elisabeth; Kemp, Andrew S; Robertson, Colin F; Tang, Mimi L K
2002-09-01
Atopic disease is associated with skewing of immune responses away from a T(H)1 toward a T(H)2 profile. Previous studies have implicated this cytokine imbalance in the development of disease. However, it is not known whether normalization of this imbalance is conversely associated with disease resolution. To further delineate the role of reduced T(H)1 and increased T(H)2 cytokine production in the pathogenesis of atopic disease and to determine whether disease resolution is associated with alteration of cytokine profiles, we investigated cytokine responses in a cohort of adult patients with asthma followed from childhood. A cohort of wheezy children and control subjects aged 7 to 10 years were recruited from 1964 to 1967. Subjects were reevaluated every 7 years to monitor the outcome of childhood asthma. At the 42-year follow-up, 89 subjects from this cohort were evaluated for mitogen and house dust mite (HDM)-induced T(H)1 (IFN-gamma) and T(H)2 (IL-4, IL-5, and IL-13) cytokine responses. Cytokine responses were compared in patients with ongoing asthma, patients with resolved asthma, and control subjects. Patients with severe ongoing asthma had significantly reduced HDM-induced IFN-gamma production compared with that of control subjects and patients with resolved asthma. In contrast, HDM-induced IFN-gamma production in patients with resolved asthma was equivalent to that seen in control subjects. Patients with ongoing and resolved asthma produced significantly higher levels of IL-5 in response to HDM compared with that seen in control subjects, with levels being equivalent in patients with active and resolved asthma. HDM-induced IL-13 production was significantly increased in the patients with resolved asthma when compared with that seen in the control subjects. PHA-induced cytokine responses did not parallel HDM-induced responses. Patients with persistent and severe atopic asthma have a reduced HDM-induced T(H)1 response, whereas those with resolved asthma do not
ERIC Educational Resources Information Center
Birch, Samantha J.; Golbeck, Amanda L.
2015-01-01
Objective: This analysis examined the effectiveness of utilizing interferon-gamma release assay (IGRA) technology in a TB (TB) screening program at a university. Participants: Participants were 2299 students at a Montana university who had presented to the university health center for TB screening during 2012 and 2013. Methods: A retrospective…
Kremers, Marjolein N. T.; Hodemaekers, Hennie M.; Hagenaars, Julia C. J. P.; Koning, Olivier H. J.; Renders, Nicole H. M.; Hermans, Mirjam H. A.; de Klerk, Arja; Notermans, Daan W.; Wever, Peter C.; Janssen, Riny
2015-01-01
A large community outbreak of Q fever occurred in the Netherlands in the period 2007 to 2010. Some of the infected patients developed chronic Q fever, which typically includes pathogen dissemination to predisposed cardiovascular sites, with potentially fatal consequences. To identify the immune mechanisms responsible for ineffective clearance of Coxiella burnetii in patients who developed chronic Q fever, we compared serum concentrations of 47 inflammation-associated markers among patients with acute Q fever, vascular chronic Q fever, and past resolved Q fever. Serum levels of gamma interferon were strongly increased in acute but not in vascular chronic Q fever patients, compared to past resolved Q fever patients. Interleukin-18 levels showed a comparable increase in acute as well as vascular chronic Q fever patients. Additionally, vascular chronic Q fever patients had lower serum levels of gamma interferon-inducible protein 10 (IP-10) and transforming growth factor β (TGF-β) than did acute Q fever patients. Serum responses for these and other markers indicate that type I immune responses to C. burnetii are affected in chronic Q fever patients. This may be attributed to an affected immune system in cardiovascular patients, which enables local C. burnetii replication at affected cardiovascular sites. PMID:25924761
Kuo, Joseph; Warner, Thomas F; Schell, Ronald F
2017-08-31
The role that cytokines play in the induction of Lyme arthritis is gradually being delineated. We showed previously that severe arthritis developed in a T-cell-driven murine model, even in mice lacking interleukin-17A (IL-17A) and administered anti-gamma-interferon (IFN-γ) antibody. Increased levels of tumor necrosis factor alpha (TNF-α) and interleukin-6 (IL-6), two pro-inflammatory cytokines, were detected in cultures of popliteal lymph node cells obtained from these mice. We hypothesized that concomitantly administered anti-IL-6, anti-TNF-α and anti-IFN-γ antibodies would inhibit the development of arthritis in IL-17A-deficient mice. Our results showed that swelling of the hind paws and histopathological changes consistent with arthritis were significantly reduced in IL-17A-deficient mice that administered the three anti-cytokine antibodies. These results suggest that treatment with multiple anti-cytokine antibodies can abrogate the induction of Lyme arthritis in mice. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Alternative activation of STAT1 and STAT3 in response to interferon-gamma.
Qing, Yulan; Stark, George R
2004-10-01
Interferon-gamma (IFNgamma) is a pluripotent cytokine whose major biological effects are mediated through a pathway in which STAT1 is the predominant and essential transcription factor. STAT3 can also be activated weakly by IFNgamma, but the mechanism of activation and function of STAT3 as a part of the interferon response are not known. Here we show that STAT3 activation is much stronger and more prolonged in STAT1-null mouse embryo fibroblasts than in wild-type cells. In response to IFNgamma, SRC-family kinases are required to activate STAT3 (but not STAT1) through tyrosine phosphorylation, whereas the receptor-bound kinases JAK1 and JAK2 are required to activate both STATs. Tyrosine 419 of the IFNgamma receptor subunit 1 (IFNGR1) is required to activate both STATs, suggesting that STAT1 and STAT3 compete with each other for the same receptor phosphotyrosine motif. Activated STAT3 can replace STAT1 in STAT1-null cells to drive the transcription of certain genes, for example, socs-3 and c/ebpdelta, which have gamma-activated sequence motifs in their promoters. Work from Ian Kerr's laboratory reveals that the gp130-linked interleukin-6 receptor, which usually activates STAT3 predominantly, activates STAT1 efficiently when STAT3 is absent. Because STAT1 and STAT3 have opposing biological effects (STAT3 is an oncogene, and STAT1 is a tumor suppressor), the reciprocal activation of these two transcription factors in response to IFNgamma or interleukin-6 suggests that their relative abundance, which may vary substantially in different normal cell types, under different conditions or in tumors is likely to have a major impact on how cells behave in response to different cytokines.
NASA Technical Reports Server (NTRS)
Shearer, William T.; Lee, Bang-Ning; Cron, Stanley G.; Rosenblatt, Howard M.; Smith, E. O'Brian; Lugg, Desmond J.; Nickolls, Peter M.; Sharp, Robert M.; Rollings, Karl; Reuben, James M.
2002-01-01
Cellular immune function has been shown to be decreased and latent virus shedding to be increased in human beings isolated during the Antarctic winter, a model used for assessing some effects of space flight. However, the balance of proinflammatory (IFN-gamma) and anti-inflammatory (IL-10 and IL-1RA) cytokines has not previously been evaluated. We therefore sought to determine whether isolation during the Antarctic winter would alter the proinflammatory and anti-inflammatory cytokine balance. Cytokine levels were measured with ELISA in monthly plasma samples from January through September 1999 in 21 study subjects in the Antarctic and 7 control subjects on Macquarie Island. There was a significant time-dependent increase in plasma IFN-gamma (P =.039) as well as decreases in IL-10 (P =.042) and IL-1RA (P =.053) in the study subjects compared with the control subjects. The study subjects also had significantly increased plasma IFN-gamma levels (P < or =.045) but decreased IL-10 and IL-1RA levels (P < or =.036) at individual time points of isolation. Isolation of human beings in the Antarctic appears to shift the plasma cytokine balance toward a proinflammatory profile. These observations are consistent with T-cell activation that might be due to activation of latent viruses, and they could hold importance for determining the risks of space flight.
Ren, Hongyu; Li, Yuhong; Jiang, Han; Du, Minquan
2016-11-01
A number of studies recently revealed a link between periodontal disease and preterm birth (PTB). PTB can be induced by dental infection with Porphyromonas gingivalis (Pg), a periodontopathic bacterium. This study aims to investigate responses of human extravillous trophoblast-derived HTR8/SVneo cells to Pg infection. Cell apoptosis, cell viability, protein expression, and cytokine production in HTR8 cells were measured via: 1) flow cytometry, 2) CCK-8 assay, 3) western blot, and 4) enzyme-linked immunosorbent assay methods, respectively. Pg decreased cell viability and increased cell apoptosis, active caspase-3 and Fas expression, and interferon-gamma (IFN-γ) secretion in HTR8 cells. Extracellular signal-regulated kinase (ERK) 1/2 inhibitor U0126 and FasL neutralizing antibody NOK1 that blocks FasL/Fas interaction both significantly suppressed Pg-induced apoptosis. U0126 also inhibited IFN-γ secretion and Fas expression close to control levels. Moreover, treatment with recombinant IFN-γ also significantly decreased number of viable HTR8 cells and increased Fas expression, suggesting IFN-γ may play an important role in Pg-induced apoptosis of HTR8 cells, at least partially through regulation of Fas expression. To the best of the authors' knowledge, this is the first study to demonstrate Pg induces IFN-γ secretion, Fas expression, and apoptosis in human extravillous trophoblast-derived HTR8/SVneo cells in an ERK1/2-dependent manner, and IFN-γ (explored by recombinant IFN-γ) and Fas are involved in Pg-induced apoptosis. The finding that Pg infection abnormally regulates inflammation and apoptosis of human trophoblasts may give new insights into the possible link of PTB with maternal periodontal disease and periodontal pathogens.
Modiano, Nir; Lu, Yanping E; Cresswell, Peter
2005-06-14
Human guanylate-binding protein-1 (hGBP-1) is a large GTPase, similar in structure to the dynamins. Like many smaller GTPases of the Ras/Rab family, it is farnesylated, suggesting it may dock into membranes and perhaps play a role in intracellular trafficking. To date, however, hGBP-1 has never been associated with a specific intracellular compartment. Here we present evidence that hGBP-1 can associate with the Golgi apparatus. Redistribution from the cytosol to the Golgi was observed by immunofluorescence and subcellular fractionation after aluminum fluoride treatment, suggesting that it occurs when hGBP-1 is in its GTP-bound state. Relocalization was blocked by a farnesyl transferase inhibitor. The C589S mutant of hGBP-1, which cannot be farnesylated, and the previously uncharacterized R48P mutant, which cannot bind GTP, both failed to localize to the Golgi. These two mutants had a dominant-negative effect, preventing endogenous wild-type hGBP-1 from efficiently redistributing after aluminum fluoride treatment. Furthermore, hGBP-1 requires another IFN-gamma-induced factor to be targeted to the Golgi, because constitutively expressed hGBP-1 remained cytosolic in cells treated with aluminum fluoride unless the cells were preincubated with IFN-gamma. Finally, two nonhydrolyzing mutants of hGBP-1, corresponding to active mutants of Ras family proteins, failed to constitutively associate with the Golgi; we propose three possible explanations for this surprising result.
Pène, Jérôme; Guglielmi, Laurence; Gauchat, Jean-François; Harrer, Nathalie; Woisetschläger, Maximilian; Boulay, Vera; Fabre, Jean-Michel; Demoly, Pascal; Yssel, Hans
2006-10-15
IL-21 is a cytokine produced by CD4+ T cells that has been reported to regulate human, as well as, mouse T and NK cell function and to inhibit Ag-induced IgE production by mouse B cells. In the present study, we show that human rIL-21 strongly enhances IgE production by both CD19+ CD27- naive, and CD19+ CD27+ memory B cells, stimulated with anti-CD40 mAb and rIL-4 and that it promotes the proliferative responses of these cells. However, rIL-21 does not significantly affect anti-CD40 mAb and rIL-4-induced Cepsilon promoter activation in a gene reporter assay, nor germline Cepsilon mRNA expression in purified human spleen or peripheral blood B cells. In contrast, rIL-21 inhibits rIL-4-induced IgE production in cultures of PBMC or total splenocytes by an IFN-gamma-dependent mechanism. The presence of a polymorphism (T-83C), in donors heterozygous for this mutation was found to be associated not only with lower rIL-21-induced IFN-gamma production levels, but also with a lower sensitivity to the inhibitory effects of IL-21 on the production of IgE, compared with those in donors expressing the wild-type IL-21R. Taken together, these results show that IL-21 differentially regulates IL-4-induced human IgE production, via its growth- and differentiation-promoting capacities on isotype-, including IgE-, committed B cells, as well as via its ability to induce IFN-gamma production, most likely by T and NK cells, whereas the outcome of these IL-21-mediated effects is dependent on the presence of a polymorphism in the IL-21R.
1989-01-01
The severe complications of dengue virus infections, hemorrhagic manifestation and shock, are much more commonly observed during secondary infections caused by a different serotype of dengue virus than that which caused the primary infections. It has been speculated, therefore, that dengue hemorrhagic fever (DHF) and dengue shock syndrome (DSS) are caused by serotype crossreactive immunopathological mechanisms. We analyzed clones of dengue serotype crossreactive T lymphocytes derived from the PBMC of a donor who had been infected with dengue 3 virus. These PBMC responded best to dengue 3 antigen, but also responded to dengue 1, 2, and 4 antigens, in bulk culture proliferation assays. 12 dengue antigen-specific clones were established using a limiting dilution technique. All of the clones had CD3+ CD4+ CD8 phenotypes. Eight clones responded to dengue 1, 2, 3, and 4 antigens and are crossreactive, while four other clones responded predominantly to dengue 3 antigen. These results indicate that the serotype crossreactive dengue-specific T lymphocyte proliferation observed in bulk cultures reflects the crossreactive responses detected at the clonal level. Serotype crossreactive clones produced high titers of IFN- gamma after stimulation with dengue 3 antigens, and also produced IFN- gamma to lower levels after stimulation with dengue 1, 2, and 4 antigens. The crossreactive clones lysed autologous lymphoblastoid cell line (LCL) pulsed with dengue antigens, and the crossreactivity of CTL lysis by T cell clones was consistent with the crossreactivity observed in proliferation assays. Epidemiological studies have shown that secondary infections with dengue 2 virus cause DHF/DSS at a higher rate than the other serotypes. We hypothesized that the lysis of dengue virus-infected cells by CTL may lead to DHF/DSS; therefore, the clones were examined for cytotoxic activity against dengue 2 virus-infected LCL. All but one of the serotype crossreactive clones lysed dengue 2 virus
Karachaliou, Niki; Gonzalez-Cao, Maria; Crespo, Guillermo; Drozdowskyj, Ana; Aldeguer, Erika; Gimenez-Capitan, Ana; Teixido, Cristina; Molina-Vila, Miguel Angel; Viteri, Santiago; De Los Llanos Gil, Maria; Algarra, Salvador Martin; Perez-Ruiz, Elisabeth; Marquez-Rodas, Ivan; Rodriguez-Abreu, Delvys; Blanco, Remedios; Puertolas, Teresa; Royo, Maria Angeles; Rosell, Rafael
2018-01-01
Background: Programmed death-ligand 1 (PD-L1) may be induced by oncogenic signals or can be upregulated via interferon gamma (IFN-γ). We have explored whether the expression of IFNG, the gene encoding IFN-γ, is associated with clinical response to the immune checkpoint blockade in non-small cell lung cancer (NSCLC) and melanoma patients. The role of inflammation-associated transcription factors STAT3, IKBKE, STAT1 and other associated genes has also been examined. Methods: Total RNA from 17 NSCLC and 21 melanoma patients was analyzed by quantitative reverse transcription PCR. STAT3 and Rantes, YAP1 and CXCL5, DNMT1, RIG1 and TET1, EOMES, IFNG, PD-L1 and CTLA4, IKBKE and NFATC1 mRNA were examined. PD-L1 protein expression in tumor and immune cells and stromal infiltration of CD8+ T-cells were also evaluated. Progression-free survival and overall survival were estimated. Results: A total of 17 NSCLC patients received nivolumab and 21 melanoma patients received pembrolizumab. Progression-free survival with nivolumab was significantly longer in NSCLC patients with high versus low IFNG expression (5.1 months versus 2 months, p = 0.0124). Progression-free survival with pembrolizumab was significantly longer in melanoma patients with high versus low IFNG expression (5.0 months versus 1.9 months, p = 0.0099). Significantly longer overall survival was observed for melanoma patients with high versus low IFNG expression (not reached versus 10.2 months p = 0.0183). There was a trend for longer overall survival for NSCLC patients with high versus low IFNG expression. Conclusions: IFN-γ is an important marker for prediction of response to immune checkpoint blockade. Further research is warranted in order to validate whether IFNG is more accurate than PD-L1. PMID:29383037
O'Brien, Kevin B; Schultz-Cherry, Stacey; Knoll, Laura J
2011-09-01
Outbreaks of influenza A viruses are associated with significant human morbidity worldwide. Given the increasing resistance to the available influenza drugs, new therapies for the treatment of influenza virus infection are needed. An alternative approach is to identify products that enhance a protective immune response. In these studies, we demonstrate that infecting mice with the Th1-inducing parasite Toxoplasma gondii prior to highly pathogenic avian H5N1 influenza virus infection led to decreased lung viral titers and enhanced survival. A noninfectious fraction of T. gondii soluble antigens (STAg) elicited an immune response similar to that elicited by live parasites, and administration of STAg 2 days after H5N1 influenza virus infection enhanced survival, lowered viral titers, and reduced clinical disease. STAg administration protected H5N1 virus-infected mice lacking lymphocytes, suggesting that while the adaptive immune response was not required for enhanced survival, it was necessary for STAg-mediated viral clearance. Mechanistically, we found that administration of STAg led to increased production of gamma interferon (IFN-γ) from natural killer (NK) cells, which were both necessary and sufficient for survival. Further, administration of exogenous IFN-γ alone enhanced survival from H5N1 influenza virus infection, although not to the same level as STAg treatment. These studies demonstrate that a noninfectious T. gondii extract enhances the protective immune response against severe H5N1 influenza virus infections even when a single dose is administered 2 days postinfection.
Lectin of Bacillus subtilis sp. as overinducer of gamma-interferonogenesis.
Kishko, Ia H; Vasylenko, M I; Pidhors'kyĭ, V S; Kovalenko, E O
1997-01-01
It has been demonstrated experimentally that lectin of Bacillus subtilis sp. in comparison with generally accepted Con A, PHA and lectin of "gold rain" grass--Laburnum anagyroides M e d i k in trials on white mice of CBA line gave in 4 hours of induction maximal titers of gamma-IFN in blood serum of animals--153.6 +/- 17.0 IU/ml. Practically identical titers had been obtained after induction by lectin "gold rain", some lower--after Con A and PHA. At swine gamma-IFN synthesis optimal density of cell suspension must contain 2.5 + 10(7) immunocytes in 1 ml, owing to which it is possible to obtain the titer equal 1 : 2150. Materials with using of bacterial lectins at various degree of purification had shown that maximal titers in blood serum of mongrel white mice were registered at administration to animals of non-purified lectin, 4 times lower--at using of half-purified and purified lectins. Data of these trials in vivo were confirmed by materials of gamma-IFN induction by immunocytes of swine, cattle and even man.
Yoneto, Toshihiko; Yoshimoto, Takayuki; Wang, Chrong-Reen; Takahama, Yasuhiro; Tsuji, Moriya; Waki, Seiji; Nariuchi, Hideo
1999-01-01
We have examined the roles of gamma interferon (IFN-γ), nitric oxide (NO), and natural killer (NK) cells in the host resistance to infection with the blood-stage malarial parasite Plasmodium berghei XAT, an irradiation-induced attenuated variant of the lethal strain P. berghei NK65. Although the infection with P. berghei XAT enhanced NK cell lytic activity of splenocytes, depletion of NK1.1+ cells caused by the treatment of mice with anti-NK1.1 antibody affected neither parasitemia nor IFN-γ production by their splenocytes. The P. berghei XAT infection induced a large amount of NO production by splenocytes during the first peak of parasitemia, while P. berghei NK65 infection induced a small amount. Unexpectedly, however, mice deficient in inducible nitric oxide synthase (iNOS−/−) cleared P. berghei XAT after two peaks of parasitemia were observed, as occurred for wild-type control mice. Although the infected iNOS−/− mouse splenocytes did not produce a detectable level of NO, they produced an amount of IFN-γ comparable to that produced by wild-type control mouse splenocytes, and treatment of these mice with neutralizing anti-IFN-γ antibody led to the progression of parasitemia and fatal outcome. CD4−/− mice infected with P. berghei XAT could not clear the parasite, and all these mice died with apparently reduced IFN-γ production. Furthermore, treatment with carrageenan increased the susceptibility of mice to P. berghei XAT infection. These results suggest that neither NO production nor NK cell activation is critical for the resistance to P. berghei XAT infection and that IFN-γ plays an important role in the elimination of malarial parasites, possibly by the enhancement of phagocytic activity of macrophages. PMID:10225894
Z{gamma}{gamma}{gamma} {yields} 0 Processes in SANC
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bardin, D. Yu., E-mail: bardin@nu.jinr.ru; Kalinovskaya, L. V., E-mail: kalinov@nu.jinr.ru; Uglov, E. D., E-mail: corner@nu.jinr.ru
2013-11-15
We describe the analytic and numerical evaluation of the {gamma}{gamma} {yields} {gamma}Z process cross section and the Z {yields} {gamma}{gamma}{gamma} decay rate within the SANC system multi-channel approach at the one-loop accuracy level with all masses taken into account. The corresponding package for numeric calculations is presented. For checking of the results' correctness we make a comparison with the other independent calculations.
Heal, Karen G; Taylor-Robinson, Andrew W
2010-01-01
The glycoalkaloid tomatine, derived from the wild tomato, can act as a powerful adjuvant to elicit an antigen-specific cell-mediated immune response to the circumsporozoite (CS) protein, a major pre-erythrocytic stage malaria vaccine candidate antigen. Using a defined MHC-class-I-restricted CS epitope in a Plasmodium berghei rodent model, antigen-specific cytotoxic T lymphocyte activity and IFN-gamma secretion ex vivo were both significantly enhanced compared to responses detected from similarly stimulated splenocytes from naive and tomatine-saline-immunized mice. Further, through lymphocyte depletion it is demonstrated that antigen-specific IFN-gamma is produced exclusively by the CD8(+) T cell subset. We conclude that the processing of the P. berghei CS peptide as an exogenous antigen and its presentation via MHC class I molecules to CD8(+) T cells leads to an immune response that is an in vitro correlate of protection against pre-erythrocytic malaria. Further characterization of tomatine as an adjuvant in malaria vaccine development is indicated.
Sneaky Gamma-Rays: Using Gravitational Lensing to Avoid Gamma-Gamma-Absorption
NASA Astrophysics Data System (ADS)
Boettcher, Markus; Barnacka, Anna
2014-08-01
It has recently been suggested that gravitational lensing studies of gamma-ray blazars might be a promising avenue to probe the location of the gamma-ray emitting region in blazars. Motivated by these prospects, we have investigated potential gamma-gamma absorption signatures of intervening lenses in the very-high-energy gamma-ray emission from lensedblazars. We considered intervening galaxies and individual stars within these galaxies. We find that the collective radiation field of galaxies acting as sources of macrolensing are not expected to lead to significant gamma-gamma absorption. Individual stars within intervening galaxies could, in principle, cause a significant opacity to gamma-gamma absorption for VHE gamma-rays if the impact parameter (the distance of closest approach of the gamma-ray to the center of the star) is small enough. However, we find that the curvature of the photon path due to gravitational lensing will cause gamma-ray photons to maintain a sufficiently large distance from such stars to avoid significant gamma-gamma absorption. This re-inforces the prospect of gravitational-lensing studies of gamma-ray blazars without interference due to gamma-gamma absorption due to the lensing objects.
Manneberg, M.; Friedlein, A.; Kurth, H.; Lahm, H. W.; Fountoulakis, M.
1994-01-01
A soluble form of the human interferon gamma receptor that is required for the identification of interferon gamma antagonists was expressed in baculovirus-infected insect cells. The protein carried N-linked carbohydrate and showed a heterogeneity on denaturing polyacrylamide gels. We investigated the utilization of the potential sites for N-linked glycosylation and the structure of the carbohydrate moieties of this soluble receptor. Amino acid sequence analysis and ion spray mass spectrometry revealed that of the five potential sites for N-linked glycosylation, Asn17 and Asn69 were always utilized, whereas Asn62 and Asn162 were utilized in approximately one-third of the protein population. Asn223 was never found to be glycosylated. The soluble receptor was treated with N-glycosidase F and the oligosaccharides released were analyzed by matrix-assisted laser desorption mass spectrometry, which showed that the protein carried six types of short carbohydrate chains. The predominant species was a hexasaccharide of molecular mass 1,039, containing a fucose subunit linked to the proximal N-acetylglucosamine residue: [formula: see text] PMID:8142896
Haldar, Arun K; Piro, Anthony S; Finethy, Ryan; Espenschied, Scott T; Brown, Hannah E; Giebel, Amanda M; Frickel, Eva-Maria; Nelson, David E; Coers, Jörn
2016-12-13
The cytokine gamma interferon (IFN-γ) induces cell-autonomous immunity to combat infections with intracellular pathogens, such as the bacterium Chlamydia trachomatis The present study demonstrates that IFN-γ-primed human cells ubiquitinate and eliminate intracellular Chlamydia-containing vacuoles, so-called inclusions. We previously described how IFN-γ-inducible immunity-related GTPases (IRGs) employ ubiquitin systems to mark inclusions for destruction in mouse cells and, furthermore, showed that the rodent pathogen Chlamydia muridarum blocks ubiquitination of its inclusions by interfering with mouse IRG function. Here, we report that ubiquitination of inclusions in human cells is independent of IRG and thus distinct from the murine pathway. We show that C. muridarum is susceptible to inclusion ubiquitination in human cells, while the closely related human pathogen C. trachomatis is resistant. C. muridarum, but not C. trachomatis, inclusions attract several markers of cell-autonomous immunity, including the ubiquitin-binding protein p62, the ubiquitin-like protein LC3, and guanylate-binding protein 1. Consequently, we find that IFN-γ priming of human epithelial cells triggers the elimination of C. muridarum, but not C. trachomatis, inclusions. This newly described defense pathway is independent of indole-2,3-dioxygenase, a known IFN-γ-inducible anti-Chlamydia resistance factor. Collectively, our observations indicate that C. trachomatis evolved mechanisms to avoid a human-specific, ubiquitin-mediated response as part of its unique adaptation to its human host. Chlamydia trachomatis is the leading cause of sexually transmitted bacterial infections and responsible for significant morbidity, including pelvic inflammatory disease, infertility, and ectopic pregnancies in women. As an obligate intracellular pathogen, C. trachomatis is in perpetual conflict with cell-intrinsic defense programs executed by its human host. Our study defines a novel anti
Rodríguez-Güell, Elisabeth; Agustí, Gemma; Corominas, Mercè; Cardona, Pere-Joan; Luquin, Marina; Julián, Esther
2008-01-01
Whole heat-killed Mycobacterium vaccae is used as an immunotherapeutic agent in tuberculosis (TB), but the compound(s) that triggers its immunostimulatory ability is not known. Here, we show that among different subcellular fractions, the cell wall skeleton induced a prominent expression of gamma interferon in splenocytes from both non-TB and TB M. vaccae-treated mice. PMID:18337379
Fink, Annette; Lemmermann, Niels A W; Gillert-Marien, Dorothea; Thomas, Doris; Freitag, Kirsten; Böhm, Verena; Wilhelmi, Vanessa; Reifenberg, Kurt; Reddehase, Matthias J; Holtappels, Rafaela
2012-11-01
Cytomegalovirus (CMV) disease with multiple organ manifestations is the most feared viral complication limiting the success of hematopoietic cell transplantation as a therapy of hematopoietic malignancies. A timely endogenous reconstitution of CD8 T cells controls CMV infection, and adoptive transfer of antiviral CD8 T cells is a therapeutic option to prevent CMV disease by bridging the gap between an early CMV reactivation and delayed endogenous reconstitution of protective immunity. Preclinical research in murine models has provided 'proof of concept' for CD8 T-cell therapy of CMV disease. Protection by CD8 T cells appears to be in conflict with the finding that CMVs encode proteins that inhibit antigen presentation to CD8 T cells by interfering with the constitutive trafficking of peptide-loaded MHC class I molecules (pMHC-I complexes) to the cell surface. Here, we have systematically explored antigen presentation in the presence of the three currently noted immune evasion proteins of murine CMV in all possible combinations and its modulation by pre-treatment of cells with interferon-gamma (IFN-γ). The data reveal improvement in antigen processing by pre-treatment with IFN-γ can almost overrule the inhibitory function of immune evasion molecules in terms of pMHC-I expression levels capable of triggering most of the specific CD8 T cells, though the intensity of stimulation did not retrieve their full functional capacity. Notably, an in vivo conditioning of host tissue cells with IFN-γ in adoptive cell transfer recipients constitutively overexpressing IFN-γ (B6-SAP-IFN-γ mice) enhanced the antiviral efficiency of CD8 T cells in this transgenic cytoimmunotherapy model.
Regulation by interferon alpha of immunoglobulin isotype selection and lymphokine production in mice
1991-01-01
Antigens and infectious agents that stimulate interferon alpha(IFN- alpha) production in mice induce antibody responses that are predominantly of the immunoglobulin (Ig)G2a isotype and contain little or no IgE. This suggested the possibility that IFN-alpha might have a role in directing Ig isotype selection. Consistent with this possibility, we have found that injection of mice with recombinant mouse IFN-alpha suppresses IgE secretion, enhances IgG2a secretion, and has no independent effect on IgG1 secretion in mice stimulated with a foreign anti-IgD antibody. Injection of mice with polyinosinic acid.polycytidylic acid (poly I.C), an inducer of macrophage IFN-alpha production, also suppresses the anti-IgD antibody-induced IgE response and stimulates the IgG2a response; these effects are blocked by a sheep antibody that neutralizes mouse IFN-alpha/beta. Both recombinant IFN- alpha and poly I.C have maximum IgE suppressive and IgG2a stimulatory effects when injected early in the anti-IgD antibody-induced immune response. Addition of IFN-alpha to mouse B cells cultured with lipopolysaccharide (LPS) + interleukin 4 (IL-4) suppresses both IgG1 and IgE production, but much less potently than IFN-gamma. IFN-alpha suppresses anti-IgD antibody-induced increases in the level of splenic IL-4 mRNA, but enhances the anti-IgD antibody-induced increase in the splenic level of IFN-gamma mRNA. These results are consistent with the effect of IFN-alpha on Ig isotype expression in mice, as IL-4 stimulates IgE and suppresses IgG2a secretion while IFN-gamma exerts opposite effects. These observations suggest that antigen presenting cells, by secreting IFN-alpha early in the course of an immune response, can influence the nature of that response both through direct effects on B cells and by influencing the differentiation of T cells. PMID:1940796
Takahashi, Yuki; Vikman, Elin; Nishikawa, Makiya; Ando, Mitsuru; Watanabe, Yoshihiko; Takakura, Yoshinobu
2010-09-01
The in vivo half-life of interferons (IFNs) is very short, and its extension would produce a better therapeutic outcome in IFN-based therapy. Delivery of IFN genes is one solution for providing a sustained supply. IFNs have a variety of functions, including the suppression of transgene expression, through interaction with IFN receptors (IFNRs). This suppression could prevent IFNs from being expressed from vectors delivered. Silencing the expression of IFNAR and IFNGR, the receptors for type I and II IFNs, respectively, in cells expressing IFNs may prolong transgene expression of IFNs. Mouse melanoma B16-BL6 cells or mouse liver were selected as a site expressing IFNs (not a target for IFN gene therapy) and IFN-expressing plasmid DNA was delivered with or without small interfering RNA (siRNA) targeting IFNRs. Transfection of B16-BL6 cells with siRNA targeting IFNAR1 subunit (IFNAR1) resulted in the reduced expression of IFNAR on the cell surface. This silencing significantly increased the IFN-beta production in cells that were transfected with IFN-beta-expressing plasmid DNA. Similar results were obtained with the combination of IFN-gamma and IFNGR. Co-injection of IFN-beta-expressing plasmid DNA with siRNA targeting IFNAR1 into mice resulted in sustained plasma concentration of IFN-beta. These results provide experimental evidence that the RNAi-mediated silencing of IFNRs in cells expressing IFN, such as hepatocytes, is an effective approach for improving transgene expression of IFNs when their therapeutic target comprises cells other than those expressing IFNs.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Achasov, N. N., E-mail: achasov@math.nsc.ru
2011-03-15
The approach to the Z {yields} {gamma}{psi} and Z {yields} {gamma}Y decay study is presented in detail, based on the sum rules for the Z {yields} cc-bar {yields} {gamma}{gamma}* and Z {yields} bb-bar {yields} {gamma}{gamma}* amplitudes and their derivatives. The branching ratios of the Z {yields} {gamma}{psi} and Z {yields} {gamma}Y decays are calculated for different hypotheses on saturation of the sum rules. The lower bounds of {Sigma}{sub {psi}} BR(Z {yields} {gamma}{psi}) = 1.95 Multiplication-Sign 10{sup -7} and {Sigma}{sub {upsilon}} BR(Z {yields} {gamma}Y) = 7.23 Multiplication-Sign 10{sup -7} are found. Deviations from the lower bounds are discussed, including the possibilitymore » of BR(Z {yields} {gamma}J/{psi}(1S)) {approx} BR(Z {yields} {gamma}Y(1S)) {approx} 10{sup -6}, that could be probably measured in LHC. The angular distributions in the Z {yields} {gamma}{psi} and Z {yields} {gamma}Y decays are also calculated.« less
Brandão, Geane Peroni; Melo, Maria Norma; Gazzinelli, Ricardo Tostes; Caetano, Braulia Costa; Ferreira, Adriana Melo; Silva, Letícia Azevedo; Vitor, Ricardo Wagner Almeida
2009-03-01
To assess reinfection of BALB/c mice with different Toxoplasma gondii strains, the animals were prime infected with the non-virulent D8 strain and challenged with virulent recombinant strains. Thirty days after challenge, brain cysts were obtained from surviving BALB/c mice and inoculated in Swiss mice to obtain tachyzoites for DNA extraction and PCR-RFLP analysis to distinguish the different T. gondii strains present in possible co-infections. Anti-Toxoplasma immune responses were evaluated in D8-primed BALB/c mice by detecting IFN-gamma and IL-10 produced by T cells and measuring immunoglobulin levels in serum samples. PCR-RFLP demonstrated that BALB/c mice were reinfected with the EGS strain at 45 days post prime infection (dpi) and with the EGS and CH3 strains at 180 dpi. High levels of IFN-gamma were detected after D8 infection, with no significant difference between 45 and 180-day intervals. However, higher IL-10 levels and higher plasmatic IgG1 and IgA were detected from samples obtained 180 days after infection. BALB/c mice were susceptible to reinfection with different recombinant T. gondii strains and this susceptibility correlated with enhancement of IL-10 production.
Moroda, Masataka; Takamoto, Masaya; Iwakura, Yoichiro; Nakayama, Jun; Aosai, Fumie
2017-12-01
Interleukin17A (IL-17A) is known to be involved in the host defense against pathogens and the pathogenesis of autoimmune diseases. Previously, we showed that excessive amounts of interferon gamma (IFN-γ) play an important role in the pathogenesis of the lethal effects of Toxoplasma gondii by inducing anaphylactic responses. In the study described in this report, we examined the effects of IL-17A deficiency on murine host defense against oral T. gondii infection. IL-17A-deficient C57BL/6 (B6) mice exhibited higher rates of mortality than wild-type (WT) mice during the acute phase of T. gondii infection. CD4 + T cells in the mesenteric lymph nodes (mLNs) and ileum of T. gondii -infected IL-17A-deficient mice produced higher levels of IFN-γ than did those of WT mice. In addition, the level of T. gondii HSP70 ( T.g HSP70) expression was also significantly increased in the ileum, mLNs, liver, and spleen of infected IL-17A-deficient mice compared with that in WT mice. These elevated levels of expression of T.g HSP70 and IFN-γ in infected IL-17A-deficient mice were presumably linked to the IL-17A defect since they decreased to WT levels after treatment with recombinant IL-17A. Furthermore, IL-17A-deficient mice were highly susceptible to the anaphylactic effect of T.g HSP70, and the survival of IL-17A-deficient mice during the acute phase was improved by treatment with an anti- T.g HSP70 monoclonal antibody. These results suggest that IL-17A plays an important role in host survival against T. gondii infection by protecting the host from an anaphylactic reaction via the downregulation of T.g HSP70 and IFN-γ production. Copyright © 2017 American Society for Microbiology.
Shin, K Y; Moon, H S; Park, H Y; Lee, T Y; Woo, Y N; Kim, H J; Lee, S J; Kong, G
2000-10-31
We have investigated the effects of tumor necrosis factor-alpha (TNF-alpha) and interferon (INF-gamma), the potent Bacillus Calmette-Guerin (BCG)-induced cytokines on the production of MMP-2, MMP-9, TIMP-1, TIMP-2 and MT1-MMP in high grade human bladder cancer cell lines, T-24, J-82 and HT-1376 cell lines. MMP-2 expression and activity were decreased in T-24 cells treated with both cytokines in a dose dependent manner. However, J-82 cells treated with TNF-alpha and INF-gamma revealed dose dependent increases of MMP-9 expression and activity with similar baseline expression and activity of MMP-2. HT-1376 cells after exposure to TNF-alpha only enhanced the expression and activity of MMP-9. These results indicate that TNF-alpha and INF-gamma could regulate the production of MMP-2 or MMP-9 on bladder cancer cells and their patterns of regulation are cell specific. Furthermore, this diverse response of bladder cancer cells to TNF-alpha and INF-gamma suggests that BCG immunotherapy may enhance the invasiveness of bladder cancer in certain conditions with induction of MMPs.
Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.
2001-01-01
Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339
Zhang, Xiaobo; De Paiva, Cintia S; Su, Zhitao; Volpe, Eugene A; Li, De-Quan; Pflugfelder, Stephen C
2014-01-01
Evidence suggests that the cytokine interferon (IFN)-γ released by natural killer and CD4(+) T cells contributes to the conjunctival goblet cell (GC) loss in dry eye. The purpose of this study was to investigate if topical neutralization of IFN-γ prevents or alleviates GC loss in an experimental desiccating stress (DS) model of dry eye. In this study, we found that topical IFN-γ neutralization significantly decreased DS-induced conjunctival GC loss. This was accompanied by decreased epithelial apoptosis, and increased IL-13 and decreased FoxA2 expression in the forniceal conjunctiva. To establish that IFN-γ produced by pathogenic CD4(+) T cells contributes to DS-induced GC loss, adoptive transfer of CD4(+) T cells isolated from DS exposed donors to naïve RAG-1(-/-) recipient mice was performed. Similar to the donor mice, topical IFN-γ neutralization decreased conjunctival GC loss, suppressed apoptosis and increased IL-13 expression in adoptive transfer recipients. In summary, this study demonstrated that topical neutralization of IFN-γ prevents GC loss via modulating apoptosis and maintaining IL-13 signaling. Copyright © 2013 Elsevier Ltd. All rights reserved.
Saldan, Alda; Mengoli, Carlo; Fiscon, Marta; Silvestre, Cristina; Fallico, Loredana; Peracchi, Marta; Furian, Lucrezia; Cusinato, Riccardo; Bonfante, Luciana; Rossi, Barbara; Marchini, Francesco; Sgarabotto, Dino; Rigotti, Paolo; Palù, Giorgio
2013-01-01
Assessing cytomegalovirus (CMV)-specific cell-mediated immunity (CMI) represents an appealing strategy for identifying transplant recipients at risk of infection. In this study, we compared two gamma interferon-releasing assays (IGRAs), Quantiferon-CMV and CMV enzyme-linked immunosorbent spot (ELISPOT), to determine the ability of each test to predict protective CMV-specific T-cell responses. Two hundred twenty-one Quantiferon-CMV and ELISPOT tests were conducted on 120 adult kidney transplant recipients (KTRs), including 100 CMV-seropositive transplant recipients (R+) and 20 CMV-seronegative transplant recipients of a CMV-positive donor (D+/R−). As a control cohort, 39 healthy adult subjects (including 33 CMV-seropositive and 6 CMV-seronegative subjects) were enrolled. CMV IgG serology was used as a reference for both tests. In the CMV-seropositive individuals, the ELISPOT and Quantiferon-CMV assays provided 46% concordance with the serology, 12% discordance, 18% disagreement between ELISPOT or Quantiferon-CMV and the serology, and 24% gray areas when one or both tests resulted in weak positives. None of the CMV-seronegative subjects showed detectable responses in the ELISPOT or the Quantiferon-CMV test. In transplant recipients, both the ELISPOT and Quantiferon-CMV assays positively correlated with each other and negatively correlated with CMV DNAemia in a significant way (P < 0.05). During the antiviral prophylaxis, all 20 D+/R− KTRs we examined displayed undetectable Quantiferon-CMV and ELISPOT results, and there was no evidence of CMV seroconversion. The receiving operator curve (ROC) statistical analysis revealed similar specificities and sensitivities in predicting detectable viremia (areas under the curve [AUC], 0.66 and 0.62 for Quantiferon-CMV and ELISPOT, respectively). ELISPOT and Quantiferon-CMV values of >150 spots/200,000 peripheral blood mononuclear cells (PBMCs) and >1 to 6 IU gamma interferon (IFN-γ) were associated with protection from CMV
Paul-Samojedny, Monika; Owczarek, Aleksander; Suchanek, Renata; Kowalczyk, Malgorzata; Fila-Danilow, Anna; Borkowska, Paulina; Kucia, Krzysztof; Kowalski, Jan
2011-03-01
Schizophrenia is a multifactorial disease with changes affecting the immune system. Dysregulation of the cytokine network in schizophrenia has been well documented. Such changes may occur due to disturbances in cytokine levels that are linked to polymorphisms of cytokine genes. However, research in the role of cytokine gene polymorphisms in schizophrenia has been surprisingly scanty. The aim of this study was to identify, in a case control study, whether polymorphism of IFN-γ gene is a risk factor for the development of paranoid schizophrenia. To the best of our knowledge, this is the first study that examines the association between the IFN-γ gene polymorphism and psychopathological symptoms in patients with paranoid schizophrenia. Polymorphism of IFN-γ (+874T/A, rs 62559044) in schizophrenic patients (n=179), as well as healthy individuals (n=196), both Polish residents, was genotyped using AS-PCR method. Of note, when analyzing the results, we took into consideration the gender of studied individuals. Surprisingly, a single-nucleotide polymorphism in the first intron of the IFN-γ gene was found to be associated with paranoid schizophrenia in males, but not in females. The presence of allele A at position +874 in the IFN-γ gene correlates with 1.66-fold higher risk of paranoid schizophrenia development in males. Differences in the genotypes may have an important role in determining the level of I gene transcription. Because other polymorphisms have been demonstrated to influence IFN-γ transcription, further analysis is necessary to clarify the role of this gene in the pathogenesis of paranoid schizophrenia.
PM-17INTRACEREBRAL IFN-γ DOES NOT ENHANCE THE RESPONSE TO VACCINE IMMUNOTHERAPY FOR CANINE GLIOMA
Pluhar, Liz; Olin, Michael; Goulart, Michelle; Andersen, Brian; Hunt, Matt; Ohlfest, John
2014-01-01
Due to the complexity of human tumor environment and host immune interactions, the majority of successful brain cancer therapies in rodent models fail to show the same efficacy when translated to human patients. Pet dogs with spontaneous glioma recapitulate important features of human disease and we have used this more representative model to assess the response to vaccine immunotherapy with and without interferon gamma (IFN-γ) gene therapy after surgery. Dogs with newly diagnosed glioma underwent surgical tumor debulking and were randomized to receive 1) autologous tumor lysate vaccines with CpG ODN as an adjuvant (n = 12) or 2) Ad-mediated interferon gamma (IFN-γ) gene therapy injected around the resection cavity followed by vaccine immunotherapy (n = 12). A grade IV IFN-γ dose-related toxicity (severe encephalitis and lymphocytic perivascular cuffing) resulted in death of one dog. No further adverse events were seen at a lower IFN-γ dose supporting the safety of the treatment. This immunotherapy activated a humoral response with specific tumor-reactive IgG antibodies detected after vaccination in all dogs. Addition of IFN-γ gene therapy did not affect the median overall survival time of 204 days versus 211 days with vaccine alone. As expected, there were significant differences (P = 0.036) in survival between dogs with low-grade (369 days) versus high-grade (204 days) tumors. During postmortem analysis, no dog with a low-grade tumor had recurrence, whereas all dogs with grade III/IV tumors died from progression. We hoped that forced IFN-γ expression would sensitize residual tumor cells to CTL recognition and recruit NK cells to kill MHC Ilow/- cells, thereby enhancing the effects of vaccine immunotherapy. Our data failed to support this theory, however the lack of difference could be due to the small number of dogs in each group (type II error) or to insufficient in situ expression of IFN-γ to elicit the desired effect.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sakaeda, Yoshiichi; Hiroi, Miki; Shimojima, Takahiro
Sulindac, a non-steroidal anti-inflammatory drug, has been shown to exert an anti-tumor effect on several types of cancer. To determine the effect of sulindac on intracellular signaling pathways in host immune cells such as macrophages, we investigated the effect of the drug on interferon gamma (IFN{gamma})-induced expression of signal transducer and activator of transcription 1 (STAT1) and other genes in mouse macrophage-like cell line RAW264.7 cells. Sulindac, but not aspirin or sodium salicylate, inhibited IFN{gamma}-induced expression of the CXC ligand 9 (CXCL9) mRNA, a chemokine for activated T cells, whereas the interferon-induced expression of CXCL10 or IFN regulatory factor-1 wasmore » not affected by sulindac. Luciferase reporter assay demonstrated that sulindac inhibited IFN{gamma}-induced promoter activity of the CXCL9 gene. Surprisingly, sulindac had no inhibitory effect on IFN{gamma}-induced STAT1 activation; however, constitutive nuclear factor {kappa}B activity was suppressed by the drug. These results indicate that sulindac selectively inhibited IFN{gamma}-inducible gene expression without inhibiting STAT1 activation.« less
Don, Elena; Farafonova, Olga; Pokhil, Suzanna; Barykina, Darya; Nikiforova, Marina; Shulga, Darya; Borshcheva, Alena; Tarasov, Sergey; Ermolaeva, Tatyana; Epstein, Oleg
2016-01-01
In preliminary ELISA studies where released-active forms (RAF) of antibodies (Abs) to interferon-gamma (IFNg) were added to the antigen-antibody system, a statistically significant difference in absorbance signals obtained in their presence in comparison to placebo was observed. A piezoelectric immunosensor assay was developed to support these data and investigate the effects of RAF Abs to IFNg on the specific interaction between Abs to IFNg and IFNg. The experimental conditions were designed and optimal electrode coating, detection circumstances and suitable chaotropic agents for electrode regeneration were selected. The developed technique was found to provide high repeatability, intermediate precision and specificity. The difference between the analytical signals of RAF Ab samples and those of the placebo was up to 50.8%, whereas the difference between non-specific controls and the placebo was within 5%–6%. Thus, the piezoelectric immunosensor as well as ELISA has the potential to be used for detecting the effects of RAF Abs to IFNg on the antigen-antibody interaction, which might be the result of RAF’s ability to modify the affinity of IFNg to specific/related Abs. PMID:26791304
Joshi, Manish; Monson, Thomas P; Woods, Gail L
2012-01-01
Interferon-gamma release assays including the QuantiFERON-TB Gold In-Tube test (QFT-GIT [Cellestis Ltd, Australia]) may be used in place of the tuberculin skin test (TST) in surveillance programs for Mycobacterium tuberculosis infection control. However, data on performance and practicality of the QFT-GIT in such programs for health care workers (HCWs) are limited. To assess the performance, practicality and reversion rate of the QFT-GIT among HCWs at a tertiary health care institution in the United States. Retrospective chart review of HCWs at Central Arkansas Veterans Healthcare System (Arkansas, USA) who underwent QFT-GIT testing as a part of their employee screening between November 1, 2008 and October 31, 2009. QFT-GIT was used to screen 3290 HCWs. The initial QFT-GIT was interpreted as positive for 129 (3.9%) HCWs, negative for 3155 (95.9%) and indeterminate for six (0.2%). Testing with QFT-GIT was repeated in 45 HCWs who had positive results on the initial test. The QFT-GIT reverted to negative in 18 (40.0%) HCWs, all of whom had negative TST status and initial interferon-gamma values of 0.35 IU⁄mL to 2.0 IU⁄mL. The QFT-GIT test is feasible in large health care setting as an alternative to TST for M tuberculosis infection screening in HCWs but is not free from challenges. The major concerns are the high number of positive test results and high reversion rates on repeat testing, illustrating poor short-term reproducibility of positive QFT-GIT test results. These results suggest adopting a borderline zone between interferon-gamma values of 0.35 IU⁄mL to 2.0 IU⁄mL, and cautious clinical interpretation of values in this range.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Caivano, Antonella; Doria-Rose, Nicole A.; Dept. of Molecular and Cell Biology, University of Washington, Seattle, WA 98124-6108
2010-11-25
We have constructed stable virus-like particles displaying the HIV-1 Gag(p17) protein as an N-terminal fusion with an engineered protein domain from the Geobacillus stearothermophilus pyruvate dehydrogenase subunit E2. Mice immunized with the Gag(p17)-E2 60-mer scaffold particles mounted a strong and sustained antibody response. Antibodies directed to Gag(p17) were boosted significantly with additional immunizations, while anti-E2 responses reached a plateau. The isotype of the induced antibodies was biased towards IgG1, and the E2-primed CD4+ T cells did not secrete IFN{gamma}. Using transgenic mouse model systems, we demonstrated that CD8+ T cells primed with E2 particles were able to exert lytic activitymore » and produce IFN{gamma}. These results show that the E2 scaffold represents a powerful vaccine delivery system for whole antigenic proteins or polyepitope engineered proteins, evoking antibody production and antigen specific CTL activity even in the absence of IFN{gamma}-producing CD4+ T cells.« less
Interferon in resistance to bacterial and protozoan infections
NASA Technical Reports Server (NTRS)
Sonnenfeld, Gerald; Gould, Cheryl L.; Kierszenbaum, Felipe; Degee, Antonie L. W.; Mansfield, John M.
1986-01-01
The effects of genetic differences in mouse strains on the modulation of protozoan infections by interferon (IFN) were investigated. In one set of experiments, three different strains of mice were injected with T. cruzi, and their sera were assayed at five time intervals for IFN titer. A greater quantity of IFN was produced by mouse strains that were susceptible to T. cruzi infection than by the more resistant strain. In another set of experiments, spleen cell cultures from inbred strains of mice were challenged with an antigen made from T.b. rhodesiense. The cells from mice resistant to infection, produced greater amounts of IFN-gamma than did cells from the susceptible mice. In a third set of experiments, it was found that mice injected with T.b. rhodesiense before being infected with a diabetogenic virus (EMC-D) were resistant to the effects of the virus and did not produce virus-specific antibody.
Cooker, Laurinda A; Peterson, Darryl; Rambow, Joann; Riser, Melisa L; Riser, Rebecca E; Najmabadi, Feridoon; Brigstock, David; Riser, Bruce L
2007-07-01
Connective tissue growth factor (CCN2) is a profibrotic factor acting downstream and independently of TGF-beta to mediate renal fibrosis. Although inflammation is often involved in the initiation and/or progression of fibrosis, the role of inflammatory cytokines in regulation of glomerular CCN2 expression, cellular proliferation, and extracellular matrix accumulation is unknown. We studied two such cytokines, TNF-alpha and IFN-gamma, for their effects on cultured mesangial cells in the presence or absence of TGF-beta, as a model for progressive renal fibrosis. Short-term treatment with TNF-alpha, like TGF-beta, significantly increased secreted CCN2 per cell, but unlike TGF-beta inhibited cellular replication. TNF-alpha combined with TGF-beta further increased CCN2 secretion and mRNA levels and reduced proliferation. Surprisingly, however, TNF-alpha treatment decreased baseline collagen type I protein and mRNA levels and largely blocked their stimulation by TGF-beta. Long-term treatment with TGF-beta or TNF-alpha alone no longer increased CCN2 protein levels. However, the combination synergistically increased CCN2. IFN-gamma had no effect on either CCN2 or collagen activity and produced a mild inhibition of TGF-beta-induced collagen only at a high concentration (500 U/ml). In summary, we report a strong positive regulatory role for TNF-alpha, but not IFN-gamma, in CCN2 production and secretion, including that driven by TGF-beta. The stimulation of CCN2 release by TNF-alpha, unlike TGF-beta, is independent of cellular proliferation and not linked to increased collagen type I accumulation. This suggests that the paradigm of TGF-beta-driven CCN2 with subsequent collagen production may be overridden by an as yet undefined inhibitory mechanism acting either directly or indirectly on matrix metabolism.
Pathan, A A; Wilkinson, K A; Wilkinson, R J; Latif, M; McShane, H; Pasvol, G; Hill, A V; Lalvani, A
2000-09-01
MHC class I-restricted CD8 cytotoxic T lymphocytes (CTL) are essential for protective immunity to Mycobacterium tuberculosis in animal models but their role in humans remains unclear. We therefore studied subjects who had successfully contained M. tuberculosis infection in vivo, i.e. exposed healthy household contacts and individuals with inactive self-healed pulmonary tuberculosis. Using the ELISPOT assay for IFN-gamma, we screened peptides from ESAT-6, a secreted antigen that is highly specific for M. tuberculosis. We identified a novel nonamer epitope: unstimulated peripheral blood-derived CD8 T cells displayed peptide-specific IFN-gamma release ex vivo while CD8 T cell lines and clones exhibited HLA-A68.02-restricted cytolytic activity and recognized endogenously processed antigen. The frequency of CD8 CTL specific for this single M. tuberculosis epitope, 1/2500 peripheral blood lymphocytes, was equivalent to the combined frequency of all IFN-gamma-secreting purified protein derivative-reactive T cells ex vivo. This highly focused CTL response was maintained in an asymptomatic contact over 2 years and is the most potent antigen-specific antimycobacterial CD8 CTL response hitherto described. Thus, human M. tuberculosis-specific CD8 CTL are not necessarily associated with active disease per se. Rather, our results are consistent with a protective role for these ESAT-6-specific CD8 T cells in the long-term control of M. tuberculosis in vivo in humans.
Kruse, Robert; Essén-Gustavsson, Birgitta; Fossum, Caroline; Jensen-Waern, Marianne
2008-08-12
Knowledge of the cytokine response at infection with Brachyspira hyodysenteriae can help understanding disease mechanism involved during swine dysentery. Since this knowledge is still limited the aim of the present study was to induce dysentery experimentally in pigs and to monitor the development of important immunoregulatory cytokines in blood collected at various stages of the disease. Ten conventional pigs (~23 kg) were orally inoculated with Brachyspira hyodysenteriae B204T. Eight animals developed muco-haemorrhagic diarrhoea with impaired general body condition. Blood was sampled before inoculation and repeatedly during acute dysentery and recovery periods and cytokine levels of IL-1beta, IL-6, Il-10, TNF-alpha and IFN-gamma were measured by ELISA. IL-1beta was increased at the beginning of the dysentery period and coincided with the appearance of Serum amyloid A and clinical signs of disease. TNF-alpha increased in all animals after inoculation, with a peak during dysentery, and IL-6 was found in 3 animals during dysentery and in the 2 animals that did not develop clinical signs of disease. IL-10 was found in all sick animals during the recovery period. IFN-gamma was not detected on any occasion. B. hyodysenteriae inoculation induced production of systemic levels of IL-1beta during the dysentery period and increased levels of IL-10 coincided with recovery from dysentery.
Nagamine, Ichiro; Yamaguchi, Yoshiyuki; Ohara, Masahiro; Ikeda, Takuhiro; Okada, Morihito
2009-03-01
A loss of human leukocyte antigen (HLA) expression in clinical tumors is one of their escape mechanisms from immune attack by HLA-restricted effector cells. In this study, the induction of HLA-unrestricted effector cells, gamma delta T cells, using zoledronate (ZOL) and interleukin (IL)-2 in vitro was investigated in patients with metastatic cancer. Peripheral blood mononuclear cells (PBMCs) from 10 cancer patients (8 colorectal and 2 esophageal) with multiple metastases and ascites lymphocytes from 3 cancer patients (1 gastric and 2 colorectal) were stimulated with varied concentrations of ZOL plus 100 U/ml IL-2 for 48 hr followed by culturing with IL-2 alone for 12 days. Lymphocyte proliferative responses were determined using 3H-TdR uptakes and interferon (IFN)-gamma production was evaluated using enzyme-linked immunosorbent assay. Surface phenotyping was performed using flow cytometry. Cytotoxic activity of effector cells was determined using 51Cr-releasing assay. It was found that proliferative responses of PBMCs were significantly stimulated with ZOL plus IL-2 when compared with IL-2 alone, showing 200 to 500-fold expansions for 2 weeks, although ZOL alone induced no response. The optimal concentration of ZOL was 1-5 microM. Ascites lymphocytes could also be stimulated with ZOL plus IL-2. The proliferative responses were remarkable in patients whose PBMCs could produce high levels of IFN-gamma during an initial 48-hr stimulation using ZOL plus IL-2. Removal of an adherent cell fraction before the induction augmented the proliferative responses in patients who otherwise had low-grade proliferative responses. Generated cells comprising approximately 90 or 20% in PBMCs from healthy donors or cancer patients, respectively, expressed gamma delta-type T-cell receptor. Gamma delta T cells showed high cytotoxic activity against CD166-positive TE12 and TE13 cancer cells but not against CD166-negative MKN45 cells. The cytotoxic activity against TE13 cells was augmented
Meager, A; Wadhwa, M; Dilger, P; Bird, C; Thorpe, R; Newsom-Davis, J; Willcox, N
2003-04-01
We have screened for spontaneous anticytokine autoantibodies in patients with infections, neoplasms and autoimmune diseases, because of their increasingly reported co-occurrence. We tested for both binding and neutralizing autoantibodies to a range of human cytokines, including interleukin-1alpha (IL-1alpha), IL-1beta, IL-2, IL-4, IL-6, IL-8, IL-10, IL-12, IL-18, interferon-alpha2 (IFN-alpha2), IFN-omega, IFN-beta, IFN-gamma, tumour necrosis factor alpha (TNF-alpha), transforming growth factor beta-1 (TGF-beta1) and granulocyte-macrophage colony stimulating factor (GM-CSF), in plasmas or sera. With two notable exceptions described below, we found only occasional, mostly low-titre, non-neutralizing antibodies, mainly to GM-CSF; also to IL-10 in pemphigoid. Strikingly, however, high-titre, mainly IgG, autoantibodies to IFN-alpha2, IFN-omega and IL-12 were common at diagnosis in patients with late-onset myasthenia gravis (LOMG+), thymoma (T) but no MG (TMG-) and especially with both thymoma and MG together (TMG+). The antibodies recognized other closely related type I IFN-alpha subtypes, but rarely the distantly related type I IFN-beta, and never (detectably) the unrelated type II IFN-gamma. Antibodies to IL-12 showed a similar distribution to those against IFN-alpha2, although prevalences were slightly lower; correlations between individual titres against each were so modest that they appear to be entirely different specificities. Neither showed any obvious correlations with clinical parameters including thymoma histology and HLA type, but they did increase sharply if the tumours recurred. These antibodies neutralized their respective cytokine in bioassays in vitro; although they persisted for years severe infections were surprisingly uncommon, despite the immunosuppressive therapy also used in most cases. These findings must hold valuable clues to autoimmunizing mechanisms in paraneoplastic autoimmunity.
Hecker, M.; Preiss, C.; Klemm, P.; Busse, R.
1996-01-01
1. In view of the potential deleterious effects of high amounts of nitric oxide (NO) produced by the inducible isoform of NO synthase (iNOS) in inflammation, the prevention of the expression of this enzyme represents an important therapeutic goal. In cytokine-stimulated cells, activation of nuclear factor kappa B (NF-kappa B) is crucial for the increase in iNOS gene expression. Since NF-kappa B activation appears to involve a redox-sensitive step, we have investigated whether three structurally unrelated antioxidants, 5,7-dihydroxyflavone (chrysin), 3,4-dichloroisocoumarin (DCI) and N-acetyl 5-hydroxytryptamine (N-acetylserotonin, NAS), affect iNOS expression in cultured RAW 264.7 monocyte/macrophages stimulated with bacterial lipopolysaccharide (LPS, 140 ng ml-1) and interferon-gamma (IFN gamma, 5 u ml-1). 2. During a 6 h incubation period neither LPS nor IFN gamma alone exerted a significant effect but when combined, caused a prominent increase in nitrite formation, iNOS mRNA and protein abundance. Co-incubation with chrysin (50 microM), DCI (50 microM) or NAS (1 mM) markedly attenuated this increase in iNOS gene expression. 3. DCI, but not chrysin or NAS, prevented the activation of NF-kappa B in cells exposed to LPS plus IFN gamma for 30 min. In contrast, all three antioxidants significantly blunted the DNA-binding activity of interferon regulatory factor 1 (IRF-1), which mediates the synergistic effect of IFN gamma on iNOS gene expression in cells treated for 2 h with LPS plus IFN gamma. 4. DCI thus appears to inhibit iNOS gene expression at the transcriptional level by preventing the activation of both NF-kappa B and IRF-1. The inhibitory effect of DCI on NF-kappa B activation, however, does not seem to be related to its antioxidative properties, since DCI, unlike chrysin or NAS, is a potent serine protease inhibitor which stabilizes the inactive NF-kappa B complex by protecting the inhibitory I kappa B-alpha subunit from proteolytic degradation. 5. The
Anticonvulsant properties of alpha, gamma, and alpha, gamma-substituted gamma-butyrolactones.
Klunk, W E; Covey, D F; Ferrendelli, J A
1982-09-01
Derivatives of gamma-butyrolactone (GBL) substituted on the alpha- and/or gamma-positions were synthesized and tested for their effects on behavior in mice, on the electroencephalographs and blood pressure of paralyzed-ventilated guinea pigs, and on electrical activity of incubated hippocampal slices. Several compounds, including alpha-ethyl-alpha-methyl GBL (alpha-EMGBL), alpha, alpha-dimethyl GBL, alpha, gamma-diethyl-alpha, gamma-dimethyl GBL, and gamma-ethyl-gamma-methyl GBL, prevented seizures induced by pentylenetetrazol, beta-ethyl-beta-methyl-gamma-butyrolactone (beta-EMGBL), picrotoxin, or all three compounds in mice and guinea pigs but had no effect on seizures induced by maximal electroshock or bicuculline. Neither gamma-hydroxybutyrate (GHB) nor alpha-isopropylidine GBL had any anticonvulsant activity. The anticonvulsant alpha-substituted compounds had a potent hypotensive effect and antagonized the hypertensive effect of beta-EMGBL, alpha-EMGBL was tested in incubated hippocampal slices and was found to depress basal activity and antagonize excitation induced by beta-EMGBL. These results demonstrate that alpha-alkyl-substituted GBL and, to a lesser extent, gamma-substituted derivatives are anticonvulsant agents and that their effects are strikingly different from those of GHB or beta-alkyl-substituted GBLs, which are epileptogenic. Possibly beta- and alpha-substituted GBLs act at the same site as agonists and antagonists, respectively.
Sayyahfar, Shirin; Karimi, Abdollah; Fahimzad, Alireza; Shamshiri, Ahmad Reza
2014-03-01
The aim of this study is to compare Tuberculin Skin Test (TST) result and interferon gamma response to human PPD (purified protein derivative), in scar positive and scar negative BCG-vaccinated children. Between August 2007 and May 2008 a total of 236 children aged 1-168 months (mean 21 months) admitted to Mofid Children's Hospital, Tehran, Iran, were enrolled in a cross-sectional study. Each patient was examined for BCG vaccine scar and tested with TST and human PPD-based Interferon Gamma Release Assay (IGRA). Two hundred and twenty one cases out of 236 (44% female, 1-168 months, mean age 21 months) were scar positive of whom 95% TST result was negative. Human PPD-based IGRA was positive in 110 (49.8%), negative in 85 (38.4 %) and indeterminate in 26 (11.8%) of scar positive patients. Fifteen children (40% female, 1-156 months; mean age 42 months) were scar negative. All the scar negative cases were TST negative. Human PPD-based IGRA was positive in 10 (66.7%), negative in 4 (26.7%) and indeterminate in 1 (6.7%) of scar negative patients. Immune responsiveness to human PPD antigens in scar positive and negative children may not correspond with results of the Tuberculin Skin Test. Copyright © 2013 Ministry of Health, Saudi Arabia. Published by Elsevier Ltd. All rights reserved.
Lee, Jung Nam; Ryu, Dong Yup; Park, Sung Han; You, Hyun Seok; Lee, Bong Eun; Kim, Dong Uk; Kim, Tae Oh; Heo, Jeong; Kim, Gwang Ha; Song, Geun Am; Kim, Suk; Park, Do Youn
2010-06-01
It is difficult to clinically and endoscopically differentiate intestinal tuberculosis (ITB) and Crohns disease (CD). The aim of this study was to evaluate the usefulness of in vitro interferon-gamma (INF-gamma) assay for differential diagnosis between ITB and CD. Sixty patients for whom differential diagnosis between ITB and CD was difficult were enrolled between January 2007 and January 2009. The INF-gamma-producing T-cell response to early secreted antigenic target 6 and culture filtrate protein 10 were measured by T-SPOT.TB blood test in vitro. We evaluated the usefulness of T-SPOT.TB blood test by comparing its results with the final diagnosis. Twenty and forty patients were revealed to be positive and negative in T-SPOT.TB blood test, respectively. Of the 20 patients found to be positive, 12 patients (60%) were finally diagnosed as ITB, 6 patients as CD, and 2 patients as Behcets enterocolitis. Of the 40 patients with negative results, 38 patients (95%) were diagnosed as CD; one as Behcets enterocolitis; one as nonspecific colitis; none as ITB. The sensitivity and specificity of T-SPOT.TB blood test for ITB were 100% and 83.3%, respectively. Positive and negative predictive values of T-SPOT.TB blood test for ITB were 60.0% and 100%, respectively. When differential diagnosis between ITB and CD is difficult, T-SPOT.TB blood test may be a helpful and rapid diagnostic tool to exclude ITB. Prospective large-scaled studies are required for further evaluation of the usefulness of T-SPOT.TB blood test for differential diagnosis between ITB and CD.
Evasion of interferon responses by Ebola and Marburg viruses.
Basler, Christopher F; Amarasinghe, Gaya K
2009-09-01
The filoviruses, Ebola virus (EBOV) and Marburg virus (MARV), cause frequently lethal viral hemorrhagic fever. These infections induce potent cytokine production, yet these host responses fail to prevent systemic virus replication. Consistent with this, filoviruses have been found to encode proteins VP35 and VP24 that block host interferon (IFN)-alpha/beta production and inhibit signaling downstream of the IFN-alpha/beta and the IFN-gamma receptors, respectively. VP35, which is a component of the viral nucleocapsid complex and plays an essential role in viral RNA synthesis, acts as a pseudosubstrate for the cellular kinases IKK-epsilon and TBK-1, which phosphorylate and activate interferon regulatory factor 3 (IRF-3) and interferon regulatory factor 7 (IRF-7). VP35 also promotes SUMOylation of IRF-7, repressing IFN gene transcription. In addition, VP35 is a dsRNA-binding protein, and mutations that disrupt dsRNA binding impair VP35 IFN-antagonist activity while leaving its RNA replication functions intact. The phenotypes of recombinant EBOV bearing mutant VP35s unable to inhibit IFN-alpha/beta demonstrate that VP35 IFN-antagonist activity is critical for full virulence of these lethal pathogens. The structure of the VP35 dsRNA-binding domain, which has recently become available, is expected to provide insight into how VP35 IFN-antagonist and dsRNA-binding functions are related. The EBOV VP24 protein inhibits IFN signaling through an interaction with select host cell karyopherin-alpha proteins, preventing the nuclear import of otherwise activated STAT1. It remains to be determined to what extent VP24 may also modulate the nuclear import of other host cell factors and to what extent this may influence the outcome of infection. Notably, the Marburg virus VP24 protein does not detectably block STAT1 nuclear import, and, unlike EBOV, MARV infection inhibits STAT1 and STAT2 phosphorylation. Thus, despite their similarities, there are fundamental differences by which
Raga, Salvador; Julià, M Rosa; Crespí, Catalina; Figuerola, Joan; Martínez, Natalia; Milà, Joan; Matamoros, Núria
2003-01-01
Gammadelta T cells have an important immunoregulatory and effector function through cytokine release. They are involved in the responses to Gram-negative bacterium and in protection of lung epithelium integrity. On the other hand, they have been implicated in airway inflammation. The aim of the present work was to study intracytoplasmic IL-2, IL-4, IFN-gamma and TNF-alpha production by gammadelta and alphabeta T lymphocytes from cystic fibrosis patients and healthy donors in response to Pseudomonas aeruginosa (PA). Flow cytometric detection was performed after peripheral blood mononuclear cells (PBMC) culture with a cytosolic extract from PA and restimulation with phorbol ester plus ionomycine. Proliferative responses, activation markers and receptor usage of gammadelta T cells were also evaluated. The highest production of cytokine was of TNF-alpha and IFN-gamma, gammadelta being better producers than alphabeta. No differences were found between patients and controls. The Vgamma9delta2 subset of gammadelta T cells was preferentially expanded. CD25 and CD45RO expression by the alphabeta T subset and PBMC proliferative response to PA were defective in cystic fibrosis lymphocytes. Our results support the hypothesis that gammadelta T lymphocytes play an important role in the immune response to PA and in the chronic inflammatory lung reaction in cystic fibrosis patients. They do not confirm the involvement of a supressed Th1 cytokine response in the pathogenesis of this disease.
Hung, Chiung-Yu; Castro-Lopez, Natalia; Cole, Garry T
2016-04-01
Coccidioidomycosis is a potentially life-threatening respiratory disease which is endemic to the southwestern United States and arid regions of Central and South America. It is responsible for approximately 150,000 infections annually in the United States alone. Almost every human organ has been reported to harbor parasitic cells of Coccidioides spp. in collective cases of the disseminated form of this mycosis. Current understanding of the mechanisms of protective immunity against lung infection has been largely derived from murine models of pulmonary coccidioidomycosis. However, little is known about the nature of the host response to Coccidioides in extrapulmonary tissue. Primary subcutaneous coccidioidal infection is rare but has been reported to result in disseminated disease. Here, we show that activation of MyD88 and Card9 signal pathways are required for resistance to Coccidioides infection following subcutaneous challenge of C57BL/6 mice, which correlates with earlier findings of the protective response to pulmonary infection. MyD88(-/-) andCard9(-/-) mice recruited reduced numbers of T cells, B cells, and neutrophils to the Coccidioides-infected hypodermis com pared to wild-type mice; however, neutrophils were dispensable for resistance to skin infection. Further studies have shown that gamma interferon (IFN-γ) production and activation of Th1 cells characterize resistance to subcutaneous infection. Furthermore, activation of a phagosomal enzyme, inducible nitric oxide synthase, which is necessary for NO production, is a requisite for fungal clearance in the hypodermis. Collectively, our data demonstrate that MyD88- and Card9-mediated IFN-γ and nitric oxide production is essential for protection against subcutaneous Coccidioides infection. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Yuan, Yitong; Liu, Shunqi; Zhao, Yue; Lian, Ling; Lian, Zhengxing
2018-01-01
Interferon-γ (IFN-γ) is critical for innate and adaptive immunity against viral and bacterial infections. IFN-γ reportedly affects the phagocytic ability of monocytes and macrophages as well as regulates pituitary function in humans and mice. The present study analyzed the impact of IFN-γ on monocyte and macrophage phagocytosis, production performance, and pituitary function in vivo and in vitro (in dwarf chickens). IFN-γ was injected into dwarf chickens through a vein, and then, the laying rate, average egg weight, and levels of follicle-stimulating hormone (FSH) and IFN-γ were measured in treatment and control groups. For the in vitro experiment, the pituitary tissues were supplemented with IFN-γ, and the mRNA expression levels of follicle-stimulating hormone beta subunit ( FSH-β ), interferon gamma receptor 1 ( IFNGR 1), and interferon gamma receptor 2 ( IFNGR 2) in the pituitary were assessed. Monocyte and macrophage phagocytosis product (PP) was decreased by IFN-γ treatment in a dose-dependent manner in vitro. In the in vivo experiment, the level of IFN-γ in the treatment group was higher than that in the control group at 7 d ( P < 0.05), 14 d ( P < 0.01), and 21 d ( P < 0.01) post-injection. Compared with the control group, monocyte and macrophage PP was lower in the treatment group after injection ( P < 0.01). The laying rate was higher in the treatment group than in the control group at 2 and 3 wk post-injection ( P < 0.05). There was a significant difference between the treatment and control groups in the levels of FSH at 1, 3, 7, and 14 d post-injection ( P < 0.01). In the in vitro experiment, increased mRNA expression levels of FSH-β , IFNGR 1, and IFNGR 2 were observed in the treatment group after stimulation with 100 U/mL IFN-γ for 24 h compared to those in the control group ( P < 0.05). IFN-γ inhibited the phagocytosis of monocytes and macrophages; up-regulated the mRNA expression levels of the FSH
Cortese, Victor S; Woolums, Amelia; Hurley, David J; Berghaus, Roy; Bernard, John K; Short, Thomas H
2017-05-01
Thirty-two Holstein cows were allocated to receive intranasal vaccination with modified live bovine herpesvirus-1 (BHV-1), bovine respiratory syncytial virus (BRSV) and parainfluenza type 3 virus (PI3V) vaccine either two weeks prior to their projected calving date, or within 24h after calving. Nasal secretions were collected twice at a 12-h interval on the day prior to vaccination (day 0) and at 2, 4, 7, 10 and 14days post vaccination to measure interferon (IFN) alpha, IFN-beta, IFN-gamma, and BHV-1-specific IgA by ELISA. Serum neutralizing antibody titers to BHV-1 and BRSV were measured on days 0, 7, and 14. There was a significant treatment effect (p<0.0004) and interaction (p<0.05) on nasal BHV-1 IgA levels, with higher IgA levels in cows vaccinated within 24h after calving. There was a significant treatment effect on nasal IFN-gamma concentration (p<0.05) and on nasal total IFN concentration (p<0.05), with higher IFN-gamma and total IFN concentrations seen in cows vaccinated within 24h after calving. There was no significant treatment or interaction effect on nasal IFN-alpha or IFN-beta concentrations, or on serum neutralizing titers to BRSV. In spite of prior viral vaccination during the previous lactation, cows vaccinated on the day of calving responded to an intranasal viral vaccination with increased concentrations of IFN-gamma and increased titers of IgA following vaccination which was significantly higher than cows vaccinated precalving. This study is the first to examine respiratory mucosal responses in immunologically mature dairy cattle vaccinated intranasally before and after calving. Copyright © 2017. Published by Elsevier B.V.
Mantegazza, R; Gebbia, M; Mora, M; Barresi, R; Bernasconi, P; Baggi, F; Cornelio, F
1996-08-01
Major histocompatibility complex (MHC) class II molecules are expressed on myoblasts after interferon-gamma (IFN-gamma) treatment, suggesting a muscle cell involvement in antigen presentation in inflammatory myopathies. However, they were not observed on normal or pathological myofibers. This discrepancy might be related to different responsiveness of developmentally differentiated muscle cells to IFN-gamma. Myoblasts expressed class II transcripts and proteins after IFN-gamma, while myotubes and innervated contracting muscle cells did not show staining for class II molecules. At all cell stages no loss of IFN-gamma receptor was detected indicating that myofiber maturation blocks their capacity to express MHC class II molecules. This suggests that completely differentiated myofibers cannot participate in class II restricted immunological reactions.
[Allergic asthma and interleukins 2, 4, 5, 6 and 12 and gamma interferon levels].
Bastida Segura, Diana Lyzbeth; López Velásquez, Benjamin; Castrejón Vázquez, María Isabel; Galicia Tapía, Jorge; Cano Altamirano, Silvia; Miranda Feria, Alfonso Javier
2004-01-01
Asthma is an inflammatory chronic illness, in which mastocyt cells, basophils, T lymphocytes, eosinophils and cytokines play a role. Its association with the production of TH2 cytokines is not well known, but it is considered an aberrant immune response, yielding the activation and recruitment of a number of effector cells (mastocyts/eosinophils) and the appearance of clinical symptoms. To determine the serum values of the interleukins 2, 4, 5, 6 and 12 and gamma interferon in relation to the severity degree of asthma and the time of immunotherapy in patients with stable chronic allergic bronchial asthma. Clinical records of allergic asthmatic patients from the external consultation at Servicio de Alergia e Immunología Clínica were reviewed in a period of 12 months (1st January 2002 to 1st January 2003) and those of healthy volunteers, forming three groups: Group 1, allergic asthmatics with immunotherapy less than 24 months; Group 2, allergic asthmatics with more than 24 months of immunotherapy, and Group 3, healthy volunteers (control group). Previous informed consent, a serum sample was taken of all subjects. Ninety-two subjects were included: 41 (45%) allergic asthmatics and 51 (55%) healthy volunteers. Significant differences were found in interleukins 2, 4, 5, 6 and 12 levels between healthy volunteers and asthmatics without relating the immunotherapy time. In the total group gamma interferon levels were not found. A relation of interleukins Th2 levels with the severity degree of asthma was not found. Differences of serum interleukins Th1 and Th2 in allergic patients related to immunotherapy time were not significant; even though, irrespective of immunotherapy time, IgG levels were always high. Patients with allergic asthma have a predominance of serum interleukins Th2 and, despite of the immunotherapy, in the maintaining phase, these continue high, which may be due to an immune system dysregulation maybe including other factors. Immunotherapy continues
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Jeeyun; Im, Young-Hyuck; Jung, Hae Hyun
2005-08-26
The A549 cells, non-small cell lung cancer cell line from human, were resistant to interferon (IFN)-{alpha} treatment. The IFN-{alpha}-treated A549 cells showed increase in protein expression levels of NF-{kappa}B and COX-2. IFN-{alpha} induced NF-{kappa}B binding activity within 30 min and this increased binding activity was markedly suppressed with inclusion of curcumin. Curcumin also inhibited IFN-{alpha}-induced COX-2 expression in A549 cells. Within 10 min, IFN-{alpha} rapidly induced the binding activity of a {gamma}-{sup 32}P-labeled consensus GAS oligonucleotide probe, which was profoundly reversed by curcumin. Taken together, IFN-{alpha}-induced activations of NF-{kappa}B and COX-2 were inhibited by the addition of curcumin in A549more » cells.« less
Human B cells fail to secrete type I interferons upon cytoplasmic DNA exposure.
Gram, Anna M; Sun, Chenglong; Landman, Sanne L; Oosenbrug, Timo; Koppejan, Hester J; Kwakkenbos, Mark J; Hoeben, Rob C; Paludan, Søren R; Ressing, Maaike E
2017-11-01
Most cells are believed to be capable of producing type I interferons (IFN I) as part of an innate immune response against, for instance, viral infections. In macrophages, IFN I is potently induced upon cytoplasmic exposure to foreign nucleic acids. Infection of these cells with herpesviruses leads to triggering of the DNA sensors interferon-inducible protein 16 (IFI16) and cyclic GMP-AMP (cGAMP) synthase (cGAS). Thereby, the stimulator of interferon genes (STING) and the downstream molecules TANK-binding kinase 1 (TBK1) and interferon regulatory factor 3 (IRF3) are sequentially activated culminating in IFN I secretion. Human gamma-herpesviruses, such as Epstein-Barr virus (EBV), exploit B cells as a reservoir for persistent infection. In this study, we investigated whether human B cells, similar to macrophages, engage the cytoplasmic DNA sensing pathway to induce an innate immune response. We found that the B cells fail to secrete IFN I upon cytoplasmic DNA exposure, although they express the DNA sensors cGAS and IFI16 and the signaling components TBK1 and IRF3. In primary human B lymphocytes and EBV-negative B cell lines, this deficiency is explained by a lack of detectable levels of the central adaptor protein STING. In contrast, EBV-transformed B cell lines did express STING, yet both these lines as well as STING-reconstituted EBV-negative B cells did not produce IFN I upon dsDNA or cGAMP stimulation. Our combined data show that the cytoplasmic DNA sensing pathway is dysfunctional in human B cells. This exemplifies that certain cell types cannot induce IFN I in response to cytoplasmic DNA exposure providing a potential niche for viral persistence. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
López-Alvarez, María R; Martínez-Sánchez, María V; Salgado-Cecilia, María G; Campillo, José A; Heine-Suñer, Damian; Villar-Permuy, Florentina; Fuster, José L; Bas, Agueda; Gil-Herrera, Juana; Muro, Manuel; García-Alonso, Ana M; Alvarez-López, María R; Minguela, Alfredo
2009-01-01
We report the first case of hemophagocytic lymphohistiocytosis (HLH) induced by the monoclonal expansion of Epstein-Barr virus (EBV)-negative NK cells. Consanguinity of the patient's parents made it necessary to discard familial HLH in the patient and her sister with identical HLA markers and demonstrate that no cause other than the expansion of NK cells, which secrete high levels of gamma interferon, was inducing HLH in this patient.
Xia, Chuan; Vijayan, Madhuvanthi; Pritzl, Curtis J; Fuchs, Serge Y; McDermott, Adrian B; Hahm, Bumsuk
2015-12-16
Influenza A virus (IAV) employs diverse strategies to circumvent type I interferon (IFN) responses, particularly by inhibiting the synthesis of type I IFNs. However, it is poorly understood if and how IAV regulates the type I IFN receptor (IFNAR)-mediated signaling mode. In this study, we demonstrate that IAV induces the degradation of IFNAR subunit 1 (IFNAR1) to attenuate the type I IFN-induced antiviral signaling pathway. Following infection, the level of IFNAR1 protein, but not mRNA, decreased. Indeed, IFNAR1 was phosphorylated and ubiquitinated by IAV infection, which resulted in IFNAR1 elimination. The transiently overexpressed IFNAR1 displayed antiviral activity by inhibiting virus replication. Importantly, the hemagglutinin (HA) protein of IAV was proved to trigger the ubiquitination of IFNAR1, diminishing the levels of IFNAR1. Further, influenza A viral HA1 subunit, but not HA2 subunit, downregulated IFNAR1. However, viral HA-mediated degradation of IFNAR1 was not caused by the endoplasmic reticulum (ER) stress response. IAV HA robustly reduced cellular sensitivity to type I IFNs, suppressing the activation of STAT1/STAT2 and induction of IFN-stimulated antiviral proteins. Taken together, our findings suggest that IAV HA causes IFNAR1 degradation, which in turn helps the virus escape the powerful innate immune system. Thus, the research elucidated an influenza viral mechanism for eluding the IFNAR signaling pathway, which could provide new insights into the interplay between influenza virus and host innate immunity. Influenza A virus (IAV) infection causes significant morbidity and mortality worldwide and remains a major health concern. When triggered by influenza viral infection, host cells produce type I interferon (IFN) to block viral replication. Although IAV was shown to have diverse strategies to evade this powerful, IFN-mediated antiviral response, it is not well-defined if IAV manipulates the IFN receptor-mediated signaling pathway. Here, we
gamma-Hexachlorocyclohexane (gamma-HCH)
Integrated Risk Information System (IRIS)
gamma - Hexachlorocyclohexane ( gamma - HCH ) ; CASRN 58 - 89 - 9 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Asse
A CpG oligonucleotide can protect mice from a low aerosol challenge dose of Burkholderia mallei.
Waag, David M; McCluskie, Michael J; Zhang, Ningli; Krieg, Arthur M
2006-03-01
Treatment with an oligodeoxynucleotide (ODN) containing CPG motifs (CpG ODN 7909) was found to protect BALB/c mice from lung infection or death after aerosol challenge with Burkholderia mallei. Protection was associated with enhanced levels of gamma interferon (IFN-gamma)-inducible protein 10, interleukin-12 (IL-12), IFN-gamma, and IL-6. Preexposure therapy with CpG ODNs may protect victims of a biological attack from glanders.
Unidentified Gamma-Ray Sources: Hunting Gamma-Ray Blazars
DOE Office of Scientific and Technical Information (OSTI.GOV)
Massaro, F.; D'Abrusco, R.; Tosti, G.
2012-04-02
One of the main scientific objectives of the ongoing Fermi mission is unveiling the nature of the unidentified {gamma}-ray sources (UGSs). Despite the large improvements of Fermi in the localization of {gamma}-ray sources with respect to the past {gamma}-ray missions, about one third of the Fermi-detected objects are still not associated to low energy counterparts. Recently, using the Wide-field Infrared Survey Explorer (WISE) survey, we discovered that blazars, the rarest class of Active Galactic Nuclei and the largest population of {gamma}-ray sources, can be recognized and separated from other extragalactic sources on the basis of their infrared (IR) colors. Basedmore » on this result, we designed an association method for the {gamma}-ray sources to recognize if there is a blazar candidate within the positional uncertainty region of a generic {gamma}-ray source. With this new IR diagnostic tool, we searched for {gamma}-ray blazar candidates associated to the UGS sample of the second Fermi {gamma}-ray catalog (2FGL). We found that our method associates at least one {gamma}-ray blazar candidate as a counterpart each of 156 out of 313 UGSs analyzed. These new low-energy candidates have the same IR properties as the blazars associated to {gamma}-ray sources in the 2FGL catalog.« less
UNIDENTIFIED {gamma}-RAY SOURCES: HUNTING {gamma}-RAY BLAZARS
DOE Office of Scientific and Technical Information (OSTI.GOV)
Massaro, F.; Ajello, M.; D'Abrusco, R.
2012-06-10
One of the main scientific objectives of the ongoing Fermi mission is unveiling the nature of unidentified {gamma}-ray sources (UGSs). Despite the major improvements of Fermi in the localization of {gamma}-ray sources with respect to the past {gamma}-ray missions, about one-third of the Fermi-detected objects are still not associated with low-energy counterparts. Recently, using the Wide-field Infrared Survey Explorer survey, we discovered that blazars, the rarest class of active galactic nuclei and the largest population of {gamma}-ray sources, can be recognized and separated from other extragalactic sources on the basis of their infrared (IR) colors. Based on this result, wemore » designed an association method for the {gamma}-ray sources to recognize if there is a blazar candidate within the positional uncertainty region of a generic {gamma}-ray source. With this new IR diagnostic tool, we searched for {gamma}-ray blazar candidates associated with the UGS sample of the second Fermi {gamma}-ray LAT catalog (2FGL). We found that our method associates at least one {gamma}-ray blazar candidate as a counterpart to each of 156 out of 313 UGSs analyzed. These new low-energy candidates have the same IR properties as the blazars associated with {gamma}-ray sources in the 2FGL catalog.« less
Critical role of type 1 cytokines in controlling initial infection with Burkholderia mallei.
Rowland, Caroline A; Lertmemongkolchai, Ganjana; Bancroft, Alison; Haque, Ashraful; Lever, M Stephen; Griffin, Kate F; Jackson, Matthew C; Nelson, Michelle; O'Garra, Anne; Grencis, Richard; Bancroft, Gregory J; Lukaszewski, Roman A
2006-09-01
Burkholderia mallei is a gram-negative bacterium which causes the potentially fatal disease glanders in humans; however, there is little information concerning cell-mediated immunity to this pathogen. The role of gamma interferon (IFN-gamma) during B. mallei infection was investigated using a disease model in which infected BALB/c mice normally die between 40 and 60 days postinfection. IFN-gamma knockout mice infected with B. mallei died within 2 to 3 days after infection, and there was uncontrolled bacterial replication in several organs, demonstrating the essential role of IFN-gamma in the innate immune response to this pathogen. Increased levels of IFN-gamma, interleukin-6 (IL-6), and monocyte chemoattractant protein 1 were detected in the sera of immunocompetent mice in response to infection, and splenic mRNA expression of IFN-gamma, IL-6, IL-12p35, and IL-27 was elevated 24 h postinfection. The effects of IL-18, IL-27, and IL-12 on stimulation of the rapid IFN-gamma production were investigated in vitro by analyzing IFN-gamma production in the presence of heat-killed B. mallei. IL-12 was essential for IFN-gamma production in vitro; IL-18 was also involved in induction of IFN-gamma, but IL-27 was not required for IFN-gamma production in response to heat-killed B. mallei. The main cellular sources of IFN-gamma were identified in vitro as NK cells, CD8+ T cells, and TCRgammadelta T cells. Our data show that B. mallei is susceptible to cell-mediated immune responses which promote expression of type 1 cytokines. This suggests that development of effective vaccines against glanders should target the production of IFN-gamma.
NASA Technical Reports Server (NTRS)
Tewari, S. N.
1976-01-01
A directionally solidified eutectic alloy (DSEA), of those viewed as potential candidates for the next generation of aircraft gas turbine blade materials, is studied for the gamma-prime growth kinetics, in the system Ni-Nb-Cr-Al, specifically: Ni-20 w/o Nb-6 w/o Cr-2.5 w/o Al gamma/gamma-prime-delta DSEA. Heat treatment, polishing and etching, and preparation for electron micrography are described, and the size distribution of gamma-prime phase following various anneals is plotted, along with gamma-prime growth kinetics in this specific DSEA, and the cube of gamma-prime particle size vs anneal time. Activation energies and coarsening kinetics are studied.
NASA Astrophysics Data System (ADS)
Chernikova, Dina; Axell, Kåre; Avdic, Senada; Pázsit, Imre; Nordlund, Anders; Allard, Stefan
2015-05-01
Two versions of the neutron-gamma variance to mean (Feynman-alpha method or Feynman-Y function) formula for either gamma detection only or total neutron-gamma detection, respectively, are derived and compared in this paper. The new formulas have particular importance for detectors of either gamma photons or detectors sensitive to both neutron and gamma radiation. If applied to a plastic or liquid scintillation detector, the total neutron-gamma detection Feynman-Y expression corresponds to a situation where no discrimination is made between neutrons and gamma particles. The gamma variance to mean formulas are useful when a detector of only gamma radiation is used or when working with a combined neutron-gamma detector at high count rates. The theoretical derivation is based on the Chapman-Kolmogorov equation with the inclusion of general reactions and corresponding intensities for neutrons and gammas, but with the inclusion of prompt reactions only. A one energy group approximation is considered. The comparison of the two different theories is made by using reaction intensities obtained in MCNPX simulations with a simplified geometry for two scintillation detectors and a 252Cf-source. In addition, the variance to mean ratios, neutron, gamma and total neutron-gamma are evaluated experimentally for a weak 252Cf neutron-gamma source, a 137Cs random gamma source and a 22Na correlated gamma source. Due to the focus being on the possibility of using neutron-gamma variance to mean theories for both reactor and safeguards applications, we limited the present study to the general analytical expressions for Feynman-alpha formulas.
Immunomodulatory intervention with Gamma interferon in mice with sepsis.
Wang, Yu; Kong, Bing-Bing; Yang, Wen-Ping; Zhao, Xin; Zhang, Rong
2017-09-15
Sepsis-triggered immune paralysis including T-cell dysfunction increase susceptibility to infection. Gamma interferon (IFNg) exert beneficial effects in patients with sepsis. Herein, we speculated that IFNg may attenuate T-cell dysfunction induced by sepsis, although the mechanisms remain elusive. To test this hypothesis, we used a model based on cecal ligation and puncture (CLP) to induce sepsis in mice. Male C57BL/6 mice were pretreated with recombinant human IFNg (0.01μg/g of body weight) before CLP. The immunophenotyping of cell surface receptor expression, and regulatory T cells (CD4+CD25+Foxp3+) were quantified by flow cytometry. Immunohistochemical staining was performed to evaluate the loss of immune effector cells. Formation of IFNg and interleukin 4 (IL-4) in the spleen and plasma levels of TNF-α, IL-6, high-mobility group box 1 (HMGB1) were determined using enzyme-linked immunosorbent assay. IFNg markedly inhibited the reduction in cytokine secretion from lipopolysaccharide (LPS)-stimulated splenocytes. IFNg-treated mices had significantly decreased percentages of programmed cell death 1 (PD-1) receptors, increased the percentages of positive costimulatory receptor CD28 on CD4 T cells expressing. IFNg markedly reduced T-cell apoptosis through upregulating the expression of Bcl-2. CLP-induced formation of regulatory T cells in the spleen was abolished in IFNg -treated mices. Moreover, IFNg treatment reduced plasma levels of TNF-α, IL-6, HMGB1. IFNg can be a powerful regulator of immune function under sepsis conditions. Therefore, targeted immune-enhancement with IFNg may be a valid therapeutic approach in sepsis. Copyright © 2017 Elsevier Inc. All rights reserved.
de Alencar, Bruna C. G.; Persechini, Pedro M.; Haolla, Filipe A.; de Oliveira, Gabriel; Silverio, Jaline C.; Lannes-Vieira, Joseli; Machado, Alexandre V.; Gazzinelli, Ricardo T.; Bruna-Romero, Oscar; Rodrigues, Mauricio M.
2009-01-01
A heterologous prime-boost strategy using plasmid DNA, followed by replication-defective recombinant adenovirus 5, is being proposed as a powerful way to elicit CD4+ and CD8+ T-cell-mediated protective immunity against intracellular pathogens. We confirmed this concept and furthered existing research by providing evidence that the heterologous prime-boost regimen using the gene encoding amastigote surface protein 2 elicited CD4+ and CD8+ T-cell-mediated protective immunity (reduction of acute parasitemia and prolonged survival) against experimental infection with Trypanosoma cruzi. Protective immunity correlated with the presence of in vivo antigen-specific cytotoxic activity prior to challenge. Based on this, our second goal was to determine the outcome of infection after heterologous prime-boost immunization of perforin-deficient mice. These mice were highly susceptible to infection. A detailed analysis of the cell-mediated immune responses in immunized perforin-deficient mice showed an impaired gamma interferon (IFN-γ) secretion by immune spleen cells upon restimulation in vitro with soluble recombinant antigen. In spite of a normal numeric expansion, specific CD8+ T cells presented several functional defects detected in vivo (cytotoxicity) and in vitro (simultaneous expression of CD107a/IFN-γ or IFN-γ/tumor necrosis factor alpha) paralleled by a decreased expression of CD44 and KLRG-1. Our final goal was to determine the importance of IFN-γ in the presence of highly cytotoxic T cells. Vaccinated IFN-γ-deficient mice developed highly cytotoxic cells but failed to develop any protective immunity. Our study thus demonstrated a role for perforin and IFN-γ in a number of T-cell-mediated effector functions and in the antiparasitic immunity generated by a heterologous plasmid DNA prime-adenovirus boost vaccination strategy. PMID:19651871
Tilahun, Ashenafi Y; Holz, Marah; Wu, Tsung-Teh; David, Chella S; Rajagopalan, Govindarajan
2011-02-03
Toxic shock syndrome (TSS) caused by the superantigen exotoxins of Staphylococcus aureus and Streptococcus pyogenes is characterized by robust T cell activation, profound elevation in systemic levels of multiple cytokines, including interferon-γ (IFN-γ), followed by multiple organ dysfunction and often death. As IFN-γ possesses pro- as well as anti-inflammatory properties, we delineated its role in the pathogenesis of TSS. Antibody-mediated in vivo neutralization of IFN-γ or targeted disruption of IFN-γ gene conferred significant protection from lethal TSS in HLA-DR3 transgenic mice. Following systemic high dose SEB challenge, whereas the HLA-DR3.IFN-γ(+/+) mice became sick and succumbed to TSS, HLA-DR3.IFN-γ(-/-) mice appeared healthy and were significantly protected from SEB-induced lethality. SEB-induced systemic cytokine storm was significantly blunted in HLA-DR3.IFN-γ(-/-) transgenic mice. Serum concentrations of several cytokines (IL-4, IL-10, IL-12p40 and IL-17) and chemokines (KC, rantes, eotaxin and MCP-1) were significantly lower in HLA-DR3.IFN-γ(-/-) transgenic mice. However, SEB-induced T cell expansion in the spleens was unaffected and expansion of SEB-reactive TCR Vβ8(+) CD4(+) and CD8(+) T cells was even more pronounced in HLA-DR3.IFN-γ(-/-) transgenic mice when compared to HLA-DR3.IFN-γ(+/+) mice. A systematic histopathological examination of several vital organs revealed that both HLA-DR3.IFN-γ(+/+) and HLA-DR3.IFN-γ(-/-) transgenic mice displayed comparable severe inflammatory changes in lungs, and liver during TSS. Remarkably, whereas the small intestines from HLA-DR3.IFN-γ(+/+) transgenic mice displayed significant pathological changes during TSS, the architecture of small intestines in HLA-DR3.IFN-γ(-/-) transgenic mice was preserved. In concordance with these histopathological changes, the gut permeability to macromolecules was dramatically increased in HLA-DR3.IFN-γ(+/+) but not HLA-DR3.IFN-γ(-/-) mice during TSS. Overall
Tilahun, Ashenafi Y.; Holz, Marah; Wu, Tsung-Teh; David, Chella S.; Rajagopalan, Govindarajan
2011-01-01
Toxic shock syndrome (TSS) caused by the superantigen exotoxins of Staphylococcus aureus and Streptococcus pyogenes is characterized by robust T cell activation, profound elevation in systemic levels of multiple cytokines, including interferon-γ (IFN-γ), followed by multiple organ dysfunction and often death. As IFN-γ possesses pro- as well as anti-inflammatory properties, we delineated its role in the pathogenesis of TSS. Antibody-mediated in vivo neutralization of IFN-γ or targeted disruption of IFN-γ gene conferred significant protection from lethal TSS in HLA-DR3 transgenic mice. Following systemic high dose SEB challenge, whereas the HLA-DR3.IFN-γ+/+ mice became sick and succumbed to TSS, HLA-DR3.IFN-γ−/− mice appeared healthy and were significantly protected from SEB-induced lethality. SEB-induced systemic cytokine storm was significantly blunted in HLA-DR3.IFN-γ−/− transgenic mice. Serum concentrations of several cytokines (IL-4, IL-10, IL-12p40 and IL-17) and chemokines (KC, rantes, eotaxin and MCP-1) were significantly lower in HLA-DR3.IFN-γ−/− transgenic mice. However, SEB-induced T cell expansion in the spleens was unaffected and expansion of SEB-reactive TCR Vβ8+ CD4+ and CD8+ T cells was even more pronounced in HLA-DR3.IFN-γ−/− transgenic mice when compared to HLA-DR3.IFN-γ+/+ mice. A systematic histopathological examination of several vital organs revealed that both HLA-DR3.IFN-γ+/+ and HLA-DR3.IFN-γ−/− transgenic mice displayed comparable severe inflammatory changes in lungs, and liver during TSS. Remarkably, whereas the small intestines from HLA-DR3.IFN-γ+/+ transgenic mice displayed significant pathological changes during TSS, the architecture of small intestines in HLA-DR3.IFN-γ−/− transgenic mice was preserved. In concordance with these histopathological changes, the gut permeability to macromolecules was dramatically increased in HLA-DR3.IFN-γ+/+ but not HLA-DR3.IFN-γ−/− mice during TSS. Overall, IFN
Very high-energy gamma rays from gamma-ray bursts.
Chadwick, Paula M
2007-05-15
Very high-energy (VHE) gamma-ray astronomy has undergone a transformation in the last few years, with telescopes of unprecedented sensitivity having greatly expanded the source catalogue. Such progress makes the detection of a gamma-ray burst at the highest energies much more likely than previously. This paper describes the facilities currently operating and their chances for detecting gamma-ray bursts, and reviews predictions for VHE gamma-ray emission from gamma-ray bursts. Results to date are summarized.
Interferon lambda (IFN-λ) efficiently blocks norovirus transmission in a mouse model.
Rocha-Pereira, Joana; Jacobs, Sophie; Noppen, Sam; Verbeken, Eric; Michiels, Thomas; Neyts, Johan
2018-01-01
Human noroviruses are highly efficient in person to person transmission thus associated with explosive outbreaks of acute gastroenteritis. Outbreak control is limited to disinfection and isolation measures. Strategies to control the spread of noroviruses should be developed and models to study norovirus transmission will greatly facilitate this. Here, a mouse-to-mouse transmission model, in which mice develop acute murine norovirus (MNV)-induced diarrhea, was used to explore the role of interferon lambda (IFN-λ) in the control of a norovirus infection. Sentinel AG129 mice [deficient in IFN-α/β and IFN-γ receptors] that were co-housed with MNV-infected mice shedding high amounts of virus in their stool, developed a MNV-infection with associated diarrhea. Inoculation of such sentinel mice with an IFN-λ expression plasmid resulted in the production of circulating IFN-λ and upregulation of the expression of IFN-stimulated genes (ISGs) of the gut. Injection of the IFN-λ-expressing plasmid to sentinels prevents MNV-induced disease upon exposure to MNV-infected mice, as well as MNV replication in the small intestine, the associated signs of inflammation and the mounting of a specific IgG-based immune response. This demonstrates that IFN-λ can alone mediate protection against transmission of norovirus. The development of a simple delivery method for IFN-λ could be explored as a strategy to control norovirus outbreaks and protect vulnerable populations such as the elderly and immunocompromised. Copyright © 2017. Published by Elsevier B.V.
Charoenvit, Yupin; Majam, Victoria Fallarme; Corradin, Giampietro; Sacci, John B.; Wang, Ruobing; Doolan, Denise L.; Jones, Trevor R.; Abot, Esteban; Patarroyo, Manuel E.; Guzman, Fanny; Hoffman, Stephen L.
1999-01-01
Most work on protective immunity against the pre-erythrocytic stages of malaria has focused on induction of antibodies that prevent sporozoite invasion of hepatocytes, and CD8+ T-cell responses that eliminate infected hepatocytes. We recently reported that immunization of A/J mice with an 18-amino-acid synthetic linear peptide from Plasmodium yoelii sporozoite surface protein 2 (SSP2) in TiterMax adjuvant induces sterile protection that is dependent on CD4+ T cells and gamma interferon (IFN-γ). We now report that immunization of inbred A/J mice and outbred CD1 mice with each of two linear synthetic peptides from the 17-kDa P. yoelii hepatocyte erythrocyte protein (HEP17) in the same adjuvant also induces protection against sporozoite challenge that is dependent on CD4+ T cells and IFN-γ. The SSP2 peptide and the two HEP17 peptides are recognized by B cells as well as T cells, and the protection induced by these peptides appears to be directed against the infected hepatocytes. In contrast to the peptide-induced protection, immunization of eight different strains of mice with radiation-attenuated sporozoites induces protection that is absolutely dependent on CD8+ T cells. Data represented here demonstrate that CD4+ T-cell-dependent protection can be induced by immunization with linear synthetic peptides. These studies therefore provide the foundation for an approach to pre-erythrocytic-stage malaria vaccine development, based on the induction of protective CD4+ T-cell responses, which will complement efforts to induce protective antibody and CD8+ T-cell responses. PMID:10531206
NASA Technical Reports Server (NTRS)
Wirth, J. J.; Kierszenbaum, F.; Sonnenfeld, G.; Zlotnik, A.
1985-01-01
Results are reported from a study of the influence gamma interferon (GIFN) and interleukin 2 (IL2) have on the capability of P388D1 cells and mouse resident peritoneal macrophages (MPM) to attach to the blood-resident parasites Trypanosoma cruzi and kill them. Cultures of trypomastigote forms of the Tulahuen strain of T. cruzi grown in bovine serum were introduced into peritoneal cells of mice, along with P388D1 cells incubated with GIFN, IL2 and both. Control cells were also maintained. Statistical analysis were then performed on data on counts of the number of dead T. Cruzi cells. The GIFN enhanced the interaction of MPM and P388D1 cells with the surface of T. Cruzi, provided the interaction was given over 12 hr to take place. A depression of the cytotoxicity of P388D1 cells was attributed to mediation by H2O2, an effect partially offset by incubation with the lymphokine GIFN.
Toki, S; Hiromatsu, K; Aoki, Y; Makino, M; Yoshikai, Y
1997-10-01
Mice with retrovirus-induced murine acquired immunodeficiency syndrome (MAIDS) were hypersensitive to lipopolysaccharide (LPS)-induced lethal shock accompanied by marked elevations of systematic interleukin 1beta (IL-beta) and interferon gamma (IFN-gamma) after LPS challenge. Pretreatment with 10 microg of recombinant human granulocyte colony-stimulating factor (rhG-CSF) protected MAIDS mice from hypersensitivity to LPS-induced lethal shock and this protection was concomitant with suppression of IFN-gamma production. Copyright 1997 Academic Press Limited.
Takii, T; Niki, N; Yang, D; Kimura, H; Ito, A; Hayashi, H; Onozaki, K
1995-12-01
The regulation of type I interleukin-1 receptor (IL-1R) expression by type I, interferon (IFN)-alpha A/D, and type II IFN, IFN-gamma, in a human fibroblast cell line TIG-1 was investigated. After 2 h stimulation with human IFN-alpha A/D or IFN-gamma, the levels of type I IL-1R mRNA increased. We previously reported that IL-1 upregulates transcription and cell surface molecules of type I IL-1R in TIG-1 cells through induction of prostaglandin (PG) E2 and cAMP accumulation. However, indomethacin was unable to inhibit the effect of IFNs, indicating that IFNs augment IL-1R expression through a pathway distinct from that of IL-1. The augmentation was also observed in other fibroblast cell lines. Nuclear run-on assays and studies of the stability of mRNA suggested that the increase in IL-1R mRNA was a result of the enhanced transcription of IL-1R gene. Binding studies using 125I-IL-1 alpha revealed that the number of cell surface IL-1R increased with no change in binding affinity by treatment with these IFNs. Pretreatment of the cells with IFNs enhanced IL-1-induced IL-6 production, indicating that IFNs upregulate functional IL-1R. IL-1 and IFNs are produced by the same cell types, as well as by the adjacent different cell types, and are concomitantly present in lesions of immune and inflammatory reactions. These results therefore suggest that IFNs exhibit synergistic effects with IL-1 through upregulation of IL-1R. Augmented production of IL-6 may also contribute to the reactions.
Interferon-gamma promoter hypomethylation and increased expression in chronic periodontitis
Zhang, Shaoping; Crivello, Antonino; Offenbacher, Steven; Moretti, Antonio; Paquette, David W.; Barros, Silvana P.
2011-01-01
Aim The goal of this investigation was to determine whether epigenetic modifications in the IFNG promoter are associated with an increase of IFNG transcription in different stages of periodontal diseases. Materials and Methods DNA was extracted from gingival biopsy samples collected from 47 total sites from 47 different subjects: 23 periodontally healthy sites, 12 experimentally induced gingivitis sites and 12 chronic periodontitis sites. Levels of DNA methylation within the IFNG promoter containing six CpG dinucleotides were determined using pyrosequencing technology. Interferon gamma mRNA expression was analysed by quantitative polymerase chain reactions using isolated RNA from part of the biological samples mentioned above. Results The methylation level of all six analysed CpG sites within the IFNG promoter region in the periodontitis biopsies {52% [interquartile range, IQR (43.8%, 63%)]} was significantly lower than periodontally healthy samples {62% [IQR (51.3%, 74%)], p =0.007} and gingivitis biopsies {63% [IQR (55%, 74%)], p =0.02}. The transcriptional level of IFNG in periodontitis biopsies was 1.96-fold and significantly higher than tissues with periodontal health (p =0.04). Although the mRNA level from experimental gingivitis samples exhibited an 8.5-fold increase as compared with periodontally healthy samples, no significant methylation difference was observed in experimental gingivitis sample. Conclusions A hypomethylation profile within IFNG promoter region is related to an increase of IFNG transcription present in the chronic periodontitis biopsies, while such an increase of IFNG in experimentally induced gingivitis seems independent of promoter methylation alteration. PMID:20958339
Lam, L K Metthew; Watson, Alan M; Ryman, Kate D; Klimstra, William B
2018-01-01
Live attenuated viruses are historically among the most effective viral vaccines. Development of a safe vaccine requires the virus to be less virulent, a phenotype that is historically arrived by empirical evaluation often leaving the mechanisms of attenuation unknown. The yellow fever virus 17D live attenuated vaccine strain has been developed as a delivery vector for heterologous antigens; however, the mechanisms of attenuation remain elusive. The successful and safe progress of 17D as a vaccine vector and the development of live attenuated vaccines (LAVs) to related flaviviruses requires an understanding of the molecular mechanisms leading to attenuation. Using subcutaneous infection of interferon-deficient mouse models of wild type yellow fever virus (WT YFV) pathogenesis and 17D-mediated immunity, we found that, in the absence of type I IFN (IFN-α/β), type II interferon (IFN-γ) restricted 17D replication, but not that of WT YFV, by 1-2 days post-infection. In this context, IFN-γ responses protected 17D-infected animals from mortality, largely restricted the virus to lymphoid organs, and eliminated viscerotropic disease signs such as steatosis in the liver and inflammatory cell infiltration into the spleen. However, WT YFV caused a disseminated infection, gross liver pathology, and rapid death of the animals. In vitro, IFN-γ treatment of myeloid cells suppressed the replication of 17D significantly more than that of WT YFV, suggesting a direct differential effect on 17D virus replication. Together these data indicate that an important mechanism of 17D attenuation in vivo is increased sensitivity to IFN-γ stimulated responses elicited early after infection.
Jung, Tae-Young; Pham, Thanh Nhan Nguyen; Umeyama, Akemi; Shoji, Noboru; Hashimoto, Toshihiro; Lee, Je-Jung; Takei, Masao
2010-09-25
Ursolic acid is triterpene isolated from Uncaria rhynchophylla and is a pharmacologically active substance. The induction of dendritic cell maturation is critical for the induction of Ag-specific T-lymphocyte response and may be essential for the development of human vaccine relying on T cell immunity. In this study, we investigated that the effect of Ursolic acid on the phenotypic and functional maturation of human monocyte-derived dendritic cells in vitro. Dendritic cells harvested on day 8 were examined using functional assay. The expression levels of CD1a, CD80, CD83, CD86, HLA-DR and CCR7 on Ursolic acid-primed dendritic cells was slightly enhanced. Ursolic acid dose-dependently enhanced the T cell stimulatory capacity in an allogeneic mixed lymphocyte reaction, as measured by T cell proliferation. The production of IL-12p70 induced by Ursolic acid-primed dendritic cells was inhibited by the anti-Toll-like receptor-2 (TLR2) mAb and anti-TLR4 mAb. Moreover, Ursolic acid-primed dendritic cells expressed levels of mRNA coding for both TLR2 and TLR4. The majority of cells produced considerable interferon-gamma (IFN-gamma), but also small amounts of interleukin (IL-4)-4. Ursolic acid-primed dendritic cells have an intermediate migratory capacity towards CCL19 and CCL21. These results suggest that Ursolic acid modulates human dendritic cells function in a fashion that favors Th1 polarization via the activation of IL-12p70 dependent on TLR2 and/or TLR4, and may be used on dendritic cells-based vaccines for cancer immunotherapy. 2010 Elsevier B.V. All rights reserved.
Effects of isolation on interferon production and hematological and immunological parameters
NASA Technical Reports Server (NTRS)
Sonnenfeld, G.; Measel, J.; Loken, M. R.; Degioanni, J.; Follini, S.; Galvagno, A.; Montalbini, M.
1992-01-01
A 27-year-old woman was maintained in an isolated state for 131 days in Carlsbad Caverns, New Mexico. Her diet was vitamin D-depleted. Determinations on the effects of such isolation on levels and activities of peripheral blood cells that are important for hematological homeostasis and immunological function were carried out. Throughout the duration of the study, the percentage of lymphoid cells that expressed CD3, CD4, CD8, CD19, Leu 8, and other markers remained relatively constant although the absolute numbers of these cells varied. Although the percentage of natural killer (NK) cells did not vary, the activity of these cells did change. NK cell activity became elevated as the isolation study progressed. Production of interferon-gamma (IFN-gamma) in response to mitogen stimulation was higher than expected throughout the isolation periods, but returned to the normal range after termination of the isolation. Red and white cell counts dropped significantly upon entering isolation, but soon returned to normal.
Hao, Junli; Jin, Wensong; Li, Xinghui; Wang, Saifeng; Zhang, Xiaojun; Fan, Hongxia; Li, Changfei; Chen, Lizhao; Gao, Bin; Liu, Guangze; Meng, Songdong
2013-01-01
Alpha interferon (IFN-α)-based therapy can effectively treat chronic hepatitis B virus (HBV) infection, which causes life-threatening complications. Responses to IFN-α therapy vary greatly in chronic hepatitis B (CHB) patients, but underlying mechanisms are almost unknown. In this study, we found that IFN-α treatment induced a marked decrease of microRNA-122 (miR-122) expression in hepatocytes. We next showed that IFN-α-induced miR-122 downregulation was only partly due to transcriptional suppression. One IFN-stimulated gene (ISG), NT5C3, which was identified as a miR-122 target, efficiently inhibited miR-122 by binding and sequestering miR-122 with its mRNA 3'-untranslated region (3'-UTR), indicating that this ISG is involved in IFN-α-mediated miR-122 suppression. Notably, the inhibitory effect of IFN-α on miR-122 was completely abolished by blocking IFN-α-induced upregulation of NT5C3 mRNA expression by RNA interference (RNAi). Meanwhile, we observed that miR-122 dramatically inhibited HBV expression and replication. Finally, we showed that IFN-α-mediated HBV-inhibitory effects could be enhanced significantly by blocking IFN-α-induced downregulation of miR-122. We therefore concluded that IFN-α-induced inhibition of miR-122 may negatively affect the anti-HBV function of IFN-α. These data provide valuable insights for a better understanding of the antiviral mechanism of IFN-α and raise further potential interest in enhancing its anti-HBV efficacy.
Hao, Junli; Jin, Wensong; Li, Xinghui; Wang, Saifeng; Zhang, Xiaojun; Fan, Hongxia; Li, Changfei; Chen, Lizhao; Gao, Bin
2013-01-01
Alpha interferon (IFN-α)-based therapy can effectively treat chronic hepatitis B virus (HBV) infection, which causes life-threatening complications. Responses to IFN-α therapy vary greatly in chronic hepatitis B (CHB) patients, but underlying mechanisms are almost unknown. In this study, we found that IFN-α treatment induced a marked decrease of microRNA-122 (miR-122) expression in hepatocytes. We next showed that IFN-α-induced miR-122 downregulation was only partly due to transcriptional suppression. One IFN-stimulated gene (ISG), NT5C3, which was identified as a miR-122 target, efficiently inhibited miR-122 by binding and sequestering miR-122 with its mRNA 3′-untranslated region (3′-UTR), indicating that this ISG is involved in IFN-α-mediated miR-122 suppression. Notably, the inhibitory effect of IFN-α on miR-122 was completely abolished by blocking IFN-α-induced upregulation of NT5C3 mRNA expression by RNA interference (RNAi). Meanwhile, we observed that miR-122 dramatically inhibited HBV expression and replication. Finally, we showed that IFN-α-mediated HBV-inhibitory effects could be enhanced significantly by blocking IFN-α-induced downregulation of miR-122. We therefore concluded that IFN-α-induced inhibition of miR-122 may negatively affect the anti-HBV function of IFN-α. These data provide valuable insights for a better understanding of the antiviral mechanism of IFN-α and raise further potential interest in enhancing its anti-HBV efficacy. PMID:23055569
van Gorkom, T; Sankatsing, S U C; Voet, W; Ismail, D M; Muilwijk, R H; Salomons, M; Vlaminckx, B J M; Bossink, A W J; Notermans, D W; Bouwman, J J M; Kremer, K; Thijsen, S F T
2018-04-01
Two-tier serology testing is most frequently used for the diagnosis of Lyme borreliosis (LB); however, a positive result is no proof of active disease. To establish a diagnosis of active LB, better diagnostics are needed. Tests investigating the cellular immune system are available, but studies evaluating the utility of these tests on well-defined patient populations are lacking. Therefore, we investigated the utility of an enzyme-linked immunosorbent spot (ELISpot) assay to diagnose active Lyme neuroborreliosis. Peripheral blood mononuclear cells (PBMCs) of various study groups were stimulated by using Borrelia burgdorferi strain B31 and various recombinant antigens, and subsequently, the number of Borrelia -specific interferon gamma (IFN-γ)-secreting T cells was measured. We included 33 active and 37 treated Lyme neuroborreliosis patients, 28 healthy individuals treated for an early manifestation of LB in the past, and 145 untreated healthy individuals. The median numbers of B. burgdorferi B31-specific IFN-γ-secreting T cells/2.5 × 10 5 PBMCs did not differ between active Lyme neuroborreliosis patients (6.0; interquartile range [IQR], 0.5 to 14.0), treated Lyme neuroborreliosis patients (4.5; IQR, 2.0 to 18.6), and treated healthy individuals (7.4; IQR, 2.3 to 14.9) ( P = 1.000); however, the median number of B. burgdorferi B31-specific IFN-γ-secreting T cells/2.5 × 10 5 PBMCs among untreated healthy individuals was lower (2.0; IQR, 0.5 to 3.9) ( P ≤ 0.016). We conclude that the Borrelia ELISpot assay, measuring the number of B. burgdorferi B31-specific IFN-γ-secreting T cells/2.5 × 10 5 PBMCs, correlates with exposure to the Borrelia bacterium but cannot be used for the diagnosis of active Lyme neuroborreliosis. Copyright © 2018 van Gorkom et al.
van Gorkom, T.; Sankatsing, S. U. C.; Voet, W.; Ismail, D. M.; Muilwijk, R. H.; Salomons, M.; Vlaminckx, B. J. M.; Bossink, A. W. J.; Notermans, D. W.; Bouwman, J. J. M.; Kremer, K.
2018-01-01
ABSTRACT Two-tier serology testing is most frequently used for the diagnosis of Lyme borreliosis (LB); however, a positive result is no proof of active disease. To establish a diagnosis of active LB, better diagnostics are needed. Tests investigating the cellular immune system are available, but studies evaluating the utility of these tests on well-defined patient populations are lacking. Therefore, we investigated the utility of an enzyme-linked immunosorbent spot (ELISpot) assay to diagnose active Lyme neuroborreliosis. Peripheral blood mononuclear cells (PBMCs) of various study groups were stimulated by using Borrelia burgdorferi strain B31 and various recombinant antigens, and subsequently, the number of Borrelia-specific interferon gamma (IFN-γ)-secreting T cells was measured. We included 33 active and 37 treated Lyme neuroborreliosis patients, 28 healthy individuals treated for an early manifestation of LB in the past, and 145 untreated healthy individuals. The median numbers of B. burgdorferi B31-specific IFN-γ-secreting T cells/2.5 × 105 PBMCs did not differ between active Lyme neuroborreliosis patients (6.0; interquartile range [IQR], 0.5 to 14.0), treated Lyme neuroborreliosis patients (4.5; IQR, 2.0 to 18.6), and treated healthy individuals (7.4; IQR, 2.3 to 14.9) (P = 1.000); however, the median number of B. burgdorferi B31-specific IFN-γ-secreting T cells/2.5 × 105 PBMCs among untreated healthy individuals was lower (2.0; IQR, 0.5 to 3.9) (P ≤ 0.016). We conclude that the Borrelia ELISpot assay, measuring the number of B. burgdorferi B31-specific IFN-γ-secreting T cells/2.5 × 105 PBMCs, correlates with exposure to the Borrelia bacterium but cannot be used for the diagnosis of active Lyme neuroborreliosis. PMID:29367297
INF-gamma rearranges membrane topography of MHC-I and ICAM-1 in colon carcinoma cells.
Bacsó, Zsolt; Bene, László; Damjanovich, László; Damjanovich, Sándor
2002-01-18
Flow-cytometric fluorescence energy transfer (FCET) measurements between fluorescently labeled cell surface MHC-I and ICAM-1 molecules indicated similar receptor patterns in the plasma membrane of interferon-gamma (INF-gamma)-treated colon carcinoma cells as those observed earlier at the surface of lymphoid cells. INF-gamma activation significantly increased the density of MHC-I and ICAM-1 proteins in the membrane. This increase in receptor density was accompanied by decreased proximity level of the homo-associated MHC-I receptors. Hetero-association of MHC-I and ICAM-1 molecules was increased by INF-gamma treatment. INF-gamma changed neither hetero- nor homo-association of transferrin receptors. By staining the sphingomyelin/cholesterol-enriched lipid microdomains with fluorescently labeled cholera toxin B subunit, we found an increase in the amount of lipid-raft associated G(M1)-gangliosides due to INF-gamma treatment. Confocal microscopic results and FCET measurements show that MHC-I and ICAM-1 are components of G(M1)-ganglioside containing lipid-rafts and also support an increase in the size of these lipid-rafts upon INF-gamma treatment.
A new assay system for guinea pig interferon biological activity.
Yamamoto, Toshiko; Jeevan, Amminikutty; Ohishi, Kazue; Nojima, Yasuhiro; Umemori, Kiyoko; Yamamoto, Saburo; McMurray, David N
2002-07-01
We have developed an assay system for guinea pig interferon (IFN) based on reduction of viral cytopathic effect (CPE) in various cell lines. CPE inhibition was detected optimally in the guinea pig fibroblast cell line 104C1 infected with encephalomyocarditis virus (EMCV). The amount of biologically active guinea pig IFN was quantified by estimating viable cell numbers colorimetrically by means of a tetrazolium compound, 2-(4-iodophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium monosodium salt (WST-1) and 1-methoxy-5-methylphenazinium methylsulfate (PMS). WST-1 color developed until stopped by the addition of sulfuric acid. This had no effect on the colorimetric assay, and the color was stable for at least 24 h. The acid also inactivated the EMCV and, thus, eliminated the viral hazard. Inhibition of CPE activity was highly correlated with the concentration of culture supernatants from BCG-vaccinated guinea pig splenocytes stimulated in vitro with tuberculin or an immunostimulatory oligoDNA. This assay detected guinea pig IFN and human IFN-alpha, but not IFN-gamma from human, mouse, rat, pig, or dog. This assay system has proved useful for the titration of guinea pig IFN, being easy to perform, free from viral hazard, relatively species specific, highly reproducible, and inexpensive.
β-Glucan from Saccharomyces cerevisiae Induces IFN-γ Production In Vivo in BALB/c Mice.
Javmen, Artur; Nemeikaitė-Čėnienė, Aušra; Bratchikov, Maksim; Grigiškis, Saulius; Grigas, Fortūnatas; Jonauskienė, Irena; Zabulytė, Danguolė; Mauricas, Mykolas
2015-01-01
β-Glucan is one of the most abundant polymers in nature and has been established as an immunomodulator. This compound has notable physiological effects on mammalian immune systems, including anti-tumor and anti-infective activities and can activate the immune response. It is considered that the immune-stimulating activities of β-glucan can depend on physicochemical parameters, such as molecular size. Saccharomyces cerevisiae, also known as baker's yeast, is a frequently used source of β-glucan. The aim of the experiments was to investigate how different Saccharomyces cerevisiae β-glucan preparations with different molecular size affect interferon-gamma (IFN-γ) production in BALB/c mice. In vivo and in vitro BALB/c mouse models were used for the investigations. Different β-glucan preparations were orally administrated in the in vivo experiments. IFN-γ production in BALB/c mice was analyzed by enzyme-linked immunosorbent assay and measuring interferon-γ RNA concentration. The results showed that orally-administered β-glucan from S. cerevisiae enhanced IFN-γ production in BALB/c mice in the in vivo model, but not by mouse leukocytes in vitro. Moreover, water-soluble β-glucan enhanced IFN-γ production more effectively than did particulate β-glucan. IFN-γ plays an important role in immunity against viral and bacterial infections. Our experiments have shown that β-glucan preparations enhance IFN-γ production in BALB/c mice and can be potentially used for immune system stimulation in mammals. Current results may be used to develop soluble β-glucan nutritional supplements. Copyright © 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
Tenforde, Mark W.; Gupte, Nikhil; Dowdy, David W.; Asmuth, David M.; Balagopal, Ashwin; Pollard, Richard B.; Sugandhavesa, Patcharaphan; Lama, Javier R.; Pillay, Sandy; Cardoso, Sandra W.; Pawar, Jyoti; Santos, Breno; Riviere, Cynthia; Mwelase, Noluthando; Kanyama, Cecilia; Kumwenda, Johnstone; Hakim, James G.; Kumarasamy, Nagalingeswaran; Bollinger, Robert; Semba, Richard D.; Campbell, Thomas B.; Gupta, Amita
2015-01-01
Objective The association between pre-antiretroviral (ART) inflammation and immune activation and risk for incident tuberculosis (TB) after ART initiation among adults is uncertain. Design Nested case-control study (n = 332) within ACTG PEARLS trial of three ART regimens among 1571 HIV-infected, treatment-naïve adults in 9 countries. We compared cases (participants with incident TB diagnosed by 96 weeks) to a random sample of controls (participants who did not develop TB, stratified by country and treatment arm). Methods We measured pre-ART C-reactive protein (CRP), EndoCab IgM, ferritin, interferon gamma (IFN-γ), interleukin 6 (IL-6), interferon gamma-inducible protein 10 (IP-10), lipopolysaccharide (LPS), soluble CD14 (sCD14), tumor necrosis factor alpha (TNF-α), and CD4/DR+/38+ and CD8/DR+/38+ T cells. Markers were defined according to established cutoff definitions when available, 75th percentile of measured values when not, and detectable versus undetectable for LPS. Using logistic regression, we measured associations between biomarkers and incident TB, adjusting for age, sex, study site, treatment arm, baseline CD4 and log10 viral load. We assessed the discriminatory value of biomarkers using receiver operating characteristic (ROC) analysis. Results Seventy-seven persons (4.9%) developed incident TB during follow-up. Elevated baseline CRP (aOR 3.25, 95% CI: 1.55–6.81) and IP-10 (aOR 1.89, 95% CI: 1.05–3.39), detectable plasma LPS (aOR 2.39, 95% CI: 1.13–5.06), and the established TB risk factors anemia and hypoalbuminemia were independently associated with incident TB. In ROC analysis, CRP, albumin, and LPS improved discrimination only modestly for TB risk when added to baseline routine patient characteristics including CD4 count, body mass index, and prior TB. Conclusion Incident TB occurs commonly after ART initiation. Although associated with higher post-ART TB risk, baseline CRP, IP-10, and LPS add limited value to routine patient characteristics
Gamma-sky.net: Portal to the gamma-ray sky
NASA Astrophysics Data System (ADS)
Voruganti, Arjun; Deil, Christoph; Donath, Axel; King, Johannes
2017-01-01
http://gamma-sky.net is a novel interactive website designed for exploring the gamma-ray sky. The Map View portion of the site is powered by the Aladin Lite sky atlas, providing a scalable survey image tesselated onto a three-dimensional sphere. The map allows for interactive pan and zoom navigation as well as search queries by sky position or object name. The default image overlay shows the gamma-ray sky observed by the Fermi-LAT gamma-ray space telescope. Other survey images (e.g. Planck microwave images in low/high frequency bands, ROSAT X-ray image) are available for comparison with the gamma-ray data. Sources from major gamma-ray source catalogs of interest (Fermi-LAT 2FHL, 3FGL and a TeV source catalog) are overlaid over the sky map as markers. Clicking on a given source shows basic information in a popup, and detailed pages for every source are available via the Catalog View component of the website, including information such as source classification, spectrum and light-curve plots, and literature references. We intend for gamma-sky.net to be applicable for both professional astronomers as well as the general public. The website started in early June 2016 and is being developed as an open-source, open data project on GitHub (https://github.com/gammapy/gamma-sky). We plan to extend it to display more gamma-ray and multi-wavelength data. Feedback and contributions are very welcome!
Watanuki, Hironobu; Chakraborty, Gunimala; Korenaga, Hiroki; Kono, Tomoya; Shivappa, R B; Sakai, Masahiro
2009-10-15
Human interferon-alpha (huIFN-alpha) is an important immunomodulatory substance used in the treatment and prevention of numerous infectious and immune-related diseases in animals. However, the immunostimulatory effects of huIFN-alpha in fish remain to be investigated. In the current study, the immune responses of the carp species Cyprinus carpio L. to treatment with huIFN-alpha were analyzed via measurement of superoxide anion production, phagocytic activity and the expression of cytokine genes including interleukin-1beta, tumor necrosis factor-alpha and interleukin 10. Low doses of huIFN-alpha were administered orally once a day for 3 days, and sampling was carried out at 1, 3 and 5 days post-treatment. Our results indicate that a low dose of huIFN-alpha significantly increased phagocytic activity and superoxide anion production in the carp kidney. The huIFN-alpha-treated fish also displayed a significant upregulation in cytokine gene expression. The current study demonstrates the stimulatory effects of huIFN-alpha on the carp immune system and highlights the immunomodulatory role of huIFN-alpha in fish.
Interferon system in women with genital papillomavirus infection receiving immunomodulatory therapy.
Rogovskaya, S I; Zhdanov, A V; Loginova, N S; Faizullin, L Z; Prilepskaya, V N; Van'ko, L V; Sukhikh, G T
2002-11-01
The interferon system was studied in women with genital papillomavirus infection. In most patients the interferon system was activated, while the ability of lymphocytes to respond to inductors decreased. Laserotherapy and immunomodulatory therapy with larifan, ridostin, and viferon for 1 month normalized blood interferon concentration (39.4% patients) and interferon-gamma production by lymphocytes in response to inductors (87.9% patients). After laser monotherapy these parameters returned to normal only in 13.2 and 7.6% patients, respectively. Correlation and regression analyses showed that changes in the interferon system were synchronized after immunomodulatory therapy. These data indicate that immunomodulatory therapy produces a complex effect on the interferon system. Measurements of blood interferon level can be used to predict the effect of further treatment with interferon-gamma inductors.
Jeevan, Amminikutty; Bonilla, Diana Lucia; McMurray, David Neil
2009-09-01
Cytokine messenger RNA (mRNA) expression was investigated in the spleen and lung digest cells of bacillus Calmette-Guérin (BCG)-vaccinated and non-vaccinated guinea pigs following low-dose, pulmonary exposure to virulent Mycobacterium tuberculosis. After purified protein derivative (PPD) stimulation, the levels of lung cell interferon-gamma (IFN-gamma), tumour necrosis factor-alpha (TNF-alpha) and spleen cell interleukin-12 (IL-12) p40 mRNAs were significantly increased in the non-vaccinated M. tuberculosis-infected guinea pigs compared to the BCG-vaccinated guinea pigs. In contrast, the expression of anti-inflammatory transforming growth factor-beta and IL-10 mRNAs was significantly enhanced in the spleens of BCG-vaccinated animals. Despite the presence of protective cytokine mRNA expression, the non-vaccinated guinea pigs had significantly higher lung and spleen bacterial burdens. In contrast, BCG-vaccinated guinea pigs controlled the bacterial multiplication in their lungs and spleens, indicating that both protective as well as anti-inflammatory cytokine responses are associated with a reduction in bacteria. In addition, lung digest cells from non-vaccinated guinea pigs contained a significantly higher percentage of neutrophils, CD3(+) and CD8(+) T cells, while the percentage of macrophages was increased in the BCG-vaccinated animals. Total and purified lung digest T cells co-cultured with lung macrophages (LMøs) proliferated poorly after PPD stimulation in both non-vaccinated and BCG-vaccinated animals while robust proliferation to PPD was observed when T cells were co-cultured with peritoneal macrophages (PMøs). Macrophages within the lung compartment appear to regulate the response of T cells irrespective of the vaccination status in guinea pigs. Taken together, our results suggest that type I cytokine mRNA expression is not associated with vaccine-induced protection in the low-dose guinea pig model of tuberculosis.
Pae, H O; Seo, W G; Oh, G S; Kim, N Y; Kim, Y M; Kwon, T O; Shin, M K; Chai, K Y; Chung, H T
2001-02-01
We have examined the effect of the aqueous extract of Rhodiola sachalinensis root (RSE), a traditional herbal medicine, on nitric oxide (NO) synthesis in murine fetal hepatocytes (BNL CL.2) by measuring the stable end-product nitrite and the mRNA of inducible NO synthase (iNOS). Interferon-gamma (IFN-gamma) by itself failed to induce NO synthesis in BNL CL.2 cells. RSE also did not elicit NO synthesis at concentrations up to 1,000 microg/ml, but dose- and time-dependently induced NO synthesis in the presence of IFN-gamma in BNL CL.2 cells. Whereas RSE or IFN-gamma failed to induce detectable levels of iNOS mRNA, a combination of RSE and IFN-gamma markedly induced iNOS mRNA in BNL CL.2 cells. Thus, we found that RSE triggered IFN-gamma-primed BNL CL.2 cells to synthesize NO by inducing iNOS gene expression. The capability of RSE to induce NO synthesis might be related to the therapeutic efficacy of RSE on the liver diseases.
Adjuvant immunotherapy of feline fibrosarcoma with recombinant feline interferon-omega.
Hampel, Verena; Schwarz, Bianca; Kempf, Christine; Köstlin, Roberto; Schillinger, Ulrike; Küchenhoff, Helmut; Fenske, Nora; Brill, Thomas; Hirschberger, Johannes
2007-01-01
Recombinant feline interferon-omega (rFeIFN-omega) was tested as a treatment option for cats with fibrosarcoma to assess safety and feasibility. Treatment with rFeIFN-omega in cats with fibrosarcoma is safe and feasible. Twenty domestic cats. In an open-labeled uncontrolled clinical trial 12 injections of 1 x 10(6) U/kg rFeIFN-omega were administered over a 5-week period: the 1st through 4th injections were given intratumorally, and the 5th through 12th injections were administered subcutaneously at the tumor excision site. Wide surgical excision of the tumors was carried out after the 4th injection and before the 5th injection of rFeIFN-omega. A Common Terminology Criteria for Adverse Events (CTCAE) analysis was conducted. Flow cytometry of fibrosarcoma cells after incubation with rFeIFN-omega and recombinant feline interferon-gamma was performed to assess the biological effect of rFeIFN-omega. Changes in blood cell count, increases in serum aspartate-amino-transferase activity, serum bilirubin concentration, serum creatinine and serum electrolyte concentrations, weight loss, anorexia, increased body temperature, and reduced general condition were observed but were mostly minor (grade 1 and 2) and self limiting. Eosinophilia (P = .025), neutropenia (P = .021), and weight loss (P < .001) were statistically correlated with rFeIFN-omega-treatment (analysis of parameters before treatment and after 3 injections of rFeIFN-omega). Flow cytometry of 5 unrelated feline fibrosarcoma cell lines showed increased expression of major histocompatibility complex (MHC) class I molecules (P = .026) in response to in vitro incubation with rFeIFN-omega, whereas expression of MHC class II molecules was not affected significantly. RFeIFN-omega for the treatment of feline fibrosarcoma is safe, well tolerated, and can be easily performed in practice. To assess the efficacy of the treatment, it should be tested in a placebo-controlled trial.
Resonance production in. gamma gamma. collisions
DOE Office of Scientific and Technical Information (OSTI.GOV)
Renard, F.M.
1983-04-01
The processes ..gamma gamma.. ..-->.. hadrons can be depicted as follows. One photon creates a q anti q pair which starts to evolve; the other photon can either (A) make its own q anti q pair and the (q anti q q anti q) system continue to evolve or (B) interact with the quarks of the first pair and lead to a modified (q anti q) system in interaction with C = +1 quantum numbers. A review of the recent theoretical activity concerning resonance production and related problems is given under the following headings: hadronic C = +1 spectroscopy (qmore » anti q, qq anti q anti q, q anti q g, gg, ggg bound states and mixing effects); exclusive ..gamma gamma.. processes (generalities, unitarized Born method, VDM and QCD); total cross section (soft and hard contributions); q/sup 2/ dependence of soft processes (soft/hard separation, 1/sup +- +/ resonances); and polarization effects. (WHK)« less
Kopp, M V; Goldstein, M; Dietschek, A; Sofke, J; Heinzmann, A; Urbanek, R
2008-04-01
The value of probiotics for primary prevention is controversial. Moreover, only little is known about the underlying immunological mechanisms of action. Therefore, we assessed the proliferative response and cytokine release in cultures of isolated mononuclear cells from pregnant women and their neonates supplemented with Lactobacillus GG (LGG) or placebo. In a double-blind, placebo-controlled prospective trial, pregnant women with at least one first-degree relative or a partner with an atopic disease were randomly assigned to receive either the probiotic LGG (ATCC 53103; 5 x 10(9) colony-forming units LGG twice daily) or placebo 4-6 weeks before expected delivery, followed by a post-natal period of 6 months. Cord blood mononuclear cells (CBMC) and peripheral blood mononuclear cells (PBMC) of the corresponding mother were isolated from cord blood and peripheral blood (n=68). The proliferative response of CBMC and PBMC was expressed as the stimulation index (SI), which was calculated according to the ratio between the mean counts per minute (c.p.m.) values measured in the wells with stimulated cells and the mean c.p.m. values measured in the wells with unstimulated cells. Additionally, the cytokines IFN-gamma, IL-10 and IL-13 in the cell culture supernatants were measured using the ELISA technique. No difference was observed between the LGG-supplemented group and the placebo group in terms of the proliferative capacity of maternal or neonatal cord blood cells in response to IL-2, beta-lactoglobulin or LGG. In vitro stimulation with LGG resulted in significantly enhanced release of IL-10 and IFN-gamma, compared with cytokine release in unstimulated controls. However, this phenomenon was observed in supernatants of maternal and neonatal MC in both groups, independent of prior supplementation with LGG. LGG has in vitro effects on enhanced IL-10 and IFN-gamma release of mononuclear cells. However, supplementation with LGG during pregnancy did not alter the proliferative
Tanveer, Mahnaz; Hasan, Zahra; Kanji, Akbar; Hussain, Rabia; Hasan, Rumina
2009-06-01
Pakistan ranks eighth in terms of tuberculosis burden worldwide, with an incidence of 181/100000. The predominant genotypes of Mycobacterium tuberculosis are reported to be the Central Asian strain 1 (CAS1) and Beijing families.Mycobacteriumtuberculosis down-regulates host pro-inflammatory cytokines, which are essential for protection against infection. There is currently little information regarding the interaction of the CAS1 genotype with host cells. We studied the growth rates of CAS1 and Beijing clinical isolates, and their ability to induce cytokines compared with the laboratory reference strain H37Rv. Host responses were studied using a THP-1 monocytic cell line model and an ex vivo whole blood assay. Growth rates of CAS1 and Beijing isolates were significantly lower (P=0.011) compared with H37Rv. All clinical isolates induced significantly lower levels of TNF-alpha secretion (P=0.003) than H37Rv in THP-1 cells and in the whole blood assay of healthy donors (n=8). They also induced lower IFN-gamma secretion in the whole blood assay (P<0.001). A positive correlation was observed between the growth indices (GI) of H37Rv, Beijing and CAS1 strains and the TNF-alpha responses they induced [Pearson's correlation coefficient (R(2)): 0.936, 0.775 and 0.55, respectively], and also between GI and IFN-gamma production (R(2): 0.422, 0.946, 0.674). These findings suggest that reduced growth rate, together with down-modulation of pro-inflammatory cytokines, is a contributory mechanism for the predominance of the CAS genotype.
Interferon-gamma and T-bet expression in a patient with toxoplasmic lymphadenopathy.
Jöhrens, Korinna; Moos, Verena; Schneider, Thomas; Stein, Harald; Anagnostopoulos, Ioannis
2010-04-01
Infection with Toxoplasma gondii (TG) presents in some individuals as a self-limited disease with a predominant lymphadenopathy characterized by prominent B-cell activation. As this is in contrast to the in vitro based concept of a T(h)1-immune response against TG, we investigated native lymphoid tissue and peripheral blood of a patient with serologic evidence of toxoplasmosis to verify which cells show T(h)1-response features. High-level expression of T-bet in monocytoid B-cells, in germinal center B-cells, and in a lesser amount in T cells could be demonstrated by immunohistochemistry. In vitro stimulation of lymph node cells with either TG, staphylococcus enterotoxin B, or phorbol 12-myristate 13-acetate/ionomycin revealed an interferon-gamma expression in T-bet(+) B cells only in the patient and not in controls. Similar results were found for T-bet(+) T cells which were also present in controls. CD4(+) peripheral blood cells stimulated with TG antigens showed a TG-specific but attenuated T(h)1-reactivity in the patient associated with a reduced expression of IL-2 when compared with controls. We conclude that the pathogenesis and course of toxoplasmic lymphadenopathy is based on a T(h)1-cell defect, which becomes compensated by the B cells mounting a T(h)1-like immune response.
CMOS image sensor for detection of interferon gamma protein interaction as a point-of-care approach.
Marimuthu, Mohana; Kandasamy, Karthikeyan; Ahn, Chang Geun; Sung, Gun Yong; Kim, Min-Gon; Kim, Sanghyo
2011-09-01
Complementary metal oxide semiconductor (CMOS)-based image sensors have received increased attention owing to the possibility of incorporating them into portable diagnostic devices. The present research examined the efficiency and sensitivity of a CMOS image sensor for the detection of antigen-antibody interactions involving interferon gamma protein without the aid of expensive instruments. The highest detection sensitivity of about 1 fg/ml primary antibody was achieved simply by a transmission mechanism. When photons are prevented from hitting the sensor surface, a reduction in digital output occurs in which the number of photons hitting the sensor surface is approximately proportional to the digital number. Nanoscale variation in substrate thickness after protein binding can be detected with high sensitivity by the CMOS image sensor. Therefore, this technique can be easily applied to smartphones or any clinical diagnostic devices for the detection of several biological entities, with high impact on the development of point-of-care applications.
Huang, Hao; Yang, Xi-Fei; Deng, Qun-Yi; Li, Bing; Liu, Guo-Hui; Zhang, Jie-Yun; Yang, Da-Fei
2012-06-01
To explore the potential application of IFN-gamma enzyme-linked immunospot (ELISPOT) assay in the diagnosis of tuberculous epididymitis (TE) by comparing ELISPOT assay with the traditional purified protein derivative (PPD) tuberculin skin test. We examined 13 TE patients using an in-house ELISPOT kit, another 11 TE patients by PPD skin testing, and 57 healthy male volunteers by parallel test with both the methods. Twelve (92.3%) of the 13 TE cases were positive on ELISPOT assay, and 10 (90.9%) of the 11 TE cases positive on PPD skin test, with no statistically significant differences between the two groups (P > 0.05). Among the 57 healthy male volunteers, 8 (14.0%) were positive on ELISPOT, and 28 (49.1%) positive on PPD test, the latter significantly higher than the former (P < 0.001). In terms of sensitivity, ELISPOT assay is similar to PPD test in the examination of tuberculous epididymitis. As for specificity, ELISPOT assay seems better than PPD test in differentiating tuberculous epididymitis patients from healthy males.
Immune-enhancing activities of low molecular weight β-glucan depolymerized by gamma irradiation
NASA Astrophysics Data System (ADS)
Sung, Nak-Yun; Byun, Eui-Hong; Kwon, Sun-Kyu; Song, Beom-Seok; Choi, Jong-il; Kim, Jae-Hun; Byun, Myung-Woo; Yoo, Young-Choon; Kim, Mee-Ree; Lee, Ju-Woon
2009-07-01
β-glucans are structural cell wall polymers of many microorganisms and cereals which possess immunomodulatory properties and have been used in the food, cosmetic and medical industry. In our previous study, β-glucan was depolymerized by gamma irradiation and leads to improve the solubility and viscosity. This study was carried out to evaluate the functional properties, mainly immune-enhancing activities of low molecular weight β-glucan fragmented by gamma irradiation. The results showed that RAW 264.7 macrophage cell stimulation activities of irradiated β-glucan were higher than that of non-irradiated β-glucan. In addition, the oral administration of gamma-irradiated β-glucan significantly increased the proliferation and cytokine (IFN-γ and IL-2) release of spleen and Peyer's patch cells compared with non-irradiated β-glucan. In conclusion, gamma irradiation could be used as an effective method for the production of depolymerized β-glucan improved functional property such as immunomodulatory activity.
Laban-Guceva, Nevenka; Antova, Magdalena; Bogoev, Milco
2007-11-01
TED is a severe eye disease leading in rare cases to decrease of sight, optic nerve compression and blindness. Recently, significant progresses in understanding the disease have been done. Nevertheless, the treatment of the disease, especially in its severe form remains challenging. Glucocorticoids (GC) have been the basis of the treatment for a long time. Orbital irradiation (OI) and optical decompression (OD) are also used in managing the severe forms of TED. Somatostatin, intravenous immunoglobulin have been also used, with conflicting results. Regarding the potential for the treatment of TED with cytokine antagonists, controlled clinical studies are not available. Since cytokines play an important role in the pathogenesis of the TED, they seemed to be logical choice for modern TED treatment. It has been shown that both Th1 (interleukin-2, tumor necrosis factor gamma, interleukin gamma) and Th2 (interleukin -4, -5, -10) profile T cells are activated in the TED. We therefore measured interleukin-gamma, IF-gamma and interleukin -10 (IL-10)(Th1 and Th2 pattern) to assess its relationship to the course of the disease. This paper shows that both Th1 (IL-2) and Th2 (IF-gamma) pathways represented by those two cytokines are not involved (IL-10 before 2.29+/-5.23 and after treatment 3.77+/-8.44; IF gamma before 0.50+/-0.24 and after treatment 0.35+/-0.19). No relationship to the response to treatment was found. GC resulted in positive response in 8/22 patients, OI (12 patients) given after CS therapy, resulted in a response in all patients. Increase in proptosis, loss of visual acuity is spite of CS treatment prompted OD in two patients, who both recovered visual acuity and proptosis fell under 25 mm Hertel.
NASA Astrophysics Data System (ADS)
Kheymits, M. D.; Leonov, A. A.; Zverev, V. G.; Galper, A. M.; Arkhangelskaya, I. V.; Arkhangelskiy, A. I.; Suchkov, S. I.; Topchiev, N. P.; Yurkin, Yu T.; Bakaldin, A. V.; Dalkarov, O. D.
2016-02-01
The GAMMA-400 gamma-ray space-based telescope has as its main goals to measure cosmic γ-ray fluxes and the electron-positron cosmic-ray component produced, theoretically, in dark-matter-particles decay or annihilation processes, to search for discrete γ-ray sources and study them in detail, to examine the energy spectra of diffuse γ-rays — both galactic and extragalactic — and to study gamma-ray bursts (GRBs) and γ-rays from the active Sun. Scientific goals of GAMMA-400 telescope require fine angular resolution. The telescope is of a pair-production type. In the converter-tracker, the incident gamma-ray photon converts into electron-positron pair in the tungsten layer and then the tracks are detected by silicon- strip position-sensitive detectors. Multiple scattering processes become a significant obstacle in the incident-gamma direction reconstruction for energies below several gigaelectronvolts. The method of utilising this process to improve the resolution is proposed in the presented work.
Solgi, G; Amirzagar, A A; Pourmand, G; Mehrsai, A R; Taherimahmoudi, M; Baradaran, N; Nicknam, M H; Ebrahimi Rad, M R; Saraji, A; Asadpoor, A A; Moheiydin, M; Nikbin, B
2009-09-01
We investigated the relevance of donor bone marrow cell infusion (DBMI) and serum levels of interferon-gamma (IFN-gamma), interleukin-10 (IL-10), and soluble CD30 (sCD30) in kidney recipients. We analyzed the allograft outcomes correlated with sCD30, IFN-gamma, and IL-10 levels using pre- and posttransplantation sera from 40 live donor renal transplants (20 patients with DBMI [2.1 x 10(9) +/- 1.3 x 10(9) mononuclear cells/body] and 20 controls). Patients with acute rejection episodes (ARE)-3/20 DBMI and 6/20 controls-showed increased sCD30 and IFN-gamma as well as decreased IL-10 posttransplantation compared with nonrejectors. Significant differences were observed for sCD30 and IFN-gamma levels: 59.54 vs 30.92 ng/mL (P = .02) and 11.91 vs 3.01 pg/mL (P = .01), respectively. Comparison of pre- and posttransplant levels of IFN-gamma, IL-10, and sCD30 in ARE patients showed higher levels in posttransplant sera except for IFN-gamma in controls (6.37 vs 11.93; P = .01). Increased IFN-gamma and IL-10 were correlated with rejection (r = .93; P = .008). sCD30 correlated with serum creatinine among ARE patients in control and DBMI groups (r = .89; P = .019; and r = 1.00; P < .0001, respectively). Higher levels of sCD30, IFN-gamma, and IL-10 posttransplantation in rejecting patients provided evidence for coexistence of cellular and humoral responses in ARE. There appeared to be a down-regulatory effect of infusion on alloresponses.
Neves, Patrícia C C; Rudersdorf, Richard A; Galler, Ricardo; Bonaldo, Myrna C; de Santana, Marlon Gilsepp Veloso; Mudd, Philip A; Martins, Maurício A; Rakasz, Eva G; Wilson, Nancy A; Watkins, David I
2010-11-29
The yellow fever 17D (YF-17D) vaccine is one of the most efficacious vaccines developed to date. Interestingly, vaccination with YF-17D induces IFN-γ production early after vaccination (days 5-7) before the development of classical antigen-specific CD8(+) and CD4(+) T cell responses. Here we investigated the cellular source of this early IFN-γ production. At days 5 and 7 post-vaccination activated CD8(+) gamma-delta TCR T cells produced IFN-γ and TNF-α. Activated CD4(+) T cells produced IFN-γ and TNF-α at day 7 post-vaccination. This early IFN-γ production was also induced after vaccination with recombinant YF-17D (rYF-17D), but was not observed after recombinant Adenovirus type 5 (rAd5) vaccination. Early IFN-γ production, therefore, might be an important aspect of yellow fever vaccination. Copyright © 2010 Elsevier Ltd. All rights reserved.
Carreño, V; Rico, M A; Pardo, M; Quiroga, J A
2001-11-01
In a pilot study of combination therapy with ribavirin and IFN alpha conducted in anti-HBe-positive individuals with chronic hepatitis B, 21% of patients achieved a sustained ALT normalization and clearance of hepatitis B virus (HBV) DNA as measured by PCR. The present work has assessed whether these sustained responses are lasting long-term. In addition, IFN gamma levels were tested serially in serum as a measure of the immune system activation during treatment. By extending the post-treatment follow-up period 2 years the occurrence of delayed HBV DNA relapses was observed. A low serum level of IFN gamma was detected during and after treatment. IFN gamma demonstrated a multiphasic time-course: the amount of IFN gamma increased in parallel with reductions in HBV DNA but also with ALT flare-ups. In conclusion, the extended follow-up study of anti-HBe-positive patients after combined treatment with ribavirin and IFN alpha has shown that sustained responses are lasting in 17% patients but also that a late onset HBV DNA relapse may occur.
IFN-γ regulates human dental pulp stem cells behavior via NF-κB and MAPK signaling
He, Xinyao; Jiang, Wenkai; Luo, Zhirong; Qu, Tiejun; Wang, Zhihua; Liu, Ningning; Zhang, Yaqing; Cooper, Paul R.; He, Wenxi
2017-01-01
During caries, dental pulp expresses a range of pro-inflammatory cytokines in response to the infectious challenge. Interferon gamma (IFN-γ) is a dimerized soluble cytokine, which is critical for immune responses. Previous study has demonstrated that IFN-γ at relative high concentration (100 ng/mL) treatment improved the impaired dentinogenic and immunosuppressive regulatory functions of disease-derived dental pulp stem cells (DPSCs). However, little is known about the regulatory effects of IFN-γ at relative low concentration on healthy DPSC behavior (including proliferation, migration, and multiple-potential differentiation). Here we demonstrate that IFN-γ at relatively low concentrations (0.5 ng/mL) promoted the proliferation and migration of DPSCs, but abrogated odonto/osteogenic differentiation. Additionally, we identified that NF-κB and MAPK signaling pathways are both involved in the process of IFN-γ-regulated odonto/osteogenic differentiation of DPSCs. DPSCs treated with IFN-γ and supplemented with pyrrolidine dithiocarbamate (PDTC, an NF-κB inhibitor) or SB203580 (a MAPK inhibitor) showed significantly improved potential for odonto/osteogenic differentiation of DPSCs both in vivo and in vitro. These data provide important insight into the regulatory effects of IFN-γ on the biological behavior of DPSCs and indicate a promising therapeutic strategy for dentin/pulp tissue engineering in future endodontic treatment. PMID:28098169
Design and Performance of the GAMMA-400 Gamma-Ray Telescope for Dark Matter Searches
NASA Technical Reports Server (NTRS)
Galper, A.M.; Adriani, O.; Aptekar, R. L.; Arkhangelskaja, I. V.; Arkhangelskiy, A.I.; Boezio, M.; Bonvicini, V.; Boyarchuk, K. A.; Fradkin, M. I.; Gusakov, Yu. V.;
2012-01-01
The GAMMA-400 gamma-ray telescope is designed to measure the fluxes of gamma-rays and cosmic-ray electrons + positrons, which can be produced by annihilation or decay of the dark matter particles, as well as to survey the celestial sphere in order to study point and extended sources of gamma-rays, measure energy spectra of Galactic and extragalactic diffuse gamma-ray emission, gamma-ray bursts, and gamma-ray emission from the Sun. GAMMA-400 covers the energy range from 100 MeV to 3000 GeV. Its angular resolution is approx. 0.01 deg (E(sub gamma) > 100 GeV), the energy resolution approx. 1% (E(sub gamma) > 10 GeV), and the proton rejection factor approx 10(exp 6). GAMMA-400 will be installed on the Russian space platform Navigator. The beginning of observations is planned for 2018.
Cossetti, Chiara; Iraci, Nunzio; Mercer, Tim R.; Leonardi, Tommaso; Alpi, Emanuele; Drago, Denise; Alfaro-Cervello, Clara; Saini, Harpreet K.; Davis, Matthew P.; Schaeffer, Julia; Vega, Beatriz; Stefanini, Matilde; Zhao, CongJian; Muller, Werner; Garcia-Verdugo, Jose Manuel; Mathivanan, Suresh; Bachi, Angela; Enright, Anton J.; Mattick, John S.; Pluchino, Stefano
2015-01-01
SUMMARY The idea that stem cell therapies work only via cell replacement is challenged by the observation of consistent intercellular molecule exchange between the graft and the host. Here we defined a mechanism of cellular signaling by which neural stem/precursor cells (NPCs) communicate with the microenvironment via extracellular vesicles (EVs), and we elucidated its molecular signature and function. We observed cytokine-regulated pathways that sort proteins and mRNAs into EVs. We described induction of interferon gamma (IFN-γ) pathway in NPCs exposed to proinflammatory cytokines that is mirrored in EVs. We showed that IFN-γ bound to EVs through Ifngr1 activates Stat1 in target cells. Finally, we demonstrated that endogenous Stat1 and Ifngr1 in target cells are indispensable to sustain the activation of Stat1 signaling by EV-associated IFN-γ/Ifngr1 complexes. Our study identifies a mechanism of cellular signaling regulated by EV-associated IFN-γ/Ifngr1 complexes, which grafted stem cells may use to communicate with the host immune system. PMID:25242146
Ordway, Diane J; Costa, Leonor; Martins, Marta; Silveira, Henrique; Amaral, Leonard; Arroz, Maria J; Ventura, Fernando A; Dockrell, Hazel M
2004-08-15
We evaluated immune responses to Mycobacterium tuberculosis in 10 health-care workers (HCWs) and 10 non-HCWs and correlated their immune status with the development of active tuberculosis (TB). Twenty individuals were randomly recruited, tested, and monitored longitudinally for TB presentation. Peripheral blood mononuclear cells (PBMCs) from donors were stimulated with M. tuberculosis and tested for cell proliferation and the production of interferon (IFN)- gamma, interleukin (IL)-5, and IL-4, by use of enzyme-linked immunosorbent or flow-cytometric assays. HCWs had higher levels of cell proliferation (24,258 cpm) and IFN- gamma (6373 pg/mL) to M. tuberculosis than did non-HCWs (cell proliferation, 11,462 cpm; IFN- gamma, 3228 pg/mL). Six of 10 HCWs showed increased median percentages of CD8+IL-4+ (4.7%) and gammadelta +IL-4+ (2.3%) T cells and progressed to active TB. HCWs who remained healthy showed increased median percentages of CD8+IFN- gamma+ (25.0%) and gammadelta +IFN- gamma+ (8.0%) and lower percentages of CD8+IL-4+ (0.05%) and gammadelta +IL-4+ (0.03%) T cells.
[Argonne Logo] [DOE Logo] Cosmic Gamma-Rays Home Publications Talks People Students Argonne > ; HEP > Cosmic Gamma-Rays Projects VERITAS Past Projects TrICE What's New CTA Cosmic Gamma-Rays The
Design and Performance of the GAMMA-400 Gamma-Ray Telescope for Dark Matter Searches
NASA Technical Reports Server (NTRS)
Galper, A. M.; Adriani, O.; Aptekar, R. L.; Arkhangelskaja, I. V.; Arkhangelskiy, A. I.; Boezio, M.; Bonvicini, V.; Boyarchuk, K. A.; Fradkin, M. I.; Gusakov, Yu V.;
2012-01-01
The GAMMA-400 gamma-ray telescope is designed to measure the fluxes of gamma-rays and cosmic-ray electrons (+) positrons, which can be produced by annihilation or decay of the dark matter particles, as well as to survey the celestial sphere in order to study point and extended sources of gamma-rays, measure energy spectra of Galactic and extragalactic diffuse gamma-ray emission, gamma-ray bursts, and gamma-ray emission from the Sun. GAMMA-400 covers the energy range from 100 MeV to 3000 GeV. Its angular resolution is approximately 0.01deg (E(sub gamma) greater than 100 GeV), the energy resolution approximately 1% (E(sub gamma) greater than 10 GeV), and the proton rejection factor approximately 10(exp 6). GAMMA-400 will be installed on the Russian space platform Navigator. The beginning of observations is planned for 2018.
OK-432 synergizes with IFN-γ to confer dendritic cells with enhanced antitumor immunity.
Pan, Ke; Lv, Lin; Zheng, Hai-xia; Zhao, Jing-jing; Pan, Qiu-zhong; Li, Jian-jun; Weng, De-sheng; Wang, Dan-dan; Jiang, Shan-shan; Chang, Alfred E; Li, Qiao; Xia, Jian-chuan
2014-03-01
Generation of functional dendritic cells (DCs) with boosted immunity after the withdrawal of initial activation/maturation conditions remains a significant challenge. In this study, we investigated the impact of a newly developed maturation cocktail consisting of OK-432 and interferon-gamma (IFN-γ) on the function of human monocyte-derived DCs (MoDCs). We found that OK-432 plus IFN-γ stimulation could induce significantly stronger expression of surface molecules, production of cytokines, as well as migration of DCs compared with OK-432 stimulation alone. Most importantly, DCs matured with OK-432 plus IFN-γ-induced maintained secretion of interleukin-12 (IL-12)p70 in secondary culture after stimulus withdrawal. Functionally, OK-432 plus IFN-γ-conditioned DCs induce remarkable Th1 and Tc1 responses more effectively than OK-432 alone, even more than the use of α-type-1 cytokine cocktail. As a result, DCs matured with OK-432 plus IFN-γ can prime stronger cytotoxic lymphocyte (CTL) and natural killer (NK) cell response against tumor cells in vitro. Peripheral blood mononuclear cells activated by DCs matured with OK-432 plus IFN-γ also showed greater tumor growth inhibition in vivo in null mice. Molecular mechanistic analysis showed that DC maturation using IFN-γ in concert with OK-432 involves the activation of p38 and nuclear factor-kappa B (NF-κB) pathways. This study provided a novel strategy to generate more potent immune segments in DC vaccine.
Polyfunctional cytokine responses by central memory CD4*T cells in response to bovine tuberculosis
USDA-ARS?s Scientific Manuscript database
CD4 T cells are crucial in immunity to tuberculosis (TB). Polyfunctional CD4 T cells simultaneously produce interferon-gamma (IFN-gamma), interleukin-2 (IL-2) and tumor necrosis factor-alpha (TNF-alpha) and play relevant roles in several chronic infections, including human TB. Mycobacterium bovis in...
Polyfunctional cytokine responses by central memory CD4+T cells in response to bovine tuberculosis
USDA-ARS?s Scientific Manuscript database
CD4 T cells are crucial in immunity to tuberculosis (TB). Polyfunctional CD4 T cells simultaneously produce interferon-gamma (IFN-gamma), interleukin-2 (IL-2) and tumor necrosis factor-alpha (TNF-alpha) and play relevant roles in several chronic infections, including human TB and HIV. Mycobacterium ...
Polyfunctional CD4 T cells in the response to bovine tuberculosis
USDA-ARS?s Scientific Manuscript database
Polyfunctional CD4 T cells simultaneously produce interferon-gamma (IFN-gamma), interleukin-2 (IL-2) and tumor necrosis factor-alpha (TNF-alpha) and play relevant roles in several chronic infections, including human TB and HIV. However, the assessment of this response in bovine infections was not fe...
Siekiera, Urszula; Jarosz-Chobot, P; Janusz, J; Koehler, Brygida
2002-01-01
Type 1 diabetes is a genetically conditioned autoimmune disease. Genes that account for strong clustering of the disease susceptibility are located within the HLA region. There is also considerable individual variation in the immune response and role of cytokine genes in the disease predisposition. The aim of our research was identification of the genetically controlled TNF-alpha, IL-10, IL-6, IFN-gamma secretion profile in children with diabetes type 1. We have examined 36 children with diabetes type 1 and 36 healthy individuals. DNA was extracted from mononuclear peripheral blood cells. For identification of the cytokine polymorphism PCR-SSP method was used. Patients with diabetes type 1 differ from the group of healthy persons in the cytokine synthesis level and in the cytokine genotypes distribution. Genotype TNF-alpha (A/G) as well as IL-10 (ATA/ATA) was found only in group of children with diabetes but not in the control group. Genotypes IL-10 (GCC/GCC), IL-6 (C/C), IFN-gamma (T/T) were observed with decreased frequency in children with diabetes type 1. No differences between patients and control group in the frequency of IL-10 (GCC/ACC) (GCC/ATA), (ACC/ACC) (ACC/ATA) IL-6 (G/G), (G/C) and IFN-gamma (T/A), (A/A) genotypes were observed. Children with diabetes type 1 were more frequent "high producers" of TNF-alpha and IL-6. It is possible to us molecular method to estimate the genetically controlled immune reactivity. It is a very important immunogenetic factor of the disease predisposition.
Rodriguez, Jason J.; Parisien, Jean-Patrick; Horvath, Curt M.
2002-01-01
Characterization of recent outbreaks of fatal encephalitis in southeast Asia identified the causative agent to be a previously unrecognized enveloped negative-strand RNA virus of the Paramyxoviridae family, Nipah virus. One feature linking Nipah virus to this family is a conserved cysteine-rich domain that is the hallmark of paramyxovirus V proteins. The V proteins of other paramyxovirus species have been linked with evasion of host cell interferon (IFN) signal transduction and subsequent antiviral responses by inducing proteasomal degradation of the IFN-responsive transcription factors, STAT1 or STAT2. Here we demonstrate that Nipah virus V protein escapes IFN by a distinct mechanism involving direct inhibition of STAT protein function. Nipah virus V protein differs from other paramyxovirus V proteins in its subcellular distribution but not in its ability to inhibit cellular IFN responses. Nipah virus V protein does not induce STAT degradation but instead inhibits IFN responses by forming high-molecular-weight complexes with both STAT1 and STAT2. We demonstrate that Nipah virus V protein accumulates in the cytoplasm by a Crm1-dependent mechanism, alters the STAT protein subcellular distribution in the steady state, and prevents IFN-stimulated STAT redistribution. Consistent with the formation of complexes, STAT protein tyrosine phosphorylation is inhibited in cells expressing the Nipah virus V protein. As a result, Nipah virus V protein efficiently prevents STAT1 and STAT2 nuclear translocation in response to IFN, inhibiting cellular responses to both IFN-α and IFN-γ. PMID:12388709
Koster, Glen Peter; Xia, Hua; Lee, Boon Kwee
2013-08-06
An optical gamma thermometer includes a metal mass having a temperature proportional to a gamma flux within a core of a nuclear reactor, and an optical fiber cable for measuring the temperature of the heated metal mass. The temperature of the heated mass may be measured by using one or more fiber grating structures and/or by using scattering techniques, such as Raman, Brillouin, and the like. The optical gamma thermometer may be used in conjunction with a conventional reactor heat balance to calibrate the local power range monitors over their useful in-service life. The optical gamma thermometer occupies much less space within the in-core instrument tube and costs much less than the conventional gamma thermometer.
NASA Technical Reports Server (NTRS)
Becker, Peter A.; Kafatos, Menas
1995-01-01
We develop a general expression for the gamma - gamma absorption coefficient, alpha(sub gamma(gamma)) for gamma-rays propagating in an arbitrary direction at an arbitrary point in space above an X-ray-emitting accretion disk. The X-ray intensity is assumed to vary as a power law in energy and radius between the outer disk radius, R(sub 0), and the inner radius, R(sub ms) which is the radius of marginal stability for a Schwarzschild black hole. We use our result for alpha(sub gamma(gamma)) to calculate the gamma - gamma optical depth, tau(sub gamma(gamma)) for gamma - rays created at height z and propagating at angle Phi relative to the disk axis, and we show that for Phi = 0 and z greater than or approx equal to R(sub 0), tau(sub gamma(gamma)) proportional to Epsilon(sup alpha)z(sup -2(alpha) - 3), where alpha is the X-ray spectral index and Epsilon is the gamma - ray energy. As an application, we use our formalism to compute the minimum distance between the central black hole and the site of production of the gamma-rays detected by EGRET during the 1991 June flare of 3C 279. In order to obtain an upper limit, we assume that all of the X-rays observed contemporaneously by Ginga were emitted by the disk. Our results suggest that the observed gamma - rays may have originated within less than or approx equal to 45 GM/sq c from a black hole of mass greater than or approx equal to 10(exp 9) solar mass, perhaps in active plasma located above the central funnel of the accretion disk. This raises the possibility of establishing a direct connection between the production of the observed gamma - rays and the accretion of material onto the black hole. We also consider the variation of the optical depth as a function of the angle of propagation Phi. Our results indicate that the "focusing" of the gamma - rays along the disk axis due to pair production is strong enough to explain the observed degree of alignment in blazar sources. If the gamma - rays are produced isotropically
Design and performance of the GAMMA-400 gamma-ray telescope for dark matter searches
NASA Astrophysics Data System (ADS)
Galper, A. M.; Adriani, O.; Aptekar, R. L.; Arkhangelskaja, I. V.; Arkhangelskiy, A. I.; Boezio, M.; Bonvicini, V.; Boyarchuk, K. A.; Fradkin, M. I.; Gusakov, Yu. V.; Kaplin, V. A.; Kachanov, V. A.; Kheymits, M. D.; Leonov, A. A.; Longo, F.; Mazets, E. P.; Maestro, P.; Marrocchesi, P.; Mereminskiy, I. A.; Mikhailov, V. V.; Moiseev, A. A.; Mocchiutti, E.; Mori, N.; Moskalenko, I. V.; Naumov, P. Yu.; Papini, P.; Picozza, P.; Rodin, V. G.; Runtso, M. F.; Sparvoli, R.; Spillantini, P.; Suchkov, S. I.; Tavani, M.; Topchiev, N. P.; Vacchi, A.; Vannuccini, E.; Yurkin, Yu. T.; Zampa, N.; Zverev, V. G.; Zirakashvili, V. N.
2013-02-01
The GAMMA-400 gamma-ray telescope is designed to measure the fluxes of gamma-rays and cosmic-ray electrons + positrons, which can be produced by annihilation or decay of the dark matter particles, as well as to survey the celestial sphere in order to study point and extended sources of gamma-rays, measure energy spectra of Galactic and extragalactic diffuse gamma-ray emission, gamma-ray bursts, and gamma-ray emission from the Sun. GAMMA-400 covers the energy range from 100 MeV to 3000 GeV. Its angular resolution is ~0.01° (Eγ > 100 GeV), the energy resolution ~1% (Eγ > 10 GeV), and the proton rejection factor ~106. GAMMA-400 will be installed on the Russian space platform Navigator. The beginning of observations is planned for 2018.
The Jak-STAT pathway stimulated by interferon alpha or interferon beta.
Horvath, Curt M
2004-11-23
Type I interferons, such as interferon alpha and interferon beta (IFN-alpha and beta), signal through a Janus kinase (Jak) to signal transduction and activator of transcription (STAT) pathway to stimulate gene expression. In response to ligand binding, the receptors dimerize, Jaks phosphorylate STAT1 and STAT2, which then dimerize and interact with a third transcriptional regulator IFN regulatory factor 9 (IRF9) to stimulate gene expression. IFN-alpha is the main innate antiviral cytokine and is essential for effective immune response to viral infection. The animation shows activation of STAT-responsive gene expression in response to type I IFNs.
The nucleocapsid protein of measles virus blocks host interferon response
DOE Office of Scientific and Technical Information (OSTI.GOV)
Takayama, Ikuyo; Sato, Hiroki; Watanabe, Akira
2012-03-01
Measles virus (MV) belongs to the genus Morbillivirus of the family Paramyxoviridae. A number of paramyxoviruses inhibit host interferon (IFN) signaling pathways in host immune systems by various mechanisms. Inhibition mechanisms have been described for many paramyxoviruses. Although there are inconsistencies among previous reports concerning MV, it appears that P/V/C proteins interfere with the pathways. In this study, we confirmed the effects of MV P gene products of a wild MV strain on IFN pathways and examined that of other viral proteins on it. Interestingly, we found that N protein acts as an IFN-{alpha}/{beta} and {gamma}-antagonist as strong as Pmore » gene products. We further investigated the mechanisms of MV-N inhibition, and revealed that MV-N blocks the nuclear import of activated STAT without preventing STAT and Jak activation or STAT degradation, and that the nuclear translocation of MV-N is important for the inhibition. The inhibitory effect of the N protein was observed as a common feature of other morbilliviruses. The results presented in this report suggest that N protein of MV as well as P/V/C proteins is involved in the inhibition of host IFN signaling pathways.« less
Inhibition of human mast cell growth and differentiation by interferon gamma-1b.
Kirshenbaum, A S; Worobec, A S; Davis, T A; Goff, J P; Semere, T; Metcalfe, D D
1998-03-01
In an effort to identify cytokines that inhibit human mast cell growth, we cultured HMC-1 cells and recombinant human stem cell factor (rhSCF)-dependent human bone marrow-derived mast cells (HBMCs) in the presence of interferon gamma (IFNgamma)-1b and interferon alpha (IFNalpha)-2b. HMC-1 cell numbers decreased in the presence of 1000 U/mL IFNgamma-1b but were unaffected by 1000 U/mL of IFNalpha-2b. HBMCs were then cultured for 0 to 7 days with 100 ng/mL rhSCF and 10 ng/mL recombinant human IL-3 (rhIL-3), followed by culture in rhSCF and administration of either 1000 U/mL IFNalpha-2b or 1000 U/mL IFNgamma-1b. HBMCs appearing in cultures with rhSCF alone or in combination with IFNalpha-2b were virtually identical in number through 8 weeks of culture. In cultures supplemented with IFNgamma-1b, HBMCs significantly decreased in number and incidence of granular metachromasia by 4 to 5 weeks (p<0.001). Similar results were obtained when human marrow was cultured from day 0 with rhSCF and IFNgamma-1b. Mature rhSCF-dependent HBMCs were also cultured at 5 weeks with rhSCF alone or in combination with IFNgamma-1b. Compared with cells cultured in rhSCF, mature 5-week HBMC cultures treated with rhSCF plus IFNgamma-1b revealed a decrease in mast cells, and those mast cells that remained had fewer toluidine blue- and tryptase-positive granules after 5 to 8 weeks. FACS analysis of rhSCF plus IFNgamma-1b-treated mature HBMCs revealed increased c-kit and Fc(epsilon)RI expression. Mast cell releasibility was not increased. IFNgamma-lb was thus able to suppress mast cell growth from CD34+ cells, suggesting that this agent should be considered as a candidate cytokine for the treatment of disorders of mast cell proliferation.
Shibata, Haruki; Katsuki, Hiroshi; Nishiwaki, Mayumi; Kume, Toshiaki; Kaneko, Shuji; Akaike, Akinori
2003-09-01
Glial cell activation associated with inflammatory reaction may contribute to pathogenic processes of neurodegenerative disorders, through production of several cytotoxic molecules. We investigated the consequences of glial activation by interferon-gamma (IFN-gamma)/lipopolysaccharide (LPS) in rat midbrain slice cultures. Application of IFN-gamma followed by LPS caused dopaminergic cell death and accompanying increases in nitrite production and lactate dehydrogenase release. Aminoguanidine, an inhibitor of inducible nitric oxide synthase (iNOS), or SB203580, an inhibitor of p38 mitogen-activated protein kinase, prevented dopaminergic cell loss as well as nitrite production. SB203580 also suppressed expression of iNOS and cyclooxygenase-2 (COX-2) induced by IFN-gamma/LPS. A COX inhibitor indomethacin protected dopaminergic neurons from IFN-gamma/LPS-induced injury, whereas selective COX-2 inhibitors such as NS-398 and nimesulide did not. Notably, indomethacin was able to attenuate neurotoxicity of a nitric oxide (NO) donor. Neutralizing antibodies against tumour necrosis factor-alpha and interleukin-1beta did not inhibit dopaminergic cell death caused by IFN-gamma/LPS, although combined application of these antibodies blocked lactate dehydrogenase release and decrease in the number of non-dopaminergic neurons. These results indicate that iNOS-derived NO plays a crucial role in IFN-gamma/LPS-induced dopaminergic cell death, and that indomethacin exerts protective effect by mechanisms probably related to NO neurotoxicity rather than through COX inhibition.
A cyclometalated iridium(III) complex used as a conductor for the electrochemical sensing of IFN-γ
NASA Astrophysics Data System (ADS)
Miao, Xiangmin; Ko, Chung-Nga; Vellaisamy, Kasipandi; Li, Zongbing; Yang, Guanjun; Leung, Chung-Hang; Ma, Dik-Lung
2017-02-01
A novel iridium(III) complex was prepared and used as a conductor for sensitive and enzyme-free electrochemical detection of interferon gamma (IFN-γ). This assay is based on a dual signal amplification mechanism involving positively charged gold nanoparticles ((+)AuNPs) and hybridization chain reaction (HCR). To construct the sensor, nafion (Nf) and (+)AuNPs composite membrane was first immobilized onto the electrode surface. Subsequently, a loop-stem structured capture probe (CP) containing a special IFN-γ interact strand was modified onto the (+)AuNP surface via the formation of Au-S bonds. Upon addition of IFN-γ, the loop-stem structure of CP was opened, and the newly exposed “sticky” region of CP then hybridized with DNA hairpin-1 (H1), which in turn opened its hairpin structure for hybridizing with DNA hairpin-2 (H2). Happen of HCR between H1 and H2 thus generated a polymeric duplex DNA (dsDNA) chain. Meanwhile, the iridium(III) complex could interact with the grooves of the dsDNA polymer, producing a strong current signal that was proportional to IFN-γ concentration. Thus, sensitive detection of IFN-γ could be realized with a detection limit down to 16.3 fM. Moreover, satisfied results were achieved by using this method for the detection of IFN-γ in human serum samples.
Zribi, Lilia; El-Goulli, Amel F; Ben-Abid, Meriem; Gharbi, Mohamed; Ben-Sghaier, Ines; Boufaden, Imed; Aoun, Karim; Bouratbine, Aïda
2017-11-15
Interferon-Gamma (IFN-γ) Release Assays (IGRAs) are easy tests that allow rapid screening of primed memory T-cells immunity in response to antigen. The aim of this study was to use IGRA to assess IFN-γ release in response to Soluble Leishmania infantum antigen (SLA) in whole blood of dogs living in endemic area of visceral leishmaniasis and to interpret IGRA results according to clinical examination, specific anti-Leishmania humoral response and presence of L. infantum DNA in blood. The study was carried out on 56 dogs living in greater Tunis area. Physical examination, quantitative serology and PCR on blood were used to characterize dogs' status in relation to Leishmania infection and disease. IGRA consisted on testing by ELISA for IFN-γ-secretion in whole blood after a 20-h challenge with SLA. PBS and Phytohemagglutinin (PHA) stimulations were used as controls. Four groups of dogs were characterized: 31 were negative by both serology and PCR, two had doubtful serology, 10 presented no to mild clinical signs but low antibodies levels and 13 were affected by Canine Leishmaniasis (CanL). In seronegative dogs, IGRA was little contributory in 4 puppies (age <6months) and 5 old dogs (median age=72months, IQR: 45-84 months) that didn't respond to PHA stimulation, IGRA was negative in 19 and positive in three animals with lymph node enlargement. In dogs with doubtful serology, IGRA was positive in one dog and negative in the other. In infected dogs with no to mild clinical signs, one dog exhibited high level of IFN-γ in absence of antigenic stimulation and all the other were positive by IGRA. CanL dogs showed variable IGRA results. Negative IGRAs (n=4) were shown in animals with the highest parasitic burden whereas positive IGRAs (n=5) were shown in dogs with negative PCR or low parasitic load. The 4 remaining dogs either didn't respond to PHA (n=2) or showed non-specific secretion in PBS tube (n=2). The results of this study showed that IGRA is a useful new tool
Polyfunctional CD4 T cells in the response to bovine tuberculosis
USDA-ARS?s Scientific Manuscript database
CD4 T cells are crucial in immunity to tuberculosis (TB). Polyfunctional CD4 T cells simultaneously produce interferon-gamma (IFN-gamma), Interleukin-2 (IL-2) and Tumor necrosis factor-alpha (TNF-alpha) and play relevant roles in several chronic infections, including human TB and HIV. However, the a...
Interferons alpha and gamma induce p53-dependent and p53-independent apoptosis, respectively.
Porta, Chiara; Hadj-Slimane, Reda; Nejmeddine, Mohamed; Pampin, Mathieu; Tovey, Michael G; Espert, Lucile; Alvarez, Sandra; Chelbi-Alix, Mounira K
2005-01-20
Type I interferon (IFN) enhances the transcription of the tumor suppressor gene p53. To elucidate the molecular mechanism mediating IFN-induced apoptosis, we analysed programmed cell death in response to type I (IFNalpha) or type II (IFNgamma) treatment in relation to p53 status. In two cell lines (MCF-7, SKNSH), IFNalpha, but not IFNgamma, enhanced apoptosis in a p53-dependent manner. Furthermore, only IFNalpha upregulated p53 as well as p53 target genes (Noxa, Mdm2 and CD95). The apoptotic response to IFNalpha decreased in the presence of ZB4, an anti-CD95 antibody, suggesting that CD95 is involved in this process. When p53 was inactivated by the E6 viral protein or the expression of a p53 mutant, IFNalpha-induced apoptosis and p53 target genes upregulation were abrogated. Altogether these results demonstrate that p53 plays a pivotal role in the IFNalpha-induced apoptotic response. IFNalpha-induced PML was unable to recruit p53 into nuclear bodies and its downregulation by siRNA did not alter CD95 expression. In contrast, IFNgamma-induced apoptosis is p53-independent. CD95 and IFN-regulatory factor 1 (IRF1) are directly upregulated by this cytokine. Apoptotic response to IFNgamma is decreased in the presence of ZB4 and strongly diminished by IRF1 siRNA, implicating both CD95 and IRF1 in IFNgamma-induced apoptotic response. Taken together, these results show that in two different cell lines, IFNalpha and IFNgamma, induce p53-dependent -independent apoptosis, respectively.
Towards molecular modeling of the impact of heparin-derived oligosaccharides on hIFN-γ binding
NASA Astrophysics Data System (ADS)
Lilkova, E.; Petkov, P.; Ilieva, N.; Litov, L.
2015-10-01
Human interferon gamma (hIFN-γ) is an important signalling molecule, which plays a key role in the formation and modulation of immune response. The role of the cytokine C-termini in the formation of a complex with the extracellular receptor is still controversial due to the lack of structural information about this domain. Moreover, the C-termini are also responsible for the high affinity interaction of hIFN-γ with the glycosaminoglicans heparan sulfate and heparin. This interaction can drastically change the properties and behaviour of the protein. We performed molecular dynamics simulations in order to model the structure of the hIFN-γ C-terminal part and the interaction of the cytokine with heparin-derived oligosaccharides. For this purpose we reconstructed the missing C-terminal amino acid residues and performed folding simulations to determine their conformation. In order to simulate the interaction with heparin-like fragments, we developed CHARMM 36 compatible force field for the sulfamate anion group that is present in the glucosamine sugar to complete the heparin and heparan sulfate force field. The new topology and parameters reproduce the available experimental structural properties of heparin-like fragments. The simulations show that the oligosaccharides quickly bind the IFN-γ C-termini and reduce their solvent accessible surface area.
... equipment? How is safety ensured? What is this equipment used for? The Gamma Knife® and its associated ... in size. top of page How does the equipment work? The Gamma Knife® utilizes a technique called ...
Gamma-400 Science Objectives Built on the Current HE Gamma-Ray and CR Results
NASA Technical Reports Server (NTRS)
Moiseev, Alexander; Mitchell, John; Thompson, David
2012-01-01
The main scientific interest of the Russian Gamma-400 team: Observe gamma-rays above approximately 50 GeV with excellent energy and angular resolution with the goals of: (1) Studying the fine spectral structure of the isotropic high-energy gamma-radiation, (2) Attempting to identify the many still-unidentified Fermi-LAT gamma-ray sources. Gamma-400 will likely be the only space-based gamma-ray observatory operating at the end of the decade. In our proposed Gamma-400-LE version, it will substantially improve upon the capabilities of Fermi LAT and AGILE in both LE and HE energy range. Measuring gamma-rays from approx 20 MeV to approx 1 TeV for at least 7 years, Gamma-400-LE will address the topics of dark matter, cosmic ray origin and propagation, neutron stars, flaring pulsars, black holes, AGNs, GRBs, and actively participate in multiwavelength campaigns.
Kim, Choon Kwan; Choi, Youn Mi; Bae, Eunsin; Jue, Mihn Sook; So, Hyung Seok; Hwang, Eung-Soo
2018-01-01
The pathogenesis of herpes zoster is closely linked to reduced varicella-zoster virus-specific cell-mediated immunity. However, little is known about the interplay between natural killer cells and psychological stress in the pathogenesis of herpes zoster. This study aimed to investigate possible associations among natural killer cells, T cells and psychological stress in herpes zoster. Interferon-gamma secretion from natural killer cell, psychological stress events, stress cognition scale scores and cytomegalovirus-specific cell-mediated immunity were compared between 44 patients with herpes zoster and 44 age- and gender-matched control subjects. A significantly lower median level of interferon-gamma secreted by natural killer cells was observed in patients with a recent diagnosis of herpes zoster than in control subjects (582.7 pg/ml vs. 1783 pg/ml; P = 0.004), whereas cytomegalovirus-specific cell-mediated immunity was not associated with herpes zoster. Psychological stress events and high stress cognition scale scores were significantly associated in patients with herpes zoster (P<0.001 and P = 0.037, respectively). However, reduced interferon-gamma secretion from natural killer cell and psychological stress were not associated. In conclusion, patients with a recent diagnosis of herpes zoster display reduced interferon-gamma secretion from natural killer cells and frequent previous psychological stress events compared with controls. However, reduced natural killer cell activity is not an immunological mediator between psychological stress and herpes zoster.
Kim, Choon Kwan; Choi, Youn Mi; Bae, Eunsin; Jue, Mihn Sook; So, Hyung Seok
2018-01-01
The pathogenesis of herpes zoster is closely linked to reduced varicella-zoster virus-specific cell-mediated immunity. However, little is known about the interplay between natural killer cells and psychological stress in the pathogenesis of herpes zoster. This study aimed to investigate possible associations among natural killer cells, T cells and psychological stress in herpes zoster. Interferon-gamma secretion from natural killer cell, psychological stress events, stress cognition scale scores and cytomegalovirus-specific cell-mediated immunity were compared between 44 patients with herpes zoster and 44 age- and gender-matched control subjects. A significantly lower median level of interferon-gamma secreted by natural killer cells was observed in patients with a recent diagnosis of herpes zoster than in control subjects (582.7 pg/ml vs. 1783 pg/ml; P = 0.004), whereas cytomegalovirus-specific cell-mediated immunity was not associated with herpes zoster. Psychological stress events and high stress cognition scale scores were significantly associated in patients with herpes zoster (P<0.001 and P = 0.037, respectively). However, reduced interferon-gamma secretion from natural killer cell and psychological stress were not associated. In conclusion, patients with a recent diagnosis of herpes zoster display reduced interferon-gamma secretion from natural killer cells and frequent previous psychological stress events compared with controls. However, reduced natural killer cell activity is not an immunological mediator between psychological stress and herpes zoster. PMID:29466462
Graw, J; Liebstein, A; Pietrowski, D; Schmitt-John, T; Werner, T
1993-12-22
The murine genes, gamma B-cry and gamma C-cry, encoding the gamma B- and gamma C-crystallins, were isolated from a genomic DNA library. The complete nucleotide (nt) sequences of both genes were determined from 661 and 711 bp, respectively, upstream from the first exon to the corresponding polyadenylation sites, comprising more than 2650 and 2890 bp, respectively. The new sequences were compared to the partial cDNA sequences available for the murine gamma B-cry and gamma C-cry, as well as to the corresponding genomic sequences from rat and man, at both the nt and predicted amino acid (aa) sequence levels. In the gamma B-cry promoter region, a canonical CCAAT-box, a TATA-box, putative NF-I and C/EBP sites were detected. An R-repeat is inserted 366 bp upstream from the transcription start point. In contrast, the gamma C-cry promoter does not contain a CCAAT-box, but some other putative binding sites for transcription factors (AP-2, UBP-1, LBP-1) were located by computer analysis. The promoter regions of all six gamma-cry from mouse, rat and human, except human psi gamma F-cry, were analyzed for common sequence elements. A complex sequence element of about 70-80 bp was found in the proximal promoter, which contains a gamma-cry-specific and almost invariant sequence (crygpel) of 14 nt, and ends with the also invariant TATA-box. Within the complex sequence element, a minimum of three further features specific for the gamma A-, gamma B- and gamma D/E/F-cry genes can be defined, at least two of which were recently shown to be functional. In addition to these four sequence elements, a subtype-specific structure of inverted repeats with different-sized spacers can be deduced from the multiple sequence alignment. A phylogenetic analysis based on the promoter region, as well as the complete exon 3 of all gamma-cry from mouse, rat and man, suggests separation of only five gamma-cry subtypes (gamma A-, gamma B-, gamma C-, gamma D- and gamma E/F-cry) prior to species separation.
Predicting diffusion paths and interface motion in gamma/gamma + beta, Ni-Cr-Al diffusion couples
NASA Technical Reports Server (NTRS)
Nesbitt, J. A.; Heckel, R. W.
1987-01-01
A simplified model has been developed to predict Beta recession and diffusion paths in ternary gamma/gamma + beta diffusion couples (gamma:fcc, beta: NiAl structure). The model was tested by predicting beta recession and diffusion paths for four gamma/gamma + beta, Ni-Cr-Al couples annealed for 100 hours at 1200 C. The model predicted beta recession within 20 percent of that measured for each of the couples. The model also predicted shifts in the concentration of the gamma phase at the gamma/gamma + beta interface within 2 at. pct Al and 6 at. pct Cr of that measured in each of the couples. A qualitative explanation based on simple kinetic and mass balance arguments has been given which demonstrates the necessity for diffusion in the two-phase region of certain gamma/gamma + beta, Ni-Cr-Al couples.
Comparison of gamma-gamma Phase Coarsening Responses of Three Powder Metal Disk Superalloys
NASA Technical Reports Server (NTRS)
Gabb, T. P.; Gayda, J.; Johnson, D. F.; MacKay, R. A.; Rogers, R. B.; Sudbrack, C. K.; Garg, A.; Locci, I. E.; Semiatin, S. L.; Kang, E.
2016-01-01
The phase microstructures of several powder metal (PM) disk superalloys were quantitatively evaluated. Contents, chemistries, and lattice parameters of gamma and gamma strengthening phase were determined for conventionally heat treated Alloy 10, LSHR, and ME3 superalloys, after electrolytic phase extractions. Several of long term heat treatments were then performed, to allow quantification of the precipitation, content, and size distribution of gamma at a long time interval to approximate equilibrium conditions. Additional coarsening heat treatments were performed at multiple temperatures and shorter time intervals, to allow quantification of the precipitation, contents and size distributions of gamma at conditions diverging from equilibrium. Modest differences in gamma and gamma lattice parameters and their mismatch were observed among the alloys, which varied with heat treatment. Yet, gamma coarsening rates were very similar for all three alloys in the heat treatment conditions examined. Alloy 10 had higher gamma dissolution and formation temperatures than LSHR and ME3, but a lower lattice mismatch, which was slightly positive for all three alloys at room temperature. The gamma precipitates of Alloy 10 appeared to remain coherent at higher temperatures than for LSHR and ME3. Higher coarsening rates were observed for gamma precipitates residing along grain boundaries than for those within grains in all three alloys, during slow-moderate quenching from supersolvus solution heat treatments, and during aging at temperatures of 843 C and higher.
Suppressing effect of low-dose gamma-ray irradiation on collagen-induced arthritis.
Nakatsukasa, Hiroko; Tsukimoto, Mitsutoshi; Ohshima, Yasuhiro; Tago, Fumitoshi; Masada, Ayako; Kojima, Shuji
2008-07-01
We previously reported attenuation of autoimmune disease by low-dose gamma-ray irradiation in MRL-lpr/lpr mice. Here, we studied the effect of low-dose gamma-ray irradiation on collagen-induced arthritis (CIA) in DBA/1J mice. Mice were immunized with type II collagen, and exposed to low-dose gamma-rays (0.5 Gy per week for 5 weeks). Paw swelling, redness, and bone degradation were suppressed by irradiation, which also delayed the onset of pathological change and reduced the severity of the arthritis. Production of tumor necrosis factor-alpha, interferon-gamma, and interleukin-6, which play important roles in the onset of CIA, was suppressed by the irradiation. The level of anti-type II collagen antibody, which is essential for the onset of CIA, was also lower in irradiated CIA mice. The population of plasma cells was increased in CIA mice, but irradiation blocked this increase. Since regulatory T cells are known to be involved in suppression of autoimmune disease, the population of CD4(+)CD25(+)Foxp3(+) regulatory T cells was measured. Intriguingly, a significant increase of these regulatory T cells was found in irradiated CIA mice. Overall, our data suggest that low-dose gamma-ray irradiation could attenuate CIA through suppression of pro-inflammatory cytokines and autoantibody production, and induction of regulatory T cells.
Walker, D H; Popov, V L; Feng, H M
2000-09-01
A mouse model of typhus rickettsiosis that reproduces the hematogenous dissemination to the critical target organs, including brain, lungs, heart, and kidneys, primary endothelial and, to a lesser degree, macrophage intracellular rickettsial infection, and typical vascular-based lesions of louse-borne typhus and murine typhus was established. Intravenous inoculation of C3H/HeN mice with Rickettsia typhi caused disease with a duration of the incubation period and mortality rate that were dependent on the infective dose of rickettsiae. Lethal infection was associated with high concentrations of R. typhi in the lungs and brain, despite a brisker humoral immune response to the rickettsiae than in the sublethal infection. Gamma interferon and CD8 T lymphocytes were demonstrated to be crucial to clearance of the rickettsiae and recovery from infection in experiments in which specific monoclonal antibodies were administered to deplete these components. Death of animals depleted of gamma interferon or CD8 T lymphocytes was associated with overwhelming rickettsial infection demonstrated by titers of infectious rickettsiae and by immunohistochemistry. An effective antirickettsial immune response was associated with elevated serum concentrations of IL-12 on Day 5 and increased secretion of IL-12 by concanavalin-A-stimulated spleen cells on Day 5. Evidence for transient suppression of the immune response consisted of marked reduction in the secretion of IL-2 and IL-12 by concanavalin-A-stimulated spleen cells on Days 10 and 15. This model offers excellent opportunities for study of attenuation and pathogenetic mechanisms of typhus rickettsiae, which are established biologic weapons of potential use in bioterrorism.
Interferon-gamma inducible protein-10 as a potential biomarker in localized scleroderma.
Magee, Kelsey E; Kelsey, Christina E; Kurzinski, Katherine L; Ho, Jonhan; Mlakar, Logan R; Feghali-Bostwick, Carol A; Torok, Kathryn S
2013-01-01
The purpose of this study was to evaluate the presence and levels of interferon-gamma inducible protein-10 (IP-10) in the plasma and skin of pediatric localized scleroderma (LS) patients compared to those of healthy pediatric controls and to determine if IP-10 levels correlate to clinical disease activity measures. The presence of IP-10 in the plasma was analyzed using a Luminex panel in 69 pediatric patients with LS and compared to 71 healthy pediatric controls. Of these patients, five had available skin biopsy specimens with concurrent clinical and serological data during the active disease phase, which were used to analyze the presence and location of IP-10 in the skin by immunohistochemistry (IHC). IP-10 levels were significantly elevated in the plasma of LS patients compared to that of healthy controls and correlated to clinical disease activity measures in LS. Immunohistochemistry staining of IP-10 was present in the dermal infiltrate of LS patients and was similar to that found in psoriasis skin specimens, the positive disease control. Elevation of IP-10 levels in the plasma compared to those of healthy controls and the presence of IP-10 staining in the affected skin of LS patients indicates that IP-10 is a potential biomarker in LS. Furthermore, significant elevation of IP-10 in LS patients with active versus inactive disease and correlations between IP-10 levels and standardized disease outcome measures of activity in LS strongly suggest that IP-10 may be a biomarker for disease activity in LS.
Interferon-gamma inducible protein-10 as a potential biomarker in localized scleroderma
2013-01-01
Introduction The purpose of this study was to evaluate the presence and levels of interferon-gamma inducible protein-10 (IP-10) in the plasma and skin of pediatric localized scleroderma (LS) patients compared to those of healthy pediatric controls and to determine if IP-10 levels correlate to clinical disease activity measures. Methods The presence of IP-10 in the plasma was analyzed using a Luminex panel in 69 pediatric patients with LS and compared to 71 healthy pediatric controls. Of these patients, five had available skin biopsy specimens with concurrent clinical and serological data during the active disease phase, which were used to analyze the presence and location of IP-10 in the skin by immunohistochemistry (IHC). Results IP-10 levels were significantly elevated in the plasma of LS patients compared to that of healthy controls and correlated to clinical disease activity measures in LS. Immunohistochemistry staining of IP-10 was present in the dermal infiltrate of LS patients and was similar to that found in psoriasis skin specimens, the positive disease control. Conclusions Elevation of IP-10 levels in the plasma compared to those of healthy controls and the presence of IP-10 staining in the affected skin of LS patients indicates that IP-10 is a potential biomarker in LS. Furthermore, significant elevation of IP-10 in LS patients with active versus inactive disease and correlations between IP-10 levels and standardized disease outcome measures of activity in LS strongly suggest that IP-10 may be a biomarker for disease activity in LS. PMID:24499523
NASA Technical Reports Server (NTRS)
1991-01-01
An overview is given of the Gamma Ray Observatory (GRO) mission. Detection of gamma rays and gamma ray sources, operations using the Space Shuttle, and instruments aboard the GRO, including the Burst and Transient Source Experiment (BATSE), the Oriented Scintillation Spectrometer Experiment (OSSE), the Imaging Compton Telescope (COMPTEL), and the Energetic Gamma Ray Experiment Telescope (EGRET) are among the topics surveyed.
Oke, Olaleke O; Magony, Andor; Anver, Himashi; Ward, Peter D; Jiruska, Premysl; Jefferys, John G R; Vreugdenhil, Martin
2010-04-01
Synchronization of neuronal activity in the visual cortex at low (30-70 Hz) and high gamma band frequencies (> 70 Hz) has been associated with distinct visual processes, but mechanisms underlying high-frequency gamma oscillations remain unknown. In rat visual cortex slices, kainate and carbachol induce high-frequency gamma oscillations (fast-gamma; peak frequency approximately 80 Hz at 37 degrees C) that can coexist with low-frequency gamma oscillations (slow-gamma; peak frequency approximately 50 Hz at 37 degrees C) in the same column. Current-source density analysis showed that fast-gamma was associated with rhythmic current sink-source sequences in layer III and slow-gamma with rhythmic current sink-source sequences in layer V. Fast-gamma and slow-gamma were not phase-locked. Slow-gamma power fluctuations were unrelated to fast-gamma power fluctuations, but were modulated by the phase of theta (3-8 Hz) oscillations generated in the deep layers. Fast-gamma was spatially less coherent than slow-gamma. Fast-gamma and slow-gamma were dependent on gamma-aminobutyric acid (GABA)(A) receptors, alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors and gap-junctions, their frequencies were reduced by thiopental and were weakly dependent on cycle amplitude. Fast-gamma and slow-gamma power were differentially modulated by thiopental and adenosine A(1) receptor blockade, and their frequencies were differentially modulated by N-methyl-D-aspartate (NMDA) receptors, GluK1 subunit-containing receptors and persistent sodium currents. Our data indicate that fast-gamma and slow-gamma both depend on and are paced by recurrent inhibition, but have distinct pharmacological modulation profiles. The independent co-existence of fast-gamma and slow-gamma allows parallel processing of distinct aspects of vision and visual perception. The visual cortex slice provides a novel in vitro model to study cortical high-frequency gamma oscillations.
A method to describe inelastic gamma field distribution in neutron gamma density logging.
Zhang, Feng; Zhang, Quanying; Liu, Juntao; Wang, Xinguang; Wu, He; Jia, Wenbao; Ti, Yongzhou; Qiu, Fei; Zhang, Xiaoyang
2017-11-01
Pulsed neutron gamma density logging (NGD) is of great significance for radioprotection and density measurement in LWD, however, the current methods have difficulty in quantitative calculation and single factor analysis for the inelastic gamma field distribution. In order to clarify the NGD mechanism, a new method is developed to describe the inelastic gamma field distribution. Based on the fast-neutron scattering and gamma attenuation, the inelastic gamma field distribution is characterized by the inelastic scattering cross section, fast-neutron scattering free path, formation density and other parameters. And the contribution of formation parameters on the field distribution is quantitatively analyzed. The results shows the contribution of density attenuation is opposite to that of inelastic scattering cross section and fast-neutron scattering free path. And as the detector-spacing increases, the density attenuation gradually plays a dominant role in the gamma field distribution, which means large detector-spacing is more favorable for the density measurement. Besides, the relationship of density sensitivity and detector spacing was studied according to this gamma field distribution, therefore, the spacing of near and far gamma ray detector is determined. The research provides theoretical guidance for the tool parameter design and density determination of pulsed neutron gamma density logging technique. Copyright © 2017 Elsevier Ltd. All rights reserved.
Fries, Pascal; Nikolić, Danko; Singer, Wolf
2007-07-01
Activated neuronal groups typically engage in rhythmic synchronization in the gamma-frequency range (30-100 Hz). Experimental and modeling studies demonstrate that each gamma cycle is framed by synchronized spiking of inhibitory interneurons. Here, we review evidence suggesting that the resulting rhythmic network inhibition interacts with excitatory input to pyramidal cells such that the more excited cells fire earlier in the gamma cycle. Thus, the amplitude of excitatory drive is recoded into phase values of discharges relative to the gamma cycle. This recoding enables transmission and read out of amplitude information within a single gamma cycle without requiring rate integration. Furthermore, variation of phase relations can be exploited to facilitate or inhibit exchange of information between oscillating cell assemblies. The gamma cycle could thus serve as a fundamental computational mechanism for the implementation of a temporal coding scheme that enables fast processing and flexible routing of activity, supporting fast selection and binding of distributed responses. This review is part of the INMED/TINS special issue Physiogenic and pathogenic oscillations: the beauty and the beast, based on presentations at the annual INMED/TINS symposium (http://inmednet.com).
Effects of Chicken Interferon Gamma on Newcastle Disease Virus Vaccine Immunogenicity
Cardenas-Garcia, Stivalis; Dunwoody, Robert P.; Marcano, Valerie; Diel, Diego G.; Williams, Robert J.; Gogal, Robert M.; Brown, Corrie C.; Miller, Patti J.; Afonso, Claudio L.
2016-01-01
More effective vaccines are needed to control avian diseases. The use of chicken interferon gamma (chIFNγ) during vaccination is a potentially important but controversial approach that may improve the immune response to antigens. In the present study, three different systems to co-deliver chIFNγ with Newcastle disease virus (NDV) antigens were evaluated for their ability to enhance the avian immune response and their protective capacity upon challenge with virulent NDV. These systems consisted of: 1) a DNA vaccine expressing the Newcastle disease virus fusion (F) protein co-administered with a vector expressing the chIFNγ gene for in ovo and booster vaccination, 2) a recombinant Newcastle disease virus expressing the chIFNγ gene (rZJ1*L/IFNγ) used as a live vaccine delivered in ovo and into juvenile chickens, and 3) the same rZJ1*L/IFNγ virus used as an inactivated vaccine for juvenile chickens. Co-administration of chIFNγ with a DNA vaccine expressing the F protein resulted in higher levels of morbidity and mortality, and higher amounts of virulent virus shed after challenge when compared to the group that did not receive chIFNγ. The live vaccine system co-delivering chIFNγ did not enhanced post-vaccination antibody response, nor improved survival after hatch, when administered in ovo, and did not affect survival after challenge when administered to juvenile chickens. The low dose of the inactivated vaccine co-delivering active chIFNγ induced lower antibody titers than the groups that did not receive the cytokine. The high dose of this vaccine did not increase the antibody titers or antigen-specific memory response, and did not reduce the amount of challenge virus shed or mortality after challenge. In summary, regardless of the delivery system, chIFNγ, when administered simultaneously with the vaccine antigen, did not enhance Newcastle disease virus vaccine immunogenicity. PMID:27409587
A Platinum-Enriched gamma+gamma' Two-Phase Bond Coat on Ni-Base Superalloys
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Ying; Pint, Bruce A; Haynes, James A
2005-01-01
Pt-enriched {gamma} + {gamma}{prime} two-phase coating was applied to directionally-solidified Ni-based superalloy Ren{acute e} 142 substrates with three different Hf levels (0.02, 0.76, and 1.37 wt.%). The coating was prepared by electroplating a thin layer of Pt on the superalloy followed by a diffusion treatment. The as-deposited coating exhibited a {gamma} + {gamma}{prime} two-phase microstructure with a major composition of Ni-16Al-18Pt-7Cr-9Co (in at.%) along with some incorporation of refractory elements from the substrates. Cyclic oxidation testing at 1100 C in air indicated improved oxidation resistance of the Ren{acute e} 142 alloys with the Pt-enriched {gamma} + {gamma}{prime} coatings. In addition,more » the oxidation resistance of both uncoated and coated alloys was proportional to the Hf content in the substrate. Compared with the single-phase {beta}-(Ni,Pt)Al coating, slightly higher mass gains and localized spallation were observed on the {gamma} + {gamma}{prime} two-phase coating, which might be due to the segregation of refractory elements and high sulfur levels in these superalloy substrates.« less
NASA Technical Reports Server (NTRS)
Cline, Thomas L.
1987-01-01
The discovery of cosmic gamma ray bursts was made with systems designed at Los Alamos Laboratory for the detection of nuclear explosions beyond the atmosphere. HELIOS-2 was the first gamma ray burst instrument launched; its initial results in 1976, seemed to deepen the mystery around gamma ray transients. Interplanetary spacecraft data were reviewed in terms of explaining the behavior and source of the transients.
Paciello, O; Borzacchiello, G; Varricchio, E; Papparella, S
2007-10-01
Peroxisome proliferator-activated receptor gamma (PPAR-gamma) is a ligand-activated transcriptional factor belonging to the steroid receptor superfamily. PPAR-gamma is expressed in multiple normal and neoplastic tissues, such as the breast, colon, lung, ovary and placenta. In addition to adipogenic and anti-inflammatory effects, PPAR-gamma activation has been shown to be anti-proliferative by its differentiation-promoting effect, suggesting that activation of PPAR-gamma may be useful in slowing or arresting the proliferation of de-differentiated tumour cells. In this study, we investigated the expression of PPAR-gamma in normal and neoplastic canine nasal epithelium. Twenty-five samples composed of five normal nasal epithelia and 20 canine nasal carcinomas, were immunohistochemically stained for PPAR-gamma. The specificity of the antibody was verified by Western Blot analysis. Confocal laser scanning microscopical investigation was also performed. In normal epithelium, the staining pattern was cytoplasmic and polarized at the cellular free edge. In carcinomas, the neoplastic cells showed mainly strong cytoplasmatic PPAR-gamma expression; moreover, perinuclear immunoreactivity was also detected and few neoplastic cells exhibited a nuclear positivity. Our results demonstrate different patterns of PPAR-gamma expression in normal canine nasal epithelium when compared with canine nasal carcinoma. The importance of this transcription factor in the pathophysiology of several different tumours has stimulated much research in this field and has opened new opportunities for the treatment of the tumours.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yokota, Shin-ichi; Okabayashi, Tamaki; Fujii, Nobuhiro, E-mail: fujii@sapmed.ac.j
2011-05-25
Measles virus (MeV) produces two accessory proteins, V and C, from the P gene. These accessory proteins have been reported to contribute to efficient virus proliferation through the modulation of host cell events. Our previous paper described that Vero cell-adapted strains of MeV led host cells to growth arrest through the upregulation of interferon regulatory factor 1 (IRF-1), and wild strains did not. In the present study, we found that C protein expression levels varied among MeV strains in infected SiHa cells. C protein levels were inversely correlated with IRF-1 expression levels and with cell growth arrest. Forced expression ofmore » C protein released cells from growth arrest. C-deficient recombinant virus efficiently upregulated IRF-1 and caused growth arrest more efficiently than the wild-type virus. C protein preferentially bound to phosphorylated STAT1 and suppressed STAT1 dimer formation. We conclude that MeV C protein suppresses IFN-{gamma} signaling pathway via inhibition of phosphorylated STAT1 dimerization.« less
ERIC Educational Resources Information Center
Gilli, Francesca; Bertolotto, Antonio; Sala, Arianna; Hoffmann, Francine; Capobianco, Marco; Malucchi, Simona; Glass, Tracy; Kappos, Ludwig; Lindberg, Raija L. P.; Leppert, David
2004-01-01
Neutralizing antibodies (NAb) against interferon-[Beta] (IFN-Beta) develop in about a third of treated multiple sclerosis patients and are believed to reduce therapeutic efficacy of IFN-[Beta] on clinical and MRI measures. The expression of the interferon acute-response protein, myxovirus resistance protein A (MxA) is a sensitive measure of the…
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sirunyan, A. M.; Tumasyan, A.; Adam, W.
Here, measurements are presented ofmore » $$ \\mathrm{ W \\gamma\\gamma } $$ and $$ \\mathrm{ Z \\gamma\\gamma } $$ production in proton-proton collisions. Fiducial cross sections are reported based on a data sample corresponding to an integrated luminosity of 19.4 fb$$^{-1}$$ collected with the CMS detector at a center-of-mass energy of 8 TeV. Signal is identified through the $$\\mathrm{ W } \\to \\ell\
Sirunyan, A. M.; Tumasyan, A.; Adam, W.; ...
2017-10-11
Here, measurements are presented ofmore » $$ \\mathrm{ W \\gamma\\gamma } $$ and $$ \\mathrm{ Z \\gamma\\gamma } $$ production in proton-proton collisions. Fiducial cross sections are reported based on a data sample corresponding to an integrated luminosity of 19.4 fb$$^{-1}$$ collected with the CMS detector at a center-of-mass energy of 8 TeV. Signal is identified through the $$\\mathrm{ W } \\to \\ell\
Dempoya, Junichi; Imaizumi, Tadaatsu; Hayakari, Ryo; Xing, Fei; Yoshida, Hidemi; Okumura, Ken; Satoh, Kei
2012-01-01
Upon viral infection, pattern recognition receptors sense viral nucleic acids, leading to the production of type I interferons (IFNs), which initiate antiviral activities. Type I IFNs bind to their cognate receptor, IFNAR, resulting in the activation of signal-transducing activators of transcription 1 (STAT1). Thus, it has long been thought that double-stranded RNA (dsRNA)-induced STAT1 phosphorylation is mediated by the transactivation of type I IFN signaling. Foreign RNA, such as viral RNA, in cells is sensed by the cytoplasmic sensors retinoic acid-inducible gene I (RIG-I) and melanoma differentiation-associated gene 5 (MDA-5). In this study, we explored the molecular mechanism responsible for STAT1 phosphorylation in response to the sensing of dsRNA by cytosolic RNA sensors. Polyinosinic-poly(C) [poly(I:C)], a synthetic dsRNA that is sensed by both RIG-I and MDA-5, induces STAT1 phosphorylation. We found that the poly(I:C)-induced initial phosphorylation of STAT1 is dependent on the RIG-I pathway and that MDA-5 is not involved in STAT1 phosphorylation. Furthermore, pretreatment of the cells with neutralizing antibody targeting the IFN receptor suppressed the initial STAT1 phosphorylation in response to poly(I:C), suggesting that this initial phosphorylation event is predominantly type I IFN dependent. In contrast, neither the known RIG-I pathway nor type I IFN is involved in the late phosphorylation of STAT1. In addition, poly(I:C) stimulated STAT1 phosphorylation in type I IFN receptor-deficient U5A cells with delayed kinetics. Collectively, our study provides evidence of a comprehensive regulatory mechanism in which dsRNA induces STAT1 phosphorylation, indicating the importance of STAT1 in maintaining very tight regulation of the innate immune system. PMID:22973045
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stinnett, Jacob; Venkataraman, Ram
The objective of this training is to explain the origin of x-rays and gamma rays, gamma ray interactions with matter, detectors and electronics used in gamma ray-spectrometry, and features of a gamma-ray spectrum for nuclear material that is safeguarded.
Chuke, Stella O; Yen, Nguyen Thi Ngoc; Laserson, Kayla F; Phuoc, Nguyen Huu; Trinh, Nguyen An; Nhung, Duong Thi Cam; Mai, Vo Thi Chi; Qui, An Dang; Hai, Hoang Hoa; Loan, Le Thien Huong; Jones, Warren G; Whitworth, William C; Shah, J Jina; Painter, John A; Mazurek, Gerald H; Maloney, Susan A
2014-01-01
Objective. Use of tuberculin skin tests (TSTs) and interferon gamma release assays (IGRAs) as part of tuberculosis (TB) screening among immigrants from high TB-burden countries has not been fully evaluated. Methods. Prevalence of Mycobacterium tuberculosis infection (MTBI) based on TST, or the QuantiFERON-TB Gold test (QFT-G), was determined among immigrant applicants in Vietnam bound for the United States (US); factors associated with test results and discordance were assessed; predictive values of TST and QFT-G for identifying chest radiographs (CXRs) consistent with TB were calculated. Results. Of 1,246 immigrant visa applicants studied, 57.9% were TST positive, 28.3% were QFT-G positive, and test agreement was 59.4%. Increasing age was associated with positive TST results, positive QFT-G results, TST-positive but QFT-G-negative discordance, and abnormal CXRs consistent with TB. Positive predictive values of TST and QFT-G for an abnormal CXR were 25.9% and 25.6%, respectively. Conclusion. The estimated prevalence of MTBI among US-bound visa applicants in Vietnam based on TST was twice that based on QFT-G, and 14 times higher than a TST-based estimate of MTBI prevalence reported for the general US population in 2000. QFT-G was not better than TST at predicting abnormal CXRs consistent with TB.
Dynamic gamma knife radiosurgery
NASA Astrophysics Data System (ADS)
Luan, Shuang; Swanson, Nathan; Chen, Zhe; Ma, Lijun
2009-03-01
Gamma knife has been the treatment of choice for various brain tumors and functional disorders. Current gamma knife radiosurgery is planned in a 'ball-packing' approach and delivered in a 'step-and-shoot' manner, i.e. it aims to 'pack' the different sized spherical high-dose volumes (called 'shots') into a tumor volume. We have developed a dynamic scheme for gamma knife radiosurgery based on the concept of 'dose-painting' to take advantage of the new robotic patient positioning system on the latest Gamma Knife C™ and Perfexion™ units. In our scheme, the spherical high dose volume created by the gamma knife unit will be viewed as a 3D spherical 'paintbrush', and treatment planning reduces to finding the best route of this 'paintbrush' to 'paint' a 3D tumor volume. Under our dose-painting concept, gamma knife radiosurgery becomes dynamic, where the patient moves continuously under the robotic positioning system. We have implemented a fully automatic dynamic gamma knife radiosurgery treatment planning system, where the inverse planning problem is solved as a traveling salesman problem combined with constrained least-square optimizations. We have also carried out experimental studies of dynamic gamma knife radiosurgery and showed the following. (1) Dynamic gamma knife radiosurgery is ideally suited for fully automatic inverse planning, where high quality radiosurgery plans can be obtained in minutes of computation. (2) Dynamic radiosurgery plans are more conformal than step-and-shoot plans and can maintain a steep dose gradient (around 13% per mm) between the target tumor volume and the surrounding critical structures. (3) It is possible to prescribe multiple isodose lines with dynamic gamma knife radiosurgery, so that the treatment can cover the periphery of the target volume while escalating the dose for high tumor burden regions. (4) With dynamic gamma knife radiosurgery, one can obtain a family of plans representing a tradeoff between the delivery time and the
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lowe, Xiu R.; Marchetti, Francesco; Lu, Xiaochen
2009-03-03
We previously showed that the expression of troponin T1 (Tnnt 1) was induced in the central nervous system (CNS) of adultmice 30 min after treatment with ketamine, a glutamate N-methyl-D-aspartic acid (NMDA) receptor antagonist. We hypothesized that Tnnt 1 expression may be an early molecular biomarker of stress response in the CNS of mice. To further evaluate this hypothesis, we investigated the regional expression of Tnnt 1 in the mouse brain using RNA in situ hybridization 4 h after systemic exposure to interferon-a (IFN-a) and gamma ionizing radiation, both of which have be associated with wide ranges of neuropsychiatric complications.more » Adult B6C3F1 male mice were treated with either human IFN-a (a single i.p. injection at 1 x 105 IU/kg) or whole body gamma-radiation (10 cGy or 2 Gy). Patterns of Tnnt 1 transcript expression were compared in various CNS regions after IFN-a, radiation and ketamine treatments (previous study). Tnnt 1 expression was consistently induced in pyramidal neurons of cerebral cortex and hippocampus after all treatment regimens including 10 cGy of ionizing radiation. Regional expression of Tnnt 1 was induced in Purkinje cells of cerebellum after ionizing radiation and ketamine treatment; but not after IFN-a treatment. None of the three treatments induced Tnnt 1 expression in glial cells. The patterns of Tnnt 1 expression in pyramidal neurons of cerebral cortex andhippocampus, which are both known to play important roles in cognitive function, memory and emotion, suggest that the expression of Tnnt 1 may be an early molecular biomarker of induced CNS stress.« less
Oliveira, Sandra Maria do Valle Leone de; Trajman, Anete; Paniago, Anamaria Mello Miranda; Motta-Castro, Ana Rita Coimbra; Ruffino-Netto, Antonio; Maciel, Ethel Leonor Noia; Croda, Julio; Bonecini-Almeida, Maria da Gloria
2017-01-01
To evaluate the frequency of and factors associated with indeterminate interferon-gamma release assay (IGRA) results in people living with HIV/AIDS (PLWHA). We tested 81 PLWHA in the central-west region of Brazil, using the tuberculin skin test and an IGRA. Information on sociodemographic and clinical variables was gathered through the use of questionnaires and from medical records. The association of those variables with indeterminate results was analyzed by calculating the adjusted ORs in a multivariate logistic regression model. Concordance was evaluated by determining the kappa statistic. Among the 81 patients evaluated, the tuberculin skin test results were positive in 18 (22.2%) of the patients, and the IGRA results were positive in 10 (12.3%), with a kappa of 0.62. The IGRA results were indeterminate in 22 (27.1%) of the patients (95% CI: 17.8-38.1%). The odds of obtaining indeterminate results were significantly higher in smokers (adjusted OR = 6.0; 95% CI: 1.4-26.7) and in samples stored for less than 35 days (adjusted OR = 14.0; 95% CI: 3.1-64.2). Patients with advanced immunosuppression (CD4+ T-cell count < 200 cells/mm3) were at a higher risk for indeterminate results (OR adjusted for smoking and inadequate duration of sample storage = 4.7; 95% CI: 0.91-24.0), although the difference was not significant. The high prevalence of indeterminate results can be a major limitation for the routine use of IGRAs in PLWHA. The need to repeat the test increases its costs and should be taken into account in cost-effectiveness studies. The processing of samples can significantly alter the results. Avaliar a frequência de resultados indeterminados de um interferon-gamma release assay (IGRA, ensaio de liberação de interferon-gama) e os fatores relacionados com esses resultados em pessoas vivendo com HIV/AIDS (PVHA). Foram avaliadas 81 PVHA na região Centro-Oeste do Brasil, por meio do teste tuberculínico e de um IGRA. Informações a respeito de vari
Albertsmeyer, Ann-Christin; Kakkassery, Vinodh; Spurr-Michaud, Sandra; Beeks, Olivia; Gipson, Ilene K
2010-03-01
Membrane-associated mucins are altered on the ocular surface in non-Sjögren's dry eye. This study sought to determine if inflammatory mediators, present in tears of dry eye patients, regulate membrane-associated mucins MUC1 and -16 at the level of gene expression, protein biosynthesis and/or ectodomain release. A human corneal limbal epithelial cell line (HCLE), which produces membrane-associated mucins, was used. Cells were treated with interleukin (IL)-6, -8, or -17, tumor necrosis factor-alpha (TNF-alpha), and Interferon-gamma (IFN-gamma), or a combination of TNF-alpha and IFN-gamma, or IFN-gamma and IL-17, for 1, 6, 24, or 48 h. Presence of receptors for these mediators was verified by RT-PCR. Effects of the cytokines on expression levels of MUC1 and -16 were determined by real-time PCR, and on mucin protein biosynthesis and ectodomain release in cell lysates and culture media, respectively, by immunoblot analysis. TNF-alpha and IFN-gamma each significantly induced MUC1 expression, cellular protein content and ectodomain release over time. Combined treatment with the two cytokines was not additive. By comparison, one of the inflammatory mediators, IFN-gamma, affected all three parameters-gene expression, cellular protein, and ectodomain release-for MUC16. Combined treatment with TNF-alpha and IFN-gamma showed effects similar to IFN-gamma alone, except that ectodomain release followed that of TNF-alpha, which induced MUC16 ectodomain release. In conclusion, inflammatory mediators present in tears of dry eye patients can affect MUC1 and -16 on corneal epithelial cells and may be responsible for alterations of surface mucins in dry eye.
Galactic plane gamma-radiation
NASA Technical Reports Server (NTRS)
Hartman, R. C.; Kniffen, D. A.; Thompson, D. J.; Fichtel, C. E.; Ogelman, H. B.; Tumer, T.; Ozel, M. E.
1979-01-01
Analysis of the SAS 2 data together with the COS B results shows that the distribution of galactic gamma-radiation has several similarities to that of other large-scale tracers of galactic structure. The radiation is primarily confined to a thin disc which exhibits offsets from b = 0 degrees similar to warping at radio frequencies. The principal distinction of the gamma-radiation is a stronger contrast in intensity between the region from 310 to 45 degrees in longitude and the regions away from the center that can be attributed to a variation in cosmic-ray density as a function of position in Galaxy. The diffuse galactic gamma-ray energy spectrum shows no significant variation in direction, and the spectrum seen along the plane is the same as that for the galactic component of the gamma-radiation at high altitudes. The uniformity of the galactic gamma-ray spectrum, the smooth decrease in intensity as a function of altitude, and the absence of any galactic gamma-ray sources at high altitudes indicate a diffuse origin for bulk of the galactic gamma-radiation rather than a collection of localized sources.
Duran, Maria Carolina; Willenbrock, Saskia; Müller, Jessika-M V; Nolte, Ingo; Feige, Karsten; Murua Escobar, Hugo
2013-04-01
Interleukin-12 (IL-12) and interferon gamma (IFN-γ) are key cytokines in immunemediated equine melanoma therapy. Currently, a method for accurate simultaneous quantification of these equine cytokines is lacking. Therefore, we sought to establish an assay that allows for accurate and simultaneous quantification of equine IL-12 (eIL-12) and IFN-γ (eIFN-γ). Several antibodies were evaluated for cross-reactivity to eIL-12 and eIFN-γ and were used to establish a bead-based Luminex assay, which was subsequently applied to quantify cytokine concentrations in biological samples. Cytokine detection ranged from 31.5-5,000 pg/ml and 15-10,000 pg/ml for eIL-12 and eIFN-γ, respectively. eIL-12 was detected in supernatants of stimulated peripheral blood mononuclear cells (PBMCs) and supernatants/cell lysates of eIL-12 expression plasmid-transfected cells. Low or undetectable cytokine concentrations were measured in negative controls. In equine serum samples, the mean measured eIL-12 concentration was 1,374 ± 8 pg/ml. The bead-based assay and ELISA for eIFN-γ used to measure eIFN-γ concentrations, showed similar concentrations. Results demonstrate, to our knowledge for the first time, that cross-reactive antibody pairs to eIL-12 and eIFN-γ and Luminex bead-based technology allow for accurate, simultaneous and multiplexed quantification of these key cytokines in biological samples.
Gamma-ray burster recurrence timescales
NASA Technical Reports Server (NTRS)
Schaefer, B. E.; Cline, T. L.
1984-01-01
Three optical transients have been found which are associated with gamma-ray bursters (GRBs). The deduced recurrence timescale for these optical transients (tau sub opt) will depend on the minimum brightness for which a flash would be detected. A detailed analysis using all available data of tau sub opt as a function of E(gamma)/E(opt) is given. For flashes similar to those found in the Harvard archives, the best estimate of tau sub opt is 0.74 years, with a 99% confidence interval from 0.23 years to 4.7 years. It is currently unclear whether the optical transients from GRBs also give rise to gamma-ray events. One way to test this association is to measure the recurrence timescale of gamma-ray events tau sub gamma. A total of 210 gamma-ray error boxes were examined and it was found that the number of observed overlaps is not significantly different from the number expected from chance coincidence. This observation can be used to place limits on tau sub gamma for an assumed luminosity function. It was found that tau sub gamma is approx. 10 yr if bursts are monoenergetic. However, if GRBs have a power law luminosity function with a wide dynamic range, then the limit is tau sub gamma 0.5 yr. Hence, the gamma-ray data do not require tau sub gamma and tau sub opt to be different.
Ishikawa, Muriel Y.; Wood, Lowell L.; Lougheed, Ronald W.; Moody, Kenton J.; Wang, Tzu-Fang
2004-05-25
A covert, gamma-ray "signature" is used as a "watermark" for property identification. This new watermarking technology is based on a unique steganographic or "hidden writing" digital signature, implemented in tiny quantities of gamma-ray-emitting radioisotopic material combinations, generally covertly emplaced on or within an object. This digital signature may be readily recovered at distant future times, by placing a sensitive, high energy-resolution gamma-ray detecting instrument reasonably precisely over the location of the watermark, which location may be known only to the object's owner; however, the signature is concealed from all ordinary detection means because its exceedingly low level of activity is obscured by the natural radiation background (including the gamma radiation naturally emanating from the object itself, from cosmic radiation and material surroundings, from human bodies, etc.). The "watermark" is used in object-tagging for establishing object identity, history or ownership. It thus may serve as an aid to law enforcement officials in identifying stolen property and prosecuting theft thereof. Highly effective, potentially very low cost identification-on demand of items of most all types is thus made possible.
NASA Technical Reports Server (NTRS)
Sonnenfeld, G.; Cunnick, J. E.; Armfield, A. V.; Wood, P. G.; Rabin, B. S.
1992-01-01
Mild electric foot-shock has been shown to be a stressor that can alter immune responses. Male Lewis rats were exposed to one session of 16 5.0-s 1.6-mA foot-shocks. Production of interferon-gamma by splenocytes in response to concanavalin-A was decreased in spleens from the shocked rats compared to control spleens. Spleen cells from rats treated with nadolol, a peripherally acting beta-adrenergic receptor antagonist, and then shocked, showed dose-dependent attenuation of the suppression of interferon-gamma production. This suggests that catecholamines mediate shock-induced suppression of interferon-gamma production. The percentage of splenic mononuclear cells expressing class II histocompatibility (Ia) antigens on their surfaces from spleens of shocked rats was determined by flow cytometry. Significantly decreased class II positive mononuclear cells were present in the spleens of shocked rats in comparison to the spleens of control rats. This may reflect an alteration of cell trafficking or decreased production of class II antigens.
NASA Technical Reports Server (NTRS)
Thompson, David
2012-01-01
Gamma rays reveal extreme, nonthermal conditions in the Universe. The Fermi Gamma-ray Space Telescope has been exploring the gamma-ray sky for more than four years, enabling a search for powerful transients like gamma-ray bursts, novae, solar flares, and flaring active galactic nuclei, as well as long-term studies including pulsars, binary systems, supernova remnants, and searches for predicted sources of gamma rays such as dark matter annihilation. Some results include a stringent limit on Lorentz invariance derived from a gamma-ray burst, unexpected gamma-ray variability from the Crab Nebula, a huge gamma-ray structure associated with the center of our galaxy, surprising behavior from some gamma-ray binary systems, and a possible constraint on some WIMP models for dark matter.
NASA Technical Reports Server (NTRS)
Wu, S. T.
2000-01-01
The project has progressed successfully during this period of performance. The highlights of the Gamma Ray Astronomy teams efforts are: (1) Support daily BATSE data operations, including receipt, archival and dissemination of data, quick-look science analysis, rapid gamma-ray burst and transient monitoring and response efforts, instrument state-of-health monitoring, and instrument commanding and configuration; (2) On-going scientific analysis, including production and maintenance of gamma-ray burst, pulsed source and occultation source catalogs, gamma-ray burst spectroscopy, studies of the properties of pulsars and black holes, and long-term monitoring of hard x-ray sources; (3) Maintenance and continuous improvement of BATSE instrument response and calibration data bases; (4) Investigation of the use of solid state detectors for eventual application and instrument to perform all sky monitoring of X-Ray and Gamma sources with high sensitivity; and (5) Support of BATSE outreach activities, including seminars, colloquia and World Wide Web pages. The highlights of this efforts can be summarized in the publications and presentation list.
Ohlinger, R.D.; Humphrey, H.W.
1985-08-26
A gamma ray detector shield comprised of a rigid, lead, cylindrical-shaped vessel having upper and lower portions with an pneumatically driven, sliding top assembly. Disposed inside the lead shield is a gamma ray scintillation crystal detector. Access to the gamma detector is through the sliding top assembly.
Cloning, sequencing, and expression of interferon-γ from elk in North America
Sweeney, Steven J.; Emerson, Carlene; Eriks, Inge S.
2001-01-01
Eradication of Mycobacterium bovis relies on accurate detection of infected animals, including potential domestic and wildlife reservoirs. Available diagnostic tests lack the sensitivity and specificity necessary for accurate detection, particularly in infected wildlife populations. Recently, an in vitro diagnostic test for cattle which measures plasma interferon-gamma (IFN-γ) levels in blood following in vitro incubation with M. bovis purified protein derivative has been enveloped. This test appears to have increased sensitivity over traditional testing. Unfortunately, it does not detect IFN-γ from Cervidae. To begin to address this problem, the IFN-γ gene from elk (Cervus elaphus) was cloned, sequenced, expressed, and characterized. cDNA was cloned from mitogen stimulated peripheral blood mononuclear cells. The predicted amino acid (aa) sequence was compared to known sequences from cattle, sheep, goats, red deer (Cervus elaphus), humans, and mice. Biological activity of the recombinant elk IFN-γ (rElkIFN-γ) was confirmed in a vesicular stomatitis virus cytopathic effect reduction assay. Production of monoclonal antibodies to IFN-γ epitopes conserved between ruminant species could provide an important tool for the development of reliable, practical diagnostic assays for detection of a delayed type hypersensitivity response to a variety of persistent infectious agents in ruminants, including M. bovis and Brucella abortus. Moreover, development of these reagents will aid investigators in studies to explore immunological responses of elk that are associated with resistance to infectious diseases.
Yano, E; Komai, T; Kawasaki, T; Kaifu, K; Atsuta, T; Kubo, Y; Fujiwara, Y
1985-09-01
The film surface of poly(gamma-benzyl-L-glutamate) (PBLG) was modified with 2-aminoethanol to enhance its hydrophilicity. Controlling the reaction conditions of PBLG and 2-aminoethanol, various types of copoly(gamma-benzyl-L-glutamate, gamma-hydroxyethyl-L-glutamine) film surfaces were obtained. Surface free energy (gamma sv), the dispersive component of gamma sv (gamma dsv), the nondispersive component of gamma sv (gamma psv), and the interfacial free energy of polymer surface with water (gamma sw), which were obtained by using the contact angle measurement and calculation method proposed by Andrade et al., were changed remarkably by the aminolysis. The gamma sv value increased after 2 h of aminolysis from 48.2 (PBLG) to 65.3 dyn/cm and gradually increased to around 70 dyn/cm after 12 h reaction. (gamma dsv) and (gamma psv) changed from 31.0 and 17.2 dyn/cm (PBLG) to 26.5 and 44.3 dyn/cm, respectively. These parameters of the material surfaces, modified over 12 h reaction, were found to be similar to those of the surfaces of canine aorta, vein, and human fibrin membrane. Blood clotting times on these polymer surfaces were comparatively longer than on siliconized glass surfaces.
López, Tatiana; García, Diego; Angel, Bárbara; Carrasco, Elena; Codner, Ethel; Ugarte, Francisca; Pérez-Bravo, Francisco
2008-02-02
In order to assess whether Fok I vitamin D receptor gene (VDR) polymorphism is involved in the genetic susceptibility of type 1 diabetes, a case-control study was conducted and VDR genotypes were related to serum concentrations of 25(OH) vitamin D and cytokines transforming growth factor beta1 (TGF-beta1) and interferon gamma (INF-gamma). 151 incident cases of type 1 diabetes and 182 non related healthy controls from Santiago were studied for VDR polymorphisms in peripheral blood DNA. Exon 2 (Fok I) segments were amplified by polimerase chain reaction and analyzed by means of restriction fragment length polymorphism to determine each corresponding genotype. Differences for allele, genotype and serological markers as 25(OH) vitamin D, TGF-beta1 and INF-gamma levels distribution between patients and controls were analyzed. Fok I polymorphism distribution analysis showed no differences between patients and controls. Among diabetics, higher levels of TGF-beta1 (median, 282.6 pg/ml; range, 131.8-3,031.4) were observed compared with healthy children (median, 232.2 pg/ml; range, 135.7-506.5) (p < 0.0038). Similar results were observed for INF-gamma concentrations (median, 121.1 pg/ml, and range, 5.3-228.8, in cases, and median, 89.6 pg/ml, and range, 10.9-117.2 in controls) (p < 0.0004). The diabetic carriers of the ff genotype showed low levels of 25(OH) vitamin D compared with the carriers of the F allele: mean (standard deviation), 23.1 (5.9) versus 27.9 (10.3) ng/ml (p < 0.03). A similar result was observed for TGF-beta1 concentrations in diabetic carriers of ff genotype and patients carriers of the F allele (298.5 versus 276.6; p < 0.05). Fok I polymorphism of VDR could have a marginal role in the immunologic disturbance in type 1 diabetes.
NASA Astrophysics Data System (ADS)
Jeong, Hyeon-Ho; Erdene, Norov; Lee, Seung-Ki; Jeong, Dae-Hong; Park, Jae-Hyoung
2011-12-01
A fiber-optic localized surface plasmon (FO LSPR) sensor was fabricated by gold nanoparticles (Au NPs) immobilized on the end-face of an optical fiber. When Au NPs were formed on the end-face of an optical fiber by chemical reaction, Au NPs aggregation occurred and the Au NPs were immobilized in various forms such as monomers, dimers, trimers, etc. The component ratio of the Au NPs on the end-face of the fabricated FO LSPR sensor was slightly changed whenever the sensors were fabricated in the same condition. Including this phenomenon, the FO LSPR sensor was fabricated with high sensitivity by controlling the density of Au NPs. Also, the fabricated sensors were measured for the resonance intensity for the different optical systems and analyzed for the effect on sensitivity. Finally, for application as a biosensor, the sensor was used for detecting the antibody-antigen reaction of interferon-gamma.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pulit-Penaloza, Joanna A.; Scherbik, Svetlana V.; Brinton, Margo A., E-mail: mbrinton@gsu.edu
2012-04-10
Although infection of mouse embryofibroblasts (MEFs) with WNV Eg101 induced interferon (IFN) beta production and STAT1 and STAT2 phosphorylation, these transcription factors (TFs) were not detected in the nucleus or on the promoters of four IRF-3-independent interferon stimulated genes (ISGs): Oas1a and Irf7 (previously characterized as IFN/ISGF3-dependent), Oas1b and Irf1. These ISGs were upregulated in WNV Eg101-infected STAT1-/-, STAT2-/-, and IFN alpha/beta receptor -/- MEFs. Although either IRF-3 or IRF-7 could amplify/sustain Oas1a and Oas1b upregulation at later times after infection, these factors were not required for the initial gene activation. The lack of upregulation of these ISGs in WNVmore » Eg101-infected IRF-3/9-/- MEFs suggested the involvement of IRF-9. Activation of Irf1 in infected MEFs did not depend on any of these IRFs. The data indicate that additional alternative activation mechanisms exist for subsets of ISGs when a virus infection has blocked ISG activation by the canonical IFN-mediated pathway.« less
Distinct Th1, Th2 and Treg cytokines balance in chronic periapical granulomas and radicular cysts.
Teixeira-Salum, Tatiana Beber; Rodrigues, Denise Bertulucci Rocha; Gervásio, Aurélia M; Souza, Cássio J A; Rodrigues, Virmondes; Loyola, Adriano Motta
2010-03-01
Periapical lesions are a host response that involves immune reaction to prevent dissemination of bacteria from an infected root canal. The purpose of this study was to evaluate the levels of nitric oxide (NO), IL-4, TGF-beta, tumor necrosis factor-alpha (TNF-alpha), and interferon-gamma (IFN-gamma) in chronic periapical lesions and to determine their possible association with clinical and radiographic parameters. Seventeen human radicular cysts and 30 periapical granulomas were used in this study. Cytokines and NO were assessed by enzyme-linked immunosorbent assay and by the Griess reaction respectively confirmed by immunohistochemical. TNF-alpha and IFN-gamma were detected in 10% of granulomas and in 41.2% and 70% of radicular cysts. IL-4 was reactive in 24% of cysts, and TGF-beta was positive in all samples. Patients with tenderness showed significantly higher levels of IFN-gamma and IL-4 (P < 0.05). Swelling was associated with high levels of TNF-alpha, IFN-gamma, and IL-4 (P < 0.05). Lesions presenting bone resorption were associated with high levels of NO (P < 0.05). Periapical granulomas display a regulatory environment characterized by high TGF-beta and low inflammatory cytokine levels, while radicular cysts has mist Th1 and Th2 inflammatory reaction with the presence of IFN-gamma, TNF-alpha, and IL-4.
Krenger, W; Cooke, K R; Crawford, J M; Sonis, S T; Simmons, R; Pan, L; Delmonte, J; Karandikar, M; Ferrara, J L
1996-11-15
Acute graft-versus-host disease (GVHD) is thought to be initiated by alloreactive type 1 T cells that secrete gamma-interferon (IFN-gamma). IFN-gamma induces the production of inflammatory cytokines, e.g., tumor necrosis factor-alpha and interleukin (IL)-1, which are the distal mediators of GVHD. We demonstrate that the transplantation of polarized type 2 murine T cells (i.e., cells secreting IL-4 but not IFN-gamma) together with T-cell-depleted bone marrow results in a significant increase in survival (P<0.001) after bone marrow transplantation across minor histocompatibility barriers (B10.BR-->CBA/J). Further analysis demonstrated that increased survival in recipients of polarized type 2 T cells correlated with diminished production of both IFN-gamma and tumor necrosis factor-alpha but with increases in IL-4 2 weeks after transplantation. Despite improved survival, histologic changes of GVHD were evident in oral mucosal and hepatic tissues at 7 weeks after bone marrow transplantation. These data provide further evidence that inflammatory cytokines in the immediate posttransplant period are pivotal to the development of mortality but that they do not correlate with individual target organ damage.
Harada, Toshie; Miura, Noriko N; Adachi, Yoshiyuki; Nakajima, Mitsuhiro; Yadomae, Toshiro; Ohno, Naohito
2004-08-01
Sparassis crispa Fr. is an edible/medicinal mushroom that recently became cultivable in Japan. SCG is a major 6-branched 1,3-beta-D-glucan in S. crispa showing antitumor activity. We recently found that the splenocytes from naive DBA/1 and DBA/2 mice strongly react with SCG to produce interferon-gamma (IFN-gamma). In this study, cytokines induced by SCG were screened and found to be IFN-gamma, tumor necrosis factor-alpha (TNF-alpha), granulocyte-macrophage colony-stimulating factor (GM-CSF), and interleukin-12 (IL-12p70). The addition of recombinant murine GM-CSF (rMuGM-CSF) to spleen cell cultures from various strains of mice synergistically enhanced IFN-gamma, TNF-alpha and IL-12p70 in the presence of SCG. In contrast, neutralizing GM-CSF using anti-GM-CSF monoclonal antibody (mAb) significantly inhibited IFN-gamma, TNF-alpha, and IL-12p70 elicited by SCG. We conclude that GM-CSF is a key molecule for cytokine induction by beta-glucan, and GM-CSF induction by SCG is the specific step in DBA/2 mice in vitro.
Omi, T; Brenig, B; Spilar Kramer, S; Iwamoto, S; Stranzinger, G; Neuenschwander, S
2005-04-01
The peroxisome proliferator-activated receptor-gamma (PPAR-gamma) is a member of the steroid/thyroid/retinoid receptor superfamily, and is primarily expressed in fat tissue. To date, two major PPAR-gamma isoforms have been identified in pig, PPAR-gamma1 and PPAR-gamma2. Porcine PPAR-gamma1a consists of two leader exons, designated A1 and A2, followed by six exons containing the open reading frame. Here, we report the isolation and characterization of three novel PPAR-gamma1 transcripts. PPAR-gamma1b is derived from exon A1, with exon A2 spliced out. PPAR-gamma1c and PPAR-gamma1d are derived from the new exon, A', containing exon A2 (gamma1c) or without exon A2 (gamma1d). Based on PCR analysis of PAC clones that included sequences from the 5'-untranslated region of the PPAR-gamma gene, the new A' exon is located between the known exons A1 and A2. We also isolated the human homologue to exon A', as well as the two new PPAR-gamma1c and -gamma1d splice variants, from human adipose tissue. Studies of the expression of porcine PPAR-gamma by real time reverse transcription-polymerase chain reaction analysis show that transcripts derived from exon A1 were not expressed at significantly different levels in visceral fat (lamina subserosa) or subcutaneous fat (back fat, inner and outer layer). In contrast, exon A'-derived transcripts were expressed at progressively higher levels in the inner and outer layers of subcutaneous fat than in visceral fat. The same expression pattern was also observed for PPAR-gamma2. We hypothesize that there are three promoters, which differentially regulate PPAR-gamma1 and PPAR-gamma2 gene expression, depending on the specific localization of the fat tissue.
Terrestrial Gamma-Ray Flashes (TGFs)
NASA Technical Reports Server (NTRS)
Fishman, Gerald J.
2010-01-01
This slide presentation reviews the observation of Terrestrial Gamma Ray Flashes (TGFs) by Gamma-Ray Telescopes. These were: (1) BATSE /Compton Observatory, (2) Solar Spectroscopic Imager, (3) AGILE Gamma-ray Telescope, and (4) Gamma-ray Burst Monitor (GBM) on the Fermi Gamma-ray Space Telescope. It contains charts which display the counts over time, a map or the TGFs observed by the Reuven Ramaty High Energy Solar Spectroscopic Imager (RHESSI). and a map showing the latitude and longitude of 85 of the TGFs observed by the Fermi GBM.
Targeting IFN-λ: therapeutic implications.
Eslam, Mohammed; George, Jacob
2016-12-01
Type-III interferons (IFN-λ), the most recently discovered family of IFNs, shares common features with other family members, but also has many distinctive activities. IFN-λ uniquely has a different receptor complex, and a more focused pattern of tissue expression and signaling effects, from other classes of IFNs. Multiple genome-wide association studies (GWAS) and subsequent validation reports suggest a pivotal role for polymorphisms near the IFNL3 gene in hepatitis C clearance and control, as also for several other epithelial cell tropic viruses. Apart from its antiviral activity, IFN-λ possesses anti-tumor, immune-inflammatory and homeostatic functions. The overlapping effects of IFN-λ with type I IFN, with a restricted tissue expression pattern renders IFN-λ an attractive therapeutic target for viral infection, cancer and autoimmune diseases, with limited side effects. Areas covered: This review will summarize the current and future therapeutic opportunities offered by this most recently discovered family of interferons. Expert opinion: Our knowledge on IFN-λ is rapidly expanding. Though there are many remaining questions and challenges that require elucidation, the unique characteristics of IFN-λ increases enthusiasm that multiple therapeutic options will emerge.
Synergistic induction of apoptosis in primary rat decidual cells by INF-gamma and TNF.
Almeida, A; Correia-da-Silva, G; Cepa, M; Bell, S C; Teixeira, N A
2007-03-01
In the rat, in response to blastocyst implantation, stromal cells of the endometrium proliferate and differentiate into decidual cells, forming the decidua. After reaching its maximum development, the decidua undergoes regression. This phenomenon appears to be due to an active process involving apoptosis. As there is sparse knowledge concerning the mechanisms of induction of decidual cell death, the potential role of cytokines present in the uterine environment during pregnancy, such as tumor necrosis factor (TNF) and interferon-gamma (INF-gamma) was explored in primary cultures of rat decidual cells. The effects of these factors upon cellular viability, nuclear morphologic alterations, expression, and enzymatic activities of the effector caspases-3/7 were evaluated. The results obtained demonstrated that in contrast to TNF, which did not induce any alteration, INF-gamma and in association with TNF caused a decrease in cell viability and an increase in the appearance of apoptotic bodies in a time-dependent manner that was augmented in the co-presence of TNF. An increase in caspase-3/7 activities after 12 hr of TNF/INF-gamma treatment was also observed. These findings suggest that INF-gamma expressed in the uterine environment may play an important role in regulating apoptosis through potential synergistic mechanisms with TNF and thereby modulate decidual stability and regression during pregnancy. (c) 2006 Wiley-Liss, Inc.
Perez-Mendez, Victor
1997-01-01
A gamma ray camera for detecting rays emanating from a radiation source such as an isotope. The gamma ray camera includes a sensor array formed of a visible light crystal for converting incident gamma rays to a plurality of corresponding visible light photons, and a photosensor array responsive to the visible light photons in order to form an electronic image of the radiation therefrom. The photosensor array is adapted to record an integrated amount of charge proportional to the incident gamma rays closest to it, and includes a transparent metallic layer, photodiode consisting of a p-i-n structure formed on one side of the transparent metallic layer, and comprising an upper p-type layer, an intermediate layer and a lower n-type layer. In the preferred mode, the scintillator crystal is composed essentially of a cesium iodide (CsI) crystal preferably doped with a predetermined amount impurity, and the p-type upper intermediate layers and said n-type layer are essentially composed of hydrogenated amorphous silicon (a-Si:H). The gamma ray camera further includes a collimator interposed between the radiation source and the sensor array, and a readout circuit formed on one side of the photosensor array.
Leung, Donald YM; Gao, Pei-Song; Grigoryev, Dmitry N; Rafaels, Nicholas M; Streib, Joanne E; Howell, Michael D; Taylor, Patricia A; Boguniewicz, Mark; Canniff, Jennifer; Armstrong, Brian; Zaccaro, Daniel J; Schneider, Lynda C; Hata, Tissa R; Hanifin, Jon M; Beck, Lisa A; Weinberg, Adriana; Barnes, Kathleen C
2011-01-01
Background The basis for increased susceptibility of atopic dermatitis (AD) patients to develop disseminated viral skin infections such as eczema herpeticum (ADEH+) is poorly understood. Objective We sought to determine whether atopic dermatitis subjects prone to disseminated viral skin infections have defects in their interferon responses. Methods GeneChip profiling was used to identify differences in gene expression of peripheral blood mononuclear cells (PBMC) from patients with a history of ADEH+ as compared to ADEH− and non-atopic controls. Key differences in protein expression were verified by ELISPOT and/or ELISA. Clinical relevance was further demonstrated by a mouse model of disseminated viral skin infection and genetic association analysis for genetic variants in IFNG and IFNGR1 and ADEH among 435 cases and controls. Results We demonstrate by global gene expression analysis selective transcriptomic changes within the interferon (IFN) superfamily of PBMCs from ADEH+ subjects reflecting low IFNγ and IFNγ receptor gene expression. IFNγ protein production was also significantly lower in ADEH+ (N=24) compared to ADEH− (N=20) and non-atopic (NA; N=20) controls. IFNγ receptor knockout (KO) mice developed disseminated viral skin infection after epicutaneous challenge with vaccinia virus (VV). Genetic variants in IFNG and IFNGR1 SNPs were significantly associated with ADEH (112 cases, 166 controls) and IFNγ production: a 2-SNP (A–G) IFNGR1 haplotype (rs10457655 and rs7749390) showed the strongest association with a reduced risk of ADEH+ ((13.2% ADEH+ vs 25.5% ADEH−, P = 0.00057). Conclusions ADEH+ patients have reduced IFNγ production, and IFNG and IFNGR1 SNPs are significantly associated with ADEH+ and may contribute to an impaired immune response to herpes simplex virus (HSV). Clinical Implications Atopic dermatitis subjects prone to disseminated viral skin infections have defects in their interferon responses. Capsule summary Using genomic
Zhou, Qin; Zhang, Wei; Chen, Shun; Wang, Anqi; Sun, Lipei; Wang, Mingshu; Jia, Renyong; Zhu, Dekang; Liu, Mafeng; Sun, Kunfeng; Yang, Qiao; Wu, Ying; Chen, Xiaoyue; Cheng, Anchun
2017-06-01
Type III interferons (IFN-λ1/λ2/λ3, also known as IL-29/28A/28B, and IFN-λ4) are a recently discovered interferon group. In this study, we first identified the Chinese goose IFN-λ (goIFN-λ). The full-length sequence of goIFN-λ was found to be 823 bp. There was only one open reading frame that contained 570 bp, and, encoded 189 amino acids. The predicted goIFN-λ protein showed 78%, 67%, and 40% amino acid identity with duIFN-λ, chIFN-λ, and hIFN-λ3, respectively. The tissue distribution of goIFN-λ existed as a parallel distribution with goIFNLR1 as its functional receptor, which was mainly expressed in epithelium-rich tissues, such as lung, gizzard, proventriculus, skin and pancreas, and immune tissues, such as harderian gland and thymus. Furthermore, the immunological characteristics studies of goIFN-λ showed that there was a significant increase in the mRNA at the transcriptional level of goIFN-λ after the peripheral blood mononuclear cells were stimulated with ploy (I:C) and ODN2006, and infected with Gosling plague virus (GPV). In vivo, the mRNA transcriptional level of goIFN-λ increased nearly 20 times in the lung tissue and nearly 40 times in the pancreatic tissue after being artificially infected with H9N2 AIV. It is suggested that goIFN-λ might play a pivotal role in the mucosal immune protection and antiviral defense.
NASA Technical Reports Server (NTRS)
Copland, Evan
2008-01-01
The activities of Al and Ni were measured using multi-cell Knudsen effusion-cell mass spectrometry (multi-cell KEMS), over the composition range 8 - 32 at.%Al and temperature range T = 1400 - 1750 K in the Ni-Al-O system. These measurements establish that equilibrium solidification of gamma'-Ni3Al-containing alloys occurs by the eutectic reaction, L (+ Al2O3) = gamma + beta (+ Al2O3), at 1640 plus or minus 1 K and a liquid composition of 24.8 plus or minus 0.2 at.%Al (at an unknown oxygen content). The {gamma + beta + Al2O3} phase field is stable over the temperature range 1633 - 1640 K, and gamma'-Ni3Al forms via the peritectiod, gamma + beta (+ Al2O3) = gamma'(+ Al2O3), at 1633 plus or minus 1 K. This behavior is inconsistent with the current Ni-Al phase diagram and a new diagram is proposed. This new Ni-Al phase diagram explains a number of unusual steady state solidification structures reported previously and provides a much simpler reaction scheme in the vicinity of the gamma'-Ni3Al phase field.
NASA Technical Reports Server (NTRS)
Stecker, F. W. (Editor); Trombka, J. I. (Editor)
1973-01-01
Conference papers on gamma ray astrophysics are summarized. Data cover the energy region from about 0.3 MeV to a few hundred GeV and theoretical models of production mechanisms that give rise to both galactic and extragalactic gamma rays.
The Gamma-ray Universe through Fermi
NASA Technical Reports Server (NTRS)
Thompson, David J.
2012-01-01
Gamma rays, the most powerful form of light, reveal extreme conditions in the Universe. The Fermi Gamma-ray Space Telescope and its smaller cousin AGILE have been exploring the gamma-ray sky for several years, enabling a search for powerful transients like gamma-ray bursts, novae, solar flares, and flaring active galactic nuclei, as well as long-term studies including pulsars, binary systems, supernova remnants, and searches for predicted sources of gamma rays such as dark matter annihilation. Some results include a stringent limit on Lorentz invariance derived from a gamma-ray burst, unexpected gamma-ray variability from the Crab Nebula, a huge ga.nuna-ray structure associated with the center of our galaxy, surprising behavior from some gamma-ray binary systems, and a possible constraint on some WIMP models for dark matter.
NASA Technical Reports Server (NTRS)
Ramaty, R.; Lingenfelter, R. E.
1986-01-01
Observations of gamma rays from solar flares, gamma ray bursts, the Galactic center, galactic nucleosynthesis, SS433, and Cygnus X-3, and their effects on astrophysical problems are discussed. It is observed that gamma ray spectra from solar flares are applicable to the study of particle acceleration and confinement and the determination of chemical abundances in the solar atmosphere. The gamma ray lines from the compact galactic object SS433 are utilized to examine the acceleration of jets, and analysis of the gamma ray lines of Cygnus X-3 reveal that particles can be accelerated in compact sources to ultrahigh energies.
A study of interdiffusion in beta + gamma/gamma + gamma prime Ni-Cr-Al. M.S. Thesis. Final Report
NASA Technical Reports Server (NTRS)
Carol, L. A.
1985-01-01
Ternary diffusion in the NiCrAl system at 1200 C was studied with beta + gamma/gamma + gamma prime infinite diffusion couples. Interdiffusion resulted in the formation of complex, multiphase diffusion zones. Concentration/distance profiles for Cr and Al in the phases present in the diffusion zone were measured after 200 hr. The Ni-rich portion of the NiCrAl phase diagram (1200 C) was also determined. From these data, bulk Cr and Al profiles were calculated and translated to diffusion paths on the ternary isotherm. Growth layer kinetics of the layers present in the diffusion zone were also measured.
Moen, Stephan Craig; Meyers, Craig Glenn; Petzen, John Alexander; Foard, Adam Muhling
2012-08-07
A method of calibrating a nuclear instrument using a gamma thermometer may include: measuring, in the instrument, local neutron flux; generating, from the instrument, a first signal proportional to the neutron flux; measuring, in the gamma thermometer, local gamma flux; generating, from the gamma thermometer, a second signal proportional to the gamma flux; compensating the second signal; and calibrating a gain of the instrument based on the compensated second signal. Compensating the second signal may include: calculating selected yield fractions for specific groups of delayed gamma sources; calculating time constants for the specific groups; calculating a third signal that corresponds to delayed local gamma flux based on the selected yield fractions and time constants; and calculating the compensated second signal by subtracting the third signal from the second signal. The specific groups may have decay time constants greater than 5.times.10.sup.-1 seconds and less than 5.times.10.sup.5 seconds.
Vitry, Marie-Alice; De Trez, Carl; Goriely, Stanislas; Dumoutier, Laure; Akira, Shizuo; Ryffel, Bernhard; Carlier, Yves; Letesson, Jean-Jacques; Muraille, Eric
2012-12-01
Brucella spp. are facultative intracellular bacterial pathogens responsible for brucellosis, a worldwide zoonosis that causes abortion in domestic animals and chronic febrile disease associated with serious complications in humans. There is currently no approved vaccine against human brucellosis, and antibiotic therapy is long and costly. Development of a safe protective vaccine requires a better understanding of the roles played by components of adaptive immunity in the control of Brucella infection. The importance of lymphocyte subsets in the control of Brucella growth has been investigated separately by various research groups and remains unclear or controversial. Here, we used a large panel of genetically deficient mice to compare the importance of B cells, transporter associated with antigen processing (TAP-1), and major histocompatibility complex class II-dependent pathways of antigen presentation as well as T helper 1 (Th1), Th2, and Th17-mediated responses on the immune control of Brucella melitensis 16 M infection. We clearly confirmed the key function played by gamma interferon (IFN-γ)-producing Th1 CD4(+) T cells in the control of B. melitensis infection, whereas IFN-γ-producing CD8(+) T cells or B cell-mediated humoral immunity plays only a modest role in the clearance of bacteria during primary infection. In the presence of a Th1 response, Th2 or Th17 responses do not really develop or play a positive or negative role during the course of B. melitensis infection. On the whole, these results could improve our ability to develop protective vaccines or therapeutic treatments against brucellosis.
Stress-induced release of HSC70 from human tumors.
Barreto, Alfonso; Gonzalez, John Mario; Kabingu, Edith; Asea, Alexzander; Fiorentino, Susana
2003-04-01
In this study, we demonstrate that the pro-inflammatory cytokine interferon-gamma (IFN-gamma) induces the active release of the constitutive form of the 70-kDa heat shock protein (HSC70) from K562 erythroleukemic cells. Treatment of K562 cells with IFN-gamma induced the upregulation of the inducible form of the 70-kDa heat shock protein (HSP70), but not the constitutive form of HSC70 within the cytosol, in a proteasome-dependent manner. In addition, IFN-gamma induced the downregulation of surface-bound HSC70, but did not significantly alter surface-bound HSP70 expression. These findings indicate that HSC70 can be actively released from tumor cells and is indicative of a previously unknown mechanism by which immune modulators stimulate the release of intracellular HSC70. This mechanism may account for the potent chaperokine activity of heat shock proteins recently observed during heat shock protein-based immunotherapy against a variety of cancers.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hatano, Ryo; Yamada, Kiyoshi; Iwamoto, Taku
2013-06-14
Highlights: •Small intestinal epithelial cells (sIECs). •sIECs are able to induce antigen specific proliferation of CD4{sup +} IELs. •sIECs induce markedly enhanced IFN-γ secretion by CD4{sup +} IELs. •Induction of enhanced IFN-γ secretion by sIECs is uniquely observed in CD4{sup +} IELs. -- Abstract: Small intestinal epithelial cells (sIECs) express major histocompatibility complex class II molecules even in a normal condition, and are known to function as antigen presenting cells (APCs) at least in vitro. These findings raised the possibility that sIECs play an important role in inducing immune responses against luminal antigens, especially those of intestinal intraepithelial lymphocytes (IELs)more » and lamina propria lymphocytes (LPLs). We herein showed that antigenic stimulation with sIECs induced markedly greater secretion of interferon-gamma (IFN-γ) by CD4{sup +} IELs, but not interleukin (IL)-4, IL-10 and IL-17 although the proliferative response was prominently lower than that with T cell-depleted splenic APCs. In contrast, no enhanced IFN-γ secretion by CD4{sup +} LPLs and primed splenic CD4{sup +} T cells was observed when stimulated with sIECs. Taken together, these results suggest that sIECs uniquely activate CD4{sup +} IELs and induce remarkable IFN-γ secretion upon antigenic stimulation in vivo.« less
Erkens, C G M; Dinmohamed, A G; Kamphorst, M; Toumanian, S; van Nispen-Dobrescu, R; Alink, M; Oudshoorn, N; Mensen, M; van den Hof, S; Borgdorff, M; Verver, S
2014-04-01
Interferon-gamma release assays (IGRAs) are reported to be more specific for the diagnosis of latent tuberculous infection (LTBI) than the tuberculin skin test (TST). The two-step procedure, TST followed by an IGRA, is reported to be cost-effective in high-income countries, but it requires more financial resources. To assess the added value of IGRA compared to TST alone in the Netherlands. Test results and background data on persons tested with an IGRA were recorded by the Public Municipal Health Services in a web-based database. The number of persons diagnosed with LTBI using different screening algorithms was calculated. In those tested with an IGRA, at least 60% of persons who would have been diagnosed with LTBI based on TST alone had a negative IGRA. Among those with a TST reaction below the cut-off for the diagnosis of LTBI, 13% had a positive IGRA. For 41% of persons tested with an IGRA after TST, the IGRA influenced whether or not an LTBI diagnosis would be made. With the IGRA as reference standard, a high proportion of persons in low-prevalence settings are treated unnecessarily for LTBI if tested with TST alone, while a small proportion eligible for preventive treatment are missed. Incremental costs of the two-step strategy seem to be balanced by the improved targeting of preventive treatment.
Pokryszko-Dragan, A; Frydecka, I; Kosmaczewska, A; Ciszak, L; Bilińska, M; Gruszka, E; Podemski, R; Frydecka, D
2012-10-01
The aim of the study was to evaluate the stimulated production of interferon-gamma (IFNγ) by peripheral CD3+CD4+ T lymphocytes in patients with multiple sclerosis (MS) with regard to the degree of fatigue, and to investigate relationships between immunological parameters, level of depression and clinical variables. Forty MS patients (30 women, 10 men, aged 22-60 years): 20 fatigued and 20 non-fatigued were involved in the study. Fatigue was evaluated using the Fatigue Severity Scale (FSS) and Modified Fatigue Impact Scale (MFIS), depression level - using Beck Depression Inventory (BDI). Production of IFNγ by stimulated peripheral blood CD3+CD4+ T lymphocytes, assessed using flow cytometry, was compared between MS patients with different levels of fatigue and controls. Correlations were searched out between immunological findings and BDI, age, duration and course of MS, relapse rate, disability (assessed in Expanded Disability Status Scale - EDSS) and its progression. Stimulated production of IFNγ by CD3+CD4+ T lymphocytes was higher in severely fatigued patients in comparison with non-fatigued ones and controls, tended to correlate with FSS and MFIS, and correlated with BDI. No relationships were found between immunological findings and disease-related variables. Stimulated production of IFNγ by peripheral CD3+CD4+ T lymphocytes is related to fatigue and depression in MS patients. Copyright © 2012 Elsevier B.V. All rights reserved.
Chuke, Stella O.; Yen, Nguyen Thi Ngoc; Laserson, Kayla F.; Phuoc, Nguyen Huu; Trinh, Nguyen An; Nhung, Duong Thi Cam; Mai, Vo Thi Chi; Qui, An Dang; Hai, Hoang Hoa; Loan, Le Thien Huong; Jones, Warren G.; Whitworth, William C.; Shah, J. Jina; Painter, John A.; Mazurek, Gerald H.; Maloney, Susan A.
2014-01-01
Objective. Use of tuberculin skin tests (TSTs) and interferon gamma release assays (IGRAs) as part of tuberculosis (TB) screening among immigrants from high TB-burden countries has not been fully evaluated. Methods. Prevalence of Mycobacterium tuberculosis infection (MTBI) based on TST, or the QuantiFERON-TB Gold test (QFT-G), was determined among immigrant applicants in Vietnam bound for the United States (US); factors associated with test results and discordance were assessed; predictive values of TST and QFT-G for identifying chest radiographs (CXRs) consistent with TB were calculated. Results. Of 1,246 immigrant visa applicants studied, 57.9% were TST positive, 28.3% were QFT-G positive, and test agreement was 59.4%. Increasing age was associated with positive TST results, positive QFT-G results, TST-positive but QFT-G-negative discordance, and abnormal CXRs consistent with TB. Positive predictive values of TST and QFT-G for an abnormal CXR were 25.9% and 25.6%, respectively. Conclusion. The estimated prevalence of MTBI among US-bound visa applicants in Vietnam based on TST was twice that based on QFT-G, and 14 times higher than a TST-based estimate of MTBI prevalence reported for the general US population in 2000. QFT-G was not better than TST at predicting abnormal CXRs consistent with TB. PMID:24738031
The tuberculin skin test increases the responses measured by T cell interferon-gamma release assays.
Vilaplana, C; Ruiz-Manzano, J; Gil, O; Cuchillo, F; Montané, E; Singh, M; Spallek, R; Ausina, V; Cardona, P J
2008-06-01
RUTI is a vaccine consisting of Mycobacterium tuberculosis bacilli grown in stress conditions that is fragmented, detoxified and liposomed. RUTI was designed to shorten the treatment of latent tuberculosis infection (LTBI) with isoniazid from 9 months to just 1 month, by additional treatment with two inoculations of RUTI 4 weeks apart. During the validation process for monitoring the immunogenicity of administration of RUTI in a Phase I clinical trial, the question arose whether to introduce the tuberculin skin test (TST) in the screening of non-LTBI volunteers. This study was designed to evaluate the effect of TST on subsequent different T-cell interferon-gamma release assay (TIGRA) responses, using a spectrum of M. tuberculosis-related antigens (ESAT-6, CFP-10, 16 kDa, 19 kDa, MPT64, Ag 85B, 38 kDa, hsp65, PPD and BCG). The results showed an increase in post-TST response even in non-LTBI subjects for most antigens tested, as measured both by whole blood assay (WBA) and ELISPOT. Increased ELISPOT response decreased toward pre-TST levels within 1 month whereas the WBA response did not. Taking into account that there is no definitive correlation between TST and TIGRA tests to diagnose LTBI and the feasibility that TST might alter the immune monitoring included in clinical trials, these data suggest that TST determination should be carefully planned to avoid any interference with TIGRA.
NASA Technical Reports Server (NTRS)
Ramaty, R.; Lingenfelter, R. E.
1982-01-01
Cosmic gamma rays, the physical processes responsible for their production and the astrophysical sites from which they were seen are reported. The bulk of the observed gamma ray emission is in the photon energy range from about 0.1 MeV to 1 GeV, where observations are carried out above the atmosphere. There are also, however, gamma ray observations at higher energies obtained by detecting the Cerenkov light produced by the high energy photons in the atmosphere. Gamma ray emission was observed from sources as close as the Sun and the Moon and as distant as the quasar 3C273, as well as from various other galactic and extragalactic sites. The radiation processes also range from the well understood, e.g. energetic particle interactions with matter, to the still incompletely researched, such as radiation transfer in optically thick electron positron plasmas in intense neutron star magnetic fields.
Viral Replication Complexes Are Targeted by LC3-Guided Interferon-Inducible GTPases.
Biering, Scott B; Choi, Jayoung; Halstrom, Rachel A; Brown, Hailey M; Beatty, Wandy L; Lee, Sanghyun; McCune, Broc T; Dominici, Erin; Williams, Lelia E; Orchard, Robert C; Wilen, Craig B; Yamamoto, Masahiro; Coers, Jörn; Taylor, Gregory A; Hwang, Seungmin
2017-07-12
All viruses with positive-sense RNA genomes replicate on membranous structures in the cytoplasm called replication complexes (RCs). RCs provide an advantageous microenvironment for viral replication, but it is unknown how the host immune system counteracts these structures. Here we show that interferon-gamma (IFNG) disrupts the RC of murine norovirus (MNV) via evolutionarily conserved autophagy proteins and the induction of IFN-inducible GTPases, which are known to destroy the membrane of vacuoles containing bacteria, protists, or fungi. The MNV RC was marked by the microtubule-associated-protein-1-light-chain-3 (LC3) conjugation system of autophagy and then targeted by immunity-related GTPases (IRGs) and guanylate-binding proteins (GBPs) upon their induction by IFNG. Further, the LC3 conjugation system and the IFN-inducible GTPases were necessary to inhibit MNV replication in mice and human cells. These data suggest that viral RCs can be marked and antagonized by a universal immune defense mechanism targeting diverse pathogens replicating in cytosolic membrane structures. Copyright © 2017 Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Hosseini, S. A.; Zangian, M.; Aghabozorgi, S.
2018-03-01
In the present paper, the light output distribution due to poly-energetic neutron/gamma (neutron or gamma) source was calculated using the developed MCNPX-ESUT-PE (MCNPX-Energy engineering of Sharif University of Technology-Poly Energetic version) computational code. The simulation of light output distribution includes the modeling of the particle transport, the calculation of scintillation photons induced by charged particles, simulation of the scintillation photon transport and considering the light resolution obtained from the experiment. The developed computational code is able to simulate the light output distribution due to any neutron/gamma source. In the experimental step of the present study, the neutron-gamma discrimination based on the light output distribution was performed using the zero crossing method. As a case study, 241Am-9Be source was considered and the simulated and measured neutron/gamma light output distributions were compared. There is an acceptable agreement between the discriminated neutron/gamma light output distributions obtained from the simulation and experiment.
Fan, Y-H; Lin, Y-L; Hwang, Y-C; Yang, H-C; Chiu, H-C; Chiou, S-H; Jong, M-H; Chow, K-C; Lin, C-C
2016-10-01
The effect of co-administration of interferon (IFN)-γ in pigs undergoing vaccination with an attenuated strain (LPC) of classical swine fever virus (CSFV) was investigated. Unvaccinated pigs demonstrated pyrexia and died 7-9 days after challenge with virulent CSFV. Pigs receiving the attenuated vaccine remained healthy after virus challenge, except for mild, transient pyrexia, whereas pigs receiving IFN-γ simultaneously with the vaccine demonstrated normal body temperatures after virus challenge. Examination by nested RT-PCR revealed greater viral load in the spleens of the pigs vaccinated with the attenuated CSFV, compared with those that had additionally received IFN-γ. Expression of major histocompatibility complex (MHC) class I and MHC class II molecules was upregulated in the spleens of the IFN-γ treated vaccinated pigs, demonstrated by immunohistochemistry. Based on Western blot analysis, anti-CSFV IgG2 antibodies were elevated in vaccinated pigs by co-administration of IFN-γ (IFN-γ(Hi): P < 0.01; IFN-γ(Lo): P <0.05). By employing the suppression subtractive hybridization technique, RT-PCR, in situ hybridization, and immunohistochemistry, T-cell factor-4 (Tcf-4) mRNA and protein expression were found to be upregulated in the spleens of vaccinated pigs that had received IFN-γ. This study suggests involvement of Tcf-4 in IFN-γ-mediated immune regulation following CSFV vaccination. Copyright © 2016 Elsevier Ltd. All rights reserved.
Measuring the charged pion polarizability in the gamma gamma -> pi+pi- reaction
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lawrence, David W.; Miskimen, Rory A.; Mushkarenkov, Alexander Nikolaevich
2013-08-01
Development has begun of a new experiment to measure the charged pion polarizabilitymore » $$\\alpha_{\\pi}-\\beta_{\\pi}$$. The charged pion polarizability ranks among the most important tests of low-energy QCD presently unresolved by experiment. Analogous to precision measurements of $$\\pi^{\\circ}\\rightarrow\\gamma\\gamma$$ that test the intrinsic odd-parity (anomalous) sector of QCD, the pion polarizability tests the intrinsic even-parity sector of QCD. The measurement will be performed using the $$\\gamma\\gamma\\rightarrow\\pi^{+{}}\\pi^{-{}}$$ cross section accessed via the Primakoff mechanism on nuclear targets using the GlueX detector in Hall D at Jefferson Lab. The linearly polarized photon source in Hall-D will be utilized to separate the Primakoff cross-section from coherent $$\\rho^{\\circ}$$ production.« less
Future prospects for gamma-ray
NASA Technical Reports Server (NTRS)
Fichtel, C.
1980-01-01
Astrophysical phenomena discussed are: the very energetic and nuclear processes associated with compact objects; astrophysical nucleo-synthesis; solar particle acceleration; the chemical composition of the planets and other bodies of the solar system; the structure of our galaxy; the origin and dynamic pressure effects of the cosmic rays; the high energy particles and energetic processes in other galaxies, especially active ones; and the degree of matter antimater symmetry of the universe. The gamma ray results of GAMMA-I, the gamma ray observatory, the gamma ray burst network, solar polar, and very high energy gamma ray telescopes on the ground provide justification for more sophisticated telescopes.
Nomura, Masaru; Hodgkinson, Suzanne J; Tran, Giang T; Verma, Nirupama D; Robinson, Catherine; Plain, Karren M; Boyd, Rochelle; Hall, Bruce M
2017-06-01
CD4 + T cells that transfer alloantigen-specific transplant tolerance are short lived in culture unless stimulated with specific-donor alloantigen and lymphocyte derived cytokines. Here, we examined if IFN-γ maintained survival of tolerance transferring CD4 + T cells. Alloantigen-specific transplant tolerance was induced in DA rats with heterotopic adult PVG heart allografts by a short course of immunosuppression and these grafts functioned for >100days with no further immunosuppression. In previous studies, we found the CD4 + T cells from tolerant rats that transfer tolerance to an irradiated DA host grafted with a PVG heart, lose their tolerance transferring ability after 3days of culture, either with or without donor alloantigen, and effect rejection of specific-donor grafts. If cultures with specific-donor alloantigen are supplemented by supernatant from ConA activated lymphocytes the tolerance transferring cells survive, suggesting these cells depend on cytokines for their survival. In this study, we found addition of rIFN-γ to MLC with specific-donor alloantigen maintained the capacity of tolerant CD4 + T cells to transfer alloantigen-specific tolerance and their ability to suppress PVG allograft rejection mediated by co-administered naïve CD4 + T cells. IFN-γ suppressed the in vitro proliferation of tolerant CD4 + T cells. Tolerant CD4 + CD25 + T cells did not proliferate in MLC to PVG stimulator cells with no cytokine added, but did when IFN-γ was present. IFN-γ did not alter proliferation of tolerant CD4 + CD25 + T cells to third-party Lewis. Tolerant CD4 + CD25 + T cells' expression of IFN-γ receptor (IFNGR) was maintained in culture when IFN-γ was present. This study suggested that IFN-γ maintained tolerance mediating alloantigen-specific CD4 + CD25 + T cells. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.
Perez-Mendez, V.
1997-01-21
A gamma ray camera is disclosed for detecting rays emanating from a radiation source such as an isotope. The gamma ray camera includes a sensor array formed of a visible light crystal for converting incident gamma rays to a plurality of corresponding visible light photons, and a photosensor array responsive to the visible light photons in order to form an electronic image of the radiation therefrom. The photosensor array is adapted to record an integrated amount of charge proportional to the incident gamma rays closest to it, and includes a transparent metallic layer, photodiode consisting of a p-i-n structure formed on one side of the transparent metallic layer, and comprising an upper p-type layer, an intermediate layer and a lower n-type layer. In the preferred mode, the scintillator crystal is composed essentially of a cesium iodide (CsI) crystal preferably doped with a predetermined amount impurity, and the p-type upper intermediate layers and said n-type layer are essentially composed of hydrogenated amorphous silicon (a-Si:H). The gamma ray camera further includes a collimator interposed between the radiation source and the sensor array, and a readout circuit formed on one side of the photosensor array. 6 figs.
Gamma ray astrophysics to the year 2000. Report of the NASA Gamma Ray Program Working Group
NASA Technical Reports Server (NTRS)
1988-01-01
Important developments in gamma-ray astrophysics up to energies of 100 GeV during the last decade are reviewed. Also, the report seeks to define the major current scientific goals of the field and proposes a vigorous program to pursue them, extending to the year 2000. The goals of gamma-ray astronomy include the study of gamma rays which provide the most direct means of studying many important problems in high energy astrophysics including explosive nucleosynthesis, accelerated particle interactions and sources, and high-energy processes around compact objects. The current research program in gamma-ray astronomy in the U.S. including the space program, balloon program and foreign programs in gamma-ray astronomy is described. The high priority recommendations for future study include an Explorer-class high resolution gamma-ray spectroscopy mission and a Get Away Special cannister (GAS-can) or Scout class multiwavelength experiment for the study of gamma-ray bursts. Continuing programs include an extended Gamma Ray Observatory mission, continuation of the vigorous program of balloon observations of the nearby Supernova 1987A, augmentation of the balloon program to provide for new instruments and rapid scientific results, and continuation of support for theoretical research. Long term recommendations include new space missions using advanced detectors to better study gamma-ray sources, the development of these detectors, continued study for the assembly of large detectors in space, collaboration with the gamma-ray astronomy missions initiated by other countries, and consideration of the Space Station attached payloads for gamma-ray experiments.
The effect of alloying on gamma and gamma prime in nickel-base superalloys
NASA Technical Reports Server (NTRS)
Dreshfield, R. L.; Wallace, J. F.
1972-01-01
An investigation was conducted to determine the compositional limits of gamma and gamma prime phases in nickel-base superalloys. Fifty-one nickel-base alloys were melted under vacuum and heat treated for 4 hours at 1190 C followed by 1008 hours at 850 C. The alloys had the following composition ranges: A1 4.0 to 13 atomic percent, Cr 6.5 to 20.5 percent, Ti 0.25 to 4.75 percent, Mo 0.0 to 6.0 percent, and W 0.0 to 4.0 percent. The residues from the ammonium sulfate electrolytic extraction for the two-phase alloys were analyzed chemically and by X-ray diffraction. The results of the investigation were used to assemble a mathematical model of the gamma-gamma prime region of the Ni-Al-Cr-Ti-Mo-W system. A computer program was written to analyze the model of the phase diagram. Some of these results are also presented graphically. The resulting model is capable of satisfactorily predicting the compositions of conjugate gamma-gamma prime phases in the alloys investigated and twelve of fifteen commercial superalloys studied.
Arsenic enhances the apoptosis induced by interferon gamma: key role of IRF-1.
El Bougrini, J; Pampin, M; Chelbi-Alix, M K
2006-05-15
Interferons (IFNs) and arsenic trioxide (As2O3) are known inhibitors of cell proliferation and have been used in the treatment of certain forms of malignancy. IFNgamma treatment of cells leads to tyrosine phosphorylation of STAT1 followed by dimerization that accumulates in the nucleus. This is followed by DNA binding, activation of target gene transcription, dephosphorylation, and return to the cytoplasm. We have shown earlier that IFNgamma and As2O3 act synergistically in acute promyelocytic leukemia cells to upregulate IRF-1 expression and to induce apoptosis. Here, we show that in the human fibrosarcoma cell line 2fTGH, As2O3 prolongs IFNgamma-induced STAT1 phosphorylation resulting in persistent binding of STAT1 to GAS motif leading to an increase in IRF-1 expression which correlated with both higher anti-proliferative effect and increased apoptosis. These biological responses induced by IFNgamma alone or in combination with As2O3 were abolished when IRF-1 expression was down-regulated by RNA interference, thus demonstrating the key role of IRF-1.
Status of the GAMMA-400 Project
NASA Technical Reports Server (NTRS)
Galper, A. M.; Adriani, O.; Aptekar, R. L.; Arkhangelskaja, I. V.; Arkhangelskiy, A. I.; Boezio, M.; Bonvicini, V.; Boyarchuk, K. A.; Gusakov, Yu. V.; Farber, M. O.;
2013-01-01
The preliminary design of the new space gamma-ray telescope GAMMA-400 for the energy range 100 MeV-3 TeV is presented. The angular resolution of the instrument, 1-2 deg at E(gamma) approximately 100 MeV and approximately 0.01 at E(gamma) greater than 100 GeV, its energy resolution is approximately 1% at E(gamma) greater than 100 GeV, and the proton rejection factor is approximately 10(exp 6) are optimized to address a broad range of science topics, such as search for signatures of dark matter, studies of Galactic and extragalactic gamma-ray sources, Galactic and extragalactic diffuse emission, gamma-ray bursts, as well as high-precision measurements of spectra of cosmic-ray electrons, positrons, and nuclei.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kumagai, T.; Abe, E.; Nakamura, M.
1997-12-31
Microstructural development of an extremely fine {alpha}{sub 2}-Ti{sub 32}Al/{gamma}-TiAl lamellar structure, which was formed by ice water quenching after solution-treatment in a high-temperature {alpha}-Ti phase field for a long period of time, was examined during isothermal treatment. In an as-quenched Ti-48at.%Al alloy, the massively transformed {gamma} ({gamma}{sub m}) and untransformed (meaning massively untransformed) fine {alpha}{sub 2}/{gamma} lamellar regions were observed. Fine {gamma} grains, which were similar to {gamma}{sub m}, were generated both within the fine {alpha}{sub 2}/{gamma} lamellae and at the boundary area between the {gamma}{sub m} and the fine {alpha}{sub 2}/{gamma} lamellar regions by aging at low-temperature (1,173 K)more » for a short time (180s). Further aging (1.8ks) caused the coarsening of these newly generated fine {gamma} grains. On the other hand, the coarsening of the {gamma} grains occurred by a high-temperature (1,323 K) aging treatment even for 180s. Fine {alpha}{sub 2} plates and particles, which were aligned to a particular direction, were observed in the {gamma} grain interiors, indicating that the newly generated {gamma} grains grew at the expense of the fine {alpha}{sub 2}/{gamma} lamellae. It can be considered that the {gamma} grain formation through the fine {alpha}{sub 2}/{gamma} lamellae is closely related to the {alpha}{sub 2}{yields}{gamma} reaction of the {alpha}{sub 2} plates sandwiched by the {gamma} plates, and needs the fast heating rate enough to overcome the {alpha}{sub 2}/{gamma}{yields}{gamma}/{gamma} lamellae reaction.« less
Kállay, Krisztián; Kassa, Csaba; Réti, Marienn; Karászi, Éva; Sinkó, János; Goda, Vera; Stréhn, Anita; Csordás, Katalin; Horváth, Orsolya; Szederjesi, Attila; Tasnády, Szabolcs; Hardi, Apor; Kriván, Gergely
2018-04-01
Viral reactivation is a frequent complication of allogeneic hematopoietic stem cell transplantation especially in children. For refractory cases, rapid virus-specific T-cell therapy would be ideally implemented within a few days. Over the course of a year in our pediatric cohort of 43 allogeneic transplantation, 9 patients fulfilled criteria for virus-specific T-cell therapy. Viral infections were due to cytomegalovirus (CMV) in 3, Epstein-Barr virus (EBV) in 2, and adenovirus (AdV) in 1 case, whereas >1 virus was detected in 3 cases. Viral diseases necessitating a T-cell therapy were CMV pneumonitis and colitis, AdV enteritis and cystitis, and EBV-induced posttransplantation lymphoproliferative disease. Cells were produced by the CliniMACS Prodigy CCS (IFN-gamma) System within 24 hours after mononuclear leukapheresis. Eight patients became completely asymptomatic, whereas 7 also cleared the virus. Six patients are alive without viral illness or sequelae demonstrating viral DNA clearance in peripheral blood with a median follow-up of 535 (350-786) days. One patient with CMV pneumonitis died of respiratory insufficiency. In 2 cases the viral illness improved or cleared, however, the patients died of invasive aspergillosis. No cases of graft-versus-host disease, rejection, organ toxicity, or recurrent infection were noticed. Virus-specific T-cell therapy implemented by the CliniMACS Prodigy CCS (IFN-gamma) System is an automated, fast, safe, and probably effective way to control resistant viral diseases after pediatric hematopoietic stem cell transplantation.
Dichotomy of protective cellular immune responses to human visceral leishmaniasis.
Khalil, E A G; Ayed, N B; Musa, A M; Ibrahim, M E; Mukhtar, M M; Zijlstra, E E; Elhassan, I M; Smith, P G; Kieny, P M; Ghalib, H W; Zicker, F; Modabber, F; Elhassan, A M
2005-05-01
Healing/protective responses in human visceral leishmaniasis (VL) are associated with stimulation/production of Th1 cytokines, such as interferon IFN-gamma, and conversion in the leishmanin skin test (LST). Such responses were studied for 90 days in 44 adult healthy volunteers from VL non-endemic areas, with no past history of VL/cutaneous leishmaniasis (CL) and LST non-reactivity following injection with one of four doses of Alum-precipitated autoclaved Leishmania major (Alum/ALM) +/- bacille Calmette-Guerin (BCG), a VL candidate vaccine. The vaccine was well tolerated with minimal localized side-effects and without an increase in antileishmanial antibodies or interleukin (IL)-5. Five volunteers (5/44; 11.4%) had significant IFN-gamma production by peripheral blood mononuclear cells (PBMCs) in response to Leishmania antigens in their prevaccination samples (P = 0.001) but were LST non-reactive. On day 45, more than half the volunteers (26/44; 59.0%) had significantly high LST indurations (mean 9.2 +/- 2.7 mm) and high IFN-gamma levels (mean 1008 +/- 395; median 1247 pg/ml). Five volunteers had significant L. donovani antigen-induced IFN-gamma production (mean 873 +/- 290; median 902; P = 0.001), but were non-reactive in LST. An additional five volunteers (5/44; 11.4%) had low IFN-gamma levels (mean 110 +/- 124 pg/ml; median 80) and were non-reactive in LST (induration = 00 mm). The remaining eight volunteers had low IFN-gamma levels, but significant LST induration (mean 10 +/- 2.9 mm; median 11). By day 90 the majority of volunteers (27/44; 61.4%) had significant LST induration (mean 10.8 +/- 9.9 mm; P < 0.001), but low levels of L. donovani antigen-induced IFN-gamma (mean 66.0 +/- 62 pg/ml; P > 0.05). Eleven volunteers (11/44; 25%) had significantly high levels of IFN-gamma and LST induration, while five volunteers had low levels of IFN-gamma (<100 pg/ml) and no LST reactivity (00 mm). One volunteer was lost to follow-up. In conclusion, it is hypothesized that
NASA Astrophysics Data System (ADS)
Medley, S. S.; Cecil, F. E.; Cole, D.; Conway, M. A.; Wilkinson, F. J., III
1985-05-01
Nuclear reactions of interest in fusion research often possess a branch yielding prompt emission of gamma radiation in excess of 15 MeV which can be exploited to provide a new fusion reaction diagnostic having applications similar to conventional neutron emission measurements. Conceptual aspects of fusion gamma diagnostics are discussed with emphasis on application to the Tokamak Fusion Test Reactor (TFTR) during deuterium neutral beam heating of D-T and D-3He plasmas. Recent measurements of the D (T, γ)5He, D(3He, γ)5Li, and D(D, γ)4He branching ratios at low center-of-mass energy (30-100 keV) and of the response of a large volume Ne226 detector for gamma detection in high neutron backgrounds are presented. Using a well-shielded Ne226 detector during 20 MW-120 kV deuterium beam heating of a tritium plasma in TFTR, the D(T, γ)5He gamma signal level is estimated to be 3.5×105 cps.
Koizumi, Yusuke; Sakagami, Takuro; Nishiyama, Naoya; Hirai, Jun; Hayashi, Yuta; Asai, Nobuhiro; Yamagishi, Yuka; Kato, Hideo; Hagihara, Mao; Sakanashi, Daisuke; Suematsu, Hiroyuki; Ogawa, Kenji; Mikamo, Hiroshige
2017-10-01
A 67-year-old Japanese female with back pain and severe cachexia visited our hospital. The diagnosis was disseminated Mycobacterium avium complex infection (dMAC) with multiple bone involvement. Anti-mycobacterial chemotherapy was started, but fever persisted and dislocation of cervical vertebrae has made her bedridden. Because anti-interferon (IFN)-γ autoantibody was positive, four doses of rituximab 375 mg/m 2 , every 7 day, were administered. Soon after treatment, progression of osteolytic lesions and wasting has stopped. We proved that rituximab has recovered IFN-γ signaling as shown by IFN-γ-induced STAT1 phosphorylation. It can be a promising option for dMAC cases with anti-IFN-γ autoantibody.
Mossman, K; Nation, P; Macen, J; Garbutt, M; Lucas, A; McFadden, G
1996-01-01
Myxoma virus is a leporipoxvirus of New World rabbits (Sylvilagus sp.) that induces a rapidly lethal infection known as myxomatosis in the European rabbit (Oryctolagus cuniculus). Like all poxviruses, myxoma virus encodes a plethora of proteins to circumvent or inhibit a variety of host antiviral immune mechanisms. M-T7, the most abundantly secreted protein of myxoma virus-infected cells, was originally identified as an interferon-gamma receptor homolog (Upton, Mossman, and McFadden, Science 258, 1369-1372, 1992). Here, we demonstrate that M-T7 is dispensable for virus replication in cultured cells but is a critical virulence factor for virus pathogenesis in European rabbits. Disruption of both copies of the M-T7 gene in myxoma virus was achieved by the deletion of 372 bp of M-T7 coding sequences, replacement with a selectable marker, p7.5Ecogpt, and selection of a recombinant virus (vMyxlac-T7gpt) resistant to mycophenolic acid. vMyxlac-T7gpt expressed no detectable M-T7 protein and infected cells supernatants were devoid of any detectable interferon-gamma binding activities. Immunohistochemical staining with anti-beta-galactosidase and anti-CD43 antibodies demonstrated that in vMyxlac-T7gpt-infected rabbits the loss of M-T7 not only caused a dramatic reduction in disease symptoms and viral dissemination to secondary sites, but also dramatically influenced host leukocyte behavior. Notably, primary lesions in wild-type virus infections were generally underlayed by large masses of inflammatory cells that did not effectively migrate into the dermal sites of viral replication, whereas in vMyxlac-T7gpt infections this apparent block to leukocyte influx was relieved. A second major phenotypic distinction noted for the M-T7 knockout virus was the extensive activation of lymphocytes in secondary immune organs, particularly the spleen and lymph nodes, by Day 4 of the infection. This is in stark contrast to infection by wild-type myxoma virus, which results in relatively
A gamma beam profile imager for ELI-NP Gamma Beam System
NASA Astrophysics Data System (ADS)
Cardarelli, P.; Paternò, G.; Di Domenico, G.; Consoli, E.; Marziani, M.; Andreotti, M.; Evangelisti, F.; Squerzanti, S.; Gambaccini, M.; Albergo, S.; Cappello, G.; Tricomi, A.; Veltri, M.; Adriani, O.; Borgheresi, R.; Graziani, G.; Passaleva, G.; Serban, A.; Starodubtsev, O.; Variola, A.; Palumbo, L.
2018-06-01
The Gamma Beam System of ELI-Nuclear Physics is a high brilliance monochromatic gamma source based on the inverse Compton interaction between an intense high power laser and a bright electron beam with tunable energy. The source, currently being assembled in Magurele (Romania), is designed to provide a beam with tunable average energy ranging from 0.2 to 19.5 MeV, rms energy bandwidth down to 0.5% and flux of about 108 photons/s. The system includes a set of detectors for the diagnostic and complete characterization of the gamma beam. To evaluate the spatial distribution of the beam a gamma beam profile imager is required. For this purpose, a detector based on a scintillator target coupled to a CCD camera was designed and a prototype was tested at INFN-Ferrara laboratories. A set of analytical calculations and Monte Carlo simulations were carried out to optimize the imager design and evaluate the performance expected with ELI-NP gamma beam. In this work the design of the imager is described in detail, as well as the simulation tools used and the results obtained. The simulation parameters were tuned and cross-checked with the experimental measurements carried out on the assembled prototype using the beam from an x-ray tube.
NASA Technical Reports Server (NTRS)
Fishman, Gerald J.
1995-01-01
A history and overview of the observed properties of gamma-ray bursts are presented. The phenomenon of gamma-ray bursts is without precedent in astronomy, having no observed property that would be a direct indicator of their distance and no counterpart object in another wavelength region. Their brief, random appearance only in the gamma-ray region has made their study difficult. The observed time profiles, spectral properties, and durations of gamma-ray bursts cover a wide range. All proposed models for their origin must be considered speculative. It is humbling to think that even after 25 years since their discovery, the distance scale of gamma-ray bursts is still very much debatable.
High energy gamma ray astronomy
NASA Technical Reports Server (NTRS)
Fichtel, Carl E.
1987-01-01
High energy gamma ray astronomy has evolved with the space age. Nonexistent twenty-five years ago, there is now a general sketch of the gamma ray sky which should develop into a detailed picture with the results expected to be forthcoming over the next decade. The galactic plane is the dominant feature of the gamma ray sky, the longitude and latitude distribution being generally correlated with galactic structural features including the spiral arms. Two molecular clouds were already seen. Two of the three strongest gamma ray sources are pulsars. The highly variable X-ray source Cygnus X-3 was seen at one time, but not another in the 100 MeV region, and it was also observed at very high energies. Beyond the Milky Way Galaxy, there is seen a diffuse radiation, whose origin remains uncertain, as well as at least one quasar, 3C 273. Looking to the future, the satellite opportunities for high energy gamma ray astronomy in the near term are the GAMMA-I planned to be launched in late 1987 and the Gamma Ray Observatory, scheduled for launch in 1990. The Gamma Ray Observatory will carry a total of four instruments covering the entire energy range from 30,000 eV to 3 x 10 to the 10th eV with over an order of magnitude increase in sensitivity relative to previous satellite instruments.
Antitumor activity of type I and type III interferons in BNL hepatoma model.
Abushahba, Walid; Balan, Murugabaskar; Castaneda, Ismael; Yuan, Yao; Reuhl, Kenneth; Raveche, Elizabeth; de la Torre, Andrew; Lasfar, Ahmed; Kotenko, Sergei V
2010-07-01
Hepatocellular carcinoma (HCC) occurs most commonly secondary to cirrhosis due to chronic hepatitis C or B virus (HCV/HBV) infections. Type I interferon (IFN-alpha) treatment of chronic HCV/HBV infections reduces the incidence of HCC in cirrhotic patients. However, IFN-alpha toxicity limits its tolerability and efficacy highlighting a need for better therapeutic treatments. A recently discovered type III IFN (IFN-lambda) has been shown to possess antiviral properties against HCV and HBV in vitro. In phase I clinical trials, IFN-lambda treatment did not cause significant adverse reactions. Using a gene therapy approach, we compared the antitumor properties of IFN-alpha and IFN-lambda in a transplantable hepatoma model of HCC. BALB/c mice were inoculated with syngeneic BNL hepatoma cells, or BNL cells expressing IFN-lambda (BNL.IFN-lambda cells) or IFN-alpha (BNL.IFN-alpha cells). Despite the lack of antiproliferative activity of IFNs on BNL cells, both BNL.IFN-lambda and BNL.IFN-alpha cells displayed retarded growth kinetics in vivo. Depletion of NK cells from splenocytes inhibited splenocyte-mediated cytotoxicity, demonstrating that NK cells play a role in IFN-induced antitumor responses. However, isolated NK cells did not respond directly to IFN-lambda. There was also a marked NK cell infiltration in IFN-lambda producing tumors. In addition, IFN-lambda and, to a lesser extent, IFN-alpha enhanced immunocytotoxicity of splenocytes primed with irradiated BNL cells. Splenocyte cytotoxicity against BNL cells was dependent on IL-12 and IFN-gamma, and mediated by dendritic cells. In contrast to NK cells, isolated from spleen CD11c+ and mPDCA+ dendritic cells responded directly to IFN-lambda. The antitumor activities of IFN-lambda against hepatoma, in combination with HCV and HBV antiviral activities warrant further investigation into the clinical use of IFN-lambda to prevent HCC in HCV/HBV-infected cirrhotic patients, as well as to treat liver cancer.
Bandyopadhyay, Sanjay; Allison, William S
2004-07-27
In crystal structures of the bovine F(1)-ATPase (MF(1)), the side chains of gammaMet(23), gammaMet(232), and gammaLeu(77) interact in a cluster. Substitution of the corresponding residues in the alpha(3)beta(3)gamma subcomplex of TF(1) with lysine lowers the ATPase activity to 2.3, 11, and 15%, respectively, of that displayed by wild-type. In contrast, TF(1) subcomplexes containing the gammaM(23)C, gammaM(232)C, and gammaL(77)C substitutions display 36, 36, and 130%, respectively, of the wild-type ATPase activity. The ATPase activity of the gammaM(23)C/gammaM(232)C double mutant subcomplex is 36% that of the wild-type subcomplex before and after cross-linking the introduced cysteines, whereas the ATPase activity of the gammaM(23)C/L(77)C double mutant increased from 50 to 85% that of wild-type after cross-linking the introduced cysteines. Only beta-beta cross-links formed when the alpha(3)(betaE(395)C)(3)gammaM(23)C double mutant was inactivated with CuCl(2). The overall results suggest that the attenuated ATPase of the mutant subcomplexes containing the gammaM(23)K, gammaL(77)K, and gammaM(232)K substitutions is caused by disruption of the cluster of hydrophobic amino acid side chains and that the midregion of the coiled-coil comprised of the amino- and carboxyl-terminal alpha helices of the gamma subunit does not undergo unwinding or major displacement from the side chain of gammaLeu(77) during ATP-driven rotation of the gamma subunit.
Immunity to Trichinella spiralis infection in vitamin A-deficient mice
1992-01-01
Vitamin A-deficient (A-) mice make strikingly poor IgG responses when they are immunized with purified protein antigens. Previously, we showed that A- T cells overproduce interferon gamma (IFN-gamma), which then could inhibit interleukin 4 (IL-4)-stimulated B cell IgG responses. To determine if the altered IFN-gamma regulation pattern and its immunological consequences would extend to a natural infection, we studied mice infected with the parasitic helminth Trichinella spiralis. The course of the infection was similar in A- and A-sufficient (A+) mice. These mice did not differ with respect to newborn larvae/female/hour produced in the intestine, or muscle larvae burden 5 wk postinfection. They also did not differ in the intestinal worm expulsion rate until day 15, when A- mice still harbored parasites, whereas A+ mice had cleared intestinal worms. Vitamin A deficiency reduced both the frequency of B lymphocytes secreting IgG1 antibodies to parasite antigens, and the bone marrow eosinophilia associated with helminth infection. The cytokine secretion patterns in infected mice were consistent with these observations and with previous studies. Mesenteric lymph node cells from infected A- mice secreted significantly more IFN-gamma, and significantly less IL-2, IL-4, and IL- 5 than infected A+ controls. A- splenocytes secreted significantly more IFN-gamma, and equivalent amounts of IL-2, IL-4, and IL-5 compared with A+ controls. Interestingly, CD4-CD8- cells secreted the majority of the IL-4 produced in the spleen. The IL-2, IL-4, and IL-5 steady-state transcript levels correlated with secreted protein levels, but IFN- gamma transcripts did not. Although they secreted more protein, A- cells contained fewer IFN-gamma transcripts than A+ cells. These results suggest two vitamin A-mediated regulation steps in IFN-gamma gene expression: positive regulation of IFN-gamma transcript levels, and negative regulation posttranscriptionally. The essentially unaltered outcome of T
NASA Technical Reports Server (NTRS)
1991-01-01
This photograph shows the Compton Gamma-Ray Observatory (GRO) being deployed by the Remote Manipulator System (RMS) arm aboard the Space Shuttle Atlantis during the STS-37 mission in April 1991. The GRO reentered Earth atmosphere and ended its successful mission in June 2000. For nearly 9 years, the GRO Burst and Transient Source Experiment (BATSE), designed and built by the Marshall Space Flight Center (MSFC), kept an unblinking watch on the universe to alert scientists to the invisible, mysterious gamma-ray bursts that had puzzled them for decades. By studying gamma-rays from objects like black holes, pulsars, quasars, neutron stars, and other exotic objects, scientists could discover clues to the birth, evolution, and death of stars, galaxies, and the universe. The gamma-ray instrument was one of four major science instruments aboard the Compton. It consisted of eight detectors, or modules, located at each corner of the rectangular satellite to simultaneously scan the entire universe for bursts of gamma-rays ranging in duration from fractions of a second to minutes. In January 1999, the instrument, via the Internet, cued a computer-controlled telescope at Las Alamos National Laboratory in Los Alamos, New Mexico, within 20 seconds of registering a burst. With this capability, the gamma-ray experiment came to serve as a gamma-ray burst alert for the Hubble Space Telescope, the Chandra X-Ray Observatory, and major gound-based observatories around the world. Thirty-seven universities, observatories, and NASA centers in 19 states, and 11 more institutions in Europe and Russia, participated in the BATSE science program.
NASA Technical Reports Server (NTRS)
1991-01-01
This photograph shows the Compton Gamma-Ray Observatory being released from the Remote Manipulator System (RMS) arm aboard the Space Shuttle Atlantis during the STS-35 mission in April 1991. The GRO reentered the Earth's atmosphere and ended its successful mission in June 2000. For nearly 9 years, GRO's Burst and Transient Source Experiment (BATSE), designed and built by the Marshall Space Flight Center, kept an unblinking watch on the universe to alert scientist to the invisible, mysterious gamma-ray bursts that had puzzled them for decades. By studying gamma-rays from objects like black holes, pulsars, quasars, neutron stars, and other exotic objects, scientists could discover clues to the birth, evolution, and death of star, galaxies, and the universe. The gamma-ray instrument was one of four major science instruments aboard the Compton. It consisted of eight detectors, or modules, located at each corner of the rectangular satellite to simultaneously scan the entire universe for bursts of gamma-rays ranging in duration from fractions of a second to minutes. In January 1999, the instrument, via the Internet, cued a computer-controlled telescope at Las Alamos National Laboratory in Los Alamos, New Mexico, within 20 seconds of registering a burst. With this capability, the gamma-ray experiment came to serve as a gamma-ray burst alert for the Hubble Space Telescope, the Chandra X-Ray Observatory, and major gound-based observatories around the world. Thirty-seven universities, observatories, and NASA centers in 19 states, and 11 more institutions in Europe and Russia, participated in BATSE's science program.
Gamma Oscillations and Visual Binding
NASA Astrophysics Data System (ADS)
Robinson, Peter A.; Kim, Jong Won
2006-03-01
At the root of visual perception is the mechanism the brain uses to analyze features in a scene and bind related ones together. Experiments show this process is linked to oscillations of brain activity in the 30-100 Hz gamma band. Oscillations at different sites have correlation functions (CFs) that often peak at zero lag, implying simultaneous firing, even when conduction delays are large. CFs are strongest between cells stimulated by related features. Gamma oscillations are studied here by modeling mm-scale patchy interconnections in the visual cortex. Resulting predictions for gamma responses to stimuli account for numerous experimental findings, including why oscillations and zero-lag synchrony are associated, observed connections with feature preferences, the shape of the zero-lag peak, and variations of CFs with attention. Gamma waves are found to obey the Schroedinger equation, opening the possibility of cortical analogs of quantum phenomena. Gamma instabilities are tied to observations of gamma activity linked to seizures and hallucinations.
Space instrumentation for gamma-ray astronomy
NASA Astrophysics Data System (ADS)
Teegarden, B. J.
1999-02-01
The decade of the 1990s has witnessed a renaissance in the field of gamma-ray astronomy. The seminal event was the launch of the Compton Gamma-Ray Observatory (CGRO) in April 1991. There have been a flood of major discoveries from CGRO including breakthroughs in gamma-ray bursts, annihilation radiation, and blazars. The Italian SAX satellite was launched in April 1996. Although not primarily a gamma-ray mission, it has added a new dimension to our understanding of gamma-ray bursts. Along with these new discoveries a firm groundwork has been laid for missions and new technology development that should maintain a healthy and vigorous field throughout most of the next decade. These include the ESA INTEGRAL mission (INTErnational Gamma-Ray Astrophysics Laboratory, to be launched in mid-2001) and the NASA GLAST mission (Gamma-Ray Large Area Space Telescope) with a likely launch in the middle of the next decade. These two missions will extend the observational capabilities well beyond those of CGRO. New technologies (to gamma-ray astronomy), such as cooled germanium detectors, silicon strip detectors, and CdTe detectors are planned for these new missions. Additional promising new technologies such as CdZnTe strip detectors, scintillator fibers, and a gamma-ray lens for future gamma-ray astronomy missions are under development in laboratories around the world.
Kowalewicz-Kulbat, Magdalena; Kaźmierczak, Dominik; Donevski, Stefan; Biet, Franck; Pestel, Joël; Rudnicka, Wiesława
2008-01-01
Mycobacterium bovis bacillus Calmette-Guérin (BCG) is a live vaccine that has been used in routine vaccination against tuberculosis for nearly 80 years. However, its efficacy is controversial. The failure of BCG vaccination may be at least partially explained by the induction of poor or inappropriate host responses. Dendritic cells (DCs) are likely to play a key role in the induction of immune response to mycobacteria by polarizing the reactivity of T lymphocytes toward a Th1 profile, contributing to the generation of protective cellular immunity against mycobacteria. In this study we aimed to investigate the production of Th1 and Th2 cytokines by naive CD4+ T cells to mycobacterial antigen-pulsed DCs in the group of young, healthy BCG vaccinated volunteers. The response of naive helper T cells was compared with the response of total blood lymphocytes. Our present results clearly showed that circulating naive CD45RA+CD4+ lymphocytes from BCG-vaccinated subjects can become effector helper cells producing IFN-gamma and IL-5 under the stimulation by autologous dendritic cells presenting mycobacterial protein antigen-PPD or infected with live M. bovis BCG bacilli.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nefkens, B M; Prakhov, S; Aguar-Bartolom��, P
2014-08-01
A new measurement of the rare, doubly radiative decay eta->pi^0 gamma gamma was conducted with the Crystal Ball and TAPS multiphoton spectrometers together with the photon tagging facility at the Mainz Microtron MAMI. New data on the dependence of the partial decay width, Gamma(eta->pi^0 gamma gamma), on the two-photon invariant mass squared, m^2(gamma gamma), as well as a new, more precise value for the decay width, Gamma(eta->pi^0 gamma gamma) = (0.33+/-0.03_tot) eV, are based on analysis of 1.2 x 10^3 eta->pi^0 gamma gamma decays from a total of 6 x 10^7 eta mesons produced in the gamma p -> etamore » p reaction. The present results for dGamma(eta->pi^0 gamma gamma)/dm^2(gamma gamma) are in good agreement with previous measurements and recent theoretical calculations for this dependence.« less
Cytokine responses in young and old rhesus monkeys: effect of caloric restriction.
Mascarucci, Paolo; Taub, Dennis; Saccani, Simona; Paloma, Marjorie A; Dawson, Harry; Roth, George S; Lane, Mark A; Ingram, Donald K
2002-05-01
Caloric restriction (CR) is the only known intervention demonstrated to retard a great variety of aging processes, extend median and maximum life-span, and decrease the incidence of age-associated diseases in mammals. Paralleling findings from rodent studies, studies in rhesus monkeys (Macaca mulatta) suggest that CR may retard many age-sensitive parameters in primates. A recent study in rhesus monkeys showed age-related dysregulation of cytokine levels. Specifically, age-related increases in interleukin-10 (IL-10) and IL-6 proteins were observed in supernatants from lipopolysaccharide (LPS)-stimulated peripheral blood mononuclear cells (PBMCs), and interferon-gamma (IFN-gamma) protein exhibited an age-related decrease in phytohemagglutinin (PHA)-stimulated PBMCs. To investigate effects of CR on age-related changes in cytokine production, we obtained PBMCs from control and CR rhesus monkeys aged 6-7 and 22-25 years. We evaluated IL-10 and IL-6 protein and gene expression after exposure to LPS and IFN-gamma protein and gene expression after PHA stimulation. The results revealed significantly higher levels of IFN-gamma protein and gene expression in aged monkeys on CR for 2 years compared with controls. No significant CR effects were observed on IL-10 and IL-6 protein levels. IFN-gamma plays an important role in the initial defense mechanism against viral and microbial disease and cancer. Altered regulation of IFN-gamma in old CR rhesus monkeys may be a key factor in reducing cancer incidence and other age-associated diseases.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Antonelli, Alessandro, E-mail: a.antonelli@med.unipi.it; Ferrari, Silvia Martina, E-mail: sm.ferrari@int.med.unipi.it; Frascerra, Silvia, E-mail: lafrasce@gmail.com
2011-07-01
Until now, no data are present about the effect of peroxisome proliferator-activated receptor (PPAR){alpha} activation on the prototype Th1 [chemokine (C-X-C motif) ligand (CXCL)10] (CXCL10) and Th2 [chemokine (C-C motif) ligand 2] (CCL2) chemokines secretion in thyroid cells. The role of PPAR{alpha} and PPAR{gamma} activation on CXCL10 and CCL2 secretion was tested in Graves' disease (GD) and control primary thyrocytes stimulated with interferon (IFN){gamma} and tumor necrosis factor (TNF){alpha}. IFN{gamma} stimulated both CXCL10 and CCL2 secretion in primary GD and control thyrocytes. TNF{alpha} alone stimulated CCL2 secretion, while had no effect on CXCL10. The combination of IFN{gamma} and TNF{alpha} hadmore » a synergistic effect both on CXCL10 and CCL2 chemokines in GD thyrocytes at levels comparable to those of controls. PPAR{alpha} activators inhibited the secretion of both chemokines (stimulated with IFN{gamma} and TNF{alpha}) at a level higher (for CXCL10, about 60-72%) than PPAR{gamma} agonists (about 25-35%), which were confirmed to inhibit CXCL10, but not CCL2. Our data show that CCL2 is modulated by IFN{gamma} and TNF{alpha} in GD and normal thyrocytes. Furthermore we first show that PPAR{alpha} activators inhibit the secretion of CXCL10 and CCL2 in thyrocytes, suggesting that PPAR{alpha} may be involved in the modulation of the immune response in the thyroid.« less
NASA Technical Reports Server (NTRS)
Copeland, Evan
2008-01-01
The activities of Al and Ni were measured using multi-cell Knudsen effusion-cell mass spectrometry (multi-cell KEMS), over the composition range 8-32 at.%Al and temperature range T=1400-1750 K in the Ni-Al-O system. These measurements establish that equilibrium solidification of gamma(sup prime)-Ni3Al-containing alloys occurs by the eutectic reaction, L (+ Al2O3)=gamma + Beta(+ Al2O3), at 1640 +/- 1 K and a liquid composition of 24.8 +/- 0.2 at.%al (at an unknown oxygen content). The {gamma + Beta (+Al2O3} phase field is stable over the temperature range 1633-1640 K, and gamma(sup prime)-Ni3Al forms via the peritectoid, gamma + Beta (+ Al2O3)=gamma(sup prime) (+ Al2O3), at 1633 +/- 1 K. This behavior is consistent with the current Ni-Al phase diagram and a new diagram is proposed. This new Ni-Al phase diagram explains a number of unusual steady-state solidification structures reported previously and provides a much simpler reaction scheme in the vicinity of the gamma(sup prime)-Ni2Al phase field.
Kim, Eun-Ha; Choi, Young-Ki; Kim, Chul-Joong; Sung, Moon-Hee; Poo, Haryoung
2015-10-06
The global outbreak of a novel swine-origin strain of the 2009 H1N1 influenza A virus and the sudden, worldwide increase in oseltamivir-resistant H1N1 influenza A viruses highlight the urgent need for novel antiviral therapy. Here, we investigated the antiviral efficacy of poly-gamma glutamate (γ-PGA), a safe and edible biomaterial that is naturally synthesized by Bacillus subtilis, against A/Puerto Rico/8/1934 (PR8) and A/California/04/2009 (CA04) H1N1 influenza A virus infections in C57BL/6 mice. Intranasal administration of γ-PGA for 5 days post-infection improved survival, increased production of antiviral cytokines including interferon-beta (IFN-β) and interleukin-12 (IL-12), and enhanced activation of natural killer (NK) cells and influenza antigen-specific cytotoxic T lymphocytes (CTL) activity. These results suggest that γ-PGA protects mice against H1N1 influenza A virus by enhancing antiviral immune responses.
DeForge, L E; Billeci, K L; Kramer, S M
2000-11-01
Given the increasing incidence of methicillin resistant Staphylococcus aureus (MRSA) and the recent emergence of MRSA with a reduced susceptibility to vancomycin, alternative approaches to the treatment of infection are of increasing relevance. The purpose of these studies was to evaluate the effect of IFN-gamma on the ability of white blood cells to kill S. aureus and to develop a simpler, higher throughput bacterial killing assay. Using a methicillin sensitive clinical isolate of S. aureus, a clinical isolate of MRSA, and a commercially available strain of MRSA, studies were conducted using a killing assay in which the bacteria were added directly into whole blood. The viability of the bacteria in samples harvested at various time points was then evaluated both by the classic CFU assay and by a new assay using alamarBlue. In the latter method, serially diluted samples and a standard curve containing known concentrations of bacteria were placed on 96-well plates, and alamarBlue was added. Fluorescence readings were taken, and the viability of the bacteria in the samples was calculated using the standard curve. The results of these studies demonstrated that the CFU and alamarBlue methods yielded equivalent detection of bacteria diluted in buffer. For samples incubated in whole blood, however, the alamarBlue method tended to yield lower viabilities than the CFU method due to the emergence of a slower growing subpopulation of S. aureus upon incubation in the blood matrix. A significant increase in bacterial killing was observed upon pretreatment of whole blood for 24 h with 5 or 25 ng/ml IFN-gamma. This increase in killing was detected equivalently by the CFU and alamarBlue methods. In summary, these studies describe a method that allows for the higher throughput analysis of the effects of immunomodulators on bacterial killing.
Jahnke, A; Hirschberger, J; Fischer, C; Brill, T; Köstlin, R; Plank, C; Küchenhoff, H; Krieger, S; Kamenica, K; Schillinger, U
2007-12-01
Despite aggressive pre- or postoperative treatment, feline fibrosarcomas have a high relapse rate. In this study, a new treatment option based on immune stimulation by intra-tumoral delivery of three feline cytokine genes was performed. The objective of this phase-I dose-escalation study was to determine a safe dose for further evaluation in a subsequent phase-II trial. Twenty-five client-owned cats with clinical diagnosis of fibrosarcoma - primary tumours as well as recurrences - entered the study. Four increasing doses of plasmids coding for feIL-2, feIFN-gamma or feGM-CSF, respectively, were previously defined. In groups I, II, III and IV these doses were 15, 50, 150 and 450 microg per plasmid and a corresponding amount of magnetic nanoparticles. Two preoperative intra-tumoral injections of the magnetic DNA solution were followed by magnetofection. A group of four control cats received only surgical treatment. Side effects were registered and graded according to the VCOG-CTCAE scale and correlated to treatment. Statistical analyses included one-way anova, post hoc and Kruskal-Wallis tests. ELISA tests detecting plasma feIFN-gamma and plasma feGM-CSF were performed. One cat out of group IV (450 microg per plasmid) showed adverse events probably related to gene delivery. As these side effects were self-limiting and occurred only in one of eight cats in group IV, this dose was determined to be well tolerable. Altogether six cats developed local recurrences during a 1-year observation period. Four of these cats had been treated with dose IV. Regarding these observations, a subsequent phase-II trial including a representative amount of cats should be tested for the efficacy of dose IV as well as dose III.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Myoung Woo; Kim, Dae Seong; Kim, Hye Ryung
Highlights: Black-Right-Pointing-Pointer Greater than 30 {mu}M ciglitazone induces cell death in glioma cells. Black-Right-Pointing-Pointer Cell death by ciglitazone is independent of PPAR{gamma} in glioma cells. Black-Right-Pointing-Pointer CGZ induces cell death by the loss of MMP via decreased Akt. -- Abstract: Peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) regulates multiple signaling pathways, and its agonists induce apoptosis in various cancer cells. However, their role in cell death is unclear. In this study, the relationship between ciglitazone (CGZ) and PPAR{gamma} in CGZ-induced cell death was examined. At concentrations of greater than 30 {mu}M, CGZ, a synthetic PPAR{gamma} agonist, activated caspase-3 and induced apoptosis inmore » T98G cells. Treatment of T98G cells with less than 30 {mu}M CGZ effectively induced cell death after pretreatment with 30 {mu}M of the PPAR{gamma} antagonist GW9662, although GW9662 alone did not induce cell death. This cell death was also observed when cells were co-treated with CGZ and GW9662, but was not observed when cells were treated with CGZ prior to GW9662. In cells in which PPAR{gamma} was down-regulated cells by siRNA, lower concentrations of CGZ (<30 {mu}M) were sufficient to induce cell death, although higher concentrations of CGZ ( Greater-Than-Or-Slanted-Equal-To 30 {mu}M) were required to induce cell death in control T98G cells, indicating that CGZ effectively induces cell death in T98G cells independently of PPAR{gamma}. Treatment with GW9662 followed by CGZ resulted in a down-regulation of Akt activity and the loss of mitochondrial membrane potential (MMP), which was accompanied by a decrease in Bcl-2 expression and an increase in Bid cleavage. These data suggest that CGZ is capable of inducing apoptotic cell death independently of PPAR{gamma} in glioma cells, by down-regulating Akt activity and inducing MMP collapse.« less
Callister, Steven M; Jobe, Dean A; Stuparic-Stancic, Aleksandra; Miyamasu, Misato; Boyle, Jeff; Dattwyler, Raymond J; Arnaboldi, Paul M
2016-05-15
Current serodiagnostics for Lyme disease lack sensitivity during early disease, and cannot determine treatment response. We evaluated an assay based on QuantiFERON technology utilizing peptide antigens derived from Borrelia burgdorferi to stimulate interferon-gamma (IFN-γ) release as an alternative to serodiagnosis for the laboratory detection of Lyme disease. Blood was obtained from patients with erythema migrans before (n = 29) and 2 months after (n = 27) antibiotic therapy. IFN-γ release was measured by enzyme-linked immunosorbent assay (ELISA) following overnight stimulation of whole blood with the peptide antigens, and compared to the results of standard serological assays (C6, ELISA, and Western blot). IFN-γ release was observed in pretreatment blood of 20 of 29 (69%) patients with Lyme disease. Following antibiotic treatment, IFN-γ was significantly reduced (P = .0002), and was detectable in only 4 of 20 (20%) initially positive patients. By contrast, anti-C6 antibodies were detected in pretreatment sera from 17 of 29 (59%) subjects, whereas only 5 of 29 (17%) patients had positive Western blot seroreactivity. Antibody responses persisted and expanded following treatment. Our findings suggest that measurement of IFN-γ after incubating blood with Borrelia antigens could be useful in the laboratory diagnosis of early Lyme disease. Also, after antibiotic treatment, this response appears to be short lived. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.
Human epidermal langerhans cells express the immunoregulatory enzyme indoleamine 2,3-dioxygenase.
von Bubnoff, Dagmar; Bausinger, Huguette; Matz, Heike; Koch, Susanne; Häcker, Georg; Takikawa, Osamu; Bieber, Thomas; Hanau, Daniel; de la Salle, Henri
2004-08-01
Langerhans cells (LC) are a special subset of dendritic cells integrating cutaneous immunity. The study of LC function is of major interest not only for efforts of vaccine design and immunotherapy but also for gaining an insight into the pathogenesis of immune-mediated cutaneous diseases and neoplasias. Recently, defined antigen-presenting cells were described that express indoleamine 2,3-dioxygenase (IDO) and inhibit T cell proliferation in vitro and in vivo. Here, we show that stimulation with interferon-gamma (IFN-gamma) induces the expression of functionally active IDO in highly purified human epidermal LC. The induction of IDO after stimulation of LC with IFN-gamma seems to follow a defined kinetic with rapid upregulation followed by a downregulation after about 24 h of culture. Accordingly, proliferation of T cells induced by anti-CD3 antibodies was modulated by supernatants of IFN-gamma-activated human epidermal LC. Importantly, downregulation of T cell proliferation by supernatants of 24 h IFN-gamma-activated LC was prevented by inhibition of IDO. These results indicate that LC not only have the capacity to stimulate but also to inhibit T cells, and suggest that LC possess an immunoregulatory function in promoting T cell tolerance by production of IDO.
1994-01-01
Lymphoproliferation, chronic B cell activation resulting in hypergammaglobulinemia, and profound immunodeficiency are prominent features of a retrovirus-induced syndrome designated murine acquired immunodeficiency syndrome (MAIDS). In vivo treatment of infected mice with recombinant interleukin 12 (IL-12) beginning at the time of infection or up to 9 wk after virus inoculation markedly inhibited the development of splenomegaly and lymphadenopathy, as well as B cell activation and Ig secretion. Treatment with IL-12 also had major effects in preventing induction of several immune defects including impaired production of interferon gamma (IFN-gamma) and IL-2 and depressed proliferative responses to various stimuli. The therapeutic effects of IL-12 on the immune system of mice with MAIDS were also associated with reduced expression of the retrovirus that causes this disease (BM5def), with lesser effects on expression of ecotropic MuLV. IL-12 treatment was not effective in IFN-gamma knockout mice or in infected mice treated simultaneously with IL-12 and anti-IFN-gamma. These results demonstrate that induction and progression of MAIDS are antagonized by IL-12 through high-level expression of IFN-gamma and may provide an experimental basis for developing treatments of retrovirus- induced immune disorders with similar immunopathogenic mechanisms. PMID:7964495
Yokota, Shin-ichi; Okabayashi, Tamaki; Yokosawa, Noriko; Fujii, Nobuhiro
2004-01-01
Natural infection with measles virus (MeV) is initiated when the virus reaches epithelial cells in the respiratory tract, oropharynx, or conjunctivae. Human epithelial cells infected with MeV frequently show growth suppression. In this study, we investigated the possible mechanisms for this suppression. The bronchiolar epithelial cell A549 showed growth arrest in G0/G1 following MeV infection or treatment with gamma interferon (IFN-γ). IFN regulatory factor-1 (IRF-1) was upregulated during MeV infection, although A549 did not produce IFN-γ. Cells of the cervical squamous cell line SiHa persistently infected with various strains of MeV displayed slower growth than uninfected SiHa cells, although the growth rates varied depending on the MeV strain. Transfection of antisense-oriented IRF-1 cDNA released the MeV-infected SiHa cells from growth suppression. Although these infected cells did not produce IFN-γ and suppressed IFN-α/β-induced Jak1 phosphorylation, Jak1 was constitutively phosphorylated. The growth rates negatively correlated with levels of both IRF-1 expression and constitutively phosphorylated Jak1. These results indicate that MeV upregulates IRF-1 in a manner that is independent of IFN but dependent on the JAK/STAT pathway. This induction of IRF-1 appears to suppress cell growth, although the extent seems to vary among MeV strains. PMID:15078941
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rogue, Alexandra; Universite de Rennes 1, 35065 Rennes Cedex; Biologie Servier, 45520 Gidy
2011-07-01
Species-differential toxic effects have been described with PPAR{alpha} and PPAR{gamma} agonists between rodent and human liver. PPAR{alpha} agonists (fibrates) are potent hypocholesterolemic agents in humans while they induce peroxisome proliferation and tumors in rodent liver. By contrast, PPAR{gamma} agonists (glitazones) and even dual PPAR{alpha}/{gamma} agonists (glitazars) have caused idiosyncratic hepatic and nonhepatic toxicities in human without evidence of any damage in rodent during preclinical studies. The mechanisms involved in such differences remain largely unknown. Several studies have identified the major target genes of PPAR{alpha} agonists in rodent liver while no comprehensive analysis has been performed on gene expression changes inducedmore » by PPAR{gamma} and dual PPAR{alpha}/{gamma} agonists. Here, we investigated transcriptomes of rat hepatocytes after 24 h treatment with two PPAR{gamma} (troglitazone and rosiglitazone) and two PPAR{alpha}/{gamma} (muraglitazar and tesaglitazar) agonists. Although, hierarchical clustering revealed a gene expression profile characteristic of each PPAR agonist class, only a limited number of genes was specifically deregulated by glitazars. Functional analyses showed that many genes known as PPAR{alpha} targets were also modulated by both PPAR{gamma} and PPAR{alpha}/{gamma} agonists and quantitative differences in gene expression profiles were observed between these two classes. Moreover, most major genes modulated in rat hepatocytes were also found to be deregulated in rat liver after tesaglitazar treatment. Taken altogether, these results support the conclusion that differential toxic effects of PPAR{alpha} and PPAR{gamma} agonists in rodent liver do not result from transcriptional deregulation of major PPAR target genes but rather from qualitative and/or quantitative differential responses of a small subset of genes.« less
Gamma Ray Pulsars: Multiwavelength Observations
NASA Technical Reports Server (NTRS)
Thompson, David J.
2004-01-01
High-energy gamma rays are a valuable tool for studying particle acceleration and radiation in the magnetospheres of energetic pulsars. The seven or more pulsars seen by instruments on the Compton Gamma Ray Observatory (CGRO) show that: the light curves usually have double-peak structures (suggesting a broad cone of emission); gamma rays are frequently the dominant component of the radiated power; and all the spectra show evidence of a high-energy turnover. For all the known gamma-ray pulsars, multiwavelength observations and theoretical models based on such observations offer the prospect of gaining a broad understanding of these rotating neutron stars. The Gamma-ray Large Area Space Telescope (GLAST), now in planning for a launch in 2006, will provide a major advance in sensitivity, energy range, and sky coverage.
Beamer, B A; Negri, C; Yen, C J; Gavrilova, O; Rumberger, J M; Durcan, M J; Yarnall, D P; Hawkins, A L; Griffin, C A; Burns, D K; Roth, J; Reitman, M; Shuldiner, A R
1997-04-28
We determined the chromosomal localization and partial genomic structure of the coding region of the human PPAR gamma gene (hPPAR gamma), a nuclear receptor important for adipocyte differentiation and function. Sequence analysis and long PCR of human genomic DNA with primers that span putative introns revealed that intron positions and sizes of hPPAR gamma are similar to those previously determined for the mouse PPAR gamma gene[13]. Fluorescent in situ hybridization localized hPPAR gamma to chromosome 3, band 3p25. Radiation hybrid mapping with two independent primer pairs was consistent with hPPAR gamma being within 1.5 Mb of marker D3S1263 on 3p25-p24.2. These sequences of the intron/exon junctions of the 6 coding exons shared by hPPAR gamma 1 and hPPAR gamma 2 will facilitate screening for possible mutations. Furthermore, D3S1263 is a suitable polymorphic marker for linkage analysis to evaluate PPAR gamma's potential contribution to genetic susceptibility to obesity, lipoatrophy, insulin resistance, and diabetes.
NASA Technical Reports Server (NTRS)
Whittenberger, J. D.; Wirth, G.
1982-01-01
A simple ternary gamma/gamma-prime-alpha alloy of nominal composition (wt-%) Ni-32Mo-6Al has been directionally solidified at 17 mm/h and tested in creep rupture at 1073, 1173, and 1273 K. A uniform microstructure consisting of square-shaped Mo fibers in a gamma + gamma-prime matrix was found despite some variation in the molybdenum and aluminum concentrations along the growth direction. Although the steady-state creep rate is well described by the normal stress temperature equation, the stress exponent (12) and the activation energy (580 kJ/mol) are high. The rupture behavior is best characterized by the Larson-Miller parameter where the constant equals 20.
Conrady, Christopher D; Halford, William P; Carr, Daniel J J
2011-02-01
The mouse model of genital herpes relies on medoxyprogesterone treatment of female mice to render the vaginal lumen susceptible to inoculation with herpes simplex virus 2 (HSV-2). In the present study, we report that mice deficient in the A1 chain of the type I interferon receptor (CD118(-/-)) are susceptible to HSV-2 in the absence of medroxyprogesterone preconditioning. In the absence of hormone pretreatment, 2,000 PFU of a clinical isolate of HSV-2 was sufficient to establish a productive infection in the vagina of 75% ± 17% and in the spinal cord of 71% ± 14% of CD118(-/-) mice, whereas the same dose of HSV-2 replicated to detectable levels in only 13% ± 13% of vaginal samples and 0% of spinal cord samples from wild-type mice, as determined at day 5 postinfection. The susceptibility to HSV-2 infection in the CD118(-/-) mice was associated with a significant reduction in the infiltration of HSV-specific cytotoxic T lymphocytes into the vaginal tissue, the local production of gamma interferon (IFN-γ), and the expression of T cell-recruiting chemokines CCL5, CXCL9, and CXCL10. Collectively, the results underscore the significant contribution of type I IFNs in resistance to genital HSV-2 infection.
NASA Technical Reports Server (NTRS)
Mackay, R. A.; Ebert, L. J.
1985-01-01
The kinetics of the formation and subsequent development of the directional coarsening of the gamma-prime precipitate in model Ni-Al-Mo-Ta superalloy single crystals are examined during tensile creep under various stress levels at 982 and 1038 C. Special attention is given to the gamma and gamma-prime relation to creep time and strain in order to trace the changing gamma-gamma-prime morphology. Directional coarsening of gamma-prime is found to begin during primary creep and its rate is shown to increase with an increase in temperature or stress level. The length of gamma-prime thickness increased linearly with time up to a plateau reached after the onset of steady state creep. The raft thickness, equal to the gamma-prime size, remained constant at this initial value up through the onset of the tertiary creep. The interlaminar spacing indicates the stability of directionally coarsened structure.
El Azbaoui, S; Alaoui Mrani, N; Sabri, A; Jouhadi, Z; Ailal, F; Bousfiha, A A; Najib, J; El Hafidi, N; Deswarte, C; Schurr, E; Bustamante, J; Boisson-Dupuis, S; Casanova, J-L; Abel, L; El Baghdadi, J
2015-12-01
Tuberculosis spondylodiscitis (TS), or Pott's disease, an extra-pulmonary form of tuberculosis (TB), is rare and difficult to diagnose in children. Some cases of severe TB in children were recently explained by inborn errors of immunity affecting the interleukin-12/interferon-gamma (IL-12/IFN-γ) axis. To analyse clinical data on Moroccan children with TS, and to perform immunological and genetic explorations of the IL-12/IFN-γ axis. We studied nine children with TS diagnosed between 2012 and 2014. We investigated the IL-12/IFN-γ circuit by both whole-blood assays and sequencing of the coding regions of 14 core genes of this pathway. A diagnosis of TS was based on a combination of clinical, biological, histological and radiological data. QuantiFERON(®)-TB Gold In-Tube results were positive in 75% of patients. Whole-blood assays showed normal IL-12 and IFN-γ production in all but one patient, who displayed impaired decreased response to IL-12. No candidate disease-causing mutations were detected in the exonic regions of the 14 genes. TS diagnosis in children remains challenging, and is based largely on imaging. Further investigations of TS in children are required to determine the role of genetic defects in pathways that may or may not be related to the IL-12/IFN-γ axis.
Toscana Virus NSs Protein Inhibits the Induction of Type I Interferon by Interacting with RIG-I
Gori-Savellini, Gianni; Valentini, Melissa
2013-01-01
Toscana virus (TOSV) is a phlebovirus, of the Bunyaviridae family, that is responsible for central nervous system (CNS) injury in humans. Previous data have shown that the TOSV NSs protein is a gamma interferon (IFN-β) antagonist when transiently overexpressed in mammalian cells, inhibiting IRF-3 induction (G. Gori Savellini, F. Weber, C. Terrosi, M. Habjan, B. Martorelli, and M. G. Cusi, J. Gen. Virol. 92:71–79, 2011). In this study, we investigated whether an upstream sensor, which has a role in the signaling cascade leading to the production of type I IFN, was involved. We found a significant decrease in RIG-I protein levels in cells overexpressing TOSV NSs, suggesting that the nonstructural protein interacts with RIG-I and targets it for proteasomal degradation. In fact, the MG-132 proteasome inhibitor was able to restore IFN-β promoter activation in cells expressing NSs, demonstrating the existence of an evasion mechanism based on inhibition of the RIG-I sensor. Furthermore, a C-terminal truncated NSs protein (ΔNSs), although able to interact with RIG-I, did not affect the RIG-I-mediated IFN-β promoter activation, suggesting that the NSs domains responsible for RIG-I-mediated signaling and interaction with RIG-I are mapped on different regions. These results contribute to identify a novel mechanism for bunyaviruses by which TOSV NSs counteracts the early IFN response. PMID:23552410
Toscana virus NSs protein inhibits the induction of type I interferon by interacting with RIG-I.
Gori-Savellini, Gianni; Valentini, Melissa; Cusi, Maria Grazia
2013-06-01
Toscana virus (TOSV) is a phlebovirus, of the Bunyaviridae family, that is responsible for central nervous system (CNS) injury in humans. Previous data have shown that the TOSV NSs protein is a gamma interferon (IFN-β) antagonist when transiently overexpressed in mammalian cells, inhibiting IRF-3 induction (G. Gori Savellini, F. Weber, C. Terrosi, M. Habjan, B. Martorelli, and M. G. Cusi, J. Gen. Virol. 92:71-79, 2011). In this study, we investigated whether an upstream sensor, which has a role in the signaling cascade leading to the production of type I IFN, was involved. We found a significant decrease in RIG-I protein levels in cells overexpressing TOSV NSs, suggesting that the nonstructural protein interacts with RIG-I and targets it for proteasomal degradation. In fact, the MG-132 proteasome inhibitor was able to restore IFN-β promoter activation in cells expressing NSs, demonstrating the existence of an evasion mechanism based on inhibition of the RIG-I sensor. Furthermore, a C-terminal truncated NSs protein (ΔNSs), although able to interact with RIG-I, did not affect the RIG-I-mediated IFN-β promoter activation, suggesting that the NSs domains responsible for RIG-I-mediated signaling and interaction with RIG-I are mapped on different regions. These results contribute to identify a novel mechanism for bunyaviruses by which TOSV NSs counteracts the early IFN response.
Gamma-hadron families and scaling violation
NASA Technical Reports Server (NTRS)
Gaisser, T. K.; Stanev, T.; Wrotniak, J. A.
1985-01-01
For three different interaction models we have simulated gamma-hadron families, including the detector (Pamir emulsion chamber) response. Rates of gamma families, hadrons, and hadron-gamma ratios were compared with experiments.
NASA Astrophysics Data System (ADS)
Wunderer, Cornelia B.; GRI Collaboration
2006-09-01
Observations of the gamma-ray sky reveal the most powerful sources and the most violent events in the Universe. While at lower wavebands the observed emission is generally dominated by thermal processes, the gamma-ray sky provides us with a view on the non-thermal Universe. Here particles are accelerated to extreme relativistic energies by mechanisms which are still poorly understood, and nuclear reactions are synthesizing the basic constituents of our world. Cosmic accelerators and cosmic explosions are the major science themes that are addressed in the gamma-ray regime. With the INTEGRAL observatory, ESA has provided a unique tool to the astronomical community revealing hundreds of sources, new classes of objects, extraordinary views of antimatter annihilation in our Galaxy, and fingerprints of recent nucleosynthesis processes. While INTEGRAL provides the global overview over the soft gamma-ray sky, there is a growing need to perform deeper, more focused investigations of gamma-ray sources. In soft X-rays a comparable step was taken going from the Einstein and the EXOSAT satellites to the Chandra and XMM/Newton observatories. Technological advances in the past years in the domain of gamma-ray focusing using Laue diffraction and multilayer coated mirror techniques have paved the way towards a gamma-ray mission, providing major improvements compared to past missions regarding sensitivity and angular resolution. Such a future Gamma-Ray Imager will allow to study particle acceleration processes and explosion physics in unprecedented detail, providing essential clues on the innermost nature of the most violent and most energetic processes in the Universe.
Kim, Ji-Yeon; Lee, Dong-Hyung; Joo, Jong-Kil; Jin, Jun-O; Wang, Ji-Won; Hong, Young-Seoub; Kwak, Jong-Young; Lee, Kyu-Sup
2009-09-01
Intraperitoneal immuno-inflammatory changes may be associated with the pathogenesis of endometriosis. We evaluated the effects of peritoneal fluid obtained from patients with endometriosis (ePF) on the release of interferon-gamma-induced protein-10 (IP-10/CXCL10) and interleukin-8 (IL-8/CXCL8) by neutrophils, CD4(+) T cells, and monocytes. Neutrophils, CD4(+) T cells, and monocytes were cultured with ePF and the chemokine levels in the supernatants were then measured using enzyme-linked immunosorbent assay. The addition of ePF to cultures of CD4(+) T cells led to a significant increase in the release of IP-10 when compared with control PF without endometriosis (cPF). There was a positive correlation between the levels of IL-8 and IP-10 in ePF (R = 0.89, P = 0.041), but not between the levels of IP-10 and IL-8 released by neutrophils, CD4(+) T cells, and monocytes. The levels of IP-10 in ePF were positively correlated with the release of IP-10 by ePF-treated neutrophils (R = 0.89, P < 0.001), CD4(+) T cells (R = 0.93, P < 0.001), and monocytes (R = 0.70, P = 0.01). Moreover, the addition of ePF significantly enhanced the interferon-gamma-induced release of IP-10 by nuetrophils and CD4(+) T cells. These findings suggest that neutrophils and T cells release differential levels of IP-10 and IL-8 in response to stimulation with ePF, and that these cells are a major source of IP-10 in the PF of endometriosis patients.
The Andromeda galaxy in gamma-rays
NASA Technical Reports Server (NTRS)
Oezel, M. E.; Berkhuijsen, E. M.
1987-01-01
Implications of high-energy gamma-ray observations of the Andromeda galaxy with the next generation of satellites Gamma-1 and GRO are discussed in the context of the origin of cosmic rays and gamma-ray processes. The present estimate of the total gamma-ray flux of this galaxy at energies above 100 MeV is a factor of about three less than previous estimates.
Foster-Chang, Sarah A; Manning, Mary L; Chandler, Laura
2014-11-01
Selection of the most suitable test(s) for detection of Mycobacterium tuberculosis (TB) infection should be based on purpose, setting, effectiveness, and cost. Two tests are available to screen for latent TB: the tuberculin skin test (TST) and the more recent interferon-gamma release assays (IGRAs). Based on the administrative, logistic, and technical ease of use, an IGRA trial was initiated by the occupational health department at an urban Veteran's Administration health care facility for TB screening of new employees. As a result, new employees completing the pre-placement process within the organization's designated 14 days increased from 77% to 97%, new employee clearance to work time decreased from 13.18 to 5.91 days, and new employee TB screening costs were reduced by 40%. The IGRA is an acceptable alternative to the TST and has significant potential to improve the process of pre-placement TB screening. Copyright 2014, SLACK Incorporated.
[Gamma interferon: basics aspects, clinic significance and terapeutic uses].
Mata-Espinosa, Dulce A; Hernández-Pando, Rogelio
2008-01-01
Interferons are a family of pleiotropic cytokines, their name was assigned because of their anti-replicative viral activity. IFNgamma or immune type II interferon does not share receptors with the type I interferon, its structure is different and its gene is located in different chromosome, although its biologic effects are similar. Along of several years of research, it has been found that IFNgamma enhances the transcription of genes involved in immunomodulation, antiviral responses and antitumoral activities. Regarding to the immune system, IFNgamma increases the cytotoxic and phagocytic activity of macrophages and upregulates the expression of major histocompatibility complex (MHC) class I and class II molecules in dendritics cells and other antigen presenting cells. IFNgamma also promotes the development and differentiation of naive CD4+ T lymphocytes to Th1 helper subset. Indeed, this cytokine has a key role in the control of bacterial, micotic, viral and parasitic infections. Depending of the micro-environment, IFNgamma has a dual role as pro or anti inflammatory cytokine. Novel therapeutic strategies are currently being developed with the aim to enhance the immune response or replace IFNgamma gene abnormal expression with beneficial results in humans, being recombinant IFNgamma safe and well tolerated.
LeVert, Francis E.; Cox, Samson A.
1981-01-01
An improved directional gamma radiation detector has a collector sandwiched etween two layers of insulation of varying thicknesses. The collector and insulation layers are contained within an evacuated casing, or emitter, which releases electrons upon exposure to gamma radiation. Delayed electrons and electrons entering the collector at oblique angles are attenuated as they pass through the insulation layers on route to the collector.
IFN-λ suppresses intestinal inflammation by non-translational regulation of neutrophil function.
Broggi, Achille; Tan, Yunhao; Granucci, Francesca; Zanoni, Ivan
2017-10-01
Interferon-λ (IFN-λ) is a central regulator of mucosal immunity; however, its signaling specificity relative to that of type I interferons is poorly defined. IFN-λ can induce antiviral interferon-stimulated genes (ISGs) in epithelia, while the effect of IFN-λ in non-epithelial cells remains unclear. Here we report that neutrophils responded to IFN-λ. We found that in addition to inducing ISG transcription, IFN-λ (but not IFN-β) specifically activated a translation-independent signaling pathway that diminished the production of reactive oxygen species and degranulation in neutrophils. In mice, IFN-λ was elicited by enteric viruses and acted on neutrophils to decrease oxidative stress and intestinal damage. Thus, IFN-λ acted as a unique immunomodulatory agent by modifying transcriptional and non-translational neutrophil responses, which might permit a controlled development of the inflammatory process.
NASA Technical Reports Server (NTRS)
Oegelman, H.; Ayasli, S.; Hacinliyan, A.
1976-01-01
Recent data from the high energy gamma ray experiment have revealed the existence of four pulsars emitting photons above 35 MeV. An attempt is made to explain the gamma ray emission from these pulsars in terms of an electron-photon cascade that develops in the magnetosphere of the pulsar. Although there is very little material above the surface of the pulsar, the very intense magnetic fields correspond to many radiation lengths which cause electrons to emit photons via magnetic bremsstrahlung and these photons to pair produce. The cascade develops until the mean photon energy drops below the pair production threshold which happens to be in the gamma ray range; at this stage the photons break out from the source.