Whole-exome sequencing reveals a rare interferon gamma receptor 1 mutation associated with myasthenia gravis.

PubMed

Qi, Guoyan; Liu, Peng; Gu, Shanshan; Yang, Hongxia; Dong, Huimin; Xue, Yinping

2018-04-01

Our study is aimed to explore the underlying genetic basis of myasthenia gravis. We collected a Chinese pedigree with myasthenia gravis, and whole-exome sequencing was performed on the two affected siblings and their parents. The candidate pathogenic gene was identified by bioinformatics filtering, which was further verified by Sanger sequencing. The homozygous mutation c.G40A (p.V14M) in interferon gamma receptor 1was identified. Moreover, the mutation was also detected in 3 cases of 44 sporadic myasthenia gravis patients. The p.V14M substitution in interferon gamma receptor 1 may affect the signal peptide function and the translocation on cell membrane, which could disrupt the binding of the ligand of interferon gamma and antibody production, contributing to myasthenia gravis susceptibility. We discovered that a rare variant c.G40A in interferon gamma receptor 1 potentially contributes to the myasthenia gravis pathogenesis. Further functional studies are needed to confirm the effect of the interferon gamma receptor 1 on the myasthenia gravis phenotype.

Frequency of indeterminate results from an interferon-gamma release assay among HIV-infected individuals.

PubMed

Oliveira, Sandra Maria do Valle Leone de; Trajman, Anete; Paniago, Anamaria Mello Miranda; Motta-Castro, Ana Rita Coimbra; Ruffino-Netto, Antonio; Maciel, Ethel Leonor Noia; Croda, Julio; Bonecini-Almeida, Maria da Gloria

2017-01-01

To evaluate the frequency of and factors associated with indeterminate interferon-gamma release assay (IGRA) results in people living with HIV/AIDS (PLWHA). We tested 81 PLWHA in the central-west region of Brazil, using the tuberculin skin test and an IGRA. Information on sociodemographic and clinical variables was gathered through the use of questionnaires and from medical records. The association of those variables with indeterminate results was analyzed by calculating the adjusted ORs in a multivariate logistic regression model. Concordance was evaluated by determining the kappa statistic. Among the 81 patients evaluated, the tuberculin skin test results were positive in 18 (22.2%) of the patients, and the IGRA results were positive in 10 (12.3%), with a kappa of 0.62. The IGRA results were indeterminate in 22 (27.1%) of the patients (95% CI: 17.8-38.1%). The odds of obtaining indeterminate results were significantly higher in smokers (adjusted OR = 6.0; 95% CI: 1.4-26.7) and in samples stored for less than 35 days (adjusted OR = 14.0; 95% CI: 3.1-64.2). Patients with advanced immunosuppression (CD4+ T-cell count < 200 cells/mm3) were at a higher risk for indeterminate results (OR adjusted for smoking and inadequate duration of sample storage = 4.7; 95% CI: 0.91-24.0), although the difference was not significant. The high prevalence of indeterminate results can be a major limitation for the routine use of IGRAs in PLWHA. The need to repeat the test increases its costs and should be taken into account in cost-effectiveness studies. The processing of samples can significantly alter the results. Avaliar a frequência de resultados indeterminados de um interferon-gamma release assay (IGRA, ensaio de liberação de interferon-gama) e os fatores relacionados com esses resultados em pessoas vivendo com HIV/AIDS (PVHA). Foram avaliadas 81 PVHA na região Centro-Oeste do Brasil, por meio do teste tuberculínico e de um IGRA. Informações a respeito de vari

Tuberculin Skin Tests versus Interferon-Gamma Release Assays in Tuberculosis Screening among Immigrant Visa Applicants.

PubMed

Chuke, Stella O; Yen, Nguyen Thi Ngoc; Laserson, Kayla F; Phuoc, Nguyen Huu; Trinh, Nguyen An; Nhung, Duong Thi Cam; Mai, Vo Thi Chi; Qui, An Dang; Hai, Hoang Hoa; Loan, Le Thien Huong; Jones, Warren G; Whitworth, William C; Shah, J Jina; Painter, John A; Mazurek, Gerald H; Maloney, Susan A

2014-01-01

Objective. Use of tuberculin skin tests (TSTs) and interferon gamma release assays (IGRAs) as part of tuberculosis (TB) screening among immigrants from high TB-burden countries has not been fully evaluated. Methods. Prevalence of Mycobacterium tuberculosis infection (MTBI) based on TST, or the QuantiFERON-TB Gold test (QFT-G), was determined among immigrant applicants in Vietnam bound for the United States (US); factors associated with test results and discordance were assessed; predictive values of TST and QFT-G for identifying chest radiographs (CXRs) consistent with TB were calculated. Results. Of 1,246 immigrant visa applicants studied, 57.9% were TST positive, 28.3% were QFT-G positive, and test agreement was 59.4%. Increasing age was associated with positive TST results, positive QFT-G results, TST-positive but QFT-G-negative discordance, and abnormal CXRs consistent with TB. Positive predictive values of TST and QFT-G for an abnormal CXR were 25.9% and 25.6%, respectively. Conclusion. The estimated prevalence of MTBI among US-bound visa applicants in Vietnam based on TST was twice that based on QFT-G, and 14 times higher than a TST-based estimate of MTBI prevalence reported for the general US population in 2000. QFT-G was not better than TST at predicting abnormal CXRs consistent with TB.

(PCG) Protein Crystal Growth Gamma-Interferon

NASA Technical Reports Server (NTRS)

1989-01-01

(PCG) Protein Crystal Growth Gamma-Interferon. Stimulates the body's immune system and is used clinically in the treatment of cancer. Potential as an anti-tumor agent against solid tumors as well as leukemia's and lymphomas. It has additional utility as an anti-ineffective agent, including antiviral, anti-bacterial, and anti-parasitic activities. Principal Investigator on STS-26 was Charles Bugg.

[Peptide Ala-Glu-Asp-Gly and interferon gamma: their role in immune response during aging].

PubMed

Lin'kova, N S; Kuznik, B I; Khavinson, V Kh

2012-01-01

The decrease of lymphocyte interferon gamma expression during aging is one of the main mechanisms leading to the immunodeficiency state in the elderly. Cell penetrating geroprotective peptide Ala-Glu-Asp-Gly has the capability to activate the proliferation of lymphocytes in thymus during its aging. The nucleotide sequence which is complementary contacted with peptide Ala-Glu-Asp-Gly was found in promoter region of interferon gamma gene. Thus, the immune protection of this peptide can be explained by its activation of the interferon gamma production in T-cells.

The Role of the Interferon-Gamma-Jak/STAT Pathway in Rheumatoid Arthritis

DTIC Science & Technology

2017-09-01

AWARD NUMBER: W81XWH-16-1-0537 TITLE: The Role of the Interferon-Gamma-Jak/STAT Pathway in Rheumatoid Arthritis PRINCIPAL INVESTIGATOR: Stanley...Sep 2016 - 31 Aug 2017 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER The Role of the Interferon-Gamma-Jak/STAT Pathway in Rheumatoid Arthritis 5b...subsets that likely counteracts IL-2 regulator activity and contribute to the pathogenesis of RA. 15. SUBJECT TERMS Rheumatoid arthritis ; Autoimmunity; T

The role of interferon gamma release assays in the monitoring of response to anti-tuberculosis treatment in children.

PubMed

Shaik, Junaid; Pillay, Manormoney; Jeena, Prakash

2014-09-01

Successful control of childhood TB requires early diagnosis, effective chemotherapy and a method of evaluating the response to therapy. Identification of suitable biomarkers that predict the response to anti-TB therapy may allow the duration of treatment to be shortened. The majority of biomarker studies in paediatric TB have focused on the role of T cell-based interferon-gamma (IFN-γ) release assays (IGRAs) in the diagnosis of either latent or active disease. Little has been published on the role of IGRAs in the monitoring response to therapy in children. We reviewed the available literature to ascertain the value of IGRAs in the monitoring of response to anti-TB therapy in children. We explored the results of the few studies that have investigated the role of IGRAs as markers of response to anti-TB treatment in children. We conclude that the role of IGRAs as surrogate markers appears promising. Robust clinical trials are, however, needed to entrench the value of IGRAs as surrogate biomarkers of response to anti-TB therapy in children. Copyright © 2013 Elsevier Ltd. All rights reserved.

Added value of interferon-gamma release assays in screening for tuberculous infection in the Netherlands.

PubMed

Erkens, C G M; Dinmohamed, A G; Kamphorst, M; Toumanian, S; van Nispen-Dobrescu, R; Alink, M; Oudshoorn, N; Mensen, M; van den Hof, S; Borgdorff, M; Verver, S

2014-04-01

Interferon-gamma release assays (IGRAs) are reported to be more specific for the diagnosis of latent tuberculous infection (LTBI) than the tuberculin skin test (TST). The two-step procedure, TST followed by an IGRA, is reported to be cost-effective in high-income countries, but it requires more financial resources. To assess the added value of IGRA compared to TST alone in the Netherlands. Test results and background data on persons tested with an IGRA were recorded by the Public Municipal Health Services in a web-based database. The number of persons diagnosed with LTBI using different screening algorithms was calculated. In those tested with an IGRA, at least 60% of persons who would have been diagnosed with LTBI based on TST alone had a negative IGRA. Among those with a TST reaction below the cut-off for the diagnosis of LTBI, 13% had a positive IGRA. For 41% of persons tested with an IGRA after TST, the IGRA influenced whether or not an LTBI diagnosis would be made. With the IGRA as reference standard, a high proportion of persons in low-prevalence settings are treated unnecessarily for LTBI if tested with TST alone, while a small proportion eligible for preventive treatment are missed. Incremental costs of the two-step strategy seem to be balanced by the improved targeting of preventive treatment.

Tuberculin Skin Tests versus Interferon-Gamma Release Assays in Tuberculosis Screening among Immigrant Visa Applicants

PubMed Central

Chuke, Stella O.; Yen, Nguyen Thi Ngoc; Laserson, Kayla F.; Phuoc, Nguyen Huu; Trinh, Nguyen An; Nhung, Duong Thi Cam; Mai, Vo Thi Chi; Qui, An Dang; Hai, Hoang Hoa; Loan, Le Thien Huong; Jones, Warren G.; Whitworth, William C.; Shah, J. Jina; Painter, John A.; Mazurek, Gerald H.; Maloney, Susan A.

2014-01-01

Objective. Use of tuberculin skin tests (TSTs) and interferon gamma release assays (IGRAs) as part of tuberculosis (TB) screening among immigrants from high TB-burden countries has not been fully evaluated. Methods. Prevalence of Mycobacterium tuberculosis infection (MTBI) based on TST, or the QuantiFERON-TB Gold test (QFT-G), was determined among immigrant applicants in Vietnam bound for the United States (US); factors associated with test results and discordance were assessed; predictive values of TST and QFT-G for identifying chest radiographs (CXRs) consistent with TB were calculated. Results. Of 1,246 immigrant visa applicants studied, 57.9% were TST positive, 28.3% were QFT-G positive, and test agreement was 59.4%. Increasing age was associated with positive TST results, positive QFT-G results, TST-positive but QFT-G-negative discordance, and abnormal CXRs consistent with TB. Positive predictive values of TST and QFT-G for an abnormal CXR were 25.9% and 25.6%, respectively. Conclusion. The estimated prevalence of MTBI among US-bound visa applicants in Vietnam based on TST was twice that based on QFT-G, and 14 times higher than a TST-based estimate of MTBI prevalence reported for the general US population in 2000. QFT-G was not better than TST at predicting abnormal CXRs consistent with TB. PMID:24738031

The tuberculin skin test increases the responses measured by T cell interferon-gamma release assays.

PubMed

Vilaplana, C; Ruiz-Manzano, J; Gil, O; Cuchillo, F; Montané, E; Singh, M; Spallek, R; Ausina, V; Cardona, P J

2008-06-01

RUTI is a vaccine consisting of Mycobacterium tuberculosis bacilli grown in stress conditions that is fragmented, detoxified and liposomed. RUTI was designed to shorten the treatment of latent tuberculosis infection (LTBI) with isoniazid from 9 months to just 1 month, by additional treatment with two inoculations of RUTI 4 weeks apart. During the validation process for monitoring the immunogenicity of administration of RUTI in a Phase I clinical trial, the question arose whether to introduce the tuberculin skin test (TST) in the screening of non-LTBI volunteers. This study was designed to evaluate the effect of TST on subsequent different T-cell interferon-gamma release assay (TIGRA) responses, using a spectrum of M. tuberculosis-related antigens (ESAT-6, CFP-10, 16 kDa, 19 kDa, MPT64, Ag 85B, 38 kDa, hsp65, PPD and BCG). The results showed an increase in post-TST response even in non-LTBI subjects for most antigens tested, as measured both by whole blood assay (WBA) and ELISPOT. Increased ELISPOT response decreased toward pre-TST levels within 1 month whereas the WBA response did not. Taking into account that there is no definitive correlation between TST and TIGRA tests to diagnose LTBI and the feasibility that TST might alter the immune monitoring included in clinical trials, these data suggest that TST determination should be carefully planned to avoid any interference with TIGRA.

A novel system to diagnose cutaneous adverse drug reactions employing the cellscan--comparison with histamine releasing test and Inf-gamma Releasing Test.

PubMed

Goldberg, Ilan; Gilburd, Boris; Kravitz, Martine Szyper; Kivity, Shmuel; Chaim, Berta Ben; Klein, Tirza; Schiffenbauer, Yael; Trubniykovr, Ela; Brenner, Sarah; Shoenfeld, Yehuda

2005-03-01

There are several mechanisms to describe allergic drug reactions yet the methods to diagnose them are limited. To compare several conventional clinical and laboratory methods to diagnose skin reactions to drugs to a new method of diagnosing drug reactions by the CellScan system. The study entailed 21 patients who were diagnosed as suffering from drug eruptions, and 105 healthy controls with no history of drug allergy. The drugs were classified into two groups according to suspicion of causing drug allergy: high and low. Most of the patients were on more than one drug, leading to 41 patient-drug interactions (assays). Histamine releasing test (HRT), interferon (INF)-gamma releasing test and CellScan examination were performed on lymphocytes of the patients and controls. The HRTwas interpreted as positive in 9 out of 18 (50%) patients and in 13 out of 35 (37%) assays. Based on the INF-gamma releasing test, positive results were observed in 16 out of 21 (76%) patients and in 24 out of 41 (59%) assays. In the CellScan test (CST), positive results were observed in 17 out of 21 (81%) patients and in 29 out of 41 (71%) assays. The rate of identifying the drug for eruption in the high suspicion level drugs was 9 out of 22 (41%) assays in the HRT, 20 out of 24 (83%) assays in the INF-gamma releasing test, and 21 out of 24 (87%) studies with the CellScan method. The rate of determining of the drug that caused the eruption in the low suspicion level drugs was 4 out of 13 (31 %) in the HRT, 4 out of 17 (24%) assays in the INF-gamma releasing test, and 8 out of 17 (47%) analyses in the CST. When examined in the CellScan, 99 out of 105 (94%) controls were interpreted as negative. This preliminary study indicates that the CellScan seems to be an easy and promising method for the detection of drugs responsible for adverse skin reactions. In contrast to the HRT and to the Interferon-gamma secretion test, the CellScan method is characterized by its ability to track and monitor the

Interferon-Gamma Promotes UV-Induced Melanoma in Mice | Center for Cancer Research

Cancer.gov

Scientists have made an unanticipated discovery in mice that interferon-gamma, a type of protein primarily used by the immune system for intercellular communication, acts as a promoter for the deadly form of skin cancer known as melanoma. This finding resulted from a series of experiments designed to understand how solar ultraviolet (UV) radiation causes melanoma. This study suggests that interferon-gamma, which has been thought to contribute to an innate defense system against cancer, under some circumstances, may instead promote melanoma and incite the development of tumors.

Effect of gamma interferon on resolution of murine chlamydial genital infection.

PubMed Central

Rank, R G; Ramsey, K H; Pack, E A; Williams, D M

1992-01-01

Mice infected in the genital tract with the Chlamydia trachomatis agent of mouse pneumonitis were treated with monoclonal rat anti-gamma interferon (anti-IFN-gamma) antibody to determine whether IFN-gamma participated in the resolution of the infection. In two experiments, anti-IFN-gamma antibody treatment resulted in significantly prolonged infections. In support of these data, passive administration of recombinant IFN-gamma to chronically infected nu/nu mice was able to bring about resolution of the infection in some animals. PMID:1398955

Review of the recombinant human interferon gamma as an immunotherapeutic: Impacts of production platforms and glycosylation.

PubMed

Razaghi, Ali; Owens, Leigh; Heimann, Kirsten

2016-12-20

Human interferon gamma is a cytokine belonging to a diverse group of interferons which have a crucial immunological function against mycobacteria and a wide variety of viral infections. To date, it has been approved for treatment of chronic granulomatous disease and malignant osteopetrosis, and its application as an immunotherapeutic agent against cancer is an increasing prospect. Recombinant human interferon gamma, as a lucrative biopharmaceutical, has been engineered in different expression systems including prokaryotic, protozoan, fungal (yeasts), plant, insect and mammalian cells. Human interferon gamma is commonly expressed in Escherichia coli, marketed as ACTIMMUNE ® , however, the resulting product of the prokaryotic expression system is unglycosylated with a short half-life in the bloodstream; the purification process is tedious and makes the product costlier. Other expression systems also did not show satisfactory results in terms of yields, the biological activity of the protein or economic viability. Thus, the review aims to synthesise available information from previous studies on the production of human interferon gamma and its glycosylation patterns in different expression systems, to provide direction to future research in this field. Copyright © 2016 Elsevier B.V. All rights reserved.

Recent considerations in the use of recombinant interferon gamma for biological therapy of atopic dermatitis.

PubMed

Brar, Kanwaljit; Leung, Donald Y M

2016-01-01

Atopic dermatitis (AD) is the most common inflammatory skin disease in the general population. There are different endophenotypes of AD that likely have a unique immune and molecular basis, such as those who are predisposed to eczema herpeticum, or Staphylococcus aureus infections. In this review, we highlight the endophenotypes of AD where reduced interferon gamma expression may be playing a role. Additionally, we review the potential role of recombinant interferon gamma therapy in the treatment of atopic dermatitis and the particular phenotypes that may benefit from this treatment. Recombinant interferon gamma treatment will likely benefit the pediatric population with AD, as well as those with susceptibilities for skin infections. Future studies are needed to elucidate whether IFN-γ may reduce the prevalence of skin infection in AD.

Tuberculosis screening of new hospital employees: compliance, clearance to work time, and cost using tuberculin skin test and interferon-gamma release assays.

PubMed

Foster-Chang, Sarah A; Manning, Mary L; Chandler, Laura

2014-11-01

Selection of the most suitable test(s) for detection of Mycobacterium tuberculosis (TB) infection should be based on purpose, setting, effectiveness, and cost. Two tests are available to screen for latent TB: the tuberculin skin test (TST) and the more recent interferon-gamma release assays (IGRAs). Based on the administrative, logistic, and technical ease of use, an IGRA trial was initiated by the occupational health department at an urban Veteran's Administration health care facility for TB screening of new employees. As a result, new employees completing the pre-placement process within the organization's designated 14 days increased from 77% to 97%, new employee clearance to work time decreased from 13.18 to 5.91 days, and new employee TB screening costs were reduced by 40%. The IGRA is an acceptable alternative to the TST and has significant potential to improve the process of pre-placement TB screening. Copyright 2014, SLACK Incorporated.

[Effectiveness of interferon-gamma release assays in the tuberculosis contact investigation of elderly people].

PubMed

Seto, Junji; Ahiko, Tadayuki

2014-04-01

To confirm the effectiveness of interferon-gamma release assays (IGRAs) in the tuberculosis (TB) contact investigation of elderly people, we analyzed the results of the QuantiFERON TB Gold in tube (QFT-3G) test, which is a commercially available IGRA. We analyzed the results of the QFT-3G test in 2,420 subjects who were in close contact with TB patients. We investigated subjects with latent TB infection and those showing the onset of TB among the QFT-3G-positive subjects. The QFT-3G-positive rate was 7.3% (95% confidence interval, 6.2%-8.3%). In addition, we demonstrated that the QFT-3G-positive rate increased with age (P < 0.001). The QFT-3G-positive rate was high, particularly in elderly people (> or = 60 years), but the rate was significantly lower than the predicted prevalence of TB infection. Therefore, it was assumed that the QFT-3G test does not always provide a positive result, even in cases of subjects with a previous TB infection. Furthermore, data from the QFT-3G-positive subjects indicated that approximately one half of subjects aged 60-69 years, approximately one-third of those aged 70-79 years, and approximately one-quarter of those aged over 80 years have had recent TB infections. In conclusion, the results of the QFT-3G test in elderly people need to be carefully evaluated according to the contact situation with TB patients; nevertheless, the QFT-3G test is useful for the screening of latent TB infection in elderly people who were in close contact with TB patients.

Evaluation of gamma interferon (IFN-gamma)-induced protein 10 (IP-10) responses for detection of cattle infected with Mycobacterium bovis: comparisons to IFN-gamma responses

USDA-ARS?s Scientific Manuscript database

Gamma interferon (IFN-gamma)-induced protein 10 (IP-10) has recently shown promise as a diagnostic biomarker of Mycobacterium tuberculosis infection of humans. The aim of the current study was to compare IP-10 and IFN-gamma responses upon Mycobacterium bovis infection in cattle using archived sample...

Frequency of indeterminate results from an interferon-gamma release assay among HIV-infected individuals

PubMed Central

de Oliveira, Sandra Maria do Valle Leone; Trajman, Anete; Paniago, Anamaria Mello Miranda; Motta-Castro, Ana Rita Coimbra; Ruffino-Netto, Antonio; Maciel, Ethel Leonor Noia; Croda, Julio; Bonecini-Almeida, Maria da Gloria

2017-01-01

ABSTRACT Objective: To evaluate the frequency of and factors associated with indeterminate interferon-gamma release assay (IGRA) results in people living with HIV/AIDS (PLWHA). Methods: We tested 81 PLWHA in the central-west region of Brazil, using the tuberculin skin test and an IGRA. Information on sociodemographic and clinical variables was gathered through the use of questionnaires and from medical records. The association of those variables with indeterminate results was analyzed by calculating the adjusted ORs in a multivariate logistic regression model. Concordance was evaluated by determining the kappa statistic. Results: Among the 81 patients evaluated, the tuberculin skin test results were positive in 18 (22.2%) of the patients, and the IGRA results were positive in 10 (12.3%), with a kappa of 0.62. The IGRA results were indeterminate in 22 (27.1%) of the patients (95% CI: 17.8-38.1%). The odds of obtaining indeterminate results were significantly higher in smokers (adjusted OR = 6.0; 95% CI: 1.4-26.7) and in samples stored for less than 35 days (adjusted OR = 14.0; 95% CI: 3.1-64.2). Patients with advanced immunosuppression (CD4+ T-cell count < 200 cells/mm3) were at a higher risk for indeterminate results (OR adjusted for smoking and inadequate duration of sample storage = 4.7; 95% CI: 0.91-24.0), although the difference was not significant. Conclusions: The high prevalence of indeterminate results can be a major limitation for the routine use of IGRAs in PLWHA. The need to repeat the test increases its costs and should be taken into account in cost-effectiveness studies. The processing of samples can significantly alter the results. PMID:28746533

Inhibited interferon-gamma but normal interleukin-3 production from rats flown on the Space Shuttle

NASA Technical Reports Server (NTRS)

Gould, Cheryl L.; Lyte, Mark; Williams, Joann; Mandel, Adrian D.; Sonnenfeld, Gerald

1987-01-01

Rats were flown on Space Shuttle SL-3 for one week. When spleen cells were removed from these rats and challenged with concanavalin-A, interferon-gamma production was severely inhibited, while interleukin-3 production was unaffected compared to ground-based control rats. These data indicate that there is a defect in interferon-gamma production in rats that have been exposed to spaceflight. This defect could contribute to, and be one reason for, immunosuppression observed after spaceflight.

Interferon Gamma as a Biomarker of Exposure to Enteric Viruses

EPA Science Inventory

Interferon gamma (IFN-γ) was selected as a biomarker for viral exposure. Twelve-week-old BALB/c mice were intraperitoneally injected with Coxsackievirus B3 or B4 diluted in phosphate-buffered saline (PBS). Control mice were injected with PBS only. Four months after viral infectio...

Plasmodium falciparum erythrocyte membrane protein-1 specifically suppresses early production of host interferon-gamma.

PubMed

D'Ombrain, Marthe C; Voss, Till S; Maier, Alexander G; Pearce, J Andrew; Hansen, Diana S; Cowman, Alan F; Schofield, Louis

2007-08-16

Plasmodium falciparum erythrocyte membrane protein-1 (PfEMP-1) is a variable antigen expressed by P. falciparum, the malarial parasite. PfEMP-1, present on the surface of infected host erythrocytes, mediates erythrocyte binding to vascular endothelium, enabling the parasite to avoid splenic clearance. In addition, PfEMP-1 is proposed to regulate host immune responses via interactions with the CD36 receptor on antigen-presenting cells. We investigated the immunoregulatory function of PfEMP-1 by comparing host cell responses to erythrocytes infected with either wild-type parasites or transgenic parasites lacking PfEMP-1. We showed that PfEMP-1 suppresses the production of the cytokine interferon-gamma by human peripheral blood mononuclear cells early after exposure to P. falciparum. Suppression of this rapid proinflammatory response was CD36 independent and specific to interferon-gamma production by gammadelta-T, NK, and alphabeta-T cells. These data demonstrate a parasite strategy for downregulating the proinflammatory interferon-gamma response and further establish transgenic parasites lacking PfEMP-1 as powerful tools for elucidating PfEMP-1 functions.

Anti-interferon-gamma antibodies in the treatment of autoimmune diseases.

PubMed

Skurkovich, Boris; Skurkovich, Simon

2003-02-01

Interferon (IFN)-gamma is an important immune regulator in normal immunity. When IFN gamma production is disturbed, various autoimmune diseases (ADs) can develop, in which we suggest that anti-IFN gamma could have a beneficial effect. Depending on the cell type in which IFN gamma synthesis is disturbed, different clinical manifestations may result. We have also proposed to remove tumor necrosis factor (TNF)-alpha, together with certain types of IFNs, to treat various ADs and AIDS, also an autoimmune condition. Anti-IFN gamma has been tested in several T-helper cell (Th1) ADs, including rheumatoid arthritis (RA), multiple sclerosis (MS), corneal transplant rejection, uveitis, Type I diabetes, schizophrenia (anti-IFN gamma and anti-TNF alpha), and various autoimmune skin diseases (alopecia areata, psoriasis vulgaris, vitiligo, pemphigus vulgaris and epidermolysis bullosa). A strong, sometimes striking, therapeutic response followed administration of anti-IFN gamma, indicating that it may be a promising therapy for Th1 ADs.

Interferon-γ Inhibits Ebola Virus Infection.

PubMed

Rhein, Bethany A; Powers, Linda S; Rogers, Kai; Anantpadma, Manu; Singh, Brajesh K; Sakurai, Yasuteru; Bair, Thomas; Miller-Hunt, Catherine; Sinn, Patrick; Davey, Robert A; Monick, Martha M; Maury, Wendy

2015-01-01

Ebola virus outbreaks, such as the 2014 Makona epidemic in West Africa, are episodic and deadly. Filovirus antivirals are currently not clinically available. Our findings suggest interferon gamma, an FDA-approved drug, may serve as a novel and effective prophylactic or treatment option. Using mouse-adapted Ebola virus, we found that murine interferon gamma administered 24 hours before or after infection robustly protects lethally-challenged mice and reduces morbidity and serum viral titers. Furthermore, we demonstrated that interferon gamma profoundly inhibits Ebola virus infection of macrophages, an early cellular target of infection. As early as six hours following in vitro infection, Ebola virus RNA levels in interferon gamma-treated macrophages were lower than in infected, untreated cells. Addition of the protein synthesis inhibitor, cycloheximide, to interferon gamma-treated macrophages did not further reduce viral RNA levels, suggesting that interferon gamma blocks life cycle events that require protein synthesis such as virus replication. Microarray studies with interferon gamma-treated human macrophages identified more than 160 interferon-stimulated genes. Ectopic expression of a select group of these genes inhibited Ebola virus infection. These studies provide new potential avenues for antiviral targeting as these genes that have not previously appreciated to inhibit negative strand RNA viruses and specifically Ebola virus infection. As treatment of interferon gamma robustly protects mice from lethal Ebola virus infection, we propose that interferon gamma should be further evaluated for its efficacy as a prophylactic and/or therapeutic strategy against filoviruses. Use of this FDA-approved drug could rapidly be deployed during future outbreaks.

Private sector tuberculosis prevention in the US: Characteristics associated with interferon-gamma release assay or tuberculin skin testing.

PubMed

Stockbridge, Erica L; Miller, Thaddeus L; Carlson, Erin K; Ho, Christine

2018-01-01

To determine whether latent tuberculosis infection risk factors are associated with an increased likelihood of latent tuberculosis infection testing in the US private healthcare sector. A national sample of medical and pharmacy claims representing services rendered January 2011 through December 2013 for 3,997,986 commercially insured individuals in the US who were 0 to 64 years of age. We used multivariable logistic regression models to determine whether TB/LTBI risk factors were associated with an increased likelihood of Interferon-Gamma Release Assay (IGRA) or Tuberculin Skin Test (TST) testing in the private sector. 4.31% (4.27-4.34%) received at least one TST/IGRA test between 2011 and 2013 while 1.69% (1.67-1.72%) received a TST/IGRA test in 2013. Clinical risk factors associated with a significantly increased likelihood of testing included HIV, immunosuppressive therapy, exposure to tuberculosis, a history of tuberculosis, diabetes, tobacco use, end stage renal disease, and alcohol use disorder. Other significant variables included gender, age, asthma, the state tuberculosis rate, population density, and percent of foreign-born persons in a county. Private sector TST/IGRA testing is not uncommon and testing varies with clinical risk indicators. Thus, the private sector can be a powerful resource in the fight against tuberculosis. Analyses of administrative data can inform how best to leverage private sector healthcare toward tuberculosis prevention activities.

The immunomodulatory effects of interferon-gamma on mature B-lymphocyte responses.

PubMed

Jurado, A; Carballido, J; Griffel, H; Hochkeppel, H K; Wetzel, G D

1989-06-15

Interferon-gamma (IFN-gamma) exerts a broad spectrum of activities which affect the responses of mature B-cells. It strongly inhibits B-cell activation, acts as a B-cell growth factor (BCGF), and also induces final differentiation to immunoglobulin (Ig) production. IFN-gamma is deeply involved in the differential control of isotype expression, as it enhances IgG2a production and suppresses both IgG1 and IgE production. Although it is now possible to draw a general scheme of the effects of IFN-gamma on B-cells, a number of paradoxical results still exist in the field. In this manuscript, different experimental systems are analyzed in an attempt to explain these apparent paradoxes.

Effects of chicken interferon Gamma on Newcastle disease virus vaccine immunogenicity

USDA-ARS?s Scientific Manuscript database

More effective vaccines are needed to control avian diseases. The use of chicken interferon gamma (chIFN') during vaccination is a potentially important but controversial approach that may improve the immune response to antigens. In the present study, three different systems to co-deliver chIFN' wit...

Increase in neutrophil Fc gamma receptor I expression following interferon gamma treatment in rheumatoid arthritis.

PubMed Central

Goulding, N J; Knight, S M; Godolphin, J L; Guyre, P M

1992-01-01

The therapeutic potential of interferon gamma (IFN gamma) in a number of disease states is still being explored, but progress is hampered by the lack of a suitable measure of in vivo biological activity. To assess the in vivo biological effects of recombinant human IFN gamma (rhIFN gamma), 14 patients were studied in a randomised, prospective, double blind, placebo controlled trial of this cytokine for the treatment of rheumatoid arthritis. The levels of Fc gamma receptors on peripheral blood neutrophils were measured at baseline and after 21 days of once daily, subcutaneous injections of rhIFN gamma or placebo. An induction of neutrophil Fc gamma receptor type I (Fc gamma RI) was seen in the group of patients receiving recombinant human rhIFN gamma but not in those receiving placebo. No change in the expression of Fc gamma RII or Fc gamma RIII was detected. The amount of induction of Fc gamma RI detected on the neutrophils of patients receiving rhIFN gamma did not correlate with clinical measures of response at either 21 days or at the end of the study (24 weeks). No significant clinical responses were observed in the rhIFN gamma group at these times. These data confirm that the reported in vitro effect of IFN gamma on human neutrophil Fc receptor expression can be reproduced in vivo. PMID:1534001

Increase in neutrophil Fc gamma receptor I expression following interferon gamma treatment in rheumatoid arthritis.

PubMed

Goulding, N J; Knight, S M; Godolphin, J L; Guyre, P M

1992-04-01

The therapeutic potential of interferon gamma (IFN gamma) in a number of disease states is still being explored, but progress is hampered by the lack of a suitable measure of in vivo biological activity. To assess the in vivo biological effects of recombinant human IFN gamma (rhIFN gamma), 14 patients were studied in a randomised, prospective, double blind, placebo controlled trial of this cytokine for the treatment of rheumatoid arthritis. The levels of Fc gamma receptors on peripheral blood neutrophils were measured at baseline and after 21 days of once daily, subcutaneous injections of rhIFN gamma or placebo. An induction of neutrophil Fc gamma receptor type I (Fc gamma RI) was seen in the group of patients receiving recombinant human rhIFN gamma but not in those receiving placebo. No change in the expression of Fc gamma RII or Fc gamma RIII was detected. The amount of induction of Fc gamma RI detected on the neutrophils of patients receiving rhIFN gamma did not correlate with clinical measures of response at either 21 days or at the end of the study (24 weeks). No significant clinical responses were observed in the rhIFN gamma group at these times. These data confirm that the reported in vitro effect of IFN gamma on human neutrophil Fc receptor expression can be reproduced in vivo.

Structural analysis and localization of the carbohydrate moieties of a soluble human interferon gamma receptor produced in baculovirus-infected insect cells.

PubMed Central

Manneberg, M.; Friedlein, A.; Kurth, H.; Lahm, H. W.; Fountoulakis, M.

1994-01-01

A soluble form of the human interferon gamma receptor that is required for the identification of interferon gamma antagonists was expressed in baculovirus-infected insect cells. The protein carried N-linked carbohydrate and showed a heterogeneity on denaturing polyacrylamide gels. We investigated the utilization of the potential sites for N-linked glycosylation and the structure of the carbohydrate moieties of this soluble receptor. Amino acid sequence analysis and ion spray mass spectrometry revealed that of the five potential sites for N-linked glycosylation, Asn17 and Asn69 were always utilized, whereas Asn62 and Asn162 were utilized in approximately one-third of the protein population. Asn223 was never found to be glycosylated. The soluble receptor was treated with N-glycosidase F and the oligosaccharides released were analyzed by matrix-assisted laser desorption mass spectrometry, which showed that the protein carried six types of short carbohydrate chains. The predominant species was a hexasaccharide of molecular mass 1,039, containing a fucose subunit linked to the proximal N-acetylglucosamine residue: [formula: see text] PMID:8142896

Electrochemical impedance spectroscopy based-on interferon-gamma detection

NASA Astrophysics Data System (ADS)

Li, Guan-Wei; Kuo, Yi-Ching; Tsai, Pei-I.; Lee, Chih-Kung

2014-03-01

Tuberculosis (TB) is an ancient disease constituted a long-term menace to public health. According to World Health Organization (WHO), mycobacterium tuberculosis (MTB) infected nearly a third of people of the world. There is about one new TB occurrence every second. Interferon-gamma (IFN-γ) is associated with susceptibility to TB, and interferongamma release assays (IGRA) is considered to be the best alternative of tuberculin skin test (TST) for diagnosis of latent tuberculosis infection (LTBI). Although significant progress has been made with regard to the design of enzyme immunoassays for IFN-γ, adopting this assay is still labor-intensive and time-consuming. To alleviate these drawbacks, we used IFN-γ antibody to facilitate the detection of IFN-γ. An experimental verification on the performance of IGRA was done in this research. We developed two biosensor configurations, both of which possess high sensitivity, specificity, and rapid IFN-γ diagnoses. The first is the electrochemical method. The second is a circular polarization interferometry configuration, which incorporates two light beams with p-polarization and s-polarization states individually along a common path, a four photo-detector quadrature configuration to arrive at a phase modulated ellipsometer. With these two methods, interaction between IFN-γ antibody and IFN-γ were explored and presented in detail.

Transforming growth factor-beta controls T helper type 1 cell development through regulation of natural killer cell interferon-gamma.

PubMed

Laouar, Yasmina; Sutterwala, Fayyaz S; Gorelik, Leonid; Flavell, Richard A

2005-06-01

Interferon-gamma and interleukin 12 produced by the innate arm of the immune system are important regulators of T helper type 1 (T(H)1) cell development, but signals that negatively regulate their expression remain controversial. Here we show that transforming growth factor-beta (TGF-beta) controlled T(H)1 differentiation through the regulation of interferon-gamma produced by natural killer (NK) cells. Blockade of TGF-beta signaling in NK cells caused the accumulation of a large pool of NK cells secreting copious interferon-gamma, responsible for T(H)1 differentiation and protection from leishmania infection. In contrast, blockade of TGF-beta signaling in dendritic cells did not affect dendritic cell homeostasis or interleukin 12 production, thus indicating a previously undescribed demarcation of the function of TGF-beta in NK cells versus dendritic cells.

Interferon-gamma inhibits intestinal restitution by preventing gap junction communication between enterocytes.

PubMed

Leaphart, Cynthia L; Qureshi, Faisal; Cetin, Selma; Li, Jun; Dubowski, Theresa; Baty, Catherine; Batey, Catherine; Beer-Stolz, Donna; Guo, Fengli; Murray, Sandra A; Hackam, David J

2007-06-01

Necrotizing enterocolitis (NEC) is characterized by interferon-gamma (IFN-gamma) release and inadequate intestinal restitution. Because enterocytes migrate together, mucosal healing may require interenterocyte communication via connexin 43-mediated gap junctions. We hypothesize that enterocyte migration requires interenterocyte communication, that IFN impairs migration by impairing connexin 43, and that impaired healing during NEC is associated with reduced gap junctions. NEC was induced in Swiss-Webster or IFN(-/-) mice, and restitution was determined in the presence of the gap junction inhibitor oleamide, or via time-lapse microscopy of IEC-6 cells. Connexin 43 expression, trafficking, and localization were detected in cultured or primary enterocytes or mouse or human intestine by confocal microscopy and (35)S-labeling, and gap junction communication was assessed using live microscopy with oleamide or connexin 43 siRNA. Enterocytes expressed connexin 43 in vitro and in vivo, and exchanged fluorescent dye via gap junctions. Gap junction inhibition significantly reduced enterocyte migration in vitro and in vivo. NEC was associated with IFN release and loss of enterocyte connexin 43 expression. IFN inhibited enterocyte migration by reducing gap junction communication through the dephosphorylation and internalization of connexin 43. Gap junction inhibition significantly increased NEC severity, whereas reversal of the inhibitory effects of IFN on gap junction communication restored enterocyte migration after IFN exposure. Strikingly, IFN(-/-) mice were protected from the development of NEC, and showed restored connexin 43 expression and intestinal restitution. IFN inhibits enterocyte migration by preventing interenterocyte gap junction communication. Connexin 43 loss may provide insights into the development of NEC, in which restitution is impaired.

Effects of interferon-gamma and tumor necrosis factor-alpha on macrophage enzyme levels

NASA Technical Reports Server (NTRS)

Pierangeli, Silvia S.; Sonnenfeld, Gerald

1989-01-01

Murine peritoneal macrophages were treated with interferon-gamma (IFN-gamma) or tumor necrosis factor-alpha (TNF). Measurements of changes in acid phosphatase and beta-glucuronidase levels were made as an indication of activation by cytokine treatment. IFN-gamma or TNF-gamma treatment resulted in a significant increase in the activities of both enzymes measured in the cell lysates. This increase was observable after 6 h of incubation, but reached its maximum level after 24 h of incubation. The effect of the treatment of the cell with both cytokines together was additive. No synergistic effect of addition of both cytokines on the enzyme levels was observed.

Risk of tuberculosis among air passengers estimated by interferon gamma release assay: survey of contact investigations, Japan, 2012 to 2015

PubMed Central

Ota, Masaki; Kato, Seiya

2017-01-01

Although the World Health Organization recommends contact investigations around air travel-associated sputum smear-positive tuberculosis (TB) patients, evidence suggests that the information thus obtained may have overestimated the risk of TB infection because it involved some contacts born in countries with high TB burden who were likely to have been infected with TB in the past, or because tuberculin skin tests were used, which are less specific than the interferon gamma release assay (IGRA) particularly in areas where Bacillus Calmette-Guérin (BCG) vaccination coverage is high. We conducted a questionnaire survey on air travel-associated TB contact investigations in local health offices of Japan from 2012 to 2015, focusing on IGRA positivity. Among 651 air travel-associated TB contacts, average positivity was 3.8% (95% confidence interval (CI): 2.5–5.6) with a statistically significant increasing trend with older age (p < 0.0094). Positivity among 0–34 year-old contacts was 1.0% (95% CI: 0.12–3.5%), suggesting their risk of TB infection is as small as among Japanese young adults with low risk of TB infection (positivity: 0.85–0.90%). Limiting the contact investigation to fewer passengers (within two seats surrounding the index case, rather than two rows) seems reasonable in the case of aircraft with many seats per row. PMID:28367799

Comparison of Cytomegalovirus (CMV) Enzyme-Linked Immunosorbent Spot and CMV Quantiferon Gamma Interferon-Releasing Assays in Assessing Risk of CMV Infection in Kidney Transplant Recipients

PubMed Central

Saldan, Alda; Mengoli, Carlo; Fiscon, Marta; Silvestre, Cristina; Fallico, Loredana; Peracchi, Marta; Furian, Lucrezia; Cusinato, Riccardo; Bonfante, Luciana; Rossi, Barbara; Marchini, Francesco; Sgarabotto, Dino; Rigotti, Paolo; Palù, Giorgio

2013-01-01

Assessing cytomegalovirus (CMV)-specific cell-mediated immunity (CMI) represents an appealing strategy for identifying transplant recipients at risk of infection. In this study, we compared two gamma interferon-releasing assays (IGRAs), Quantiferon-CMV and CMV enzyme-linked immunosorbent spot (ELISPOT), to determine the ability of each test to predict protective CMV-specific T-cell responses. Two hundred twenty-one Quantiferon-CMV and ELISPOT tests were conducted on 120 adult kidney transplant recipients (KTRs), including 100 CMV-seropositive transplant recipients (R+) and 20 CMV-seronegative transplant recipients of a CMV-positive donor (D+/R−). As a control cohort, 39 healthy adult subjects (including 33 CMV-seropositive and 6 CMV-seronegative subjects) were enrolled. CMV IgG serology was used as a reference for both tests. In the CMV-seropositive individuals, the ELISPOT and Quantiferon-CMV assays provided 46% concordance with the serology, 12% discordance, 18% disagreement between ELISPOT or Quantiferon-CMV and the serology, and 24% gray areas when one or both tests resulted in weak positives. None of the CMV-seronegative subjects showed detectable responses in the ELISPOT or the Quantiferon-CMV test. In transplant recipients, both the ELISPOT and Quantiferon-CMV assays positively correlated with each other and negatively correlated with CMV DNAemia in a significant way (P < 0.05). During the antiviral prophylaxis, all 20 D+/R− KTRs we examined displayed undetectable Quantiferon-CMV and ELISPOT results, and there was no evidence of CMV seroconversion. The receiving operator curve (ROC) statistical analysis revealed similar specificities and sensitivities in predicting detectable viremia (areas under the curve [AUC], 0.66 and 0.62 for Quantiferon-CMV and ELISPOT, respectively). ELISPOT and Quantiferon-CMV values of >150 spots/200,000 peripheral blood mononuclear cells (PBMCs) and >1 to 6 IU gamma interferon (IFN-γ) were associated with protection from CMV

Interferon-Gamma Promotes UV-Induced Melanoma in Mice | Center for Cancer Research

Cancer.gov

Scientists have made an unanticipated discovery in mice that interferon-gamma, a type of protein primarily used by the immune system for intercellular communication, acts as a promoter for the deadly form of skin cancer known as melanoma. This finding resulted from a series of experiments designed to understand how solar ultraviolet (UV) radiation causes melanoma. This study

Mitochondria-dependent and -independent mechanisms in tumour necrosis factor-related apoptosis-inducing ligand (TRAIL)-induced apoptosis are both regulated by interferon-gamma in human breast tumour cells.

PubMed Central

Ruiz-Ruiz, Carmen; López-Rivas, Abelardo

2002-01-01

Tumour necrosis factor-related apoptosis-inducing ligand (TRAIL/APO-2L) induces apoptosis in a variety of tumour cells upon binding to death receptors TRAIL-R1 and TRAIL-R2. Here we describe the sensitization by interferon (IFN)-gamma to TRAIL-induced apoptosis in the breast tumour cell lines MCF-7 and MDA-MB231. IFN-gamma promoted TRAIL-mediated activation of caspase-8, Bcl-2 interacting domain death agonist (Bid) degradation, Bcl-2-associated X protein (Bax) translocation to mitochondria, cytochrome c release to the cytosol and activation of caspase-9 in these cell lines. No changes in the expression of TRAIL receptors were observed upon IFN-gamma treatment. Overexpression of Bcl-2 in MCF-7 cells completely inhibited IFN-gamma-induced sensitization to TRAIL-mediated cell death. Interestingly, TRAIL-induced apoptosis was also clearly enhanced by IFN-gamma in caspase-3-overexpressing MCF-7 cells, in the absence of Bax translocation to mitochondria and cytochrome c release to the cytosol. In summary, our results suggest that IFN-gamma facilitates TRAIL-induced activation of mitochondria-regulated as well as mitochondria-independent apoptotic pathways in breast tumour cells. PMID:11936954

Double-blind trial of recombinant gamma-interferon versus placebo in the treatment of rheumatoid arthritis. 1989.

PubMed

Cannon, Grant W; Pincus, Seth H; Emkey, Ronald D; Denes, Alex; Cohen, Selwyn A; Wolfe, Frederick; Saway, P Anthony; Jaffer, Adrian M; Weaver, Arthur L; Cogen, Lewis; Schindler, John D

2008-02-01

One hundred five patients were enrolled in a 12-week, randomized, prospective, double-blind, placebo-controlled trial of recombinant human gamma-interferon (rHu gamma-IFN) for the treatment of rheumatoid arthritis. Fifty-four patients received rHu gamma-IFN and 51 received placebo. Forty-two patients in each group completed the 12-week trial. Some clinical improvement occurred in both groups of patients. Although the improvement with rHu gamma-IFN was greater than that with placebo, the differences were generally not statistically significant.

Enhanced gamma interferon responses of mouse spleen cells following immunotherapy for tuberculosis relapse.

PubMed

Gil, Olga; Vilaplana, Cristina; Guirado, Evelyn; Díaz, Jorge; Cáceres, Neus; Singh, Mahavir; Cardona, Pere-Joan

2008-11-01

Gamma interferon responses of spleen cells in mice were examined during postchemotherapy relapse of intraperitoneally induced latent tuberculous infection. The mycobacterial extract RUTI, which prevented the relapse, significantly enhanced the immune responses to secreted and structural recombinant mycobacterial antigens, suggesting that RUTI-mediated protection was mediated by activated T cells.

Role of gamma interferon in a neonatal mouse model of group B streptococcal disease.

PubMed Central

Cusumano, V; Mancuso, G; Genovese, F; Delfino, D; Beninati, C; Losi, E; Teti, G

1996-01-01

The aim of this study was to assess the role of gamma interferon (IFN-gamma) in a neonatal mouse model of group B streptococcal (GBS) sepsis. IFN-gamma was produced by spleen cells at 24, 48, and 72 h after GBS challenge. Treatment with anti-IFN-gamma at 6 h before challenge totally abrogated the IFN-gamma response but did not affect survival. Subcutaneous administration of recombinant IFN-gamma (2,500 IU per pup) at 18 h after challenge resulted in increased survival time and reduced blood colony counts at 48 and 72 h. In vitro preincubation of neonatal whole blood with IFN-gamma before the addition of GBS resulted in significant restriction of bacterial growth. These data indicate that administration of recombinant IFN-gamma can partially restore impaired host defenses against GBS in neonatal mice. This cytokine may be useful for the treatment of neonatal infections. PMID:8757817

Comparison of Tuberculin Skin Test result and interferon gamma response to human PPD in BCG scar positive and negative children.

PubMed

Sayyahfar, Shirin; Karimi, Abdollah; Fahimzad, Alireza; Shamshiri, Ahmad Reza

2014-03-01

The aim of this study is to compare Tuberculin Skin Test (TST) result and interferon gamma response to human PPD (purified protein derivative), in scar positive and scar negative BCG-vaccinated children. Between August 2007 and May 2008 a total of 236 children aged 1-168 months (mean 21 months) admitted to Mofid Children's Hospital, Tehran, Iran, were enrolled in a cross-sectional study. Each patient was examined for BCG vaccine scar and tested with TST and human PPD-based Interferon Gamma Release Assay (IGRA). Two hundred and twenty one cases out of 236 (44% female, 1-168 months, mean age 21 months) were scar positive of whom 95% TST result was negative. Human PPD-based IGRA was positive in 110 (49.8%), negative in 85 (38.4 %) and indeterminate in 26 (11.8%) of scar positive patients. Fifteen children (40% female, 1-156 months; mean age 42 months) were scar negative. All the scar negative cases were TST negative. Human PPD-based IGRA was positive in 10 (66.7%), negative in 4 (26.7%) and indeterminate in 1 (6.7%) of scar negative patients. Immune responsiveness to human PPD antigens in scar positive and negative children may not correspond with results of the Tuberculin Skin Test. Copyright © 2013 Ministry of Health, Saudi Arabia. Published by Elsevier Ltd. All rights reserved.

Disseminated Penicilliosis, Recurrent Bacteremic Nontyphoidal Salmonellosis, and Burkholderiosis Associated with Acquired Immunodeficiency Due to Autoantibody against Gamma Interferon ▿

PubMed Central

Tang, Bone Siu-Fai; Chan, Jasper Fuk-Woo; Chen, Min; Tsang, Owen Tak-Yin; Mok, M. Y.; Lai, Raymond Wai-Man; Lee, Rodney; Que, Tak-Lun; Tse, Herman; Li, Iris Wai-Sum; To, Kelvin Kai-Wang; Cheng, Vincent Chi-Chung; Chan, Eric Yuk-Tat; Zheng, Bojian; Yuen, Kwok-Yung

2010-01-01

Acquired immunodeficiency due to autoantibody against gamma interferon has recently been associated with opportunistic nontuberculous mycobacteriosis, especially among Southeast Asians. We report another 8 cases, all except one apparently immunocompetent hosts who suffered from concomitant or sequential infections by other intracellular pathogens causing penicilliosis, extraintestinal nontyphoidal salmonellosis, and burkholderiosis. The only case with an underlying immunodeficiency syndrome had systemic lupus erythematosus that was quiescent throughout the multiple infective episodes. Eight out of 10 (80.0%) patients with serological evidence of penicilliosis, 5 out of 7 (71.4%) with culture-positive extraintestinal nontyphoidal salmonellosis, 5 out of 28 (17.9%) with serological evidence of melioidosis, and 7 out of 13 (53.8%) with culture-positive nontuberculous mycobacteriosis possessed autoantibody against gamma interferon, whereas only 1 out of 100 patients with systemic lupus erythematosus did. Our study represents the first and largest case series linking this emerging immunodeficiency syndrome with these atypical infections in apparently immunocompetent hosts. Thus, we advocate that any patient with unexplained recurrent or polymicrobial infections due to these intracellular pathogens should be screened for acquired immunodeficiency due to autoantibody against gamma interferon. PMID:20445006

[Aerosolized recombinant interferon-gamma prevent antigen-induced eosinophil recruitment in guinea pig trachea].

PubMed

Gao, Y; Chenping; Lin, X P

1997-10-01

In order to determine whether interferon-gamma (IFN-gamma) inhibits eosinphil infiltration in the trachea of asthmatic guinea pigs induced by Rhizopus nigricans. We had administered aerosolized rIFN-gamma in the tracheas of 30 sensitized guinea pigs which had been divided into six groups, then teated animal inhaled rIFN-gamma of 5 x 10(4), 20 x 10(4), and 40 x 10(4) concentration, BDP and normal saline respectively at 24 h, 12 h, 2 h before being challenged. (1) Provocation positive rates decreased in 40 x 10(4) rIFN-gamma and BDP group compared with that in normal saline group and before intervention (P < 0.05), airway resistence decreased (P < 0.01). (2) The administration of aerosolized rIFN-gamma (40 x 10(4)) and BDP also decreased fungus-induced eosnophils but not other cells infiltration in the trachea. (3) In BALF, Eos count and ECP level were obviously lower than those in other groups. However, eosinophil numbers did not show significant change in the peripheral blood. Local administration of rIFN-gamma (40 x 10(4)) may reduce airway inflammation and intervene asthmatic attack by inhibition of Eos, ECP infiltration in airways.

Development of an aptamer beacon for detection of interferon-gamma.

PubMed

Tuleuova, Nazgul; Jones, Caroline N; Yan, Jun; Ramanculov, Erlan; Yokobayashi, Yohei; Revzin, Alexander

2010-03-01

Traditional antibody-based affinity sensing strategies employ multiple reagents and washing steps and are unsuitable for real-time detection of analyte binding. Aptamers, on the other hand, may be designed to monitor binding events directly, in real-time, without the need for secondary labels. The goal of the present study was to design an aptamer beacon for fluorescence resonance energy transfer (FRET)-based detection of interferon-gamma (IFN-gamma)--an important inflammatory cytokine. Variants of DNA aptamer modified with biotin moieties and spacers were immobilized on avidin-coated surfaces and characterized by surface plasmon resonance (SPR). The SPR studies showed that immobilization of aptamer via the 3' end resulted in the best binding IFN-gamma (K(d) = 3.44 nM). This optimal aptamer variant was then used to construct a beacon by hybridizing fluorophore-labeled aptamer with an antisense oligonucleotide strand carrying a quencher. SPR studies revealed that IFN-gamma binding with an aptamer beacon occurred within 15 min of analyte introduction--suggesting dynamic replacement of the quencher-complementary strand by IFN-gamma molecules. To further highlight biosensing applications, aptamer beacon molecules were immobilized inside microfluidic channels and challenged with varying concentration of analyte. Fluorescence microscopy revealed low fluorescence in the absence of analyte and high fluorescence after introduction of IFN-gamma. Importantly, unlike traditional antibody-based immunoassays, the signal was observed directly upon binding of analyte without the need for multiple washing steps. The surface immobilized aptamer beacon had a linear range from 5 to 100 nM and a lower limit of detection of 5 nM IFN-gamma. In conclusion, we designed a FRET-based aptamer beacon for monitoring of an inflammatory cytokine-IFN-gamma. In the future, this biosensing strategy will be employed to monitor dynamics of cytokine production by the immune cells.

Effect of gamma interferon on lung function of mustard gas exposed patients, after 15 years.

PubMed

Ghanei, Mostafa; Panahi, Yoones; Mojtahedzadeh, Mojtaba; Khalili, Ali Reza Hosseini; Aslani, Jafar

2006-01-01

Bronchiolitis has been known to be among the main the pathological features of lung lesions in Mustard Gas (MG) exposed patients. The purpose of this research was to evaluate the efficacy of interferon gamma-1b on the lung function in MG exposed patients with bronchiolitis. Thirty-six bronchiolitis patients, whose lung lesion had been diagnosed through High Resolution Computerized Tomography (HRCT) of the chest and also pathological study, were divided into two 18-member case and control groups. Both groups were receiving their conventional treatment (inhaled Felixotide and Servent). The case group were treated for 6 months with a combination of 200 microg of interferon gamma-1b (given three times per week subcutaneously) plus 7.5 mg of prednisolone (given once a day), while the control group received their previous conventional medications. Lung function was measured at base line and after 1, 3 and 6 months of treatment. In case and control groups, Forced Expiratory Volume in first second (FEV1) did not have statistical differences at the base line (49.3 +/- 2.9 and 48.7 +/- 4.1, respectively = 0.6), whereas a significant increase was seen in the case group (66.3 +/- 5.4) compared control group (57.3 +/- 8.6) at the subsequent months (P = 0.001 for the difference between the groups). Similar pattern of increase was observed in Forced Vital Capacity (FVC). The findings of this study indicate that a 6-month treatment with interferon gamma-1b plus a low-dose prednisolone is associated with an improvement in the lung function in mustard-gas exposed patients with bronchiolitis.

Interferon-gamma induces apoptosis and augments the expression of Fas and Fas ligand by microglia in vitro.

PubMed

Badie, B; Schartner, J; Vorpahl, J; Preston, K

2000-04-01

Activation of microglia by interferon-gamma (IFN-gamma) has been implicated in a number of central nervous system (CNS) inflammatory disease processes. Because IFN-gamma has also been shown to play a role in programmed cell death, we investigated its cytotoxicity and its effect on the Fas apoptotic pathway in microglia. Flow cytometry was used to quantify the IFN-gamma-mediated apoptotic response and Fas and Fas ligand (FasL) expression in two well-characterized murine microglia cell lines (BV-2 and N9). Nuclear fragmentation, suggestive of apoptosis, was noted within 24 h of incubation of microglia with IFN-gamma (10 U/ml). After a 72-h incubation, almost every BV-2 and N9 microglia, but not GL261 glioma cells, underwent cell death and detached from the culture plates. This cytotoxicity occurred even at low IFN-gamma concentrations (1 U/ml) and was inhibited by BAF, a pan-caspase inhibitor. Incubation of BV-2 and N9 microglia, but not GL261 glioma cells, with IFN-gamma also potentiated the expression of Fas and FasL in a similar dose-response and time-course manner, as seen for the apoptotic response. Whereas Fas expression increased by 100% in both microglia cells, FasL upregulation was more pronounced and increased by as much as 200% in the N9 cells. These findings suggest that in addition to its role as a microglia activator, IFN-gamma may also induce apoptosis of microglia, possibly through simultaneous upregulation of Fas and FasL. Interferon-gamma modulation of the Fas pathway and apoptosis in microglia may be important in the pathogenesis of inflammatory CNS disease processes. Copyright 2000 Academic Press.

Interferon-gamma of the giant panda (Ailuropoda melanoleuca): complementary DNA cloning, expression, and phylogenetic analysis.

PubMed

Tao, Yaqiong; Zeng, Bo; Xu, Liu; Yue, Bisong; Yang, Dong; Zou, Fangdong

2010-01-01

Interferon-gamma (IFN-gamma) is the only member of type II IFN and is vital in the regulation of immune and inflammatory responses. Herein we report the cloning, expression, and sequence analysis of IFN-gamma from the giant panda (Ailuropoda melanoleuca). The open reading frame of this gene is 501 base pair in length and encodes a polypeptide consisting of 166 amino acids. All conserved N-linked glycosylation sites and cysteine residues among carnivores were found in the predicted amino acid sequence of the giant panda. Recombinant giant panda IFN-gamma with a V5 epitope and polyhistidine tag was expressed in HEK293 host cells and confirmed by Western blotting. Phylogenetic analysis of mammalian IFN-gamma-coding sequences indicated that the giant panda IFN-gamma was closest to that of carnivores, then to ungulates and dolphin, and shared a distant relationship with mouse and human. These results represent a first step into the study of IFN-gamma in giant panda.

How Methodologic Differences Affect Results of Economic Analyses: A Systematic Review of Interferon Gamma Release Assays for the Diagnosis of LTBI

PubMed Central

Oxlade, Olivia; Pinto, Marcia; Trajman, Anete; Menzies, Dick

2013-01-01

Introduction Cost effectiveness analyses (CEA) can provide useful information on how to invest limited funds, however they are less useful if different analysis of the same intervention provide unclear or contradictory results. The objective of our study was to conduct a systematic review of methodologic aspects of CEA that evaluate Interferon Gamma Release Assays (IGRA) for the detection of Latent Tuberculosis Infection (LTBI), in order to understand how differences affect study results. Methods A systematic review of studies was conducted with particular focus on study quality and the variability in inputs used in models used to assess cost-effectiveness. A common decision analysis model of the IGRA versus Tuberculin Skin Test (TST) screening strategy was developed and used to quantify the impact on predicted results of observed differences of model inputs taken from the studies identified. Results Thirteen studies were ultimately included in the review. Several specific methodologic issues were identified across studies, including how study inputs were selected, inconsistencies in the costing approach, the utility of the QALY (Quality Adjusted Life Year) as the effectiveness outcome, and how authors choose to present and interpret study results. When the IGRA versus TST test strategies were compared using our common decision analysis model predicted effectiveness largely overlapped. Implications Many methodologic issues that contribute to inconsistent results and reduced study quality were identified in studies that assessed the cost-effectiveness of the IGRA test. More specific and relevant guidelines are needed in order to help authors standardize modelling approaches, inputs, assumptions and how results are presented and interpreted. PMID:23505412

[Adenovirus-mediated canine interferon-gamma expression and its antiviral activity against canine parvovirus].

PubMed

Zhang, Kao; Jin, Huijun; Zhong, Fei; Li, Xiujin; Neng, Changai; Chen, Huihui; Li, Wenyan; Wen, Jiexia

2012-11-04

To construct recombinant adenovirus containing canine interferon-gamma (cIFN-gamma) gene and to investigate its antiviral activity against canine parvovirus in Madin-Darby canine kidney cells (MDCK). [Methods] The cIFN-gamma gene was inserted into adenovirus shuttle plasmid to construct pShuttle3-cIFN-gamma expression vector, from which the cIFN-gamma expression cassette was transferred into the adenovirus genomic plasmid pAdeno-X by specific restriction sites to generate recombinant adenovirus genomic plasmid pAd-cIFN-gamma. The pAd-cIFN-gamma plasmid was linearized by digestion and transfected into human embryonic kidney (HEK) 293T cells to generate the replication-defective cIFN-gamma recombinant adenovirus (Ad-cIFN-gamma). To analyze its anti-canine parvovirus activity, the MDCK cells were pre-infected by Ad-cIFN-gamma recombinant adenovirus, and then infected by canine parvovirus. The antiviral activity of the Ad-cIFN-gamma recombinant adenovirus against parvovirus was analyzed. The recombinant adenovirus containing cIFN-gamma gene was constructed by the ligation method. The recombinant adenovirus could mediates recombinant cIFN-gamma secretory expression in MDCK cells. The Ad-cIFN-gamma recombinant adenovirus could significantly inhibit canine parvovirus replication in MDCK cells pre-infected with the recombinant adenovirus. These results indicate that the Ad-cIFN-gamma recombinant adenovirus has the potent antiviral activity against canine parvovirus. The Ad-cIFN-gamma recombinant adenovirus was successfully constructed by the ligation method and possessed a powerful antiviral activity against canine parvovirus.

Cloning, sequencing and expression of white rhinoceros (Ceratotherium simum) interferon-gamma (IFN-gamma) and the production of rhinoceros IFN-gamma specific antibodies.

PubMed

Morar, D; Tijhaar, E; Negrea, A; Hendriks, J; van Haarlem, D; Godfroid, J; Michel, A L; Rutten, V P M G

2007-01-15

Bovine tuberculosis (BTB) is endemic in African buffalo (Syncerus caffer) in the Kruger National Park (KNP). In addition to buffalo, Mycobacterium bovis has been found in at least 14 other mammalian species in South Africa, including kudu (Tragelaphus strepsiceros), Chacma baboon (Papio ursinus) and lion (Panthera leo). This has raised concern about the spillover into other potentially susceptible species like rhinoceros, thus jeopardising breeding and relocation projects aiming at the conservation of biodiversity. Hence, procedures to screen for and diagnose BTB in black rhinoceros (Diceros bicornis) and white rhinoceros (Ceratotherium simum) need to be in place. The Interferon-gamma (IFN-gamma) assay is used as a routine diagnostic tool to determine infection of cattle and recently African buffalo, with M. bovis and other mycobacteria. The aim of the present work was to develop reagents to set up a rhinoceros IFN-gamma (RhIFN-gamma) assay. The white rhinoceros IFN-gamma gene was cloned, sequenced and expressed as a mature protein. Amino acid (aa) sequence analysis revealed that RhIFN-gamma shares a homology of 90% with equine IFN-gamma. Monoclonal antibodies, as well as polyclonal chicken antibodies (Yolk Immunoglobulin-IgY) with specificity for recombinant RhIFN-gamma were produced. Using the monoclonals as capture antibodies and the polyclonal IgY for detection, it was shown that recombinant as well as native white rhinoceros IFN-gamma was recognised. This preliminary IFN-gamma enzyme-linked immunosorbent assay (ELISA), has the potential to be developed into a diagnostic assay for M. bovis infection in rhinoceros.

Effect of interferon on the replication of mink cell focus-inducing virus in murine cells: synthesis, processing, assembly, and release of viral proteins.

PubMed Central

Bilello, J A; Wivel, N A; Pitha, P M

1982-01-01

Treatment of mink cell focus-inducing (MCF) virus (isolate AK-13) producing SC-1 cells with mouse fibroblast interferon (150 to 600 U/ml) led to a 100-fold decrease in the release of infectious virus, whereas there was a 2.5- to 10-fold decrease in various parameters of virus particle release. Analysis of labeled virion proteins indicated that a temporal change in virion protein composition occurred after interferon treatment. After a 24-h exposure of chronically infected cells to interferon, the virions produced contained a 85,000-dalton glycoprotein (apparently of nonviral origin) which was in excess of the virus envelope glycoprotein gp70. Particles produced from cells treated with interferon for 32 to 48 h were nearly devoid of gp70 and contained substantially lower quantities of p30. Intracellular processing of viral precursor polyproteins to the mature virion structural proteins was not altered in the presence of interferon. However, an accumulation of the viral p30 and p12E proteins was observed in interferon-treated cells, consistent with an increase in cell-associated virions. Immunoprecipitation analysis of the tissue culture fluids from [35S]methionine-labeled control and interferon-treated cells revealed marked decrease in p30 and p15E/p12E released after interferon treatment. In contrast, gp70 did not accumulate in interferon-treated cells, but was released into the culture medium in a form that was neither pelletable nor associated with p15E/p12E. Images PMID:6180173

Comparing an Interferon Gamma Release Assay with the Tuberculin Skin Test During Pregnancy: Implications for Tuberculosis Screening During Prenatal Care.

PubMed

Molina, Rose; Venkatesh, Kartik; Schantz-Dunn, Julianna; Meadows, Audra; Nour, Nawal; Diouf, Khady

2016-06-01

Background Currently there are no guidelines regarding optimal screening for latent tuberculosis infection during pregnancy. Objective This study measures completion rates and the concordance between the TSPOT.TB, a commercially available interferon gamma release assay (IGRA), and the traditional tuberculin skin test (TST) in a predominantly urban minority obstetrics practice. Design This is an observational cohort study of 141 pregnant women enrolled from an obstetrics practice with a large immigrant population. Women with a history of a positive TST result were excluded. Demographic and clinical risk factors for tuberculosis were assessed. Enrolled women underwent a T-SPOT.TB test and placement of TST, and returned in 48-72 h for TST interpretation. We calculated the completion rate and frequency of a positive result for each test, as well as the concordance between the T-SPOT.TB and TST. Results Among the 141 women enrolled, 75 % were either Latina or African-American, 44 % were born in a country with a high TB prevalence, and 52 % had received the Bacillus Calmette-Guerin vaccine. Seven women (5 %) had a positive screening test, a total of 3 positive T-SPOT.TB results and 6 positive TST results, and all were from countries with a high TB prevalence. The concordance of the two tests was 96.3 %. The completion rate for the T-SPOT.TB was 98 %, while the completion rate for the TST was 63 %. The IGRA test had a markedly higher completion rate in addition to maintaining high concordance with the two-step TST in this population of pregnant women with a high prevalence of prior TB exposure. Targeted screening of women from countries with a high prevalence of tuberculosis may be warranted during prenatal care.

Kinetics of a Tuberculosis-Specific Gamma Interferon Release Assay in Military Personnel with a Positive Tuberculin Skin Test▿ †

PubMed Central

van Brummelen, Sigrid E.; Bauwens, Anja M.; Schlösser, Noël J.; Arend, Sandra M.

2010-01-01

Treatment of latent Mycobacterium tuberculosis infection on the basis of the tuberculin skin test (TST) result is inaccurate due to the false-positive TST results that occur after Mycobacterium bovis BCG vaccination or exposure to nontuberculous mycobacteria (NTM). Gamma interferon release assays (IGRAs) are based on M. tuberculosis-specific antigens. In a previous study among BCG-naïve military employees, a positive TST result after deployment was mostly associated with a negative IGRA result, suggesting exposure to NTM. Data regarding the kinetics of IGRAs are limited and controversial. The present study aimed to reassess the rate of false-positive TST results and to evaluate the kinetics of the Quantiferon TB Gold In-Tube assay (QFT-Git) in military personnel with a positive TST result. QFT-Git was performed at the time of inclusion in the study and was repeated after 2, 6, 12, and 18 or 24 months. Of 192 participants, 17 were recruits and 175 were screened after deployment (n = 169) or because of travel or health care work. Baseline positive QFT-Git results were observed in 7/17 (41.2%) and 12/174 (6.9%) participants, respectively. During follow-up, a negative QFT-Git result remained negative in 163/165 (98.8%) participants. Of 18 subjects with an initial positive QFT-Git result, reversion to a negative result occurred in 1/6 (16%) recruits, whereas it occurred in 8/12 (66%) subjects after deployment or with other risk factors (P = 0.046). The quantitative result was significantly lower in subjects with reversion than in those with consistent positive results (P = 0.017). This study confirmed a low rate of positive QFT-Git results among military personnel with a positive TST result after deployment, supporting the hypothesis of exposure to NTM. Reversion of the majority of initially low-positive QFT-Git results indicates that QFT-Git may be useful for the diagnosis of later reinfections. PMID:20375241

Screening travellers to high-endemic countries for infection with Mycobacterium tuberculosis using interferon gamma release assay; a prospective study.

PubMed

Elfrink, Floor; van den Hoek, Anneke; Mensen, Marlies E; Sonder, Gerard J B

2014-09-23

International travel from low-incidence to high-incidence countries for tuberculosis (TB) is regarded as a risk factor for acquiring TB infection. In this prospective study among long-term travellers we examined the incidence of TB infection using Interferon gamma release assay (IGRA) test and compared these data with results from a visit to the TB department to which all long-term travellers were routinely referred. Immunocompetent adults, travelling for 13-52 weeks to TB-endemic countries, donated blood pre- and post-travel for IGRA. The pre-travel IGRA was only tested in case of a positive IGRA post-travel. Results from their visit(s) to the TB department for TST pre- and post-travel were collected and compared with study results. We found two IGRA conversions in a group of 516 travellers, resulting in an attack rate (AR) of 0.4% (95% CI: 0.5 - 13.9) and an incidence rate (IR) of 0.85 per 1000 person-months (95% CI: 0.1-3.1).We found 5 tuberculin skin test (TST) conversions, resulting in AR of 1.9% (5/261; 95% CI: 0.6 - 4.4) and an IR of 4.26 per 1000 person-months (95% CI: 1.38- 9.94). In our study these converters all had a negative IGRA. One traveller however, who was retested later at the TB department due to a positive TST, then appeared to have seroconverted. The risk of long-term travellers among our study population acquiring TB infection is low. We conclude that post-travel IGRA alone could be used for screening for TB infection among long-term travellers to high-endemic TB countries, but preferably not earlier than 8 weeks after return. One might even argue that IGRA testing should be limited to only those travellers who are going to work in a medical setting. A person with a positive IGRA should be referred to a TB physician for further evaluation.

Interferon system in women with genital papillomavirus infection receiving immunomodulatory therapy.

PubMed

Rogovskaya, S I; Zhdanov, A V; Loginova, N S; Faizullin, L Z; Prilepskaya, V N; Van'ko, L V; Sukhikh, G T

2002-11-01

The interferon system was studied in women with genital papillomavirus infection. In most patients the interferon system was activated, while the ability of lymphocytes to respond to inductors decreased. Laserotherapy and immunomodulatory therapy with larifan, ridostin, and viferon for 1 month normalized blood interferon concentration (39.4% patients) and interferon-gamma production by lymphocytes in response to inductors (87.9% patients). After laser monotherapy these parameters returned to normal only in 13.2 and 7.6% patients, respectively. Correlation and regression analyses showed that changes in the interferon system were synchronized after immunomodulatory therapy. These data indicate that immunomodulatory therapy produces a complex effect on the interferon system. Measurements of blood interferon level can be used to predict the effect of further treatment with interferon-gamma inductors.

Development and evaluation of an interferon-γ release assay in Asian elephants (Elephas maximus).

PubMed

Paudel, Sarad; Villanueva, Marvin A; Mikota, Susan K; Nakajima, Chie; Gairhe, Kamal P; Subedi, Suraj; Rayamajhi, Nabin; Sashika, Mariko; Shimozuru, Michito; Matsuba, Takashi; Suzuki, Yasuhiko; Tsubota, Toshio

2016-08-01

We developed an interferon-γ release assay (IGRA) specific for Asian elephants (Elephas maximus). Whole blood collected from forty captive Asian elephants was stimulated with three different mitogens i.e., phytohemagglutinin (PHA), pokweed mitogen (PWM) and phorbol myristate aceteate/ionomycin (PMA/I). A sandwich ELISA that was able to recognize the recombinant elephant interferon-γ (rEIFN-γ) as well as native interferon-γ from the Asian elephants was performed using anti-elephant IFN-γ rabbit polyclonal antibodies as capture antibodies and biotinylated anti-elephant IFN-γ rabbit polyclonal antibodies as detection antibodies. PMA/I was the best mitogen to use as a positive control for an Asian elephant IGRA. The development of an Asian elephant-specific IGRA that detects native IFN-γ in elephant whole blood provides promising results for its application as a potential diagnostic tool for diseases, such as tuberculosis (TB) in Asian elephants.

Evidence for a gamma-interferon receptor that regulates macrophage tumoricidal activity

PubMed Central

1984-01-01

Gamma-interferon (IFN-gamma) is the macrophage-activating factor (MAF) produced by normal murine splenic cells and the murine T cell hybridoma 24/G1 that induces nonspecific tumoricidal activity in macrophages. Incubation of 24/G1 supernatants diluted to 8.3 IRU IFN-gamma/ml with 6 X 10(6) elicited peritoneal macrophages or bone marrow-derived macrophages for 4 h at 37 degrees C, resulted in removal of 80% of the MAF activity from the lymphokine preparation. Loss of activity appeared to result from absorption and not consumption because (a) 40% of the activity was removed after exposure to macrophage for 30 min at 4 degrees C, (b) no reduction of MAF activity was detected when the 24/G1 supernatant was incubated with macrophage culture supernatants, and (c) macrophage-treated supernatants showed a selective loss of MAF activity but not interleukin 2 (IL-2) activity. Absorption was dependent on the input of either IFN-gamma or macrophages and was time dependent at 37 degrees C but not at 4 degrees C. With four rodent species tested, absorption of murine IFN-gamma displayed species specificity. However, cultured human peripheral blood monocytes and the human histiocytic lymphoma cell line U937 were able to absorb the murine lymphokine. Although the majority of murine cell lines tested absorbed 24/G1 MAF activity, two murine macrophage cell lines, P388D1 and J774, were identified which absorbed significantly reduced amounts of natural IFN- gamma. Purified murine recombinant IFN-gamma was absorbed by elicited macrophages but not by P388D1. Normal macrophages but not P388D1 bound fluoresceinated microspheres coated with recombinant IFN-gamma and binding was inhibited by pretreatment of the normal cells with 24/G1 supernatants. Scatchard plot analysis showed that 12,000 molecules of soluble 125I-recombinant IFN-gamma bound per bone marrow macrophage with a Ka of 0.9 X 10(8) M-1. Binding was quantitatively inhibitable by natural IFN-gamma but not by murine IFN alpha. IFN

A short 2 week dose titration regimen reduces the severity of flu-like symptoms with initial interferon gamma-1b treatment.

PubMed

Devane, John G; Martin, Mary L; Matson, Mark A

2014-06-01

Flu-like symptoms (FLS) are commonly experienced by patients receiving interferon gamma-1b which may cause discontinuation or disruption of dosing during initial therapy or on re-initiation following a break in therapy. In contrast to Type I interferons, the impact of dose-titration on FLS has not been reported and is not a practice described or included in the approved prescribing information for interferon gamma-1b.The objective of this study was to assess the effect of a 2 week titration regimen on the severity of FLS during the initial 3 weeks of therapy with three times weekly subcutaneous injections of interferon gamma-1b. Healthy men and women were randomized into a double-blind, two-period, crossover study. Each study period was 3 weeks in duration and there was a minimum 15 day washout between treatment periods. Two treatment regimens were compared: No Titration dosing (full 50 mcg/m(2) subcutaneously [s.c.] three times weekly for 3 weeks) and Titration (15 mcg/m(2) s.c. three times weekly during week 1, 30 mcg/m(2) s.c. three times weekly during week 2 followed by the full dose of 50 mcg/m(2) s.c. three times weekly during week 3). Subjects remained in the clinic for at least 12 hours following each injection. FLS was based on a composite score for fever, chills, tiredness and muscle aches assessed at baseline and 4, 8 and 12 hours following each injection. Acetaminophen was allowed at the discretion of the PI. The primary endpoint was the change from baseline in FLS severity at 8 hours averaged over the 3 weeks of treatment. Additional endpoints included FLS at 4 and 12 hours, individual flu-like symptoms, rates of discontinuation, incidence of FLS and acetaminophen use. NCT 01929382. Of the 40 subjects randomized, there were 15 (37.5%) discontinuations. Titration resulted in a significant reduction in FLS severity at 8 hours (p = 0.023) averaged over the 3 week treatment period. The difference in 3 week FLS severity reflects differences

Differential effects of human interferon alpha and interferon gamma on xenografted human thyroid tissue in severe combined immunodeficient mice and nude mice.

PubMed

Kawai, K; Enomoto, T; Fornasier, V; Resetkova, E; Volpé, R

1997-03-01

We have studied the in vivo effects of human interferon alpha (IFN-alpha) and interferon gamma (IFN-gamma) administration on human thyroid tissue xenografted into two mouse strains: severe combined immunodeficient (SCID) mice and nude mice. Human lymphocytes survive in SCID mice but are lysed in nude mice. Thyroid tissues from Graves' disease or Hashimoto's thyroiditis, or paranodular [normal, (N)] tissue was xenografted into SCID mice (0.8 g/mouse) pretreated with anti-asialo GM-1 antiserum and radiation and also into nude mice. One week after xenografting, SCID and nude mice were divided into three groups. Group A was treated with IFN-alpha intraperitoneally (2,000 units/mouse) three times weekly; group B was treated with IFN-gamma similarly; group C was treated with phosphate buffered saline (PBS) only (control). Autologous human peripheral blood mononuclear cells (PBMCs) were added to mice receiving N xenografts. Blood was taken every 2 weeks for levels of IgG and thyroid antibodies (TAb). After 6 weeks of treatment, mice were sacrificed, and xenograft thyrocyte histocompatibility leukocyte antigen (HLA-DR) and intercellular adhesion molecule (ICAM-1) expression were measured. In addition, thyrocyte cultures were stimulated in vitro with 200 units/ml of either IFN-alpha or IFN-gamma or PBS (control). SCID mice xenografted with autoimmune thyroid disease (AITD) in group A showed a significantly higher TAb production than group C, whereas in group B, TAb production was not statistically increased compared to control (group C). SCID mice xenografted with N did not produce TAb in any group, nor did nude mice xenografted with AITD. Thyrocyte HLA-DR expression was markedly increased in group A and B in SCID mice xenografted with Graves' disease, Hashimoto's thyroiditis, and N tissue compared to group C. In contrast, only group B (IFN-gamma) showed an increase in thyrocyte HLA-DR in nude mice. In the in vitro studies, only IFN-gamma (not IFN-alpha) stimulated

Dual specific oral tolerance induction using interferon gamma for IgE-mediated anaphylactic food allergy and the dissociation of local skin allergy and systemic oral allergy: tolerance or desensitization?

PubMed

Noh, G; Jang, E H

2014-01-01

Specific oral tolerance induction (SOTI) for IgE-mediated food allergy (IFA) can be successfully achieved using interfero gamma (classic SOTI). In this study, a tolerable dose was introduced during tolerance induction with interferon gamma (dual SOTI), and its effectiveness was evaluated. The study population comprised 25 IFA patients. Blood samples were taken for analysis, including complete blood count with differential counts of eosinophils, serum total IgE levels, and specific IgE for allergenic foods. Skin prick tests were conducted with the allergens. Oral food challenges were performed to diagnose IFA. Ten patients received dual SOTI, 5 received classic SOTI, 5 received SOTI without interferon gamma (original SOTI), and 5 were not treated (controls). Patients treated with dual SOTI and classic SOTI using interferon gamma became tolerant to the allergenic food. The tolerable dose was introduced successfully in dual SOTI. It was difficult to proceed with the same dosing protocol used for classic SOTI in cases treated with original SOTI. Following dual SOTI, the systemic reaction to oral intake subsided, but the local skin reaction to contact with the allergenic food persisted. Dual SOTI is an improved protocol for SOTI using interferon gamma for IFA.The local skin reaction and systemic reaction to oral intake were dissociated following dual SOTI. In cases of food allergy, tolerance appears to result from desensitization to allergens.

Inhibition of interferon-gamma expression by osmotic shrinkage of peripheral blood lymphocytes.

PubMed

Lang, K S; Weigert, C; Braedel, S; Fillon, S; Palmada, M; Schleicher, E; Rammensee, H-G; Lang, F

2003-01-01

A hypertonic environment, as it prevails in renal medulla or in hyperosmolar states such as hyperglycemia of diabetes mellitus, has been shown to impair the immune response, thus facilitating the development of infection. The present experiments were performed to test whether hypertonicity influences activation of T lymphocytes. To this end, peripheral blood lymphocytes (PBL) of cytomegalovirus (CMV)-positive donors were stimulated by human leukocyte antigen (HLA)-A2-restricted CMV epitope NLVPMVATV to produce interferon (IFN)-gamma at varying extracellular osmolarity. As a result, increasing extracellular osmolarity during exposure to the CMV antigen indeed decreased IFN-gamma formation. Addition of NaCl was more effective than urea. A 50% inhibition was observed at 350 mosM by addition of NaCl. The combined application of the Ca(2+) ionophore ionomycin (1 microg/ml) and the phorbol ester phorbol 12-myristate 13-acetate (PMA; 5 microg/ml) stimulated IFN-gamma production, an effect again reversed by hyperosmolarity. Moreover, hyperosmolarity abrogated the stimulating effect of ionomycin (1 microg/ml) and PMA (5 microg/ml) on the transcription factors activator protein (AP)-1, nuclear factor of activated T cells (NFAT), and NF-kappaB but not Sp1. In conclusion, osmotic cell shrinkage blunts the stimulatory action of antigen exposure on IFN-gamma production, an effect explained at least partially by suppression of transcription factor activation.

COULD INTERFERON-GAMMA BE A THERAPEUTIC TARGET FOR TREATING HEART FAILURE?

PubMed Central

Levick, Scott P.; Goldspink, Paul H.

2013-01-01

The cytokine interferon-gamma (IFN-γ), is the only known member of the type II family of interferons, and as such, binds to its own distinct receptor. It is important in host defense against infection, as well as adaptive immune responses. Whilst a wide array of cytokines are known to be involved in adverse remodeling of the heart and the progression to heart failure, the role of IFN-γ is unclear. Recent evidence from clinical studies, animal models of myocarditis and hypertension, as well as isolated cell studies, provide conflicting data as to whether IFN-γ is pathological or protective in the heart. Thus, it is important to highlight these discrepant findings so that areas of future investigation can be identified to more clearly determine the precise role of IFN-γ in the heart. Accordingly, this review will: 1) discuss the source of IFN-γ in the diseased heart; 2) summarize the data from animal studies; 3) discuss the effects of IFN-γ on isolated cardiac fibroblasts and cardiomyocytes; 4) identify signaling mechanisms that may be invoked by IFN-γ in the heart; and 5) present the clinical evidence supporting a role for IFN-γ in heart failure. PMID:23589353

Vertebral osteomyelitis due to Aspergillus fumigatus in a patient with chronic granulomatous disease successfully treated with antifungal agents and interferon-gamma.

PubMed

Al-Tawfiq, Jaffar A; Al-Abdely, Hail M

2010-05-01

We report a case of invasive aspergillosis due to Aspergillus fumigatus involving the cervical and thoracic vertebrae and upper mediastinum of a 17 year-old Saudi male with chronic granulomatous disease (CGD). The patient did not respond to a long course of liposomal amphotericin B but did to surgical drainage and a combination of caspofungin and itraconazole with subsequent suppression with oral voriconazole. Fourteen months after the start of therapy, the patient had anterior dislocation of T2 thoracic vertebra with cord transection and quadriplegia. He was then treated intravenously with liquid itraconazole and interferon-gamma. The patient made a remarkable recovery over a 2-year period and was eventually able to walk independently. Thus, a combination of antifungals and interferon-gamma may have resulted in the positive outcome in this case.

Interleukin-12- and interferon-gamma-mediated natural killer cell activation by Agaricus blazei Murill.

PubMed

Yuminamochi, Eri; Koike, Taisuke; Takeda, Kazuyoshi; Horiuchi, Isao; Okumura, Ko

2007-06-01

Dried fruiting bodies of Agaricus blazei Murill (A. blazei) and its extracts have generally used as complementary and alternative medicines (CAMs). Here, we report that the oral administration of A. blazei augmented cytotoxicity of natural killer (NK) cells in wild-type (WT) C57BL/6, C3H/HeJ, and BALB/c mice. Augmented cytotoxicity was demonstrated by purified NK cells from treated wild-type (WT) and RAG-2-deficient mice, but not from interferon-gamma (IFN-gamma) deficient mice. NK cell activation and IFN-gamma production was also observed in vitro when dendritic cell (DC)-rich splenocytes of WT mice were coincubation with an extract of A. blazei. Both parameters were largely inhibited by neutralizing anti-interleukin-12 (IL-12) monoclonal antibody (mAb) and completely inhibited when anti-IL-12 mAb and anti-IL-18 mAb were used in combination. An aqueous extract of the hemicellulase-digested compound of A. blazei particle; (ABPC) induced IFN-gamma production more effectively, and this was completely inhibited by anti-IL-12 mAb alone. NK cell cytotoxicty was augmented with the same extracts, again in an IL-12 and IFN-gamma-dependent manner. These results clearly demonstrated that A. blazei and ABPC augmented NK cell activation through IL-12-mediated IFN-gamma production.

Production and characterization of guinea pig recombinant gamma interferon and its effect on macrophage activation.

PubMed

Jeevan, A; McFarland, C T; Yoshimura, T; Skwor, T; Cho, H; Lasco, T; McMurray, D N

2006-01-01

Gamma interferon (IFN-gamma) plays a critical role in the protective immune responses against mycobacteria. We previously cloned a cDNA coding for guinea pig IFN-gamma (gpIFN-gamma) and reported that BCG vaccination induced a significant increase in the IFN-gamma mRNA expression in guinea pig cells in response to living mycobacteria and that the virulent H37Rv strain of Mycobacterium tuberculosis stimulated less IFN-gamma mRNA than did the attenuated H37Ra strain. In this study, we successfully expressed and characterized recombinant gpIFN-gamma with a histidine tag at the N terminus (His-tagged rgpIFN-gamma) in Escherichia coli. rgpIFN-gamma was identified as an 18-kDa band in the insoluble fraction; therefore, the protein was purified under denaturing conditions and renatured. N-terminal amino acid sequencing of the recombinant protein yielded the sequence corresponding to the N terminus of His-tagged gpIFN-gamma. The recombinant protein upregulated major histocompatibility complex class II expression in peritoneal macrophages. The antiviral activity of rgpIFN-gamma was demonstrated with a guinea pig fibroblast cell line (104C1) infected with encephalomyocarditis virus. Interestingly, peritoneal macrophages treated with rgpIFN-gamma did not produce any nitric oxide but did produce hydrogen peroxide and suppressed the intracellular growth of mycobacteria. Furthermore, rgpIFN-gamma induced morphological alterations in cultured macrophages. Thus, biologically active rgpIFN-gamma has been successfully produced and characterized in our laboratory. The study of rgpIFN-gamma will further increase our understanding of the cellular and molecular responses induced by BCG vaccination in the guinea pig model of pulmonary tuberculosis.

Evaluation of Gamma Interferon and Antibody Tuberculosis Tests in Alpacas

PubMed Central

Holder, Tom; Clifford, Derek; Dexter, Ian; Brewer, Jacky; Smith, Noel; Waring, Laura; Crawshaw, Tim; Gillgan, Steve; Lyashchenko, Konstantin; Lawrence, John; Clarke, John; de la Rua-Domenech, Ricardo; Vordermeier, Martin

2012-01-01

We describe the performance of cell-based and antibody blood tests for the antemortem diagnosis of tuberculosis (TB) in South American camelids (SAC). The sensitivity and specificity of the gamma interferon (IFN-γ) release assay, two lateral flow rapid antibody tests (Stat-Pak and Dual Path Platform [DPP]), and two enzyme-linked immunosorbent assay (ELISA)-based antibody tests (Idexx and Enferplex) were determined using diseased alpacas from Mycobacterium bovis culture-confirmed breakdown herds and TB-free alpacas from geographical areas with no history of bovine TB, respectively. Our results show that while the sensitivities of the IFN-γ and antibody tests were similar (range of 57.7% to 66.7%), the specificity of the IFN-γ test (89.1%) was lower than those of any of the antibody tests (range of 96.4% to 97.4%). This lower specificity of the IFN-γ test was at least in part due to undisclosed Mycobacterium microti infection in the TB-free cohort, which stimulates a positive purified protein derivative (PPD) response. The sensitivity of infection detection could be increased by combining two antibody tests, but even the use of all four antibody tests failed to detect all diseased alpacas. These antibody-negative alpacas were IFN-γ positive. We found that the maximum sensitivity could be achieved only by the combination of the IFN-γ test with two antibody tests in a “test package,” although this resulted in decreased specificity. The data from this evaluation of tests with defined sensitivity and specificity provide potential options for antemortem screening of SAC for TB in herd breakdown situations and could also find application in movement testing and tracing investigations. PMID:22914362

Evaluation of gamma interferon and antibody tuberculosis tests in alpacas.

PubMed

Rhodes, Shelley; Holder, Tom; Clifford, Derek; Dexter, Ian; Brewer, Jacky; Smith, Noel; Waring, Laura; Crawshaw, Tim; Gillgan, Steve; Lyashchenko, Konstantin; Lawrence, John; Clarke, John; de la Rua-Domenech, Ricardo; Vordermeier, Martin

2012-10-01

We describe the performance of cell-based and antibody blood tests for the antemortem diagnosis of tuberculosis (TB) in South American camelids (SAC). The sensitivity and specificity of the gamma interferon (IFN-γ) release assay, two lateral flow rapid antibody tests (Stat-Pak and Dual Path Platform [DPP]), and two enzyme-linked immunosorbent assay (ELISA)-based antibody tests (Idexx and Enferplex) were determined using diseased alpacas from Mycobacterium bovis culture-confirmed breakdown herds and TB-free alpacas from geographical areas with no history of bovine TB, respectively. Our results show that while the sensitivities of the IFN-γ and antibody tests were similar (range of 57.7% to 66.7%), the specificity of the IFN-γ test (89.1%) was lower than those of any of the antibody tests (range of 96.4% to 97.4%). This lower specificity of the IFN-γ test was at least in part due to undisclosed Mycobacterium microti infection in the TB-free cohort, which stimulates a positive purified protein derivative (PPD) response. The sensitivity of infection detection could be increased by combining two antibody tests, but even the use of all four antibody tests failed to detect all diseased alpacas. These antibody-negative alpacas were IFN-γ positive. We found that the maximum sensitivity could be achieved only by the combination of the IFN-γ test with two antibody tests in a "test package," although this resulted in decreased specificity. The data from this evaluation of tests with defined sensitivity and specificity provide potential options for antemortem screening of SAC for TB in herd breakdown situations and could also find application in movement testing and tracing investigations.

Production of interferon-gamma by in vivo tumor-sensitized T cells: Association with active antitumor immunity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bursuker, I.; Pearce, M.T.

1990-02-01

The state of active immunity to Meth A fibrosarcoma in mice immunized with an admixture of Meth A cells and Propionibacterium acnes is associated with possession by the host of spleen cells capable of producing interferon-gamma (IFN-gamma) upon in vitro restimulation with irradiated tumor cells. The ability of spleen cells from immunized mice to produce IFN-gamma in response to irradiated Meth A cells decays as active antitumor immunity is replaced by a state of immunological memory. The IFN-producing cells are L3T4+Ly2+, cyclophosphamide-sensitive and radiosensitive T cells, as determined by their sensitivity to corresponding monoclonal antibodies and complement. The induction ofmore » IFN-gamma production by in vivo tumor-sensitized T cells is tumor specific, in that spleen cells from mice immunized against Meth A fibrosarcoma can produce IFN in response to irradiated Meth A cells but not in response to another syngeneic tumor M109 lung carcinoma.« less

Inhibition of human mast cell growth and differentiation by interferon gamma-1b.

PubMed

Kirshenbaum, A S; Worobec, A S; Davis, T A; Goff, J P; Semere, T; Metcalfe, D D

1998-03-01

In an effort to identify cytokines that inhibit human mast cell growth, we cultured HMC-1 cells and recombinant human stem cell factor (rhSCF)-dependent human bone marrow-derived mast cells (HBMCs) in the presence of interferon gamma (IFNgamma)-1b and interferon alpha (IFNalpha)-2b. HMC-1 cell numbers decreased in the presence of 1000 U/mL IFNgamma-1b but were unaffected by 1000 U/mL of IFNalpha-2b. HBMCs were then cultured for 0 to 7 days with 100 ng/mL rhSCF and 10 ng/mL recombinant human IL-3 (rhIL-3), followed by culture in rhSCF and administration of either 1000 U/mL IFNalpha-2b or 1000 U/mL IFNgamma-1b. HBMCs appearing in cultures with rhSCF alone or in combination with IFNalpha-2b were virtually identical in number through 8 weeks of culture. In cultures supplemented with IFNgamma-1b, HBMCs significantly decreased in number and incidence of granular metachromasia by 4 to 5 weeks (p<0.001). Similar results were obtained when human marrow was cultured from day 0 with rhSCF and IFNgamma-1b. Mature rhSCF-dependent HBMCs were also cultured at 5 weeks with rhSCF alone or in combination with IFNgamma-1b. Compared with cells cultured in rhSCF, mature 5-week HBMC cultures treated with rhSCF plus IFNgamma-1b revealed a decrease in mast cells, and those mast cells that remained had fewer toluidine blue- and tryptase-positive granules after 5 to 8 weeks. FACS analysis of rhSCF plus IFNgamma-1b-treated mature HBMCs revealed increased c-kit and Fc(epsilon)RI expression. Mast cell releasibility was not increased. IFNgamma-lb was thus able to suppress mast cell growth from CD34+ cells, suggesting that this agent should be considered as a candidate cytokine for the treatment of disorders of mast cell proliferation.

Continuous in vivo infusion of interferon-gamma (IFN-gamma) enhances engraftment of syngeneic wild-type cells in Fanca-/- and Fancg-/- mice.

PubMed

Si, Yue; Ciccone, Samantha; Yang, Feng-Chun; Yuan, Jin; Zeng, Daisy; Chen, Shi; van de Vrugt, Henri J; Critser, John; Arwert, Fre; Haneline, Laura S; Clapp, D Wade

2006-12-15

Fanconi anemia (FA) is a heterogeneous genetic disorder characterized by bone marrow (BM) failure and cancer susceptibility. Identification of the cDNAs of FA complementation types allows the potential of using gene transfer technology to introduce functional cDNAs as transgenes into autologous stem cells and provide a cure for the BM failure in FA patients. However, strategies to enhance the mobilization, transduction, and engraftment of exogenous stem cells are required to optimize efficacy prior to widespread clinical use. Hypersensitivity of Fancc-/- cells to interferon-gamma (IFN-gamma), a nongenotoxic immune-regulatory cytokine, enhances engraftment of syngeneic wild-type (WT) cells in Fancc-/- mice. However, whether this phenotype is of broad relevance in other FA complementation groups is unresolved. Here we show that primitive and mature myeloid progenitors in Fanca-/- and Fancg-/- mice are hypersensitive to IFN-gamma and that in vivo infusion of IFN-gamma at clinically relevant concentrations was sufficient to allow consistent long-term engraftment of isogenic WT repopulating stem cells. Given that FANCA, FANCC, and FANCG complementation groups account for more than 90% of all FA patients, these data provide evidence that IFN-gamma conditioning may be a useful nongenotoxic strategy for myelopreparation in FA patients.

Interferon Gamma in African Trypanosome Infections: Friends or Foes?

PubMed

Wu, Hui; Liu, Gongguan; Shi, Meiqing

2017-01-01

African trypanosomes cause fatal infections in both humans and livestock. Interferon gamma (IFN-γ) plays an essential role in resistance to African trypanosomes. However, increasing evidence suggests that IFN-γ, when excessively synthesized, also induces immunopathology, enhancing susceptibility to the infection. Thus, production of IFN-γ must be tightly regulated during infections with African trypanosomes to ensure that a robust immune response is elicited without tissue destruction. Early studies have shown that secretion of IFN-γ is downregulated by interleukin 10 (IL-10). More recently, IL-27 has been identified as a negative regulator of IFN-γ production during African trypanosome infections. In this review, we discuss the current state of our understanding of the role of IFN-γ in African trypanosome infections. We have focused on the cellular source of IFN-γ, its beneficial and detrimental effects, and mechanisms involved in regulation of its production, highlighting some recent advances and offering some perspectives on future directions.

Stress-induced release of HSC70 from human tumors.

PubMed

Barreto, Alfonso; Gonzalez, John Mario; Kabingu, Edith; Asea, Alexzander; Fiorentino, Susana

2003-04-01

In this study, we demonstrate that the pro-inflammatory cytokine interferon-gamma (IFN-gamma) induces the active release of the constitutive form of the 70-kDa heat shock protein (HSC70) from K562 erythroleukemic cells. Treatment of K562 cells with IFN-gamma induced the upregulation of the inducible form of the 70-kDa heat shock protein (HSP70), but not the constitutive form of HSC70 within the cytosol, in a proteasome-dependent manner. In addition, IFN-gamma induced the downregulation of surface-bound HSC70, but did not significantly alter surface-bound HSP70 expression. These findings indicate that HSC70 can be actively released from tumor cells and is indicative of a previously unknown mechanism by which immune modulators stimulate the release of intracellular HSC70. This mechanism may account for the potent chaperokine activity of heat shock proteins recently observed during heat shock protein-based immunotherapy against a variety of cancers.

Interferon-gamma response to the treatment of active pulmonary and extra-pulmonary tuberculosis.

PubMed

Liang, L; Shi, R; Liu, X; Yuan, X; Zheng, S; Zhang, G; Wang, W; Wang, J; England, K; Via, L E; Cai, Y; Goldfeder, L C; Dodd, L E; Barry, C E; Chen, R Y

2017-10-01

Interferon-gamma (IFN-γ) release assays (IGRAs) are used to diagnose tuberculosis (TB) but not to measure treatment response. To measure IFN-γ response to active anti-tuberculosis treatment. Patients from the Henan Provincial Chest Hospital, Henan, China, with TB symptoms and/or signs were enrolled into this prospective, observational cohort study and followed for 6 months of treatment, with blood and sputum samples collected at 0, 2, 4, 6, 8, 16 and 24 weeks. The QuantiFERON® TB-Gold assay was run on collected blood samples. Participants received a follow-up telephone call at 24 months to determine relapse status. Of the 152 TB patients enrolled, 135 were eligible for this analysis: 118 pulmonary (PTB) and 17 extra-pulmonary TB (EPTB) patients. IFN-γ levels declined significantly over time among all patients (P = 0.002), with this decline driven by PTB patients (P = 0.001), largely during the initial 8 weeks of treatment (P = 0.019). IFN-γ levels did not change among EPTB patients over time or against baseline culture or drug resistance status. After 6 months of effective anti-tuberculosis treatment, IFN-γ levels decreased significantly in PTB patients, largely over the initial 8 weeks of treatment. IFN-γ concentrations may offer some value for monitoring anti-tuberculosis treatment response among PTB patients.

Equine interferon gamma synthesis in lymphocytes after in vivo infection and in vitro stimulation with EHV-1.

PubMed

Paillot, R; Daly, J M; Juillard, V; Minke, J M; Hannant, D; Kydd, J H

2005-08-22

Equine cytotoxic T lymphocyte (CTL) responses to equine herpesvirus-1 (EHV-1) are well characterised but little is known about the cytokine response after infection or vaccination. EHV-1 is common in horses and infects lymphocytes in vivo. This virus was used as a model to measure the synthesis of interferon gamma (IFN-gamma) by equine peripheral blood mononuclear cells (PBMC) after in vivo infection and/or in vitro stimulation with EHV-1. Both flow cytometry and ELISPOT assays were used to quantify equine IFN-gamma using a mouse anti-bovine IFN-gamma monoclonal antibody (clone CC302; shown to cross-react with recombinant equine IFN-gamma) and a rabbit anti-canine IFN-gamma polyclonal antibody. The percentage of PBMC synthesising IFN-gamma after in vitro stimulation with EHV-1 increased with age. In yearlings infected experimentally with EHV-1, PBMC showed two peaks of IFN-gamma synthesis, 11 and 56 days after infection. The IFN-gamma synthesis was principally associated with CD8(+) cells. The patterns of IFN-gamma synthesis detected by intracellular IFN-gamma staining or ELISPOT were compared with CTL data and shown to be similar. These methods were also applied successfully to frozen samples of PBMC. Measurement of equine IFN-gamma using these simple techniques can now be applied to future studies on protective cellular immune responses following virus infection and/or vaccination of horses.

Pilot study of whole-blood gamma interferon response to the Vibrio cholerae toxin B subunit and resistance to enterotoxigenic Escherichia coli-associated diarrhea.

PubMed

Flores, Jose; DuPont, Herbert L; Paredes-Paredes, Mercedes; Aguirre-Garcia, M Magdalena; Rojas, Araceli; Gonzalez, Alexei; Okhuysen, Pablo C

2010-05-01

Enterotoxigenic Escherichia coli (ETEC), which produces heat-labile toxin (LT), is a common cause of travelers' diarrhea (TD). The B subunit of ETEC LT is immunologically related to the B subunit of Vibrio cholerae toxin (CT). In this pilot study we evaluated the whole-blood gamma interferon response to CT B in 17 U.S. adults traveling to Mexico. Only one of nine subjects who demonstrated a cellular immune response as determined by whole-blood gamma interferon production to CT B on arrival to Mexico developed diarrhea, whereas five of eight without a cellular response developed diarrhea. Markers of the cellular immune response to ETEC LT could help in identifying individuals immune to ETEC LT, and these markers deserve additional study.

CD4 T lymphocytes from patients with chronic fatigue syndrome have decreased interferon-gamma production and increased sensitivity to dexamethasone.

PubMed

Visser, J; Blauw, B; Hinloopen, B; Brommer, E; de Kloet, E R; Kluft, C; Nagelkerken, L

1998-02-01

A disturbed hypothalamus-pituitary-adrenal gland axis and alterations at the immune system level have been observed in patients with chronic fatigue syndrome (CFS). Glucocorticoids are known to modulate T cell responses; therefore, purified CD4 T cells from CFS patients were studied to determine whether they have an altered sensitivity to dexamethasone (DEX). CD4 T cells from CFS patients produced less interferon-gamma than did cells from controls; by contrast, interleukin-4 production and cell proliferation were comparable. With CD4 T cells from CFS patients (compared with cells from controls), a 10- to 20-fold lower DEX concentration was needed to achieve 50% inhibition of interleukin-4 production and proliferation, indicating an increased sensitivity to DEX in CFS patients. Surprisingly, interferon-gamma production in patients and controls was equally sensitive to DEX. A differential sensitivity of cytokines or CD4 T cell subsets to glucocorticoids might explain an altered immunologic function in CFS patients.

Value of the tuberculin skin testing and of an interferon-gamma release assay in haemodialysis patients after exposure to M. tuberculosis

PubMed Central

2012-01-01

Background Patients with end-stage renal disease (ESRD) and Mycobacterium tuberculosis infection pose a high risk of developing active TB disease. It is therefore important to detect latent TB infection (LTBI) to be able to offer treatment and prevent progression to TB disease. We assessed the value of the tuberculin skin test (TST) and of an interferon-gamma release assay (Quantiferon®-TB Gold in-Tube, QFT) for diagnosing LTBI in ESRD patients, after prolonged exposure to a highly contagious TB case in a haemodialysis unit. As a high number of patients presented erythema without induration in the TST response, this type of reaction was also analysed. Method The TST and QFT were simultaneously performed twelve weeks after the last possible exposure to a bacilliferous TB patient. If the first TST (TST-1) was negative, a second TST (TST-2) was performed 15 days later to detect a booster response. A comparison was made between the TST responses (including those cases with erythema without induration) and those for the QFT. The correlation with risk of infection and the concordance between tests were both analysed. Results A total of 52 patients fulfilled the inclusion criteria. Overall, 11 patients (21.2%) had a positive TST response: 3 for TST-1 and 8 for TST-2, and 18 patients (34.6%) showed a positive QFT response (p = 0.065). Erythema without induration was found in 3 patients at TST-1 and in a further 9 patients at TST-2. The three patients with erythema without induration in TST-1 had a positive TST-2 response. Concordance between TST and QFT was weak for TST-1 (κ = 0.21); it was moderate for overall TST (κ = 0.49); and it was strong if both induration and erythema (κ = 0.67) were considered. Conclusions In patients with ESRD, erythema without induration in the TST response could potentially be an indicator of M. tuberculosis infection. The QFT shows better accuracy for LTBI diagnosis than the TST. PMID:22905901

Mycobacterium avium Complex Empyema in a Patient with Interferon Gamma Autoantibodies

PubMed Central

Chung, Heath H; Opal, Steven M; Dworkin, Jonathan D

2014-01-01

Interferon gamma (IFN-γ) autoantibodies are a relatively recently discovered clinical entity, which have been shown to be associated with disseminated non-tuberculous mycobacterial (NTM) infections and other opportunistic infections. Interestingly, isolated NTM infections (without disseminated NTM infection) have not been shown to be a good predictor of the presence of IFN-γ autoantibodies. This case describes an isolated NTM empyema in a patient with IFN-γ autoantibodies and makes the argument that the development of an NTM empyema in a patient with no known immunodeficiency should prompt consideration for IFN-γ testing. Additionally, this case underscores the importance for clinicians to recognize that an unusual infection without the typical cause of impairment in immunity should prompt a more thorough investigation of the patient's immune system. PMID:25285250

Development of a lion-specific interferon-gamma assay.

PubMed

Maas, M; van Kooten, P J S; Schreuder, J; Morar, D; Tijhaar, E; Michel, A L; Rutten, V P M G

2012-10-15

The ongoing spread of bovine tuberculosis (BTB) in African free-ranging lion populations, for example in the Kruger National Park, raises the need for diagnostic assays for BTB in lions. These, in addition, would be highly relevant for zoological gardens worldwide that want to determine the BTB status of their lions, e.g. for translocations. The present study concerns the development of a lion-specific IFN-γ assay, following the production and characterization of monoclonal antibodies specific for lion interferon-gamma (IFN-γ). Recombinant lion IFN-γ (rLIFN-γ) was produced in mammalian cells and used to immunize mice to establish hybridoma cell lines producing monoclonal antibodies. These were used to develop a sensitive, lion IFN-γ-specific capture ELISA, able to detect rLIFN-γ to the level of 160 pg/ml. Recognition of native lion IFN-γ was shown in an initial assessment of supernatants of mitogen stimulated whole blood cultures of 11 known BTB-negative lions. In conclusion, the capture ELISA shows potential as a diagnostic assay for bovine tuberculosis in lions. Preliminary results also indicate the possible use of the test for other (feline) species. Copyright © 2012 Elsevier B.V. All rights reserved.

Tumor necrosis factor alpha mediates resistance to Trypanosoma cruzi infection in mice by inducing nitric oxide production in infected gamma interferon-activated macrophages.

PubMed Central

Silva, J S; Vespa, G N; Cardoso, M A; Aliberti, J C; Cunha, F Q

1995-01-01

Cell invasion by Trypanosoma cruzi and its intracellular replication are essential for continuation of the parasite life cycle and for production of Chagas' disease. T. cruzi is able to replicate in nucleated cells and can be killed by activated macrophages. Gamma interferon (IFN-gamma) is one of the major stimuli for the activation of macrophages and has been shown to be a key activation factor for the killing of intracellular parasites through a mechanism dependent upon nitric oxide (NO) biosynthesis. We show that although the addition of exogenous tumor necrosis factor alpha (TNF-alpha) does not potentiate the trypanocidal activity of IFN-gamma in vitro, treatment of resistant C57BI/6 mice with an anti-TNF-alpha monoclonal antibody increased parasitemia and mortality. In addition, the anti-TNF-alpha-treated animals had decreased NO production, both in vivo and in vitro, suggesting an important role for TNF-alpha in controlling infection. In order to better understand the role of TNF-alpha in the macrophage-mediating killing of parasites, cultures of T. cruzi-infected macrophages were treated with an anti-TNF-alpha monoclonal antibody. IFN-gamma-activated macrophages failed to kill intracellular parasites following treatment with 100 micrograms of anti-TNF-alpha. In these cultures, the number of parasites released at various time points after infection was significantly increased while NO production was significantly reduced. We conclude that IFN-gamma-activated macrophages produce TNF-alpha after infection by T. cruzi and suggest that this cytokine plays a role in amplifying NO production and parasite killing. PMID:7591147

Graft-versus-host disease causes failure of donor hematopoiesis and lymphopoiesis in interferon-gamma receptor-deficient hosts.

PubMed

Delisle, Jean-Sébastien; Gaboury, Louis; Bélanger, Marie-Pier; Tassé, Eliane; Yagita, Hideo; Perreault, Claude

2008-09-01

The immunopathologic condition known as graft-versus-host disease (GVHD) results from a type I T-cell process. However, a prototypical type I cytokine, interferon-gamma (IFN-gamma), can protect against several manifestations of GVHD in recipients of major histocompatibility complex (MHC)-mismatched hematopoietic cells. We transplanted hematopoietic cells from C3H.SW donors in wild-type (wt) and IFN-gamma-receptor-deficient (IFN-gammaRKO) MHC-matched C57BL/6 recipients. In IFN-gammaRKO recipients, host cells were unresponsive to IFN-gamma, whereas wt donor cells were exposed to exceptionally high levels of IFN-gamma. From an IFN-gamma perspective, we could therefore evaluate the impact of a loss-of-function on host cells and gain-of-function on donor cells. We found that lack of IFN-gammaR prevented up-regulation of MHC proteins on host cells but did not mitigate damage to most target organs. Two salient phenotypes in IFN-gammaRKO recipients involved donor cells: lymphoid hypoplasia and hematopoietic failure. Lymphopenia was due to FasL-induced apoptosis and decreased cell proliferation. Bone marrow aplasia resulted from a decreased proliferation of hematopoietic stem/progenitor cells that was associated with down-regulation of 2 genes negatively regulated by IFN-gamma: Ccnd1 and Myc. We conclude that IFN-gamma produced by alloreactive T cells may entail a severe graft-versus-graft reaction and could be responsible for cytopenias that are frequently observed in subjects with GVHD.

Cost effectiveness of interferon-gamma release assay for tuberculosis screening using three months of rifapentine and isoniazid among long-term expatriates from low to high incidence countries.

PubMed

Kowada, Akiko

Long-term expatriates from low to high tuberculosis (TB) incidence countries get high rates of active TB and latent TB infection (LTBI). TB screening for expatriates is important for occupational health. Interferon-gamma release assays are more accurate than tuberculin skin test (TST). Rifapentine plus isoniazid for 3 months (3HP) is as effective as 9 months of isoniazid (9H) with a higher treatment-completion rate. Decision trees and Markov models were constructed using a societal perspective on a lifetime horizon. The target population was a hypothetical cohort of 30 year-old expatriates. Seven strategies; TST with 3HP or 9H, QuantiFERON ® -TB Gold In-Tube (QFT) with 3HP or 9H, T-SPOT ® .TB (TSPOT) with 3HP or 9H and chest X-ray examination (CXR) were modeled. The main outcome measure of effectiveness was quality-adjusted life-years (QALYs) gained. QFT with 3HP yielded the greatest benefits with the lowest cost ($US 674.8; 25.95660 QALYs [year 2012 values]). CXR was the least cost-effective ($US 13,666.8; 24.62917 QALYs). Cost-effectiveness was sensitive to adherence rate of 3HP and QFT specificity, but not to BCG vaccination rate. Entry LTBI screening using QFT treated with 3HP is recommended on the basis of cost effectiveness among long-term expatriates from low to high incidence countries. Copyright © 2016 Elsevier Ltd. All rights reserved.

Dysregulation of Serum Gamma Interferon Levels in Vascular Chronic Q Fever Patients Provides Insights into Disease Pathogenesis

PubMed Central

Kremers, Marjolein N. T.; Hodemaekers, Hennie M.; Hagenaars, Julia C. J. P.; Koning, Olivier H. J.; Renders, Nicole H. M.; Hermans, Mirjam H. A.; de Klerk, Arja; Notermans, Daan W.; Wever, Peter C.; Janssen, Riny

2015-01-01

A large community outbreak of Q fever occurred in the Netherlands in the period 2007 to 2010. Some of the infected patients developed chronic Q fever, which typically includes pathogen dissemination to predisposed cardiovascular sites, with potentially fatal consequences. To identify the immune mechanisms responsible for ineffective clearance of Coxiella burnetii in patients who developed chronic Q fever, we compared serum concentrations of 47 inflammation-associated markers among patients with acute Q fever, vascular chronic Q fever, and past resolved Q fever. Serum levels of gamma interferon were strongly increased in acute but not in vascular chronic Q fever patients, compared to past resolved Q fever patients. Interleukin-18 levels showed a comparable increase in acute as well as vascular chronic Q fever patients. Additionally, vascular chronic Q fever patients had lower serum levels of gamma interferon-inducible protein 10 (IP-10) and transforming growth factor β (TGF-β) than did acute Q fever patients. Serum responses for these and other markers indicate that type I immune responses to C. burnetii are affected in chronic Q fever patients. This may be attributed to an affected immune system in cardiovascular patients, which enables local C. burnetii replication at affected cardiovascular sites. PMID:25924761

Ionizing radiation potentiates the induction of nitric oxide synthase by interferon-gamma (Ifn-gamma) or Ifn-gamma and lipopolysaccharide in bnl cl.2 murine embryonic liver cells: role of hydrogen peroxide.

PubMed

Yoo, J C; Pae, H O; Choi, B M; Kim, W I; Kim, J D; Kim, Y M; Chung, H T

2000-02-01

The effects of ionizing irradiation on the nitric oxide (NO) production in murine embryonic liver cell line, BNL CL.2 cells, were investigated. Various doses (5-40 Gy) of radiation made BNL CL.2 cells responsive to interferon-gamma alone for the production of NO in a dose-dependent manner. Small amounts of lipopolysaccharide (LPS) or tumor necrosis factor-alpha (TNF-alpha) synergized with IFN-gamma in the production of NO from irradiated BNL CL.2 cells, even though LPS or TNF-alpha alone did not induce NO production from the same cells. Immunoblots showed parallel induction of inducible nitric oxide synthase (iNOS). NO production in irradiated BNL CL.2 cells by IFN-gamma or IFN-gamma plus LPS was decreased by the addition of catalase, suggesting that H(2)O(2) produced by ionizing irradiation primed the cells to trigger NO production in response to IFN-gamma or IFN-gamma plus LPS. Furthermore, the treatment of nongamma-irradiated BNL CL.2 cells with H(2)O(2) made the cells responsive to IFN-gamma or IFN-gamma plus LPS for the production of NO. This study shows that ionizing irradiation has the ability to induce iNOS gene expression in responsive to IFN-gamma via the formation of H(2)O(2) in BNL CL.2 murine embryonic liver cells.

Alternative activation of STAT1 and STAT3 in response to interferon-gamma.

PubMed

Qing, Yulan; Stark, George R

2004-10-01

Interferon-gamma (IFNgamma) is a pluripotent cytokine whose major biological effects are mediated through a pathway in which STAT1 is the predominant and essential transcription factor. STAT3 can also be activated weakly by IFNgamma, but the mechanism of activation and function of STAT3 as a part of the interferon response are not known. Here we show that STAT3 activation is much stronger and more prolonged in STAT1-null mouse embryo fibroblasts than in wild-type cells. In response to IFNgamma, SRC-family kinases are required to activate STAT3 (but not STAT1) through tyrosine phosphorylation, whereas the receptor-bound kinases JAK1 and JAK2 are required to activate both STATs. Tyrosine 419 of the IFNgamma receptor subunit 1 (IFNGR1) is required to activate both STATs, suggesting that STAT1 and STAT3 compete with each other for the same receptor phosphotyrosine motif. Activated STAT3 can replace STAT1 in STAT1-null cells to drive the transcription of certain genes, for example, socs-3 and c/ebpdelta, which have gamma-activated sequence motifs in their promoters. Work from Ian Kerr's laboratory reveals that the gp130-linked interleukin-6 receptor, which usually activates STAT3 predominantly, activates STAT1 efficiently when STAT3 is absent. Because STAT1 and STAT3 have opposing biological effects (STAT3 is an oncogene, and STAT1 is a tumor suppressor), the reciprocal activation of these two transcription factors in response to IFNgamma or interleukin-6 suggests that their relative abundance, which may vary substantially in different normal cell types, under different conditions or in tumors is likely to have a major impact on how cells behave in response to different cytokines.

Gamma-interferon causes a selective induction of the lysosomal proteases, cathepsins B and L, in macrophages

NASA Technical Reports Server (NTRS)

Lah, T. T.; Hawley, M.; Rock, K. L.; Goldberg, A. L.

1995-01-01

Previous studies have indicated that acid-optimal cysteine proteinase(s) in the endosomal-lysosomal compartments, cathepsins, play a critical role in the proteolytic processing of endocytosed proteins to generate the antigenic peptides presented to the immune system on major histocompatibility complex (MHC) class II molecules. The presentation of these peptides and the expression of MHC class II molecules by macrophages and lymphocytes are stimulated by gamma-interferon (gamma-IFN). We found that treatment of human U-937 monocytes with gamma-IFN increased the activities and the content of the two major lysosomal cysteine proteinases, cathepsins B and L. Assays of protease activity, enzyme-linked immunosorbant assays (ELISA) and immunoblotting showed that this cytokine increased the amount of cathepsin B 5-fold and cathepsin L 3-fold in the lysosomal fraction. By contrast, the aspartic proteinase, cathepsin D, in this fraction was not significantly altered by gamma-IFN treatment. An induction of cathepsins B and L was also observed in mouse macrophages, but not in HeLa cells. These results suggest coordinate regulation in monocytes of the expression of cathepsins B and L and MHC class II molecules. Presumably, this induction of cysteine proteases contributes to the enhancement of antigen presentation by gamma-IFN.

Interferon-gamma enhances radiation-induced cell death via downregulation of Chk1

PubMed Central

Kim, Kwang Seok; Choi, Kyu Jin; Bae, Sangwoo

2012-01-01

Interferon-gamma (IFNγ) is a cytokine with roles in immune responses as well as in tumor control. Interferon is often used in cancer treatment together with other therapies. Here we report a novel approach to enhancement of cancer cell killing by combined treatment of IFNγ with ionizing radiation. We found that IFNγ treatment alone in HeLa cells induced phosphorylation of Chk1 in a time- and dose-dependent manner, and resulted in cell arrest. Moreover IFNγ treatment was correlated with attenuation of Chk1 as the treatment shortened protein half-life of Chk1. As Chk1 is an essential cell cycle regulator for viability after DNA damage, attenuation of Chk1 by IFNγ pre-treatment in HeLa cells resulted in increased cell death following ionizing radiation about 2-folds than ionizing radiation treatment alone whereas IFNγ treatment alone had little effect on cell death. X-linked inhibitor of apoptosis-associated factor 1 (XAF1), an IFN-induced gene, seems to partly regulate IFNγ-induced Chk1 destabilization and radiation sensitivity because transient depletion of XAF1 by siRNA prevented IFNγ-induced Chk1 attenuation and partly protected cells from IFNγ-enhanced radiation cell killing. Therefore the results provide a novel rationale to combine IFNγ pretreatment and DNA-damaging anti-cancer drugs such as ionizing radiation to enhance cancer cell killing. PMID:22825336

Acetylcholine Release in Prefrontal Cortex Promotes Gamma Oscillations and Theta-Gamma Coupling during Cue Detection.

PubMed

Howe, William M; Gritton, Howard J; Lusk, Nicholas A; Roberts, Erik A; Hetrick, Vaughn L; Berke, Joshua D; Sarter, Martin

2017-03-22

The capacity for using external cues to guide behavior ("cue detection") constitutes an essential aspect of attention and goal-directed behavior. The cortical cholinergic input system, via phasic increases in prefrontal acetylcholine release, plays an essential role in attention by mediating such cue detection. However, the relationship between cholinergic signaling during cue detection and neural activity dynamics in prefrontal networks remains unclear. Here we combined subsecond measures of cholinergic signaling, neurophysiological recordings, and cholinergic receptor blockade to delineate the cholinergic contributions to prefrontal oscillations during cue detection in rats. We first confirmed that detected cues evoke phasic acetylcholine release. These cholinergic signals were coincident with increased neuronal synchrony across several frequency bands and the emergence of theta-gamma coupling. Muscarinic and nicotinic cholinergic receptors both contributed specifically to gamma synchrony evoked by detected cues, but the effects of blocking the two receptor subtypes were dissociable. Blocking nicotinic receptors primarily attenuated high-gamma oscillations occurring during the earliest phases of the cue detection process, while muscarinic (M1) receptor activity was preferentially involved in the transition from high to low gamma power that followed and corresponded to the mobilization of networks involved in cue-guided decision making. Detected cues also promoted coupling between gamma and theta oscillations, and both nicotinic and muscarinic receptor activity contributed to this process. These results indicate that acetylcholine release coordinates neural oscillations during the process of cue detection. SIGNIFICANCE STATEMENT The capacity of learned cues to direct attention and guide responding ("cue detection") is a key component of goal-directed behavior. Rhythmic neural activity and increases in acetylcholine release in the prefrontal cortex contribute to

Acetylcholine Release in Prefrontal Cortex Promotes Gamma Oscillations and Theta–Gamma Coupling during Cue Detection

PubMed Central

Hetrick, Vaughn L.; Berke, Joshua D.

2017-01-01

The capacity for using external cues to guide behavior (“cue detection”) constitutes an essential aspect of attention and goal-directed behavior. The cortical cholinergic input system, via phasic increases in prefrontal acetylcholine release, plays an essential role in attention by mediating such cue detection. However, the relationship between cholinergic signaling during cue detection and neural activity dynamics in prefrontal networks remains unclear. Here we combined subsecond measures of cholinergic signaling, neurophysiological recordings, and cholinergic receptor blockade to delineate the cholinergic contributions to prefrontal oscillations during cue detection in rats. We first confirmed that detected cues evoke phasic acetylcholine release. These cholinergic signals were coincident with increased neuronal synchrony across several frequency bands and the emergence of theta–gamma coupling. Muscarinic and nicotinic cholinergic receptors both contributed specifically to gamma synchrony evoked by detected cues, but the effects of blocking the two receptor subtypes were dissociable. Blocking nicotinic receptors primarily attenuated high-gamma oscillations occurring during the earliest phases of the cue detection process, while muscarinic (M1) receptor activity was preferentially involved in the transition from high to low gamma power that followed and corresponded to the mobilization of networks involved in cue-guided decision making. Detected cues also promoted coupling between gamma and theta oscillations, and both nicotinic and muscarinic receptor activity contributed to this process. These results indicate that acetylcholine release coordinates neural oscillations during the process of cue detection. SIGNIFICANCE STATEMENT The capacity of learned cues to direct attention and guide responding (“cue detection”) is a key component of goal-directed behavior. Rhythmic neural activity and increases in acetylcholine release in the prefrontal cortex

Poor agreement between interferon-gamma release assays and the tuberculin skin test among HIV-infected individuals in the country of Georgia.

PubMed

Chkhartishvili, Nikoloz; Kempker, Russell R; Dvali, Natia; Abashidze, Lela; Sharavdze, Lali; Gabunia, Pati; Blumberg, Henry M; Del Rio, Carlos; Tsertsvadze, Tengiz

2013-11-01

Improved tests to diagnose latent TB infection (LTBI) are needed. We sought to evaluate the performance of two commercially available interferon-gamma release assays (IGRAs) compared to the tuberculin skin test (TST) for the diagnosis of LTBI and to identify risk factors for LTBI among HIV-infected individuals in Georgia, a country with high rates of TB. HIV-patients were enrolled from the National AIDS Center in Tbilisi, Georgia. After providing informed consent, each participant completed a questionnaire, had blood drawn for QuantiFERON-TB Gold in-Tube (QFT-GIT) and T-SPOT.TB testing and had a TST placed. The TST was read at 48-72 hrs with ≥ 5 mm induration considered positive. Between 2009-2011, 240 HIV-infected persons (66% male) with a median age of 38 years and a median CD4 count of 255 cells/μl (IQR: 124-412) had diagnostic testing for LTBI performed. 94% had visible evidence of a BCG scar. The TST was positive in 41 (17%) patients; QFT-GIT in 70 (29%); and T-SPOT.TB in 56 (24%). At least one diagnostic test was positive in 109 (45%) patients and only among 13 (5%) patients were all three tests positive. Three (1%) QFT-GIT and 19 (8%) T-SPOT.TB test results were indeterminate. The agreement among all pairs of tests was poor: QFT-GIT vs. T-SPOT.TB (κ = 0.18, 95% CI .07-.30), QFT-GIT vs. TST (κ = 0.29, 95% CI .16-.42), and TST vs. T-SPOT.TB (κ = 0.22, 95% CI .07-.29). Risk factors for LTBI varied by diagnostic test and none showed associations between positive test results and well-known risk factors for TB, such as imprisonment, drug abuse and immunological status. A high proportion of HIV patients had at least one positive diagnostic test for LTBI; however, there was very poor agreement among all tests. This lack of agreement makes it difficult to know which test is superior and most appropriate for LTBI testing among HIV-infected patients. While further follow-up studies will help determine the predictive ability of different LTBI tests, improved

Heterogeneity within populations of recombinant Chinese hamster ovary cells expressing human interferon-gamma.

PubMed

Coppen, S R; Newsam, R; Bull, A T; Baines, A J

1995-04-20

The Chinese hamster ovary (CHO) cell line has great commercial importance in the production of recombinant human proteins, especially those for therapeutic use. Much attention has been paid to CHO cell population physiology in order to define factors affecting product fidelity and yield. Such studies have revealed that recombinant proteins, including human interferon-gamma (IFN-gamma), can be heterogeneous both in glycosylation and in proteolytic processing. The type of heterogeneity observed depends on the growth physiology of the cell population, although the relationship between them is complex. In this article we report results of a cytological study of the CHO320 line which expresses recombinant human IFN-gamma. When grown in suspension culture, this cell line exhibited three types of heterogeneity: (1) heterogeneity of the production of IFN-gamma within the cell population, (2) heterogeneity of the number of nuclei and mitotic spindles in dividing cells, and (3) heterogeneity of cellular environment. The last of these arises from cell aggregates which form in suspension culture: Some cells are exposed to the culture medium; others are fully enclosed within the mass with little or no direct access to the medium. Thus, live cells producing IFN-gamma are heterogeneous in their environment, with variable access to O(2) and nutrients. Within the aggregates, it appears that live cells proliferate on a dead cell mass. The layer of live cells can be several cells deep. Specific cell-cell attachments are observed between the living cells in these aggregates. Two proteins, known to be required for the formation of certain types of intercellular junctions, spectrin and vinculin, have been localized to the regions of cell-cell contact. The aggregation of the cells appears to be an active process requiring protein synthesis. (c) 1995 John Wiley & Sons, Inc.

Household food insecurity is associated with low interferon-gamma levels in pregnant Indian women.

PubMed

Vaidya, A; Bhosale, R; Sambarey, P; Suryavanshi, N; Young, S; Mave, V; Kanade, S; Kulkarni, V; Deshpande, P; Balasubramanian, U; Elf, J; Gupte, N; Gupta, A; Mathad, J S

2017-07-01

Over 20% of tuberculosis (TB) cases during pregnancy occur in India. To determine the association between household food insecurity and interferon-gamma (IFN-γ) levels in pregnancy. Pregnant women in India were administered the Household Food Insecurity Access Scale (HFIAS) questionnaire and underwent an IFN-γ release assay. Logistic regression was used to identify factors associated with food insecurity. Of 538 women, 60 (11%) had household food insecurity, 47 (78%) of which were moderate or severe food insecure. After mitogen stimulation, moderate or severe food insecure women had a median IFN-γ concentration of 4.2 IU/ml (IQR 2.2-9.8) vs. 8.4 IU/ml (IQR 3.0-10) in women with no or mild food insecurity (P = 0.03). In multivariate analysis, higher IFN-γ concentrations were associated with human immunodeficiency virus infection (OR 1.3, 95%CI 0.51-2.1, P = 0.001), and inversely associated with moderate or severe food insecurity (OR -1.6, 95%CI -2.9 to -0.27, P = 0.02) and the number of adults in the household (OR -0.08, 95%CI -0.16 to -0.01, P = 0.03). There was no association between food insecurity and IFN-γ response to Mycobacterium tuberculosis antigen. Food insecurity in pregnancy is associated with low IFN-γ levels. There was no association between food insecurity and IFN-γ response to M. tuberculosis antigen, but our study was underpowered to detect this outcome.

Persistently retained interferon-gamma responsiveness in individuals with a history of pulmonary tuberculosis.

PubMed

Seo, Kwang Won; Ahn, Jong-Joon; Ra, Seung Won; Kwon, Woon-Jung; Jegal, Yangjin

2014-06-01

The interferon gamma (IFN-γ) release assays (IGRAs) are the best method of detecting Mycobacterium tuberculosis infection. However, reports on IGRAs results obtained during and right after the treatment of tuberculosis (TB) have presented differing results. Some studies have shown declining responses, whereas other reports described persistent, fluctuating, or increasing responses. We postulated that the IGRA-positivity will decrease or revert long time after treatment of TB, and thus, evaluated the response of IGRA in subjects with a history of pulmonary TB. Seventy subjects (M:F = 51:19; age = 53.2 ± 11.8 years) underwent tuberculin skin tests (TSTs) and IGRA. The interval of time elapsed after the completion of anti-TB treatment was < 10 years for 16 subjects, 10-20 years for 13 subjects, 20-30 years for 16 subjects, and ≥ 30 years for 25 subjects. The TST was positive in 49 subjects (74%) and negative in 17 subjects (26%). The IGRA was positive in 52 subjects (74%) and negative in 18 subjects (26%). The IFN-γ level and the size of induration showed good correlation (r = 0.525, P < 0.001). However, the correlation between time elapsed after the completion of anti-TB treatment and the size of induration or that between time and the IFN-γ level was not significant. The TST and IGRA were positive in 72.7% and 68.0% of subjects ≥ 30 years after the treatment of pulmonary TB. In conclusion, majority of subjects with a history of pulmonary TB are IGRA-positive, even a few decades after the completion of anti-TB treatment.

Inhibited interferon production after space flight

NASA Technical Reports Server (NTRS)

Sonnenfeld, G.; Gould, C. L.; Williams, J.; Mandel, A. D.

1988-01-01

Several studies have been performed in our laboratories indicating that interferon production may be impaired in rodents after space flight. Using an antiorthostatic suspension model that simulates some of the effects of microgravity seen during space flight, we have shown that interferon-alpha/beta production was inhibited. The inhibition was not due solely to the stress of suspension. The inhibited interferon production was transient, as suspended animals returned to normal caging recovered the ability to produce interferon. Antiorthostatic suspension of mice also resulted in a loss of resistance to infection with the diabetogenic strain of encephalomyocarditis virus, which correlated with the drop in interferon production. In rats flown in US Space Shuttle mission SL-3, interferon-gamma production was inhibited severely when spleen cells were challenged with concanavalin-A upon return to earth. In contrast, interleukin-3 production by these cells was normal. These results suggest that immune responses may be altered after antiorthostatic modeling or space flight, and the resistance to viral infections may be especially affected.

The Significance of Sensitive Interferon Gamma Release Assays for Diagnosis of Latent Tuberculosis Infection in Patients Receiving Tumor Necrosis Factor-α Antagonist Therapy.

PubMed

Jung, Yu Jung; Woo, Hye In; Jeon, Kyeongman; Koh, Won-Jung; Jang, Dong Kyoung; Cha, Hoon Suk; Koh, Eun Mi; Lee, Nam Yong; Kang, Eun-Suk

2015-01-01

We compared two interferon gamma release assays (IGRAs), QuantiFERON-TB Gold In-Tube (QFT-GIT) and T-SPOT.TB, for diagnosis of latent tuberculosis infection (LTBI) in patients before and while receiving tumor necrosis factor (TNF)-α antagonist therapy. This study evaluated the significance of sensitive IGRAs for LTBI screening and monitoring. Before starting TNF-α antagonist therapy, 156 consecutive patients with rheumatic diseases were screened for LTBI using QFT-GIT and T-SPOT.TB tests. According to our study protocol, QFT-GIT-positive patients received LTBI treatment. Patients positive by any IGRAs were subjected to follow-up IGRA tests after completing LTBI-treatment and/or during TNF-α antagonist therapy. At the initial LTBI screening, 45 (28.9%) and 70 (44.9%) patients were positive by QFT-GIT and T-SPOT.TB, respectively. The agreement rate between IGRA results was 78.8% (k = 0.56; 95% confidence interval [95% CI] = 0.43 to 0.68). Of 29 patients who were positive only by T-SPOT.TB in the initial screening, 83% (19/23) were persistently positive by T-SPOT.TB, while QFT-GIT testing showed that 36% (9/25) had conversion during TNF-α antagonist therapy. By the end of the follow-up period (218 to 1,264 days), four patients (4/137, 2.9%) developed active tuberculosis (TB) diseases during receiving TNF-α antagonist therapy. Among them, one was Q-T+, one was Q+T-, and the remaining two were Q-T- at the initial screening (Q, QuantiFERON-TB Gold In-Tube; T, T-SPOT.TB; +, positive; -, negative). Two (2/4, 50%) patients with TB reactivation had at least one prior risk factor consistent with previous TB infection. This study demonstrated the need to capitalize on sensitive IGRAs to monitor for LTBI in at-risk patients for a more sensitive diagnosis in countries with an intermediate TB burden.

Mice with Pulmonary Tuberculosis Treated with Mycobacterium vaccae Develop Strikingly Enhanced Recall Gamma Interferon Responses to M. vaccae Cell Wall Skeleton▿

PubMed Central

Rodríguez-Güell, Elisabeth; Agustí, Gemma; Corominas, Mercè; Cardona, Pere-Joan; Luquin, Marina; Julián, Esther

2008-01-01

Whole heat-killed Mycobacterium vaccae is used as an immunotherapeutic agent in tuberculosis (TB), but the compound(s) that triggers its immunostimulatory ability is not known. Here, we show that among different subcellular fractions, the cell wall skeleton induced a prominent expression of gamma interferon in splenocytes from both non-TB and TB M. vaccae-treated mice. PMID:18337379

Gamma Interferon-Induced T-Cell Loss in Virulent Mycobacterium avium Infection

PubMed Central

Flórido, Manuela; Pearl, John E.; Solache, Alejandra; Borges, Margarida; Haynes, Laura; Cooper, Andrea M.; Appelberg, Rui

2005-01-01

Infection by virulent Mycobacterium avium caused progressive severe lymphopenia in C57BL/6 mice due to increased apoptosis rates. T-cell depletion did not occur in gamma interferon (IFN-γ)-deficient mice which showed increased T-cell numbers and proliferation; in contrast, deficiency in nitric oxide synthase 2 did not prevent T-cell loss. Although T-cell loss was IFN-γ dependent, expression of the IFN-γ receptor on T cells was not required for depletion. Similarly, while T-cell loss was optimal if the T cells expressed IFN-γ, CD8+ T-cell depletion could occur in the absence of T-cell-derived IFN-γ. Depletion did not require that the T cells be specific for mycobacterial antigen and was not affected by deficiencies in the tumor necrosis factor receptors p55 or p75, the Fas receptor (CD95), or the respiratory burst enzymes or by forced expression of bcl-2 in hematopoietic cells. PMID:15908387

[Regulating human interferon-gamma gene expression in marrow stromal cells in mice by Tet-off system].

PubMed

Qin, Xin-Tian; Lu, Yue; Tan, Yin-Duo; Chen, Xiao-Qin; Gen, Qi-Rong

2008-01-01

We have constructed plasmid "pTre-IFN-gamma" and proved that the Tet-off system could regulate the expression of human interferon-gamma (IFN-gamma) gene in murine marrow stromal cells in vitro. This study was to investigate the regulatory reversibility of Tet-off system and its effect on the expression of human IFN-gamma gene in murine marrow stromal cells in mice. Plasmids pTet-off and pTre-IFN-gamma were co-transfected into murine marrow stromal cells. The expression of IFN-gamma in marrow stromal cells was detected with ELISA. The marrow stromal cells were transfused into BABL/c naked mice after co-transfection. The expression of IFN-gamma mRNA in the spleen was detected by real-time fluorescent quantitative reverse transcription-polymerase chain reaction (RT-PCR). IFN-gamma protein was detected in the culture solution of marrow stromal cells after co-transfection. The secretion peak appeared within the first 72 h. The protein level of IFN-gamma was significantly lower in 300 ng/ml tetracycline hydrochloride-treated marrow stroma cells than in untreated cells [(67.11+/-22.14) pg/1 x 10(7) cells vs. (319.96+/-29.04) pg/1 x 10(7) cells, P<0.001]; its expression was increased when removed tetracycline hydrochloride (P=0.032). The expression of human IFN-gamma mRNA was detected in the spleen. The mRNA level of IFN-gamma was significantly higher in untreated group than in continuous tetracycline hydrochloride-treated group [(1.5+/-0.7)x10(5) copies . (100 mg)(-1) vs. (6.9+/-5.3)x10(2) copies . (100 mg)(-1), P<0.001]; its expression in the mice received tetracycline hydrochloride for one single time lay between the above two groups with significant difference. In mice, Tet-off system could rapidly, efficiently and reversibly regulate the expression of human IFN-gamma gene in marrow stromal cells in vitro and in vivo.

Interleukin-4 but not gamma interferon production correlates with the severity of murine cutaneous leishmaniasis.

PubMed Central

Morris, L; Troutt, A B; McLeod, K S; Kelso, A; Handman, E; Aebischer, T

1993-01-01

For murine cutaneous leishmaniasis, data to date suggest a correlation between the presence of gamma interferon (IFN-gamma) and resistance in C57BL/6 mice and the presence of interleukin-4 (IL-4) and disease in BALB/c mice. In this study, 13 inbred strains of mice covering the range of susceptibility to disease were infected with Leishmania major to determine whether the subsequent expression of IFN-gamma or IL-4 is a reliable indicator of cure or progressive disease. The presence of IL-4 and IFN-gamma mRNAs in the draining lymph nodes was examined 9 weeks after infection, when differences in disease severity became obvious. There were large differences in the levels of IL-4 mRNA among the different strains, whereas IFN-gamma mRNA was detected at similar levels in all strains. The levels of IL-4 mRNA correlated with lesion score, with susceptible and intermediate strains containing up to 100-fold more than any of the resistant strains. Differences in the levels of IFN-gamma mRNA were within only a fourfold range, with significant overlap among susceptible, intermediate, and resistant strains. Similarly, the levels of IFN-gamma secreted in vitro by lymph node cells from infected mice in response to L. major antigens were within a 10-fold range for most strains, and there was no correlation with lesion score. Analysis of Leishmania-specific antibody levels revealed a correlation between immunoglobulin G1 (IgG1) titers and lesion score, consistent with the role of IL-4 as a switch factor for IgG1. In contrast, there was no correlation between IgG2a titers and lesion score, supporting the notion that IFN-gamma synthesis (which promotes IgG2a production) is not correlated with disease state. These data suggest that along the spectrum of murine cutaneous leishmaniasis, IL-4 is a reliable indicator of disease, but IFN-gamma is not prognostic for resistance. Images PMID:8335376

Effect of interferons and other biological response modifiers (BRMS) on macrophage-mediated inhibition of Listeria monocytogenes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Badger, A.M.; Swift, B.; Sung, C.P.

1986-03-05

Recombinant murine gamma interferon (IFN-..gamma..) activates oil elicited C57BL/6 peritoneal macrophages to inhibit the growth of Listeria. Maximum activity is obtained with 10-20 units/ml, can be demonstrated in the absence of antibiotics and is not due to LPS contamination. Studies of the kinetics of this phenomenon demonstrate that a 30 minute incubation with IFN-..gamma.. is sufficient to initiate the antiproliferative state and full activity can be obtained with a 4 hour incubation. Alpha/beta interferon (IFN-..cap alpha../..beta..) is also active but requires 100X more units to obtain equivalent activity. The evaluation of a number of other BRMS demonstrated that MDP andmore » LPS could stimulate phagocytosis of Listeria but could not inhibit their growth. Bestatin, tuftsin, Con A, A23187 and Poly I:C did not stimulate either phagocytosis or growth inhibitory activity. These compounds were also tested for their ability to enhance the release of superoxide anion from PMA stimulated macrophages. With the exception of tuftsin and bestatin all of the BRMS tested were able to enhance the production of oxidative burst products confirming the findings of others of the dissociation between the two functions.« less

The likelihood of an indeterminate test result from a whole-blood interferon-gamma release assay for the diagnosis of Mycobacterium tuberculosis infection in children correlates with age and immune status.

PubMed

Haustein, Thomas; Ridout, Deborah A; Hartley, John C; Thaker, Urvashi; Shingadia, Delane; Klein, Nigel J; Novelli, Vas; Dixon, Garth L J

2009-08-01

Interferon-gamma release assays for the diagnosis of infection with Mycobacterium tuberculosis have been increasingly used in recent years and are endorsed by national guidelines, but experience regarding their use in children is still limited. We retrospectively evaluated the routine use of the QuantiFERON-TB Gold In-Tube assay (QFT-IT) in a pediatric tertiary care center with a high prevalence of immunocompromising conditions. The relationship between age, immune status, and likelihood of an indeterminate test result was analyzed using logistic regression analysis and fractional polynomials. Two hundred thirty-seven tests from 237 children were included in the analysis. Fifty-nine children (25%) were immunocompromised by our definition. An indeterminate test result was obtained in 83 children (35%). The likelihood of an indeterminate test result was inversely correlated with age (P < 0.001) for children who were not known to be immunocompromised, and decreased by 13% per year of age. Impaired immunity (P < 0.001) was independently associated with a higher probability of an indeterminate QFT-IT. Among 161 children with a documented tuberculin skin test, 89% had a concordant QFT-IT (kappa = 0.71). Twelve of 16 patients with culture-proven TB had a positive QFT-IT. These data suggest that QFT-IT may not provide a determinate test result in a substantial proportion of children in a tertiary care setting due to the combination of young age and primary and acquired immune deficiencies.

Screening of latent tuberculosis infection among health care workers working in Hajj pilgrimage area in Saudi Arabia, using interferon gamma release assay and tuberculin skin test.

PubMed

Bukhary, Zakeya A; Amer, Soliman M; Emara, Magdy M; Abdalla, Mohammad E; Ali, Sahar A

2018-01-01

Interferon gamma release assays (IGRA) is highly specific for Mycobacterium tuberculosis and is the preferred test in BCG-vaccinated individuals. The few studies that have screened health care workers (HCWs) in Saudi Arabia for latent tuberculosis infection (LTBI) using IGRA have varied in agreement with the traditional tuberculin skin test (TST). Assess the prevalence of LTBI among HCWs working in the Hajj pilgrimage using IGRA and TST and measuring their agreement. Cross-sectional prospective. Multiple non-tertiary care hospitals. HCWs who worked during the Hajj pilgrimage in Saudi Arabia in December 2015. Data was collected by standarized questionnaire. Samples were drawn and analyzed by standard methods. The prevalence of LTBI among HCW and the agreement by kappa statistic between QFT-GIT and TST. 520 subjects. Nurses accounted for 30.7% of the sample and physicians, 19.2%. The majority were BCG vaccinated (98.5%). There were a total of 56 positive by QFT-GIT and the LTBI rate was 10.8%. In 50 QFT positive/476 TST negative the LTBI rate was 10.5% in discordant tests, and in 6 QFT positive/44 TST positive it was 13.6% in concordant tests. The overall agreement between both tests was poor-83% and kappa was 0.02. LTBI prevalence was associated with longer employment (13.1 [9.2] years). The QFT-GIT positive test was significantly higher in physicians (P=.02) and in HCWs working in chest hospitals 16/76 (21.05%) (P=.001). Agreement between the tests was poor. QFT-GIT detected LTBI when TST was negative in HCWs who had a history of close contact with TB patients. A second step TST was not feasible within 2-3 weeks. None.

Effect of Pregnancy on Interferon Gamma Release Assay and Tuberculin Skin Test Detection of Latent TB Infection Among HIV-Infected Women in a High Burden Setting.

PubMed

LaCourse, Sylvia M; Cranmer, Lisa M; Matemo, Daniel; Kinuthia, John; Richardson, Barbra A; Horne, David J; John-Stewart, Grace

2017-05-01

Peripartum immunologic changes may affect latent tuberculosis infection (LTBI) diagnostic performance among HIV-infected women. HIV-infected women were serially tested with tuberculin skin test (TST) and interferon gamma release assay [QuantiFERON TB Gold In-tube (QFT)] in pregnancy and 6 weeks postpartum in Kenya. Prevalence, sensitivity and agreement, and correlates of QFT/TST positivity were assessed. Quantitative QFT mitogen and Mycobacterium tuberculosis antigen (Mtb-Ag) responses were compared by peripartum stage. Incidence of test conversion at 6 weeks postpartum was evaluated in baseline TST-/QFT- women. Among 100 HIV-infected women, median age was 26 years, median CD4 was 555 cells per cubic millimeter, and 88% were on antiretrovirals. More women were QFT+ than TST+ in both pregnancy (35.4% vs. 13.5%, P = 0.001) and postpartum (29.6% vs. 14.8%, P < 0.001). Among 18 consistently QFT+ women, 8 (44%) converted from TST- to TST+, with improved test agreement postpartum (56.9%, κ = 0.20 to 82.4%, κ = 0.60). Three initially QFT-/TST- women had test conversion (TST+ and/or QFT+), suggesting new infection (incidence 13.4/100 person-years). Mean QFT mitogen (4.46 vs. 7.64 IU/mL, P < 0.001) and Mtb-Ag (1.03 vs. 1.54 IU/mL, P = 0.03) responses were lower among all women retested in pregnancy vs. postpartum, and specifically among persistently QFT+ women (Mtb-Ag: 3.46 vs. 4.48 IU/mL, P = 0.007). QFT indeterminate rate was higher in pregnancy (16%) compared with postpartum (0%) because of lower mitogen response. QFT identified >2-fold more women with LTBI compared with TST in pregnancy and postpartum. Lower QFT Mtb-Ag and mitogen responses in pregnancy compared with postpartum suggest that pregnancy-associated immunologic changes may influence LTBI test performance.

Treatment of trypanosome-infected mice with exogenous interferon, interferon inducers, or antibody to interferon

NASA Technical Reports Server (NTRS)

Degee, Antonie L. W.; Mansfield, John M.; Sonnenfeld, Gerald

1986-01-01

Earlier studies have demonstrated that mice resistant to Trypanosoma brucei rhodesiense (the B10.BR/SgSnJ strain) produces, upon infection by this parasite, two peaks of serum interferon (IFN), while the susceptible mice (C3HeB/FeJ) produces no IFN. In the present study, survival times were compared for B10.BR/SgSnJ, C3HeB/FeJ, and CBA/J (an intermediately resistant strain) mice that were injected, prior to infection with the parasite, with either of the following three preparations (1) IFN-gamma, (2) an antibody to IFN-gamma and (3) polyriboinosinic-polyribocytidylic acid (to induce IFN-alpha/beta). No effect on the survival times of mice by any of these preparations could be demonstrated, contrary to some previous reports.

Annexin V Incorporated into Influenza Virus Particles Inhibits Gamma Interferon Signaling and Promotes Viral Replication

PubMed Central

Berri, Fatma; Haffar, Ghina; Lê, Vuong Ba; Sadewasser, Anne; Paki, Katharina; Lina, Bruno; Wolff, Thorsten

2014-01-01

ABSTRACT During the budding process, influenza A viruses (IAVs) incorporate multiple host cell membrane proteins. However, for most of them, their significance in viral morphogenesis and infectivity remains unknown. We demonstrate here that the expression of annexin V (A5) is upregulated at the cell surface upon IAV infection and that a substantial proportion of the protein is present in lipid rafts, the site of virus budding. Western blotting and immunogold analysis of highly purified IAV particles showed the presence of A5 in the virion. Significantly, gamma interferon (IFN-γ)-induced Stat phosphorylation and IFN-γ-induced 10-kDa protein (IP-10) production in macrophage-derived THP-1 cells was inhibited by purified IAV particles. Disruption of the IFN-γ signaling pathway was A5 dependent since downregulation of its expression or its blockage reversed the inhibition and resulted in decreased viral replication in vitro. The functional significance of these results was also observed in vivo. Thus, IAVs can subvert the IFN-γ antiviral immune response by incorporating A5 into their envelope during the budding process. IMPORTANCE Many enveloped viruses, including influenza A viruses, bud from the plasma membrane of their host cells and incorporate cellular surface proteins into viral particles. However, for the vast majority of these proteins, only the observation of their incorporation has been reported. We demonstrate here that the host protein annexin V is specifically incorporated into influenza virus particles during the budding process. Importantly, we showed that packaged annexin V counteracted the antiviral activity of gamma interferon in vitro and in vivo. Thus, these results showed that annexin V incorporated in the viral envelope of influenza viruses allow viral escape from immune surveillance. Understanding the role of host incorporated protein into virions may reveal how enveloped RNA viruses hijack the host cell machinery for their own purposes. PMID

Siglec-1 inhibits RSV-induced interferon gamma production by adult T cells in contrast to newborn T cells.

PubMed

Jans, Jop; Unger, Wendy W J; Vissers, Marloes; Ahout, Inge M L; Schreurs, Inge; Wickenhagen, Arthur; de Groot, Ronald; de Jonge, Marien I; Ferwerda, Gerben

2018-04-01

Interferon gamma (IFN-γ) plays an important role in the antiviral immune response during respiratory syncytial virus (RSV) infections. Monocytes and T cells are recruited to the site of RSV infection, but it is unclear whether cell-cell interactions between monocytes and T cells regulate IFN-γ production. In this study, micro-array data identified the upregulation of sialic acid-binding immunoglobulin-type lectin 1 (Siglec-1) in human RSV-infected infants. In vitro, RSV increased expression of Siglec-1 on healthy newborn and adult monocytes. RSV-induced Siglec-1 on monocytes inhibited IFN-γ production by adult CD4 + T cells. In contrast, IFN-γ production by RSV in newborns was not affected by Siglec-1. The ligand for Siglec-1, CD43, is highly expressed on adult CD4 + T cells compared to newborns. Our data show that Siglec-1 reduces IFN-γ release by adult T cells possibly by binding to the highly expressed CD43. The Siglec-1-dependent inhibition of IFN-γ in adults and the low expression of CD43 on newborn T cells provides a better understanding of the immune response against RSV in early life and adulthood. © 2017 The Authors. European Journal of Immunology published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Effect of treatment with interferon-gamma and concanavalin A on the course of infection of mice with Salmonella typhimurium strain LT-2

NASA Technical Reports Server (NTRS)

Gould, Cheryl L.; Sonnenfeld, Gerald

1987-01-01

The effect of pretreatment of mice with 34 units/day, for five days, of interferon-gamma (IFN-gamma) on the course of infection with LD50 of Salmonella typhimurium strain LT-2 was assessed, using two IFN preparations: (1) a hybridoma supernatant fluid containing concanavalin-A-induced IFN-gamma activity and (2) pure murine IFN-gamma produced by recombinant DNA technology. The hybridoma supernatant-treated Salmonella-infected mice were found to die faster than mice treated only with Salmonella. Pure murine IFN-gamma was found to protect infected mice significantly, with 95 percent of mice surviving LD50 infection. In contrast, the Salmonella-infected mice treated with hybridoma supernatant were found to die faster than the Salmonella-infected untreated controls. Mice treated with concanavalin A alone prior to infection with S. typhimurium died more quickly than the untreated infected controls, suggesting that contamination with concanavalin A had a detrimental effect on mice survival.

Stress-induced alterations in interferon production and class II histocompatibility antigen expression

NASA Technical Reports Server (NTRS)

Sonnenfeld, G.; Cunnick, J. E.; Armfield, A. V.; Wood, P. G.; Rabin, B. S.

1992-01-01

Mild electric foot-shock has been shown to be a stressor that can alter immune responses. Male Lewis rats were exposed to one session of 16 5.0-s 1.6-mA foot-shocks. Production of interferon-gamma by splenocytes in response to concanavalin-A was decreased in spleens from the shocked rats compared to control spleens. Spleen cells from rats treated with nadolol, a peripherally acting beta-adrenergic receptor antagonist, and then shocked, showed dose-dependent attenuation of the suppression of interferon-gamma production. This suggests that catecholamines mediate shock-induced suppression of interferon-gamma production. The percentage of splenic mononuclear cells expressing class II histocompatibility (Ia) antigens on their surfaces from spleens of shocked rats was determined by flow cytometry. Significantly decreased class II positive mononuclear cells were present in the spleens of shocked rats in comparison to the spleens of control rats. This may reflect an alteration of cell trafficking or decreased production of class II antigens.

Interferon-gamma alone triggers the production of nitric oxide from serum-starved BNL CL.2, murine embryonic liver cells.

PubMed

Pae, H O; Yoo, J C; Choi, B M; Paik, S G; Kim, Y H; Jin, H S; Chung, H T

1999-01-01

A previous study has demonstrated that both interferon-gamma (IFN-gamma) and lipopolysaccharide (LPS) were needed to induce the production of nitric oxide (NO) in BNL CL.2 cells, murine embryonic liver cells. We here demonstrate that when BNL CL.2 cells were cultured with serum-free medium, they were induced to produce NO by the stimulation of IFN-gamma alone. BNL CL.2 cells were cultured with serum-free or serum-containing medium for 1-3 days and then stimulated to synthesize NO by IFN-gamma. Surprisingly, only serum-starved cells showed significant amount of nitrite accumulation and iNOS protein expression in response to IFN-gamma in dose- and time-dependent manners, but serum-supplied cells did not. When the cells were stimulated with IFN-gamma, tumor necrosis factor-alpha (TNF-alpha), or LPS in combinations, only the combination of IFN-gamma and LPS produced more NO than that produced by IFN-gamma alone. The production of NO by the cells stimulated with IFN-gamma or IFN-gamma plus LPS was blocked by the addition of N(G)-monomethyl-L-arginine (N(G)MMA), a NO synthesis inhibitor. To address the intracellular signal pathway responsible for the production of NO by the cells stimulated with IFN-gamma aloneor IFN-gamma plus LPS, we examined the effects of several protein kinase inhibitors on the production of NO from the cells. The production of NO was significantly inhibited by protein tyrosine kinase (PTK) inhibitors, genistein and herbimycin A, but not by protein kinase A or C inhibitors. These results suggest that the deprivation of serum from BNL CL.2 cell culture medium might prime the cells to induce NO synthesis when the cells are triggered by IFN-gamma and the involvement of PTK signal transduction pathway in the expression of inducible NO synthase gene in murine hepatoma cells.

Interferon-gamma exerts its negative regulatory effect primarily on the earliest stages of murine erythroid progenitor cell development.

PubMed

Wang, C Q; Udupa, K B; Lipschitz, D A

1995-01-01

Interferon-gamma (INF-gamma) has been shown to suppress erythropoiesis and perhaps to contribute to the anemia of chronic disease. In this study we demonstrated that the concentration of INF gamma required to suppress murine burst forming unit-erythroid (BFU-E) growth was significantly less than that required to suppress colony forming unit-erythroid (CFU-E) growth. INF gamma acted at the most primitive step in erythroid progenitor cell differentiation and proliferation, as inhibition was maximal when added at the time of BFU-E culture initiation. Inhibition was progressively less if INF gamma addition was delayed after culture initiation. The effects of INF gamma on BFU-E did not require the presence of interleukin-1 alpha (IL-1 alpha), tumor necrosis factor-alpha (TNF alpha), or granulocyte macrophage colony stimulating factor (GM-CSF), as its effects were not neutralized by monoclonal antibodies against IL-1 alpha, TNF alpha, or GM-CSF. This applied whether INF gamma was added to culture with individual antibodies or with a combination of all three antibodies. INF gamma was not required for IL-1 alpha- or TNF alpha-induced suppression of BFU-E, as their effects were not neutralized by a monoclonal anti-INF gamma antibody. In contrast, GM-CSF-induced suppression of BFU-E was negated by the simultaneous addition of anti-INF gamma. We have previously shown that the addition of TNF alpha does not suppress BFU-E growth in cultures from marrow depleted of macrophages. Suppression did occur, however, if a small concentration of INF gamma that does not inhibit and increasing concentration of TNF alpha were added to culture, suggesting a synergistic effect between INF-gamma and TNF alpha. These observations suggest that INF gamma is a potent direct inhibitor of erythroid colony growth in vitro. It exerts its negative regulatory effect primarily on the earliest stages of erythroid progenitor cell differentiation and proliferation, as much higher doses are required to

Interferon Induced Transfer of Viral Resistance

DTIC Science & Technology

1982-02-01

released from the cell membrane. We have also shown that CM’s activity is removed by a gelatin /sepharose affinity column which selectively binds...interferon preparation adsorbing to the WISH cells, interferon was subjected to gelatin /sepharose affinity chromatography to remove endogenous...caused an increase in the amount of H-.amnino acids incorporated into a gelatin binding protein, presumably fibronectin. This suggests that in addition to

Differential co-promoting activities of alpha, beta and gamma interferons in the murine skin two-stage carcinogenesis model.

PubMed

Reiners, J J; Cantu, A; Thai, G; Pavone, A

1993-03-01

SENCAR mice develop more papillomas in two-stage skin carcinogenesis protocols if gamma interferon (IFN-gamma) is co-administered with 12-O-tetradecanoylphorbol-13-acetate (TPA) during the promotion phase. In the current study preparations of murine alpha, beta and gamma IFNs were surveyed for their abilities to modulate TPA-dependent promotion and induction of epidermal hyperplasia, inflammation and ornithine decarboxylase activity (ODC). Single or multiple i.p. administrations of IFN-alpha, -beta or -gamma (< or = 2500 units) did not induce epidermal hyperplasia, inflammation or ODC activity. Single or multiple i.p. administrations of IFN-alpha, -beta or -gamma (2500 units) to mice being topically promoted with 0.1 or 1 microgram of TPA did not alter the epidermal hyperplasia induced by the phorbol ester. The vascular permeability of the skin, as evaluated by the extravasation of Evans blue dye, was increased in a dose-dependent fashion by TPA over the range of 0.1-1 microgram. Treatment of mice promoted with 0.1 microgram of TPA with IFN-gamma (> or = 2500 units) significantly increased the skin's vascular permeability. Comparable effects were not obtained with IFN-beta (IFN-alpha not tested). Treatment of TPA-promoted mice with IFN-gamma, and to a lesser extent IFN-beta, weakly potentiated the TPA-dependent induction of epidermal ODC activity. Under conditions in which IFN-gamma had co-promoting activities in an initiation-promotion protocol, co-treatment of initiated mice with 1 microgram of TPA and IFN-alpha or -beta (100-5000 units) did not reproducibly alter tumor latency., or papilloma and carcinoma multiplicities. These findings suggest that the co-promoting activities of IFNs are restricted to the gamma class, and are not uniformly reflected by parameters commonly employed as short-term markers of tumor promotion.

[Gamma interferon: basics aspects, clinic significance and terapeutic uses].

PubMed

Mata-Espinosa, Dulce A; Hernández-Pando, Rogelio

2008-01-01

Interferons are a family of pleiotropic cytokines, their name was assigned because of their anti-replicative viral activity. IFNgamma or immune type II interferon does not share receptors with the type I interferon, its structure is different and its gene is located in different chromosome, although its biologic effects are similar. Along of several years of research, it has been found that IFNgamma enhances the transcription of genes involved in immunomodulation, antiviral responses and antitumoral activities. Regarding to the immune system, IFNgamma increases the cytotoxic and phagocytic activity of macrophages and upregulates the expression of major histocompatibility complex (MHC) class I and class II molecules in dendritics cells and other antigen presenting cells. IFNgamma also promotes the development and differentiation of naive CD4+ T lymphocytes to Th1 helper subset. Indeed, this cytokine has a key role in the control of bacterial, micotic, viral and parasitic infections. Depending of the micro-environment, IFNgamma has a dual role as pro or anti inflammatory cytokine. Novel therapeutic strategies are currently being developed with the aim to enhance the immune response or replace IFNgamma gene abnormal expression with beneficial results in humans, being recombinant IFNgamma safe and well tolerated.

Use of an Interferon Gamma Release Assay (IGRA) to test T-cell responsiveness to soluble Leishmania infantum antigen in whole blood of dogs from endemic areas.

PubMed

Zribi, Lilia; El-Goulli, Amel F; Ben-Abid, Meriem; Gharbi, Mohamed; Ben-Sghaier, Ines; Boufaden, Imed; Aoun, Karim; Bouratbine, Aïda

2017-11-15

Interferon-Gamma (IFN-γ) Release Assays (IGRAs) are easy tests that allow rapid screening of primed memory T-cells immunity in response to antigen. The aim of this study was to use IGRA to assess IFN-γ release in response to Soluble Leishmania infantum antigen (SLA) in whole blood of dogs living in endemic area of visceral leishmaniasis and to interpret IGRA results according to clinical examination, specific anti-Leishmania humoral response and presence of L. infantum DNA in blood. The study was carried out on 56 dogs living in greater Tunis area. Physical examination, quantitative serology and PCR on blood were used to characterize dogs' status in relation to Leishmania infection and disease. IGRA consisted on testing by ELISA for IFN-γ-secretion in whole blood after a 20-h challenge with SLA. PBS and Phytohemagglutinin (PHA) stimulations were used as controls. Four groups of dogs were characterized: 31 were negative by both serology and PCR, two had doubtful serology, 10 presented no to mild clinical signs but low antibodies levels and 13 were affected by Canine Leishmaniasis (CanL). In seronegative dogs, IGRA was little contributory in 4 puppies (age <6months) and 5 old dogs (median age=72months, IQR: 45-84 months) that didn't respond to PHA stimulation, IGRA was negative in 19 and positive in three animals with lymph node enlargement. In dogs with doubtful serology, IGRA was positive in one dog and negative in the other. In infected dogs with no to mild clinical signs, one dog exhibited high level of IFN-γ in absence of antigenic stimulation and all the other were positive by IGRA. CanL dogs showed variable IGRA results. Negative IGRAs (n=4) were shown in animals with the highest parasitic burden whereas positive IGRAs (n=5) were shown in dogs with negative PCR or low parasitic load. The 4 remaining dogs either didn't respond to PHA (n=2) or showed non-specific secretion in PBS tube (n=2). The results of this study showed that IGRA is a useful new tool

Complementation of a mutant cell line: central role of the 91 kDa polypeptide of ISGF3 in the interferon-alpha and -gamma signal transduction pathways.

PubMed Central

Müller, M; Laxton, C; Briscoe, J; Schindler, C; Improta, T; Darnell, J E; Stark, G R; Kerr, I M

1993-01-01

Mutants in complementation group U3, completely defective in the response of all genes tested to interferons (IFNs) alpha and gamma, do not express the 91 and 84 kDa polypeptide components of interferon-stimulated gene factor 3 (ISGF3), a transcription factor known to play a primary role in the IFN-alpha response pathway. The 91 and 84 kDa polypeptides are products of a single gene. They result from differential splicing and differ only in a 38 amino acid extension at the C-terminus of the 91 kDa polypeptide. Complementation of U3 mutants with cDNA constructs expressing the 91 kDa product at levels comparable to those observed in induced wild-type cells completely restored the response to both IFN-alpha and -gamma and the ability to form ISGF3. Complementation with the 84 kDa component similarly restored the ability to form ISGF3 and, albeit to a lower level, the IFN-alpha response of all genes tested so far. It failed, however, to restore the IFN-gamma response of any gene analysed. The precise nature of the DNA motifs and combination of factors required for the transcriptional response of all genes inducible by IFN-alpha and -gamma remains to be established. The results presented here, however, emphasize the apparent general requirement of the 91 kDa polypeptide in the primary transcriptional response to both types of IFN. Images PMID:7693454

Lactobacillus GG has in vitro effects on enhanced interleukin-10 and interferon-gamma release of mononuclear cells but no in vivo effects in supplemented mothers and their neonates.

PubMed

Kopp, M V; Goldstein, M; Dietschek, A; Sofke, J; Heinzmann, A; Urbanek, R

2008-04-01

The value of probiotics for primary prevention is controversial. Moreover, only little is known about the underlying immunological mechanisms of action. Therefore, we assessed the proliferative response and cytokine release in cultures of isolated mononuclear cells from pregnant women and their neonates supplemented with Lactobacillus GG (LGG) or placebo. In a double-blind, placebo-controlled prospective trial, pregnant women with at least one first-degree relative or a partner with an atopic disease were randomly assigned to receive either the probiotic LGG (ATCC 53103; 5 x 10(9) colony-forming units LGG twice daily) or placebo 4-6 weeks before expected delivery, followed by a post-natal period of 6 months. Cord blood mononuclear cells (CBMC) and peripheral blood mononuclear cells (PBMC) of the corresponding mother were isolated from cord blood and peripheral blood (n=68). The proliferative response of CBMC and PBMC was expressed as the stimulation index (SI), which was calculated according to the ratio between the mean counts per minute (c.p.m.) values measured in the wells with stimulated cells and the mean c.p.m. values measured in the wells with unstimulated cells. Additionally, the cytokines IFN-gamma, IL-10 and IL-13 in the cell culture supernatants were measured using the ELISA technique. No difference was observed between the LGG-supplemented group and the placebo group in terms of the proliferative capacity of maternal or neonatal cord blood cells in response to IL-2, beta-lactoglobulin or LGG. In vitro stimulation with LGG resulted in significantly enhanced release of IL-10 and IFN-gamma, compared with cytokine release in unstimulated controls. However, this phenomenon was observed in supernatants of maternal and neonatal MC in both groups, independent of prior supplementation with LGG. LGG has in vitro effects on enhanced IL-10 and IFN-gamma release of mononuclear cells. However, supplementation with LGG during pregnancy did not alter the proliferative

[Allergic asthma and interleukins 2, 4, 5, 6 and 12 and gamma interferon levels].

PubMed

Bastida Segura, Diana Lyzbeth; López Velásquez, Benjamin; Castrejón Vázquez, María Isabel; Galicia Tapía, Jorge; Cano Altamirano, Silvia; Miranda Feria, Alfonso Javier

2004-01-01

Asthma is an inflammatory chronic illness, in which mastocyt cells, basophils, T lymphocytes, eosinophils and cytokines play a role. Its association with the production of TH2 cytokines is not well known, but it is considered an aberrant immune response, yielding the activation and recruitment of a number of effector cells (mastocyts/eosinophils) and the appearance of clinical symptoms. To determine the serum values of the interleukins 2, 4, 5, 6 and 12 and gamma interferon in relation to the severity degree of asthma and the time of immunotherapy in patients with stable chronic allergic bronchial asthma. Clinical records of allergic asthmatic patients from the external consultation at Servicio de Alergia e Immunología Clínica were reviewed in a period of 12 months (1st January 2002 to 1st January 2003) and those of healthy volunteers, forming three groups: Group 1, allergic asthmatics with immunotherapy less than 24 months; Group 2, allergic asthmatics with more than 24 months of immunotherapy, and Group 3, healthy volunteers (control group). Previous informed consent, a serum sample was taken of all subjects. Ninety-two subjects were included: 41 (45%) allergic asthmatics and 51 (55%) healthy volunteers. Significant differences were found in interleukins 2, 4, 5, 6 and 12 levels between healthy volunteers and asthmatics without relating the immunotherapy time. In the total group gamma interferon levels were not found. A relation of interleukins Th2 levels with the severity degree of asthma was not found. Differences of serum interleukins Th1 and Th2 in allergic patients related to immunotherapy time were not significant; even though, irrespective of immunotherapy time, IgG levels were always high. Patients with allergic asthma have a predominance of serum interleukins Th2 and, despite of the immunotherapy, in the maintaining phase, these continue high, which may be due to an immune system dysregulation maybe including other factors. Immunotherapy continues

Effect of interferon-gamma on complement gene expression in different cell types.

PubMed

Lappin, D F; Guc, D; Hill, A; McShane, T; Whaley, K

1992-01-15

We have studied the expression of the complement components C2, C3, factor B, C1 inhibitor (C1-inh), C4-binding protein (C4-bp) and factor H in human peripheral blood monocytes, skin fibroblasts, umbilical vein endothelial cells (HUVEC) and the human hepatoma cell line G2 (Hep G2) in the absence and the presence of interferon-gamma (IFN-gamma). E.l.i.s.a. performed on culture fluids, run-on transcription assays, Northern blot and double-dilution dot-blot techniques confirmed that monocytes expressed all six components, whereas fibroblasts, HUVEC and HepG2 each expressed five of the six components. Fibroblasts and HUVEC did not synthesize C4-bp, and Hep G2 did not produce factor H. In addition to these differences, the synthesis rates of C3, C1-inh and factor H were not the same in all cell types. However, the synthesis rates of C2 and factor B were similar in all four cell types. The half-lives of the mRNAs were shorter in monocytes than in other cell types. Monocyte factor H mRNA had a half-life of 12 min in monocytes, compared with over 3 h in fibroblasts and HUVEC. The instability of factor H mRNA in monocytes may contribute to their low factor H secretion rate. IFN-gamma produced dose-dependent stimulation of C2, factor B, C1-inh, C4-bp and factor H synthesis by all cell types expressing these proteins, but decreased C3 synthesis in all four cell types. Cell-specific differences in the response to IFN-gamma were observed. The increased rates of transcription of the C1-inh and factor H genes in HUVEC were greater than in other cell types, while the increased rate of transcription of the C2, factor B and C1-inh genes in Hep G2 cells was less than in other cell types. IFN-gamma did not affect the stability of C3, factor H or C4 bp mRNAs, but increased the stability of factor B and C1-inh mRNAs and decreased the stability of C2 mRNA. Although these changes occurred in all four cell types studied, the half-life of C1-inh mRNA in monocytes was increased almost 4-fold

Pre-immune state induced by chicken interferon gamma inhibits the replication of H1N1 human and H9N2 avian influenza viruses in chicken embryo fibroblasts.

PubMed

Yuk, Seong-Su; Lee, Dong-Hun; Park, Jae-Keun; Tseren-Ochir, Erdene-Ochir; Kwon, Jung-Hoon; Noh, Jin-Yong; Lee, Joong-Bok; Park, Seung-Yong; Choi, In-Soo; Song, Chang-Seon

2016-04-27

Interferon gamma (IFN-γ), an immunoregulatory cytokine, is known to control many microbial infections. In a previous study, chicken interferon gamma (chIFN-γ) was found to be up-regulated following avian influenza virus (AIV) infection in specific pathogen-free chickens. We aimed to investigate whether the pre-immune state induced by chIFN-γ could generate an antiviral response against influenza virus. We generated a chIFN-γ-expressing plasmid and transfected it into chicken embryo fibroblasts (CEFs) and then infected the cells with human origin H1N1 or avian origin H9N2 influenza viruses. Viral titers of culture medium were evaluated in MDCK cell and the viral RNA and IFN-stimulated genes (ISGs) were then quantified by real-time reverse transcriptase polymerase. To further evaluate the role of the antiviral effect of chIFN-γ by using a backward approach, synthetic small interfering RNAs (siRNA) targeting chIFN-γ were used to suppress chIFN-γ. The chIFN-γ-stimulated CEFs inhibited the replication of viral RNA (vRNA) and showed a mild decrease in the infectious virus load released in the culture medium. Compared to the mock-transfected control, the messenger RNA (mRNA) levels of type I IFNs and IFN-stimulated genes were up-regulated in the cells expressing chIFN-γ. After treatment with the siRNA, we detected a higher expression of viral genes than that observed in the mock-transfected control. Our results suggest that apart from the important role played by chIFN-γ in the antiviral state generated against influenza virus infection, the pre-immune state induced by chIFN-γ can be helpful in mitigating the propagation of influenza virus.

Association of monoclonal expansion of Epstein-Barr virus-negative CD158a+ NK cells secreting large amounts of gamma interferon with hemophagocytic lymphohistiocytosis.

PubMed

López-Alvarez, María R; Martínez-Sánchez, María V; Salgado-Cecilia, María G; Campillo, José A; Heine-Suñer, Damian; Villar-Permuy, Florentina; Fuster, José L; Bas, Agueda; Gil-Herrera, Juana; Muro, Manuel; García-Alonso, Ana M; Alvarez-López, María R; Minguela, Alfredo

2009-01-01

We report the first case of hemophagocytic lymphohistiocytosis (HLH) induced by the monoclonal expansion of Epstein-Barr virus (EBV)-negative NK cells. Consanguinity of the patient's parents made it necessary to discard familial HLH in the patient and her sister with identical HLA markers and demonstrate that no cause other than the expansion of NK cells, which secrete high levels of gamma interferon, was inducing HLH in this patient.

Interferon-gamma interferes with transforming growth factor-beta signaling through direct interaction of YB-1 with Smad3.

PubMed

Higashi, Kiyoshi; Inagaki, Yutaka; Fujimori, Ko; Nakao, Atsuhito; Kaneko, Hideo; Nakatsuka, Iwao

2003-10-31

Transforming growth factor-beta (TGF-beta) and interferon-gamma (IFN-gamma) exert antagonistic effects on collagen synthesis in human dermal fibroblasts. We have recently shown that Y box-binding protein YB-1 mediates the inhibitory effects of IFN-gamma on alpha2(I) procollagen gene (COL1A2) transcription through the IFN-gamma response element located between -161 and -150. Here we report that YB-1 counter-represses TGF-beta-stimulated COL1A2 transcription by interfering with Smad3 bound to the upstream sequence around -265 and subsequently by interrupting the Smad3-p300 interaction. Western blot and immunofluorescence analyses using inhibitors for Janus kinases or casein kinase II suggested that the casein kinase II-dependent signaling pathway mediates IFN-gamma-induced nuclear translocation of YB-1. Down-regulation of endogenous YB-1 expression by double-stranded YB-1-specific RNA abrogated the transcriptional repression of COL1A2 by IFN-gamma in the absence and presence of TGF-beta. In transient transfection assays, overexpression of YB-1 in human dermal fibroblasts exhibited antagonistic actions against TGF-beta and Smad3. Physical interaction between Smad3 and YB-1 was demonstrated by immunoprecipitation-Western blot analyses, and electrophoretic mobility shift assays using the recombinant Smad3 and YB-1 proteins indicated that YB-1 forms a complex with Smad3 bound to the Smad-binding element. Glutathione S-transferase pull-down assays showed that YB-1 binds to the MH1 domain of Smad3, whereas the central and carboxyl-terminal regions of YB-1 were required for its interaction with Smad3. YB-1 also interferes with the Smad3-p300 interaction by its preferential binding to p300. Altogether, the results provide a novel insight into the mechanism by which IFN-gamma/YB-1 counteracts TGF-beta/Smad3. They also indicate that IFN-gamma/YB-1 inhibits COL1A2 transcription by dual actions: via the IFN-gamma response element and through a cross-talk with the TGF

Sphingosine kinase inhibitor suppresses IL-18-induced interferon-gamma production through inhibition of p38 MAPK activation in human NK cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cheon, Soyoung; Song, Seok Bean; Jung, Minkyung

2008-09-12

Natural killer (NK) cells play an important role in the innate immune response. Interleukin-18 (IL-18) is a well-known interferon-gamma (IFN-{gamma} inducing factor, which stimulates immune response in NK and T cells. Sphingosine kinase (SPHK) catalyzes the formation of sphingosine 1-phosphate (S1P), which acts as a second messenger to function as an anti-apoptotic factor and proliferation stimulator of immune cells. In this study, to elucidate whether SPHK is involved in IL-18-induced IFN-{gamma} production, we measured IL-18-induced IFN-{gamma} production after pre-treatment with SPHK inhibitor (SKI) in NK-92MI cells. We found that IL-18-induced IFN-{gamma} expression was blocked by SKI pre-treatment in both mRNAmore » and protein levels. In addition, the increased IFN-{gamma} production by stimulation with IL-18 is mediated through both SPHK and p38 MAPK. To determine the upstream signals of SKI and p38 MAPK in IL-18-induced IFN-{gamma} production, phosphorylation levels of p38 MAPK was measured after SKI pre-treatment. As a result, inhibition of SPHK by SKI blocked phosphorylation of p38 MAPK, showing that SPHK activation by IL-18 is an upstream signal of p38 MAPK activation. Inhibition of SPHK by SKI also inhibited IL-18-induced IFN-{gamma} production in human primary NK cells. In conclusion, SPHK activation is an essential factor for IL-18-induced IFN-{gamma} production via p38 MAPK.« less

Alternative mechanism by which IFN-gamma enhances tumor recognition: active release of heat shock protein 72.

PubMed

Bausero, Maria A; Gastpar, Robert; Multhoff, Gabriele; Asea, Alexzander

2005-09-01

IFN-gamma exhibits differential effects depending on the target and can induce cellular activation and enhance survival or mediate cell death via activation of apoptotic pathways. In this study, we demonstrate an alternative mechanism by which IFN-gamma enhances tumor recognition, mediated by the active release of Hsp72. We demonstrate that stimulation of 4T1 breast adenocarcinoma cells and K562 erythroleukemic cells with IFN-gamma triggers the cellular stress response, which results in the enhanced expression of total Hsp72 expression without a significant increase in cell death. Intracellular expression of Hsp72 was abrogated in cells stably transfected with a mutant hsf-1 gene. IFN-gamma-induced Hsp72 expression correlated with enhanced surface expression and consequent release of Hsp72 into the culture medium. Pretreatment of tumors with compounds known to the block the classical protein transport pathway, including monensin, brefeldin A, tunicamycin, and thapsigargin, did not significantly block Hsp72 release. However, pretreatment with intracellular calcium chelator BAPTA-AM or disruption of lipid rafts using methyl beta-cyclodextrin completely abrogated IFN-gamma-induced Hsp72 release. Biochemical characterization revealed that Hsp72 is released within exosomes and has the ability to up-regulate CD83 expression and stimulate IL-12 release by naive dendritic cells. Pretreatment with neutralizing mAb or depletion of Hsp72 completely abrogated its chaperokine function. Taken together, these findings are indicative of an additional previously unknown mechanism by which IFN-gamma promotes tumor surveillance and furthers our understanding of the central role of extracellular Hsp72 as an endogenous adjuvant and danger signal.

Role of polymorphic Fc receptor Fc gammaRIIa in cytokine release and adverse effects of murine IgG1 anti-CD3/T cell receptor antibody (WT31).

PubMed

Tax, W J; Tamboer, W P; Jacobs, C W; Frenken, L A; Koene, R A

1997-01-15

Anti-CD3 monoclonal antibody (mAb) OKT3 is immunosuppressive, but causes severe adverse effects during the first administration ("first-dose reaction"). These adverse effects are presumably caused by cytokine release that results from T-cell activation. In vitro, T-cell activation by anti-CD3 mAb requires interaction with monocyte Fc receptors. The Fc receptor for murine IgG1, Fc gammaRIIa, is polymorphic. In some individuals, murine IgG1 anti-CD3 mAb causes T-cell proliferation and cytokine release in vitro (high responders [HR]), whereas in individuals with the low-responder (LR) phenotype it does not. We have now investigated the role of this Fc gammaRIIa polymorphism in the release of cytokines in vivo and the occurrence of adverse effects after the administration of WT31, a murine IgG1 anti-CD3/T cell receptor mAb. WT31 caused an increase of plasma tumor necrosis factor-alpha in all four HR patients and none of the five LR patients. In all HR patients except one, plasma gamma-interferon and interleukin 6 also increased, and a first-dose response was observed, whereas no cytokine release or adverse effects occurred in any of the LR patients. WT31 caused lymphopenia in all HR and none of the LR patients. FACS analysis demonstrated that in HR patients, after the initial disappearance of CD3+ cells from peripheral blood, modulation of CD3 occurred, whereas in LR patients a high degree of coating of the lymphocytes was observed. Surprisingly, WT31 also induced a marked granulocytopenia, as well as a decrease of thrombocytes, in three of the four HR patients (and in none of the LR patients). These data provide direct clinical evidence that Fc receptor interaction determines the release of cytokines and the occurrence of adverse effects after administration of anti-CD3/T cell receptor mAb. Furthermore, these data suggest that tumor necrosis factor-alpha by itself is not sufficient to induce the first-dose reaction.

Interferon-gamma: biologic functions and HCV therapy (type I/II) (1 of 2 parts).

PubMed

Gattoni, A; Parlato, A; Vangieri, B; Bresciani, M; Derna, R

2006-01-01

This review is aimed at exhaustively presenting and discussing the interferon-gamma (IFN-gamma), a cytokine that plays an important role in inducing and modulating an array of immune responses. A review of the most significant and recent clinical trials was performed. Although IFN-gamma has some antiviral activity, it is much less active in this regard than type I IFNs. IFN-gamma is involved in the regulation of nearly all phases of the immune and inflammatory responses, including the activation and differentiation of T cells, B cells, NK cells, macrophages, and others. It is therefore best regarded as a distint immunoregulatory cytokine. IFN-gamma secretion is a hallmark of Th1 lymphocytes. It is also secreted by nearly all CD8 T cells, by some Th0 cells, and by NK cells. Each of these cell types secretes IFN-gamma only when activated, usually as part of immune response and especially in response to IL-2 and IL-12. IFN-gamma production is inhibited by IL-4, IL-10, TGFbeta, glucocorticoids, cyclosporin A and FK506. Nearly all cell types express the heterodimeric receptor for IFN-beta and respond to this cytokine by increasing the surface expression of class I MHC proteins. As a result, virtually any cell in the vicinity of an IFN-beta-secreting cell becomes more efficient at presenting endogenous antigens and hence a better target for cytotoxic killing if it harbors an intracellular pathogen. Unlike the type I IFNs, IFN-gamma also increases the expression of class II MHC proteins on professional APCs, and so promotes antigen presentation to helper T cells as well. It also induces de novo expression of class II MHC proteins on venular endothelial cells and on some other epithelial and connective tissue cells that do not otherwise express them, thus enabling these cell types to function as temporary APCs at sites of intense immune reactions. The effector functions of NK cells are to lyse virus-infected cells and to secrete IFN-gamma, which activates macrofages to

Rapid activation of the interferon system in vivo.

PubMed Central

Dianzani, F; Gullino, P; Baron, S

1978-01-01

Experiments were carried out to study the kinetics of local interferon production in the subcutaneous tissues of rats stimulated with Newcastle disease virus. Specifically, the interferon produced and released in the extracellular fluids was collected at various intervals of time in micropore chambers implanted into the subcutaneous tissue of rats. Interferon was detected at moderate titers 1 h after induction, and it was present at high titer at 2 h. The interferon levels remained remarkably high in the samples collected after 3, 5, and 24 h, and in some rats it was still detectable after 48 and 72 h. Since control experiments showed that it requires 2 to 3 h for interferon to penetrate the chambers, it may be concluded that high concentrations of interferon are present in the extracellular fluid within 1 h of induction. The evaluation of the kinetics of production and of the concentrations attained in the extracellular fluid suggests that in a solid tissue a cell infected by a potent interferon inducer may produce interferon early enough and in sufficient quantity to protect neighboring cells before the production of progeny virions. PMID:669799

Effects of tumor necrosis factor-alpha and interferon-gamma on expressions of matrix metalloproteinase-2 and -9 in human bladder cancer cells.

PubMed

Shin, K Y; Moon, H S; Park, H Y; Lee, T Y; Woo, Y N; Kim, H J; Lee, S J; Kong, G

2000-10-31

We have investigated the effects of tumor necrosis factor-alpha (TNF-alpha) and interferon (INF-gamma), the potent Bacillus Calmette-Guerin (BCG)-induced cytokines on the production of MMP-2, MMP-9, TIMP-1, TIMP-2 and MT1-MMP in high grade human bladder cancer cell lines, T-24, J-82 and HT-1376 cell lines. MMP-2 expression and activity were decreased in T-24 cells treated with both cytokines in a dose dependent manner. However, J-82 cells treated with TNF-alpha and INF-gamma revealed dose dependent increases of MMP-9 expression and activity with similar baseline expression and activity of MMP-2. HT-1376 cells after exposure to TNF-alpha only enhanced the expression and activity of MMP-9. These results indicate that TNF-alpha and INF-gamma could regulate the production of MMP-2 or MMP-9 on bladder cancer cells and their patterns of regulation are cell specific. Furthermore, this diverse response of bladder cancer cells to TNF-alpha and INF-gamma suggests that BCG immunotherapy may enhance the invasiveness of bladder cancer in certain conditions with induction of MMPs.

Immunomodulatory intervention with Gamma interferon in mice with sepsis.

PubMed

Wang, Yu; Kong, Bing-Bing; Yang, Wen-Ping; Zhao, Xin; Zhang, Rong

2017-09-15

Sepsis-triggered immune paralysis including T-cell dysfunction increase susceptibility to infection. Gamma interferon (IFNg) exert beneficial effects in patients with sepsis. Herein, we speculated that IFNg may attenuate T-cell dysfunction induced by sepsis, although the mechanisms remain elusive. To test this hypothesis, we used a model based on cecal ligation and puncture (CLP) to induce sepsis in mice. Male C57BL/6 mice were pretreated with recombinant human IFNg (0.01μg/g of body weight) before CLP. The immunophenotyping of cell surface receptor expression, and regulatory T cells (CD4+CD25+Foxp3+) were quantified by flow cytometry. Immunohistochemical staining was performed to evaluate the loss of immune effector cells. Formation of IFNg and interleukin 4 (IL-4) in the spleen and plasma levels of TNF-α, IL-6, high-mobility group box 1 (HMGB1) were determined using enzyme-linked immunosorbent assay. IFNg markedly inhibited the reduction in cytokine secretion from lipopolysaccharide (LPS)-stimulated splenocytes. IFNg-treated mices had significantly decreased percentages of programmed cell death 1 (PD-1) receptors, increased the percentages of positive costimulatory receptor CD28 on CD4 T cells expressing. IFNg markedly reduced T-cell apoptosis through upregulating the expression of Bcl-2. CLP-induced formation of regulatory T cells in the spleen was abolished in IFNg -treated mices. Moreover, IFNg treatment reduced plasma levels of TNF-α, IL-6, HMGB1. IFNg can be a powerful regulator of immune function under sepsis conditions. Therefore, targeted immune-enhancement with IFNg may be a valid therapeutic approach in sepsis. Copyright © 2017 Elsevier Inc. All rights reserved.

STING-Dependent Interferon-λ1 Induction in HT29 Cells, a Human Colorectal Cancer Cell Line, After Gamma-Radiation.

PubMed

Chen, Jianzhou; Markelc, Bostjan; Kaeppler, Jakob; Ogundipe, Vivian M L; Cao, Yunhong; McKenna, W Gillies; Muschel, Ruth J

2018-05-01

To investigate the induction of type III interferons (IFNs) in human cancer cells by gamma-rays. Type III IFN expression in human cancer cell lines after gamma-ray irradiation in vitro was assessed by reverse transcription-quantitative polymerase chain reaction and enzyme-linked immunosorbent assay. Signaling pathways mediating type III IFN induction were examined by a variety of means, including immunoblotting, flow cytometry, confocal imaging, and reverse transcription-quantitative polymerase chain reaction. Key mediators in these pathways were further explored and validated using gene CRISPR knockout or short hairpin RNA knockdown. Exposure to gamma-rays directly induced type III IFNs (mainly IFNL1) in human cancer cell lines in dose- and time-dependent fashions. The induction of IFNL1 was primarily mediated by the cytosolic DNA sensors-STING-TBK1-IRF1 signaling axis, with a lesser contribution from the nuclear factor kappa b signaling in HT29 cells. In addition, type III IFN signaling through its receptors serves as a positive feedback loop, further enhancing IFN expression via up-regulation of the kinases in the STING-TBK1 signaling axis. Our results suggest that IFNL1 can be up-regulated in human cancer cell lines after gamma-ray treatment. In HT29 cells this induction occurs via the STING pathway, adding another layer of complexity to the understanding of radiation-induced antitumor immunity, and may provide novel insights into IFN-based cancer treatment. Copyright © 2018 Elsevier Inc. All rights reserved.

[Effects of interferon-gamma on cytotoxicity of murine activated macrophages against murine glioma cells].

PubMed

Ohyama, K; Kikuchi, H; Oda, Y; Moritake, K; Yamasaki, T

1993-06-01

We studied the effects of mouse IFN-gamma on the cytotoxic activity of murine activated macrophages (M phi) against mouse VM-Glioma cells (H-2b). Activated M phi were obtained from peritoneal exudate cells of mice from four strains, C57BL/6 (H-2b), C3H/He(H-2k), DBA/2 (H-2d), and BALB/c (H-2d), following intraperitoneal injection of (1) LPS 200 micrograms, (2) BCG 200 micrograms, (3) C. parvum 200 micrograms, or (4) MDP 350 micrograms 7 days prior to 20-hr 51Cr release-assay. Of the various combination of mouse strains and activating agents tested, that of activated M phi of the C3H/He mouse with induction by LPS had the most tumoricidal effect against the glioma cells, which was not MHC restricted. Although LPS-activated M phi underwent marked loss of cytotoxicity following initiation of in vitro culture, this 24 hr pretreatment with IFN-gamma inhibited this reduction in tumoricidal effects in a dose-dependent fashion. On the other hand, 24 hr pretreatment of target cells with IFN-gamma did not increase their susceptibility to lysis by activated M phi. These findings suggest that IFN-gamma augments the in vitro tumoricidal activation of M phi; This effect appears to be unrelated to any influence of IFN-gamma on target sensitivity to lysis by macrophages.

Enhancing effects of gamma interferon on phagocytic cell association with and killing of Trypanosoma cruzi

NASA Technical Reports Server (NTRS)

Wirth, J. J.; Kierszenbaum, F.; Sonnenfeld, G.; Zlotnik, A.

1985-01-01

Results are reported from a study of the influence gamma interferon (GIFN) and interleukin 2 (IL2) have on the capability of P388D1 cells and mouse resident peritoneal macrophages (MPM) to attach to the blood-resident parasites Trypanosoma cruzi and kill them. Cultures of trypomastigote forms of the Tulahuen strain of T. cruzi grown in bovine serum were introduced into peritoneal cells of mice, along with P388D1 cells incubated with GIFN, IL2 and both. Control cells were also maintained. Statistical analysis were then performed on data on counts of the number of dead T. Cruzi cells. The GIFN enhanced the interaction of MPM and P388D1 cells with the surface of T. Cruzi, provided the interaction was given over 12 hr to take place. A depression of the cytotoxicity of P388D1 cells was attributed to mediation by H2O2, an effect partially offset by incubation with the lymphokine GIFN.

Further characterization of [3H]gamma-aminobutyric acid release from isolated neuronal growth cones: role of intracellular Ca2+ stores.

PubMed

Lockerbie, R O; Gordon-Weeks, P R

1986-04-01

We have recently shown that growth cones isolated from neonatal rat forebrain possess uptake and release mechanisms for the neurotransmitter gamma-aminobutyric acid. About half of the K+-induced release of [3H]gamma-aminobutyric acid from isolated growth cones is dependent on extracellular Ca2+. The remaining component of the [3H]gamma-aminobutyric acid release is unaffected by removal of extracellular Ca2+ and is resistant to blockade by the voltage-sensitive Ca2+-channel blocker methoxyverapamil. In the present series of experiments we have used caffeine to assess the possible role of intracellular stores of Ca2+ in supporting that component of the K+-induced release of [3H]gamma-aminobutyric acid from isolated growth cones that is independent of extracellular Ca2+. We have chosen caffeine because of its well established effect of releasing Ca2+ from smooth endoplasmic reticulum in muscle. We found that caffeine can release [3H]gamma-aminobutyric acid from isolated growth cones. This effect persists in Ca2+-free medium, in the presence of methoxyverapamil and in the absence of Na+. Furthermore, isobutylmethylxanthine could not substitute for caffeine suggesting that the caffeine effect is not due to phosphodiesterase inhibition and the subsequent rise in intracellular cyclic nucleotides. A combination of the mitochondrial poisons, Antimycin A and sodium azide had no effect on the release of [3H]gamma-aminobutyric acid induced either by caffeine or by high K+. We conclude that caffeine causes the release of Ca2+ from a non-mitochondrial store within the growth cone and that this Ca2+ store supports that component of the K+-induced release of [3H]gamma-aminobutyric acid that is independent of extracellular Ca2+.

Association between level of interferon gamma and acid-fast bacillipositivity in pulmonary tuberculosis

NASA Astrophysics Data System (ADS)

Priwahyuningtyas, N. B.; Sinaga, B. Y. M.; Pandia, P.; Eyanoer, P. C.

2018-03-01

Tuberculosis is an infectious disease which caused by Mycobacterium tuberculosis (M. tuberculosis) that infected numerous organ especially the lung. A person’s immunity is very affecting for a person exposed to pulmonary tuberculosis. T-helper-1 cell (Th1) is very influential in the immune system especially in interfering intracellular bacterial infection. One of the cytokines known produced by Th1 cell is interferon gamma (IFN-γ) which is in eliminating M. tuberculosis. The study aims to identify the association between level of IFN-γ and AFB positivity in pulmonary tuberculosis patients in Medan. It is a case-control study. The subjects of the study were 60 new cases of pulmonary tuberculosis with AFB sputum smear- positive that never received ATT consisting 20 cases AFB (+1), 20 cases AFB (+2) and 20 cases AFB (+3).Samples were plasma collected from the venous blood of pulmonary tuberculosis patients. The plasma then underwent laboratory assay with ELISA techniques. Independent t-test was p<0.05 considered significant. Level of IFN-γ in TB AFB (+1) is higher than TB AFB (+2) and (+3), with thesignificant statistical result (p=0.001).

Interferon-gamma promoter hypomethylation and increased expression in chronic periodontitis

PubMed Central

Zhang, Shaoping; Crivello, Antonino; Offenbacher, Steven; Moretti, Antonio; Paquette, David W.; Barros, Silvana P.

2011-01-01

Aim The goal of this investigation was to determine whether epigenetic modifications in the IFNG promoter are associated with an increase of IFNG transcription in different stages of periodontal diseases. Materials and Methods DNA was extracted from gingival biopsy samples collected from 47 total sites from 47 different subjects: 23 periodontally healthy sites, 12 experimentally induced gingivitis sites and 12 chronic periodontitis sites. Levels of DNA methylation within the IFNG promoter containing six CpG dinucleotides were determined using pyrosequencing technology. Interferon gamma mRNA expression was analysed by quantitative polymerase chain reactions using isolated RNA from part of the biological samples mentioned above. Results The methylation level of all six analysed CpG sites within the IFNG promoter region in the periodontitis biopsies {52% [interquartile range, IQR (43.8%, 63%)]} was significantly lower than periodontally healthy samples {62% [IQR (51.3%, 74%)], p =0.007} and gingivitis biopsies {63% [IQR (55%, 74%)], p =0.02}. The transcriptional level of IFNG in periodontitis biopsies was 1.96-fold and significantly higher than tissues with periodontal health (p =0.04). Although the mRNA level from experimental gingivitis samples exhibited an 8.5-fold increase as compared with periodontally healthy samples, no significant methylation difference was observed in experimental gingivitis sample. Conclusions A hypomethylation profile within IFNG promoter region is related to an increase of IFNG transcription present in the chronic periodontitis biopsies, while such an increase of IFNG in experimentally induced gingivitis seems independent of promoter methylation alteration. PMID:20958339

Role of interferon in resistance and immunity to protozoa

NASA Technical Reports Server (NTRS)

Sonnenfeld, G.; Degee, A. L. W.; Mansfield, J. M.; Newsome, A. L.; Arnold, R. R.

1985-01-01

Production of interferon (I) in response to protozoan infection, and the interferon-mediated inhibition of parasite replication were studied in order to determine if these effects may be related to immunologic-mediated resistance of the hosts. Two extracellular parasites-Trypanosoma brucei rhodesiense and Naegleria fowlei were used. Upon infection with the trypanosome, only resistant strains of mice produced I. An early peak of alpha/beta I is followed by appearance of gamma I, which coincided with antibody production and a drop in parasitemia. In case of the amoeba, pretreatment of its suspension with alpha/beta I inhibits its replication in vitro, and appears to protect mice from the infection and the disease. It is proposed that production of interferon, with its regulatory effect on the immune responses, may play a major role in regulating the processes of protozoan-caused diseases.

Extensive transmission of Mycobacterium tuberculosis among children on a school bus.

PubMed

Neira-Munoz, Edmundo; Smith, Janette; Cockcroft, Paul; Basher, Damian; Abubakar, Ibrahim

2008-09-01

We report a tuberculosis outbreak in school children caused by exposure to a sputum-smear positive school bus driver. Exposed children were assessed using 2 versions of interferon-gamma release assays. Fifty-five percent (18/34) had a positive interferon-gamma release assays and 4 children developed tuberculosis. This suggests that transmission may be very efficient in this setting and highlights the need for early diagnosis.

T-SPOT.TB Interferon-γ Release Assay Performance in Healthcare Worker Screening at Nineteen U.S. Hospitals.

PubMed

King, Thomas C; Upfal, Mark; Gottlieb, Andrew; Adamo, Philip; Bernacki, Edward; Kadlecek, Chris P; Jones, Jeffrey G; Humphrey-Carothers, Frances; Rielly, Albert F; Drewry, Pamela; Murray, Kathy; DeWitt, Marcie; Matsubara, Janet; O'Dea, Louis; Balser, John; Wrighton-Smith, Peter

2015-08-01

Interferon-γ release assays have significant advantages over tuberculin skin testing in many clinical situations. However, recent studies have called into question their reliability in serial testing of healthcare workers because of reportedly high rates of positivity and high conversion/reversion rates on retesting. To define the performance characteristics of the T-SPOT.TB test, an interferon-γ release assay, during serial screening programs of healthcare workers at 19 U.S. hospitals. A total of 42,155 T-SPOT.TB test results from healthcare workers at 19 geographically diverse hospitals obtained for routine tuberculosis screening programs were analyzed to determine the rates of positivity, reversion, and conversion in serial testing data. In 19,630 evaluable serial pairs from 16,076 healthcare workers, the mean test positivity rate was 2.3% (range, 0.0-27.4%). The mean conversion rate was 0.8% (range, 0.0-2.5%), and the mean reversion rate was 17.6%. Positivity and conversion rates correlated with known tuberculosis risk factors including age and sex. The observed specificity of the T-SPOT.TB test was at least 98.6%. The high concordance and test completion rates in this study suggest that the T-SPOT.TB test is a reliable tool for healthcare worker serial screening. As expected, the observed positivity rates were lower compared with the tuberculin skin test, likely reflecting the higher specificity of this test. Furthermore, the observed rates of conversion were low and significantly correlated with the geographic incidence of tuberculosis. Our findings suggest that the T-SPOT.TB test is an accurate and reliable way to screen healthcare workers.

[The usefulness of in vitro interferon-gamma assay for differential diagnosis between intestinal tuberculosis and Crohns disease].

PubMed

Lee, Jung Nam; Ryu, Dong Yup; Park, Sung Han; You, Hyun Seok; Lee, Bong Eun; Kim, Dong Uk; Kim, Tae Oh; Heo, Jeong; Kim, Gwang Ha; Song, Geun Am; Kim, Suk; Park, Do Youn

2010-06-01

It is difficult to clinically and endoscopically differentiate intestinal tuberculosis (ITB) and Crohns disease (CD). The aim of this study was to evaluate the usefulness of in vitro interferon-gamma (INF-gamma) assay for differential diagnosis between ITB and CD. Sixty patients for whom differential diagnosis between ITB and CD was difficult were enrolled between January 2007 and January 2009. The INF-gamma-producing T-cell response to early secreted antigenic target 6 and culture filtrate protein 10 were measured by T-SPOT.TB blood test in vitro. We evaluated the usefulness of T-SPOT.TB blood test by comparing its results with the final diagnosis. Twenty and forty patients were revealed to be positive and negative in T-SPOT.TB blood test, respectively. Of the 20 patients found to be positive, 12 patients (60%) were finally diagnosed as ITB, 6 patients as CD, and 2 patients as Behcets enterocolitis. Of the 40 patients with negative results, 38 patients (95%) were diagnosed as CD; one as Behcets enterocolitis; one as nonspecific colitis; none as ITB. The sensitivity and specificity of T-SPOT.TB blood test for ITB were 100% and 83.3%, respectively. Positive and negative predictive values of T-SPOT.TB blood test for ITB were 60.0% and 100%, respectively. When differential diagnosis between ITB and CD is difficult, T-SPOT.TB blood test may be a helpful and rapid diagnostic tool to exclude ITB. Prospective large-scaled studies are required for further evaluation of the usefulness of T-SPOT.TB blood test for differential diagnosis between ITB and CD.

Effect of leukocyte therapy on tumor necrosis factor-alpha and interferon-gamma production in patients with recurrent spontaneous abortion.

PubMed

Gharesi-Fard, Behrouz; Zolghadri, Jaleh; Kamali-Sarvestani, Eskandar

2008-03-01

Considering the deleterious role of T helper1 (Th1) cells in pregnancy outcome, a successful treatment for recurrent spontaneous abortion (RSA) should be able to make a significant shift away from Th1 responses. Although paternal leukocyte immunization has been used for treatment of RSA for years, because of methodological differences there is no consensus on the mechanism of action and effectiveness of this method. Twenty-five Iranian non-pregnant women with RSA and 16 non-pregnant control women with at least two successful pregnancies were included in this study. All cases were followed up after leukocyte therapy for pregnancy outcome. Mononuclear cells from women were co-cultured with the husband's mononuclear cells before and after immunotherapy. The levels of tumor necrosis factor-alpha (TNF-alpha) and interferon-gamma (IFN-gamma) were checked on culture supernatant by enzyme-linked immunosorbent assay method. The mean concentration of TNF-alpha was significantly higher in patients compared with that in normal controls (P=0.0001). After immunotherapy, the TNF-alpha level was only significantly decreased in women with successful outcome (P=0.0001). Immunotherapy also induced a significant reduction in the IFN-gamma level (P=0.009). The results of this investigation confirm the role of TNF-alpha in RSA and propose the assessment of TNF-alpha production as a valuable prognostic parameter for the prediction of abortion after leukocyte therapy.

Interferon Gamma potentiates the injury caused by MPP(+) on SH-SY5Y cells, which is attenuated by the nitric oxide synthases inhibition.

PubMed

Titze-de-Almeida, Simoneide S; Lustosa, Cátia Faria; Horst, Camila Hillesheim; Bel, Elaine Del; Titze-de-Almeida, Ricardo

2014-12-01

This study examined whether the cytokine interferon (IFN) gamma plays a role in the injury of SH-SY5Y cells caused by MPP(+) (1-methyl-4-phenylpyridinium). First of all, IFN-gamma sensitized cells to the neurotoxin MPP(+), as determined by MTT (3-(4,5-dimethylthiazol-2-y1)-2,5-diphenyltetrazolium bromide) assay. MPP(+)-injured cells showed higher reactive oxygen species (ROS) levels, which was reinforced by IFN-gamma. The injury triggered a marked expression of the neuronal NOS (nNOS) enzyme. L-NAME [N(ω)-nitro-L-arginine methyl ester, a non-specific NOS inhibitor] reestablished the cell viability after IFN-gamma challenging, and recovered cells from MPP(+) injury (95.0 vs. 84.7 %; P < 0.05). Seven-NI (7-nitroindazole, a nNOS inhibitor) protected cells against the injury by MPP(+) co-administered with IFN-gamma. Both inhibitors restrained the apoptosis of SH-SY5Y cells caused by MPP(+)/IFN-gamma. Regarding oxidative stress, L-NAME and 7-NI attenuated the increase in ROS levels caused by MPP(+) (45.3 or 48.4 vs. 87.9 %, P < 0.05). Indeed, L-NAME was more effective than 7-NI for reducing oxidative stress caused by MPP(+) under IFN-gamma exposition. The nNOS gene silencing by small-interfering RNAs recovered cells challenged by IFN-gamma (24 h), or MPP(+) (8 h). In conclusion, IFN-gamma sensitizes cells to MPP(+)-induced injury, also causing an increase in ROS levels. Pretreating cells with L-NAME or 7-NI reverts both the oxidative stress and apoptosis triggered by the neurotoxin MPP(+). Taking together, our data reinforce that IFN-gamma and NOS enzymes play a role in oxidative stress and dopaminergic cell death triggered by MPP(+).

CMOS image sensor for detection of interferon gamma protein interaction as a point-of-care approach.

PubMed

Marimuthu, Mohana; Kandasamy, Karthikeyan; Ahn, Chang Geun; Sung, Gun Yong; Kim, Min-Gon; Kim, Sanghyo

2011-09-01

Complementary metal oxide semiconductor (CMOS)-based image sensors have received increased attention owing to the possibility of incorporating them into portable diagnostic devices. The present research examined the efficiency and sensitivity of a CMOS image sensor for the detection of antigen-antibody interactions involving interferon gamma protein without the aid of expensive instruments. The highest detection sensitivity of about 1 fg/ml primary antibody was achieved simply by a transmission mechanism. When photons are prevented from hitting the sensor surface, a reduction in digital output occurs in which the number of photons hitting the sensor surface is approximately proportional to the digital number. Nanoscale variation in substrate thickness after protein binding can be detected with high sensitivity by the CMOS image sensor. Therefore, this technique can be easily applied to smartphones or any clinical diagnostic devices for the detection of several biological entities, with high impact on the development of point-of-care applications.

Interferon-gamma and T-bet expression in a patient with toxoplasmic lymphadenopathy.

PubMed

Jöhrens, Korinna; Moos, Verena; Schneider, Thomas; Stein, Harald; Anagnostopoulos, Ioannis

2010-04-01

Infection with Toxoplasma gondii (TG) presents in some individuals as a self-limited disease with a predominant lymphadenopathy characterized by prominent B-cell activation. As this is in contrast to the in vitro based concept of a T(h)1-immune response against TG, we investigated native lymphoid tissue and peripheral blood of a patient with serologic evidence of toxoplasmosis to verify which cells show T(h)1-response features. High-level expression of T-bet in monocytoid B-cells, in germinal center B-cells, and in a lesser amount in T cells could be demonstrated by immunohistochemistry. In vitro stimulation of lymph node cells with either TG, staphylococcus enterotoxin B, or phorbol 12-myristate 13-acetate/ionomycin revealed an interferon-gamma expression in T-bet(+) B cells only in the patient and not in controls. Similar results were found for T-bet(+) T cells which were also present in controls. CD4(+) peripheral blood cells stimulated with TG antigens showed a TG-specific but attenuated T(h)1-reactivity in the patient associated with a reduced expression of IL-2 when compared with controls. We conclude that the pathogenesis and course of toxoplasmic lymphadenopathy is based on a T(h)1-cell defect, which becomes compensated by the B cells mounting a T(h)1-like immune response.

Delayed growth of EL4 lymphoma in SR-A-deficient mice is due to upregulation of nitric oxide and interferon-gamma production by tumor-associated macrophages.

PubMed

Komohara, Yoshihiro; Takemura, Kenichi; Lei, Xiao Feng; Sakashita, Naomi; Harada, Mamoru; Suzuki, Hiroshi; Kodama, Tatsuhiko; Takeya, Motohiro

2009-11-01

Class A scavenger receptors (SR-A, CD204) are highly expressed in tumor-associated macrophages (TAM). To investigate the function of SR-A in TAM, wild-type and SR-A-deficient (SR-A(-/-)) mice were injected with EL4 cells. Although these groups of mice did not differ in the numbers of infiltrating macrophages and lymphocytes and in neovascularization, SR-A(-/-) mice had delayed growth of EL4 tumors. Expression of inducible nitric oxide (NO) synthase and interferon (IFN)-gamma mRNA increased significantly in tumor tissues from SR-A(-/-) mice. Engulfment of necrotic EL4 cells induced upregulation of NO and IFN-gamma production by cultured macrophages, and production of NO and IFN-gamma increased in SR-A(-/-) macrophages in vitro. IFN-beta production by cultured macrophages was also elevated in SR-A(-/-) macrophages in vitro. These results suggested that the antitumor activity of macrophages increased in SR-A(-/-) mice because of upregulation of NO and IFN-gamma production. These data indicate an important role of SR-A in regulating TAM function by inhibiting toll-like receptor (TLR)4-IFN-beta signaling.

Application of genetically engineered Salmonella typhimurium for interferon-gamma-induced therapy against melanoma.

PubMed

Yoon, Wonsuck; Park, Yoo Chang; Kim, Jinseok; Chae, Yang Seok; Byeon, Jung Hye; Min, Sang-Hyun; Park, Sungha; Yoo, Young; Park, Yong Keun; Kim, Byeong Mo

2017-01-01

Salmonella have been experimentally used as anti-cancer agents, because they show selective growth in tumours. In this study, we genetically modified attenuated Salmonella typhimurium to express and secrete interferon-gamma (IFN-γ) as a tumouricidal agent to enhance the therapeutic efficacy of Salmonella. IFN-γ was fused to the N-terminal region (residues 1-160) of SipB (SipB160) for secretion from bacterial cells. Attenuated S. typhimurium expressing recombinant IFN-γ (S. typhimurium (IFN-γ)) invaded the melanoma cells and induced cytotoxicity. Subcutaneous administration of S. typhimurium (IFN-γ) also efficiently inhibited tumour growth and prolonged the survival of C57BL/6 mice bearing B16F10 melanoma compared with administration of phosphate-buffered saline (PBS), unmodified S. typhimurium or S. typhimurium expressing empty vector (S. typhimurium [Vec]) in a natural killer (NK) cell-dependent manner. Moreover, genetically modified Salmonella, including S. typhimurium (IFN-γ), showed little toxicity to normal tissues with no observable adverse effects. However, S. typhimurium (IFN-γ)-mediated tumour suppression was attributed to direct killing of tumour cells rather than to stable anti-tumour immunity. Collectively, these results suggest that tumour-targeted therapy using S. typhimurium (IFN-γ) has potential for melanoma treatment. Copyright © 2016 Elsevier Ltd. All rights reserved.

Interferon-gamma regulates nucleoside transport systems in macrophages through signal transduction and activator of transduction factor 1 (STAT1)-dependent and -independent signalling pathways.

PubMed Central

Soler, Concepció; Felipe, Antonio; García-Manteiga, José; Serra, Maria; Guillén-Gómez, Elena; Casado, F Javier; MacLeod, Carol; Modolell, Manuel; Pastor-Anglada, Marçal; Celada, Antonio

2003-01-01

The expressions of CNT and ENT (concentrative and equilibrative nucleoside transporters) in macrophages are differentially regulated by IFN-gamma (interferon-gamma). This cytokine controls gene expression through STAT1-dependent and/or -independent pathways (where STAT1 stands for signal transduction and activator of transcription 1). In the present study, the role of STAT1 in the response of nucleoside transporters to IFN-gamma was studied using macrophages from STAT1 knockout mice. IFN-gamma triggered an inhibition of ENT1-related nucleoside transport activity through STAT1-dependent mechanisms. Such inhibition of macrophage growth and ENT1 activity by IFN-gamma is required for DNA synthesis. Interestingly, IFN-gamma led to an induction of the CNT1- and CNT2-related nucleoside transport activities independent of STAT1, thus ensuring the supply of extracellular nucleosides for the STAT1-independent RNA synthesis. IFN-gamma up-regulated CNT2 mRNA and CNT1 protein levels and down-regulated ENT1 mRNA in both wild-type and STAT1 knockout macrophages. This is consistent with a STAT1-independent, long-term-mediated, probably transcription-dependent, regulation of nucleoside transporter genes. Moreover, STAT1-dependent post-transcriptional mechanisms are implicated in the regulation of ENT1 activity. Although nitric oxide is involved in the regulation of ENT1 activity in B-cells at a post-transcriptional level, our results show that STAT1-dependent induction of nitric oxide by IFN-gamma is not implicated in the regulation of ENT1 activity in macrophages. Our results indicate that both STAT1-dependent and -independent pathways are involved in the regulation of nucleoside transporters by IFN-gamma in macrophages. PMID:12868960

Coexposure of mice to trovafloxacin and lipopolysaccharide, a model of idiosyncratic hepatotoxicity, results in a unique gene expression profile and interferon gamma-dependent liver injury.

PubMed

Shaw, Patrick J; Ditewig, Amy C; Waring, Jeffrey F; Liguori, Michael J; Blomme, Eric A; Ganey, Patricia E; Roth, Robert A

2009-01-01

The antibiotic trovafloxacin (TVX) has caused severe idiosyncratic hepatotoxicity in people, whereas levofloxacin (LVX) has not. Mice cotreated with TVX and lipopolysaccharide (LPS), but not with LVX and LPS, develop severe hepatocellular necrosis. Mice were treated with TVX and/or LPS, and hepatic gene expression changes were measured before liver injury using gene array. Hepatic gene expression profiles from mice treated with TVX/LPS clustered differently from those treated with LPS or TVX alone. Several of the probe sets expressed differently in TVX/LPS-treated mice were involved in interferon (IFN) signaling and the janus kinase/signal transducers and activators of transcription (JAK/STAT) pathway. A time course of plasma concentrations of IFN-gamma and interleukin (IL)-18, which directly induces IFN-gamma production, revealed that both cytokines were selectively increased in TVX/LPS-treated mice. Both IL-18(-/-) and IFN-gamma(-/-) mice were significantly protected from TVX/LPS-induced liver injury. In addition, IFN-gamma(-/-) mice had decreased plasma concentrations of tumor necrosis factor-alpha, IL-18, and IL-1beta when compared to wild-type mice. In conclusion, the altered expression of genes involved in IFN signaling in TVX/LPS-treated mice led to the finding that IL-18 and IFN-gamma play a critical role in TVX/LPS-induced liver injury.

Correlations between endotoxin, interferon-gamma, biopterin and serum phospholipase A2-activities during lethal gram negative sepsis in rats.

PubMed

Hunsicker, A; Kullich, W; Weissenhofer, W; Lorenz, D; Petermann, J; Rokos, H; Schwesinger, G

1997-05-01

To establish a standardised reproducible animal model of intraperitoneal sepsis, and to investigate early immunoserological responses to find a mediator-based system for evaluation and grading of diffuse peritonitis in patients Prospective experimental study 4 Teaching hospitals, Germany and Austria 42 LEW. 1W rats, 12 of which acted as controls Gram negative sepsis was induced by intraperitoneal injection of 6 ml of a mixture of Escherichia coli (K1:H+) 10(10) organisms/ml, autogenous haemoglobin 2.9 ml (haemoglobin concentration 3%), 0.9% sodium chloride 3 ml, and suspension 0.1 ml. Control rats were given physiological saline 6 ml alone. Concentrations of endotoxin, interferon gamma (IFN-gamma), and biopterin, and serum phospholipase A2 (PLA2) activity. There were significant differences between the septic and control rats in concentrations of endotoxin (EU/ml) (median (interquartile range) 21.85 (2.02-159.5) compared with 0, p < 0.0001; IFN-gamma (pg/ml) 1263.0 (271.0-7575.0) compared with 101.0 (89.0-141.0), p < 0.0001; biopterin (nmol/L) 111.0 (66.4-156.3) compared with 53.7 (38.3-67.6), p < 0.001; and PLA2 (U/L) 163.0 (125.8-209.0) compared with 112.5 (88.5-126.5) p < 0.01. Measurements of concentrations of endotoxin, IFN-gamma, pteridines, and PLA2 activity may well be adequate markers for early recognition of sepsis, and perhaps for grading it during the first 6 hours after induction. The allow a clear distinction to be made between septic and non-septic disorders in 87% of cases.

Interferon effects on protozoan infections

NASA Technical Reports Server (NTRS)

Sonnenfeld, G.; Wirth, J.; Kierszenbaum, F.; Degee, A. L. W.; Mansfield, J. M.

1985-01-01

The effects of interferon (IFN) on mice infected with two different parasitic protozoans, Trypanosoma cruzi and Trypanosoma brucei rhodesiense, are investigated experimentally. The preparation of the cell cultures, IFN and assays, antibody, and the experimental procedures are described. It is observed that in cells treated with IFN-gamma there is an increased association of T. cruzi with murine macrophages and an increase in the killing of T. cruzi by IFN-gamma-treated murine macrophages. For spleen cells infected with T.b. rhodesiense in vitro, it is detected that live trypanosomes cannot induce IFN in cells from normal mice, but can in cells from immunized mice; and that trypanosome-lysates induce IFN in vitro in cells from normal mice. The data suggest that there is a two-step mechanism for mice against T. cruzi and T.b. rhodesiense.

Biosynthesis and N-glycosylation of human interferon-gamma. Asn25 and Asn97 differ markedly in how efficiently they are glycosylated and in their oligosaccharide composition.

PubMed

Sareneva, T; Mørtz, E; Tölö, H; Roepstorff, P; Julkunen, I

1996-12-01

Interferon-gamma (IFN-gamma) is a secretory glycoprotein produced by T cells in response to antigenic or mitogenic stimuli. We studied the kinetics of the synthesis, N-glycosylation, and secretion of IFN-gamma in human CD8+ T lymphocytes stimulated via T-cell receptor. Highly elevated IFN-gamma mRNA levels were found as early as 1 h after stimulation. Maximal IFN-gamma protein synthesis was observed 2-4 h after induction and appeared to correlate to steady-state IFN-gamma mRNA levels. As analyzed by pulse/chase experiments, the secretion of IFN-gamma from T cells was very rapid, the secretion half-time being approximately 20-25 min. Inhibition of N-glycosylation by tunicamycin dramatically reduced the expression of IFN-gamma, but did not block its secretion. Natural IFN-gamma is heterogeneously glycosylated and doubly, singly, and unglycosylated forms exist. Experiments performed in a cell-free translation/glycosylation system with mutated IFN-gamma constructs lacking either one of the potential glycosylation sites suggested that Asn25 is more efficiently glycosylated than Asn97. Site-specific oligosaccharide analysis of natural IFN-gamma by glycosidase treatment followed by matrix-assisted-laser-desorption-ionization mass spectrometry revealed considerable variation in the carbohydrate structures, with more than 30 different forms. The glycans at Asn25 consisted of fucosylated, mainly complex-type oligosaccharides, whereas the glycans at Asn97 were more heterogeneous, with hybrid and high-mannose structures. Our results emphasize the essential role of N-linked glycans in the biology of IFN-gamma and show that there is a considerable heterogeneity in the individual sugar chains of this important human cytokine.

Histaminergic regulation of interferon-gamma (IFN-gamma) production by human natural killer (NK) cells.

PubMed

Asea, A; Hansson, M; Czerkinsky, C; Houze, T; Hermodsson, S; Strannegård, O; Hellstrand, K

1996-08-01

Monocytes, recovered from human peripheral blood by counter-current centrifugal elutriation, effectively inhibit the production of IFN-gamma by CD3-/56+ NK cells in response to IL-2. This study aimed at defining the nature of the inhibitory signal, particularly the importance of monocyte-derived reactive metabolites of oxygen. It was found that monocytes recovered from patients with chronic granulomatous disease (CGD), a condition characterized by deficient NADPH-oxidase activity of phagocytes, did not inhibit IFN-gamma production by NK cells. Further, catalase, a scavenger of hydrogen peroxide, completely reversed the inhibitory signal whereas scavengers of the superoxide anion, hypohalous acids, the hydroxyl radical, or nitric oxide synthesis inhibitors such as L-NMMA were ineffective. Inhibition of IFN-gamma production was operating on a pretranslational level, as indicated by the inability of enriched NK cells to accumulate IFN-gamma mRNA in the presence of elutriated monocytes. Hydrogen peroxide, at micromolar concentrations, reconstituted the inhibition of IFN-gamma production when added to enriched NK cells. Histamine, a biogenic amine which inhibits the generation of reactive oxygen metabolites in monocytes, abrogated the inhibition of IFN-gamma production in NK cells; by this mechanism, histamine strongly synergized with IL-2 to induce IFN-gamma in mixtures of NK cells and monocytes. The synergizing effect of histamine was specifically mediated by H2-type histamine receptors. We conclude that: (i) the induction of IFN-gamma mRNA in NK cells is effectively down-regulated by products of the oxidative metabolism of monocytes; and (ii) histamine effectively enhances IFN-gamma production by preventing monocyte-induced oxidative damage to NK cells.

Partial interferon-gamma receptor 1 deficiency in a child with tuberculoid bacillus Calmette-Guérin infection and a sibling with clinical tuberculosis.

PubMed Central

Jouanguy, E; Lamhamedi-Cherradi, S; Altare, F; Fondanèche, M C; Tuerlinckx, D; Blanche, S; Emile, J F; Gaillard, J L; Schreiber, R; Levin, M; Fischer, A; Hivroz, C; Casanova, J L

1997-01-01

Complete interferon-gamma receptor 1 (IFNgammaR1) deficiency has been identified previously as a cause of fatal bacillus Calmette-Guérin (BCG) infection with lepromatoid granulomas, and of disseminated nontuberculous mycobacterial (NTM) infection in children who had not been inoculated with BCG. We report here a kindred with partial IFNgammaR1 deficiency: one child afflicted by disseminated BCG infection with tuberculoid granulomas, and a sibling, who had not been inoculated previously with BCG, with clinical tuberculosis. Both responded to antimicrobials and are currently well without prophylactic therapy. Impaired response to IFN-gamma was documented in B cells by signal transducer and activator of transcription 1 nuclear translocation, in fibroblasts by cell surface HLA class II induction, and in monocytes by cell surface CD64 induction and TNF-alpha secretion. Whereas cells from healthy children responded to even low IFN-gamma concentrations (10 IU/ml), and cells from a child with complete IFNgammaR1 deficiency did not respond to even high IFN-gamma concentrations (10,000 IU/ml), cells from the two siblings did not respond to low or intermediate concentrations, yet responded to high IFN-gamma concentrations. A homozygous missense IFNgR1 mutation was identified, and its pathogenic role was ascertained by molecular complementation. Thus, whereas complete IFNgammaR1 deficiency in previously identified kindreds caused fatal lepromatoid BCG infection and disseminated NTM infection, partial IFNgammaR1 deficiency in this kindred caused curable tuberculoid BCG infection and clinical tuberculosis. PMID:9389728

Designing of interferon-gamma inducing MHC class-II binders

PubMed Central

2013-01-01

Background The generation of interferon-gamma (IFN-γ) by MHC class II activated CD4+ T helper cells play a substantial contribution in the control of infections such as caused by Mycobacterium tuberculosis. In the past, numerous methods have been developed for predicting MHC class II binders that can activate T-helper cells. Best of author’s knowledge, no method has been developed so far that can predict the type of cytokine will be secreted by these MHC Class II binders or T-helper epitopes. In this study, an attempt has been made to predict the IFN-γ inducing peptides. The main dataset used in this study contains 3705 IFN-γ inducing and 6728 non-IFN-γ inducing MHC class II binders. Another dataset called IFNgOnly contains 4483 IFN-γ inducing epitopes and 2160 epitopes that induce other cytokine except IFN-γ. In addition we have alternate dataset that contains IFN-γ inducing and equal number of random peptides. Results It was observed that the peptide length, positional conservation of residues and amino acid composition affects IFN-γ inducing capabilities of these peptides. We identified the motifs in IFN-γ inducing binders/peptides using MERCI software. Our analysis indicates that IFN-γ inducing and non-inducing peptides can be discriminated using above features. We developed models for predicting IFN-γ inducing peptides using various approaches like machine learning technique, motifs-based search, and hybrid approach. Our best model based on the hybrid approach achieved maximum prediction accuracy of 82.10% with MCC of 0.62 on main dataset. We also developed hybrid model on IFNgOnly dataset and achieved maximum accuracy of 81.39% with 0.57 MCC. Conclusion Based on this study, we have developed a webserver for predicting i) IFN-γ inducing peptides, ii) virtual screening of peptide libraries and iii) identification of IFN-γ inducing regions in antigen (http://crdd.osdd.net/raghava/ifnepitope/). Reviewers This article was reviewed by Prof Kurt

The relationship between Q gamma and Ca release from the sarcoplasmic reticulum in skeletal muscle

PubMed Central

1991-01-01

Asymmetric membrane currents and fluxes of Ca2+ release were determined in skeletal muscle fibers voltage clamped in a Vaseline-gap chamber. The conditioning pulse protocol 1 for suppressing Ca2+ release and the "hump" component of charge movement current (I gamma), described in the first paper of this series, was applied at different test pulse voltages. The amplitude of the current suppressed during the ON transient reached a maximum at slightly suprathreshold test voltages (- 50 to -40 mV) and decayed at higher voltages. The component of charge movement current suppressed by 20 microM tetracaine also went through a maximum at low pulse voltages. This anomalous voltage dependence is thus a property of I gamma, defined by either the conditioning protocol or the tetracaine effect. A negative (inward-going) phase was often observed in the asymmetric current during the ON of depolarizing pulses. This inward phase was shown to be an intramembranous charge movement based on (a) its presence in the records of total membrane current, (b) its voltage dependence, with a maximum at slightly suprathreshold voltages, (c) its association with a "hump" in the asymmetric current, (d) its inhibition by interventions that reduce the "hump", (e) equality of ON and OFF areas in the records of asymmetric current presenting this inward phase, and (f) its kinetic relationship with the time derivative of Ca release flux. The nonmonotonic voltage dependence of the amplitude of the hump and the possibility of an inward phase of intramembranous charge movement are used as the main criteria in the quantitative testing of a specific model. According to this model, released Ca2+ binds to negatively charged sites on the myoplasmic face of the voltage sensor and increases the local transmembrane potential, thus driving additional charge movement (the hump). This model successfully predicts the anomalous voltage dependence and all the kinetic properties of I gamma described in the previous

Mycobacterium tuberculosis infection in health care workers in rural India: comparison of a whole-blood interferon gamma assay with tuberculin skin testing.

PubMed

Pai, Madhukar; Gokhale, Kaustubh; Joshi, Rajnish; Dogra, Sandeep; Kalantri, Shriprakash; Mendiratta, Deepak K; Narang, Pratibha; Daley, Charles L; Granich, Reuben M; Mazurek, Gerald H; Reingold, Arthur L; Riley, Lee W; Colford, John M

2005-06-08

Mycobacterium tuberculosis infection in health care workers has not been adequately studied in developing countries using newer diagnostic tests. To estimate latent tuberculosis infection prevalence in health care workers using the tuberculin skin test (TST) and a whole-blood interferon gamma (IFN-gamma) assay; to determine agreement between the tests; and to compare their correlation with risk factors. A cross-sectional comparison study of 726 health care workers aged 18 to 61 years (median age, 22 years) with no history of active tuberculosis conducted from January to May 2004, at a rural medical school in India. A total of 493 (68%) of the health care workers had direct contact with patients with tuberculosis and 514 (71%) had BCG vaccine scars. Tuberculin skin testing was performed using 1-TU dose of purified protein derivative RT23, and the IFN-gamma assay was performed by measuring IFN-gamma response to early secreted antigenic target 6, culture filtrate protein 10, and a portion of tuberculosis antigen TB7.7. Agreement between TST and the IFN-gamma assay, and comparison of the tests with respect to their association with risk factors. A large proportion of the health care workers were latently infected; 360 (50%) were positive by either TST or IFN-gamma assay, and 226 (31%) were positive by both tests. The prevalence estimates of TST and IFN-gamma assay positivity were comparable (41%; 95% confidence interval [CI], 38%-45% and 40%; 95% CI, 37%-43%, respectively). Agreement between the tests was high (81.4%; kappa = 0.61; 95% CI, 0.56-0.67). Increasing age and years in the health profession were significant risk factors for both IFN-gamma assay and TST positivity. BCG vaccination had little impact on TST and IFN-gamma assay results. Our study showed high latent tuberculosis infection prevalence in Indian health care workers, high agreement between TST and IFN-gamma assay, and similar association between positive test results and risk factors. Although TST and

The effect of fermented milk on interferon production in malnourished children and in anorexia nervosa patients undergoing nutritional care.

PubMed

Solis, B; Nova, E; Gómez, S; Samartín, S; Mouane, N; Lemtouni, A; Belaoui, H; Marcos, A

2002-12-01

For several years cytokine production has been associated with infections but it was not suspected that some types of food could also induce cytokines, even in a state of non-infection. Lactic bacteria can induce interferon (IFN) production in human healthy subjects, thus, a better protection against infections would be expected. Therefore, we planned to evaluate the effect of two diets including yoghurt or milk on IFN-gamma production during nutritional recovery in two different situations of malnutrition: (1) children with diarrhoea; and (2) patients with anorexia nervosa (AN). Both the diet including yoghurt of that including milk seemed to increase IFN-gamma production at the end of nutritional recovery in the malnourished children with diarrhoea. The significance of interferon production and the lymphocyte subset increase should be explored to know if a better resistance against pathogens is related to them. Regulation of intestinal absorption and moderate stimulation of interferon production make the yoghurt-based diet a good choice in the nutritional care of children. In the same way, an increase in the IFN-gamma production was observed in AN patients consuming yoghurt. This increase of IFN-gamma production could be considered a biological marker to detect the effect of probiotics on the immune response, especially in the improvement of a deficient nutritional status.

Successful Application of the Gamma-Interferon Assay in a Bovine Tuberculosis Eradication Program: The French Bullfighting Herd Experience.

PubMed

Keck, Nicolas; Boschiroli, Maria-Laura; Smyej, Florence; Vogler, Valérie; Moyen, Jean-Louis; Desvaux, Stéphanie

2018-01-01

In the French Camargue region, where bovine tuberculosis had been enzootic for several years in bullfighting cattle herds, the gamma-interferon (IFN) assay was used since 2003 in parallel with the intradermal test in order to increase overall disease detection sensitivity in infected herds. This study presents the results of a field-evaluation of the assay during a 10-year period (2004-2014) of disease control and surveillance program and explores the particular pattern of IFN assay results in bullfight herds in comparison to cattle from other regions of France. The low sensitivity [59.2% (50.6; 67.3)] of IFN assay using the tuberculin stimulation could be related to the poor gamma-IFN production from bullfight cattle blood cells which is significantly lower than in animals of conventional breeds. The characteristics of the assay were progressively adapted to the epidemiological situation and the desired strategic applications. Data analysis with a receiver operating characteristic curve based on a simple S/P value algorithm allowed for the determination of a new cutoff adapted for a global screening, giving a high specificity of 99.9% results and a high accuracy of the assay. Having regularly risen to above 5% since 2005, with a peak around 10% in 2010, the annual incidence dropped to under 1% in 2014. The positive predictive value relative to the bacteriological confirmation evolved during the years, from 33% in 2009 to 12% during the last screening period, a normal trend in a context of decreasing prevalence. The estimated rate of false-positive reactions during screening campaigns was 0.67%, confirming the high specificity of the test, measured in bTB negative herds, in this epidemiological context. The proportion of false-positive reactions decreased with the age and was higher in males than in females. Although these results indicate that the IFN assay is accurate in the field, it also emphasizes great differences between interferon quantities produced by

Peroxisome-proliferator-activated receptor-{gamma} agonists inhibit the release of proinflammatory cytokines from RSV-infected epithelial cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Arnold, Ralf; Koenig, Wolfgang

2006-03-15

The epithelial cells of the airways are the target cells for respiratory syncytial virus (RSV) infection and the site of the majority of the inflammation associated with the disease. Recently, peroxisome-proliferator-activated receptor {gamma} (PPAR{gamma}), a member of the nuclear hormone receptor superfamily, has been shown to possess anti-inflammatory properties. Therefore, we investigated the role of PPAR{gamma} agonists (15d-PGJ{sub 2}, ciglitazone and troglitazone) on the synthesis of RSV-induced cytokine release from RSV-infected human lung epithelial cells (A549). We observed that all PPAR{gamma} ligands inhibited dose-dependently the release of TNF-{alpha}, GM-CSF, IL-1{alpha}, IL-6 and the chemokines CXCL8 (IL-8) and CCL5 (RANTES) frommore » RSV-infected A549 cells. Concomitantly, the PPAR{gamma} ligands diminished the cellular amount of mRNA encoding for IL-6, CXCL8 and CCL5 and the RSV-induced binding activity of the transcription factors NF-{kappa}B (p65/p50) and AP-1 (c-fos), respectively. Our data presented herein suggest a potential application of PPAR{gamma} ligands in the anti-inflammatory treatment of RSV infection.« less

Promotion of interferon-gamma production by natural killer cells via suppression of murine peritoneal macrophage prostaglandin E₂ production using intravenous anesthetic propofol.

PubMed

Inada, Takefumi; Kubo, Kozue; Shingu, Koh

2010-10-01

Propofol is an intravenous anesthetic, widely used for general anesthesia during surgery, which inevitably involves tissue trauma with inflammation. At sites of inflammation, prostanoids, especially prostaglandin E₂ (PGE₂), are abundant. This study addresses the effect of propofol on macrophage PGE₂ production. Using thioglycollate-elicited murine peritoneal macrophages, propofol (7.5-30 μM) suppressed lipopolysaccharide-induced PGE₂ production. The suppression was via the direct inhibition of cyclooxygenase (COX) enzyme activity and due neither to the downregulation of COX expression nor the inhibition of arachidonic acid release from plasma membranes. In macrophage:natural killer (NK) cell co-culture, propofol dramatically increased interferon-gamma (IFN-γ) production, and the actions of propofol were mimicked by a selective COX-2 inhibitor, NS-398, as well as the selective EP4 receptor antagonist L-161,982, suggesting a role of PGE₂ suppression in the upregulation of IFN-γ production. Furthermore, in purified NK cell culture, PGE₂ directly suppressed the production of IFN-γ by activated NK cells, which was reversed by selective inhibition of EP4 activity. Taken together, our results show that, in macrophage:NK cell co-culture, propofol, through the suppression of macrophage PGE₂ production, upregulates NK cell IFN-γ production by alleviating EP4 receptor-mediated suppression of IFN-γ production. Propofol may potentially exert considerable influence on inflammation and immunity by suppressing PGE₂ synthesis. Copyright © 2010 Elsevier B.V. All rights reserved.

MOLECULAR CLONING, SEQUENCING, EXPRESSION AND BIOLOGICAL ACTIVITY OF GIANT PANDA (AILUROPODA MELANOLEUCA) INTERFERON-GAMMA.

PubMed

Zhu, Hui; Wang, Wen-Xiu; Wang, Bao-Qin; Zhu, Xiao-Fu; Wu, Xu-Jin; Ma, Qing-Yi; Chen, De-Kun

2012-06-29

The giant panda (Ailuropoda melanoleuca) is an endangered species and indigenous to China. Interferon-gamma (IFN-γ) is the only member of type □ IFN and is vital for the regulation of host adapted immunity and inflammatory response. Little is known aboutthe FN-γ gene and its roles in giant panda.In this study, IFN-γ gene of Qinling giant panda was amplified from total blood RNA by RT-CPR, cloned, sequenced and analysed. The open reading frame (ORF) of Qinling giant panda IFN-γ encodes 152 amino acidsand is highly similar to Sichuan giant panda with an identity of 99.3% in cDNA sequence. The IFN-γ cDNA sequence was ligated to the pET32a vector and transformed into E. coli BL21 competent cells. Expression of recombinant IFN-γ protein of Qinling giant panda in E. coli was confirmed by SDS-PAGE and Western blot analysis. Biological activity assay indicated that the recombinant IFN-γ protein at the concentration of 4-10 µg/ml activated the giant panda peripheral blood lymphocytes,while at 12 µg/mlinhibited. the activation of the lymphocytes.These findings provide insights into the evolution of giant panda IFN-γ and information regarding amino acid residues essential for their biological activity.

Respiratory Francisella tularensis live vaccine strain infection induces Th17 cells and prostaglandin E2, which inhibits generation of gamma interferon-positive T cells.

PubMed

Woolard, Matthew D; Hensley, Lucinda L; Kawula, Thomas H; Frelinger, Jeffrey A

2008-06-01

Two key routes of Francisella tularensis infection are through the skin and airway. We wished to understand how the route of inoculation influenced the primary acute adaptive immune response. We show that an intranasal inoculation of the F. tularensis live vaccine strain (LVS) with a 1,000-fold-smaller dose than an intradermal dose results in similar growth kinetics and peak bacterial burdens. In spite of similar bacterial burdens, we demonstrate a difference in the quality, magnitude, and kinetics of the primary acute T-cell response depending on the route of inoculation. Further, we show that prostaglandin E(2) secretion in the lung is responsible for the difference in the gamma interferon (IFN-gamma) response. Intradermal inoculation led to a large number of IFN-gamma(+) T cells 7 days after infection in both the spleen and the lung. In contrast, intranasal inoculation induced a lower number of IFN-gamma(+) T cells in the spleen and lung but an increased number of Th17 cells in the lung. Intranasal infection also led to a significant increase of prostaglandin E(2) (PGE(2)) in the bronchoalveolar lavage fluid. Inhibition of PGE(2) production with indomethacin treatment resulted in increased numbers of IFN-gamma(+) T cells and decreased bacteremia in the lungs of intranasally inoculated mice. This research illuminates critical differences in acute adaptive immune responses between inhalational and dermal infection with F. tularensis LVS mediated by the innate immune system and PGE(2).

Gamma Interferon Loaded onto Albumin Nanoparticles: In Vitro and In Vivo Activities against Brucella abortus▿

PubMed Central

Segura, S.; Gamazo, C.; Irache, J. M.; Espuelas, S.

2007-01-01

The aim of this study was to evaluate the activity of gamma interferon (IFN-γ) when it was either adsorbed onto or loaded into albumin nanoparticles. Brucella abortus-infected macrophages and infected BALB/c mice were selected as the models for testing of the therapeutic potentials of these cytokine delivery systems, in view of the well-established role of IFN-γ-activated macrophages for the control of Brucella sp. infections. Whereas the encapsulation of IFN-γ inside the matrix of nanoparticles completely abrogated its activity, adsorbed IFN-γ increased by 0.75 log unit the bactericidal effect induced by RAW macrophages activated with free IFN-γ, along with a higher level of production of nitric oxide. In infected BALB/c-mice, IFN-γ adsorbed onto nanoparticles was also more active than free cytokine in reducing the number of bacteria in the spleens, and the effect was mediated by an increased ratio of IFN-γ-secreting (Th1) to interleukin-4-secreting (Th2) cells. Overall, albumin nanoparticles would be suitable as carriers that target IFN-γ to macrophages and, thus, potentiate their therapeutic activity. PMID:17220401

OV-104's RMS releases Gamma Ray Observatory (GRO) during STS-37 deployment

NASA Image and Video Library

1991-04-07

Atlantis', Orbiter Vehicle (OV) 104's, remote manipulator system (RMS) releases Gamma Ray Observatory (GRO) during STS-37 deployment. Visible on the GRO as it drifts away from the RMS end effector are the four complement instruments: the Energetic Gamma Ray Experiment (bottom); Imaging Compton Telescope (COMPTEL) (center); Oriented Scintillation Spectrometer Experiment (OSSE) (top); and Burst and Transient Source Experiment (BATSE) (at four corners). GRO's solar array (SA) panels are extended and are in orbit configuration. View was taken through aft flight deck window which reflects some of the crew compartment interior.

Establishment of a novel endothelial target mouse model of a typhus group rickettsiosis: evidence for critical roles for gamma interferon and CD8 T lymphocytes.

PubMed

Walker, D H; Popov, V L; Feng, H M

2000-09-01

A mouse model of typhus rickettsiosis that reproduces the hematogenous dissemination to the critical target organs, including brain, lungs, heart, and kidneys, primary endothelial and, to a lesser degree, macrophage intracellular rickettsial infection, and typical vascular-based lesions of louse-borne typhus and murine typhus was established. Intravenous inoculation of C3H/HeN mice with Rickettsia typhi caused disease with a duration of the incubation period and mortality rate that were dependent on the infective dose of rickettsiae. Lethal infection was associated with high concentrations of R. typhi in the lungs and brain, despite a brisker humoral immune response to the rickettsiae than in the sublethal infection. Gamma interferon and CD8 T lymphocytes were demonstrated to be crucial to clearance of the rickettsiae and recovery from infection in experiments in which specific monoclonal antibodies were administered to deplete these components. Death of animals depleted of gamma interferon or CD8 T lymphocytes was associated with overwhelming rickettsial infection demonstrated by titers of infectious rickettsiae and by immunohistochemistry. An effective antirickettsial immune response was associated with elevated serum concentrations of IL-12 on Day 5 and increased secretion of IL-12 by concanavalin-A-stimulated spleen cells on Day 5. Evidence for transient suppression of the immune response consisted of marked reduction in the secretion of IL-2 and IL-12 by concanavalin-A-stimulated spleen cells on Days 10 and 15. This model offers excellent opportunities for study of attenuation and pathogenetic mechanisms of typhus rickettsiae, which are established biologic weapons of potential use in bioterrorism.

Effect of recombinant human gamma interferon on intracellular activities of antibiotics against Listeria monocytogenes in the human macrophage cell line THP-1.

PubMed Central

Scorneaux, B; Ouadrhiri, Y; Anzalone, G; Tulkens, P M

1996-01-01

Listeria monocytogenes is a facultative intracellular pathogen which enters cells by endocytosis and reaches phagolysosomes from where it escapes and multiplies in the cytosol of untreated cells. Exposure of macrophages to gamma interferon (IFN-gamma) restricts L. monocytogenes to phagosomes and prevents its intracellular multiplication. We have tested whether IFN-gamma also modulates the susceptibility of L. monocytogenes to antibiotics. We selected drugs from three different classes displaying marked properties concerning their cellular accumulation and subcellular distribution, namely, ampicillin (not accumulated by cells but present in cytosol), azithromycin (largely accumulated by cells but mostly restricted to lysosomes), and sparfloxacin (accumulated to a fair extent but detected only in cytosol). We used a continuous line of myelomonocytic cells (THP-1 macrophages), which display specific surface receptors for IFN-gamma, and examined the activity of these antibiotics against L. monocytogenes Hly+ (virulent variant) and L. monocytogenes Hly- (a nonvirulent variant defective in hemolysin production). Untreated THP-1 and phorbol myristate acetate-differentiated THP-1 were permissive for infection and multiplication of intracellular L. monocytogenes Hly+ (virulent variant). All three antibiotics tested were bactericidal against this Listeria strain when added to an extracellular concentration of 10x their MIC. After preexposure of THP-1 to IFN-gamma, L. monocytogenes Hly+ was still phagocytosed but no longer grew intracellularly. The activity of ampicillin became almost undetectable (antagonistic effect), and that of azithromycin was unchanged (additive effect with that of IFN-gamma), whereas that of sparfloxacin was markedly enhanced (synergy). A similar behavior (lack of bacterial growth, associated with a loss of activity of ampicillin, an enhanced activity of sparfloxacin, and unchanged activity of azithromycin) was observed in cells infected with L

Interferon-gamma inducible protein-10 as a potential biomarker in localized scleroderma.

PubMed

Magee, Kelsey E; Kelsey, Christina E; Kurzinski, Katherine L; Ho, Jonhan; Mlakar, Logan R; Feghali-Bostwick, Carol A; Torok, Kathryn S

2013-01-01

The purpose of this study was to evaluate the presence and levels of interferon-gamma inducible protein-10 (IP-10) in the plasma and skin of pediatric localized scleroderma (LS) patients compared to those of healthy pediatric controls and to determine if IP-10 levels correlate to clinical disease activity measures. The presence of IP-10 in the plasma was analyzed using a Luminex panel in 69 pediatric patients with LS and compared to 71 healthy pediatric controls. Of these patients, five had available skin biopsy specimens with concurrent clinical and serological data during the active disease phase, which were used to analyze the presence and location of IP-10 in the skin by immunohistochemistry (IHC). IP-10 levels were significantly elevated in the plasma of LS patients compared to that of healthy controls and correlated to clinical disease activity measures in LS. Immunohistochemistry staining of IP-10 was present in the dermal infiltrate of LS patients and was similar to that found in psoriasis skin specimens, the positive disease control. Elevation of IP-10 levels in the plasma compared to those of healthy controls and the presence of IP-10 staining in the affected skin of LS patients indicates that IP-10 is a potential biomarker in LS. Furthermore, significant elevation of IP-10 in LS patients with active versus inactive disease and correlations between IP-10 levels and standardized disease outcome measures of activity in LS strongly suggest that IP-10 may be a biomarker for disease activity in LS.

Interferon-gamma inducible protein-10 as a potential biomarker in localized scleroderma

PubMed Central

2013-01-01

Introduction The purpose of this study was to evaluate the presence and levels of interferon-gamma inducible protein-10 (IP-10) in the plasma and skin of pediatric localized scleroderma (LS) patients compared to those of healthy pediatric controls and to determine if IP-10 levels correlate to clinical disease activity measures. Methods The presence of IP-10 in the plasma was analyzed using a Luminex panel in 69 pediatric patients with LS and compared to 71 healthy pediatric controls. Of these patients, five had available skin biopsy specimens with concurrent clinical and serological data during the active disease phase, which were used to analyze the presence and location of IP-10 in the skin by immunohistochemistry (IHC). Results IP-10 levels were significantly elevated in the plasma of LS patients compared to that of healthy controls and correlated to clinical disease activity measures in LS. Immunohistochemistry staining of IP-10 was present in the dermal infiltrate of LS patients and was similar to that found in psoriasis skin specimens, the positive disease control. Conclusions Elevation of IP-10 levels in the plasma compared to those of healthy controls and the presence of IP-10 staining in the affected skin of LS patients indicates that IP-10 is a potential biomarker in LS. Furthermore, significant elevation of IP-10 in LS patients with active versus inactive disease and correlations between IP-10 levels and standardized disease outcome measures of activity in LS strongly suggest that IP-10 may be a biomarker for disease activity in LS. PMID:24499523

Delayed translational silencing of ceruloplasmin transcript in gamma interferon-activated U937 monocytic cells: role of the 3' untranslated region

NASA Technical Reports Server (NTRS)

Mazumder, B.; Fox, P. L.

1999-01-01

Ceruloplasmin (Cp) is an acute-phase protein with ferroxidase, amine oxidase, and pro- and antioxidant activities. The primary site of Cp synthesis in human adults is the liver, but it is also synthesized by cells of monocytic origin. We have shown that gamma interferon (IFN-gamma) induces the synthesis of Cp mRNA and protein in monocytic cells. We now report that the induced synthesis of Cp is terminated by a mechanism involving transcript-specific translational repression. Cp protein synthesis in U937 cells ceased after 16 h even in the presence of abundant Cp mRNA. RNA isolated from cells treated with IFN-gamma for 24 h exhibited a high in vitro translation rate, suggesting that the transcript was not defective. Ribosomal association of Cp mRNA was examined by sucrose centrifugation. When Cp synthesis was high, i.e., after 8 h of IFN-gamma treatment, Cp mRNA was primarily associated with polyribosomes. However, after 24 h, when Cp synthesis was low, Cp mRNA was primarily in the nonpolyribosomal fraction. Cytosolic extracts from cells treated with IFN-gamma for 24 h, but not for 8 h, contained a factor which blocked in vitro Cp translation. Inhibitor expression was cell type specific and present in extracts of human cells of myeloid origin, but not in several nonmyeloid cells. The inhibitory factor bound to the 3' untranslated region (3'-UTR) of Cp mRNA, as shown by restoration of in vitro translation by synthetic 3'-UTR added as a "decoy" and detection of a binding complex by RNA gel shift analysis. Deletion mapping of the Cp 3'-UTR indicated an internal 100-nucleotide region of the Cp 3'-UTR that was required for complex formation as well as for silencing of translation. Although transcript-specific translational control is common during development and differentiation and global translational control occurs during responses to cytokines and stress, to our knowledge, this is the first report of translational silencing of a specific transcript following cytokine

Results of space experiment program "Interferon". II. Influence of spaceflight conditions on the activity of interferon preparations and interferon inducers ("Interferon II").

PubMed

Tálas, M; Bátkai, L; Stöger, I; Nagy, K; Hiros, L; Konstantinova, I; Kozharinov, V

1983-01-01

The influence of spaceflight conditions on the biological activity of HuIFN-alpha preparations (lyophilized, in solution and in ointment) and interferon inducers was studied. In antiviral activity no difference was observed between the samples kept aboard the spaceship and the controls kept under ground conditions. The interferon inducers poly I:C, poly G:C and gossipol placed in the space laboratory for 7 days maintained their interferon-inducing capacity. The circulating interferon level in mice was the same irrespective of the induction being performed with flight or ground-control samples of inducers.

Effects of Chicken Interferon Gamma on Newcastle Disease Virus Vaccine Immunogenicity

PubMed Central

Cardenas-Garcia, Stivalis; Dunwoody, Robert P.; Marcano, Valerie; Diel, Diego G.; Williams, Robert J.; Gogal, Robert M.; Brown, Corrie C.; Miller, Patti J.; Afonso, Claudio L.

2016-01-01

More effective vaccines are needed to control avian diseases. The use of chicken interferon gamma (chIFNγ) during vaccination is a potentially important but controversial approach that may improve the immune response to antigens. In the present study, three different systems to co-deliver chIFNγ with Newcastle disease virus (NDV) antigens were evaluated for their ability to enhance the avian immune response and their protective capacity upon challenge with virulent NDV. These systems consisted of: 1) a DNA vaccine expressing the Newcastle disease virus fusion (F) protein co-administered with a vector expressing the chIFNγ gene for in ovo and booster vaccination, 2) a recombinant Newcastle disease virus expressing the chIFNγ gene (rZJ1*L/IFNγ) used as a live vaccine delivered in ovo and into juvenile chickens, and 3) the same rZJ1*L/IFNγ virus used as an inactivated vaccine for juvenile chickens. Co-administration of chIFNγ with a DNA vaccine expressing the F protein resulted in higher levels of morbidity and mortality, and higher amounts of virulent virus shed after challenge when compared to the group that did not receive chIFNγ. The live vaccine system co-delivering chIFNγ did not enhanced post-vaccination antibody response, nor improved survival after hatch, when administered in ovo, and did not affect survival after challenge when administered to juvenile chickens. The low dose of the inactivated vaccine co-delivering active chIFNγ induced lower antibody titers than the groups that did not receive the cytokine. The high dose of this vaccine did not increase the antibody titers or antigen-specific memory response, and did not reduce the amount of challenge virus shed or mortality after challenge. In summary, regardless of the delivery system, chIFNγ, when administered simultaneously with the vaccine antigen, did not enhance Newcastle disease virus vaccine immunogenicity. PMID:27409587

T-Cell Mineralocorticoid Receptor Controls Blood Pressure by Regulating Interferon-Gamma.

PubMed

Sun, Xue-Nan; Li, Chao; Liu, Yuan; Du, Lin-Juan; Zeng, Meng-Ru; Zheng, Xiao-Jun; Zhang, Wu-Chang; Liu, Yan; Zhu, Mingjiang; Kong, Deping; Zhou, Li; Lu, Limin; Shen, Zhu-Xia; Yi, Yi; Du, Lili; Qin, Mu; Liu, Xu; Hua, Zichun; Sun, Shuyang; Yin, Huiyong; Zhou, Bin; Yu, Ying; Zhang, Zhiyuan; Duan, Sheng-Zhong

2017-05-12

Hypertension remains to be a global public health burden and demands novel intervention strategies such as targeting T cells and T-cell-derived cytokines. Mineralocorticoid receptor (MR) antagonists have been clinically used to treat hypertension. However, the function of T-cell MR in blood pressure (BP) regulation has not been elucidated. We aim to determine the role of T-cell MR in BP regulation and to explore the mechanism. Using T-cell MR knockout mouse in combination with angiotensin II-induced hypertensive mouse model, we demonstrated that MR deficiency in T cells strikingly decreased both systolic and diastolic BP and attenuated renal and vascular damage. Flow cytometric analysis showed that T-cell MR knockout mitigated angiotensin II-induced accumulation of interferon-gamma (IFN-γ)-producing T cells, particularly CD8 + population, in both kidneys and aortas. Similarly, eplerenone attenuated angiotensin II-induced elevation of BP and accumulation of IFN-γ-producing T cells in wild-type mice. In cultured CD8 + T cells, T-cell MR knockout suppressed IFN-γ expression whereas T-cell MR overexpression and aldosterone both enhanced IFN-γ expression. At the molecular level, MR interacted with NFAT1 (nuclear factor of activated T-cells 1) and activator protein-1 in T cells. Finally, T-cell MR overexpressing mice manifested more elevated BP compared with control mice after angiotensin II infusion and such difference was abolished by IFN-γ-neutralizing antibodies. MR may interact with NFAT1 and activator protein-1 to control IFN-γ in T cells and to regulate target organ damage and ultimately BP. Targeting MR in T cells specifically may be an effective novel approach for hypertension treatment. © 2017 American Heart Association, Inc.

Gamma Interferon-Induced Guanylate Binding Protein 1 Is a Novel Actin Cytoskeleton Remodeling Factor

PubMed Central

Ostler, Nicole; Britzen-Laurent, Nathalie; Liebl, Andrea; Naschberger, Elisabeth; Lochnit, Günter; Ostler, Markus; Forster, Florian; Kunzelmann, Peter; Ince, Semra; Supper, Verena; Praefcke, Gerrit J. K.; Schubert, Dirk W.; Stockinger, Hannes; Herrmann, Christian

2014-01-01

Gamma interferon (IFN-γ) regulates immune defenses against viruses, intracellular pathogens, and tumors by modulating cell proliferation, migration, invasion, and vesicle trafficking processes. The large GTPase guanylate binding protein 1 (GBP-1) is among the cellular proteins that is the most abundantly induced by IFN-γ and mediates its cell biologic effects. As yet, the molecular mechanisms of action of GBP-1 remain unknown. Applying an interaction proteomics approach, we identified actin as a strong and specific binding partner of GBP-1. Furthermore, GBP-1 colocalized with actin at the subcellular level and was both necessary and sufficient for the extensive remodeling of the fibrous actin structure observed in IFN-γ-exposed cells. These effects were dependent on the oligomerization and the GTPase activity of GBP-1. Purified GBP-1 and actin bound to each other, and this interaction was sufficient to impair the formation of actin filaments in vitro, as demonstrated by atomic force microscopy, dynamic light scattering, and fluorescence-monitored polymerization. Cosedimentation and band shift analyses demonstrated that GBP-1 binds robustly to globular actin and slightly to filamentous actin. This indicated that GBP-1 may induce actin remodeling via globular actin sequestering and/or filament capping. These results establish GBP-1 as a novel member within the family of actin-remodeling proteins specifically mediating IFN-γ-dependent defense strategies. PMID:24190970

Gamma interferon-induced guanylate binding protein 1 is a novel actin cytoskeleton remodeling factor.

PubMed

Ostler, Nicole; Britzen-Laurent, Nathalie; Liebl, Andrea; Naschberger, Elisabeth; Lochnit, Günter; Ostler, Markus; Forster, Florian; Kunzelmann, Peter; Ince, Semra; Supper, Verena; Praefcke, Gerrit J K; Schubert, Dirk W; Stockinger, Hannes; Herrmann, Christian; Stürzl, Michael

2014-01-01

Gamma interferon (IFN-γ) regulates immune defenses against viruses, intracellular pathogens, and tumors by modulating cell proliferation, migration, invasion, and vesicle trafficking processes. The large GTPase guanylate binding protein 1 (GBP-1) is among the cellular proteins that is the most abundantly induced by IFN-γ and mediates its cell biologic effects. As yet, the molecular mechanisms of action of GBP-1 remain unknown. Applying an interaction proteomics approach, we identified actin as a strong and specific binding partner of GBP-1. Furthermore, GBP-1 colocalized with actin at the subcellular level and was both necessary and sufficient for the extensive remodeling of the fibrous actin structure observed in IFN-γ-exposed cells. These effects were dependent on the oligomerization and the GTPase activity of GBP-1. Purified GBP-1 and actin bound to each other, and this interaction was sufficient to impair the formation of actin filaments in vitro, as demonstrated by atomic force microscopy, dynamic light scattering, and fluorescence-monitored polymerization. Cosedimentation and band shift analyses demonstrated that GBP-1 binds robustly to globular actin and slightly to filamentous actin. This indicated that GBP-1 may induce actin remodeling via globular actin sequestering and/or filament capping. These results establish GBP-1 as a novel member within the family of actin-remodeling proteins specifically mediating IFN-γ-dependent defense strategies.

Inverse modelling of radionuclide release rates using gamma dose rate observations

NASA Astrophysics Data System (ADS)

Hamburger, Thomas; Stohl, Andreas; von Haustein, Christoph; Thummerer, Severin; Wallner, Christian

2014-05-01

relatively sparse grid and the temporal resolution of available data may be low within the order of hours or a day. Gamma dose rates on the other hand are observed routinely on a much denser grid and higher temporal resolution. Gamma dose rate measurements contain no explicit information on the observed spectrum of radionuclides and have to be interpreted carefully. Nevertheless, they provide valuable information for the inverse evaluation of the source term due to their availability (Saunier et al., 2013). We present a new inversion approach combining an atmospheric dispersion model and observations of radionuclide activity concentrations and gamma dose rates to obtain the source term of radionuclides. We use the Lagrangian particle dispersion model FLEXPART (Stohl et al., 1998; Stohl et al., 2005) to model the atmospheric transport of the released radionuclides. The gamma dose rates are calculated from the modelled activity concentrations. The inversion method uses a Bayesian formulation considering uncertainties for the a priori source term and the observations (Eckhardt et al., 2008). The a priori information on the source term is a first guess. The gamma dose rate observations will be used with inverse modelling to improve this first guess and to retrieve a reliable source term. The details of this method will be presented at the conference. This work is funded by the Bundesamt für Strahlenschutz BfS, Forschungsvorhaben 3612S60026. References Davoine, X. and Bocquet, M., Atmos. Chem. Phys., 7, 1549-1564, 2007. Devell, L., et al., OCDE/GD(96)12, 1995. Eckhardt, S., et al., Atmos. Chem. Phys., 8, 3881-3897, 2008. Saunier, O., et al., Atmos. Chem. Phys., 13, 11403-11421, 2013. Stohl, A., et al., Atmos. Environ., 32, 4245-4264, 1998. Stohl, A., et al., Atmos. Chem. Phys., 5, 2461-2474, 2005. Stohl, A., et al., Atmos. Chem. Phys., 12, 2313-2343, 2012.

Protective Role of Gamma Interferon during the Recall Response to Influenza Virus

PubMed Central

Bot, Adrian; Bot, Simona; Bona, Constantin A.

1998-01-01

During secondary immune responses to influenza virus, virus-specific T memory cells are a major source of gamma interferon (IFN-γ). We assessed the contribution of IFN-γ to heterologous protection against the A/WSN/33 (H1N1) virus of wild-type and IFN-γ−/− mice previously immunized with the A/HK/68 (H3N2) virus. The IFN-γ−/− mice displayed significantly reduced survival rates subsequent to a challenge with various doses of the A/WSN/33 virus. This was associated with an impaired ability of the IFN-γ−/− mice to completely clear the pulmonary virus by day 7 after the challenge, although significant reduction of the virus titers was noted. However, the IFN-γ−/− mice developed type A influenza virus cross-reactive cytotoxic T lymphocytes (CTLs) similar to the wild-type mice, as demonstrated by both cytotoxicity and a limiting-dilution assay for the estimation of CTL precursor frequency. The pulmonary recruitment of T cells in IFN-γ−/− mice was not dramatically affected, and the percentage of CD4+ and CD8+ T cells was similar to that of wild-type mice. The T cells from IFN-γ−/− mice did not display a significant switch toward a Th2 profile. Furthermore, the IFN-γ−/− mice retained the ability to mount significant titers of WSN and HK virus-specific hemagglutination-inhibiting antibodies. Together, these results are consistent with a protective role of IFN-γ during the heterologous response against influenza virus independently of the generation and local recruitment of cross-reactive CTLs. PMID:9658110

[Effects of recombinant human alpha-2b and gamma interferons on bone marrow megakaryocyte progenitors (CFU-Meg) from patients with chronic myelocytic leukemia].

PubMed

Tanabe, Y; Dan, K; Kuriya, S; Nomura, T

1989-10-01

The effects of recombinant human interferon (IFN) alpha-2b and gamma on the bone marrow megakaryocyte progenitors (CFU-Meg) were compared between eight patients in the chronic phase of Ph1-positive chronic myelocytic leukemia (CML) and five hematologically normal patients. CFU-Meg was assayed in plasma clot culture added with phytohemagglutinin-stimulated leukocyte-conditioned medium as a source of colony stimulating activity. The average count of CFU-Meg colonies formed from the bone marrow of CML patients was 5.5 times that of normal controls. Spontaneous CFU-Meg colonies were grown in seven of eight CML patients, but in none of five controls. Colony formation by CFU-Meg in CML as well as normal bone marrow was suppressed by the two preparations of IFN in a dose dependent fashion. Their suppressive influence on colonies from CFU-Meg was comparable between CML and normal bone marrow at lower concentrations, but was less marked for CML than normal bone marrow at higher concentrations. The formation of CFU-Meg colonies from CML bone marrow was more severely suppressed by IFN-gamma than IFN-alpha-2b. Depletion of either T lymphocytes or adherent cells from the CML bone marrow cells diminished the suppressive effects of IFN-gamma, but had no influence on the effects of IFN-alpha-2b.

Effects of interferon-gamma and lipopolysaccharide on macrophage iron metabolism are mediated by nitric oxide-induced degradation of iron regulatory protein 2.

PubMed

Kim, S; Ponka, P

2000-03-03

Iron regulatory proteins (IRP-1 and IRP-2) control the synthesis of transferrin receptors (TfR) and ferritin by binding to iron-responsive elements, which are located in the 3'-untranslated region and the 5'-untranslated region of their respective mRNAs. Cellular iron levels affect binding of IRPs to iron-responsive elements and consequently expression of TfR and ferritin. Moreover, NO(*), a redox species of nitric oxide that interacts primarily with iron, can activate IRP-1 RNA binding activity resulting in an increase in TfR mRNA levels. Recently we found that treatment of RAW 264.7 cells (a murine macrophage cell line) with NO(+) (nitrosonium ion, which causes S-nitrosylation of thiol groups) resulted in a rapid decrease in RNA binding of IRP-2 followed by IRP-2 degradation, and these changes were associated with a decrease in TfR mRNA levels (Kim, S., and Ponka, P. (1999) J. Biol. Chem. 274, 33035-33042). In this study, we demonstrated that stimulation of RAW 264.7 cells with lipopolysaccharide (LPS) and interferon-gamma (IFN-gamma) increased IRP-1 binding activity, whereas RNA binding of IRP-2 decreased and was followed by a degradation of this protein. Moreover, the decrease of IRP-2 binding/protein levels was associated with a decrease in TfR mRNA levels in LPS/IFN-gamma-treated cells, and these changes were prevented by inhibitors of inducible nitric oxide synthase. Furthermore, LPS/IFN-gamma-stimulated RAW 264.7 cells showed increased rates of ferritin synthesis. These results suggest that NO(+)-mediated degradation of IRP-2 plays a major role in iron metabolism during inflammation.

Topical interferon-gamma neutralization prevents conjunctival goblet cell loss in experimental murine dry eye.

PubMed

Zhang, Xiaobo; De Paiva, Cintia S; Su, Zhitao; Volpe, Eugene A; Li, De-Quan; Pflugfelder, Stephen C

2014-01-01

Evidence suggests that the cytokine interferon (IFN)-γ released by natural killer and CD4(+) T cells contributes to the conjunctival goblet cell (GC) loss in dry eye. The purpose of this study was to investigate if topical neutralization of IFN-γ prevents or alleviates GC loss in an experimental desiccating stress (DS) model of dry eye. In this study, we found that topical IFN-γ neutralization significantly decreased DS-induced conjunctival GC loss. This was accompanied by decreased epithelial apoptosis, and increased IL-13 and decreased FoxA2 expression in the forniceal conjunctiva. To establish that IFN-γ produced by pathogenic CD4(+) T cells contributes to DS-induced GC loss, adoptive transfer of CD4(+) T cells isolated from DS exposed donors to naïve RAG-1(-/-) recipient mice was performed. Similar to the donor mice, topical IFN-γ neutralization decreased conjunctival GC loss, suppressed apoptosis and increased IL-13 expression in adoptive transfer recipients. In summary, this study demonstrated that topical neutralization of IFN-γ prevents GC loss via modulating apoptosis and maintaining IL-13 signaling. Copyright © 2013 Elsevier Ltd. All rights reserved.

Cumulative False-Positive QuantiFERON-TB Interferon-γ Release Assay Results.

PubMed

Gamsky, Thomas E; Lum, Thomas; Hung-Fan, Melody; Green, Jon A

2016-05-01

Despite reports of unreliability, the QuantiFERON-TB interferon-γ release assay is increasingly used for the annual screening of individuals at risk for latent tuberculosis. Continued use of the QuantiFERON-TB assay suggests the need for more definitive evidence of its reproducibility and accuracy. To examine reproducibility and the accumulation of false-positive test results when the QuantiFERON-TB is repeated annually and to examine the validity of confirming positive test results with the performance of a second QuantiFERON-TB. We performed a retrospective, longitudinal evaluation of results from serial screening of a cohort of emergency responders from 2001 to 2013. Results of tuberculin tests and QuantiFERON-TB tests performed annually as part of a mandated first responder examination were retroactively reviewed. In this population, positive results occurred in new individuals each year. QuantiFERON-TB results were positive in 80 of 557 tuberculin test-negative individuals examined annually for a maximum of 7 years. Only 10 individuals with initially positive results remained positive when the test was repeated the next year, and 9 of these 10 were QuantiFERON-TB-negative within 3 years. The number of individuals with a positive result increased annually, and, after 7 years, 32 (27.4%) of 117 people had a positive result. When viewed in the context of the extensive literature documenting unreliable QuantiFERON-TB test performance, our findings of frequent, cumulative, sporadic, and irreproducible positive results support discontinuing the use of the QuantiFERON-TB assay for the diagnosis of latent tuberculosis in low-risk populations.

Fabrication of fiber-optic localized surface plasmon resonance sensor and its application to detect antibody-antigen reaction of interferon-gamma

NASA Astrophysics Data System (ADS)

Jeong, Hyeon-Ho; Erdene, Norov; Lee, Seung-Ki; Jeong, Dae-Hong; Park, Jae-Hyoung

2011-12-01

A fiber-optic localized surface plasmon (FO LSPR) sensor was fabricated by gold nanoparticles (Au NPs) immobilized on the end-face of an optical fiber. When Au NPs were formed on the end-face of an optical fiber by chemical reaction, Au NPs aggregation occurred and the Au NPs were immobilized in various forms such as monomers, dimers, trimers, etc. The component ratio of the Au NPs on the end-face of the fabricated FO LSPR sensor was slightly changed whenever the sensors were fabricated in the same condition. Including this phenomenon, the FO LSPR sensor was fabricated with high sensitivity by controlling the density of Au NPs. Also, the fabricated sensors were measured for the resonance intensity for the different optical systems and analyzed for the effect on sensitivity. Finally, for application as a biosensor, the sensor was used for detecting the antibody-antigen reaction of interferon-gamma.

Identifying Mechanisms by Which Escherichia coli O157:H7 Subverts Interferon-γ Mediated Signal Transducer and Activator of Transcription-1 Activation

PubMed Central

Ho, Nathan K.; Crandall, Ian; Sherman, Philip M.

2012-01-01

Enterohemorrhagic Escherichia coli serotype O157:H7 is a food borne enteric bacterial pathogen that causes significant morbidity and mortality in both developing and industrialized nations. E. coli O157:H7 infection of host epithelial cells inhibits the interferon gamma pro-inflammatory signaling pathway, which is important for host defense against microbial pathogens, through the inhibition of Stat-1 tyrosine phosphorylation. The aim of this study was to determine which bacterial factors are involved in the inhibition of Stat-1 tyrosine phosphorylation. Human epithelial cells were challenged with either live bacteria or bacterial-derived culture supernatants, stimulated with interferon-gamma, and epithelial cell protein extracts were then analyzed by immunoblotting. The results show that Stat-1 tyrosine phosphorylation was inhibited by E. coli O157:H7 secreted proteins. Using sequential anion exchange and size exclusion chromatography, YodA was identified, but not confirmed to mediate subversion of the Stat-1 signaling pathway using isogenic mutants. We conclude that E. coli O157:H7 subverts Stat-1 tyrosine phosphorylation in response to interferon-gamma through a still as yet unidentified secreted bacterial protein. PMID:22253910

Assessment of safety and interferon gamma responses of Mycobacterium bovis BCG vaccine in goat kids and milking goats.

PubMed

Pérez de Val, Bernat; Vidal, Enric; López-Soria, Sergio; Marco, Alberto; Cervera, Zoraida; Martín, Maite; Mercader, Irene; Singh, Mahavir; Raeber, Alex; Domingo, Mariano

2016-02-10

Vaccination of domestic animals has emerged as an alternative long-term strategy for the control of tuberculosis (TB). A trial under field conditions was conducted in a TB-free goat herd to assess the safety of the Mycobacterium bovis BCG vaccine. Eleven kids and 10 milking goats were vaccinated with BCG. Bacterial shedding and interferon gamma (IFN-γ) responses were monitored throughout the study. Comprehensive pathological examination and mycobacterial culture of target tissues were performed. BCG vaccine strain was only isolated from the draining lymph node of the injection site of a kid euthanized at week 8 post-vaccination. The remaining animals were euthanized at week 24. Six out of 20 showed small granulomas at the injection site. BCG shedding was not detected in either faeces or in milk throughout the study. All vaccinated kids showed BCG-induced IFN-γ responses at week 8 post-vaccination. BCG vaccination of goats showed no lack of biological safety for the animals, environment and public health, and local adverse reactions were negligible. Copyright © 2016 Elsevier Ltd. All rights reserved.

The effect of co-administration of DNA carrying chicken interferon-gamma gene on protection of chickens against infectious bursal disease by DNA-mediated vaccination.

PubMed

Hsieh, Ming Kun; Wu, Ching Ching; Lin, Tsang Long

2006-11-17

The purpose of the present study was to determine whether DNA vaccination by co-administration of DNA coding for chicken interferon-gamma (IFN-gamma) gene and DNA encoding for the VP243 gene of IBDV could enhance immune response and protection efficacy of chickens against challenge by IBDV. Plasmids carrying VP243 gene of IBDV strain variant E (VE) (P/VP243/E) and chicken IFN-gamma gene (P/cIFN-gamma) were constructed, respectively. One-day-old chickens were intramuscularly injected with P/VP243/E, or P/cIFN-gamma, or both once, twice, or three times into the thigh muscle of one leg or the thigh muscles of two separate legs at weekly intervals. Chickens were orally challenged with IBDV strain VE at 3 weeks of age and observed for 10 days. Chickens receiving two plasmids in the same site two times had significantly higher (P<0.05) bursal lesion scores and significantly lower (P<0.05) bursa weight/body weight ratios than those that only received P/VP243/E two or three times. Chickens inoculated with two plasmids separately in the thigh muscles of different legs or P/VP243/E two times had 33-50% protection and those receiving two plasmids in the same sites did not have any protection against IBD. The enzyme-linked immunosorbent assay (ELISA) and virus neutralization (VN) titers to IBDV of chickens in the groups with three doses of P/VP243/E were significantly higher (P<0.05) than those in groups receiving two doses of P/VP243/E or P/VP243/E and P/cIFN-gamma. Chickens protected by DNA vaccination did not have detectable IBDV antigen in the bursae as determined by immunofluorescent antibody assay (IFA). The results indicated that co-administration of plasmid encoding chicken IFN-gamma gene with plasmid encoding a large segment gene of the IBDV did not enhance immune response and protection against challenge by IBDV.

Three-dimensional crystal structure of recombinant murine interferon-beta.

PubMed Central

Senda, T; Shimazu, T; Matsuda, S; Kawano, G; Shimizu, H; Nakamura, K T; Mitsui, Y

1992-01-01

The crystal structure of recombinant murine interferon-beta (IFN-beta) has been solved by the multiple isomorphous replacement method and refined to an R-factor of 20.5% against 2.6 A X-ray diffraction data. The structure shows a variant of the alpha-helix bundle with a new chain-folding topology, which seems to represent a basic structural framework of all the IFN-alpha and IFN-beta molecules belonging to the type I family. Functionally important segments of the polypeptide chain, as implied through numerous gene manipulation studies carried out so far, are spatially clustered indicating the binding site(s) to the receptor(s). Comparison of the present structure with those of other alpha-helical cytokine proteins, including porcine growth hormone, interleukin 2 and interferon gamma, indicated either a topological similarity in chain folding or a similar spatial arrangement of the alpha-helices. Images PMID:1505514

[Interleukin 8 and interferon gamma in ocular toxoplasmosis].

PubMed

Czepiel, Jacek; Biesiada, Grazyna; Sobczyk-Krupiarz, Iwona; Miklasszewska, Grazyna; Fedak, Danuta; Solnica, Bogdan; Mach, Tomasz; Garlicki, Aleksander

2011-01-01

Toxoplasmosis is one of the most common parasitic infections in the world, it is caused by Toxoplasma gondii. The infection is typically asymptomatic or the symptoms are very mild. Approximately 10% patients have limphadenopathy, involvement of the others organs, like eyes, nervous system, liver, heart, are observed more rarely. The aim of our study was to assess the level of selected cytokines in blood among patients with ocular toxoplasmosis. We have enrolled in the study 30 patients, 19-42 years old, treated for ocular toxoplasmosis, and 20 healthy volunteers, 20-48 years old, to the control group. Tests for blood morphology, C-reactive protein, the level of IL-8 and IFN-gamma were performed in all patients. The blood parameters in toxoplasmosis group were performed before antiparasitic treatment was given. The level of IFN-gamma in blood was lower among patients with ocular toxoplasmosis comparing with control group (1.52 vs. 4.18 pg/ml; p = 0.002). The level of IL-8 in blood was lower among patients with ocular toxoplasmosis comparing with control group (22.96 vs. 94.3 pg/ml; p = 0,007). There were no correlations between analyzed cytokines and blood morphology or CRP. The low level of IFN-gamma and IL-8 in blood is important factor leading to reactivation of the ocular toxoplasmosis.

Interferon-gamma and interleukin-10 profile of children with tuberculosis in North Sumatera, Indonesia

NASA Astrophysics Data System (ADS)

Daulay, R. S.; Daulay, R. M.

2018-03-01

Cellular immunity was mediated the host immune response against Mycobacterium tuberculosis, in which cytokine and T-helper (Th) 1 cells play an important role. Interferon-gamma (IFN-γ) is a leading cytokine involved in the immune response of tuberculosis (TB).The primary function of IFN-γ is to activate macrophages in opposition Mycobacterium tuberculosis. Contrast from IFN-γ, interleukin-10 (IL-10) is considered inhibitory cytokine, important to an adequate balance between inflammatory responses. To analyze cytokine profile, particularly IFN-γ and IL-10 of the children with TB in Indonesia, a cross-sectional study was conducted at two general hospitals and seven primary health care located in Medan and Batubara, North Sumatera, Indonesia. Among 51 children with TB disease and 51 healthy children, found that IFN-γ and IL-10 levels were lower in TB patients compared to healthy children. Statistically significant decreased production of the IFN-γ levels (p=0.042) were found in TB patients 9.41 (1.10-28.06) pg/ml contrast to healthy children 6.30 (1.30-89.76) pg/ml. Homologue finding of the IL-10 levels were also found in TB patients 4.93 (0.22-48.01) pg/ml and 4.93 (0.07-81.60) pg/ml in healthy children, but not statistically significant (p=0.784). High levels of IL-10 were not proven to suppress the levels production of IFN-γ in TB patients.

Robust Protection against Highly Virulent Foot-and-Mouth Disease Virus in Swine by Combination Treatment with Recombinant Adenoviruses Expressing Porcine Alpha and Gamma Interferons and Multiple Small Interfering RNAs

PubMed Central

Park, Jong-Hyeon; Lee, Kwang-Nyeong; Kim, Se-Kyung; You, Su-Hwa; Kim, Taeseong; Tark, Dongseob; Lee, Hyang-Sim; Seo, Min-Goo; Kim, Byounghan

2015-01-01

ABSTRACT Because the currently available vaccines against foot-and-mouth disease (FMD) provide no protection until 4 to 7 days postvaccination, the only alternative method to halt the spread of the FMD virus (FMDV) during outbreaks is the application of antiviral agents. Combination treatment strategies have been used to enhance the efficacy of antiviral agents, and such strategies may be advantageous in overcoming viral mechanisms of resistance to antiviral treatments. We have developed recombinant adenoviruses (Ads) for the simultaneous expression of porcine alpha and gamma interferons (Ad-porcine IFN-αγ) as well as 3 small interfering RNAs (Ad-3siRNA) targeting FMDV mRNAs encoding nonstructural proteins. The antiviral effects of Ad-porcine IFN-αγ and Ad-3siRNA expression were tested in combination in porcine cells, suckling mice, and swine. We observed enhanced antiviral effects in porcine cells and mice as well as robust protection against the highly pathogenic strain O/Andong/SKR/2010 and increased expression of cytokines in swine following combination treatment. In addition, we showed that combination treatment was effective against all serotypes of FMDV. Therefore, we suggest that the combined treatment with Ad-porcine IFN-αγ and Ad-3siRNA may offer fast-acting antiviral protection and be used with a vaccine during the period that the vaccine does not provide protection against FMD. IMPORTANCE The use of current foot-and-mouth disease (FMD) vaccines to induce rapid protection provides limited effectiveness because the protection does not become effective until a minimum of 4 days after vaccination. Therefore, during outbreaks antiviral agents remain the only available treatment to confer rapid protection and reduce the spread of foot-and-mouth disease virus (FMDV) in livestock until vaccine-induced protective immunity can become effective. Interferons (IFNs) and small interfering RNAs (siRNAs) have been reported to be effective antiviral agents against

Interferon-gamma and interlukin-4 patterns in BALB/c mice suffering from cutaneous leishmaniasis treated with cantharidin.

PubMed

Maroufi, Yahya; Ghaffarifar, Fatemeh; Dalimi, Abdolhosein; Sharifi, Zohreh

2014-06-01

Cutaneous leishmaniasis is a health problem in the world. Lesions should be treated on cosmetically or functionally important sites, such as the face and hands. Cantharidin is a terpenoid compound produced naturally by beetles of Meloidae and Oedemeridae families. The current study aimed to investigate the effect of cantharidin on Cutaneous Leishmaniasis (CL) lesions and IFN-γ and IL-4 patterns in infected BALB/c mice. INFECTED BALB/C MICE WERE DIVIDED INTO FIVE GROUPS AS: untreated (control group), eucerin-treated and 0.05%, 0.1% and 0.5% cantharidin-treated. Lesions diameter was measured by Vernier caliper every three days for four weeks. Cytokines levels were measured by enzyme-linked immunosorbent assay (ELISA) using U-CyTech kit. The results indicated that treatment with cantharidin exacerbates lesions compared with the controls, except for 0.05% cantharidin dose that restrained lesion growth significantly. Interferon gamma level in cantharidin-treated groups was significantly less than that of the control group. But interlukin-4 level was similar among the groups. The current study results indicated that high doses of cantharidin exacerbates leishmaniasis lesion, but low dose of cantharidin inhibits lesion growth.

Interferon-Gamma and Interlukin-4 Patterns in BALB/c Mice Suffering From Cutaneous Leishmaniasis Treated With Cantharidin

PubMed Central

Maroufi, Yahya; Ghaffarifar, Fatemeh; Dalimi, Abdolhosein; Sharifi, Zohreh

2014-01-01

Background: Cutaneous leishmaniasis is a health problem in the world. Lesions should be treated on cosmetically or functionally important sites, such as the face and hands. Cantharidin is a terpenoid compound produced naturally by beetles of Meloidae and Oedemeridae families. Objectives: The current study aimed to investigate the effect of cantharidin on Cutaneous Leishmaniasis (CL) lesions and IFN-γ and IL-4 patterns in infected BALB/c mice. Materials and Methods: Infected BALB/c mice were divided into five groups as: untreated (control group), eucerin-treated and 0.05%, 0.1% and 0.5% cantharidin-treated. Lesions diameter was measured by Vernier caliper every three days for four weeks. Cytokines levels were measured by enzyme-linked immunosorbent assay (ELISA) using U-CyTech kit. Results: The results indicated that treatment with cantharidin exacerbates lesions compared with the controls, except for 0.05% cantharidin dose that restrained lesion growth significantly. Interferon gamma level in cantharidin-treated groups was significantly less than that of the control group. But interlukin-4 level was similar among the groups. Conclusions: The current study results indicated that high doses of cantharidin exacerbates leishmaniasis lesion, but low dose of cantharidin inhibits lesion growth. PMID:25371808

Identification and Characterization of Neospora caninum Cyclophilin That Elicits Gamma Interferon Production

PubMed Central

Tuo, Wenbin; Fetterer, Raymond; Jenkins, Mark; Dubey, J. P.

2005-01-01

Gamma interferon (IFN-γ) response is essential to the development of a host protective immunity in response to infections by intracellular parasites. Neosporosis, an infection caused by the intracellular protozoan parasite Neospora caninum, is fatal when there is a complete lack of IFN-γ in the infected host. However, the mechanism by which IFN-γ is elicited by the invading parasite is unclear. This study has identified a microbial protein in the N. caninum tachyzoite N. caninum cyclophilin (NcCyP) as a major component of the parasite responsible for the induction of IFN-γ production by bovine peripheral blood mononuclear cells (PBMC) and antigen-specific CD4+ T cells. NcCyP has high sequence homology (86%) with Toxoplasma gondii 18-kDa CyP with a calculated molecular mass of 19.4 kDa. NcCyP is a secretory protein with a predicted signal peptide of 17 amino acids. Abundant NcCyP was detected in whole-cell N. caninum tachyzoite lysate antigen (NcAg) and N. caninum tachyzoite culture supernatant. In N. caninum tachyzoite culture supernatant, three NcCyP bands of 19, 22, and 24 kDa were identified. NcAg stimulated high levels of IFN-γ production by PBMC and CD4+ T cells. The IFN-γ-inducing effect of NcAg was blocked by cyclosporine, a specific ligand for CyP, in a dose-dependent manner. Furthermore, cyclosporine abolished IFN-γ production by PBMC from naïve cows as well as PBMC and CD4+ T cells from infected/immunized cows. These results indicate that the N. caninum tachyzoite naturally produces a potent IFN-γ-inducing protein, NcCyP, which may be important for parasite survival as well as host protection. PMID:16041025

Stimulated peripheral production of interferon-gamma is related to fatigue and depression in multiple sclerosis.

PubMed

Pokryszko-Dragan, A; Frydecka, I; Kosmaczewska, A; Ciszak, L; Bilińska, M; Gruszka, E; Podemski, R; Frydecka, D

2012-10-01

The aim of the study was to evaluate the stimulated production of interferon-gamma (IFNγ) by peripheral CD3+CD4+ T lymphocytes in patients with multiple sclerosis (MS) with regard to the degree of fatigue, and to investigate relationships between immunological parameters, level of depression and clinical variables. Forty MS patients (30 women, 10 men, aged 22-60 years): 20 fatigued and 20 non-fatigued were involved in the study. Fatigue was evaluated using the Fatigue Severity Scale (FSS) and Modified Fatigue Impact Scale (MFIS), depression level - using Beck Depression Inventory (BDI). Production of IFNγ by stimulated peripheral blood CD3+CD4+ T lymphocytes, assessed using flow cytometry, was compared between MS patients with different levels of fatigue and controls. Correlations were searched out between immunological findings and BDI, age, duration and course of MS, relapse rate, disability (assessed in Expanded Disability Status Scale - EDSS) and its progression. Stimulated production of IFNγ by CD3+CD4+ T lymphocytes was higher in severely fatigued patients in comparison with non-fatigued ones and controls, tended to correlate with FSS and MFIS, and correlated with BDI. No relationships were found between immunological findings and disease-related variables. Stimulated production of IFNγ by peripheral CD3+CD4+ T lymphocytes is related to fatigue and depression in MS patients. Copyright © 2012 Elsevier B.V. All rights reserved.

Reversal in fatigued athletes of a defect in interferon gamma secretion after administration of Lactobacillus acidophilus.

PubMed

Clancy, R L; Gleeson, M; Cox, A; Callister, R; Dorrington, M; D'Este, C; Pang, G; Pyne, D; Fricker, P; Henriksson, A

2006-04-01

Fatigue and impaired performance in athletes is well recognised and has been loosely linked to "overtraining". Reduced concentration of IgA in the saliva and increased shedding of Epstein Barr virus (EBV) have been associated with intense training in elite athletes. To determine whether athletes presenting with fatigue and impaired performance had an immune defect relevant to defective containment of EBV infection, and whether a probiotic preparation (Lactobacillus acidophilus) shown to enhance mucosal immunity in animal models could reverse any detected abnormality. The fatigued athletes had clinical characteristics consistent with re-activation of EBV infection and significantly (p = 0.02) less secretion of interferon (IFN) gamma from blood CD4 positive T cells. After one month of daily capsules containing 2 x 10(10) colony forming units of L acidophilus, secretion of IFNgamma from T cells had increased significantly (p = 0.01) to levels found in healthy control athletes. A significant (p = 0.03) increase in salivary IFNgamma concentrations in healthy control athletes after the one month course of L acidophilus demonstrated in man the capacity for this probiotic to enhance the mucosal IFNgamma concentration. This is the first evidence of a T cell defect in fatigued athletes, and of its reversal following probiotic therapy.

Myxoma virus M-T7, a secreted homolog of the interferon-gamma receptor, is a critical virulence factor for the development of myxomatosis in European rabbits.

PubMed

Mossman, K; Nation, P; Macen, J; Garbutt, M; Lucas, A; McFadden, G

1996-01-01

Myxoma virus is a leporipoxvirus of New World rabbits (Sylvilagus sp.) that induces a rapidly lethal infection known as myxomatosis in the European rabbit (Oryctolagus cuniculus). Like all poxviruses, myxoma virus encodes a plethora of proteins to circumvent or inhibit a variety of host antiviral immune mechanisms. M-T7, the most abundantly secreted protein of myxoma virus-infected cells, was originally identified as an interferon-gamma receptor homolog (Upton, Mossman, and McFadden, Science 258, 1369-1372, 1992). Here, we demonstrate that M-T7 is dispensable for virus replication in cultured cells but is a critical virulence factor for virus pathogenesis in European rabbits. Disruption of both copies of the M-T7 gene in myxoma virus was achieved by the deletion of 372 bp of M-T7 coding sequences, replacement with a selectable marker, p7.5Ecogpt, and selection of a recombinant virus (vMyxlac-T7gpt) resistant to mycophenolic acid. vMyxlac-T7gpt expressed no detectable M-T7 protein and infected cells supernatants were devoid of any detectable interferon-gamma binding activities. Immunohistochemical staining with anti-beta-galactosidase and anti-CD43 antibodies demonstrated that in vMyxlac-T7gpt-infected rabbits the loss of M-T7 not only caused a dramatic reduction in disease symptoms and viral dissemination to secondary sites, but also dramatically influenced host leukocyte behavior. Notably, primary lesions in wild-type virus infections were generally underlayed by large masses of inflammatory cells that did not effectively migrate into the dermal sites of viral replication, whereas in vMyxlac-T7gpt infections this apparent block to leukocyte influx was relieved. A second major phenotypic distinction noted for the M-T7 knockout virus was the extensive activation of lymphocytes in secondary immune organs, particularly the spleen and lymph nodes, by Day 4 of the infection. This is in stark contrast to infection by wild-type myxoma virus, which results in relatively

Inverse modelling of radionuclide release rates using gamma dose rate observations

NASA Astrophysics Data System (ADS)

Hamburger, Thomas; Evangeliou, Nikolaos; Stohl, Andreas; von Haustein, Christoph; Thummerer, Severin; Wallner, Christian

2015-04-01

Severe accidents in nuclear power plants such as the historical accident in Chernobyl 1986 or the more recent disaster in the Fukushima Dai-ichi nuclear power plant in 2011 have drastic impacts on the population and environment. Observations and dispersion modelling of the released radionuclides help to assess the regional impact of such nuclear accidents. Modelling the increase of regional radionuclide activity concentrations, which results from nuclear accidents, underlies a multiplicity of uncertainties. One of the most significant uncertainties is the estimation of the source term. That is, the time dependent quantification of the released spectrum of radionuclides during the course of the nuclear accident. The quantification of the source term may either remain uncertain (e.g. Chernobyl, Devell et al., 1995) or rely on estimates given by the operators of the nuclear power plant. Precise measurements are mostly missing due to practical limitations during the accident. The release rates of radionuclides at the accident site can be estimated using inverse modelling (Davoine and Bocquet, 2007). The accuracy of the method depends amongst others on the availability, reliability and the resolution in time and space of the used observations. Radionuclide activity concentrations are observed on a relatively sparse grid and the temporal resolution of available data may be low within the order of hours or a day. Gamma dose rates, on the other hand, are observed routinely on a much denser grid and higher temporal resolution and provide therefore a wider basis for inverse modelling (Saunier et al., 2013). We present a new inversion approach, which combines an atmospheric dispersion model and observations of radionuclide activity concentrations and gamma dose rates to obtain the source term of radionuclides. We use the Lagrangian particle dispersion model FLEXPART (Stohl et al., 1998; Stohl et al., 2005) to model the atmospheric transport of the released radionuclides. The

A randomized, double-blind, phase I/II trial of tumor necrosis factor and interferon-gamma for treatment of AIDS-related complex (Protocol 025 from the AIDS Clinical Trials Group).

PubMed

Agosti, J M; Coombs, R W; Collier, A C; Paradise, M A; Benedetti, J K; Jaffe, H S; Corey, L

1992-05-01

To determine safety and efficacy of tumor necrosis factor (TNF) and interferon-gamma (IFN gamma) in the treatment of patients with acquired immunodeficiency syndrome (AIDS)-related complex, a randomized, double-blind study was conducted. Twenty-five patients with AIDS-related complex and CD4 lymphocytes less than or equal to 500 x 10(6)/L attended an AIDS Clinical Trials Unit of a tertiary referral center. Patients were administered tumor necrosis factor (TNF) (10 micrograms/m2) or IFN gamma (10 micrograms/m2), or both intramuscularly three times weekly for 16 weeks. Side effects from all three preparations included fever, constitutional symptoms, and local reactions. No significant hematologic, hepatic, renal, or coagulation abnormalities were observed. CD4 lymphocyte counts, beta 2-microglobulin, p24 antigen levels, and anti-p24 antibody did not change significantly during therapy. Similarly, no significant change was noted in rates of HIV isolation from peripheral blood mononuclear cells or plasma. TNF and IFN gamma were tolerable after premedication with acetaminophen; however, no significant change in markers of human immunodeficiency virus infection was demonstrated. These cytokines alone do not appear to be of benefit, nor do they appear to hasten the progression of HIV infection.

Apoptosis of Trypanosoma musculi co-cultured with LPS activated macrophages: enhanced expression of nitric oxide synthase INF-gamma and caspase.

PubMed

Gugssa, A; Gebru, S; Lee, C M; Baccetti, B; Anderson, W

2005-08-01

Trypanosoma musculi-macrophage co-cultures were studied to investigate the biological role of lipopolysaccharide (LPS) induced cytokines in controlling the proliferation of parasites in vitro. Macrophages, isolated by peritoneal lavage, sustained the growth and proliferation of the parasites. Macrophages activated with LPS were characterized by up-regulation of nitric oxide synthase (iNOS) and phagocytosis of fluorescent latex spheres. Activated macrophages showed marked inhibition of the association and proliferation of the parasites. The LPS treated macrophages produced cytokines, especially interferon gamma (INF-gamma), which was detected by Western blot. Trypanosomes, inhibited from association with macrophages, did not proliferate and instead formed clusters held together by their flagella. Cells in these clusters were apoptotic, as demonstrated by the Apoptag reaction and gel fragmentation assay. In addition, high levels of caspase 8 and caspase 3 were shown in floating trypanosome clusters. The results would suggest that INF-gamma and other cytokines released by activated macrophages, possibly functioning through the INF-gammaR1, Fas ligand, CD95 or other death ligands in the trypanosome plasma membrane initiates the apoptosis cascade in trypanosomes.

A novel mechanism of skin tumor promotion involving interferon-gamma (IFNγ)/signal transducer and activator of transcription-1 (Stat1) signaling.

PubMed

Bozeman, Ronald; Abel, Erika L; Macias, Everardo; Cheng, Tianyi; Beltran, Linda; DiGiovanni, John

2015-08-01

The current study was designed to explore the role of signal transducer and activator of transcription 1 (Stat1) during tumor promotion using the mouse skin multistage carcinogenesis model. Topical treatment with both 12-O-tetradecanoylphorbol-13-acetate (TPA) and 3-methyl-1,8-dihydroxy-9-anthrone (chrysarobin or CHRY) led to rapid phosphorylation of Stat1 on both tyrosine (Y701) and serine (S727) residues in epidermis. CHRY treatment also led to upregulation of unphosphorylated Stat1 (uStat1) at later time points. CHRY treatment also led to upregulation of interferon regulatory factor 1 (IRF-1) mRNA and protein, which was dependent on Stat1. Further analyses demonstrated that topical treatment with CHRY but not TPA upregulated interferon-gamma (IFNγ) mRNA in the epidermis and that the induction of both IRF-1 and uStat1 was dependent on IFNγ signaling. Stat1 deficient (Stat1(-/-) ) mice were highly resistant to skin tumor promotion by CHRY. In contrast, the tumor response (in terms of both papillomas and squamous cell carcinomas) was similar in Stat1(-/-) mice and wild-type littermates with TPA as the promoter. Maximal induction of both cyclooxygenase-2 and inducible nitric oxide synthase in epidermis following treatment with CHRY was also dependent on the presence of functional Stat1. These studies define a novel mechanism associated with skin tumor promotion by the anthrone class of tumor promoters involving upregulation of IFNγ signaling in the epidermis and downstream signaling through activated (phosphorylated) Stat1, IRF-1 and uStat1. © 2014 Wiley Periodicals, Inc.

Neopterin formation and tryptophan degradation by a human myelomonocytic cell line (THP-1) upon cytokine treatment.

PubMed

Werner-Felmayer, G; Werner, E R; Fuchs, D; Hausen, A; Reibnegger, G; Wachter, H

1990-05-15

Determination of neopterin [D-erythro-6-(1',2',3'-trihydroxypropyl)pterin] in body fluids is a powerful diagnostic tool in a variety of diseases in which activation of cellular immune mechanisms is involved, such as certain malignancies, allograft rejection, and autoimmune and infectious diseases. In vitro, neopterin is released into the supernatant by peripheral blood-derived monocytes/macrophages upon stimulation with gamma-interferon. In parallel, cleavage of tryptophan by indoleamine 2,3-dioxygenase is induced. We report here that the human myelomonocytic cell line THP-1 forms neopterin and degrades tryptophan upon treatment with gamma-interferon. Like in macrophages alpha-interferon and beta-interferon induce these pathways only to a much smaller degree. The action of interferons is enhanced by cotreatment with tumor necrosis factor alpha, lipopolysaccharide, or dexamethasone. gamma-Interferon-induced neopterin formation and indoleamine 2,3-dioxygenase activity are increased by raising extracellular tryptophan concentrations. The pattern of intracellularly formed pteridines upon stimulation with gamma-interferon shows the unique characteristics of human monocytes/macrophages. Neopterin, monapterin, and biopterin are produced in a 50:2:1 ratio. Thus, the THP-1 cell line provides a permanent, easily accessible in vitro system for studying the induction and mechanism of neopterin formation.

Gamma-oryzanol-loaded calcium pectinate microparticles reinforced with chitosan: optimization and release characteristics.

PubMed

Lee, Ji-Soo; Kim, Jong Soo; Lee, Hyeon Gyu

2009-05-01

Response surface methodology was used to optimize microparticle preparation conditions, including the ratio of pectin:gamma-oryzanol (OZ) (X(1)), agitation speed (X(2)), and the concentration of emulsifier (X(3)), for maximal entrapment efficiency (EE) of OZ-loaded Ca pectinate microparticles. The optimized values of X(1), X(2), and X(3) were found to be 2.72:5.28, 1143.5 rpm, and 2.61%, respectively. Experimental results obtained for the optimum formulation agreed favorably with the predicted results, indicating the usefulness of predicting models for EE. In order to evaluate the effect of chitosan-coating and blending on the release pattern of the entrapped OZ from microparticles, chitosan-coated and blended Ca pectinate microparticles were prepared. Release studies revealed that the chitosan treatments, especially the chitosan-coating, were effective in suppressing the release in both simulated gastric fluid (SGF) and intestinal fluid (SIF).

Role of Gamma Interferon in the Pathogenesis of Severe Schistosomiasis in Interleukin-4-Deficient Mice

PubMed Central

La Flamme, Anne Camille; Patton, Elisabeth A.; Pearce, Edward J.

2001-01-01

In the absence of interleukin-4 (IL-4), infection with Schistosoma mansoni leads to a severe fatal disease rather than the chronic survivable condition that occurs in wild-type (WT) mice. Because the sustained production of NO most closely correlates to weight loss and fatality in infected IL-4−/− mice and because gamma interferon (IFN-γ) is an important inducer of inducible NO synthase, infected IL-4−/− mice were treated with anti-IFN-γ antibodies to determine the role of IFN-γ during schistosomiasis in WT and IL-4−/− animals. When IFN-γ was neutralized, Th2 responses were enhanced and NO production was reduced in both WT and IL-4−/− mice. The decreased NO production correlated with a rescue of proliferation in splenocytes from infected IL-4−/− mice. Furthermore, the neutralization of IFN-γ in vivo improved the gross appearance of the liver and led to a reduction in granuloma size in infected IL-4−/− but not WT mice. However, the neutralization of IFN-γ in vivo did not affect the development of severe disease in infected IL-4−/− mice. These results suggest that while the increased production of IFN-γ does lead to some of the pathology observed in infected IL-4−/− mice, it is not ultimately responsible for cachexia and death. PMID:11705919

Fish oil feeding delays influenza virus clearance and impairs production of interferon-gamma and virus-specific immunoglobulin A in the lungs of mice.

PubMed

Byleveld, P M; Pang, G T; Clancy, R L; Roberts, D C

1999-02-01

Ingestion of fish oil can suppress the inflammatory response to injury and may impair host resistance to infection. To investigate the effect of a diet containing fish oil on immunity to viral infection, 148 BALB/c mice were fed diets containing 3 g/100 g of sunflower oil with either 17 g/100 g of fish oil or beef tallow for 14 d before intranasal challenge with live influenza virus. At d 1 and d 5 after infection, the mice fed fish oil had higher lung viral load and lower body weight (P < 0.05). In addition to the greater viral load and weight loss at d 5 after infection, the fish oil group consumed less food (P < 0.05) while the beef tallow group was clearing the virus, had regained their preinfection weights and was returning to their preinfection food consumption. The fish oil group had impaired production of lung interferon-gamma (IFN-gamma), serum immunoglobulin (Ig) G and lung IgA-specific antibodies (all P < 0. 05) although lung IFN-alpha/beta and the relative proportions of bronchial lymph node CD4+ and CD8+ T lymphocytes did not differ between groups after infection. The present study demonstrates a delay in virus clearance in mice fed fish oil associated with reduced IFN-gamma and antibody production and a greater weight loss and suppression of appetite following influenza virus infection. However, differences observed during the course of infection did not affect the ultimate outcome as both groups cleared the virus and returned to preinfection food consumption and body weight by d 7.

Borrelia-primed and -infected mice deficient of interleukin-17 develop arthritis after neutralization of gamma-interferon.

PubMed

Kuo, Joseph; Warner, Thomas F; Schell, Ronald F

2017-03-01

The immune mechanisms responsible for development of Lyme arthritis are partially understood with interleukin-17 (IL-17) and gamma-interferon (IFN-γ) playing a generally accepted role. Elevated levels of IL-17 and/or IFN-γ have been reported in samples from human Lyme arthritis patients and experimental mice. In addition, IL-17 and IFN-γ have been implicated in the onset of arthritis in Borrelia-primed and -infected C57BL/6 mice. Recently, we showed that IL-17-deficient mice developed swelling and histopathological changes consistent with arthritis in the presence of high levels of IFN-γ. We hypothesized that neutralization of IFN-γ in IL-17-deficient mice would inhibit Borrelia-induced arthritis. Our results, however, showed that swelling of the hind paws and histopathological changes of arthritis did not differ between Borrelia-primed and -infected IL-17-deficient and wild-type mice with or without neutralization of IFN-γ. We also found higher levels of tumor necrosis factor alpha (TNF-α) and IL-6 in the popliteal lymph node cells of Borrelia-primed and -infected IL-17-deficient mice after neutralization of IFN-γ. These results suggest that multiple cytokines interact in the development of Borrelia-induced arthritis. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Dampened STING-Dependent Interferon Activation in Bats.

PubMed

Xie, Jiazheng; Li, Yang; Shen, Xurui; Goh, Geraldine; Zhu, Yan; Cui, Jie; Wang, Lin-Fa; Shi, Zheng-Li; Zhou, Peng

2018-03-14

Compared with terrestrial mammals, bats have a longer lifespan and greater capacity to co-exist with a variety of viruses. In addition to cytosolic DNA generated by these viral infections, the metabolic demands of flight cause DNA damage and the release of self-DNA into the cytoplasm. However, whether bats have an altered DNA sensing/defense system to balance high cytosolic DNA levels remains an open question. We demonstrate that bats have a dampened interferon response due to the replacement of the highly conserved serine residue (S358) in STING, an essential adaptor protein in multiple DNA sensing pathways. Reversing this mutation by introducing S358 restored STING functionality, resulting in interferon activation and virus inhibition. Combined with previous reports on bat-specific changes of other DNA sensors such as TLR9, IFI16, and AIM2, our findings shed light on bat adaptation to flight, their long lifespan, and their unique capacity to serve as a virus reservoir. Copyright © 2018 Elsevier Inc. All rights reserved.

The highly virulent variola and monkeypox viruses express secreted inhibitors of type I interferon.

PubMed

Fernández de Marco, María del Mar; Alejo, Alí; Hudson, Paul; Damon, Inger K; Alcami, Antonio

2010-05-01

Variola virus (VARV) caused smallpox, one of the most devastating human diseases and the first to be eradicated, but its deliberate release represents a dangerous threat. Virulent orthopoxviruses infecting humans, such as monkeypox virus (MPXV), could fill the niche left by smallpox eradication and the cessation of vaccination. However, immunomodulatory activities and virulence determinants of VARV and MPXV remain largely unexplored. We report the molecular characterization of the VARV- and MPXV-secreted type I interferon-binding proteins, which interact with the cell surface after secretion and prevent type I interferon responses. The proteins expressed in the baculovirus system have been purified, and their interferon-binding properties characterized by surface plasmon resonance. The ability of these proteins to inhibit a broad range of interferons was investigated to identify potential adaptation to the human immune system. Furthermore, we demonstrate by Western blot and activity assays the expression of the type I interferon inhibitor during VARV and MPXV infections. These findings are relevant for the design of new vaccines and therapeutics to smallpox and emergent virulent orthopoxviruses because the type I interferon-binding protein is a major virulence factor in animal models, vaccination with this protein induces protective immunity, and its neutralization prevents disease progression.

The effect of centaurein on interferon-{gamma} expression and Listeria infection in mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chang, S.-L.; Department of Biological Science and Technology, National Chiao Tung University, 1001, Ta Hsueh Road, Hsinchu 300, Taiwan; Yeh, H.-H.

2007-02-15

We previously found that centaurein enhanced IFN-{gamma} transcription in T cells. Here, we demonstrate that centaurein increased the IFN-{gamma} expression in T and NK cells and the serum IFN-{gamma} level in mice. Centaurein elevated the transcription of T-bet but not GATA-3, which is consistent with its effect on that of IFN-{gamma} but not IL-4. Additionally, centaurein effectively protected mice against Listeria infection. Moreover, centaurein per se or in combination with antibiotics could treat Listeria infection. Our mechanistic studies suggest that centaurein augments IFN-{gamma} expression via a transcriptional up-regulation of T-bet and that centaurein protects against or treats Listeria infection viamore » a modulation of IFN-{gamma} expression.« less

Human Atopic Dermatitis Complicated by Eczema Herpeticum is Associated with Abnormalities in Gamma Interferon Response

PubMed Central

Leung, Donald YM; Gao, Pei-Song; Grigoryev, Dmitry N; Rafaels, Nicholas M; Streib, Joanne E; Howell, Michael D; Taylor, Patricia A; Boguniewicz, Mark; Canniff, Jennifer; Armstrong, Brian; Zaccaro, Daniel J; Schneider, Lynda C; Hata, Tissa R; Hanifin, Jon M; Beck, Lisa A; Weinberg, Adriana; Barnes, Kathleen C

2011-01-01

Background The basis for increased susceptibility of atopic dermatitis (AD) patients to develop disseminated viral skin infections such as eczema herpeticum (ADEH+) is poorly understood. Objective We sought to determine whether atopic dermatitis subjects prone to disseminated viral skin infections have defects in their interferon responses. Methods GeneChip profiling was used to identify differences in gene expression of peripheral blood mononuclear cells (PBMC) from patients with a history of ADEH+ as compared to ADEH− and non-atopic controls. Key differences in protein expression were verified by ELISPOT and/or ELISA. Clinical relevance was further demonstrated by a mouse model of disseminated viral skin infection and genetic association analysis for genetic variants in IFNG and IFNGR1 and ADEH among 435 cases and controls. Results We demonstrate by global gene expression analysis selective transcriptomic changes within the interferon (IFN) superfamily of PBMCs from ADEH+ subjects reflecting low IFNγ and IFNγ receptor gene expression. IFNγ protein production was also significantly lower in ADEH+ (N=24) compared to ADEH− (N=20) and non-atopic (NA; N=20) controls. IFNγ receptor knockout (KO) mice developed disseminated viral skin infection after epicutaneous challenge with vaccinia virus (VV). Genetic variants in IFNG and IFNGR1 SNPs were significantly associated with ADEH (112 cases, 166 controls) and IFNγ production: a 2-SNP (A–G) IFNGR1 haplotype (rs10457655 and rs7749390) showed the strongest association with a reduced risk of ADEH+ ((13.2% ADEH+ vs 25.5% ADEH−, P = 0.00057). Conclusions ADEH+ patients have reduced IFNγ production, and IFNG and IFNGR1 SNPs are significantly associated with ADEH+ and may contribute to an impaired immune response to herpes simplex virus (HSV). Clinical Implications Atopic dermatitis subjects prone to disseminated viral skin infections have defects in their interferon responses. Capsule summary Using genomic

Lion (Panthera leo) and cheetah (Acinonyx jubatus) IFN-gamma sequences.

PubMed

Maas, Miriam; Van Rhijn, Ildiko; Allsopp, Maria T E P; Rutten, Victor P M G

2010-04-15

Cloning and sequencing of the full length lion and cheetah interferon-gamma (IFN-gamma) transcript will enable the expression of the recombinant cytokine, to be used for production of monoclonal antibodies and to set up lion and cheetah-specific IFN-gamma ELISAs. These are relevant in blood-based diagnosis of bovine tuberculosis, an important threat to lions in the Kruger National Park. Alignment of nucleotide and amino acid sequences of lion and cheetah and that of domestic cats showed homologies of 97-100%. Copyright 2009 Elsevier B.V. All rights reserved.

The highly virulent variola and monkeypox viruses express secreted inhibitors of type I interferon

PubMed Central

Fernández de Marco, María del Mar; Alejo, Alí; Hudson, Paul; Damon, Inger K.; Alcami, Antonio

2010-01-01

Variola virus (VARV) caused smallpox, one of the most devastating human diseases and the first to be eradicated, but its deliberate release represents a dangerous threat. Virulent orthopoxviruses infecting humans, such as monkeypox virus (MPXV), could fill the niche left by smallpox eradication and the cessation of vaccination. However, immunomodulatory activities and virulence determinants of VARV and MPXV remain largely unexplored. We report the molecular characterization of the VARV- and MPXV-secreted type I interferon-binding proteins, which interact with the cell surface after secretion and prevent type I interferon responses. The proteins expressed in the baculovirus system have been purified, and their interferon-binding properties characterized by surface plasmon resonance. The ability of these proteins to inhibit a broad range of interferons was investigated to identify potential adaptation to the human immune system. Furthermore, we demonstrate by Western blot and activity assays the expression of the type I interferon inhibitor during VARV and MPXV infections. These findings are relevant for the design of new vaccines and therapeutics to smallpox and emergent virulent orthopoxviruses because the type I interferon-binding protein is a major virulence factor in animal models, vaccination with this protein induces protective immunity, and its neutralization prevents disease progression.—Fernández de Marco, M. M., Alejo, A., Hudson, P., Damon, I. K., Alcami, A. The highly virulent variola and monkeypox viruses express secreted inhibitors of type I interferon. PMID:20019241

Interferon modulation of c-myc expression in cloned Daudi cells: relationship to the phenotype of interferon resistance.

PubMed

Dron, M; Modjtahedi, N; Brison, O; Tovey, M G

1986-05-01

Treatment of interferon-sensitive Daudi cell with electrophoretically pure human interferon alpha markedly reduced the level of c-myc mRNA, increased the level of class I histocompatibility antigen (HLA) mRNA, and did not affect the level of actin mRNA within the same cells. In contrast, the level of c-myc mRNA or HLA mRNA did not change significantly following interferon treatment in different clones of Daudi cells selected for resistance to the antiproliferative action of interferon. These cells possessed interferon receptors, however, and responded to interferon modulation of other genes, including 2',5' oligoisoadenylate synthetase (M. G. Tovey, M. Dron, K. E. Mogensen, B. Lebleu, N. Metchi, and J. Begon-Lours, Guymarho, J. Gen. Virol., 64:2649-2653, 1983; M. Dron, M. G. Tovey, and P. Eid, J. Gen. Virol., 66:787-795, 1985). A clone of interferon-resistant Daudi cells which had reverted to almost complete sensitivity to both the antiproliferative action of interferon and the interferon-enhanced expression of HLA mRNA remained refractory, however, to interferon modulation of c-myc expression, suggesting that a reduced level of c-myc mRNA may not be a prerequisite for inhibition of cell proliferation in interferon-treated cells. Our results do not exclude the possibility, however, that posttranscriptional modification(s) of c-myc expression may precede an inhibition of cell proliferation in interferon-treated cells.

Interferon-γ regulates chemokine expression and release in the human mast cell line HMC1: role of nitric oxide

PubMed Central

Gilchrist, M; Befus, A D

2008-01-01

Mast cells (MCs) are critical immune effector cells that release cytokines and chemokines involved in both homeostasis and disease. Interferon-γ (IFN-γ) is a pleiotropic cytokine that regulates multiple cellular activities. IFN-γ modulates rodent MC responsiveness via production of nitric oxide (NO), although the effects in human MC populations is unknown. We sought to investigate the effects of IFN-γ on expression of the chemokines interleukin-8 (IL-8) and CCL1 (I-309) in a human mast cell line (HMC1) and to determine the underlying regulatory mechanism. Nitric oxide synthase (NOS), IL-8 and CCL1 expression was determined using real-time polymerase chain reaction (PCR). NOS protein expression was analysed using western blot. NOS activity was determined using the citrulline assay. IL-8 and CCL1 release was measured by specific enzyme-linked immunosorbent assay (ELISA). IFN-γ inhibited phorbol 12-myristate 13-acetate (PMA)-induced release of IL-8 and CCL1 (by 47 and 38%). Real-time PCR analysis of IFN-γ-treated HMC1 showed a significant (P < 0·05) time-dependent increase in NOS1 and NOS3 mRNA. NOS3 protein was significantly increased at 18 hr, which correlated with a significant (P < 0·05) increase in constitutive NOS (cNOS) activity. IFN-γ-induced inhibition of chemokine expression and release was NO dependent, as treatment with the NOS inhibitor NG-nitro-l-arginine methyl ester (l-NAME) reduced the IFN-γ inhibitory effect on IL-8 and CCL1 mRNA expression. NO donors mimicked the IFN-γ effect. IFN-γ inhibited PMA-induced cAMP response element binding protein (CREB) phosphorylation and DNA-binding activity. Our observations indicate for the first time that IFN-γ enhances endogenous NO formation through NOS3 activity, and that NO regulates the transcription and release of IL-8 and CCL1 in a human MC line. PMID:17662042

Interferon-gamma improves impaired dentinogenic and immunosuppressive functions of irreversible pulpitis-derived human dental pulp stem cells

PubMed Central

Sonoda, Soichiro; Yamaza, Haruyoshi; Ma, Lan; Tanaka, Yosuke; Tomoda, Erika; Aijima, Reona; Nonaka, Kazuaki; Kukita, Toshio; Shi, Songtao; Nishimura, Fusanori; Yamaza, Takayoshi

2016-01-01

Clinically, irreversible pulpitis is treated by the complete removal of pulp tissue followed by replacement with artificial materials. There is considered to be a high potential for autologous transplantation of human dental pulp stem cells (DPSCs) in endodontic treatment. The usefulness of DPSCs isolated from healthy teeth is limited. However, DPSCs isolated from diseased teeth with irreversible pulpitis (IP-DPSCs) are considered to be suitable for dentin/pulp regeneration. In this study, we examined the stem cell potency of IP-DPSCs. In comparison with healthy DPSCs, IP-DPSCs expressed lower colony-forming capacity, population-doubling rate, cell proliferation, multipotency, in vivo dentin regeneration, and immunosuppressive activity, suggesting that intact IP-DPSCs may be inadequate for dentin/pulp regeneration. Therefore, we attempted to improve the impaired in vivo dentin regeneration and in vitro immunosuppressive functions of IP-DPSCs to enable dentin/pulp regeneration. Interferon gamma (IFN-γ) treatment enhanced in vivo dentin regeneration and in vitro T cell suppression of IP-DPSCs, whereas treatment with tumor necrosis factor alpha did not. Therefore, these findings suggest that IFN-γ may be a feasible modulator to improve the functions of impaired IP-DPSCs, suggesting that autologous transplantation of IFN-γ-accelerated IP-DPSCs might be a promising new therapeutic strategy for dentin/pulp tissue engineering in future endodontic treatment. PMID:26775677

Evaluation of pre- and posttransplantation serum interferon-gamma and soluble CD30 for predicting liver allograft rejection.

PubMed

Kim, K H; Oh, E-J; Jung, E-S; Park, Y-J; Choi, J Y; Kim, D-G; Lee, K Y; Kang, C S

2006-06-01

The aim of the present study was to identify whether the serum interferon-gamma (IFNgamma), a Th1 cytokine, or soluble CD30 (sCD30), a marker for activation of Th2 cytokine-producing T cells, predict acute cellular rejection episodes among liver graft patients. Pretransplant and posttransplant sera from 32 living donor liver transplant recipients obtained on days 1, 3, and 7 after surgery were tested for serum IFNgamma and sCD30 concentrations using commercial enzyme-linked immunosorbent assay kits. Recipients with an acute rejection episode (ARE) (n=14) displayed significantly higher IFNgamma concentrations pretransplant than did the patients with no ARE (n=18) (P<.05). The pretransplant serum levels of sCD30 were not different between the non-ARE and ARE groups. However, in comparison with the non-ARE group, who showed steadily decreasing serum sCD30 levels after transplantation, 12 among the 14 patients in the ARE group showed increasing sCD30 levels from day 1 to day 3 after transplantation (P<.05). These results suggest that the sCD30 increment during the early period after liver transplantation affects the immune response of rejection. This observation emphasizes the clinical relevance of serum sCD30, in addition to serum IFNgamma, as predictive markers for acute liver graft rejection.

Identifying Predictors of Interferon-γ Release Assay Results in Pediatric Latent Tuberculosis: A Protective Role of Bacillus Calmette-Guérin?

PubMed Central

Sotgiu, Giovanni; Altet-Gómez, Neus; Tsolia, Maria; Ruga, Ezia; Velizarova, Svetlana; Kampmann, Beate

2012-01-01

Rationale: Interferon-γ (IFN-γ) release assays are widely used to diagnose latent infection with Mycobacterium tuberculosis in adults, but their performance in children remains incompletely evaluated to date. Objectives: To investigate factors influencing results of IFN-γ release assays in children using a large European data set. Methods: The Pediatric Tuberculosis Network European Trials group pooled and analyzed data from five sites across Europe comprising 1,128 children who were all investigated for latent tuberculosis infection by tuberculin skin test and at least one IFN-γ release assay. Multivariate analyses examined age, bacillus Calmette-Guérin (BCG) vaccination status, and sex as predictor variables of results. Subgroup analyses included children who were household contacts. Measurements and Main Results: A total of 1,093 children had a QuantiFERON-TB Gold In-Tube assay and 382 had a T-SPOT.TB IFN-γ release assay. Age was positively correlated with a positive blood result (QuantiFERON-TB Gold In-Tube: odds ratio [OR], 1.08 per year increasing age [P < 0.0001]; T-SPOT.TB: OR, 1.14 per year increasing age [P < 0.001]). A positive QuantiFERON-TB Gold In-Tube result was shown by 5.5% of children with a tuberculin skin test result less than 5 mm, by 14.8% if less than 10 mm, and by 20.2% if less than 15 mm. Prior BCG vaccination was associated with a negative IFN-γ release assay result (QuantiFERON-TB Gold In-Tube: OR, 0.41 [P < 0.001]; T-SPOT.TB: OR, 0.41 [P < 0.001]). Young age was a predictor of indeterminate IFN-γ release assay results, but indeterminate rates were low (3.6% in children < 5 yr, 1% in children > 5 yr). Conclusions: Our data show that BCG vaccination may be effective in protecting children against Mycobacterium tuberculosis infection. To restrict use of IFN-γ release assays to children with positive skin tests risks underestimating latent infection. PMID:22700862

Interferon modulation of c-myc expression in cloned Daudi cells: relationship to the phenotype of interferon resistance.

PubMed Central

Dron, M; Modjtahedi, N; Brison, O; Tovey, M G

1986-01-01

Treatment of interferon-sensitive Daudi cell with electrophoretically pure human interferon alpha markedly reduced the level of c-myc mRNA, increased the level of class I histocompatibility antigen (HLA) mRNA, and did not affect the level of actin mRNA within the same cells. In contrast, the level of c-myc mRNA or HLA mRNA did not change significantly following interferon treatment in different clones of Daudi cells selected for resistance to the antiproliferative action of interferon. These cells possessed interferon receptors, however, and responded to interferon modulation of other genes, including 2',5' oligoisoadenylate synthetase (M. G. Tovey, M. Dron, K. E. Mogensen, B. Lebleu, N. Metchi, and J. Begon-Lours, Guymarho, J. Gen. Virol., 64:2649-2653, 1983; M. Dron, M. G. Tovey, and P. Eid, J. Gen. Virol., 66:787-795, 1985). A clone of interferon-resistant Daudi cells which had reverted to almost complete sensitivity to both the antiproliferative action of interferon and the interferon-enhanced expression of HLA mRNA remained refractory, however, to interferon modulation of c-myc expression, suggesting that a reduced level of c-myc mRNA may not be a prerequisite for inhibition of cell proliferation in interferon-treated cells. Our results do not exclude the possibility, however, that posttranscriptional modification(s) of c-myc expression may precede an inhibition of cell proliferation in interferon-treated cells. Images PMID:3785169

Decreased release of histamine and sulfidoleukotrienes by human peripheral blood leukocytes after wasp venom immunotherapy is partially due to induction of IL-10 and IFN-gamma production of T cells.

PubMed

Pierkes, M; Bellinghausen, I; Hultsch, T; Metz, G; Knop, J; Saloga, J

1999-02-01

Recent studies provide evidence that venom immunotherapy (VIT) alters the pattern of cytokine production by inducing an allergen-specific T-cell shift in cytokine expression from TH2 (IL-4, IL-5) to TH1 (IFN-gamma) cytokines and also inducing the production of IL-10. This study was carried out to analyze whether these changes in cytokine production of T cells already observed 1 week after the initiation of VIT in subjects with wasp venom allergy also influence the reactivity of effector cells, such as mast cells and basophils. All subjects included in this study had a history of severe systemic allergic reactions to wasp stings and positive skin test responses with venom and venom-specific IgE in the sera. Peripheral blood leukocytes were isolated before and after the initiation of VIT (rush therapy reaching a maintenance dose of 100 microg venom injected subcutaneously within 1 week) and preincubated with or without addition of IL-10, IFN-gamma, IL-10 + IFN-gamma, anti-IL-10, or anti-IFN-gamma. After stimulation with wasp venom, histamine and sulfidoleukotriene release were assessed by ELISA and compared with spontaneous release and total histamine content. After the induction of VIT, venom-induced absolute and relative histamine and sulfidoleukotriene release were reduced. This was at least partially due to the induction of IFN-gamma and IL-10 production, because (1) neutralization of IL-10 and IFN-gamma by mAbs partially restored the release after the initiation of VIT and (2) the addition of exogenous IFN-gamma and IL-10 caused a statistically significant diminution of the venom-induced histamine and sulfidoleukotriene release before VIT. Depletion of CD2(+) T cells also restored the releasability after VIT. These data indicate that T cells (producing IL-10 and IFN-gamma after VIT) play a key role for the inhibition of histamine and sulfidoleukotriene release of effector cells.

Contradictory results in interferon research

NASA Technical Reports Server (NTRS)

Sonnenfeld, G.

1984-01-01

Several reports on immunologically related interferon research, both in the areas of basic science and clinical research, are briefly reviewed, and it is noted that in many cases the results obtained are contradictory. It is argued, however, that the contradictory results are not surprising since interferon is a biological response modifier and has been known to produce opposite results even when the same interferon prepartion is used. It is emphasized that dosage, timing, route, and other experimental conditions are essential factors in planning immunological studies with interferon. Careful planning of future experiments with interferon should be required to prevent the possible generation of effects that are opposite to those expected.

Recombinant bovine S100A8 and A9 enhance IL-1β secretion of interferon-gamma primed monocytes.

PubMed

Koy, Mirja; Hambruch, Nina; Hussen, Jamal; Pfarrer, Christiane; Seyfert, Hans-Martin; Schuberth, Hans-Joachim

2013-09-15

Calgranulin A (S100A8) and B (S100A9) are found at high levels in inflamed tissue and have been associated with acute and chronic inflammatory disorders. Calgranulins are discussed as damage-associated molecular patterns (DAMPs). To analyze the role of calgranulins for inflammatory responses, bovine S100A8 and S100A9 were cloned, successfully expressed and FPLC-purified. Both molecules did not induce NF-κB activation in boTLR4-transfected HEK293 cells and stimulation of bovine monocytes with both proteins did not result in interleukin 1β (IL-1β) secretion or an upregulated mRNA expression of selected genes (IL1B, TNF, CXCL8, IL10, IL12). However, Interferon γ (IFN-γ) primed bovine monocytes released significantly higher amounts of IL-1β after stimulation with S100A8, S100A9, and co-stimulation with adenosine triphosphate (ATP). In IL-4/IL-13-primed monocytes, the IL-1β release was completely abrogated. The results imply that TLR4/MyD88/NF-κB-independent S100A8/A9-mediated activation of the inflammasome in cattle is favored in a Th1 environment and that S100A8 and S100A9 act as a DAMP in cattle. Copyright © 2013 Elsevier B.V. All rights reserved.

Effect of thiopental sodium on the release of glutamate and gamma-aminobutyric acid from rats prefrontal cortical synaptosomes.

PubMed

Liu, Hongliang; Yao, Shanglong

2004-01-01

To investigate the effect of thiopental sodium on the release of glutamate and gamma-aminobutyric acid (GABA) from synaptosomes in the prefrontal cortex, synaptosomes were made, the spontaneous release and the evoked release by 30 mmol/L KCl or 20 micromol/L veratridine of glutamate and GABA were performed under various concentrations of thiopental sodium (10-300 micromol/L), glutamate and GABA concentrations were determined by reversed-phase high-performance liquid chromatography. Our results showed that spontaneous release and evoked release of glutamate were significantly inhibited by 30 micromol/L, 100 micromol/L and 300 micromol/L thiopental sodium, IC50 of thiopental sodium was 25.8 +/- 2.3 micromol/L for the spontaneous release, 23.4 +/- 2.4 micromol/L for KCl-evoked release, and 24.3 +/- 1.8 micromol/L for veratridine-evoked release. But GABA spontaneous release and evoked release were unaffected. The study showed that thiopental sodium with clinically related concentrations could inhibit the release of glutamate, but had no effect on the release of GABA from rats prefrontal cortical synaptosomes.

Interferon Alfa-2b Injection

MedlinePlus

Interferon alfa-2b injection is used to treat a number of conditions.Interferon alfa-2b injection is used alone or in combination ... lymphoma (NHL; a slow-growing blood cancer). Interferon alfa-2b is in a class of medications called ...

Myeloid interferon-γ receptor deficiency does not affect atherosclerosis in LDLR(-/-) mice.

PubMed

Boshuizen, Marieke C S; Neele, Annette E; Gijbels, Marion J J; van der Velden, Saskia; Hoeksema, Marten A; Forman, Ruth A; Muller, Werner; Van den Bossche, Jan; de Winther, Menno P J

2016-03-01

Atherosclerosis is a chronic lipid-driven inflammatory disease of the arterial wall. Interferon gamma (IFNγ) is an important immunomodulatory cytokine and a known pro-atherosclerotic mediator. However, cell-specific targeting of IFNγ or its signaling in atherosclerosis development has not been studied yet. As macrophages are important IFNγ targets, we here addressed the involvement of myeloid IFNγ signaling in murine atherosclerosis. Bone marrow was isolated from interferon gamma receptor 2 chain (IFNγR2) wildtype and myeloid IFNγR2 deficient mice and injected into lethally irradiated LDLR(-/-) mice. After recovery mice were put on a high fat diet for 10 weeks after which atherosclerotic lesion analysis was performed. In addition, the accompanying liver inflammation was assessed. Even though absence of myeloid IFNγ signaling attenuated the myeloid IFNγ response, no significant differences in atherosclerotic lesion size or phenotype were found. Also, when examining the liver inflammatory state no effects of IFNγR2 deficiency could be observed. Overall, our data argue against a role for myeloid IFNγR2 in atherosclerosis development. Since myeloid IFNγ signaling seems to be nonessential throughout atherogenesis, it is important to understand the mechanisms by which IFNγ acts in atherogenesis. In the future new studies should be performed considering other cell-specific targets. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Molecular characterization and development of Sarcocystis speeri sarcocysts in gamma interferon gene knockout mice.

PubMed

Dubey, J P; Verma, S K; Dunams, D; Calero-Bernal, R; Rosenthal, B M

2015-11-01

The North American opossum (Didelphis virginiana) is the definitive host for at least three named species of Sarcocystis: Sarcocystis falcatula, Sarcocystis neurona and Sarcocystis speeri. The South American opossums (Didelphis albiventris, Didelphis marsupialis and Didelphis aurita) are definitive hosts for S. falcatula and S. lindsayi. The sporocysts of these Sarcocystis species are similar morphologically. They are also not easily distinguished genetically because of the difficulties of DNA extraction from sporocysts and availability of distinguishing genetic markers. Some of these species can be distinguished by bioassay; S. neurona and S. speeri are infective to gamma interferon gene knockout (KO) mice, but not to budgerigars (Melopsittacus undulatus); whereas S. falcatula and S. lindsayi are infective to budgerigars but not to KO mice. The natural intermediate host of S. speeri is unknown. In the present study, development of sarcocysts of S. speeri in the KO mice is described. Sarcocysts were first seen at 12 days post-inoculation (p.i.), and they became macroscopic (up to 4 mm long) by 25 days p.i. The structure of the sarcocyst wall did not change from the time bradyzoites had formed at 50-220 days p.i. Sarcocysts contained unique villar protrusions, 'type 38'. The polymerase chain reaction amplifications and sequences analysis of three nuclear loci (18S rRNA, 28S rRNA and ITS1) and two mitochondrial loci (cox1 and cytb) of S. speeri isolate from an Argentinean opossum (D. albiventris) confirmed its membership among species of Sarcocystis and indicated an especially close relationship to another parasite in this genus that employs opossums as its definitive host, S. neurona. These results should be useful in finding natural intermediate host of S. speeri.

The Jak-STAT pathway stimulated by interferon alpha or interferon beta.

PubMed

Horvath, Curt M

2004-11-23

Type I interferons, such as interferon alpha and interferon beta (IFN-alpha and beta), signal through a Janus kinase (Jak) to signal transduction and activator of transcription (STAT) pathway to stimulate gene expression. In response to ligand binding, the receptors dimerize, Jaks phosphorylate STAT1 and STAT2, which then dimerize and interact with a third transcriptional regulator IFN regulatory factor 9 (IRF9) to stimulate gene expression. IFN-alpha is the main innate antiviral cytokine and is essential for effective immune response to viral infection. The animation shows activation of STAT-responsive gene expression in response to type I IFNs.

Can gamma irradiation during radiotherapy influence the metal release process for biomedical CoCrMo and 316L alloys?

PubMed

Wei, Zheng; Edin, Jonathan; Karlsson, Anna Emelie; Petrovic, Katarina; Soroka, Inna L; Odnevall Wallinder, Inger; Hedberg, Yolanda

2018-02-09

The extent of metal release from implant materials that are irradiated during radiotherapy may be influenced by irradiation-formed radicals. The influence of gamma irradiation, with a total dose of relevance for radiotherapy (e.g., for cancer treatments) on the extent of metal release from biomedical stainless steel AISI 316L and a cobalt-chromium alloy (CoCrMo) was investigated in physiological relevant solutions (phosphate buffered saline with and without 10 g/L bovine serum albumin) at pH 7.3. Directly after irradiation, the released amounts of metals were significantly higher for irradiated CoCrMo as compared to nonirradiated CoCrMo, resulting in an increased surface passivation (enhanced passive conditions) that hindered further release. A similar effect was observed for 316L showing lower nickel release after 1 h of initially irradiated samples as compared to nonirradiated samples. However, the effect of irradiation (total dose of 16.5 Gy) on metal release and surface oxide composition and thickness was generally small. Most metals were released initially (within seconds) upon immersion from CoCrMo but not from 316L. Albumin induced an increased amount of released metals from AISI 316L but not from CoCrMo. Albumin was not found to aggregate to any greater extent either upon gamma irradiation or in the presence of trace metal ions, as determined using different light scattering techniques. Further studies should elucidate the effect of repeated friction and fractionated low irradiation doses on the short- and long term metal release process of biomedical materials. © 2018 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater, 2018. © 2018 The Authors Journal of Biomedical Materials Research Part B: Applied Biomaterials Published by Wiley Periodicals, Inc.

Treatment of three patients with systemic mastocytosis with interferon alpha-2b.

PubMed

Worobec, A S; Kirshenbaum, A S; Schwartz, L B; Metcalfe, D D

1996-08-01

It has been reported that the administration of interferon alpha-2b is of potential benefit in the treatment of mastocytosis based on a single patient study (NEJM, Feb 27, 1992, 326(9):619-623). Following this report, we administered interferon alpha-2b at a dose of 4 to 5 million units per square meter of body surface area for at least 12 months to one patient with mastocytosis with an associated hematologic disorder (patient 1), one patient with aggressive systemic mastocytosis (patient 2), and one patient with indolent mastocytosis (patient 3). Patients were monitored with the following clinical and laboratory parameters: serial bone marrow biopsies and aspirates, patient log of histamine release attacks, medication dependency, plasma tryptase levels, serum lactate dehydrogenase (LDH) levels, white blood cell counts and differentials, extent of urticaria pigmentosa lesions, bony involvement, and extent of gastrointestinal involvement and hepatomegaly. We also examined the ability of interferon alpha-2b to inhibit recombinant human stem cell factor (rhSCF)-dependent mast cell proliferation from CD34+ bone marrow-derived cells. All patients demonstrated continued progression of disease in one or more clinical criteria at one year of therapy. Similarly, interferon alpha-2b did not inhibit the culture of mast cells from CD34+ bone marrow-derived cells in the presence of SCF. Thus, in our study of three patients with systemic mastocytosis, treatment with interferon alpha-2b was found to be ineffective in controlling progression of disease.

Cerebrospinal fluid interferon-gamma-inducible protein 10 (IP-10, CXCL10) in HIV-1 infection.

PubMed

Cinque, Paola; Bestetti, Arabella; Marenzi, Roberta; Sala, Serena; Gisslen, Magnus; Hagberg, Lars; Price, Richard W

2005-11-01

Interferon-gamma-inducible protein (IP-10 or CXCL10) is a potent chemoattractant and has been suggested to enhance retrovirus infection and mediate neuronal injury. In order to assess this chemokine in central nervous system (CNS) HIV infection, we measured the cerebrospinal fluid (CSF) and plasma concentrations of CXCL10 by immunoassay in samples derived from 97 HIV-infected subjects across a spectrum of immunological progression and CNS complications and from 16 HIV seronegative control subjects studied at three clinical centers between 1994 and 2001. We also examined changes in the CSF and plasma CXCL10 concentrations in 30 subjects starting and three stopping antiretroviral therapy. CSF CXCL10 concentrations: (1) correlated with CSF HIV RNA and white blood cell (WBC) counts, but not with blood CXCL10, HIV RNA, or CD4 counts; (2) were increased in subjects with primary and asymptomatic HIV infections and AIDS dementia complex, but less frequently in those with more advanced infection, with or without CNS opportunistic diseases except cytomegalovirus encephalitis; (3) decreased in subjects starting antiretroviral in association with decreases in CSF and plasma HIV RNA and CSF WBCs; and (4) conversely, increased in subjects stopping treatment in parallel with CSF HIV RNA and WBCs. These results confirm that CSF CXCL10 associates closely with both CSF HIV and WBCs and suggest that this chemokine may be both a response to and contributing determinant of local infection. High CSF levels may be useful in the diagnosis of ADC in subjects with advanced immunosuppression in whom CMV encephalitis has been ruled out, though this issue requires further study.

Effects of interferon on antibody formation

NASA Technical Reports Server (NTRS)

Sonnenfeld, G.

1984-01-01

Studies of the effects of interferon on primary and secondary antibody responses and of the relationship of interferon to other cytokines, or cell products, are presented. Dosage- and timing-dependent immunoenhancing and immunosuppressive activities of interferon are documented for mouse spleen cell cultures and for mice infected with murine hepatitis virus (MHV-3). A possibility that altered interferon production might lead to immunopathological disorders, such as lupus erythematosus, AIDS, arthritis, etc., is discussed. Latest technological developments are presented that indicate that interferon does apparently play a major role in the regulation of antibody responses.

Interferon-gamma receptor-deficiency renders mice highly susceptible to toxoplasmosis by decreased macrophage activation.

PubMed

Deckert-Schlüter, M; Rang, A; Weiner, D; Huang, S; Wiestler, O D; Hof, H; Schlüter, D

1996-12-01

Toxoplasma gondii may cause severe infections in immunocompromised patients including fetuses and those with AIDS. Among the factors mediating protection against T. gondii, IFN-gamma has gained special attention. To analyze the role of IFN-gamma in the early phase of toxoplasmosis, IFN-gamma receptor-deficient (IFN-gamma R0/0) mice were orally infected with low-virulent toxoplasms. IFN-gamma R0/0 mice died of the disease up to day 10 postinfection, whereas immunocompetent wild-type (WT) mice developed a chronic toxoplasmosis. Histopathology revealed that in IFN-gamma R0/0 mice, the parasite multiplied unrestrictedly in the small intestine, the intestinal lymphatic tissue, the liver, and the spleen. Ultimately, animals died of a necrotizing hepatitis. In WT mice, the same organs were effected, but multiplication of the parasite was effectively limited. Compared with WT mice, immunohistochemistry and flow cytometry demonstrated that in IFN-gamma R0/0 mice, macrophages were only marginally activated in response to the infection, as evidenced by a reduced expression of major histocompatability complex class II antigens. In addition, immunohistochemistry and RT-PCR showed a reduced production of the macrophage-derived cytokines tumor necrosis factor-alpha, inducible nitric oxide synthase, and IL-1 beta in the liver of IFN-gamma R0/0 mice. In contrast, activation of T cells, recruitment of immune cells to inflammatory foci, and anti-T. gondii IgM antibody production were unaffected by the mutation of the IFN-gamma R. Moreover, induction of IL-2, IL-4, and IL-10 mRNA transcripts in the liver was normal in IFN-gamma R0/0 mice. Adoptive transfer experiments revealed that the immune T cells of WT animals did not protect IFN-gamma R0/0 mice from lethal infection with highly virulent toxoplasms, whereas WT mice were significantly protected by the adoptive transfer. Based on these studies, we conclude that IFN-gamma is absolutely required for an efficient activation of

HLA-DRB1 and HLA-DQB1 Are Associated with Adult-Onset Immunodeficiency with Acquired Anti-Interferon-Gamma Autoantibodies

PubMed Central

Pithukpakorn, Manop; Roothumnong, Ekkapong; Angkasekwinai, Nasikarn; Suktitipat, Bhoom; Assawamakin, Anunchai; Luangwedchakarn, Voravich; Umrod, Pinklow; Thongnoppakhun, Wanna; Foongladda, Suporn; Suputtamongkol, Yupin

2015-01-01

Recently a newly identified clinical syndrome of disseminated non-tuberculous mycobacterial diseases (with or without other opportunistic infections in adult patients who were previously healthy, has been recognized in association with an acquired autoantibody to interferon-gamma. This syndrome is emerging as an important cause of morbidity and mortality, especially among people of Asian descent. Trigger for the production of this autoantibody remains unknown, but genetic factors are strongly suspected to be involved. We compared HLA genotyping between 32 patients with this clinical syndrome, and 38 controls. We found that this clinical syndrome was associated with very limited allele polymorphism, with HLA-DRB1 and DQB1 alleles, especially HLA-DRB1*15:01, DRB1*16:02, DQB1*05:01 and DQB1*05:02. Odds ratio of DRB1*15:01, DRB1*16:02, DQB1*05:01 and DQB1*05:02 were 7.03 (95% CI, 2.18–22.69, P<0.0001, 9.06 (95% CI, 2.79–29.46, P<0.0001), 6.68 (95% CI, 2.29–19.52, P = 0.0004), and 6.64 (95% CI, 2.30–19.20, P = 0.0004), respectively. Further investigation is warranted to provide better understanding on pathogenesis of this association. PMID:26011559

Mink parvoviruses and interferons: in vitro studies.

PubMed Central

Wiedbrauk, D L; Bloom, M E; Lodmell, D L

1986-01-01

Although interferons can inhibit the replication of a number of viruses, little is known about their ability to inhibit parvovirus replication. Therefore, in vitro experiments were done to determine if Aleutian disease virus and mink enteritis virus, two autonomously replicating mink parvoviruses, induced interferon, were sensitive to the effects of interferon, or inhibited the production of interferon. The results indicated that these parvoviruses neither induced nor were sensitive to the effects of interferon. Furthermore, preexisting parvovirus infections did not inhibit poly(I).poly(C)-induced interferon production. This independence from the interferon system may, therefore, be a general property of the autonomously replicating parvoviruses. PMID:2431162

Secretion of interferon gamma from human immune cells is altered by exposure to tributyltin and dibutyltin.

PubMed

Lawrence, Shanieek; Reid, Jacqueline; Whalen, Margaret

2015-05-01

Tributyltin (TBT) and dibutyltin (DBT) are widespread environmental contaminants found in food, beverages, and human blood samples. Both of these butyltins (BTs) interfere with the ability of human natural killer (NK) cells to lyse target cells and alter secretion of the pro-inflammatory cytokine tumor necrosis factor alpha (TNFα) from human immune cells in vitro. The capacity of BTs to interfere with secretion of other pro-inflammatory cytokines has not been examined. Interferon gamma (IFNγ) is a modulator of adaptive and innate immune responses, playing an important role in overall immune competence. This study shows that both TBT and DBT alter secretion of IFNγ from human immune cells. Peripheral blood cell preparations that were increasingly reconstituted were used to determine if exposures to either TBT or DBT affected IFNγ secretion and how the makeup of the cell preparation influenced that effect. IFNγ secretion was examined after 24 h, 48 h, and 6 day exposures to TBT (200 - 2.5 nM) and DBT (5 - 0.05 µM) in highly enriched human NK cells, a monocyte-depleted preparation of PBMCs, and monocyte-containing PBMCs. Both BTs altered IFNγ secretion from immune cells at most of the conditions tested (either increasing or decreasing secretion). However, there was significant variability among donors as to the concentrations and time points that showed changes as well as the baseline secretion of IFNγ. The majority of donors showed an increase in IFNγ secretion in response to at least one concentration of TBT or DBT at a minimum of one length of exposure. © 2013 Wiley Periodicals, Inc.

The interferons.

PubMed Central

Toy, J L

1983-01-01

An overview of the interferons is presented. A description of something of what is known about them is given, including: their genes; their protein structures and characteristics; their mechanisms of actions; and their varied biological effects emphasising particularly their immunomodulatory actions. Finally, a brief summary is made of the current status of human clinical studies that have been conducted with interferons in the oncological and viral fields, mentioning also recent findings in patients who have the acquired immunodeficiency syndrome (AIDS). PMID:6193915

Changes in serum hepatitis C virus RNA in interferon nonresponders retreated with interferon plus ribavirin: a preliminary report.

PubMed

Nyberg, L; Albrecht, J; Glue, P; Gianelli, G; Zambas, D; Elliot, M; Conrad, A; McHutchison, J

1999-06-01

Ribavirin, a nucleoside analogue, inhibits replication of RNA and DNA viruses and may control hepatitis C virus (HCV) infection through modulation of anti-inflammatory and antiviral actions. Ribavirin monotherapy has no effect on serum HCV RNA levels. In combination with interferon, this agent appears to enhance the efficacy of interferon. The aim of this study was to monitor serum HCV RNA levels early during therapy with interferon and ribavirin compared with that previously seen in the same patients during interferon monotherapy. Five patients who previously showed no response to therapy with interferon alfa 3 MU three times weekly for 6 months were retreated with the identical dose of interferon alfa 2b in combination with oral ribavirin 1,000 mg/day. Serum HCV RNA levels were monitored at baseline, week 4, week 8, and week 12 of therapy by a quantitative multicycle polymerase chain reaction assay. In the first 8 to 12 weeks, serum HCV RNA levels showed a greater decrease in all patients when retreated with combination therapy compared with interferon alone. Mean (+/- SEM) serum HCV RNA levels for interferon therapy alone were 3.3 +/- 0.95, 1.2 +/- 0.95, 1.6 +/- 1.2, and 2.3 +/- 1.2 x 10(6) copies/ml at week 0, 4, 8, and 12, respectively. This was compared with 3.3 +/- 0.83, 0.3 +/- 0.2, 0.03 +/- 0.02, and 0.15 +/- 0.14 x 10(6), respectively, for the interferon and ribavirin group (p < 0.07 at week 8). Two of five patients had undetectable serum HCV RNA during combination therapy. Combination therapy with interferon and ribavirin in prior interferon nonresponders reduces serum HCV RNA levels compared with interferon alone. This may suggest some additional antiviral effect of ribavirin when given with interferon.

The importance of communication in promoting voluntary participation in an experimental trial: A qualitative study based on the assessment of the gamma-interferon test for the diagnosis of bovine tuberculosis in France

PubMed Central

Dufour, Barbara; Praud, Anne

2017-01-01

Understanding the factors leading each stakeholder to participate in an experimental trial is a key element for improving trial set-up and for identifying selection bias in statistical analyses. An experimental protocol, validated by the European Commission, was developed in France to assess the ability of the gamma-interferon test in terms of accuracy to replace the second intradermal skin test in cases of suspected bovine tuberculosis. Implemented between 2013 and 2015, this experimental trial was based on voluntary participation. To determine and understand the motivation or reluctance of farmers to take part in this trial, we carried out a sociological survey in France. Our study was based on semi-structured interviews with the farmers and other stakeholders involved. The analysis of findings demonstrated that shortening the lock-up period during tuberculosis suspicion, following the use of a gamma-interferon test, was an important aim and a genuine challenge for the animal health stakeholders. However, some farmers did not wish to continue the trial because it could potentially have drastic consequences for them. Moreover, misunderstandings and confusion concerning the objectives and consequences of the trial led stakeholders to reject it forcefully. Based on our results, we offer some recommendations: clear and appropriate communication tools should be prepared to explain the protocol and its aims. In addition, these types of animal health trials should be designed with the stakeholders’ interests in mind. This study provides a better understanding of farmer motivations and stakeholder influences on trial participation and outcomes. The findings can be used to help design trials so that they promote participation by farmers and by all animal health stakeholders in general. PMID:28973018

Influence of poly (lactide-co-glycolide) type and gamma irradiation on the betamethasone acetate release from the in situ forming systems.

PubMed

Rafienia, Mohammad; Emami, Shahriar Hojjati; Mirzadeh, Hamid; Mobedi, Hamid; Karbasi, Saeed

2009-04-01

In situ forming biodegradable polymeric systems were prepared from Poly (DL-lactide-co-glycolide), RG504H (50:50, lactide:glycolide), RG756 (75:25) and mixture of them. They were dissolved in N-methyl-2-pyrrolidone (33% w/w) and mixed with betamethasone acetate (BTMA, 5 and 10% w/w) and ethyl heptanoate (5% w/w, as an additive). The effects of gamma irradiation, drug loading, type of polymers and solvent removal were evaluated on release profiles. Scanning electron microscopy (SEM) of RG756 samples loaded by BTMA did not show any degradation until two weeks. Differential scanning calorimeter (DSC) experiments confirmed insignificant decrease in T(g), and consequently release rate. Declining T(g) of RG504H and RG756 after gamma irradiation was about 0.4 and 1.46 degrees C, respectively. High performance liquid chromatography (HPLC) revealed that BTMA release is more rapid from the formulations prepared using the RG504H with lower molecular weight. The formulations prepared by RG756 had lower burst release (2.5-41%) than the samples based on RG504H (60-67%) and mixture of them (30-33%). Regarding this research three different kinds of steriled in situ forming systems were developed which can release BTMA for 24, 90 and 60 days.

Detection of bacterial pyrogens on the basis of their effects on gamma interferon-mediated formation of neopterin or nitrite in cultured monocyte cell lines.

PubMed Central

Werner-Felmayer, G; Baier-Bitterlich, G; Fuchs, D; Hausen, A; Murr, C; Reibnegger, G; Werner, E R; Wachter, H

1995-01-01

In a number of mammalian cell types, pteridine biosynthesis from guanosine 5'-triphosphate and formation of nitric oxide from L-arginine are induced by gamma interferon (IFN-gamma) and bacterial lipopolysaccharide (LPS). We assessed the possibility of using such metabolic alterations for the in vitro detection of pyrogens. Products from gram-negative and gram-positive bacteria and related synthetic compounds were tested for their potential to induce either of these pathways. Stimulation of pteridine biosynthesis was monitored as the formation of neopterin in the human myelomonocytic cell line THP-1. The formation of nitric oxide was determined as nitrite in murine J774A.1 macrophage cultures. The substances tested included toxic and detoxified parts of LPS and lipid A from Escherichia coli, Salmonella typhimurium, Salmonella minnesota, and Klebsiella pneumoniae as well as lipoteichoic acid and toxic shock syndrome toxin 1 from Staphylococcus aureus. Furthermore, two cell wall compounds from Mycobacterium tuberculosis, trehalose 6,6'-dimycolate and N-acetylmuramyl-L-alanyl-D-isoglutamine, which are active components of Freund's adjuvant, were used. When applied as a single stimulus, only the whole LPS molecule potently stimulated neopterin or nitrite formation. Lipid A and products from gram-positive bacteria were weakly active. For neopterin formation, lipid A required the presence of fetal calf serum. Besides detoxified LPS and independently from the presence of serum, all bacterial compounds tested strongly increased the effects mediated by IFN-gamma. Our results show that bacterial pyrogens can be detected by monitoring the formation of neopterin or nitrite. This may provide a basis for the development of an in vitro assay for the detection of pyrogenic contamination with the aim of replacing the currently used animal test. PMID:7664177

[Association between Fok I vitamin D receptor (VDR) gene polymorphism and plasmatic concentrations of transforming growth factor-beta1 and interferon gamma in type 1 diabetes mellitus].

PubMed

López, Tatiana; García, Diego; Angel, Bárbara; Carrasco, Elena; Codner, Ethel; Ugarte, Francisca; Pérez-Bravo, Francisco

2008-02-02

In order to assess whether Fok I vitamin D receptor gene (VDR) polymorphism is involved in the genetic susceptibility of type 1 diabetes, a case-control study was conducted and VDR genotypes were related to serum concentrations of 25(OH) vitamin D and cytokines transforming growth factor beta1 (TGF-beta1) and interferon gamma (INF-gamma). 151 incident cases of type 1 diabetes and 182 non related healthy controls from Santiago were studied for VDR polymorphisms in peripheral blood DNA. Exon 2 (Fok I) segments were amplified by polimerase chain reaction and analyzed by means of restriction fragment length polymorphism to determine each corresponding genotype. Differences for allele, genotype and serological markers as 25(OH) vitamin D, TGF-beta1 and INF-gamma levels distribution between patients and controls were analyzed. Fok I polymorphism distribution analysis showed no differences between patients and controls. Among diabetics, higher levels of TGF-beta1 (median, 282.6 pg/ml; range, 131.8-3,031.4) were observed compared with healthy children (median, 232.2 pg/ml; range, 135.7-506.5) (p < 0.0038). Similar results were observed for INF-gamma concentrations (median, 121.1 pg/ml, and range, 5.3-228.8, in cases, and median, 89.6 pg/ml, and range, 10.9-117.2 in controls) (p < 0.0004). The diabetic carriers of the ff genotype showed low levels of 25(OH) vitamin D compared with the carriers of the F allele: mean (standard deviation), 23.1 (5.9) versus 27.9 (10.3) ng/ml (p < 0.03). A similar result was observed for TGF-beta1 concentrations in diabetic carriers of ff genotype and patients carriers of the F allele (298.5 versus 276.6; p < 0.05). Fok I polymorphism of VDR could have a marginal role in the immunologic disturbance in type 1 diabetes.

Effects of positive results for Mycobacterium avium subsp paratuberculosis as determined by microbial culture of feces or antibody ELISA on results of caudal fold tuberculin test and interferon-gamma assay for tuberculosis in cattle.

PubMed

Dunn, John R; Kaneene, John B; Grooms, Daniel L; Bolin, Steven R; Bolin, Carole A; Bruning-Fann, Colleen S

2005-02-01

To determine whether cattle testing positive for Mycobacterium avium subsp paratuberculosis as determined by microbial culture of feces or antibody ELISA were more likely to have false-positive responses on the caudal fold tuberculin (CFT) test or interferon-gamma (IFN-gamma) assay for Mycobacterium bovis than cattle testing negative for M paratuberculosis. 1043 cattle from 10 herds in Michigan. Feces and blood samples for plasma were collected from cattle > or =24 months old on the day the CFT test was read. Fecal samples were submitted for microbial culture for M paratuberculosis. Plasma samples were tested for antibody against M paratuberculosis, and IFN-gamma after stimulation with purified protein derivative tuberculin from M bovis or M avium. Of 1043 cattle, 180 (17.3%) had positive CFT test results (suspects) and 8 (0.8%) had positive IFN-gamma assay results after stimulation with purified protein derivative tuberculin from M bovis. Forty-five (4.3%) and 115 (11.0%) cattle tested positive for M paratuberculosis as determined by microbial culture of feces and antibody ELISA, respectively. Cattle with positive responses for M paratuberculosis appeared to have an increased likelihood of false-positive results on the CFT test, although this association was not significant. No significant association was detected among cattle testing positive for M paratuberculosis as determined by microbial culture of feces and antibody ELISA and positive CFT test and IFN-gamma assay results for M bovis.

Plasma interferon-gamma-inducible protein-10 (IP-10) levels during acute hepatitis C virus infection

PubMed Central

Grebely, Jason; Feld, Jordan J.; Applegate, Tanya; Matthews, Gail V.; Hellard, Margaret; Sherker, Alana; Petoumenos, Kathy; Zang, Geng; Shaw, Ineke; Yeung, Barbara; George, Jacob; Teutsch, Suzy; Kaldor, John M.; Cherepanov, Vera; Bruneau, Julie; Shoukry, Naglaa H.; Lloyd, Andrew R.; Dore, Gregory J.

2013-01-01

Systemic levels of interferon-gamma-inducible protein-10 (IP-10) are predictive of treatment-induced clearance in chronic HCV. In the present study, factors associated with plasma IP-10 levels at the time of acute HCV detection and the association between IP-10 levels and spontaneous clearance were assessed in three cohorts of acute HCV infection. Among 300 individuals, 245 (181 male, 47 HIV+) were HCV RNA+ at acute HCV detection. In adjusted analysis, factors independently associated with IP-10 levels ≥150 pg/mL (median level) included HCV RNA levels >6 log IU/mL, HIV co-infection and non-Aboriginal ethnicity. Among 245 HCV RNA+ at acute HCV detection, 214 were untreated (n=137) or had persistent infection (infection duration ≥26 weeks) at treatment initiation (n=77). Spontaneous clearance occurred in 14% (29 of 214). Individuals without spontaneous clearance had significantly higher mean plasma IP-10 levels at the time of acute HCV detection than those with clearance (248±32 vs. 142±22 pg/mL, P=0.008). The proportion of individuals with spontaneous clearance was 0% (0 of 22, P=0.048) and 16% (27 of 165) and in those in those with and without plasma IP-10 levels ≥380 pg/mL. In adjusted analyses, favourable IL28B genotype was associated with spontaneous clearance, while higher HCV RNA level was independently associated with lower odds of spontaneous clearance. Conclusion High IP-10 levels at acute HCV detection were associated with failure to spontaneously clear HCV. Patients with acute HCV and high baseline IP-10 levels, particularly >380 pg/mL, should be considered for early therapeutic intervention, and those with low levels should defer therapy for potential spontaneous clearance. PMID:23325615

Glycosaminoglycans mediate retention of the poxvirus type I interferon binding protein at the cell surface to locally block interferon antiviral responses

PubMed Central

Montanuy, Imma; Alejo, Ali; Alcami, Antonio

2011-01-01

Eradication of smallpox was accomplished 30 yr ago, but poxviral infections still represent a public health concern due to the potential release of variola virus or the emergence of zoonotic poxviruses, such as monkeypox virus. A critical determinant of poxvirus virulence is the inhibition of interferons (IFNs) by the virus-encoded type I IFN-binding protein (IFNα/βBP). This immunomodulatory protein is secreted and has the unique property of interacting with the cell surface in order to prevent IFN-mediated antiviral responses. However, the mechanism of its attachment to the cell surface remains unknown. Using surface plasmon resonance and cell-binding assays, we report that the IFNα/βBP from vaccinia virus, the smallpox vaccine, interacts with cell surface glycosaminoglycans (GAGs). Analysis of the contribution of different regions of the protein to cell surface binding demonstrated that clusters of basic residues in the first immunoglobulin domain mediate GAG interactions. Furthermore, mutation of the GAG-interaction motifs does not affect its IFN-binding and -blocking capacity. Functional conservation of GAG-binding sites is demonstrated for the IFNα/βBP from variola and monkeypox viruses, extending our understanding of immune modulation by the most virulent human poxviruses. These results are relevant for the design of improved vaccines and intervention strategies.—Montanuy, I., Alejo, A., Alcami, A. Glycosaminoglycans mediate retention of the poxvirus type I interferon binding protein at the cell surface to locally block interferon antiviral responses. PMID:21372110

No Love Lost Between Viruses and Interferons.

PubMed

Fensterl, Volker; Chattopadhyay, Saurabh; Sen, Ganes C

2015-11-01

The interferon system protects mammals against virus infections. There are several types of interferons, which are characterized by their ability to inhibit virus replication and resultant pathogenesis by triggering both innate and cell-mediated immune responses. Virus infection is sensed by a variety of cellular pattern-recognition receptors and triggers the synthesis of interferons, which are secreted by the infected cells. In uninfected cells, cell surface receptors recognize the secreted interferons and activate intracellular signaling pathways that induce the expression of interferon-stimulated genes; the proteins encoded by these genes inhibit different stages of virus replication. To avoid extinction, almost all viruses have evolved mechanisms to defend themselves against the interferon system. Consequently, a dynamic equilibrium of survival is established between the virus and its host, an equilibrium that can be shifted to the host's favor by the use of exogenous interferon as a therapeutic antiviral agent.

Adenoviral mediated interferon-alpha 2b gene therapy suppresses the pro-angiogenic effect of vascular endothelial growth factor in superficial bladder cancer.

PubMed

Adam, Liana; Black, Peter C; Kassouf, Wassim; Eve, Beryl; McConkey, David; Munsell, Mark F; Benedict, William F; Dinney, Colin P N

2007-05-01

Intravesical adenovirus mediated interferon-alpha gene transfer has a potent therapeutic effect against superficial human bladder carcinoma xenografts growing in the bladder of athymic nude mice. We determined whether the inhibition of angiogenesis might contribute to the antitumor effect. We treated several human urothelial carcinoma cells with adenovirus mediated interferon-alpha 2b and monitored its effects on the production of angiogenic factors using real-time reverse-transcription polymerase chain reaction, Western blotting, and immunohistochemical analysis and a gel shift based transcription factor array. To assess the role of adenovirus mediated interferon 2b in angiogenic activity we used in vitro invasion assays and evaluated the anti-angiogenic effects of adenovirus mediated interferon gene therapy in an orthotopic murine model of human superficial bladder cancer. In adenovirus mediated interferon-alpha infected 253J B-V cells vascular endothelial growth factor was decreased and anti-angiogenic interferon-gamma inducible protein 10 was up-regulated. In contrast, the addition of as much as 100,000 IU recombinant interferon had no apparent effect on vascular endothelial growth factor production. Conditioned medium derived from adenovirus mediated interferon 2b infected 253J B-V cells greatly decreased the invasive potential of human endothelial cells and down-regulated their matrix metalloproteinase 2 expression compared to controls. Furthermore, adenovirus mediated interferon 2b blocked pro-angiogenic nuclear signals, such as the transcription factors activating protein-1 and 2, stimulating protein-1, nuclear factor kappaB and c-myb. In vivo experiments revealed significant vascular endothelial growth factor down-regulation and decreased tumor vessel density in the adenovirus mediated interferon 2b treated group compared to controls. Treatment with adenovirus mediated interferon 2b increases the angiostatic activity of the bladder cancer microenvironment

[Plasma levels of interferon gamma and interleukin 10 in patients with lymphonodular toxoplasmosis].

PubMed

Bielec, D; Patorska-Mach, E; Semczuk, G; Toruń, E

1997-01-01

The concentrations of IFN gamma and IL 10 in plasma of sixteen patients with toxoplasmic lymphadenopathy were measured. These examinations were carried out two times in the interval of a month. We found increased level of IFN gamma and normal concentrations of IL 10 in both of these terms.

Roles of CD4+ T Cells and Gamma Interferon in Protective Immunity against Babesia microti Infection in Mice

PubMed Central

Igarashi, Ikuo; Suzuki, Reiko; Waki, Seiji; Tagawa, Yoh-Ichi; Seng, Seyha; Tum, Sothyra; Omata, Yoshitaka; Saito, Atsushi; Nagasawa, Hideyuki; Iwakura, Yohichiro; Suzuki, Naoyoshi; Mikami, Takeshi; Toyoda, Yutaka

1999-01-01

Babesia microti produces a self-limiting infection in mice, and recovered mice are resistant to reinfection. In the present study, the role of T cells in protective immunity against challenge infection was examined. BALB/c mice which recovered from primary infection showed strong protective immunity against challenge infection. In contrast, nude mice which failed to control the primary infection and were cured with an antibabesial drug did not show protection against challenge infection. Treatment of immune mice with anti-CD4 monoclonal antibody (MAb) diminished the protective immunity against challenge infection, but treatment with anti-CD8 MAb had no effect on the protection. Transfer of CD4+ T-cell-depleted spleen cells resulted in higher parasitemia than transfer of CD8+ T-cell-depleted spleen cells. A high level of gamma interferon (IFN-γ), which was produced by CD4+ T cells, was observed for the culture supernatant of spleen cells from immune mice, and treatment of immune mice with anti-IFN-γ MAb partially reduced the protection. Moreover, no protection against challenge infection was found in IFN-γ-deficient mice. On the other hand, treatment of immune mice with MAbs against interleukin-2 (IL-2), IL-4, or tumor necrosis factor alpha did not affect protective immunity. These results suggest essential requirements for CD4+ T cells and IFN-γ in protective immunity against challenge infection with B. microti. PMID:10417185

The elephant interferon gamma assay: a contribution to diagnosis of tuberculosis in elephants.

PubMed

Angkawanish, T; Morar, D; van Kooten, P; Bontekoning, I; Schreuder, J; Maas, M; Wajjwalku, W; Sirimalaisuwan, A; Michel, A; Tijhaar, E; Rutten, V

2013-11-01

Mycobacterium tuberculosis (M. tb) has been shown to be the main causative agent of tuberculosis in elephants worldwide. M. tb may be transmitted from infected humans to other species including elephants and vice versa, in case of prolonged intensive contact. An accurate diagnostic approach covering all phases of the infection in elephants is required. As M. tb is an intracellular pathogen and cell-mediated immune (CMI) responses are elicited early after infection, the skin test is the CMI assay of choice in humans and cattle. However, this test is not applicable in elephants. The interferon gamma (IFN-γ) assay is considered a good alternative for the skin test in general, validated for use in cattle and humans. This study was aimed at development of an IFN-γ assay applicable for diagnosis of tuberculosis in elephants. Recombinant elephant IFN-γ (rEpIFN-γ) produced in eukaryotic cells was used to immunize mice and generate the monoclonal antibodies. Hybridomas were screened for IFN-γ-specific monoclonal antibody production and subcloned, and antibodies were isotyped and affinity purified. Western blot confirmed recognition of the rEpIFN-γ. The optimal combination of capture and detection antibodies selected was able to detect rEpIFN-γ in concentrations as low as 1 pg/ml. The assay was shown to be able to detect the native elephant IFN-γ, elicited in positive-control cultures (pokeweed mitogen (PWM), phorbol myristate acetate plus ionomycin (PMA/I)) of both Asian and African elephant whole-blood cultures (WBC). Preliminary data were generated using WBC from non-infected elephants, a M. tb infection-suspected elephant and a culture-confirmed M. tb-infected elephant. The latter showed measurable production of IFN-γ after stimulation with ESAT6/CFP10 PPDB and PPDA in concentration ranges as elicited in WBC by Mycobacterium tuberculosis complex (MTBC)-specific antigens in other species. Hence, the IFN-γ assay presented potential as a diagnostic tool for the

[Fish interferon response and its molecular regulation: a review].

PubMed

Zhang, Yibing; Gui, Jianfang

2011-05-01

Interferon response is the first line of host defense against virus infection. Recent years have witnessed tremendous progress in understanding of fish innate response to virus infection, especially in fish interferon antiviral response. A line of fish genes involved in interferon antiviral response have been identified and functional studies further reveal that fish possess an IFN antiviral system similar to mammals. However, fish virus-induced interferon genes contain introns similar to mammalian type III interferon genes although they encode proteins similar to type I interferons, which makes it hard to understand the evolution of vertebrate interferon genes directly resulting in a debate on nomenclature of fish interferon genes. Actually, fish display some unique mechanisms underlying interferon antiviral response. This review documents the recent progress on fish interferon response and its molecular mechanism.

Screening health care workers with interferon-γ release assay versus tuberculin skin test: impact on costs and adherence to testing (the SWITCH study).

PubMed

Wrighton-Smith, Peter; Sneed, Laurie; Humphrey, Frances; Tao, Xuguang; Bernacki, Edward

2012-07-01

To determine the price point at which an interferon-γ release assay (IGRA) is less costly than a tuberculin skin test (TST) for health care employee tuberculosis screening. A multidecision tree-based cost model incorporating inputs gathered from time-motion studies and parallel testing by IGRA and TST was conducted in a subset of our employees. Administering a TST testing program costs $73.20 per person screened, $90.80 per new hire, and $63.42 per annual screen. Use of an IGRA for employee health testing is cost saving at an IGRA test cost of $54.83 or less per test and resulted in higher completion rates because of the elimination of the need for a second visit to interpret the TST. Using an IGRA for employee health screening can be an institutional cost saving and results in higher compliance rates.

Effects of isolation on interferon production and hematological and immunological parameters

NASA Technical Reports Server (NTRS)

Sonnenfeld, G.; Measel, J.; Loken, M. R.; Degioanni, J.; Follini, S.; Galvagno, A.; Montalbini, M.

1992-01-01

A 27-year-old woman was maintained in an isolated state for 131 days in Carlsbad Caverns, New Mexico. Her diet was vitamin D-depleted. Determinations on the effects of such isolation on levels and activities of peripheral blood cells that are important for hematological homeostasis and immunological function were carried out. Throughout the duration of the study, the percentage of lymphoid cells that expressed CD3, CD4, CD8, CD19, Leu 8, and other markers remained relatively constant although the absolute numbers of these cells varied. Although the percentage of natural killer (NK) cells did not vary, the activity of these cells did change. NK cell activity became elevated as the isolation study progressed. Production of interferon-gamma (IFN-gamma) in response to mitogen stimulation was higher than expected throughout the isolation periods, but returned to the normal range after termination of the isolation. Red and white cell counts dropped significantly upon entering isolation, but soon returned to normal.

Human macrophage gamma interferon decreases gene expression but not replication of Mycobacterium tuberculosis: analysis of the host-pathogen reciprocal influence on transcription in a comparison of strains H37Rv and CMT97.

PubMed

Cappelli, G; Volpe, P; Sanduzzi, A; Sacchi, A; Colizzi, V; Mariani, F

2001-12-01

Mycobacterium tuberculosis is an intracellular pathogen that readily survives and replicates in human macrophages (MPhi). Host cells have developed different mycobactericidal mechanisms, including the production of inflammatory cytokines. The aim of this study was to compare the MPhi response, in terms of cytokine gene expression, to infection with the M. tuberculosis laboratory strain H37Rv and the clinical M. tuberculosis isolate CMT97. Both strains induce the production of interleukin-12 (IL-12) and IL-16 at comparable levels. However, the clinical isolate induces a significantly higher and more prolonged MPhi activation, as shown by reverse transcription-PCR analysis of IL-1beta, IL-6, IL-10, transforming growth factor beta, tumor necrosis factor alpha, and gamma interferon (IFN-gamma) transcripts. Interestingly, when IFN-gamma transcription is high, the number of M. tuberculosis genes expressed decreases and vice versa, whereas no mycobactericidal effect was observed in terms of bacterial growth. Expression of 11 genes was also studied in the two M. tuberculosis strains by infecting resting or activated MPhi and compared to bacterial intracellular survival. In both cases, a peculiar inverse correlation between expression of these genes and multiplication was observed. The number and type of genes expressed by the two strains differed significantly.

Gastrin-Releasing Peptide (GRP) in the Ovine Uterus: Regulation by Interferon Tau and Progesterone1

PubMed Central

Song, Gwonhwa; Satterfield, M. Carey; Kim, Jinyoung; Bazer, Fuller W.; Spencer, Thomas E.

2008-01-01

Gastrin-releasing peptide (GRP) is abundantly expressed by endometrial glands of the ovine uterus and processed into different bioactive peptides, including GRP1-27, GRP18-27, and a C-terminus, that affect cell proliferation and migration. However, little information is available concerning the hormonal regulation of endometrial GRP and expression of GRP receptors in the ovine endometrium and conceptus. These studies determined the effects of pregnancy, progesterone (P4), interferon tau (IFNT), placental lactogen (CSH1), and growth hormone (GH) on expression of GRP in the endometrium and GRP receptors (GRPR, NMBR, BRS3) in the endometrium, conceptus, and placenta. In pregnant ewes, GRP mRNA and protein were first detected predominantly in endometrial glands after Day 10 and were abundant from Days 18 through 120 of gestation. Treatment with IFNT and progesterone but not CSH1 or GH stimulated GRP expression in the endometrial glands. Western blot analyses identified proGRP in uterine luminal fluid and allantoic fluid from Day 80 unilateral pregnant ewes but not in uterine luminal fluid of either cyclic or early pregnant ewes. GRPR mRNA was very low in the Day 18 conceptus and undetectable in the endometrium and placenta; NMBR and BRS3 mRNAs were undetectable in ovine uteroplacental tissues. Collectively, the present studies validate GRP as a novel IFNT-stimulated gene in the glands of the ovine uterus, revealed that IFNT induction of GRP is dependent on P4, and found that exposure of the ovine uterus to P4 for 20 days induces GRP expression in endometrial glands. PMID:18448839

Interaction with extracellular matrix proteins influences Lsh/Ity/Bcg (candidate Nramp) gene regulation of macrophage priming/activation for tumour necrosis factor-alpha and nitrite release.

PubMed

Formica, S; Roach, T I; Blackwell, J M

1994-05-01

The murine resistance gene Lsh/Ity/Bcg regulates activation of macrophages for tumour necrosis factor-alpha (TNF-alpha)-dependent production of nitric oxide mediating antimicrobial activity against Leishmania, Salmonella and Mycobacterium. As Lsh is differentially expressed in macrophages from different tissue sites, experiments were performed to determine whether interaction with extracellular matrix (ECM) proteins would influence the macrophage TNF-alpha response. Plating of bone marrow-derived macrophages onto purified fibrinogen or fibronectin-rich L929 cell-derived matrices, but not onto mannan, was itself sufficient to stimulate TNF-alpha release, with significantly higher levels released from congenic B10.L-Lshr compared to C57BL/10ScSn (Lshs) macrophages. Only macrophages plated onto fibrinogen also released measurable levels of nitrites, again higher in Lshr compared to Lshs macrophages. Addition of interferon-gamma (IFN-gamma), but not bacterial lipopolysaccharide or mycobacterial lipoarabinomannan, as a second signal enhanced the TNF-alpha and nitrite responses of macrophages plated onto fibrinogen, particularly in the Lshr macrophages. Interaction with fibrinogen and fibronectin also primed macrophages for an enhanced TNF-alpha response to leishmanial parasites, but this was only translated into enhanced nitrite responses in the presence of IFN-gamma. In these experiments, Lshr macrophages remained superior in their TNF-alpha responses throughout, but to a degree which reflected the magnitude of the difference observed on ECM alone. Hence, the specificity for the enhanced TNF-alpha responses of Lshr macrophages lay in their interaction with fibrinogen and fibronectin ECM, while a differential nitrite response was only observed with fibrinogen and/or IFN-gamma. The results are discussed in relation to the possible function of the recently cloned candidate gene Nramp, which has structural identity to eukaryote transporters and an N-terminal cytoplasmic

Controlling nuclear JAKs and STATs for specific gene activation by IFN{gamma}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Noon-Song, Ezra N.; Ahmed, Chulbul M.; Dabelic, Rea

2011-07-08

Highlights: {yields} Gamma interferon (IFN{gamma}) and its receptor subunit, IFNGR1, interact with the promoter region of IFN{gamma}-associated genes along with transcription factor STAT1{alpha}. {yields} We show that activated Janus kinases pJAK2 and pJAK1 also associate with IFNGR1 in the nucleus. {yields} The activated Janus kinases are responsible for phosphorylation of tyrosine 41 on histone H3, an important epigenetic event for specific gene activation. -- Abstract: We previously showed that gamma interferon (IFN{gamma}) and its receptor subunit, IFNGR1, interacted with the promoter region of IFN{gamma}-activated genes along with transcription factor STAT1{alpha}. Recent studies have suggested that activated Janus kinases pJAK2 andmore » pJAK1 also played a role in gene activation by phosphorylation of histone H3 on tyrosine 41. This study addresses the question of the role of activated JAKs in specific gene activation by IFN{gamma}. We carried out chromatin immunoprecipitation (ChIP) followed by PCR in IFN{gamma} treated WISH cells and showed association of pJAK1, pJAK2, IFNGR1, and STAT1 on the same DNA sequence of the IRF-1 gene promoter. The {beta}-actin gene, which is not activated by IFN{gamma}, did not show this association. The movement of activated JAK to the nucleus and the IRF-1 promoter was confirmed by the combination of nuclear fractionation, confocal microscopy and DNA precipitation analysis using the biotinylated GAS promoter. Activated JAKs in the nucleus was associated with phosphorylated tyrosine 41 on histone H3 in the region of the GAS promoter. Unphosphorylated JAK2 was found to be constitutively present in the nucleus and was capable of undergoing activation in IFN{gamma} treated cells, most likely via nuclear IFNGR1. Association of pJAK2 and IFNGR1 with histone H3 in IFN{gamma} treated cells was demonstrated by histone H3 immunoprecipitation. Unphosphorylated STAT1 protein was associated with histone H3 of untreated cells. IFN{gamma

Combination alpha-interferon and lamivudine therapy for alpha-interferon-resistant chronic hepatitis B infection: results of a pilot study.

PubMed

Mutimer, D; Naoumov, N; Honkoop, P; Marinos, G; Ahmed, M; de Man, R; McPhillips, P; Johnson, M; Williams, R; Elias, E; Schalm, S

1998-06-01

Alpha-interferon achieves seroconversion in about one third of naive patients. Attempts to achieve seroconversion in patients who have previously failed alpha-interferon have proved disappointing. Combination chemotherapy (alpha-interferon with a nucleoside analogue) might provide a treatment alternative for these patients. We have undertaken a phase 2 study in 20 patients who had previously failed at least one course of alpha-interferon. The study was designed to assess the safety, tolerability and efficacy of the combination. All patients were treated for 16 weeks with alpha-interferon in combination with 12 or 16 weeks of Lamivudine (3'TC). Patients were followed for 16 weeks post-treatment. Pharmacokinetic studies were performed to identify/exclude significant pharmacokinetic drug interaction. The combination was well tolerated, and side-effects of the combination were indistinguishable from the recognised side-effects of alpha-interferon. Pharmacokinetic studies performed on days 1 and 29 did not show any significant interaction. All patients achieved HBV DNA clearance during treatment, but 19 relapsed at the end of treatment. HBeAg/anti-HBe seroconversion was observed for four patients, but was sustained for a single patient (who also had sustained DNA clearance). Combination therapy with alpha-interferon and lamivudine given for 16 weeks appears safe and is well tolerated. However, for this group of patients who had previously failed interferon monotherapy, the efficacy of combination interferon/lamivudine therapy appears disappointing, and other treatment strategies should be investigated.

Cost-effectiveness of interferon-γ release assay versus chest X-ray for tuberculosis screening of employees.

PubMed

Kowada, Akiko

2011-12-01

Currently, an annual chest X-ray examination (CXR) for detection of active tuberculosis (TB) in employees aged ≥40 years is recommended in the guidelines of the Japan Industrial Safety and Health Law. Interferon-γ release assays are new alternatives to the tuberculin skin test for detecting Mycobacterium tuberculosis infection, with higher specificity than the tuberculin skin test and without cross-reactivity with the Bacille Calmette-Guérin vaccine. This study aimed to assess the cost-effectiveness of employee TB screening using QuantiFERON-TB Gold In-Tube (QFT) versus CXR. Markov models were constructed. The target population was a hypothetical cohort of immunocompetent 40-year-old individuals, using a societal perspective and a lifetime horizon. All costs and clinical benefits were discounted at a fixed annual rate of 3%. In a base-case analysis, the QFT strategy was the most cost-effective ($US 262.84; 22.87049 quality-adjusted life-years [QALYs]) compared with no screening ($448.38; 22.85452 QALYs) and CXR ($543.50; 22.85453 QALYs) [year 2009 values]. The QFT strategy is currently robust for screening Bacille Calmette-Guérin- vaccinated employees in Japan. There appears to be little role for CXR. These findings may be applicable to other countries in terms of choosing optimal TB screening for employees. Copyright © 2011 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Mosby, Inc. All rights reserved.

A randomized phase II trial comparing two different sequence combinations of autologous vaccine and human recombinant interferon gamma and human recombinant interferon alpha2B therapy in patients with metastatic renal cell carcinoma: clinical outcome and analysis of immunological parameters.

PubMed

Schwaab, T; Heaney, J A; Schned, A R; Harris, R D; Cole, B F; Noelle, R J; Phillips, D M; Stempkowski, L; Ernstoff, M S

2000-04-01

The clinical observation of spontaneous regression in patients with renal cell carcinoma (RCC) and the response to various immunotherapeutic therapies strongly suggest a role for the host immune system in this disease. Prior studies showed that sequential administration of interferon (IFN) gamma and IFN alpha to RCC patients was safe. Clinical responses as well as immune changes in the peripheral blood mononuclear cell compartment were observed. Autologous tumor cell vaccines (AV) have also demonstrated activity in renal cell carcinoma. We hypothesize that the addition of AV to sequential IFN gamma and a therapy might improve the tumor-specific immune response by providing an appropriate source of antigen in the appropriate cytokine environment. To our knowledge, this is the first trial using AV combined with IFN alpha and IFN gamma. The purpose of this study was to evaluate the feasibility of manufacturing and administering (AV) from resected tumor samples, and administration of AV with combination IFN gamma and IFN alpha therapy. Finally, the impact on immunological parameters of these treatment options was assessed. Patients with metastatic RCC were randomly assigned to receive AV plus bCG along with a sequential administration of IFN gamma and a either together or after initiation of vaccine. Toxicity and clinical responses were evaluated. Modulations of the immune system were investigated by analyzing phenotype, cytokine mRNA expression, T cell proliferation and cytotoxicity in the peripheral blood mononuclear cell compartment. Fourteen patients with metastatic renal cell carcinoma were enrolled in this study; 9 were available for response evaluation. In a 70 day period, 3 (33%) showed mixed responses, 5 (56%) stable disease and 1 (11%) progression of disease. Toxicities were consistent with previous clinical reports. In the flow-cytometry phenotype analysis, stimulation of distinct subsets of circulating T-lymphocytes and a decrease of CD8+ T cell subsets was

Perforin and gamma interferon expression are required for CD4+ and CD8+ T-cell-dependent protective immunity against a human parasite, Trypanosoma cruzi, elicited by heterologous plasmid DNA prime-recombinant adenovirus 5 boost vaccination.

PubMed

de Alencar, Bruna C G; Persechini, Pedro M; Haolla, Filipe A; de Oliveira, Gabriel; Silverio, Jaline C; Lannes-Vieira, Joseli; Machado, Alexandre V; Gazzinelli, Ricardo T; Bruna-Romero, Oscar; Rodrigues, Mauricio M

2009-10-01

A heterologous prime-boost strategy using plasmid DNA, followed by replication-defective recombinant adenovirus 5, is being proposed as a powerful way to elicit CD4(+) and CD8(+) T-cell-mediated protective immunity against intracellular pathogens. We confirmed this concept and furthered existing research by providing evidence that the heterologous prime-boost regimen using the gene encoding amastigote surface protein 2 elicited CD4(+) and CD8(+) T-cell-mediated protective immunity (reduction of acute parasitemia and prolonged survival) against experimental infection with Trypanosoma cruzi. Protective immunity correlated with the presence of in vivo antigen-specific cytotoxic activity prior to challenge. Based on this, our second goal was to determine the outcome of infection after heterologous prime-boost immunization of perforin-deficient mice. These mice were highly susceptible to infection. A detailed analysis of the cell-mediated immune responses in immunized perforin-deficient mice showed an impaired gamma interferon (IFN-gamma) secretion by immune spleen cells upon restimulation in vitro with soluble recombinant antigen. In spite of a normal numeric expansion, specific CD8(+) T cells presented several functional defects detected in vivo (cytotoxicity) and in vitro (simultaneous expression of CD107a/IFN-gamma or IFN-gamma/tumor necrosis factor alpha) paralleled by a decreased expression of CD44 and KLRG-1. Our final goal was to determine the importance of IFN-gamma in the presence of highly cytotoxic T cells. Vaccinated IFN-gamma-deficient mice developed highly cytotoxic cells but failed to develop any protective immunity. Our study thus demonstrated a role for perforin and IFN-gamma in a number of T-cell-mediated effector functions and in the antiparasitic immunity generated by a heterologous plasmid DNA prime-adenovirus boost vaccination strategy.

Genetic and environmental determinants of interferon-tau secretion by in vivo- and in vitro-derived bovine blastocysts.

PubMed

Kubisch, H M; Larson, M A; Ealy, A D; Murphy, C N; Roberts, R M

2001-04-30

Several experiments were conducted to assess the effects of genotype and various culture media on interferon-tau secretion by in vitro-derived bovine blastocysts and to compare these values with interferon released by blastocysts flushed from superovulated cows. In experiment 1, oocytes were inseminated with semen from three different bulls. While paternal genotype had no effect on cleavage rate, the size or hatching ability of blastocysts, it was a significant determinant of the embryo's ability to develop to the blastocyst stage and of subsequent interferon-tau secretion. In the second experiment, embryos were cultured in synthetic oviductal fluid containing either polyvinyl alcohol, bovine serum albumin or fetal bovine serum. While there was no effect of supplement on the percentage of embryos developing to the blastocyst stage, blastocysts which formed in medium with polyvinyl alcohol had significantly fewer cells, were older at blastocyst formation and produced significantly more interferon-tau. In the third experiment, embryos were cultured to the blastocyst stage in either TCM199 alone or in co-culture with buffalo rat liver, bovine oviductal or bovine uterine epithelial cells. Culture with oviductal or buffalo rat liver cells increased blastocyst cell number, although secretion of interferon-tau was not affected. In the final experiment, bovine blastocysts were flushed from superovulated cows on Day 7 following insemination. Overall, secretion of interferon-tau by in vivo-produced blastocysts did not differ from that of age-matched blastocysts produced in vitro.

Interferon gamma peptidomimetic targeted to hepatic stellate cells ameliorates acute and chronic liver fibrosis in vivo.

PubMed

Bansal, Ruchi; Prakash, Jai; De Ruiter, Marieke; Poelstra, Klaas

2014-04-10

Hepatic stellate cells play a crucial role in the pathogenesis of hepatic fibrosis. Thus, pharmacological inhibition of pro-fibrotic activities of these cells might lead to an effective therapy for this disease. Among the potent anti-fibrotics, interferon gamma (IFNγ), a proinflammatory cytokine, is highly efficacious but it failed in clinical trials due to the poor efficacy and multiple adverse effects attributed to the ubiquitous IFNγ receptor (IFNγR) expression. To resolve these drawbacks, we chemically synthesized a chimeric molecule containing (a) IFNγ signaling peptide (IFNγ peptidomimetic, mimγ) that retains the agonistic activities of IFNγ but lacks an extracellular receptor recognition sequence for IFNγR; coupled via heterobifunctional PEG linker to (b) bicyclic platelet derived growth factor beta receptor (PDGFβR)-binding peptide (BiPPB) to induce internalization into the stellate cells that express PDGFβR. The synthesized targeted IFNγ peptidomimetic (mimγ-BiPPB) was extensively investigated for its anti-fibrotic and adverse effects in acute and chronic CCl4-induced liver fibrosis models in mice. Treatment with mimγ-BiPPB, after the onset of disease, markedly inhibited both early and established hepatic fibrosis as reflected by a reduced intrahepatic α-SMA, desmin and collagen-I mRNA expression and protein levels. While untargeted mimγ and BiPPB had no effect, and native IFNγ only induced a moderate reduction. Additionally, no off-target effects, e.g. systemic inflammation, were found with mimγ-BiPPB, which were substantially observed in mice treated with native IFNγ. The present study highlights the beneficial effects of a novel BiPPB mediated cell-specific targeting of IFNγ peptidomimetic to the disease-inducing cells and therefore represents a highly potential therapeutic approach to treat fibrotic diseases. Copyright © 2014 Elsevier B.V. All rights reserved.

Effects of type I/type II interferons and transforming growth factor-beta on B-cell differentiation and proliferation. Definition of costimulation and cytokine requirements for immunoglobulin synthesis and expression.

PubMed

Estes, D M; Tuo, W; Brown, W C; Goin, J

1998-12-01

In this report, we sought to determine the role of selected type I interferons [interferon-alpha (IFN-alpha) and interferon-tau (IFN-tau)], IFN-gamma and transforming growth factor-beta (TGF-beta) in the regulation of bovine antibody responses. B cells were stimulated via CD40 in the presence or absence of B-cell receptor (BCR) cross-linking. IFN-alpha enhanced IgM, IgG2 and IgA responses but did not enhance IgG1 responses. BCR signalling alone was more effective at inducing IgG2 responses with IFN-alpha than dual cross-linking with CD40. Recombinant ovine IFN-tau was less effective at inducing IgG2 responses when compared with IFN-alpha, though IgA responses were similar in magnitude following BCR cross-linking. At higher concentrations, IFN-tau enhanced IgA responses greater than twofold over the levels observed with IFN-alpha. Previous studies have shown that addition of IFN-gamma to BCR or pokeweed mitogen-activated bovine B cells stimulates IgG2 production. However, following CD40 stimulation alone, IFN-gamma was relatively ineffective at stimulating high-rate synthesis of any non-IgM isotype. Dual cross-linking via CD40 and the BCR resulted in decreased synthesis of IgM with a concomitant increase in IgA and similar levels of IgG2 production to those obtained via the BCR alone. We also assessed the effects of endogenous and exogenous TGF-beta on immunoglobulin synthesis by bovine B cells. Exogenous TGF-beta stimulates both IgG2 and IgA production following CD40 and BCR cross-linking in the presence of IL-2. Blocking endogenous TGF-beta did not inhibit the up-regulation of IgG2 or IgA by interferons.

[The expression of interferon-lambda1 in CHO cell].

PubMed

Yuan, Wu-Mei; Ma, Fen-Lian; Zhang, Qian; Zheng, Wen-Zhi; Zheng, Li-Shu

2013-06-01

To construct the eukaryotic expression vector PCI-dhfr-lambda1 and PCI-dhfr-SP163-lambda1 which linked the enhancer SP163 with interferon lambda1. Then express the interferon lambda1 in CHO (dhfr-) cells. Using PCR method to introduce the restriction enzyme sites and through the fusion PCR binding the enhancer with the interferon Lambda1. After sequenced, lambda1 and SP163-lambda1 was inserted into PCI-dhfr forming the expression vector PCI-dhfr-lambda1 and PCI-dhfr-SP163-lambda1 which was constructed successfully confirming by sequencing. Then the expressing vectors were transfected into CHO (dhfr-) cells using liposome transfection method and interferon lambda1 protein was assayed with indirect immunofluorescence and Western Blot. Using cytopathic effect inhibition evaluated the antiviral activity of interferon lambda1. Successfully constructing the eukaryotic expression vectors of interferon lambda and the vectors could express interferon lambda1. The result of immunofluorescence showed the enhancer developed the expression of interferon lambda1. Detecting the interferon lambda1 in CHO (dhfr-) cells after transfecting 48 hour using Western Blot. The cytopathic effect inhibition showed the expressed interferon lambda1 has the antiviral activity. Successfully expressed the interferon lambda1 in CHO (dhfr-) cells and the protein possesses antiviral activity, which may supply a valuable basis for building the stable cell line of interferon lambda1.

Pegylated interferons Lambda-1a and alfa-2a display different gene induction and cytokine and chemokine release profiles in whole blood, human hepatocytes and peripheral blood mononuclear cells.

PubMed

Freeman, J; Baglino, S; Friborg, J; Kraft, Z; Gray, T; Hill, M; McPhee, F; Hillson, J; Lopez-Talavera, J C; Wind-Rotolo, M

2014-06-01

Pegylated interferon-lambda-1a (Lambda), a type III interferon (IFN) in clinical development for the treatment of chronic HCV infection, has shown comparable efficacy and an improved safety profile to a regimen based on pegylated IFN alfa-2a (alfa). To establish a mechanistic context for this improved profile, we investigated the ex vivo effects of Lambda and alfa on cytokine and chemokine release, and on expression of IFN-stimulated genes (ISGs) in primary human hepatocytes and peripheral blood mononuclear cells (PBMCs) from healthy subjects. Our findings were further compared with changes observed in blood analysed from HCV-infected patients treated with Lambda or alfa in clinical studies. mRNA transcript and protein expression of the IFN-λ-limiting receptor subunit was lower compared with IFN-α receptor subunits in all cell types. Upon stimulation, alfa and Lambda induced ISG expression in hepatocytes and PBMCs, although in PBMCs Lambda-induced ISG expression was modest. Furthermore, alfa and Lambda induced release of cytokines and chemokines from hepatocytes and PBMCs, although differences in their kinetics of induction were observed. In HCV-infected patients, alfa treatment induced ISG expression in whole blood after single and repeat dosing. Lambda treatment induced modest ISG expression after single dosing and showed no induction after repeat dosing. Alfa and Lambda treatment increased IP-10, iTAC, IL-6, MCP-1 and MIP-1β levels in serum, with alfa inducing higher levels of all mediators compared with Lambda. Overall, ex vivo and in vivo induction profiles reported in this analysis strongly correlate with clinical observations of fewer related adverse events for Lambda vs those typically associated with alfa. © 2014 John Wiley & Sons Ltd.

Analyzing the Utilization of Interferon-Gamma Screening for Tuberculosis at Recruit Training Command, Great Lakes

DTIC Science & Technology

2006-05-31

the project through a business case analysis conducted on this same subject. CAPT Monestersky, Preventive Medicine; LCDR Jacobs, Occupational Medicine...TB and LTBI (Taylor, Nolan, & Blumberg , Interferon-y screening for TB 8 2005). They are based on science founded in the 1 9 th century. The current...identify individuals who may not be suitable for service. For the majority who are suitable, the "P" days allow time to complete necessary business

Beyond Tryptophan Synthase: Identification of Genes That Contribute to Chlamydia trachomatis Survival during Gamma Interferon-Induced Persistence and Reactivation

PubMed Central

Muramatsu, Matthew K.; Brothwell, Julie A.; Stein, Barry D.; Putman, Timothy E.; Rockey, Daniel D.

2016-01-01

Chlamydia trachomatis can enter a viable but nonculturable state in vitro termed persistence. A common feature of C. trachomatis persistence models is that reticulate bodies fail to divide and make few infectious progeny until the persistence-inducing stressor is removed. One model of persistence that has relevance to human disease involves tryptophan limitation mediated by the host enzyme indoleamine 2,3-dioxygenase, which converts l-tryptophan to N-formylkynurenine. Genital C. trachomatis strains can counter tryptophan limitation because they encode a tryptophan-synthesizing enzyme. Tryptophan synthase is the only enzyme that has been confirmed to play a role in interferon gamma (IFN-γ)-induced persistence, although profound changes in chlamydial physiology and gene expression occur in the presence of persistence-inducing stressors. Thus, we screened a population of mutagenized C. trachomatis strains for mutants that failed to reactivate from IFN-γ-induced persistence. Six mutants were identified, and the mutations linked to the persistence phenotype in three of these were successfully mapped. One mutant had a missense mutation in tryptophan synthase; however, this mutant behaved differently from previously described synthase null mutants. Two hypothetical genes of unknown function, ctl0225 and ctl0694, were also identified and may be involved in amino acid transport and DNA damage repair, respectively. Our results indicate that C. trachomatis utilizes functionally diverse genes to mediate survival during and reactivation from persistence in HeLa cells. PMID:27430273

Regulation of the substance P-induced contraction via the release of acetylcholine and gamma-aminobutyric acid in the guinea-pig urinary bladder.

PubMed Central

Shirakawa, J.; Nakanishi, T.; Taniyama, K.; Kamidono, S.; Tanaka, C.

1989-01-01

1. The action of substance P (SP) on the release of gamma-aminobutyric acid (GABA) and acetylcholine (ACh) and on contraction were studied in strips of the guinea-pig urinary bladder. Substance P induced a dose-dependent contraction of strips of guinea-pig urinary bladder (EC50 = 1.2 x 10(-9) M). This contraction was not altered by tetrodotoxin, but with a dose of 10(-9) M and less, there was a complete inhibition by 10(-6) M) atropine. Contractions initiated by 3 x 10(-9) M) SP or more were partly inhibited by atropine. The EC50 value of substance P in the presence of atropine was 7.0 x 10(-9) M. 2. Substance P induced a Ca2+-dependent and tetrodotoxin-resistant release of [3H]-acetylcholine (ACh) from strips of urinary bladder preloaded with [3H]-choline (EC50 = 4.9 x 10(-10) M), and this release was antagonized by [D-Pro2,D-Trp7,9] substance P. 3. Bicuculline increased the substance P-induced contraction and the release of [3H]-ACh from the strips. 4. Substance P induced a Ca2+-dependent and tetrodotoxin-sensitive release of [3H]-gamma-aminobutyric acid (GABA) from strips preloaded with [3H]-GABA (EC50 = 2.6 x 10(-9) M), and this release was antagonized by [D-Pro2,D-Trp7,9] substance P. 5. Therefore, substance P appears to exert excitatory effects on the contractility of urinary bladder predominantly by stimulating its own receptor located on the cholinergic nerve terminals. GABA released by substance P inhibits stimulation of the cholinergic neurone. However, the direct action of substance P on the cholinergic neurone is more potent that the indirect action via GABA release. PMID:2479440

Essential Cell-Autonomous Role for Interferon (IFN) Regulatory Factor 1 in IFN-γ-Mediated Inhibition of Norovirus Replication in Macrophages

PubMed Central

Maloney, Nicole S.; Thackray, Larissa B.; Goel, Gautam; Hwang, Seungmin; Duan, Erning; Vachharajani, Punit; Xavier, Ramnik

2012-01-01

Noroviruses (NVs) cause the majority of cases of epidemic nonbacterial gastroenteritis worldwide and contribute to endemic enteric disease. However, the molecular mechanisms responsible for immune control of their replication are not completely understood. Here we report that the transcription factor interferon regulatory factor 1 (IRF-1) is required for control of murine NV (MNV) replication and pathogenesis in vivo. This led us to studies documenting a cell-autonomous role for IRF-1 in gamma interferon (IFN-γ)-mediated inhibition of MNV replication in primary macrophages. This role of IRF-1 in the inhibition of MNV replication by IFN-γ is independent of IFN-αβ signaling. While the signal transducer and activator of transcription STAT-1 was also required for IFN-γ-mediated inhibition of MNV replication in vitro, class II transactivator (CIITA), interferon regulatory factor 3 (IRF-3), and interferon regulatory factor 7 (IRF-7) were not required. We therefore hypothesized that there must be a subset of IFN-stimulated genes (ISGs) regulated by IFN-γ in a manner dependent only on STAT-1 and IRF-1. Analysis of transcriptional profiles of macrophages lacking various transcription factors confirmed this hypothesis. These studies identify a key role for IRF-1 in IFN-γ-dependent control of norovirus infection in mice and macrophages. PMID:22973039

Vpu-Mediated Counteraction of Tetherin Is a Major Determinant of HIV-1 Interferon Resistance

PubMed Central

Kmiec, Dorota; Iyer, Shilpa S.; Stürzel, Christina M.; Sauter, Daniel; Hahn, Beatrice H.

2016-01-01

ABSTRACT Human immunodeficiency virus type 1 (HIV-1) groups M, N, O, and P are the result of independent zoonotic transmissions of simian immunodeficiency viruses (SIVs) infecting great apes in Africa. Among these, only Vpu proteins of pandemic HIV-1 group M strains evolved potent activity against the restriction factor tetherin, which inhibits virus release from infected cells. Thus, effective Vpu-mediated tetherin antagonism may have been a prerequisite for the global spread of HIV-1. To determine whether this particular function enhances primary HIV-1 replication and interferon resistance, we introduced mutations into the vpu genes of HIV-1 group M and N strains to specifically disrupt their ability to antagonize tetherin, but not other Vpu functions, such as degradation of CD4, down-modulation of CD1d and NTB-A, and suppression of NF-κB activity. Lack of particular human-specific adaptations reduced the ability of HIV-1 group M Vpu proteins to enhance virus production and release from primary CD4+ T cells at high levels of type I interferon (IFN) from about 5-fold to 2-fold. Interestingly, transmitted founder HIV-1 strains exhibited higher virion release capacity than chronic control HIV-1 strains irrespective of Vpu function, and group M viruses produced higher levels of cell-free virions than an N group HIV-1 strain. Thus, efficient virus release from infected cells seems to play an important role in the spread of HIV-1 in the human population and requires a fully functional Vpu protein that counteracts human tetherin. PMID:27531907

Human B cells fail to secrete type I interferons upon cytoplasmic DNA exposure.

PubMed

Gram, Anna M; Sun, Chenglong; Landman, Sanne L; Oosenbrug, Timo; Koppejan, Hester J; Kwakkenbos, Mark J; Hoeben, Rob C; Paludan, Søren R; Ressing, Maaike E

2017-11-01

Most cells are believed to be capable of producing type I interferons (IFN I) as part of an innate immune response against, for instance, viral infections. In macrophages, IFN I is potently induced upon cytoplasmic exposure to foreign nucleic acids. Infection of these cells with herpesviruses leads to triggering of the DNA sensors interferon-inducible protein 16 (IFI16) and cyclic GMP-AMP (cGAMP) synthase (cGAS). Thereby, the stimulator of interferon genes (STING) and the downstream molecules TANK-binding kinase 1 (TBK1) and interferon regulatory factor 3 (IRF3) are sequentially activated culminating in IFN I secretion. Human gamma-herpesviruses, such as Epstein-Barr virus (EBV), exploit B cells as a reservoir for persistent infection. In this study, we investigated whether human B cells, similar to macrophages, engage the cytoplasmic DNA sensing pathway to induce an innate immune response. We found that the B cells fail to secrete IFN I upon cytoplasmic DNA exposure, although they express the DNA sensors cGAS and IFI16 and the signaling components TBK1 and IRF3. In primary human B lymphocytes and EBV-negative B cell lines, this deficiency is explained by a lack of detectable levels of the central adaptor protein STING. In contrast, EBV-transformed B cell lines did express STING, yet both these lines as well as STING-reconstituted EBV-negative B cells did not produce IFN I upon dsDNA or cGAMP stimulation. Our combined data show that the cytoplasmic DNA sensing pathway is dysfunctional in human B cells. This exemplifies that certain cell types cannot induce IFN I in response to cytoplasmic DNA exposure providing a potential niche for viral persistence. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

In vivo induction of interferon gamma expression in grey horses with metastatic melanoma resulting from direct injection of plasmid DNA coding for equine interleukin 12.

PubMed

Müller, J-M V; Wissemann, J; Meli, M L; Dasen, G; Lutz, H; Heinzerling, L; Feige, K

2011-11-01

Whole blood pharmacokinetics of intratumourally injected naked plasmid DNA coding for equine Interleukin 12 (IL-12) was assessed as a means of in vivo gene transfer in the treatment of melanoma in grey horses. The expression of induced interferon gamma (IFN-g) was evaluated in order to determine the pharmacodynamic properties of in vivo gene transduction. Seven grey horses bearing melanoma were injected intratumourally with 250 µg naked plasmid DNA coding for IL-12. Peripheral blood and biopsies from the injection site were taken at 13 time points until day 14 post injection (p.i.). Samples were analysed using quantitative real-time PCR. Plasmid DNA was quantified in blood samples and mRNA expression for IFN-g in tissue samples. Plasmid DNA showed fast elimination kinetics with more than 99 % of the plasmid disappearing within 36 hours. IFN-g expression increased quickly after IL-12 plasmid injection, but varied between individual horses. Intratumoural injection of plasmid DNA is a feasible method for inducing transgene expression in vivo. Biological activity of the transgene IL-12 was confirmed by measuring expression of IFN-g.

Human Dental Pulp Stem Cells Suppress Alloantigen-induced Immunity by Stimulating T Cells to Release Transforming Growth Factor Beta.

PubMed

Kwack, Kyu Hwan; Lee, Jung Min; Park, Sang Hyuk; Lee, Hyeon Woo

2017-01-01

Human dental pulp stem cells (hDPSCs) are ideal candidates for regenerating damaged dental tissue. To examine the possibility that hDPSCs may be used to regenerate pulp, we tested their in vitro effects on acute allogeneic immune responses. A peripheral blood mononuclear cell (PBMC) proliferation assay and immunoglobulin (Ig) production assay were performed to evaluate the immunosuppressive properties of hDPSCs. The mixed lymphocyte reaction was suppressed by incubation with hDPSCs. Transforming growth factor beta (TGF-β) was the major soluble factor responsible for inhibiting the allogeneic proliferation of PBMCs. The production of IgM and IgG by allogeneic activation of responder B lymphocytes was also completely abrogated by TGF-β released from hDPSCs via interferon gamma in response to activation of the responder T lymphocytes. hDPSCs inhibit acute allogeneic immune responses by their release of TGF-β as a result of allogeneic stimulation of T lymphocytes. This study provides an insight into the potential clinical use of hDPSCs for allogeneic transplantation. Copyright © 2016 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

C-Reactive Protein (CRP), Interferon Gamma-Inducible Protein 10 (IP-10), and Lipopolysaccharide (LPS) Are Associated with Risk of Tuberculosis after Initiation of Antiretroviral Therapy in Resource-Limited Settings

PubMed Central

Tenforde, Mark W.; Gupte, Nikhil; Dowdy, David W.; Asmuth, David M.; Balagopal, Ashwin; Pollard, Richard B.; Sugandhavesa, Patcharaphan; Lama, Javier R.; Pillay, Sandy; Cardoso, Sandra W.; Pawar, Jyoti; Santos, Breno; Riviere, Cynthia; Mwelase, Noluthando; Kanyama, Cecilia; Kumwenda, Johnstone; Hakim, James G.; Kumarasamy, Nagalingeswaran; Bollinger, Robert; Semba, Richard D.; Campbell, Thomas B.; Gupta, Amita

2015-01-01

Objective The association between pre-antiretroviral (ART) inflammation and immune activation and risk for incident tuberculosis (TB) after ART initiation among adults is uncertain. Design Nested case-control study (n = 332) within ACTG PEARLS trial of three ART regimens among 1571 HIV-infected, treatment-naïve adults in 9 countries. We compared cases (participants with incident TB diagnosed by 96 weeks) to a random sample of controls (participants who did not develop TB, stratified by country and treatment arm). Methods We measured pre-ART C-reactive protein (CRP), EndoCab IgM, ferritin, interferon gamma (IFN-γ), interleukin 6 (IL-6), interferon gamma-inducible protein 10 (IP-10), lipopolysaccharide (LPS), soluble CD14 (sCD14), tumor necrosis factor alpha (TNF-α), and CD4/DR+/38+ and CD8/DR+/38+ T cells. Markers were defined according to established cutoff definitions when available, 75th percentile of measured values when not, and detectable versus undetectable for LPS. Using logistic regression, we measured associations between biomarkers and incident TB, adjusting for age, sex, study site, treatment arm, baseline CD4 and log10 viral load. We assessed the discriminatory value of biomarkers using receiver operating characteristic (ROC) analysis. Results Seventy-seven persons (4.9%) developed incident TB during follow-up. Elevated baseline CRP (aOR 3.25, 95% CI: 1.55–6.81) and IP-10 (aOR 1.89, 95% CI: 1.05–3.39), detectable plasma LPS (aOR 2.39, 95% CI: 1.13–5.06), and the established TB risk factors anemia and hypoalbuminemia were independently associated with incident TB. In ROC analysis, CRP, albumin, and LPS improved discrimination only modestly for TB risk when added to baseline routine patient characteristics including CD4 count, body mass index, and prior TB. Conclusion Incident TB occurs commonly after ART initiation. Although associated with higher post-ART TB risk, baseline CRP, IP-10, and LPS add limited value to routine patient characteristics

Directional gamma detector

DOEpatents

LeVert, Francis E.; Cox, Samson A.

1981-01-01

An improved directional gamma radiation detector has a collector sandwiched etween two layers of insulation of varying thicknesses. The collector and insulation layers are contained within an evacuated casing, or emitter, which releases electrons upon exposure to gamma radiation. Delayed electrons and electrons entering the collector at oblique angles are attenuated as they pass through the insulation layers on route to the collector.

Gene expression and production of tumor necrosis factor alpha, interleukin 1, interleukin 6, and gamma interferon in C3H/HeN and C57BL/6N mice in acute Mycoplasma pulmonis disease.

PubMed Central

Faulkner, C B; Simecka, J W; Davidson, M K; Davis, J K; Schoeb, T R; Lindsey, J R; Everson, M P

1995-01-01

Studies were conducted to determine whether the production of various cytokines is associated with Mycoplasma pulmonis disease expression. Susceptible C3H/HeN and resistant C57BL/6N mice were inoculated intranasally with 10(7) CFU of virulent M. pulmonis UAB CT or avirulent M. pulmonis UAB T. Expression of genes for tumor necrosis factor alpha (TNF-alpha), interleukin 1 alpha (IL-1 alpha), IL-1 beta, IL-6, and gamma interferon (IFN-gamma) in whole lung tissue and TNF-alpha gene expression in bronchoalveolar lavage (BAL) cells was determined by reverse transcription-PCR using specific cytokine primers at various times postinoculation. In addition, concentrations of TNF-alpha, IL-1, IL-6, and IFN-gamma were determined in BAL fluid and serum samples at various times postinoculation. Our results showed that there was a sequential appearance of cytokines in the lungs of infected mice: TNF-alpha, produced primarily by BAL cells, appeared first, followed by IL-1 and IL-6, which were followed by IFN-gamma. Susceptible C3H/HeN mice had higher and more persistent concentrations of TNF-alpha and IL-6 in BAL fluid than did resistant C57BL/6N mice, indicating that TNF-alpha and possibly IL-6 are important factors in pathogenesis of acute M. pulmonis disease in mice. Serum concentrations of IL-6 were elevated in C3H/HeN mice, but not C57BL/6N mice, following infection with M. pulmonis, suggesting that IL-6 has both local and systemic effects in M. pulmonis disease. PMID:7558323

Interferon-gamma increased epithelial barrier function via upregulating claudin-7 expression in human submandibular gland duct epithelium.

PubMed

Abe, Ayumi; Takano, Kenichi; Kojima, Takashi; Nomura, Kazuaki; Kakuki, Takuya; Kaneko, Yakuto; Yamamoto, Motohisa; Takahashi, Hiroki; Himi, Tetsuo

2016-06-01

Tight junctions (TJs) are necessary for salivary gland function and may serve as indicators of salivary gland epithelial dysfunction. IgG4-related disease (IgG4-RD) is a newly recognized fibro-inflammatory condition which disrupts the TJ associated epithelial barrier. The salivary glands are one of the most frequently involved organs in IgG4-RD, however, changes of the TJ associated epithelial barrier in salivary gland duct epithelium is poorly understood. Here, we investigated the regulation and function of TJs in human submandibular gland ductal epithelial cells (HSDECs) in normal and IgG4-RD. We examined submandibular gland (SMG) tissue from eight control individuals and 22 patients with IgG4-RD and established an HSDEC culture system. Immunohistochemistry, immunocytochemistry, western blotting, and measurement of transepithelial electrical resistance (TER) were performed. Claudin-4, claudin-7, occludin, and JAM-A were expressed at the apical side of the duct epithelium in submandibular gland (SMG) tissue and at the cell borders in HSDECs of normal and IgG4-RD. The expression and distribution of TJs in SMG tissue were not different in control individuals and patients with IgG4-RD in vivo and in vitro. Although interferon-gamma (IFNγ) generally disrupts the integrity and function of TJs, as manifested by decreased epithelial barrier function, IFNγ markedly increased the epithelial barrier function of HSDECs via upregulation of claudin-7 expression in HSDECs from patients with IgG4-RD. This is the first report showing an IFNγ-dependent increase in epithelial barrier function in the salivary gland duct epithelium. Our results provide insights into the functional significance of TJs in salivary gland duct epithelium in physiological and pathological conditions, including IgG4-RD.

Gamma-amino butyric acid (GABA) release in the ciliated protozoon Paramecium occurs by neuronal-like exocytosis.

PubMed

Ramoino, P; Milanese, M; Candiani, S; Diaspro, A; Fato, M; Usai, C; Bonanno, G

2010-04-01

Paramecium primaurelia expresses a significant amount of gamma-amino butyric acid (GABA). Paramecia possess both glutamate decarboxylase (GAD)-like and vesicular GABA transporter (vGAT)-like proteins, indicating the ability to synthesize GABA from glutamate and to transport GABA into vesicles. Using antibodies raised against mammalian GAD and vGAT, bands with an apparent molecular weight of about 67 kDa and 57 kDa were detected. The presence of these bands indicated a similarity between the proteins in Paramecium and in mammals. VAMP, syntaxin and SNAP, putative proteins of the release machinery that form the so-called SNARE complex, are present in Paramecium. Most VAMP, syntaxin and SNAP fluorescence is localized in spots that vary in size and density and are primarily distributed near the plasma membrane. Antibodies raised against mammal VAMP-3, sintaxin-1 or SNAP-25 revealed protein immunoblot bands having molecular weights consistent with those observed in mammals. Moreover, P. primaurelia spontaneously releases GABA into the environment, and this neurotransmitter release significantly increases after membrane depolarization. The depolarization-induced GABA release was strongly reduced not only in the absence of extracellular Ca(2+) but also by pre-incubation with bafilomycin A1 or with botulinum toxin C1 serotype. It can be concluded that GABA occurs in Paramecium, where it is probably stored in vesicles capable of fusion with the cell membrane; accordingly, GABA can be released from Paramecium by stimulus-induced, neuronal-like exocytotic mechanisms.

Interferon-gamma +874 T/A and interleukin-10 -1082 A/G single nucleotide polymorphism in Egyptian children with tuberculosis.

PubMed

Mosaad, Y M; Soliman, O E; Tawhid, Z E; Sherif, D M

2010-10-01

The aim was to investigate the association of interferon-gamma (IFN-γ) +874 T/A and interleukin-10 (IL-10)-1082 A/G single nucleotide polymorphisms with tuberculous infection and post-BCG lymphadenitis in Egyptian children. IFN-γ +874 T/A and IL-10 -1082 A/G polymorphism detection by amplification refractory mutation system technique was carried out for 110 patients with TB, 40 patients with post-BCG lymphadenitis and 118 healthy controls. IFN-γ +874 A allele was higher in TB and post-BCG patients than those in healthy controls (Pc=0.006 and 0.002, respectively). IFN-γ +874 genotype AA was significantly higher in patients with TB than that in control (Pc=0.015), in extrapulmonary than patients with pulmonary TB (PTB) (Pc=0.009), and young children with TB below 5 years (Pc=0.024). No statistically significant differences were observed between patients with TB and controls for the frequency of IL-10(-1082) alleles or genotypes (P>0.05); however, a statistically significant difference in the frequency of IL-10 (-1082) GG genotype was found between patients with pulmonary and extrapulmonary TB (Pc=0.003). Low producer IFN-γ +874 A/A genotype is associated with post-BCG lymphadenitis and TB disease especially in younger children below 5 years. IL-10-1082 G/G genotype did not exhibit significant association except for increased GG frequency in PTB. Both cytokine polymorphisms have no relation to tuberculin reaction in patients with TB. © 2010 The Authors. Scandinavian Journal of Immunology © 2010 Blackwell Publishing Ltd.

CXCR6 promotes atherosclerosis by supporting T-cell homing, interferon-gamma production, and macrophage accumulation in the aortic wall.

PubMed

Galkina, Elena; Harry, Brian L; Ludwig, Andreas; Liehn, Elisa A; Sanders, John M; Bruce, Anthony; Weber, Christian; Ley, Klaus

2007-10-16

T lymphocytes are thought to be important in atherosclerosis, but very little is known about the mechanisms of lymphocyte recruitment into atherosclerosis-prone aortas. In this study we tested the hypothesis that CXCR6, a chemokine receptor that is expressed on a subset of CD4+ T helper 1 cells and natural killer T cells, is involved in lymphocyte homing into the aortic wall and modulates the development and progression of atherosclerosis. To investigate the role of CXCR6 in the development and progression of atherosclerosis, we bred CXCR6-deficient (CXCR6(GFP/GFP)) mice with apolipoprotein E-deficient (ApoE(-/-)) mice. We found that CXCR6(GFP/GFP)/ApoE(-/-) mice fed a Western diet for 17 weeks or a chow diet for 56 weeks had decreased atherosclerosis compared with ApoE(-/-) controls. Flow cytometry analysis of the aortas from CXCR6(GFP/GFP)/ApoE(-/-) mice showed that the reduction of atherosclerosis was accompanied by a decreased percentage of CXCR6+ T cells within the aortas. Short-term homing experiments demonstrated that CXCR6 is involved in the recruitment of CXCR6+ leukocytes into the atherosclerosis-prone aortic wall. The reduced percentage of CXCR6+ T cells within the aortas resulted in significantly diminished production of interferon-gamma and reduction of CD11b+/CD68+ macrophages in the aorta. These data provide evidence for a proatherosclerotic role of CXCR6. Absence of CXCR6 alters the recruitment of CXCR6+ leukocytes and modulates the local immune response within the aortic wall.

Secretion of Interferon gamma (IFNγ) from Human Immune Cells is Altered by Exposure to Tributyltin (TBT) and Dibutyltin (DBT)

PubMed Central

Lawrence, Shanieek; Reid, Jacqueline; Whalen, Margaret

2013-01-01

Tributyltin (TBT) and dibutyltin (DBT) are widespread environmental contaminants found in food, beverages, and human blood samples. Both of these butyltins (BTs) interfere with the ability of human natural killer (NK) cells to lyse target cells and also alter secretion of the pro-inflammatory cytokine tumor necrosis factor alpha (TNFα) from human immune cells in vitro. The capacity of BTs to interfere with secretion of other pro-inflammatory cytokines has not been examined. Interferon gamma (IFNγ) is a modulator of adaptive and innate immune responses, playing an important role in overall immune competence. This study shows that both TBT and DBT alter secretion of IFNγ from human immune cells. Peripheral blood cell preparations that were increasingly reconstituted were used to determine if exposures to either TBT or DBT affected IFNγ secretion and how the makeup of the cell preparation influenced that effect. IFNγ secretion was examined after 24 h, 48 h and 6 day exposures to TBT (200- 2.5 nM) and DBT (5- 0.05 μM) in highly enriched human NK cells, a monocyte-depleted preparation of PBMCs, and monocyte-containing PBMCs. Both BTs altered IFNγ secretion from NK cells at most of the conditions tested (either increasing or decreasing secretion). However, there was significant variability among donors as to the concentrations and time points that showed changes as well as the baseline secretion of IFNγ. The majority of donors showed an increase in IFNγ secretion in response to at least one concentration of TBT or DBT at a minimum of one length of exposure. PMID:24357260

Identification of the low affinity receptor for immunoglobulin E on mouse mast cells and macrophages as Fc gamma RII and Fc gamma RIII.

PubMed

Takizawa, F; Adamczewski, M; Kinet, J P

1992-08-01

In addition to their well characterized high affinity immunoglobulin E (IgE) receptors (Fc epsilon RI) mast cells have long been suspected to express undefined Fc receptors capable of binding IgE with low affinity. In this paper, we show that Fc gamma RII and Fc gamma RIII, but not Mac-2, on mouse mast cells and macrophages bind IgE-immune complexes. This binding is efficiently competed by 2.4G2, a monoclonal antibody against the extracellular homologous region of both Fc gamma RII and Fc gamma RIII. Furthermore, IgE-immune complexes bind specifically to Fc gamma RII or Fc gamma RIII transfected into COS-7 cells. The association constants of IgE binding estimated from competition experiments are about 3.1 x 10(5) M-1 for Fc gamma RII, and 4.8 x 10(5) M-1 for Fc gamma RIII. Engagement of Fc gamma RII and Fc gamma RIII with IgE-immune complexes (after blocking access to Fc epsilon RI) or with IgG-immune complexes triggers C57.1 mouse mast cells to release serotonin. This release is inhibited by 2.4G2, and at maximum, reaches 30-40% of the intracellular content, about half of the maximal release (60-80%) obtained after Fc epsilon RI engagement. These data demonstrate that mouse Fc gamma RII and Fc gamma RIII are not isotype specific, and that the binding of IgE-immune complexes to these receptors induces cell activation.

Evasion of interferon responses by Ebola and Marburg viruses.

PubMed

Basler, Christopher F; Amarasinghe, Gaya K

2009-09-01

The filoviruses, Ebola virus (EBOV) and Marburg virus (MARV), cause frequently lethal viral hemorrhagic fever. These infections induce potent cytokine production, yet these host responses fail to prevent systemic virus replication. Consistent with this, filoviruses have been found to encode proteins VP35 and VP24 that block host interferon (IFN)-alpha/beta production and inhibit signaling downstream of the IFN-alpha/beta and the IFN-gamma receptors, respectively. VP35, which is a component of the viral nucleocapsid complex and plays an essential role in viral RNA synthesis, acts as a pseudosubstrate for the cellular kinases IKK-epsilon and TBK-1, which phosphorylate and activate interferon regulatory factor 3 (IRF-3) and interferon regulatory factor 7 (IRF-7). VP35 also promotes SUMOylation of IRF-7, repressing IFN gene transcription. In addition, VP35 is a dsRNA-binding protein, and mutations that disrupt dsRNA binding impair VP35 IFN-antagonist activity while leaving its RNA replication functions intact. The phenotypes of recombinant EBOV bearing mutant VP35s unable to inhibit IFN-alpha/beta demonstrate that VP35 IFN-antagonist activity is critical for full virulence of these lethal pathogens. The structure of the VP35 dsRNA-binding domain, which has recently become available, is expected to provide insight into how VP35 IFN-antagonist and dsRNA-binding functions are related. The EBOV VP24 protein inhibits IFN signaling through an interaction with select host cell karyopherin-alpha proteins, preventing the nuclear import of otherwise activated STAT1. It remains to be determined to what extent VP24 may also modulate the nuclear import of other host cell factors and to what extent this may influence the outcome of infection. Notably, the Marburg virus VP24 protein does not detectably block STAT1 nuclear import, and, unlike EBOV, MARV infection inhibits STAT1 and STAT2 phosphorylation. Thus, despite their similarities, there are fundamental differences by which

[Interferon alpha-2b modified with polyethylene glycol].

PubMed

Wu, Yingxin; Zhai, Yanqin; Lei, Jiandu; Ma, Guanghui; Su, Zhiguo

2008-09-01

In order to obtain a more stable PEGylated interferon alpha-2b, and prolong its half life, interferon alpha-2b (IFN alpha-2b) was modified with monomethoxy polyethylene glycol propionaldehyde (mPEG-ALD) 20000. It was found that the optimized reaction condition for the maximum bioactivity and highest PEGylation degree of the mono PEGylated interferon alpha-2b was as follows: in 20 mmol/L, pH 6.5, citric acid and sodium dihydrogen phosphate buffer, the concentration of IFN alpha-2b was 4 mg/mL, and the molar ratio of PEG/IFN alpha-2b was 8:1, and the reaction time was 20 h at 4 degrees C. Under the optimized reaction condition, the mono PEGylation degree reached to 55%. Ion exchange chromatography was used to separate and purify mono PEGylated interferon alpha-2b from the reaction mixture. The purity of mono PEGylated interferon alpha-2b was higher than 97% characterized by HPLC. The bioactivity of the mono PEGylated interferon alpha-2b was 13.4% of the native IFN alpha-2b, while its half life in SD rat is much longer than the native IFN alpha-2b. The mono PEGylated interferon alpha-2b is also stable in aqueous.

Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice

PubMed Central

Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.

2001-01-01

Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339

Features of Postoperative Immune Suppression Are Reversible With Interferon Gamma and Independent of Interleukin-6 Pathways.

PubMed

Longbottom, E Rebecca; Torrance, Hew D T; Owen, Helen C; Fragkou, Paraskevi C; Hinds, Charles J; Pearse, Rupert M; O'Dwyer, Michael J

2016-08-01

The aim of this study was to evaluate the role of interleukin (IL)-6 pathways in postoperative immune suppression and to assess the reversibility of this phenomenon. The postoperative period is characterized by increased IL-6 production and features of immune suppression. In vitro, IL-6 mediates anti-inflammatory effects through inhibition of interferon gamma (IFN-γ) pathways. The significance of the immunomodulatory effects of IL-6 in the clinical setting of postoperative immune suppression remains unclear. Patients over 45 years old undergoing elective surgery, involving the gastrointestinal tract, were recruited. IL-6 levels were assayed using an enzyme linked immunosorbent assay preoperatively, and at 24 and 48 hours. Peripheral blood mononuclear cells from healthy volunteers were cultured in perioperative serum and CD14Human Leukocyte Antigen-DR (HLA-DR) [monocyte HLA-DR (mHLA-DR)] geometric mean florescent intensity was measured in the presence and absence of IL-6 neutralizing antibody and recombinant IFN-γ. Of the 108 patients, 41 developed a postoperative infection. The IL-6 levels increased 19-fold from the preoperative sample to 24 hours postoperatively (P < 0.0001). Higher IL-6 levels at 24 (P = 0.0002) and 48 hours (P = 0.003) were associated with subsequent postoperative infectious complications. mHLA-DR mean florescent intensity fell when healthy peripheral blood mononuclear cells were cultured with postoperative serum compared with preoperative serum (P = 0.008). This decrease was prevented by the presence of IFN-γ in the culture media, but not by the presence of IL-6-neutralizing antibody. IL-6 levels increase after a major surgery and are associated with an increased susceptibility to postoperative infections. Serum obtained from postoperative patients induces an immunosuppressive response, reflected in reduced mHLA-DR levels, mediated through IL-6 independent pathways and is reversible with IFN-γ. These data may have

Continuous in vivo infusion of interferon-gamma (IFN-γ) enhances engraftment of syngeneic wild-type cells in Fanca–/– and Fancg–/– mice

PubMed Central

Si, Yue; Ciccone, Samantha; Yang, Feng-Chun; Yuan, Jin; Zeng, Daisy; Chen, Shi; van de Vrugt, Henri J.; Critser, John; Arwert, Fre; Haneline, Laura S.; Clapp, D. Wade

2006-01-01

Fanconi anemia (FA) is a heterogeneous genetic disorder characterized by bone marrow (BM) failure and cancer susceptibility. Identification of the cDNAs of FA complementation types allows the potential of using gene transfer technology to introduce functional cDNAs as transgenes into autologous stem cells and provide a cure for the BM failure in FA patients. However, strategies to enhance the mobilization, transduction, and engraftment of exogenous stem cells are required to optimize efficacy prior to widespread clinical use. Hypersensitivity of Fancc–/– cells to interferon-gamma (IFN-γ), a nongenotoxic immune-regulatory cytokine, enhances engraftment of syngeneic wild-type (WT) cells in Fancc–/– mice. However, whether this phenotype is of broad relevance in other FA complementation groups is unresolved. Here we show that primitive and mature myeloid progenitors in Fanca–/– and Fancg–/– mice are hypersensitive to IFN-γ and that in vivo infusion of IFN-γ at clinically relevant concentrations was sufficient to allow consistent long-term engraftment of isogenic WT repopulating stem cells. Given that FANCA, FANCC, and FANCG complementation groups account for more than 90% of all FA patients, these data provide evidence that IFN-γ conditioning may be a useful nongenotoxic strategy for myelopreparation in FA patients. PMID:16946306

Interferon-based treatment of chronic hepatitis C.

PubMed

Souvignet, Claude; Lejeune, Olivier; Trepo, Christian

2007-01-01

The treatment of patients with chronic hepatitis C has rapidly evolved in the past 10 years centered on the use of interferon alpha 2 as an antiviral and immunomodulatory agent against hepatitis C virus. Firstly used as a monotherapy associated with a deceiving long-term efficacy, interferon alpha was then combined with ribavirin, a nucleoside analog with large antiviral properties. Combination of both drugs dramatically improved the efficacy of treatment with 50% of patients reaching a sustained viral response, characterized by the final eradication of the virus from the infected individual. Surprisingly, this synergistic effect remains greatly unexplained. The third step consisted in the use of pegylated interferon in order to adapt its pharmacokinetics and to allow a better efficacy with a more tolerable dosing schedule: once weekly subcutaneous injection instead of thrice weekly. Pegylated interferon combined with ribavirin during 24-48 weeks of treatment is the current standard of care with nearly 60% of sustained virologic response, overall. Development of new forms of interferon alpha are on the way with promising preliminary results.

Stability of human interferon-beta 1: oligomeric human interferon-beta 1 is inactive but is reactivated by monomerization.

PubMed

Utsumi, J; Yamazaki, S; Kawaguchi, K; Kimura, S; Shimizu, H

1989-10-05

Human interferon-beta 1 is extremely stable is a low ionic strength solution of pH 2 such as 10 mM HCl at 37 degrees C. However, the presence of 0.15 M NaCl led to a remarkable loss of antiviral activity. The molecular-sieve high-performance liquid chromatography revealed that, whereas completely active human interferon-beta 1 eluted as a 25 kDa species (monomeric form), the inactivated preparation eluted primarily as a 90 kDa species (oligomeric form). The specific activity (units per mg protein) of the oligomeric form was approx. 10% of that of the monomeric form. This observation shows that oligomeric human interferon-beta 1 is apparently in an inactive form. When the oligomeric eluate was resolved by polyacrylamide gel containing sodium dodecyl sulphate (SDS), it appeared to be monomeric under non-reducing conditions. Monomerization of the oligomeric human interferon-beta 1 by treatment with 1% SDS, fully regenerated its antiviral activity. These results suggest that the inactivation of the human interferon-beta 1 preparation was caused by its oligomerization via hydrophobic interactions without the formation of intermolecular disulphide bonds. These oligomers can be dissociated by SDS to restore biological activity.

Combined therapy with danazol, pegilated interferon, and ribavirin improves thrombocytopenia and liver injury in rats with fibrosis.

PubMed

Alvarez, Guillermo Cabrera; Madrid-Marina, Vicente; Jimenez-Mendez, Ricardo; Buitimea, Angel Leon; Román, Margarita Bahena; Cortez-Gomez, Rudyard; Esparza, Jorge Reyes; Rodríguez-Fragoso, Lourdes

2007-01-01

The aim of this study was to investigate the effects of combinations of pegilated-interferon (PEG-IFN), ribavirin, and danazol on thrombocytopenia and liver injury in rats with fibrosis. Male adult Wistar rats were treated with either mineral oil, danazol (0.83 mg/kg per day), PEG-interferon alpha-2a (PEG-IFN, 0.3 microg/ week) + ribavirin (12 mg/kg per day), PEG-IFN + ribavirin + danazol, CCl(4) (4 g/kg for eight weeks), CCl(4) + PEG-IFN + ribavirin, or CCl(4) + PEG-IFN + ribavirin+ danazol. The following assays were conducted: hematology, clinical chemistry, liver function, liver fibrosis, lymphocyte cytokine mRNA expression, and bone-marrow DNA content. Platelet counts were low in sham-treated animals and animals treated with PEG- IFN + ribavirin (30% and 25% respectively; P < 0.05). PEG-IFN + ribavirin + danazol reduced platelet counts of fibrotic animals by only 9% (P < 0.05). PEG- IFN + ribavirin reduced hepatic collagen content by 50%, whereas danazol + PEG-IFN + ribavirin reduced hepatic collagen content by 60% (P < 0.05). PEG-IFN + ribavirin reduced the total bilirubin concentration by 27%, alanine amino transferase (ALT) activity by 75% and gamma-glutamyl transpeptidase (gamma-GTP) activity by 74% (P < 0.05). In contrast, danazol + PEG-IFN + ribavirin reduced total bilirubin levels by 61%, alkaline phosphatase activity by 45%, ALT activity by 76%, and gamma-GTP activity by 74% (P < 0.05). The only treatment that increased interleukin 10 (IL-10) mRNA in fibrotic rats was PEG-IFN + ribavirin. However, danazol + PEG-IFN + ribavirin reduced the expression of IL-6, IL-10, tumor necrosis factor alpha and transforming growth factor ss. Bone-marrow DNA content was not altered by any treatment. In conclusion, PEG-IFN + ribavirin + danazol could be a new therapeutic option for patients with liver injury, fibrosis, and thrombocytopenia.

Effect of chronic treatment with the GABA transaminase inhibitors gamma-vinyl GABA and ethanolamine O-sulphate on the in vitro GABA release from rat hippocampus.

PubMed

Qume, M; Fowler, L J

1997-10-01

1. The effects of 2, 8 and 21 day oral treatment with the specific gamma-aminobutyric acid transaminase (GABA-T) inhibitors gamma-vinyl GABA (GVG) and ethanolamine O-sulphate (EOS) on brain GABA levels, GABA-T activity, and basal and stimulated GABA release from rat cross-chopped brain hippocampal slices was investigated. 2. Treatment with GABA-T inhibitors lead to a reduction in brain GABA-T activity by 65-80% compared with control values, with a concomitant increase in brain GABA content of 40-100%. 3. Basal hippocampal GABA release was increased to 250-450% of control levels following inhibition of GABA-T activity. No Ca2+ dependence was observed in either control or treated tissues. 4. GVG and EOS administration led to a significant elevation in the potassium stimulated release of GABA from cross-chopped hippocampal slices compared with that of controls. Although stimulated GABA release from control tissues was decreased in the presence of a low Ca2+ medium, GVG and EOS treatment abolished this Ca2+ dependency. 5. GABA compartmentalization, Na+ and Cl- coupled GABA uptake carriers and glial release may provide explanations for the loss of the Ca2+ dependency of stimulated GABA release observed following GVG and EOS treatment. 6. Administration of GABA-T inhibitors led to increases in both basal and stimulated hippocampal GABA release. However, it is not clear which is the most important factor in the anticonvulsant activity of these drugs, the increased GABA content 'leaking' out of neurones and glia leading to widespread inhibition, or the increase in stimulated GABA release which may occur following depolarization caused by an epileptic discharge.

Identification of the low affinity receptor for immunoglobulin E on mouse mast cells and macrophages as Fc gamma RII and Fc gamma RIII

PubMed Central

1992-01-01

In addition to their well characterized high affinity immunoglobulin E (IgE) receptors (Fc epsilon RI) mast cells have long been suspected to express undefined Fc receptors capable of binding IgE with low affinity. In this paper, we show that Fc gamma RII and Fc gamma RIII, but not Mac-2, on mouse mast cells and macrophages bind IgE-immune complexes. This binding is efficiently competed by 2.4G2, a monoclonal antibody against the extracellular homologous region of both Fc gamma RII and Fc gamma RIII. Furthermore, IgE-immune complexes bind specifically to Fc gamma RII or Fc gamma RIII transfected into COS-7 cells. The association constants of IgE binding estimated from competition experiments are about 3.1 x 10(5) M-1 for Fc gamma RII, and 4.8 x 10(5) M-1 for Fc gamma RIII. Engagement of Fc gamma RII and Fc gamma RIII with IgE-immune complexes (after blocking access to Fc epsilon RI) or with IgG-immune complexes triggers C57.1 mouse mast cells to release serotonin. This release is inhibited by 2.4G2, and at maximum, reaches 30-40% of the intracellular content, about half of the maximal release (60-80%) obtained after Fc epsilon RI engagement. These data demonstrate that mouse Fc gamma RII and Fc gamma RIII are not isotype specific, and that the binding of IgE-immune complexes to these receptors induces cell activation. PMID:1386873

Prenatal Dexamethasone and Postnatal High-Fat Diet Decrease Interferon Gamma Production through an Age-Dependent Histone Modification in Male Sprague-Dawley Rats

PubMed Central

Yu, Hong-Ren; Tain, You-Lin; Sheen, Jiunn-Ming; Tiao, Mao-Meng; Chen, Chih-Cheng; Kuo, Ho-Chang; Hung, Pi-Lien; Hsieh, Kai-Sheng; Huang, Li-Tung

2016-01-01

Overexposure to prenatal glucocorticoid (GC) disturbs hypothalamic-pituitary-adrenocortical axis-associated neuroendocrine metabolism and susceptibility to metabolic syndrome. A high-fat (HF) diet is a major environmental factor that can cause metabolic syndrome. We aimed to investigate whether prenatal GC plus a postnatal HF diet could alter immune programming in rat offspring. Pregnant Sprague-Dawley rats were given intraperitoneal injections of dexamethasone or saline at 14–21 days of gestation. Male offspring were then divided into four groups: vehicle, prenatal dexamethasone exposure, postnatal HF diet (VHF), and prenatal dexamethasone exposure plus a postnatal HF diet (DHF). The rats were sacrificed and adaptive immune function was evaluated. Compared to the vehicle, the DHF group had lower interferon gamma (IFN-γ) production by splenocytes at postnatal day 120. Decreases in H3K9 acetylation and H3K36me3 levels at the IFN-γ promoter correlated with decreased IFN-γ production. The impaired IFN-γ production and aberrant site-specific histone modification at the IFN-γ promoter by prenatal dexamethasone treatment plus a postnatal HF diet resulted in resilience at postnatal day 180. Prenatal dexamethasone and a postnatal HF diet decreased IFN-γ production through a site-specific and an age-dependent histone modification. These findings suggest a mechanism by which prenatal exposure to GC and a postnatal environment exert effects on fetal immunity programming. PMID:27669212

Disseminated tuberculosis

MedlinePlus

... lesions Interferon-gamma release blood test, such as the QFT-Gold test to test for prior exposure to TB ... verify that A.D.A.M. follows rigorous standards of quality and accountability. A.D.A.M. is among the first to achieve this important distinction for online ...

Interferon in resistance to bacterial and protozoan infections

NASA Technical Reports Server (NTRS)

Sonnenfeld, Gerald; Gould, Cheryl L.; Kierszenbaum, Felipe; Degee, Antonie L. W.; Mansfield, John M.

1986-01-01

The effects of genetic differences in mouse strains on the modulation of protozoan infections by interferon (IFN) were investigated. In one set of experiments, three different strains of mice were injected with T. cruzi, and their sera were assayed at five time intervals for IFN titer. A greater quantity of IFN was produced by mouse strains that were susceptible to T. cruzi infection than by the more resistant strain. In another set of experiments, spleen cell cultures from inbred strains of mice were challenged with an antigen made from T.b. rhodesiense. The cells from mice resistant to infection, produced greater amounts of IFN-gamma than did cells from the susceptible mice. In a third set of experiments, it was found that mice injected with T.b. rhodesiense before being infected with a diabetogenic virus (EMC-D) were resistant to the effects of the virus and did not produce virus-specific antibody.

Serum profile of cytokines interferon gamma and interleukin-10 in ewes subjected to artificial insemination by cervical retraction.

PubMed

Alvares, C T G; Cruz, J F; Romano, C C; Brandão, F Z

2016-04-15

This study evaluated the influence of artificial insemination (AI) by cervical retraction (CRI) on serum levels of interferon gamma (IFNγ) and interleukin-10 (IL-10) in ewes. Synchronized pluriparous Santa Inês ewes were subjected to natural mating (NM, n = 8) and AI, which was performed for a fixed time (55 ± 1 hour) by CRI (n = 8) or laparoscopy (n = 8). Ewes were classified as pregnant, with return to estrus (RE) or with embryonic loss (EL). Blood samples were collected on Day 0, Day 3, Day 5, Day 12, and Day 17 (Day 0 = AI/NM) for progesterone dosage and cytokines were quantified from Day 0 to Day 12. Progesterone levels were constant, except for a decrease in ewes with RE at Day 17 (P < 0.05). Regardless of the reproductive method used, there was no difference in the IFNγ and IL-10 levels at any time, with averages of 642.1, 713.2, and 741.2 pg/mL for IFNγ and 667.1, 616.8, and 721.1 pg/mL for IL-10 when using CRI, laproscopy, and NM, respectively. Regarding the physiological status, ewes with EL had lower serum levels of IFNγ and IL-10 than pregnant ewes and ewes with RE, regardless of the reproductive method used, with averages of 769.1, 714.9, and 555.7 pg/mL for IFNγ and 713.8, 699.3, and 578.7 pg/mL for IL-10 in pregnant ewes, ewes with RE and EL, respectively (P < 0.01). In conclusion, AI by CRI in Santa Inês ewes does not alter the profile of serum cytokines IFNγ and IL-10 and does not induce an inflammatory reaction that can compromise pregnancy. Copyright © 2016 Elsevier Inc. All rights reserved.

Parasite-mediated upregulation of NK cell-derived gamma interferon protects against severe highly pathogenic H5N1 influenza virus infection.

PubMed

O'Brien, Kevin B; Schultz-Cherry, Stacey; Knoll, Laura J

2011-09-01

Outbreaks of influenza A viruses are associated with significant human morbidity worldwide. Given the increasing resistance to the available influenza drugs, new therapies for the treatment of influenza virus infection are needed. An alternative approach is to identify products that enhance a protective immune response. In these studies, we demonstrate that infecting mice with the Th1-inducing parasite Toxoplasma gondii prior to highly pathogenic avian H5N1 influenza virus infection led to decreased lung viral titers and enhanced survival. A noninfectious fraction of T. gondii soluble antigens (STAg) elicited an immune response similar to that elicited by live parasites, and administration of STAg 2 days after H5N1 influenza virus infection enhanced survival, lowered viral titers, and reduced clinical disease. STAg administration protected H5N1 virus-infected mice lacking lymphocytes, suggesting that while the adaptive immune response was not required for enhanced survival, it was necessary for STAg-mediated viral clearance. Mechanistically, we found that administration of STAg led to increased production of gamma interferon (IFN-γ) from natural killer (NK) cells, which were both necessary and sufficient for survival. Further, administration of exogenous IFN-γ alone enhanced survival from H5N1 influenza virus infection, although not to the same level as STAg treatment. These studies demonstrate that a noninfectious T. gondii extract enhances the protective immune response against severe H5N1 influenza virus infections even when a single dose is administered 2 days postinfection.

Interferon-alpha in the treatment of multiple myeloma.

PubMed

Khoo, Teh Liane; Vangsted, Annette Juul; Joshua, Douglas; Gibson, John

2011-03-01

Interferons are soluble proteins produced naturally by cells in response to viruses. It has both anti-proliferative and immunomodulating properties and is one of the first examples of a biological response modifier use to treat the haematological malignancy multiple myeloma. Interferon has been used in this clinical practice for over thirty years. However, despite considerable efforts, numerous clinical trials and two large meta-analysis, its exact role in the management of multiple myeloma still remains unclear. Its role in the treatment of multiple myeloma has been as a single induction agent, a co-induction agent with other chemotherapy regimens, and as maintenance therapy after conventional chemotherapy or complete remission after autologous or allogeneic transplantation. Interferon as a single induction agent or co-induction agent with other chemotherapy agents appears only to have minimal benefit in myeloma. Its role as maintenance therapy in the plateau phase of myeloma also remains uncertain. More recently, the use of interferon must now compete with the "new drugs"--thalidomide, lenalidomide and bortezomib in myeloma treatment. Will there be a future role of interferon in the treatment of multiple myeloma or will interferon be resigned to the history books remains to be seen.

Escherichia coli K-12 can utilize an exogenous gamma-glutamyl peptide as an amino acid source, for which gamma-glutamyltranspeptidase is essential.

PubMed

Suzuki, H; Hashimoto, W; Kumagai, H

1993-09-01

Escherichia coli K-12 can utilize a gamma-glutamyl peptide as an amino acid source, for which gamma-glutamyltranspeptidase (EC 2.3.2.2) is essential. We suggest that the gamma-glutamyl linkage of a gamma-glutamyl peptide is hydrolyzed by gamma-glutamyltranspeptidase located in the periplasmic space, and the released amino acid is taken up and utilized by E. coli.

Effect of carprofen administration during banding or burdizzo castration of bulls on plasma cortisol, in vitro interferon-gamma production, acute-phase proteins, feed intake, and growth.

PubMed

Pang, W Y; Earley, B; Sweeney, T; Crowe, M A

2006-02-01

The objective of this study was to determine the effect of carprofen (C) administration before banding or burdizzo castration of bulls on cortisol, in vitro interferon-gamma (IFN-gamma) production, acute-phase proteins, feed intake, and growth. Fifty Holstein Friesian bulls (5.5 mo old; 191 +/- 3.7 kg) were blocked by weight and assigned randomly to 1 of 5 treatments (n = 10/treatment): 1) untreated control (2) banding castration at 0 min (Band); 3) Band following an i.v. injection of 1.4 mg/kg of BW of C at -20 min (Band+C); 4) Burdizzo castration at 0 min (Burd); or 5) Burd following 1.4 mg/kg of BW of C at -20 min (Burd+C). Castration acutely increased plasma cortisol concentrations compared with control; no significant differences occurred in peak and interval to peak cortisol responses between Band and Band+C or Burd and Burd+C groups. The administration of C in Band+C reduced (P < 0.05) the cortisol concentration between 6 and 12 h postcastration compared with Band animals. Overall, the integrated cortisol response was greater (P < 0.05) in the castrates than in control, whereas C treatments tended to reduce this response compared with Band (P = 0.08) and Burd (P = 0.07), respectively. Plasma fibrinogen was elevated in Band animals on d 14 and in Burd animals on d 3 and 14. Carprofen administration reduced Band- and Burd-induced fibrinogen production on d 14 and 3, respectively. Plasma haptoglobin was elevated in Band animals on d 3 and 35 compared with control, and C administration was effective in reducing the haptoglobin elevation on d 35 in Band+C compared with Band. There were no differences among treatments in in vitro IFN-gamma production induced by concanavalin A and phytohemagglutinin on d 1 and 2. Overall from d -1 to 16, there were no DMI differences among treatments. From d -1 to 35, there were no ADG differences among treatments. In conclusion, banding and burdizzo castration increased plasma cortisol with no change in in vitro IFN-gamma

Specificity of the Tuberculin Skin Test and the T-SPOT."TB" Assay among Students in a Low-Tuberculosis Incidence Setting

ERIC Educational Resources Information Center

Talbot, Elizabeth A.; Harland, Dawn; Wieland-Alter, Wendy; Burrer, Sherry; Adams, Lisa V.

2012-01-01

Objective: Interferon-[gamma] release assays (IGRAs) are an important tool for detecting latent "Mycobacterium tuberculosis" infection (LTBI). Insufficient data exist about IGRA specificity in college health centers, most of which screen students for LTBI using the tuberculin skin test (TST). Participants: Students at a low-TB incidence college…

Tuberculosis Screening on a Health Science Campus: Use of QuantiFERON-TB Gold Test for Students and Employees

ERIC Educational Resources Information Center

Veeser, Peggy Ingram; Smith, Phillip Karl; Handy, Barry; Martin, Sharon R.

2007-01-01

Detecting and managing "Mycobacterium tuberculosis" (TB) infection in a health-science center population is a clinical dilemma. Tuberculin skin tests are still the preferred method for detecting present or past infection of TB. The authors discuss the performance of whole blood interferon gamma release assay test commercially known as…

Specificity, cross-talk and adaptation in Interferon signaling

NASA Astrophysics Data System (ADS)

Zilman, Anton

Innate immune system is the first line of defense of higher organisms against pathogens. It coordinates the behavior of millions of cells of multiple types, achieved through numerous signaling molecules. This talk focuses on the signaling specificity of a major class of signaling molecules - Type I Interferons - which are also used therapeutically in the treatment of a number of diseases, such as Hepatitis C, multiple sclerosis and some cancers. Puzzlingly, different Interferons act through the same cell surface receptor but have different effects on the target cells. They also exhibit a strange pattern of temporal cross-talk resulting in a serious clinical problem - loss of response to Interferon therapy. We combined mathematical modeling with quantitative experiments to develop a quantitative model of specificity and adaptation in the Interferon signaling pathway. The model resolves several outstanding experimental puzzles and directly affects the clinical use of Type I Interferons in treatment of viral hepatitis and other diseases.

Transfer of interferon alfa into human breast milk.

PubMed

Kumar, A R; Hale, T W; Mock, R E

2000-08-01

Originally assumed to be antiviral substances, the efficacy of interferons in a number of pathologies, including malignancies, multiple sclerosis, and other immune syndromes, is increasingly recognized. This study provides data on the transfer of interferon alfa (2B) into human milk of a patient receiving massive intravenous doses for the treatment of malignant melanoma. Following an intravenous dose of 30 million IU, the amount of interferon transferred into human milk was only slightly elevated (1551 IU/mL) when compared to control milk (1249 IU/mL). These data suggest that even following enormous doses, interferon is probably too large in molecular weight to transfer into human milk in clinically relevant amounts.

Substance P provoked gamma-aminobutyric acid release from the myenteric plexus of the guinea-pig small intestine.

PubMed Central

Tanaka, C; Taniyama, K

1985-01-01

The release of [3H]gamma-aminobutyric acid (GABA) from the isolated small intestine of the guinea-pig pre-loaded with [3H]GABA was measured in the presence of substance P and vasoactive intestinal polypeptide (VIP). Substance P (10(-10)-10(-7) M) produced a dose-dependent increase in the fractional rate of [3H]GABA release. VIP, even at 10(-7) M, did not affect the spontaneous [3H]GABA release nor the release of [3H]GABA evoked by electrical transmural stimulation (0.5 ms, 15 V, 10 Hz for 30 s). The release of endogenous GABA from the isolated small intestine was measured in the presence of substance P (10(-9) M). After 60 min superfusion, the spontaneous release of GABA was 4.61 +/- 0.14 pmol min-1 g-1 wet wt. (n = 20). Substance P (10(-9) M) produced an approximate 2-fold spontaneous release of endogeneous GABA (8.74 +/- 0.21 pmol min-1 g-1 wet wt. (n = 10)). Perfusion with Ca-free medium containing 1 mM-EGTA and tetrodotoxin (3 X 10(-7) M) inhibited the release of endogenous GABA evoked by substance P (10(-9) M). (D-Pro2, D-Trp7,9) substance P (10(-6) M) antagonized the release of endogenous GABA evoked by substance P (10(-9) M). These results indicate that substance P induces a neuronal release of GABA through its receptor located in the guinea-pig small intestine. Substance P (10(-11)-10(-7) M) produced a dose-dependent increase in the fractional rate of [3H]acetylcholine (ACh) release from the isolated small intestine pre-loaded with [3H]choline. The release of [3H]ACh evoked by substance P (10(-9) M) was inhibited by perfusion with Ca-free medium containing 1 mM-EGTA, tetrodotoxin (3 X 10(-7) M) and (D-Pro2, D-Trp7,9)substance P (10(-6) M). Bicuculline (10(-6) M) inhibited the release of [3H]ACh evoked by substance P (10(-9) M) by 68.1 +/- 4.6% (n = 5), thereby suggesting that the substance P-evoked ACh release is partly mediated through the endogenous GABA released by substance P. These results provide evidence for the neurotransmitter role of GABA and a

Differential effects of LPS, IFN-gamma and TNF alpha on the secretion of lysozyme by individual human mononuclear phagocytes: relationship to cell maturity.

PubMed Central

Lewis, C E; McCarthy, S P; Lorenzen, J; McGee, J O

1990-01-01

Human mononuclear phagocytes can be activated to perform a variety of complex functions by exposure to the immunomodulators, lipopolysaccharide (LPS), interferon-gamma (IFN-gamma) and tumour necrosis factor alpha (TNF alpha). Although such activation often involves the release of various cytokines by monocytes and macrophages, little is known of the effects of such signals on their secretion of lysozyme (LZM). In this study, a reverse haemolytic plaque assay for LZM secretion is coupled with immunocytochemistry for the pan macrophage (CD68) marker, EBM/11. This enabled the direct effects of LPS, IFN-gamma and TNF alpha on the secretion of LZM by individual, immunoidentified human mononuclear phagocytes to be investigated. The overall secretion of this peptide by populations of freshly isolated or 3-day cultured monocytes was augmented by exposure for 6 hr to bacterial LPS, recombinant human IFN-gamma or recombinant human TNF alpha. Extension of the culture period for monocytes from 3 to 7 days prior to use in the assay resulted in higher levels of LZM secretion, which could be further increased by TNF alpha but not by LPS or IFN-gamma. Individual peritoneal macrophages activated by inflammation in vivo were uniform in their augmented LZM responses to TNF alpha, but a small subpopulation of human peritoneal macrophages, which may represent younger 'inflammatory' exudate macrophages, was seen to be preferentially responsive to the LZM-stimulating effects of LPS and IFN-gamma. These studies suggest that (i) secretion of LZM by human mononuclear phagocytes can be regulated by LPS and IFN-gamma, although the effects of these agents may be dependent upon the state of maturation and/or differentiation of the cells, and (ii) TNF alpha is a potent stimulant of LZM secretion by monocytes and macrophages irrespective of cell maturity. Images Figure 1 Figure 1 PMID:2107146

Interferon in lyssavirus infection.

PubMed

Rieder, Martina; Finke, Stefan; Conzelmann, Karl-Klaus

2012-01-01

Rabies is a zoonosis still claiming more than 50 000 human deaths per year. Typically, human cases are due to infection with rabies virus, the prototype of the Lyssavirus genus, but sporadic cases of rabies-like encephalitis caused by other lyssaviruses have been reported. In contrast to rabies virus, which has an extremely broad host range including many terrestrial warm-blooded animals, rabies-related viruses are associated predominantly with bats and rarely infect terrestrial species. In spite of a very close genetic relationship of rabies and rabies-related viruses, the factors determining the limited host range of rabies-related viruses are not clear. In the past years the importance of viral countermeasures against the host type I interferon system for establishment of an infection became evident. The rabies virus phosphoprotein (P) has emerged as a critical factor required for paralysing the signalling cascades leading to transcriptional activation of interferon genes as well as interferon signalling pathways, thereby limiting expression of antiviral and immune stimulatory genes. Comparative studies would be of interest in order to determine whether differential abilities of the lyssavirus P proteins contribute to the restricted host range of lyssaviruses.

INF-gamma rearranges membrane topography of MHC-I and ICAM-1 in colon carcinoma cells.

PubMed

Bacsó, Zsolt; Bene, László; Damjanovich, László; Damjanovich, Sándor

2002-01-18

Flow-cytometric fluorescence energy transfer (FCET) measurements between fluorescently labeled cell surface MHC-I and ICAM-1 molecules indicated similar receptor patterns in the plasma membrane of interferon-gamma (INF-gamma)-treated colon carcinoma cells as those observed earlier at the surface of lymphoid cells. INF-gamma activation significantly increased the density of MHC-I and ICAM-1 proteins in the membrane. This increase in receptor density was accompanied by decreased proximity level of the homo-associated MHC-I receptors. Hetero-association of MHC-I and ICAM-1 molecules was increased by INF-gamma treatment. INF-gamma changed neither hetero- nor homo-association of transferrin receptors. By staining the sphingomyelin/cholesterol-enriched lipid microdomains with fluorescently labeled cholera toxin B subunit, we found an increase in the amount of lipid-raft associated G(M1)-gangliosides due to INF-gamma treatment. Confocal microscopic results and FCET measurements show that MHC-I and ICAM-1 are components of G(M1)-ganglioside containing lipid-rafts and also support an increase in the size of these lipid-rafts upon INF-gamma treatment.

Cyclodextrin controlled release of poorly water-soluble drugs from hydrogels.

PubMed

Woldum, Henriette Sie; Larsen, Kim Lambertsen; Madsen, Flemming

2008-01-01

The effect of 2-hydroxypropyl-beta-cyclodextrin and gamma-cyclodextrin on the release of ibuprofen, ketoprofen and prednisolone was studied. Stability constants calculated for inclusion complexes show size dependence for complexes with both cyclodextrins. Hydrogels were prepared by ultraviolet irradiation and release of each model drug was studied. For drugs formulated using cyclodextrins an increase in the achievable concentration and in the release from hydrogels was obtained due to increased solubility, although the solubility of all gamma-cyclodextrin complexes was limited. The load also was increased by adjusting pH for the acidic drugs and this exceeds the increase obtained with gamma-cyclodextrin addition.

Interferon-gamma, macrophages, and virus spread after HSV-1 injection.

PubMed

Cathcart, Heather M; Zheng, Mei; Covar, Jason J; Liu, Yi; Podolsky, Robert; Atherton, Sally S

2011-06-07

After uniocular anterior chamber (AC) injection of HSV-1, the anterior segment of BALB/c mice becomes inflamed and infected; however, virus does not spread from the anterior segment to cause retinitis in the injected eye. The purpose of these studies was to determine whether interferon (IFN-)-γ and Mac-1(+) cells play a role in preventing direct anterior-to-posterior spread of HSV-1 in the injected eye. One AC of adult female BALB/c mice was injected with HSV-1 (KOS). The location of IFN-α, IFN-β, and IFN-γ in the injected eye was determined by immunofluorescence, and mRNA expression was quantified by qPCR. Injected eyes of IFN-γ knockout or clodronate-treated macrophage-depleted mice were examined to determine whether the absence of IFN-γ or Mac-1(+) macrophages affected the sites or timing of virus spread. IFN-α, IFN-β, and IFN-γ were observed in the anterior segment of injected eyes through 72 hours and mRNA levels of IFN-β and IFN-γ were increased in virus-infected eyes 48 to 120 hours after infection. However, the absence of IFN-γ or macrophages did not affect either the sites or the timing of HSV-1 infection in injected eyes. Protection of the retina of the injected eye does not depend on a single cell type or cytokine. In addition, in the eye, as in other sites of the body, there are redundancies in the innate response to virus infection.

Individual and combined tumoricidal effects of dexamethasone and interferons on human leukocyte cell lines.

PubMed

Pan, L Y; Guyre, P M

1988-02-01

We investigated the influence of glucocorticoids on two effects of interferons (IFNs) which are thought to relate to their antitumor actions: cytotoxic activity and induction of HLA antigen expression. We treated human myeloid cell lines (U-937, HL-60, THP-1, K-562, and KG-1a), and T-(MOLT-4) and B- (Daudi) lymphoblastic cell lines with concentrations of IFN-alpha, IFN-gamma, and dexamethasone (Dex) which are commonly achieved in the circulation following therapeutic administration. The results show that for every cell line except Daudi, the greatest inhibition of cell growth occurred when IFN-gamma and Dex treatments were combined. The advantage of combined IFN-gamma and Dex treatment over treatment with either agent alone was most dramatic for the three cell lines (U-937, HL-60, and THP-1) which have monocytoid characteristics. There was also more growth inhibition by the combination of IFN-alpha and Dex than by either agent alone for all seven cell lines tested. The induction of HLA antigen expression by IFN-alpha and IFN-gamma, an effect which could increase recognition of the tumor cells by the immune system, was as great or greater in the presence of Dex as in its absence. These results demonstrate that glucocorticoids do not inhibit, and in some cases enhance, two effects of IFNs that appear to be related to their antitumor actions: inhibition of tumor cell proliferation and enhancement of HLA antigen expression.

Interferon Induced Transfer of Viral Resistance

DTIC Science & Technology

1981-02-01

necseeary and Identify by block number) - Interferon, Cell Communication, Resistance Transfer, Viruses , Antibody Production, Polypeptide Hormones...lymphocytes and the foreign cells, but not mycoplasmas or endogenous viruses , appears to be required for induction. The kinetics of production of leukocyte...interferon by nonsensitized lymphocytes in response to foreign cells is similar to that induced by viruses . We have shown that a component probably of Vie

[Interferons--its method of administration and adverse effect related to pharmacokinetics ].

PubMed

Furue, H

1984-02-01

The potential role of interferons in the treatment of malignant diseases is currently being evaluated. This paper reviews experimental and clinical findings regarding pharmacokinetics, method of administration, and side reactions of interferons. Interferon in the blood is rapidly cleared from the circulation. Intramuscular injection of alpha-interferon causes low but stable interferon levels in the blood. However, in the case of beta-interferon, interferon is never detected consistently in the blood after intramuscular or subcutaneous administration. The studies with animal models suggest that doses higher than those given in current clinical trials will be necessary to obtain clearly beneficial effects in human. The maximum safely tolerated daily dose is appreciably higher than that used in most previous studies, although even at this level, considerable toxicity may be encountered. Adequate method of administration, route, dose and interval are not yet established at all. Exact mechanism of anticancer activity is not yet well defined. The most frequent side reaction is fever. However, the exact mechanism to cause these side reactions is also not yet clarified. Dose limiting central nervous system toxicities, hypotension, hypocalcaemia etc. are occasionally encountered in some instances. Antibody to interferon is demonstrated in some cases. Purification of interferon does not always causes reduction of side reactions. The treatment of cancer cases with interferon has just started and there are many problems to be solved. However, therapeutic beneficial may be achieved in the treatment of malignant tumors by appropriate combinations of interferon with conventional treatment. More laboratory studies as well as carefully controlled clinical observations are warranted.

Allocation of Interferon Gamma mRNA Positive Cells in Caecum Hallmarks a Protective Trait Against Histomonosis.

PubMed

Kidane, Fana Alem; Mitra, Taniya; Wernsdorf, Patricia; Hess, Michael; Liebhart, Dieter

2018-01-01

Histomonosis is a parasitic disease of gallinaceous birds characterized by necrotic lesions in cacum and liver that usually turns fatal in turkeys while it is less severe in chickens. Vaccination using in vitro attenuated Histomonas meleagridis has been experimentally shown to confer protection against histomonosis. The protective mechanisms that underpin the vaccine-induced immune response are not resolved so far. Therefore, the actual study aimed to evaluate the location and quantitative distribution patterns of signature cytokines of type 1 [interferon gamma (IFN-γ)] or type 2 [interleukin (IL)-13] immune responses in vaccinated or infected hosts. An intergroup and interspecies difference in the spatial and temporal distribution patterns of cytokine mRNA positive cells was evident. Quantification of cells showed a significantly decreased percentage of IFN-γ mRNA positive cells at 4 days post-inoculation (DPI) in caeca of turkeys inoculated exclusively with the attenuated or the virulent inocula, compared to control birds. The decrement was followed by a surge of cells expressing mRNA for IFN-γ or IL-13, reaching a peak of increment at 10 DPI. By contrast, turkeys challenged following vaccination showed a slight increment of cecal IFN-γ mRNA positive cells at 4 DPI after which positive cell counts became comparable to control birds. The increase in infected birds was accompanied by an extensive distribution of positively stained cells up to the muscularis layer of cecal tissue whereas the vaccine group maintained an intact mucosal structure. In chickens, the level of changes of positive cells was generally lower compared to turkeys. However, control chickens were found with a higher percentage of IFN-γ mRNA positive cells in cecum compared to their turkey counterparts indicating a higher resistance to histomonosis, similar to the observation in immunized turkeys. In chickens, it could be shown that the changes of cytokine-positive cells were related to

Beta-interferon inhibits cell infection by Trypanosoma cruzi

NASA Technical Reports Server (NTRS)

Kierszenbaum, F.; Sonnenfeld, G.

1984-01-01

Beta interferon has been shown to inhibit the capacity of bloodstream forms of the flagellate Trypanosoma cruzi, the causative agent of Chagas' disease, to associate with and infect mouse peritoneal macrophages and rat heart myoblasts. The inhibitory effect was abrogated in the presence of specific antibodies to the interferon. Pretreatment of the parasites with interferon reduced their infectivity for untreated host cells, whereas pretreament of either type of host cell did not affect the interaction. The effect of interferon on the trypanosomes was reversible; the extent of the inhibitory effect was significantly reduced afer 20 min, and was undetectable after 60 min when macrophages were used as host cells. For the myoblasts, 60 min elapsed before the inhibitory effect began to subside and 120 min elapsed before it became insignificant or undetectable.

Natural Killer Cells and Helicobacter pylori Infection: Bacterial Antigens and Interleukin-12 Act Synergistically To Induce Gamma Interferon Production

PubMed Central

Yun, Cheol H.; Lundgren, Anna; Azem, Josef; Sjöling, Åsa; Holmgren, Jan; Svennerholm, Ann-Mari; Lundin, B. Samuel

2005-01-01

Helicobacter pylori is known to induce a local immune response, which is characterized by activation of lymphocytes and the production of IFN-γ in the stomach mucosa. Since not only T cells, but also natural killer (NK) cells, are potent producers of gamma interferon (IFN-γ), we investigated whether NK cells play a role in the immune response to H. pylori infection. Our results showed that NK cells were present in both the gastric and duodenal mucosae but that H. pylori infection did not affect the infiltration of NK cells into the gastrointestinal area. Furthermore, we could show that NK cells could be activated directly by H. pylori antigens, as H. pylori bacteria, as well as lysate from H. pylori, induced the secretion of IFN-γ by NK cells. NK cells were also activated without direct contact when separated from the bacteria by an epithelial cell layer, indicating that the activation of NK cells by H. pylori can also occur in vivo, in the infected stomach mucosa. Moreover, the production of IFN-γ by NK cells was greatly enhanced when a small amount of interleukin-12 (IL-12) was added, and this synergistic effect was associated with increased expression of the IL-12 receptor β2. It was further evident that bacterial lysate alone was sufficient to induce the activation of cytotoxicity-related molecules. In conclusion, we demonstrated that NK cells are present in the gastroduodenal mucosa of humans and that NK cells produce high levels of IFN-γ when stimulated with a combination of H. pylori antigen and IL-12. We propose that NK cells play an active role in the local immune response to H. pylori infection. PMID:15731046

CD8+ T Cell Exhaustion, Suppressed Gamma Interferon Production, and Delayed Memory Response Induced by Chronic Brucella melitensis Infection

PubMed Central

Durward-Diioia, Marina; Harms, Jerome; Khan, Mike; Hall, Cherisse; Smith, Judith A.

2015-01-01

Brucella melitensis is a well-adapted zoonotic pathogen considered a scourge of mankind since recorded history. In some cases, initial infection leads to chronic and reactivating brucellosis, incurring significant morbidity and economic loss. The mechanism by which B. melitensis subverts adaptive immunological memory is poorly understood. Previous work has shown that Brucella-specific CD8+ T cells express gamma interferon (IFN-γ) and can transition to long-lived memory cells but are not polyfunctional. In this study, chronic infection of mice with B. melitensis led to CD8+ T cell exhaustion, manifested by programmed cell death 1 (PD-1) and lymphocyte activation gene 3 (LAG-3) expression and a lack of IFN-γ production. The B. melitensis-specific CD8+ T cells that produced IFN-γ expressed less IFN-γ per cell than did CD8+ cells from uninfected mice. Both memory precursor (CD8+ LFA1HI CD127HI KLRG1LO) and long-lived memory (CD8+ CD27HI CD127HI KLRG1LO) cells were identified during chronic infection. Interestingly, after adoptive transfer, mice receiving cells from chronically infected animals were able to contain infection more rapidly than recipients of cells from acutely infected or uninfected donors, although the proportions of exhausted CD8+ T cells increased after adoptive transfer in both challenged and unchallenged recipients. CD8+ T cells of challenged recipients initially retained the stunted IFN-γ production found prior to transfer, and cells from acutely infected mice were never seen to transition to either memory subset at all time points tested, up to 30 days post-primary infection, suggesting a delay in the generation of memory. Here we have identified defects in Brucella-responsive CD8+ T cells that allow chronic persistence of infection. PMID:26416901

Knockdown of hTERT and concurrent treatment with interferon-gamma inhibited proliferation and invasion of human glioblastoma cell lines

PubMed Central

George, Joseph; Banik, Naren L.; Ray, Swapan K.

2011-01-01

Human telomerase reverse transcriptase (hTERT) is the catalytic component of telomerase that facilitates tumor cell invasion and proliferation. Telomerase and hTERT are remarkably upregulated in majority of cancers including glioblastoma. Interferon-gamma (IFN-γ) modulates several cellular activities including cell cycle and multiplication through transcriptional regulation. The present investigation was designed to unravel the molecular mechanisms of the inhibition of cell proliferation, migration, and invasion of human glioblastoma SNB-19 and LN-18 cell lines after knockdown of hTERT using a plasmid vector based siRNA and concurrent treatment with IFN-γ. We observed more than 80% inhibition of cell proliferation, migration, and invasion of both cell lines after the treatment with combination of hTERT siRNA and IFN-γ. Our studies also showed accumulation of apoptotic cells in subG1 phase and an increase in cell population in G0/G1 with a reduction in G2/M phase indicating cell cycle arrest in G0/G1 phase for apoptosis. Semiquantitative and real-time RT-PCR analyses demonstrated significant downregulation of c- Myc and upregulation of p21 Waf1 and p27 Kip1. Western blotting confirmed the downregulation of the molecules involved in cell proliferation, migration, and invasion and also showed upregulation of cell cycle inhibitors. In conclusion, our study demonstrated that knockdown of hTERT siRNA and concurrent treatment with IFN-γ effectively inhibited cell proliferation, migration, and invasion in glioblastoma cells through downregulation of the molecules involved in these processes and cell cycle inhibition. Therefore, the combination of hTERT siRNA and IFN-γ offers a potential therapeutic strategy for controlling growth of human glioblastoma cells. PMID:20394835

Role of T Cells and Gamma Interferon during Induction of Hypersensitivity to Lipopolysaccharide by Toxic Shock Syndrome Toxin 1 in Mice

PubMed Central

Dinges, Martin M.; Schlievert, Patrick M.

2001-01-01

The superantigenic function of toxic shock syndrome toxin 1 (TSST-1) is generally regarded as an important determinant of its lethal effects in humans or experimental animals. This study examined the role of superantigenicity in a BALB/c mouse model of lethal TSST-1-induced hypersensitivity to lipopolysaccharide (LPS). In this model, TSST-1 greatly potentiated both LPS-induced lethality, as well as LPS-induced serum tumor necrosis factor alpha (TNF-α) activity. Although BALB/c-SCID mice were resistant to these LPS enhancement effects of TSST-1, BALB/c-SCID mice reconstituted with T cells were completely susceptible to the enhancement effect of TSST-1 on LPS-induced serum TNF-α. Mice pretreated with cyclosporine (Cs) or neutralizing antibodies against gamma interferon (IFN-γ) did not develop lethal LPS hypersensitivity when injected with TSST-1, and these agents reduced the enhancement effect of TSST-1 on LPS-induced serum TNF-α by 99 and 85%, respectively. Cs pretreatment also completely inhibited the known capacity of TSST-1 to amplify LPS-induced levels of IFN-γ in serum. In contrast, mice given Cs after a priming injection of TSST-1, but before LPS, still exhibited lethal hypersensitivity to LPS. Cs given after TSST-1 also did not inhibit enhancement of LPS-induced serum TNF-α by TSST-1 but inhibited the enhancement effect of TSST-1 on LPS-induced serum IFN-γ by 50%. These experiments support the theory that TSST-1-induced hypersensitivity to LPS is mediated primarily by IFN-γ derived from superantigen-activated T cells. PMID:11179286

Induced expression of mRNA for IL-5, IL-6, TNF-alpha, MIP-2 and IFN-gamma in immunologically activated rat peritoneal mast cells: inhibition by dexamethasone and cyclosporin A.

PubMed

Williams, C M; Coleman, J W

1995-10-01

We examined the capacity of purified rat peritoneal connective tissue-type mast cells (PMC) to express mRNA for several cytokines. Stimulation of PMC with anti-IgE for 4 hr induced the expression of mRNA encoding interleukin-5 (IL-5), IL-6, tumour necrosis factor-alpha (TNF-alpha), macrophage inflammatory protein-2 (MIP-2) and interferon-gamma (IFN-gamma). Unstimulated PMC expressed detectable mRNA for TNF-alpha but not for the other four cytokines. Incubation of PMC with cyclosporin A (CsA) or dexamethasone (DEX), each at 10(-6) M for 24 hr, significantly inhibited the induced expression of mRNA for each of the five cytokines, and also inhibited release of biologically active TNF-alpha. Throughout these experiments mRNA levels of the housekeeping gene G3PDH were not altered by stimulation with anti-IgE or incubation with CsA or DEX. We conclude that immunological activation of rat PMC induces gene expression of several cytokines and that expression of these genes can be inhibited by immunosuppressive drugs.

Induced expression of mRNA for IL-5, IL-6, TNF-alpha, MIP-2 and IFN-gamma in immunologically activated rat peritoneal mast cells: inhibition by dexamethasone and cyclosporin A.

PubMed Central

Williams, C M; Coleman, J W

1995-01-01

We examined the capacity of purified rat peritoneal connective tissue-type mast cells (PMC) to express mRNA for several cytokines. Stimulation of PMC with anti-IgE for 4 hr induced the expression of mRNA encoding interleukin-5 (IL-5), IL-6, tumour necrosis factor-alpha (TNF-alpha), macrophage inflammatory protein-2 (MIP-2) and interferon-gamma (IFN-gamma). Unstimulated PMC expressed detectable mRNA for TNF-alpha but not for the other four cytokines. Incubation of PMC with cyclosporin A (CsA) or dexamethasone (DEX), each at 10(-6) M for 24 hr, significantly inhibited the induced expression of mRNA for each of the five cytokines, and also inhibited release of biologically active TNF-alpha. Throughout these experiments mRNA levels of the housekeeping gene G3PDH were not altered by stimulation with anti-IgE or incubation with CsA or DEX. We conclude that immunological activation of rat PMC induces gene expression of several cytokines and that expression of these genes can be inhibited by immunosuppressive drugs. Images Figure 1 Figure 2 Figure 3 PMID:7490125

Immunoglobulin Fc gamma receptor promotes immunoglobulin uptake, immunoglobulin-mediated calcium increase, and neurotransmitter release in motor neurons

NASA Technical Reports Server (NTRS)

Mohamed, Habib A.; Mosier, Dennis R.; Zou, Ling L.; Siklos, Laszlo; Alexianu, Maria E.; Engelhardt, Jozsef I.; Beers, David R.; Le, Wei-dong; Appel, Stanley H.

2002-01-01

Receptors for the Fc portion of immunoglobulin G (IgG; FcgammaRs) facilitate IgG uptake by effector cells as well as cellular responses initiated by IgG binding. In earlier studies, we demonstrated that amyotrophic lateral sclerosis (ALS) patient IgG can be taken up by motor neuron terminals and transported retrogradely to the cell body and can alter the function of neuromuscular synapses, such as increasing intracellular calcium and spontaneous transmitter release from motor axon terminals after passive transfer. In the present study, we examined whether FcgammaR-mediated processes can contribute to these effects of ALS patient immunoglobulins. F(ab')(2) fragments (which lack the Fc portion) of ALS patient IgG were not taken up by motor axon terminals and were not retrogradely transported. Furthermore, in a genetically modified mouse lacking the gamma subunit of the FcR, the uptake of whole ALS IgG and its ability to enhance intracellular calcium and acetylcholine release were markedly attenuated. These data suggest that FcgammaRs appear to participate in IgG uptake into motor neurons as well as IgG-mediated increases in intracellular calcium and acetylcholine release from motor axon terminals. Copyright 2002 Wiley-Liss, Inc.

Arthritis is inhibited in Borrelia-primed and infected interleukin-17A-deficient mice after administration of anti-gamma-interferon, anti-tumor necrosis factor alpha and anti-interleukin-6 antibodies.

PubMed

Kuo, Joseph; Warner, Thomas F; Schell, Ronald F

2017-08-31

The role that cytokines play in the induction of Lyme arthritis is gradually being delineated. We showed previously that severe arthritis developed in a T-cell-driven murine model, even in mice lacking interleukin-17A (IL-17A) and administered anti-gamma-interferon (IFN-γ) antibody. Increased levels of tumor necrosis factor alpha (TNF-α) and interleukin-6 (IL-6), two pro-inflammatory cytokines, were detected in cultures of popliteal lymph node cells obtained from these mice. We hypothesized that concomitantly administered anti-IL-6, anti-TNF-α and anti-IFN-γ antibodies would inhibit the development of arthritis in IL-17A-deficient mice. Our results showed that swelling of the hind paws and histopathological changes consistent with arthritis were significantly reduced in IL-17A-deficient mice that administered the three anti-cytokine antibodies. These results suggest that treatment with multiple anti-cytokine antibodies can abrogate the induction of Lyme arthritis in mice. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Measles virus C protein suppresses gamma-activated factor formation and virus-induced cell growth arrest

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yokota, Shin-ichi; Okabayashi, Tamaki; Fujii, Nobuhiro, E-mail: fujii@sapmed.ac.j

2011-05-25

Measles virus (MeV) produces two accessory proteins, V and C, from the P gene. These accessory proteins have been reported to contribute to efficient virus proliferation through the modulation of host cell events. Our previous paper described that Vero cell-adapted strains of MeV led host cells to growth arrest through the upregulation of interferon regulatory factor 1 (IRF-1), and wild strains did not. In the present study, we found that C protein expression levels varied among MeV strains in infected SiHa cells. C protein levels were inversely correlated with IRF-1 expression levels and with cell growth arrest. Forced expression ofmore » C protein released cells from growth arrest. C-deficient recombinant virus efficiently upregulated IRF-1 and caused growth arrest more efficiently than the wild-type virus. C protein preferentially bound to phosphorylated STAT1 and suppressed STAT1 dimer formation. We conclude that MeV C protein suppresses IFN-{gamma} signaling pathway via inhibition of phosphorylated STAT1 dimerization.« less

Interferon for the treatment of genital warts: a systematic review

PubMed Central

2009-01-01

Background Interferon has been widely used in the treatment of genital warts for its immunomodulatory, antiproliferative and antiviral properties. Currently, no evidence that interferon improves the complete response rate or reduces the recurrence rate of genital warts has been generally provided. The aim of this review is to assess, from randomized control trials (RCTs), the efficacy and safety of interferon in curing genital warts. Methods We searched Cochrane Sexually Transmitted Diseases Group's Trials Register (January, 2009), Cochrane Central Register of Controlled Trials (2009, issue 1), PubMed (1950-2009), EMBASE (1974-2009), Chinese Biomedical Literature Database (CBM) (1975-2009), China National Knowledge Infrastructure (CNKI) (1979-2009), VIP database (1989-2009), as well as reference lists of relevant studies. Two reviewers independently screened searched studies, extracted data and evaluated their methodological qualities. RevMan 4.2.8 software was used for meta-analysis Results 12 RCTs involving 1445 people were included. Among them, 7 studies demonstrated the complete response rate of locally-used interferon as compared to placebo for treating genital warts. Based on meta-analysis, the rate of Complete response of the two interventions differed significantly (locally-used interferon:44.4%; placebo:16.1%). The difference between the two groups had statistical significance (RR 2.68, 95% CI 1.79 to 4.02, P < 0.00001). 5 studies demonstrated the complete response rate of systemically-used interferon as compared to placebo for treating genital warts. Based on meta-analysis, the rate of Complete response of the two interventions had no perceivable discrepancy (systemically-used interferon:27.4%; placebo:26.4%). The difference between the two groups had no statistical significance (RR1.25, 95% CI 0.80 to 1.95, P > 0.05). 7 studies demonstrated the recurrence rate of interferon as compared to placebo for treating genital warts. Based on meta-analysis, the

Interferon for the treatment of genital warts: a systematic review.

PubMed

Yang, Jin; Pu, Yu-Guo; Zeng, Zhong-Ming; Yu, Zhi-Jian; Huang, Na; Deng, Qi-Wen

2009-09-21

Interferon has been widely used in the treatment of genital warts for its immunomodulatory, antiproliferative and antiviral properties. Currently, no evidence that interferon improves the complete response rate or reduces the recurrence rate of genital warts has been generally provided. The aim of this review is to assess, from randomized control trials (RCTs), the efficacy and safety of interferon in curing genital warts. We searched Cochrane Sexually Transmitted Diseases Group's Trials Register (January, 2009), Cochrane Central Register of Controlled Trials (2009, issue 1), PubMed (1950-2009), EMBASE (1974-2009), Chinese Biomedical Literature Database (CBM) (1975-2009), China National Knowledge Infrastructure (CNKI) (1979-2009), VIP database (1989-2009), as well as reference lists of relevant studies. Two reviewers independently screened searched studies, extracted data and evaluated their methodological qualities. RevMan 4.2.8 software was used for meta-analysis 12 RCTs involving 1445 people were included. Among them, 7 studies demonstrated the complete response rate of locally-used interferon as compared to placebo for treating genital warts. Based on meta-analysis, the rate of Complete response of the two interventions differed significantly (locally-used interferon:44.4%; placebo:16.1%). The difference between the two groups had statistical significance (RR 2.68, 95% CI 1.79 to 4.02, P < 0.00001). 5 studies demonstrated the complete response rate of systemically-used interferon as compared to placebo for treating genital warts. Based on meta-analysis, the rate of Complete response of the two interventions had no perceivable discrepancy (systemically-used interferon:27.4%; placebo:26.4%). The difference between the two groups had no statistical significance (RR1.25, 95% CI 0.80 to 1.95, P > 0.05). 7 studies demonstrated the recurrence rate of interferon as compared to placebo for treating genital warts. Based on meta-analysis, the recurrence rate of the two

Inflammation activates the interferon signaling pathways in taste bud cells.

PubMed

Wang, Hong; Zhou, Minliang; Brand, Joseph; Huang, Liquan

2007-10-03

Patients with viral and bacterial infections or other inflammatory illnesses often experience taste dysfunctions. The agents responsible for these taste disorders are thought to be related to infection-induced inflammation, but the mechanisms are not known. As a first step in characterizing the possible role of inflammation in taste disorders, we report here evidence for the presence of interferon (IFN)-mediated signaling pathways in taste bud cells. IFN receptors, particularly the IFN-gamma receptor IFNGR1, are coexpressed with the taste cell-type markers neuronal cell adhesion molecule and alpha-gustducin, suggesting that both the taste receptor cells and synapse-forming cells in the taste bud can be stimulated by IFN. Incubation of taste bud-containing lingual epithelia with recombinant IFN-alpha and IFN-gamma triggered the IFN-mediated signaling cascades, resulting in the phosphorylation of the downstream STAT1 (signal transducer and activator of transcription protein 1) transcription factor. Intraperitoneal injection of lipopolysaccharide or polyinosinic:polycytidylic acid into mice, mimicking bacterial and viral infections, respectively, altered gene expression patterns in taste bud cells. Furthermore, the systemic administration of either IFN-alpha or IFN-gamma significantly increased the number of taste bud cells undergoing programmed cell death. These findings suggest that bacterial and viral infection-induced IFNs can act directly on taste bud cells, affecting their cellular function in taste transduction, and that IFN-induced apoptosis in taste buds may cause abnormal cell turnover and skew the representation of different taste bud cell types, leading to the development of taste disorders. To our knowledge, this is the first study providing direct evidence that inflammation can affect taste buds through cytokine signaling pathways.

[Alpha-interferon and mental disorders].

PubMed

Debien, C; De Chouly De Lenclave, M B; Foutrein, P; Bailly, D

2001-01-01

The interferon alpha stands as a reference both in oncology and virology. But its efficiency is limited by frequent somatic as well as neuropsychic side effects. As a matter of fact, the reduction or the ending of a chemotherapy treatment come chiefly from the psychiatric complications caused by the use of interferon. For about 30% of patients, various psychic disorders are noticed: personality disorders, mood disorders, anxiety states, suicidal tendencies, manic and psychotic symptoms. We thus propose a review which shall be completed by a discussion on wether the interferon is responsible or not of the appearance of the described mental disorders. We shall conclude with a synthesis of the proposed practical management when confronted with such disorders. Psychiatric complications under interferon-Alpha. The appearance of psychiatric complications caused by interferon has been the subject of many publications. They have also raised the question of the toxicity mechanism which is still misunderstood today. This toxicity appears to be dose-dependent with variations depending on the daily dose given, the mode of administration, the combination with other chemotherapy treatments, the concomitance with a cerebral radiotherapy or a medical history of psychiatric disorders. Most of these effects occur after three weeks of treatment but non specific neuropsychic symptoms can be observed earlier. Non specific symptoms. They appear early but are difficult to detect, though they bring together a whole lot of clinical signs: asthenia, irritability, psychomotor slowdown, depressive mood or even a real "subsyndromic" depressive syndrome, anorexia, decline of the libido, concentration and attention problems, dizzy spells and headaches. Some authors have described intense and fluctuating of personality, mixing anxiety, irritability and disorder of drive control. Depression. Depression is the most frequently found psychiatric pathology in studies but the real frequency of clear

Interactions of the interferon system with cellular metabolism

NASA Technical Reports Server (NTRS)

Sonnenfeld, Gerald

1986-01-01

The results of studies concerning the interaction of the interferon (Inf) system with the activities of carcinogens, tumor promoters, and cytochrome P-450 are presented. The results show that the addition of a tumor promoter (TPA or 4-O-methyl-TPA) to a tissue culture enhances virus-induced Inf-gamma production, suggesting a potential value of tumor promoters in the biosynthesis of commercial Inf. On the other hand, the carcinogens were reported to inhibit the induction of Inf-alpha/beta in cultured cells and in intact animals (with no effect on the administered or preformed Inf). The demonstration of a correlation between the carcinogenic potential of a compound and its inhibitive effect on Inf production suggests a possible use of the Inf production assay in the evaluation of the carcinogenicity of chemicals. In addition, it was shown that the induction of Inf-alpha/beta as well as the administration of this Inf depresses the levels of rat liver cytochrome P-450 which is responsible for binding lipophilic drugs, steroids, and carcinogens, thus increasing the toxicity of the respective chemical.

Cost-effectiveness of alternative strategies for interferon-γ release assays and tuberculin skin test in tuberculous uveitis.

PubMed

Ang, Marcus; Nguyen, Hai V; Kiew, Sieh Yean; Chen, Shu; Chee, Soon-Phaik; Finkelstein, Eric

2015-07-01

Although tuberculous uveitis remains a major cause of ocular morbidity in the developing world, there is no consensus on which diagnostic test or testing strategy is the most cost effective. In this study we carried out a cost-effectiveness analysis to determine the most cost-effective diagnostic test strategy. In this prospective study, we recruited 102 patients from Singapore National Eye Centre with signs suggestive of tuberculous uveitis. Using prospective data from this cohort and from published meta-analyses, we modelled the incremental cost effectiveness of the following strategies: tuberculin skin test (TST) only; interferon-γ release assay (IGRA) only; IGRA following a positive TST result; and dual-test strategy, conducting TST and IGRA at presentation. Incremental cost-effectiveness ratios (ICERs) were calculated for each strategy and analysed using a willingness-to-pay threshold of $50,000 per quality-adjusted life year (QALY) gained. In our population, the least cost effective was the IGRA-only strategy. The dual-test strategy was the most cost effective, with an improvement of 0.017 QALY at an incremental cost of $190 relative to the TST-only strategy (ICER $11,500); while the TST-only strategy was more cost effective than the third strategy, using IGRA following a positive TST result (ICER $3610). This remained consistent while varying the costs of IGRA and TST, the incidence of tuberculosis and tuberculous uveitis, as well as the diagnostic accuracy of IGRA and TST found in previous studies in various populations. The dual-test strategy (performing TST and IGRA at presentation) was the most cost effective strategy for the diagnosis of tuberculous uveitis in our population. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

Usefulness of interferon-γ release assay for the diagnosis of sputum smear-negative pulmonary and extra-pulmonary TB in Zhejiang Province, China.

PubMed

Ji, Lei; Lou, Yong-Liang; Wu, Zhong-Xiu; Jiang, Jin-Qin; Fan, Xing-Li; Wang, Li-Fang; Liu, Xiao-Xiang; Du, Peng; Yan, Jie; Sun, Ai-Hua

2017-09-01

Quick diagnosis of smear-negative pulmonary tuberculosis (TB) and extra-pulmonary TB are urgently needed in clinical diagnosis. Our research aims to investigate the usefulness of the interferon-γ release assay (IGRA) for the diagnosis of smear-negative pulmonary and extra-pulmonary TB. We performed TB antibody and TB-IGRA tests on 389 pulmonary TB patients (including 120 smear-positive pulmonary TB patients and 269 smear-negative pulmonary TB patients), 113 extra-pulmonary TB patients, 81 patients with other pulmonary diseases and 100 healthy controls. Blood samples for the TB-Ab test and the TB-IGRA were collected, processed, and interpreted according to the manufacturer's protocol. The detection ratio of smear-positive pulmonary TB patients and smear-negative pulmonary TB patients were 90.8% (109 of 120) and 89.6% (241 of 269), respectively. There was no statistically significant difference of its performance between these two sample sets (P > 0.05). The detection ratio of positive TB patients and extra-pulmonary TB patients were 90.0% (350 of 389) and 87.6% (99 of 113), respectively, which was not significantly different (P > 0.05). In this work, the total detection ratio using TB-IGRA was 89.4%, therefore TB-IGRA has diagnostic values in smear-negative pulmonary TB and extra-pulmonary TB diagnosis.

A morphological screening of protein crystals for interferon delivery by metal ion-chelate technology.

PubMed

Jiang, Yanbo; Shi, Kai; Wang, Shuo; Li, Xuefeng; Cui, Fude

2010-12-01

This study presents a preliminary exploration on extending the half-life of therapeutic proteins by crystallization strategy without new molecular entities generation. Recombinant human interferon (rhIFN) α-2b, a model protein drug in this case, was crystallized using a hanging-drop vapor diffusion method. A novel chelating technique with metal ions was employed to promote crystals formation. The effects of key factors such as seeding protein concentration, pH of the hanging drop, ionic strength of the equilibration solution, and precipitants were investigated. Size-exclusion liquid chromatography, antiviral activity determination, and enzyme-linked immunosorbent assay indicated that both the molecular integrity and biological potency of rhIFN were not significantly affected by crystallization process. In addition, the in vitro release behavior of rhIFN from crystal lattice was characterized by an initial fast release, followed by a sustained release up to 48 hour. The work described here suggested an exciting possibility of therapeutic protein crystals as a long-acting formulation.

Enhanced antitumor reactivity of tumor-sensitized T cells by interferon alfa

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vander Woude, D.L.; Wagner, P.D.; Shu, S.

Tumor-draining lymph node cells from mice bearing the methylcholanthrene-induced MCA 106 tumors can be sensitized in vitro to acquire antitumor reactivity. We examined the effect of interferon alfa on the function of cells that underwent in vitro sensitization in adoptive immunotherapy. Interferon alfa increased the antitumor reactivity of in vitro sensitized cells in the treatment of MCA 106 pulmonary metastases. This effect was evident in irradiated mice, indicating that a host response to the interferon alfa was not required. Interferon alfa treatment increased class I major histocompatibility complex antigen expression on tumor cells and increased their susceptibility to lysis bymore » in vitro sensitized cells. These results suggest that interferon alfa enhancement of adoptive immunotherapy was mediated by its effect on tumor cells. Interferon alfa may be a useful adjunct to the adoptive immunotherapy of human cancer.« less

Downregulation of Interleukin-18-Mediated Cell Signaling and Interferon Gamma Expression by the Hepatitis B Virus e Antigen

PubMed Central

Jegaskanda, S.; Ahn, S. H.; Skinner, N.; Thompson, A. J.; Ngyuen, T.; Holmes, J.; De Rose, R.; Navis, M.; Winnall, W. R.; Kramski, M.; Bernardi, G.; Bayliss, J.; Colledge, D.; Sozzi, V.; Visvanathan, K.; Locarnini, S. A.; Kent, S. J.

2014-01-01

ABSTRACT The mechanisms by which hepatitis B virus (HBV) establishes and maintains chronic hepatitis B infection (CHB) are poorly defined. Innate immune responses play an important role in reducing HBV replication and pathogenesis. HBV has developed numerous mechanisms to escape these responses, including the production of the secreted hepatitis B e antigen (HBeAg), which has been shown to regulate antiviral toll-like receptor (TLR) and interleukin-1 (IL-1) signaling. IL-18 is a related cytokine that inhibits HBV replication in hepatoma cell lines and in the liver through the induction of gamma interferon (IFN-γ) by NK cells and T cells. We hypothesized that HBV or HBV proteins inhibit IFN-γ expression by NK cells as an accessory immunomodulatory function. We show that HBeAg protein inhibits the NF-κB pathway and thereby downregulates NK cell IFN-γ expression. Additionally, IFN-γ expression was significantly inhibited by exposure to serum from individuals with HBeAg-positive but not HBeAg-negative chronic HBV infection. Further, we show that the HBeAg protein suppresses IL-18-mediated NF-κB signaling in NK and hepatoma cells via modulation of the NF-κB pathway. Together, these findings show that the HBeAg inhibits IL-18 signaling and IFN-γ expression, which may play an important role in the establishment and/or maintenance of persistent HBV infection. IMPORTANCE It is becoming increasingly apparent that NK cells play a role in the establishment and/or maintenance of chronic hepatitis B infection. The secreted HBeAg is an important regulator of innate and adaptive immune responses. We now show that the HBeAg downregulates NK cell-mediated IFN-γ production and IL-18 signaling, which may contribute to the establishment of infection and/or viral persistence. Our findings build on previous studies showing that the HBeAg also suppresses the TLR and IL-1 signaling pathways, suggesting that this viral protein is a key regulator of antiviral innate immune responses

Nuclear receptor ERR alpha and coactivator PGC-1 beta are effectors of IFN-gamma-induced host defense.

PubMed

Sonoda, Junichiro; Laganière, Josée; Mehl, Isaac R; Barish, Grant D; Chong, Ling-Wa; Li, Xiangli; Scheffler, Immo E; Mock, Dennis C; Bataille, Alain R; Robert, Francois; Lee, Chih-Hao; Giguère, Vincent; Evans, Ronald M

2007-08-01

Macrophage activation by the proinflammatory cytokine interferon-gamma (IFN-gamma) is a critical component of the host innate response to bacterial pathogenesis. However, the precise nature of the IFN-gamma-induced activation pathway is not known. Here we show using genome-wide expression and chromatin-binding profiling that IFN-gamma induces the expression of many nuclear genes encoding mitochondrial respiratory chain machinery via activation of the nuclear receptor ERR alpha (estrogen-related receptor alpha, NR3B1). Studies with macrophages lacking ERR alpha demonstrate that it is required for induction of mitochondrial reactive oxygen species (ROS) production and efficient clearance of Listeria monocytogenes (LM) in response to IFN-gamma. As a result, mice lacking ERR alpha are susceptible to LM infection, a phenotype that is localized to bone marrow-derived cells. Furthermore, we found that IFN-gamma-induced activation of ERR alpha depends on coactivator PGC-1 beta (peroxisome proliferator-activated receptor gamma coactivator-1 beta), which appears to be a direct target for the IFN-gamma/STAT-1 signaling cascade. Thus, ERR alpha and PGC-1 beta act together as a key effector of IFN-gamma-induced mitochondrial ROS production and host defense.

Persistent interferon transgene expression by RNA interference-mediated silencing of interferon receptors.

PubMed

Takahashi, Yuki; Vikman, Elin; Nishikawa, Makiya; Ando, Mitsuru; Watanabe, Yoshihiko; Takakura, Yoshinobu

2010-09-01

The in vivo half-life of interferons (IFNs) is very short, and its extension would produce a better therapeutic outcome in IFN-based therapy. Delivery of IFN genes is one solution for providing a sustained supply. IFNs have a variety of functions, including the suppression of transgene expression, through interaction with IFN receptors (IFNRs). This suppression could prevent IFNs from being expressed from vectors delivered. Silencing the expression of IFNAR and IFNGR, the receptors for type I and II IFNs, respectively, in cells expressing IFNs may prolong transgene expression of IFNs. Mouse melanoma B16-BL6 cells or mouse liver were selected as a site expressing IFNs (not a target for IFN gene therapy) and IFN-expressing plasmid DNA was delivered with or without small interfering RNA (siRNA) targeting IFNRs. Transfection of B16-BL6 cells with siRNA targeting IFNAR1 subunit (IFNAR1) resulted in the reduced expression of IFNAR on the cell surface. This silencing significantly increased the IFN-beta production in cells that were transfected with IFN-beta-expressing plasmid DNA. Similar results were obtained with the combination of IFN-gamma and IFNGR. Co-injection of IFN-beta-expressing plasmid DNA with siRNA targeting IFNAR1 into mice resulted in sustained plasma concentration of IFN-beta. These results provide experimental evidence that the RNAi-mediated silencing of IFNRs in cells expressing IFN, such as hepatocytes, is an effective approach for improving transgene expression of IFNs when their therapeutic target comprises cells other than those expressing IFNs.

Inactivation of human interferon by body fluids

NASA Technical Reports Server (NTRS)

Cesario, T. C.; Mandell, A.; Tilles, J. G.

1973-01-01

Description of the effects of human feces, bile, saliva, serum, and cerebrospinal fluid on interferon activity. It is shown that crude interferon is inactivated by at least 50% more than with the control medium used, when incubated for 4 hr in vitro in the presence of serum, saliva, or cerebrospinal liquid, and by close to 100% when incubated with stool extract or bile.

Intact Pneumococci Trigger Transcription of Interferon-Related Genes in Human Monocytes, while Fragmented, Autolyzed Bacteria Subvert This Response

PubMed Central

Nordén, Rickard; Martner, Anna; Samuelsson, Ebba; Hynsjö, Lars; Wold, Agnes E.

2017-01-01

ABSTRACT A peculiar trait of pneumococci (Streptococcus pneumoniae) is their propensity to undergo spontaneous lysis during stationary growth due to activation of the enzyme autolysin (LytA), which fragments the peptidoglycan cell wall. The fragments that are generated upon autolysis impair phagocytosis and reduce production of interleukin-12 (IL-12) and gamma interferon (IFN-γ) by human leukocytes in response to intact pneumococci, thereby impeding crucial host defenses. The objective was to identify additional monocyte genes whose transcription is induced by intact pneumococci and subverted by autolyzed bacteria. Monocytes were isolated from healthy blood donors and stimulated for 3 h with UV-inactivated S. pneumoniae (Rx1PLY− LytA+ strain), which is capable of autolyzing, its LytA− isogenic autolysin-deficient mutant, or a mixture of the two (containing twice the initial bacterial concentration). Gene expression was assessed by Illumina microarray, and selected findings were confirmed by reverse transcription-quantitative real-time PCR (RT-qPCR), enzyme-linked immunosorbent assay (ELISA), and flow cytometry. In all, we identified 121 genes that were upregulated to a significantly higher degree by intact than autolyzed pneumococci. These included IFNB1 and a large set of interferon-induced genes, such as IFIT3, RSAD2, CFCL1, and CXCL10 genes, as well as IL12B and CD40 genes. RT-qPCR revealed that transcription of these genes in response to intact pneumococci diminished when autolyzed pneumococci were admixed and that this pattern was independent of pneumolysin. Thus, transcription of interferon-related genes is triggered by intact pneumococci and subverted by fragments generated by spontaneous bacterial autolysis. We suggest that interferon-related pathways are important for elimination of pneumococci and that autolysis contributes to virulence by extinguishing these pathways. PMID:28223347

Arsenic enhances the apoptosis induced by interferon gamma: key role of IRF-1.

PubMed

El Bougrini, J; Pampin, M; Chelbi-Alix, M K

2006-05-15

Interferons (IFNs) and arsenic trioxide (As2O3) are known inhibitors of cell proliferation and have been used in the treatment of certain forms of malignancy. IFNgamma treatment of cells leads to tyrosine phosphorylation of STAT1 followed by dimerization that accumulates in the nucleus. This is followed by DNA binding, activation of target gene transcription, dephosphorylation, and return to the cytoplasm. We have shown earlier that IFNgamma and As2O3 act synergistically in acute promyelocytic leukemia cells to upregulate IRF-1 expression and to induce apoptosis. Here, we show that in the human fibrosarcoma cell line 2fTGH, As2O3 prolongs IFNgamma-induced STAT1 phosphorylation resulting in persistent binding of STAT1 to GAS motif leading to an increase in IRF-1 expression which correlated with both higher anti-proliferative effect and increased apoptosis. These biological responses induced by IFNgamma alone or in combination with As2O3 were abolished when IRF-1 expression was down-regulated by RNA interference, thus demonstrating the key role of IRF-1.

Development of tolerance to the effects of vigabatrin (gamma-vinyl-GABA) on GABA release from rat cerebral cortex, spinal cord and retina.

PubMed Central

Neal, M. J.; Shah, M. A.

1990-01-01

1. The effects of acute and chronic vigabatrin (gamma-vinyl-GABA) (GVG) administration on gamma-aminobutyric acid (GABA) levels and release in rat cortical slices, spinal cord slices and retinas were studied. 2. GVG (250 mgkg-1 i.p.) administered to rats 18 h before death (acute administration) produced an almost 3 fold increase in GABA levels of the cortex and spinal cord and a 6 fold increase in retinal GABA. The levels of glutamate, aspartate, glycine and taurine were unaffected. 3. When GVG (250 mgkg-1 i.p.) was administered daily for 17 days (chronic administration) a similar (almost 3 fold) increase in cortical GABA occurred but the increases in spinal and retinal GABA were reduced by approximately 40%. 4. Acute administration of GVG strikingly increased the potassium-evoked release (KCl 50 mM) of GABA from all three tissues. This enhanced evoked release was reduced by about 50% in tissues taken from rats that had been chronically treated with GVG. 5. Acute administration of GVG reduced GABA-transaminase (GABA-T) activity by approximately 80% in cortex and cord and by 98% in the retina. Following the chronic administration of GVG, there was a trend for GABA-T activities to recover (significant only in cortex). Acute administration of GVG had no effect on glutamic acid decarboxylase (GAD) activity in cortex or spinal cord. However, chronic treatment resulted in significant decreases in GAD activity in both the cortex and cord (35% and 50% reduction respectively).(ABSTRACT TRUNCATED AT 250 WORDS) PMID:2379037

Reversion and conversion of Mycobacterium tuberculosis IFN-gamma ELISpot results during anti-tuberculous treatment in HIV-infected children.

PubMed

Connell, Tom G; Davies, Mary-Ann; Johannisen, Christine; Wood, Kathryn; Pienaar, Sandy; Wilkinson, Katalin A; Wilkinson, Robert J; Zar, Heather J; Beatty, David; Nicol, Mark P; Curtis, Nigel; Eley, Brian

2010-05-27

Recent interest has focused on the potential use of serial interferon gamma (IFN-gamma) release assay (IGRA) measurements to assess the response to anti-tuberculous (TB) treatment. The kinetics of IFN-gamma responses to Mycobacterium tuberculosis (MTB) antigens in HIV-infected children during treatment have not however been previously investigated. IFN-gamma responses to the MTB antigens, ESAT-6, CFP-10 and PPD were measured by an enzyme-linked immunospot assay (IFN-gamma ELISpot) at presentation and at one, two and six months after starting anti-tuberculous treatment in HIV-infected children with definite or probable TB. Responses at different time points were compared using a Mann-Whitney U test with paired data analysed using the Wilcoxon signed rank test. A Fisher's exact or Chi-squared test was used to compare proportions when test results were analysed as dichotomous outcomes. Of 102 children with suspected TB, 22 (21%) had definite TB and 24 (23%) probable TB. At least one follow up IFN-gamma ELISpot assay result was available for 31 (67%) of the 46 children. In children with definite or probable TB in whom the IFN-gamma ELISpot assay result was positive at presentation, anti-tuberculous treatment was accompanied by a significant decrease in both the magnitude of the IFN-gamma response to individual or combined MTB-specific antigens (ESAT-6 median 110 SFCs/106 PBMC (IQR 65-305) at presentation vs. 15 (10-115) at six months, p = 0.04; CFP-10 177 (48-508) vs. 20 (5-165), p = 0.004, ESAT-6 or CFP-10 median 250 SFCs/106 PBMC (IQR 94-508) vs. 25 (10-165), p = 0.004) and in the proportion of children with a positive IFN-gamma ELISpot assay (Fisher's exact test: ESAT-6 15/0 vs 5/11, p = 0.0002, CFP-10 22/0 vs 8/17, p = 0.0001, ESAT-6 or CFP-10 22/0 vs. 9/17, p= 0.002). However almost half of the children had a positive IFN-gamma ELISpot assay after six months of anti-tuberculous treatment. In addition, there was conversion of the IFN-gamma ELISpot assay result

Growth Arrest of Epithelial Cells during Measles Virus Infection Is Caused by Upregulation of Interferon Regulatory Factor 1

PubMed Central

Yokota, Shin-ichi; Okabayashi, Tamaki; Yokosawa, Noriko; Fujii, Nobuhiro

2004-01-01

Natural infection with measles virus (MeV) is initiated when the virus reaches epithelial cells in the respiratory tract, oropharynx, or conjunctivae. Human epithelial cells infected with MeV frequently show growth suppression. In this study, we investigated the possible mechanisms for this suppression. The bronchiolar epithelial cell A549 showed growth arrest in G0/G1 following MeV infection or treatment with gamma interferon (IFN-γ). IFN regulatory factor-1 (IRF-1) was upregulated during MeV infection, although A549 did not produce IFN-γ. Cells of the cervical squamous cell line SiHa persistently infected with various strains of MeV displayed slower growth than uninfected SiHa cells, although the growth rates varied depending on the MeV strain. Transfection of antisense-oriented IRF-1 cDNA released the MeV-infected SiHa cells from growth suppression. Although these infected cells did not produce IFN-γ and suppressed IFN-α/β-induced Jak1 phosphorylation, Jak1 was constitutively phosphorylated. The growth rates negatively correlated with levels of both IRF-1 expression and constitutively phosphorylated Jak1. These results indicate that MeV upregulates IRF-1 in a manner that is independent of IFN but dependent on the JAK/STAT pathway. This induction of IRF-1 appears to suppress cell growth, although the extent seems to vary among MeV strains. PMID:15078941

Interferon gamma, an important marker of response to immune checkpoint blockade in non-small cell lung cancer and melanoma patients

PubMed Central

Karachaliou, Niki; Gonzalez-Cao, Maria; Crespo, Guillermo; Drozdowskyj, Ana; Aldeguer, Erika; Gimenez-Capitan, Ana; Teixido, Cristina; Molina-Vila, Miguel Angel; Viteri, Santiago; De Los Llanos Gil, Maria; Algarra, Salvador Martin; Perez-Ruiz, Elisabeth; Marquez-Rodas, Ivan; Rodriguez-Abreu, Delvys; Blanco, Remedios; Puertolas, Teresa; Royo, Maria Angeles; Rosell, Rafael

2018-01-01

Background: Programmed death-ligand 1 (PD-L1) may be induced by oncogenic signals or can be upregulated via interferon gamma (IFN-γ). We have explored whether the expression of IFNG, the gene encoding IFN-γ, is associated with clinical response to the immune checkpoint blockade in non-small cell lung cancer (NSCLC) and melanoma patients. The role of inflammation-associated transcription factors STAT3, IKBKE, STAT1 and other associated genes has also been examined. Methods: Total RNA from 17 NSCLC and 21 melanoma patients was analyzed by quantitative reverse transcription PCR. STAT3 and Rantes, YAP1 and CXCL5, DNMT1, RIG1 and TET1, EOMES, IFNG, PD-L1 and CTLA4, IKBKE and NFATC1 mRNA were examined. PD-L1 protein expression in tumor and immune cells and stromal infiltration of CD8+ T-cells were also evaluated. Progression-free survival and overall survival were estimated. Results: A total of 17 NSCLC patients received nivolumab and 21 melanoma patients received pembrolizumab. Progression-free survival with nivolumab was significantly longer in NSCLC patients with high versus low IFNG expression (5.1 months versus 2 months, p = 0.0124). Progression-free survival with pembrolizumab was significantly longer in melanoma patients with high versus low IFNG expression (5.0 months versus 1.9 months, p = 0.0099). Significantly longer overall survival was observed for melanoma patients with high versus low IFNG expression (not reached versus 10.2 months p = 0.0183). There was a trend for longer overall survival for NSCLC patients with high versus low IFNG expression. Conclusions: IFN-γ is an important marker for prediction of response to immune checkpoint blockade. Further research is warranted in order to validate whether IFNG is more accurate than PD-L1. PMID:29383037

ROS mediates interferon gamma induced phosphorylation of Src, through the Raf/ERK pathway, in MCF-7 human breast cancer cell line.

PubMed

Zibara, Kazem; Zeidan, Asad; Bjeije, Hassan; Kassem, Nouhad; Badran, Bassam; El-Zein, Nabil

2017-03-01

Interferon gamma (IFN-ɣ) is a pleiotropic cytokine which plays dual contrasting roles in cancer. Although IFN-ɣ has been clinically used to treat various malignancies, it was recently shown to have protumorigenic activities. Reactive oxygen species (ROS) are overproduced in cancer cells, mainly due to NADPH oxidase activity, which results into several changes in signaling pathways. In this study, we examined IFN-ɣ effect on the phosphorylation levels of key signaling proteins, through ROS production, in the human breast cancer cell line MCF-7. After treatment by IFN-ɣ, results showed a significant increase in the phosphorylation of STAT1, Src, raf, AKT, ERK1/2 and p38 signaling molecules, in a time specific manner. Src and Raf were found to be involved in early stages of IFN-ɣ signaling since their phosphorylation increased very rapidly. Selective inhibition of Src-family kinases resulted in an immediate significant decrease in the phosphorylation status of Raf and ERK1/2, but not p38 and AKT. On the other hand, IFN-ɣ resulted in ROS generation, through H 2 O 2 production, whereas pre-treatment with the ROS inhibitor NAC caused ROS inhibition and a significant decrease in the phosphorylation levels of AKT, ERK1/2, p38 and STAT1. Moreover, pretreatment with a selective NOX1 inhibitor resulted in a significant decrease of AKT phosphorylation. Finally, no direct relationship was found between ROS production and calcium mobilization. In summary, IFN-ɣ signaling in MCF-7 cell line is ROS-dependent and follows the Src/Raf/ERK pathway whereas its signaling through the AKT pathway is highly dependent on NOX1.

Two distinct interferon-γ genes in Tetraodon nigroviridis: Functional analysis during Vibrio parahaemolyticus infection.

PubMed

Peng, Wan; Lu, Dan-Qi; Li, Gao-Fei; Zhang, Xu; Yao, Mi; Zhang, Yong; Lin, Hao-Ran

2016-02-01

Interferon gamma (IFNγ) is a Th1 cytokine that plays a very important role in almost all phases of immune and inflammatory responses. In this study, we explored the functions of IFNγ1 and IFNγ2 of Tetraodon nigroviridis. Treating T. nigroviridis spleen and head kidney cells in vitro with recombinant T. nigroviridis IFNγ1 protein (rTn IFNγ1) or recombinant T. nigroviridis IFNγ2 protein (rTn IFNγ2) enhanced their nitric oxide responses. Both rTn IFNγ1 and rTn IFNγ2 also induced the expression of interferon-stimulated gene 15 (ISG15), a common anti-viral gene, although the expression of the interferon-inducible Mx gene was markedly inhibited by rTn IFNγ1 and was induced by rTn IFNγ2. The in vivo effects of rTn IFNγ1 and rTn IFNγ2 on Vibrio parahaemolyticus (V. parahaemolyticus) infection were assessed by intraperitoneally injecting rTn IFNγ1 or rTn IFNγ2 (100 ng) and V. parahaemolyticus (8 × 10(10)CFU/mL) into T. nigroviridis. A comparison of the group treated only with V. parahaemolyticus and those also treated with rTn IFNγ1 or rTn IFNγ2 showed that neither of these IFNγs protected T. nigroviridis from V. parahaemolyticus infection. However, rTn IFNγ1 more rapidly and robustly promoted inflammatory responses compared with rTn IFNγ2, whereas rTn IFNγ2 was involved in inducing the host to develop a more effective response earlier during the later stage of a V. parahaemolyticus infection. Moreover, microRNA-29b (miR-29b) expression is inversely correlated with IFNγ2 expression in T. nigroviridis. Copyright © 2015 Elsevier Ltd. All rights reserved.

Hematopoietic stem cell loss and hematopoietic failure in severe aplastic anemia is driven by macrophages and aberrant podoplanin expression.

PubMed

McCabe, Amanda; Smith, Julianne N P; Costello, Angelica; Maloney, Jackson; Katikaneni, Divya; MacNamara, Katherine C

2018-05-17

Severe aplastic anemia results from profound hematopoietic stem cell loss. T cells and interferon gamma have long been associated with severe aplastic anemia, yet the underlying mechanisms driving hematopoietic stem cell loss remain unknown. Using a mouse model of severe aplastic anemia, we demonstrate that interferon gamma-dependent hematopoietic stem cell loss required macrophages. Interferon gamma was necessary for bone marrow macrophage persistence, despite loss of other myeloid cells and hematopoietic stem cells. Depleting macrophages or abrogating interferon gamma signaling specifically in macrophages did not impair T cell activation or interferon gamma production in the bone marrow but rescued hematopoietic stem cells and reduced mortality. Thus, macrophages are not required for induction of interferon gamma in severe aplastic anemia and rather act as sensors of interferon gamma. Macrophage depletion rescued thrombocytopenia, increased bone marrow megakaryocytes, preserved platelet-primed stem cells, and increased the platelet-repopulating capacity of transplanted hematopoietic stem cells. In addition to the hematopoietic effects, severe aplastic anemia induced loss of non-hematopoietic stromal populations, including podoplanin-positive stromal cells. However, a subset of podoplanin-positive macrophages was increased during disease, and blockade of podoplanin in mice was sufficient to rescue disease. Our data further our understanding of disease pathogenesis demonstrating a novel role for macrophages as sensors of interferon gamma, thus illustrating an important role for the microenvironment in pathogenesis of severe aplastic anemia. Copyright © 2018, Ferrata Storti Foundation.

Important role of interferon regulatory factor (IRF)-3 in the interferon response of mouse macrophages upon infection by Newcastle disease virus.

PubMed

Wilden, Holger; Schirrmacher, Volker; Fournier, Philippe

2011-08-01

Newcastle disease virus (NDV) is an interesting agent for activating innate immune activity in macrophages including secretion of TNF-α and IFN-α, upregulation of TRAIL and activation of NF-κB and iNOS. However, the molecular mechanism of such cellular activities remains largely unknown. Tumor selectivity of replication of NDV has been described to be linked to deviations in tumor cells of the type I interferon response. We therefore focused on the interferon response to NDV of macrophages as part of innate anti-viral and anti-tumor activity. In particular, we investigated the functional significance of the interferon regulatory factor genes (IRF)-3 and IRF-7. Deletion of the IRF-3 or IRF-7 gene was found to increase susceptibility of mouse macrophages to virus infection. Surprisingly, NDV replicated better in IRF-3 KO than in IRF-7 KO macrophages. Further analysis showed that IRF-3 KO macrophages have a lower basal and NDV-induced RIG-I expression in comparison to IRF-7 KO macrophages. This might explain why, in IRF-3 KO macrophages, the secretion of type I interferons after NDV infection is delayed, when compared to IRF-7 KO and wild-type macrophages. In addition, IRF-3 KO cells showed reduced NDV-induced levels of IRF-7. This effect could be prevented by priming the cells first by interferon-α. Further results indicated that an early production of type I interferon rather than high maximal levels at later time points are important for resistance to infection by NDV. In conclusion, these results demonstrate an important role of IRF-3 for the innate anti-viral response to NDV of mouse macrophages.

Inhibition of Interferon-beta Responses in Multiple Sclerosis Immune Cells Associated With High-Dose Statins

PubMed Central

Feng, Xuan; Han, Diana; Kilaru, Bharat K.; Franek, Beverly S.; Niewold, Timothy B.; Reder, Anthony T.

2014-01-01

Objective To determine whether statins affect type 1 interferon responses in relapsing-remitting multiple sclerosis (RRMS). Design Study effects of atorvastatin on type 1 interferon responses in Jurkat cells, mononuclear cells (MNCs) from therapy-naive patients with RRMS in vitro, and MNCs from interferon-treated RRMS patients in vivo in 4 conditions: no drug, statin only, interferon-beta only, and statin added on to interferon-beta therapy. Patients The study examined clinically stable patients with RRMS: 21 therapy-naive patients and 14 patients receiving interferon-beta with a statin. Interventions Statin effects on in vitro and in vivo interferon-beta–induced STAT1 transcription factor activation, expression of interferon-stimulated proteins in MNCs, and serum type 1 interferon activity. Results In vitro, atorvastatin dose dependently inhibited expression of interferon-stimulated P-Y-STAT1 by 44% (P< .001), interferon regulatory factor 1 protein by 30% (P= .006), and myxovirus resistance 1 protein by 32% (P=.004) compared with no-statin control in MNCs from therapy-naive RRMS patients. In vivo, 9 of 10 patients who received high-dose statins (80 mg) had a significant reduction in interferon-beta therapy–induced serum interferon-α/β activity, whereas only 2 of 4 patients who received medium-dose statins (40 mg) had reductions. High-dose add-on statin therapy significantly blocked interferon-beta function, with less P-Y-STAT1 transcription factor activation, and reduced myxovirus resistance 1 protein and viperin protein production. Medium doses of statins did not change STAT1 activation. Conclusions High-dose add-on statin therapy significantly reduces interferon-beta function and type 1 interferon responses in RRMS patients. These data provide a putative mechanism for how statins could counteract the beneficial effects of interferon-beta and worsen disease. PMID:22801747

No changes in serum concentrations of interleukin 10 (IL-10) and interferon gamma (IF-gamma) before and after treatment of the thyroid eye disease (TED).

PubMed

Laban-Guceva, Nevenka; Antova, Magdalena; Bogoev, Milco

2007-11-01

TED is a severe eye disease leading in rare cases to decrease of sight, optic nerve compression and blindness. Recently, significant progresses in understanding the disease have been done. Nevertheless, the treatment of the disease, especially in its severe form remains challenging. Glucocorticoids (GC) have been the basis of the treatment for a long time. Orbital irradiation (OI) and optical decompression (OD) are also used in managing the severe forms of TED. Somatostatin, intravenous immunoglobulin have been also used, with conflicting results. Regarding the potential for the treatment of TED with cytokine antagonists, controlled clinical studies are not available. Since cytokines play an important role in the pathogenesis of the TED, they seemed to be logical choice for modern TED treatment. It has been shown that both Th1 (interleukin-2, tumor necrosis factor gamma, interleukin gamma) and Th2 (interleukin -4, -5, -10) profile T cells are activated in the TED. We therefore measured interleukin-gamma, IF-gamma and interleukin -10 (IL-10)(Th1 and Th2 pattern) to assess its relationship to the course of the disease. This paper shows that both Th1 (IL-2) and Th2 (IF-gamma) pathways represented by those two cytokines are not involved (IL-10 before 2.29+/-5.23 and after treatment 3.77+/-8.44; IF gamma before 0.50+/-0.24 and after treatment 0.35+/-0.19). No relationship to the response to treatment was found. GC resulted in positive response in 8/22 patients, OI (12 patients) given after CS therapy, resulted in a response in all patients. Increase in proptosis, loss of visual acuity is spite of CS treatment prompted OD in two patients, who both recovered visual acuity and proptosis fell under 25 mm Hertel.

Cross-talk between IGF-1 and estrogen receptors attenuates intracellular changes in ventral spinal cord 4.1 motoneuron cells due to interferon-gamma exposure

PubMed Central

Park, Sookyoung; Nozaki, Kenkichi; Smith, Joshua A.; Krause, James S.; Banik, Naren L.

2014-01-01

Insulin-like growth factor-1 (IGF-1) is a neuroprotective growth factor that promotes neuronal survival by inhibition of apoptosis. In order to examine whether IGF-1 exerts cytoprotective effects against extracellular inflammatory stimulation, ventral spinal cord 4.1 (VSC4.1) motoneuron cells were treated with interferon-gamma (IFN-γ). Our data demonstrated apoptotic changes, increased calpain:calpastatin and Bax:Bcl-2 ratios, and expression of apoptosis related proteases (caspase-3 and −12) in motoneurons rendered by IFN-γ in a dose-dependent manner. Post-treatment with IGF-1 attenuated these changes. In addition, IGF-1 treatment of motoneurons exposed to IFN-γ decreased expression of inflammatory markers (cyclooxygenase-2 and nuclear factor-kappa B:inhibitor of kappa B ratio). Furthermore, IGF-1 attenuated the loss of expression of IGF-1 receptors (IGF-1Rα and IGF-1Rβ) and estrogen receptors (ERα and ERβ) induced by IFN-γ. To determine whether the protective effects of IGF-1 are associated with ERs, ERs antagonist ICI and selective siRNA targeted against ERα and ERβ were used in VSC4.1 motoneurons. Distinctive morphological changes were observed following siRNA knockdown of ERα and ERβ. In particular, apoptotic cell death assessed by TUNEL assay was enhanced in both ERα and ERβ-silenced VSC4.1 motoneurons following IFN-γ and IGF-1 exposure. These results suggest that IGF-1 protects motoneurons from inflammatory insult by a mechanism involving pivotal interactions with ERα and ERβ. PMID:24188094

T helper cell-mediated interferon-gamma expression after human parvovirus B19 infection: persisting VP2-specific and transient VP1u-specific activity

PubMed Central

Franssila, R; Auramo, J; Modrow, S; Möbs, M; Oker-Blom, C; Käpylä, P; Söderlund-Venermo, M; Hedman, K

2005-01-01

Human parvovirus B19 is a small non-enveloped DNA virus with an icosahedral capsid consisting of proteins of only two species, the major protein VP2 and the minor protein VP1. VP2 is contained within VP1, which has an additional unique portion (VP1u) of 227 amino acids. We determined the ability of eukaryotically expressed parvovirus B19 virus-like particles consisting of VP1 and VP2 in the ratio recommended for vaccine use, or of VP2 alone, to stimulate, in an HLA class II restricted manner, peripheral blood mononuclear cells (PBMC) to proliferate and to secrete interferon gamma (IFN-γ) and interleukin (IL)-10 cytokines among recently and remotely B19 infected subjects. PBMC reactivity with VP1u was determined specifically with a prokaryotically expressed VP1u antigen. In general, B19-specific IFN-γ responses were stronger than IL-10 responses in both recent and remote infection; however, IL-10 responses were readily detectable among both groups, with the exception of patients with relapsed or persisting symptoms who showed strikingly low IL-10 responses. Whereas VP1u-specific IFN-γ responses were very strong among the recently infected subjects, the VP1u-specific IFN-γ and IL-10 responses were virtually absent among the remotely infected subjects. The disappearance of VP1u-specific IFN-γ expression is surprising, as B-cell immunity against VP1u is well maintained. PMID:16178856

Treatment of Hepatitis C Infections with Interferon: A Historical Perspective

DTIC Science & Technology

2010-01-01

infected AKR cells: a novel effect of interferon,” Proceedings of the National Academy of Sciences of the United States of America, vol. 71, no. 9, pp...Treatment of Hepatitis C Infections with Interferon: A Historical Perspective Robert M. Friedman and Sara Contente Department of Pathology, Uniformed...involve new anti-HCV agents that are currently under development. The antiviral activity of interferon (IFN), first described in 1957, was in a chick cell

IFN-gamma induction by SCG, 1,3-beta-D-glucan from Sparassis crispa, in DBA/2 mice in vitro.

PubMed

Harada, Toshie; Miura, Noriko N; Adachi, Yoshiyuki; Nakajima, Mitsuhiro; Yadomae, Toshiro; Ohno, Naohito

2002-12-01

Sparassis crispa Fr. in an edible mushroom recently cultivable in Japan. A branched beta-glucan from S. crispa (SCG) is a major 6-branched 1,3-beta-D-glucan showing antitumor activity. In this study, we examined interferon-gamma (IFN-gamma) induction by SCG from splenocytes in DBA/2 mice in vitro. In the splenocytes derived from almost all inbred strains of mice except for DBA/1 and DBA/2 mice, IFN-gamma production was not induced by SCG. The breeder and genders of DBA/2 mice showed no influence on IFN-gamma induction by SCG. On the other hand, the magnitude of IFN-gamma induction was lower in young mice than in their older counterparts. IFN-gamma was induced by SCG in adherent splenocytes, but IFN-gamma production was most significantly increased by SCG in instances involving coexistence of adherent and nonadherent splenocytes. In fact, inhibition of cell-cell contact reduced IFN-gamma induction by SCG. In addition, interleukin-12 p70 (IL-12p70) was induced by SCG in DBA/2 mice. It was suggested that soluble factors and cell-cell contact mediate synergistic effects on SCG-induced IFN-gamma production.

Cen A Optical Gamma Composite

NASA Image and Video Library

2017-12-08

NASA release April 1, 2010 The gamma-ray output from Cen A's lobes exceeds their radio output by more than ten times. High-energy gamma rays detected by Fermi's Large Area Telescope are depicted as purple in this gamma ray/optical composite of the galaxy. Credit: NASA/DOE/Fermi LAT Collaboration, Capella Observatory To learn more about these images go to: www.nasa.gov/mission_pages/GLAST/news/smokestack-plumes.html NASA Goddard Space Flight Center is home to the nation's largest organization of combined scientists, engineers and technologists that build spacecraft, instruments and new technology to study the Earth, the sun, our solar system, and the universe.

A mutation in the interferon regulatory element of HBV may influence the response of interferon treatment in chronic hepatitis B patients.

PubMed

Lu, Jia-Jie; Chen, En-Qiang; Yang, Jia-Hong; Zhou, Tao-You; Liu, Li; Tang, Hong

2012-01-10

A functional interferon regulatory element (IRE) has been found in the EnhI/X promoter region of hepatitis B virus (HBV) genome. The purpose of this study is to compare the gene order of responder and non-responder to interferon therapy in patients with chronic hepatitis B (CHB), so as to evaluate the relationship between IRE mutation and the response to interferon treatment for CHB patients. Synthetic therapeutic effect is divided into complete response (CR), partial response (PR) and non-response (NR). Among the 62 cases included in this study, 40 cases (64.5%) were in the response group (CR and PR) and 22 (35.5%) cases were in the NR group. Wild type sequence of HBV IRE TTTCACTTTC were found in 35 cases (56.5%), and five different IRE gene sequences. included TTTtACTTTC, TTTCAtTTTC, TTTtAtTTTC, TTTtACTTTt and cTTtACcTTC, were found in 22 cases (35.5%), 1 case (1.6%), 1 case (1.6%), 2 cases (3.2%) and 1 case (1.6%) respectively. There were 41.9%cases (26/62) with forth base C→T mutation, consisted of 32.5% (13/40) cases in response group and 59.1% (13/22) cases in NR group. Among the 35 cases with IRE sequences, there were 67.5% (27/40) cases in response group and 36.4% (8/22) in NR group, and the difference in IRE sequences between two groups was statistic significantly (P = 0.027). The result suggested that there is likely relationship between the forth base mutation (C→T) of IRE region and the response of HBV to Interferon therapy, and this mutation may partially decrease the inhibition effect of interferon on HBV. The forth base C→T mutation in IRE element of HBV may partially influence the response of Interferon treatment in CHB patients.

Expression of interferon-gamma and tumour necrosis factor-alpha messenger RNA does not correlate with protection in guinea pigs challenged with virulent Mycobacterium tuberculosis by the respiratory route.

PubMed

Jeevan, Amminikutty; Bonilla, Diana Lucia; McMurray, David Neil

2009-09-01

Cytokine messenger RNA (mRNA) expression was investigated in the spleen and lung digest cells of bacillus Calmette-Guérin (BCG)-vaccinated and non-vaccinated guinea pigs following low-dose, pulmonary exposure to virulent Mycobacterium tuberculosis. After purified protein derivative (PPD) stimulation, the levels of lung cell interferon-gamma (IFN-gamma), tumour necrosis factor-alpha (TNF-alpha) and spleen cell interleukin-12 (IL-12) p40 mRNAs were significantly increased in the non-vaccinated M. tuberculosis-infected guinea pigs compared to the BCG-vaccinated guinea pigs. In contrast, the expression of anti-inflammatory transforming growth factor-beta and IL-10 mRNAs was significantly enhanced in the spleens of BCG-vaccinated animals. Despite the presence of protective cytokine mRNA expression, the non-vaccinated guinea pigs had significantly higher lung and spleen bacterial burdens. In contrast, BCG-vaccinated guinea pigs controlled the bacterial multiplication in their lungs and spleens, indicating that both protective as well as anti-inflammatory cytokine responses are associated with a reduction in bacteria. In addition, lung digest cells from non-vaccinated guinea pigs contained a significantly higher percentage of neutrophils, CD3(+) and CD8(+) T cells, while the percentage of macrophages was increased in the BCG-vaccinated animals. Total and purified lung digest T cells co-cultured with lung macrophages (LMøs) proliferated poorly after PPD stimulation in both non-vaccinated and BCG-vaccinated animals while robust proliferation to PPD was observed when T cells were co-cultured with peritoneal macrophages (PMøs). Macrophages within the lung compartment appear to regulate the response of T cells irrespective of the vaccination status in guinea pigs. Taken together, our results suggest that type I cytokine mRNA expression is not associated with vaccine-induced protection in the low-dose guinea pig model of tuberculosis.

Interleukin-28B polymorphisms and interferon gamma inducible protein-10 serum levels in seronegative occult hepatitis C virus infection.

PubMed

Bartolomé, Javier; Castillo, Inmaculada; Quiroga, Juan Antonio; Carreño, Vicente

2016-02-01

Polymorphisms upstream interleukin (IL)-28B gene and serum levels of interferon gamma inducible protein-10 (IP-10) are associated with spontaneous and treatment-induced hepatitis C virus (HCV) clearance. Patients with seronegative occult HCV infection are anti-HCV and serum HCV-RNA negative but have viral RNA in liver and abnormal values of liver enzymes. We examined if the rs12979860 polymorphism of IL-28B and serum IP-10 levels differ between chronic and seronegative occult CV infection. IL-28B polymorphism was determined with allele specific TaqMan probes in total DNA isolated from peripheral blood mononuclear cells and IP-10 by an enzyme-linked immunosorbent assay in serum from 99 patients with seronegative occult HCV infection and 130 untreated patients with chronic hepatitis C. IL-28B genotypes were also determined in 54 healthy volunteers. Prevalence of the IL-28B CC genotype was significantly higher in seronegative occult HCV infection (52/99; 52.5%) than in chronic hepatitis C (32/130; 24.6%, P < 0.0001) or healthy controls (19/54: 32.5%, P = 0.039). Among patients with seronegative occult HCV infection, HCV-RNA load in liver was significantly lower in those with the IL-28B CC genotype than in those with CT + TT genotypes (2.8 × 10(5)  ± 5.8 × 10(4) vs. 4.1 × 10(5)  ± 5.9 × 10(4)  copies/μg of total RNA respectively; P = 0.023). Mean serum IP-10 levels were significantly lower in patients with seronegative occult HCV infection than in patients with chronic hepatitis C (160.8 ± 17.9 vs. 288.7 ± 13.3 pg/ml respectively; P < 0.0001). These findings suggest that the host immune response plays an important role in seronegative occult HCV infection in comparison with chronic hepatitis C. © 2015 Wiley Periodicals, Inc.

Enhancement of antiproliferative activity of interferons by RNA interference-mediated silencing of SOCS gene expression in tumor cells.

PubMed

Takahashi, Yuki; Kaneda, Haruka; Takasuka, Nana; Hattori, Kayoko; Nishikawa, Makiya; Watanabe, Yoshihiko; Takakura, Yoshinobu

2008-08-01

The suppressor of cytokine signaling (SOCS) proteins, negative regulators of interferon (IFN)-induced signaling pathways, is involved in IFN resistance of tumor cells. To improve the growth inhibitory effect of IFN-beta and IFN-gamma on a murine melanoma cell line, B16-BL6, and a murine colon carcinoma cell line, Colon26 cells, SOCS-1 and SOCS-3 gene expression in tumor cells was downregulated by transfection of plasmid DNA expressing short hairpin RNA targeting one of these genes (pshSOCS-1 and pshSOCS-3, respectively). Transfection of pshSOCS-1 significantly increased the antiproliferative effect of IFN-gamma on B16-BL6 cells. However, any other combinations of plasmids and IFN had little effect on the growth of B16-BL6 cells. In addition, transfection of pshSOCS-1 and pshSOCS-3 produced little improvement in the effect of IFN on Colon26 cells. To understand the mechanism underlining these findings, the level of SOCS gene expression was measured by real time polymerase chain reaction. Addition of IFN-gamma greatly increased the SOCS-1 mRNA expression in B16-BL6 cells. Taking into account the synergistic effect of pshSOCS-1 and IFN-gamma on the growth of B16-BL6 cells, these findings suggest that IFN-gamma-induced high SOCS-1 gene expression in B16-BL6 cells significantly interferes with the antiproliferative effect of IFN-gamma. These results indicate that silencing SOCS gene expression can be an effective strategy to enhance the antitumor effect of IFN under conditions in which the SOCS gene expression is upregulated by IFN.

The Predominant CD4+ Th1 Cytokine Elicited to Chlamydia trachomatis Infection in Women Is Tumor Necrosis Factor Alpha and Not Interferon Gamma

PubMed Central

Gupta, Kanupriya; Ogendi, Brian M. O.; Bakshi, Rakesh K.; Kapil, Richa; Press, Christen G.; Sabbaj, Steffanie; Lee, Jeannette Y.

2017-01-01

ABSTRACT Chlamydia trachomatis infection is the most prevalent bacterial sexually transmitted infection and can cause significant reproductive morbidity in women. There is insufficient knowledge of C. trachomatis-specific immune responses in humans, which could be important in guiding vaccine development efforts. In contrast, murine models have clearly demonstrated the essential role of T helper type 1 (Th1) cells, especially interferon gamma (IFN-γ)-producing CD4+ T cells, in protective immunity to chlamydia. To determine the frequency and magnitude of Th1 cytokine responses elicited to C. trachomatis infection in humans, we stimulated peripheral blood mononuclear cells from 90 chlamydia-infected women with C. trachomatis elementary bodies, Pgp3, and major outer membrane protein and measured IFN-γ-, tumor necrosis factor alpha (TNF-α)-, and interleukin-2 (IL-2)-producing CD4+ and CD8+ T-cell responses using intracellular cytokine staining. The majority of chlamydia-infected women elicited CD4+ TNF-α responses, with frequency and magnitude varying significantly depending on the C. trachomatis antigen used. CD4+ IFN-γ and IL-2 responses occurred infrequently, as did production of any of the three cytokines by CD8+ T cells. About one-third of TNF-α-producing CD4+ T cells coproduced IFN-γ or IL-2. In summary, the predominant Th1 cytokine response elicited to C. trachomatis infection in women was a CD4+ TNF-α response, not CD4+ IFN-γ, and a subset of the CD4+ TNF-α-positive cells produced a second Th1 cytokine. PMID:28100498

IFN-gamma Impairs Release of IL-8 by IL-1beta-stimulated A549 Lung Carcinoma Cells

PubMed Central

Boost, Kim A; Sadik, Christian D; Bachmann, Malte; Zwissler, Bernhard; Pfeilschifter, Josef; Mühl, Heiko

2008-01-01

Background Production of interferon (IFN)-γ is key to efficient anti-tumor immunity. The present study was set out to investigate effects of IFNγ on the release of the potent pro-angiogenic mediator IL-8 by human A549 lung carcinoma cells. Methods A549 cells were cultured and stimulated with interleukin (IL)-1β alone or in combination with IFNγ. IL-8 production by these cells was analyzed with enzyme linked immuno sorbent assay (ELISA). mRNA-expression was analyzed by real-time PCR and RNase protection assay (RPA), respectively. Expression of inhibitor-κ Bα, cellular IL-8, and cyclooxygenase-2 was analyzed by Western blot analysis. Results Here we demonstrate that IFNγ efficiently reduced IL-8 secretion under the influence of IL-1β. Surprisingly, real-time PCR analysis and RPA revealed that the inhibitory effect of IFNγ on IL-8 was not associated with significant changes in mRNA levels. These observations concurred with lack of a modulatory activity of IFNγ on IL-1β-induced NF-κB activation as assessed by cellular IκB levels. Moreover, analysis of intracellular IL-8 suggests that IFNγ modulated IL-8 secretion by action on the posttranslational level. In contrast to IL-8, IL-1β-induced cyclooxygenase-2 expression and release of IL-6 were not affected by IFNγ indicating that modulation of IL-1β action by this cytokine displays specificity. Conclusion Data presented herein agree with an angiostatic role of IFNγ as seen in rodent models of solid tumors and suggest that increasing T helper type 1 (Th1)-like functions in lung cancer patients e.g. by local delivery of IFNγ may mediate therapeutic benefit via mechanisms that potentially include modulation of pro-angiogenic IL-8. PMID:18801189

Should they stay, or should they go? Relative future risk of bovine tuberculosis for interferon-gamma test-positive cattle left on farms.

PubMed

Lahuerta-Marin, Angela; Gallagher, Martin; McBride, Stewart; Skuce, Robin; Menzies, Fraser; McNair, Jim; McDowell, Stanley W J; Byrne, Andrew W

2015-09-04

Bovine tuberculosis (bTB), caused by Mycobacterium bovis, is a serious infectious disease that remains an ongoing concern for cattle farming worldwide. Tuberculin skin-tests are often used to identify infected animals (reactors) during test-and-cull programs, however, due to relatively poor sensitivity, additional tests can be implemented in parallel. For example, in Northern Ireland interferon-gamma (IFN-g) testing is used in high-risk herds. However, skin-test negative animals which are positive to the IFN-g test are not required by law to be slaughtered - therefore the final choice for these animals' fate is left with the owner. During this study we investigated whether these animals represented a greater risk of becoming a skin reactor, relative to IFN-g test negative animals from the same herds. Our study population included 1107 IFN-g positive animals from 239 herds. A Cox-proportional hazard model indicated that animals which tested IFN-g positive were 2.31 times (95% CI: 1.92-2.79; P < 0.001) more likely to become a reactor compared with IFN-g negative animals. Animals from dairy herds, and from herds in the south-east, were of higher risk than animals from beef herds and other regions, respectively. Our findings suggest that IFN-g positive animals represent a higher risk of failing a skin-test in the future, indicating the value of IFN-g testing for identifying early-stage infected animals. These IFN-g positive animals are not under any disease restriction, and may move freely (trade), which may put recipient herds at increased risk. Our findings provide important evidence for stakeholders engaged in bTB eradication programs.

Card9- and MyD88-Mediated Gamma Interferon and Nitric Oxide Production Is Essential for Resistance to Subcutaneous Coccidioides posadasii Infection.

PubMed

Hung, Chiung-Yu; Castro-Lopez, Natalia; Cole, Garry T

2016-04-01

Coccidioidomycosis is a potentially life-threatening respiratory disease which is endemic to the southwestern United States and arid regions of Central and South America. It is responsible for approximately 150,000 infections annually in the United States alone. Almost every human organ has been reported to harbor parasitic cells of Coccidioides spp. in collective cases of the disseminated form of this mycosis. Current understanding of the mechanisms of protective immunity against lung infection has been largely derived from murine models of pulmonary coccidioidomycosis. However, little is known about the nature of the host response to Coccidioides in extrapulmonary tissue. Primary subcutaneous coccidioidal infection is rare but has been reported to result in disseminated disease. Here, we show that activation of MyD88 and Card9 signal pathways are required for resistance to Coccidioides infection following subcutaneous challenge of C57BL/6 mice, which correlates with earlier findings of the protective response to pulmonary infection. MyD88(-/-) andCard9(-/-) mice recruited reduced numbers of T cells, B cells, and neutrophils to the Coccidioides-infected hypodermis com pared to wild-type mice; however, neutrophils were dispensable for resistance to skin infection. Further studies have shown that gamma interferon (IFN-γ) production and activation of Th1 cells characterize resistance to subcutaneous infection. Furthermore, activation of a phagosomal enzyme, inducible nitric oxide synthase, which is necessary for NO production, is a requisite for fungal clearance in the hypodermis. Collectively, our data demonstrate that MyD88- and Card9-mediated IFN-γ and nitric oxide production is essential for protection against subcutaneous Coccidioides infection. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Coordinated therapeutic effects of immune modulators and interferon.

PubMed Central

Cerutti, I; Chany, C

1983-01-01

Immune modulators injected 24 h before encephalomyocarditis virus significantly increase antiviral resistance in mice when interferon is administered 1 h after the virus. These immune modulators can be crude bacterial extracts or synthetic drugs. In some cases, the responses are additive; in others, they are clearly cooperative. To protect the mice against the development of 180 TG Crocker sarcomas, the association of bacterial extracts and interferon is highly effective under the condition that the drug concentrations and chronological order and number of injections are well defined. In contrast, the conjunction of interferon and synthetic immune modulators, in particular cimetidine, result in delayed tumor development with no significant change in the final survival rate in the experimental model described here. PMID:6315585

Regulation of Production of Mucosal Antibody to Pneumococcal Protein Antigens by T-Cell-Derived Gamma Interferon and Interleukin-10 in Children

PubMed Central

Zhang, Qibo; Bernatoniene, Jolanta; Bagrade, Linda; Paton, James C.; Mitchell, Timothy J.; Hammerschmidt, Sven; Nunez, Desmond A.; Finn, Adam

2006-01-01

Nasopharyngeal tonsils (adenoids) are part of human nasopharynx-associated lymphoid tissue, which may play an important role in local defense against pneumococci. Recent studies with animals have suggested that several pneumococcal proteins, including CbpA and pneumolysin (Ply), may be vaccine candidates. Our recent data obtained with children suggest that antibodies to these proteins may protect against carriage. This study was performed to investigate the regulation of the T-cell-dependent antibody responses to CbpA and pneumolysin by cytokines in adenoidal immune cells from children. Adenoidal mononuclear cells (MNC) were cultured with pneumococcal concentrated culture supernatants (CCS) or recombinant proteins. Cytokine expression profiles in adenoidal MNC after antigen stimulation were analyzed by reverse transcription-PCR, protein array analysis, and an immunoassay, along with an antibody production analysis. The roles, interactions, and cellular sources of the main cytokines identified were evaluated further. Pneumococcal CCS induced production of CbpA- and Ply-specific antibodies in association with several chemokines and cytokines, including gamma interferon (IFN-γ) and interleukin-10 (IL-10) in MNC. The antibody production correlated well with the concentrations of these two cytokines. Addition of recombinant IFN-γ or IL-10 enhanced antibody production, and monoclonal antibodies to these two cytokines and T-cell depletion significantly reduced antibody production. Intracellular cytokine staining showed that T cells are a major source of IFN-γ and IL-10. Recombinant Ply and, to a lesser extent, recombinant CbpA induced significant production of IFN-γ and IL-10 in MNC. T-cell-derived IFN-γ and IL-10 may be key regulators of production of mucosal antibody to pneumococcal protein antigens in the nasopharynx and may play an important role in local protection against pneumococcal infection in children. PMID:16861661

Effect of pro-inflammatory mediators on membrane-associated mucins expressed by human ocular surface epithelial cells.

PubMed

Albertsmeyer, Ann-Christin; Kakkassery, Vinodh; Spurr-Michaud, Sandra; Beeks, Olivia; Gipson, Ilene K

2010-03-01

Membrane-associated mucins are altered on the ocular surface in non-Sjögren's dry eye. This study sought to determine if inflammatory mediators, present in tears of dry eye patients, regulate membrane-associated mucins MUC1 and -16 at the level of gene expression, protein biosynthesis and/or ectodomain release. A human corneal limbal epithelial cell line (HCLE), which produces membrane-associated mucins, was used. Cells were treated with interleukin (IL)-6, -8, or -17, tumor necrosis factor-alpha (TNF-alpha), and Interferon-gamma (IFN-gamma), or a combination of TNF-alpha and IFN-gamma, or IFN-gamma and IL-17, for 1, 6, 24, or 48 h. Presence of receptors for these mediators was verified by RT-PCR. Effects of the cytokines on expression levels of MUC1 and -16 were determined by real-time PCR, and on mucin protein biosynthesis and ectodomain release in cell lysates and culture media, respectively, by immunoblot analysis. TNF-alpha and IFN-gamma each significantly induced MUC1 expression, cellular protein content and ectodomain release over time. Combined treatment with the two cytokines was not additive. By comparison, one of the inflammatory mediators, IFN-gamma, affected all three parameters-gene expression, cellular protein, and ectodomain release-for MUC16. Combined treatment with TNF-alpha and IFN-gamma showed effects similar to IFN-gamma alone, except that ectodomain release followed that of TNF-alpha, which induced MUC16 ectodomain release. In conclusion, inflammatory mediators present in tears of dry eye patients can affect MUC1 and -16 on corneal epithelial cells and may be responsible for alterations of surface mucins in dry eye.

Feline Tetherin Efficiently Restricts Release of Feline Immunodeficiency Virus but Not Spreading of Infection▿

PubMed Central

Dietrich, Isabelle; McMonagle, Elizabeth L.; Petit, Sarah J.; Vijayakrishnan, Swetha; Logan, Nicola; Chan, Chi N.; Towers, Greg J.; Hosie, Margaret J.; Willett, Brian J.

2011-01-01

Domestic cats endure infections by all three subfamilies of the retroviridae: lentiviruses (feline immunodeficiency virus [FIV]), gammaretroviruses (feline leukemia virus [FeLV]), and spumaretroviruses (feline foamy virus [FFV]). Thus, cats present an insight into the evolution of the host-retrovirus relationship and the development of intrinsic/innate immune mechanisms. Tetherin (BST-2) is an interferon-inducible transmembrane protein that inhibits the release of enveloped viruses from infected cells. Here, we characterize the feline homologue of tetherin and assess its effects on the replication of FIV. Tetherin was expressed in many feline cell lines, and expression was induced by interferons, including alpha interferon (IFN-α), IFN-ω, and IFN-γ. Like human tetherin, feline tetherin displayed potent inhibition of FIV and HIV-1 particle release; however, this activity resisted antagonism by either HIV-1 Vpu or the FIV Env and “OrfA” proteins. Further, as overexpression of complete FIV genomes in trans could not overcome feline tetherin, these data suggest that FIV lacks a functional tetherin antagonist. However, when expressed stably in feline cell lines, tetherin did not abrogate the replication of FIV; indeed, syncytium formation was significantly enhanced in tetherin-expressing cells infected with cell culture-adapted (CD134-independent) strains of FIV (FIV Fca-F14 and FIV Pco-CoLV). Thus, while tetherin may prevent the release of nascent viral particles, cell-to-cell spread remains efficient in the presence of abundant viral receptors and tetherin upregulation may enhance syncytium formation. Accordingly, tetherin expression in vivo may promote the selective expansion of viral variants capable of more efficient cell-to-cell spread. PMID:21490095

Feline tetherin efficiently restricts release of feline immunodeficiency virus but not spreading of infection.

PubMed

Dietrich, Isabelle; McMonagle, Elizabeth L; Petit, Sarah J; Vijayakrishnan, Swetha; Logan, Nicola; Chan, Chi N; Towers, Greg J; Hosie, Margaret J; Willett, Brian J

2011-06-01

Domestic cats endure infections by all three subfamilies of the retroviridae: lentiviruses (feline immunodeficiency virus [FIV]), gammaretroviruses (feline leukemia virus [FeLV]), and spumaretroviruses (feline foamy virus [FFV]). Thus, cats present an insight into the evolution of the host-retrovirus relationship and the development of intrinsic/innate immune mechanisms. Tetherin (BST-2) is an interferon-inducible transmembrane protein that inhibits the release of enveloped viruses from infected cells. Here, we characterize the feline homologue of tetherin and assess its effects on the replication of FIV. Tetherin was expressed in many feline cell lines, and expression was induced by interferons, including alpha interferon (IFN-α), IFN-ω, and IFN-γ. Like human tetherin, feline tetherin displayed potent inhibition of FIV and HIV-1 particle release; however, this activity resisted antagonism by either HIV-1 Vpu or the FIV Env and "OrfA" proteins. Further, as overexpression of complete FIV genomes in trans could not overcome feline tetherin, these data suggest that FIV lacks a functional tetherin antagonist. However, when expressed stably in feline cell lines, tetherin did not abrogate the replication of FIV; indeed, syncytium formation was significantly enhanced in tetherin-expressing cells infected with cell culture-adapted (CD134-independent) strains of FIV (FIV Fca-F14 and FIV Pco-CoLV). Thus, while tetherin may prevent the release of nascent viral particles, cell-to-cell spread remains efficient in the presence of abundant viral receptors and tetherin upregulation may enhance syncytium formation. Accordingly, tetherin expression in vivo may promote the selective expansion of viral variants capable of more efficient cell-to-cell spread.

Interferon action: two (2'-5')(A)n synthetases specified by distinct mRNAs in Ehrlich ascites tumor cells treated with interferon.

PubMed

St Laurent, G; Yoshie, O; Floyd-Smith, G; Samanta, H; Sehgal, P B; Lengyel, P

1983-05-01

(2'-5')(A)n synthetase and RNAase L (a latent endoribonuclease) are among the mediators of interferon action. The product of (2'-5')(A)n synthetase (i.e., (2'-5')(A)n) binds, and thereby activates RNAase L. Interferons induce in Ehrlich ascites tumor (EAT) cells two mRNAs (sizes 1.5 kb and 3.8 kb), which can be translated in Xenopus oocytes into (2'-5')(A)n synthetases of 20,000 to 30,000 daltons and 85,000 to 100,000 daltons, respectively. (2'-5')(A)n synthetases of corresponding sizes are induced by interferons in EAT cells. In the cell extract the bulk of the larger enzyme is in the cytoplasmic fraction, and the bulk of the smaller one in the nuclear fraction. The only known function of (2'-5')(A)n is the activation of RNAase L, and RNAase L can be selectively crosslinked to a (2'-5')(A)n derivative in a cytoplasmic extract from EAT cells. The same (2'-5')(A)n derivative can be crosslinked to several proteins in the nuclear extract of EAT cells, and some of these proteins are induced by interferon.

Interferon-λ restricts West Nile virus neuroinvasion by tightening the blood-brain barrier.

PubMed

Lazear, Helen M; Daniels, Brian P; Pinto, Amelia K; Huang, Albert C; Vick, Sarah C; Doyle, Sean E; Gale, Michael; Klein, Robyn S; Diamond, Michael S

2015-04-22

Although interferon-λ [also known as type III interferon or interleukin-28 (IL-28)/IL-29] restricts infection by several viruses, its inhibitory mechanism has remained uncertain. We used recombinant interferon-λ and mice lacking the interferon-λ receptor (IFNLR1) to evaluate the effect of interferon-λ on infection with West Nile virus, an encephalitic flavivirus. Cell culture studies in mouse keratinocytes and dendritic cells showed no direct antiviral effect of exogenous interferon-λ, even though expression of interferon-stimulated genes was induced. We observed no differences in West Nile virus burden between wild-type and Ifnlr1(-/-) mice in the draining lymph nodes, spleen, or blood. We detected increased West Nile virus infection in the brain and spinal cord of Ifnlr1(-/-) mice, yet this was not associated with a direct antiviral effect in mouse neurons. Instead, we observed an increase in blood-brain barrier permeability in Ifnlr1(-/-) mice. Treatment of mice with pegylated interferon-λ2 resulted in decreased blood-brain barrier permeability, reduced West Nile virus infection in the brain without affecting viremia, and improved survival against lethal virus challenge. An in vitro model of the blood-brain barrier showed that interferon-λ signaling in mouse brain microvascular endothelial cells increased transendothelial electrical resistance, decreased virus movement across the barrier, and modulated tight junction protein localization in a protein synthesis- and signal transducer and activator of transcription 1 (STAT1)-independent manner. Our data establish an indirect antiviral function of interferon-λ in which noncanonical signaling through IFNLR1 tightens the blood-brain barrier and restricts viral neuroinvasion and pathogenesis. Copyright © 2015, American Association for the Advancement of Science.

Interferons and Their Receptors in Birds: A Comparison of Gene Structure, Phylogenetic Analysis, and Cross Modulation

PubMed Central

Zhou, Hao; Chen, Shun; Wang, Mingshu; Cheng, Anchun

2014-01-01

Interferon may be thought of as a key, with the interferon receptor as the signal lock: Crosstalk between them maintains their balance during viral infection. In this review, the protein structure of avian interferon and the interferon receptor are discussed, indicating remarkable similarity between different species. However, the structures of the interferon receptors are more sophisticated than those of the interferons, suggesting that the interferon receptor is a more complicated signal lock system and has considerable diversity in subtypes or structures. Preliminary evolutionary analysis showed that the subunits of the interferon receptor formed a distinct clade, and the orthologs may be derived from the same ancestor. Furthermore, the development of interferons and interferon receptors in birds may be related to an animal’s age and the maintenance of a balanced state. In addition, the equilibrium between interferon and its receptor during pathological and physiological states revealed that the virus and the host influence this equilibrium. Birds could represent an important model for studies on interferon’s antiviral activities and may provide the basis for new antiviral strategies. PMID:25405736

Blockade of interferon Beta, but not interferon alpha, signaling controls persistent viral infection.

PubMed

Ng, Cherie T; Sullivan, Brian M; Teijaro, John R; Lee, Andrew M; Welch, Megan; Rice, Stephanie; Sheehan, Kathleen C F; Schreiber, Robert D; Oldstone, Michael B A

2015-05-13

Although type I interferon (IFN-I) is thought to be beneficial against microbial infections, persistent viral infections are characterized by high interferon signatures suggesting that IFN-I signaling may promote disease pathogenesis. During persistent lymphocytic choriomeningitis virus (LCMV) infection, IFNα and IFNβ are highly induced early after infection, and blocking IFN-I receptor (IFNAR) signaling promotes virus clearance. We assessed the specific roles of IFNβ versus IFNα in controlling LCMV infection. While blockade of IFNβ alone does not alter early viral dissemination, it is important in determining lymphoid structure, lymphocyte migration, and anti-viral T cell responses that lead to accelerated virus clearance, approximating what occurs during attenuation of IFNAR signaling. Comparatively, blockade of IFNα was not associated with improved viral control, but with early dissemination of virus. Thus, despite their use of the same receptor, IFNβ and IFNα have unique and distinguishable biologic functions, with IFNβ being mainly responsible for promoting viral persistence. Copyright © 2015 Elsevier Inc. All rights reserved.

Inhibition by antioxidants of nitric oxide synthase expression in murine macrophages: role of nuclear factor kappa B and interferon regulatory factor 1.

PubMed Central

Hecker, M.; Preiss, C.; Klemm, P.; Busse, R.

1996-01-01

1. In view of the potential deleterious effects of high amounts of nitric oxide (NO) produced by the inducible isoform of NO synthase (iNOS) in inflammation, the prevention of the expression of this enzyme represents an important therapeutic goal. In cytokine-stimulated cells, activation of nuclear factor kappa B (NF-kappa B) is crucial for the increase in iNOS gene expression. Since NF-kappa B activation appears to involve a redox-sensitive step, we have investigated whether three structurally unrelated antioxidants, 5,7-dihydroxyflavone (chrysin), 3,4-dichloroisocoumarin (DCI) and N-acetyl 5-hydroxytryptamine (N-acetylserotonin, NAS), affect iNOS expression in cultured RAW 264.7 monocyte/macrophages stimulated with bacterial lipopolysaccharide (LPS, 140 ng ml-1) and interferon-gamma (IFN gamma, 5 u ml-1). 2. During a 6 h incubation period neither LPS nor IFN gamma alone exerted a significant effect but when combined, caused a prominent increase in nitrite formation, iNOS mRNA and protein abundance. Co-incubation with chrysin (50 microM), DCI (50 microM) or NAS (1 mM) markedly attenuated this increase in iNOS gene expression. 3. DCI, but not chrysin or NAS, prevented the activation of NF-kappa B in cells exposed to LPS plus IFN gamma for 30 min. In contrast, all three antioxidants significantly blunted the DNA-binding activity of interferon regulatory factor 1 (IRF-1), which mediates the synergistic effect of IFN gamma on iNOS gene expression in cells treated for 2 h with LPS plus IFN gamma. 4. DCI thus appears to inhibit iNOS gene expression at the transcriptional level by preventing the activation of both NF-kappa B and IRF-1. The inhibitory effect of DCI on NF-kappa B activation, however, does not seem to be related to its antioxidative properties, since DCI, unlike chrysin or NAS, is a potent serine protease inhibitor which stabilizes the inactive NF-kappa B complex by protecting the inhibitory I kappa B-alpha subunit from proteolytic degradation. 5. The

Influence of exercise on NA- and Hsp72-induced release of IFNγ by the peritoneal suspension of macrophages and lymphocytes from genetically obese Zucker rats.

PubMed

Martín-Cordero, L; García, J J; Hinchado, M D; Bote, E; Ortega, E

2013-03-01

Regular physical exercise is recognized as a nonpharmacological therapeutic strategy in the treatment of metabolic syndrome, and has been proposed for improving obesity, diabetic status, insulin resistance, and immune response. The aim of the present study was to evaluate the effect of a regular exercise program (treadmill running, 5 days/week for 14 weeks at 35 cm/s for 35 min in the last month) on the release of the pro-inflammatory cytokine interferon gamma (IFNγ) by peritoneal cells (macrophages and lymphocytes) from obese Zucker rats (fa/fa) in response to noradrenaline (NA) and heat shock proteins of 72 kDa (Hsp72), and the possible adaptation due to training for a bout acute exercise (a single session of 25-35 min at 35 cm/s). In healthy (lean Fa/fa) and obese animals, peritoneal cells released greater concentrations of IFNγ in response to Hsp72 and lower concentrations in response to NA. The regular exercise training protocol, evaluated in the obese animals, produced a clear change in the regulation of the release of IFNγ. Peritoneal immune cells from trained animals released more IFNγ in response to NA, but there was a reduction in the release of IFNγ in response to Hsp72. In the obese animals, regular exercise caused a change in the inhibitory effect of NA (which now becomes stimulatory) and the stimulatory effect of Hsp72e (which now becomes inhibitory) in relation to the release of IFNγ. This reflects that Hsp72, induced by the prior release of NA following exercise-induced stress, plays a role in the homeostatic balance of release of IFNγ by peritoneal immune cells in obese animals during exercise.

A comparison of mucosal inflammatory responses to Giardia muris in resistant B10 and susceptible BALB/c mice.

PubMed

Venkatesan, P; Finch, R G; Wakelin, D

1997-03-01

In the first three weeks of primary Giardia muris infections B10 mice clear infection more rapidly than BALB/c mice. There is evidence that interferon-gamma contributes to the relative resistance of B10 mice. The nature of the functional contribution of interferon-gamma is unclear and does not relate to the secretory or serum antibody response. Mucosal inflammatory events in these strains have been studied. Apart from a small rise in both strains of goblet cell and mucosal mast cell numbers, associated with release of mast cell protease-1 in serum, no inflammatory infiltrate was observed at the time trophozoites were cleared from the intestinal lumen. Inhibition of mast cell products (5-hydroxytryptamine and histamine) by cyproheptadine enhanced the intensity of infection in both strains. The relative resistance of B10 mice could not be explained in terms of the mucosal inflammatory response.

Cross-talk between IGF-1 and estrogen receptors attenuates intracellular changes in ventral spinal cord 4.1 motoneuron cells because of interferon-gamma exposure.

PubMed

Park, Sookyoung; Nozaki, Kenkichi; Smith, Joshua A; Krause, James S; Banik, Naren L

2014-03-01

Insulin-like growth factor-1 (IGF-1) is a neuroprotective growth factor that promotes neuronal survival by inhibition of apoptosis. To examine whether IGF-1 exerts cytoprotective effects against extracellular inflammatory stimulation, ventral spinal cord 4.1 (VSC4.1) motoneuron cells were treated with interferon-gamma (IFN-γ). Our data demonstrated apoptotic changes, increased calpain:calpastatin and Bax:Bcl-2 ratios, and expression of apoptosis-related proteases (caspase-3 and -12) in motoneurons rendered by IFN-γ in a dose-dependent manner. Post-treatment with IGF-1 attenuated these changes. In addition, IGF-1 treatment of motoneurons exposed to IFN-γ decreased expression of inflammatory markers (cyclooxygenase-2 and nuclear factor-kappa B:inhibitor of kappa B ratio). Furthermore, IGF-1 attenuated the loss of expression of IGF-1 receptors (IGF-1Rα and IGF-1Rβ) and estrogen receptors (ERα and ERβ) induced by IFN-γ. To determine whether the protective effects of IGF-1 are associated with ERs, ERs antagonist ICI and selective siRNA targeted against ERα and ERβ were used in VSC4.1 motoneurons. Distinctive morphological changes were observed following siRNA knockdown of ERα and ERβ. In particular, apoptotic cell death assessed by TUNEL assay was enhanced in both ERα and ERβ-silenced VSC4.1 motoneurons following IFN-γ and IGF-1 exposure. These results suggest that IGF-1 protects motoneurons from inflammatory insult by a mechanism involving pivotal interactions with ERα and ERβ. © 2013 International Society for Neurochemistry.

Cross-talk between interferon-gamma and interleukin-18 in melanogenesis.

PubMed

Zhou, Jia; Ling, Jingjing; Wang, Yong; Shang, Jing; Ping, Fengfeng

2016-10-01

Skin is the largest organ in our body and strategically placed to provide a metabolically active biological barrier against a range of noxious stressors. A lot of inflammatory cytokines, which are increased after ultraviolet (UV) irradiation produced by keratinocytes or other immunocytes, are closely related to pigmentary changes, including interleukin-18 (IL-18) and interferon-γ (IFN-γ). In this study, the effect of cross-talk between IL-18 and IFN-γ on melanogenesis was investigated. Treatment with IL-18 resulted in a dose-dependent increase of melanogenesis, while IFN-γ made an opposite effect. This influence of IL-18 and IFN-γ was mediated by regulations of microphthalmia-associated transcription factor (MITF) and its downstream enzymatic cascade expressions. Furthermore, IFN-γ inhibited basal and IL-18-induced melanogenesis. IFN-γ increased signal transducer and activator of transcription-1 (STAT-1) phosphorylation to play its position in regulating melanin pigmentation, and its inhibitory effect could be prevented by Janus Kinase 1 (JAK 1) inhibitor. IFN-γ could inhibit melanogenesis by decreasing melanocyte dendrite formation. In addition, IFN-γ inhibited the expressions of Rab Pases to suppress the mature and transport of melanosomes. IL-18 could rapidly induce Akt and PTEN phosphorylation and p65 expression in B16F10 cells. When treatment with IL-18 and IFN-γ together, the phosphorylation level of Protein Kinase B (Akt) and phosphatase and tensin homolog deleted on chromosome ten (PTEN) and expression of p65 NF-κB were inhibited, compared with treated with IL-18 only. Our studies indicated that IFN-γ could directly induce B16F10 cells apoptosis in vitro. Furthermore, we demonstrated that IFN-γ markedly up-regulated IL-18 binding protein (BP) production in normal human foreskin-derived epidermal keratinocytes in dose-dependent manner. UVB irradiation induced protease-activated receptor-2 (PAR-2) expression in NHEK, IFN-γ could inhibit this

Human interferon and its inducers: clinical program overview at Roswell Park Memorial Institute.

PubMed

Carter, W A; Horoszewicz, J S

1978-11-01

An overview of the clinical interferon program at Roswell Park Memorial Institute is presented. Purified fibroblast interferon and a novel inducer of human interferon [rIn-r(C12,U)n] are being evaluated for possible antiviral, antiproliferative, and immunomodulatory activities in patients with cancer.

Suppressing effect of low-dose gamma-ray irradiation on collagen-induced arthritis.

PubMed

Nakatsukasa, Hiroko; Tsukimoto, Mitsutoshi; Ohshima, Yasuhiro; Tago, Fumitoshi; Masada, Ayako; Kojima, Shuji

2008-07-01

We previously reported attenuation of autoimmune disease by low-dose gamma-ray irradiation in MRL-lpr/lpr mice. Here, we studied the effect of low-dose gamma-ray irradiation on collagen-induced arthritis (CIA) in DBA/1J mice. Mice were immunized with type II collagen, and exposed to low-dose gamma-rays (0.5 Gy per week for 5 weeks). Paw swelling, redness, and bone degradation were suppressed by irradiation, which also delayed the onset of pathological change and reduced the severity of the arthritis. Production of tumor necrosis factor-alpha, interferon-gamma, and interleukin-6, which play important roles in the onset of CIA, was suppressed by the irradiation. The level of anti-type II collagen antibody, which is essential for the onset of CIA, was also lower in irradiated CIA mice. The population of plasma cells was increased in CIA mice, but irradiation blocked this increase. Since regulatory T cells are known to be involved in suppression of autoimmune disease, the population of CD4(+)CD25(+)Foxp3(+) regulatory T cells was measured. Intriguingly, a significant increase of these regulatory T cells was found in irradiated CIA mice. Overall, our data suggest that low-dose gamma-ray irradiation could attenuate CIA through suppression of pro-inflammatory cytokines and autoantibody production, and induction of regulatory T cells.

Interferon Beta-1b Injection

MedlinePlus

... course of disease where symptoms flare up from time to time) of multiple sclerosis (MS, a disease in which ... interferon beta-1b injection at around the same time of day each time you inject it. Follow ...

Chromatin organization as an indicator of glucocorticoid induced natural killer cell dysfunction.

PubMed

Misale, Michael S; Witek Janusek, Linda; Tell, Dina; Mathews, Herbert L

2018-01-01

It is well-established that psychological distress reduces natural killer cell immune function and that this reduction can be due to the stress-induced release of glucocorticoids. Glucocorticoids are known to alter epigenetic marks associated with immune effector loci, and are also known to influence chromatin organization. The purpose of this investigation was to assess the effect of glucocorticoids on natural killer cell chromatin organization and to determine the relationship of chromatin organization to natural killer cell effector function, e.g. interferon gamma production. Interferon gamma production is the prototypic cytokine produced by natural killer cells and is known to modulate both innate and adaptive immunity. Glucocorticoid treatment of human peripheral blood mononuclear cells resulted in a significant reduction in interferon gamma production. Glucocorticoid treatment also resulted in a demonstrable natural killer cell nuclear phenotype. This phenotype was localization of the histone, post-translational epigenetic mark, H3K27me3, to the nuclear periphery. Peripheral nuclear localization of H3K27me3 was directly related to cellular levels of interferon gamma. This nuclear phenotype was determined by direct visual inspection and by use of an automated, high through-put technology, the Amnis ImageStream. This technology combines the per-cell information content provided by standard microscopy with the statistical significance afforded by large sample sizes common to standard flow cytometry. Most importantly, this technology provides for a direct assessment of the localization of signal intensity within individual cells. The results demonstrate glucocorticoids to dysregulate natural killer cell function at least in part through altered H3K27me3 nuclear organization and demonstrate H3K27me3 chromatin organization to be a predictive indicator of glucocorticoid induced immune dysregulation of natural killer cells. Copyright © 2017 Elsevier Inc. All rights

Interferons and Interferon Regulatory Factors in Malaria

PubMed Central

Claser, Carla; Tan, Kevin Shyong Wei; Rénia, Laurent

2014-01-01

Malaria is one of the most serious infectious diseases in humans and responsible for approximately 500 million clinical cases and 500 thousand deaths annually. Acquired adaptive immune responses control parasite replication and infection-induced pathologies. Most infections are clinically silent which reflects on the ability of adaptive immune mechanisms to prevent the disease. However, a minority of these can become severe and life-threatening, manifesting a range of overlapping syndromes of complex origins which could be induced by uncontrolled immune responses. Major players of the innate and adaptive responses are interferons. Here, we review their roles and the signaling pathways involved in their production and protection against infection and induced immunopathologies. PMID:25157202

How Does Vaccinia Virus Interfere With Interferon?

PubMed

Smith, Geoffrey L; Talbot-Cooper, Callum; Lu, Yongxu

2018-01-01

Interferons (IFNs) are secreted glycoproteins that are produced by cells in response to virus infection and other stimuli and induce an antiviral state in cells bearing IFN receptors. In this way, IFNs restrict virus replication and spread before an adaptive immune response is developed. Viruses are very sensitive to the effects of IFNs and consequently have evolved many strategies to interfere with interferon. This is particularly well illustrated by poxviruses, which have large dsDNA genomes and encode hundreds of proteins. Vaccinia virus is the prototypic poxvirus and expresses many proteins that interfere with IFN and are considered in this review. These proteins act either inside or outside the cell and within the cytoplasm or nucleus. They function by restricting the production of IFN by blocking the signaling pathways leading to transcription of IFN genes, stopping IFNs binding to their receptors, blocking IFN-induced signal transduction leading to expression of interferon-stimulated genes (ISGs), or inhibiting the antiviral activity of ISG products. © 2018 Elsevier Inc. All rights reserved.

Tetherin Suppresses Type I Interferon Signaling by Targeting MAVS for NDP52-Mediated Selective Autophagic Degradation in Human Cells.

PubMed

Jin, Shouheng; Tian, Shuo; Luo, Man; Xie, Weihong; Liu, Tao; Duan, Tianhao; Wu, Yaoxing; Cui, Jun

2017-10-19

Tetherin (BST2/CD317) is an interferon-inducible antiviral factor known for its ability to block the release of enveloped viruses from infected cells. Yet its role in type I interferon (IFN) signaling remains poorly defined. Here, we demonstrate that Tetherin is a negative regulator of RIG-I like receptor (RLR)-mediated type I IFN signaling by targeting MAVS. The induction of Tetherin by type I IFN accelerates MAVS degradation via ubiquitin-dependent selective autophagy in human cells. Moreover, Tetherin recruits E3 ubiquitin ligase MARCH8 to catalyze K27-linked ubiquitin chains on MAVS at lysine 7, which serves as a recognition signal for NDP52-dependent autophagic degradation. Taken together, our findings reveal a negative feedback loop of RLR signaling generated by Tetherin-MARCH8-MAVS-NDP52 axis and provide insights into a better understanding of the crosstalk between selective autophagy and optimal deactivation of type I IFN signaling. Copyright © 2017 Elsevier Inc. All rights reserved.

Interferon-γ acts as a regulator in the trade-off between phagocytosis and production performance in dwarf chickens.

PubMed

Yuan, Yitong; Liu, Shunqi; Zhao, Yue; Lian, Ling; Lian, Zhengxing

2018-01-01

Interferon-γ (IFN-γ) is critical for innate and adaptive immunity against viral and bacterial infections. IFN-γ reportedly affects the phagocytic ability of monocytes and macrophages as well as regulates pituitary function in humans and mice. The present study analyzed the impact of IFN-γ on monocyte and macrophage phagocytosis, production performance, and pituitary function in vivo and in vitro (in dwarf chickens). IFN-γ was injected into dwarf chickens through a vein, and then, the laying rate, average egg weight, and levels of follicle-stimulating hormone (FSH) and IFN-γ were measured in treatment and control groups. For the in vitro experiment, the pituitary tissues were supplemented with IFN-γ, and the mRNA expression levels of follicle-stimulating hormone beta subunit ( FSH-β ), interferon gamma receptor 1 ( IFNGR 1), and interferon gamma receptor 2 ( IFNGR 2) in the pituitary were assessed. Monocyte and macrophage phagocytosis product (PP) was decreased by IFN-γ treatment in a dose-dependent manner in vitro. In the in vivo experiment, the level of IFN-γ in the treatment group was higher than that in the control group at 7 d ( P  < 0.05), 14 d ( P  < 0.01), and 21 d ( P  < 0.01) post-injection. Compared with the control group, monocyte and macrophage PP was lower in the treatment group after injection ( P  < 0.01). The laying rate was higher in the treatment group than in the control group at 2 and 3 wk post-injection ( P  < 0.05). There was a significant difference between the treatment and control groups in the levels of FSH at 1, 3, 7, and 14 d post-injection ( P  < 0.01). In the in vitro experiment, increased mRNA expression levels of FSH-β , IFNGR 1, and IFNGR 2 were observed in the treatment group after stimulation with 100 U/mL IFN-γ for 24 h compared to those in the control group ( P  < 0.05). IFN-γ inhibited the phagocytosis of monocytes and macrophages; up-regulated the mRNA expression levels of the FSH

Using Gamma-Radiation for Drug Releasing from MWNT Vehicle

NASA Astrophysics Data System (ADS)

Li, Jun; Sun, Hao; Dai, Yao-Dong

2010-03-01

A drug delivery system via multi-walled carbon nanotube (MWNT) vehicle was synthesized in aqueous solution. MWNTs were first noncovalently functionalized with chitosan oligomers (CS) with a molecule weight of 4000-6000, making MWNTs water-soluble, and then a cancer ancillary drug tea polyphenols (TP) was conjugated mainly via the hydrogen bond between CS and TP molecules, making MWNTs efficient vehicle for drug delivering. The release of drug molecules can be realized by pH variation and γ-radiation, leading to new methods for controlling drug release from carbon nanotubes carrier. Due to the high penetrability of γ-rays, γ-radiation shows up new opportunities in controlled drug release, possibly facilitating the future cancer treatment in vivo.

Various heterologous cells exhibit interferon induced transfer of viral resistance.

PubMed

Hughes, T K; Blalock, J E; Baron, S

1978-01-01

Previously it was shown that cocultivation of mouse L and human WISH or baby hamster kidney cells in the presence of mouse interferon resulted in decreased viral yield from both cell species. We now show that this phenomenon also occurs when rabbit kidney and human WISH cells, with their corresponding interferons, are cocultivated with human WISH and baby hamster kidney cells, respectively. This finding increases the number of donor cell types to three. The related finding that monkey VERO and chick embryo cells can be recipients of transferred resistance expands the number of heterologous recipient cell species capable of receiving transferred resistence to five. Not all cell types tested have been shown to function in this transfer system. The fact that VERO cells, which do not produce interferon, are capable of receiving transferred resistence is significant because it indicates that the mechanism of transfer does not involve production or interferon by the recipient cells.

Interferon alpha for the adjuvant treatment of cutaneous melanoma.

PubMed

Mocellin, Simone; Lens, Marko B; Pasquali, Sandro; Pilati, Pierluigi; Chiarion Sileni, Vanna

2013-06-18

Interferon alpha is the only agent approved for the postoperative adjuvant treatment of high-risk cutaneous melanoma. However, the survival advantage associated with this treatment is unclear, especially in terms of overall survival. Thus, adjuvant interferon is not universally considered a gold standard treatment by all oncologists. To assess the disease-free survival and overall survival effects of interferon alpha as adjuvant treatment for people with high-risk cutaneous melanoma. We searched the following databases up to August 2012: the Cochrane Skin Group Specialised Register, CENTRAL in The Cochrane Library (2012, issue 8), MEDLINE (from 2005), EMBASE (from 2010), AMED (from 1985), and LILACS (from 1982). We also searched trials databases in 2011, and proceedings of the ASCO annual meeting from 2000 to 2011. We checked the reference lists of selected articles for further references to relevant trials. We included only randomised controlled trials (RCTs) comparing interferon alpha to observation (or any other treatment) for the postoperative (adjuvant) treatment of patients with high-risk skin melanoma, that is, people with regional lymph node metastasis (American Joint Committee on Cancer (AJCC) TNM (tumour, lymph node, metastasis) stage III) undergoing radical lymph node dissection, or people without nodal disease but with primary tumour thickness greater than 1 mm (AJCC TNM stage II). Two authors extracted data, and a third author independently verified the extracted data. The main outcome measure was the hazard ratio (HR), which is the ratio of the risk of the event occurring in the treatment arm (adjuvant interferon) compared to the control arm (no adjuvant interferon). The survival data were either entered directly into Review Manager (RevMan) or extrapolated from Kaplan-Meier plots and then entered into RevMan. Based on the presence of between-study heterogeneity, we applied a fixed-effect or random-effects model for calculating the pooled estimates

Induction of gamma delta T cells using zoledronate plus interleukin-2 in patients with metastatic cancer.

PubMed

Nagamine, Ichiro; Yamaguchi, Yoshiyuki; Ohara, Masahiro; Ikeda, Takuhiro; Okada, Morihito

2009-03-01

A loss of human leukocyte antigen (HLA) expression in clinical tumors is one of their escape mechanisms from immune attack by HLA-restricted effector cells. In this study, the induction of HLA-unrestricted effector cells, gamma delta T cells, using zoledronate (ZOL) and interleukin (IL)-2 in vitro was investigated in patients with metastatic cancer. Peripheral blood mononuclear cells (PBMCs) from 10 cancer patients (8 colorectal and 2 esophageal) with multiple metastases and ascites lymphocytes from 3 cancer patients (1 gastric and 2 colorectal) were stimulated with varied concentrations of ZOL plus 100 U/ml IL-2 for 48 hr followed by culturing with IL-2 alone for 12 days. Lymphocyte proliferative responses were determined using 3H-TdR uptakes and interferon (IFN)-gamma production was evaluated using enzyme-linked immunosorbent assay. Surface phenotyping was performed using flow cytometry. Cytotoxic activity of effector cells was determined using 51Cr-releasing assay. It was found that proliferative responses of PBMCs were significantly stimulated with ZOL plus IL-2 when compared with IL-2 alone, showing 200 to 500-fold expansions for 2 weeks, although ZOL alone induced no response. The optimal concentration of ZOL was 1-5 microM. Ascites lymphocytes could also be stimulated with ZOL plus IL-2. The proliferative responses were remarkable in patients whose PBMCs could produce high levels of IFN-gamma during an initial 48-hr stimulation using ZOL plus IL-2. Removal of an adherent cell fraction before the induction augmented the proliferative responses in patients who otherwise had low-grade proliferative responses. Generated cells comprising approximately 90 or 20% in PBMCs from healthy donors or cancer patients, respectively, expressed gamma delta-type T-cell receptor. Gamma delta T cells showed high cytotoxic activity against CD166-positive TE12 and TE13 cancer cells but not against CD166-negative MKN45 cells. The cytotoxic activity against TE13 cells was augmented

Loss of the type I interferon pathway increases vulnerability of mice to genital herpes simplex virus 2 infection.

PubMed

Conrady, Christopher D; Halford, William P; Carr, Daniel J J

2011-02-01

The mouse model of genital herpes relies on medoxyprogesterone treatment of female mice to render the vaginal lumen susceptible to inoculation with herpes simplex virus 2 (HSV-2). In the present study, we report that mice deficient in the A1 chain of the type I interferon receptor (CD118(-/-)) are susceptible to HSV-2 in the absence of medroxyprogesterone preconditioning. In the absence of hormone pretreatment, 2,000 PFU of a clinical isolate of HSV-2 was sufficient to establish a productive infection in the vagina of 75% ± 17% and in the spinal cord of 71% ± 14% of CD118(-/-) mice, whereas the same dose of HSV-2 replicated to detectable levels in only 13% ± 13% of vaginal samples and 0% of spinal cord samples from wild-type mice, as determined at day 5 postinfection. The susceptibility to HSV-2 infection in the CD118(-/-) mice was associated with a significant reduction in the infiltration of HSV-specific cytotoxic T lymphocytes into the vaginal tissue, the local production of gamma interferon (IFN-γ), and the expression of T cell-recruiting chemokines CCL5, CXCL9, and CXCL10. Collectively, the results underscore the significant contribution of type I IFNs in resistance to genital HSV-2 infection.

Radon Release and Its Simulated Effect on Radiation Doses.

PubMed

Orabi, Momen

2017-03-01

One of the main factors that affect the uncertainty in calculating the gamma-radiation absorbed dose rate inside a room is the variation in the degree of secular equilibrium of the considered radioactive series. A component of this factor, considered in this paper, is the release of radon (Rn) from building materials to the living space of the room. This release takes place through different steps. These steps are represented and mathematically formulated. The diffusion of radon inside the material is described by Fick's second law. Some of the factors affecting the radon release rate (e.g. covering walls, moisture, structure of the building materials, etc.) are discussed. This scheme is used to study the impact of radon release on the gamma-radiation absorbed dose rate inside a room. The investigation is carried out by exploiting the MCNP simulation software. Different building materials are considered with different radon release rates. Special care is given to Rn due to its relatively higher half-life and higher indoor concentration than the other radon isotopes. The results of the presented model show that the radon release is of a significant impact in some building materials.

Enhanced production of human influenza virus in PBS-12SF cells with a reduced interferon response.

PubMed

Carvajal-Yepes, Monica; Sporer, Kelly R B; Carter, Jenna L; Colvin, Christopher J; Coussens, Paul M

2015-01-01

Influenza is one of the most important infectious diseases in humans. The best way to prevent severe illness caused by influenza infection is vaccination. Cell culture-derived influenza vaccines are being considered in addition to the widely used egg-based system in order to support the increasing seasonal demand and to be prepared in case of a pandemic. Cell culture based systems offer increased safety, capacity, and flexibility with reduced downstream processing relative to embryonated eggs. We have previously reported a chick embryo cell line, termed PBS-12SF, that supports replication of human and avian influenza A viruses to high titers (>10(7) PFU/ml) without the need for exogenous proteases or serum proteins. Viral infections in cells are limited by the Interferon (IFN) response typified by production of type I IFNs that bind to the IFNα/β receptor and activate an antiviral state. In this study, we investigated how neutralizing the interferon (IFN) response in PBS-12SF cells, via shRNA-mediated knock-down of IFNAR1 mRNA expression, affects influenza virus production. We were successful in knocking down ∼90% of IFNAR1 protein expression by this method, resulting in a significant decrease in the response to recombinant chIFNα stimulation in PBS-12SF cells as shown by a reduction in expression of interferon-responsive genes when compared to control cells. Additionally; IFNAR1-knock-down cells displayed enhanced viral HA production and released more virus into cell culture supernatants than parental PBS-12SF cells.

Detection of Mycobacterium bovis infection in African buffaloes (Syncerus caffer) using QuantiFERON®-TB Gold (QFT) tubes and the Qiagen cattletype® IFN-gamma ELISA.

PubMed

Bernitz, Netanya; Clarke, Charlene; Roos, Eduard O; Goosen, Wynand J; Cooper, David; van Helden, Paul D; Parsons, Sven D C; Miller, Michele A

2018-02-01

African buffaloes (Syncerus caffer) are wildlife maintenance hosts of Mycobacterium bovis, the cause of bovine tuberculosis. Consequently, M. bovis infected buffaloes pose a transmission risk for cattle and other wildlife species. Previously, a modification to the Qiagen QuantiFERON ® -TB Gold (QFT) system, using QFT tubes and an in-house bovine interferon-gamma (IFN-γ) ELISA, was evaluated for the detection of M. bovis infection in buffaloes. Subsequently, Qiagen has developed a commercially available cattletype ® IFN-gamma ELISA for the detection of antigen-specific IFN-γ release in ruminants. The aim of this study was to investigate the use of QFT tubes and the cattletype ® IFN-gamma ELISA, in a cattletype IFN-γ release assay (IGRA), to detect M. bovis infection in African buffaloes. The test agreements between the cattletype IGRA, single comparative intradermal skin test (SCITT) and Bovigam ® 1G IGRA in two M. bovis-exposed buffalo populations (n = 134 and n = 92) were calculated and κ coefficients ranged from 0.65 (95% CI 0.48-0.82) to 0.86 (95% CI 0.72-0.99). Increasing the QFT incubation time in one M. bovis-exposed buffalo cohort (n = 92), from 20 to 40 h, had no effect on the cattletype IGRA test results. Inter-assay and intra-assay reproducibility determination for the cattletype IGRA produced coefficient of variations (CV) <9.1% and <1.7%, respectively. A total of 21/21 known M. bovis-unexposed buffaloes tested negative in the cattletype IGRA. Moreover, the cattletype IGRA test result values were significantly greater for 13 M. bovis culture-positive buffaloes compared with 14 M. bovis-exposed culture-negative (P < .01) and 21 M. bovis-unexposed (P < .001) buffaloes, respectively. These findings suggest that the combination of QFT tubes and the cattletype ® IFN-gamma ELISA is a promising new diagnostic assay for the detection of M. bovis infection in African buffaloes. However, further research is needed to evaluate the

Treatment of inflammatory airway disease in young standardbreds with interferon alpha

PubMed Central

2004-01-01

Abstract The effect of oral treatment with natural or recombinant human interferon alpha (HIA) on inflammatory airway disease in young standardbreds was assessed in a double-blind, randomized clinical trial. A total of 34 horses with nasal discharge, excess mucus in the trachea, and a persistent cough of at least 2 weeks’ duration that interfered with training completed the trial. Horses were rested for 1 week and received oral treatment with either a saline placebo, recombinant human interferon alpha (rHIA; 90 U/horse/day), or natural human interferon alpha (nHIA: 50 U/horse/day) for 5 days. There was a significant decline in nasal discharge and cough scores in all groups and the apparent response rate was similar. However, significantly fewer horses relapsed within 2 weeks once treatment was ceased when interferon rather than placebo was used (P = 0.012). Seventeen of 22 horses treated with rHIA or nHIA were cough-free 4 weeks after treatment, compared with only 4 of 12 after treatment with the placebo. Treatment with oral interferon is a useful adjunct to rest in standardbreds with inflammatory airway disease. PMID:15317391

Possible prevention of chronic hepatitis B by early interferon therapy.

PubMed

Trépo, C; Chemin, I; Petit, M A; Chossegros, P; Zoulim, F; Chevallier, P; Sepetjan, M

1990-01-01

A study is currently underway to investigate the efficacy of interferon therapy in patients with prolonged (greater than or equal to 10 weeks but less than 6 months) hepatitis B infection. To date, a total of 15 patients have been enrolled in the study and randomly assigned to receive either placebo for 24 weeks (n = 8) or interferon 5 million units subcutaneously 3 times a week for 24 weeks (n = 7), with follow up for 1 year. Thirteen patients have completed the follow-up period: seven patients in the placebo group and six in the treated group. Five of the six treated patients completely eradicated the infection during interferon therapy, with clearance of hepatitis B e and surface antigens, and seroconversion to antibody positivity in each case. Two of the eight placebo patients seroconverted during the placebo period. Clearance of hepatitis B e antigen was associated with a sudden rise in serum transaminase levels and an exacerbation of hepatitis, a phenomenon that has also been reported in chronic hepatitis B patients who have responded well to interferon therapy. Therapy was well tolerated in all cases. Our results suggest that interferon treatment of patients with prolonged hepatitis B infection may prevent progression to chronicity. If confirmed by further study, they should trigger more vigilant screening for patients with raised serum transaminase levels and viral markers of hepatitis B infection.

Expansion of amphibian intronless interferons revises the paradigm for interferon evolution and functional diversity

USDA-ARS?s Scientific Manuscript database

Interferons (IFNs) are key cytokines identified in vertebrates, and evolutionary dominance of intronless IFN genes in amniotes is a signature event in IFN evolution. For the first time, we show that the emergence and expansion of intronless IFN genes is evident in amphibians, shown by 24-37 intronle...

Identification of a human non-interferon lymphokine activating monocyte complement biosynthesis.

PubMed Central

Drouet, C; Reboul, A; Colomb, M

1989-01-01

A monocyte-stimulating activity produced by mitogen-induced mononuclear cells has been defined by its ability to enhance the synthesis in vitro of complement C1 subcomponents, C2 and C3. A lymphokine responsible for this activity was purified from culture supernatants of peripheral blood mononuclear cells activated by staphylococcal enterotoxin A. From 0.5 litre of supernatant the purification procedure [(NH4)2SO4 precipitation, phenyl-Sepharose chromatography and preparative electrofocusing] yielded about 100 pmol of purified lymphokine. Its pI is 7.9 and its Mr, estimated by SDS/polyacrylamide-gel electrophoresis, is 14,600, 27,000 and 56,000, the high-Mr species representing oligomeric forms of the Mr-14,600 molecule. Its amino acid analysis reveals a high percentage of hydrophobic amino acids (34%); the absence of histidine residues suggests that it is a novel monocyte-activating lymphokine. It enhances C1r and C1s biosynthesis at a pretranslational level. From its structure and activity this lymphokine appears different from gamma-interferon. Images Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:2481436

The effects of interferon-alpha/beta in a model of rat heart transplantation

NASA Technical Reports Server (NTRS)

Slater, A. D.; Klein, J. B.; Sonnenfeld, G.; Ogden, L. L. 2nd; Gray, L. A. Jr

1992-01-01

Interferons have multiple immunologic effects. One such effect is the activation of expression of cell surface antigens. Interferon alpha/beta enhance expression of class I but not class II histocompatibility antigens. Contradictory information has been published regarding the effect of interferon-alpha/beta administration in patients with kidney transplantation. In a model of rat heart transplantation we demonstrated that administration of interferon-alpha/beta accelerated rejection in a dose-dependent fashion in the absence of maintenance cyclosporine. Animals treated with maintenance cyclosporine had evidence of increased rejection at 20 days that was resolved completely at 45 days with cyclosporine alone.

[Research Progress on Antiviral Activity of Interferon-induced Transmembrane Proteins].

PubMed

Chen, Yongkun; Zhu, Wenfei; Shu, Yuelong

2016-03-01

Interferon-induced Transmembrane Proteins (IFITMs) were identified through small interference RNA (siRNA) screening method in 1980s. The antiviral properties of the IFITMs were firstly discovered in 1996. Recently, its antiviral effect and mechanism have become a research hotspot. Many studies have shown that IFITM can inhibit the replication of multiple pathogenic viruses, including influenza A virus (IAV), Human Immunodeficiency Virus (HIV-1), hepatitis C virus (HCV), Ebola virus (EBOV), West Nile virus and so on. IFITMs inhibit the replication of virus in the early stage of the viral life cycle, which occurred before the release of viral genomes into the cytosol. Recent studies indicate that IFITM proteins could block viral replication by mediate viral membrane fusion. However, the mechanism is still under investigation. Here we review the discovery and characterization of the IFITM proteins, elucidate their antiviral activities and the potential mechanisms.

New hemolysin (gamma) produced by Escherichia coli.

PubMed

Walton, J R; Smith, D H

1969-04-01

A new hemolysin (gamma) of Escherichia coli, active in the absence of viable bacteria, has been recognized in mutants resistant to nalidixic acid. Nalidixic acid affects either the production or release of the hemolysin.

Induction of interferon-gamma and downstream pathways during establishment of fetal persistent infection with bovine viral diarrhea virus.

PubMed

Smirnova, Natalia P; Webb, Brett T; McGill, Jodi L; Schaut, Robert G; Bielefeldt-Ohmann, Helle; Van Campen, Hana; Sacco, Randy E; Hansen, Thomas R

2014-04-01

Development of transplacental infection depends on the ability of the virus to cross the placenta and replicate within the fetus while counteracting maternal and fetal immune responses. Unfortunately, little is known about this complex process. Non-cytopathic (ncp) strains of bovine viral diarrhea virus (BVDV), a pestivirus in the Flaviviridae family, cause persistent infection in early gestational fetuses (<150 days; persistently infected, PI), but are cleared by immunocompetent animals and late gestational fetuses (>150 days; transiently infected, TI). Evasion of innate immune response and development of immunotolerance to ncp BVDV have been suggested as possible mechanisms for the establishment of the persistent infection. Previously we have observed a robust temporal induction of interferon (IFN) type I (innate immune response) and upregulation of IFN stimulated genes (ISGs) in BVDV TI fetuses. Modest chronic upregulation of ISGs in PI fetuses and calves reflects a stimulated innate immune response during persistent BVDV infection. We hypothesized that establishing persistent fetal BVDV infection is also accompanied by the induction of IFN-gamma (IFN-γ). The aims of the present study were to determine IFN-γ concentration in blood and amniotic fluid from control, TI and PI fetuses during BVDV infection and analyze induction of the IFN-γ downstream pathways in fetal lymphoid tissues. Two experiments with in vivo BVDV infections were completed. In Experiment 1, pregnant heifers were infected with ncp BVDV type 2 on day 75 or 175 of gestation or kept naïve to generate PI, TI and control fetuses, respectively. Fetuses were collected by Cesarean section on day 190. In Experiment 2, fetuses were collected on days 82, 89, 97, 192 and 245 following infection of pregnant heifers on day 75 of gestation. The results were consistent with the hypothesis that ncp BVDV infection induces IFN-γ secretion during acute infection in both TI and PI fetuses and that lymphoid

Chlamydia trachomatis Is Resistant to Inclusion Ubiquitination and Associated Host Defense in Gamma Interferon-Primed Human Epithelial Cells.

PubMed

Haldar, Arun K; Piro, Anthony S; Finethy, Ryan; Espenschied, Scott T; Brown, Hannah E; Giebel, Amanda M; Frickel, Eva-Maria; Nelson, David E; Coers, Jörn

2016-12-13

The cytokine gamma interferon (IFN-γ) induces cell-autonomous immunity to combat infections with intracellular pathogens, such as the bacterium Chlamydia trachomatis The present study demonstrates that IFN-γ-primed human cells ubiquitinate and eliminate intracellular Chlamydia-containing vacuoles, so-called inclusions. We previously described how IFN-γ-inducible immunity-related GTPases (IRGs) employ ubiquitin systems to mark inclusions for destruction in mouse cells and, furthermore, showed that the rodent pathogen Chlamydia muridarum blocks ubiquitination of its inclusions by interfering with mouse IRG function. Here, we report that ubiquitination of inclusions in human cells is independent of IRG and thus distinct from the murine pathway. We show that C. muridarum is susceptible to inclusion ubiquitination in human cells, while the closely related human pathogen C. trachomatis is resistant. C. muridarum, but not C. trachomatis, inclusions attract several markers of cell-autonomous immunity, including the ubiquitin-binding protein p62, the ubiquitin-like protein LC3, and guanylate-binding protein 1. Consequently, we find that IFN-γ priming of human epithelial cells triggers the elimination of C. muridarum, but not C. trachomatis, inclusions. This newly described defense pathway is independent of indole-2,3-dioxygenase, a known IFN-γ-inducible anti-Chlamydia resistance factor. Collectively, our observations indicate that C. trachomatis evolved mechanisms to avoid a human-specific, ubiquitin-mediated response as part of its unique adaptation to its human host. Chlamydia trachomatis is the leading cause of sexually transmitted bacterial infections and responsible for significant morbidity, including pelvic inflammatory disease, infertility, and ectopic pregnancies in women. As an obligate intracellular pathogen, C. trachomatis is in perpetual conflict with cell-intrinsic defense programs executed by its human host. Our study defines a novel anti

Type I interferons modulate methotrexate resistance in gestational trophoblastic neoplasia.

PubMed

Elias, Kevin M; Harvey, Richard A; Hasselblatt, Kathleen T; Seckl, Michael J; Berkowitz, Ross S

2017-06-01

Resistance to methotrexate is a leading clinical problem in gestational trophoblastic neoplasia (GTN), but there are limited laboratory models for this condition. We created isogenic trophoblastic cell lines resistant to methotrexate and compared these to the parent cell lines using gene expression microarrays and qRT-PCR followed by mechanistic studies using recombinant cytokines, pathway inhibitors, and patient sera. Gene expression microarrays and focused analysis by qRT-PCR revealed methotrexate led to type I interferon upregulation, in particular interferon alpha 2 (IFNA2), and methotrexate resistance was associated with chronic low level increases in type I interferon expression. Recombinant IFNA2 imparted chemosensitive choriocarcinoma cells with partial resistance to methotrexate, while chemoresistant choriocarcinoma cells were uniquely sensitive to fludarabine, a STAT1 inhibitor. In pre-treatment patient sera, IFNA2 levels correlated with subsequent resistance to methotrexate chemotherapy. Methotrexate resistance is influenced by type I interferon signaling with prognostic and therapeutic implications for treating women with GTN. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Pharmacokinetic and pharmacodynamic characterization of a new formulation containing synergistic proportions of interferons alpha-2b and gamma (HeberPAG®) in patients with mycosis fungoides: an open-label trial

PubMed Central

2012-01-01

Background The synergistic combination of interferon (IFN) alpha-2b and IFN gamma results in more potent in vitro biological effects mediated by both IFNs. The aim of this investigation was to evaluate by first time the pharmacokinetics and pharmacodynamics of this combination in patients with mycosis fungoides. Methods An exploratory, prospective, open-label clinical trial was conducted. Twelve patients, both genders, 18 to 75 years-old, with mycosis fungoides at stages IB to III, were eligible for the study. All of them received intramuscularly a single high dose (23 × 106 IU) of a novel synergistic IFN mixture (HeberPAG®) for pharmacokinetic and pharmacodynamic studies. Serum IFN alpha-2b and IFN gamma concentrations were measured during 96 hours by commercial enzyme immunoassays (EIA) specific for each IFN. Other blood IFN-inducible markers and laboratory variables were used as pharmacodynamics and safety criteria. Results The pharmacokinetic evaluation by EIA yielded a similar pattern for both IFNs that are also in agreement with the well-known described profiles for these molecules when these are administered separately. The average values for main parameters were: Cmax: 263 and 9.3 pg/mL; Tmax: 9.5 and 6.9 h; AUC: 4483 and 87.5 pg.h/mL, half-life (t1/2): 4.9 and 13.4 h; mean residence time (MRT): 13.9 and 13.5 h, for serum IFN alpha-2b and IFN gamma, respectively. The pharmacodynamic variables were strongly stimulated by simultaneous administration of both IFNs: serum neopterin and beta-2 microglobulin levels (β2M), and stimulation of 2’-5’ oligoadenylate synthetase (OAS1) mRNA expression. The most encouraging data was the high increment of serum neopterin, 8.0 ng/mL at 48 h, not been described before for any unmodified or pegylated IFN. Additionally, β2M concentration doubled the pre-dose value at 24–48 hours. For both variables the values remained clearly upper baseline levels at 96 hours. Conclusions HeberPAG®possesses improved

Azathioprine versus Beta Interferons for Relapsing-Remitting Multiple Sclerosis: A Multicentre Randomized Non-Inferiority Trial

PubMed Central

Massacesi, Luca; Tramacere, Irene; Amoroso, Salvatore; Battaglia, Mario A.; Benedetti, Maria Donata; Filippini, Graziella; La Mantia, Loredana; Repice, Anna; Solari, Alessandra; Tedeschi, Gioacchino; Milanese, Clara

2014-01-01

For almost three decades in many countries azathioprine has been used to treat relapsing-remitting multiple sclerosis. However its efficacy was usually considered marginal and following approval of β interferons for this indication it was no longer recommended as first line treatment, even if presently no conclusive direct β interferon-azathioprine comparison exists. To compare azathioprine efficacy versus the currently available β interferons in relapsing-remitting multiple sclerosis, a multicenter, randomized, controlled, single-blinded, non-inferiority trial was conducted in 30 Italian multiple sclerosis centers. Eligible patients (relapsing-remitting course; ≥2 relapses in the last 2 years) were randomly assigned to azathioprine or β interferons. The primary outcome was annualized relapse rate ratio (RR) over 2 years. Key secondary outcome was number of new brain MRI lesions. Patients (n = 150) were randomized in 2 groups (77 azathioprine, 73 β interferons). At 2 years, clinical evaluation was completed in 127 patients (62 azathioprine, 65 β interferons). Annualized relapse rate was 0.26 (95% Confidence Interval, CI, 0.19–0.37) in the azathioprine and 0.39 (95% CI 0.30–0.51) in the interferon group. Non-inferiority analysis showed that azathioprine was at least as effective as β interferons (relapse RRAZA/IFN 0.67, one-sided 95% CI 0.96; p<0.01). MRI outcomes were analyzed in 97 patients (50 azathioprine and 47 β interferons). Annualized new T2 lesion rate was 0.76 (95% CI 0.61–0.95) in the azathioprine and 0.69 (95% CI 0.54–0.88) in the interferon group. Treatment discontinuations due to adverse events were higher (20.3% vs. 7.8%, p = 0.03) in the azathioprine than in the interferon group, and concentrated within the first months of treatment, whereas in the interferon group discontinuations occurred mainly during the second year. The results of this study indicate that efficacy of azathioprine is not inferior to that of �

[Characterization and comparison of interferon reference standards using UPLC-MS].

PubMed

Tao, Lei; Pei, De-ning; Han, Chun-mei; Chen, Wei; Rao, Chun-ming; Wang, Jun-zhi

2015-01-01

The study aims to characterize and compare interferon reference standards from 5 manufacturers. By testing molecular mass and trypsin-digested peptide mass mapping, the amino acid sequence was verified and post-translational modifications such as disulfide bond were identified. Results show that the molecular mass and amino acid sequence were consistent with theory; the disulfide bonds of 4 lots of interferon were Cys1-Cys98/Cys29-Cys138, 1 lot was Cys29-Cys139/Cys86-Cys99; N-terminal "+Met", acetyl N-terminal and Met oxidation were identified in part of the sample. UPLC-MS can be used to characterize and compare interferon reference standards from different manufacturers.

The Extragalactic Background Light and the Gamma-ray Opacity of the Universe

NASA Technical Reports Server (NTRS)

Dwek, Eli; Krennrich, Frank

2012-01-01

The extragalactic background light (EBL) is one of the fundamental observational quantities in cosmology. All energy releases from resolved and unresolved extragalactic sources, and the light from any truly diffuse background, excluding the cosmic microwave background (CMB), contribute to its intensity and spectral energy distribution. It therefore plays a crucial role in cosmological tests for the formation and evolution of stellar objects and galaxies, and for setting limits on exotic energy releases in the universe. The EBL also plays an important role in the propagation of very high energy gamma-rays which are attenuated en route to Earth by pair producing gamma-gamma interactions with the EBL and CMB. The EBL affects the spectrum of the sources, predominantly blazars, in the approx 10 GeV to 10 TeV energy regime. Knowledge of the EBL intensity and spectrum will allow the determination of the intrinsic blazar spectrum in a crucial energy regime that can be used to test particle acceleration mechanisms and VHE gamma-ray production models. Conversely, knowledge of the intrinsic gamma-ray spectrum and the detection of blazars at increasingly higher redshifts will set strong limits on the EBL and its evolution. This paper reviews the latest developments in the determination of the EBL and its impact on the current understanding of the origin and production mechanisms of gamma-rays in blazars, and on energy releases in the universe. The review concludes with a summary and future directions in Cherenkov Telescope Array techniques and in infrared ground-based and space observatories that will greatly improve our knowledge of the EBL and the origin and production of very high energy gamma-rays.

Compton Gamma-Ray Observatory

NASA Technical Reports Server (NTRS)

1991-01-01

This photograph shows the Compton Gamma-Ray Observatory being released from the Remote Manipulator System (RMS) arm aboard the Space Shuttle Atlantis during the STS-35 mission in April 1991. The GRO reentered the Earth's atmosphere and ended its successful mission in June 2000. For nearly 9 years, GRO's Burst and Transient Source Experiment (BATSE), designed and built by the Marshall Space Flight Center, kept an unblinking watch on the universe to alert scientist to the invisible, mysterious gamma-ray bursts that had puzzled them for decades. By studying gamma-rays from objects like black holes, pulsars, quasars, neutron stars, and other exotic objects, scientists could discover clues to the birth, evolution, and death of star, galaxies, and the universe. The gamma-ray instrument was one of four major science instruments aboard the Compton. It consisted of eight detectors, or modules, located at each corner of the rectangular satellite to simultaneously scan the entire universe for bursts of gamma-rays ranging in duration from fractions of a second to minutes. In January 1999, the instrument, via the Internet, cued a computer-controlled telescope at Las Alamos National Laboratory in Los Alamos, New Mexico, within 20 seconds of registering a burst. With this capability, the gamma-ray experiment came to serve as a gamma-ray burst alert for the Hubble Space Telescope, the Chandra X-Ray Observatory, and major gound-based observatories around the world. Thirty-seven universities, observatories, and NASA centers in 19 states, and 11 more institutions in Europe and Russia, participated in BATSE's science program.

[Alpha interferon induced hyperthyroidism: a case report and review of the literature].

PubMed

Maiga, I; Valdes-Socin, H; Thiry, A; Delwaide, J; Sidibe, A T; Beckers, A

2015-01-01

Treatment with alpha interferon in hepatitis C triggers a thyroid autoimmunity in a variable percentage of cases (2-8%). This complication raises some questions about its screening, the possibility to continue anti-viral therapy and thyroid treatment. Alpha interferon has an immunomodulatory effect on the thyroid, but also an inhibitory effect on thyroid hormone synthesis. This explains the occurrence of cases of thyroid dysfunction, which often remain undetected because of their latency. Factors predicting thyroid dysfunction with interferon use are: female sex, history of thyroid disease and previous autoimmunity. Several clinical aspects are encountered including hypothyroidism (the most frequent depending on the series) and hyperthyroidism related to Graves' disease. For their detection, a cooperation between general practionners, gastroenterologists and endocrinologists is mandatory thyroid function tests are requested before, during and after treatment,with alpha interferon. Therapeutic aspects of thyroid disorders range from simple monitoring to symptomatic treatment, such as thyroxine prescription in the presence of hypothyroidism. Antithyroid drugs radioactive iodine or thyroid surgery are used in cases of severe or persistent Graves' disease induced by alpha interferon.

Synergistic induction of apoptosis in primary rat decidual cells by INF-gamma and TNF.

PubMed

Almeida, A; Correia-da-Silva, G; Cepa, M; Bell, S C; Teixeira, N A

2007-03-01

In the rat, in response to blastocyst implantation, stromal cells of the endometrium proliferate and differentiate into decidual cells, forming the decidua. After reaching its maximum development, the decidua undergoes regression. This phenomenon appears to be due to an active process involving apoptosis. As there is sparse knowledge concerning the mechanisms of induction of decidual cell death, the potential role of cytokines present in the uterine environment during pregnancy, such as tumor necrosis factor (TNF) and interferon-gamma (INF-gamma) was explored in primary cultures of rat decidual cells. The effects of these factors upon cellular viability, nuclear morphologic alterations, expression, and enzymatic activities of the effector caspases-3/7 were evaluated. The results obtained demonstrated that in contrast to TNF, which did not induce any alteration, INF-gamma and in association with TNF caused a decrease in cell viability and an increase in the appearance of apoptotic bodies in a time-dependent manner that was augmented in the co-presence of TNF. An increase in caspase-3/7 activities after 12 hr of TNF/INF-gamma treatment was also observed. These findings suggest that INF-gamma expressed in the uterine environment may play an important role in regulating apoptosis through potential synergistic mechanisms with TNF and thereby modulate decidual stability and regression during pregnancy. (c) 2006 Wiley-Liss, Inc.

Interferon Beta-1a Intramuscular Injection

MedlinePlus

... course of disease where symptoms flare up from time to time) of multiple sclerosis (MS, a disease in which ... interferon beta-1a intramuscular at around the same time of day on your injection days. Follow the ...

Physicochemical properties and antioxidant activity of gamma-oryzanol-loaded liposome formulations for topical use.

PubMed

Viriyaroj, Amornrat; Ngawhirunpat, Tanasait; Sukma, Monrudee; Akkaramongkolporn, Prasert; Ruktanonchai, Uracha; Opanasopit, Praneet

2009-01-01

The objective of this study is to prepare the gamma-oryzanol-loaded liposomes and investigate their physicochemical properties and antioxidant activity intended for cosmetic applications. Liposomes, Composing phosphatidylCholine (PC) and Cholesterol (Chol), CHAPS or sodium taurocholate (NaTC) were prepared by sonication method. Gamma-oryzanol-loaded liposomes were prepared by using 3, 5 and 10% gamma-oryzanol as an initial concentration. The formulation factors in a particular type and composition of lipid and initial drug loading on the physicochemical properties (i.e., particle size, zeta potential, entrapment efficiency, drug release) and antioxidant activity were studied. The particle sizes of bare liposomes were in nanometer range. The gamma-oryzanol-loaded liposomes in formulations of PC/CHAPS and PC/NaTC liposomes were smaller than PC/Chol liposomes. The incorporation efficiency of 10% gamma-oryzanol-loaded PC/Chol liposomes was less than gamma-oryzanol-loaded PC/CHAPS liposomes and PC/NaTC liposomes allowing higher in vitro release rate due to higher free gamma-oryzanol in buffer solution. The antioxidant activity of gamma-oryzanol-loaded liposomes was not different from pure gamma-oryzanol. Both gamma-oryzanol-loaded PC/CHAPS liposomes and PC/NaTC liposomes were showed to enhance the antioxidant activity in NHF cells. gamma-oryzanol-loaded PC/Chol liposomes demonstrated the lowest cytotoxicity in NHF cells. It was conceivably concluded that liposomes prepared in this study are suitable for gamma-oryzanol incorporation without loss of antioxidant activity.

Renal thrombotic microangiopathy caused by interferon beta-1a treatment for multiple sclerosis

PubMed Central

Mahe, Julien; Meurette, Aurélie; Moreau, Anne; Vercel, Caroline; Jolliet, Pascale

2013-01-01

Interferon beta-1a is available as an immunomodulating agent for relapsing forms of multiple sclerosis. Common side effects include flu-like symptoms, asthenia, anorexia, and administration site reaction. Kidney disorders are rarely reported. In this study we describe the case of a woman who has been undergoing treatment with interferon beta-1a for multiple sclerosis for 5 years. She developed a hemolytic-uremic syndrome with intravascular hemolysis in a context of severe hypertension. A kidney biopsy showed a thrombotic microangiopathy. This observation highlights an uncommon side effect of long-term interferon beta-1a therapy. Pathophysiological mechanisms leading to this complication might be explained by the antiangiogenic activity of interferon. PMID:23950639

T-SPOT.TB in Detection of Active Tuberculosis During Pregnancy: A Retrospective Study in China.

PubMed

Chen, Qiaopei; Guo, Xuxiao; Wang, Xinfeng; Wang, Maoshui

2016-01-06

Interferon-gamma release assays have not been validated in active TB among pregnant women. Therefore, the objective of this retrospective study was to estimate the diagnostic value of T-SPOT.TB in active TB among pregnant women. Between May 2012 and May 2015, 26 consecutive pregnant women with suspected TB were enrolled in our study. The clinicopathological characteristics and T-SPOT.TB results were reviewed and analyzed. Pregnant patients were divided into a TB group (n=21) and a Non-TB group (n=5). In the TB group, 5 patients had pulmonary TB, 5 had pulmonary TB+ extrapulmonary TB, and 11 had exclusively extrapulmonary TB. The most common site of extrapulmonary TB was pleural (n=11). Statistical analysis showed that the lymphocyte count in the TB group was lower than in the Non-TB group (P<0.05). For detection of active TB during pregnancy, T-SPOT.TB had a high sensitivity of 100.0% (84.5%-100.0%) and a specificity of 80.0% (37.6-96.4%). T-SPOT.TB shows good performance in detection of active tuberculosis during pregnancy. Interferon gamma release assay for TB screening of pregnant women is recommended in clinical practice because it may be a more appropriate diagnostic tool than the tuberculin skin test.

Adjuvant immunotherapy of feline fibrosarcoma with recombinant feline interferon-omega.

PubMed

Hampel, Verena; Schwarz, Bianca; Kempf, Christine; Köstlin, Roberto; Schillinger, Ulrike; Küchenhoff, Helmut; Fenske, Nora; Brill, Thomas; Hirschberger, Johannes

2007-01-01

Recombinant feline interferon-omega (rFeIFN-omega) was tested as a treatment option for cats with fibrosarcoma to assess safety and feasibility. Treatment with rFeIFN-omega in cats with fibrosarcoma is safe and feasible. Twenty domestic cats. In an open-labeled uncontrolled clinical trial 12 injections of 1 x 10(6) U/kg rFeIFN-omega were administered over a 5-week period: the 1st through 4th injections were given intratumorally, and the 5th through 12th injections were administered subcutaneously at the tumor excision site. Wide surgical excision of the tumors was carried out after the 4th injection and before the 5th injection of rFeIFN-omega. A Common Terminology Criteria for Adverse Events (CTCAE) analysis was conducted. Flow cytometry of fibrosarcoma cells after incubation with rFeIFN-omega and recombinant feline interferon-gamma was performed to assess the biological effect of rFeIFN-omega. Changes in blood cell count, increases in serum aspartate-amino-transferase activity, serum bilirubin concentration, serum creatinine and serum electrolyte concentrations, weight loss, anorexia, increased body temperature, and reduced general condition were observed but were mostly minor (grade 1 and 2) and self limiting. Eosinophilia (P = .025), neutropenia (P = .021), and weight loss (P < .001) were statistically correlated with rFeIFN-omega-treatment (analysis of parameters before treatment and after 3 injections of rFeIFN-omega). Flow cytometry of 5 unrelated feline fibrosarcoma cell lines showed increased expression of major histocompatibility complex (MHC) class I molecules (P = .026) in response to in vitro incubation with rFeIFN-omega, whereas expression of MHC class II molecules was not affected significantly. RFeIFN-omega for the treatment of feline fibrosarcoma is safe, well tolerated, and can be easily performed in practice. To assess the efficacy of the treatment, it should be tested in a placebo-controlled trial.

Influence of gamma radiation onto polymeric matrix with papain

NASA Astrophysics Data System (ADS)

Zulli, Gislaine; Lopes, Patrícia Santos; Velasco, Maria Valéria Robles; Alcântara, Mara Tânia Silva; Rogero, Sizue Ota; Lugao, Ademar Benévolo; Mathor, Monica Beatriz

2010-03-01

Papain is a proteolytic enzyme that has been widely used as debridement agent for scars and wound healing treatment. However, papain presents low stability, which limits its use to extemporaneous or short shelf-life formulations. The purpose of this study was to entrap papain into a polymeric matrix in order to obtain a drug delivery system that could be used as medical device. Since these systems must be sterile, gamma radiation is an interesting option and presents advantages in relation to conventional agents: no radioactive residues are formed; the product can be sterilized inside the final packaging and has an excellent reliability. The normative reference for the establishment of the sterilizing dose determines 25 kGy as the inactivation dose for viable microorganisms. A silicone dispersion was selected to prepare membranes containing 2% (w/w) papain. Irradiated and non-irradiated membranes were simultaneously assessed in order to verify whether gamma radiation interferes with the drug-releasing profile. Results showed that irradiation does not affect significantly papain release and its activity. Therefore papain shows radioresistance in the irradiation conditions applied. In conclusion, gamma radiation can be easily used as sterilizing agent without affecting the papain release profile and its activity onto the biocompatible device is studied.

Underlying pathways for interferon risk to type II diabetes mellitus.

PubMed

Abdel-Hamid, Nabil; Jubori, Taghreed Al; Farhan, Amaal; Mahrous, Mariam; Gouri, Adel; Awad, Ezzat; Breuss, Johannes

2013-11-01

It has been known that chronic liver treatments interfere with blood glucose metabolism. It was recognized that diabetes mellitus among chronic hepatitis C was greater in other types of chronic liver diseases. Hepatitis C directly promotes insulin resistance through the proteosomal degradation of insulin resistance substrate. It suppressed hepatocyte glucose uptake through down-regulation of surface expression of glucose transporter. Long-term exposure to cytokine over expression seems to be cytotoxic to both beta cells of the pancreas and to hepatocytes. Elevated tumor necrosis factor-a, or its neutralization, increased insulin sensitivity. Interferon-a may also elevate the serum level of interleukin-1 which is cytotoxic to pancreatic islet cells. Both diabetes mellitus and resistance to interferon-a therapy are abnormally mediated by over-expression of suppressor of cytokine signaling-1 in hepatocytes of chronic hepatitis C patients. These data suggest that interferon-a therapy should be administered with caution in patients showing any predisposition to Diabetes mellitus. Anti inflammatory therapy is critically recommended as a protector against disease development due to cytokine mediated Diabetes mellitus during hepatitis C therapy, since inflammation seems to be a main candidate to interferon suspected diabetogenesis.

Stratification by interferon-γ release assay level predicts risk of incident TB.

PubMed

Winje, Brita Askeland; White, Richard; Syre, Heidi; Skutlaberg, Dag Harald; Oftung, Fredrik; Mengshoel, Anne Torunn; Blix, Hege Salvesen; Brantsæter, Arne Broch; Holter, Ellen Kristine; Handal, Nina; Simonsen, Gunnar Skov; Afset, Jan Egil; Bakken Kran, Anne Marte

2018-04-05

Targeted testing and treatment of latent TB infection (LTBI) are priorities on the global health agenda, but LTBI management remains challenging. We aimed to evaluate the prognostic value of the QuantiFERON TB-Gold (QFT) test for incident TB, focusing on the interferon (IFN)-γ level, when applied in routine practice in a low TB incidence setting. In this large population-based prospective cohort, we linked QFT results in Norway (1 January 2009-30 June 2014) with national registry data (Norwegian Surveillance System for Infectious Diseases, Norwegian Prescription Database, Norwegian Patient Registry and Statistics Norway) to assess the prognostic value of QFT for incident TB. Participants were followed until 30 June 2016. We used restricted cubic splines to model non-linear relationships between IFN-γ levels and TB, and applied these findings to a competing risk model. The prospective analyses included 50 389 QFT results from 44 875 individuals, of whom 257 developed TB. Overall, 22% (n=9878) of QFT results were positive. TB risk increased with the IFN-γ level until a plateau level, above which further increase was not associated with additional prognostic information. The HRs for TB were 8.8 (95% CI 4.7 to 16.5), 19.2 (95% CI 11.6 to 31.6) and 31.3 (95% CI 19.8 to 49.5) times higher with IFN-γ levels of 0.35 to <1.00, 1.00 to <4.00 and >4.00 IU/mL, respectively, compared with negative tests (<0.35 IU/mL). Consistently, QFT demonstrates increased risk of incident TB with rising IFN-γ concentrations, indicating that IFN-γ levels may be used to guide targeted treatment of LTBI. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Topical delivery of liposomally encapsulated interferon evaluated in a cutaneous herpes guinea pig model.

PubMed Central

Weiner, N; Williams, N; Birch, G; Ramachandran, C; Shipman, C; Flynn, G

1989-01-01

The topical delivery of liposomally encapsulated interferon was evaluated in the cutaneous herpes simplex virus guinea pig model. Application of liposomally entrapped interferon caused a reduction of lesion scores, whereas application of interferon formulated as a solution or as an emulsion was ineffective. The method of liposomal preparation rather than the lipid composition of the bilayers appeared to be the most important factor for reducing lesion scores. Only liposomes prepared by the dehydration-rehydration method were effective. This finding implied that the dehydration and subsequent rehydration of the liposomes facilitate partitioning of the interferon into liposomal bilayers, where the drug is positioned for transfer into the lipid compartment of the stratum corneum. Liposomes do not appear to function as permeation enhancers but seem to provide the needed physicochemical environment for transfer of interferon into the skin. PMID:2802550

GammaLib and ctools. A software framework for the analysis of astronomical gamma-ray data

NASA Astrophysics Data System (ADS)

Knödlseder, J.; Mayer, M.; Deil, C.; Cayrou, J.-B.; Owen, E.; Kelley-Hoskins, N.; Lu, C.-C.; Buehler, R.; Forest, F.; Louge, T.; Siejkowski, H.; Kosack, K.; Gerard, L.; Schulz, A.; Martin, P.; Sanchez, D.; Ohm, S.; Hassan, T.; Brau-Nogué, S.

2016-08-01

The field of gamma-ray astronomy has seen important progress during the last decade, yet to date no common software framework has been developed for the scientific analysis of gamma-ray telescope data. We propose to fill this gap by means of the GammaLib software, a generic library that we have developed to support the analysis of gamma-ray event data. GammaLib was written in C++ and all functionality is available in Python through an extension module. Based on this framework we have developed the ctools software package, a suite of software tools that enables flexible workflows to be built for the analysis of Imaging Air Cherenkov Telescope event data. The ctools are inspired by science analysis software available for existing high-energy astronomy instruments, and they follow the modular ftools model developed by the High Energy Astrophysics Science Archive Research Center. The ctools were written in Python and C++, and can be either used from the command line via shell scripts or directly from Python. In this paper we present the GammaLib and ctools software versions 1.0 that were released at the end of 2015. GammaLib and ctools are ready for the science analysis of Imaging Air Cherenkov Telescope event data, and also support the analysis of Fermi-LAT data and the exploitation of the COMPTEL legacy data archive. We propose using ctools as the science tools software for the Cherenkov Telescope Array Observatory.

Dopamine Modulates Delta-Gamma Phase-Amplitude Coupling in the Prefrontal Cortex of Behaving Rats.

PubMed

Andino-Pavlovsky, Victoria; Souza, Annie C; Scheffer-Teixeira, Robson; Tort, Adriano B L; Etchenique, Roberto; Ribeiro, Sidarta

2017-01-01

Dopamine release and phase-amplitude cross-frequency coupling (CFC) have independently been implicated in prefrontal cortex (PFC) functioning. To causally investigate whether dopamine release affects phase-amplitude comodulation between different frequencies in local field potentials (LFP) recorded from the medial PFC (mPFC) of behaving rats, we used RuBiDopa, a light-sensitive caged compound that releases the neurotransmitter dopamine when irradiated with visible light. LFP power did not change in any frequency band after the application of light-uncaged dopamine, but significantly strengthened phase-amplitude comodulation between delta and gamma oscillations. Saline did not exert significant changes, while injections of dopamine and RuBiDopa produced a slow increase in comodulation for several minutes after the injection. The results show that dopamine release in the medial PFC shifts phase-amplitude comodulation from theta-gamma to delta-gamma. Although being preliminary results due to the limitation of the low number of animals present in this study, our findings suggest that dopamine-mediated modification of the frequencies involved in comodulation could be a mechanism by which this neurotransmitter regulates functioning in mPFC.

Interferon after surgery for women with advanced (Stage II-IV) epithelial ovarian cancer.

PubMed

Lawal, Aramide O; Musekiwa, Alfred; Grobler, Liesl

2013-06-06

Epithelial ovarian cancer (EOC) is a life-threatening disease. Most often women become symptomatic only in the advanced stages of the disease, increasing the difficulty of treatment. Whilst the disease responds well to surgery and chemotherapy, the relapse rate is high. New treatments to prevent disease recurrence or progression, prolong survival, and increase the quality of life are needed. To assess the effectiveness and safety of interferon after surgery in the treatment of advanced (stage II-IV) EOC. The Cochrane Gynaecological Cancer Review Group Specialized Register, Cochrane Central Register of Controlled Trials (CENTRAL) Issue 1, 2012, MEDLINE and EMBASE were searched to January 2012. Handsearching of conference proceedings was also undertaken. Reference lists of reviews and included trials were screened and experts in the field were contacted for additional trials. Clinical trials registers were searched for ongoing trials. Randomised controlled trials (RCTs) involving participants with advanced EOC that compared post-operative chemotherapy alone with post-operative interferon therapy in combination with chemotherapy or post-operative chemotherapy followed by interferon or observation alone Two review authors (AL and AM) independently screened the search results for relevant trials and extracted pre-specified information from each included trial. Data were managed using Review Manager 5.1. Hazard ratios (HR) were calculated for time-to-event outcomes and risk ratios (RR) for dichotomous outcomes, with corresponding 95% confidence intervals (CI). Five trials, including 1476 participants, were included in the review. Two trials compared interferon with observation alone and three trials compared interferon plus chemotherapy with chemotherapy alone. A meta-analysis of two trials involving 370 participants found no significant difference in both overall survival (HR 1.14, 95% CI 0.84 to 1.55) and progression free survival (HR 0.99, 95% CI 0.79 to 1.24) between

Viral Replication Complexes Are Targeted by LC3-Guided Interferon-Inducible GTPases.

PubMed

Biering, Scott B; Choi, Jayoung; Halstrom, Rachel A; Brown, Hailey M; Beatty, Wandy L; Lee, Sanghyun; McCune, Broc T; Dominici, Erin; Williams, Lelia E; Orchard, Robert C; Wilen, Craig B; Yamamoto, Masahiro; Coers, Jörn; Taylor, Gregory A; Hwang, Seungmin

2017-07-12

All viruses with positive-sense RNA genomes replicate on membranous structures in the cytoplasm called replication complexes (RCs). RCs provide an advantageous microenvironment for viral replication, but it is unknown how the host immune system counteracts these structures. Here we show that interferon-gamma (IFNG) disrupts the RC of murine norovirus (MNV) via evolutionarily conserved autophagy proteins and the induction of IFN-inducible GTPases, which are known to destroy the membrane of vacuoles containing bacteria, protists, or fungi. The MNV RC was marked by the microtubule-associated-protein-1-light-chain-3 (LC3) conjugation system of autophagy and then targeted by immunity-related GTPases (IRGs) and guanylate-binding proteins (GBPs) upon their induction by IFNG. Further, the LC3 conjugation system and the IFN-inducible GTPases were necessary to inhibit MNV replication in mice and human cells. These data suggest that viral RCs can be marked and antagonized by a universal immune defense mechanism targeting diverse pathogens replicating in cytosolic membrane structures. Copyright © 2017 Elsevier Inc. All rights reserved.

Ocrelizumab versus Interferon Beta-1a in Relapsing Multiple Sclerosis.

PubMed

Hauser, Stephen L; Bar-Or, Amit; Comi, Giancarlo; Giovannoni, Gavin; Hartung, Hans-Peter; Hemmer, Bernhard; Lublin, Fred; Montalban, Xavier; Rammohan, Kottil W; Selmaj, Krzysztof; Traboulsee, Anthony; Wolinsky, Jerry S; Arnold, Douglas L; Klingelschmitt, Gaelle; Masterman, Donna; Fontoura, Paulo; Belachew, Shibeshih; Chin, Peter; Mairon, Nicole; Garren, Hideki; Kappos, Ludwig

2017-01-19

B cells influence the pathogenesis of multiple sclerosis. Ocrelizumab is a humanized monoclonal antibody that selectively depletes CD20+ B cells. In two identical phase 3 trials, we randomly assigned 821 and 835 patients with relapsing multiple sclerosis to receive intravenous ocrelizumab at a dose of 600 mg every 24 weeks or subcutaneous interferon beta-1a at a dose of 44 μg three times weekly for 96 weeks. The primary end point was the annualized relapse rate. The annualized relapse rate was lower with ocrelizumab than with interferon beta-1a in trial 1 (0.16 vs. 0.29; 46% lower rate with ocrelizumab; P<0.001) and in trial 2 (0.16 vs. 0.29; 47% lower rate; P<0.001). In prespecified pooled analyses, the percentage of patients with disability progression confirmed at 12 weeks was significantly lower with ocrelizumab than with interferon beta-1a (9.1% vs. 13.6%; hazard ratio, 0.60; 95% confidence interval [CI], 0.45 to 0.81; P<0.001), as was the percentage of patients with disability progression confirmed at 24 weeks (6.9% vs. 10.5%; hazard ratio, 0.60; 95% CI, 0.43 to 0.84; P=0.003). The mean number of gadolinium-enhancing lesions per T 1 -weighted magnetic resonance scan was 0.02 with ocrelizumab versus 0.29 with interferon beta-1a in trial 1 (94% lower number of lesions with ocrelizumab, P<0.001) and 0.02 versus 0.42 in trial 2 (95% lower number of lesions, P<0.001). The change in the Multiple Sclerosis Functional Composite score (a composite measure of walking speed, upper-limb movements, and cognition; for this z score, negative values indicate worsening and positive values indicate improvement) significantly favored ocrelizumab over interferon beta-1a in trial 2 (0.28 vs. 0.17, P=0.004) but not in trial 1 (0.21 vs. 0.17, P=0.33). Infusion-related reactions occurred in 34.3% of the patients treated with ocrelizumab. Serious infection occurred in 1.3% of the patients treated with ocrelizumab and in 2.9% of those treated with interferon beta-1a. Neoplasms

Pregnancy IFN-gamma responses to foetal alloantigens are altered by maternal allergy and gravidity status.

PubMed

Breckler, L A; Hale, J; Taylor, A; Dunstan, J A; Thornton, C A; Prescott, S L

2008-11-01

During pregnancy, variations in maternal-foetal cellular interactions may influence immune programming. This study was carried out to determine if maternal responses to foetal alloantigens are altered by maternal allergic disease and/or previous pregnancies. For this cohort study, peripheral blood was collected from allergic (n = 69) and nonallergic (n = 63) pregnant women at 20, 30, 36-week gestation and 6-week postpartum (pp). Cord blood was collected at delivery. Mixed lymphocyte reactions were used to measure maternal cytokine responses [interleukin-6 (IL-6), IL-10, IL-13 and (interferon-gamma) IFN-gamma] at each time point towards foetal mononuclear cells. Maternal cytokine responses during pregnancy (20, 30 and 36 weeks) were suppressed compared to the responses at 6-week pp. The ratio of maternal IFN-gamma/IL-13 and IFN-gamma/IL-10 responses were lower during pregnancy. Allergic mothers had lower IFN-gamma responses at each time-point during pregnancy with the greatest difference in responses observed at 36-week gestation. When allergic and nonallergic women were further stratified by gravidity group, IFN-gamma responses of allergic multigravid mothers were significantly lower than nonallergic multigravid mothers during pregnancy. During normal pregnancy, peripheral T-cell cytokine responses to foetal alloantigens may be altered by both allergic status of the mother and previous pregnancies. These factors could influence the cytokine milieu experienced by the foetus and will be further explored in the development of allergic disease during early life.

An Association of Unique microRNA Turnover Machinery with Prostate Cancer Progression

DTIC Science & Technology

2017-10-01

hormone -refractory prostate 543 carcinoma pre-treated with interferon-gamma and vaccinated with autologous PSA-544 peptide loaded dendritic cells--a...as mRNA expression (Fig. 2A). Among three IFNs, IFNγ elevation is associated in PCa patients after radiation and hormonal therapy. We decided to...development. For example, a study has demonstrated that fibroblast growth factor 11 (FGF11) 321 released by the recruited CD4+ T cells can induce cell invasion

The effect of food on gastrointestinal (GI) transit of sustained-release ibuprofen tablets as evaluated by gamma scintigraphy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Borin, M.T.; Khare, S.; Beihn, R.M.

1990-03-01

The GI transit of radiolabeled sustained-release ibuprofen 800-mg tablets in eight healthy, fed volunteers was monitored using external gamma scintigraphy. Ibuprofen serum concentrations were determined from blood samples drawn over 36 hr following dosing. Sustained-release ibuprofen tablets containing 0.18% of 170Er2O3 (greater than 96% 170Er) in the bulk formulation were manufactured under pilot-scale conditions and were radiolabeled utilizing a neutron activation procedure which converted stable 170Er to radioactive 171Er (t1/2 = 7.5 hr). At the time of dosing, each tablet contained 50 mu Ci of 171Er. Dosage form position were reported at various time intervals. In five subjects the sustained-releasemore » tablet remained in the stomach and eroded slowly over 7-12 hr, resulting in gradual increases in small bowel radioactivity. In the remaining three subjects, the intact tablet was ejected from the stomach and a gastric residence time of approximately 4 hr was measured. This is in marked contrast to a previous study conducted in fasted volunteers in which gastric retention time ranged from 10 to 60 min. Differences in GI transit between fed and fasted volunteers had little effect on ibuprofen bioavailability. AUC and Tmax were unaltered and Cmax was increased by 24%, which is in agreement with results from a previous, crossover-design food effect study.« less

Interferon Gamma Messenger RNA Signature in Tumor Biopsies Predicts Outcomes in Patients with Non-Small-Cell Lung Carcinoma or Urothelial Cancer Treated with Durvalumab.

PubMed

Higgs, Brandon W; Morehouse, Christopher; Streicher, Katie L; Brohawn, Philip; Pilataxi, Fernanda; Gupta, Ashok; Ranade, Koustubh

2018-05-01

To identify a predictive biomarker for durvalumab, an anti-programmed death ligand 1 (PD-L1) monoclonal antibody. RNA sequencing of 97 advanced-stage non-small-cell lung carcinoma (NSCLC) biopsies from a nonrandomized phase 1b/2 clinical trial (1108/NCT01693562) were profiled to identify a predictive signature; 62 locally advanced or metastatic urothelial cancer (UC) tumors from the same study were profiled to confirm predictive utility of the signature. Thirty NSCLC patients provided pre- and posttreatment tumors for messenger RNA (mRNA) analysis. NSCLC with ≥25% tumor cells and UC with ≥25% tumor or immune cells stained for PD-L1 at any intensity were scored PD-L1 positive (PD-L1+). Kaplan-Meier and Cox proportional hazards analyses were used to adjust for gender, age, prior therapies, histology, ECOG, liver metastasis, and smoking. Tumor mutation burden (TMB) was calculated using data from The Cancer Genome Atlas (TCGA).  In the NSCLC discovery set, a four-gene interferon gamma (IFNγ)-positive (IFNγ+) signature comprising IFNγ, CD274, LAG3, and CXCL9 was associated with higher overall response rates, longer median progression-free survival, and overall survival compared with signature-low patients. IFNγ+-signature NSCLC patients had improved survival regardless of immunohistochemistry (IHC) PD-L1 status. These associations were replicated in a UC cohort. The IFNγ+ signature was induced twofold (P = 0.003) by durvalumab after 8 weeks of therapy in NSCLC patients, and baseline signature was associated with TMB but not survival in TCGA data.  The IFNγ+ mRNA signature may assist in identifying patients with improved outcomes to durvalumab, independent of PD-L1 assessed by IHC. Copyright ©2018, American Association for Cancer Research.

Interleukin-17A-Deficient Mice Are Highly Susceptible to Toxoplasma gondii Infection Due to Excessively Induced T. gondii HSP70 and Interferon Gamma Production.

PubMed

Moroda, Masataka; Takamoto, Masaya; Iwakura, Yoichiro; Nakayama, Jun; Aosai, Fumie

2017-12-01

Interleukin17A (IL-17A) is known to be involved in the host defense against pathogens and the pathogenesis of autoimmune diseases. Previously, we showed that excessive amounts of interferon gamma (IFN-γ) play an important role in the pathogenesis of the lethal effects of Toxoplasma gondii by inducing anaphylactic responses. In the study described in this report, we examined the effects of IL-17A deficiency on murine host defense against oral T. gondii infection. IL-17A-deficient C57BL/6 (B6) mice exhibited higher rates of mortality than wild-type (WT) mice during the acute phase of T. gondii infection. CD4 + T cells in the mesenteric lymph nodes (mLNs) and ileum of T. gondii -infected IL-17A-deficient mice produced higher levels of IFN-γ than did those of WT mice. In addition, the level of T. gondii HSP70 ( T.g HSP70) expression was also significantly increased in the ileum, mLNs, liver, and spleen of infected IL-17A-deficient mice compared with that in WT mice. These elevated levels of expression of T.g HSP70 and IFN-γ in infected IL-17A-deficient mice were presumably linked to the IL-17A defect since they decreased to WT levels after treatment with recombinant IL-17A. Furthermore, IL-17A-deficient mice were highly susceptible to the anaphylactic effect of T.g HSP70, and the survival of IL-17A-deficient mice during the acute phase was improved by treatment with an anti- T.g HSP70 monoclonal antibody. These results suggest that IL-17A plays an important role in host survival against T. gondii infection by protecting the host from an anaphylactic reaction via the downregulation of T.g HSP70 and IFN-γ production. Copyright © 2017 American Society for Microbiology.

Cytokine secretion induced by superantigens in peripheral blood mononuclear cells, lamina propria lymphocytes, and intraepithelial lymphocytes.

PubMed Central

Sperber, K; Silverstein, L; Brusco, C; Yoon, C; Mullin, G E; Mayer, L

1995-01-01

Superantigens are potent inducers of T-cell proliferation and induce a broad range of cytokines, including tumor necrosis factor (TNF), gamma interferon, and interleukin 2 (IL-2). In the present study, we compared the abilities of different staphylococcal superantigens (staphylococcal enterotoxin B [SEB], staphylococcal enterotoxin E [SEE], and toxic shock syndrome toxin 1 [TSST-1]) to stimulate distinct cytokine profiles in peripheral blood mononuclear cells (PBMC), lamina propria lymphocytes (LPL), and intraepithelial lymphocytes (IEL). One million PBMC, LPL, and IEL were stimulated with various concentrations of superantigen (10 to 0.001 ng/ml) for 24, 48, and 72 h. Maximum cytokine production by PBMC, LPL, and IEL was observed for all three superantigens at 48 h at a concentration of 1 ng/ml. In PBMC, SEE and TSST-1 stimulated more IL-2 and gamma interferon than SEB. SEE and TSST-1 also stimulated more TNF and IL-4 production than SEB. In contrast, SEB stimulated more IL-6 than either SEE or TSST-1. In LPL, there was no SEE-induced IL-2 or IL-4 production, but IL-6, TNF, and gamma interferon were induced. SEB similarly induced no IL-2 or gamma interferon from the LPL, but IL-4, IL-6, and TNF were detected. TSST-1 stimulation of LPL resulted in IL-2 and TNF production but no IL-4, IL-6, or gamma interferon. In IEL, SEE induced no IL-2, IL-4, or gamma interferon but produced IL-6 and TNF, while SEB stimulation resulted in no IL-2 or gamma interferon but did result in detectable IL-4, IL-6, and TNF. Taken together, these data indicate that there are significant differences in the cytokine profiles induced by superantigens in LPL and IEL compared with those in PBMC, and these differences may relate to differences in activation requirements. PMID:7583927

Rhabdomyolysis following interferon-beta treatment in a patient with multiple sclerosis - A case report.

PubMed

Dalbjerg, Sara Maria; Tsakiri, Anna; Frederiksen, Jette Lautrup

2016-07-01

Multiple sclerosis is an inflammatory disease of the central nervous system for which there is currently no cure. Interferon-beta-1-alpha is worldwide one of the most widely used treatments in multiple sclerosis. To our knowledge there is one previous reported case of rhabdomyolysis associated with Interferon-beta treatment. We describe a 30 year old man with relapsing remitting multiple sclerosis who developed rhabdomyolysis and increased creatine kinase following Interferon-beta-1-alpha therapy. After the medication was discontinued, the patient rapidly improved. Clinicians should be aware of the possibility of rhabdomyolysis occurring during Interferon-beta-1-alpha therapy. In cases where patients complain of severe myalgia, and in particular if weakness is reported, creatine kinase activity should be measured to prevent irreversible rhabdomyolysis during Interferon-beta-1-alpha therapy in patients with multiple sclerosis. Copyright © 2016 Elsevier B.V. All rights reserved.

Monitoring acute phase proteins in retrovirus infected cats undergoing feline interferon-ω therapy.

PubMed

Leal, R O; Gil, S; Sepúlveda, N; McGahie, D; Duarte, A; Niza, M M R E; Tavares, L

2014-01-01

Recombinant feline interferon-ω therapy is an immunomodulator currently used in the treatment of different retroviral diseases including feline immune deficiency virus and feline leukaemia virus. Although its mechanism of action remains unclear, this drug appears to potentiate the innate response. Acute phase proteins are one of the key components of innate immunity and studies describing their use as a monitoring tool for the immune system in animals undergoing interferon-ω therapy are lacking. This study aimed to determine whether interferon-ω therapy influences acute phase protein concentrations namely serum amyloid-A, α-1-glycoprotein and C-reactive protein. A single-arm study was performed using 16 cats, living in an animal shelter, naturally infected with retroviruses and subjected to the interferon-ω therapy licensed protocol. Samples were collected before (D0), during (D10 and D30) and after therapy (D65). Serum amyloid-A and C-reactive protein were measured by specific enzyme-linked immunosorbent assay kits and α-1-glycoprotein by single radial immunodiffusion. All the acute phase proteins significantly increased in cats undergoing interferon-ω therapy (D0/D65: P<0·05) CLINICAL SIGNIFICANCE: Acute phase proteins appear to be reasonable predictors of innate-immune stimulation and may be useful in the individual monitoring of naturally retroviral infected cats undergoing interferon-ω therapy. © 2013 British Small Animal Veterinary Association.

Vanderbilt University Gamma Irradiation of Nano-modified Concrete (2017 Milestone Report)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Deichert, Geoffrey G.; Linton, Kory D.; Terrani, Kurt A.

This document outlines the irradiation of concrete specimens in the Gamma Irradiation Facility in the High Flux Isotope Reactor (HFIR) at Oak Ridge National Laboratory (ORNL). Two gamma irradiation runs were performed in July of 2017 on 18 reference mortar bar specimens, 26 reference cement paste bar specimens, and 28 reference cement paste tab specimens to determine the dose and temperature response of the specimens in the gamma irradiation environment. Specimens from the first two gamma irradiations were surveyed and released to Vanderbilt University. The temperature and dose information obtained informs the test parameters of the final two gamma irradiationsmore » of nano-modified concrete planned for FY 2018.« less

Bifactorial versus monofactorial molecular status of Staphylococcus aureus gamma-toxin.

PubMed

Guidi-Rontani, C; Fouque, F; Alouf, J E

1994-01-01

The extracellular Staphylococcus aureus gamma-toxin (hemolysin) released by the Smith 5R strain has been purified (M(r) 38 kDa, pl 9.55). We established that this cytolysin is a single polypeptide fully lytic on rabbit erythrocytes. In contrast, this toxin alone was unable to lyse other cells and was required to act jointly with an accessory 58 kDa protein released by the same strain. This protein, named sensitizing protein (SP), was required in order to damage the cytoplasmic membranes of other red blood cells including human erythrocytes as well as that of other eukaryotic cells (Jurkat and Hep-2). The lytic process can be referred to as conditional synergistic or cooperative lysis. gamma-toxin, and SP were also found able to disrupt phospholipid/cholesterol containing liposomes. We demonstrated that a minor membrane phospholipid, phosphatidylinositol, is crucial for gamma-toxin binding to cells and/or channel formation through membrane lipid bilayer.

Anti-cytokine autoantibodies in autoimmunity: preponderance of neutralizing autoantibodies against interferon-alpha, interferon-omega and interleukin-12 in patients with thymoma and/or myasthenia gravis.

PubMed

Meager, A; Wadhwa, M; Dilger, P; Bird, C; Thorpe, R; Newsom-Davis, J; Willcox, N

2003-04-01

We have screened for spontaneous anticytokine autoantibodies in patients with infections, neoplasms and autoimmune diseases, because of their increasingly reported co-occurrence. We tested for both binding and neutralizing autoantibodies to a range of human cytokines, including interleukin-1alpha (IL-1alpha), IL-1beta, IL-2, IL-4, IL-6, IL-8, IL-10, IL-12, IL-18, interferon-alpha2 (IFN-alpha2), IFN-omega, IFN-beta, IFN-gamma, tumour necrosis factor alpha (TNF-alpha), transforming growth factor beta-1 (TGF-beta1) and granulocyte-macrophage colony stimulating factor (GM-CSF), in plasmas or sera. With two notable exceptions described below, we found only occasional, mostly low-titre, non-neutralizing antibodies, mainly to GM-CSF; also to IL-10 in pemphigoid. Strikingly, however, high-titre, mainly IgG, autoantibodies to IFN-alpha2, IFN-omega and IL-12 were common at diagnosis in patients with late-onset myasthenia gravis (LOMG+), thymoma (T) but no MG (TMG-) and especially with both thymoma and MG together (TMG+). The antibodies recognized other closely related type I IFN-alpha subtypes, but rarely the distantly related type I IFN-beta, and never (detectably) the unrelated type II IFN-gamma. Antibodies to IL-12 showed a similar distribution to those against IFN-alpha2, although prevalences were slightly lower; correlations between individual titres against each were so modest that they appear to be entirely different specificities. Neither showed any obvious correlations with clinical parameters including thymoma histology and HLA type, but they did increase sharply if the tumours recurred. These antibodies neutralized their respective cytokine in bioassays in vitro; although they persisted for years severe infections were surprisingly uncommon, despite the immunosuppressive therapy also used in most cases. These findings must hold valuable clues to autoimmunizing mechanisms in paraneoplastic autoimmunity.

Polarization of the prompt gamma-ray emission from the gamma-ray burst of 6 December 2002.

PubMed

Coburn, Wayne; Boggs, Steven E

2003-05-22

Observations of the afterglows of gamma-ray bursts (GRBs) have revealed that they lie at cosmological distances, and so correspond to the release of an enormous amount of energy. The nature of the central engine that powers these events and the prompt gamma-ray emission mechanism itself remain enigmatic because, once a relativistic fireball is created, the physics of the afterglow is insensitive to the nature of the progenitor. Here we report the discovery of linear polarization in the prompt gamma-ray emission from GRB021206, which indicates that it is synchrotron emission from relativistic electrons in a strong magnetic field. The polarization is at the theoretical maximum, which requires a uniform, large-scale magnetic field over the gamma-ray emission region. A large-scale magnetic field constrains possible progenitors to those either having or producing organized fields. We suggest that the large magnetic energy densities in the progenitor environment (comparable to the kinetic energy densities of the fireball), combined with the large-scale structure of the field, indicate that magnetic fields drive the GRB explosion.

Different modulation by histamine of IL-4 and interferon-gamma (IFN-γ) release according to the phenotype of human Th0, Th1 and Th2 clones

PubMed Central

LAGIER, B; LEBEL, B; BOUSQUET, J; PÈNE, J

1997-01-01

Histamine, an important inflammatory mediator in allergic diseases and asthma, has been reported to have modulator effects on T cells, suggesting that the bronchial microenvironment may regulate the function of resident T cells. We examined the effect of histamine on the release of the Th2-associated cytokines IL-4 and IL-5 and the Th1-associated cytokine IFN-γ by 30 CD4+ T cell clones from peripheral blood or bronchial biopsy of one atopic subject. Based on the IL-4/IFN-γ ratio, the clones were ascribed to the Th2 (ratio >1), Th0 (ratio ⩾ 0.1 and ⩽1) or Th1 (ratio <0.1) phenotype. Histamine inhibited IFN-γ production by Th1-like cells (P<0.02, Kruskall–Wallis), especially from bronchial biopsy, but had no effect on IL-4 release. Regarding Th0 clones, histamine inhibited IL-4 production (P<0.02) in a dose-dependent manner and slightly inhibited IFN-γ production, but had no effect on Th2-like cells. Histamine had a heterogeneous and insignificant effect on IL-5 production. The H2-receptor antagonist ranitidine completely reversed the inhibition of IL-4 and IFN-γ production, whereas the agonist dimaprit mimicked this effect. In contrast, H1- and H3-receptor agonists and antagonists had no significant effect. These data demonstrate that histamine has different effects on IL-4 and IFN-γ release by T helper cells according to their phenotype via H2-receptors. This study extends the immunomodulatory effects of histamine which may contribute to the perpetuation of airway inflammation in asthma. PMID:9182905

Modulation of the release of norepinephrine by gamma-aminobutyric acid and morphine in the frontal cerebral cortex of the rat

DOE Office of Scientific and Technical Information (OSTI.GOV)

Peoples, R.W.

1989-01-01

Agents that enhance gamma-aminobutyric acid, or GABA, neurotransmission modulate certain effects of opioids, such as analgesia. Opioid analgesia is mediated in part by norepinephrine in the forebrain. In this study, the interactions between morphine and GABAergic agents on release of ({sup 3}H) norepinephrine from rat frontal cerebral cortical slices were examined. GABA, 5 {times} 10{sup {minus}5}-10{sup {minus}3} M, enhanced potassium stimulated ({sup 3}H) norepinephrine release and reversed the inhibitory effect of morphine in a noncompetitive manner. GABA did not enhance release of ({sup 3}H) norepinephrine stimulated by the calcium ionophore A23187. The effect of GABA was reduced by the GABA{submore » A} receptor antagonists bicuculline methiodide or picrotoxin, and by the selective inhibitor of GABA uptake SKF 89976A, but was blocked completely only when bicuculline methiodide and SKF 89976A were used in combination. The GABA{sub A} agonist muscimol, 10{sup {minus}4} M, mimicked the effect of GABA, but the GABA{sub B} agonist ({plus minus})baclofen, 10{sup {minus}4} M, did not affect the release of ({sup 3}H) norepinephrine in the absence or the presence of morphine. Thus GABA appears to produce this effect by stimulating GABA uptake and GABA{sub A}, but not GABA{sub B}, receptors. In contrast to the results that would be predicted for an event involving GABA{sub A} receptors, however, the effect of GABA did not desensitize, and benzodiazepine agonists did not enhance the effect of GABA at any concentration tested between 10{sup {minus}8} and 10{sup {minus}4} M. Thus these receptors may constitute a subclass of GABA{sub A} receptors. These results support a role of GABA uptake and GABA{sub A} receptors in enhancing the release of norepinephrine and modulating its inhibition by opioids in the frontal cortex of the rat.« less

CD4+ T-Cell- and Gamma Interferon-Dependent Protection against Murine Malaria by Immunization with Linear Synthetic Peptides from a Plasmodium yoelii 17-Kilodalton Hepatocyte Erythrocyte Protein

PubMed Central

Charoenvit, Yupin; Majam, Victoria Fallarme; Corradin, Giampietro; Sacci, John B.; Wang, Ruobing; Doolan, Denise L.; Jones, Trevor R.; Abot, Esteban; Patarroyo, Manuel E.; Guzman, Fanny; Hoffman, Stephen L.

1999-01-01

Most work on protective immunity against the pre-erythrocytic stages of malaria has focused on induction of antibodies that prevent sporozoite invasion of hepatocytes, and CD8+ T-cell responses that eliminate infected hepatocytes. We recently reported that immunization of A/J mice with an 18-amino-acid synthetic linear peptide from Plasmodium yoelii sporozoite surface protein 2 (SSP2) in TiterMax adjuvant induces sterile protection that is dependent on CD4+ T cells and gamma interferon (IFN-γ). We now report that immunization of inbred A/J mice and outbred CD1 mice with each of two linear synthetic peptides from the 17-kDa P. yoelii hepatocyte erythrocyte protein (HEP17) in the same adjuvant also induces protection against sporozoite challenge that is dependent on CD4+ T cells and IFN-γ. The SSP2 peptide and the two HEP17 peptides are recognized by B cells as well as T cells, and the protection induced by these peptides appears to be directed against the infected hepatocytes. In contrast to the peptide-induced protection, immunization of eight different strains of mice with radiation-attenuated sporozoites induces protection that is absolutely dependent on CD8+ T cells. Data represented here demonstrate that CD4+ T-cell-dependent protection can be induced by immunization with linear synthetic peptides. These studies therefore provide the foundation for an approach to pre-erythrocytic-stage malaria vaccine development, based on the induction of protective CD4+ T-cell responses, which will complement efforts to induce protective antibody and CD8+ T-cell responses. PMID:10531206

Loss of the Type I Interferon Pathway Increases Vulnerability of Mice to Genital Herpes Simplex Virus 2 Infection ▿

PubMed Central

Conrady, Christopher D.; Halford, William P.; Carr, Daniel J. J.

2011-01-01

The mouse model of genital herpes relies on medoxyprogesterone treatment of female mice to render the vaginal lumen susceptible to inoculation with herpes simplex virus 2 (HSV-2). In the present study, we report that mice deficient in the A1 chain of the type I interferon receptor (CD118−/−) are susceptible to HSV-2 in the absence of medroxyprogesterone preconditioning. In the absence of hormone pretreatment, 2,000 PFU of a clinical isolate of HSV-2 was sufficient to establish a productive infection in the vagina of 75% ± 17% and in the spinal cord of 71% ± 14% of CD118−/− mice, whereas the same dose of HSV-2 replicated to detectable levels in only 13% ± 13% of vaginal samples and 0% of spinal cord samples from wild-type mice, as determined at day 5 postinfection. The susceptibility to HSV-2 infection in the CD118−/− mice was associated with a significant reduction in the infiltration of HSV-specific cytotoxic T lymphocytes into the vaginal tissue, the local production of gamma interferon (IFN-γ), and the expression of T cell-recruiting chemokines CCL5, CXCL9, and CXCL10. Collectively, the results underscore the significant contribution of type I IFNs in resistance to genital HSV-2 infection. PMID:21147921

Gamma-interferon exerts a critical early restriction on replication and dissemination of yellow fever virus vaccine strain 17D-204.

PubMed

Lam, L K Metthew; Watson, Alan M; Ryman, Kate D; Klimstra, William B

2018-01-01

Live attenuated viruses are historically among the most effective viral vaccines. Development of a safe vaccine requires the virus to be less virulent, a phenotype that is historically arrived by empirical evaluation often leaving the mechanisms of attenuation unknown. The yellow fever virus 17D live attenuated vaccine strain has been developed as a delivery vector for heterologous antigens; however, the mechanisms of attenuation remain elusive. The successful and safe progress of 17D as a vaccine vector and the development of live attenuated vaccines (LAVs) to related flaviviruses requires an understanding of the molecular mechanisms leading to attenuation. Using subcutaneous infection of interferon-deficient mouse models of wild type yellow fever virus (WT YFV) pathogenesis and 17D-mediated immunity, we found that, in the absence of type I IFN (IFN-α/β), type II interferon (IFN-γ) restricted 17D replication, but not that of WT YFV, by 1-2 days post-infection. In this context, IFN-γ responses protected 17D-infected animals from mortality, largely restricted the virus to lymphoid organs, and eliminated viscerotropic disease signs such as steatosis in the liver and inflammatory cell infiltration into the spleen. However, WT YFV caused a disseminated infection, gross liver pathology, and rapid death of the animals. In vitro, IFN-γ treatment of myeloid cells suppressed the replication of 17D significantly more than that of WT YFV, suggesting a direct differential effect on 17D virus replication. Together these data indicate that an important mechanism of 17D attenuation in vivo is increased sensitivity to IFN-γ stimulated responses elicited early after infection.

Predictive Factors for Beneficial Response to Interferon-alfa Therapy in Chronic Hepatitis C

PubMed Central

Yoon, Seung-Kew; Kim, Sung Soo; Park, Young Min; Shim, Kyu Sik; Lee, Chang Don; Sun, Hee Sik; Park, Doo Ho; Kim, Boo Sung; Ryu, Wang Shick; Cho, Joong Myung

1995-01-01

Objectives: Interferon is the only established teatment for chronic hepatitis C but the host-dependent or virus-related factors affecting the response rate to interferon therapy are not yet dear. The purpose of this study was to investigate the factors predictive of response to interferon-alfa therapy in chronic hepatitis C. Methods: Twenty-five consecutive patients with chronic hepatitis C were randomized to three regimens of interferon-alfa: group A (n=7, 3MU every day for 3 months), group B (n=8, 3MU every other day for 3 months) and group C (n=10, 3MU every other day for 6 months), We quantified serum HC RNA levels by competitive reverse transcription-polymerase chain reaction (RT-PCR)and performed HCV genotyping using type-specific primers deduced from the NS5 region of the HCV genome. We also attempted to identify which demographic, biochemical and histologic factors in addition to virus-related factors would significantly predict beneficial response to interferon by multivariate analysis. Results: Sustained responders were 8 (36.4%), nonsustained responders were 2 (9.1%) and nonresponders were 12 (54.5%) of 22 patients who had received complete therapy. The initial HCV RNA level (logarithmic transformed copy numbers per ml of serum)in sustained responders (5.75±0.39) was significantly lower than that of nonsustained responders (6.80±0.71)and nonresponders (6.70±0.52) (p<0.05). In multivariate multiple logistic regression analysis, the serum HCV RNA level before therapy was only the independent predictor of a sustained response to interferon-alfa therapy (p=0.001). Conclusions: Serum HCV RNA level before therapy was the most useful predictor of a sustained response to interferon-alfa therapy for chronic hepatitis C. PMID:7495780

The lived experience of interferon-free treatments for hepatitis C: A thematic analysis.

PubMed

Whiteley, David; Whittaker, Anne; Elliott, Lawrie; Cunningham-Burley, Sarah

2016-12-01

International discourse concerning the evolution in hepatitis C virus (HCV) therapy has tended to focus on improving outcomes, shortened treatment length and reduced side-effects of interferon-free regimens. How these treatments are being understood and experienced by the people receiving them has so far been overlooked. This study therefore aimed to explore the lived experience of individuals taking interferon-free HCV therapies. Data were generated through 16 semi-structured interviews with a purposive sample of eight participants, recruited from a university hospital in Scotland. The interviews took place between June 2015 and March 2016, before and after a period of interferon-free HCV treatment. The data were interrogated using a thematic analysis, underpinned by social phenomenological theory. Three overriding themes were identified. 'Expectations and realisations' characterised the influence that interferon continued to cast over interferon-free treatment, contrasting the practicalities of taking interferon-free therapy with preconceived notions. 'An honour and a pleasure' portrayed a positive experience of an undemanding therapy, yet among those with a history of drug use, was also positioned as a privilege, associated with feelings of luck and guilt. 'Treatment needs' illustrated the strategies participants used to search for treatment efficacy, and the value those with a significant history of drug use placed on support. One nonconforming case is then discussed to enhance rigour and trustworthiness. This is the first qualitative exploration of the experience of interferon-free HCV treatment reported globally. The results from this study suggest a cultural lag exists between the pharmacological developments which have been witnessed, and societal understandings of them. This has implications for the way services meet the needs of, and offer therapy to, HCV positive individuals. Copyright © 2016 Elsevier B.V. All rights reserved.

Alopecia of IFN-gamma knockout mouse as a model for disturbance of the hair cycle: a unique arrest of the hair cycle at the anagen phase accompanied by mitosis.

PubMed

Hirota, Ryuichiro; Tajima, Sadao; Yoneda, Yukio; Tamayama, Takumi; Watanabe, Masahito; Ueda, Kouichi; Kubota, Takahiro; Yoshida, Ryotaro

2002-09-01

Interferon-gamma(-/-) (IFN-gamma(-/-)) and IFN-gamma(+/+) C57BL/6 mice (3 weeks of age) completed the production of morphogenesis-derived hair. Around 6 weeks of age, however, most of the IFN-gamma(-/-) but none of the IFN-gamma(+/+) mice began to lose hairs in the dorsal and occipital areas in the absence of inflammatory reactions, and the alopecia was sustained for at least several 10-week periods of observation. A single subcutaneous injection of IFN-gamma to IFN-gamma(-/-) mice at 3, but not 4, 5, or 8 weeks of age could protect all the mice from alopecia, revealing that the lack of IFN-gamma around 3 weeks of age is directly responsible for the alopecia. Histologic features showed that the hair follicles of the IFN-gamma(+/+) mice passed through the anagen (4-5 weeks of age) and catagen/telogen ( approximately 6 weeks of age) phases, whereas those of IFN-gamma(-/-) mice (5 weeks of age or older) stayed in the anagen phase. TUNEL and bromodeoxyuridine experiments suggested that an arrest with unlimited DNA synthesis of the hair cycle in the anagen phase by the lack of IFN-gamma-dependent apoptosis in the midfollicle region and diffuse shedding of previously formed hair induced alopecia in IFN-gamma(-/-) mice.

Dopamine Modulates Delta-Gamma Phase-Amplitude Coupling in the Prefrontal Cortex of Behaving Rats

PubMed Central

Andino-Pavlovsky, Victoria; Souza, Annie C.; Scheffer-Teixeira, Robson; Tort, Adriano B. L.; Etchenique, Roberto; Ribeiro, Sidarta

2017-01-01

Dopamine release and phase-amplitude cross-frequency coupling (CFC) have independently been implicated in prefrontal cortex (PFC) functioning. To causally investigate whether dopamine release affects phase-amplitude comodulation between different frequencies in local field potentials (LFP) recorded from the medial PFC (mPFC) of behaving rats, we used RuBiDopa, a light-sensitive caged compound that releases the neurotransmitter dopamine when irradiated with visible light. LFP power did not change in any frequency band after the application of light-uncaged dopamine, but significantly strengthened phase-amplitude comodulation between delta and gamma oscillations. Saline did not exert significant changes, while injections of dopamine and RuBiDopa produced a slow increase in comodulation for several minutes after the injection. The results show that dopamine release in the medial PFC shifts phase-amplitude comodulation from theta-gamma to delta-gamma. Although being preliminary results due to the limitation of the low number of animals present in this study, our findings suggest that dopamine-mediated modification of the frequencies involved in comodulation could be a mechanism by which this neurotransmitter regulates functioning in mPFC. PMID:28536507

Interferon-free treatment for HCV-infected patients with decompensated cirrhosis.

PubMed

Kanda, Tatsuo

2017-01-01

Progress in interferon-free treatment against hepatitis C virus (HCV) has remained a challenge in patients with decompensated cirrhosis due to a paucity of information on efficacy and safety profiles. This review illustrates that interferon-free treatment could result in greater than 85 % sustained virological response (SVR) rates in patients with HCV genotype 1 and decompensated cirrhosis. The combination of pangenotypic HCV NS5A inhibitor velpatasvir and HCV NS5B inhibitor sofosbuvir has demonstrated high SVR rates in patients with HCV genotypes 1, 2, 3, 4 or 6 and decompensated cirrhosis. Certain patients discontinued treatment due to adverse events, death or having liver transplantation. Taken together, interferon-free treatment could produce higher SVR rates in decompensated hepatic cirrhosis. However, as adverse events were occasionally observed, liver transplantation should always be considered as well. Further improvements in treatment are called for in patients with decompensated cirrhosis.